Science.gov

Sample records for early replication events

  1. Inhibiting early-stage events in HIV-1 replication by small-molecule targeting of the HIV-1 capsid.

    PubMed

    Kortagere, Sandhya; Madani, Navid; Mankowski, Marie K; Schön, Arne; Zentner, Isaac; Swaminathan, Gokul; Princiotto, Amy; Anthony, Kevin; Oza, Apara; Sierra, Luz-Jeannette; Passic, Shendra R; Wang, Xiaozhao; Jones, David M; Stavale, Eric; Krebs, Fred C; Martín-García, Julio; Freire, Ernesto; Ptak, Roger G; Sodroski, Joseph; Cocklin, Simon; Smith, Amos B

    2012-08-01

    The HIV-1 capsid (CA) protein plays essential roles in both early and late stages of virl replication and has emerged as a novel drug target. We report hybrid structure-based virtual screening to identify small molecules with the potential to interact with the N-terminal domain (NTD) of HIV-1 CA and disrupt early, preintegration steps of the HIV-1 replication cycle. The small molecule 4,4'-[dibenzo[b,d]furan-2,8-diylbis(5-phenyl-1H-imidazole-4,2-diyl)]dibenzoic acid (CK026), which had anti-HIV-1 activity in single- and multiple-round infections but failed to inhibit viral replication in peripheral blood mononuclear cells (PBMCs), was identified. Three analogues of CK026 with reduced size and better drug-like properties were synthesized and assessed. Compound I-XW-053 (4-(4,5-diphenyl-1H-imidazol-2-yl)benzoic acid) retained all of the antiviral activity of the parental compound and inhibited the replication of a diverse panel of primary HIV-1 isolates in PBMCs, while displaying no appreciable cytotoxicity. This antiviral activity was specific to HIV-1, as I-XW-053 displayed no effect on the replication of SIV or against a panel of nonretroviruses. Direct interaction of I-XW-053 was quantified with wild-type and mutant CA protein using surface plasmon resonance and isothermal titration calorimetry. Mutation of Ile37 and Arg173, which are required for interaction with compound I-XW-053, crippled the virus at an early, preintegration step. Using quantitative PCR, we demonstrated that treatment with I-XW-053 inhibited HIV-1 reverse transcription in multiple cell types, indirectly pointing to dysfunction in the uncoating process. In summary, we have identified a CA-specific compound that targets and inhibits a novel region in the NTD-NTD interface, affects uncoating, and possesses broad-spectrum anti-HIV-1 activity.

  2. Early events in the pathogenesis of foot-and-mouth disease in pigs; identification of oropharyngeal tonsils as sites of primary and sustained viral replication

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A time-course study was performed to elucidate the early events of foot-and-mouth disease virus (FMDV) infection in pigs subsequent to simulated natural inoculation. The earliest detectable event was primary infection in the lingual and paraepiglotic tonsils at 6 hours post inoculation (hpi) charact...

  3. DNA breaks early in replication in B cell cancers

    Cancer.gov

    Research by scientists at the NCI has identified a new class of DNA sites in cells that break early in the replication process. They found that these break sites correlate with damage often seen in B cell cancers, such as diffuse large B cell lymphoma.

  4. Early Word Comprehension in Infants: Replication and Extension

    ERIC Educational Resources Information Center

    Bergelson, Elika; Swingley, Daniel

    2015-01-01

    A handful of recent experimental reports have shown that infants of 6-9 months know the meanings of some common words. Here, we replicate and extend these findings. With a new set of items, we show that when young infants (age 6-16 months, n = 49) are presented with side-by-side video clips depicting various common early words, and one clip is…

  5. Differential host response, rather than early viral replication efficiency, correlates with pathogenicity caused by influenza viruses.

    PubMed

    Askovich, Peter S; Sanders, Catherine J; Rosenberger, Carrie M; Diercks, Alan H; Dash, Pradyot; Navarro, Garnet; Vogel, Peter; Doherty, Peter C; Thomas, Paul G; Aderem, Alan

    2013-01-01

    Influenza viruses exhibit large, strain-dependent differences in pathogenicity in mammalian hosts. Although the characteristics of severe disease, including uncontrolled viral replication, infection of the lower airway, and highly inflammatory cytokine responses have been extensively documented, the specific virulence mechanisms that distinguish highly pathogenic strains remain elusive. In this study, we focused on the early events in influenza infection, measuring the growth rate of three strains of varying pathogenicity in the mouse airway epithelium and simultaneously examining the global host transcriptional response over the first 24 hours. Although all strains replicated equally rapidly over the first viral life-cycle, their growth rates in both lung and tracheal tissue strongly diverged at later times, resulting in nearly 10-fold differences in viral load by 24 hours following infection. We identified separate networks of genes in both the lung and tracheal tissues whose rapid up-regulation at early time points by specific strains correlated with a reduced viral replication rate of those strains. The set of early-induced genes in the lung that led to viral growth restriction is enriched for both NF-κB binding site motifs and members of the TREM1 and IL-17 signaling pathways, suggesting that rapid, NF-κB -mediated activation of these pathways may contribute to control of viral replication. Because influenza infection extending into the lung generally results in severe disease, early activation of these pathways may be one factor distinguishing high- and low-pathogenicity strains.

  6. Low rate of replication fork progression lengthens the replication timing of a locus containing an early firing origin

    PubMed Central

    Bénard, Marianne; Maric, Chrystelle; Pierron, Gérard

    2007-01-01

    Invariance of temporal order of genome replication in eukaryotic cells and its correlation with gene activity has been well-documented. However, recent data suggest a relax control of replication timing. To evaluate replication schedule accuracy, we detailed the replicational organization of the developmentally regulated php locus that we previously found to be lately replicated, even though php gene is highly transcribed in naturally synchronous plasmodia of Physarum. Unexpectedly, bi-dimensional agarose gel electrophoreses of DNA samples prepared at specific time points of S phase showed that replication of the locus actually begins at the onset of S phase but it proceeds through the first half of S phase, so that complete replication of php-containing DNA fragments occurs in late S phase. Origin mapping located replication initiation upstream php coding region. This proximity and rapid fork progression through the coding region result in an early replication of php gene. We demonstrated that afterwards an unusually low fork rate and unidirectional fork pausing prolong complete replication of php locus, and we excluded random replication timing. Importantly, we evidenced that the origin linked to php gene in plasmodium is not fired in amoebae when php expression dramatically reduced, further illustrating replication-transcription coupling in Physarum. PMID:17717000

  7. Low rate of replication fork progression lengthens the replication timing of a locus containing an early firing origin.

    PubMed

    Bénard, Marianne; Maric, Chrystelle; Pierron, Gérard

    2007-01-01

    Invariance of temporal order of genome replication in eukaryotic cells and its correlation with gene activity has been well-documented. However, recent data suggest a relax control of replication timing. To evaluate replication schedule accuracy, we detailed the replicational organization of the developmentally regulated php locus that we previously found to be lately replicated, even though php gene is highly transcribed in naturally synchronous plasmodia of Physarum. Unexpectedly, bi-dimensional agarose gel electrophoreses of DNA samples prepared at specific time points of S phase showed that replication of the locus actually begins at the onset of S phase but it proceeds through the first half of S phase, so that complete replication of php-containing DNA fragments occurs in late S phase. Origin mapping located replication initiation upstream php coding region. This proximity and rapid fork progression through the coding region result in an early replication of php gene. We demonstrated that afterwards an unusually low fork rate and unidirectional fork pausing prolong complete replication of php locus, and we excluded random replication timing. Importantly, we evidenced that the origin linked to php gene in plasmodium is not fired in amoebae when php expression dramatically reduced, further illustrating replication-transcription coupling in Physarum.

  8. Early Events in RNA Folding

    NASA Astrophysics Data System (ADS)

    Thirumalai, D.; Lee, Namkyung; Woodson, Sarah A.; Klimov, Dk

    2001-10-01

    We describe a conceptual framework for understanding the way large RNA molecules fold based on the notion that their free-energy landscape is rugged. A key prediction of our theory is that RNA folding can be described by the kinetic partitioning mechanism (KPM). According to KPM a small fraction of molecules folds rapidly to the native state whereas the remaining fraction is kinetically trapped in a low free-energy non-native state. This model provides a unified description of the way RNA and proteins fold. Single-molecule experiments on Tetrahymena ribozyme, which directly validate our theory, are analyzed using KPM. We also describe the earliest events that occur on microsecond time scales in RNA folding. These must involve collapse of RNA molecules that are mediated by counterion-condensation. Estimates of time scales for the initial events in RNA folding are provided for the Tetrahymena ribozyme.

  9. Early Events of DNA Photodamage

    NASA Astrophysics Data System (ADS)

    Schreier, Wolfgang J.; Gilch, Peter; Zinth, Wolfgang

    2015-04-01

    Ultraviolet (UV) radiation is a leading external hazard to the integrity of DNA. Exposure to UV radiation triggers a cascade of chemical reactions, and many molecular products (photolesions) have been isolated that are potentially dangerous for the cellular system. The early steps that take place after UV absorption by DNA have been studied by ultrafast spectroscopy. The review focuses on the evolution of excited electronic states, the formation of photolesions, and processes suppressing their formation. Emphasis is placed on lesions involving two thymine bases, such as the cyclobutane pyrimidine dimer, the (6-4) lesion, and its Dewar valence isomer.

  10. The Problems of Replication in the Early Stages of Evolution: Enumeration of Variants and Spatial Configurations of Replicators

    NASA Astrophysics Data System (ADS)

    Melkikh, Alexey V.

    2014-12-01

    Two main problems of replication in the early stages of evolution are discussed: the problem of exponentially large number of conformational degrees of freedom and the problem of enumeration of variants.

  11. A post-entry role for CD63 in early HIV-1 replication

    SciTech Connect

    Li Guangyu; Dziuba, Natallia; Friedrich, Brian; Murray, James L.; Ferguson, Monique R.

    2011-04-10

    Macrophages and CD4{sup +} lymphocytes are the major reservoirs for HIV-1 infection. CD63 is a tetraspanin transmembrane protein, which has been shown to play an essential role during HIV-1 replication in macrophages. In this study, we further confirm the requirement of CD63 in early HIV-1 replication events in both macrophages and a CD4{sup +} cell line. Further analysis revealed that viral attachment and cell-cell fusion were unaffected by CD63 silencing. However, CD63-depleted macrophages showed a significant decrease in the initiation and completion of HIV-1 reverse transcription, affecting subsequent events of the HIV-1 life cycle. Integration of HIV-1 cDNA as well as the formation of 2-LTR circles was notably reduced. Reporter assays showed that CD63 down regulation reduced production of the early HIV protein Tat. In agreement, CD63 silencing also inhibited production of the late protein p24. These findings suggest that CD63 plays an early post-entry role prior to or at the reverse transcription step.

  12. At Short Telomeres Tel1 Directs Early Replication and Phosphorylates Rif1

    PubMed Central

    Sridhar, Akila; Kedziora, Sylwia; Donaldson, Anne D.

    2014-01-01

    The replication time of Saccharomyces cerevisiae telomeres responds to TG1–3 repeat length, with telomeres of normal length replicating late during S phase and short telomeres replicating early. Here we show that Tel1 kinase, which is recruited to short telomeres, specifies their early replication, because we find a tel1Δ mutant has short telomeres that nonetheless replicate late. Consistent with a role for Tel1 in driving early telomere replication, initiation at a replication origin close to an induced short telomere was reduced in tel1Δ cells, in an S phase blocked by hydroxyurea. The telomeric chromatin component Rif1 mediates late replication of normal telomeres and is a potential substrate of Tel1 phosphorylation, so we tested whether Tel1 directs early replication of short telomeres by inactivating Rif1. A strain lacking both Rif1 and Tel1 behaves like a rif1Δ mutant by replicating its telomeres early, implying that Tel1 can counteract the delaying effect of Rif1 to control telomere replication time. Proteomic analyses reveals that in yku70Δ cells that have short telomeres, Rif1 is phosphorylated at Tel1 consensus sequences (S/TQ sites), with phosphorylation of Serine-1308 being completely dependent on Tel1. Replication timing analysis of a strain mutated at these phosphorylation sites, however, suggested that Tel1-mediated phosphorylation of Rif1 is not the sole mechanism of replication timing control at telomeres. Overall, our results reveal two new functions of Tel1 at shortened telomeres: phosphorylation of Rif1, and specification of early replication by counteracting the Rif1-mediated delay in initiation at nearby replication origins. PMID:25329891

  13. Early Word Comprehension in Infants: Replication and Extension

    PubMed Central

    Bergelson, Elika; Swingley, Daniel

    2014-01-01

    A handful of recent experimental reports have shown that infants of 6 to 9 months know the meanings of some common words. Here, we replicate and extend these findings. With a new set of items, we show that when young infants (age 6-16 months, n=49) are presented with side-by-side video clips depicting various common early words, and one clip is named in a sentence, they look at the named video at above-chance rates. We demonstrate anew that infants understand common words by 6-9 months, and that performance increases substantially around 14 months. The results imply that 6-9 month olds’ failure to understand words not referring to objects (verbs, adjectives, performatives) in a similar prior study is not attributable to the use of dynamic video depictions. Thus, 6-9 month olds’ experience of spoken language includes some understanding of common words for concrete objects, but relatively impoverished comprehension of other words. PMID:26664329

  14. Early Events in Ionic Liquid Radiation Chemistry

    SciTech Connect

    Wishart, J.F.; Cook, A.; Rimmer, R.D.; Gohdo, M.

    2010-09-14

    Ionic liquids are interesting and useful materials whose solvation time scales are up to thousands of times longer than in conventional solvents. The extended lifetimes of pre-solvated electrons and other energetic species in ionic liquids has profound consequences for the radiolytic product distributions and reactivity patterns. We use a newly developed, multiplexed variation of pulse-probe spectroscopy to measure the kinetics of the early dynamical and reactive events in ionic liquids.

  15. Early intranuclear replication of African swine fever virus genome modifies the landscape of the host cell nucleus.

    PubMed

    Simões, Margarida; Martins, Carlos; Ferreira, Fernando

    2015-12-01

    Although African swine fever virus (ASFV) replicates in viral cytoplasmic factories, the presence of viral DNA within the host cell nucleus has been previously reported to be essential for productive infection. Herein, we described, for the first time, the intranuclear distribution patterns of viral DNA replication events, preceding those that occur in the cytoplasmic compartment. Using BrdU pulse-labelling experiments, newly synthesized ASFV genomes were exclusively detected inside the host cell nucleus at the early phase of infection, both in swine monocyte-derived macrophages (MDMs) and Vero cells. From 8hpi onwards, BrdU labelling was only observed in ASFV cytoplasmic factories. Our results also show that ASFV specifically activates the Ataxia Telangiectasia Mutated Rad-3 related (ATR) pathway in ASFV-infected swine MDMs from the early phase of infection, most probably because ASFV genome is recognized as foreign DNA. Morphological changes of promyelocytic leukaemia nuclear bodies (PML-NBs), nuclear speckles and Cajal bodies were also found in ASFV-infected swine MDMs, strongly suggesting the viral modulation of cellular antiviral responses and cellular transcription, respectively. As described for other viral infections, the nuclear reorganization that takes place during ASFV infection may also provide an environment that favours its intranuclear replication events. Altogether, our results contribute for a better understanding of ASFV replication strategies, starting with an essential intranuclear DNA replication phase which induces host nucleus changes towards a successful viral infection.

  16. Polyoma virus early-late switch: regulation of late RNA accumulation by DNA replication.

    PubMed

    Liu, Z; Carmichael, G G

    1993-09-15

    Early in infection of permissive mouse cells, messages from the early region of the polyoma virus genome accumulate preferentially over those from the late region. After initiation of DNA replication, the balance between early and late gene expression is reversed in favor of the late products. In previous work from our laboratory, we showed that viral early proteins do not activate the polyoma late promoter in the absence of DNA replication. Here we show that activation of the late genes in replication-incompetent viral genomes can occur if actively replicating genomes are present in the same cell. A low level of DNA replication, however, is insufficient to induce the early-late switch. Furthermore, replication-competent genomes that fail to accumulate late RNA molecules are defective in the transactivation of replication-incompetent genomes. We suggest that titration of an unknown diffusible factor(s) after DNA replication relieves the block to late RNA accumulation seen in the early phase, with most of this titration being attributable to late-strand RNA molecules themselves.

  17. Dynamics of DNA Replication during Premeiosis and Early Meiosis in Wheat

    PubMed Central

    Rey, María-Dolores; Prieto, Pilar

    2014-01-01

    Meiosis is a specialised cell division that involves chromosome replication, two rounds of chromosome segregation and results in the formation of the gametes. Meiotic DNA replication generally precedes chromosome pairing, recombination and synapsis in sexually developing eukaryotes. In this work, replication has been studied during premeiosis and early meiosis in wheat using flow cytometry, which has allowed the quantification of the amount of DNA in wheat anther in each phase of the cell cycle during premeiosis and each stage of early meiosis. Flow cytometry has been revealed as a suitable and user-friendly tool to detect and quantify DNA replication during early meiosis in wheat. Chromosome replication was detected in wheat during premeiosis and early meiosis until the stage of pachytene, when chromosomes are associated in pairs to further recombine and correctly segregate in the gametes. In addition, the effect of the Ph1 locus, which controls chromosome pairing and affects replication in wheat, was also studied by flow cytometry. Here we showed that the Ph1 locus plays an important role on the length of meiotic DNA replication in wheat, particularly affecting the rate of replication during early meiosis in wheat. PMID:25275307

  18. Dynamics of DNA replication during premeiosis and early meiosis in wheat.

    PubMed

    Rey, María-Dolores; Prieto, Pilar

    2014-01-01

    Meiosis is a specialised cell division that involves chromosome replication, two rounds of chromosome segregation and results in the formation of the gametes. Meiotic DNA replication generally precedes chromosome pairing, recombination and synapsis in sexually developing eukaryotes. In this work, replication has been studied during premeiosis and early meiosis in wheat using flow cytometry, which has allowed the quantification of the amount of DNA in wheat anther in each phase of the cell cycle during premeiosis and each stage of early meiosis. Flow cytometry has been revealed as a suitable and user-friendly tool to detect and quantify DNA replication during early meiosis in wheat. Chromosome replication was detected in wheat during premeiosis and early meiosis until the stage of pachytene, when chromosomes are associated in pairs to further recombine and correctly segregate in the gametes. In addition, the effect of the Ph1 locus, which controls chromosome pairing and affects replication in wheat, was also studied by flow cytometry. Here we showed that the Ph1 locus plays an important role on the length of meiotic DNA replication in wheat, particularly affecting the rate of replication during early meiosis in wheat.

  19. Early events in axon/dendrite polarization.

    PubMed

    Cheng, Pei-lin; Poo, Mu-ming

    2012-01-01

    Differentiation of axons and dendrites is a critical step in neuronal development. Here we review the evidence that axon/dendrite formation during neuronal polarization depends on the intrinsic cytoplasmic asymmetry inherited by the postmitotic neuron, the exposure of the neuron to extracellular chemical factors, and the action of anisotropic mechanical forces imposed by the environment. To better delineate the functions of early signals among a myriad of cellular components that were shown to influence axon/dendrite formation, we discuss their functions by distinguishing their roles as determinants, mediators, or modulators and consider selective degradation of these components as a potential mechanism for axon/dendrite polarization. Finally, we examine whether these early events of axon/dendrite formation involve local autocatalytic activation and long-range inhibition, as postulated by Alan Turing for the morphogenesis of patterned biological structure.

  20. Early events in axon/dendrite polarization.

    PubMed

    Cheng, Pei-lin; Poo, Mu-ming

    2012-01-01

    Differentiation of axons and dendrites is a critical step in neuronal development. Here we review the evidence that axon/dendrite formation during neuronal polarization depends on the intrinsic cytoplasmic asymmetry inherited by the postmitotic neuron, the exposure of the neuron to extracellular chemical factors, and the action of anisotropic mechanical forces imposed by the environment. To better delineate the functions of early signals among a myriad of cellular components that were shown to influence axon/dendrite formation, we discuss their functions by distinguishing their roles as determinants, mediators, or modulators and consider selective degradation of these components as a potential mechanism for axon/dendrite polarization. Finally, we examine whether these early events of axon/dendrite formation involve local autocatalytic activation and long-range inhibition, as postulated by Alan Turing for the morphogenesis of patterned biological structure. PMID:22715881

  1. Antibiotic-dependent expression of early transcription factor subunits leads to stringent control of vaccinia virus replication.

    PubMed

    Hagen, Caitlin J; Titong, Allison; Sarnoski, Ethan A; Verardi, Paulo H

    2014-03-01

    The use of vaccinia virus (VACV) as the vaccine against variola virus resulted in the eradication of smallpox. VACV has since been used in the development of recombinant vaccine and therapeutic vectors, but complications associated with uncontrolled viral replication have constrained its use as a live viral vector. We propose to improve the safety of VACV as a live-replicating vector by using elements of the tet operon to control the transcription of genes that are essential for viral growth. Poxviruses encode all enzymes and factors necessary for their replication within the host cell cytoplasm. One essential VACV factor is the vaccinia early transcription factor (VETF) packaged into the viral core. This heterodimeric protein is required for expression of early VACV genes. VETF is composed of a large subunit encoded by the A7L gene and a small subunit encoded by the D6R gene. Two recombinant VACVs were generated in which either the A7L or D6R gene was placed under the control of tet operon elements to allow their transcription, and therefore viral replication, to be dependent on tetracycline antibiotics such as doxycycline. In the absence of inducers, no plaques were produced but abortively infected cells could be identified by expression of a reporter gene. In the presence of doxycycline, both recombinant viruses replicated indistinguishably from the wild-type strain. This stringent control of VACV replication can be used for the development of safer, next-generation VACV vaccines and therapeutic vectors. Such replication-inducible VACVs would only replicate when administered with tetracycline antibiotics, and if adverse events were to occur, treatment would be as simple as antibiotic cessation.

  2. Kinetochores coordinate pericentromeric cohesion and early DNA replication by Cdc7-Dbf4 kinase recruitment.

    PubMed

    Natsume, Toyoaki; Müller, Carolin A; Katou, Yuki; Retkute, Renata; Gierliński, Marek; Araki, Hiroyuki; Blow, J Julian; Shirahige, Katsuhiko; Nieduszynski, Conrad A; Tanaka, Tomoyuki U

    2013-06-01

    Centromeres play several important roles in ensuring proper chromosome segregation. Not only do they promote kinetochore assembly for microtubule attachment, but they also support robust sister chromatid cohesion at pericentromeres and facilitate replication of centromeric DNA early in S phase. However, it is still elusive how centromeres orchestrate all these functions at the same site. Here, we show that the budding yeast Dbf4-dependent kinase (DDK) accumulates at kinetochores in telophase, facilitated by the Ctf19 kinetochore complex. This promptly recruits Sld3-Sld7 replication initiator proteins to pericentromeric replication origins so that they initiate replication early in S phase. Furthermore, DDK at kinetochores independently recruits the Scc2-Scc4 cohesin loader to centromeres in G1 phase. This enhances cohesin loading and facilitates robust pericentromeric cohesion in S phase. Thus, we have found the central mechanism by which kinetochores orchestrate early S phase DNA replication and robust sister chromatid cohesion at microtubule attachment sites.

  3. Wolbachia Blocks Viral Genome Replication Early in Infection without a Transcriptional Response by the Endosymbiont or Host Small RNA Pathways.

    PubMed

    Rainey, Stephanie M; Martinez, Julien; McFarlane, Melanie; Juneja, Punita; Sarkies, Peter; Lulla, Aleksei; Schnettler, Esther; Varjak, Margus; Merits, Andres; Miska, Eric A; Jiggins, Francis M; Kohl, Alain

    2016-04-01

    The intracellular endosymbiotic bacterium Wolbachia can protect insects against viral infection, and is being introduced into mosquito populations in the wild to block the transmission of arboviruses that infect humans and are a major public health concern. To investigate the mechanisms underlying this antiviral protection, we have developed a new model system combining Wolbachia-infected Drosophila melanogaster cell culture with the model mosquito-borne Semliki Forest virus (SFV; Togaviridae, Alphavirus). Wolbachia provides strong antiviral protection rapidly after infection, suggesting that an early stage post-infection is being blocked. Wolbachia does appear to have major effects on events distinct from entry, assembly or exit as it inhibits the replication of an SFV replicon transfected into the cells. Furthermore, it causes a far greater reduction in the expression of proteins from the 3' open reading frame than the 5' non-structural protein open reading frame, indicating that it is blocking the replication of viral RNA. Further to this separation of the replicase proteins and viral RNA in transreplication assays shows that uncoupling of viral RNA and replicase proteins does not overcome Wolbachia's antiviral activity. This further suggests that replicative processes are disrupted, such as translation or replication, by Wolbachia infection. This may occur by Wolbachia mounting an active antiviral response, but the virus did not cause any transcriptional response by the bacterium, suggesting that this is not the case. Host microRNAs (miRNAs) have been implicated in protection, but again we found that host cell miRNA expression was unaffected by the bacterium and neither do our findings suggest any involvement of the antiviral siRNA pathway. We conclude that Wolbachia may directly interfere with early events in virus replication such as translation of incoming viral RNA or RNA transcription, and this likely involves an intrinsic (as opposed to an induced

  4. Wolbachia Blocks Viral Genome Replication Early in Infection without a Transcriptional Response by the Endosymbiont or Host Small RNA Pathways

    PubMed Central

    McFarlane, Melanie; Juneja, Punita; Sarkies, Peter; Lulla, Aleksei; Schnettler, Esther; Varjak, Margus; Merits, Andres; Miska, Eric A.; Jiggins, Francis M.; Kohl, Alain

    2016-01-01

    The intracellular endosymbiotic bacterium Wolbachia can protect insects against viral infection, and is being introduced into mosquito populations in the wild to block the transmission of arboviruses that infect humans and are a major public health concern. To investigate the mechanisms underlying this antiviral protection, we have developed a new model system combining Wolbachia-infected Drosophila melanogaster cell culture with the model mosquito-borne Semliki Forest virus (SFV; Togaviridae, Alphavirus). Wolbachia provides strong antiviral protection rapidly after infection, suggesting that an early stage post-infection is being blocked. Wolbachia does appear to have major effects on events distinct from entry, assembly or exit as it inhibits the replication of an SFV replicon transfected into the cells. Furthermore, it causes a far greater reduction in the expression of proteins from the 3´ open reading frame than the 5´ non-structural protein open reading frame, indicating that it is blocking the replication of viral RNA. Further to this separation of the replicase proteins and viral RNA in transreplication assays shows that uncoupling of viral RNA and replicase proteins does not overcome Wolbachia’s antiviral activity. This further suggests that replicative processes are disrupted, such as translation or replication, by Wolbachia infection. This may occur by Wolbachia mounting an active antiviral response, but the virus did not cause any transcriptional response by the bacterium, suggesting that this is not the case. Host microRNAs (miRNAs) have been implicated in protection, but again we found that host cell miRNA expression was unaffected by the bacterium and neither do our findings suggest any involvement of the antiviral siRNA pathway. We conclude that Wolbachia may directly interfere with early events in virus replication such as translation of incoming viral RNA or RNA transcription, and this likely involves an intrinsic (as opposed to an induced

  5. The Chemistry of Early Self-Replicating Systems

    NASA Technical Reports Server (NTRS)

    Bada, Jeffrey L.

    2004-01-01

    On June 10, 2003, a symposium 'Celebrating 50 Years of Prebiotic Chemistry' honoring the 50th Anniversary of the 1953 publication of the Miller Experiment in SCIENCE was held at the University of California, San Diego. This event was organized and hosted by the NASA Specialized Center of Research and Training in Exobiology. It was sponsored by NASA, the Dean of Physical Sciences and the Department of Chemistry and Biochemistry at the University of California, San Diego (UCSD). The following events were held: 1) For the symposium, public lectures and a reception were held at UCSD on June 10, 2003 in honor of the 50th Anniversary of the Miller Experiment. The speakers were the NSCORT/Exobiology Principal Investigators Dr. Jeffrey L. Bada and Dr. Gerald F. Joyce and the moderator, Dr. Leslie Orgel; 2) A evening discussion seminar and dinner was held at UCSD with invited scientists, NSCORT investigators, NASA Headquarters Officials and the Chancellor and Officials of the University of California, San Diego. Stanley Miller has had a long history of support from the NASA Exobiology Section. This event commemorated the anniversary of his classic experiment and was a small recognition of his contributions to the field.

  6. Replication protein A safeguards genome integrity by controlling NER incision events

    PubMed Central

    Overmeer, René M.; Moser, Jill; Volker, Marcel; Kool, Hanneke; Tomkinson, Alan E.; van Zeeland, Albert A.

    2011-01-01

    Single-stranded DNA gaps that might arise by futile repair processes can lead to mutagenic events and challenge genome integrity. Nucleotide excision repair (NER) is an evolutionarily conserved repair mechanism, essential for removal of helix-distorting DNA lesions. In the currently prevailing model, NER operates through coordinated assembly of repair factors into pre- and post-incision complexes; however, its regulation in vivo is poorly understood. Notably, the transition from dual incision to repair synthesis should be rigidly synchronized as it might lead to accumulation of unprocessed repair intermediates. We monitored NER regulatory events in vivo using sequential UV irradiations. Under conditions that allow incision yet prevent completion of repair synthesis or ligation, preincision factors can reassociate with new damage sites. In contrast, replication protein A remains at the incomplete NER sites and regulates a feedback loop from completion of DNA repair synthesis to subsequent damage recognition, independently of ATR signaling. Our data reveal an important function for replication protein A in averting further generation of DNA strand breaks that could lead to mutagenic and recombinogenic events. PMID:21282463

  7. Reconstructing Early Events in Eukaryotic Evolution.

    PubMed

    Roger

    1999-10-01

    Resolving the order of events that occurred during the transition from prokaryotic to eukaryotic cells remains one of the greatest problems in cell evolution. One view, the Archezoa hypothesis, proposes that the endosymbiotic origin of mitochondria occurred relatively late in eukaryotic evolution and that several mitochondrion-lacking protist groups diverged before the establishment of the organelle. Phylogenies based on small subunit ribosomal RNA and several protein-coding genes supported this proposal, placing amitochondriate protists such as diplomonads, parabasalids, and Microsporidia as the earliest diverging eukaryotic lineages. However, trees of other molecules, such as tubulins, heat shock protein 70, TATA box-binding protein, and the largest subunit of RNA polymerase II, indicate that Microsporidia are not deeply branching eukaryotes but instead are close relatives of the Fungi. Furthermore, recent discoveries of mitochondrion-derived genes in the nuclear genomes of entamoebae, Microsporidia, parabasalids, and diplomonads suggest that these organisms likely descend from mitochondrion-bearing ancestors. Although several protist lineages formally remain as candidates for Archezoa, most evidence suggests that the mitochondrial endosymbiosis took place prior to the divergence of all extant eukaryotes. In addition, discoveries of proteobacterial-like nuclear genes coding for cytoplasmic proteins indicate that the mitochondrial symbiont may have contributed more to the eukaryotic lineage than previously thought. As genome sequence data from parabasalids and diplomonads accumulate, it is becoming clear that the last common ancestor of these protist taxa and other extant eukaryotic groups already possessed many of the complex features found in most eukaryotes but lacking in prokaryotes. However, our confidence in the deeply branching position of diplomonads and parabasalids among eukaryotes is weakened by conflicting phylogenies and potential sources of artifact

  8. Submicron X-Ray Replication Technology For Early Application

    NASA Astrophysics Data System (ADS)

    Fencil, C. R.; Hughes, G. P.

    1983-11-01

    First-generation, full-wafer exposure, X-ray lithography equipment has been in continuous operation since 1979 in a pilot line application.(1,2,3) Second-generation, full-wafer exposure systems that incorporate the latest advancements in X-ray lithography are now being developed for early, submicron, VLSI patterning. This paper discusses recent advances in E-beam gun design and high-speed rotating anode development in terms of X-ray lithographic performances such as resolution and image contrast. In addition, the performance of a physical optics alignment technique that is compatible with submicron IC pattern overlay requirements is reported. The Perkin-Elmer X-100 full-wafer exposure system is a valuable development tool because of its flexibility. It is compatible with all X-ray masks and resists and can be used to expose either 75 mm or 100 mm diameter wafers.

  9. DNA Replication Origin Interference Increases the Spacing between Initiation Events in Human Cells

    PubMed Central

    Lebofsky, Ronald; Heilig, Roland; Sonnleitner, Max; Weissenbach, Jean

    2006-01-01

    Mammalian DNA replication origins localize to sites that range from base pairs to tens of kilobases. A regular distribution of initiations in individual cell cycles suggests that only a limited number of these numerous potential start sites are converted into activated origins. Origin interference can silence redundant origins; however, it is currently unknown whether interference participates in spacing functional human initiation events. By using a novel hybridization strategy, genomic Morse code, on single combed DNA molecules from primary keratinocytes, we report the initiation sites present on 1.5 Mb of human chromosome 14q11.2. We confirm that initiation zones are widespread in human cells, map to intergenic regions, and contain sequence motifs found at other mammalian initiation zones. Origins used per cell cycle are less abundant than the potential sites of initiation, and their limited use increases the spacing between initiation events. Between-zone interference decreases in proportion to the distance from the active origin, whereas within-zone interference is 100% efficient. These results identify a hierarchical organization of origin activity in human cells. Functional origins govern the probability that nearby origins will fire in the context of multiple potential start sites of DNA replication, and this is mediated by origin interference. PMID:17005913

  10. Cell-Type Specific Responses to DNA Replication Stress in Early C. elegans Embryos

    PubMed Central

    Stevens, Holly; Williams, Ashley B.

    2016-01-01

    To better understand how the cellular response to DNA replication stress is regulated during embryonic development, we and others have established the early C. elegans embryo as a model system to study this important problem. As is the case in most eukaryotic cell types, the replication stress response is controlled by the ATR kinase in early worm embryos. In this report we use RNAi to systematically characterize ATR pathway components for roles in promoting cell cycle delay during a replication stress response, and we find that these genetic requirements vary, depending on the source of stress. We also examine how individual cell types within the embryo respond to replication stress, and we find that the strength of the response, as defined by duration of cell cycle delay, varies dramatically within blastomeres of the early embryo. Our studies shed light on how the replication stress response is managed in the context of embryonic development and show that this pathway is subject to developmental regulation. PMID:27727303

  11. Early replication dynamics of sex-linked mitochondrial DNAs in the doubly uniparental inheritance species Ruditapes philippinarum (Bivalvia Veneridae).

    PubMed

    Guerra, D; Ghiselli, F; Milani, L; Breton, S; Passamonti, M

    2016-03-01

    Mitochondrial homoplasmy, which is maintained by strictly maternal inheritance and a series of bottlenecks, is thought to be an adaptive condition for metazoans. Doubly uniparental inheritance (DUI) is a unique mode of mitochondrial transmission found in bivalve species, in which two distinct mitochondrial genome (mtDNA) lines are present, one inherited through eggs (F) and one through sperm (M). During development, the two lines segregate in a sex- and tissue-specific manner: females lose M during embryogenesis, whereas males actively segregate it in the germ line. These two pivotal events are still poorly characterized. Here we investigated mtDNA replication dynamics during embryogenesis and pre-adulthood of the venerid Ruditapes philippinarum using real-time quantitative PCR. We found that both mtDNAs do not detectably replicate during early embryogenesis, and that the M line might be lost from females around 24 h of age. A rise in mtDNA copy number was observed before the first reproductive season in both sexes, with the M mitochondrial genome replicating more than the F in males, and we associate these boosts to the early phase of gonad production. As evidence indicates that DUI relies on the same molecular machine of mitochondrial maternal inheritance that is common in most animals, our data are relevant not only to DUI but also to shed light on how differential segregations of mtDNA variants, in the same nuclear background, may be controlled during development. PMID:26626575

  12. Early replication dynamics of sex-linked mitochondrial DNAs in the doubly uniparental inheritance species Ruditapes philippinarum (Bivalvia Veneridae).

    PubMed

    Guerra, D; Ghiselli, F; Milani, L; Breton, S; Passamonti, M

    2016-03-01

    Mitochondrial homoplasmy, which is maintained by strictly maternal inheritance and a series of bottlenecks, is thought to be an adaptive condition for metazoans. Doubly uniparental inheritance (DUI) is a unique mode of mitochondrial transmission found in bivalve species, in which two distinct mitochondrial genome (mtDNA) lines are present, one inherited through eggs (F) and one through sperm (M). During development, the two lines segregate in a sex- and tissue-specific manner: females lose M during embryogenesis, whereas males actively segregate it in the germ line. These two pivotal events are still poorly characterized. Here we investigated mtDNA replication dynamics during embryogenesis and pre-adulthood of the venerid Ruditapes philippinarum using real-time quantitative PCR. We found that both mtDNAs do not detectably replicate during early embryogenesis, and that the M line might be lost from females around 24 h of age. A rise in mtDNA copy number was observed before the first reproductive season in both sexes, with the M mitochondrial genome replicating more than the F in males, and we associate these boosts to the early phase of gonad production. As evidence indicates that DUI relies on the same molecular machine of mitochondrial maternal inheritance that is common in most animals, our data are relevant not only to DUI but also to shed light on how differential segregations of mtDNA variants, in the same nuclear background, may be controlled during development.

  13. Early events in geotropism of seedling shoots

    NASA Technical Reports Server (NTRS)

    Pickard, B. G.

    1985-01-01

    Developments during the first ten minutes of geotropic stimulation in plant seedling shoots are reviewed. Topics include induction and curvature; early processes; the relationship between auxin, electric field, calcium, and differential growth; gravity reception leading to Went-Cholodny transport; and comparison of root and shoot. Early processes reviewed are sedimentation of amyloplasts, release of ethylene, rise of electrical and auxin asymmetry, redistribution of calcium, asymmetric vascular transport, increase in tendency to deposit callose, and simulation of putative exocytotic voltage transients.

  14. Potent and selective inhibition of human immunodeficiency virus (HIV)-1 and HIV-2 replication by a class of bicyclams interacting with a viral uncoating event.

    PubMed Central

    De Clercq, E; Yamamoto, N; Pauwels, R; Baba, M; Schols, D; Nakashima, H; Balzarini, J; Debyser, Z; Murrer, B A; Schwartz, D

    1992-01-01

    A series of bicyclams have been shown to be potent and selective inhibitors of human immunodeficiency virus (HIV). The compounds are inhibitory to the replication of various HIV-1 and HIV-2 strains in various human T-cell systems, including peripheral blood lymphocytes, at 0.14-1.4 microM, without being toxic to the host cells at 2.2 mM. The bicyclam JM2763 is active against 3'-azido-3'-deoxythymidine (zidovudine; AZT)-resistant HIV-1 strains and acts additively with AZT. Mechanism of action studies revealed that the bicyclams (i.e., JM2763) interact with an early event of the retrovirus replicative cycle, which could be tentatively identified as a viral uncoating event. Images PMID:1608936

  15. DNA replication stress induces deregulation of the cell cycle events in root meristems of Allium cepa

    PubMed Central

    Żabka, Aneta; Polit, Justyna Teresa; Maszewski, Janusz

    2012-01-01

    Background and Aims Prolonged treatment of Allium cepa root meristems with changing concentrations of hydroxyurea (HU) results in either premature chromosome condensation or cell nuclei with an uncommon form of biphasic chromatin organization. The aim of the current study was to assess conditions that compromise cell cycle checkpoints and convert DNA replication stress into an abnormal course of mitosis. Methods Interphase-mitotic (IM) cells showing gradual changes of chromatin condensation were obtained following continuous 72 h treatment of seedlings with 0·75 mm HU (without renewal of the medium). HU-treated root meristems were analysed using histochemical stainings (DNA-DAPI/Feulgen; starch-iodide and DAB staining for H2O2 production), Western blotting [cyclin B-like (CBL) proteins] and immunochemistry (BrdU incorporation, detection of γ-H2AX and H3S10 phosphorylation). Key Results Continuous treatment of onion seedlings with a low concentration of HU results in shorter root meristems, enhanced production of H2O2, γ-phosphorylation of H2AX histones and accumulation of CBL proteins. HU-induced replication stress gives rise to axially elongated cells with half interphase/half mitotic structures (IM-cells) having both decondensed and condensed domains of chromatin. Long-term HU treatment results in cell nuclei resuming S phase with gradients of BrdU labelling. This suggests a polarized distribution of factors needed to re-initiate stalled replication forks. Furthermore, prolonged HU treatment extends both the relative time span and the spatial scale of H3S10 phosphorylation known in plants. Conclusions The minimum cell length and a threshold level of accumulated CBL proteins are both determining factors by which the nucleus attains commitment to induce an asynchronous course of chromosome condensation. Replication stress-induced alterations in an orderly route of the cell cycle events probably reflect a considerable reprogramming of metabolic functions of

  16. Remote Acculturation of Early Adolescents in Jamaica towards European American Culture: A Replication and Extension

    PubMed Central

    Ferguson, Gail M.; Bornstein, Marc H.

    2015-01-01

    Remote acculturation is a modern form of non-immigrant acculturation identified among early adolescents in Jamaica as “Americanization”. This study aimed to replicate the original remote acculturation findings in a new cohort of early adolescents in Jamaica (n = 222; M = 12.08 years) and to extend our understanding of remote acculturation by investigating potential vehicles of indirect and intermittent intercultural contact. Cluster analyses replicated prior findings: Relative to Traditional Jamaican adolescents (62%), Americanized Jamaican adolescents (38%) reported stronger European American cultural orientation, lower Jamaican orientation, lower family obligations, and greater conflict with parents. More U.S. media (girls) and less local media and local sports (all) were the primary vehicles of intercultural contact predicting higher odds of Americanization. U.S. food, U.S. tourism, and transnational communication were also linked to U.S. orientation. Findings have implications for acculturation research and for practice and policy targeting Caribbean youth and families. PMID:25709142

  17. Endocrinologic events in early pregnancy failure.

    PubMed

    Aspillaga, M O; Whittaker, P G; Grey, C E; Lind, T

    1983-12-15

    Fourteen women experiencing early pregnancy failure have been studied during the time of conception and at frequent intervals until spontaneous abortion occurred. Serial measurements of serum estradiol, progesterone, 17 alpha-hydroxyprogesterone, prolactin, human placental lactogen (hPL), and human chorionic gonadotropin (hCG) were determined; regular sonar scanning allowed the time of fetal death to be determined to within 7 days in six patients and a diagnosis of blighted ovum to be made in the remainder. In all patients serum progesterone and estradiol concentrations were within the normal range up to 7 weeks but appeared to decrease from about 8 weeks' gestation whether or not a living fetus was present. The placenta continued to produce hCG and hPL but, despite the continuing presence of hCG, the levels of 17 alpha-hydroxyprogesterone declined to concentrations below those associated with normal pregnancy. These data suggest that the placenta may require a particular stimulus to take over production of progesterone and estradiol.

  18. Alpha interferon inhibits early stages of the human immunodeficiency virus type 1 replication cycle.

    PubMed Central

    Shirazi, Y; Pitha, P M

    1992-01-01

    In this study, we have analyzed the effect of human alpha interferon (IFN-alpha) on a single replication cycle of human immunodeficiency virus type 1 (HIV-1) infection in the lymphocytic cell line CEM-174, which is highly sensitive to the antiviral effects of IFN. Pretreatment of cells with 50 to 500 U of recombinant human IFN-alpha per ml resulted in a marked reduction in viral RNA and protein synthesis. The effect of IFN-alpha was dose dependent and was amplified in multiple infection cycles. IFN-induced inhibition of viral protein synthesis could be detected only when cells were treated with IFN-alpha prior to infection or when IFN-alpha was added up to 10 h postinfection, but not if IFN-alpha was added at the later stages of HIV-1 replication cycle or after the HIV-1 infection was already established. Analysis of the integrated HIV-1 provirus showed a marked decrease in the levels of proviral DNA in IFN-treated cells. Thus, in contrast to the previous studies on established HIV-1 infection in T cells, in which the IFN block appeared to be at the posttranslational level, during de novo infection, IFN-alpha interferes with an early step of HIV-1 replication cycle that occurs prior to the integration of the proviral DNA. These results indicate that the early IFN block of HIV-1 replication, which has been previously observed only in primary marcophages, can also be detected in the IFN-sensitive T cells, indicating that the early IFN block is not limited to macrophages. Images PMID:1738192

  19. Work-family enrichment and job performance: a constructive replication of affective events theory.

    PubMed

    Carlson, Dawn; Kacmar, K Michele; Zivnuska, Suzanne; Ferguson, Merideth; Whitten, Dwayne

    2011-07-01

    Based on affective events theory (AET), we hypothesize a four-step model of the mediating mechanisms of positive mood and job satisfaction in the relationship between work-family enrichment and job performance. We test this model for both directions of enrichment (work-to-family and family-to-work). We used two samples to test the model using structural equation modeling. Results from Study 1, which included 240 full-time employees, were replicated in Study 2, which included 189 matched subordinate-supervisor dyads. For the work-to-family direction, results from both samples support our conceptual model and indicate mediation of the enrichment-performance relationship for the work-to-family direction of enrichment. For the family-to-work direction, results from the first sample support our conceptual model but results from the second sample do not. Our findings help elucidate mixed findings in the enrichment and job performance literatures and contribute to an understanding of the mechanisms linking these concepts. We conclude with a discussion of the practical and theoretical implications of our findings.

  20. Nigericin is a potent inhibitor of the early stage of vaccinia virus replication.

    PubMed

    Myskiw, Chad; Piper, Jessica; Huzarewich, Rhiannon; Booth, Tim F; Cao, Jingxin; He, Runtao

    2010-12-01

    Poxviruses remain a significant public health concern due to their potential use as bioterrorist agents and the spread of animal borne poxviruses, such as monkeypox virus, to humans. Thus, the identification of small molecule inhibitors of poxvirus replication is warranted. Vaccinia virus is the prototypic member of the Orthopoxvirus genus, which also includes variola and monkeypox virus. In this study, we demonstrate that the carboxylic ionophore nigericin is a potent inhibitor of vaccinia virus replication in several human cell lines. In HeLa cells, we found that the 50% inhibitory concentration of nigericin against vaccinia virus was 7.9 nM, with a selectivity index of 1038. We present data demonstrating that nigericin targets vaccinia virus replication at a post-entry stage. While nigericin moderately inhibits both early vaccinia gene transcription and translation, viral DNA replication and intermediate and late gene expression are severely compromised in the presence of nigericin. Our results demonstrate that nigericin has the potential to be further developed into an effective antiviral to treat poxvirus infections. PMID:20951746

  1. Autophagy during early stages contributes to bovine viral diarrhea virus replication in MDBK cells.

    PubMed

    Fu, Qiang; Shi, Huijun; Zhang, Hui; Ren, Yan; Guo, Fei; Qiao, Jun; Jia, Bin; Wang, Pengyan; Chen, Chuangfu

    2014-10-01

    Autophagy (or autophagocytosis) is an essential and precise control process by which cells degrade unnecessary or dysfunctional cellular components or organelles in the cytoplasm in response to nutrient depletion, exogenous pathogens, or other stimuli. This process results in the removal of damaged or surplus organelles and macromolecular complexes via a lysosome-dependent mechanism. Bovine viral diarrhea virus (BVDV) is a ssRNA virus of the Flaviviridae family (genus Pestivirus). BVDV infection results in major economic losses due to poor reproductive performance and poor calf performance in cattle herds. In our previous studies, we have shown that BVDV NADL infection significantly increases autophagy in MDBK cells. To further define the interactions between autophagy and BVDV infection, we investigated the effects of autophagy on the replication of BVDV NADL. The findings showed that autophagy was inhibited by treatment with 3-methyladenine (3-MA) or wortmannin and that the knockdown of LC3 and Beclin1 using lentivirus-mediated RNA interference (RNAi) suppressed BVDV NADL replication. In contrast, the findings showed the replication of BVDV NADL was significantly increased by treatment with the autophagy inducer rapamycin within 18 h post-infection (pi). However, the mRNA levels of BVDV NADL 5'UTRs showed a downward trend after 18 h pi, and this effect was reversed by chloroquine treatment. Therefore, we inferred that infection with BVDV NADL increases autophagy, which in turn favors BVDV NADL replication at early stages.

  2. Method for early detection of cooling-loss events

    DOEpatents

    Bermudez, Sergio A.; Hamann, Hendrik F.; Marianno, Fernando J.

    2015-12-22

    A method of detecting cooling-loss event early is provided. The method includes defining a relative humidity limit and change threshold for a given space, measuring relative humidity in the given space, determining, with a processing unit, whether the measured relative humidity is within the defined relative humidity limit, generating a warning in an event the measured relative humidity is outside the defined relative humidity limit and determining whether a change in the measured relative humidity is less than the defined change threshold for the given space and generating an alarm in an event the change is greater than the defined change threshold.

  3. Method for early detection of cooling-loss events

    DOEpatents

    Bermudez, Sergio A.; Hamann, Hendrik; Marianno, Fernando J.

    2015-06-30

    A method of detecting cooling-loss event early is provided. The method includes defining a relative humidity limit and change threshold for a given space, measuring relative humidity in the given space, determining, with a processing unit, whether the measured relative humidity is within the defined relative humidity limit, generating a warning in an event the measured relative humidity is outside the defined relative humidity limit and determining whether a change in the measured relative humidity is less than the defined change threshold for the given space and generating an alarm in an event the change is greater than the defined change threshold.

  4. Operational early warning platform for extreme meteorological events

    NASA Astrophysics Data System (ADS)

    Mühr, Bernhard; Kunz, Michael

    2015-04-01

    Operational early warning platform for extreme meteorological events Most natural disasters are related to extreme weather events (e.g. typhoons); weather conditions, however, are also highly relevant for humanitarian and disaster relief operations during and after other natural disaster like earthquakes. The internet service "Wettergefahren-Frühwarnung" (WF) provides various information on extreme weather events, especially when these events are associated with a high potential for large damage. The main focus of the platform is on Central Europe, but major events are also monitored worldwide on a daily routine. WF provides high-resolution forecast maps for many weather parameters which allow detailed and reliable predictions about weather conditions during the next days in the affected areas. The WF service became operational in February 2004 and is part of the Center for Disaster Management and Risk Reduction Technology (CEDIM) since 2007. At the end of 2011, CEDIM embarked a new type of interdisciplinary disaster research termed as forensic disaster analysis (FDA) in near real time. In case of an imminent extreme weather event WF plays an important role in CEDIM's FDA group. It provides early and precise information which are always available and updated several times during a day and gives advice and assists with articles and reports on extreme events.

  5. Traumatic Events and Children: How Early Childhood Educators Can Help.

    ERIC Educational Resources Information Center

    Alat, Kazim

    2002-01-01

    Examines the range of children's responses to traumatic events and identifies common symptoms of posttraumatic stress disorder (PTSD). Identifies protective and risk factors for PTSD. Discusses ways early childhood educators can provide a sense of security and regularity in their classrooms and use classroom activities to facilitate coping with…

  6. Early apoptosis of porcine alveolar macrophages limits avian influenza virus replication and pro-inflammatory dysregulation.

    PubMed

    Chang, Pengxiang; Kuchipudi, Suresh V; Mellits, Kenneth H; Sebastian, Sujith; James, Joe; Liu, Jinhua; Shelton, Holly; Chang, Kin-Chow

    2015-01-01

    Pigs are evidently more resistant to avian than swine influenza A viruses, mediated in part through frontline epithelial cells and alveolar macrophages (AM). Although porcine AM (PAM) are crucial in influenza virus control, their mode of control is unclear. To gain insight into the possible role of PAM in the mediation of avian influenza virus resistance, we compared the host effects and replication of two avian (H2N3 and H6N1) and three mammalian (swine H1N1, human H1N1 and pandemic H1N1) influenza viruses in PAM. We found that PAM were readily susceptible to initial infection with all five avian and mammalian influenza viruses but only avian viruses caused early and extensive apoptosis (by 6 h of infection) resulting in reduced virus progeny and moderated pro-inflammation. Full length viral PB1-F2 present only in avian influenza viruses is a virulence factor that targets AM for mitochondrial-associated apoptotic cell death. With the use of reverse genetics on an avian H5N1 virus, we found that full length PB1-F2 contributed to increased apoptosis and pro-inflammation but not to reduced virus replication. Taken together, we propose that early apoptosis of PAM limits the spread of avian influenza viruses and that PB1-F2 could play a contributory role in the process. PMID:26642934

  7. Early nucleosome deposition on, and replication of, HSV DNA requires cell factor PCNA

    PubMed Central

    Sanders, Iryna; Boyer, Mark; Fraser, Nigel W.

    2015-01-01

    Herpes Simplex Virus (HSV) is a double stranded DNA virus that can cause lytic infections in epithelial cells of the skin and latent infections in neuronal cells of the peripheral nervous system. After virion attachment to the cell membrane, the capsid enters the cytoplasm and is transported to the nucleus. Following docking at the nuclear pore, the HSV DNA, and contents of the virion, are injected into the nucleus. The viral DNA that enters the nucleus is devoid of histones, but begins to be covered with them soon after entry. The covering of histones, in the form of nucleosomes, reaches a maximum during the early stages of infection and drops off during late infection (after DNA replication). However during latency the genome is saturated with nucleosomes. In this study, we examine the role of cell Proliferating Cell Nuclear Antigen (PCNA) a cellular DNA polymerase accessory protein (processivity factor), and cell DNA polymerases in histone deposition during the early stages of HSV infection. Using SiRNA knockdown, and a cytosine arabinoside (araC) chemical inhibitor, we conclude that PCNA is important for viral replication and histone deposition. However, cell DNA polymerases that bind PCNA do not appear to be required for these processes and PCNA does not appear to bind to the viral DNA polymerase (which has its own viral processivity factor). PMID:25672886

  8. Early apoptosis of porcine alveolar macrophages limits avian influenza virus replication and pro-inflammatory dysregulation

    PubMed Central

    Chang, Pengxiang; Kuchipudi, Suresh V.; Mellits, Kenneth H.; Sebastian, Sujith; James, Joe; Liu, Jinhua; Shelton, Holly; Chang, Kin-Chow

    2015-01-01

    Pigs are evidently more resistant to avian than swine influenza A viruses, mediated in part through frontline epithelial cells and alveolar macrophages (AM). Although porcine AM (PAM) are crucial in influenza virus control, their mode of control is unclear. To gain insight into the possible role of PAM in the mediation of avian influenza virus resistance, we compared the host effects and replication of two avian (H2N3 and H6N1) and three mammalian (swine H1N1, human H1N1 and pandemic H1N1) influenza viruses in PAM. We found that PAM were readily susceptible to initial infection with all five avian and mammalian influenza viruses but only avian viruses caused early and extensive apoptosis (by 6 h of infection) resulting in reduced virus progeny and moderated pro-inflammation. Full length viral PB1-F2 present only in avian influenza viruses is a virulence factor that targets AM for mitochondrial-associated apoptotic cell death. With the use of reverse genetics on an avian H5N1 virus, we found that full length PB1-F2 contributed to increased apoptosis and pro-inflammation but not to reduced virus replication. Taken together, we propose that early apoptosis of PAM limits the spread of avian influenza viruses and that PB1-F2 could play a contributory role in the process. PMID:26642934

  9. Chasing the Origin of Viruses: Capsid-Forming Genes as a Life-Saving Preadaptation within a Community of Early Replicators.

    PubMed

    Jalasvuori, Matti; Mattila, Sari; Hoikkala, Ville

    2015-01-01

    Virus capsids mediate the transfer of viral genetic information from one cell to another, thus the origin of the first viruses arguably coincides with the origin of the viral capsid. Capsid genes are evolutionarily ancient and their emergence potentially predated even the origin of first free-living cells. But does the origin of the capsid coincide with the origin of viruses, or is it possible that capsid-like functionalities emerged before the appearance of true viral entities? We set to investigate this question by using a computational simulator comprising primitive replicators and replication parasites within a compartment matrix. We observe that systems with no horizontal gene transfer between compartments collapse due to the rapidly emerging replication parasites. However, introduction of capsid-like genes that induce the movement of randomly selected genes from one compartment to another rescues life by providing the non-parasitic replicators a mean to escape their current compartments before the emergence of replication parasites. Capsid-forming genes can mediate the establishment of a stable meta-population where parasites cause only local tragedies but cannot overtake the whole community. The long-term survival of replicators is dependent on the frequency of horizontal transfer events, as systems with either too much or too little genetic exchange are doomed to succumb to replication-parasites. This study provides a possible scenario for explaining the origin of viral capsids before the emergence of genuine viruses: in the absence of other means of horizontal gene transfer between compartments, evolution of capsid-like functionalities may have been necessary for early life to prevail.

  10. Discrete gene replication events drive coupling between the cell cycle and circadian clocks

    PubMed Central

    Paijmans, Joris; Bosman, Mark; ten Wolde, Pieter Rein; Lubensky, David K.

    2016-01-01

    Many organisms possess both a cell cycle to control DNA replication and a circadian clock to anticipate changes between day and night. In some cases, these two rhythmic systems are known to be coupled by specific, cross-regulatory interactions. Here, we use mathematical modeling to show that, additionally, the cell cycle generically influences circadian clocks in a nonspecific fashion: The regular, discrete jumps in gene-copy number arising from DNA replication during the cell cycle cause a periodic driving of the circadian clock, which can dramatically alter its behavior and impair its function. A clock built on negative transcriptional feedback either phase-locks to the cell cycle, so that the clock period tracks the cell division time, or exhibits erratic behavior. We argue that the cyanobacterium Synechococcus elongatus has evolved two features that protect its clock from such disturbances, both of which are needed to fully insulate it from the cell cycle and give it its observed robustness: a phosphorylation-based protein modification oscillator, together with its accompanying push–pull read-out circuit that responds primarily to the ratios of different phosphoform concentrations, makes the clock less susceptible to perturbations in protein synthesis; the presence of multiple, asynchronously replicating copies of the same chromosome diminishes the effect of replicating any single copy of a gene. PMID:27035936

  11. Early Holocene meltwater events in the Labrador Sea

    NASA Astrophysics Data System (ADS)

    Pearce, Christof; Jennings, Anne; Andrews, John; Hillaire-Marcel, Claude; Seidenkrantz, Marit-Solveig; Lewis, Mike

    2016-04-01

    During the early Holocene, the Labrador Sea was strongly influenced by the presence of the remainder of the Laurentide Ice Sheet and its active eastern margin. Glacial advances and retreats lead to episodic release of meltwater and icebergs with potential impact on ocean circulation and climate during the deglaciation. The purpose of this study is to use detrital carbonate (DC) records in the Labrador Sea to study the spatial variability of the carbonate events and inferred sources and routing of glacial meltwater originating from Hudson Strait (HS) as well as potential contributions from Northern Baffin Bay (NBB) ice sheet margins. We use DC in sediment cores as a proxy for glacial meltwater and ice berg drift from these areas. More than 20 sediment cores with published DC, stable oxygen isotope, and radiocarbon stratigraphies provide the data for this study. Our hypothesis is that the complex interplay of current systems, shelf and slope bathymetry and location of meltwater and ice berg injection points will affect the spatial distribution of the DC events. In addition, differences in local ocean reservoir age for shelf, slope and open ocean sites may also contribute to offsets in the apparent ages of DC events. Identification of DC peaks also is influenced by sedimentation rates and sampling resolution. To objectively correlate DC events, we study mostly published core data, removing all earlier assumptions about marine reservoir ages and assess all core chronologies with their associated errors. Our results show that none of the DC events is found in all sites and no record captures all of the DC events. Despite this, some of the larger events occur in several records and allow robust temporal and spatial mapping of the meltwater pathways. Besides the meltwater route due south along the Labrador margin on the shelf, some events show a clear signal in deeper Labrador Sea sites pointing at a more direct injection of freshwater in the subpolar gyre.

  12. Early Immunologic Events at the Tick-Host Interface

    PubMed Central

    Heinze, Dar M.; Carmical, J. Russ; Aronson, Judith F.; Thangamani, Saravanan

    2012-01-01

    Ixodes species ticks are competent vectors of tick-borne viruses including tick-borne encephalitis and Powassan encephalitis. Tick saliva has been shown to facilitate and enhance viral infection. This likely occurs by saliva-mediated modulation of host responses into patterns favorable for viral infection and dissemination. Because of the rapid kinetics of tick-borne viral transmission, this modulation must occur as early as tick attachment and initiation of feeding. In this study, cutaneous bite-site lesions were analyzed using Affymetrix mouse genome 430A 2.0 arrays and histopathology at 1, 3, 6, and 12 hours after uninfected Ixodes scapularis nymphal tick attachment. At 1 and 3 hrs after attachment, the gene expression profile is markedly different than at later time points. Upregulated gene ontology term clusters enriched at 1 and 3 hrs were related to post-translational modification. At 6 and 12 hrs, cytoskeletal rearrangements, DNA replication/cell division, inflammation, and chemotaxis were prominent clusters. At 6 and 12 hrs, extracellular matrix, signaling, and DNA binding clusters were downregulated. Histopathological analysis shows minimal inflammation at 1 and 3 hrs but an appreciable neutrophil infiltrate at 6 and 12 hrs. In addition, putative hyperemia, localized necrosis, and increased ECM deposition were identified. Putting the gene expression and histopathology analysis together suggests early tick feeding is characterized by modulation of host responses in resident cells that merges into a nascent, neutrophil-driven immune response by 12 hrs post-attachment. PMID:23077588

  13. Early Cytokine Dysregulation and Viral Replication Are Associated with Mortality During Lethal Influenza Infection

    PubMed Central

    Vogel, Alexander J.; Harris, Seth; Marsteller, Nathan; Condon, Shirley A.

    2014-01-01

    Abstract Infection with influenza A virus (IAV) leads to acute lung injury and possibly fatal complications, especially in immunocompromised, elderly, or chronically infected individuals. Therefore, it is important to study the factors that lead to pathology and mortality in infected hosts. In this report, we analyze immune responses to infection at a sublethal (0.1 LD50) and lethal (1 LD50) dose of the highly pathogenic IAV A/Puerto Rico/8/34 (PR8). Our experiments revealed that infection with a 1 LD50 dose induced peak viral titers at day 2 compared to day 4 in the 0.1 LD50 dose. Moreover, early cytokine dysregulation was observed in the lethal dose with significantly elevated levels of IFN-α, TNF-α, CXCL9, IL-6, and MCP-1 produced at day 2. Early inflammatory responses following infection with 1 LD50 correlated with a greater influx of neutrophils into the lung. However, depletion of neutrophils enhanced morbidity following IAV infection. Though no differences in CD8+ cell function were observed, CD4+ effector responses were impaired in the lungs 8 days after infection with 1 LD50. Histological analysis revealed significant pathology in lethally infected mice at day 2 and day 6 postinfection, when viral titers remained high. Treating lethally infected mice with oseltamivir inhibited viral titers to sublethal levels, and abrogated the pathology associated with the lethal dose. Together, these results suggest that early cytokine dysregulation and viral replication play a role in pulmonary damage and high mortality in lethally infected mice. PMID:24787235

  14. Studies to show that with podophyllotoxin the early replicative stages of herpes simplex virus type 1 depend upon functional cytoplasmic microtubules.

    PubMed

    Hammonds, T R; Denyer, S P; Jackson, D E; Irving, W L

    1996-09-01

    The antiviral activity of podophyllotoxin against herpes simplex type 1 virus (HSV-1) grown in Vero cells was studied by a simple microtitration assay. Antiviral effects were induced at similar concentrations as direct cellular toxicity, as characterised by a time-dependent loss of cell monolayer. Podophyllotoxin-mediated toxicity arises from cytoplasmic microtubular, and hence cytoskeletal, decay. Some degree of selectivity was seen for inhibition of virus replication over direct cellular toxicity. Podophyllotoxin acted against an early viral process, as an antiviral effect was still seen if drug was removed 2 h after infection. Similar effects were seen with colchicine, a classical tubulin-binding compound, but not with bromovinyldeoxyuridine. Podophyllotoxin was capable of inducing a cytoprotective effect in Vero cells, as pre-treatment of cells abrogated virus growth for up to 90 min after removal of drug. This is coincident with the repolymerisation of cellular microtubules and re-formation of the cytoskeleton. We conclude that HSV-1 relies upon a functional cellular cytoskeleton for efficient completion of an early replicative event. Such a process may be the transport of viral material to the nucleus or inhibition of the formation of intranuclear viral 'replication factories', bodies containing cytoskeletal fragments constructed after viral infection.

  15. Neurodegeneration is an early event in diabetic retinopathy: therapeutic implications.

    PubMed

    Simó, Rafael; Hernández, Cristina

    2012-10-01

    Diabetic retinopathy (DR) remains the leading cause of blindness among working-age individuals in developed countries. Current treatments for DR are indicated in advanced stages of the disease and are associated with significant adverse effects. Therefore, new pharmacological treatments for the early stages of DR are needed. DR has been classically considered to be a microcirculatory disease of the retina. However, there is growing evidence to suggest that retinal neurodegeneration is an early event in the pathogenesis of DR, which participates in the microcirculatory abnormalities that occur in DR. Therefore, the study of the underlying mechanisms that lead to neurodegeneration will be essential for identifying new therapeutic targets. From the clinical point of view, the identification of those patients in whom retinal neurodegeneration appears will be crucial for implementing early treatment based on neuroprotective drugs. When the early stages of DR are the therapeutic target, it would be inconceivable to recommend an aggressive treatment such as intravitreous injections. By contrast, topical administration of neuroprotective drugs by using eye drops is a possible option. However, clinical trials to determine the safety and effectiveness of this non-invasive route, as well as a standardisation of the methods for monitoring neurodegeneration, are needed. PMID:22887976

  16. The key molecular events during Macrobrachium rosenbergii nodavirus (MrNV) infection and replication in Sf9 insect cells.

    PubMed

    Somrit, Monsicha; Watthammawut, Atthaboon; Chotwiwatthanakun, Charoonroj; Weerachatyanukul, Wattana

    2016-09-01

    In this study we demonstrated that Macrobrachium rosenbergii nodavirus (MrNV) was able to internalize and replicate in Sf9 insect cells, with levels of infection altered by substances affecting the caveolin-(CAV) mediated endocytosis pathway. The use of Sf9 cells for efficient MrNV replication and propagation was demonstrated by confocal microscopy and PCR amplification, through which early viral binding and internalization were initially detectable at 30min post-infection; whereas at 72h, the distinguishable sign of late-MrNV infection was observable as the gradual accumulation of a cytopathic effect (CPE) in the cells, ultimately resulting in cellular disruption. Moreover, during the early period of infection, the MrNV signals were highly co-localized with CAV1 signals of the CAV-mediated endocytosis pathway. The use of genistein as an inhibitor of the CAV-mediated endocytosis pathway significantly reduced MrNV and CAV1 co-localization, and also reduced the levels of MrNV infection in Sf9 cells as shown by PCR and ELISA. Moreover, the addition of the pathway agonist okadaic acid not only recovered but also augmented both the levels of MrNV co-localization with CAV1 and of Sf9 infection in the presence of genistein inhibition; therefore demonstrating that MrNV infection in Sf9 cells was associated with the CAV-mediated endocytosis pathway machinery. PMID:27327530

  17. The key molecular events during Macrobrachium rosenbergii nodavirus (MrNV) infection and replication in Sf9 insect cells.

    PubMed

    Somrit, Monsicha; Watthammawut, Atthaboon; Chotwiwatthanakun, Charoonroj; Weerachatyanukul, Wattana

    2016-09-01

    In this study we demonstrated that Macrobrachium rosenbergii nodavirus (MrNV) was able to internalize and replicate in Sf9 insect cells, with levels of infection altered by substances affecting the caveolin-(CAV) mediated endocytosis pathway. The use of Sf9 cells for efficient MrNV replication and propagation was demonstrated by confocal microscopy and PCR amplification, through which early viral binding and internalization were initially detectable at 30min post-infection; whereas at 72h, the distinguishable sign of late-MrNV infection was observable as the gradual accumulation of a cytopathic effect (CPE) in the cells, ultimately resulting in cellular disruption. Moreover, during the early period of infection, the MrNV signals were highly co-localized with CAV1 signals of the CAV-mediated endocytosis pathway. The use of genistein as an inhibitor of the CAV-mediated endocytosis pathway significantly reduced MrNV and CAV1 co-localization, and also reduced the levels of MrNV infection in Sf9 cells as shown by PCR and ELISA. Moreover, the addition of the pathway agonist okadaic acid not only recovered but also augmented both the levels of MrNV co-localization with CAV1 and of Sf9 infection in the presence of genistein inhibition; therefore demonstrating that MrNV infection in Sf9 cells was associated with the CAV-mediated endocytosis pathway machinery.

  18. APOBEC3G restricts early HIV-1 replication in the cytoplasm of target cells

    SciTech Connect

    Anderson, Jenny L.; Hope, Thomas J.

    2008-05-25

    Cellular APOBEC3G (A3G) protein is packaged into human immunodeficiency virus type 1 (HIV-1) virions in producer cells yet restricts viral replication in target cells. To characterize this restriction in target cells, the effect of A3G on generating various HIV-1 cDNA products was measured by quantitative real-time PCR. A3G decreased cDNA products from Vif-deficient HIV-1, with minor effects on early reverse transcripts and larger declines in late reverse transcripts. However, the greatest decline was typically observed in nuclear 2-LTR circles. Moreover, the magnitude of these declines varied with A3G dose. Adding integration inhibitor did not stop the A3G-mediated loss in 2-LTR circles. Moreover, obstructing HIV-1 nuclear entry using vesicular stomatitis virus matrix protein did not stop the A3G-mediated decline in late reverse transcripts. Collectively, these data suggest that A3G has important restriction activity in the cytoplasm and progressively diminishes viral cytoplasmic and nuclear cDNA forms with increasing magnitude during restriction.

  19. Discovery of gramine derivatives that inhibit the early stage of EV71 replication in vitro.

    PubMed

    Wei, Yanhong; Shi, Liqiao; Wang, Kaimei; Liu, Manli; Yang, Qingyu; Yang, Ziwen; Ke, Shaoyong

    2014-01-01

    Enterovirus 71 (EV71) is a notable causative agent of hand, foot, and mouth disease in children, which is associated with an increased incidence of severe neurological disease and death, yet there is no specific treatment or vaccine for EV71 infections. In this study, the antiviral activity of gramine and 21 gramine derivatives against EV71 was investigated in cell-based assays. Eighteen derivatives displayed some degree of inhibitory effects against EV71, in that they could effectively inhibit virus-induced cytopathic effects (CPEs), but the anti-EV71 activity of the lead compound gramine was not observed. Studies on the preliminary modes of action showed that these compounds functioned by targeting the early stage of the EV71 lifecycle after viral entry, rather than inactivating the virus directly, inhibiting virus adsorption or affecting viral release from the cells. Among these derivatives, one (compound 4s) containing pyridine and benzothiazole units showed the most potency against EV71. Further studies demonstrated that derivative 4s could profoundly inhibit viral RNA replication, protein synthesis, and virus-induced apoptosis in RD cells. These results indicate that derivative 4s might be a feasible therapeutic agent against EV71 infection and that these gramine derivatives may provide promising lead scaffolds for the further design and synthesis of potential antiviral agents.

  20. Pentacyclic triterpenes in birch bark extract inhibit early step of herpes simplex virus type 1 replication.

    PubMed

    Heidary Navid, M; Laszczyk-Lauer, M N; Reichling, J; Schnitzler, P

    2014-09-25

    Antiviral agents frequently applied for treatment of herpesvirus infections include acyclovir and its derivatives. The antiviral effect of a triterpene extract of birch bark and its major pentacyclic triterpenes, i.e. betulin, lupeol and betulinic acid against acyclovir-sensitive and acyclovir-resistant HSV type 1 strains was examined. The cytotoxic effect of a phytochemically defined birch bark triterpene extract (TE) as well as different pentacyclic triterpenes was analyzed in cell culture, and revealed a moderate cytotoxicity on RC-37 cells. TE, betulin, lupeol and betulinic acid exhibited high levels of antiviral activity against HSV-1 in viral suspension tests with IC50 values ranging between 0.2 and 0.5 μg/ml. Infectivity of acyclovir-sensitive and clinical isolates of acyclovir-resistant HSV-1 strains was significantly reduced by all tested compounds and a direct concentration- and time-dependent antiherpetic activity could be demonstrated. In order to determine the mode of antiviral action, TE and the compounds were added at different times during the viral infection cycle. Addition of these drugs to uninfected cells prior to infection or to herpesvirus-infected cells during intracellular replication had low effect on virus multiplication. Minor virucidal activity of triterpenes was observed, however both TE and tested compounds exhibited high anti-herpetic activity when viruses were pretreated with these drugs prior to infection. Pentacyclic triterpenes inhibit acyclovir-sensitive and acyclovir-resistant clinical isolates of HSV-1 in the early phase of infection.

  1. Replication initiation and elongation fork rates within a differentially expressed human multicopy locus in early S phase.

    PubMed Central

    Scott, R S; Truong, K Y; Vos, J M

    1997-01-01

    Replication of the 400 copies of the 43 kb human ribosomal RNA (rDNA) locus spans most of the S phase. To examine the basis for the unusual pattern of rDNA replication, a sensitive strategy was developed to map origins of DNA replication and measure apparent rates of fork progression within a chromosomal locus. This technique, termed differential intragenomic replication timing, revealed that initiation within the actively transcribed rDNA occurred in early S within a 10.7 kb region spanning the promoter and 5' external transcribed spacer. Forks emanating from this early bidirectional origin progressed at an apparent slow rate with the sense and anti-sense forks moving at 0.32 and 0.23 kb/min. Using a photochemical-based technique, the chromatin status of the rDNA repeats was assayed throughout the S phase. Approximately 85% of the rDNA repeats were in a transcriptionally active chromatin structure at the start of S phase. A progressive decrease in the transcription state of the rDNA loci was observed, reaching a minimum between 3 and 6 h in mid S phase. Altogether, the data suggest a link between RNA polymerase I mediated transcription and site-specific initiation of DNA replication within the rDNA multicopy locus. PMID:9358159

  2. The extent of early viral replication is a critical determinant of the natural history of simian immunodeficiency virus infection.

    PubMed Central

    Lifson, J D; Nowak, M A; Goldstein, S; Rossio, J L; Kinter, A; Vasquez, G; Wiltrout, T A; Brown, C; Schneider, D; Wahl, L; Lloyd, A L; Williams, J; Elkins, W R; Fauci, A S; Hirsch, V M

    1997-01-01

    Different patterns of viral replication correlate with the natural history of disease progression in humans and macaques infected with human immunodeficiency virus type 1 (HIV-1) and simian immunodeficiency virus (SIV), respectively. However, the viral and host factors influencing these patterns of viral replication in vivo are poorly understood. We intensively studied viral replication in macaques receiving identical inocula of SIV. Marked differences in viral replication patterns were apparent within the first week following inoculation, a time prior to the development of measurable specific immune effector responses to viral antigens. Plasma viral RNA levels measured on day 7 postinoculation correlated with levels measured in the postacute phase of infection. Differences in the susceptibility of host cells from different animals to in vitro SIV infection correlated with the permissiveness of the animals for early in vivo viral replication and hence with the postacute set point level of plasma viremia. These results suggest that host factors that exert their effects prior to full development of specific immune responses are critical in establishing the in vivo viral replication pattern and associated clinical course in subjects infected with SIV and, by extension, with HIV-1. PMID:9371613

  3. Prediction models for early risk detection of cardiovascular event.

    PubMed

    Purwanto; Eswaran, Chikkannan; Logeswaran, Rajasvaran; Abdul Rahman, Abdul Rashid

    2012-04-01

    Cardiovascular disease (CVD) is the major cause of death globally. More people die of CVDs each year than from any other disease. Over 80% of CVD deaths occur in low and middle income countries and occur almost equally in male and female. In this paper, different computational models based on Bayesian Networks, Multilayer Perceptron,Radial Basis Function and Logistic Regression methods are presented to predict early risk detection of the cardiovascular event. A total of 929 (626 male and 303 female) heart attack data are used to construct the models.The models are tested using combined as well as separate male and female data. Among the models used, it is found that the Multilayer Perceptron model yields the best accuracy result.

  4. The very early events following photoexcitation of carotenoids.

    PubMed

    Hashimoto, Hideki; Yanagi, Kazuhiro; Yoshizawa, Masayuki; Polli, Dario; Cerullo, Giulio; Lanzani, Guglielmo; De Silvestri, Sandro; Gardiner, Alastair T; Cogdell, Richard J

    2004-10-01

    The recent availability of laser pulses with 10-20 fs duration, tunable throughout the visible and near infrared wavelengths, has facilitated the investigation, with unprecedented temporal resolution, into the very early events of energy relaxation in carotenoids [Science 298 (2002) 2395; Synth. Metals 139 (2003) 893]. This has enabled us to clearly demonstrate the existence of an additional intermediate state, Sx, lying between the S2 (1(1)Bu+) and S1 (2(1)Ag-) states. In addition, by applying time-resolved stimulated Raman spectroscopy with femtosecond time resolution, it has also been shown that vibrational relaxation in electronic excited states plays an important role in these interconversions. In this mini-review, we describe briefly the current understanding of Sx and the other intermediate excited states that can be formed by relaxation from S2, mainly focusing attention on the above two topics. Emphasis is also placed on some of the major remaining unsolved issues in carotenoid photochemistry.

  5. Gene Expression Changes and Early Events in Cotton Fibre Development

    PubMed Central

    Lee, Jinsuk J.; Woodward, Andrew W.; Chen, Z. Jeffrey

    2007-01-01

    Background Cotton is the dominant source of natural textile fibre and a significant oil crop. Cotton fibres, produced by certain species in the genus Gossypium, are seed trichomes derived from individual cells of the epidermal layer of the seed coat. Cotton fibre development is delineated into four distinct and overlapping developmental stages: fibre initiation, elongation, secondary wall biosynthesis and maturation. Scope Recent advances in gene expression studies are beginning to provide new insights into a better understanding of early events in cotton fibre development. Fibre cell development is a complex process involving many pathways, including various signal transduction and transcriptional regulation components. Several analyses using expressed sequence tags and microarray have identified transcripts that preferentially accumulate during fibre development. These studies, as well as complementation and overexpression experiments using cotton genes in arabidopsis and tobacco, indicate some similar molecular events between trichome development from the leaf epidermis and fibre development from the ovule epidermis. Specifically, MYB transcription factors regulate leaf trichome development in arabidopsis and may regulate seed trichome development in cotton. In addition, transcript profiling and ovule culture experiments both indicate that several phytohormones and other signalling pathways mediate cotton fibre development. Auxin and gibberellins promote early stages of fibre initiation; ethylene- and brassinosteroid-related genes are up-regulated during the fibre elongation phase; and genes associated with calmodulin and calmodulin-binding proteins are up-regulated in fibre initials. Additional genomic data, mutant and functional analyses, and genome mapping studies promise to reveal the critical factors mediating cotton fibre cell development. PMID:17905721

  6. Replication RCT of Early Universal Prevention Effects on Young Adult Substance Misuse

    PubMed Central

    Spoth, Richard; Trudeau, Linda; Redmond, Cleve; Shin, Chungyeol

    2014-01-01

    Objective For many substances, more frequent and problematic use occurs in young adulthood; these types of use are predicted by the timing of initiation during adolescence. We replicated and extended an earlier study examining whether delayed substance initiation during adolescence, resulting from universal preventive interventions implemented in middle school, reduces problematic use in young adulthood. Method Participants were middle school students from 36 Iowa schools randomly assigned to the Strengthening Families Program plus Life Skills Training (SFP 10–14 + LST), LST-only, or a control condition. Self-report questionnaires were collected at 11 time points, including four during young adulthood. The intercept (average level) and rate of change (slope) in young adult frequency measures (drunkenness, alcohol-related problems, cigarettes, and illicit drugs) across ages 19–22 were modeled as outcomes influenced by growth factors describing substance initiation during adolescence. Analyses entailed testing a two-step hierarchical latent growth curve model; models included the effects of baseline risk, intervention condition assignment, and their interaction. Results Analyses showed significant indirect intervention effects on the average levels of all young adult outcomes, through effects on adolescent substance initiation growth factors, along with intervention by risk interaction effects favoring the higher-risk subsample. Additional direct effects on young adult use were observed in some cases. Relative reduction rates were larger for the higher-risk subsample at age 22, ranging from 5.8% to 36.4% on outcomes showing significant intervention effects. Conclusions Universal preventive interventions implemented during early adolescence have the potential to decrease the rates of substance use and associated problems, into young adulthood. PMID:24821095

  7. Importance of bacterial replication and alveolar macrophage-independent clearance mechanisms during early lung infection with Streptococcus pneumoniae.

    PubMed

    Camberlein, Emilie; Cohen, Jonathan M; José, Ricardo; Hyams, Catherine J; Callard, Robin; Chimalapati, Suneeta; Yuste, Jose; Edwards, Lindsey A; Marshall, Helina; van Rooijen, Nico; Noursadeghi, Mahdad; Brown, Jeremy S

    2015-03-01

    Although the importance of alveolar macrophages for host immunity during early Streptococcus pneumoniae lung infection is well established, the contribution and relative importance of other innate immunity mechanisms and of bacterial factors are less clear. We have used a murine model of S. pneumoniae early lung infection with wild-type, unencapsulated, and para-amino benzoic acid auxotroph mutant TIGR4 strains to assess the effects of inoculum size, bacterial replication, capsule, and alveolar macrophage-dependent and -independent clearance mechanisms on bacterial persistence within the lungs. Alveolar macrophage-dependent and -independent (calculated indirectly) clearance half-lives and bacterial replication doubling times were estimated using a mathematical model. In this model, after infection with a high-dose inoculum of encapsulated S. pneumoniae, alveolar macrophage-independent clearance mechanisms were dominant, with a clearance half-life of 24 min compared to 135 min for alveolar macrophage-dependent clearance. In addition, after a high-dose inoculum, successful lung infection required rapid bacterial replication, with an estimated S. pneumoniae doubling time of 16 min. The capsule had wide effects on early lung clearance mechanisms, with reduced half-lives of 14 min for alveolar macrophage-independent and 31 min for alveolar macrophage-dependent clearance of unencapsulated bacteria. In contrast, with a lower-dose inoculum, the bacterial doubling time increased to 56 min and the S. pneumoniae alveolar macrophage-dependent clearance half-life improved to 42 min and was largely unaffected by the capsule. These data demonstrate the large effects of bacterial factors (inoculum size, the capsule, and rapid replication) and alveolar macrophage-independent clearance mechanisms during early lung infection with S. pneumoniae. PMID:25583525

  8. Importance of bacterial replication and alveolar macrophage-independent clearance mechanisms during early lung infection with Streptococcus pneumoniae.

    PubMed

    Camberlein, Emilie; Cohen, Jonathan M; José, Ricardo; Hyams, Catherine J; Callard, Robin; Chimalapati, Suneeta; Yuste, Jose; Edwards, Lindsey A; Marshall, Helina; van Rooijen, Nico; Noursadeghi, Mahdad; Brown, Jeremy S

    2015-03-01

    Although the importance of alveolar macrophages for host immunity during early Streptococcus pneumoniae lung infection is well established, the contribution and relative importance of other innate immunity mechanisms and of bacterial factors are less clear. We have used a murine model of S. pneumoniae early lung infection with wild-type, unencapsulated, and para-amino benzoic acid auxotroph mutant TIGR4 strains to assess the effects of inoculum size, bacterial replication, capsule, and alveolar macrophage-dependent and -independent clearance mechanisms on bacterial persistence within the lungs. Alveolar macrophage-dependent and -independent (calculated indirectly) clearance half-lives and bacterial replication doubling times were estimated using a mathematical model. In this model, after infection with a high-dose inoculum of encapsulated S. pneumoniae, alveolar macrophage-independent clearance mechanisms were dominant, with a clearance half-life of 24 min compared to 135 min for alveolar macrophage-dependent clearance. In addition, after a high-dose inoculum, successful lung infection required rapid bacterial replication, with an estimated S. pneumoniae doubling time of 16 min. The capsule had wide effects on early lung clearance mechanisms, with reduced half-lives of 14 min for alveolar macrophage-independent and 31 min for alveolar macrophage-dependent clearance of unencapsulated bacteria. In contrast, with a lower-dose inoculum, the bacterial doubling time increased to 56 min and the S. pneumoniae alveolar macrophage-dependent clearance half-life improved to 42 min and was largely unaffected by the capsule. These data demonstrate the large effects of bacterial factors (inoculum size, the capsule, and rapid replication) and alveolar macrophage-independent clearance mechanisms during early lung infection with S. pneumoniae.

  9. Rubella virus-like replicon particles: analysis of encapsidation determinants and non-structural roles of capsid protein in early post-entry replication.

    PubMed

    Claus, Claudia; Tzeng, Wen-Pin; Liebert, U G; Frey, Teryl K

    2012-03-01

    Rubella virus (RUBV) contains a plus-strand RNA genome with two ORFs, one encoding the non-structural replicase proteins (NS-ORF) and the second encoding the virion structural proteins (SP-ORF). This study describes development and use of a trans-encapsidation system for the assembly of infectious RUBV-like replicon particles (VRPs) containing RUBV replicons (self replicating genomes with the SP-ORF replaced with a reporter gene). First, this system was used to map signals within the RUBV genome that mediate packaging of viral RNA. Mutations within a proposed packaging signal did not significantly affect relative packaging efficiency. The insertion of various fragments derived from the RUBV genome into Sindbis virus replicons revealed that there are several regions within the RUBV genome capable of enhancing encapsidation of heterologous replicon RNAs. Secondly, the trans-encapsidation system was used to analyse the effect of alterations within the capsid protein (CP) on release of VRPs and subsequent initiation of replication in newly infected cells. Deletion of the N-terminal eight amino acids of the CP reduced VRP titre significantly, which could be partially complemented by native CP provided in trans, indicating that this mutation affected an entry or post-entry event in the replication cycle. To test this hypothesis, the trans-encapsidation system was used to demonstrate the rescue of a lethal deletion within P150, one of the virus replicase proteins, by CP contained within the virus particle. This novel finding substantiated the functional role of CP in early post-entry replication. PMID:22113006

  10. The Salmonella Typhimurium effector protein SopE transiently localizes to the early SCV and contributes to intracellular replication.

    PubMed

    Vonaesch, Pascale; Sellin, Mikael E; Cardini, Steven; Singh, Vikash; Barthel, Manja; Hardt, Wolf-Dietrich

    2014-12-01

    Salmonella enterica serovar Typhimurium (S. Tm) is a facultative intracellular pathogen that induces entry into non-phagocytic cells by a Type III secretion system (TTSS) and cognate effector proteins. Upon host cell entry, S. Tm expresses a second TTSS and subverts intracellular trafficking to create a replicative niche - the Salmonella-containing vacuole (SCV). SopE, a guanidyl exchange factor (GEF) for Rac1 and Cdc42, is translocated by the TTSS-1 upon host cell contact and promotes entry through triggering of actin-dependent ruffles. After host cell entry, the bulk of SopE undergoes proteasomal degradation. Here we show that a subfraction is however detectable on the nascent SCV membrane up to ∼ 6 h post infection. Membrane localization of SopE and the closely related SopE2 differentially depend on the Rho-GTPase-binding GEF domain, and to some extent involves also the unstructured N-terminus. SopE localizes transiently to the early SCV, dependent on continuous synthesis and secretion by the TTSS-1 during the intracellular state. Mutant strains lacking SopE or SopE2 are attenuated in early intracellular replication, while complementation restores this defect. Hence, the present study reveals an unanticipated role for SopE and SopE2 in establishing the Salmonella replicative niche, and further emphasizes the importance of entry effectors in later stages of host-cell manipulation.

  11. Rhythmic Engagement with Music in Early Childhood: A Replication and Extension

    ERIC Educational Resources Information Center

    Ilari, Beatriz

    2015-01-01

    The purpose of this study was to replicate and extend previous findings on spontaneous movement and rhythmic engagement with music in infancy. Using the identical stimuli and procedures from the original study, I investigated spontaneous rhythmic movements in response to music, infant-directed speech, and contrasting rhythmic patterns in 30…

  12. Baculovirus resistance in codling moth (Cydia pomonella L.) caused by early block of virus replication.

    PubMed

    Asser-Kaiser, Sabine; Radtke, Pit; El-Salamouny, Said; Winstanley, Doreen; Jehle, Johannes A

    2011-02-20

    An up to 10,000-fold resistance against the biocontrol agent Cydia pomonella granulovirus (CpGV) was observed in field populations of codling moth, C. pomonella, in Europe. Following different experimental approaches, a modified peritrophic membrane, a modified midgut receptor, or a change of the innate immune response could be excluded as possible resistance mechanisms. When CpGV replication was traced by quantitative PCR in different tissues of susceptible and resistant insects after oral and intra-hemocoelic infection, no virus replication could be detected in any of the tissues of resistant insects, suggesting a systemic block prior to viral DNA replication. This conclusion was corroborated by fluorescence microscopy using a modified CpGV (bacCpGV(hsp-eGFP)) carrying enhanced green fluorescent gene (eGFP), which showed that infection in resistant insects did not spread. In conclusion, the different lines of evidence indicate that CpGV can enter but not replicate in the cells of resistant codling moth larvae. PMID:21190707

  13. The expression of N-terminal deletion DNA pilot proteins inhibits the early stages of phiX174 replication.

    PubMed

    Ruboyianes, Mark V; Chen, Min; Dubrava, Mathew S; Cherwa, James E; Fane, Bentley A

    2009-10-01

    The phiX174 DNA pilot protein H contains four predicted C-terminal coiled-coil domains. The region of the gene encoding these structures was cloned, expressed in vivo, and found to strongly inhibit wild-type replication. DNA and protein synthesis was investigated in the absence of de novo H protein synthesis and in wild-type-infected cells expressing the inhibitory proteins (DeltaH). The expression of the DeltaH proteins interfered with early stages of DNA replication, which did not require de novo H protein synthesis, suggesting that the inhibitory proteins interfere with the wild-type H protein that enters the cell with the penetrating DNA. As transcription and protein synthesis are dependent on DNA replication in positive single-stranded DNA life cycles, viral protein synthesis was also reduced. However, unlike DNA synthesis, efficient viral protein synthesis required de novo H protein synthesis, a novel function for this protein. A single amino acid change in the C terminus of protein H was both necessary and sufficient to confer resistance to the inhibitory DeltaH proteins, restoring both DNA and protein synthesis to wild-type levels. DeltaH proteins derived from the resistant mutant did not inhibit wild-type or resistant mutant replication. The inhibitory effects of the DeltaH proteins were lessened by the coexpression of the internal scaffolding protein, which may suppress H-H protein interactions. While coexpression relieved the block in DNA biosynthesis, viral protein synthesis remained suppressed. These data indicate that protein H's role in DNA replication and stimulating viral protein synthesis can be uncoupled. PMID:19640994

  14. Absence of the BaeR protein leads to the early initiation of DNA replication in Escherichia coli.

    PubMed

    Yao, Y; Wunier, W; Morigen, M

    2015-01-01

    Escherichia coli cells have dozens of two-component systems to sense and respond to various stimuli, and thereby cope with changing environments. BaeS/BaeR is one such two-component system, and it deals with a variety of envelope stresses. Interestingly, the ArcA/ArcB and TorS/TorR two-component systems are known to be associated with initiation of DNA replication; however, the effects of BaeS/BaeR on initiation of DNA replication remain unknown. Flow cytometry analysis revealed that the average number of replication origins (oriCs) per cell in ΔbaeR mutants was approximately 30% higher than that in wild-type cells. So was the growth rate of ΔbaeR cells. Ectopic expression of BaeR from the pbaeR plasmid reversed the ΔbaeR mutant phenotypes. The results indicate that absence of BaeR leads to the early initiation of DNA replication. Further, deletion of BaeR caused an increase in the amount of DnaA per cell, but did not change concentration of DnaA, which is the initiator protein.The average number of oriCs per cell in Δspy mutants was the same as that found in the wild-type cells although spy gene expression is controlled by BaeR. These results suggest that BaeR may indirectly affect initiation of replication by controlling expression of the dnaA gene. PMID:26681035

  15. Eclipse period during replication of plasmid R1: contributions from structural events and from the copy-number control system.

    PubMed

    Olsson, Jan A; Berg, Otto G; Dasgupta, Santanu; Nordström, Kurt

    2003-10-01

    The eclipse period (the time period during which a newly replicated plasmid copy is not available for a new replication) of plasmid R1 in Escherichia coli was determined with the classic Meselson-Stahl density-shift experiment. A mini-plasmid with the wild-type R1 replicon and a mutant with a thermo-inducible runaway-replication phenotype were used in this work. The eclipses of the chromosome and of the wild-type plasmid were 0.6 and 0.2 generation times, respectively, at temperatures ranging from 30 degrees C to 42 degrees C. The mutant plasmid had a similar eclipse at temperatures up to 38 degrees C. At 42 degrees C, the plasmid copy number increased rapidly because of the absence of replication control and replication reached a rate of 350-400 plasmid replications per cell and cell generation. During uncontrolled replication, the eclipse was about 3 min compared with 10 min at controlled replication (the wild-type plasmid at 42 degrees C). Hence, the copy-number control system contributed significantly to the eclipse. The eclipse in the absence of copy-number control (3 min) presumably is caused by structural requirements: the covalently closed circular plasmid DNA has to regain the right degree of superhelicity needed for initiation of replication and it takes time to assemble the initiation factors. PMID:14507381

  16. Eclipse period during replication of plasmid R1: contributions from structural events and from the copy-number control system.

    PubMed

    Olsson, Jan A; Berg, Otto G; Dasgupta, Santanu; Nordström, Kurt

    2003-10-01

    The eclipse period (the time period during which a newly replicated plasmid copy is not available for a new replication) of plasmid R1 in Escherichia coli was determined with the classic Meselson-Stahl density-shift experiment. A mini-plasmid with the wild-type R1 replicon and a mutant with a thermo-inducible runaway-replication phenotype were used in this work. The eclipses of the chromosome and of the wild-type plasmid were 0.6 and 0.2 generation times, respectively, at temperatures ranging from 30 degrees C to 42 degrees C. The mutant plasmid had a similar eclipse at temperatures up to 38 degrees C. At 42 degrees C, the plasmid copy number increased rapidly because of the absence of replication control and replication reached a rate of 350-400 plasmid replications per cell and cell generation. During uncontrolled replication, the eclipse was about 3 min compared with 10 min at controlled replication (the wild-type plasmid at 42 degrees C). Hence, the copy-number control system contributed significantly to the eclipse. The eclipse in the absence of copy-number control (3 min) presumably is caused by structural requirements: the covalently closed circular plasmid DNA has to regain the right degree of superhelicity needed for initiation of replication and it takes time to assemble the initiation factors.

  17. Early Function of the Abutilon Mosaic Virus AC2 Gene as a Replication Brake

    PubMed Central

    Krenz, Björn; Deuschle, Kathrin; Deigner, Tobias; Unseld, Sigrid; Kepp, Gabi; Wege, Christina; Kleinow, Tatjana

    2015-01-01

    ABSTRACT The C2/AC2 genes of monopartite/bipartite geminiviruses of the genera Begomovirus and Curtovirus encode important pathogenicity factors with multiple functions described so far. A novel function of Abutilon mosaic virus (AbMV) AC2 as a replication brake is described, utilizing transgenic plants with dimeric inserts of DNA B or with a reporter construct to express green fluorescent protein (GFP). Their replicational release upon AbMV superinfection or the individual and combined expression of epitope-tagged AbMV AC1, AC2, and AC3 was studied. In addition, the effects were compared in the presence and in the absence of an unrelated tombusvirus suppressor of silencing (P19). The results show that AC2 suppresses replication reproducibly in all assays and that AC3 counteracts this effect. Examination of the topoisomer distribution of supercoiled DNA, which indicates changes in the viral minichromosome structure, did not support any influence of AC2 on transcriptional gene silencing and DNA methylation. The geminiviral AC2 protein has been detected here for the first time in plants. The experiments revealed an extremely low level of AC2, which was slightly increased if constructs with an intron and a hemagglutinin (HA) tag in addition to P19 expression were used. AbMV AC2 properties are discussed with reference to those of other geminiviruses with respect to charge, modification, and size in order to delimit possible reasons for the different behaviors. IMPORTANCE The (A)C2 genes encode a key pathogenicity factor of begomoviruses and curtoviruses in the plant virus family Geminiviridae. This factor has been implicated in the resistance breaking observed in agricultural cotton production. AC2 is a multifunctional protein involved in transcriptional control, gene silencing, and regulation of basal biosynthesis. Here, a new function of Abutilon mosaic virus AC2 in replication control is added as a feature of this protein in viral multiplication, providing a novel

  18. Model of early self-replication based on covalent complementarity for a copolymer of glycerate-3-phosphate and glycerol-3-phosphate

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1989-01-01

    Glyceraldehyde-3-phosphate acts as the substrate in a model of early self-replication of a phosphodiester copolymer of glycerate-3-phosphate and glycerol-3-phosphate. This model of self-replication is based on covalent complementarity in which information transfer is mediated by a single covalent bond, in contrast to multiple weak interactions that establish complementarity in nucleic acid replication. This replication model is connected to contemporary biochemistry through its use of glyceraldehyde-3-phosphate, a central metabolite of glycolysis and photosynthesis.

  19. The replication timing program of the Chinese hamster β-globin locus is established coincident with its repositioning near peripheral heterochromatin in early G1 phase

    PubMed Central

    Li, Feng; Chen, Jianhua; Izumi, Masako; Butler, Mark C.; Keezer, Susan M.; Gilbert, David M.

    2001-01-01

    We have examined the dynamics of nuclear repositioning and the establishment of a replication timing program for the actively transcribed dihydrofolate reductase (DHFR) locus and the silent β-globin gene locus in Chinese hamster ovary cells. The DHFR locus was internally localized and replicated early, whereas the β-globin locus was localized adjacent to the nuclear periphery and replicated during the middle of S phase, coincident with replication of peripheral heterochromatin. Nuclei were prepared from cells synchronized at various times during early G1 phase and stimulated to enter S phase by introduction into Xenopus egg extracts, and the timing of DHFR and β-globin replication was evaluated in vitro. With nuclei isolated 1 h after mitosis, neither locus was preferentially replicated before the other. However, with nuclei isolated 2 or 3 h after mitosis, there was a strong preference for replication of DHFR before β-globin. Measurements of the distance of DHFR and β-globin to the nuclear periphery revealed that the repositioning of the β-globin locus adjacent to peripheral heterochromatin also took place between 1 and 2 h after mitosis. These results suggest that the CHO β-globin locus acquires the replication timing program of peripheral heterochromatin upon association with the peripheral subnuclear compartment during early G1 phase. PMID:11470818

  20. Early Responsivity to Moral Events: Physiological and Behavioral Correlates?

    ERIC Educational Resources Information Center

    Lamb, Sharon; And Others

    This study investigated toddlers' reactions to morally related events to determine whether age was a factor in emotional reaction, whether the middle of the second year was a salient time for the emergence of emotional reactions to such events, and whether heart rate change could be used as a new measure of moral responsivity. While their heart…

  1. Replicating vaccines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Early work on fish immunology and disease resistance demonstrated fish (like animals and humans) that survived infection were typically resistant to re-infection with the same pathogen. The concepts of resistance upon reinfection lead to the research and development of replicating (live) vaccines in...

  2. Application of conditionally replicating adenoviruses in tumor early diagnosis technology, gene-radiation therapy and chemotherapy.

    PubMed

    Li, Shun; Ou, Mengting; Wang, Guixue; Tang, Liling

    2016-10-01

    Conditionally replicating adenoviruses (CRAds), or known as replication-selective adenoviruses, were discovered as oncolytic gene vectors several years ago. They have a strong ability of scavenging tumor and lesser toxicity to normal tissue. CRAds not only have a tumor-killing ability but also can combine with gene therapy, radiotherapy, and chemotherapy to induce tumor cell apoptosis. In this paper, we review the structure of CRAds and CRAd vectors and summarize the current application of CRAds in tumor detection as well as in radiotherapy and suicide gene-mediating chemotherapy. We also propose further research strategies that can improve the application value of CRAds, including enhancing tumor destruction effect, further reducing toxic effect, reducing immunogenicity, constructing CRAds that can target tumor stem cells, and trying to use mesenchymal stem cells (MSCs) as the carriers for oncolytic adenoviruses. As their importance to cancer diagnosis, gene-radiation, and chemotherapy, CRAds may play a considerable role in clinical diagnosis and various cancer treatments in the future. PMID:27557721

  3. Recombinant plasmids carrying promoters, genes and the origin of DNA replication of the early region of bacteriophage T7.

    PubMed Central

    Scherzinger, E; Lauppe, H F; Voll, N; Wanke, M

    1980-01-01

    Two full-length contiguous HpaI fragments of the 0 to 18.2% region of T7 H DNA (HpF-H and HpG) were inserted into plasmids pHV14 or pC194 using oligo(dG . dC) connectors or synthetic HindIII adaptors. Amplification of the two early T7 fragments was achieved by transforming lysostaphin-treated S. aureus W57 with the hybrid plasmids. Experimental evidence is presented suggesting that neither of these T7 segments can be cloned in an intact form in E. coli. One of the hybrids, pHV14-HpF-H, proved to be unstable even in B. subtilis 168. The supercoiled recombinant plasmids were tested for their capacity to support RNA synthesis by purified E. coli or T7 RNA polymerases and to serve as templates in a cell-free T7 DNA replication system. The results of these in vitro studies indicate the presence of active "early" promoters in the cloned fragment HpF-H and active "late" promoters, as well as a functional origin of replication in the cloned fragment HpG. Images PMID:7433121

  4. Event Conceptualization by Early Dutch-German Bilinguals: Insights from Linguistic and Eye-Tracking Data

    ERIC Educational Resources Information Center

    Flecken, Monique

    2011-01-01

    This experimental study investigates event construal by early Dutch-German bilinguals, as reflected in their oral depiction of everyday events shown in video clips. The starting point is the finding that the expression of an aspectual perspective (progressive aspect), and its consequences for event construal, is dependent on the extent to which…

  5. Malpighi, Swammerdam and the colourful silkworm: replication and visual representation in early modern science.

    PubMed

    Cobb, Matthew

    2002-04-01

    In 1669, Malpighi published the first systematic dissection of an insect. The manuscript of this work contains a striking water-colour of the silkworm, which is described here for the first time. On repeating Malpighi's pioneering investigation, Swammerdam found what he thought were a number of errors, but was hampered by Malpighi's failure to explain his techniques. This may explain Swammerdam's subsequent description of his methods. In 1675, as he was about to abandon his scientific researches for a life of religious contemplation, Swammerdam destroyed his manuscript on the silkworm, but not before sending the drawings to Malpighi. These figures, with their rich and unique use of colour, are studied here for the first time. The role played by Henry Oldenburg, secretary of the Royal Society, in encouraging contact between the two men is emphasized and the way this exchange reveals the development of some key features of modern science - replication and modern scientific illustration - is discussed.

  6. Type I Interferon Released by Myeloid Dendritic Cells Reversibly Impairs Cytomegalovirus Replication by Inhibiting Immediate Early Gene Expression

    PubMed Central

    Holzki, Julia Katharina; Dağ, Franziska; Dekhtiarenko, Iryna; Rand, Ulfert; Casalegno-Garduño, Rosaely; Trittel, Stephanie; May, Tobias; Riese, Peggy

    2015-01-01

    ABSTRACT Cytomegalovirus (CMV) is a ubiquitous beta-herpesvirus whose reactivation from latency is a major cause of morbidity and mortality in immunocompromised hosts. Mouse CMV (MCMV) is a well-established model virus to study virus-host interactions. We showed in this study that the CD8-independent antiviral function of myeloid dendritic cells (mDC) is biologically relevant for the inhibition of MCMV replication in vivo and in vitro. In vivo ablation of CD11c+ DC resulted in higher viral titers and increased susceptibility to MCMV infection in the first 3 days postinfection. We developed in vitro coculture systems in which we cocultivated MCMV-infected endothelial cells or fibroblasts with T cell subsets and/or dendritic cells. While CD8 T cells failed to control MCMV replication, bone marrow-derived mDC reduced viral titers by a factor of up to 10,000. Contact of mDC with the infected endothelial cells was crucial for their antiviral activity. Soluble factors secreted by the mDC blocked MCMV replication at the level of immediate early (IE) gene expression, yet the viral lytic cycle reinitiated once the mDC were removed from the cells. On the other hand, the mDC did not impair MCMV replication in cells deficient for the interferon (IFN) alpha/beta receptor (IFNAR), arguing that type I interferons were critical for viral control by mDC. In light of our recent observation that type I IFN is sufficient for the induction of latency immediately upon infection, our results imply that IFN secreted by mDC may play an important role in the establishment of CMV latency. IMPORTANCE Numerous studies have focused on the infection of DC with cytomegaloviruses and on the establishment of latency within them. However, almost all of these studies have relied on the infection of DC monocultures in vitro, whereas DC are just one among many cell types present in an infection site in vivo. To mimic this aspect of the in vivo situation, we cocultured DC with infected endothelial cells

  7. Effects of Early or Overexpression of the Autographa californica Multiple Nucleopolyhedrovirus orf94 (ODV-e25) on Virus Replication.

    PubMed

    Luo, Xiao-Chun; Wang, Shan-Shan; Zhang, Jie; Qian, Duo-Duo; Wang, Si-Min; Li, Lu-Lin

    2013-01-01

    odv-e25(e25) is one of the core genes of baculoviruses. To investigate how it functions in the replication cycle of a baculovirus, a number of Autographa californica multiple nucleopolyhedrovirus recombinants with e25 under control of the promoter of immediate early gene ie1, or the promoter of the very late hyperexpressed gene p10, were constructed using a bacmid system, and the effects of early expression or overexpression of e25 on replication of the virus were evaluated. Microscopy and titration assays demonstrated that bacmids with e25 under control of ie1 promoter were unable to produce budded viruses; and that the recombinant viruses with e25 under control of p10 promoter generated budded virus normally, but formation of occlusion bodies were dramatically reduced and delayed in the infected cells. Electron microscopy showed that there were no mature virions or intact nucleocapsids present in the cells transfected with a recombinant bacmid with e25 under control of ie1 promoter. Quantitative real-time PCR analysis demonstrated that alteration of the e25 promoter did not affect viral DNA synthesis. The reporter gene expression from the promoter of the major capsid protein gene vp39 was reduced 63% by early expression of e25. Confocal microscopy revealed that E25 was predominantly localized in nuclei by 24 hours post infection with wild-type virus, but it remained in the cytoplasm in the cells transfected with a recombinant bacmid with e25 under control of the ie1 promoter, suggesting that the transport of E25 into nuclei was regulated in a specific and strict time dependent manner.

  8. Early Events in the Pathogenesis of Avian Salmonellosis

    PubMed Central

    Henderson, S. Christine; Bounous, Denise I.; Lee, Margie D.

    1999-01-01

    Salmonellae are gastrointestinal pathogens of man and animals. However, strains that are host-specific avian pathogens are often avirulent in mammals, and those which are nonspecific are commensal in poultry. The objective of this study was to determine whether host specificity was exhibited by bacterial abilities to invade epithelial cells or resist leukocyte killing. In this study, leukocytes isolated from humans and chickens were used to kill Salmonella in vitro. Both Salmonella pullorum, an avian-specific serotype, and Salmonella typhimurium, a broad-host-range serotype, were sensitive to killing by polymorphonuclear leukocytes isolated from both species. Both serotypes replicated in cells of the MQ-NCSU avian-macrophage cell line. In contrast, S. pullorum was noninvasive for cultured epithelial Henle 407, chick kidney, chick ovary, and budgerigar abdominal tumor cells. In the bird challenge, however, S. typhimurium rapidly caused inflammation of the intestinal mucosa, but S. pullorum preferentially targeted the bursa of Fabricius prior to eliciting intestinal inflammation. Salmonella serotypes which cause typhoid fever in mice have been shown to target the gut-associated lymphoid tissue. Observations from this study show that S. pullorum initiated a route of infection in chicks comparable to the route it takes in cases of enteric fever. PMID:10377142

  9. Early dissociation of nuclear factor I from the origin during initiation of adenovirus DNA replication studied by origin immobilization.

    PubMed

    Coenjaerts, F E; van der Vliet, P C

    1994-12-11

    The DNA-binding domain of Nuclear Factor I (NFIBD) enhances initiation of adenovirus DNA replication up to 50-fold by binding to the auxiliary region of the origin and positioning the viral DNA polymerase. To study if and when NFIBD dissociates from the template, we immobilized origin DNA to glutathione-agarose beads by means of a GST-NFIBD fusion protein. This immobilized template is active in replication. By analyzing the release of prelabeled templates from the beads under different conditions, we show that NFIBD dissociates already early during initiation. During preinitiation NFIBD remains bound, but as soon as dCTP, dATP or dTTP are added, efficient dissociation occurs. A much lower dissociation level was induced by addition of dGTP. Since dCTP, dATP and dTTP are required for formation of a pTP-CAT initiation intermediate, we explain our results by conformational changes occurring in the polymerase during initiation leading to disruption of both the interaction between the polymerase and NFI as well as the interaction between NFI and the DNA.

  10. Temperature variability and early clustering of record-breaking events

    NASA Astrophysics Data System (ADS)

    Anderson, Amalia; Kostinski, Alex

    2016-05-01

    As the number of climatological studies using record-breaking statistics is growing rapidly, understanding the sensitivity of the chosen time period becomes essential. To that end, here we examine the evolving variability of monthly mean temperatures and its dependence on beginning and final year. Specifically, we use an index, α, based on record-breaking statistics and employing reversibility such that < α>=0 indicates no trend in variability. Generally, < α> has decreased between 1900 and 2013, indicating decreasing variability relative to early decades for stations from the contiguous USA (United States Historical Climatology Network, version 2.5). We find, somewhat surprisingly, that the observed decrease is due to an early excess of records beginning in 1917 (record low value) and 1921 (record high value). While detailed results depend on whether the data is gridded, detrended, etc., the general finding appears remarkably robust and holds globally as well.

  11. Topologically associating domains and their long-range contacts are established during early G1 coincident with the establishment of the replication-timing program.

    PubMed

    Dileep, Vishnu; Ay, Ferhat; Sima, Jiao; Vera, Daniel L; Noble, William S; Gilbert, David M

    2015-08-01

    Mammalian genomes are partitioned into domains that replicate in a defined temporal order. These domains can replicate at similar times in all cell types (constitutive) or at cell type-specific times (developmental). Genome-wide chromatin conformation capture (Hi-C) has revealed sub-megabase topologically associating domains (TADs), which are the structural counterparts of replication domains. Hi-C also segregates inter-TAD contacts into defined 3D spatial compartments that align precisely to genome-wide replication timing profiles. Determinants of the replication-timing program are re-established during early G1 phase of each cell cycle and lost in G2 phase, but it is not known when TAD structure and inter-TAD contacts are re-established after their elimination during mitosis. Here, we use multiplexed 4C-seq to study dynamic changes in chromatin organization during early G1. We find that both establishment of TADs and their compartmentalization occur during early G1, within the same time frame as establishment of the replication-timing program. Once established, this 3D organization is preserved either after withdrawal into quiescence or for the remainder of interphase including G2 phase, implying 3D structure is not sufficient to maintain replication timing. Finally, we find that developmental domains are less well compartmentalized than constitutive domains and display chromatin properties that distinguish them from early and late constitutive domains. Overall, this study uncovers a strong connection between chromatin re-organization during G1, establishment of replication timing, and its developmental control. PMID:25995270

  12. Genetic moderation of stability in attachment security from early childhood to age 18 years: A replication study.

    PubMed

    Raby, K Lee; Roisman, Glenn I; Booth-LaForce, Cathryn

    2015-11-01

    A longstanding question for attachment theory and research is whether genetically based characteristics of the child influence the development of attachment security and its stability over time. This study attempted to replicate and extend recent findings indicating that the developmental stability of attachment security is moderated by oxytocin receptor (OXTR) genetic variants. Using longitudinal data from over 550 individuals, there was no evidence that OXTR rs53576 moderated the association between attachment security during early childhood and overall coherence of mind ("security") during the Adult Attachment Interview at age 18 years. Additional analyses involving a second commonly investigated OXTR variant (rs2254298) and indices of individuals' dismissing and preoccupied attachment states of mind also failed to provide robust evidence for oxytonergic moderation of the stability in attachment security across development. The discussion focuses on research strategies for investigating genetic contributions to attachment security across the life span.

  13. Catching jetted tidal disruption events early in millimetre

    NASA Astrophysics Data System (ADS)

    Yuan, Qiang; Wang, Q. Daniel; Lei, Wei-Hua; Gao, He; Zhang, Bing

    2016-09-01

    Relativistic jets can form from at least some tidal disruption events (TDEs) of (sub-)stellar objects around supermassive black holes. We detect the millimetre (MM) emission of IGR J12580+0134 - the nearest TDE known in the galaxy NGC 4845 at the distance of only 17 Mpc, based on Planck all-sky survey data. The data show significant flux jumps after the event, followed by substantial declines, in all six high-frequency Planck bands from 100 to 857 GHz. We further show that the evolution of the MM flux densities is well consistent with our model prediction from an off-axis jet, as was initially suggested from radio and X-ray observations. This detection represents the second TDE with MM detections; the other is Sw J1644+57, an on-axis jetted TDE at redshift of 0.35. Using the on- and off-axis jet models developed for these two TDEs as templates, we estimate the detection potential of similar events with the Large Millimeter Telescope (LMT) and the Atacama Large Millimeter/submillimeter Array (ALMA). Assuming an exposure of 1 h, we find that the LMT (ALMA) can detect jetted TDEs up to redshifts z ˜ 1 (2), for a typical disrupted star mass of ˜1 M⊙. The detection rates of on- and off-axis TDEs can be as high as ˜0.6 (13) and 10 (220) yr-1, respectively, for the LMT (ALMA). We briefly discuss how such observations, together with follow-up radio monitoring, may lead to major advances in understanding the jetted TDEs themselves and the ambient environment of the circumnuclear medium.

  14. Plasmid-like replicative intermediates of the Epstein-Barr virus lytic origin of DNA replication.

    PubMed Central

    Pfüller, R; Hammerschmidt, W

    1996-01-01

    During the lytic phase of herpesviruses, intermediates of viral DNA replication are found as large concatemeric molecules in the infected cells. It is not known, however, what the early events in viral DNA replication that yield these concatemers are. In an attempt to identify these early steps of DNA replication, replicative intermediates derived from the lytic origin of Epstein-Barr virus, oriLyt, were analyzed. As shown by density shift experiments with bromodeoxyuridine, oriLyt replicated semiconservatively soon after induction of the lytic cycle and oriLyt-containing DNA is amplified to yield monomeric plasmid progeny DNA (besides multimeric forms and high-molecular-weight DNA). A new class of plasmid progeny DNA which have far fewer negative supercoils than do plasmids extracted from uninduced cells is present only in cells undergoing the lytic cycle of Epstein-Barr virus. This finding is consistent with plasmid DNAs having fewer nucleosomes before extraction. The newly replicated plasmid DNAs are dependent on a functional oriLyt in cis and support an efficient marker transfer into Escherichia coli as monomeric plasmids. Multimeric forms of presumably circular progeny DNA of oriLyt, as well as detected recombination events, indicate that oriLyt-mediated DNA replication is biphasic: an early theta-like mode is followed by a complex pattern which could result from rolling-circle DNA replication. PMID:8648674

  15. The future is now: early life events preset adult behaviour.

    PubMed

    Patchev, A V; Rodrigues, A J; Sousa, N; Spengler, D; Almeida, O F X

    2014-01-01

    To consider the evidence that human and animal behaviours are epigenetically programmed by lifetime experiences. Extensive PubMed searches were carried out to gain a broad view of the topic, in particular from the perspective of human psychopathologies such as mood and anxiety disorders. The selected literature cited is complemented by previously unpublished data from the authors' laboratories. Evidence that physiological and behavioural functions are particularly sensitive to the programming effects of environmental factors such as stress and nutrition during early life, and perhaps at later stages of life, is reviewed and extended. Definition of stimulus- and function-specific critical periods of programmability together with deeper understanding of the molecular basis of epigenetic regulation will deliver greater appreciation of the full potential of the brain's plasticity while providing evidence-based social, psychological and pharmacological interventions to promote lifetime well-being.

  16. Early events in the disulfide-coupled folding of BPTI.

    PubMed Central

    Bulaj, G.; Goldenberg, D. P.

    1999-01-01

    Recent studies of the refolding of reduced bovine pancreatic trypsin inhibitor (BPTI) have shown that a previously unidentified intermediate with a single disulfide is formed much more rapidly than any other one-disulfide species. This intermediate contains a disulfide that is present in the native protein (between Cys14 and 38), but it is thermodynamically less stable than the other two intermediates with single native disulfides. To characterize the role of the [14-38] intermediate and the factors that favor its formation, detailed kinetic and mutational analyses of the early disulfide-formation steps were carried out. The results of these studies indicate that the formation of [14-38] from the fully reduced protein is favored by both local electrostatic effects, which enhance the reactivities of the Cys14 and 38 thiols, and conformational tendencies that are diminished by the addition of urea and are enhanced at lower temperatures. At 25 degrees C and pH 7.3, approximately 35% of the reduced molecules were found to initially form the 14-38 disulfide, but the majority of these molecules then undergo intramolecular rearrangements to generate non-native disulfides, and subsequently the more stable intermediates with native disulfides. Amino acid replacements, other than those involving Cys residues, were generally found to have only small effects on either the rate of forming [14-38] or its thermodynamic stability, even though many of the same substitutions greatly destabilized the native protein and other disulfide-bonded intermediates. In addition, those replacements that did decrease the steady-state concentration of [14-38] did not adversely affect further folding and disulfide formation. These results suggest that the weak and transient interactions that are often detected in unfolded proteins and early folding intermediates may, in some cases, not persist or promote subsequent folding steps. PMID:10493584

  17. Replicating the Ice-Volume Signal of the Early Pleistocene with a Complex Earth System Model

    NASA Astrophysics Data System (ADS)

    Tabor, C. R.; Poulsen, C. J.; Pollard, D.

    2013-12-01

    Milankovitch theory proposes high-latitude summer insolation intensity paces the ice ages by controlling perennial snow cover amounts (Milankovitch, 1941). According to theory, the ~21 kyr cycle of precession should dominate the ice-volume records since it has the greatest influence on high-latitude summer insolation. Modeling experiments frequently support Milankovitch theory by attributing the majority of Northern Hemisphere high-latitude summer snowmelt to changes in the cycle of precession (e.g. Jackson and Broccoli, 2003). However, ice-volume proxy records, especially those of the Early Pleistocene (2.6-0.8 Ma), display variability with a period of ~41 kyr (Raymo and Lisiecki, 2005), indicative of insolation forcing from obliquity, which has a much smaller influence on summer insolation intensity than precession. Several hypotheses attempt to explain the discrepancies between Milkankovitch theory and the proxy records by invoking phenomena such as insolation gradients (Raymo and Nisancioglu, 2003), hemispheric offset (Raymo et al., 2006; Lee and Poulsen, 2009), and integrated summer energy (Huybers, 2006); however, all of these hypotheses contain caveats (Ruddiman, 2006) and have yet to be supported by modeling studies that use a complex GCM. To explore potential solutions to this '41 kyr problem,' we use an Earth system model composed of the GENESIS GCM and Land Surface model, the BIOME4 vegetation model, and the Pennsylvania State ice-sheet model. Using an asynchronous coupling technique, we run four idealized transient combinations of obliquity and precession, representing the orbital extremes of the Pleistocene (Berger and Loutre, 1991). Each experiment is run through several complete orbital cycles with a dynamic ice domain spanning North America and Greenland, and fixed preindustrial greenhouse-gas concentrations. For all orbital configurations, model results produce greater ice-volume spectral power at the frequency of obliquity despite significantly

  18. HIV-protease inhibitors block the replication of both vesicular stomatitis and influenza viruses at an early post-entry replication step

    SciTech Connect

    Federico, Maurizio

    2011-08-15

    The inhibitors of HIV-1 protease (PIs) have been designed to block the activity of the viral aspartyl-protease. However, it is now accepted that this family of inhibitors can also affect the activity of cell proteases. Since the replication of many virus species requires the activity of host cell proteases, investigating the effects of PIs on the life cycle of viruses other than HIV would be of interest. Here, the potent inhibition induced by saquinavir and nelfinavir on the replication of both vesicular stomatitis and influenza viruses is described. These are unrelated enveloped RNA viruses infecting target cells upon endocytosis and intracellular fusion. The PI-induced inhibition was apparently a consequence of a block at the level of the fusion between viral envelope and endosomal membranes. These findings would open the way towards the therapeutic use of PIs against enveloped RNA viruses other than HIV.

  19. Early activation of MyD88-mediated autophagy sustains HSV-1 replication in human monocytic THP-1 cells

    PubMed Central

    Siracusano, Gabriel; Venuti, Assunta; Lombardo, Daniele; Mastino, Antonio; Esclatine, Audrey; Sciortino, Maria Teresa

    2016-01-01

    Autophagy is a cellular degradation pathway that exerts numerous functions in vital biological processes. Among these, it contributes to both innate and adaptive immunity. On the other hand, pathogens have evolved strategies to manipulate autophagy for their own advantage. By monitoring autophagic markers, we showed that HSV-1 transiently induced autophagosome formation during early times of the infection of monocytic THP-1 cells and human monocytes. Autophagy is induced in THP-1 cells by a mechanism independent of viral gene expression or viral DNA accumulation. We found that the MyD88 signaling pathway is required for HSV-1-mediated autophagy, and it is linked to the toll-like receptor 2 (TLR2). Interestingly, autophagy inhibition by pharmacological modulators or siRNA knockdown impaired viral replication in both THP-1 cells and human monocytes, suggest that the virus exploits the autophagic machinery to its own benefit in these cells. Taken together, these findings indicate that the early autophagic response induced by HSV-1 exerts a proviral role, improving viral production in a semi-permissive model such as THP-1 cells and human monocytes. PMID:27509841

  20. Live Cell Imaging of Early Autophagy Events: Omegasomes and Beyond

    PubMed Central

    Karanasios, Eleftherios; Stapleton, Eloise; Walker, Simon A.; Manifava, Maria; Ktistakis, Nicholas T.

    2013-01-01

    Autophagy is a cellular response triggered by the lack of nutrients, especially the absence of amino acids. Autophagy is defined by the formation of double membrane structures, called autophagosomes, that sequester cytoplasm, long-lived proteins and protein aggregates, defective organelles, and even viruses or bacteria. Autophagosomes eventually fuse with lysosomes leading to bulk degradation of their content, with the produced nutrients being recycled back to the cytoplasm. Therefore, autophagy is crucial for cell homeostasis, and dysregulation of autophagy can lead to disease, most notably neurodegeneration, ageing and cancer. Autophagosome formation is a very elaborate process, for which cells have allocated a specific group of proteins, called the core autophagy machinery. The core autophagy machinery is functionally complemented by additional proteins involved in diverse cellular processes, e.g. in membrane trafficking, in mitochondrial and lysosomal biology. Coordination of these proteins for the formation and degradation of autophagosomes constitutes the highly dynamic and sophisticated response of autophagy. Live cell imaging allows one to follow the molecular contribution of each autophagy-related protein down to the level of a single autophagosome formation event and in real time, therefore this technique offers a high temporal and spatial resolution. Here we use a cell line stably expressing GFP-DFCP1, to establish a spatial and temporal context for our analysis. DFCP1 marks omegasomes, which are precursor structures leading to autophagosomes formation. A protein of interest (POI) can be marked with either a red or cyan fluorescent tag. Different organelles, like the ER, mitochondria and lysosomes, are all involved in different steps of autophagosome formation, and can be marked using a specific tracker dye. Time-lapse microscopy of autophagy in this experimental set up, allows information to be extracted about the fourth dimension, i.e. time. Hence we

  1. A herpes simplex virus scaffold peptide that binds the portal vertex inhibits early steps in viral replication.

    PubMed

    Yang, Kui; Wills, Elizabeth; Baines, Joel D

    2013-06-01

    Previous experiments identified a 12-amino-acid (aa) peptide that was sufficient to interact with the herpes simplex virus 1 (HSV-1) portal protein and was necessary to incorporate the portal into capsids. In the present study, cells were treated at various times postinfection with peptides consisting of a portion of the Drosophila antennapedia protein, previously shown to enter cells efficiently, fused to either wild-type HSV-1 scaffold peptide (YPYYPGEARGAP) or a control peptide that contained changes at positions 4 and 5. These 4-tyrosine and 5-proline residues are highly conserved in herpesvirus scaffold proteins and were previously shown to be critical for the portal interaction. Treatment early in infection with subtoxic levels of wild-type peptide reduced viral infectivity by over 1,000-fold, while the mutant peptide had little effect on viral yields. In cells infected for 3 h in the presence of wild-type peptide, capsids were observed to transit to the nuclear rim normally, as viewed by fluorescence microscopy. However, observation by electron microscopy in thin sections revealed an aberrant and significant increase of DNA-containing capsids compared to infected cells treated with the mutant peptide. Early treatment with peptide also prevented formation of viral DNA replication compartments. These data suggest that the antiviral peptide stabilizes capsids early in infection, causing retention of DNA within them, and that this activity correlates with peptide binding to the portal protein. The data are consistent with the hypothesis that the portal vertex is the conduit through which DNA is ejected to initiate infection.

  2. Sambucus nigra extracts inhibit infectious bronchitis virus at an early point during replication

    PubMed Central

    2014-01-01

    an early point in infection, probably by rendering the virus non-infectious. They also suggest that future studies using S. nigra extract to treat or prevent IBV or other coronaviruses are warranted. PMID:24433341

  3. Compartmentalized replication of R5 T cell-tropic HIV-1 in the central nervous system early in the course of infection.

    PubMed

    Sturdevant, Christa Buckheit; Joseph, Sarah B; Schnell, Gretja; Price, Richard W; Swanstrom, Ronald; Spudich, Serena

    2015-03-01

    Compartmentalized HIV-1 replication within the central nervous system (CNS) likely provides a foundation for neurocognitive impairment and a potentially important tissue reservoir. The timing of emergence and character of this local CNS replication has not been defined in a population of subjects. We examined the frequency of elevated cerebrospinal fluid (CSF) HIV-1 RNA concentration, the nature of CSF viral populations compared to the blood, and the presence of a cellular inflammatory response (with the potential to bring infected cells into the CNS) using paired CSF and blood samples obtained over the first two years of infection from 72 ART-naïve subjects. Using single genome amplification (SGA) and phylodynamics analysis of full-length env sequences, we compared CSF and blood viral populations in 33 of the 72 subjects. Independent HIV-1 replication in the CNS (compartmentalization) was detected in 20% of sample pairs analyzed by SGA, or 7% of all sample pairs, and was exclusively observed after four months of infection. In subjects with longitudinal sampling, 30% showed evidence of CNS viral replication or pleocytosis/inflammation in at least one time point, and in approximately 16% of subjects we observed evolving CSF/CNS compartmentalized viral replication and/or a marked CSF inflammatory response at multiple time points suggesting an ongoing or recurrent impact of the infection in the CNS. Two subjects had one of two transmitted lineages (or their recombinant) largely sequestered within the CNS shortly after transmission, indicating an additional mechanism for establishing early CNS replication. Transmitted variants were R5 T cell-tropic. Overall, examination of the relationships between CSF viral populations, blood and CSF HIV-1 RNA concentrations, and inflammatory responses suggested four distinct states of viral population dynamics, with associated mechanisms of local viral replication and the early influx of virus into the CNS. This study considerably

  4. Early Combination Antiretroviral Therapy Limits Exposure to HIV-1 Replication and Cell-Associated HIV-1 DNA Levels in Infants

    PubMed Central

    McManus, Margaret; Mick, Eric; Hudson, Richard; Mofenson, Lynne M.; Sullivan, John L.; Somasundaran, Mohan; Luzuriaga, Katherine

    2016-01-01

    The primary aim of this study was to measure HIV-1 persistence following combination antiretroviral therapy (cART) in infants and children. Peripheral blood mononuclear cell (PBMC) HIV-1 DNA was quantified prior to and after 1 year of cART in 30 children, stratified by time of initiation (early, age <3 months, ET; late, age >3 months-2 years, LT). Pre-therapy PBMC HIV-1 DNA levels correlated with pre-therapy plasma HIV-1 levels (r = 0.59, p<0.001), remaining statistically significant (p = 0.002) after adjustment for prior perinatal antiretroviral exposure and age at cART initiation. PBMC HIV-1 DNA declined significantly after 1 year of cART (Overall: -0.91±0.08 log10 copies per million PBMC, p<0.001; ET: -1.04±0.11 log10 DNA copies per million PBMC, p<0.001; LT: -0.74 ±0.13 log10 DNA copies per million PBMC, p<0.001) but rates of decline did not differ significantly between ET and LT. HIV-1 replication exposure over the first 12 months of cART, estimated as area-under-the-curve (AUC) of circulating plasma HIV-1 RNA levels, was significantly associated with PBMC HIV-1 DNA at one year (r = 0.51, p = 0.004). In 21 children with sustained virologic suppression after 1 year of cART, PBMC HIV-1 DNA levels continued to decline between years 1 and 4 (slope -0.21 log10 DNA copies per million PBMC per year); decline slopes did not differ significantly between ET and LT. PBMC HIV-1 DNA levels at 1 year and 4 years of cART correlated with age at cART initiation (1 year: p = 0.04; 4 years: p = 0.03) and age at virologic control (1 and 4 years, p = 0.02). Altogether, these data indicate that reducing exposure to HIV-1 replication and younger age at cART initiation are associated with lower HIV-1 DNA levels at and after one year of age, supporting the concept that HIV-1 diagnosis and cART initiation in infants should occur as early as possible. PMID:27104621

  5. ABA Inhibits Embryo Cell Expansion and Early Cell Division Events During Coffee (Coffea arabica ‘Rubi’) Seed Germination

    PubMed Central

    Da Silva, E. A. Amaral; Toorop, Peter E.; Van Lammeren, André A. M.; Hilhorst, Henk W. M.

    2008-01-01

    Background and Aims Coffee seed germination represents an interplay between the embryo and the surrounding endosperm. A sequence of events in both parts of the seed determines whether germination will be successful or not. Following previous studies, the aim here was to further characterize the morphology of endosperm degradation and embryo growth with respect to morphology and cell cycle, and the influence of abscisic acid on these processes. Methods Growth of cells in a fixed region of the axis was quantified from light micrographs. Cell cycle events were measured by flow cytometry and by immunocytochemistry, using antibodies against β-tubulin. Aspects of the endosperm were visualized by light and scanning electron microscopy. Key Results The embryonic axis cells grew initially by isodiametric expansion. This event coincided with reorientation and increase in abundance of microtubules and with accumulation of β-tubulin. Radicle protrusion was characterized by a shift from isodiametric expansion to elongation of radicle cells and further accumulation of β-tubulin. Early cell division events started prior to radicle protrusion. Abscisic acid decreased the abundance of microtubules and inhibited the growth of the embryo cells, the reorganization of the microtubules, DNA replication in the embryonic axis, the formation of a protuberance and the completion of germination. The endosperm cap cells had smaller and thinner cell walls than the rest of the endosperm. Cells in the endosperm cap displayed compression followed by loss of cell integrity and the appearance of a protuberance prior to radicle protrusion. Conclusions Coffee seed germination is the result of isodiametric growth of the embryo followed by elongation, at the expense of integrity of endosperm cap cells. The cell cycle, including cell division, is initiated prior to radicle protrusion. ABA inhibits expansion of the embryo, and hence subsequent events, including germination. PMID:18617534

  6. Sequences within the early and late promoters of archetype JC virus restrict viral DNA replication and infectivity.

    PubMed

    Daniel, A M; Swenson, J J; Mayreddy, R P; Khalili, K; Frisque, R J

    1996-02-01

    Two forms of JC virus (JCV) have been isolated from its human host, an archetype found in kidney tissue and urine of nonimmunocompromised individuals and a rearranged type detected in lymphocytes and brain tissue of patients with and without progressive multifocal leukoencephalopathy. To investigate the hypothesis that alterations to the archetype transcriptional control region yield rearranged forms of the virus exhibiting new tissue tropic and pathogenic potentials, attempts were made to propagate archetype JCV in human renal and glial cell cultures. Although rearranged forms of JCV multiplied in these cells, archetype JCV failed to do so. Through the use of chimeric and mutant viral genomes, and a cell line that constitutively expresses viral T protein, we demonstrated that archetype's inactivity relative to that of rearranged forms was due to differences in the promoter-enhancer and not in the protein coding regions or origin of DNA replication. Additional analyses revealed that the absence of a large tandem duplication and the presence of a 23- and a 66-base pair sequence in the archetype transcriptional control region were responsible for this restricted lytic behavior. We discuss the possibility that deletion and duplication events within the archetype promoter-enhancer might yield more active viral variants via the loss of a negative, or the creation of a positive, transcriptional control signal(s).

  7. The Importance of First Impressions: Early Events in Mycobacterium tuberculosis Infection Influence Outcome

    PubMed Central

    Cadena, Anthony M.; Fortune, Sarah M.

    2016-01-01

    ABSTRACT Tuberculosis remains a major health threat in much of the world. New vaccines against Mycobacterium tuberculosis are essential for preventing infection, disease, and transmission. However, the host immune responses that need to be induced by an effective vaccine remain unclear. Increasingly, it has become clear that early events in infection are of major importance in the eventual outcome of the infection. Studying such events in humans is challenging, as they occur within the lung and thoracic lymph nodes, and any clinical signs of early infection are relatively nonspecific. Nonetheless, clinical studies and animal models of tuberculosis have provided new insights into the local events that occur in the first few weeks of tuberculosis. Development of an effective vaccine requires a clear understanding of the successful (and detrimental) early host responses against M. tuberculosis, with the goal to improve upon natural immune responses and prevent infection or disease. PMID:27048801

  8. The Importance of First Impressions: Early Events in Mycobacterium tuberculosis Infection Influence Outcome.

    PubMed

    Cadena, Anthony M; Flynn, JoAnne L; Fortune, Sarah M

    2016-01-01

    Tuberculosis remains a major health threat in much of the world. New vaccines against Mycobacterium tuberculosis are essential for preventing infection, disease, and transmission. However, the host immune responses that need to be induced by an effective vaccine remain unclear. Increasingly, it has become clear that early events in infection are of major importance in the eventual outcome of the infection. Studying such events in humans is challenging, as they occur within the lung and thoracic lymph nodes, and any clinical signs of early infection are relatively nonspecific. Nonetheless, clinical studies and animal models of tuberculosis have provided new insights into the local events that occur in the first few weeks of tuberculosis. Development of an effective vaccine requires a clear understanding of the successful (and detrimental) early host responses against M. tuberculosis, with the goal to improve upon natural immune responses and prevent infection or disease.

  9. Requirement of multiple cis-acting elements in the human cytomegalovirus major immediate-early distal enhancer for viral gene expression and replication.

    PubMed

    Meier, Jeffery L; Keller, Michael J; McCoy, James J

    2002-01-01

    We have shown previously that the human cytomegalovirus (HCMV) major immediate-early (MIE) distal enhancer is needed for MIE promoter-dependent transcription and viral replication at low multiplicities of infection (MOI). To understand how this region works, we constructed and analyzed a series of HCMVs with various distal enhancer mutations. We show that the distal enhancer is composed of at least two parts that function independently to coordinately activate MIE promoter-dependent transcription and viral replication. One such part is contained in a 47-bp segment that has consensus binding sites for CREB/ATF, SP1, and YY1. At low MOI, these working parts likely function in cis to directly activate MIE gene expression, thus allowing viral replication to ensue. Three findings support the view that these working parts are likely cis-acting elements. (i) Deletion of either part of a bisegmented distal enhancer only slightly alters MIE gene transcription and viral replication. (ii) Reversing the distal enhancer's orientation largely preserves MIE gene transcription and viral replication. (iii) Placement of stop codons at -300 or -345 in all reading frames does not impair MIE gene transcription and viral replication. Lastly, we show that these working parts are dispensable at high MOI, partly because of compensatory stimulation of MIE promoter activity and viral replication that is induced by a virion-associated component(s) present at a high viral particle/cell ratio. We conclude that the distal enhancer is a complex multicomponent cis-acting region that is required to augment both MIE promoter-dependent transcription and HCMV replication.

  10. Early Infection HIV-1 Envelope V1-V2 Genotypes Do Not Enhance Binding or Replication in Cells Expressing High Levels of α4β7 Integrin

    PubMed Central

    Etemad, Behzad; Gonzalez, Oscar A.; McDonough, Sean; Pena-Cruz, Victor; Sagar, Manish

    2013-01-01

    It has been postulated that HIV-1 envelope properties, such as shorter and less glycosylated V1-V2 loops commonly observed among non-subtype B early – transmitted viruses, promote utilization of the gut homing integrin α4β7. This property potentially confers an advantage to some HIV-1 variants early after acquisition. We found that replication competent recombinant viruses incorporating HIV-1 subtype A compact and less glycosylated early versus chronic phase V1-V2 loops demonstrated no significant difference in binding to α4β7 high CD8+ T cells or replication in α4β7 high CD4+ T cells. Integrin α4β7 usage does not select for shorter less glycosylated envelopes during transmission. PMID:23797693

  11. Early infection HIV-1 envelope V1-V2 genotypes do not enhance binding or replication in cells expressing high levels of α4β7 integrin.

    PubMed

    Etemad, Behzad; Gonzalez, Oscar A; McDonough, Sean; Pena-Cruz, Victor; Sagar, Manish

    2013-11-01

    It has been postulated that HIV-1 envelope properties, such as shorter and less-glycosylated V1-V2 loops commonly observed among non-subtype B early-transmitted viruses, promote utilization of the gut homing integrin α4β7. This property potentially confers an advantage to some HIV-1 variants early after acquisition. We found that replication-competent recombinant viruses incorporating HIV-1 subtype A compact and less-glycosylated early versus chronic phase V1-V2 loops demonstrated no significant difference in binding to α4β7 high CD8⁺ T cells or replication in α4β7 high CD4⁺ T cells. Integrin α4β7 usage does not select for shorter less-glycosylated envelopes during transmission. PMID:23797693

  12. Evidence for an early pliocene cold event in the southern oceans

    SciTech Connect

    Burckle, L.H.; Mortlock, R.A. ); Rudolph, S. )

    1993-01-01

    Although it is generally agreed that the early Pliocene witnessed the last great climate warming before the onset of Northern Hemisphere glaciation, it is generally not recognized that this time interval also witnessed what appear to be major glaciations in both northern and southern Hemispheres. This describes a study of brief, intense warm events in the early Pliocene as well as evidence for at least one major glaciation during this time interval. 13 refs.

  13. Nup153 and Nup98 bind the HIV-1 core and contribute to the early steps of HIV-1 replication

    SciTech Connect

    Di Nunzio, Francesca; Fricke, Thomas; Miccio, Annarita; Valle-Casuso, Jose Carlos; Perez, Patricio; Souque, Philippe; Rizzi, Ermanno; Severgnini, Marco; Mavilio, Fulvio; Charneau, Pierre; Diaz-Griffero, Felipe

    2013-05-25

    The early steps of HIV-1 replication involve the entry of HIV-1 into the nucleus, which is characterized by viral interactions with nuclear pore components. HIV-1 developed an evolutionary strategy to usurp the nuclear pore machinery and chromatin in order to integrate and efficiently express viral genes. In the current work, we studied the role of nucleoporins 153 and 98 (Nup153 and Nup98) in infection of human Jurkat lymphocytes by HIV-1. We showed that Nup153-depleted cells exhibited a defect in nuclear import, while depletion of Nup 98 caused a slight defect in HIV integration. To explore the biochemical viral determinants for the requirement of Nup153 and Nup98 during HIV-1 infection, we tested the ability of these nucleoporins to interact with HIV-1 cores. Our findings showed that both nucleoporins bind HIV-1 cores suggesting that this interaction is important for HIV-1 nuclear import and/or integration. Distribution analysis of integration sites in Nup153-depleted cells revealed a reduced tendency of HIV-1 to integrate in intragenic sites, which in part could account for the large infectivity defect observed in Nup153-depleted cells. Our work strongly supports a role for Nup153 in HIV-1 nuclear import and integration. - Highlights: ► We studied the role of Nup98 and Nup153 in HIV-1 infection. ► Nup98 binds the HIV-1 core and is involved in HIV-1 integration. ► Nup153 binds the HIV-1 core and is involved in HIV-1 nuclear import. ► Depletion of Nup153 decreased the integration of HIV-1 in transcriptionally active sites.

  14. Let's Party! How To Plan Special Events and Raise Money in Early Childhood Programs.

    ERIC Educational Resources Information Center

    Rice, Judith Anne

    This guide for early childhood program administrators provides guidelines and makes suggestions for planning special events to facilitate opportunities for parents, children, teachers, and organizations to connect in ways that strengthen individuals and communities and raise money for the organization. Part 1, "Planning," focuses on organization,…

  15. How Early Events Affect Growing Brains. An Interview with Neuroscientist Pat Levitt

    ERIC Educational Resources Information Center

    National Scientific Council on the Developing Child, 2006

    2006-01-01

    Recent advances in neuroscience show clearly how experience can change brain neurochemicals, and how this in turn affects the way the brain functions. As a result, early negative events actually get built into the growing brain's neurochemistry, altering the brain's architecture. Research is continuing to investigate how children with genetic…

  16. Controls of event-based pesticide leaching in natural soils: A systematic study based on replicated field scale irrigation experiments

    NASA Astrophysics Data System (ADS)

    Klaus, Julian; Zehe, Erwin; Elsner, Martin; Palm, Juliane; Schneider, Dorothee; Schröder, Boris; Steinbeiss, Sibylle; van Schaik, Loes; West, Stephanie

    2014-05-01

    Tile drains strongly influence the water cycle in agricultural catchment in terms of water quantity and quality. The connectivity of preferential flow to tile drains can create shortcuts for rapid transport of solutes into surface waters. The leaching of pesticides can be linked to a set of main factors including, rainfall characteristics, soil moisture, chemical properties of the pesticides, soil properties, and preferential flow paths. The connectivity of the macropore system to the tile drain is crucial for pesticide leaching. Concurring influences of the main factors, threshold responses and the role of flow paths are still poorly understood. The objective of this study is to investigate these influences by a replica series of three irrigation experiments on a tile drain field site using natural and artificial tracers together with applied pesticides. We found a clear threshold behavior in the initialization of pesticide transport that was different between the replica experiments. Pre-event soil water contributed significantly to the tile drain flow, and creates a flow path for stored pesticides from the soil matrix to the tile drain. This threshold is controlled by antecedent soil moisture and precipitation characteristics, and the interaction between the soil matrix and preferential flow system. Fast transport of pesticides without retardation and the remobilization could be attributed to this threshold and the interaction between the soil matrix and the preferential flow system. Thus, understanding of the detailed preferential flow processes clearly enhances the understanding of pesticide leaching on event and long term scale, and can further improve risk assessment and modeling approaches.

  17. Environmental change during the Late Berriasian - Early Valanginian: a prelude to the late Early Valanginian carbon-isotope event?

    NASA Astrophysics Data System (ADS)

    Morales, Chloé; Schnyder, Johann; Spangenberg, Jorge; Adatte, Thierry; Westermann, Stephane; Föllmi, Karl

    2010-05-01

    The Valanginian period is well known for a positive excursion in marine and terrestrial δ13C records, which has been interpreted as the consequence of a major perturbation in the global carbon cycle (Lini et al., 1992; Erba et al., 2004). In contrast to the positive δ13C excursions of the Early Aptian and latest Cenomanian, marine organic-rich sediments have only been recognized from a few localities (van de Schootbrugge et al., 2003; Reboulet et al., 2003; Gröcke et al., 2005; Westermann et al., in press). The δ13C excursion began in the late Early Valanginian (campylotoxus ammonite zone) and gradually ended during the Late Valanginian. It is associated with a phase of widespread carbonate-platform drowning on the shelf (Föllmi et al., 1994) and a decline in calcareous nannofossils in the pelagic realm (Erba et al., 2004). As a triggering mechanism, numerous authors invoke the formation of the Parañà-Etendeka flood basalt. The correlation of this episode with the Valanginian δ13C event depends, however, on the absolute ages attributed to the Valanginian stage. The recent geological timescale by Ogg et al. (2008) shows that the major eruptional phase occurred during the Late Valanginian. This may imply that the late Early Valanginian δ13C event resulted from a combination of different factors. Important paleoenvironmental change occurred already in the latest Berriasian and earliest Valanginian, prior to the positive δ13C excursion. An increase in nutrient input near the onset of the δ13C excursion (campylotoxus ammonite zone), which may be considered as a trigger of the carbon cycle perturbation, has been identified in different studies, (Hennig, 2003; Duchamp-Alphonse et al., 2007; Bornemann & Mutterlose, 2008). Heterozoan faunal associations became dominant since the Early Valanginian on the northern Tethyan Helvetic platform and may indicate the beginning of sea-water eutrophication (Föllmi et al., 2007). Clay assemblages in the Tethys and Western

  18. Multiple Polyploidization Events across Asteraceae with Two Nested Events in the Early History Revealed by Nuclear Phylogenomics

    PubMed Central

    Huang, Chien-Hsun; Zhang, Caifei; Liu, Mian; Hu, Yi; Gao, Tiangang; Qi, Ji; Ma, Hong

    2016-01-01

    Biodiversity results from multiple evolutionary mechanisms, including genetic variation and natural selection. Whole-genome duplications (WGDs), or polyploidizations, provide opportunities for large-scale genetic modifications. Many evolutionarily successful lineages, including angiosperms and vertebrates, are ancient polyploids, suggesting that WGDs are a driving force in evolution. However, this hypothesis is challenged by the observed lower speciation and higher extinction rates of recently formed polyploids than diploids. Asteraceae includes about 10% of angiosperm species, is thus undoubtedly one of the most successful lineages and paleopolyploidization was suggested early in this family using a small number of datasets. Here, we used genes from 64 new transcriptome datasets and others to reconstruct a robust Asteraceae phylogeny, covering 73 species from 18 tribes in six subfamilies. We estimated their divergence times and further identified multiple potential ancient WGDs within several tribes and shared by the Heliantheae alliance, core Asteraceae (Asteroideae–Mutisioideae), and also with the sister family Calyceraceae. For two of the WGD events, there were subsequent great increases in biodiversity; the older one proceeded the divergence of at least 10 subfamilies within 10 My, with great variation in morphology and physiology, whereas the other was followed by extremely high species richness in the Heliantheae alliance clade. Our results provide different evidence for several WGDs in Asteraceae and reveal distinct association among WGD events, dramatic changes in environment and species radiations, providing a possible scenario for polyploids to overcome the disadvantages of WGDs and to evolve into lineages with high biodiversity. PMID:27604225

  19. A temperature sensitive mutant of heat shock protein 70 reveals an essential role during the early steps of tombusvirus replication.

    PubMed

    Wang, Robert Yung-Liang; Stork, Jozsef; Pogany, Judit; Nagy, Peter D

    2009-11-10

    By co-opting host proteins for their replication, plus-stranded RNA viruses can support robust replication and suppress host anti-viral responses. Tomato bushy stunt virus (TBSV) recruit the cellular heat shock protein 70 (Hsp70), an abundant cytosolic chaperone, into the replicase complex. By taking advantage of yeast model host, we demonstrate that the four-member SSA subfamily of HSP70 genes is essential for TBSV replication. The constitutively expressed SSA1 and SSA2, which are resident proteins in the viral replicase, can be complemented by the heat-inducible SSA3 and/or SSA4 for TBSV replication. Using a yeast strain carrying a temperature sensitive ssa1(ts), but lacking functional SSA2/3/4, we show that inactivation of Ssa1p(ts) led to a defect in membrane localization of the viral replication proteins, resulting in cytosolic distribution of the viral proteins and lack of replicase activity. An in vitro replicase assembly assay with Ssa1p(ts) revealed that functional Ssa1p is required during the replicase assembly process, but not during minus- or plus-strand synthesis. Temperature shift experiments from nonpermissive to permissive in ssa1(ts) yeast revealed that the re-activated Ssa1p(ts) could promote efficient TBSV replication in the absence of other SSA genes. We also demonstrate that the purified recombinant Ssa3p can facilitate the in vitro assembly of the TBSV replicase on yeast membranes, demonstrating that Ssa3p can fully complement the function of Ssa1p. Taken together, the cytosolic SSA subfamily of Hsp70 proteins play essential and multiple roles in TBSV replication. PMID:19748649

  20. Energetic Particle Cross-field Propagation Early in a Solar Event

    NASA Astrophysics Data System (ADS)

    Laitinen, T.; Dalla, S.; Marsh, M. S.

    2013-08-01

    Solar energetic particles (SEPs) have been observed to easily spread across heliographic longitudes, and the mechanisms responsible for this behavior remain unclear. We use full-orbit simulations of a 10 MeV proton beam in a turbulent magnetic field to study to what extent the spread across the mean field can be described as diffusion early in a particle event. We compare the full-orbit code results to solutions of a Fokker-Planck equation including spatial and pitch angle diffusion, and of one including also propagation of the particles along random-walking magnetic field lines. We find that propagation of the particles along meandering field lines is the key process determining their cross-field spread at 1 AU at the beginning of the simulated event. The mean square displacement of the particles an hour after injection is an order of magnitude larger than that given by the diffusion model, indicating that models employing spatial cross-field diffusion cannot be used to describe early evolution of an SEP event. On the other hand, the diffusion of the particles from their initial field lines is negligible during the first 5 hr, which is consistent with the observations of SEP intensity dropouts. We conclude that modeling SEP events must take into account the particle propagation along meandering field lines for the first 20 hr of the event.

  1. Generation of eGFP expressing recombinant Zaire ebolavirus for analysis of early pathogenesis events and high-throughput antiviral drug screening.

    PubMed

    Towner, Jonathan S; Paragas, Jason; Dover, Jason E; Gupta, Manisha; Goldsmith, Cynthia S; Huggins, John W; Nichol, Stuart T

    2005-02-01

    Zaire ebolavirus causes large outbreaks of severe and usually fatal hemorrhagic disease in humans for which there is no effective treatment or cure. To facilitate examination of early critical events in viral pathogenesis and to identify antiviral compounds, a recombinant Zaire ebolavirus was engineered to express a foreign protein, eGFP, to provide a rapid and sensitive means to monitor virus replication in infected cells. This genetically engineered virus represents the first insertion of a foreign gene into ebolavirus. We show that Ebola-eGFP virus (EboZ-eGFP) infects known early targets of human infections and serves as an ideal model to screen antiviral compounds in less time than any previously published assay.

  2. Carbonate platform evidence of ocean acidification at the onset of the early Toarcian oceanic anoxic event

    NASA Astrophysics Data System (ADS)

    Trecalli, Alberto; Spangenberg, Jorge; Adatte, Thierry; Föllmi, Karl B.; Parente, Mariano

    2012-12-01

    The early Toarcian oceanic anoxic event (Early Jurassic;˜183 Myr ago) is associated with one of the largest negative carbon isotope excursion (CIE) in the whole Phanerozoic (3-7‰). Estimates of the magnitude and rate of CO2 injection in the ocean-atmosphere system are compatible with a scenario of ocean acidification. Many carbonate platforms drowned in the Pliensbachian, well before the early Toarcian event. In this paper we test the hypothesis of surface water ocean acidification by presenting data from a resilient carbonate platform: the Apennine Carbonate Platform of southern Italy. The studied sections document a dramatic shift of the carbonate factory from massive biocalcification to chemical precipitation. Lithiotis bivalves and calcareous algae (Palaeodasycladus mediterraneus), which were the most prolific carbonate producers of Pliensbachian carbonate platforms, disappear during the first phase of the early Toarcian CIE, before the most depleted values are reached. We discuss the local versus supraregional significance of this shift and propose a scenario involving abrupt decline of carbonate saturation, forced by CO2 release at the beginning of the early Toarcian CIE, followed by a calcification overshoot, driven by the recovery of ocean alkalinity. Attribution of the demise of carbonate platform hypercalcifiers to ocean acidification is supported by palaeophysiology and reinforced by experimental data on the detrimental effects of ocean acidification on recent shellfishes and calcareous algae.

  3. Chlamydia trachomatis Infection of Endocervical Epithelial Cells Enhances Early HIV Transmission Events.

    PubMed

    Buckner, Lyndsey R; Amedee, Angela M; Albritton, Hannah L; Kozlowski, Pamela A; Lacour, Nedra; McGowin, Chris L; Schust, Danny J; Quayle, Alison J

    2016-01-01

    Chlamydia trachomatis causes a predominantly asymptomatic, but generally inflammatory, genital infection that is associated with an increased risk for HIV acquisition. Endocervical epithelial cells provide the major niche for this obligate intracellular bacterium in women, and the endocervix is also a tissue in which HIV transmission can occur. The mechanism by which CT infection enhances HIV susceptibility at this site, however, is not well understood. Utilizing the A2EN immortalized endocervical epithelial cell line grown on cell culture inserts, we evaluated the direct role that CT-infected epithelial cells play in facilitating HIV transmission events. We determined that CT infection significantly enhanced the apical-to-basolateral migration of cell-associated, but not cell-free, HIVBaL, a CCR5-tropic strain of virus, across the endocervical epithelial barrier. We also established that basolateral supernatants from CT-infected A2EN cells significantly enhanced HIV replication in peripheral mononuclear cells and a CCR5+ T cell line. These results suggest that CT infection of endocervical epithelial cells could facilitate both HIV crossing the mucosal barrier and subsequent infection or replication in underlying target cells. Our studies provide a mechanism by which this common STI could potentially promote the establishment of founder virus populations and the maintenance of local HIV reservoirs in the endocervix. Development of an HIV/STI co-infection model also provides a tool to further explore the role of other sexually transmitted infections in enhancing HIV acquisition.

  4. Dissemination of a highly virulent pathogen: tracking the early events that define infection.

    PubMed

    Gonzalez, Rodrigo J; Lane, M Chelsea; Wagner, Nikki J; Weening, Eric H; Miller, Virginia L

    2015-01-01

    The series of events that occurs immediately after pathogen entrance into the body is largely speculative. Key aspects of these events are pathogen dissemination and pathogen interactions with the immune response as the invader moves into deeper tissues. We sought to define major events that occur early during infection of a highly virulent pathogen. To this end, we tracked early dissemination of Yersinia pestis, a highly pathogenic bacterium that causes bubonic plague in mammals. Specifically, we addressed two fundamental questions: (1) do the bacteria encounter barriers in disseminating to draining lymph nodes (LN), and (2) what mechanism does this nonmotile bacterium use to reach the LN compartment, as the prevailing model predicts trafficking in association with host cells. Infection was followed through microscopy imaging in addition to assessing bacterial population dynamics during dissemination from the skin. We found and characterized an unexpected bottleneck that severely restricts bacterial dissemination to LNs. The bacteria that do not pass through this bottleneck are confined to the skin, where large numbers of neutrophils arrive and efficiently control bacterial proliferation. Notably, bottleneck formation is route dependent, as it is abrogated after subcutaneous inoculation. Using a combination of approaches, including microscopy imaging, we tested the prevailing model of bacterial dissemination from the skin into LNs and found no evidence of involvement of migrating phagocytes in dissemination. Thus, early stages of infection are defined by a bottleneck that restricts bacterial dissemination and by neutrophil-dependent control of bacterial proliferation in the skin. Furthermore, and as opposed to current models, our data indicate an intracellular stage is not required by Y. pestis to disseminate from the skin to draining LNs. Because our findings address events that occur during early encounters of pathogen with the immune response, this work can

  5. Traumatic events involving friends and family members in a sample of African American early adolescents.

    PubMed

    Jenkins, Esther J; Wang, Edward; Turner, Larry

    2009-07-01

    The current study examines violent and nonviolent traumatic events involving friends and family members as predictors of PTSD, depression, internalizing, and externalizing behaviors in a sample of 403 African American early adolescents from chronically violent environments. Although there are many studies of urban children's exposure to community violence, few address the unique contribution of events involving significant others, and almost no research addresses African American youths' exposure to traumatic events other than violence. This study found that violent and nonviolent traumatic events were pervasive in the lives of these urban youth, and that they were as likely to report loss and injury of a close other through an accident as an act of violence. There were strong gender differences in the data. Unexpectedly, injury or loss of a close friend or family member from nonviolent events, but not from violent events, predicted PTSD, internalizing, and depression for boys. The results are discussed in terms of their implications for school-based universal interventions in communities where large numbers of children live with loss and trauma.

  6. Dramatic early event in chronic allograft nephropathy: increased but not decreased expression of MMP-9 gene

    PubMed Central

    2013-01-01

    Objective The infiltration of mononuclear cells and replication and migration of smooth muscle cells (SMCs) from media into the intima in the vascular wall are the cardinal pathological changes in the early stage of chronic allograft nephropathy (CAN). But the mechanism is unclear. Therefore we investigated the role of matrix metalloproteinase 9 (MMP-9) and its interaction with TGF-beta1, tubulointerstitial mononuclear cells infiltration and migration of SMCs in the early stage of CAN. Methods Kidneys of Fisher (F334) rats were orthotopically transplanted into bilaterally nephrectomized Lewis (LEW) recipients. To suppress an initial episode of acute rejection, rats were briefly treated with cyclosporine A (1.5 mg/kg/day) for the first 10 days. Animals were harvested at 12 weeks after transplantation for histological, immunohistochemistry and molecular biological analysis. Results The expression of MMP-9 was up-regulated in interstitium and vascular wall in the early stage of CAN, where there were interstitial mononuclear cells infiltration and SMCs migration and proliferation. Moreover the expression of MMP-9 were positively correlated with the degree of interstitial mononuclear cells infiltration, the quantity of SMCs in arteriolar wall, and also the increased TFG-beta1 expression in the tubulointerstitium and arteriolar wall. Conclusions MMP-9 may play an important role in the mechanism of pathological changes during the earlier period of CAN. Virtual Slides The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1582313332832700. PMID:23351884

  7. Early Life Conditions, Adverse Life Events, and Chewing Ability at Middle and Later Adulthood

    PubMed Central

    Watt, Richard G.; Tsakos, Georgios

    2014-01-01

    Objectives. We sought to determine the extent to which early life conditions and adverse life events impact chewing ability in middle and later adulthood. Methods. Secondary analyses were conducted based on data from waves 2 and 3 of the Survey of Health, Ageing, and Retirement in Europe (SHARE), collected in the years 2006 to 2009 and encompassing information on current chewing ability and the life history of persons aged 50 years or older from 13 European countries. Logistic regression models were estimated with sequential inclusion of explanatory variables representing living conditions in childhood and adverse life events. Results. After controlling for current determinants of chewing ability at age 50 years or older, certain childhood and later life course socioeconomic, behavioral, and cognitive factors became evident as correlates of chewing ability at age 50 years or older. Specifically, childhood financial hardship was identified as an early life predictor of chewing ability at age 50 years or older (odds ratio = 1.58; 95% confidence interval = 1.22, 2.06). Conclusions. Findings suggest a potential enduring impact of early life conditions and adverse life events on oral health in middle and later adulthood and are relevant for public health decision-makers who design strategies for optimal oral health. PMID:24625140

  8. An Early Warning System for Loan Risk Assessment Based on Rare Event Simulation

    NASA Astrophysics Data System (ADS)

    Zhou, Hong; Qiu, Yue; Wu, Yueqin

    System simulation is one of important tool for risk assessment. In this paper, a new method is presented to deal with credit risk assessment problems for commercial banks based on rare event simulation. The failure probability of repaying loans of listed company is taken as the criterion to measure the level of credit risk. The rare-event concept is adopted to construct the model of credit risk identification in commercial banks, and cross-entropy scheme is designed to implement the rare event simulation, based on which the loss probability can be assessed. Numerical experiments have shown that the method has a strong capability to identify the credit risk for commercial banks and offers a good tool for early warning.

  9. Early Events in Helix Unfolding Under External Forces: A Milestoning Analysis

    PubMed Central

    Kreuzer, Steven M; Elber, Ron; Moon, Tess J

    2012-01-01

    Initial events of helix breakage as a function of load are considered using Molecular Dynamics simulations and Milestoning analysis. A helix length of ~100 amino acids is considered as a model for typical helices found in molecular machines and as a model that minimizes end effects for early events of unfolding. Transitions of individual amino acids (averaged over the helix’s interior residues) are examined and its surrounding hydrogen bonds are considered. Dense kinetic networks are constructed that, with Milestoning analysis, provide the overall kinetics of early breakage events. Network analysis and selection of MaxFlux pathways illustrate that load impacts unfolding mechanisms in addition to time scales. At relatively high (100pN) load levels, the principal intermediate is the 310-helix, while at relatively low (10pN) levels the π-helix is significantly populated, albeit not as an unfolding intermediate. Coarse variables are examined at different levels of resolution; the rate of unfolding illustrates remarkable stability under changes in the coarsening. Consistent prediction of about ~5ns for the time of a single amino-acid unfolding event are obtained. Hydrogen bonds are much faster coarse variables (by about 2 orders of magnitude) compared to backbone torsional transition, which gates unfolding and thereby provides the appropriate coarse variable for the initiation of unfolding. PMID:22471347

  10. Early Reading Success and Its Relationship to Reading Achievement and Reading Volume: Replication of "10 Years Later"

    ERIC Educational Resources Information Center

    Sparks, Richard L.; Patton, Jon; Murdoch, Amy

    2014-01-01

    Cunningham and Stanovich reported a longitudinal investigation over 10 years that examined the unique influence of exposure to print in explaining individual differences on various measures of reading achievement and declarative (general) knowledge. The present study replicated their investigation with a larger number of participants and…

  11. Genetic Moderation of Stability in Attachment Security from Early Childhood to Age 18 Years: A Replication Study

    ERIC Educational Resources Information Center

    Raby, K. Lee; Roisman, Glenn I.; Booth-LaForce, Cathryn

    2015-01-01

    A longstanding question for attachment theory and research is whether genetically based characteristics of the child influence the development of attachment security and its stability over time. This study attempted to replicate and extend recent findings indicating that the developmental stability of attachment security is moderated by oxytocin…

  12. Replicating nucleosomes

    PubMed Central

    Ramachandran, Srinivas; Henikoff, Steven

    2015-01-01

    Eukaryotic replication disrupts each nucleosome as the fork passes, followed by reassembly of disrupted nucleosomes and incorporation of newly synthesized histones into nucleosomes in the daughter genomes. In this review, we examine this process of replication-coupled nucleosome assembly to understand how characteristic steady-state nucleosome landscapes are attained. Recent studies have begun to elucidate mechanisms involved in histone transfer during replication and maturation of the nucleosome landscape after disruption by replication. A fuller understanding of replication-coupled nucleosome assembly will be needed to explain how epigenetic information is replicated at every cell division. PMID:26269799

  13. Replication and Control of Circular Bacterial Plasmids

    PubMed Central

    del Solar, Gloria; Giraldo, Rafael; Ruiz-Echevarría, María Jesús; Espinosa, Manuel; Díaz-Orejas, Ramón

    1998-01-01

    An essential feature of bacterial plasmids is their ability to replicate as autonomous genetic elements in a controlled way within the host. Therefore, they can be used to explore the mechanisms involved in DNA replication and to analyze the different strategies that couple DNA replication to other critical events in the cell cycle. In this review, we focus on replication and its control in circular plasmids. Plasmid replication can be conveniently divided into three stages: initiation, elongation, and termination. The inability of DNA polymerases to initiate de novo replication makes necessary the independent generation of a primer. This is solved, in circular plasmids, by two main strategies: (i) opening of the strands followed by RNA priming (theta and strand displacement replication) or (ii) cleavage of one of the DNA strands to generate a 3′-OH end (rolling-circle replication). Initiation is catalyzed most frequently by one or a few plasmid-encoded initiation proteins that recognize plasmid-specific DNA sequences and determine the point from which replication starts (the origin of replication). In some cases, these proteins also participate directly in the generation of the primer. These initiators can also play the role of pilot proteins that guide the assembly of the host replisome at the plasmid origin. Elongation of plasmid replication is carried out basically by DNA polymerase III holoenzyme (and, in some cases, by DNA polymerase I at an early stage), with the participation of other host proteins that form the replisome. Termination of replication has specific requirements and implications for reinitiation, studies of which have started. The initiation stage plays an additional role: it is the stage at which mechanisms controlling replication operate. The objective of this control is to maintain a fixed concentration of plasmid molecules in a growing bacterial population (duplication of the plasmid pool paced with duplication of the bacterial population

  14. Lateglacial and early Holocene palaeoenvironmental 'events' in Sluggan Bog, Northern Ireland: comparisons with the Greenland NGRIP GICC05 event stratigraphy

    NASA Astrophysics Data System (ADS)

    Walker, Mike; Lowe, John; Blockley, Simon P. E.; Bryant, Charlotte; Coombes, Paul; Davies, Siwan; Hardiman, Mark; Turney, Chris S. M.; Watson, Jenny

    2012-03-01

    A multi-proxy Lateglacial environmental record is described from Sluggan Bog in County Antrim, Northern Ireland. Pollen, plant macrofossil, charcoal, sediment chemistry, stable isotope and sedimentological data provide a multi-faceted picture of local and regional environmental changes during the transition from the Last Cold Stage to the beginning of the present interglacial, and enable a series of distinctive palaeoenvironmental 'events' to be identified. A combination of radiometric and AMS radiocarbon dates on both humic and humin sediment fractions, and on charcoal fragments and plant macrofossils, provides one of the most closely-constrained radiocarbon timescales for any Lateglacial site in the British Isles. The evidence suggests that an initial period of warm conditions, beginning in the Sluggan record around 14.2 ka b2k (before AD 2000), and when open Salix-Betula woodland was locally present, was succeeded first by a heathland phase, then by a re-establishment of wood and scrub, before this was replaced during the later part of the Lateglacial (Woodgrange) Interstadial by species-rich grassland. In terms of timing, this sequence corresponds very closely to the GI-1e, GI-1d, GI-1c series of events in the Greenland NGRIP ice core. A short-lived Betula phase towards the end of the interstadial in the Sluggan sequence may reflect the short-lived climatic warming of GI-1a, although the radiocarbon age model suggests that it occurred prior to that event. There is a similar age discrepancy between the two sequences at the end of the interstadial with the onset of the Nahanagan (Younger Dryas) Stadial in Sluggan appearing to predate that in NGRIP by up to 200 yrs. By contrast, there is a very close correspondence between the date on the onset of the Holocene inferred from the pollen record in Sluggan (11.69 ka b2k) and the age of the Pleistocene-Holocene boundary (11.7 ka b2k) in NGRIP. While uncertainties remain over the climatic signals in the later

  15. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin

  16. Stressful Events in Early Childhood and Developmental Trajectories of Bedwetting at School Age

    PubMed Central

    Sullivan, Sarah; von Gontard, Alexander; Heron, Jon

    2016-01-01

    Objective To examine whether early stressful events are associated with developmental trajectories of bedwetting. Methods This is a prospective cohort study comprising 8,761 participants from the Avon Longitudinal Study of Parents and Children. Stressful events were measured using a maternal questionnaire completed at 3 time points before their child was 4 years old. The association between stressful events and trajectories of bedwetting from 4 to 9 years was examined using multinomial regression. Results The association with stressful events was strongest for the frequent persistent bedwetting trajectory (wetting at least twice a week up to age 9). A 1 standard deviation increase in the stressful events score was associated with a 29% (13–47%) increase in the odds of experiencing frequent persistent bedwetting compared with normal attainment of nighttime bladder control. Conclusions Clinicians and parents should be aware that continence is a developmental outcome that is associated with high levels of stress in the family. PMID:27072719

  17. Modulation of in vitro transformation and the early and late modes of DNA replication of uv-irradiation Syrian hamster cells by caffeine

    SciTech Connect

    Doniger, J.; DiPaolo, J.A.

    1981-09-01

    The effect of caffeine on post-uv DNA replication was studied to determine its relevance to carcinogenesis. The level of uv-induced transformed colonies of Syrian hamster embryo cells (HEC) was increased up to fivefold when caffeine was added to cells between 0 and 6 h post-uv. The greatest increase was observed when the interval between uv irradiation and caffeine addition was 4 h. Two modes of DNA replication occurred after uv irradiation. During the early mode (0 to 3 h post-uv) the size of nascent strands, as measured by alkaline sucrose sedimentation, was smaller than those in nonirradiated cells, whereas during the late mode they recovered to normal size. Caffeine inhibited the rate of elongation of nascent strands during the early mode. When caffeine was added immediately after uv irradiation, the conversion of the early mode to the late mode was inhibited. Studies on the effects of caffeine have now been extended to the late mode. While caffeine has little effect with the fd elements beginning from the 10th day after irradiation is connected with their proliferation but not with the migration out from lymphoid organs.

  18. Notch pathway regulates female germ cell meiosis progression and early oogenesis events in fetal mouse.

    PubMed

    Feng, Yan-Min; Liang, Gui-Jin; Pan, Bo; Qin, Xun-Si; Zhang, Xi-Feng; Chen, Chun-Lei; Li, Lan; Cheng, Shun-Feng; De Felici, Massimo; Shen, Wei

    2014-01-01

    A critical process of early oogenesis is the entry of mitotic oogonia into meiosis, a cell cycle switch regulated by a complex gene regulatory network. Although Notch pathway is involved in numerous important aspects of oogenesis in invertebrate species, whether it plays roles in early oogenesis events in mammals is unknown. Therefore, the rationale of the present study was to investigate the roles of Notch signaling in crucial processes of early oogenesis, such as meiosis entry and early oocyte growth. Notch receptors and ligands were localized in mouse embryonic female gonads and 2 Notch inhibitors, namely DAPT and L-685,458, were used to attenuate its signaling in an in vitro culture system of ovarian tissues from 12.5 days post coitum (dpc) fetus. The results demonstrated that the expression of Stra8, a master gene for germ cell meiosis, and its stimulation by retinoic acid (RA) were reduced after suppression of Notch signaling, and the other meiotic genes, Dazl, Dmc1, and Rec8, were abolished or markedly decreased. Furthermore, RNAi of Notch1 also markedly inhibited the expression of Stra8 and SCP3 in cultured female germ cells. The increased methylation status of CpG islands within the Stra8 promoter of the oocytes was observed in the presence of DAPT, indicating that Notch signaling is probably necessary for maintaining the epigenetic state of this gene in a way suitable for RA stimulation. Furthermore, in the presence of Notch inhibitors, progression of oocytes through meiosis I was markedly delayed. At later culture periods, the rate of oocyte growth was decreased, which impaired subsequent primordial follicle assembly in cultured ovarian tissues. Taken together, these results suggested new roles of the Notch signaling pathway in female germ cell meiosis progression and early oogenesis events in mammals.

  19. Arsenic inhibits mast cell degranulation via suppression of early tyrosine phosphorylation events.

    PubMed

    Shim, Juyoung; Kennedy, Rachel H; Weatherly, Lisa M; Hutchinson, Lee M; Pelletier, Jonathan H; Hashmi, Hina N; Blais, Kayla; Velez, Alejandro; Gosse, Julie A

    2016-11-01

    Exposure to arsenic is a global health concern. We previously documented an inhibitory effect of inorganic Arsenite on IgE-mediated degranulation of RBL-2H3 mast cells (Hutchinson et al., 2011; J. Appl. Toxicol. 31: 231-241). Mast cells are tissue-resident cells that are positioned at the host-environment interface, thereby serving vital roles in many physiological processes and disease states, in addition to their well-known roles in allergy and asthma. Upon activation, mast cells secrete several mediators from cytoplasmic granules, in degranulation. The present study is an investigation of Arsenite's molecular target(s) in the degranulation pathway. Here, we report that arsenic does not affect degranulation stimulated by either the Ca(2) (+) ionophore A23187 or thapsigargin, which both bypass early signaling events. Arsenic also does not alter degranulation initiated by another non-IgE-mediated mast cell stimulant, the G-protein activator compound 48/80. However, arsenic inhibits Ca(2) (+) influx into antigen-activated mast cells. These results indicate that the target of arsenic in the degranulation pathway is upstream of the Ca(2) (+) influx. Phospho-Syk and phospho-p85 phosphoinositide 3-kinase enzyme-linked immunosorbent assays data show that arsenic inhibits early phosphorylation events. Taken together, this evidence indicates that the mechanism underlying arsenic inhibition of mast cell degranulation occurs at the early tyrosine phosphorylation steps in the degranulation pathway. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27018130

  20. Evidence of systematic bias in sexual over- and underperception of naturally occurring events: a direct replication of Haselton (2003) in a more gender-equal culture.

    PubMed

    Bendixen, Mons

    2014-11-17

    Error Management Theory (Haselton and Buss, 2000; Haselton and Nettle, 2006) maintains that natural selection has engineered adaptations for judgment under uncertainty to minimize the overall cost of making errors, leading to universal biases in judgments of sexual interest in men and women. This study, using a sample of het erosexual Norwegian students (n = 308), was carried out as a direct replication of Haselton's (2003) original study of naturally occurring events of sexual misperception. The results strongly supported the main hypotheses in the original study, showing that women reported being subject to opposite-sex sexual overperception far more often relative to underperception, and that this difference was small for men. In support of Error Management Theory, and in contrast to Social Role / Structure Theory expectations, the pattern of misperception for women and men was largely invariant across studies and across demographic groups within a culture. The findings suggest that cross-national differences in the level of gender inequality do not influence reports of sexual over- and underperception in women and men. Beyond sex, factors associated with more sexual overperception relative to underperception were being single, young, and having attitudes condoning casual sex.

  1. Early events following experimental infection with Peste-Des-Petits ruminants virus suggest immune cell targeting.

    PubMed

    Pope, Robert A; Parida, Satya; Bailey, Dalan; Brownlie, Joe; Barrett, Thomas; Banyard, Ashley C

    2013-01-01

    Peste-des-petits ruminants virus (PPRV) is a viral pathogen that causes a devastating plague of small ruminants. PPRV is an economically significant disease that continues to be a major obstacle to the development of sustainable agriculture across the developing world. The current understanding of PPRV pathogenesis has been heavily assumed from the closely related rinderpest virus (RPV) and other morbillivirus infections alongside data derived from field outbreaks. There have been few studies reported that have focused on the pathogenesis of PPRV and very little is known about the processes underlying the early stages of infection. In the present study, 15 goats were challenged by the intranasal route with a virulent PPRV isolate, Côte d'Ivoire '89 (CI/89) and sacrificed at strategically defined time-points post infection to enable pre- and post-mortem sampling. This approach enabled precise monitoring of the progress and distribution of virus throughout the infection from the time of challenge, through peak viraemia and into a period of convalescence. Observations were then related to findings of previous field studies and experimental models of PPRV to develop a clinical scoring system for PPRV. Importantly, histopathological investigations demonstrated that the initial site for virus replication is not within the epithelial cells of the respiratory mucosa, as has been previously reported, but is within the tonsillar tissue and lymph nodes draining the site of inoculation. We propose that virus is taken up by immune cells within the respiratory mucosa which then transport virus to lymphoid tissues where primary virus replication occurs, and from where virus enters circulation. Based on these findings we propose a novel clinical scoring methodology for PPRV pathogenesis and suggest a fundamental shift away from the conventional model of PPRV pathogenesis.

  2. Evidence for Early Local Viral Replication and Local Production of Antiviral Immunity upon Mucosal Simian-Human Immunodeficiency Virus SHIV89.6 Infection in Macaca nemestrina

    PubMed Central

    Ambrose, Zandrea; Larsen, Kay; Thompson, Jannelle; Stevens, Yvonne; Finn, Eric; Hu, Shiu-Lok; Bosch, Marnix L.

    2001-01-01

    Transmission of human immunodeficiency virus type 1 (HIV-1) is largely a result of heterosexual exposure, leading many investigators to evaluate mucosal vaccines for protection against intravaginal (i.vag.) transmission in macaque models of AIDS. Relatively little is known, however, about the dynamics of viral replication and the ensuing immune response following mucosal infection. We have utilized a simian-human immunodeficiency virus (SHIV) to study the differences in viremia, CD4 T-cell percentages, and mucosal and systemic anti-SHIV humoral and cellular immune responses during primary infection of animals infected either intravenously (i.v.) or i.vag. Positive viral cocultures, peripheral blood mononuclear cell viral load peaks, and CD4 cell declines were delayed by 1 week in the i.vag. inoculated animals compared to the animals infected i.v., demonstrating delayed viral spreading to the periphery. In contrast, mucosal anti-SHIV antibody levels were greater in magnitude and arose more rapidly and mucosal CD8+ T-cell responses were enhanced in the i.vag. group animals, whereas both the magnitudes and times of onset of systemic immune responses for the animals in the two groups did not differ. These observations demonstrate that compartmentalization of viral replication and induction of local antiviral immunity occur in the genital tract early after i.vag. but not i.v. inoculation. Induction of mucosal immunity to target this local, contained replication should be a goal in HIV vaccine development. PMID:11507204

  3. Preserving the Past: An Early Interview Improves Delayed Event Memory in Children With Intellectual Disabilities

    PubMed Central

    Brown, Deirdre A; Lewis, Charlie N; Lamb, Michael E

    2015-01-01

    The influence of an early interview on children's (N = 194) later recall of an experienced event was examined in children with mild and moderate intellectual disabilities (CWID; 7–12 years) and typically developing (TD) children matched for chronological (7–12 years) or mental (4–9 years) age. Children previously interviewed were more informative, more accurate, and less suggestible. CWID (mild) recalled as much information as TD mental age matches, and were as accurate as TD chronological age matches. CWID (moderate) recalled less than TD mental age matches but were as accurate. Interviewers should elicit CWID's recall as early as possible and consider developmental level and severity of impairments when evaluating eyewitness testimony. PMID:25876042

  4. Association with positive outcome induces early effects in event-related brain potentials.

    PubMed

    Schacht, Annekathrin; Adler, Nele; Chen, Peiyao; Guo, Taomei; Sommer, Werner

    2012-01-01

    Emotional pictures, faces, or words elicit an early posterior negativity (EPN) in the event-related potential, starting around 200-400 ms, followed by a late positive complex (LPC). Occasionally, also very early effects of emotion (VEEEs) are seen prior to 200 ms. The present study examined whether VEEEs can be due to direct links established by reinforcement learning. In the learning session, participants learned to associate previously unknown Chinese words with monetary gain, loss, or neither. In the test session, they were required to distinguish the learned stimuli from novel distracters. Specific to stimuli associated with positive outcome a VEEE, consisting of a posterior positivity, appeared around 150 ms and an LPC between 550 and 700 ms, whereas an EPN was absent. These results show that previous association with reward can induce VEEEs, indicating that emotion effects in ERPs may arise in the absence of biologically preparedness and semantic meaning. PMID:22027086

  5. Early maritime economy and El Nino events at Quebrada Tacahuay, Peru

    USGS Publications Warehouse

    Keefer, D.K.; DeFrance, Susan D.; Moseley, M.E.; Richardson, J. B.; Satterlee, D.R.; Day-Lewis, A.

    1998-01-01

    The archaeological site of Quebrada Tacahuay, Peru, dates to 12,700 to 12,500 calibrated years before the present (10,770 to 10,530 carbon-14 years before the present). It contains some of the oldest evidence of maritime- based economic activity in the New World. Recovered materials include a hearth, lithic cutting tools and flakes, and abundant processed marine fauna, primarily seabirds and fish. Sediments below and above the occupation layer were probably generated by El Nino events, indicating that El Nino was active during the Pleistocene as well as during the early and middle Holocene.

  6. Effects of 60 Hz electromagnetic fields on early growth in three plant species and a replication of previous results

    SciTech Connect

    Davis, M.S.

    1996-05-01

    In an attempt to replicate the findings of Smith et al., seeds of Raphanus sativus L. (radish), Sinapsis alba L. (mustard), and Hordeum vulgare L. (barley) were grown for between 9 and 21 days in continuous electromagnetic fields (EMFs) at ion-cyclotron resonance conditions for stimulation of Ca{sup 2+} (B{sub H} = 78.3 {micro}T, B{sub HAC} = 40 {micro}T peak-peak at 60 Hz, B{sub v} = 0). On harvesting, radish showed results similar to those of Smith et al. Dry stem weight and plant height were both significantly greater (Mann-Whitney tests, Ps < 0.05) in EMF-exposed plants than in control plants in each EMF experiment. Wet root weight was significantly greater in EMF-exposed plants in two out of three experiments, as were dry leaf weight, dry whole weight, and stem diameter. Dry root weight, wet leaf weight, and wet whole weight were significantly greater in EMF-exposed plants in one of three experiments. All significant differences indicated an increase in weight or size in the EMF-exposed plants. In each of the sham experiments, no differences between exposed and control plants were evident. Mustard plants failed to respond to the EMFs in any of the plant parameters measured. In one experiment, barley similarly failed to respond; but in another showed significantly greater wet root weight and significantly smaller stem diameter and dry seed weight at the end of the experiment in exposed plants compared to control plants. Although these results give no clue about the underlying bioelectromagnetic mechanism, they demonstrate that, at least for one EMF-sensitive biosystem, results can be independently replicated in another laboratory. Such replication is crucial in establishing the validity of bioelectromagnetic science.

  7. Early arrival of Southern Source Water in the deep North Atlantic prior to Heinrich event 2

    NASA Astrophysics Data System (ADS)

    Gutjahr, Marcus; Lippold, JöRg

    2011-06-01

    The Atlantic Meridional Overturning Circulation (AMOC) plays an important role in the Northern Hemisphere climate system. Significant interest went into the question of how excessive freshwater input through melting of continental ice can affect its overturning vigor and, hence, heat supply, to higher northern latitudes. Such forcing can be tested by investigating its behavior during extreme iceberg discharge events into the open North Atlantic during the last glacial period, the so-called Heinrich events (HE). Here we present neodymium (Nd) isotope compositions of past seawater, a sensitive chemical water mass tag, extracted from sediments of Ocean Drilling Program Site 1063 in the western North Atlantic (Bermuda Rise), covering the period surrounding HE 2, the Last Glacial Maximum, and the early deglaciation. These data are compared with a record of the kinematic circulation tracer (231Pa/230Th)xs extracted from the same sediment core. Both tracers indicate significant circulation changes preceding intense ice rafting during HE 2 by almost 2 kyr. Moreover, the Nd isotope record suggests the presence of deeply ventilating North Atlantic Deep Water early during Marine Isotope Stage 2 until it was replaced by Southern Source Water at ˜27 ka. The early switch to high (Pa/Th)xs and radiogenic ɛNd in relation to intensified ice rafting during HE 2 suggests that ice rafting into the open North Atlantic during major HE 2 was preceded by an early change of the AMOC. This opens the possibility that variations in AMOC contributed to or even triggered the ice sheet instability rather than merely responding to it.

  8. Early Cretaceous High Arctic Magmatism and the Oceanic Anoxic Event 1a

    NASA Astrophysics Data System (ADS)

    Planke, Sverre; Polteau, Stephane; Faleide, Jan Inge; Svensen, Henrik; Myklebust, Reidun; Midtkandal, Ivar; Corfu, Fernando

    2014-05-01

    The High Arctic Large Igneous Province (HALIP) comprises Early and Late Cretaceous igneous deposits extending from the Canadian Arctic Archipelago in the west to the east Siberian Island in the east. It also includes anomalously thick igneous crust in the Canada Basin. We have mapped out the distribution of HALIP volcanic extrusive and intrusive rocks in the Barents Sea based on field work and borehole data in Svalbard and extensive geophysical data in the offshore areas. The volcanic extrusive and intrusive rocks in the Barents Sea Large Igneous Province (BLIP) are present in a 700 000 km2 large region extending across the northern and eastern Barents Sea. The igneous complex is dominated by a large sill complex intruded into organic-rich Jurassic to Permian age sequences in the East Barents Basin, on Svalbard and on Franz Josef Land. Geochemical data suggest that the tholeiitic igneous rocks were likely formed during a short-lived melting event. New geochronology data (U/Pb on zircons) suggest that the igneous event occurred in the Early Aptian or Barremian. Marine and terrestrial Cretaceous shales and sandstones of the Carolinefjellet, Helvetiafjellet, and Rurikfjellet formations have recently been cored in four boreholes on Svalbard (the Longyearbyen CO2 Laboratory). We have completed a comprehensive analytical program of samples from the boreholes, including geochronology (Ar/Ar and zircon U/Pb), biostratigraphy (palynology), and geochemistry (ICP-MS, RockEval, TOC). In the boreholes, the Barremian-early Aptian Helvetiafjellet Formation is overlaid by early Aptian sapropel-rich shales of the Carolinefjellet Formation. Carbon isotope data reveal a negative excursion in this anoxic interval, most likely representing the Oceanic Anoxic Event 1a (OAE1a). The geochronology data suggest that the intrusive BLIP volcanism occurred at the tim e of the early Aptian OAE1a. We propose that the link between the BLIP and the OAE1a is a massive release of thermogenic methane

  9. Compartmentalization of prokaryotic DNA replication.

    PubMed

    Bravo, Alicia; Serrano-Heras, Gemma; Salas, Margarita

    2005-01-01

    It becomes now apparent that prokaryotic DNA replication takes place at specific intracellular locations. Early studies indicated that chromosomal DNA replication, as well as plasmid and viral DNA replication, occurs in close association with the bacterial membrane. Moreover, over the last several years, it has been shown that some replication proteins and specific DNA sequences are localized to particular subcellular regions in bacteria, supporting the existence of replication compartments. Although the mechanisms underlying compartmentalization of prokaryotic DNA replication are largely unknown, the docking of replication factors to large organizing structures may be important for the assembly of active replication complexes. In this article, we review the current state of this subject in two bacterial species, Escherichia coli and Bacillus subtilis, focusing our attention in both chromosomal and extrachromosomal DNA replication. A comparison with eukaryotic systems is also presented.

  10. Early viral replication and induced or constitutive immunity in rainbow trout families with differential resistance to Infectious hematopoietic necrosis virus (IHNV)

    USGS Publications Warehouse

    Purcell, M.K.; LaPatra, S.E.; Woodson, J.C.; Kurath, G.; Winton, J.R.

    2010-01-01

    The main objective of this study was to assess correlates of innate resistance in rainbow trout full-sibling families that differ in susceptibility to Infectious hematopoietic necrosis virus (IHNV). As part of a commercial breeding program, full-sibling families were challenged with IHNV by waterborne exposure at the 1 g size to determine susceptibility to IHNV. Progeny from select families (N = 7 families) that varied in susceptibility (ranging from 32 to 90% cumulative percent mortality (CPM)) were challenged again at the 10 g size by intra-peritoneal injection and overall mortality, early viral replication and immune responses were evaluated. Mortality challenges included 20–40 fish per family while viral replication and immune response studies included 6 fish per family at each time point (24, 48 and 72 h post-infection (hpi)). CPM at the 1 g size was significantly correlated with CPM at the 10 g size, indicating that inherent resistance was a stable trait irrespective of size. In the larger fish, viral load was measured by quantitative reverse-transcriptase PCR in the anterior kidney and was a significant predictor of family disease outcome at 48 hpi. Type I interferon (IFN) transcript levels were significantly correlated with an individual's viral load at 48 and 72 hpi, while type II IFN gene expression was significantly correlated with an individual's viral load at 24 and 48 hpi. Mean family type I but not type II IFN gene expression was weakly associated with susceptibility at 72 hpi. There was no association between mean family susceptibility and the constitutive expression of a range of innate immune genes (e.g. type I and II IFN pathway genes, cytokine and viral recognition receptor genes). The majority of survivors from the challenge had detectable serum neutralizing antibody titers but no trend was observed among families. This result suggests that even the most resistant families experienced sufficient levels of viral replication to trigger specific

  11. Environmental controls on marine ecosystems during the early Toarcian extinction event

    NASA Astrophysics Data System (ADS)

    Danise, Silvia; Twitchett, Richard J.

    2015-04-01

    The fossil record has the potential to provide valuable insights into species response to past climate change if paleontological data are combined with appropriate proxies of environmental change. In the early Toarcian (Early Jurassic, ˜183Ma ago) rapid warming coincided with a main perturbation in the carbon cycle, seal level rise, widespread deposition of organic-rich, black shales under anoxic conditions, increased weathering rates and a biotic crisis in the marine realm, with the extinction of approximately 5% of families and 26% of genera. Because of this complex suite of inter-linked environmental and oceanographic changes, a key challenge is to determine which of these were most influential in controlling specific aspects of extinction and ecological collapse. In this study we combine high resolution palaeontological and palaeoenvironmental data from the coastal sections of the Whitby Mudstone Formation in North Yorkshire, UK, to reconstruct how climate changes controlled the structure of benthic and nektonic communities through the event, over a time period of ˜1.7 Ma. We show that benthic and nektonic ecosystems became decoupled and were driven by different environmental variables. Although rapid warming has been invoked as the main trigger of this event, the palaeotemperature proxy was a poor predictor of marine community dynamics, and abiotic factors indirectly linked to temperature, such as change in seawater dissolved oxygen concentration and nutrient inputs, were more important.

  12. The early Toarcian anoxic event: what the beginning and the end of the story are?

    NASA Astrophysics Data System (ADS)

    Mattioli, Emanuela; Plancq, Julien; Raucsik, Béla

    2010-05-01

    The early Toarcian anoxic event: what the beginning and the end of the story are? E. Mattioli (1), J. Plancq (1), and B. Rauksik (2) (1) UMR 5125 PEPS, CNRS, France; Université Lyon 1, Campus de la DOUA, Bâtiment Géode, 69622 Villeurbanne Cedex, France (emanuela.mattioli@univ-lyon1.fr) (2) Department of Earth and Environmental Sciences, University of Pannonia, Veszprém, Hungary The early Toarcian anoxic event (T-OAE) and the associated biotic crisis have received much attention in the last decade. However, the events forewarning the crisis as well as its aftermath are still poorly known. The T-OAE coincides with a prominent carbon isotope negative excursion (T-CIE) that is preceded by an excursion of similar intensity at the Pliensbachian-Toarcian boundary (Hesselbo et al., 2007). The onset of T-CIE occurred some 700 kyr later than the end of the Boundary-CIE (Suan et al., 2008a). This succession of events demonstrates that the T-OAE was a complex suite of environmental perturbations. In this work, we focused on calcareous nannofossil assemblages occurring in the Peniche section (Portugal) during the Boundary-CIE with the aim to understand if calcifying plankton reacted in a similar/different way to the two CIEs. Also, two sections and one borehole located along a W-E transect, along the NW-Tethyan shelf (in the Yorkshire coast, in the E Paris Basin, and in Mecsek Basin, respectively), were investigated to assess which way calcareous nannoplankton recovered after the crisis, and if the recovery was a synchronous event. The production by nannoplankton collapsed during the T-CIE, as demonstrated by the lowest absolute abundance of nannofossils measured in Peniche and other studied sites (Mattioli et al., 2008). Besides this nannofossil abundance decrease, also the size of the incertae sedis Schizosphaerella test was drastically reduced (Suan et al., 2008b). If a similar size decrease is also recorded during the Boundary-CIE, calcareous nannofossil abundances are

  13. Events during Early Triassic recovery from the end-Permian extinction

    NASA Astrophysics Data System (ADS)

    Tong, Jinnan; Zhang, Suxin; Zuo, Jingxun; Xiong, Xinqi

    2007-01-01

    The Palaeozoic-Mesozoic transition is characterized not only by the biggest Phanerozoic mass extinction, at the end of Permian, but also a prolonged period of recovery of the biota during the succeeding Early Triassic. The delayed recovery is generally attributed to the effects of extreme environmental conditions on the Early Triassic ecosystem. However, there has been very little study of the cause and mechanism of the environmental conditions that prevailed during the period of extinction and subsequent recovery. Research on the Permian-Triassic boundary and Lower Triassic, especially that on environmental events at the beginning of the Triassic in South China, indicates that the slowness of the recovery may be the result of three factors: (1) extreme environmental conditions that persisted through the transitional period and which were maintained by, for example, intermittent contemporary volcanism; (2) a passive evolutionary and ecologic strategy of the biota, in which r-selection taxa were dominant and K-selection forms insignificant; (3) an immature, poorly functioning ecosystem, which had difficulty in responding to and withstanding extreme environmental changes. According to data from South China, environmental changes were frequent during the Late Permian, and especially serious at the Permian-Triassic boundary. The Late Permian ecosystem was well structured and fully functioning as a result of a long period of steady development during the late Palaeozoic, and was capable of resisting general environmental changes. However, increasingly frequent and probably more extreme environmental events in the latest Permian may have led to a general collapse of this ecosystem and to the mass extinction at the end of the Permian. The Early Triassic ecosystem was immature, functioned poorly, and was unable to respond effectively to environmental changes, so that persisting extreme environmental conditions slowed ecosystem reconstruction considerably, and the recovery

  14. Increased Axonal Ribosome Numbers Is an Early Event in the Pathogenesis of Amyotrophic Lateral Sclerosis

    PubMed Central

    Verheijen, Mark H. G.; Peviani, Marco; Hendricusdottir, Rita; Bell, Erin M.; Lammens, Martin; Smit, August B.; Bendotti, Caterina; van Minnen, Jan

    2014-01-01

    Myelinating glia cells support axon survival and functions through mechanisms independent of myelination, and their dysfunction leads to axonal degeneration in several diseases. In amyotrophic lateral sclerosis (ALS), spinal motor neurons undergo retrograde degeneration, and slowing of axonal transport is an early event that in ALS mutant mice occurs well before motor neuron degeneration. Interestingly, in familial forms of ALS, Schwann cells have been proposed to slow disease progression. We demonstrated previously that Schwann cells transfer polyribosomes to diseased and regenerating axons, a possible rescue mechanism for disease-induced reductions in axonal proteins. Here, we investigated whether elevated levels of axonal ribosomes are also found in ALS, by analysis of a superoxide dismutase 1 (SOD1)G93A mouse model for human familial ALS and a patient suffering from sporadic ALS. In both cases, we found that the disorder was associated with an increase in the population of axonal ribosomes in myelinated axons. Importantly, in SOD1G93A mice, the appearance of axonal ribosomes preceded the manifestation of behavioral symptoms, indicating that upregulation of axonal ribosomes occurs early in the pathogenesis of ALS. In line with our previous studies, electron microscopy analysis showed that Schwann cells might serve as a source of axonal ribosomes in the disease-compromised axons. The early appearance of axonal ribosomes indicates an involvement of Schwann cells early in ALS neuropathology, and may serve as an early marker for disease-affected axons, not only in ALS, but also for other central and peripheral neurodegenerative disorders. PMID:24498056

  15. Temporal sequence and spatial distribution of early events of fertilization in single sea urchin eggs

    SciTech Connect

    Eisen, A.; Kiehart, D.P.; Wieland, S.J.; Reynolds, G.T.

    1984-11-01

    Measurements and observations of five early events of fertilization, singly and in pairs, from single sea urchin eggs have revealed the precise temporal sequence and spatial distribution of these events. In the Arbacia punctulata egg, a wave of surface contraction occurs coincident with membrane depolarization (t = 0). These two earliest events are followed by the onset of a rapid, propagated increase in cytoplasmic-free calcium at approx.23 s as measured by calcium-aequorin luminescence. The luminescence reaches its peak value by 40 s after the membrane depolarization. The luminescence remains uniformly elevated for some time before its decay over several minutes. The onset of an increase in the pyridin nucleotide (NAD(P)H) fluorescence follows the membrane depolarization at approx.51 s. The fertilization membrane begins its elevation in a wave-like fashion coincidentally with the increase in NAD(P)H fluorescence. Similar results are observed in the Lytechinus variegatus egg. The results suggest that while the increase in cytoplasmic-free calcium may be important for many changes occurring in the egg, the elevated-free calcium is not directly responsible for the propagated wave of cortical granule exocytosis. 32 references, 10 figures.

  16. A lacustrine record of early Holocene watershed events and vegetation history, Corvara in Badia, Dolomites (Italy)

    NASA Astrophysics Data System (ADS)

    Borgatti, Lisa; Ravazzi, Cesare; Donegana, Marta; Corsini, Alessandro; Marchetti, Mauro; Soldati, Mauro

    2007-02-01

    The early-middle Holocene lacustrine succession of Corvara in Badia (Italian Dolomites, 1521 m a.s.l.) records landslides and other watershed events before the onset of human pressure. The sensitivity of this archive to relate climate change, watershed processes and vegetation dynamics in the catchment has been explored through a stratigraphic study, including the analysis of sedimentological features, magnetic properties, palaeobotanical records and radiocarbon dating. A palaeolake existed between 10.1 k and 7 k cal. yr BP and was surrounded by a dense conifer forest. Long-term forest dynamics driven by ecological processes and by climatic conditions favourable to upward forest expansion is recorded throughout the pollen record. Within the fine clastic sedimentation, distinct layers enriched in organic debris of terrestrial origin have been attributed to instant events produced by mass movements. Their age fits the chronology of large landslide events already known in the catchment, enabling correlation of the field evidence of landslides with the lacustrine record. Landslide frequency is controlled by geological and structural factors, but it is significantly modulated by the centennial-millennial climatic phases that characterise the Holocene in the Alps. The taphonomical properties of pollen and macroremains provided valuable insight on the mechanism of watershed processes. Copyright

  17. Irregularities in Early Seismic Rupture Propagation for Large Events in a Crustal Earthquake Model

    NASA Astrophysics Data System (ADS)

    Lapusta, N.; Rice, J. R.; Rice, J. R.

    2001-12-01

    We study early seismic propagation of model earthquakes in a 2-D model of a vertical strike-slip fault with depth-variable rate and state friction properties. Our model earthquakes are obtained in fully dynamic simulations of sequences of instabilities on a fault subjected to realistically slow tectonic loading (Lapusta et al., JGR, 2000). This work is motivated by results of Ellsworth and Beroza (Science, 1995), who observe that for many earthquakes, far-field velocity seismograms during initial stages of dynamic rupture propagation have irregular fluctuations which constitute a "seismic nucleation phase". In our simulations, we find that such irregularities in velocity seismograms can be caused by two factors: (1) rupture propagation over regions of stress concentrations and (2) partial arrest of rupture in neighboring creeping regions. As rupture approaches a region of stress concentration, it sees increasing background stress and its moment acceleration (to which velocity seismographs in the far field are proportional) increases. After the peak in stress concentration, the rupture sees decreasing background stress and moment acceleration decreases. Hence a fluctuation in moment acceleration is created. If rupture starts sufficiently far from a creeping region, then partial arrest of rupture in the creeping region causes a decrease in moment acceleration. As the other parts of rupture continue to develop, moment acceleration then starts to grow again, and a fluctuation again results. Other factors may cause the irregularities in moment acceleration, e.g., phenomena such as branching and/or intermittent rupture propagation (Poliakov et al., submitted to JGR, 2001) which we have not studied here. Regions of stress concentration are created in our model by arrest of previous smaller events as well as by interactions with creeping regions. One such region is deep in the fault zone, and is caused by the temperature-induced transition from seismogenic to creeping

  18. Dose and Effect Thresholds for Early Key Events in a PPARα-Mediated Mode of Action.

    PubMed

    Lake, April D; Wood, Charles E; Bhat, Virunya S; Chorley, Brian N; Carswell, Gleta K; Sey, Yusupha M; Kenyon, Elaina M; Padnos, Beth; Moore, Tanya M; Tennant, Alan H; Schmid, Judith E; George, Barbara Jane; Ross, David G; Hughes, Michael F; Corton, J Christopher; Simmons, Jane Ellen; McQueen, Charlene A; Hester, Susan D

    2016-02-01

    Current strategies for predicting adverse health outcomes of environmental chemicals are centered on early key events in toxicity pathways. However, quantitative relationships between early molecular changes in a given pathway and later health effects are often poorly defined. The goal of this study was to evaluate short-term key event indicators using qualitative and quantitative methods in an established pathway of mouse liver tumorigenesis mediated by peroxisome proliferator-activated receptor alpha (PPARα). Male B6C3F1 mice were exposed for 7 days to di (2-ethylhexyl) phthalate (DEHP), di-n-octyl phthalate (DNOP), and n-butyl benzyl phthalate (BBP), which vary in PPARα activity and liver tumorigenicity. Each phthalate increased expression of select PPARα target genes at 7 days, while only DEHP significantly increased liver cell proliferation labeling index (LI). Transcriptional benchmark dose (BMDT) estimates for dose-related genomic markers stratified phthalates according to hypothetical tumorigenic potencies, unlike BMDs for non-genomic endpoints (relative liver weights or proliferation). The 7-day BMDT values for Acot1 as a surrogate measure for PPARα activation were 29, 370, and 676 mg/kg/day for DEHP, DNOP, and BBP, respectively, distinguishing DEHP (liver tumor BMD of 35 mg/kg/day) from non-tumorigenic DNOP and BBP. Effect thresholds were generated using linear regression of DEHP effects at 7 days and 2-year tumor incidence values to anchor early response molecular indicators and a later phenotypic outcome. Thresholds varied widely by marker, from 2-fold (Pdk4 and proliferation LI) to 30-fold (Acot1) induction to reach hypothetical tumorigenic expression levels. These findings highlight key issues in defining thresholds for biological adversity based on molecular changes. PMID:26519955

  19. Early events of citrus greening (Huanglongbing) disease development at the ultrastructural level.

    PubMed

    Folimonova, Svetlana Y; Achor, Diann S

    2010-09-01

    Citrus greening (Huanglongbing [HLB]) is one of the most destructive diseases of citrus worldwide. The causal agent of HLB in Florida is thought to be 'Candidatus Liberibacter asiaticus'. Understanding of the early events in HLB infection is critical for the development of effective measures to control the disease. In this work, we conducted cytopathological studies by following the development of the disease in citrus trees graft inoculated with 'Ca. L. asiaticus'-containing material under greenhouse conditions to examine the correlation between ultrastructural changes and symptom production, with the main objective of characterizing the early events of infection. Based on our observations, one of the first degenerative changes induced upon invasion of the pathogen appears to be swelling of middle lamella between cell walls surrounding sieve elements. This anatomical aberration was often observed in samples from newly growing flushes in inoculated sweet orange and grapefruit trees at the early "presymptomatic" stage of HLB infection. Development of symptoms and their progression correlated with an increasing degree of microscopic aberrations. Remarkably, the ability to observe the bacterium in the infected tissue also correlated with the degree of the disease progression. Large numbers of bacterial cells were found in phloem sieve tubes in tissue samples from presymptomatic young flushes. In contrast, we did not observe the bacteria in highly symptomatic leaf samples, suggesting a possibility that, at more advanced stages of the disease, a major proportion of 'Ca. L. asiaticus' is present in a nonviable state. We trust that observations reported here advance our understanding of how 'Ca. L. asiaticus' causes disease. Furthermore, they may be an important aid in answering a question: when and where within an infected tree the tissue serves as a better inoculum source for acquisition and transmission of the bacterium by its psyllid vector.

  20. Universal Sequence Replication, Reversible Polymerization and Early Functional Biopolymers: A Model for the Initiation of Prebiotic Sequence Evolution

    PubMed Central

    Walker, Sara Imari; Grover, Martha A.; Hud, Nicholas V.

    2012-01-01

    Many models for the origin of life have focused on understanding how evolution can drive the refinement of a preexisting enzyme, such as the evolution of efficient replicase activity. Here we present a model for what was, arguably, an even earlier stage of chemical evolution, when polymer sequence diversity was generated and sustained before, and during, the onset of functional selection. The model includes regular environmental cycles (e.g. hydration-dehydration cycles) that drive polymers between times of replication and functional activity, which coincide with times of different monomer and polymer diffusivity. Template-directed replication of informational polymers, which takes place during the dehydration stage of each cycle, is considered to be sequence-independent. New sequences are generated by spontaneous polymer formation, and all sequences compete for a finite monomer resource that is recycled via reversible polymerization. Kinetic Monte Carlo simulations demonstrate that this proposed prebiotic scenario provides a robust mechanism for the exploration of sequence space. Introduction of a polymer sequence with monomer synthetase activity illustrates that functional sequences can become established in a preexisting pool of otherwise non-functional sequences. Functional selection does not dominate system dynamics and sequence diversity remains high, permitting the emergence and spread of more than one functional sequence. It is also observed that polymers spontaneously form clusters in simulations where polymers diffuse more slowly than monomers, a feature that is reminiscent of a previous proposal that the earliest stages of life could have been defined by the collective evolution of a system-wide cooperation of polymer aggregates. Overall, the results presented demonstrate the merits of considering plausible prebiotic polymer chemistries and environments that would have allowed for the rapid turnover of monomer resources and for regularly varying monomer

  1. Does Silent Reading Speed in Normal Adult Readers Depend on Early Visual Processes? Evidence from Event-Related Brain Potentials

    ERIC Educational Resources Information Center

    Korinth, Sebastian Peter; Sommer, Werner; Breznitz, Zvia

    2012-01-01

    Little is known about the relationship of reading speed and early visual processes in normal readers. Here we examined the association of the early P1, N170 and late N1 component in visual event-related potentials (ERPs) with silent reading speed and a number of additional cognitive skills in a sample of 52 adult German readers utilizing a Lexical…

  2. Early events of human T lymphocyte activation are associated with type I protein kinase A activity.

    PubMed Central

    Laxminarayana, D; Berrada, A; Kammer, G M

    1993-01-01

    Human T lymphocytes possess both the type I and II isozymes of protein kinase A (PKA). The type I (PKA-I) isozyme is predominantly associated with the plasma membrane, whereas the type II (PKA-II) isozyme is primarily localized to the cytosol. Because the functions of both PKA-I and PKA-II isozymes in the biochemical events of T lymphocyte activation have not been clearly elucidated, we tested the hypothesis that very early events of normal human T lymphocyte activation are mediated by the PKA-I and/or PKA-II isozyme(s). Fresh normal human T cells and a normal human CD4+ T cell line (GK606) activated with anti-CD3-epsilon and recombinant interleukin 1 alpha (rIL-1 alpha) exhibited a peak six- to sevenfold increase of PKA phosphotransferase activity at 5 min that returned to baseline by 60 min. Similarly, both fresh T cells and the T cell line activated by phorbol myristate acetate and ionomycin demonstrated a peak eightfold increase of PKA activity by 15 min that returned toward baseline by 60 min. Chromatographic separation of the PKA isozymes and quantification of phosphotransferase activities after T cell activation by either agonist pair showed preferential activation of the PKA-I isozyme, resulting in a significant reduction in the ratio of PKA-I to PKA-II isozyme activity from 3.1:1-6.2:1 to 1.1:1-3.2:1. PKA-I isozyme activation resulted in the release of free catalytic (C) subunit, an increase in C subunit phosphotransferase activity, and the phosphorylation of T cell plasma membrane-associated proteins, p14, p17, p20, p21, p38, and p48. However, activation of the PKA-I isozyme did not appear to be required for the transcription of IL-2 mRNA, an event necessary for mitosis. These data indicate that ligand-induced T cell activation is associated with rapid activation of the PKA-I, but not PKA-II, isozyme that results in phosphorylation of plasma membrane-associated proteins. The involvement of the PKA-I isozyme during the very early events of T cell

  3. Early somatosensory event-related potentials reveal attentional bias for internal stimuli in social anxiety.

    PubMed

    Kanai, Yoshihiro; Nittono, Hiroshi; Kubo, Kenta; Sasaki-Aoki, Shoko; Iwanaga, Makoto

    2012-03-01

    The present study used event-related brain potentials (ERPs) to investigate allocation of attentional resources to internal and external stimuli in individuals with social anxiety. High and low socially anxious individuals were presented with depictions of various facial expressions or household objects, followed by an internal (vibration presented to the finger) or external probe (the letter "E"). Participants were told that the vibration signals physiological changes and were asked to detect both probes. High socially anxious individuals showed larger front-central N140 amplitudes in response to vibratory internal probes as compared to non-anxious controls. ERPs elicited by picture stimuli and external probes and reaction times in response to both probe types did not differ between high and low social anxiety individuals. Early somatosensory ERPs reveal an attentional bias for internal stimuli that does not appear in overt behavior. PMID:22285128

  4. Reliability of demographic and socioeconomic variables in predicting early initiation of breastfeeding: a replication analysis using the Kenya Demographic and Health Survey data

    PubMed Central

    Matanda, Dennis J; Mittelmark, Maurice B; Urke, Helga B; Amugsi, Dickson A

    2014-01-01

    Objectives Examine the reliability of sociodemographic variables in predicting initiation of breastfeeding within an hour of birth (EarlyBF), using data from 1998, 2003 and 2008–2009. Study design A replication analysis using the Kenya Demographic and Health Survey (KDHS) data collected in 1998, 2003 and 2008–2009. The candidate predictor variables were child's gender, home or health facility place of birth, vaginal or caesarean mode of birth, urban or rural setting, province of residence, Wealth Index and maternal education, occupation, literacy and media exposure. Setting Kenya. Participants 6375 dyads of mothers aged 15–49 and their children aged 0–23 months (2125 dyads in each of the survey years). Results Mode of birth and province were statistically significant predictors of EarlyBF in 1998, 2003 and 2008–2009. Children delivered through caesarean section were non-EarlyBF in 1998 (OR 2.63, 95% CI 1.72 to 4.04), 2003 (OR 3.36, 95% CI 1.83 to 6.16) and 2008 (OR 3.51, 95% CI 2.17 to 5.69). The same was true of those living in the Western province in 1998 (OR 2.67, 95% CI 1.61 to 4.43), 2003 (OR 4.92, 95% CI 3.01 to 8.04) and 2008 (OR 6.07, 95% CI 3.54 to 10.39). Conclusions The 1998 KDHS data do not provide the basis for reliable prediction of EarlyBF, with reliability conceptualised as replicability of findings using highly similar data sets from 2003 and 2008–2009. Most of the demographic and socioeconomic variables were unreliable predictors of EarlyBF. We speculate that activities in parts or all of Kenya changed the analysis context in the period between 1998 and 2008–2009, and these changes were of a sufficient magnitude to affect the relationships under investigation. The degree to which this is a general problem in child health research is not known, calling for further research to investigate this methodological issue with other health end points and other data. PMID:24939811

  5. Predicting adverse obstetric outcome after early pregnancy events and complications: a review.

    PubMed

    van Oppenraaij, R H F; Jauniaux, E; Christiansen, O B; Horcajadas, J A; Farquharson, R G; Exalto, N

    2009-01-01

    BACKGROUND The aim was to evaluate the impact of early pregnancy events and complications as predictors of adverse obstetric outcome. METHODS We conducted a literature review on the impact of first trimester complications in previous and index pregnancies using Medline and Cochrane databases covering the period 1980-2008. RESULTS Clinically relevant associations of adverse outcome in the subsequent pregnancy with an odds ratio (OR) > 2.0 after complications in a previous pregnancy are the risk of perinatal death after a single previous miscarriage, the risk of very preterm delivery (VPTD) after two or more miscarriages, the risk of placenta praevia, premature preterm rupture of membranes, VPTD and low birthweight (LBW) after recurrent miscarriage and the risk of VPTD after two or more termination of pregnancy. Clinically relevant associations of adverse obstetric outcome in the ongoing pregnancy with an OR > 2.0 after complications in the index pregnancy are the risk of LBW and very low birthweight (VLBW) after a threatened miscarriage, the risk of pregnancy-induced hypertension, pre-eclampsia, placental abruption, preterm delivery (PTD), small for gestational age and low 5-min Apgar score after detection of an intrauterine haematoma, the risk of VPTD and intrauterine growth restriction after a crown-rump length discrepancy, the risk of VPTD, LBW and VLBW after a vanishing twin phenomenon and the risk of PTD, LBW and low 5-min Apgar score in a pregnancy complicated by severe hyperemesis gravidarum. CONCLUSIONS Data from our literature review indicate, by finding significant associations, that specific early pregnancy events and complications are predictors for subsequent adverse obstetric and perinatal outcome. Though, some of these associations are based on limited or small uncontrolled studies. Larger population-based controlled studies are needed to confirm these findings. Nevertheless, identification of these risks will improve obstetric care. PMID:19270317

  6. The lncRNA NRON modulates HIV-1 replication in a NFAT-dependent manner and is differentially regulated by early and late viral proteins.

    PubMed

    Imam, Hasan; Bano, Aalia Shahr; Patel, Paresh; Holla, Prasida; Jameel, Shahid

    2015-03-02

    A majority of the human genome is transcribed into noncoding RNAs, of which the functions of long noncoding RNAs (lncRNAs) are poorly understood. Many host proteins and RNAs have been characterized for their roles in HIV/AIDS pathogenesis, but there is only one lncRNA, NEAT1, which is shown to affect the HIV-1 life cycle. We profiled 90 disease-related lncRNAs and found NRON (noncoding repressor of Nuclear Factor of Activated T cells [NFAT]) to be one of several lncRNAs whose expression was significantly altered following HIV-1 infection. The regulation of NRON expression during the HIV-1 life cycle was complex; its levels were reduced by the early viral accessory protein Nef and increased by the late protein Vpu. Consequently, Nef and Vpu also modulated activity of the transcription factor NFAT. The knockdown of NRON enhanced HIV-1 replication through increased activity of NFAT and the viral LTR. Using siRNA-mediated NFAT knockdown, we show the effects of NRON on HIV-1 replication to be mediated by NFAT, and the viral Nef and Vpu proteins to modulate NFAT activity through their effects on NRON. These findings add the lncRNA, NRON to the vast repertoire of host factors utilized by HIV for infection and persistence.

  7. Early Intervention with a Parent-Delivered Massage Protocol Directed at Tactile Abnormalities Decreases Severity of Autism and Improves Child-to-Parent Interactions: A Replication Study

    PubMed Central

    Silva, Louisa M. T.; Gabrielsen, Kristen R.; Budden, Sarojini S.; Buenrostro, Martha; Horton, Gretchen

    2015-01-01

    Tactile abnormalities are severe and universal in preschool children with autism. They respond well to treatment with a daily massage protocol directed at tactile abnormalities (QST massage for autism). Treatment is based on a model for autism proposing that tactile impairment poses a barrier to development. Two previous randomized controlled trials evaluating five months of massage treatment reported improvement of behavior, social/communication skills, and tactile and other sensory symptoms. This is the first report from a two-year replication study evaluating the protocol in 103 preschool children with autism. Parents gave daily treatment; trained staff gave weekly treatment and parent support. Five-month outcomes replicated earlier studies and showed normalization of receptive language (18%, P = .03), autistic behavior (32%, P = .006), total sensory abnormalities (38%, P = .0000005), tactile abnormalities (49%, P = .0002), and decreased autism severity (medium to large effect size, P = .008). In addition, parents reported improved child-to-parent interactions, bonding, and decreased parenting stress (44%, P = .00008). Early childhood special education programs are tasked with addressing sensory abnormalities and engaging parents in effective home programs. Until now, they have lacked research-based methods to do so. This program fulfills the need. It is recommended to parents and ECSE programs (ages 3–5) at autism diagnosis. PMID:25878901

  8. Reflections on some early events related to behavior analysis of child development.

    PubMed

    Bijou, S W

    1996-01-01

    A series of events related to the early application of behavioral principles to child behavior and development is described. The events began in the 1930s at Columbia University with a solicited letter from John B. Watson suggesting a master's degree thesis problem, and continued through the 1950s and 1960s at the University of Washington. Specifically, these happenings resulted in (a) research demonstrating that Skinner's laboratory method for studying nonhuman organisms could be profitably applied to the laboratory study of young normal children; (b) a demonstration that by successive approximations, a normal child can be operantly conditioned to respond to an arbitrary situation; (c) research showing that the effects of simple schedules of reinforcement obtained with nonhuman organisms could be duplicated in young normal and retarded children; (d) the demonstration that Skinner's operant laboratory method could be adapted to study young children in field situations; (e) research showing that operant principles can be successfully applied to the treatment of a young autistic boy with a serious visual handicap; (f) laboratory studies showing that mothers can be trained to treat their own young children who have behavior problems; (g) an in-home study demonstrating that a mother can treat her own child who has behavior problems; (h) a demonstration that operant principles can be applied effectively to teaching reading, writing, and arithmetic to children with retardation; and (i) publication of a book, Child Development: A Systematic and Empirical Theory, in collaboration with Donald M. Baer, by Prentice Hall in their Century Psychological Series.

  9. New Early Jurassic Tetrapod Assemblages Constrain Triassic-Jurassic Tetrapod Extinction Event

    NASA Astrophysics Data System (ADS)

    Olsen, P. E.; Shubin, N. H.; Anders, M. H.

    1987-08-01

    The discovery of the first definitively correlated earliest Jurassic (200 million years before present) tetrapod assemblage (Fundy basin, Newark Supergroup, Nova Scotia) allows reevaluation of the duration of the Triassic-Jurassic tetrapod extinction event. Present are tritheledont and mammal-like reptiles, prosauropod, theropod, and ornithischian dinosaurs, protosuchian and sphenosuchian crocodylomorphs, sphenodontids, and hybodont, semionotid, and palaeonisciform fishes. All of the families are known from Late Triassic and Jurassic strata from elsewhere; however, pollen and spore, radiometric, and geochemical correlation indicate an early Hettangian age for these assemblages. Because all ``typical Triassic'' forms are absent from these assemblages, most Triassic-Jurassic tetrapod extinctions occurred before this time and without the introduction of new families. As was previously suggested by studies of marine invertebrates, this pattern is consistent with a global extinction event at the Triassic-Jurassic boundary. The Manicouagan impact structure of Quebec provides dates broadly compatible with the Triassic-Jurassic boundary and, following the impact theory of mass extinctions, may be implicated in the cause.

  10. Constraints on early events in Martian history as derived from the cratering record

    SciTech Connect

    Barlow, N.G. )

    1990-08-30

    The shapes and densities of crater size-frequency distribution curves are used to constrain two major events early in Martian history: termination of high obliteration rates and viability of the multiple impact origin of the crustal dichotomy. Distribution curves of fresh craters superposed on uplands, intercrater plains, and ridged plains display shapes and densities indicative of formation prior to the end of heavy bombardment. This observation correlates with other geologic evidence, suggesting a major change in the erosional regime following the last major basin size impact (i.e., Argrye). In addition, the multisloped nature of the curves supports the idea that the downturn in the crater size-frequency distribution curves reflects the size-frequency distribution of the impactors rather than being the result of erosion. The crustal dichotomy formed prior to the heavy bombardment intermediate epoch based on distribution curves of knobby terrain; if the dichotomy resulted from a single gigantic impact, this observation places constraints on when this event happened. An alternate theory for dichotomy formation, the multiple-impact basin idea, is questioned: since distribution curves of large basins as well as heavy bombardment era units are not represented by a {minus}3 differential power law function, this study finds fewer basins missing on Mars compare to the Moon and Mercury than previously reported. The area covered by these missing basins is less than that covered the northern plains.

  11. Early event-related brain potentials that reflect interest for content information in the media.

    PubMed

    Adachi, Shinobu; Morikawa, Koji; Nittono, Hiroshi

    2012-03-28

    This study investigated the relationship between event-related brain potentials (ERPs) to abridged content information in the media and the subsequent decisions to view the full content. Student volunteers participated in a task that simulated information selection on the basis of the content information. Screenshots of television clips and headlines of news articles on the Web were used as content information for the image condition and the headline condition, respectively. Following presentation of a stimulus containing content information, participants decided whether or not they would view the full content by pressing a select or a reject button. When the select button was pressed, participants were presented with a television clip or a news article. When the reject button was pressed, participants continued on to the next trial, without viewing further. In comparison with rejected stimuli, selected stimuli elicited a larger negative component, with a peak latency of ∼250 ms. The increase in the negative component was independent of the type of visual stimulus. These results suggest that interest toward content information is reflected in early-stage event-related brain potential responses. PMID:22336875

  12. Dephosphorylation of Ezrin as an Early Event in Renal Microvillar Breakdown and Anoxic Injury

    NASA Astrophysics Data System (ADS)

    Chen, Jing; Cohn, Jonathan A.; Mandel, Lazaro J.

    1995-08-01

    Disruption of the renal proximal tubule (PT) brush border is a prominent early event during ischemic injury to the kidney. The molecular basis for this event is unknown. Within the brush border, ezrin may normally link the cytoskeleton to the cell plasma membrane. Anoxia causes ezrin to dissociate from the cytoskeleton and also causes many cell proteins to become dephosphorylated in renal PTs. This study examines the hypothesis that ezrin dephosphorylation accompanies and may mediate the anoxic disruption of the rabbit renal PT. During normoxia, 73 ±. 3% of the cytoskeleton-associated (Triton-insoluble) ezrin was phosphorylated, but 88 ± 6% of dissociated (Triton-soluble) ezrin was dephosphorylated. Phosphorylation was on serine/threonine residues, since ezrin was not detectable by an antibody against phosphotyrosine. After 60 min of anoxia, phosphorylation of total intracellular ezrin significantly decreased from 72 ± 2% to 21 ± 9%, and ezrin association with the cytoskeleton decreased from 91 ± 2% to 58 ± 2%. Calyculin A (1 μM), the serine/threonine phosphatase inhibitor, inhibited the dephosphorylation of ezrin during anoxia by 57% and also blocked the dissociation of ezrin from the cytoskeleton by 53%. Our results demonstrate that (i) the association of ezrin with the renal microvillar cytoskeleton is correlated with phosphorylation of ezrin serine/threonine residues and (ii) anoxia may cause disruption of the renal brush border by dephosphorylating ezrin and thereby dissociating the brush border membrane from the cytoskeleton.

  13. Background- versus event-level biotic variability: Hyperthermals of the late Paleocene and early Eocene

    NASA Astrophysics Data System (ADS)

    Gibbs, S.; Murphy, B. H.; Pälike, H.

    2009-12-01

    The Paleocene-Eocene Thermal Maximum (PETM) was an abrupt global warming event 55 million years ago (Ma) which has received much attention in recent years as an analogue for anthropogenic carbon emissions. We now know that the PETM was not unique, but was perhaps the most extreme of a number of abrupt carbon cycle perturbations throughout the late Paleocene and early Eocene. These inferred transient warming events, or ‘hyperthermals’, all have characteristic negative carbon isotope excursions (CIE). Unlike the PETM, it is currently unclear whether there was a significant biotic response to these additional CIEs, and if so, whether the amplitude of response varied systematically with excursion magnitude. Here, we present high-resolution nannofossil records from a two million year interval spanning the Paleocene-Eocene boundary at Ocean Drilling Program (ODP) Site 1209 in the paleo-subequatorial Pacific. This interval, from ~55 to 53 Ma, includes the PETM, a second hyperthermal named the Eocene Thermal Maximum 2 (ETM2 or ‘Elmo’), and a further number of smaller excursions. These data allow us to look for common biotic signatures and to document the level of assemblage variability relative to the inferred levels of environmental change associated with each CIE. We use this dataset as a case-study for investigating different statistical means of quantifying and comparing biotic responses to background and event-level perturbation. Preliminary analyses suggest that, as expected, the PETM exhibited the greatest level of assemblage variability, well above background levels, followed in order of CIE magnitude by the ETM2. Several of the smaller excursions have no significant assemblage variability above background levels, pointing to a critical threshold level of environmental perturbation.

  14. Calcareous nannoplankton changes across the early Toarcian oceanic anoxic event in the western Tethys

    NASA Astrophysics Data System (ADS)

    Mattioli, Emanuela; Pittet, Bernard; Suan, Guillaume; Mailliot, Samuel

    2008-09-01

    Calcareous nannoplankton were profoundly affected by environmental perturbations coincident with the early Toarcian oceanic anoxic event (T-OAE). We quantify the abundance of nannofossils across the T-OAE at three locations in Western Europe, where the event is marked by a prominent negative carbon isotope excursion (CIE). Data were treated by statistical analysis, and the Shannon diversity index was applied in order to describe nannofossil assemblage changes related to paleoenvironmental evolution. In the basal Toarcian, before the T-OAE, high proportions of taxa with an affinity for low temperature (e.g., P. liasicus, T. patulus, Bussonius) occurred. This observation is consistent with interpretations of published oxygen isotope records. During the T-OAE, the lowest abundance of nannofossils is observed, but there is a peak of a coccolith (Calyculus) from an organism that probably thrived in low-saline surface waters depleted of nitrate. At the end of the perturbation, the lowest diversities of nannofossils occurred, and assemblages are dominated by Crepidolithus crassus, a deep dweller. This interval corresponded to progressive reoxygenation of deep water and the reoccupation of the deep photic zone by nannoplankton. The highest abundance of nannofossils is recorded above the CIE and testifies to the recovery of the entire nannoplankton community. The T-OAE was widespread (perhaps global) and probably linked to major changes in the atmosphere and hydrosphere. However, the record of this event varies in the basins surrounding the western Tethys, suggesting regional imprints on the global signal. The regional variability may attest to establishment of effective connections between the Arctic and Tethys oceans, which allowed cool, low-saline water formed at high latitudes to stream toward the western Tethys.

  15. Membrane remodeling, an early event in benzo[alpha]pyrene-induced apoptosis

    SciTech Connect

    Tekpli, Xavier; Rissel, Mary; Huc, Laurence; Catheline, Daniel; Sergent, Odile; Rioux, Vincent; Legrand, Philippe; Holme, Jorn A.; Dimanche-Boitrel, Marie-Therese; Lagadic-Gossmann, Dominique

    2010-02-15

    Benzo[alpha]pyrene (B[alpha]P) often serves as a model for mutagenic and carcinogenic polycyclic aromatic hydrocarbons (PAHs). Our previous work suggested a role of membrane fluidity in B[alpha]P-induced apoptotic process. In this study, we report that B[alpha]P modifies the composition of cholesterol-rich microdomains (lipid rafts) in rat liver F258 epithelial cells. The cellular distribution of the ganglioside-GM1 was markedly changed following B[alpha]P exposure. B[alpha]P also modified fatty acid composition and decreased the cholesterol content of cholesterol-rich microdomains. B[alpha]P-induced depletion of cholesterol in lipid rafts was linked to a reduced expression of 3-hydroxy-3-methylglutaryl-CoA reductase (HMG-CoA reductase). Aryl hydrocarbon receptor (AhR) and B[alpha]P-related H{sub 2}O{sub 2} formation were involved in the reduced expression of HMG-CoA reductase and in the remodeling of membrane microdomains. The B[alpha]P-induced membrane remodeling resulted in an intracellular alkalinization observed during the early phase of apoptosis. In conclusion, B[alpha]P altered the composition of plasma membrane microstructures through AhR and H{sub 2}O{sub 2} dependent-regulation of lipid biosynthesis. In F258 cells, the B[alpha]P-induced membrane remodeling was identified as an early apoptotic event leading to an intracellular alkalinization.

  16. Enhanced tocopherol levels during early germination events in Chamaerops humilis var. humilis seeds.

    PubMed

    Siles, Laura; Alegre, Leonor; Tijero, Verónica; Munné-Bosch, Sergi

    2015-10-01

    Most angiosperms accumulate vitamin E in the form of tocopherols in seeds, exerting a protective antioxidant role. However, several palm trees principally accumulate tocotrienols, rather than tocopherols, in seeds, as it occurs in other monocots. To unravel the protective role of either tocopherols or tocotrienols against lipid peroxidation during seed germination in Chamaerops humilis var. humilis; seed viability, natural and induced germination capacity, seed water content, malondialdehyde levels (as an indicator of the extent of lipid peroxidation) and vitamin E levels (including both tocopherols and tocotrienols) were examined at various germination phases in a simulated, natural seed bank. At the very early stages of germination (operculum removal), malondialdehyde levels increased 2.8-fold, to decrease later up to 74%, thus indicating a transient lipid peroxidation at early stages of germination. Tocopherol levels were absent in quiescent seeds and did not increase during operculum removal, but increased later presumably dampening malondialdehyde accumulation. Thereafter, tocopherols continued increasing, while lipid peroxidation levels decreased. By contrast, tocotrienols levels remained constant or even decreased as germination progressed, showing no correlation with lipid peroxidation levels. We hypothesize that despite their high tocotrienol content, seeds synthesize tocopherols during germination to protect lipids from peroxidation events.

  17. Uncovering Driver DNA Methylation Events in Nonsmoking Early Stage Lung Adenocarcinoma.

    PubMed

    Zhang, Xindong; Gao, Lin; Liu, Zhi-Ping; Jia, Songwei; Chen, Luonan

    2016-01-01

    As smoking rates decrease, proportionally more cases with lung adenocarcinoma occur in never-smokers, while aberrant DNA methylation has been suggested to contribute to the tumorigenesis of lung adenocarcinoma. It is extremely difficult to distinguish which genes play key roles in tumorigenic processes via DNA methylation-mediated gene silencing from a large number of differentially methylated genes. By integrating gene expression and DNA methylation data, a pipeline combined with the differential network analysis is designed to uncover driver methylation genes and responsive modules, which demonstrate distinctive expressions and network topology in tumors with aberrant DNA methylation. Totally, 135 genes are recognized as candidate driver genes in early stage lung adenocarcinoma and top ranked 30 genes are recognized as driver methylation genes. Functional annotation and the differential network analysis indicate the roles of identified driver genes in tumorigenesis, while literature study reveals significant correlations of the top 30 genes with early stage lung adenocarcinoma in never-smokers. The analysis pipeline can also be employed in identification of driver epigenetic events for other cancers characterized by matched gene expression data and DNA methylation data. PMID:27610367

  18. Early Events in the Nonadiabatic Relaxation Dynamics of 4-(N,N-Dimethylamino)benzonitrile.

    PubMed

    Kochman, Michał A; Tajti, Attila; Morrison, Carole A; Miller, R J Dwayne

    2015-03-10

    4-(N,N-Dimethylamino)benzonitrile (DMABN) is the archetypal system for dual fluorescence. Several past studies, both experimental and theoretical, have examined the mechanism of its relaxation in the gas phase following photoexcitation to the S2 state, without converging to a single description. In this contribution, we report first-principles simulations of the early events involved in this process performed using the nonadiabatic trajectory surface hopping (TSH) approach in combination with the ADC(2) electronic structure method. ADC(2) is verified to reproduce the ground- and excited-state structures of DMABN in reasonably close agreement with previous theoretical benchmarks. The TSH simulations predict that internal conversion from the S2 state to the S1 takes place as early as 8.5 fs, on average, after the initial photoexcitation, and with no significant torsion of the dimethylamino group relative to the aromatic ring. As evidenced by supporting EOM-CCSD calculations, the population transfer from S2 to S1 can be attributed to the skeletal deformation modes of the aromatic ring and the stretching of the ring-dimethylamino nitrogen bond. The non- or slightly twisted locally excited structure is the predominant product of the internal conversion, and the twisted intramolecular charge transfer structure is formed through equilibration with the locally excited structure with no change of adiabatic state. These findings point toward a new interpretation of data from previous time-resolved experiments. PMID:26579762

  19. Dysregulation of RBFOX2 Is an Early Event in Cardiac Pathogenesis of Diabetes.

    PubMed

    Nutter, Curtis A; Jaworski, Elizabeth A; Verma, Sunil K; Deshmukh, Vaibhav; Wang, Qiongling; Botvinnik, Olga B; Lozano, Mario J; Abass, Ismail J; Ijaz, Talha; Brasier, Allan R; Garg, Nisha J; Wehrens, Xander H T; Yeo, Gene W; Kuyumcu-Martinez, Muge N

    2016-06-01

    Alternative splicing (AS) defects that adversely affect gene expression and function have been identified in diabetic hearts; however, the mechanisms responsible are largely unknown. Here, we show that the RNA-binding protein RBFOX2 contributes to transcriptome changes under diabetic conditions. RBFOX2 controls AS of genes with important roles in heart function relevant to diabetic cardiomyopathy. RBFOX2 protein levels are elevated in diabetic hearts despite low RBFOX2 AS activity. A dominant-negative (DN) isoform of RBFOX2 that blocks RBFOX2-mediated AS is generated in diabetic hearts. DN RBFOX2 interacts with wild-type (WT) RBFOX2, and ectopic expression of DN RBFOX2 inhibits AS of RBFOX2 targets. Notably, DN RBFOX2 expression is specific to diabetes and occurs at early stages before cardiomyopathy symptoms appear. Importantly, DN RBFOX2 expression impairs intracellular calcium release in cardiomyocytes. Our results demonstrate that RBFOX2 dysregulation by DN RBFOX2 is an early pathogenic event in diabetic hearts. PMID:27239029

  20. Inflammation-induced microvascular insulin resistance is an early event in diet-induced obesity.

    PubMed

    Zhao, Lina; Fu, Zhuo; Wu, Jing; Aylor, Kevin W; Barrett, Eugene J; Cao, Wenhong; Liu, Zhenqi

    2015-12-01

    Endothelial dysfunction and vascular insulin resistance usually coexist and chronic inflammation engenders both. In the present study, we investigate the temporal relationship between vascular insulin resistance and metabolic insulin resistance. We assessed insulin responses in all arterial segments, including aorta, distal saphenous artery and the microvasculature, as well as the metabolic insulin responses in muscle in rats fed on a high-fat diet (HFD) for various durations ranging from 3 days to 4 weeks with or without sodium salicylate treatment. Compared with controls, HFD feeding significantly blunted insulin-mediated Akt (protein kinase B) and eNOS [endothelial nitric oxide (NO) synthase] phosphorylation in aorta in 1 week, blunted vasodilatory response in small resistance vessel in 4 weeks and microvascular recruitment in as early as 3 days. Insulin-stimulated whole body glucose disposal did not begin to progressively decrease until after 1 week. Salicylate treatment fully inhibited vascular inflammation, prevented microvascular insulin resistance and significantly improved muscle metabolic responses to insulin. We conclude that microvascular insulin resistance is an early event in diet-induced obesity and insulin resistance and inflammation plays an essential role in this process. Our data suggest microvascular insulin resistance contributes to the development of metabolic insulin resistance in muscle and muscle microvasculature is a potential therapeutic target in the prevention and treatment of diabetes and its related complications.

  1. Early maternal deprivation enhances voluntary alcohol intake induced by exposure to stressful events later in life.

    PubMed

    Peñasco, Sara; Mela, Virginia; López-Moreno, Jose Antonio; Viveros, María-Paz; Marco, Eva M

    2015-01-01

    In the present study, we aimed to assess the impact of early life stress, in the form of early maternal deprivation (MD, 24 h on postnatal day, pnd, 9), on voluntary alcohol intake in adolescent male and female Wistar rats. During adolescence, from pnd 28 to pnd 50, voluntary ethanol intake (20%, v/v) was investigated using the two-bottle free choice paradigm. To better understand the relationship between stress and alcohol consumption, voluntary alcohol intake was also evaluated following additional stressful events later in life, that is, a week of alcohol cessation and a week of alcohol cessation combined with exposure to restraint stress. Female animals consumed more alcohol than males only after a second episode of alcohol cessation combined with restraint stress. MD did not affect baseline voluntary alcohol intake but increased voluntary alcohol intake after stress exposure, indicating that MD may render animals more vulnerable to the effects of stress on alcohol intake. During adolescence, when animals had free access to alcohol, MD animals showed lower body weight gain but a higher growth rate than control animals. Moreover, the higher growth rate was accompanied by a decrease in food intake, suggesting an altered metabolic regulation in MD animals that may interact with alcohol intake.

  2. Dysregulation of RBFOX2 is an early event in cardiac pathogenesis of diabetes

    PubMed Central

    Nutter, Curtis A.; Jaworski, Elizabeth A.; Verma, Sunil K.; Deshmukh, Vaibhav; Wang, Qiongling; Botvinnik, Olga B.; Lozano, Mario J.; Abass, Ismail J.; Ijaz, Talha; Brasier, Allan R.; Garg, Nisha J.; Wehrens, Xander H.T.; Yeo, Gene W.; Kuyumcu-Martinez, Muge N.

    2016-01-01

    Alternative splicing (AS) defects that adversely affect gene expression and function have been identified in diabetic hearts; however, the mechanisms responsible are largely unknown. Here we show that the RNA-binding protein RBFOX2 contributes to transcriptome changes under diabetic conditions. RBFOX2 controls AS of genes with important roles in heart function relevant to diabetic cardiomyopathy. RBFOX2 protein levels are elevated in diabetic hearts despite low RBFOX2 AS activity. A dominant negative (DN) isoform of RBFOX2 that blocks RBFOX2-mediated AS is generated in diabetic hearts. DN RBFOX2 interacts with wild type RBFOX2 and ectopic expression of DN RBFOX2 inhibits AS of RBFOX2 targets. Notably, DN RBFOX2 expression is specific to diabetes and occurs at early stages before cardiomyopathy symptoms appear. Importantly, DN RBFOX2 expression impairs intracellular calcium release in cardiomyocytes. Our results demonstrate that RBFOX2 dysregulation by DN RBFOX2 is an early pathogenic event in diabetic hearts. PMID:27239029

  3. Early spring, severe frost events, and drought induce rapid carbon loss in high elevation meadows.

    PubMed

    Arnold, Chelsea; Ghezzehei, Teamrat A; Berhe, Asmeret Asefaw

    2014-01-01

    By the end of the 20th century, the onset of spring in the Sierra Nevada mountain range of California has been occurring on average three weeks earlier than historic records. Superimposed on this trend is an increase in the presence of highly anomalous "extreme" years, where spring arrives either significantly late or early. The timing of the onset of continuous snowpack coupled to the date at which the snowmelt season is initiated play an important role in the development and sustainability of mountain ecosystems. In this study, we assess the impact of extreme winter precipitation variation on aboveground net primary productivity and soil respiration over three years (2011 to 2013). We found that the duration of snow cover, particularly the timing of the onset of a continuous snowpack and presence of early spring frost events contributed to a dramatic change in ecosystem processes. We found an average 100% increase in soil respiration in 2012 and 2103, compared to 2011, and an average 39% decline in aboveground net primary productivity observed over the same time period. The overall growing season length increased by 57 days in 2012 and 61 days in 2013. These results demonstrate the dependency of these keystone ecosystems on a stable climate and indicate that even small changes in climate can potentially alter their resiliency.

  4. Early Spring, Severe Frost Events, and Drought Induce Rapid Carbon Loss in High Elevation Meadows

    PubMed Central

    Arnold, Chelsea; Ghezzehei, Teamrat A.; Berhe, Asmeret Asefaw

    2014-01-01

    By the end of the 20th century, the onset of spring in the Sierra Nevada mountain range of California has been occurring on average three weeks earlier than historic records. Superimposed on this trend is an increase in the presence of highly anomalous “extreme” years, where spring arrives either significantly late or early. The timing of the onset of continuous snowpack coupled to the date at which the snowmelt season is initiated play an important role in the development and sustainability of mountain ecosystems. In this study, we assess the impact of extreme winter precipitation variation on aboveground net primary productivity and soil respiration over three years (2011 to 2013). We found that the duration of snow cover, particularly the timing of the onset of a continuous snowpack and presence of early spring frost events contributed to a dramatic change in ecosystem processes. We found an average 100% increase in soil respiration in 2012 and 2103, compared to 2011, and an average 39% decline in aboveground net primary productivity observed over the same time period. The overall growing season length increased by 57 days in 2012 and 61 days in 2013. These results demonstrate the dependency of these keystone ecosystems on a stable climate and indicate that even small changes in climate can potentially alter their resiliency. PMID:25207640

  5. Relationship between early and late stages of information processing: an event-related potential study

    PubMed Central

    Portella, Claudio; Machado, Sergio; Arias-Carrión, Oscar; Sack, Alexander T.; Silva, Julio Guilherme; Orsini, Marco; Leite, Marco Antonio Araujo; Silva, Adriana Cardoso; Nardi, Antonio E.; Cagy, Mauricio; Piedade, Roberto; Ribeiro, Pedro

    2012-01-01

    The brain is capable of elaborating and executing different stages of information processing. However, exactly how these stages are processed in the brain remains largely unknown. This study aimed to analyze the possible correlation between early and late stages of information processing by assessing the latency to, and amplitude of, early and late event-related potential (ERP) components, including P200, N200, premotor potential (PMP) and P300, in healthy participants in the context of a visual oddball paradigm. We found a moderate positive correlation among the latency of P200 (electrode O2), N200 (electrode O2), PMP (electrode C3), P300 (electrode PZ) and the reaction time (RT). In addition, moderate negative correlation between the amplitude of P200 and the latencies of N200 (electrode O2), PMP (electrode C3), P300 (electrode PZ) was found. Therefore, we propose that if the secondary processing of visual input (P200 latency) occurs faster, the following will also happen sooner: discrimination and classification process of this input (N200 latency), motor response processing (PMP latency), reorganization of attention and working memory update (P300 latency), and RT. N200, PMP, and P300 latencies are also anticipated when higher activation level of occipital areas involved in the secondary processing of visual input rise (P200 amplitude). PMID:23355929

  6. Uncovering Driver DNA Methylation Events in Nonsmoking Early Stage Lung Adenocarcinoma

    PubMed Central

    Jia, Songwei; Chen, Luonan

    2016-01-01

    As smoking rates decrease, proportionally more cases with lung adenocarcinoma occur in never-smokers, while aberrant DNA methylation has been suggested to contribute to the tumorigenesis of lung adenocarcinoma. It is extremely difficult to distinguish which genes play key roles in tumorigenic processes via DNA methylation-mediated gene silencing from a large number of differentially methylated genes. By integrating gene expression and DNA methylation data, a pipeline combined with the differential network analysis is designed to uncover driver methylation genes and responsive modules, which demonstrate distinctive expressions and network topology in tumors with aberrant DNA methylation. Totally, 135 genes are recognized as candidate driver genes in early stage lung adenocarcinoma and top ranked 30 genes are recognized as driver methylation genes. Functional annotation and the differential network analysis indicate the roles of identified driver genes in tumorigenesis, while literature study reveals significant correlations of the top 30 genes with early stage lung adenocarcinoma in never-smokers. The analysis pipeline can also be employed in identification of driver epigenetic events for other cancers characterized by matched gene expression data and DNA methylation data. PMID:27610367

  7. Event-related potentials reveal early activation of body part representations in action concept comprehension.

    PubMed

    Lu, Aitao; Liu, Jing; Zhang, John X

    2012-03-01

    With tasks involving action concept comprehension, many fMRI studies have reported brain activations in sensori-motor regions specific to effectors of the referent action. There is relatively less evidence whether such activations reflect early semantic access or late conceptual re-processing. Here we recorded event-related potentials when participants recognized noun-verb pairs. For Congruent pairs, the verb was the one most commonly associated with the noun (e.g., football-kick). Compared with a control condition, verbs in Congruent pairs showed priming effects in the time windows of 100-150 ms and 210-260 ms. Such activation seems to be specific to body part but not other aspects of the action as similar priming effect was also found when the noun and verb involved different actions though sharing the same body part (e.g., football-jump), documenting for the first time the early activation of body part representations in action concept comprehension. PMID:22306088

  8. Early Maternal Deprivation Enhances Voluntary Alcohol Intake Induced by Exposure to Stressful Events Later in Life

    PubMed Central

    Peñasco, Sara; Mela, Virginia; López-Moreno, Jose Antonio; Viveros, María-Paz; Marco, Eva M.

    2015-01-01

    In the present study, we aimed to assess the impact of early life stress, in the form of early maternal deprivation (MD, 24 h on postnatal day, pnd, 9), on voluntary alcohol intake in adolescent male and female Wistar rats. During adolescence, from pnd 28 to pnd 50, voluntary ethanol intake (20%, v/v) was investigated using the two-bottle free choice paradigm. To better understand the relationship between stress and alcohol consumption, voluntary alcohol intake was also evaluated following additional stressful events later in life, that is, a week of alcohol cessation and a week of alcohol cessation combined with exposure to restraint stress. Female animals consumed more alcohol than males only after a second episode of alcohol cessation combined with restraint stress. MD did not affect baseline voluntary alcohol intake but increased voluntary alcohol intake after stress exposure, indicating that MD may render animals more vulnerable to the effects of stress on alcohol intake. During adolescence, when animals had free access to alcohol, MD animals showed lower body weight gain but a higher growth rate than control animals. Moreover, the higher growth rate was accompanied by a decrease in food intake, suggesting an altered metabolic regulation in MD animals that may interact with alcohol intake. PMID:25821601

  9. Uncovering Driver DNA Methylation Events in Nonsmoking Early Stage Lung Adenocarcinoma

    PubMed Central

    Jia, Songwei; Chen, Luonan

    2016-01-01

    As smoking rates decrease, proportionally more cases with lung adenocarcinoma occur in never-smokers, while aberrant DNA methylation has been suggested to contribute to the tumorigenesis of lung adenocarcinoma. It is extremely difficult to distinguish which genes play key roles in tumorigenic processes via DNA methylation-mediated gene silencing from a large number of differentially methylated genes. By integrating gene expression and DNA methylation data, a pipeline combined with the differential network analysis is designed to uncover driver methylation genes and responsive modules, which demonstrate distinctive expressions and network topology in tumors with aberrant DNA methylation. Totally, 135 genes are recognized as candidate driver genes in early stage lung adenocarcinoma and top ranked 30 genes are recognized as driver methylation genes. Functional annotation and the differential network analysis indicate the roles of identified driver genes in tumorigenesis, while literature study reveals significant correlations of the top 30 genes with early stage lung adenocarcinoma in never-smokers. The analysis pipeline can also be employed in identification of driver epigenetic events for other cancers characterized by matched gene expression data and DNA methylation data.

  10. Event-related potentials reveal early activation of body part representations in action concept comprehension.

    PubMed

    Lu, Aitao; Liu, Jing; Zhang, John X

    2012-03-01

    With tasks involving action concept comprehension, many fMRI studies have reported brain activations in sensori-motor regions specific to effectors of the referent action. There is relatively less evidence whether such activations reflect early semantic access or late conceptual re-processing. Here we recorded event-related potentials when participants recognized noun-verb pairs. For Congruent pairs, the verb was the one most commonly associated with the noun (e.g., football-kick). Compared with a control condition, verbs in Congruent pairs showed priming effects in the time windows of 100-150 ms and 210-260 ms. Such activation seems to be specific to body part but not other aspects of the action as similar priming effect was also found when the noun and verb involved different actions though sharing the same body part (e.g., football-jump), documenting for the first time the early activation of body part representations in action concept comprehension.

  11. Early pulmonary events of nose-only water pipe (shisha) smoking exposure in mice.

    PubMed

    Nemmar, Abderrahim; Al Hemeiri, Ahmed; Al Hammadi, Naser; Yuvaraju, Priya; Beegam, Sumaya; Yasin, Javed; Elwasila, Mohamed; Ali, Badreldin H; Adeghate, Ernest

    2015-03-01

    Water pipe smoking (WPS) is increasing in popularity and prevalence worldwide. Convincing data suggest that the toxicants in WPS are similar to that of cigarette smoke. However, the underlying pathophysiologic mechanisms related to the early pulmonary events of WPS exposure are not understood. Here, we evaluated the early pulmonary events of nose-only exposure to mainstream WPS generated by commercially available honey flavored "moasel" tobacco. BALB/c mice were exposed to WPS 30 min/day for 5 days. Control mice were exposed using the same protocol to atmospheric air only. We measured airway resistance using forced oscillation technique, and pulmonary inflammation was evaluated histopathologically and by biochemical analysis of bronchoalveolar lavage (BAL) fluid and lung tissue. Lung oxidative stress was evaluated biochemically by measuring the level of reactive oxygen species (ROS), lipid peroxidation (LPO), reduced glutathione (GSH), catalase, and superoxide dismutase (SOD). Mice exposed to WPS showed a significant increase in the number of neutrophils (P < 0.05) and lymphocytes (P < 0.001). Moreover, total protein (P < 0.05), lactate dehydrogenase (P < 0.005), and endothelin (P < 0.05) levels were augmented in bronchoalveolar lavage fluid. Tumor necrosis factor α (P < 0.005) and interleukin 6 (P < 0.05) concentrations were significantly increased in lung following the exposure to WPS. Both ROS (P < 0.05) and LPO (P < 0.005) in lung tissue were significantly increased, whereas the level and activity of antioxidants including GSH (P < 0.0001), catalase (P < 0.005), and SOD (P < 0.0001) were significantly decreased after WPS exposure, indicating the occurrence of oxidative stress. In contrast, airway resistance was not increased in WPS exposure. We conclude that subacute, nose-only exposure to WPS causes lung inflammation and oxidative stress without affecting pulmonary function suggesting that inflammation and oxidative stress are early

  12. Early pulmonary events of nose-only water pipe (shisha) smoking exposure in mice

    PubMed Central

    Nemmar, Abderrahim; Hemeiri, Ahmed Al; Hammadi, Naser Al; Yuvaraju, Priya; Beegam, Sumaya; Yasin, Javed; Elwasila, Mohamed; Ali, Badreldin H; Adeghate, Ernest

    2015-01-01

    Water pipe smoking (WPS) is increasing in popularity and prevalence worldwide. Convincing data suggest that the toxicants in WPS are similar to that of cigarette smoke. However, the underlying pathophysiologic mechanisms related to the early pulmonary events of WPS exposure are not understood. Here, we evaluated the early pulmonary events of nose-only exposure to mainstream WPS generated by commercially available honey flavored “moasel” tobacco. BALB/c mice were exposed to WPS 30 min/day for 5 days. Control mice were exposed using the same protocol to atmospheric air only. We measured airway resistance using forced oscillation technique, and pulmonary inflammation was evaluated histopathologically and by biochemical analysis of bronchoalveolar lavage (BAL) fluid and lung tissue. Lung oxidative stress was evaluated biochemically by measuring the level of reactive oxygen species (ROS), lipid peroxidation (LPO), reduced glutathione (GSH), catalase, and superoxide dismutase (SOD). Mice exposed to WPS showed a significant increase in the number of neutrophils (P < 0.05) and lymphocytes (P < 0.001). Moreover, total protein (P < 0.05), lactate dehydrogenase (P < 0.005), and endothelin (P < 0.05) levels were augmented in bronchoalveolar lavage fluid. Tumor necrosis factor α (P < 0.005) and interleukin 6 (P < 0.05) concentrations were significantly increased in lung following the exposure to WPS. Both ROS (P < 0.05) and LPO (P < 0.005) in lung tissue were significantly increased, whereas the level and activity of antioxidants including GSH (P < 0.0001), catalase (P < 0.005), and SOD (P < 0.0001) were significantly decreased after WPS exposure, indicating the occurrence of oxidative stress. In contrast, airway resistance was not increased in WPS exposure. We conclude that subacute, nose-only exposure to WPS causes lung inflammation and oxidative stress without affecting pulmonary function suggesting that inflammation and oxidative stress are

  13. Early pulmonary events of nose-only water pipe (shisha) smoking exposure in mice.

    PubMed

    Nemmar, Abderrahim; Al Hemeiri, Ahmed; Al Hammadi, Naser; Yuvaraju, Priya; Beegam, Sumaya; Yasin, Javed; Elwasila, Mohamed; Ali, Badreldin H; Adeghate, Ernest

    2015-03-01

    Water pipe smoking (WPS) is increasing in popularity and prevalence worldwide. Convincing data suggest that the toxicants in WPS are similar to that of cigarette smoke. However, the underlying pathophysiologic mechanisms related to the early pulmonary events of WPS exposure are not understood. Here, we evaluated the early pulmonary events of nose-only exposure to mainstream WPS generated by commercially available honey flavored "moasel" tobacco. BALB/c mice were exposed to WPS 30 min/day for 5 days. Control mice were exposed using the same protocol to atmospheric air only. We measured airway resistance using forced oscillation technique, and pulmonary inflammation was evaluated histopathologically and by biochemical analysis of bronchoalveolar lavage (BAL) fluid and lung tissue. Lung oxidative stress was evaluated biochemically by measuring the level of reactive oxygen species (ROS), lipid peroxidation (LPO), reduced glutathione (GSH), catalase, and superoxide dismutase (SOD). Mice exposed to WPS showed a significant increase in the number of neutrophils (P < 0.05) and lymphocytes (P < 0.001). Moreover, total protein (P < 0.05), lactate dehydrogenase (P < 0.005), and endothelin (P < 0.05) levels were augmented in bronchoalveolar lavage fluid. Tumor necrosis factor α (P < 0.005) and interleukin 6 (P < 0.05) concentrations were significantly increased in lung following the exposure to WPS. Both ROS (P < 0.05) and LPO (P < 0.005) in lung tissue were significantly increased, whereas the level and activity of antioxidants including GSH (P < 0.0001), catalase (P < 0.005), and SOD (P < 0.0001) were significantly decreased after WPS exposure, indicating the occurrence of oxidative stress. In contrast, airway resistance was not increased in WPS exposure. We conclude that subacute, nose-only exposure to WPS causes lung inflammation and oxidative stress without affecting pulmonary function suggesting that inflammation and oxidative stress are early

  14. Reflections on some early events related to behavior analysis of child development.

    PubMed

    Bijou, S W

    1996-01-01

    A series of events related to the early application of behavioral principles to child behavior and development is described. The events began in the 1930s at Columbia University with a solicited letter from John B. Watson suggesting a master's degree thesis problem, and continued through the 1950s and 1960s at the University of Washington. Specifically, these happenings resulted in (a) research demonstrating that Skinner's laboratory method for studying nonhuman organisms could be profitably applied to the laboratory study of young normal children; (b) a demonstration that by successive approximations, a normal child can be operantly conditioned to respond to an arbitrary situation; (c) research showing that the effects of simple schedules of reinforcement obtained with nonhuman organisms could be duplicated in young normal and retarded children; (d) the demonstration that Skinner's operant laboratory method could be adapted to study young children in field situations; (e) research showing that operant principles can be successfully applied to the treatment of a young autistic boy with a serious visual handicap; (f) laboratory studies showing that mothers can be trained to treat their own young children who have behavior problems; (g) an in-home study demonstrating that a mother can treat her own child who has behavior problems; (h) a demonstration that operant principles can be applied effectively to teaching reading, writing, and arithmetic to children with retardation; and (i) publication of a book, Child Development: A Systematic and Empirical Theory, in collaboration with Donald M. Baer, by Prentice Hall in their Century Psychological Series. PMID:22478239

  15. Reflections on some early events related to behavior analysis of child development

    PubMed Central

    Bijou, Sidney W.

    1996-01-01

    A series of events related to the early application of behavioral principles to child behavior and development is described. The events began in the 1930s at Columbia University with a solicited letter from John B. Watson suggesting a master's degree thesis problem, and continued through the 1950s and 1960s at the University of Washington. Specifically, these happenings resulted in (a) research demonstrating that Skinner's laboratory method for studying nonhuman organisms could be profitably applied to the laboratory study of young normal children; (b) a demonstration that by successive approximations, a normal child can be operantly conditioned to respond to an arbitrary situation; (c) research showing that the effects of simple schedules of reinforcement obtained with nonhuman organisms could be duplicated in young normal and retarded children; (d) the demonstration that Skinner's operant laboratory method could be adapted to study young children in field situations; (e) research showing that operant principles can be successfully applied to the treatment of a young autistic boy with a serious visual handicap; (f) laboratory studies showing that mothers can be trained to treat their own young children who have behavior problems; (g) an in-home study demonstrating that a mother can treat her own child who has behavior problems; (h) a demonstration that operant principles can be applied effectively to teaching reading, writing, and arithmetic to children with retardation; and (i) publication of a book, Child Development: A Systematic and Empirical Theory, in collaboration with Donald M. Baer, by Prentice Hall in their Century Psychological Series. PMID:22478239

  16. Subclinical alexithymia modulates early audio-visual perceptive and attentional event-related potentials

    PubMed Central

    Delle-Vigne, Dyna; Kornreich, Charles; Verbanck, Paul; Campanella, Salvatore

    2014-01-01

    Introduction: Previous studies have highlighted the advantage of using audio–visual oddball tasks (instead of unimodal ones) in order to electrophysiologically index subclinical behavioral differences. Since alexithymia is highly prevalent in the general population, we investigated whether the use of various bimodal tasks could elicit emotional effects in low- vs. high-alexithymic scorers. Methods: Fifty students (33 females and 17 males) were split into groups based on low and high scores on the Toronto Alexithymia Scale (TAS-20). During event-related potential (ERP) recordings, they were exposed to three kinds of audio–visual oddball tasks: neutral-AVN—(geometrical forms and bips), animal-AVA—(dog and cock with their respective shouts), or emotional-AVE—(faces and voices) stimuli. In each condition, participants were asked to quickly detect deviant events occurring amongst a train of repeated and frequent matching stimuli (e.g., push a button when a sad face–voice pair appeared amongst a train of neutral face–voice pairs). P100, N100, and P300 components were analyzed: P100 refers to visual perceptive and attentional processing, N100 to auditory ones, and the P300 relates to response-related stages, involving memory processes. Results: High-alexithymic scorers presented a particular pattern of results when processing the emotional stimulations, reflected in early ERP components by increased P100 and N100 amplitudes in the emotional oddball tasks [P100: F(2, 48) = 20,319, p < 0.001; N100: F(2, 96) = 8,807, p = 0.001] as compared to the animal or neutral ones. Indeed, regarding the P100, subjects exhibited a higher amplitude in the AVE condition (8.717 μV), which was significantly different from that observed during the AVN condition (4.382 μV, p < 0.001). For the N100, the highest amplitude was found in the AVE condition (−4.035 μV) and the lowest was observed in the AVN condition (−2.687 μV, p = 0.003). However, no effect was found on the

  17. Early events of fertilization in sea urchin eggs are sensitive to actin-binding organic molecules.

    PubMed

    Chun, Jong T; Limatola, Nunzia; Vasilev, Filip; Santella, Luigia

    2014-08-01

    We previously demonstrated that many aspects of the intracellular Ca(2+) increase in fertilized eggs of starfish are significantly influenced by the state of the actin cytoskeleton. In addition, the actin cytoskeleton appeared to play comprehensive roles in modulating cortical granules exocytosis and sperm entry during the early phase of fertilization. In the present communication, we have extended our work to sea urchin which is believed to have bifurcated from the common ancestor in the phylogenetic tree some 500 million years ago. To corroborate our earlier findings in starfish, we have tested how the early events of fertilization in sea urchin eggs are influenced by four different actin-binding drugs that promote either depolymerization or stabilization of actin filaments. We found that all the actin drugs commonly blocked sperm entry in high doses and significantly reduced the speed of the Ca(2+) wave. At low doses, however, cytochalasin B and phalloidin increased the rate of polyspermy. Overall, certain aspects of Ca(2+) signaling in these eggs were in line with the morphological changes induced by the actin drugs. That is, the time interval between the cortical flash and the first Ca(2+) spot at the sperm interaction site (the latent period) was significantly prolonged in the eggs pretreated with cytochalasin B or latrunculin A, whereas the Ca(2+) decay kinetics after the peak was specifically attenuated in the eggs pretreated with jasplakinolide or phalloidin. In addition, the sperm interacting with the eggs pretreated with actin drugs often generated multiple Ca(2+) waves, but tended to fail to enter the egg. Thus, our results indicated that generation of massive Ca(2+) waves is neither indicative of sperm entry nor sufficient for cortical granules exocytosis in the inseminated sea urchin eggs, whereas the structure and functionality of the actin cytoskeleton are the major determining factors in the two processes.

  18. Stress Granule Components G3BP1 and G3BP2 Play a Proviral Role Early in Chikungunya Virus Replication

    PubMed Central

    Scholte, Florine E. M.; Tas, Ali; Albulescu, Irina C.; Žusinaite, Eva; Merits, Andres; Snijder, Eric J.

    2015-01-01

    Caribbean underline the importance of better understanding CHIKV replication. Stress granules (SGs) are cytoplasmic protein-mRNA aggregates formed in response to various stresses, including viral infection. The RNA-binding proteins G3BP1 and G3BP2 are essential SG components. SG formation and the resulting translational inhibition are generally considered an antiviral response, and many viruses manipulate or block this process. Late in infection, we and others have observed CHIKV nonstructural protein 3 in cytoplasmic G3BP1- and G3BP2-containing granules. These virally induced foci differed from true SGs and did not appear to represent replication complexes. Surprisingly, we found that G3BP1 and G3BP2 were also needed for efficient CHIKV replication, likely by facilitating the switch from translation to genome amplification early in infection. PMID:25653451

  19. The strontium isotope seawater curve during the early Middle Miocene and its relation to paleoceanographic events

    SciTech Connect

    Hodell, D.A. . Dept. of Geology); Woodruff, F. . Dept. Geological Sciences)

    1992-01-01

    Breaks in slope of the strontium isotope seawater curve signal fundamental changes in either rates of continental weathering, seafloor spreading (i.e., tectonic reorganizations), or submarine dissolution of marine carbonates. The authors conducted a detailed study of the change in slope of the strontium isotopic seawater curve that occurred during the early middle Miocene in three Pacific DSDP sites (289, 574, and 588). The change in slope from the rapid rise in Sr-87/Sr-86 of the early Miocene (60 ppm/Ma) to the less rapid increase of the mid- and late Miocene (22 ppm/Ma) occurred between two periods of maximum [delta]C-13 values dated between 15.5 and 15.2 Ma. This internal was followed by relatively constant Sr-87/Sr-86 values (averaging 0.70878) between 15.2 and 14.2 Ma. Sr-87/Sr-86 ratios began to increase again after 14.2 Ma, but at a reduced rate compared to the early Miocene. The break in slope in Sr-87/Sr-86 preceded the mid-Miocene increase in [delta]O-18 that represents ice growth on Antarctica, which began at 14.9 Ma and increased rapidly after 14.2 Ma. In 2 out of 3 of the sites, the break in Sr-slope between 15.5 and 15.2 Ma is accompanied by a small, but significant, decrease in Sr-87/Sr-86 values. They speculate, that this decrease in Sr-87/Sr-86 may have been related to massive dissolution of older carbonate on the sea floor associated with NH2B (Neogene Hiatus 2 of Keller and Barron, 1983). This event may have important implications for changes in carbonate chemistry of the oceans. Numerical modeling of the strontium isotope budget will be used to test the feasibility of this mechanism and to estimate the volume and age of dissolved carbonate needed to produce the observed decrease in Sr-87/Sr-86.

  20. The Early Toarcian Oceanic Anoxic Event: A Southern Hemisphere record from Chile

    NASA Astrophysics Data System (ADS)

    Fantasia, Alicia; Föllmi, Karl B.; Adatte, Thierry; Spangenberg, Jorge E.; Bernárdez, Enrique; Mattioli, Emanuela

    2016-04-01

    The Early Toarcian was marked by important environmental changes, marine oxygen deficiency and extensive organic-rich sediment deposition (T-OAE; ˜182 Ma, Early Jurassic). The T-OAE coincides with a marked negative carbon isotope excursion (CIE) recorded in marine carbonate, and marine and terrestrial organic carbon. This is commonly attributed to the massive release of isotopically light carbon to the atmospheric and oceanic reservoirs derived from the destabilization of methane hydrates from marine sediments and/or the emissions of thermogenic methane from the eruption of the Karoo-Ferrar LIP (e.g., Hesselbo et al., 2000; Kemp et al., 2005; Svensen et al., 2007; Mazzini et al., 2010). Moreover, in most documented marine sections, this episode is marked by a generalized crisis in carbonate production and marine invertebrate extinctions (e.g. Jenkyns, 1988; Röhl et al., 2005; Suan et al., 2001). Several studies of the T-OAE have been conducted on sediments in central and northwest Europe, but only few data are available from the Southern Hemisphere, leading to large uncertainty concerning the exact expression of this event in this part of the world. The aims of this study are to characterize the sediments deposited during the Andean equivalents of the tenuicostatum and falciferum European Zones and establish in which way the T-OAE affected this region. In the Early Jurassic, the Andean basin was in a back-arc setting with marine corridors connected to Panthalassa. In this study, we have generated new high-resolution sedimentological, geochemical and mineralogical data from the sections of El Peñon and Quebrada Asiento, located in Chile in the northeastern area of the city of Copiapó, Atacama region. The biostratigraphy of these sections has been studied by von Hillebrandt and Schidt-Effing (1981) and complemented here by a biostratigraphy based on calcareous nannofossils. The sections consist of a succession of marl, limestone and siltstone of Pliensbachian and

  1. A single amino acid change in the E2 glycoprotein of Sindbis virus confers neurovirulence by altering an early step of virus replication.

    PubMed Central

    Dropulic, L K; Hardwick, J M; Griffin, D E

    1997-01-01

    Amino acid changes in the envelope glycoproteins of Sindbis virus have been linked to neurovirulence; however, the molecular mechanisms by which these amino acid changes alter neurovirulence are not known. Recombinant-virus studies have mapped an important determinant of neurovirulence in adult mice to a single amino acid change, glutamine to histidine, at position 55 of the E2 glycoprotein (P. C. Tucker, E. G. Strauss, R. J. Kuhn, J. H. Strauss, and D. E. Griffin, J. Virol. 67:4605-4610, 1993). To investigate how histidine confers neurovirulence, we examined the various stages of the virus life cycle in neural (N18) and nonneural (BHK) cells. In BHK cells, recombinant viruses 633 (E255Q) and TE (E255H) replicated similarly. In contrast, in N18 neuroblastoma cells, TE established infection more efficiently, replicated faster, and achieved higher rates of virus release than did 633. Viral structural protein synthesis was similar in 633- and TE-infected BHK cells, while in N18 cells, structural protein synthesis was detected only in TE-infected cells at 6 h and remained higher for at least 16 h postinfection. Viral RNA synthesis was initiated more rapidly and was up to fivefold greater in TE- versus 633-infected N18 cells. Taken together with other data demonstrating minimal effects on virus binding and entry (P. C. Tucker, S. H. Lee, N. Bui, D. Martinie, and D. E. Griffin, J. Virol. 71:6106-6112, 1997), these data suggest that E2 position 55 plays an important role at early stages of infection of neural cells, thereby facilitating neurovirulence. PMID:9223504

  2. Gender, facial attractiveness, and early and late event-related potential components.

    PubMed

    Zhang, Zimu; Deng, Zhidong

    2012-12-01

    Facial attractiveness has been an interesting topic in cognitive psychology due to its key role in human communication and experience. The evaluation of attractiveness is adjusted by many factors including gender differences and cultural biases. In this paper, event-related potential (ERP) activity was recorded in an oddball paradigm from 10 Chinese men and 10 Chinese women who judged attractiveness of faces. Participants were told to detect faces with neutral expression and judge their attractiveness among a train of neutral objects that were presented more frequently than the faces. The ERP analyses showed that there was enhanced detection over early (P1, N170, P2, N300) and late (P3b) components in both genders. This suggests that a biased electrophysiological response to attractive faces compared to unattractive faces could indicate the involvement of emotion and reward pathways in judging facial attractiveness. Specifically, there were delayed P1 and P3b latencies in response to attractive faces with slower response times in men compared to women. From an evolutionary perspective, this may suggest that men attribute more value to facial appearances, especially attractive features, than women do, as evidenced by their cognitive load while processing attractive faces compared to unattractive faces.

  3. Autophagic degradation of aquaporin-2 is an early event in hypokalemia-induced nephrogenic diabetes insipidus.

    PubMed

    Khositseth, Sookkasem; Uawithya, Panapat; Somparn, Poorichaya; Charngkaew, Komgrid; Thippamom, Nattakan; Hoffert, Jason D; Saeed, Fahad; Michael Payne, D; Chen, Shu-Hui; Fenton, Robert A; Pisitkun, Trairak

    2015-12-17

    Hypokalemia (low serum potassium level) is a common electrolyte imbalance that can cause a defect in urinary concentrating ability, i.e., nephrogenic diabetes insipidus (NDI), but the molecular mechanism is unknown. We employed proteomic analysis of inner medullary collecting ducts (IMCD) from rats fed with a potassium-free diet for 1 day. IMCD protein quantification was performed by mass spectrometry using a label-free methodology. A total of 131 proteins, including the water channel AQP2, exhibited significant changes in abundance, most of which were decreased. Bioinformatic analysis revealed that many of the down-regulated proteins were associated with the biological processes of generation of precursor metabolites and energy, actin cytoskeleton organization, and cell-cell adhesion. Targeted LC-MS/MS and immunoblotting studies further confirmed the down regulation of 18 selected proteins. Electron microscopy showed autophagosomes/autophagolysosomes in the IMCD cells of rats deprived of potassium for only 1 day. An increased number of autophagosomes was also confirmed by immunofluorescence, demonstrating co-localization of LC3 and Lamp1 with AQP2 and several other down-regulated proteins in IMCD cells. AQP2 was also detected in autophagosomes in IMCD cells of potassium-deprived rats by immunogold electron microscopy. Thus, enhanced autophagic degradation of proteins, most notably including AQP2, is an early event in hypokalemia-induced NDI.

  4. Event-related potentials reveal early activation of syntax information in Chinese verb processing.

    PubMed

    Deng, Yuan; Wu, Qiuyan; Wang, Jin; Feng, Liping; Xiao, Qing

    2016-09-19

    By taking advantage of the semantic-syntactic characteristics of Chinese verbs, the current study examined the brain activity of automatic activation of syntactic features at the single word level. Both syntactic (transitivity) and semantic (integrity) features of the verb were manipulated. Event-related potentials were measured while subjects performed lexical decision tasks on visually presented verbs at the single word level. The results showed that there was a significant transitivity effect in both lateral and midline areas for the 150-200ms time window (N200 effect), indicating the retrieval of the syntactic feature. There was also a significant syntactic-semantic interaction at the late stage of verb processing (N400 effect) in the midline central-parietal region, reflecting syntactic influences on semantic processing. These findings suggest that transitivity is an integral part of the mental representation of Chinese verbs and such information can be retrieved at the early stage of single verb processing and can influence subsequent semantic integration. These results also reveal the special features of Chinese language processing. PMID:27466021

  5. Event-related potentials reveal early activation of syntax information in Chinese verb processing.

    PubMed

    Deng, Yuan; Wu, Qiuyan; Wang, Jin; Feng, Liping; Xiao, Qing

    2016-09-19

    By taking advantage of the semantic-syntactic characteristics of Chinese verbs, the current study examined the brain activity of automatic activation of syntactic features at the single word level. Both syntactic (transitivity) and semantic (integrity) features of the verb were manipulated. Event-related potentials were measured while subjects performed lexical decision tasks on visually presented verbs at the single word level. The results showed that there was a significant transitivity effect in both lateral and midline areas for the 150-200ms time window (N200 effect), indicating the retrieval of the syntactic feature. There was also a significant syntactic-semantic interaction at the late stage of verb processing (N400 effect) in the midline central-parietal region, reflecting syntactic influences on semantic processing. These findings suggest that transitivity is an integral part of the mental representation of Chinese verbs and such information can be retrieved at the early stage of single verb processing and can influence subsequent semantic integration. These results also reveal the special features of Chinese language processing.

  6. Autophagic degradation of aquaporin-2 is an early event in hypokalemia-induced nephrogenic diabetes insipidus

    PubMed Central

    Khositseth, Sookkasem; Uawithya, Panapat; Somparn, Poorichaya; Charngkaew, Komgrid; Thippamom, Nattakan; Hoffert, Jason D.; Saeed, Fahad; Michael Payne, D.; Chen, Shu-Hui; Fenton, Robert A.; Pisitkun, Trairak

    2015-01-01

    Hypokalemia (low serum potassium level) is a common electrolyte imbalance that can cause a defect in urinary concentrating ability, i.e., nephrogenic diabetes insipidus (NDI), but the molecular mechanism is unknown. We employed proteomic analysis of inner medullary collecting ducts (IMCD) from rats fed with a potassium-free diet for 1 day. IMCD protein quantification was performed by mass spectrometry using a label-free methodology. A total of 131 proteins, including the water channel AQP2, exhibited significant changes in abundance, most of which were decreased. Bioinformatic analysis revealed that many of the down-regulated proteins were associated with the biological processes of generation of precursor metabolites and energy, actin cytoskeleton organization, and cell-cell adhesion. Targeted LC-MS/MS and immunoblotting studies further confirmed the down regulation of 18 selected proteins. Electron microscopy showed autophagosomes/autophagolysosomes in the IMCD cells of rats deprived of potassium for only 1 day. An increased number of autophagosomes was also confirmed by immunofluorescence, demonstrating co-localization of LC3 and Lamp1 with AQP2 and several other down-regulated proteins in IMCD cells. AQP2 was also detected in autophagosomes in IMCD cells of potassium-deprived rats by immunogold electron microscopy. Thus, enhanced autophagic degradation of proteins, most notably including AQP2, is an early event in hypokalemia-induced NDI. PMID:26674602

  7. Early Events in Insulin Fibrillization Studied by Time-Lapse Atomic Force Microscopy

    PubMed Central

    Podestà, Alessandro; Tiana, Guido; Milani, Paolo; Manno, Mauro

    2006-01-01

    The importance of understanding the mechanism of protein aggregation into insoluble amyloid fibrils lies not only in its medical consequences, but also in its more basic properties of self-organization. The discovery that a large number of uncorrelated proteins can form, under proper conditions, structurally similar fibrils has suggested that the underlying mechanism is a general feature of polypeptide chains. In this work, we address the early events preceding amyloid fibril formation in solutions of zinc-free human insulin incubated at low pH and high temperature. Here, we show by time-lapse atomic force microscopy that a steady-state distribution of protein oligomers with a quasiexponential tail is reached within a few minutes after heating. This metastable phase lasts for a few hours, until fibrillar aggregates are observable. Although for such complex systems different aggregation mechanisms can occur simultaneously, our results indicate that the prefibrillar phase is mainly controlled by a simple coagulation-evaporation kinetic mechanism, in which concentration acts as a critical parameter. These experimental facts, along with the kinetic model used, suggest a critical role for thermal concentration fluctuations in the process of fibril nucleation. PMID:16239333

  8. Early events in insulin fibrillization studied by time-lapse atomic force microscopy.

    PubMed

    Podestà, Alessandro; Tiana, Guido; Milani, Paolo; Manno, Mauro

    2006-01-15

    The importance of understanding the mechanism of protein aggregation into insoluble amyloid fibrils lies not only in its medical consequences, but also in its more basic properties of self-organization. The discovery that a large number of uncorrelated proteins can form, under proper conditions, structurally similar fibrils has suggested that the underlying mechanism is a general feature of polypeptide chains. In this work, we address the early events preceding amyloid fibril formation in solutions of zinc-free human insulin incubated at low pH and high temperature. Here, we show by time-lapse atomic force microscopy that a steady-state distribution of protein oligomers with a quasiexponential tail is reached within a few minutes after heating. This metastable phase lasts for a few hours, until fibrillar aggregates are observable. Although for such complex systems different aggregation mechanisms can occur simultaneously, our results indicate that the prefibrillar phase is mainly controlled by a simple coagulation-evaporation kinetic mechanism, in which concentration acts as a critical parameter. These experimental facts, along with the kinetic model used, suggest a critical role for thermal concentration fluctuations in the process of fibril nucleation.

  9. Association of CD8 with p56lck is required for early T cell signalling events.

    PubMed Central

    Chalupny, N J; Ledbetter, J A; Kavathas, P

    1991-01-01

    The human CD8 glycoprotein functions as a co-receptor during T cell activation by both binding to MHC class I and transducing a transmembrane signal. The ability of CD8 to transduce a signal is mediated in part by its association with the protein tyrosine kinase p56lck. Using a panel of human CD8 alpha mutants, we demonstrated that the presence of a functional p56lck binding site is required for the early signalling events transduced by CD8, including increased [Ca2+]i and protein tyrosine phosphorylation. In addition, our results demonstrate that wild-type and all mutant forms of CD8 alpha have an inhibitory effect on signal transduction after CD3-CD3 or CD3-CD4 crosslinking when transfected into the (CD3+, CD4+, CD8-) H9 T cell line, suggesting that intermolecular associations of CD8, independent of its association with p56lck, are responsible for this effect. Signalling through CD4 or CD8 in a double positive thymocyte may therefore be different than in a single positive thymocyte or mature T cell. Images PMID:1902413

  10. Polarization of the endomembrane system is an early event in fucoid zygote development

    PubMed Central

    Hadley, Rhett; Hable, Whitney E; Kropf, Darryl L

    2006-01-01

    Background Fucoid zygotes are excellent experimental organisms for investigating mechanisms that establish cell polarity and determine the site of tip growth. A common feature of polarity establishment is targeting endocytosis and exocytosis (secretion) to localized cortical domains. We have investigated the spatiotemporal development of endomembrane asymmetry in photopolarizing zygotes, and examined the underlying cellular physiology. Results The vital dye FM4-64 was used to visualize endomembranes. The endomembrane system preferentially accumulated at the rhizoid (growth) pole within 4 h of fertilization. The polarized endomembrane array was initially labile and reoriented when the developmental axis changed direction in response to changing light cues. Pharmacological studies indicated that vesicle trafficking, actin and microtubules were needed to maintain endomembrane polarity. In addition, endocytosis required a functional cortical actin cytoskeleton. Conclusion Endomembrane polarization is an early event in polarity establishment, beginning very soon after photolocalization of cortical actin to the presumptive rhizoid site. Targeting of endocytosis and secretion to the rhizoid cortex contributes to membrane asymmetry. We suggest that microtubule-actin interactions, possibly involving microtubule capture and stabilization at actin-rich sites in the rhizoid, may organize the endomembrane array. PMID:16504093

  11. Early life events influence whole-of-life metabolic health via gut microflora and gut permeability.

    PubMed

    Kerr, Caroline A; Grice, Desma M; Tran, Cuong D; Bauer, Denis C; Li, Dongmei; Hendry, Phil; Hannan, Garry N

    2015-01-01

    The capacity of our gut microbial communities to maintain a stable and balanced state, termed 'resilience', in spite of perturbations is vital to our achieving and maintaining optimal health. A loss of microbial resilience is observed in a number of diseases including obesity, diabetes and metabolic syndrome. There are large gaps in our understanding of why an individual's co-evolved microflora consortium fail to develop resilience thereby establishing a trajectory towards poor metabolic health. This review examines the connections between the developing gut microbiota and intestinal barrier function in the neonate, infant and during the first years of life. We propose that the effects of early life events on the gut microflora and permeability, whilst it is in a dynamic and vulnerable state, are fundamental in shaping the microbial consortia's resilience and that it is the maintenance of resilience that is pivotal for metabolic health throughout life. We review the literature supporting this concept suggesting new potential research directions aimed at developing a greater understanding of the longitudinal effects of the gut microflora on metabolic health and potential interventions to recalibrate the 'at risk' infant gut microflora in the direction of enhanced metabolic health.

  12. EFFECT OF ARSENICALS ON THE EXPRESSION OF CELL CYCLE PROTEINS AND EARLY SIGNALING EVENTS IN PRIMARY HUMAN KERATINOCYTES.

    EPA Science Inventory

    Effect of Arsenicals on the Expression of Cell Cycle Proteins and Early Signaling Events in Primary Human Keratinocytes.

    Mudipalli, A, Owen R. D. and R. J. Preston, Environmental Carcinogenesis Division, USEPA, RTP, NC 27711.

    Environmental exposure to arsenic is a m...

  13. Proxies for Redox Conditions during early Aptian Ocean Anoxic Event 1a

    NASA Astrophysics Data System (ADS)

    Brassell, S. C.

    2012-04-01

    Reports of higher concentrations of biomarkers for photic zone anoxia, namely isorenieratane and chlorobactane, in sediments that correspond to warmer episodes during the Cenomanian-Turonian oceanic anoxic event (OAE2) prompts consideration of the potential association of ocean stratification and anoxia with enhanced temperatures during other Ocean Anoxic Events (OAE). Recognition of temperature variations based on the TEX86 proxy for a sediment sequence rich in organic matter from Shatsky Rise (ODP Site 1207) corresponding to OAE1a (early Aptian) affords the opportunity for such an investigation. Moreover, the 50 cm continuous section of this OAE1a interval that was recovered enabled sampling to examine detailed stratigraphic variations in the abundances and compositions of a range of geochemical characteristics, both molecular and elemental, including possible biological responses to temperature fluctuations and other palaeoenvironmental conditions, notably the levels of oxygenation of the depositional setting. The temperature-dependent variations in biomarkers and other geochemical proxies through the OAE1a interval included: (i) decreasing concentrations of 2-methylhopanes derived from cyanobacteria with increasing temperature, and (ii) fluctuations in V concentrations that reflect temperature trends, and correspond closely with organic C contents, except where Corg >30%. Among parameters linked to levels of oxygenation, the biomarker constituents in the OAE1a interval include steroidal and hopanoid ketones consistent with an oxygenated water column, but the sediments also contain traces of isorenieratane from green sulphur bacteria suggesting intermittent photic zone anoxia. Similarly, the observed values far exceeding unity for the lycopane index [(lycopane + n-C35)/n-C31] imply anoxic bottom waters, although the location of Shatsky Rise in the mid-Pacific during the Aptian may skew this ratio because of the paucity of biological sources for n-C31. In

  14. How the timing of weather events influences early development in a large mammal.

    PubMed

    Hendrichsen, D K; Tyler, N J C

    2014-07-01

    Capturing components of the weather that drive environment-animal interactions is a perennial problem in ecology. Identifying biologically significant elements of weather conditions in sensible statistics suitable for analysis of life history variation and population dynamics is central. Meteorological variables such as temperature, precipitation, and wind modulate rates of heat loss in animals, but analysis of their effects on endothermic species is complicated by the fact that their influence on energy balance is not invariably linear, even across the thermoneutral range. Rather, the thermal load imposed by a given set of weather conditions is a function of organisms' metabolic requirement, which, crucially, may vary spontaneously both seasonally and across different life phases. We propose that the endogenous component of variation in metabolic demand introduces a temporal dimension and that, as a consequence, the specific effect of meteorological variables on energy balance and attendant life history parameters is a function of the timing of weather events with respect to the organism's metabolic rhythm(s). To test this, we examined how a spontaneous increase in metabolic demand influenced the effect of weather on early development in a large mammal. Specifically, we examined interaction between the exponential rise in the energy requirements of pregnancy and depth of snow, which restricts dams' access to forage, on the body mass of reindeer calves (Rangifer tarandus) at weaning. As expected, we detected a significant temporal component: the specific negative effect of snow on weaning mass was not constant, but increased across pregnancy. The life history response was therefore better predicted by interaction between the magnitude and the timing of weather events than by their magnitude alone. To our knowledge, this is the first demonstration of the influence of an endogenous metabolic dynamic on the impact of weather on a life history trait in a free

  15. Impact of LIP formation on marine productivity during early Aptian and latest Cenomanian Oceanic Anoxic Events

    NASA Astrophysics Data System (ADS)

    Erba, E.; Duncan, R.

    2003-04-01

    Of all the Cretaceous Oceanic Anoxic Events (OAEs), the Early Aptian OAE1a and latest Cenomanian OAE2 are truly global in nature and typically represented by carbonate crisis and Corg-rich black shales. They correlate with onset and climax of the mid-Cretaceous greenhouse, a time of exceptional warmth with accelerated burial of organic matter, carbon and strontium isotope excursions, and major biotic changes. Extraordinary rates of volcanism during the formation of Ontong Java and Caribbean Plateaus are proposed to have introduced excess CO_2 in the ocean/atmosphere system, turning the climate into a super-greenhouse state. High-resolution multidisciplinary investigations of well-dated sections indicate that marine ecosystems reacted to higher fertility and pCO2 by reducing biomineralization and increasing production of organic matter. In particular, rates of calcitization and evolutionary changes of micrite-forming calcareous nannoplankton (the biological and carbonate pump) affected the organic and inorganic carbon cycle as well as diffusion of atmospheric CO_2 in the Cretaceous ocean. Increasing geological evidence suggests that OAE1a and OAE2 were mainly oceanic productivity events, directly or indirectly controlled by submarine volcanic eruptions. High levels of volcanogenic CO_2 in the atmosphere accelerated continental weathering and increased nutrient content in oceanic surface waters via river run-off. However, only coastal eutrophication can be triggered by river input, and this mechanism cannot explain enhanced primary productivity in remote parts of large oceans like those recorded in wide-spread sediments of OAE1a and OAE2. Conversely, global productivity can be stimulated by hydrothermal megaplumes that introduce in the oceans high concentrations of dissolved and particulate metals that are biolimiting (and toxic) and, consequently, can trigger large blooms (and deaths) of primary producers. We speculate that during OAE1a and OAE2, higher productivity

  16. How the timing of weather events influences early development in a large mammal.

    PubMed

    Hendrichsen, D K; Tyler, N J C

    2014-07-01

    Capturing components of the weather that drive environment-animal interactions is a perennial problem in ecology. Identifying biologically significant elements of weather conditions in sensible statistics suitable for analysis of life history variation and population dynamics is central. Meteorological variables such as temperature, precipitation, and wind modulate rates of heat loss in animals, but analysis of their effects on endothermic species is complicated by the fact that their influence on energy balance is not invariably linear, even across the thermoneutral range. Rather, the thermal load imposed by a given set of weather conditions is a function of organisms' metabolic requirement, which, crucially, may vary spontaneously both seasonally and across different life phases. We propose that the endogenous component of variation in metabolic demand introduces a temporal dimension and that, as a consequence, the specific effect of meteorological variables on energy balance and attendant life history parameters is a function of the timing of weather events with respect to the organism's metabolic rhythm(s). To test this, we examined how a spontaneous increase in metabolic demand influenced the effect of weather on early development in a large mammal. Specifically, we examined interaction between the exponential rise in the energy requirements of pregnancy and depth of snow, which restricts dams' access to forage, on the body mass of reindeer calves (Rangifer tarandus) at weaning. As expected, we detected a significant temporal component: the specific negative effect of snow on weaning mass was not constant, but increased across pregnancy. The life history response was therefore better predicted by interaction between the magnitude and the timing of weather events than by their magnitude alone. To our knowledge, this is the first demonstration of the influence of an endogenous metabolic dynamic on the impact of weather on a life history trait in a free

  17. Phase noise reveals early category-specific modulation of the event-related potentials

    PubMed Central

    Németh, Kornél; Kovács, Petra; Vakli, Pál; Kovács, Gyula; Zimmer, Márta

    2014-01-01

    Previous studies have found that the amplitude of the early event-related potential (ERP) components evoked by faces, such as N170 and P2, changes systematically as a function of noise added to the stimuli. This change has been linked to an increased perceptual processing demand and to enhanced difficulty in perceptual decision making about faces. However, to date it has not yet been tested whether noise manipulation affects the neural correlates of decisions about face and non-face stimuli similarly. To this end, we measured the ERPs for faces and cars at three different phase noise levels. Subjects performed the same two-alternative age-discrimination task on stimuli chosen from young–old morphing continua that were created from faces as well as cars and were calibrated to lead to similar performances at each noise-level. Adding phase noise to the stimuli reduced performance and enhanced response latency for the two categories to the same extent. Parallel to that, phase noise reduced the amplitude and prolonged the latency of the face-specific N170 component. The amplitude of the P1 showed category-specific noise dependence: it was enhanced over the right hemisphere for cars and over the left hemisphere for faces as a result of adding phase noise to the stimuli, but remained stable across noise levels for cars over the left and for faces over the right hemisphere. Moreover, noise modulation altered the category-selectivity of the N170, while the P2 ERP component, typically associated with task decision difficulty, was larger for the more noisy stimuli regardless of stimulus category. Our results suggest that the category-specificity of noise-induced modulations of ERP responses starts at around 100 ms post-stimulus. PMID:24795689

  18. Evaluation of an early warning system for glacial lake outburst flood (GLOF) events in Huaraz, Peru

    NASA Astrophysics Data System (ADS)

    McKinney, D. C.; Somos-Valenzuela, M. A.

    2014-12-01

    People in Cordillera Blanca range in Peru have a long history dealing with natural disasters associated to high mountains; particularly Glacier Lakes Outburst Flood (GLOF). Examples in the Cordillera Blanca vary from a GLOF that occurred in 1941 that killed more than 5000 people in the city of Huaraz to recent events from Lake Artison Baja in 2012 and Lake 513 on 2010, which were not devastating thanks to safety systems previously installed in those lakes. However, glaciers continue melting leaving new lakes or changing the characteristics of lakes that were previously controlled making safety systems obsolete that worked successfully in the past protecting communities downstream. Lake Palcacocha has evolved from being safe after the installation of a safety system in 1970 to an imminent source of GLOF risk due to the expansion that has occurred during the last 40 years increasing from a volume of 500,000 to 17 million m3. In response to this risk the community in Huaraz is planning an Early Warning System (EWS) that will allow the population to mobilize to a safe area in case a GLOF occurs. In this work we present an adaptation of the LifeSIM model to calculate the benefits from such an EWS using 2007 census data and a FLO-2D flood simulation model. The outputs are the number of people in Huaraz that could lose their life due to a GLOF. Our results indicate that without an EWS around 19,773 people could lose their life; whereas, if an EWS is installed the number of victims reduces to 7344. Finally, if mobilization of the affected population is improved the value reduces to 2865. The results show the importance of the EWS as well as informing and training the population to how to react if a GLOF occurs.

  19. Early venous thromboembolic events are associated with worse prognosis in patients with lung cancer

    PubMed Central

    Kourelis, Taxiarchis V.; Wysokinska, Ewa M; Wang, Yi; Yang, Ping; Mansfield, Aaron S.; Tafur, Alfonso J.

    2016-01-01

    Objectives Venous thromboembolic events (VTE) are a leading cause of death in cancer patients. We hypothesized that early VTE (EVTE, within 3 months of diagnosis) in patients with lung cancer (LC) are associated with worse overall survival (OS). Materials and methods We identified 727 patients with LC between 1998 and 2011. Late VTE (LVTE) were defined as VTE occurring after 3 months from LC diagnosis. Advance disease (AD) was defined as patients with Stage IV non-small cell lung cancer (NSCLC) or extensive stage small cell lung cancer (SCLC), and non-advanced disease (non-AD) was defined as ≤ Stage III NSCLC or limited stage SCLC. Results Out of 727 patients included in our review, 617 patients had NSCLC (85%), 94 (13%) SCLC, and 16 (2%) low grade neuroendocrine tumors. Ninety five patients (13%) experienced VTE, 44 (6%) experienced an EVTE and 49 (7%) had a LVTE. Patients with an EVTE had worse OS when compared to all other patients (medians 4 vs. 17 months, p < 0.0001). EVTE were associated with worse OS in patients with non-AD (medians 12 vs. 42 months, p = 0.01) and AD (medians 4 vs. 6 months, p = 0.02). When considering patients with NSCLC only, in a multivariate model that included age, stage, performance status > 2, administration of chemotherapy and Charlson comorbidity index, EVTE were an independent predictor of increased mortality (HR 2.4; 95% CI 1.6–3.3). Conclusions EVTE are associated with worse OS, irrespective of stage of the disease. Our findings underscore the need for an efficient preventive strategy for VTE among patients with lung cancer. PMID:25453848

  20. Combination therapy including CpG oligodeoxynucleotides and entecavir induces early viral response and enhanced inhibition of viral replication in a woodchuck model of chronic hepadnaviral infection.

    PubMed

    Meng, Zhongji; Zhang, Xiaoyong; Pei, Rongjuan; Zhang, Ejuan; Kemper, Thekla; Vollmer, Jörg; Davis, Heather L; Glebe, Dieter; Gerlich, Wolfram; Roggendorf, Michael; Lu, Mengji

    2016-01-01

    CpG oligodeoxynucleotides (ODNs) stimulate immune cells via TLR9 and are potentially useful immunomodulators for the treatment of chronic viral infections. In the present study, different classes of CpGs were tested for their capacities for innate immune activation and antiviral activities in the woodchuck model. A class P CpG ODN was found to stimulate interferon (IFN) production in woodchuck peripheral blood mononuclear cells (PBMCs) in vitro, and following subcutaneous administration in vivo, it was observed to induce IFN and MxA expression in woodchuck PBMCs. Combination treatment with CpG ODN and entecavir (ETV) led to effective suppression of the woodchuck hepatitis virus (WHV) load in the woodchucks, with early viral responses and inhibition of replication. The woodchuck hepatitis surface antigen (WHsAg) serum concentrations were strongly decreased by CpG and ETV together but not by either agent alone, indicating synergistic effects. However, viral control post-treatment was still transient, similar to that observed with ETV alone. Significantly elevated levels of serum aspartate aminotransferase (AST) but not of alanine aminotransferase (ALT) in some of the woodchucks receiving CpG ODN were noted, but these increases were resolved before the completion of treatment and were not associated with an elevated serum bilirubin level or coagulation disorders, suggesting the absence of a significant safety concern. PMID:26585244

  1. The Early Toarcian Oceanic Anoxic Event and its sedimentary record in Switzerland

    NASA Astrophysics Data System (ADS)

    Fantasia, Alicia; Föllmi, Karl B.; Adatte, Thierry; Spangenberg, Jorge E.; Montero-Serrano, Jean-Carlos

    2015-04-01

    In the Jurassic period, the Early Toarcian Oceanic Anoxic Event (T-OAE), about 183 Ma ago, was a global perturbation of paleoclimatic and paleoenvironmental conditions. This episode was associated with a crisis in marine carbonate accumulation, climate warming, an increase in sea level, ocean acidification, enhanced continental weathering, whereas organic-rich sediments are noticeable for example in the Atlantic and in the Tethys. This episode is associated with a negative carbon excursion, which is recorded both in marine and terrestrial environments. The cause(s) of this environmental crisis remain(s) still controversial. Nevertheless, the development of negative δ13C excursions is commonly interpreted as due to the injection of isotopically-light carbon associated with gas hydrate dissociation, the thermal metamorphism of carbon-rich sediments and input of thermogenic and volcanogenic carbon related to the formation of the Karoo-Ferrar basaltic province in southern Gondwana (Hesselbo et al., 2000, 2007; Beerling et al., 2002; Cohen et al., 2004, 2007; McElwain et al., 2005, Beerling and Brentnall, 2007; Svensen et al., 2007; Hermoso et al., 2009, 2012; Mazzini et al., 2010). Several studies of the T-OAE have been conducted on sediments in central and northwest Europe, but only few data are available concerning the Swiss sedimentary records. Therefore, we focused on two sections in the Jura Plateau (canton Aargau): the Rietheim section (Montero-Serrano et al., submitted) and the Gipf section (current study). A multidisciplinary approach has been chosen and the tools to be used are based on sedimentological observations (sedimentary condensation, etc.), biostratigraphy, mineralogy (bulk-rock composition), facies and microfacies analysis (presence or absence of benthos), clay-mineralogy composition (climatic conditions), major and trace-element analyses (productivity, redox conditions, etc.), phosphorus (trophic levels, anoxia), carbon isotopes and organic

  2. Early monitoring of the human polyomavirus BK replication and sequencing analysis in a cohort of adult kidney transplant patients treated with basiliximab

    PubMed Central

    2011-01-01

    previous studies indicating that BKV replication may occur during the early hours after kidney transplantation, reaches the highest incidence in the third post-transplantation month and then decreases within the sixth month, maybe due to induction therapy. Moreover, it might become clinically useful whether specific BKV subtypes or rearrangements could be linked to a particular disease state in order to detect them before BKVAN onset. PMID:21849069

  3. Mood reactivity to daily negative events in early adolescence: relationship to risk for psychopathology.

    PubMed

    Schneiders, Josien; Nicolson, Nancy A; Berkhof, Johannes; Feron, Frans J; van Os, Jim; deVries, Marten W

    2006-05-01

    Emotional responses to negative daily experiences in young adolescents may provide important clues to the development of psychopathology, but research is lacking. This study assessed momentary mood reactivity to daily events as a function of risk profile in a school sample, ages 11-14. High-risk (HR, n=25) and low-risk (LR, n=106) subgroups completed frequent self-reports of mood and events for 5 days. HR adolescents reported more negative events involving family and peers. Multilevel modeling results showed that negative events, especially if stressful, were associated with increased negative and decreased positive affects, with heightened responses in HR adolescents. HR adolescents with greater stress over the last 3 months showed additional increases in depressed mood following negative events. Altered reactivity to and dysfunctional appraisals of daily events may link adolescent risk profiles to later mental health problems.

  4. Interactions of MCP1 with Components of the Replication Machinery in Mammalian Cells

    PubMed Central

    Bronze-da-Rocha, Elsa; Lin, Chii-Mei; Shimura, Tsutomu; Aladjem, Mirit I.

    2011-01-01

    Eukaryotic DNA replication starts with the assembly of a pre-replication complex (pre-RC) at replication origins. We have previously demonstrated that Metaphase Chromosome Protein 1 (MCP1) is involved in the early events of DNA replication. Here we show that MCP1 associates with proteins that are required for the establishment of the pre-replication complex. Reciprocal immunoprecipitation analysis showed that MCP1 interacted with Cdc6, ORC2, ORC4, MCM2, MCM3 and MCM7, with Cdc45 and PCNA. Immunofluorescence studies demonstrated the co-localization of MCP1 with some of those proteins. Moreover, biochemical studies utilizing chromatin-immunoprecipitation (ChIP) revealed that MCP1 preferentially binds replication initiation sites in human cells. Interestingly, although members of the pre-RC are known to interact with some hallmarks of heterochromatin, our co-immunoprecipitation and immunofluorescence analyses showed that MCP1 did not interact and did not co-localize with heterochromatic proteins including HP1β and MetH3K9. These observations suggest that MCP1 is associated with replication factors required for the initiation of DNA replication and binds to the initiation sites in loci that replicate early in S-phase. In addition, immunological assays revealed the association of MCP1 forms with histone H1 variants and mass spectrometry analysis confirmed that MCP1 peptides share common sequences with H1.2 and H1.5 subtypes. PMID:21383955

  5. The Cenozoic Diversity of Agglutinated Foraminifera - Evidence for a late Oligocene to early Miocene diversification event

    NASA Astrophysics Data System (ADS)

    Kaminski, Michael; Setoyama, Eiichi; Kender, Sev; Cetean, Claudia

    2014-05-01

    The agglutinated foraminifera are among the most abundant micro-organisms in the deep marine environment and have a diversity record extending back to the late Precambrian. We present an updated diversity curve for agglutinated foraminiferal genera based on the stratigraphic ranges of all the agglutinated genera recognized as valid in the classification of Kaminski (2014). The data set for this analysis is based on the stratigraphic ranges of agglutinated genera published in Foraminiferal Genera and their Classification, which has been subsequently updated based on published studies and our new observations. The mean standing diversity of agglutinated foraminiferal genera was compiled by counting the number of boundary crossers rather than the number of genera in each stage. In this study, we report the stratigraphic and geographical occurrence of a benthic foraminiferal diversification event that has previously received little attention. In the latest Oligocene to earliest Miocene a number of trochospiral agglutinated genera with alveolar or canaliculate walls first appeared in the fossil record. Our studies of late Oligocene of the Congo fan, offshore Angola (Kender et al., 2008; Cetean and Kaminski, 2011) have revealed a diverse assemblage that includes new taxa of deep-water agglutinated foraminifera. In a biostratigraphic study of the Miocene foraminiferal assemblages Kender et al. (2008) noted steadily increasing diversity and proportions of infaunal agglutinated foraminiferal morphotypes over the lower Miocene interval. The proportion of infaunal agglutinated foraminifera assigned to the order Textularida increased dramatically in the lower mid-Miocene, suggesting expansion of the oxygen minimum zone into deeper waters. In addition to the trochospiral alveolar genera, several species of Reticulophragmium and Cyclammina display rapid diversification into numerous separate lineages that are at present not reflected in our generic diversity record owing to

  6. Organic geochemistry of the early Toarcian oceanic anoxic event in Hawsker Bottoms, Yorkshire, England

    NASA Astrophysics Data System (ADS)

    French, K. L.; Sepúlveda, J.; Trabucho-Alexandre, J.; Gröcke, D. R.; Summons, R. E.

    2014-03-01

    A comprehensive organic geochemical investigation of the Hawsker Bottoms outcrop section in Yorkshire, England has provided new insights about environmental conditions leading into and during the Toarcian oceanic anoxic event (T-OAE; ∼183 Ma). Rock-Eval and molecular analyses demonstrate that the section is uniformly within the early oil window. Hydrogen index (HI), organic petrography, polycyclic aromatic hydrocarbon (PAH) distributions, and tricyclic terpane ratios mark a shift to a lower relative abundance of terrigenous organic matter supplied to the sampling locality during the onset of the T-OAE and across a lithological transition. Unlike other ancient intervals of anoxia and extinction, biomarker indices of planktonic community structure do not display major changes or anomalous values. Depositional environment and redox indicators support a shift towards more reducing conditions in the sediment porewaters and the development of a seasonally stratified water column during the T-OAE. In addition to carotenoid biomarkers for green sulfur bacteria (GSB), we report the first occurrence of okenane, a marker of purple sulfur bacteria (PSB), in marine samples younger than ∼1.64 Ga. Based on modern observations, a planktonic source of okenane's precursor, okenone, would require extremely shallow photic zone euxinia (PZE) and a highly restricted depositional environment. However, due to coastal vertical mixing, the lack of planktonic okenone production in modern marine sulfidic environments, and building evidence of okenone production in mat-dwelling Chromatiaceae, we propose a sedimentary source of okenone as an alternative. Lastly, we report the first parallel compound-specific δC13 record in marine- and terrestrial-derived biomarkers across the T-OAE. The δC13 records of short-chain n-alkanes, acyclic isoprenoids, and long-chain n-alkanes all encode negative carbon isotope excursions (CIEs), and together, they support an injection of isotopically light

  7. Early Verb Learning: How Do Children Learn How to Compare Events?

    ERIC Educational Resources Information Center

    Childers, Jane B.; Parrish, Rebecca; Olson, Christina V.; Burch, Clare; Fung, Gavin; McIntyre, Kevin P.

    2016-01-01

    An important problem verb learners must solve is how to extend verbs. Children could use cross-situational information to guide their extensions; however, comparing events is difficult. In 2 studies, researchers tested whether children benefit from initially seeing a pair of similar events ("progressive alignment") while learning new…

  8. Transfection of Arabidopsis protoplasts with a Plum pox virus (PPV) infectious clone for studying early molecular events associated with PPV infection.

    PubMed

    Raghupathy, Mohan B; Griffiths, Jonathan S; Stobbs, Lorne W; Brown, Daniel C W; Brandle, James E; Wang, Aiming

    2006-09-01

    The development of novel strategies against plant viral diseases relies on a better understanding of molecular virus-host interactions. Here, we report an easy, efficient and reproducible protocol for Arabidopsis protoplast isolation and transfection to study the infection and replication of a potyvirus, Plum pox virus (PPV). Macerozyme and cellulose were used to release protoplasts from Arabidopsis leaf tissues, and polyethylene glycol-mediated DNA uptake was employed for transfection of a PPV infectious clone. Protoplast viability was monitored by fluorescein diacetate staining, and transfection efficiency was estimated by transient expression of the green fluorescent protein. The protocol allowed production of 95% viable mesophyll protoplasts and a successful transfection rate of 35%. The system was used further in a time-course experiment to investigate PPV viral RNA accumulation. It was found that 3 h post-transfection (hpt) in the transfected protoplasts viral RNA increased by about 150-fold and progressively accumulated to reach the maximum at 12 hpt. Viral RNA then decreased dramatically at 24 hpt reaching 40% of its peak level. Considering the availability of the whole genome microarrays, and other genomic resources of Arabidopsis, the synchronized single-cell (protoplast) infection system will be useful for elucidating early molecular events associated with PPV infection. PMID:16777241

  9. A replication-competent retrovirus arising from a split-function packaging cell line was generated by recombination events between the vector, one of the packaging constructs, and endogenous retroviral sequences.

    PubMed

    Chong, H; Starkey, W; Vile, R G

    1998-04-01

    Previously we reported the presence of a replication-competent retrovirus in supernatant from a vector-producing line derived from a widely used split-function amphotropic packaging cell line. Rigorous routine screening of all retroviral stocks produced in our laboratory has not, previously or since, indicated the presence of such a virus. Replication-competent retroviruses have never previously been used in our laboratory, and stringent screening of all routinely used cell lines has not revealed the presence of any helper viruses. Therefore, it is highly unlikely that this virus represents an adventitious cross-contaminant or had been imported unknowingly with our cell line stocks. PCR studies with DNA from infected cell lines and Northern blot analysis and reverse transcriptase PCR with RNA from infected cells suggest that the helper virus arose by recombination events, at sites of partial homology, between sequences in the vector, one of the packaging constructs, and endogenous retroviral elements. These recombinations were not present in stocks of the packaging cell line or in an initial stock of the vector-producing line, indicating that these events occurred while the vector-producing line was being passaged for harvest of supernatant stocks. PMID:9525583

  10. The asymmetry of telomere replication contributes to replicative senescence heterogeneity.

    PubMed

    Bourgeron, Thibault; Xu, Zhou; Doumic, Marie; Teixeira, Maria Teresa

    2015-10-15

    In eukaryotes, the absence of telomerase results in telomere shortening, eventually leading to replicative senescence, an arrested state that prevents further cell divisions. While replicative senescence is mainly controlled by telomere length, the heterogeneity of its onset is not well understood. This study proposes a mathematical model based on the molecular mechanisms of telomere replication and shortening to decipher the causes of this heterogeneity. Using simulations fitted on experimental data obtained from individual lineages of senescent Saccharomyces cerevisiae cells, we decompose the sources of senescence heterogeneity into interclonal and intraclonal components, and show that the latter is based on the asymmetry of the telomere replication mechanism. We also evidence telomere rank-switching events with distinct frequencies in short-lived versus long-lived lineages, revealing that telomere shortening dynamics display important variations. Thus, the intrinsic heterogeneity of replicative senescence and its consequences find their roots in the asymmetric structure of telomeres.

  11. Microgravity Effects on the Early Events of Biological Nitrogen Fixation in Medicago Truncatula: Results from the SyNRGE Experiment

    NASA Technical Reports Server (NTRS)

    Stutte, Gary W.; Roberts, Michael

    2012-01-01

    SyNRGE (Symbiotic Nodulation in a Reduced Gravity Environment) was a sortie mission on STS-135 in the Biological Research in Canisters (BRIC) hardware to study the effect of microgravity on a plant-microbe symbiosis resulting in biological nitrogen fixation. Medicago truncatula, a model species for th legume family, was inoculated with its bacterial symbiont, Sinorhizobium meliloti, to observe early biomolecular events associated with infection and nodulation in Petri Dish Fixation Units (PDFU's).

  12. Interrelationships between Yeast Ribosomal Protein Assembly Events and Transient Ribosome Biogenesis Factors Interactions in Early Pre-Ribosomes

    PubMed Central

    Jakob, Steffen; Ohmayer, Uli; Neueder, Andreas; Hierlmeier, Thomas; Perez-Fernandez, Jorge; Hochmuth, Eduard; Deutzmann, Rainer; Griesenbeck, Joachim; Tschochner, Herbert; Milkereit, Philipp

    2012-01-01

    Early steps of eukaryotic ribosome biogenesis require a large set of ribosome biogenesis factors which transiently interact with nascent rRNA precursors (pre-rRNA). Most likely, concomitant with that initial contacts between ribosomal proteins (r-proteins) and ribosome precursors (pre-ribosomes) are established which are converted into robust interactions between pre-rRNA and r-proteins during the course of ribosome maturation. Here we analysed the interrelationship between r-protein assembly events and the transient interactions of ribosome biogenesis factors with early pre-ribosomal intermediates termed 90S pre-ribosomes or small ribosomal subunit (SSU) processome in yeast cells. We observed that components of the SSU processome UTP-A and UTP-B sub-modules were recruited to early pre-ribosomes independently of all tested r-proteins. On the other hand, groups of SSU processome components were identified whose association with early pre-ribosomes was affected by specific r-protein assembly events in the head-platform interface of the SSU. One of these components, Noc4p, appeared to be itself required for robust incorporation of r-proteins into the SSU head domain. Altogether, the data reveal an emerging network of specific interrelationships between local r-protein assembly events and the functional interactions of SSU processome components with early pre-ribosomes. They point towards some of these components being transient primary pre-rRNA in vivo binders and towards a role for others in coordinating the assembly of major SSU domains. PMID:22431976

  13. A new reporter mouse cytomegalovirus reveals maintained immediate-early gene expression but poor virus replication in cycling liver sinusoidal endothelial cells

    PubMed Central

    2013-01-01

    Background The MCMV major immediate early promoter/enhancer (MIEP) is a bidirectional promoter that drives the expression of the three immediate early viral genes, namely ie1, ie2 and ie3. The regulation of their expression is intensively studied, but still incompletely understood. Methods We constructed a reporter MCMV, (MCMV-MIEPr) expressing YFP and tdTomato under the control of the MIEP as proxies of ie1 and ie2, respectively. Moreover, we generated a liver sinusoidal endothelial cell line (LSEC-uniLT) where cycling is dependent on doxycycline. We used these novel tools to study the kinetics of MIEP-driven gene expression in the context of infection and at the single cell level by flow cytometry and by live imaging of proliferating and G0-arrested cells. Results MCMV replicated to higher titers in G0-arrested LSEC, and cycling cells showed less cytopathic effect or YFP and tdTomato expression at 5 days post infection. In the first 24 h post infection, however, there was no difference in MIEP activity in cycling or G0-arrested cells, although we could observe different profiles of MIEP gene expression in different cell types, like LSECs, fibroblasts or macrophages. We monitored infected LSEC-uniLT in G0 by time lapse microscopy over five days and noticed that most cells survived infection for at least 96 h, arguing that quick lysis of infected cells could not account for the spread of the virus. Interestingly, we noticed a strong correlation between the ratio of median YFP and tdTomato expression and length of survival of infected cells. Conclusion By means of our newly developed genetic tools, we showed that the expression pattern of MCMV IE1 and IE2 genes differs between macrophages, endothelial cells and fibroblasts. Substantial and cell-cycle independent differences in the ie1 and ie2 transcription could also be observed within individual cells of the same population, and marked ie2 gene expression was associated with longer survival of the infected cells

  14. Serotonin Transporter-Linked Polymorphic Region (5-HTTLPR) Genotype and Stressful Life Events Interact to Predict Preschool-Onset Depression: A Replication and Developmental Extension

    ERIC Educational Resources Information Center

    Bogdan, Ryan; Agrawal, Arpana; Gaffrey, Michael S.; Tillman, Rebecca; Luby, Joan L.

    2014-01-01

    Background: Scientific enthusiasm about gene × environment interactions, spurred by the 5-HTTLPR (serotonin transporter-linked polymorphic region) × SLEs (stressful life events) interaction predicting depression, have recently been tempered by sober realizations of small effects and meta-analyses reaching opposing conclusions. These mixed findings…

  15. Human Mitochondrial DNA Replication

    PubMed Central

    Holt, Ian J.; Reyes, Aurelio

    2012-01-01

    Elucidation of the process of DNA replication in mitochondria is in its infancy. For many years, maintenance of the mitochondrial genome was regarded as greatly simplified compared to the nucleus. Mammalian mitochondria were reported to lack all DNA repair systems, to eschew DNA recombination, and to possess but a single DNA polymerase, polymerase γ. Polγ was said to replicate mitochondrial DNA exclusively via one mechanism, involving only two priming events and a handful of proteins. In this “strand-displacement model,” leading strand DNA synthesis begins at a specific site and advances approximately two-thirds of the way around the molecule before DNA synthesis is initiated on the “lagging” strand. Although the displaced strand was long-held to be coated with protein, RNA has more recently been proposed in its place. Furthermore, mitochondrial DNA molecules with all the features of products of conventional bidirectional replication have been documented, suggesting that the process and regulation of replication in mitochondria is complex, as befits a genome that is a core factor in human health and longevity. PMID:23143808

  16. Early events in tissues during infection with pathogenic (SIVmac239) and nonpathogenic (SIVmac1A11) molecular clones of simian immunodeficiency virus.

    PubMed Central

    Lackner, A. A.; Vogel, P.; Ramos, R. A.; Kluge, J. D.; Marthas, M.

    1994-01-01

    The extent of virus replication, tissue distribution, localization of virus within tissues, and the presence of pathological lesions was examined early after experimental infection of rhesus monkeys with simian immunodeficiency virus (SIV). Three strains of SIV were used: molecularly cloned pathogenic SIVmac239; molecularly cloned nonpathogenic SIVmac1A11; and uncloned pathogenic SIVmac. The major targets of infection in all animals at 2 weeks postinoculation were the thymus and spleen. The distribution of virus within lymphoid organs varied with the viral inoculum: nonpathogenic SIVmac1A11 was present primarily within lymphoid follicles and in the thymic cortex; SIVmac239 was present primarily within periarteriolar lymphoid sheaths in the spleen, the paracortex of lymph nodes, and the medulla of the thymus; uncloned SIVmac was present in all these areas but tended to parallel the distribution of SIVmac239. Animals inoculated with nonpathogenic SIVmac1A11 had fewer SIV-positive cells by in situ hybridization and after 13 weeks postinoculation, virus was undetectable in any tissue from these animals. No significant pathological abnormalities were recognized in animals inoculated with this nonpathogenic virus. In contrast, nearly half of the animals inoculated with either SIVmac or SIVmac239 developed significant pathological lesions, including opportunistic infections by 13 weeks postinoculation, highlighting the virulence of these viruses. Our results indicate marked differences in tissue distribution between pathogenic and nonpathogenic molecular clones of SIV during the acute phase of infection. The most striking differences were the absence of SIVmac1A11 from the central nervous system and thymic medulla. The prominent early involvement of the thymus suggests that infection of this organ is a key event in the induction of immune suppression by SIV. Images Figure 1 Figure 2 Figure 3 PMID:8053500

  17. Early terrestrial impact events: Archean spherule layers in the Barberton Greenstone Belt, South Africa

    NASA Astrophysics Data System (ADS)

    Ozdemir, Seda; Koeberl, Christian; Schulz, Toni; Reimold, W. Uwe; Hofmann, Axel

    2015-04-01

    In addition to the oldest known impact structure on Earth, the 2.02-billion-year-old Vredefort Structure in South Africa, the evidence of Early Earth impact events are Archean spherule beds in South Africa and Australia. These spherules have been interpreted as condensation products from impact plumes and molten impact ejecta or/and impact ejecta that were melted during atmospheric re-entry [e.g., 1,2]. The 3.2-3.5 Ga spherule layers in the Barberton Greenstone Belt in South Africa currently represent the oldest known remnants of impact deposits on Earth. Aiming at identification of extraterrestrial components and to determine the diagenetic and metamorphic history of spherule layer intersections recently recovered in the CT3 drill core from the northeastern part of the Barberton Greenstone Belt, we have studied samples from these layers in terms of petrography and geochemistry. All samples, including spherule layer intersections and intercalating country rocks, were studied for mineral identification by optical and electron microscopy, as well as electron microprobe analysis (EPMA) at Natural History Museum Vienna and Museum für Naturkunde Berlin (MfN). Major and trace element compositions were determined via X-ray fluorescence spectrometry at MfN and instrumental neutron activation analysis (INAA) at University of Vienna. Os isotopes were measured by thermal ionization mass spectrometry (N-TIMS) at University of Vienna. Eighteen spherule beds are distributed over 150 meter drill core in CT3. Spherules are variably, deformed or undeformed. The high number of these layers may have been caused by tectonic duplication. Spherule beds are intercalated with shale, chert, carbonate, and/or sulfide deposits (country rocks). The size range of spherules is 0.5 to 2 mm, and some layers exhibit gradation. Shapes of spherules differ from spherical to ovoid, as well as teardrops, and spherules commonly show off-center vesicles, which have been interpreted as a primary

  18. Massive Expansion of Marine Archaea During The Early Albian Oceanic Anoxic Event 1B

    NASA Astrophysics Data System (ADS)

    Kuypers, M. M.; Kuypers, M. M.; Blokker, P.; Erbacher, J.; Kinkel, H.; Pancost, R. D.; Pancost, R. D.; Schouten, S.; Sinninghe Damsté, J. S.

    2001-12-01

    Oceanic anoxic events (OAEs), periods of globally enhanced burial of organic matter (OM) in the marine realm, played an important role in the mid-Cretaceous `greenhouse climate' by effectively reducing atmospheric carbon dioxide concentrations. It is generally believed that these OAEs were caused either by decreased remineralisation or increased production of phytoplanktonic OM. Here we show that enhanced organic carbon (OC) burial during the early Albian OAE1b (~112 My) was caused by a different process. Combined biogeochemical and stable carbon isotopic analyses indicate that black shales from this period contain up to 80% of OC derived from archaea. Archaea-derived isoprenoidal tetraether membrane lipids and free and macromolecularly bound isoprenoid alkanes are abundantly present in these black shales. More specifically the presence of certain ether lipids (cyclic biphytane tetraethers) indicates representatives of the pelagic archaea. To the best of our knowledge this is the earliest fossil evidence for marine planktonic archaea, extending their geological record by more than 60 million years. The diversity of archaeal lipids recovered from the OAE1b black shales suggests that they derive from a multitude of archaeal species. However, the specific 13C enrichment of all such lipids indicates a common `heavy' (13C-rich) carbon source for the archaea and/or a common pathway of carbon-fixation with a reduced 13C fractionation effect compared to the Calvin cycle used by algae, cyanobacteria and higher plants. The large differences (up to 12%) in 13C/12C ratios between the algal biomarkers and the much more abundant archaeal molecular fossils suggest that the latter were not living heterotrophically on photoautotrophic biomass. It seems likely that the archaea present during OAE1b used a chemical energy source (possibly ammonium) for carbon fixation since photoautotrophy within the domain of the Archaea is restricted to only a few species from hypersaline

  19. [Eventful life stories. Members of student fraternities persecuted in Silesia in the early 19th century].

    PubMed

    Schmidt, Walter

    2003-01-01

    This study supplemented by three charts and a list of biographies, is, for the first time, encompassing their life-data, their resumés and even their professional careers as well as political commitments shown by more than 200 Silesian students. They, at the University of Breslau, but also at other German universities, had joined the student fraternities in the 20-ies and early 30-ies of the 19th century and, in consequence, were persecuted by state authorities, notably in Prussia and, in the majority of cases, had been sentenced to prison terms of varying degrees. The first demagogic persecution, which happened in the first half of the twenties, culminating in 1822 in the Breslau Arminen Trail and ending up with the staging of the Youth-Association-Trail in 1826, had implicated about 100 Silesians, with a smaller portion of them - apart from teh three Youth-Association Silesians who were sentenced to five years imprisonment in a fortress - getting away with a relatively short "political fortress imprisonment". Later a considerable part of them made a career in the prussian judicial authority, in the institutions of higher learning, as parish priests, physicians and scientists, whereas any political engagement remained a rare exception. Out of the 137 Silesian members of the student fraternities affected by the second wave of persecution, the overwhelming majority of them being Protestants and originating partly from the middle classes, mostly artisans, and from intellectual background, with about a hundred of them being given essentially higher sentences ranging from six years up to capital punishment and, in the event of reprieves, they had to serve their sentences between six months and four-to-six years in a fortress. The majority of them made a medium-level professional career, never exceeding the medium ranks, as judicial officers, lawyers in state or communal services, parish priests, teachers or physicians. However, from this group of persecuted persons, a

  20. Major events in the late Precambrian to early Triassic geohistory of the Arabian Peninsula

    SciTech Connect

    Stump, T.E.; Connally, T.C.; Van der Eem, J.G.L.A. )

    1993-09-01

    The late Precambrian to Early Triassic of the Arabian Peninsula occur in five supergroups. Their geohistory resulted from sedimentation along fluvial to midshelf facies tracts, eustatic oscillation and periodic uplift. The first supergroup, Plate Precambrian-Middle Cambrian, includes the Siq/Salib and Yatib formations. Deposited by north-eastward-flowing braided streams, they eroded and buried an Arabian shield topography. The Saq Formation lies in angular unconformity on the Siq which documents early Middle Cambrian uplift. Supergroup two, Middle Cambrian-middle Caradocian, the Burj and Saq formations, the Hanadir, Kahfah, and Ra'an members, Qasim Formation, were deposited on a stable continental margin in fluvio-deltaic to midshelf settings. Coastal onlap occurred in the Middle Cambrian, early Llanvirn, middle Llandeilo and early Caradoc. Middle Caradocian uplift deeply eroded parts of central and southern Arabia. Supergroup three of middle Caradocian-early Llandoverian are the Quwarah Member, Qasim Formation and the Zarqa/Sarah formations. They were deposited in a fluvio-deltaic shallow shelf. Late Ashgill uplift, combined with glacially induced sea level lowering, incised valleys up to 2000 ft (610 m) deep. Supergroup four, early Llandovery-Middle Carboniferous, includes the Qalibah, Tawil, Jauf, Jubah and Berwath formations. They were deposited in a fluvio-deltaic marine, river dominated system. The Quysaiba and Sharawra members, Qalibah Formation, were the offshore clays and prodelta sands, the Tawil-Jubah were the fluvial to delta front, and the Berwath the delta plain facies. Deep pre-Tawil erosion documents late Silurian-Early Devonian uplift. The fifth supergroup are the Juwayl, Unayzah, Khuff and Sudair formations. The first two units were deposited in a glacio-fluvial system which eroded and infilled a Hercynian topography. The Khuff transgression occurred during the Artinsklan-Tartarian and the Early Triassic regressive Sudair documents renewed uplift.

  1. Middle Devonian to Early Carboniferous event stratigraphy of Devils Gate and Northern Antelope Range sections, Nevada, U.S.A

    USGS Publications Warehouse

    Sandberg, C.A.; Morrow, J.R.; Poole, F.G.; Ziegler, W.

    2003-01-01

    The classic type section of the Devils Gate Limestone at Devils Gate Pass is situated on the eastern slope of a proto-Antler forebulge that resulted from convergence of the west side of the North American continent with an ocean plate. The original Late Devonian forebulge, the site of which is now located between Devils Gate Pass and the Northern Antelope Range, separated the continental-rise to deep-slope Woodruff basin on the west from the backbulge Pilot basin on the east. Two connections between these basins are recorded by deeper water siltstone beds at Devils Gate; the older one is the lower tongue of the Woodruff Formation, which forms the basal unit of the upper member of the type Devils Gate, and the upper one is the overlying, thin lower member of the Pilot Shale. The forebulge and the backbulge Pilot basin originated during the middle Frasnian (early Late Devonian) Early hassi Zone, shortly following the Alamo Impact within the punctata Zone in southern Nevada. Evidence of this impact is recorded by coeval and reworked shocked quartz grains in the Northern Antelope Range and possibly by a unique bypass-channel or megatsunami-uprush sandy diamictite within carbonate-platform rocks of the lower member of the type Devils Gate Limestone. Besides the Alamo Impact and three regional events, two other important global events are recorded in the Devils Gate section. The semichatovae eustatic rise, the maximum Late Devonian flooding event, coincides with the sharp lithogenetic change at the discordant boundary above the lower member of the Devils Gate Limestone. Most significantly, the Devils Gate section contains the thickest and most complete rock record in North America across the late Frasnian linguiformis Zone mass extinction event. Excellent exposures include not only the extinction shale, but also a younger. Early triangularis Zone tsunamite breccia, produced by global collapse of carbonate platforms during a shallowing event that continued into the next

  2. Seismology-based early identification of dam-formation landquake events

    NASA Astrophysics Data System (ADS)

    Wu, Y. M.; Chao, W. A.

    2015-12-01

    Flooding resulting from the bursting of dams formed by landquake events such as rock avalanches, landslides and debris flows can lead to serious bank erosion and inundation of populated areas near rivers. Seismic waves can be generated by landquake events which can be described as time-dependent forces (unloading/reloading cycles) acting on the Earth. In this study, we conduct inversions of long-period (LP, period ≥ 20 sec) waveforms for different source mechanisms. Results show that single-force (SF) mechanism better explains the observed seismograms generated by landquake events. We then perform inversions for the landquake force histories (LFHs) of ten events, which provide quantitative characterization of the initiation, propagation and termination stages of the slope failures. When the results obtained from LP waveforms are analyzed together with high-frequency (HF, 1-3 Hz) seismic signals, we find a relatively strong late-arriving seismic phase (dubbed Dam-forming phase or D-phase) recorded clearly in the HF waveforms at the closest stations, which potentially marks the time when the collapsed masses sliding into river and perhaps even impacting the topographic barrier on the opposite bank. Consequently, our approach to analyzing the LP and HF waveforms developed in this study has a high potential for identifying five dam-forming landquake events (DFLEs) in near real-time using broadband seismic records, which can provide timely warnings of the impending floods to downstream residents.

  3. Exposure to traumatic events and the behavioral health of children enrolled in an early childhood system of care.

    PubMed

    Snyder, Frank J; Roberts, Yvonne Humenay; Crusto, Cindy A; Connell, Christian M; Griffin, Amy; Finley, Meghan K; Radway, Susan; Marshall, Tim; Kaufman, Joy S

    2012-12-01

    Children may be exposed to numerous types of traumatic events that can negatively affect their development. The scope to which studies have examined an array of events among young children has been limited, thereby restricting our understanding of exposure and its relationship to behavioral functioning. The current cross-sectional study describes traumatic event exposure in detail and its relationship to behavioral health among an at-risk sample of young children (N = 184), under 6 years of age, upon enrollment into an early childhood, family-based, mental health system of care. Caregivers completed home-based semistructured interviews that covered children's exposure to 24 different types of traumatic events and behavioral and emotional functioning. Findings indicated that nearly 72% of young children experienced 1 or more types of traumatic events. Multiple regression model results showed that exposure was significantly associated with greater behavioral and emotional challenges with children's age, gender, race/ethnicity, household income, and caregiver's education in the model. These findings highlight the prevalence of traumatic exposures among an at-risk sample of young children in a system of care and suggest that this exposure is associated with behavioral and emotional challenges at a young age.

  4. Human papillomavirus type 31 replication modes during the early phases of the viral life cycle depend on transcriptional and posttranscriptional regulation of E1 and E2 expression.

    PubMed

    Hubert, Walter G; Laimins, Laimonis A

    2002-03-01

    The E1 and E2 proteins are both required for papillomavirus DNA replication, and replication efficiency is controlled by the abundance of these factors. In human papillomaviruses (HPVs), the regulation of E1 and E2 expression and its effect on viral replication are not well understood. In particular, it is not known if E1 and E2 modulate their own expression and how posttranscriptional mechanisms may affect the levels of the replication proteins. Previous studies have implicated splicing within the E6 open reading frame (ORF) as being important for modulating replication of HPV type 31 (HPV31) through altered expression of E1 and E2. To analyze the function of the E6 intron in viral replication more specifically, we examined the effects of E6 splicing mutations in the context of entire viral genomes in transient assays. HPV31 genomes which had mutations in the splice donor site (E6SD) or the splice acceptor site (E6SA), a deletion of the intron (E6ID), or substituted heterologous intron sequences (E6IS) were constructed. Compared to wild-type (wt) HPV31, pHPV31-E6SD, -E6SA, and -E6IS replicated inefficiently while pHPV31-E6ID replicated at an intermediate level. Cotransfection of the E6 mutant genomes with an E1 expression vector strongly activated their replication levels, indicating that efficient expression of E1 requires E6 internal splicing. In contrast, replication was activated only moderately with an E2 expression vector. Replacing the wt E6 intron in HPV31 with a heterologous intron from simian virus 40 (E6SR2) resulted in replication levels similar to that of the wt in the absence of expression vectors, suggesting that mRNA splicing upstream of the E1 ORF is important for high-level replication. To examine the effects of E6 intron splicing on E1 and E2 expression directly, we constructed reporter DNAs in which the luciferase coding sequences were fused in frame to the E1 (E1Luc) or E2 (E2Luc) gene. Reporter activities were then analyzed in transient

  5. Carbonate platform drowning events along the northern Tethyan margin during the early Cretaceous

    NASA Astrophysics Data System (ADS)

    Föllmi, K. B.; van de Schootbrugge, B.; Godet, A.; Bodin, S.; Linder, P.; Adatte, Th.

    2003-04-01

    During the early Cretaceous, the carbonate platform attached to the northern Tethyan margin experienced a series of platform drowning episodes, which can be widely traced. The five episodes recognized cover the early Valanginian to early Hauterivian (D1), middle Hauterivian (D2), late Hauterivian to early Barremian (D3), early to early late Aptian (D4), and late Aptian to early Albian (D5). The particular sensitivity towards drowning in this platform system was probably related to its marginal paleoposition (ca. 30 degree N) with regards to reef growth, to its attachment to the European continent (a periodic source of reef-unfriendly weathering products), as well as to prevailing paleoceanographic conditions (sea-level change, upwelling intensity, presence or absence of connections to the boreal realm). Drowning episodes are usually preceded by changes in carbonate production from a chlorozoan to a foramol mode, with important increases in accumulation rates. The drowning episodes themselves are documented by erosional surfaces and/or by the formation of strongly condensed beds rich in coarse sand, glauconite, phosphate, and biosilica. The presence of ammonites is a key to their dating. If resolvable, the onset of drowning appears to be diachronous, and its evolution is by stepwise onlap onto the platform (D1, D4). Termination of drowning appears in all cases synchronous. Drowning episodes D1, D4, and D5 are correlated to positive excursions in the delta C-13 record, albeit with a slight diachronity in their onsets (drowning episodes lead the delta C-13 record), whereas episode D2 correlates to a negative excursion and episode D3 to a long and steady increase in delta C-13 values. This suggests that no uniform mechanism can be assumed for all five episodes but that each episode needs to be examined in its own context. An important element in all episodes is the change in weathering style and intensity in the continental hinterland, which profoundly affected

  6. Predicting Addiction Potential on the Basis of Early Traumatic Events, Dissociative Experiences, and Suicide Ideation

    PubMed Central

    Sajadi, Seyedeh Fatemeh; Hajjari, Zahra; Zargar, Yadollah; Mehrabizade Honarmand, Mahnaz; Arshadi, Nasrin

    2014-01-01

    Background: There is a great deal of medical literature suggesting that substance use disorder is a serious clinical concern, affecting general population and associated with considerable economic, societal, and personal costs. Objectives: This study sought to clarify the relationship between early trauma, dissociative experience, and suicide ideation as predictive factors of active and passive addiction potential (A/PAP) in high-school students. Patients and Methods: Three hundred students with the mean age of 15.72 y were selected via multistage random sampling. All participants were asked to complete Iranian addiction potential scale, early trauma inventory, dissociative experiences scale, and Beck’s suicide ideation scale. Analyzing data was done using canonical correlation. Results: Structural coefficients showed that the pattern of high scores in A/PAP correlates with the pattern of high scores in early trauma, dissociative experience and suicide ideation. The findings of the study showed that the combination of low A/PAP can probably decrease the likelihood of early trauma, dissociative experience and suicide ideation. Conclusions: Early trauma, dissociative experience, and suicide ideation can predict A/PAP and explain the considerable variance of survival index. PMID:25741480

  7. The Caulobacter crescentus ctrA P1 promoter is essential for the coordination of cell cycle events that prevent the overinitiation of DNA replication.

    PubMed

    Schredl, Alexander T; Perez Mora, Yannet G; Herrera, Anabel; Cuajungco, Math P; Murray, Sean R

    2012-10-01

    The master regulator CtrA oscillates during the Caulobacter cell cycle due to temporally regulated proteolysis and transcription. It is proteolysed during the G1-S transition and reaccumulates in predivisional cells as a result of transcription from two sequentially activated promoters, P1 and P2. CtrA reinforces its own synthesis by directly mediating the activation of P2 concurrently with repression of P1. To explore the role of P1 in cell cycle control, we engineered a mutation into the native ctrA locus that prevents transcription from P1 but not P2. As expected, the ctrA P1 mutant exhibits striking growth, morphological and DNA replication defects. Unexpectedly, we found CtrA and its antagonist SciP, but not DnaA, GcrA or CcrM accumulation to be dramatically reduced in the ctrA P1 mutant. SciP levels closely paralleled CtrA accumulation, suggesting that CtrA acts as a rheostat to modulate SciP abundance. Furthermore, the reappearance of CtrA and CcrM in predivisional cells was delayed in the P1 mutant by 0.125 cell cycle unit in synchronized cultures. High levels of ccrM transcription despite low levels of CtrA and increased transcription of ctrA P2 in the ctrA P1 mutant are two examples of robustness in the cell cycle. Thus, Caulobacter can adjust regulatory pathways to partially compensate for reduced and delayed CtrA accumulation in the ctrA P1 mutant.

  8. Binding sites for the herpes simplex virus immediate-early protein ICP4 impose an increased dependence on viral DNA replication on simple model promoters located in the viral genome.

    PubMed

    Koop, K E; Duncan, J; Smiley, J R

    1993-12-01

    We examined the ability of binding sites for the herpes simplex virus immediate-early protein ICP4 to alter the regulation of closely linked promoters by placing strong ICP4 binding sites upstream or downstream of simple TATA promoters in the intact viral genome. We found that binding sites strongly reduced the levels of expression at early times postinfection and that this effect was partially overcome after the onset of viral DNA replication. These data confirm that DNA-bound ICP4 can inhibit the activity of a closely linked promoter and raise the possibility that ICP4 binding sites contribute to temporal regulation during infection.

  9. Seismology-based early identification of dam-formation landquake events.

    PubMed

    Chao, Wei-An; Zhao, Li; Chen, Su-Chin; Wu, Yih-Min; Chen, Chi-Hsuan; Huang, Hsin-Hua

    2016-01-01

    Flooding resulting from the bursting of dams formed by landquake events such as rock avalanches, landslides and debris flows can lead to serious bank erosion and inundation of populated areas near rivers. Seismic waves can be generated by landquake events which can be described as time-dependent forces (unloading/reloading cycles) acting on the Earth. In this study, we conduct inversions of long-period (LP, period ≥20 s) waveforms for the landquake force histories (LFHs) of ten events, which provide quantitative characterization of the initiation, propagation and termination stages of the slope failures. When the results obtained from LP waveforms are analyzed together with high-frequency (HF, 1-3 Hz) seismic signals, we find a relatively strong late-arriving seismic phase (dubbed Dam-forming phase or D-phase) recorded clearly in the HF waveforms at the closest stations, which potentially marks the time when the collapsed masses sliding into river and perhaps even impacting the topographic barrier on the opposite bank. Consequently, our approach to analyzing the LP and HF waveforms developed in this study has a high potential for identifying five dam-forming landquake events (DFLEs) in near real-time using broadband seismic records, which can provide timely warnings of the impending floods to downstream residents. PMID:26753931

  10. Riding the Wave to Reach the Masses: Natural Events in Early Twentieth Century Portuguese Daily Press

    ERIC Educational Resources Information Center

    Simoes, Ana; Carneiro, Ana; Diogo, Maria Paula

    2012-01-01

    This paper brings together science communicated in newspapers in Portugal by looking at how news on natural events were communicated in two different newspapers--the capital newspaper "Diario de Noticias" ("Daily News") and the "Diario dos Acores" ("Azores Daily"). In particular, we look at how the 1900 solar eclipse, a hot topic throughout…

  11. Origins of Early Adolescents' Hope: Personality, Parental Attachment, and Stressful Life Events

    ERIC Educational Resources Information Center

    Otis, Kristin L.; Huebner, E. Scott; Hills, Kimberly J.

    2016-01-01

    Psychology has recently increased attention to identifying psychological qualities in individuals that indicate positive mental health, such as hope. In an effort to understand further the origins of hope, we examined the relations among parental attachment, stressful life events, personality variables, and hope in a sample of 647 middle school…

  12. Seismology-based early identification of dam-formation landquake events

    PubMed Central

    Chao, Wei-An; Zhao, Li; Chen, Su-Chin; Wu, Yih-Min; Chen, Chi-Hsuan; Huang, Hsin-Hua

    2016-01-01

    Flooding resulting from the bursting of dams formed by landquake events such as rock avalanches, landslides and debris flows can lead to serious bank erosion and inundation of populated areas near rivers. Seismic waves can be generated by landquake events which can be described as time-dependent forces (unloading/reloading cycles) acting on the Earth. In this study, we conduct inversions of long-period (LP, period ≥20 s) waveforms for the landquake force histories (LFHs) of ten events, which provide quantitative characterization of the initiation, propagation and termination stages of the slope failures. When the results obtained from LP waveforms are analyzed together with high-frequency (HF, 1–3 Hz) seismic signals, we find a relatively strong late-arriving seismic phase (dubbed Dam-forming phase or D-phase) recorded clearly in the HF waveforms at the closest stations, which potentially marks the time when the collapsed masses sliding into river and perhaps even impacting the topographic barrier on the opposite bank. Consequently, our approach to analyzing the LP and HF waveforms developed in this study has a high potential for identifying five dam-forming landquake events (DFLEs) in near real-time using broadband seismic records, which can provide timely warnings of the impending floods to downstream residents. PMID:26753931

  13. Seismology-based early identification of dam-formation landquake events.

    PubMed

    Chao, Wei-An; Zhao, Li; Chen, Su-Chin; Wu, Yih-Min; Chen, Chi-Hsuan; Huang, Hsin-Hua

    2016-01-12

    Flooding resulting from the bursting of dams formed by landquake events such as rock avalanches, landslides and debris flows can lead to serious bank erosion and inundation of populated areas near rivers. Seismic waves can be generated by landquake events which can be described as time-dependent forces (unloading/reloading cycles) acting on the Earth. In this study, we conduct inversions of long-period (LP, period ≥20 s) waveforms for the landquake force histories (LFHs) of ten events, which provide quantitative characterization of the initiation, propagation and termination stages of the slope failures. When the results obtained from LP waveforms are analyzed together with high-frequency (HF, 1-3 Hz) seismic signals, we find a relatively strong late-arriving seismic phase (dubbed Dam-forming phase or D-phase) recorded clearly in the HF waveforms at the closest stations, which potentially marks the time when the collapsed masses sliding into river and perhaps even impacting the topographic barrier on the opposite bank. Consequently, our approach to analyzing the LP and HF waveforms developed in this study has a high potential for identifying five dam-forming landquake events (DFLEs) in near real-time using broadband seismic records, which can provide timely warnings of the impending floods to downstream residents.

  14. Integrating Sentence-Structural and Event Information in Early Verb Learning

    ERIC Educational Resources Information Center

    Yuan, Sylvia Hsin Wei

    2009-01-01

    Children use syntax as well as observations of events to learn verb meanings. This is known as syntactic bootstrapping. This dissertation investigated the origins and mechanisms of syntactic bootstrapping. Prior evidence suggested that two-year-olds, but not younger children, could use aspects of sentence structure to assign different…

  15. Mood Reactivity to Daily Negative Events in Early Adolescence: Relationship to Risk for Psychopathology

    ERIC Educational Resources Information Center

    Schneiders, Josien; Nicolson, Nancy A.; Berkhof, Johannes; Feron, Frans J.; van Os, Jim; deVries, Marten W.

    2006-01-01

    Emotional responses to negative daily experiences in young adolescents may provide important clues to the development of psychopathology, but research is lacking. This study assessed momentary mood reactivity to daily events as a function of risk profile in a school sample, ages 11-14. High-risk (HR, n = 25) and low-risk (LR, n = 106) subgroups…

  16. Early Processing of Emotional Faces in Children with Autism: An Event-Related Potential Study

    ERIC Educational Resources Information Center

    Batty, Magali; Meaux, Emilie; Wittemeyer, Kerstin; Roge, Bernadette; Taylor, Margot J.

    2011-01-01

    Social deficits are one of the most striking manifestations of autism spectrum disorders (ASDs). Among these social deficits, the recognition and understanding of emotional facial expressions has been widely reported to be affected in ASDs. We investigated emotional face processing in children with and without autism using event-related potentials…

  17. Traumatic and Stressful Events in Early Childhood: Can Treatment Help Those at Highest Risk?

    ERIC Educational Resources Information Center

    Ippen, Chandra Ghosh; Harris, William W.; Van Horn, Patricia; Lieberman, Alicia F.

    2011-01-01

    Objective: This study involves a reanalysis of data from a randomized controlled trial to examine whether child-parent psychotherapy (CPP), an empirically based treatment focusing on the parent-child relationship as the vehicle for child improvement, is efficacious for children who experienced multiple traumatic and stressful life events (TSEs).…

  18. Exposure to Potentially Traumatic Events in Early Childhood: Differential Links to Emergent Psychopathology

    ERIC Educational Resources Information Center

    Briggs-Gowan, Margaret J.; Carter, Alice S.; Clark, Roseanne; Augustyn, Marilyn; McCarthy, Kimberly J.; Ford, Julian D.

    2010-01-01

    Research NeedsObjective: To examine associations between exposure to potentially traumatic events (PTEs) and clinical patterns of symptoms and disorders in preschool children. Method: Two hundred and thirteen referred and non-referred children, ages 24 to 48 months (MN = 34.9, SD = 6.7 months) were studied. Lifetime exposure to PTEs (family…

  19. Modeling and analysis of early events in T-lymphocyte antigen-activated intracellular-signaling pathways

    NASA Astrophysics Data System (ADS)

    Zheng, Yanan; Balakrishnan, Venkataramanan; Buzzard, Greg; Geahlen, Robert; Harrison, Marietta; Rundell, Ann

    2005-12-01

    The T-cell antigen-activated signaling pathway is a highly regulated intracellular biochemical system that is crucial for initiating an appropriate adaptive immune response. To improve the understanding of the complex regulatory mechanisms controlling the early events in T-cell signaling, a detailed mathematical model was developed that utilizes ordinary differential equations to describe chemical reactions of the signaling pathway. The model parameter values were constrained by experimental data on the activation of a specific signaling intermediate and indicated an initial rapid cascade of phosphorylation events followed by a comparatively slow signal downregulation. Nonlinear analysis of the model suggested that thresholding and bistability occur as a result of the embedded positive and negative feedback loops within the model. These nonlinear system properties may enhance the T-cell receptor specificity and provide sub-threshold noise filtering with switch-like behavior to ensure proper cell response. Additional analysis using a reduced second-order model led to further understanding of the observed system behavior. Moreover, the interactions between the positive and negative feedback loops enabled the model to exhibit, among a variety of other feasible dynamics, a sustained oscillation that corresponds to a stable limit cycle in the two-dimensional phase plane. Quantitative analysis in this paper has helped identify potential regulatory mechanisms in the early T-cell signaling events. This integrated approach provides a framework to quantify and discover the ensemble of interconnected T-cell antigen-activated signaling pathways from limited experimental data.

  20. TP53 mutations are early events in chronic lymphocytic leukemia disease progression and precede evolution to complex karyotypes.

    PubMed

    Lazarian, Gregory; Tausch, Eugen; Eclache, Virginie; Sebaa, Amel; Bianchi, Vincent; Letestu, Remi; Collon, Jean-Francois; Lefebvre, Valerie; Gardano, Laura; Varin-Blank, Nadine; Soussi, Thierry; Stilgenbauer, Stephen; Cymbalista, Florence; Baran-Marszak, Fanny

    2016-10-15

    TP53 abnormalities lead to resistance to purine analogues and are found in over 40% of patients with refractory chronic lymphocytic leukemia (CLL). At diagnosis, no more than 5% of patients carry the 17p deletion, most cases harbour mutations within the other TP53 allele. The incidence of a TP53 mutation as the only alteration is approximately 5%, but this depends on the sensitivity of the technique. Recently, having a complex karyotype has been considered a strong adverse prognostic factor. However, there are no longitudinal studies simultaneously examining the presence of the 17p deletion, TP53 mutations and karyotype abnormalities. We conducted a retrospective longitudinal study of 31 relapsed/refractory CLL patients. Two to six blood samples per patient were analyzed, with a median follow-up of 8 years. In this report, we assessed the sequence of events of TP53 clonal evolution and correlated the presence of TP53 abnormalities to genetic instability during progression and treatment. Next-generation sequencing allowed the early detection of TP53 mutated clones and was able to be performed on a routine basis, demonstrating an excellent correlation between the Illumina and Ion Torrent technologies. We concluded that TP53 mutations are early events and precede clonal evolution to complex karyotypes. We strongly recommend the early and iterated detection of TP53 mutations in progressive cases. PMID:27270786

  1. IL-17A mediates inflammatory and tissue remodelling events in early human tendinopathy

    PubMed Central

    Millar, Neal L.; Akbar, Moeed; Campbell, Abigail L.; Reilly, James H.; Kerr, Shauna C.; McLean, Michael; Frleta-Gilchrist, Marina; Fazzi, Umberto G.; Leach, William J.; Rooney, Brian P.; Crowe, Lindsay A. N.; Murrell, George A. C.; McInnes, Iain B.

    2016-01-01

    Increasingly, inflammatory mediators are considered crucial to the onset and perpetuation of tendinopathy. We sought evidence of interleukin 17A (IL-17A) expression in early human tendinopathy and thereafter, explored mechanisms whereby IL-17A mediated inflammation and tissue remodeling in human tenocytes. Torn supraspinatus tendon (established pathology) and matched intact subscapularis tendon (representing ‘early pathology’) along with control biopsies were collected from patients undergoing shoulder surgery. Markers of inflammation and IL-17A were quantified by RT-PCR and immunohistochemistry. Human tendon cells were derived from hamstring tendon obtained during ACL reconstruction. In vitro effects of IL-17A upon tenocytes were measured using RT-PCR, multiplex cytokine assays, apoptotic proteomic profiling, immunohistochemistry and annexin V FACS staining. Increased expression of IL-17A was detected in ‘early tendinopathy’ compared to both matched samples and non-matched control samples (p < 0.01) by RT-PCR and immunostaining. Double immunofluoresence staining revealed IL-17A expression in leukocyte subsets including mast cells, macrophages and T cells. IL-17A treated tenocytes exhibited increased production of proinflammatory cytokines (p < 0.001), altered matrix regulation (p < 0.01) with increased Collagen type III and increased expression of several apoptosis related factors. We propose IL-17A as an inflammatory mediator within the early tendinopathy processes thus providing novel therapeutic approaches in the management of tendon disorders. PMID:27263531

  2. IL-17A mediates inflammatory and tissue remodelling events in early human tendinopathy.

    PubMed

    Millar, Neal L; Akbar, Moeed; Campbell, Abigail L; Reilly, James H; Kerr, Shauna C; McLean, Michael; Frleta-Gilchrist, Marina; Fazzi, Umberto G; Leach, William J; Rooney, Brian P; Crowe, Lindsay A N; Murrell, George A C; McInnes, Iain B

    2016-01-01

    Increasingly, inflammatory mediators are considered crucial to the onset and perpetuation of tendinopathy. We sought evidence of interleukin 17A (IL-17A) expression in early human tendinopathy and thereafter, explored mechanisms whereby IL-17A mediated inflammation and tissue remodeling in human tenocytes. Torn supraspinatus tendon (established pathology) and matched intact subscapularis tendon (representing 'early pathology') along with control biopsies were collected from patients undergoing shoulder surgery. Markers of inflammation and IL-17A were quantified by RT-PCR and immunohistochemistry. Human tendon cells were derived from hamstring tendon obtained during ACL reconstruction. In vitro effects of IL-17A upon tenocytes were measured using RT-PCR, multiplex cytokine assays, apoptotic proteomic profiling, immunohistochemistry and annexin V FACS staining. Increased expression of IL-17A was detected in 'early tendinopathy' compared to both matched samples and non-matched control samples (p < 0.01) by RT-PCR and immunostaining. Double immunofluoresence staining revealed IL-17A expression in leukocyte subsets including mast cells, macrophages and T cells. IL-17A treated tenocytes exhibited increased production of proinflammatory cytokines (p < 0.001), altered matrix regulation (p < 0.01) with increased Collagen type III and increased expression of several apoptosis related factors. We propose IL-17A as an inflammatory mediator within the early tendinopathy processes thus providing novel therapeutic approaches in the management of tendon disorders. PMID:27263531

  3. Spiders do not evoke greater early posterior negativity in the event-related potential as snakes.

    PubMed

    He, Hongshen; Kubo, Kenta; Kawai, Nobuyuki

    2014-09-10

    It has been long believed that both snakes and spiders are archetypal fear stimuli for humans. Furthermore, snakes have been assumed as stronger threat cues for nonhuman primates. However, it is still unclear whether spiders hold a special status in human perception. The current study explored to what extent spider pictures draw early visual attention [as assessed with early posterior negativity (EPN)] when compared with insects similar to spiders. To measure the EPN, participants watched a random rapid serial presentation of pictures, which consisted of two conditions: spider condition (spider, wasp, bumblebee, beetle) and snake condition (snake, bird). EPN amplitudes revealed no significant difference between spider, wasp, bumblebee, and beetle pictures, whereas EPN amplitudes were significantly larger for snake pictures relative to bird pictures. In addition, EPN amplitudes were significantly larger for snake pictures relative to spider pictures. These results suggest that the early visual attentional capture of animate objects is stronger for snakes, whereas spiders do not appear to hold special early attentional value.

  4. Introduction: Cortical event-related potentials and early language development: Variations with age and nutrition

    Technology Transfer Automated Retrieval System (TEKTRAN)

    There is increasing evidence in the form of language-relevant sensory processing and discrimination that the foundations for speech perception are present at birth and are subject to significant modification during the first year of life. However, charting the course of early language development is...

  5. The Canonical Immediate Early 3 Gene Product pIE611 of Mouse Cytomegalovirus Is Dispensable for Viral Replication but Mediates Transcriptional and Posttranscriptional Regulation of Viral Gene Products

    PubMed Central

    Rattay, Stephanie; Trilling, Mirko; Megger, Dominik A.; Sitek, Barbara; Meyer, Helmut E.; Hengel, Hartmut

    2015-01-01

    ABSTRACT Transcription of mouse cytomegalovirus (MCMV) immediate early ie1 and ie3 is controlled by the major immediate early promoter/enhancer (MIEP) and requires differential splicing. Based on complete loss of genome replication of an MCMV mutant carrying a deletion of the ie3-specific exon 5, the multifunctional IE3 protein (611 amino acids; pIE611) is considered essential for viral replication. Our analysis of ie3 transcription resulted in the identification of novel ie3 isoforms derived from alternatively spliced ie3 transcripts. Construction of an IE3-hemagglutinin (IE3-HA) virus by insertion of an in-frame HA epitope sequence allowed detection of the IE3 isoforms in infected cells, verifying that the newly identified transcripts code for proteins. This prompted the construction of an MCMV mutant lacking ie611 but retaining the coding capacity for the newly identified isoforms ie453 and ie310. Using Δie611 MCMV, we demonstrated the dispensability of the canonical ie3 gene product pIE611 for viral replication. To determine the role of pIE611 for viral gene expression during MCMV infection in an unbiased global approach, we used label-free quantitative mass spectrometry to delineate pIE611-dependent changes of the MCMV proteome. Interestingly, further analysis revealed transcriptional as well as posttranscriptional regulation of MCMV gene products by pIE611. IMPORTANCE Cytomegaloviruses are pathogenic betaherpesviruses persisting in a lifelong latency from which reactivation can occur under conditions of immunosuppression, immunoimmaturity, or inflammation. The switch from latency to reactivation requires expression of immediate early genes. Therefore, understanding of immediate early gene regulation might add insights into viral pathogenesis. The mouse cytomegalovirus (MCMV) immediate early 3 protein (611 amino acids; pIE611) is considered essential for viral replication. The identification of novel protein isoforms derived from alternatively spliced ie3

  6. Ar-Ar Dating of Martian Meteorite, Dhofar 378: An Early Shock Event?

    NASA Technical Reports Server (NTRS)

    Park, J.; Bogard, D. D.

    2006-01-01

    Martian meteorite, Dhofar 378 (Dho378) is a basaltic shergottite from Oman, weighing 15 g, and possessing a black fusion crust. Chemical similarities between Dho378 and the Los Angeles 001 shergottite suggests that they might have derived from the same Mars locale. The plagioclase in other shergottites has been converted to maskelenite by shock, but Dho378 apparently experienced even more intense shock heating, estimated at 55-75 GPa. Dho378 feldspar (approximately 43 modal %) melted, partially flowed and vesiculated, and then partially recrystallized. Areas of feldspathic glass are appreciably enriched in K, whereas individual plagioclases show a range in the Or/An ratio of approximately 0.18-0.017. Radiometric dating of martian shergottites indicate variable formation times of 160-475 Myr, whereas cosmic ray exposure (CRE) ages of shergottites indicate most were ejected from Mars within the past few Myr. Most determined Ar-39-Ar-40 ages of shergottites appear older than other radiometric ages because of the presence of large amounts of martian atmosphere or interior Ar-40. Among all types of meteorites and returned lunar rocks, the impact event that initiated the CRE age very rarely reset the Ar-Ar age. This is because a minimum time and temperature is required to facilitate Ar diffusion loss. It is generally assumed that the shock-texture characteristics in martian meteorites were produced by the impact events that ejected the rocks from Mars, although the time of these shock events (as opposed to CRE ages) are not directly dated. Here we report Ar-39-Ar-40 dating of Dho378 plagioclase. We suggest that the determined age dates the intense shock heating event this meteorite experienced, but that it was not the impact that initiated the CRE age.

  7. The "terminal Triassic catastrophic extinction event" in perspective: a review of carboniferous through Early Jurassic terrestrial vertebrate extinction patterns

    USGS Publications Warehouse

    Weems, R.E.

    1992-01-01

    A catastrophic terminal Triassic extinction event among terrestrial vertebrates is not supported by available evidence. The current model for such an extinction is based on at least eight weak or untenable assumptions: (1) a terminal Triassic extinction-inducing asteroid impact occurred, (2) a terminal Triassic synchronous mass extinction of terrestrial vertebrates occurred, (3) a concurrent terminal Triassic marine extinction occurred, (4) all terrestrial vertebrate families have similar diversities and ecologies, (5) changes in familial diversity can be gauged accurately from the known fossil record, (6) extinction of families can be compared through time without normalizing for changes in familial diversity through time, (7) extinction rates can be compared without normalizing for differing lengths of geologic stages, and (8) catastrophic mass extinctions do not select for small size. These assumptions have resulted in unsupportable and (or) erroneous conclusions. Carboniferous through Early Jurassic terrestrial vertebrate families mostly have evolution and extinction patterns unlike the vertebrate evolution and extinction patterns during the terminal Cretaceous event. Only the Serpukhovian (mid Carboniferous) extinction event shows strong analogy to the terminal Cretaceous event. Available data suggest no terminal Triassic extinction anomaly, but rather a prolonged and nearly steady decline in the global terrestrial vertebrate extinction rate throughout the Triassic and earliest Jurassic. ?? 1992.

  8. Modeling evidences for global warming, Arctic seawater freshening, and sluggish oceanic circulation during the Early Toarcian anoxic event

    NASA Astrophysics Data System (ADS)

    Dera, Guillaume; Donnadieu, Yannick

    2012-06-01

    The paleoecological disturbances recorded during the Early Toarcian warming event (183 Myr ago), including marine anoxia, sea level rise, seawater acidification, carbonate production crisis, and species extinctions, are often regarded as past examples of Earth's possible responses to the rapid emergence of super greenhouse conditions. However, physical mechanisms explaining both the global and local expressions of paleoenvironmental events are still highly debated. Here we analyze the paleoclimatic and paleoceanographic consequences of increases in atmospheric pCO2 levels at a multiscale resolution using a fully coupled ocean-atmosphere model (FOAM). We show that, in association with stronger high-latitude precipitation rates and enhanced continental runoff, the demise of polar sea ice due to the global warming event involved a regional freshening of Arctic surface seawaters. These disturbances lead to progressive slowdowns of the global oceanic circulation accountable for widespread ocean stratification and bottom anoxia processes in deep oceanic settings and epicontinental basins. In agreement with very negative oxygen isotope values measured on fossil shells from the NW Tethys, our simulations also show that recurrent discharges of brackish and nutrient-rich Arctic surface waters through the Viking Corridor could have led to both vertical and geographical gradients in salinity and seawater δ18O in the NW Tethyan seas. Locally contrasted conditions in water mass density and rises in productivity rates due to strong nutrient supplies could partly explain the regional severity of the anoxic event in the restricted Euro-boreal domains, as it has been previously suggested and modeled regionally.

  9. Does silent reading speed in normal adult readers depend on early visual processes? evidence from event-related brain potentials.

    PubMed

    Korinth, Sebastian Peter; Sommer, Werner; Breznitz, Zvia

    2012-01-01

    Little is known about the relationship of reading speed and early visual processes in normal readers. Here we examined the association of the early P1, N170 and late N1 component in visual event-related potentials (ERPs) with silent reading speed and a number of additional cognitive skills in a sample of 52 adult German readers utilizing a Lexical Decision Task (LDT) and a Face Decision Task (FDT). Amplitudes of the N170 component in the LDT but, interestingly, also in the FDT correlated with behavioral tests measuring silent reading speed. We suggest that reading speed performance can be at least partially accounted for by the extraction of essential structural information from visual stimuli, consisting of a domain-general and a domain-specific expertise-based portion.

  10. Early trimpi events from lightning-induced electric fields in the ionosphere: An alternative explanation. (Reannouncement with new availability information)

    SciTech Connect

    Burke, W.J.

    1992-12-31

    Two classes of Trimpi modulation of VLF signals in the Earth-ionosphere waveguide have been identified in the literature. The more common type occurs 1 s or more after causative lightning strokes, the second in less than 100 ms. The authors explore the possibility that these early Trimpi events result from lightning-generated, electric field impulses lowering the mirror altitudes of trapped electrons. To overcome the mirror force on energetic electrons, upward-directed electric fields with strength of a few tens of mV/m are required. This is well within the range of electric field observed on sounding rockets above thunderstorms.

  11. Early events in speciation: polymorphism for hybrid male sterility in Drosophila.

    PubMed

    Reed, Laura K; Markow, Therese A

    2004-06-15

    Capturing the process of speciation early enough to determine the initial genetic causes of reproductive isolation remains a major challenge in evolutionary biology. We have found, to our knowledge, the first example of substantial intraspecific polymorphism for genetic factors contributing to hybrid male sterility. Specifically, we show that the occurrence of hybrid male sterility in crosses between Drosophila mojavensis and its sister species, Drosophila arizonae, is controlled by factors present at different frequencies in different populations of D. mojavensis. In addition, we show that hybrid male sterility is a complex phenotype; some hybrid males with motile sperm still cannot sire offspring. Because male sterility factors in hybrids between these species are not yet fixed within D. mojavensis, this system provides an invaluable opportunity to characterize the genetics of reproductive isolation at an early stage.

  12. Parental Substance Abuse As an Early Traumatic Event. Preliminary Findings on Neuropsychological and Personality Functioning in Young Drug Addicts Exposed to Drugs Early.

    PubMed

    Parolin, Micol; Simonelli, Alessandra; Mapelli, Daniela; Sacco, Marianna; Cristofalo, Patrizia

    2016-01-01

    Parental substance use is a major risk factor for child development, heightening the risk of drug problems in adolescence and young adulthood, and exposing offspring to several types of traumatic events. First, prenatal drug exposure can be considered a form of trauma itself, with subtle but long-lasting sequelae at the neuro-behavioral level. Second, parents' addiction often entails a childrearing environment characterized by poor parenting skills, disadvantaged contexts and adverse childhood experiences (ACEs), leading to dysfunctional outcomes. Young adults born from/raised by parents with drug problems and diagnosed with a Substance Used Disorder (SUD) themselves might display a particularly severe condition in terms of cognitive deficits and impaired personality function. This preliminary study aims to investigate the role of early exposure to drugs as a traumatic event, capable of affecting the psychological status of young drug addicts. In particular, it intends to examine the neuropsychological functioning and personality profile of young adults with severe SUDs who were exposed to drugs early in their family context. The research involved three groups, each consisting of 15 young adults (aged 18-24): a group of inpatients diagnosed with SUDs and exposed to drugs early, a comparison group of non-exposed inpatients and a group of non-exposed youth without SUDs. A neuropsychological battery (Esame Neuropsicologico Breve-2), an assessment procedure for personality disorders (Shedler-Westen Assessment Procedure-200) and the Symptom CheckList-90-Revised were administered. According to present preliminary results, young drug addicts exposed to drugs during their developmental age were characterized by elevated rates of neuropsychological impairments, especially at the expense of attentive and executive functions (EF); personality disorders were also common but did not differentiate them from non-exposed youth with SUDs. Alternative multi-focused prevention and

  13. Parental Substance Abuse As an Early Traumatic Event. Preliminary Findings on Neuropsychological and Personality Functioning in Young Drug Addicts Exposed to Drugs Early

    PubMed Central

    Parolin, Micol; Simonelli, Alessandra; Mapelli, Daniela; Sacco, Marianna; Cristofalo, Patrizia

    2016-01-01

    Parental substance use is a major risk factor for child development, heightening the risk of drug problems in adolescence and young adulthood, and exposing offspring to several types of traumatic events. First, prenatal drug exposure can be considered a form of trauma itself, with subtle but long-lasting sequelae at the neuro-behavioral level. Second, parents' addiction often entails a childrearing environment characterized by poor parenting skills, disadvantaged contexts and adverse childhood experiences (ACEs), leading to dysfunctional outcomes. Young adults born from/raised by parents with drug problems and diagnosed with a Substance Used Disorder (SUD) themselves might display a particularly severe condition in terms of cognitive deficits and impaired personality function. This preliminary study aims to investigate the role of early exposure to drugs as a traumatic event, capable of affecting the psychological status of young drug addicts. In particular, it intends to examine the neuropsychological functioning and personality profile of young adults with severe SUDs who were exposed to drugs early in their family context. The research involved three groups, each consisting of 15 young adults (aged 18–24): a group of inpatients diagnosed with SUDs and exposed to drugs early, a comparison group of non-exposed inpatients and a group of non-exposed youth without SUDs. A neuropsychological battery (Esame Neuropsicologico Breve-2), an assessment procedure for personality disorders (Shedler-Westen Assessment Procedure-200) and the Symptom CheckList-90-Revised were administered. According to present preliminary results, young drug addicts exposed to drugs during their developmental age were characterized by elevated rates of neuropsychological impairments, especially at the expense of attentive and executive functions (EF); personality disorders were also common but did not differentiate them from non-exposed youth with SUDs. Alternative multi-focused prevention and

  14. An early warning indicator for atmospheric blocking events using transfer operators

    SciTech Connect

    Tantet, Alexis Burgt, Fiona R. van der; Dijkstra, Henk A.

    2015-03-15

    The existence of persistent midlatitude atmospheric flow regimes with time-scales larger than 5–10 days and indications of preferred transitions between them motivates to develop early warning indicators for such regime transitions. In this paper, we use a hemispheric barotropic model together with estimates of transfer operators on a reduced phase space to develop an early warning indicator of the zonal to blocked flow transition in this model. It is shown that the spectrum of the transfer operators can be used to study the slow dynamics of the flow as well as the non-Markovian character of the reduction. The slowest motions are thereby found to have time scales of three to six weeks and to be associated with meta-stable regimes (and their transitions) which can be detected as almost-invariant sets of the transfer operator. From the energy budget of the model, we are able to explain the meta-stability of the regimes and the existence of preferred transition paths. Even though the model is highly simplified, the skill of the early warning indicator is promising, suggesting that the transfer operator approach can be used in parallel to an operational deterministic model for stochastic prediction or to assess forecast uncertainty.

  15. Age Dating Merger Events in Early Type Galaxies via the Detection of AGB Light

    NASA Technical Reports Server (NTRS)

    Bothun, G.

    2005-01-01

    A thorough statistical analysis of the J-H vs. H-K color plane of all detected early type galaxies in the 2MASS catalog with velocities less than 5000 km/s has been performed. This all sky survey is not sensitive to one particular galactic environment and therefore a representative range of early type galaxy environments have been sampled. Virtually all N-body simulation so major mergers produces a central starburst due to rapid collection of gas. This central starburst is of sufficient amplitude to change the stellar population in the central regions of the galaxy. Intermediate age populations are given away by the presence of AGB stars which will drive the central colors redder in H-K relative to the J- H baseline. This color anomaly has a lifetime of 2-5 billion years depending on the amplitude of the initial starburst Employing this technique on the entire 2MASS sample (several hundred galaxies) reveals that the AGB signature occurs less than 1% of the time. This is a straightforward indication that virtually all nearby early type galaxies have not had a major merger occur within the last few billion years.

  16. Impaired Early Attentional Processes in Parkinson’s Disease: A High-Resolution Event-Related Potentials Study

    PubMed Central

    Bocquillon, Perrine; Bourriez, Jean-Louis; Palmero-Soler, Ernesto; Defebvre, Luc; Derambure, Philippe; Dujardin, Kathy

    2015-01-01

    Introduction The selection of task-relevant information requires both the focalization of attention on the task and resistance to interference from irrelevant stimuli. A previous study using the P3 component of the event-related potentials suggested that a reduced ability to resist interference could be responsible for attention disorders at early stages of Parkinson’s disease (PD), with a possible role of the dorsolateral prefrontal cortex (DLPFC). Methods Our objective was to better determine the origin of this impairment, by studying an earlier ERP component, the N2, and its subcomponents, as they reflect early inhibition processes and as they are known to have sources in the anterior cingulate cortex (ACC), which is involved together with the DLPFC in inhibition processes. Fifteen early-stage PD patients and 15 healthy controls (HCs) performed a three-stimulus visual oddball paradigm, consisting in detecting target inputs amongst standard stimuli, while resisting interference from distracter ones. A 128-channel electroencephalogram was recorded during this task and the generators of the N2 subcomponents were identified using standardized weighted low-resolution electromagnetic tomography (swLORETA). Results PD patients displayed fewer N2 generators than HCs in both the DLPFC and the ACC, for all types of stimuli. In contrast to controls, PD patients did not show any differences between their generators for different N2 subcomponents. Conclusion Our data suggest that impaired inhibition in PD results from dysfunction of the DLPFC and the ACC during the early stages of attentional processes. PMID:26135906

  17. The onset of childhood amnesia in childhood: a prospective investigation of the course and determinants of forgetting of early-life events.

    PubMed

    Bauer, Patricia J; Larkina, Marina

    2014-01-01

    The present research was an examination of the onset of childhood amnesia and how it relates to maternal narrative style, an important determinant of autobiographical memory development. Children and their mothers discussed unique events when the children were 3 years of age. Different subgroups of children were tested for recall of the events at ages 5, 6, 7, 8, and 9 years. At the later session they were interviewed by an experimenter about the events discussed 2 to 6 years previously with their mothers (early-life events). Children aged 5, 6, and 7 remembered 60% or more of the early-life events. In contrast, children aged 8 and 9 years remembered fewer than 40% of the early-life events. Overall maternal narrative style predicted children's contributions to mother-child conversations at age 3 years; it did not have cross-lagged relations to memory for early-life events at ages 5 to 9 years. Maternal deflections of the conversational turn to the child predicted the amount of information children later reported about the early-life events. The findings have implications for our understanding of the onset of childhood amnesia and the achievement of an adult-like distribution of memories in the school years. They highlight the importance of forgetting processes in explanations of the amnesia.

  18. Ar-39-Ar-40 Evidence for Early Impact Events on the LL Parent Body

    NASA Technical Reports Server (NTRS)

    Dixon, E. T.; Bogard, D. D.; Garrison, D. H.; Rubin, A. E.

    2006-01-01

    We determined Ar-39-Ar-40 ages of eight LL chondrites, and one igneous inclusion from an LL chondrite, with the object of understanding the thermal history of the LL-chondrite parent body. The meteorites in this study have a range of petrographic types from LL3.3 to LL6, and shock stages from S1 to S4. These meteorites reveal a range of K-Ar ages from 23.66 to 24.50 Ga, and peak ages from 23.74 to 24.55 Ga. Significantly, three of the eight chondrites (LL4, 5, 6) have K-Ar ages of -4.27 Ga. One of these (MIL99301) preserves an Ar-39-Ar-40 age of 4.23 +/- 0.03 Ga from low-temperature extractions, and an older age of 4.52 +/- 0.08 Ga from the highest temperature extractions. In addition, an igneous-textured impact melt DOM85505,22 has a peak Ar-39-Ar-40 age of >= 4.27 Ga. We interpret these results as evidence for impact events that occurred at about 4.27 Ga on the LL parent body that produced local impact melts, reset the Ar-39-Ar-40 ages of some meteorites, and exhumed (or interred) others, resulting in a range of cooling ages. The somewhat younger peak age of 3.74 Ga from GR095658 (LL3.3) suggests an additional impact event close to timing of impact-reset ages of some other ordinary chondrites between 3.6-3.8 Ga. The results from MIL99301 suggest that some apparently unshocked (Sl) chondrites may have substantially reset Ar-39-Ar-40 ages. A previous petrographic investigation of MIL99301 suggested that reheating to temperatures less than or equal to type 4 petrographic conditions (600C) caused fractures in olivine to anneal, resulting in a low apparent shock stage of S1 (unshocked). The Ar-39-Ar-40 age spectrum of MIL99301 is consistent with this interpretation. Older ages from high-T extractions may date an earlier impact event at 4.52 +/- 0.08 Ga, whereas younger ages from lower-T extractions date a later impact event at 4.23 Ar-39-Ar-40 0.03 Ga that may have caused annealing of feldspar and olivine

  19. SeismoGeodesy: Combination of High Rate, Real-time GNSS and Accelerometer Observations and Rapid Seismic Event Notification for Earth Quake Early Warning and Volcano Monitoring

    NASA Astrophysics Data System (ADS)

    Jackson, Michael; Zimakov, Leonid; Moessmer, Matthias

    2015-04-01

    Scientific GNSS networks are moving towards a model of real-time data acquisition, epoch-by-epoch storage integrity, and on-board real-time position and displacement calculations. This new paradigm allows the integration of real-time, high-rate GNSS displacement information with acceleration and velocity data to create very high-rate displacement records. The mating of these two instruments allows the creation of a new, very high-rate (200 Hz) displacement observable that has the full-scale displacement characteristics of GNSS and high-precision dynamic motions of seismic technologies. It is envisioned that these new observables can be used for earthquake early warning studies, volcano monitoring, and critical infrastructure monitoring applications. Our presentation will focus on the characteristics of GNSS, seismic, and strong motion sensors in high dynamic environments, including historic earthquakes replicated on a shake table over a range of displacements and frequencies. We will explore the optimum integration of these sensors from a filtering perspective including simple harmonic impulses over varying frequencies and amplitudes and under the dynamic conditions of various earthquake scenarios. We will also explore the tradeoffs between various GNSS processing schemes including real-time precise point positioning (PPP) and real-time kinematic (RTK) as applied to seismogeodesy. In addition we will discuss implementation of a Rapid Seismic Event Notification System that provides quick delivery of digital data from seismic stations to the acquisition and processing center and a full data integrity model for real-time earthquake notification that provides warning prior to significant ground shaking.

  20. Early Holocene catastrophic mass-wasting event and fan-delta development on the Hua-tung coast, eastern Taiwan

    NASA Astrophysics Data System (ADS)

    Hsieh, Meng-Long; Liew, Ping-Mei; Chen, Hua-Wen

    2011-11-01

    Landslides and debris flows rarely occurred during historical times in the tectonically active Coastal Range of eastern Taiwan. This topographic stability, however, contrasts greatly with the widespread existence of terraced alluvial fans and fan-deltas on the Hua-tung coast which fringes the range. This study focuses on the two largest fan-terrace systems on the Hua-tung coast, both of which consist of alluvial fans (plane-view areas up to 8 km 2) larger than their contributing catchments. Stratigraphic data show that both systems were in sandy, wave-dominated settings during de-glacial times. The systems were then disturbed by a catastrophic landslide/debris-flow event (or events), which brought enormous amounts of gravel (Facies Gm) into the systems, deforming previously-deposited marine sands (Facies Sm) and shallowing the seafloor. The combined Gm/Sm complex yields multiple radiocarbon dates ranging from 11.3 to 8.3 ka cal BP, with a cluster around 8.6 ka cal BP. This mass-wasting event has been unique since the emergence of its contributing catchment 0.2-0.3 Ma ago. The low frequency of such an event could reflect the great resistance of rock mass in the source areas to weathering and erosion. The common blockage of valley floors by giant-boulder piles, which limits channel incision and sediment transport, could also increase the apparent stability of the mountain. The trigger of landslides in the Coastal Range has been linked to large earthquakes. Additionally, we propose that the great magnitude and duration of the observed early Holocene event were caused by the contemporaneous prolonged rainfall (and/or high frequency of typhoons) associated with the East Asian summer monsoon maximum.

  1. Dynamic Crystallography Reveals Early Signalling Events in Ultraviolet Photoreceptor UVR8

    PubMed Central

    Zeng, Xiaoli; Ren, Zhong; Wu, Qi; Fan, Jun; Peng, Pan-Pan; Tang, Kun; Zhang, Ruiqin; Zhao, Kai-Hong; Yang, Xiaojing

    2015-01-01

    Arabidopsis thaliana UVR8 (AtUVR8) is a long-sought-after photoreceptor that undergoes dimer dissociation in response to UV-B light. Crystallographic and mutational studies have identified two crucial tryptophan residues for UV-B responses in AtUVR8. However, the mechanism of UV-B perception and structural events leading up to dimer dissociation remain elusive at the molecular level. We applied dynamic crystallography to capture light-induced structural events in photoactive AtUVR8 crystals. Here we report two intermediate structures at 1.67Å resolution. At the epicenter of UV-B signaling, concerted motions associated with Trp285/Trp233 lead to ejection of a water molecule, which weakens an intricate network of hydrogen bonds and salt bridges at the dimer interface. Partial opening of the β-propeller structure due to thermal relaxation of conformational strains originating in the epicenter further disrupts the dimer interface and leads to dimer dissociation. These dynamic crystallographic observations provide structural insights into the photo-perception and signaling mechanism of UVR8. PMID:26097745

  2. Knockin' on pollen's door: live cell imaging of early polarization events in germinating Arabidopsis pollen

    PubMed Central

    Vogler, Frank; Konrad, Sebastian S. A.; Sprunck, Stefanie

    2015-01-01

    Pollen tubes are an excellent system for studying the cellular dynamics and complex signaling pathways that coordinate polarized tip growth. Although several signaling mechanisms acting in the tip-growing pollen tube have been described, our knowledge on the subcellular and molecular events during pollen germination and growth site selection at the pollen plasma membrane is rather scarce. To simultaneously track germinating pollen from up to 12 genetically different plants we developed an inexpensive and easy mounting technique, suitable for every standard microscope setup. We performed high magnification live-cell imaging during Arabidopsis pollen activation, germination, and the establishment of pollen tube tip growth by using fluorescent marker lines labeling either the pollen cytoplasm, vesicles, the actin cytoskeleton or the sperm cell nuclei and membranes. Our studies revealed distinctive vesicle and F-actin polarization during pollen activation and characteristic growth kinetics during pollen germination and pollen tube formation. Initially, the germinating Arabidopsis pollen tube grows slowly and forms a uniform roundish bulge, followed by a transition phase with vesicles heavily accumulating at the growth site before switching to rapid tip growth. Furthermore, we found the two sperm cells to be transported into the pollen tube after the phase of rapid tip growth has been initiated. The method presented here is suitable to quantitatively study subcellular events during Arabidopsis pollen germination and growth, and for the detailed analysis of pollen mutants with respect to pollen polarization, bulging, or growth site selection at the pollen plasma membrane. PMID:25954283

  3. Toward a Molecular Theory of Early and Late Events in Monomer to Amyloid Fibril Formation

    NASA Astrophysics Data System (ADS)

    Straub, John E.; Thirumalai, D.

    2011-05-01

    Quantitative understanding of the kinetics of fibril formation and the molecular mechanism of transition from monomers to fibrils is needed to obtain insights into the growth of amyloid fibrils and more generally self-assembly multisubunit protein complexes. Significant advances using computations of protein aggregation in a number of systems have established generic and sequence-specific aspects of the early steps in oligomer formation. Theoretical considerations, which view oligomer and fibril growth as diffusion in a complex energy landscape, and computational studies, involving minimal lattice and coarse-grained models, have revealed general principles governing the transition from monomeric protein to ordered fibrillar aggregates. Detailed atomistic calculations have explored the early stages of the protein aggregation pathway for a number of amyloidogenic proteins, most notably amyloid β- (Aβ-) protein and fragments from proteins linked to various diseases. These computational studies have provided insights into the role of sequence, role of water, and specific interatomic interactions underlying the thermodynamics and dynamics of elementary kinetic steps in the aggregation pathway. Novel methods are beginning to illustrate the structural basis for the production of Aβ-peptides through interactions with secretases in the presence of membranes. We show that a variety of theoretical approaches, ranging from scaling arguments to minimal models to atomistic simulations, are needed as a complement to experimental studies probing the principles governing protein aggregation.

  4. The influence of surface energy on early adherent events of osteoblast on titanium substrates.

    PubMed

    Lai, Hong-Chang; Zhuang, Long-Fei; Liu, Xin; Wieland, Marco; Zhang, Zhi-Yong; Zhang, Zhi-Yuan

    2010-04-01

    Surface energy of implant material is one of the important factors in the process of osseointegration. How surface energy regulates the signaling pathway of osteoblasts, however, is not well understood. Cell adhesion is one of the first steps essential to subsequent proliferation and differentiation of bone cells before tissue formation. Our present study was designed to investigate how surface energy may influence the early adhesion of human alveolar osteoblasts (AOBs). Substrates applied were two groups of titanium disks: (1) hydrophobic sandblasted and acid-etched (SLA) surfaces; (2) chemically modified hydrophilic SLA (modSLA) ones. Cell morphology and cell attachment were examined by scanning electron microscopy (SEM). Defined cytoskeletal actin organization was immunohistochemically examined using confocal laser scanning microscopy. RT-PCR was applied to detect and to compare the expression of focal adhesion kinase (FAK) of osteoblasts cultured on the two groups of substrates. The attachment rates of AOBs cultured on modSLA substrates were significantly higher than the cells on SLA ones within 3 h. AOBs on modSLA developed more defined actin stress fibers after 6 h of attachment. FAK expression was comparably higher on modSLA after 6 h. Within the limitation of the current study, higher surface energy of titanium surfaces enhanced the cell adhesion in the early stage of cell response and may work through influencing the expression of adhesion-associated molecules.

  5. Early coagulation events induce acute lung injury in a rat model of blunt traumatic brain injury.

    PubMed

    Yasui, Hideki; Donahue, Deborah L; Walsh, Mark; Castellino, Francis J; Ploplis, Victoria A

    2016-07-01

    Acute lung injury (ALI) and systemic coagulopathy are serious complications of traumatic brain injury (TBI) that frequently lead to poor clinical outcomes. Although the release of tissue factor (TF), a potent initiator of the extrinsic pathway of coagulation, from the injured brain is thought to play a key role in coagulopathy after TBI, its function in ALI following TBI remains unclear. In this study, we investigated whether the systemic appearance of TF correlated with the ensuing coagulopathy that follows TBI in ALI using an anesthetized rat blunt trauma TBI model. Blood and lung samples were obtained after TBI. Compared with controls, pulmonary edema and increased pulmonary permeability were observed as early as 5 min after TBI without evidence of norepinephrine involvement. Systemic TF increased at 5 min and then diminished 60 min after TBI. Lung injury and alveolar hemorrhaging were also observed as early as 5 min after TBI. A biphasic elevation of TF was observed in the lungs after TBI, and TF-positive microparticles (MPs) were detected in the alveolar spaces. Fibrin(ogen) deposition was also observed in the lungs within 60 min after TBI. Additionally, preadministration of a direct thrombin inhibitor, Refludan, attenuated lung injuries, thus implicating thrombin as a direct participant in ALI after TBI. The results from this study demonstrated that enhanced systemic TF may be an initiator of coagulation activation that contributes to ALI after TBI. PMID:27190065

  6. Astrochronology of the Valanginian Stage (Early Cretaceous) : implications for the origin of the Weissert Event

    NASA Astrophysics Data System (ADS)

    Martinez, Mathieu; Deconinck, Jean-François; Pellenard, Pierre; Reboulet, Stéphane; Riquier, Laurent

    2013-04-01

    Due to the scarcity of available radioisotopic ages in the Lower Cretaceous, the Geologic Time Scale presents uncertainties that impact palaeoceanographic and palaeoclimatic reconstructions. Particularly, the chronological relationship between the Mid-Valanginian carbon-isotope excursion (namely the 'Weissert Event') and the activity of the Paraná-Etendeka Large Igneous Province is debated. To better constrain this relationship, an astrochronology of the Valanginian Stage is proposed based on high-resolution gamma-ray spectrometry measurements performed on five biostratigraphically well-constrained sections throughout the Vocontian Basin (SE France). The Valanginian sediments of the Vocontian Basin are composed of decimetric hemipelagic marl-limestone alternations. These lithologic cycles are attributed to orbital forcing because marls and limestones display significant differences within clay mineralogy, geochemistry and faunal assemblages and these marl-limestone alternations are correlated throughout the Western Tethys and the Atlantic Ocean. Among the analyzed sections, Vergol (GSSP candidate for the Berriasian-Valanginian boundary), La Charce (GSSP candidate for the Valanginian-Hauterivian boundary) and Angles (Valanginian Hypostratotype) are standard sections for the Valanginian Stage since all ammonite zones and subzones are precisely identified and bounded. Spectral analyses were performed using the multi-taper method and amplitude spectrograms on the gamma-ray signals. The comparison between sedimentary frequency ratios derived from the spectral analyses and orbital frequency ratios calculated from astronomical solutions allows the identification of a pervasive dominance of the precession and the 405 kyr-eccentricity cycles throughout the Valanginian Stage. A duration of 5.1 myr is proposed for the Valanginian Stage on the base of the recognition of the 405 kyr-eccentricity cycles. This duration is in agreement with the orbital calibration proposed from

  7. Early age-related changes in episodic memory retrieval as revealed by event-related potentials.

    PubMed

    Guillaume, Cécile; Clochon, Patrice; Denise, Pierre; Rauchs, Géraldine; Guillery-Girard, Bérengère; Eustache, Francis; Desgranges, Béatrice

    2009-01-28

    Familiarity is better preserved than recollection in ageing. The age at which changes first occur and the slope of the subsequent decline, however, remain unclear. In this study, we investigated changes in episodic memory, by using event-related potentials (ERPs) in young (m=24), middle-aged (m=58) and older (m=70) adults. Although behavioural performance did not change before the age of 65 years, changes in ERP correlates were already present in the middle-aged adults. The ERP correlates of recollection and monitoring processes were the first to be affected by ageing, with a linear decrease as age increased. Conversely, the ERP correlate of familiarity remained unchanged, at least up to the age of 65 years. These results suggest a differential time course for the age effects on episodic retrieval. PMID:19104457

  8. Depth deviation and occurrence of early surgical complications or unexpected events using a single stereolithographic surgi-guide.

    PubMed

    Cassetta, M; Stefanelli, L V; Giansanti, M; Di Mambro, A; Calasso, S

    2011-12-01

    The purpose of this study was to determine the accuracy of depth implant insertion and to describe the frequency of early surgical complications or unexpected events, recorded using a single, totally guided, stereolithographic surgi-guide (bone-, mucosa- and teeth-supported) for both osteotomy site preparation and implant delivery. Ten adults were included in this study. Six patients were treated in both arches, and the number of computer aided implantology (CAI) interventions was 16, which equalled the number of guides used, for a total of 111 implants inserted. Complications and unexpected events occurred during the positioning of the surgical guide and whilst preparing the implant site and installing implants. In order to minimize the risk of complications and unexpected events, attention must be paid to every stage of treatment, including checking computed tomography (CT) images, guide manufacturing, proper guide positioning in the mouth, guide fixation, rotational allowance of drill in tubes, shape and sharpness of the drills, first entry point, mouth opening and guided implant insertion.

  9. Risk of Cerebrovascular Events in Elderly Patients After Radiation Therapy Versus Surgery for Early-Stage Glottic Cancer

    SciTech Connect

    Hong, Julian C.; Kruser, Tim J.; Gondi, Vinai; Mohindra, Pranshu; Cannon, Donald M.; Harari, Paul M.; Bentzen, Søren M.

    2013-10-01

    Purpose: Comprehensive neck radiation therapy (RT) has been shown to increase cerebrovascular disease (CVD) risk in advanced-stage head-and-neck cancer. We assessed whether more limited neck RT used for early-stage (T1-T2 N0) glottic cancer is associated with increased CVD risk, using the Surveillance, Epidemiology, and End Results (SEER)-Medicare linked database. Methods and Materials: We identified patients ≥66 years of age with early-stage glottic laryngeal cancer from SEER diagnosed from 1992 to 2007. Patients treated with combined surgery and RT were excluded. Medicare CPT codes for carotid interventions, Medicare ICD-9 codes for cerebrovascular events, and SEER data for stroke as the cause of death were collected. Similarly, Medicare CPT and ICD-9 codes for peripheral vascular disease (PVD) were assessed to serve as an internal control between treatment groups. Results: A total of 1413 assessable patients (RT, n=1055; surgery, n=358) were analyzed. The actuarial 10-year risk of CVD was 56.5% (95% confidence interval 51.5%-61.5%) for the RT cohort versus 48.7% (41.1%-56.3%) in the surgery cohort (P=.27). The actuarial 10-year risk of PVD did not differ between the RT (52.7% [48.1%-57.3%]) and surgery cohorts (52.6% [45.2%-60.0%]) (P=.89). Univariate analysis showed an increased association of CVD with more recent diagnosis (P=.001) and increasing age (P=.001). On multivariate Cox analysis, increasing age (P<.001) and recent diagnosis (P=.002) remained significantly associated with a higher CVD risk, whereas the association of RT and CVD remained not statistically significant (HR=1.11 [0.91-1.37,] P=.31). Conclusions: Elderly patients with early-stage laryngeal cancer have a high burden of cerebrovascular events after surgical management or RT. RT and surgery are associated with comparable risk for subsequent CVD development after treatment in elderly patients.

  10. Developmental Differences in Memory During Early Childhood: Insights From Event-Related Potentials

    PubMed Central

    Riggins, Tracy; Rollins, Leslie

    2014-01-01

    Age-related differences in behavioral and electrophysiological indices of memory were examined in 3-to-6-year-old children (n=76). Behaviorally, no differences were observed in children’s ability to identify old items; however, 3-year-old children were less accurate in correctly rejecting new items and 3- and 4-year-old children recalled fewer contextual details compared to 5- and 6-year-old children. Age-related differences in electrophysiological measures (800-1000ms after stimulus onset) were observed both to items recalled with contextual details, which increased between 3 and 4 years, and items recalled without contextual details, which were greatest in 5-year-old children, even after adjusting for global age-related differences. These findings, interpreted within a dual process framework, may suggest changes in both recollection and familiarity processes during early childhood. PMID:25677124

  11. Long-term impact of early life events on physiology and behaviour.

    PubMed

    Boersma, G J; Bale, T L; Casanello, P; Lara, H E; Lucion, A B; Suchecki, D; Tamashiro, K L

    2014-09-01

    This review discusses the effects of stress and nutrition throughout development and summarises studies investigating how exposure to stress or alterations in nutrition during the pre-conception, prenatal and early postnatal periods can affect the long-term health of an individual. In general, the data presented here suggest that that anything signalling potential adverse conditions later in life, such as high levels of stress or low levels of food availability, will lead to alterations in the offspring, possibly of an epigenetic nature, preparing the offspring for these conditions later in life. However, when similar environmental conditions are not met in adulthood, these alterations may have maladaptive consequences, resulting in obesity and heightened stress sensitivity. The data also suggest that the mechanism underlying these adult phenotypes might be dependent on the type and the timing of exposure.

  12. MSH6 and MUTYH Deficiency Is a Frequent Event in Early-Onset Colorectal Cancer

    PubMed Central

    Giráldez, María Dolores; Balaguer, Francesc; Bujanda, Luis; Cuatrecasas, Miriam; Muñoz, Jenifer; Alonso-Espinaco, Virginia; Larzabal, Mikel; Petit, Anna; Gonzalo, Victoria; Ocaña, Teresa; Moreira, Leticia; Enríquez-Navascués, José María; Boland, C. Richard; Goel, Ajay; Castells, Antoni; Castellví-Bel, Sergi

    2011-01-01

    Purpose Early-onset colorectal cancer (CRC) is suggestive of a hereditary predisposition. Lynch syndrome is the most frequent CRC hereditary cause. The MUTYH gene has also been related to hereditary CRC. A systematic characterization of these two diseases has not been reported previously in this population. Experimental Design We studied a retrospectively collected series of 140 patients ≤50 years old diagnosed with nonpolyposis CRC. Demographic, clinical, and familial features were obtained. Mismatch repair (MMR) deficiency was determined by microsatellite instability (MSI) analysis, and immunostaining for MLH1, MSH2, MSH6, and PMS2 proteins. Germline MMR mutations were evaluated in all MMR-deficient cases. Tumor samples with loss of MLH1 or MSH2 protein expression were analyzed for somatic methylation. Germline MUTYH mutations were evaluated in all cases. BRAF V600E and KRAS somatic mutational status was also determined. Results Fifteen tumors (11.4%) were MSI, and 20 (14.3%) showed loss of protein expression (7 for MLH1/PMS2, 2 for isolated MLH1, 3 for MSH2/MSH6, 7 for isolated MSH6, and 1 for MSH6/PMS2). We identified 11 (7.8%) germline MMR mutations, 4 in MLH1, 1 in MSH2, and 6 in MSH6. Methylation analysis revealed one case with somatic MLH1 methylation. Biallelic MUTYH mutations were detected in four (2.8%) cases. KRAS and BRAF V600E mutations were present in 39 (27.9%) and 5 (3.6%) cases, respectively. Conclusions Loss of MSH6 expression is the predominant cause of MMR deficiency in early-onset CRC. Our findings prompt the inclusion of MSH6 and MUTYH screening as part of the genetic counseling of these patients and their relatives. PMID:20924129

  13. Event-related brain potentials reveal the time-course of language change detection in early bilinguals.

    PubMed

    Kuipers, Jan-Rouke; Thierry, Guillaume

    2010-05-01

    Using event-related brain potentials, we investigated the temporal course of language change detection in proficient bilinguals as compared to matched controls. Welsh-English bilingual participants and English controls were presented with a variant of the oddball paradigm involving picture-word pairs. The language of the spoken word was manipulated such that English was the frequent stimulus (75%) and Welsh the infrequent stimulus (25%). We also manipulated semantic relatedness between pictures and words, such that only half of the pictures were followed by a word that corresponded with the identity of the picture. The P2 wave was significantly modulated by language in the bilingual group only, suggesting that this group detected a language change as early as 200 ms after word onset. Monolinguals also reliably detected the language change, but at a later stage of semantic integration (N400 range), since Welsh words were perceived as meaningless. The early detection of a language change in bilinguals triggered stimulus re-evaluation mechanisms reflected by a significant P600 modulation by Welsh words. Furthermore, compared to English unrelated words, English words matching the picture identity elicited significantly greater P2 amplitudes in the bilingual group only, suggesting that proficient bilinguals validate an incoming word against their expectation based on the context. Overall, highly proficient bilinguals appear to detect language changes very early on during speech perception and to consciously monitor language changes when they occur.

  14. Analysis of the viral replication cycle of adenovirus serotype 2 after inactivation by free chlorine.

    PubMed

    Gall, Aimee M; Shisler, Joanna L; Mariñas, Benito J

    2015-04-01

    Free chlorine is effective at inactivating a wide range of waterborne viral pathogens including human adenovirus (HAdV), but the mechanisms by which free chlorine inactivates HAdV and other human viruses remain to be elucidated. Such advances in fundamental knowledge are key for development of new disinfection technologies and novel sensors to detect infectious viruses in drinking water. We developed and tested a quantitative assay to analyze several steps in the HAdV replication cycle upon increasing free chlorine exposure. We used quantitative polymerase chain reaction (qPCR) to detect HAdV genomic DNA as a means to quantify attachment and genome replication of untreated and treated virions. Also, we used quantitative reverse-transcription PCR (RT-qPCR) to quantify the transcription of E1A (first early protein) and hexon mRNA. We compared these replication cycle events to virus inactivation kinetics to determine what stage of the virus replication cycle was inhibited as a function of free chlorine exposure. We observed that adenovirus inactivated at levels up to 99.99% by free chlorine still attached to host cells; however, viral DNA synthesis and early E1A and late hexon gene transcription were inhibited. We conclude that free chlorine exposure interferes with a replication cycle event occurring postbinding but prior to early viral protein synthesis.

  15. Dormant origins licensed by excess Mcm2-7 are required for human cells to survive replicative stress.

    PubMed

    Ge, Xin Quan; Jackson, Dean A; Blow, J Julian

    2007-12-15

    In late mitosis and early G1, Mcm2-7 complexes are loaded onto DNA to license replication origins for use in the upcoming S phase. However, the amount of Mcm2-7 loaded is in significant excess over the number of origins normally used. We show here that in human cells, excess chromatin-bound Mcm2-7 license dormant replication origins that do not fire during normal DNA replication, in part due to checkpoint activity. Dormant origins were activated within active replicon clusters if replication fork progression was inhibited, despite the activation of S-phase checkpoints. After lowering levels of chromatin-bound Mcm2-7 in human cells by RNA interference (RNAi), the use of dormant origins was suppressed in response to replicative stress. Although cells with lowered chromatin-bound Mcm2-7 replicated at normal rates, when challenged with replication inhibitors they had dramatically reduced rates of DNA synthesis and reduced viability. These results suggest that the use of dormant origins licensed by excess Mcm2-7 is a new and physiologically important mechanism that cells utilize to maintain DNA replication rates under conditions of replicative stress. We propose that checkpoint kinase activity can preferentially suppress initiation within inactive replicon clusters, thereby directing new initiation events toward active clusters that are experiencing replication problems.

  16. Salt stress sensing and early signalling events in plant roots: Current knowledge and hypothesis.

    PubMed

    Shabala, Sergey; Wu, Honghong; Bose, Jayakumar

    2015-12-01

    Soil salinity is a major environmental constraint to crop production. While the molecular identity and functional expression of Na(+) transport systems mediating Na(+) exclusion from the cytosol has been studied in detail, far less is known about the mechanisms by which plants sense high Na(+) levels in the soil and the rapid signalling events that optimise plant performance under saline conditions. This review aims to fill this gap. We first discuss the nature of putative salt stress sensors, candidates which include Na(+) transport systems, mechanosensory proteins, proteins with regulatory Na(+) binding sites, sensing mediated by cyclic nucleotide-gated channels, purine receptors, annexin and voltage gating. We suggest that several transport proteins may be clustered together to form a microdomain in a lipid raft, allowing rapid changes in the activity of an individual protein to be translated into stress-induced Ca(2+) and H2O2 signatures. The pathways of stress signalling to downstream targets are discussed, and the kinetics and specificity of salt stress signalling between glycophytes and halophytes is compared. We argue that these sensing mechanisms operate in parallel, providing plants with a robust system for decoding information about the specific nature and severity of the imposed salt stress.

  17. Repression of early lateral root initiation events by transient water deficit in barley and maize

    PubMed Central

    Babé, Aurélie; Lavigne, Tristan; Séverin, Jean-Philippe; Nagel, Kerstin A.; Walter, Achim; Chaumont, François; Batoko, Henri; Beeckman, Tom; Draye, Xavier

    2012-01-01

    The formation of lateral roots (LRs) is a key driver of root system architecture and developmental plasticity. The first stage of LR formation, which leads to the acquisition of founder cell identity in the pericycle, is the primary determinant of root branching patterns. The fact that initiation events occur asynchronously in a very small number of cells inside the parent root has been a major difficulty in the study of the molecular regulation of branching patterns. Inducible systems that trigger synchronous lateral formation at predictable sites have proven extremely valuable in Arabidopsis to decipher the first steps of LR formation. Here, we present a LR repression system for cereals that relies on a transient water-deficit treatment, which blocks LR initiation before the first formative divisions. Using a time-lapse approach, we analysed the dynamics of this repression along growing roots and were able to show that it targets a very narrow developmental window of the initiation process. Interestingly, the repression can be exploited to obtain negative control root samples where LR initiation is absent. This system could be instrumental in the analysis of the molecular basis of drought-responsive as well as intrinsic pathways of LR formation in cereals. PMID:22527396

  18. Salt stress sensing and early signalling events in plant roots: Current knowledge and hypothesis.

    PubMed

    Shabala, Sergey; Wu, Honghong; Bose, Jayakumar

    2015-12-01

    Soil salinity is a major environmental constraint to crop production. While the molecular identity and functional expression of Na(+) transport systems mediating Na(+) exclusion from the cytosol has been studied in detail, far less is known about the mechanisms by which plants sense high Na(+) levels in the soil and the rapid signalling events that optimise plant performance under saline conditions. This review aims to fill this gap. We first discuss the nature of putative salt stress sensors, candidates which include Na(+) transport systems, mechanosensory proteins, proteins with regulatory Na(+) binding sites, sensing mediated by cyclic nucleotide-gated channels, purine receptors, annexin and voltage gating. We suggest that several transport proteins may be clustered together to form a microdomain in a lipid raft, allowing rapid changes in the activity of an individual protein to be translated into stress-induced Ca(2+) and H2O2 signatures. The pathways of stress signalling to downstream targets are discussed, and the kinetics and specificity of salt stress signalling between glycophytes and halophytes is compared. We argue that these sensing mechanisms operate in parallel, providing plants with a robust system for decoding information about the specific nature and severity of the imposed salt stress. PMID:26706063

  19. Early cerebrovascular and parenchymal events following prenatal exposure to the putative neurotoxin methylazoxymethanol.

    PubMed

    Bassanini, Stefania; Hallene, Kerri; Battaglia, Giorgio; Finardi, Adele; Santaguida, Stefano; Cipolla, Marilyn; Janigro, Damir

    2007-05-01

    One of the most common causes of neurological disabilities are malformations of cortical development (MCD). A useful animal model of MCD consists of prenatal exposure to methylazoxymethanol (MAM), resulting in a postnatal phenotype characterized by cytological aberrations reminiscent of human MCD. Although postnatal effects of MAM are likely a consequence of prenatal events, little is known on how the developing brain reacts to MAM. General assumption is the effects of prenatally administered MAM are short lived (24 h) and neuroblast-specific. MAM persisted for several days after exposure in utero in both maternal serum and fetal brain, but at levels lower than predicted by a neurotoxic action. MAM levels and time course were consistent with a different mechanism of indirect neuronal toxicity. The most prominent acute effects of MAM were cortical swelling associated with mild cortical disorganization and neurodegeneration occurring in absence of massive neuronal cell death. Delayed or aborted vasculogenesis was demonstrated by MAM's ability to hinder vessel formation. In vitro, MAM reduced synthesis and release of VEGF by endothelial cells. Decreased expression of VEGF, AQP1, and lectin-B was consistent with a vascular target in prenatal brain. The effects of MAM on cerebral blood vessels persisted postnatally, as indicated by capillary hypodensity in heterotopic areas of adult rat brain. In conclusion, these results show that MAM does not act only as a neurotoxin per se, but may additionally cause a short-lived toxic effect secondary to cerebrovascular dysfunction, possibly due to a direct anti-angiogenic effect of MAM itself.

  20. Repression of early lateral root initiation events by transient water deficit in barley and maize.

    PubMed

    Babé, Aurélie; Lavigne, Tristan; Séverin, Jean-Philippe; Nagel, Kerstin A; Walter, Achim; Chaumont, François; Batoko, Henri; Beeckman, Tom; Draye, Xavier

    2012-06-01

    The formation of lateral roots (LRs) is a key driver of root system architecture and developmental plasticity. The first stage of LR formation, which leads to the acquisition of founder cell identity in the pericycle, is the primary determinant of root branching patterns. The fact that initiation events occur asynchronously in a very small number of cells inside the parent root has been a major difficulty in the study of the molecular regulation of branching patterns. Inducible systems that trigger synchronous lateral formation at predictable sites have proven extremely valuable in Arabidopsis to decipher the first steps of LR formation. Here, we present a LR repression system for cereals that relies on a transient water-deficit treatment, which blocks LR initiation before the first formative divisions. Using a time-lapse approach, we analysed the dynamics of this repression along growing roots and were able to show that it targets a very narrow developmental window of the initiation process. Interestingly, the repression can be exploited to obtain negative control root samples where LR initiation is absent. This system could be instrumental in the analysis of the molecular basis of drought-responsive as well as intrinsic pathways of LR formation in cereals. PMID:22527396

  1. Early transcriptomic events in microdissected Arabidopsis nematode-induced giant cells.

    PubMed

    Barcala, Marta; García, Alejandra; Cabrera, Javier; Casson, Stuart; Lindsey, Keith; Favery, Bruno; García-Casado, Gloria; Solano, Roberto; Fenoll, Carmen; Escobar, Carolina

    2010-02-01

    Root-knot nematodes differentiate highly specialized feeding cells in roots (giant cells, GCs), through poorly characterized mechanisms that include extensive transcriptional changes. While global transcriptome analyses have used galls, which are complex root structures that include GCs and surrounding tissues, no global gene expression changes specific to GCs have been described. We report on the differential transcriptome of GCs versus root vascular cells, induced in Arabidopsis by Meloidogyne javanica at a very early stage of their development, 3 days after infection (d.p.i.). Laser microdissection was used to capture GCs and root vascular cells for microarray analysis, which was validated through qPCR and by a promoter-GUS fusion study. Results show that by 3 d.p.i., GCs exhibit major gene repression. Although some genes showed similar regulation in both galls and GCs, the majority had different expression patterns, confirming the molecular distinctiveness of the GCs within the gall. Most of the differentially regulated genes in GCs have no previously assigned function. Comparisons with other transcriptome analyses revealed similarities between GCs and cell suspensions differentiating into xylem cells. This suggests a molecular link between GCs and developing vascular cells, which represent putative GC stem cells. Gene expression in GCs at 3 d.p.i. was also found to be similar to crown galls induced by Agrobacterium tumefaciens, a specialized root biotroph. PMID:20003167

  2. A comparative study of diversification events: the early Paleozoic versus the Mesozoic

    NASA Technical Reports Server (NTRS)

    Erwin, D. H.; Valentine, J. W.; Sepkoski, J. J. Jr; Sepkoski JJ, J. r. (Principal Investigator)

    1987-01-01

    We compare two major long-term diversifications of marine animal families that began during periods of low diversity but produced strikingly different numbers of phyla, classes, and orders. The first is the early-Paleozoic diversification (late Vendian-Ordovician; 182 MY duration) and the other the Mesozoic phase of the post-Paleozoic diversification (183 MY duration). The earlier diversification was associated with a great burst of morphological invention producing many phyla, classes, and orders and displaying high per taxon rates of family origination. The later diversification lacked novel morphologies recognized as phyla and classes, produced fewer orders, and displayed lower per taxon rates of family appearances. The chief difference between the diversifications appears to be that the earlier one proceeded from relatively narrow portions of adaptive space, whereas the latter proceeded from species widely scattered among adaptive zones and representing a variety of body plans. This difference is believed to explain the major differences in the products of these great radiations. Our data support those models that hold that evolutionary opportunity is a major factor in the outcome of evolutionary processes.

  3. Joint Effect of Early Microvascular Damage in the Eye & Kidney on Risk of Cardiovascular Events

    PubMed Central

    Yip, Wanfen; Sabanayagam, Charumathi; Ong, Peng Guan; Patel, Uptal D; Chow, Khuan Yew; Tai, E Shyong; Ling, Lieng H; Wong, Tien Yin; Cheung, Carol Yim-lui

    2016-01-01

    Microalbuminuria is associated with an increased risk of cardiovascular disease (CVD), but not all individuals require treatment. Retinal microvascular abnormalities and microalbuminuria reflect early systemic microvascular changes. We examined the joint effect of retinal abnormalities and microalbuminuria on CVD risk in an Asian cohort. We conducted a prospective, population-based study. Retinal abnormalities were defined as presence of retinopathy and/or retinal venular widening. Microalbuminuria was defined as urinary albumin: creatinine ratio between 30–300 mg/g. Incident CVD was defined as newly diagnosed clinical stroke, acute myocardial infarction or CVD death. Cox regression models were performed to determine the associations between retinal abnormalities and microalbuminuria with risk of CVD, while controlling for established risk factors. 3,496 participants (aged ≥ 40) were free of prevalent CVD. During the follow-up (5.8 years), 126 (3.60%) participants developed CVD. Persons presenting with both retinal abnormalities and microalbuminuria were 6.71 times (95% CI, 2.68, 16.79) as likely to have incident CVD compared with those without either abnormalities. There was a significant interaction effect between retinal abnormalities and microalbuminuria on incident CVD. Assessment of retinal abnormalities in patients with microalbuminuria may provide additional value in identifying persons at risk of developing CVD. PMID:27273133

  4. Joint Effect of Early Microvascular Damage in the Eye &Kidney on Risk of Cardiovascular Events.

    PubMed

    Yip, Wanfen; Sabanayagam, Charumathi; Ong, Peng Guan; Patel, Uptal D; Chow, Khuan Yew; Tai, E Shyong; Ling, Lieng H; Wong, Tien Yin; Cheung, Carol Yim-Lui

    2016-01-01

    Microalbuminuria is associated with an increased risk of cardiovascular disease (CVD), but not all individuals require treatment. Retinal microvascular abnormalities and microalbuminuria reflect early systemic microvascular changes. We examined the joint effect of retinal abnormalities and microalbuminuria on CVD risk in an Asian cohort. We conducted a prospective, population-based study. Retinal abnormalities were defined as presence of retinopathy and/or retinal venular widening. Microalbuminuria was defined as urinary albumin: creatinine ratio between 30-300 mg/g. Incident CVD was defined as newly diagnosed clinical stroke, acute myocardial infarction or CVD death. Cox regression models were performed to determine the associations between retinal abnormalities and microalbuminuria with risk of CVD, while controlling for established risk factors. 3,496 participants (aged ≥ 40) were free of prevalent CVD. During the follow-up (5.8 years), 126 (3.60%) participants developed CVD. Persons presenting with both retinal abnormalities and microalbuminuria were 6.71 times (95% CI, 2.68, 16.79) as likely to have incident CVD compared with those without either abnormalities. There was a significant interaction effect between retinal abnormalities and microalbuminuria on incident CVD. Assessment of retinal abnormalities in patients with microalbuminuria may provide additional value in identifying persons at risk of developing CVD. PMID:27273133

  5. Human cytomegalovirus function inhibits replication of herpes simplex virus

    SciTech Connect

    Cockley, K.D.; Shiraki, K.; Rapp, F.

    1988-01-01

    Human embryonic lung (HEL) cells infected with human cytomegalovirus (HCMV) restricted the replication of herpes simplex virus type 1 (HSV-1). A delay in HSV replication of 15 h as well as a consistent, almost 3 log inhibition of HSV replication in HCMV-infected cell cultures harvested 24 to 72 h after superinfection were observed compared with controls infected with HSV alone. Treatment of HCMV-infected HEL cells with cycloheximide (100 ..mu..g/ml) for 3 or 24 h was demonstrated effective in blocking HCMV protein synthesis, as shown by immunoprecipitation with HCMV antibody-positive polyvalent serum. Cycloheximide treatment of HCMV-infected HEL cells and removal of the cycloheximide block before superinfection inhibited HSV-1 replication more efficiently than non-drug-treated superinfected controls. HCMV DNA-negative temperature-sensitive mutants restricted HSV as efficiently as wild-type HCMV suggesting that immediate-early and/or early events which occur before viral DNA synthesis are sufficient for inhibition of HSV. Inhibition of HSV-1 in HCMV-infected HEL cells was unaffected by elevated temperature (40.5/sup 0/C). However, prior UV irradiation of HCMV removed the block to HSV replication, demonstrating the requirement for an active HCMV genome. HSV-2 replication was similarly inhibited in HCMV-infected HEL cells. Superinfection of HCMV-infected HEL cells with HSV-1 labeled with (/sup 3/H)thymidine provided evidence that the labeled virus could penetrate to the nucleus of cells after superinfection. Evidence for penetration of superinfecting HSV into HCMV-infected cells was also provided by blot hybridization of HSV DNA synthesized in cells infected with HSV alone versus superinfected cell cultures at 0 and 48 h after superinfection.

  6. Replication fork collapse at replication terminator sequences.

    PubMed

    Bidnenko, Vladimir; Ehrlich, S Dusko; Michel, Bénédicte

    2002-07-15

    Replication fork arrest is a source of genome re arrangements, and the recombinogenic properties of blocked forks are likely to depend on the cause of blockage. Here we study the fate of replication forks blocked at natural replication arrest sites. For this purpose, Escherichia coli replication terminator sequences Ter were placed at ectopic positions on the bacterial chromosome. The resulting strain requires recombinational repair for viability, but replication forks blocked at Ter are not broken. Linear DNA molecules are formed upon arrival of a second round of replication forks that copy the DNA strands of the first blocked forks to the end. A model that accounts for the requirement for homologous recombination for viability in spite of the lack of chromosome breakage is proposed. This work shows that natural and accidental replication arrests sites are processed differently.

  7. The PRESSCA operational early warning system for landslide forecasting: the 11-12 November 2013 rainfall event in Central Italy.

    NASA Astrophysics Data System (ADS)

    Ciabatta, Luca; Brocca, Luca; Ponziani, Francesco; Berni, Nicola; Stelluti, Marco; Moramarco, Tommaso

    2014-05-01

    The Umbria Region, located in Central Italy, is one of the most landslide risk prone area in Italy, almost yearly affected by landslides events at different spatial scales. For early warning procedures aimed at the assessment of the hydrogeological risk, the rainfall thresholds represent the main tool for the Italian Civil Protection System. As shown in previous studies, soil moisture plays a key-role in landslides triggering. In fact, acting on the pore water pressure, soil moisture influences the rainfall amount needed for activating a landslide. In this work, an operational physically-based early warning system, named PRESSCA, that takes into account soil moisture for the definition of rainfall thresholds is presented. Specifically, the soil moisture conditions are evaluated in PRESSCA by using a distributed soil water balance model that is recently coupled with near real-time satellite soil moisture product obtained from ASCAT (Advanced SCATterometer) and from in-situ monitoring data. The integration of three different sources of soil moisture information allows to estimate the most accurate possible soil moisture condition. Then, both observed and forecasted rainfall data are compared with the soil moisture-based thresholds in order to obtain risk indicators over a grid of ~ 5 km. These indicators are then used for the daily hydrogeological risk evaluation and management by the Civil Protection regional service, through the sharing/delivering of near real-time landslide risk scenarios (also through an open source web platform: www.cfumbria.it). On the 11th-12th November, 2013, Umbria Region was hit by an exceptional rainfall event with up to 430mm/72hours that resulted in significant economic damages, but fortunately no casualties among the population. In this study, the results during the rainfall event of PRESSCA system are described, by underlining the model capability to reproduce, two days in advance, landslide risk scenarios in good spatial and temporal

  8. The actin cytoskeleton participates in the early events of autophagosome formation upon starvation induced autophagy

    PubMed Central

    Aguilera, Milton Osmar; Berón, Walter; Colombo, María Isabel

    2012-01-01

    Autophagy is a process by which cytoplasmic material is sequestered in a double-membrane vesicle destined for degradation. Nutrient deprivation stimulates the pathway and the number of autophagosomes in the cell increases in response to such stimulus. In the current report we have demonstrated that actin is necessary for starvation-mediated autophagy. When the actin cytoskeleton is depolymerized, the increase in autophagic vacuoles in response to the starvation stimulus was abolished without affecting maturation of remaining autophagosomes. In addition, actin filaments colocalized with ATG14, BECN1/Beclin1 and PtdIns3P-rich structures, and some of them have a typical omegasome shape stained with the double FYVE domain or ZFYVE1/DFCP1. In contrast, no major colocalization between actin and ULK1, ULK2, ATG5 or MAP1LC3/LC3 was observed. Taken together, our data indicate that actin has a role at very early stages of autophagosome formation linked to the PtdIns3P generation step. In addition, we have found that two members of the Rho family of proteins, RHOA and RAC1 have a regulatory function on starvation-mediated autophagy, but with opposite roles. Indeed, RHOA has an activatory role whereas Rac has an inhibitory one. We have also found that inhibition of the RHOA effector ROCK impaired the starvation-mediated autophagic response. We propose that actin participates in the initial membrane remodeling stage when cells require an enhanced rate of autophagosome formation, and this actin function would be tightly regulated by different members of the Rho family. PMID:22863730

  9. The actin cytoskeleton participates in the early events of autophagosome formation upon starvation induced autophagy.

    PubMed

    Aguilera, Milton Osmar; Berón, Walter; Colombo, María Isabel

    2012-11-01

    Autophagy is a process by which cytoplasmic material is sequestered in a double-membrane vesicle destined for degradation. Nutrient deprivation stimulates the pathway and the number of autophagosomes in the cell increases in response to such stimulus. In the current report we have demonstrated that actin is necessary for starvation-mediated autophagy. When the actin cytoskeleton is depolymerized, the increase in autophagic vacuoles in response to the starvation stimulus was abolished without affecting maturation of remaining autophagosomes. In addition, actin filaments colocalized with ATG14, BECN1/Beclin1 and PtdIns3P-rich structures, and some of them have a typical omegasome shape stained with the double FYVE domain or ZFYVE1/DFCP1. In contrast, no major colocalization between actin and ULK1, ULK2, ATG5 or MAP1LC3/LC3 was observed. Taken together, our data indicate that actin has a role at very early stages of autophagosome formation linked to the PtdIns3P generation step. In addition, we have found that two members of the Rho family of proteins, RHOA and RAC1 have a regulatory function on starvation-mediated autophagy, but with opposite roles. Indeed, RHOA has an activatory role whereas Rac has an inhibitory one. We have also found that inhibition of the RHOA effector ROCK impaired the starvation-mediated autophagic response. We propose that actin participates in the initial membrane remodeling stage when cells require an enhanced rate of autophagosome formation, and this actin function would be tightly regulated by different members of the Rho family.

  10. Early nucleation events in the polymerization of actin, probed by time-resolved small-angle x-ray scattering

    PubMed Central

    Oda, Toshiro; Aihara, Tomoki; Wakabayashi, Katsuzo

    2016-01-01

    Nucleators generating new F-actin filaments play important roles in cell activities. Detailed information concerning the events involved in nucleation of actin alone in vitro is fundamental to understanding these processes, but such information has been hard to come by. We addressed the early process of salt-induced polymerization of actin using the time-resolved synchrotron small-angle X-ray scattering (SAXS). Actin molecules in low salt solution maintain a monomeric state by an electrostatic repulsive force between molecules. On mixing with salts, the repulsive force was rapidly screened, causing an immediate formation of many of non-polymerizable dimers. SAXS kinetic analysis revealed that tetramerization gives the highest energetic barrier to further polymerization, and the major nucleation is the formation of helical tetramers. Filaments start to grow rapidly with the formation of pentamers. These findings suggest an acceleration mechanism of actin assembly by a variety of nucleators in cells. PMID:27775032

  11. The early region 1B 55-kilodalton oncoprotein of adenovirus relieves growth restrictions imposed on viral replication by the cell cycle.

    PubMed Central

    Goodrum, F D; Ornelles, D A

    1997-01-01

    The E1B 55-kDa oncoprotein of adenovirus enables the virus to overcome restrictions imposed on viral replication by the cell cycle. Approximately 20% of HeLa cells infected with an E1B 55-kDa mutant adenovirus produced virus when evaluated by electron microscopy or by assays for infectious centers. By contrast, all HeLa cells infected with a wild-type adenovirus produced virus. The yield of E1B mutant virus from randomly cycling HeLa cells correlated with the fraction of cells in S phase at the time of infection. In synchronously growing HeLa cells, approximately 75% of the cells infected during S phase with the E1B mutant virus produced virus, whereas only 10% of the cells infected during G1 produced virus. The yield of E1B mutant virus from HeLa cells infected during S phase was sevenfold greater than that of cells infected during G1 and threefold greater than that of cells infected during asynchronous growth. Cells infected during S phase with the E1B mutant virus exhibited severe cytopathic effects, whereas cells infected with the E1B mutant virus during G1 exhibited a mild cytopathic effect. Viral DNA synthesis appeared independent of the cell cycle because equivalent amounts of viral DNA were synthesized in cells infected with either wild-type or E1B mutant virus. The inability of the E1B mutant virus to replicate was not mediated by the status of p53. These results define a novel property of the large tumor antigen of adenovirus in relieving growth restrictions imposed on viral replication by the cell cycle. PMID:8985383

  12. Early event-related potentials indicate context-specific target processing for eye and hand motor systems.

    PubMed

    Wehrspaun, Claudia C; Pfabigan, Daniela M; Sailer, Uta

    2013-01-01

    Concurrent eye and hand movements toward a common visual target require different motor programs based on identical visual input. We used event-related brain potentials (ERP) to determine if and when the processing of the visual target differs for the two motor systems. The N2, an index for target evaluation, was more negative for the target of a hand than of an eye movement in two experiments. A possible interpretation for this finding is different visual target processing. Targets for hand movements require a different weighting of visual information, for example concerning features such as surface structure which are important for hand but not for eye movements. In experiment 2, the early C1-component, which had an average maximum at 67 ms following target onset, was significantly more negative when subjects pointed at the stimuli. Traditionally, the C1 has been regarded as a sensory component, but recent studies have linked it to higher order processing, such as attention and expectations. Thus, the present data indicate that target processing for eye or hand movements is already context-specific during early visual information processing. We suggest that differences in a target's relevance for upcoming movements modify target processing as well as sensory expectations.

  13. Differential Network Analyses of Alzheimer’s Disease Identify Early Events in Alzheimer’s Disease Pathology

    DOE PAGES

    Xia, Jing; Rocke, David M.; Perry, George; Ray, Monika

    2014-01-01

    In late-onset Alzheimer’s disease (AD), multiple brain regions are not affected simultaneously. Comparing the gene expression of the affected regions to identify the differences in the biological processes perturbed can lead to greater insight into AD pathogenesis and early characteristics. We identified differentially expressed (DE) genes from single cell microarray data of four AD affected brain regions: entorhinal cortex (EC), hippocampus (HIP), posterior cingulate cortex (PCC), and middle temporal gyrus (MTG). We organized the DE genes in the four brain regions into region-specific gene coexpression networks. Differential neighborhood analyses in the coexpression networks were performed to identify genes with lowmore » topological overlap (TO) of their direct neighbors. The low TO genes were used to characterize the biological differences between two regions. Our analyses show that increased oxidative stress, along with alterations in lipid metabolism in neurons, may be some of the very early events occurring in AD pathology. Cellular defense mechanisms try to intervene but fail, finally resulting in AD pathology as the disease progresses. Furthermore, disease annotation of the low TO genes in two independent protein interaction networks has resulted in association between cancer, diabetes, renal diseases, and cardiovascular diseases.« less

  14. Timing of the Toarcian Ocean Anoxic Event (Early Jurassic) from correlation of astronomically forced global stratigraphic sections

    NASA Astrophysics Data System (ADS)

    Huang, C.; Hinnov, L. A.; Hesselbo, S. P.

    2012-12-01

    The Early Toarcian Oceanic Anoxic Event (OAE) in the Early Jurassic Period is associated with a major negative carbon isotope excursion (CIE), mass extinction, marine transgression and global warming. The Toarcian OAE is thought to have been caused by flood basalt magmatism, and may have been a trigger for mass extinction. However, these proposed causes of the Toarcian OAE and associated biotic crisis are not adequately resolved by a precise chronology. The duration of the Toarcian OAE has been estimated to be anywhere from ~0.12 to ~0.9 Myr, most recently 0.74 to 3.26 Myr from U-Pb dating. The CIE associated with the Toarcian OAE has a similar pattern at numerous localities, and there is evidence for astronomical forcing of marine carbon isotopes. Here we estimate a duration of ~625 kyr for the main negative CIE, ~860 kyr for the polymorphum zone and >1.58 Myr for the levisoni zone based on 405-kyr astronomical eccentricity tuning of the marine section at Peniche (Portugal). This 405-kyr tuned series provides a ~2.5 Myr continuous high-resolution chronology through the Early Toarcian. There are 6, or possibly 7 short eccentricity cycles in the main CIE interval at Peniche. To confirm this astronomically based estimate, we analyzed five other sections at Yorkshire (UK), Dotternhausen (Germany), Valdorbia (Italy), Mechowo (Poland) and Serrucho, Neuquén (Argentina), from marine and terrestrial carbon isotopic series. These six stratigraphic sections from Early Jurassic western Tethys and eastern Panthalassa record the Toarcian OAE with ~6 prominent carbon isotope cycles in the CIE that provide us a 600 ± 100 kyr duration. The Peniche 405 kyr-tuned series indicates that the pre- and post-CIE intervals experienced strong precession-eccentricity-forced climate change, whereas the CIE interval is marked by dominant obliquity forcing. These dramatic and abrupt changes in astronomical response in the carbon isotopes point to fundamental shifting in the Early Toarcian

  15. Perturbation of bile acid homeostasis is an early pathogenesis event of drug induced liver injury in rats

    SciTech Connect

    Yamazaki, Makoto; Miyake, Manami; Sato, Hiroko; Masutomi, Naoya; Tsutsui, Naohisa; Adam, Klaus-Peter; Alexander, Danny C.; Lawton, Kay A.; Milburn, Michael V.; Ryals, John A.; Wulff, Jacob E.; Guo, Lining

    2013-04-01

    Drug-induced liver injury (DILI) is a significant consideration for drug development. Current preclinical DILI assessment relying on histopathology and clinical chemistry has limitations in sensitivity and discordance with human. To gain insights on DILI pathogenesis and identify potential biomarkers for improved DILI detection, we performed untargeted metabolomic analyses on rats treated with thirteen known hepatotoxins causing various types of DILI: necrosis (acetaminophen, bendazac, cyclosporine A, carbon tetrachloride, ethionine), cholestasis (methapyrilene and naphthylisothiocyanate), steatosis (tetracycline and ticlopidine), and idiosyncratic (carbamazepine, chlorzoxasone, flutamide, and nimesulide) at two doses and two time points. Statistical analysis and pathway mapping of the nearly 1900 metabolites profiled in the plasma, urine, and liver revealed diverse time and dose dependent metabolic cascades leading to DILI by the hepatotoxins. The most consistent change induced by the hepatotoxins, detectable even at the early time point/low dose, was the significant elevations of a panel of bile acids in the plasma and urine, suggesting that DILI impaired hepatic bile acid uptake from the circulation. Furthermore, bile acid amidation in the hepatocytes was altered depending on the severity of the hepatotoxin-induced oxidative stress. The alteration of the bile acids was most evident by the necrosis and cholestasis hepatotoxins, with more subtle effects by the steatosis and idiosyncratic hepatotoxins. Taking together, our data suggest that the perturbation of bile acid homeostasis is an early event of DILI. Upon further validation, selected bile acids in the circulation could be potentially used as sensitive and early DILI preclinical biomarkers. - Highlights: ► We used metabolomics to gain insights on drug induced liver injury (DILI) in rats. ► We profiled rats treated with thirteen hepatotoxins at two doses and two time points. ► The toxins decreased the

  16. Early-Life Events, Including Mode of Delivery and Type of Feeding, Siblings and Gender, Shape the Developing Gut Microbiota.

    PubMed

    Martin, Rocio; Makino, Hiroshi; Cetinyurek Yavuz, Aysun; Ben-Amor, Kaouther; Roelofs, Mieke; Ishikawa, Eiji; Kubota, Hiroyuki; Swinkels, Sophie; Sakai, Takafumi; Oishi, Kenji; Kushiro, Akira; Knol, Jan

    2016-01-01

    Colonization of the infant gut is believed to be critically important for a healthy growth as it influences gut maturation, metabolic, immune and brain development in early life. Understanding factors that influence this process is important, since an altered colonization has been associated with a higher risk of diseases later in life. Fecal samples were collected from 108 healthy neonates in the first half year of life. The composition and functionality of the microbiota was characterized by measuring 33 different bacterial taxa by qPCR/RT qPCR, and 8 bacterial metabolites. Information regarding gender, place and mode of birth, presence of siblings or pets; feeding pattern and antibiotic use was collected by using questionnaires. Regression analysis techniques were used to study associations between microbiota parameters and confounding factors over time. Bacterial DNA was detected in most meconium samples, suggesting bacterial exposure occurs in utero. After birth, colonization by species of Bifidobacterium, Lactobacillus and Bacteroides was influenced by mode of delivery, type of feeding and presence of siblings, with differences found at species level and over time. Interestingly, infant-type bifidobacterial species such as B. breve or B. longum subsp infantis were confirmed as early colonizers apparently independent of the factors studied here, while B. animalis subsp. lactis presence was found to be dependent solely on the type of feeding, indicating that it might not be a common infant gut inhabitant. One interesting and rather unexpected confounding factor was gender. This study contributes to our understanding of the composition of the microbiota in early life and the succession process and the evolution of the microbial community as a function of time and events occurring during the first 6 months of life. Our results provide new insights that could be taken into consideration when selecting nutritional supplementation strategies to support the

  17. Early-Life Events, Including Mode of Delivery and Type of Feeding, Siblings and Gender, Shape the Developing Gut Microbiota

    PubMed Central

    Cetinyurek Yavuz, Aysun; Ben-Amor, Kaouther; Roelofs, Mieke; Ishikawa, Eiji; Kubota, Hiroyuki; Swinkels, Sophie; Sakai, Takafumi; Oishi, Kenji; Kushiro, Akira; Knol, Jan

    2016-01-01

    Colonization of the infant gut is believed to be critically important for a healthy growth as it influences gut maturation, metabolic, immune and brain development in early life. Understanding factors that influence this process is important, since an altered colonization has been associated with a higher risk of diseases later in life. Fecal samples were collected from 108 healthy neonates in the first half year of life. The composition and functionality of the microbiota was characterized by measuring 33 different bacterial taxa by qPCR/RT qPCR, and 8 bacterial metabolites. Information regarding gender, place and mode of birth, presence of siblings or pets; feeding pattern and antibiotic use was collected by using questionnaires. Regression analysis techniques were used to study associations between microbiota parameters and confounding factors over time. Bacterial DNA was detected in most meconium samples, suggesting bacterial exposure occurs in utero. After birth, colonization by species of Bifidobacterium, Lactobacillus and Bacteroides was influenced by mode of delivery, type of feeding and presence of siblings, with differences found at species level and over time. Interestingly, infant-type bifidobacterial species such as B. breve or B. longum subsp infantis were confirmed as early colonizers apparently independent of the factors studied here, while B. animalis subsp. lactis presence was found to be dependent solely on the type of feeding, indicating that it might not be a common infant gut inhabitant. One interesting and rather unexpected confounding factor was gender. This study contributes to our understanding of the composition of the microbiota in early life and the succession process and the evolution of the microbial community as a function of time and events occurring during the first 6 months of life. Our results provide new insights that could be taken into consideration when selecting nutritional supplementation strategies to support the

  18. Cytoplasmic Viral Replication Complexes

    PubMed Central

    den Boon, Johan A.; Diaz, Arturo; Ahlquist, Paul

    2010-01-01

    Many viruses that replicate in the cytoplasm compartmentalize their genome replication and transcription in organelle-like structures that enhance replication efficiency and protection from host defenses. In particular, recent studies with diverse positive-strand RNA viruses have further elucidated the ultrastructure of membrane-bounded RNA replication complexes and their close coordination with virion assembly and budding. The structure, function and assembly of some positive-strand RNA virus replication complexes have parallels and potential evolutionary links with the replicative cores of double-strand RNA virus and retrovirus virions, and more general similarities with the replication factories of cytoplasmic DNA viruses. PMID:20638644

  19. Dynamics of Escherichia coli chromosome segregation during multifork replication.

    PubMed

    Nielsen, Henrik J; Youngren, Brenda; Hansen, Flemming G; Austin, Stuart

    2007-12-01

    Slowly growing Escherichia coli cells have a simple cell cycle, with replication and progressive segregation of the chromosome completed before cell division. In rapidly growing cells, initiation of replication occurs before the previous replication rounds are complete. At cell division, the chromosomes contain multiple replication forks and must be segregated while this complex pattern of replication is still ongoing. Here, we show that replication and segregation continue in step, starting at the origin and progressing to the replication terminus. Thus, early-replicated markers on the multiple-branched chromosomes continue to separate soon after replication to form separate protonucleoids, even though they are not segregated into different daughter cells until later generations. The segregation pattern follows the pattern of chromosome replication and does not follow the cell division cycle. No extensive cohesion of sister DNA regions was seen at any growth rate. We conclude that segregation is driven by the progression of the replication forks.

  20. Inhibition of iridovirus protein synthesis and virus replication by antisense morpholino oligonucleotides targeted to the major capsid protein, the 18 kDa immediate-early protein, and a viral homolog of RNA polymerase II

    SciTech Connect

    Sample, Robert; Bryan, Locke; Long, Scott; Majji, Sai; Hoskins, Glenn; Sinning, Allan; Olivier, Jake; Chinchar, V. Gregory . E-mail: vchinchar@microbio.umsmed.edu

    2007-02-20

    Frog virus 3 (FV3) is a large DNA virus that encodes {approx} 100 proteins. Although the general features of FV3 replication are known, the specific roles that most viral proteins play in the virus life cycle have not yet been elucidated. To address the question of viral gene function, antisense morpholino oligonucleotides (asMOs) were used to transiently knock-down expression of specific viral genes and thus infer their role in virus replication. We designed asMOs directed against the major capsid protein (MCP), an 18 kDa immediate-early protein (18K) that was thought to be a viral regulatory protein, and the viral homologue of the largest subunit of RNA polymerase II (vPol-II{alpha}). All three asMOs successfully inhibited translation of the targeted protein, and two of the three asMOs resulted in marked phenotypic changes. Knock-down of the MCP resulted in a marked reduction in viral titer without a corresponding drop in the synthesis of other late viral proteins. Transmission electron microscopy (TEM) showed that in cells treated with the anti-MCP MO assembly sites were devoid of viral particles and contained numerous aberrant structures. In contrast, inhibition of 18K synthesis did not block virion formation, suggesting that the 18K protein was not essential for replication of FV3 in fathead minnow (FHM) cells. Finally, consistent with the view that late viral gene expression is catalyzed by a virus-encoded or virus-modified Pol-II-like protein, knock-down of vPol-II{alpha} triggered a global decline in late gene expression and virus yields without affecting the synthesis of early viral genes. Collectively, these results demonstrate the utility of using asMOs to elucidate the function of FV3 proteins.

  1. Early impact event and fluid activity on H chondrite parent body registered in the Pułtusk meteorite

    NASA Astrophysics Data System (ADS)

    Krzesinska, Agata

    2015-04-01

    Impact is one of the most important processes affecting asteroids, but it is neglected as a source for heat of these bodies. Recent modeling work show, however, that impact into warm planetesimals is able to cause global-scale temperature increase to the point of melting of silicates [1]. An obvious consequence of this fact is that the impact activity in early evolution of asteroids may promote formation of melt and its differentiation. H chondrites provide some lines of evidence for an early, 4.4 Ga impact event on their parent body. The event resulted in formation of heavily shocked and melted H chondrites with old gas retention ages [2, 3], including Portales Valley, an unique metal-rich breccia [e.g. 4]. The impact led also, very likely, to unmixing of silicate and metal-sulfide melts and to formation of silicate-iron non-magmatic IIE meteorites [5]. Additional evidence for this event, and for melting it caused, may come from highly equilibrated and recrystallized fragments of the Pułtusk meteorite containing vein-like metal accumulations [6]. In the Pułtusk, vein-like metal accumulations are kamacite-rich, and basically depleted in sulfides. They form many tendrils into the equilibrated, well recrystallized chondritic rock. Marked feature of the chondritic rock at the contact with accumulations is presence of unusually large phosphate and feldspar grains. The minerals bear record of crystallization from melt. Both vein-like metal accumulations and chondritic rock record, however, slow cooling rate. Phopshates are in the meteorite represented by merrillite and apatite, predominantly intergrown with each other. Merrillite poikilitically encloses silicate grains. It is probably of magmatic origin, since it contains detectable amount of potassium and high content of sodium. Apatite contains varying concentrations of chlorine, fluorine and missing structural component. Content of Cl and F are negatively correlated and both elements are heterogeneously distributed

  2. Subsurface warming in the subpolar North Atlantic during rapid climate events in the Early and Mid-Pleistocene

    NASA Astrophysics Data System (ADS)

    Hernández-Almeida, Iván; Sierro, Francisco; Cacho, Isabel; Abel Flores, José

    2014-05-01

    A new high-resolution reconstruction of the temperature and salinity of the subsurface waters using paired Mg/Ca-δ18O measurements on the planktonic foraminifera Neogloboquadrina pachyderma sinistrorsa (sin.) was conducted on a deep-sea sediment core in the subpolar North Atlantic (Site U1314). This study aims to reconstruct millennial-scale subsurface hydrography variations during the Early and Mid-Pleistocene (MIS 31-19). These rapid climate events are characterized by abrupt shifts between warm/cold conditions, and ice-sheet oscillations, as evidenced by major ice rafting events recorded in the North Atlantic sediments (Hernández-Almeida et al., 2012), similar to those found during the Last Glacial period (Marcott et al, 2011). The Mg/Ca derived paleotemperature and salinity oscillations prior and during IRD discharges at Site U1314 are related to changes in intermediate circulation. The increases in Mg/Ca paleotemperatures and salinities during the IRD event are preceded by short episodes of cooling and freshening of subsurface waters. The response of the AMOC to this perturbation is an increased of warm and salty water coming from the south, transported to high latitudes in the North Atlantic beneath the thermocline. This process is accompanied by a southward shift in the convection cell from the Nordic Seas to the subpolar North Atlantic and better ventilation of the North Atlantic at mid-depths. Poleward transport of warm and salty subsurface subtropical waters causes intense basal melting and thinning of marine ice-shelves, that culminates in large-scale instability of the ice sheets, retreat of the grounding line and iceberg discharge. The mechanism proposed involves the coupling of the AMOC with ice-sheet dynamics, and would explain the presence of these fluctuations before the establishment of high-amplitude 100-kyr glacial cycles. Hernández-Almeida, I., Sierro, F.J., Cacho, I., Flores, J.A., 2012. Impact of suborbital climate changes in the North

  3. Spatial regulation and organization of DNA replication within the nucleus.

    PubMed

    Natsume, Toyoaki; Tanaka, Tomoyuki U

    2010-01-01

    Duplication of chromosomal DNA is a temporally and spatially regulated process. The timing of DNA replication initiation at various origins is highly coordinated; some origins fire early and others late during S phase. Moreover, inside the nuclei, the bulk of DNA replication is physically organized in replication factories, consisting of DNA polymerases and other replication proteins. In this review article, we discuss how DNA replication is organized and regulated spatially within the nucleus and how this spatial organization is linked to temporal regulation. We focus on DNA replication in budding yeast and fission yeast and, where applicable, compare yeast DNA replication with that in bacteria and metazoans.

  4. Decoupling of carbon isotope records between organic matter and carbonate prior to the Toarcian Oceanic Anoxic Event (Early Jurassic)

    NASA Astrophysics Data System (ADS)

    Bodin, Stephane; Kothe, Tim; Krencker, Francois-Nicolas; Suan, Guillaume; Heimhofer, Ulrich; Immenhauser, Adrian

    2014-05-01

    Across the Pliensbachian-Toarcian boundary (P-To, Early Jurassic), ca. 1 Myr before the Toarcian Oceanic Anoxic Event (T-OAE), an initial negative carbon isotope excursion has been documented in western Tethys sedimentary rocks. In carbonate, its amplitude (2-3 permil) is similar to the subsequent excursion recorded at the onset of the T-OAE. Being also associated with a rapid warming event, the significance of this first carbon isotope shift, in terms of paleoenvironmental interpretation and triggering mechanism, remains however elusive. Taking advantage of expanded and rather continuous sections in the High Atlas of Morocco, several high-resolution, paired organic-inorganic carbon isotope records have been obtained across the Upper Pliensbachian - Lower Toarcian interval. At the onset of the T-OAE, an abrupt 1-2 permil negative shift is recorded in both organic and inorganic phases, succeeded by a relatively longer term 1-2 permil negative trend and a final slow return to pre-excursion conditions. In accordance with previous interpretations, this pattern indicates a perturbation of the entire exogenic carbon isotope reservoir at the onset of the T-OAE by the sudden release of isotopically light carbon into the atmosphere. By contrast, there is no negative shift in carbon isotopes for the P-To event recorded in bulk organic matter of Morocco. Given the strong dominance of terrestrial particles in the bulk organic matter fraction, this absence indicates that massive input of 12C-rich carbon into the atmosphere is not likely to have happened during the P-To event. A pronounced (2 permil) and abrupt negative shift in carbon isotope is however recorded in the bulk carbonate phase. We suggest that this decoupling between organic and inorganic phase is due to changes in the nature of the bulk carbonate phase. Indeed, the negative shift occurs at the lithological transition between Pliensbachian-lowermost Toarcian limestone-marl alternations and the Lower Toarcian marl

  5. Cell-cycle-specific initiation of replication.

    PubMed

    Nordström, K; Austin, S J

    1993-11-01

    The following characteristics are relevant when replication of chromosomes and plasmids is discussed in relation to the cell cycle: the timing or replication, the selection of molecules for replication, and the coordination of multiple initiation events within a single cell cycle. Several fundamentally different methods have been used to study these processes: Meselson-Stahl density-shift experiments, experiments with the so-called 'baby machine', sorting of cells according to size, and flow cytometry. The evidence for precise timing and co-ordination of chromosome replication in Escherichia coli is overwhelming. Similarly, the high-copy-number plasmid ColE1 and the low-copy-number plasmids R1/R100 without any doubt replicate randomly throughout the cell cycle. Data about the low-copy-number plasmids F and P1 are conflicting. This calls for new types of experiments and for a better understanding of how these plasmids control their replication and partitioning.

  6. Evidence of resilience to past climate change in Southwest Asia: Early farming communities and the 9.2 and 8.2 ka events

    NASA Astrophysics Data System (ADS)

    Flohr, Pascal; Fleitmann, Dominik; Matthews, Roger; Matthews, Wendy; Black, Stuart

    2016-03-01

    Climate change is often cited as a major factor in social change. The so-called 8.2 ka event was one of the most pronounced and abrupt Holocene cold and arid events. The 9.2 ka event was similar, albeit of a smaller magnitude. Both events affected the Northern Hemisphere climate and caused cooling and aridification in Southwest Asia. Yet, the impacts of the 8.2 and 9.2 ka events on early farming communities in this region are not well understood. Current hypotheses for an effect of the 8.2 ka event vary from large-scale site abandonment and migration (including the Neolithisation of Europe) to continuation of occupation and local adaptation, while impacts of the 9.2 ka have not previously been systematically studied. In this paper, we present a thorough assessment of available, quality-checked radiocarbon (14C) dates for sites from Southwest Asia covering the time interval between 9500 and 7500 cal BP, which we interpret in combination with archaeological evidence. In this way, the synchronicity between changes observed in the archaeological record and the rapid climate events is tested. It is shown that there is no evidence for a simultaneous and widespread collapse, large-scale site abandonment, or migration at the time of the events. However, there are indications for local adaptation. We conclude that early farming communities were resilient to the abrupt, severe climate changes at 9250 and 8200 cal BP.

  7. Early Results of Three-Year Monitoring of Red Wood Ants’ Behavioral Changes and Their Possible Correlation with Earthquake Events

    PubMed Central

    Berberich, Gabriele; Berberich, Martin; Grumpe, Arne; Wöhler, Christian; Schreiber, Ulrich

    2013-01-01

    Simple Summary For three years (2009–2012), two red wood ant mounds (Formica rufa-group), located at the seismically active Neuwied Basin (Eifel, Germany), have been monitored 24/7 by high-resolution cameras. Early results show that ants have a well-identifiable standard daily routine. Correlation with local seismic events suggests changes in the ants’ behavior hours before the earthquake: the nocturnal rest phase and daily activity are suppressed, and standard daily routine does not resume until the next day. At present, an automated image evaluation routine is being applied to the video streams. Based on this automated approach, a statistical analysis of the ant behavior will be carried out. Abstract Short-term earthquake predictions with an advance warning of several hours or days are currently not possible due to both incomplete understanding of the complex tectonic processes and inadequate observations. Abnormal animal behaviors before earthquakes have been reported previously, but create problems in monitoring and reliability. The situation is different with red wood ants (RWA; Formica rufa-group (Hymenoptera: Formicidae)). They have stationary mounds on tectonically active, gas-bearing fault systems. These faults may be potential earthquake areas. For three years (2009–2012), two red wood ant mounds (Formica rufa-group), located at the seismically active Neuwied Basin (Eifel, Germany), have been monitored 24/7 by high-resolution cameras with both a color and an infrared sensor. Early results show that ants have a well-identifiable standard daily routine. Correlation with local seismic events suggests changes in the ants’ behavior hours before the earthquake: the nocturnal rest phase and daily activity are suppressed, and standard daily routine does not resume until the next day. At present, an automated image evaluation routine is being applied to the more than 45,000 hours of video streams. Based on this automated approach, a statistical analysis of

  8. Calcium isotope evidence for dramatic increase of continental weathering during the Toarcian oceanic anoxic event (Early Jurassic)

    NASA Astrophysics Data System (ADS)

    Brazier, Jean-Michel; Suan, Guillaume; Tacail, Théo; Simon, Laurent; Martin, Jeremy E.; Mattioli, Emanuela; Balter, Vincent

    2015-02-01

    The early Toarcian was punctuated by pulses of massive carbon injection that are thought to have triggered, through increased greenhouse conditions, elevated continental discharge and nutrient input, marine anoxia, seawater acidification and species extinctions. Nevertheless, the mode and tempo of changes in continental weathering across this interval remains highly debated, leading to considerable uncertainty about the main causes of these perturbations. In this study we present calcium isotope measurements (δ44/40Ca) of well-preserved brachiopods and bulk rock samples from the hemipelagic strata of Pliensbachian-Toarcian age of Peniche in Portugal in order to constrain changes in the calcium cycle and hence changes in continental weathering during the early Toarcian. The data reveal a similar trend as carbon isotope data from the same section and show negative excursions of about 0.5‰ at the Pliensbachian-Toarcian transition (Pl-To) and at the base of the Toarcian Oceanic Anoxic Event (T-OAE) interval. The comparison of δ44/40Ca ratios recorded in brachiopods and bulk rock corrected for variable dolomite contribution indicates that these excursions reflect changes in the global isotopic composition of seawater rather than changes in the dominant mineralogy of calcifying organisms or in hydrological budget of the considered basin. Box modeling results suggest that the Pl-To and T-OAE δ44/40Ca excursions can be explained by a transient 90% decrease of carbonate accumulation due to seawater acidification followed by a 500% increase in continental weathering rates. The sharp increases in continental weathering inferred from the δ44/40Ca ratios seem overall consistent with lower Toarcian sedimentological and biotic records that document rapid crises in carbonate production followed by episodes of increased calcium carbonate burial. Nevertheless, the maximum of carbonate burial recorded by most NW European basinal successions occurs several hundreds of kyrs after

  9. Rapid changes in the redox conditions of the western Tethys Ocean during the early Aptian oceanic anoxic event

    NASA Astrophysics Data System (ADS)

    Westermann, Stéphane; Stein, Melody; Matera, Virginie; Fiet, Nicolas; Fleitmann, Dominik; Adatte, Thierry; Föllmi, Karl B.

    2013-11-01

    The early Aptian (125 to 121 Ma) records an episode of severe environmental change including a major perturbation of the carbon cycle, an oceanic anoxic event (OAE 1a, 122.5 Ma), a platform drowning episode and a biocalcification crisis. We propose to trace changes in the oxygenation state of the ocean during the early Aptian anoxic event using the redox-sensitive trace-element (RSTE) distribution, phosphorus accumulation rates (PARs) and organic-matter characterization in three different basins of the western Tethys. The following sections have been investigated: Gorgo a Cerbara (central Italy) in the Umbria Marche basin, Glaise (SE France) in the Vocontian basin and Cassis/La Bédoule (SE France) located in the Provencal basin. In the Gorgo a Cerbara section, RSTE distributions show a low background level along the main part of the section, contrasted by different maxima in concentrations within the Selli level. In the Glaise section, the Goguel level displays a weak increase in RSTE contents coeval with moderate TOC values. At Cassis/La Bédoule, no significant RSTE enrichments have been observed in sediments equivalent to the Selli level. These differences in the records of the geochemical proxies of the Selli level or its equivalent indicate the deposition under different redox conditions, probably related to the paleogeography. Our data indicate the development of anoxic-euxinic conditions in the deeper part of the Tethys during OAE 1a, whereas in the shallower environments, conditions were less reducing. Moreover, at Gorgo a Cerbara, the Selli level is characterized by rapid changes in the intensity of reducing conditions in the water column. Ocean eutrophication seems to be a major factor in the development and the persistence of anoxia as suggested by the PAR evolution. Higher PAR values at the onset of OAE 1a suggest an increase in nutrient input, whereas the return to lower values through the first part of the OAE 1a interval may be related to the

  10. A late eocene-early Oligocene transgressive event in the Golfo San Jorge basin: Palynological results and stratigraphic implications

    NASA Astrophysics Data System (ADS)

    Paredes, José M.; Foix, Nicolás; Guerstein, G. Raquel; Guler, María V.; Irigoyen, Martín; Moscoso, Pablo; Giordano, Sergio

    2015-11-01

    A new Cenozoic dataset in the subsurface of the South Flank of the Golfo San Jorge Basin (Santa Cruz province) allowed to identify a non-previously recognized transgressive event of late Eocene to early Oligocene age. Below of a marine succession containing a dinoflagellate cyst assemblage that characterizes the C/G palynological zone of the Chenque Formation (early Miocene), a 80-110 m thick marine succession contains a palynological assemblage integrated by Gelatia inflata, Diphyes colligerum and Reticulatosphaera actinocoronata supporting the occurrence of a marine incursion in the basin during the Eocene-Oligocene transition (EOT). The new lithostratigraphic unit - here defined as El Huemul Formation - covers in sharp contact to the Sarmiento Formation, and become thinner from East to West; the unit has been identified in about 1800 well logs covering up to 3500 km2, and its subsurface distribution exceed the boundaries of the study area. The El Huemul Formation consists of a thin lag of glauconitic sandstones with fining-upward log motif, followed by a mudstone-dominated succession that coarsening-upward to sandstones, evidencing a full T-R cycle. Preservation of the El Huemul Formation in the subsurface of the South Flank has been favored by the reactivation of WNW-ESE late Cretaceous normal faults, and by the generation of N-S striking normal faults of Paleocene-Eocene age. Flexural loading associated to igneous intrusions of Paleocene?- middle Eocene age also promoted the increase of subsidence in the South Flank of the basin prior to the transgression.

  11. Altered expression of CKs 14/20 is an early event in a rat model of multistep bladder carcinogenesis.

    PubMed

    Gil da Costa, Rui M; Oliveira, Paula A; Vasconcelos-Nóbrega, Carmen; Arantes-Rodrigues, Regina; Pinto-Leite, Rosário; Colaço, Aura A; de la Cruz, Luis F; Lopes, Carlos

    2015-10-01

    Cytokeratins (CKs) 14 and 20 are promising markers for diagnosing urothelial lesions and for studying their prognosis and histogenesis. This work aimed to study the immunohistochemical staining patterns of CK14/20 during multistep carcinogenesis leading to papillary bladder cancer in a rat model. Thirty female Fischer 344 rats were divided into three groups: group 1 (control); group 2, which received N-butyl-N-(4-hydroxybutyl)nitrosamine (BBN) for 20 weeks plus 1 week without treatment; and group 3, which received BBN for 20 weeks plus 8 weeks without treatment. Bladder lesions were classified histologically. CK14 and CK20 immunostaining was assessed according to its distribution and intensity. In control animals, 0-25% of basal cells and umbrella cells stained positive for CK14 and CK20 respectively. On groups 2 and 3, nodular hyperplastic lesions showed normal CK20 and moderately increased CK14 staining (26-50% of cells). Dysplasia, squamous metaplasia, papilloma, papillary tumours of low malignant potential and low- and high-grade papillary carcinomas showed increased CK14 and CK20 immunostaining in all epithelial layers. Altered CK14 and CK20 expression is an early event in urothelial carcinogenesis and is present in a wide spectrum of urothelial superficial neoplastic and preneoplastic lesions. PMID:26515584

  12. A computational model for early events in B cell antigen receptor signaling: analysis of the roles of Lyn and Fyn

    PubMed Central

    Barua, Dipak; Hlavacek, William S.; Lipniacki, Tomasz

    2012-01-01

    B cell antigen receptor (BCR) signaling regulates the activities and fates of B cells. BCR signaling encompasses two feedback loops emanating from Lyn and Fyn, which are Src-family protein tyrosine kinases (SFKs). Positive feedback arises from SFK-mediated trans phosphorylation of BCR and receptor-bound Lyn and Fyn, which increases the kinase activities of Lyn and Fyn. Negative feedback arises from SFK-mediated cis phosphorylation of the transmembrane adapter protein PAG1, which recruits the cytosolic protein tyrosine kinase Csk to the plasma membrane, where it acts to decrease the kinase activities of Lyn and Fyn. To study the effects of the positive and negative feedback loops on the dynamical stability of BCR signaling and the relative contributions of Lyn and Fyn to BCR signaling, we consider here a rule-based model for early events in BCR signaling that encompasses membrane-proximal interactions of six proteins: BCR, Lyn, Fyn, Csk, PAG1 and Syk, a cytosolic protein tyrosine kinase that is activated as a result of SFK-mediated phosphorylation of BCR. The model is consistent with known effects of Lyn and Fyn deletions. We find that BCR signaling can generate a single pulse or oscillations of Syk activation depending on the strength of antigen signal and the relative levels of Lyn and Fyn. We also show that bistability can arise in Lyn or Csk deficient cells. PMID:22711887

  13. Indirect comparisons of adverse events and dropout rates in early Parkinson's disease trials of pramipexole, ropinirole, and rasagiline.

    PubMed

    Zagmutt, Francisco J; Tarrants, Marcy L

    2012-07-01

    The comparative safety profiles of monotherapeutic treatments for Parkinson's disease (PD) can provide valuable therapeutic information. The objective of this study was to perform an indirect comparison of Adverse Events (AEs) and Dropout Rates (DRs) among clinical trials of pramipexole, ropinirole, and rasagiline. Outcomes analyzed included DRs, total AEs, and AE categories: Cognitive (CG), Gastrointestinal (GI), and Sleep/Fatigue (SF). The odds-ratio (OR) and Credible Interval (CrI) of outcomes between products using placebo as common comparator was calculated using indirect meta-analytical methods. AEs incidences for subjects receiving rasagiline were not significantly different from placebo, whereas DRs were significantly lower than for placebo (OR = 0.55; 95% CrI = 0.34-0.88). Patients receiving pramipexole or ropinirole had higher incidence of all AEs and DRs than patients taking rasagiline, except for the nonsignificant incidence of CG for ropinirole vs. rasagiline (1.76; 0.69-4.70). The incidence of GI (2.11; 1.13-4.06) and SF (2.75; 1.42-5.47) was significantly higher for ropinirole than for pramipexole, whereas the incidence of CG was significantly lower for ropinirole than for pramipexole (0.22; 0.07-0.69). Findings suggest that subjects with early PD treated with rasagiline have fewer AEs and DRs than those treated with pramipexole or ropinirole. GI and SF AEs were highest for subjects treated with ropinirole, while individuals treated with pramipexole exhibited the highest incidence of cognitive AEs.

  14. Stimulation of Na/sup +//H/sup +/ antiport is an early event in hypertrophy of renal proximal tubular cells

    SciTech Connect

    Fine, L.G.; Badie-Dezfooly, B.; Lowe, A.G.; Hamzeh, A.; Wells, J.; Salehmoghaddam, S.

    1985-03-01

    Renal hypertrophy in vivo is achieved by an increase in protein content per cell and an increase in cell size with minimal hyperplasia. Hypertrophied renal tubular cells remain quiescent and demonstrate an increase in transcellular transport rates. This situation was simulated in vitro by exposing a confluent, quiescent primary culture of rabbit renal proximal tubular cells to either insulin, prostaglandin E/sub 1/, or hypertonic NaCl for 24 or 48 hr. Protein per cell increased by 20-30% with little or no increase in (/sup 3/H)thymidine incorporation into DNA. Mean cell volume was also increased in insulin- and hypertonic NaCl-treated but not in prostaglandin E/sub 1/-treated cells. Two hours of exposure to the growth stimuli increased amiloride-sensitive Na/sup +/ uptake, Na-dependent H/sup +/ efflux, and ouabain-sensitive Rb/sup +/ uptake, indicating that stimulation of Na/sup +//H/sup +/ antiport (exchange) occurs as an early event in their action. Hypertrophied cells continued to demonstrate enhanced Na/sup +//H/sup +/ antiport after the growth stimuli were removed for 3 hr, by which time their acute effects are reversed.

  15. Altered expression of CKs 14/20 is an early event in a rat model of multistep bladder carcinogenesis.

    PubMed

    Gil da Costa, Rui M; Oliveira, Paula A; Vasconcelos-Nóbrega, Carmen; Arantes-Rodrigues, Regina; Pinto-Leite, Rosário; Colaço, Aura A; de la Cruz, Luis F; Lopes, Carlos

    2015-10-01

    Cytokeratins (CKs) 14 and 20 are promising markers for diagnosing urothelial lesions and for studying their prognosis and histogenesis. This work aimed to study the immunohistochemical staining patterns of CK14/20 during multistep carcinogenesis leading to papillary bladder cancer in a rat model. Thirty female Fischer 344 rats were divided into three groups: group 1 (control); group 2, which received N-butyl-N-(4-hydroxybutyl)nitrosamine (BBN) for 20 weeks plus 1 week without treatment; and group 3, which received BBN for 20 weeks plus 8 weeks without treatment. Bladder lesions were classified histologically. CK14 and CK20 immunostaining was assessed according to its distribution and intensity. In control animals, 0-25% of basal cells and umbrella cells stained positive for CK14 and CK20 respectively. On groups 2 and 3, nodular hyperplastic lesions showed normal CK20 and moderately increased CK14 staining (26-50% of cells). Dysplasia, squamous metaplasia, papilloma, papillary tumours of low malignant potential and low- and high-grade papillary carcinomas showed increased CK14 and CK20 immunostaining in all epithelial layers. Altered CK14 and CK20 expression is an early event in urothelial carcinogenesis and is present in a wide spectrum of urothelial superficial neoplastic and preneoplastic lesions.

  16. Early Life Events Carry Over to Influence Pre-Migratory Condition in a Free-Living Songbird

    PubMed Central

    Mitchell, Greg W.; Guglielmo, Christopher G.; Wheelwright, Nathaniel T.; Freeman-Gallant, Corey R.; Norris, D. Ryan

    2011-01-01

    Conditions experienced during development can have long-term consequences for individual success. In migratory songbirds, the proximate mechanisms linking early life events and survival are not well understood because tracking individuals across stages of the annual cycle can be extremely challenging. In this paper, we first use a 13 year dataset to demonstrate a positive relationship between 1st year survival and nestling mass in migratory Savannah sparrows (Passerculus sandwichensis). We also use a brood manipulation experiment to show that nestlings from smaller broods have higher mass in the nest relative to individuals from larger broods. Having established these relationships, we then use three years of field data involving multiple captures of individuals throughout the pre-migratory period and a multi-level path model to examine the hypothesis that conditions during development limit survival during migration by affecting an individual's ability to accumulate sufficient lean tissue and fat mass prior to migration. We found a positive relationship between fat mass during the pre-migratory period (Sept–Oct) and nestling mass and a negative indirect relationship between pre-migratory fat mass and fledging date. Our results provide the first evidence that conditions during development limit survival during migration through their effect on fat stores. These results are particularly important given recent evidence showing that body condition of songbirds at fledging is affected by climate change and anthropogenic changes to landscape structure. PMID:22194925

  17. Restricted replication of herpes simplex virus in spinal ganglia of resistant mice is accompanied by an early infiltration of immunoglobulin G-bearing cells.

    PubMed Central

    Cook, M L; Stevens, J G

    1983-01-01

    In an attempt to define the nature of the difference in the susceptibility of C57BL/6 (resistant) and A/J (susceptible) mice to herpes simplex virus type 1, we initiated a study of virus progression through the nervous system. After inoculation of virus in a rear footpad, C57BL/6 mice were found to be more than 500-fold more resistant, but resistance did not extend to pseudorabies virus. In additional investigations, it was found that the virus was selectively restricted at the level of spinal ganglia in C57BL/6 mice. No intrinsic difference in the ability of this tissue from either mouse strain to replicate virus was found. However, by 4 days after infection, morphological investigations indicated that a mononuclear cell infiltrate was present surrounding infected neurons and satellite cells both earlier and in greater numbers in the ganglia of C57BL/6 mice. Immunohistochemical methods showed that most of these cells did not express Thy 1.2 antigen, but the vast majority bore immunoglobulin G. The mechanism by which these infiltrating cells could restrict virus spread is discussed. Images PMID:6302004

  18. Adenovirus Early Proteins and Host Sumoylation

    PubMed Central

    Sohn, Sook-Young

    2016-01-01

    ABSTRACT The human adenovirus genome is transported into the nucleus, where viral gene transcription, viral DNA replication, and virion assembly take place. Posttranslational modifications by small ubiquitin-like modifiers (SUMOs) are implicated in the regulation of diverse cellular processes, particularly nuclear events. It is not surprising, therefore, that adenovirus modulates and utilizes the host sumoylation system. Adenovirus early proteins play an important role in establishing optimal host environments for virus replication within infected cells by stimulating the cell cycle and counteracting host antiviral defenses. Here, we review findings on the mechanisms and functional consequences of the interplay between human adenovirus early proteins and the host sumoylation system. PMID:27651358

  19. Adenovirus Early Proteins and Host Sumoylation.

    PubMed

    Sohn, Sook-Young; Hearing, Patrick

    2016-01-01

    The human adenovirus genome is transported into the nucleus, where viral gene transcription, viral DNA replication, and virion assembly take place. Posttranslational modifications by small ubiquitin-like modifiers (SUMOs) are implicated in the regulation of diverse cellular processes, particularly nuclear events. It is not surprising, therefore, that adenovirus modulates and utilizes the host sumoylation system. Adenovirus early proteins play an important role in establishing optimal host environments for virus replication within infected cells by stimulating the cell cycle and counteracting host antiviral defenses. Here, we review findings on the mechanisms and functional consequences of the interplay between human adenovirus early proteins and the host sumoylation system. PMID:27651358

  20. Surveying genome replication

    PubMed Central

    Kearsey, Stephen

    2002-01-01

    Two recent studies have added microarrays to the toolkit used to analyze the origins of replication in yeast chromosomes, providing a fuller picture of how genomic DNA replication is organized. PMID:12093380

  1. Inhibition of the FACT Complex Reduces Transcription from the Human Cytomegalovirus Major Immediate Early Promoter in Models of Lytic and Latent Replication.

    PubMed

    O'Connor, Christine M; Nukui, Masatoshi; Gurova, Katerina V; Murphy, Eain A

    2016-04-01

    The successful colonization of the majority of the population by human cytomegalovirus is a direct result of the virus's ability to establish and, more specifically, reactivate from latency. The underlying cellular factors involved in viral reactivation remain unknown. Here, we show that the host complexfacilitateschromatintranscription (FACT) binds to the major immediate early promoter (MIEP) and that inhibition of this complex reduces MIEP transactivation, thus inhibiting viral reactivation. PMID:26865717

  2. Replicating repetitive DNA.

    PubMed

    Tognetti, Silvia; Speck, Christian

    2016-05-27

    The function and regulation of repetitive DNA, the 'dark matter' of the genome, is still only rudimentarily understood. Now a study investigating DNA replication of repetitive centromeric chromosome segments has started to expose a fascinating replication program that involves suppression of ATR signalling, in particular during replication stress. PMID:27230530

  3. Transcriptomic dose-and-time-course indicators of early key events in a cytotoxicity-mediated mode of action for rodent urinary bladder tumorigenesis

    EPA Science Inventory

    TRANSCRIPTOMIC DOSE- AND TIME-COURSE INDICATORS OF EARLY KEY EVENTS IN A CYTOTOXICITY-MEDIATED MODE OF ACTION FOR RODENT URINARY BLADDER TUMORIGENESISDiuron is a substituted urea compound used globally as an herbicide. Urinary bladder tumors were induced in rats after chronic die...

  4. Replication in Practice: Lessons from Five Lead Agencies

    ERIC Educational Resources Information Center

    McGonigel, Mary

    2005-01-01

    This article describes the replication efforts of five programs funded by the Pritzker Early Childhood Foundation and determines what methods are key to replication success. Before replication can take place, the lead agency must have substantial evidence of its effectiveness and know its core elements. It must also think carefully about how its…

  5. Regulation of chromosomal replication in Caulobacter crescentus.

    PubMed

    Collier, Justine

    2012-03-01

    The alpha-proteobacterium Caulobacter crescentus is characterized by its asymmetric cell division, which gives rise to a replicating stalked cell and a non-replicating swarmer cell. Thus, the initiation of chromosomal replication is tightly regulated, temporally and spatially, to ensure that it is coordinated with cell differentiation and cell cycle progression. Waves of DnaA and CtrA activities control when and where the initiation of DNA replication will take place in C. crescentus cells. The conserved DnaA protein initiates chromosomal replication by directly binding to sites within the chromosomal origin (Cori), ensuring that DNA replication starts once and only once per cell cycle. The CtrA response regulator represses the initiation of DNA replication in swarmer cells and in the swarmer compartment of pre-divisional cells, probably by competing with DnaA for binding to Cori. CtrA and DnaA are controlled by multiple redundant regulatory pathways that include DNA methylation-dependent transcriptional regulation, temporally regulated proteolysis and the targeting of regulators to specific locations within the cell. Besides being critical regulators of chromosomal replication, CtrA and DnaA are also master transcriptional regulators that control the expression of many genes, thus connecting DNA replication with other events of the C. crescentus cell cycle.

  6. Strong alkalinization of Chara cell surface in the area of cell wall incision as an early event in mechanoperception.

    PubMed

    Bulychev, Alexander A; Alova, Anna V; Bibikova, Tatiana N

    2013-11-01

    Mechanical wounding of cell walls occurring in plants under the impact of pathogens or herbivores can be mimicked by cell wall incision with a glass micropipette. Measurements of pH at the surface of Chara corallina internodes following microperforation of cell wall revealed a rapid (10-30s) localized alkalinization of the apoplast after a lag period of 10-20s. The pH increase induced by incision could be as large as 3 pH units and relaxed slowly, with a halftime up to 20min. The axial pH profile around the incision zone was bell-shaped and localized to a small area, extending over a distance of about 100μm. The pH response was suppressed by lowering cell turgor upon the replacement of artificial pond water (APW) with APW containing 50mM sorbitol. Stretching of the plasma membrane during its impression into the cell wall defect is likely to activate the Ca(2+) channels, as evidenced from sensitivity of the incision-induced alkalinization to the external calcium concentration and to the addition of Ca(2+)-channel blockers, such as La(3+), Gd(3+), and Zn(2+). The maximal pH values attained at the incision site (~10.0) were close to pH in light-dependent alkaline zones of Chara cells. The involvement of cytoskeleton in the origin of alkaline patch was documented by observations that the incision-induced pH transients were suppressed by the inhibitors of microtubules (oryzalin and taxol) and, to a lesser extent, by the actin inhibitor (cytochalasin B). The results indicate that the localized increase in apoplastic pH is an early event in mechanoperception and depends on light, cytoskeleton, and intracellular calcium.

  7. Inhibition of mitochondrial fusion is an early and critical event in breast cancer cell apoptosis by dietary chemopreventative benzyl isothiocyanate.

    PubMed

    Sehrawat, Anuradha; Croix, Claudette St; Baty, Catherine J; Watkins, Simon; Tailor, Dhanir; Singh, Rana P; Singh, Shivendra V

    2016-09-01

    Benzyl isothiocyanate (BITC) is a highly promising phytochemical abundant in cruciferous vegetables with preclinical evidence of in vivo efficacy against breast cancer in xenograft and transgenic mouse models. Mammary cancer chemoprevention by BITC is associated with apoptotic cell death but the underlying mechanism is not fully understood. Herein, we demonstrate for the first time that altered mitochondrial dynamics is an early and critical event in BITC-induced apoptosis in breast cancer cells. Exposure of MCF-7 and MDA-MB-231 cells to plasma achievable doses of BITC resulted in rapid collapse of mitochondrial filamentous network. BITC treatment also inhibited polyethyleneglycol-induced mitochondrial fusion. In contrast, a normal human mammary epithelial cell line (MCF-10A) that was derived from fibrocystic breast disease, was resistant to BITC-mediated alterations in mitochondrial dynamics as well as apoptosis. Transient or sustained decrease in levels of proteins engaged in regulation of mitochondrial fission and fusion was clearly evident after BITC treatment in both cancer cell lines. A trend for a decrease in the levels of mitochondrial fission- and fusion-related proteins was also observed in vivo in tumors of BITC-treated mice compared with control. Immortalized mouse embryonic fibroblasts from Drp1 knockout mice were resistant to BITC-induced apoptosis when compared with those from wild-type mice. Upon treatment with BITC, Bak dissociated from mitofusin 2 in both MCF-7 and MDA-MB-231 cells suggesting a crucial role for interaction of Bak and mitofusins in BITC-mediated inhibition of fusion and morphological dynamics. In conclusion, the present study provides novel insights into the molecular complexity of BITC-induced cell death. PMID:27374852

  8. Strong alkalinization of Chara cell surface in the area of cell wall incision as an early event in mechanoperception.

    PubMed

    Bulychev, Alexander A; Alova, Anna V; Bibikova, Tatiana N

    2013-11-01

    Mechanical wounding of cell walls occurring in plants under the impact of pathogens or herbivores can be mimicked by cell wall incision with a glass micropipette. Measurements of pH at the surface of Chara corallina internodes following microperforation of cell wall revealed a rapid (10-30s) localized alkalinization of the apoplast after a lag period of 10-20s. The pH increase induced by incision could be as large as 3 pH units and relaxed slowly, with a halftime up to 20min. The axial pH profile around the incision zone was bell-shaped and localized to a small area, extending over a distance of about 100μm. The pH response was suppressed by lowering cell turgor upon the replacement of artificial pond water (APW) with APW containing 50mM sorbitol. Stretching of the plasma membrane during its impression into the cell wall defect is likely to activate the Ca(2+) channels, as evidenced from sensitivity of the incision-induced alkalinization to the external calcium concentration and to the addition of Ca(2+)-channel blockers, such as La(3+), Gd(3+), and Zn(2+). The maximal pH values attained at the incision site (~10.0) were close to pH in light-dependent alkaline zones of Chara cells. The involvement of cytoskeleton in the origin of alkaline patch was documented by observations that the incision-induced pH transients were suppressed by the inhibitors of microtubules (oryzalin and taxol) and, to a lesser extent, by the actin inhibitor (cytochalasin B). The results indicate that the localized increase in apoplastic pH is an early event in mechanoperception and depends on light, cytoskeleton, and intracellular calcium. PMID:23850637

  9. Plate tectonics hiati as the cause of global glaciations: 1. Early Proterozoic events and the rise of oxygen

    NASA Astrophysics Data System (ADS)

    Osmaston, M. F.

    2003-04-01

    Plate tectonics is the main way in which the Earth's internal heat is brought to the surface and lost, so it seems that global tectonics should not stop and start. Consequently the long-standing fact that, globally, no orogenic granitoid or greenstone U-Pb ages have been found in the 2.45--2.22 Ga interval has been attributed to defective sampling. Here I argue that this interval was indeed a prolonged hiatus in plate tectonics, being the first of two. The other, but differently caused, was in the late Proterozoic and is the topic of Part 2. The feature common to both hiati, and relevant to global glaciation, is that mid-ocean ridges (MORs) die and subside, potentially lowering sea-level by several kilometres, causing loss of atmospheric CO2 by weathering and an increase in planetary albedo. For the origin of the first hiatus we must first go back to formation of the core. The current iron-percolation model is invalidated by the fact that its corollary, the arrival of a water and siderophile-rich "late veneer" at the end of percolation, would be required to arrive some 60 Ma after the Moon, which never had a late veneer, was already in Earth orbit. The available alternative [1] would have given the early Earth a wet and low-viscosity convecting mantle able to dispose of the early heat with high efficiency; so that by 2.8 Ga MORs began to deepen, exposing cratons to massive weathering which lowered atmospheric CO2. The well-documented late Archaean acceleration of crustal addition to cratons, or, more precisely, of TTG-granitoid intrusion of greenstone belts, is also, paradoxically, evidence of waning mantle heat. Such wide-belt intrusion, grouped into quasi-coeval 'events', are examples of post-subduction magmatism (PSM), marking interruption of flat-slab subduction under a greenstone belt when a microcraton arrived [2]. On each occasion the TTG, derived from the subducted and reheated oceanic crust, advected subducting-plate heat to the surface that would

  10. Mouse cytomegalovirus immediate-early protein 1 binds with host cell repressors to relieve suppressive effects on viral transcription and replication during lytic infection.

    PubMed

    Tang, Qiyi; Maul, Gerd G

    2003-01-01

    Herpesviruses start their transcriptional cascade at nuclear domain 10 (ND10). The deposition of virus genomes at these nuclear sites occurs due to the binding of the interferon-inducible repressor protein promyelocytic leukemia protein (PML) and/or Daxx to a viral DNA-protein complex. However, the presence of repressive proteins at the nuclear site of virus transcription has remained unexplained. We investigated the mouse cytomegalovirus (MCMV) immediate-early 1 protein (IE1), which is necessary for productive infection at low multiplicities of infection and therefore likely to be involved in overcoming cellular repression. Temporal analysis of IE1 distribution revealed its initial segregation into ND10 by binding to PML and/or Daxx and IE1-dependent recruitment of the transcriptional repressor histone deacetylase-2 (HDAC-2) to this site. However, these protein aggregates are dissociated in cells producing sufficient IE1 through titration of PML, Daxx, and HDAC-2. Importantly, binding of IE1 to HDAC-2 decreased deacetylation activity. Moreover, inhibition of HDAC by trichostatin-A resulted in an increase in viral protein synthesis, an increase in cells starting the formation of prereplication compartments, and an increase in the total infectious viruses produced. Thus, IE1, like trichostatin-A, reverses the repressive effect of HDAC evident in the presence of acetylated histones in the immediate-early promoter region. Since HDAC also binds to the promoter region of IE1, as determined by the chromatin immunoprecipitation assay, these combined results suggest that IE1 inhibits or reverses HDAC-mediated repression of the infecting viral genomes, possibly by a process akin to activation of heterochromatin. We propose that even permissive cells can repress transcription of infecting viral genomes through repressors, including HDAC, Daxx, and PML, and the segregation of IE1 to ND10 that would inactivate those repressors. The virus can counter this repression by

  11. The evolution of replicators.

    PubMed Central

    Szathmáry, E

    2000-01-01

    Replicators of interest in chemistry, biology and culture are briefly surveyed from a conceptual point of view. Systems with limited heredity have only a limited evolutionary potential because the number of available types is too low. Chemical cycles, such as the formose reaction, are holistic replicators since replication is not based on the successive addition of modules. Replicator networks consisting of catalytic molecules (such as reflexively autocatalytic sets of proteins, or reproducing lipid vesicles) are hypothetical ensemble replicators, and their functioning rests on attractors of their dynamics. Ensemble replicators suffer from the paradox of specificity: while their abstract feasibility seems to require a high number of molecular types, the harmful effect of side reactions calls for a small system size. No satisfactory solution to this problem is known. Phenotypic replicators do not pass on their genotypes, only some aspects of the phenotype are transmitted. Phenotypic replicators with limited heredity include genetic membranes, prions and simple memetic systems. Memes in human culture are unlimited hereditary, phenotypic replicators, based on language. The typical path of evolution goes from limited to unlimited heredity, and from attractor-based to modular (digital) replicators. PMID:11127914

  12. Enhanced Viral Replication by Cellular Replicative Senescence

    PubMed Central

    Kim, Ji-Ae; Seong, Rak-Kyun

    2016-01-01

    Cellular replicative senescence is a major contributing factor to aging and to the development and progression of aging-associated diseases. In this study, we sought to determine viral replication efficiency of influenza virus (IFV) and Varicella Zoster Virus (VZV) infection in senescent cells. Primary human bronchial epithelial cells (HBE) or human dermal fibroblasts (HDF) were allowed to undergo numbers of passages to induce replicative senescence. Induction of replicative senescence in cells was validated by positive senescence-associated β-galactosidase staining. Increased susceptibility to both IFV and VZV infection was observed in senescent HBE and HDF cells, respectively, resulting in higher numbers of plaque formation, along with the upregulation of major viral antigen expression than that in the non-senescent cells. Interestingly, mRNA fold induction level of virus-induced type I interferon (IFN) was attenuated by senescence, whereas IFN-mediated antiviral effect remained robust and potent in virus-infected senescent cells. Additionally, we show that a longevity-promoting gene, sirtuin 1 (SIRT1), has antiviral role against influenza virus infection. In conclusion, our data indicate that enhanced viral replication by cellular senescence could be due to senescence-mediated reduction of virus-induced type I IFN expression. PMID:27799874

  13. Amplification of JNK signaling is necessary to complete the murine gammaherpesvirus 68 lytic replication cycle.

    PubMed

    Stahl, James A; Paden, Clinton R; Chavan, Shweta S; MacLeod, Veronica; Edmondson, Ricky D; Speck, Samuel H; Forrest, J Craig

    2012-12-01

    Several studies have previously defined host-derived signaling events capable of driving lytic gammaherpesvirus replication or enhancing immediate-early viral gene expression. Yet signaling pathways that regulate later stages of the productive gammaherpesvirus replication cycle are still poorly defined. In this study, we utilized a mass spectrometric approach to identify c-Jun as an abundant cellular phosphoprotein present in late stages of lytic murine gammaherpesvirus 68 (MHV68) infection. Kinetically, c-Jun phosphorylation was enhanced as infection progressed, and this correlated with enhanced phosphorylation of the c-Jun amino-terminal kinases JNK1 and JNK2 and activation of AP-1 transcription. These events were dependent on progression beyond viral immediate-early gene expression, but not dependent on viral DNA replication. Both pharmacologic and dominant-negative blockade of JNK1/2 activity inhibited viral replication, and this correlated with inhibition of viral DNA synthesis and reduced viral gene expression. These data suggest a model in which MHV68 by necessity amplifies and usurps JNK/c-Jun signaling as infection progresses in order to facilitate late stages of the MHV68 lytic infection cycle.

  14. Replicational organization of three weakly expressed loci in Physarum polycephalum.

    PubMed

    Maric, Chrystelle; Swanston, Emma; Bailey, Juliet; Pierron, Gérard

    2002-06-01

    We previously mapped early-activated replication origins in the promoter regions of five abundantly transcribed genes in the slime mold Physarum polycephalum. This physical linkage between origins and genes is congruent with the preferential early replication of the active genes in mammalian cells. To determine how general this replicational organization is in the synchronous plasmodium of Physarum, we analyzed the replication of three weakly expressed genes. Bromodeoxyuridine (BrdUrd) density-shift and gene dosage experiments indicated that the redB (regulated in development) and redE genes replicate early, whereas redA replicates in mid-S phase. Bi-dimensional gel electrophoresis revealed that redA coincides with an origin that appears to be activated within a large temporal window in S phase so that the replication of the gene is not well defined temporally. The early replication of the redB and redE genes is due to the simultaneous activation of flanking origins at the onset of S phase. As a result, these two genes correspond to termination sites of DNA replication. Our data demonstrate that not all the Physarum promoters are preferred sites of initiation but, so far, all the expressed genes analyzed in detail either coincide with a replication origin or are embedded into a cluster of early firing replicons. PMID:12034812

  15. Infection of Brachypodium distachyon by formae speciales of Puccinia graminis: early infection events and host-pathogen incompatibility.

    PubMed

    Figueroa, Melania; Alderman, Stephen; Garvin, David F; Pfender, William F

    2013-01-01

    Puccinia graminis causes stem rust, a serious disease of cereals and forage grasses. Important formae speciales of P. graminis and their typical hosts are P. graminis f. sp. tritici (Pg-tr) in wheat and barley, P. graminis f. sp. lolii (Pg-lo) in perennial ryegrass and tall fescue, and P. graminis f. sp. phlei-pratensis (Pg-pp) in timothy grass. Brachypodium distachyon is an emerging genetic model to study fungal disease resistance in cereals and temperate grasses. We characterized the P. graminis-Brachypodium pathosystem to evaluate its potential for investigating incompatibility and non-host resistance to P. graminis. Inoculation of eight Brachypodium inbred lines with Pg-tr, Pg-lo or Pg-pp resulted in sporulating lesions later accompanied by necrosis. Histological analysis of early infection events in one Brachypodium inbred line (Bd1-1) indicated that Pg-lo and Pg-pp were markedly more efficient than Pg-tr at establishing a biotrophic interaction. Formation of appressoria was completed (60-70% of germinated spores) by 12 h post-inoculation (hpi) under dark and wet conditions, and after 4 h of subsequent light exposure fungal penetration structures (penetration peg, substomatal vesicle and primary infection hyphae) had developed. Brachypodium Bd1-1 exhibited pre-haustorial resistance to Pg-tr, i.e. infection usually stopped at appressorial formation. By 68 hpi, only 0.3% and 0.7% of the Pg-tr urediniospores developed haustoria and colonies, respectively. In contrast, development of advanced infection structures by Pg-lo and Pg-pp was significantly more common; however, Brachypodium displayed post-haustorial resistance to these isolates. By 68 hpi the percentage of urediniospores that only develop a haustorium mother cell or haustorium in Pg-lo and Pg-pp reached 8% and 5%, respectively. The formation of colonies reached 14% and 13%, respectively. We conclude that Brachypodium is an apt grass model to study the molecular and genetic components of incompatiblity

  16. Infection of Brachypodium distachyon by Formae Speciales of Puccinia graminis: Early Infection Events and Host-Pathogen Incompatibility

    PubMed Central

    Figueroa, Melania; Alderman, Stephen; Garvin, David F.; Pfender, William F.

    2013-01-01

    Puccinia graminis causes stem rust, a serious disease of cereals and forage grasses. Important formae speciales of P. graminis and their typical hosts are P. graminis f. sp. tritici (Pg-tr) in wheat and barley, P. graminis f. sp. lolii (Pg-lo) in perennial ryegrass and tall fescue, and P. graminis f. sp. phlei-pratensis (Pg-pp) in timothy grass. Brachypodium distachyon is an emerging genetic model to study fungal disease resistance in cereals and temperate grasses. We characterized the P. graminis-Brachypodium pathosystem to evaluate its potential for investigating incompatibility and non-host resistance to P. graminis. Inoculation of eight Brachypodium inbred lines with Pg-tr, Pg-lo or Pg-pp resulted in sporulating lesions later accompanied by necrosis. Histological analysis of early infection events in one Brachypodium inbred line (Bd1-1) indicated that Pg-lo and Pg-pp were markedly more efficient than Pg-tr at establishing a biotrophic interaction. Formation of appressoria was completed (60–70% of germinated spores) by 12 h post-inoculation (hpi) under dark and wet conditions, and after 4 h of subsequent light exposure fungal penetration structures (penetration peg, substomatal vesicle and primary infection hyphae) had developed. Brachypodium Bd1-1 exhibited pre-haustorial resistance to Pg-tr, i.e. infection usually stopped at appressorial formation. By 68 hpi, only 0.3% and 0.7% of the Pg-tr urediniospores developed haustoria and colonies, respectively. In contrast, development of advanced infection structures by Pg-lo and Pg-pp was significantly more common; however, Brachypodium displayed post-haustorial resistance to these isolates. By 68 hpi the percentage of urediniospores that only develop a haustorium mother cell or haustorium in Pg-lo and Pg-pp reached 8% and 5%, respectively. The formation of colonies reached 14% and 13%, respectively. We conclude that Brachypodium is an apt grass model to study the molecular and genetic components of incompatiblity

  17. Cardiovascular events prior to or early after diagnosis of systemic lupus erythematosus in the systemic lupus international collaborating clinics cohort

    PubMed Central

    Urowitz, M B; Gladman, D D; Anderson, N M; Su, J; Romero-Diaz, J; Bae, S C; Fortin, P R; Sanchez-Guerrero, J; Clarke, A; Bernatsky, S; Gordon, C; Hanly, J G; Wallace, D J; Isenberg, D; Rahman, A; Merrill, J; Ginzler, E; Alarcón, G S; Fessler, B F; Petri, M; Bruce, I N; Khamashta, M; Aranow, C; Dooley, M; Manzi, S; Ramsey-Goldman, R; Sturfelt, G; Nived, O; Steinsson, K; Zoma, A; Ruiz-Irastorza, G; Lim, S; Kalunian, K C; Ỉnanç, M; van Vollenhoven, R; Ramos-Casals, M; Kamen, D L; Jacobsen, S; Peschken, C; Askanase, A; Stoll, T

    2016-01-01

    Objective To describe the frequency of myocardial infarction (MI) prior to the diagnosis of systemic lupus erythematosus (SLE) and within the first 2 years of follow-up. Methods The systemic lupus international collaborating clinics (SLICC) atherosclerosis inception cohort enters patients within 15 months of SLE diagnosis. MIs were reported and attributed on a specialised vascular event form. MIs were confirmed by one or more of the following: abnormal ECG, typical or atypical symptoms with ECG abnormalities and elevated enzymes (≥2 times upper limit of normal), or abnormal stress test, echocardiogram, nuclear scan or angiogram. Descriptive statistics were used. Results 31 of 1848 patients who entered the cohort had an MI. Of those, 23 patients had an MI prior to SLE diagnosis or within the first 2 years of disease. Of the 23 patients studied, 60.9% were female, 78.3% were Caucasian, 8.7% black, 8.7% Hispanic and 4.3% other. The mean age at SLE diagnosis was 52.5±15.0 years. Of the 23 MIs that occurred, 16 MIs occurred at a mean of 6.1±7.0 years prior to diagnosis and 7 occurred within the first 2 years of follow-up. Risk factors associated with early MI in univariate analysis are male sex, Caucasian, older age at diagnosis, hypertension, hypercholesterolaemia, family history of MI and smoking. In multivariate analysis only age (OR=1.06 95% CI 1.03 to 1.09), hypertension (OR=5.01, 95% CI 1.38 to 18.23), hypercholesterolaemia (OR=4.43, 95% CI 1.51 to 12.99) and smoking (OR=7.50, 95% CI 2.38 to 23.57) remained significant risk factors. Conclusions In some patients with lupus, MI may develop even before the diagnosis of SLE or shortly thereafter, suggesting that there may be a link between autoimmune inflammation and atherosclerosis. PMID:27099765

  18. Replication of Early B-cell Factor 1 (EBF1) Gene-by-psychosocial Stress Interaction Effects on Central Adiposity in a Korean Population

    PubMed Central

    Min, Jin-Young

    2016-01-01

    Objectives Central obesity plays a major role in the development of many chronic diseases, including cardiovascular disease and cancer. Chronic stress may be involved in the pathophysiology of central obesity. Although several large-scale genome-wide association studies have reported susceptibility genes for central adiposity, the effects of interactions between genes and psychosocial stress on central adiposity have rarely been examined. A recent study focusing on Caucasians discovered the novel gene early B-cell factor 1 (EBF1), which was associated with central obesity-related traits via interactions with stress levels. We aimed to evaluate EBF1 gene-by-stress interaction effects on central adiposity traits, including visceral adipose tissue (VAT), in Korean adults. Methods A total of 1467 Korean adults were included in this study. We selected 22 single-nucleotide polymorphisms (SNPs) in the EBF1 gene and analyzed their interactions with stress on central adiposity using additive, dominant, and recessive genetic modeling. Results The four SNPs that had strong linkage disequilibrium relationships (rs10061900, rs10070743, rs4704967, and rs10056564) demonstrated significant interactions with the waist-hip ratio in the dominant model (pint<0.007). In addition, two other SNPs (rs6556377 and rs13180086) were associated with VAT by interactions with stress levels, especially in the recessive genetic model (pint<0.007). As stress levels increased, the mean values of central adiposity traits according to SNP genotypes exhibited gradual but significant changes (p<0.05). Conclusions These results suggest that the common genetic variants for EBF1 are associated with central adiposity through interactions with stress levels, emphasizing the importance of managing stress in the prevention of central obesity. PMID:27744667

  19. The impact of early institutional rearing on the ability to discriminate facial expressions of emotion: an event-related potential study.

    PubMed

    Parker, Susan W; Nelson, Charles A

    2005-01-01

    Event-related potentials (ERPs), in response to 4 facial expressions of fear, angry, happy, and sad, were collected from 72 institutionalized children (IG), ages 7 to 32 months, in Bucharest, Romania, and compared with ERPs from 33 children, ages 8 to 32 months, who had never been institutionalized (NIG). The NIG and IG exhibited different patterns of responding in early latency components. Moreover, group differences in amplitude were evident across all components. Such differences may point to the role of early deprivation in disrupting the development of the neural circuitry involved in the recognition of facial expressions. PMID:15693757

  20. Mechanism of chromosomal DNA replication initiation and replication fork stabilization in eukaryotes.

    PubMed

    Wu, LiHong; Liu, Yang; Kong, DaoChun

    2014-05-01

    Chromosomal DNA replication is one of the central biological events occurring inside cells. Due to its large size, the replication of genomic DNA in eukaryotes initiates at hundreds to tens of thousands of sites called DNA origins so that the replication could be completed in a limited time. Further, eukaryotic DNA replication is sophisticatedly regulated, and this regulation guarantees that each origin fires once per S phase and each segment of DNA gets duplication also once per cell cycle. The first step of replication initiation is the assembly of pre-replication complex (pre-RC). Since 1973, four proteins, Cdc6/Cdc18, MCM, ORC and Cdt1, have been extensively studied and proved to be pre-RC components. Recently, a novel pre-RC component called Sap1/Girdin was identified. Sap1/Girdin is required for loading Cdc18/Cdc6 to origins for pre-RC assembly in the fission yeast and human cells, respectively. At the transition of G1 to S phase, pre-RC is activated by the two kinases, cyclindependent kinase (CDK) and Dbf4-dependent kinase (DDK), and subsequently, RPA, primase-polα, PCNA, topoisomerase, Cdc45, polδ, and polɛ are recruited to DNA origins for creating two bi-directional replication forks and initiating DNA replication. As replication forks move along chromatin DNA, they frequently stall due to the presence of a great number of replication barriers on chromatin DNA, such as secondary DNA structures, protein/DNA complexes, DNA lesions, gene transcription. Stalled forks must require checkpoint regulation for their stabilization. Otherwise, stalled forks will collapse, which results in incomplete DNA replication and genomic instability. This short review gives a concise introduction regarding the current understanding of replication initiation and replication fork stabilization.

  1. Reanalyses of Anomalous Gravitational Microlensing Events in the OGLE-III Early Warning System Database with Combined Data

    NASA Astrophysics Data System (ADS)

    Jeong, J.; Park, H.; Han, C.; Gould, A.; Udalski, A.; Szymański, M. K.; Pietrzyński, G.; Soszyński, I.; Poleski, R.; Ulaczyk, K.; Wyrzykowski, Ł.; OGLE Collaboration; Abe, F.; Bennett, D. P.; Bond, I. A.; Botzler, C. S.; Freeman, M.; Fukui, A.; Fukunaga, D.; Itow, Y.; Koshimoto, N.; Masuda, K.; Matsubara, Y.; Muraki, Y.; Namba, S.; Ohnishi, K.; Rattenbury, N. J.; Saito, To.; Sullivan, D. J.; Sweatman, W. L.; Sumi, T.; Suzuki, D.; Tristram, P. J.; Tsurumi, N.; Wada, K.; Yamai, N.; Yock, P. C. M.; Yonehara, A.; MOA Collaboration; Albrow, M. D.; Batista, V.; Beaulieu, J.-P.; Caldwell, J. A. R.; Cassan, A.; Cole, A.; Coutures, C.; Dieters, S.; Dominik, M.; Dominis Prester, D.; Donatowicz, J.; Fouqué, P.; Greenhill, J.; Hoffman, M.; Huber, M.; Jørgensen, U. G.; Kane, S. R.; Kubas, D.; Martin, R.; Marquette, J.-B.; Menzies, J.; Pitrou, C.; Pollard, K.; Sahu, K. C.; Vinter, C.; Wambsganss, J.; Williams, A.; PLANET Collaboration; Allen, W.; Bolt, G.; Choi, J.-Y.; Christie, G. W.; DePoy, D. L.; Drummond, J.; Gaudi, B. S.; Hwang, K.-H.; Jung, Y. K.; Lee, C.-U.; Mallia, F.; Maoz, D.; Maury, A.; McCormick, J.; Monard, L. A. G.; Moorhouse, D.; Natusch, T.; Ofek, E. O.; Park, B.-G.; Pogge, R. W.; Santallo, R.; Shin, I.-G.; Thornley, G.; Yee, J. C.; μFUN Collaboration; Bramich, D. M.; Burgdorf, M.; Horne, K.; Hundertmark, M.; Kains, N.; Snodgrass, C.; Steele, I.; Street, R.; Tsapras, Y.; RoboNet Collaboration

    2015-05-01

    We reanalyze microlensing events in the published list of anomalous events that were observed from the Optical Gravitational Lensing Experiment (OGLE) lensing survey conducted during the 2004-2008 period. In order to check the existence of possible degenerate solutions and extract extra information, we conduct analyses based on combined data from other survey and follow-up observation and consider higher-order effects. Among the analyzed events, we present analyses of eight events for which either new solutions are identified or additional information is obtained. We find that the previous binary-source interpretations of five events are better interpreted by binary-lens models. These events include OGLE-2006-BLG-238, OGLE-2007-BLG-159, OGLE-2007-BLG-491, OGLE-2008-BLG-143, and OGLE-2008-BLG-210. With additional data covering caustic crossings, we detect finite-source effects for six events including OGLE-2006-BLG-215, OGLE-2006-BLG-238, OGLE-2006-BLG-450, OGLE-2008-BLG-143, OGLE-2008-BLG-210, and OGLE-2008-BLG-513. Among them, we are able to measure the Einstein radii of three events for which multi-band data are available. These events are OGLE-2006-BLG-238, OGLE-2008-BLG-210, and OGLE-2008-BLG-513. For OGLE-2008-BLG-143, we detect higher-order effects induced by the changes of the observer’s position caused by the orbital motion of the Earth around the Sun. In addition, we present degenerate solutions resulting from the known close/wide or ecliptic degeneracy. Finally, we note that the masses of the binary companions of the lenses of OGLE-2006-BLG-450 and OGLE-2008-BLG-210 are in the brown-dwarf regime.

  2. Tectonic setting of the North Gondwana margin during the Early Ordovician: A comparison of the Ollo de Sapo and Famatina magmatic events

    NASA Astrophysics Data System (ADS)

    Del Greco, Kassandra; Johnston, Stephen T.; Shaw, Jessica

    2016-06-01

    This paper presents a comparison of compiled geochronological and geochemical data from the Ollo de Sapo and Famatina magmatic events. The Ollo de Sapo magmatic sequence is located in northwest Iberia and was emplaced during the early-Ordovician from 495 to 474 Ma. The Famatina Complex is a magmatic sequence located in Northern Argentina that was emplaced during the early- to mid-Ordovician from 483 to 463 Ma. These magmatic events are currently interpreted to have been emplaced in different tectonic settings despite both having occurred along the North Gondwana margin. Geochronological data indicates that these magmatic events occurred contemporaneously over at least 9 m.y. and therefore can provide a snapshot of the northern Gondwana margin during the mid-Ordovician. Major element data indicates that both magmatic suites are calc-alkaline to alkali-calcic and trace element and REE data show magmatic signatures that are indistinguishable. This study highlights the similarity between the Ollo de Sapo and the Famatina magmatic suites and discusses alternative models for their emplacement based on paleomagnetic and paleobiogeographical data. These data indicate that the Ollo de Sapo was likely emplaced in a subduction zone setting, while the Famatina magmatic suite may be of parautochthonous origin to Gondwana, implying that the Pampeanan margin may not have been active during the early- to mid-Ordovician.

  3. Who Needs Replication?

    ERIC Educational Resources Information Center

    Porte, Graeme

    2013-01-01

    In this paper, the editor of a recent Cambridge University Press book on research methods discusses replicating previous key studies to throw more light on their reliability and generalizability. Replication research is presented as an accepted method of validating previous research by providing comparability between the original and replicated…

  4. Global organization of replication time zones of the mouse genome

    PubMed Central

    Farkash-Amar, Shlomit; Lipson, Doron; Polten, Andreas; Goren, Alon; Helmstetter, Charles; Yakhini, Zohar; Simon, Itamar

    2008-01-01

    The division of genomes into distinct replication time zones has long been established. However, an in-depth understanding of their organization and their relationship to transcription is incomplete. Taking advantage of a novel synchronization method (“baby machine”) and of genomic DNA microarrays, we have, for the first time, mapped replication times of the entire mouse genome at a high temporal resolution. Our data revealed that although most of the genome has a distinct time of replication either early, middle, or late S phase, a significant portion of the genome is replicated asynchronously. Analysis of the replication map revealed the genomic scale organization of the replication time zones. We found that the genomic regions between early and late replication time zones often consist of extremely large replicons. Analysis of the relationship between replication and transcription revealed that early replication is frequently correlated with the transcription potential of a gene and not necessarily with its actual transcriptional activity. These findings, along with the strong conservation found between replication timing in human and mouse genomes, emphasize the importance of replication timing in transcription regulation. PMID:18669478

  5. Environmental perturbations at the early Eocene ETM2, H2, and I1 events as inferred by Tethyan calcareous plankton (Terche section, northeastern Italy)

    NASA Astrophysics Data System (ADS)

    D'Onofrio, Roberta; Luciani, Valeria; Fornaciari, Eliana; Giusberti, Luca; Boscolo Galazzo, Flavia; Dallanave, Edoardo; Westerhold, Thomas; Sprovieri, Mario; Telch, Sonia

    2016-09-01

    Several early Eocene hyperthermals have been recently investigated and characterized in terms of temperature anomalies and oceanographic changes. The effects of these climatic perturbations on biotic communities are much less constrained. Here we present new records from the Terche section (northeastern Italy) that, for the first time, integrates data on planktic foraminifera and calcareous nannofossils across three post-Paleocene-Eocene Thermal Maximum negative carbon isotope excursions (CIEs). The biomagnetostratigraphic framework generated at Terche allows us to confidently relate such CIEs to the Eocene Thermal Maximum 2 (ETM2), H2, and I1 events. Each of these events coincides with lithological anomalies characterized by significantly lower calcium carbonate content (marly units, MUs). We interpret these MUs as mainly linked to an effect of increased terrigenous dilution, as dissolution proxies do not display significant variations. Calcareous plankton assemblages change significantly across these events and radiolarians increase. Observed changes suggest that transient warming and environmental perturbations, though more intense during ETM2, occurred during each of the three investigated perturbations. Variations among calcareous plankton suggest increase in surface-water eutrophication with respect to the pre-event conditions, coupled with a weakening of the upper water-column thermal stratification. Higher nutrient discharge was related to intensification of the hydrological cycle as a consequence of the warmer climate. These conditions persisted during the early CIE recovery, implying slower recovery rates for the environment and biota than for the carbon cycle.

  6. Fragile Site Instability in Saccharomyces cerevisiae Causes Loss of Heterozygosity by Mitotic Crossovers and Break-Induced Replication

    PubMed Central

    Miller, Shaylynn D.; Casper, Anne M.

    2013-01-01

    Loss of heterozygosity (LOH) at tumor suppressor loci is a major contributor to cancer initiation and progression. Both deletions and mitotic recombination can lead to LOH. Certain chromosomal loci known as common fragile sites are susceptible to DNA lesions under replication stress, and replication stress is prevalent in early stage tumor cells. There is extensive evidence for deletions stimulated by common fragile sites in tumors, but the role of fragile sites in stimulating mitotic recombination that causes LOH is unknown. Here, we have used the yeast model system to study the relationship between fragile site instability and mitotic recombination that results in LOH. A naturally occurring fragile site, FS2, exists on the right arm of yeast chromosome III, and we have analyzed LOH on this chromosome. We report that the frequency of spontaneous mitotic BIR events resulting in LOH on the right arm of yeast chromosome III is higher than expected, and that replication stress by low levels of polymerase alpha increases mitotic recombination 12-fold. Using single-nucleotide polymorphisms between the two chromosome III homologs, we mapped the locations of recombination events and determined that FS2 is a strong hotspot for both mitotic reciprocal crossovers and break-induced replication events under conditions of replication stress. PMID:24068975

  7. Ostracods and facies of the Early and Middle Frasnian at Devils Gate in Nevada: Relationship to the Alamo Event

    USGS Publications Warehouse

    Casier, J.-G.; Berra, I.; Olempska, Ewa; Sandberg, C.; Preat, A.

    2006-01-01

    In order to document the Alamo Event and to investigate its influence on shallow-marine environments, we undertook a study of ostracods, conodonts, and analysis of the sedimentology of the lower member of the type Devils Gate Limestone, Six major carbonate microfacies (MF1-MF6) ranging from open-marine environments below storm wave base to pre-evaporitic supratidal lagoons were recognized. The sedimentological study detected no important sedimentological changes during the Alamo Event; only an influx of detrital material and lithoclasts indicate that an unusual event had occurred. Ostracods are generally rare or absent in the lower member of the Devils Gate Limestone, and only 2,000 carapaces, valves and fragments were extracted; from these some 26 taxa were identified. Two new species, Voronina? eureka and Serenida dorsoplicata are proposed. The ostracods belong to the Eifelian Mega-Assemblage and their distribution was influenced by strong salinity variations. Because of the rarity and low diversity of ostracods and conodonts in samples collected from the lower part of the lower member of the Devils Gate Limestone it is not adequate to demonstrate conclusively an extinction event close to the Alamo Event Bed. Nevertheless the greater abundance and diversity of ostracods above this bed seems to indicate that the Alamo Event did not result in significant extinction of ostracod taxa in this shallow water setting. The ostracod fauna present in the lower member of the Devils Gate Limestone suggests faunal exchanges between Nevada and the Russian Platform via the Western Canadian platform.

  8. The DNA repair endonuclease Mus81 facilitates fast DNA replication in the absence of exogenous damage

    PubMed Central

    Fu, Haiqing; Martin, Melvenia M.; Regairaz, Marie; Huang, Liang; You, Yang; Lin, Chi-Mei; Ryan, Michael; Kim, RyangGuk; Shimura, Tsutomu; Pommier, Yves; Aladjem, Mirit I.

    2015-01-01

    The Mus81 endonuclease resolves recombination intermediates and mediates cellular responses to exogenous replicative stress. Here, we show that Mus81 also regulates the rate of DNA replication during normal growth by promoting replication fork progression while reducing the frequency of replication initiation events. In the absence of Mus81 endonuclease activity, DNA synthesis is slowed and replication initiation events are more frequent. In addition, Mus81 deficient cells fail to recover from exposure to low doses of replication inhibitors and cell viability is dependent on the XPF endonuclease. Despite an increase in replication initiation frequency, cells lacking Mus81 use the same pool of replication origins as Mus81-expressing cells. Therefore, decelerated DNA replication in Mus81 deficient cells does not initiate from cryptic or latent origins not used during normal growth. These results indicate that Mus81 plays a key role in determining the rate of DNA replication without activating a novel group of replication origins. PMID:25879486

  9. The DNA repair endonuclease Mus81 facilitates fast DNA replication in the absence of exogenous damage.

    PubMed

    Fu, Haiqing; Martin, Melvenia M; Regairaz, Marie; Huang, Liang; You, Yang; Lin, Chi-Mei; Ryan, Michael; Kim, RyangGuk; Shimura, Tsutomu; Pommier, Yves; Aladjem, Mirit I

    2015-01-01

    The Mus81 endonuclease resolves recombination intermediates and mediates cellular responses to exogenous replicative stress. Here, we show that Mus81 also regulates the rate of DNA replication during normal growth by promoting replication fork progression while reducing the frequency of replication initiation events. In the absence of Mus81 endonuclease activity, DNA synthesis is slowed and replication initiation events are more frequent. In addition, Mus81-deficient cells fail to recover from exposure to low doses of replication inhibitors and cell viability is dependent on the XPF endonuclease. Despite an increase in replication initiation frequency, cells lacking Mus81 use the same pool of replication origins as Mus81-expressing cells. Therefore, decelerated DNA replication in Mus81-deficient cells does not initiate from cryptic or latent origins not used during normal growth. These results indicate that Mus81 plays a key role in determining the rate of DNA replication without activating a novel group of replication origins. PMID:25879486

  10. The Temporal Program of Chromosome Replication: Genomewide Replication in clb5Δ Saccharomyces cerevisiae

    PubMed Central

    McCune, Heather J.; Danielson, Laura S.; Alvino, Gina M.; Collingwood, David; Delrow, Jeffrey J.; Fangman, Walton L.; Brewer, Bonita J.; Raghuraman, M. K.

    2008-01-01

    Temporal regulation of origin activation is widely thought to explain the pattern of early- and late-replicating domains in the Saccharomyces cerevisiae genome. Recently, single-molecule analysis of replication suggested that stochastic processes acting on origins with different probabilities of activation could generate the observed kinetics of replication without requiring an underlying temporal order. To distinguish between these possibilities, we examined a clb5Δ strain, where origin firing is largely limited to the first half of S phase, to ask whether all origins nonspecifically show decreased firing (as expected for disordered firing) or if only some origins (“late” origins) are affected. Approximately half the origins in the mutant genome show delayed replication while the remainder replicate largely on time. The delayed regions can encompass hundreds of kilobases and generally correspond to regions that replicate late in wild-type cells. Kinetic analysis of replication in wild-type cells reveals broad windows of origin firing for both early and late origins. Our results are consistent with a temporal model in which origins can show some heterogeneity in both time and probability of origin firing, but clustering of temporally like origins nevertheless yields a genome that is organized into blocks showing different replication times. PMID:18832352

  11. A global profile of replicative polymerase usage

    PubMed Central

    Müller, Carolin A.; Miyabe, Izumi; Brooks, Tony; Retkute, Renata; Hubank, Mike; Nieduszyski, Conrad A.; Carr, Antony M.

    2014-01-01

    Three eukaryotic DNA polymerases are essential for genome replication. Polα-primase initiates each synthesis event and is rapidly replaced by processive DNA polymerases: Polε replicates the leading strand while Polδ performs lagging strand synthesis. However, it is not known whether this division of labour is maintained across the whole genome or how uniform it is within single replicons. Using S. pombe, we have developed a polymerase usage sequencing (Pu-seq) strategy to map polymerase usage genome–wide. Pu–seq provides direct replication origin location and efficiency data and indirect estimates of replication timing. We confirm that the division of labour is broadly maintained across an entire genome. However, our data suggest a subtle variability in the usage of the two polymerases within individual replicons. We propose this results from occasional leading strand initiation by Polδ followed by exchange for Polε. PMID:25664722

  12. Replication origins and timing of temporal replication in budding yeast: how to solve the conundrum?

    PubMed

    Barberis, Matteo; Spiesser, Thomas W; Klipp, Edda

    2010-05-01

    Similarly to metazoans, the budding yeast Saccharomyces cereviasiae replicates its genome with a defined timing. In this organism, well-defined, site-specific origins, are efficient and fire in almost every round of DNA replication. However, this strategy is neither conserved in the fission yeast Saccharomyces pombe, nor in Xenopus or Drosophila embryos, nor in higher eukaryotes, in which DNA replication initiates asynchronously throughout S phase at random sites. Temporal and spatial controls can contribute to the timing of replication such as Cdk activity, origin localization, epigenetic status or gene expression. However, a debate is going on to answer the question how individual origins are selected to fire in budding yeast. Two opposing theories were proposed: the "replicon paradigm" or "temporal program" vs. the "stochastic firing". Recent data support the temporal regulation of origin activation, clustering origins into temporal blocks of early and late replication. Contrarily, strong evidences suggest that stochastic processes acting on origins can generate the observed kinetics of replication without requiring a temporal order. In mammalian cells, a spatiotemporal model that accounts for a partially deterministic and partially stochastic order of DNA replication has been proposed. Is this strategy the solution to reconcile the conundrum of having both organized replication timing and stochastic origin firing also for budding yeast? In this review we discuss this possibility in the light of our recent study on the origin activation, suggesting that there might be a stochastic component in the temporal activation of the replication origins, especially under perturbed conditions. PMID:21037857

  13. Fast events in protein folding: structural volume changes accompanying the early events in the N-->I transition of apomyoglobin induced by ultrafast pH jump.

    PubMed

    Abbruzzetti, S; Crema, E; Masino, L; Vecli, A; Viappiani, C; Small, J R; Libertini, L J; Small, E W

    2000-01-01

    Ultrafast, laser-induced pH jump with time-resolved photoacoustic detection has been used to investigate the early protonation steps leading to the formation of the compact acid intermediate (I) of apomyoglobin (ApoMb). When ApoMb is in its native state (N) at pH 7.0, rapid acidification induced by a laser pulse leads to two parallel protonation processes. One reaction can be attributed to the binding of protons to the imidazole rings of His24 and His119. Reaction with imidazole leads to an unusually large contraction of -82 +/- 3 ml/mol, an enthalpy change of 8 +/- 1 kcal/mol, and an apparent bimolecular rate constant of (0.77 +/- 0.03) x 10(10) M(-1) s(-1). Our experiments evidence a rate-limiting step for this process at high ApoMb concentrations, characterized by a value of (0. 60 +/- 0.07) x 10(6) s(-1). The second protonation reaction at pH 7. 0 can be attributed to neutralization of carboxylate groups and is accompanied by an apparent expansion of 3.4 +/- 0.2 ml/mol, occurring with an apparent bimolecular rate constant of (1.25 +/- 0.02) x 10(11) M(-1) s(-1), and a reaction enthalpy of about 2 kcal/mol. The activation energy for the processes associated with the protonation of His24 and His119 is 16.2 +/- 0.9 kcal/mol, whereas that for the neutralization of carboxylates is 9.2 +/- 0.9 kcal/mol. At pH 4.5 ApoMb is in a partially unfolded state (I) and rapid acidification experiments evidence only the process assigned to carboxylate protonation. The unusually large contraction and the high energetic barrier observed at pH 7.0 for the protonation of the His residues suggests that the formation of the compact acid intermediate involves a rate-limiting step after protonation.

  14. Time of replication of yeast centromeres and telomeres.

    PubMed

    McCarroll, R M; Fangman, W L

    1988-08-12

    The time of replication of centromeres and telomeres of the yeast S. cerevisiae was determined by performing Meselson-Stahl experiments with synchronized cells. The nine centromeres examined become hybrid in density early in S phase, eliminating the possibility that a delay in the replication of centromeres until mitosis is responsible for sister chromatid adherence and proper chromosome segregation at anaphase. The conserved sequence element Y', present at most telomeres, replicates late in S phase, as do the unique sequences adjacent to five specific telomeres. The early and late replication times of these structural elements may be either essential for their proper function or a consequence of some architectural feature of the chromosome.

  15. Adenovirus DNA Replication

    PubMed Central

    Hoeben, Rob C.; Uil, Taco G.

    2013-01-01

    Adenoviruses have attracted much attention as probes to study biological processes such as DNA replication, transcription, splicing, and cellular transformation. More recently these viruses have been used as gene-transfer vectors and oncolytic agents. On the other hand, adenoviruses are notorious pathogens in people with compromised immune functions. This article will briefly summarize the basic replication strategy of adenoviruses and the key proteins involved and will deal with the new developments since 2006. In addition, we will cover the development of antivirals that interfere with human adenovirus (HAdV) replication and the impact of HAdV on human disease. PMID:23388625

  16. Recombination and Replication

    PubMed Central

    Syeda, Aisha H.; Hawkins, Michelle; McGlynn, Peter

    2014-01-01

    The links between recombination and replication have been appreciated for decades and it is now generally accepted that these two fundamental aspects of DNA metabolism are inseparable: Homologous recombination is essential for completion of DNA replication and vice versa. This review focuses on the roles that recombination enzymes play in underpinning genome duplication, aiding replication fork movement in the face of the many replisome barriers that challenge genome stability. These links have many conserved features across all domains of life, reflecting the conserved nature of the substrate for these reactions, DNA. PMID:25341919

  17. Combined oxygen- and carbon-isotope records through the Early Jurassic: multiple global events and two modes of carbon-cycle/temperature coupling

    NASA Astrophysics Data System (ADS)

    Hesselbo, S. P.; Korte, C.

    2010-12-01

    The Jurassic comprises some 55 million years of Earth history. However, within the Jurassic, only one major environmental change (hyperthermal) event is really well known - the Early Toarcian Oceanic Anoxic Event (OAE) at ~183 Ma - and until very recently the extent to which the accompanying environmental changes were global has been strongly debated. Nevertheless, partly as a result of the international effort to define Global Stratotype Sections and Points (GSSPs), much more is now being discovered about environmental changes taking place at and around the other Jurassic Age (Stage) boundaries, to the extent that meaningful comparisons between these events can begin to be made. Here we present new carbon and oxygen isotope data from mollusks (bivalves and belemnites) and brachiopods collected through the marine Early Jurassic succession of NE England, including the Sinemurian-Plienbachian boundary GSSP. All materials have been screened by chemical analysis and scanning electron microscopy to check for diagenetic alteration. Analysis of carbon isotopes from marine calcite is supplemented by analysis of carbon-isotope values from fossil wood collected through the same section. It is demonstrated that both long-term and short-term carbon-isotope shifts from the UK Early Jurassic represent global changes in carbon cycle balances. The Sinemurian-Pliensbachian boundary event is an event of global significance and shows several similarities to the Toarcian OAE (relative sea-level change, carbon-isotope signature), but also some significant contrasts (oxygen-isotope based paleotemperatures which provide no evidence for warming). Significant contrast in oxygen- and carbon-isotope co-variation also occurs on a long timescale. There appear to be two modes in the co-variation of carbon and oxygen isotopes through this time interval: mode 1 shows positive correlation and may be explained by conventional sources and sinks for carbon-dioxide; mode 2, representing negative

  18. Glacioeustatic fluctuation: The mechanism linking stable isotope events and sequence stratigraphy from the early Oligocene to middle Miocene

    SciTech Connect

    Abreu, V. ); Haddad, G. )

    1996-01-01

    One of the most difficult challenges of sequence stratigraphy is the establishment of synchronism between events observed in widely-separated basins. Problems arise because the resolution of the best stratigraphic methods is not good enough to establish the synchronism of similar-aged events on a global scale. Unless a common mechanism affecting global eustasy is assumed, such as variations in the ice volume, there is no a priori reason to expect that sequences of similar age in widely-separated basins are indeed synchronous. The stable oxygen isotope composition of marine carbonates is a proxy for sea level which has been underutilized in sequence stratigraphy. Identification of isotope events is based on d[sup 18]O data from DSDP and ODP sites 522, 529, 563, 608, and 747 drilled in the Atlantic and Indian oceans. These records were used to define Oligocene and Miocene oxygen isotope zones. In addition, we present isotope data from PETROBRAS Well A drilled in the Campos Basin (Brazil). Ages of isotope events correspond well with the ages of sequence boundaries and maximum flooding surfaces. Because of the good correlation between the isotope and sequence stratigraphic records, we reconfirm that ice-volume change is the common mechanism driving sea-level fluctuations from the Oligocene to present.

  19. Glacioeustatic fluctuation: The mechanism linking stable isotope events and sequence stratigraphy from the early Oligocene to middle Miocene

    SciTech Connect

    Abreu, V.; Haddad, G.

    1996-12-31

    One of the most difficult challenges of sequence stratigraphy is the establishment of synchronism between events observed in widely-separated basins. Problems arise because the resolution of the best stratigraphic methods is not good enough to establish the synchronism of similar-aged events on a global scale. Unless a common mechanism affecting global eustasy is assumed, such as variations in the ice volume, there is no a priori reason to expect that sequences of similar age in widely-separated basins are indeed synchronous. The stable oxygen isotope composition of marine carbonates is a proxy for sea level which has been underutilized in sequence stratigraphy. Identification of isotope events is based on d{sup 18}O data from DSDP and ODP sites 522, 529, 563, 608, and 747 drilled in the Atlantic and Indian oceans. These records were used to define Oligocene and Miocene oxygen isotope zones. In addition, we present isotope data from PETROBRAS Well A drilled in the Campos Basin (Brazil). Ages of isotope events correspond well with the ages of sequence boundaries and maximum flooding surfaces. Because of the good correlation between the isotope and sequence stratigraphic records, we reconfirm that ice-volume change is the common mechanism driving sea-level fluctuations from the Oligocene to present.

  20. Modeling DNA Replication.

    ERIC Educational Resources Information Center

    Bennett, Joan

    1998-01-01

    Recommends the use of a model of DNA made out of Velcro to help students visualize the steps of DNA replication. Includes a materials list, construction directions, and details of the demonstration using the model parts. (DDR)

  1. Abiotic self-replication.

    PubMed

    Meyer, Adam J; Ellefson, Jared W; Ellington, Andrew D

    2012-12-18

    The key to the origins of life is the replication of information. Linear polymers such as nucleic acids that both carry information and can be replicated are currently what we consider to be the basis of living systems. However, these two properties are not necessarily coupled. The ability to mutate in a discrete or quantized way, without frequent reversion, may be an additional requirement for Darwinian evolution, in which case the notion that Darwinian evolution defines life may be less of a tautology than previously thought. In this Account, we examine a variety of in vitro systems of increasing complexity, from simple chemical replicators up to complex systems based on in vitro transcription and translation. Comparing and contrasting these systems provides an interesting window onto the molecular origins of life. For nucleic acids, the story likely begins with simple chemical replication, perhaps of the form A + B → T, in which T serves as a template for the joining of A and B. Molecular variants capable of faster replication would come to dominate a population, and the development of cycles in which templates could foster one another's replication would have led to increasingly complex replicators and from thence to the initial genomes. The initial genomes may have been propagated by RNA replicases, ribozymes capable of joining oligonucleotides and eventually polymerizing mononucleotide substrates. As ribozymes were added to the genome to fill gaps in the chemistry necessary for replication, the backbone of a putative RNA world would have emerged. It is likely that such replicators would have been plagued by molecular parasites, which would have been passively replicated by the RNA world machinery without contributing to it. These molecular parasites would have been a major driver for the development of compartmentalization/cellularization, as more robust compartments could have outcompeted parasite-ridden compartments. The eventual outsourcing of metabolic

  2. Abiotic self-replication.

    PubMed

    Meyer, Adam J; Ellefson, Jared W; Ellington, Andrew D

    2012-12-18

    The key to the origins of life is the replication of information. Linear polymers such as nucleic acids that both carry information and can be replicated are currently what we consider to be the basis of living systems. However, these two properties are not necessarily coupled. The ability to mutate in a discrete or quantized way, without frequent reversion, may be an additional requirement for Darwinian evolution, in which case the notion that Darwinian evolution defines life may be less of a tautology than previously thought. In this Account, we examine a variety of in vitro systems of increasing complexity, from simple chemical replicators up to complex systems based on in vitro transcription and translation. Comparing and contrasting these systems provides an interesting window onto the molecular origins of life. For nucleic acids, the story likely begins with simple chemical replication, perhaps of the form A + B → T, in which T serves as a template for the joining of A and B. Molecular variants capable of faster replication would come to dominate a population, and the development of cycles in which templates could foster one another's replication would have led to increasingly complex replicators and from thence to the initial genomes. The initial genomes may have been propagated by RNA replicases, ribozymes capable of joining oligonucleotides and eventually polymerizing mononucleotide substrates. As ribozymes were added to the genome to fill gaps in the chemistry necessary for replication, the backbone of a putative RNA world would have emerged. It is likely that such replicators would have been plagued by molecular parasites, which would have been passively replicated by the RNA world machinery without contributing to it. These molecular parasites would have been a major driver for the development of compartmentalization/cellularization, as more robust compartments could have outcompeted parasite-ridden compartments. The eventual outsourcing of metabolic

  3. Effects of aging on P300 between late young-age and early middle-age adulthood: an electroencephalogram event-related potential study.

    PubMed

    Bourisly, Ali K

    2016-09-28

    The aim of this study was to identify age-related changes of P300 peak amplitude and P300 latency between closely separated nonsenile age groups (late young-aged adults and early middle-aged adults) and to investigate whether or not P300 has the potential to be used as a measure of cognitive aging even among nonsenile age groups. Twenty-eight adults (25-55 years old) completed an event-related potential oddball task. The elicitation of both P300 peak amplitude and P300 latency indicated age-related changes of P300. The results of the study showed that the P300 target peak amplitude was significantly larger in late young age compared with early middle age and that P300 target latency was also significantly delayed in early middle age compared with late young age. The results of this work contribute toward research efforts on a consensus on how aging affects event-related potential and/or P300. The main conclusions are that there exist significant age-related P300 changes even between closely separated, relatively younger, and nonsenile age groups, and that P300 has the potential to be used as a measure for cognitive aging even in nonsenile adults.

  4. Orbital control on carbon cycle alterations and hyperthermal events in a cooling world: the late Early to Mid Eocene record at Possagno (southern Alps, Italy)

    NASA Astrophysics Data System (ADS)

    Galeotti, Simone; Sprovieri, Mario; Moretti, Matteo; Rio, Domenico; Fornaciari, Eliana; Giusberti, Luca; Agnini, Claudia; Backman, Jan; Lanci, Luca; Luciani, Valeria

    2013-04-01

    The late Early Eocene to Middle Eocene ~50-45 Million years ago (Ma) time interval in the middle bathyal, pelagic/hemipelagic succession of the Western Tethys Possagno section (southern Alps, Veneto), contains several episodes of negative carbon isotope excursions (CIEs) and concomitant dissolution of carbonates. These episodes are superimposed on a long term global climate cooling that started at about 51 Ma following the Early Eocene Climatic Optimum (EECO). Spectral analysis indicates that CIEs and dissolution events are paced by orbital forcing, confirming the global significance of previous finding on the same interval from Western and Southern Atlantic and Equatorial Pacific sites. The frequency and magnitude of CIEs through time is controlled by long-term modulations of orbital parameters, including long eccentricity (400 kyr) and a 1.2 million year modulation. Highest frequency of events - at the orbital scale - is observed across the EECO, which provides an observational basis to validate theoretical models predicting a threshold effect resulting from orbital forcing superimposed on gradually changing mean global boundary conditions. The observation of the 1.2 million year beat (long-term modulation of obliquity) together with previously published observation of enhanced obliquity (41 kyr) forcing across major CIEs and dissolution intervals indicates that high latitude feedbacks to orbital forcing played a fundamental role in the emplacement of the hyperthermals. The observed orbital forcing signature closely match that of early Eocene hyperthermals, suggesting similar driving processes.

  5. Impacts of a water stress followed by an early frost event on beech (Fagus sylvatica L.) susceptibility to Scolytine ambrosia beetles - Research strategy and first results

    NASA Astrophysics Data System (ADS)

    La Spina, Sylvie; de Cannière, Charles; Molenberg, Jean-Marc; Vincke, Caroline; Deman, Déborah; Grégoire, Jean-Claude

    2010-05-01

    Climate change tends to induce more frequent abiotic and biotic extreme events, having large impacts on tree vitality. Weakened trees are then more susceptible to secondary insect outbreaks, as it happened in Belgium in the early 2000s: after an early frost event, secondary Scolytine ambrosia beetles attacks were observed on beech trees. In this study, we test if a combination of stress, i.e. a soil water deficit preceding an early frost, could render trees more attractive to beetles. An experimental study was set in autumn 2008. Two parcels of a beech forest were covered with plastic tents to induce a water stress by rain interception. The parcels were surrounded by 2-meters depth trenches to avoid water supply by streaming. Soil water content and different indicators of tree water use (sap flow, predawn leaf water potential, tree radial growth) were followed. In autumn 2010, artificial frost injuries will be inflicted to trees using dry ice. Trees attractivity for Scolytine insects, and the success of insect colonization will then be studied. The poster will focus on experiment setting and first results (impacts of soil water deficit on trees).

  6. DNA replication origins.

    PubMed

    Leonard, Alan C; Méchali, Marcel

    2013-10-01

    The onset of genomic DNA synthesis requires precise interactions of specialized initiator proteins with DNA at sites where the replication machinery can be loaded. These sites, defined as replication origins, are found at a few unique locations in all of the prokaryotic chromosomes examined so far. However, replication origins are dispersed among tens of thousands of loci in metazoan chromosomes, thereby raising questions regarding the role of specific nucleotide sequences and chromatin environment in origin selection and the mechanisms used by initiators to recognize replication origins. Close examination of bacterial and archaeal replication origins reveals an array of DNA sequence motifs that position individual initiator protein molecules and promote initiator oligomerization on origin DNA. Conversely, the need for specific recognition sequences in eukaryotic replication origins is relaxed. In fact, the primary rule for origin selection appears to be flexibility, a feature that is modulated either by structural elements or by epigenetic mechanisms at least partly linked to the organization of the genome for gene expression.

  7. Replication of lightweight mirrors

    NASA Astrophysics Data System (ADS)

    Chen, Ming Y.; Matson, Lawrence E.; Lee, Heedong; Chen, Chenggang

    2009-08-01

    The fabrication of lightweight mirror assemblages via a replication technique offers great potential for eliminating the high cost and schedule associated with the grinding and polishing steps needed for conventional glass or SiC mirrors. A replication mandrel is polished to an inverse figure shape and to the desired finish quality. It is then, coated with a release layer, the appropriate reflective layer, and followed by a laminate for coefficient of thermal expansion (CTE) tailorability and strength. This optical membrane is adhered to a mirror structural substrate with a low shrinkage, CTE tailored adhesive. Afterwards, the whole assembly is separated from the mandrel. The mandrel is then cleaned and reused for the next replication run. The ultimate goal of replication is to preserve the surface finish and figure of the optical membrane upon its release from the mandrel. Successful replication requires a minimization of the residual stresses within the optical coating stack, the curing stresses from the adhesive and the thermal stress resulting from CTE mismatch between the structural substrate, the adhesive, and the optical membrane. In this paper, the results on replicated trials using both metal/metal and ceramic/ceramic laminates adhered to light weighted structural substrates made from syntactic foams (both inorganic and organic) will be discussed.

  8. Effects of adverse early-life events on aggression and anti-social behaviours in animals and humans.

    PubMed

    Haller, J; Harold, G; Sandi, C; Neumann, I D

    2014-10-01

    We review the impact of early adversities on the development of violence and antisocial behaviour in humans, and present three aetiological animal models of escalated rodent aggression, each disentangling the consequences of one particular adverse early-life factor. A review of the human data, as well as those obtained with the animal models of repeated maternal separation, post-weaning social isolation and peripubertal stress, clearly shows that adverse developmental conditions strongly affect aggressive behaviour displayed in adulthood, the emotional responses to social challenges and the neuronal mechanisms activated by conflict. Although similarities between models are evident, important differences were also noted, demonstrating that the behavioural, emotional and neuronal consequences of early adversities are to a large extent dependent on aetiological factors. These findings support recent theories on human aggression, which suggest that particular developmental trajectories lead to specific forms of aggressive behaviour and brain dysfunctions. However, dissecting the roles of particular aetiological factors in humans is difficult because these occur in various combinations; in addition, the neuroscientific tools employed in humans still lack the depth of analysis of those used in animal research. We suggest that the analytical approach of the rodent models presented here may be successfully used to complement human findings and to develop integrative models of the complex relationship between early adversity, brain development and aggressive behaviour.

  9. Associations of Mother-Child Reminiscing about Negative Past Events, Coping, and Self-Concept in Early Childhood

    ERIC Educational Resources Information Center

    Goodvin, Rebecca; Romdall, Lisa

    2013-01-01

    Parent-child reminiscing conversations in early childhood have received theoretical attention as a forum for children's self-concept development, but this has been little addressed in empirical work. This study examines associations between emotion reminiscing and children's self-concepts and, building from the reminiscing and…

  10. Rumination as a Mechanism Linking Stressful Life Events to Symptoms of Depression and Anxiety: Longitudinal Evidence in Early Adolescents and Adults

    PubMed Central

    Michl, Louisa C.; McLaughlin, Katie A.; Shepherd, Kathrine; Nolen-Hoeksema, Susan

    2014-01-01

    Rumination is a well-established risk factor for the onset of major depression and anxiety symptomatology in both adolescents and adults. Despite the robust associations between rumination and internalizing psychopathology, there is a dearth of research examining factors that might lead to a ruminative response style. In the current study, we examined whether social environmental experiences were associated with rumination. Specifically, we evaluated whether self-reported exposure to stressful life events predicted subsequent increases in rumination. We also investigated whether rumination served as a mechanism underlying the longitudinal association between self-reported stressful life events and internalizing symptoms. Self-reported stressful life events, rumination, and symptoms of depression and anxiety were assessed in 2 separate longitudinal samples. A sample of early adolescents (N = 1,065) was assessed at 3 time points spanning 7 months. A sample of adults (N = 1,132) was assessed at 2 time points spanning 12 months. In both samples, self-reported exposure to stressful life events was associated longitudinally with increased engagement in rumination. In addition, rumination mediated the longitudinal relationship between self-reported stressors and symptoms of anxiety in both samples and the relationship between self-reported life events and symptoms of depression in the adult sample. Identifying the psychological and neurobiological mechanisms that explain a greater propensity for rumination following stressors remains an important goal for future research. This study provides novel evidence for the role of stressful life events in shaping characteristic responses to distress, specifically engagement in rumination, highlighting potentially useful targets for interventions aimed at preventing the onset of depression and anxiety. PMID:23713497

  11. Correlating carbon and oxygen isotope events in early to middle Miocene shallow marine carbonates in the Mediterranean region using orbitally tuned chemostratigraphy and lithostratigraphy

    PubMed Central

    Piller, Werner E.; Reuter, Markus; Harzhauser, Mathias

    2015-01-01

    Abstract During the Miocene prominent oxygen isotope events (Mi‐events) reflect major changes in glaciation, while carbonate isotope maxima (CM‐events) reflect changes in organic carbon burial, particularly during the Monterey carbon isotope excursion. However, despite their importance to the global climate history they have never been recorded in shallow marine carbonate successions. The Decontra section on the Maiella Platform (central Apennines, Italy), however, allows to resolve them for the first time in such a setting during the early to middle Miocene. The present study improves the stratigraphic resolution of parts of the Decontra section via orbital tuning of high‐resolution gamma ray (GR) and magnetic susceptibility data to the 405 kyr eccentricity metronome. The tuning allows, within the established biostratigraphic, sequence stratigraphic, and isotope stratigraphic frameworks, a precise correlation of the Decontra section with pelagic records of the Mediterranean region, as well as the global paleoclimatic record and the global sea level curve. Spectral series analyses of GR data further indicate that the 405 kyr orbital cycle is particularly well preserved during the Monterey Event. Since GR is a direct proxy for authigenic uranium precipitation during increased burial of organic carbon in the Decontra section, it follows the same long‐term orbital pacing as observed in the carbon isotope records. The 405 kyr GR beat is thus correlated with the carbon isotope maxima observed during the Monterey Event. Finally, the Mi‐events can now be recognized in the δ18O record and coincide with plankton‐rich, siliceous, or phosphatic horizons in the lithology of the section. PMID:27546980

  12. Developmental regulation of DNA replication: replication fork barriers and programmed gene amplification in Tetrahymena thermophila.

    PubMed

    Zhang, Z; Macalpine, D M; Kapler, G M

    1997-10-01

    The palindromic Tetrahymena ribosomal DNA (rDNA) minichromosome is amplified 10,000-fold during development. Subsequent vegetative replication is cell cycle regulated. rDNA replication differs fundamentally in cycling vegetative and nondividing amplifying cells. Using two-dimensional gel electrophoresis, we show for the first time that replication origins that direct gene amplification also function in normal dividing cells. Two classes of amplification intermediates were identified. The first class is indistinguishable from vegetative rDNA, initiating in just one of the two 5' nontranscribed spacer (NTS) copies in the rDNA palindrome at either of two closely spaced origins. Thus, these origins are active throughout the life cycle and their regulation changes at different developmental stages. The second, novel class of amplification intermediates is generated by multiple initiation events. Intermediates with mass greater than fully replicated DNA were observed, suggesting that onionskin replication occurs at this stage. Unlike amplified rDNA in Xenopus laevis, the novel Tetrahymena species are not produced by random initiation; replication also initiates in the 5' NTS. Surprisingly, a replication fork barrier which is activated only in these amplifying molecules blocks the progression of forks near the center of the palindrome. Whereas barriers have been previously described, this is the first instance in which programmed regulation of replication fork progression has been demonstrated in a eukaryote.

  13. The onset of the Early Eocene Climatic Optimum, including the K/X event, at Branch Stream, Clarence Valley, New Zealand

    NASA Astrophysics Data System (ADS)

    Slotnick, B. S.; Dickens, G. R.; Hollis, C. J.; Crampton, J. S.; Strong, P.; Dallanave, E.; Philips, A.

    2014-12-01

    The Early Eocene Climatic Optimum (EECO), lasting from ~53-50 Ma, has been characterized as the warmest sustained interval through the Cenozoic. It was comprised of a broad temperature maximum with elevated atmospheric pCO2, noticeable shifts in carbon cycling, and a variety of faunal and floral changes. This included one, and likely additional, brief (<200 kyr) intervals of extreme warming, the K/X event. At least for the most prominent events, the long-term drop in δ13C and short-term Carbon Isotope Excursions (CIEs) have been coupled to massive fluxes of 13C-depleted carbon into the exogenic system and global climate change. However, much about EECO remains unknown because of a lack of detailed and coupled proxy records; we are currently generating useful records to better characterize lithological and geochemical signatures of EECO. Here, we help rectify this problem by presenting a new lithologic and carbon isotopic record for a ~84-m-thick section of early Eocene upper slope calcareous-rich sediments, now lithified and exposed along Branch Stream, New Zealand. Comparison of new carbon isotopic and lithologic records of this greatly expanded section to nearby Mead Stream identifies multiple negative CIEs in short succession and generally more marl during lowermost EECO (~53.3-51.7 Ma), with the most prominent of these equating to the K/X event. The early Eocene lithologic and δ13C records at Branch and Mead Streams are remarkably similar to each other, with the following distinctions: sequences at Branch Stream are thicker and generally have a wider range of δ13C across CIEs. Both expanded sections are marked by terrigenous dilution, best explained by enhanced seasonal precipitation, elevated greenhouse-gas concentrations, and likely global warming. These data indicate lowermost EECO can be described as a time with a general δ13C low superimposed by a series of short-term climate perturbations.

  14. High resolution chronology of late Cretaceous-early Tertiary events determined from 21,000 yr orbital-climatic cycles in marine sediments

    NASA Technical Reports Server (NTRS)

    Herbert, Timothy D.; Dhondt, Steven

    1988-01-01

    A number of South Atlantic sites cored by the Deep Sea Drilling Project (DSDP) recovered late Cretaceous and early Tertiary sediments with alternating light-dark, high-low carbonate content. The sedimentary oscillations were turned into time series by digitizing color photographs of core segments at a resolution of about 5 points/cm. Spectral analysis of these records indicates prominent periodicity at 25 to 35 cm in the Cretaceous intervals, and about 15 cm in the early Tertiary sediments. The absolute period of the cycles that is determined from paleomagnetic calibration at two sites is 20,000 to 25,000 yr, and almost certainly corresponds to the period of the earth's precessional cycle. These sequences therefore contain an internal chronometer to measure events across the K/T extinction boundary at this scale of resolution. The orbital metronome was used to address several related questions: the position of the K/T boundary within magnetic chron 29R, the fluxes of biogenic and detrital material to the deep sea immediately before and after the K/T event, the duration of the Sr anomaly, and the level of background climatic variability in the latest Cretaceous time. The carbonate/color cycles that were analyzed contain primary records of ocean carbonate productivity and chemistry, as evidenced by bioturbational mixing of adjacent beds and the weak lithification of the rhythmic sequences. It was concluded that sedimentary sequences that contain orbital cyclicity are capable of providing resolution of dramatic events in earth history with much greater precision than obtainable through radiometric methods. The data show no evidence for a gradual climatic deterioration prior to the K/T extinction event, and argue for a geologically rapid revolution at this horizon.

  15. Residue-specific Fluorescent Probes of α-Synuclein: Detection of Early Events at the N- and C-termini during Fibril Assembly†

    PubMed Central

    Yap, Thai Leong; Pfefferkorn, Candace M.; Lee, Jennifer C.

    2011-01-01

    In the Parkinson’s disease-associated state, α-synuclein (α-syn) undergoes large conformational changes forming ordered, β-sheet containing fibrils. To unravel the role of specific residues during the fibril assembly process, we prepared single-Cys mutants in the disordered (G7C and Y136C) and proximal (V26C and L100C) fibril core sites and derivatized them with environment sensitive dansyl (Dns) fluorophores. Dns fluorescence exhibits residue-specificity in spectroscopic properties as well as kinetic behavior; early kinetic events were revealed by probes located at positions 7 and 136 compared to those positioned at 26 and 100. PMID:21338068

  16. A replicator-specific binding protein essential for site-specific initiation of DNA replication in mammalian cells

    PubMed Central

    Zhang, Ya; Huang, Liang; Fu, Haiqing; Smith, Owen K.; Lin, Chii Mei; Utani, Koichi; Rao, Mishal; Reinhold, William C.; Redon, Christophe E.; Ryan, Michael; Kim, RyangGuk; You, Yang; Hanna, Harlington; Boisclair, Yves; Long, Qiaoming; Aladjem, Mirit I.

    2016-01-01

    Mammalian chromosome replication starts from distinct sites; however, the principles governing initiation site selection are unclear because proteins essential for DNA replication do not exhibit sequence-specific DNA binding. Here we identify a replication-initiation determinant (RepID) protein that binds a subset of replication-initiation sites. A large fraction of RepID-binding sites share a common G-rich motif and exhibit elevated replication initiation. RepID is required for initiation of DNA replication from RepID-bound replication origins, including the origin at the human beta-globin (HBB) locus. At HBB, RepID is involved in an interaction between the replication origin (Rep-P) and the locus control region. RepID-depleted murine embryonic fibroblasts exhibit abnormal replication fork progression and fewer replication-initiation events. These observations are consistent with a model, suggesting that RepID facilitates replication initiation at a distinct group of human replication origins. PMID:27272143

  17. Early events in xenograft development from the human embryonic stem cell line HS181--resemblance with an initial multiple epiblast formation.

    PubMed

    Gertow, Karin; Cedervall, Jessica; Jamil, Seema; Ali, Rouknuddin; Imreh, Marta P; Gulyas, Miklos; Sandstedt, Bengt; Ahrlund-Richter, Lars

    2011-01-01

    Xenografting is widely used for assessing in vivo pluripotency of human stem cell populations. Here, we report on early to late events in the development of mature experimental teratoma from a well-characterized human embryonic stem cell (HESC) line, HS181. The results show an embryonic process, increasingly chaotic. Active proliferation of the stem cell derived cellular progeny was detected already at day 5, and characterized by the appearance of multiple sites of engraftment, with structures of single or pseudostratified columnar epithelium surrounding small cavities. The striking histological resemblance to developing embryonic ectoderm, and the formation of epiblast-like structures was supported by the expression of the markers OCT4, NANOG, SSEA-4 and KLF4, but a lack of REX1. The early neural marker NESTIN was uniformly expressed, while markers linked to gastrulation, such as BMP-4, NODAL or BRACHYURY were not detected. Thus, observations on day 5 indicated differentiation comparable to the most early transient cell populations in human post implantation development. Confirming and expanding on previous findings from HS181 xenografts, these early events were followed by an increasingly chaotic development, incorporated in the formation of a benign teratoma with complex embryonic components. In the mature HS181 teratomas not all types of organs/tissues were detected, indicating a restricted differentiation, and a lack of adequate spatial developmental cues during the further teratoma formation. Uniquely, a kinetic alignment of rare complex structures was made to human embryos at diagnosed gestation stages, showing minor kinetic deviations between HS181 teratoma and the human counterpart.

  18. Inflammatory cytokines imbalance in the very early phase of acute coronary syndrome: correlations with angiographic findings and in-hospital events.

    PubMed

    Brunetti, Natale Daniele; Munno, Irene; Pellegrino, Pier Luigi; Ruggero, Vincenzo; Correale, Michele; De Gennaro, Luisa; Cuculo, Andrea; Campanale, Erasmo Giulio; Di Biase, Matteo

    2011-02-01

    The aim of this study is to investigate the release of some inflammatory cytokines (Cks) during the very early phase (first 24 h) of acute coronary syndrome (ACS). Twenty-six consecutive subjects admitted to coronary care unit with ACS underwent serial blood sampling in order to evaluate concentrations of interleukin (IL)-2, IL-10, IL-18, tumor necrosis factor (TNF)-α, and interferon (IFN)-γ. Blood samples were taken within 6 h after onset of chest pain (T₀), at 12 h (T₁), and at 24 h (T₂). Patients were thus divided into four groups comparing pro-inflammatory Ck release (IL-2, TNF-α, and IFN-γ) and anti-inflammatory activity (IL-10). Clinical features, risk factors, incidence of adverse events, and coronary angiography findings were compared with Ck activation. Ck levels were significantly increased if compared with baseline. Subjects with marked inflammatory response showed a higher incidence of left anterior descending coronary disease (IL-2, p < 0.001; TNF-α and IFN-γ, p < 0.05) and more often incurred early complications (IL-2, p < 0.05; IFN-γ, p < 0.001). A correlation was detectable between IL-18 levels and myocardial enzyme release (creatine kinase, r = 0.47; lactate dehydrogenase, r = 0.54; troponin I, r = 0.58; p < 0.05). TNF-α levels were associated with a worse prognosis at follow-up (Log rank, p < 0.05). A Ck activation characterizes the early phase of ACS. Early inflammatory reaction seems to correlate with coronary disease and adverse events.

  19. Deciphering early events involved in hyperosmotic stress-induced programmed cell death in tobacco BY-2 cells

    PubMed Central

    Monetti, Emanuela; Kadono, Takashi; Bouteau, François

    2014-01-01

    Hyperosmotic stresses represent one of the major constraints that adversely affect plants growth, development, and productivity. In this study, the focus was on early responses to hyperosmotic stress- (NaCl and sorbitol) induced reactive oxygen species (ROS) generation, cytosolic Ca2+ concentration ([Ca2+]cyt) increase, ion fluxes, and mitochondrial potential variations, and on their links in pathways leading to programmed cell death (PCD). By using BY-2 tobacco cells, it was shown that both NaCl- and sorbitol-induced PCD seemed to be dependent on superoxide anion (O2·–) generation by NADPH-oxidase. In the case of NaCl, an early influx of sodium through non-selective cation channels participates in the development of PCD through mitochondrial dysfunction and NADPH-oxidase-dependent O2·– generation. This supports the hypothesis of different pathways in NaCl- and sorbitol-induced cell death. Surprisingly, other shared early responses, such as [Ca2+]cyt increase and singlet oxygen production, do not seem to be involved in PCD. PMID:24420571

  20. Deciphering early events involved in hyperosmotic stress-induced programmed cell death in tobacco BY-2 cells.

    PubMed

    Monetti, Emanuela; Kadono, Takashi; Tran, Daniel; Azzarello, Elisa; Arbelet-Bonnin, Delphine; Biligui, Bernadette; Briand, Joël; Kawano, Tomonori; Mancuso, Stefano; Bouteau, François

    2014-03-01

    Hyperosmotic stresses represent one of the major constraints that adversely affect plants growth, development, and productivity. In this study, the focus was on early responses to hyperosmotic stress- (NaCl and sorbitol) induced reactive oxygen species (ROS) generation, cytosolic Ca(2+) concentration ([Ca(2+)]cyt) increase, ion fluxes, and mitochondrial potential variations, and on their links in pathways leading to programmed cell death (PCD). By using BY-2 tobacco cells, it was shown that both NaCl- and sorbitol-induced PCD seemed to be dependent on superoxide anion (O2·(-)) generation by NADPH-oxidase. In the case of NaCl, an early influx of sodium through non-selective cation channels participates in the development of PCD through mitochondrial dysfunction and NADPH-oxidase-dependent O2·(-) generation. This supports the hypothesis of different pathways in NaCl- and sorbitol-induced cell death. Surprisingly, other shared early responses, such as [Ca(2+)]cyt increase and singlet oxygen production, do not seem to be involved in PCD.

  1. Early Solar System Alkali Fractionation Events Recorded by K-Ca Isotopes in the Yamato-74442 LL-Chondritic Breccia

    NASA Technical Reports Server (NTRS)

    Tatsunori, T.; Misawa, K.; Okano, O.; Shih, C.-Y.; Nyquist, L. E.; Simon, J. I.; Tappa, M. J.; Yoneda, S.

    2015-01-01

    Radiogenic ingrowth of Ca-40 due to decay of K-40 occurred early in the solar system history causing the Ca-40 abundance to vary within different early-former reservoirs. Marshall and DePaolo ] demonstrated that the K-40/Ca-40 decay system could be a useful radiogenic tracer for studies of terrestrial rocks. Shih et al. [3,4] determined 40K/40Ca ages of lunar granitic rock fragments and discussed the chemical characteristics of their source materials. Recently, Yokoyama et al. [5] showed the application of the K-40/Ca-40 chronometer for high K/Ca materials in ordinary chondrites (OCs). High-precision calcium isotopic data are needed to constrain mixing processes among early solar system materials and the time of planetesimal formation. To better constrain the solar system calcium isotopic compositions among astromaterials, we have determined the calcium isotopic compositions of OCs and an angrite. We further estimated a source K/Ca ratio for alkali-rich fragments in a chondritic breccia using the estimated solar system initial Ca-40/Ca-44.

  2. Key Immune Events of the Pathomechanisms of Early Cardioembolic Stroke: Multi-Database Mining and Systems Biology Approach.

    PubMed

    Wu, Chia-Chou; Chen, Bor-Sen

    2016-01-01

    While inflammation has generally been regarded as a negative factor in stroke recovery, this viewpoint has recently been challenged by demonstrating that inflammation is a necessary and sufficient factor for regeneration in the zebrafish brain injury model. This close relationship with inflammation suggests that a re-examination of the immune system's role in strokes is necessary. We used a systems biology approach to investigate the role of immune-related functions via their interactions with other molecular functions in early cardioembolic stroke. Based on protein interaction models and on microarray data from the blood of stroke subjects and healthy controls, networks were constructed to delineate molecular interactions at four early stages (pre-stroke, 3 h, 5 h and 24 h after stroke onset) of cardioembolic stroke. A comparative analysis of functional networks identified interactions of immune-related functions with other molecular functions, including growth factors, neuro/hormone and housekeeping functions. These provide a potential pathomechanism for early stroke pathophysiology. In addition, several potential targets of miRNA and methylation regulations were derived based on basal level changes observed in the core networks and literature. The results provide a more comprehensive understanding of stroke progression mechanisms from an immune perspective and shed light on acute stroke treatments. PMID:26927091

  3. The E. coli DNA Replication Fork.

    PubMed

    Lewis, J S; Jergic, S; Dixon, N E

    2016-01-01

    DNA replication in Escherichia coli initiates at oriC, the origin of replication and proceeds bidirectionally, resulting in two replication forks that travel in opposite directions from the origin. Here, we focus on events at the replication fork. The replication machinery (or replisome), first assembled on both forks at oriC, contains the DnaB helicase for strand separation, and the DNA polymerase III holoenzyme (Pol III HE) for DNA synthesis. DnaB interacts transiently with the DnaG primase for RNA priming on both strands. The Pol III HE is made up of three subassemblies: (i) the αɛθ core polymerase complex that is present in two (or three) copies to simultaneously copy both DNA strands, (ii) the β2 sliding clamp that interacts with the core polymerase to ensure its processivity, and (iii) the seven-subunit clamp loader complex that loads β2 onto primer-template junctions and interacts with the α polymerase subunit of the core and the DnaB helicase to organize the two (or three) core polymerases. Here, we review the structures of the enzymatic components of replisomes, and the protein-protein and protein-DNA interactions that ensure they remain intact while undergoing substantial dynamic changes as they function to copy both the leading and lagging strands simultaneously during coordinated replication.

  4. Modeling DNA Replication Intermediates

    SciTech Connect

    Broyde, S.; Roy, D.; Shapiro, R.

    1997-06-01

    While there is now available a great deal of information on double stranded DNA from X-ray crystallography, high resolution NMR and computer modeling, very little is known about structures that are representative of the DNA core of replication intermediates. DNA replication occurs at a single strand/double strand junction and bulged out intermediates near the junction can lead to frameshift mutations. The single stranded domains are particularly challenging. Our interest is focused on strategies for modeling the DNA of these types of replication intermediates. Modeling such structures presents special problems in addressing the multiple minimum problem and in treating the electrostatic component of the force field. We are testing a number of search strategies for locating low energy structures of these types and we are also investigating two different distance dependent dielectric functions in the coulombic term of the force field. We are studying both unmodified DNA and DNA damaged by aromatic amines, carcinogens present in the environment in tobacco smoke, barbecued meats and automobile exhaust. The nature of the structure adopted by the carcinogen modified DNA at the replication fork plays a key role in determining whether the carcinogen will cause a mutation during replication that can initiate the carcinogenic process. In the present work results are presented for unmodified DNA.

  5. Ancient DNA from South-East Europe Reveals Different Events during Early and Middle Neolithic Influencing the European Genetic Heritage.

    PubMed

    Hervella, Montserrat; Rotea, Mihai; Izagirre, Neskuts; Constantinescu, Mihai; Alonso, Santos; Ioana, Mihai; Lazăr, Cătălin; Ridiche, Florin; Soficaru, Andrei Dorian; Netea, Mihai G; de-la-Rua, Concepcion

    2015-01-01

    The importance of the process of Neolithization for the genetic make-up of European populations has been hotly debated, with shifting hypotheses from a demic diffusion (DD) to a cultural diffusion (CD) model. In this regard, ancient DNA data from the Balkan Peninsula, which is an important source of information to assess the process of Neolithization in Europe, is however missing. In the present study we show genetic information on ancient populations of the South-East of Europe. We assessed mtDNA from ten sites from the current territory of Romania, spanning a time-period from the Early Neolithic to the Late Bronze Age. mtDNA data from Early Neolithic farmers of the Starčevo Criş culture in Romania (Cârcea, Gura Baciului and Negrileşti sites), confirm their genetic relationship with those of the LBK culture (Linienbandkeramik Kultur) in Central Europe, and they show little genetic continuity with modern European populations. On the other hand, populations of the Middle-Late Neolithic (Boian, Zau and Gumelniţa cultures), supposedly a second wave of Neolithic migration from Anatolia, had a much stronger effect on the genetic heritage of the European populations. In contrast, we find a smaller contribution of Late Bronze Age migrations to the genetic composition of Europeans. Based on these findings, we propose that permeation of mtDNA lineages from a second wave of Middle-Late Neolithic migration from North-West Anatolia into the Balkan Peninsula and Central Europe represent an important contribution to the genetic shift between Early and Late Neolithic populations in Europe, and consequently to the genetic make-up of modern European populations.

  6. Ancient DNA from South-East Europe Reveals Different Events during Early and Middle Neolithic Influencing the European Genetic Heritage

    PubMed Central

    Hervella, Montserrat; Rotea, Mihai; Izagirre, Neskuts; Constantinescu, Mihai; Alonso, Santos; Ioana, Mihai; Lazăr, Cătălin; Ridiche, Florin; Soficaru, Andrei Dorian; Netea, Mihai G.; de-la-Rua, Concepcion

    2015-01-01

    The importance of the process of Neolithization for the genetic make-up of European populations has been hotly debated, with shifting hypotheses from a demic diffusion (DD) to a cultural diffusion (CD) model. In this regard, ancient DNA data from the Balkan Peninsula, which is an important source of information to assess the process of Neolithization in Europe, is however missing. In the present study we show genetic information on ancient populations of the South-East of Europe. We assessed mtDNA from ten sites from the current territory of Romania, spanning a time-period from the Early Neolithic to the Late Bronze Age. mtDNA data from Early Neolithic farmers of the Starčevo Criş culture in Romania (Cârcea, Gura Baciului and Negrileşti sites), confirm their genetic relationship with those of the LBK culture (Linienbandkeramik Kultur) in Central Europe, and they show little genetic continuity with modern European populations. On the other hand, populations of the Middle-Late Neolithic (Boian, Zau and Gumelniţa cultures), supposedly a second wave of Neolithic migration from Anatolia, had a much stronger effect on the genetic heritage of the European populations. In contrast, we find a smaller contribution of Late Bronze Age migrations to the genetic composition of Europeans. Based on these findings, we propose that permeation of mtDNA lineages from a second wave of Middle-Late Neolithic migration from North-West Anatolia into the Balkan Peninsula and Central Europe represent an important contribution to the genetic shift between Early and Late Neolithic populations in Europe, and consequently to the genetic make-up of modern European populations. PMID:26053041

  7. Ancient DNA from South-East Europe Reveals Different Events during Early and Middle Neolithic Influencing the European Genetic Heritage.

    PubMed

    Hervella, Montserrat; Rotea, Mihai; Izagirre, Neskuts; Constantinescu, Mihai; Alonso, Santos; Ioana, Mihai; Lazăr, Cătălin; Ridiche, Florin; Soficaru, Andrei Dorian; Netea, Mihai G; de-la-Rua, Concepcion

    2015-01-01

    The importance of the process of Neolithization for the genetic make-up of European populations has been hotly debated, with shifting hypotheses from a demic diffusion (DD) to a cultural diffusion (CD) model. In this regard, ancient DNA data from the Balkan Peninsula, which is an important source of information to assess the process of Neolithization in Europe, is however missing. In the present study we show genetic information on ancient populations of the South-East of Europe. We assessed mtDNA from ten sites from the current territory of Romania, spanning a time-period from the Early Neolithic to the Late Bronze Age. mtDNA data from Early Neolithic farmers of the Starčevo Criş culture in Romania (Cârcea, Gura Baciului and Negrileşti sites), confirm their genetic relationship with those of the LBK culture (Linienbandkeramik Kultur) in Central Europe, and they show little genetic continuity with modern European populations. On the other hand, populations of the Middle-Late Neolithic (Boian, Zau and Gumelniţa cultures), supposedly a second wave of Neolithic migration from Anatolia, had a much stronger effect on the genetic heritage of the European populations. In contrast, we find a smaller contribution of Late Bronze Age migrations to the genetic composition of Europeans. Based on these findings, we propose that permeation of mtDNA lineages from a second wave of Middle-Late Neolithic migration from North-West Anatolia into the Balkan Peninsula and Central Europe represent an important contribution to the genetic shift between Early and Late Neolithic populations in Europe, and consequently to the genetic make-up of modern European populations. PMID:26053041

  8. Studies on the Coordination of Ribosomal Protein Assembly Events Involved in Processing and Stabilization of Yeast Early Large Ribosomal Subunit Precursors

    PubMed Central

    Sauert, Martina; Martín-Marcos, Pilar; Tamame, Mercedes; Tschochner, Herbert; Griesenbeck, Joachim; Milkereit, Philipp

    2015-01-01

    Cellular production of ribosomes involves the formation of highly defined interactions between ribosomal proteins (r-proteins) and ribosomal RNAs (rRNAs). Moreover in eukaryotic cells, efficient ribosome maturation requires the transient association of a large number of ribosome biogenesis factors (RBFs) with newly forming ribosomal subunits. Here, we investigated how r-protein assembly events in the large ribosomal subunit (LSU) rRNA domain II are coordinated with each other and with the association of RBFs in early LSU precursors of the yeast Saccharomyces cerevisiae. Specific effects on the pre-ribosomal association of RBFs could be observed in yeast mutants blocked in LSU rRNA domain II assembly. Moreover, formation of a cluster of r-proteins was identified as a downstream event in LSU rRNA domain II assembly. We analyzed in more detail the functional relevance of eukaryote specific bridges established by this r-protein cluster between LSU rRNA domain II and VI and discuss how they can support the stabilization and efficient processing of yeast early LSU precursor RNAs. PMID:26642313

  9. A novel type of detergent-resistant membranes may contribute to an early protein sorting event in epithelial cells.

    PubMed

    Alfalah, Marwan; Wetzel, Gabi; Fischer, Ina; Busche, Roger; Sterchi, Erwin E; Zimmer, Klaus-Peter; Sallmann, Hans-Peter; Naim, Hassan Y

    2005-12-30

    One sorting mechanism of apical and basolateral proteins in epithelial cells is based on their solubility profiles with Triton X-100. Nevertheless, apical proteins themselves are also segregated beyond the trans-Golgi network by virtue of their association or nonassociation with cholesterol/sphingolipid-rich microdomains (Jacob, R., and Naim, H. Y. (2001) Curr. Biol. 11, 1444-1450). Therefore, extractability with Triton X-100 does not constitute an absolute criterion of protein sorting. Here, we investigate the solubility patterns of apical and basolateral proteins with other detergents and demonstrate that the mild detergent Tween 20 is adequate to discriminate between apical and basolateral proteins during early stages in their biosynthesis. Although the mannose-rich forms of the apical proteins sucrase-isomaltase, lactase-phlorizin hydrolase, aminopeptidase N, and dipeptidylpeptidase IV reveal similar solubility profiles comprising soluble and nonsoluble fractions, the basolateral proteins, vesicular stomatitis virus G protein, major histocompatibility complex class I, and CD46 are entirely soluble with this detergent. The insoluble Tween 20 membranes are enriched in phosphatidylinositol and phosphatidylglycerol compatible with their synthesis in the endoplasmic reticulum and the existence of a novel class of detergent-resistant membranes. The association of the mannose-rich biosynthetic forms of the apical proteins, sucraseisomaltase, lactase-phlorizin hydrolase, aminopeptidase N, and dipeptidylpeptidase IV with the Tween 20-resistant membranes suggests an early polarized sorting mechanism prior to maturation in the Golgi apparatus.

  10. Avian Retroviral Replication

    PubMed Central

    Justice, James; Beemon, Karen L.

    2013-01-01

    Avian retroviruses have undergone intense study since the beginning of the 20th century. They were originally identified as cancer-inducing filterable agents in chicken neoplasms. Since their discovery, the study of these simple retroviruses has contributed greatly to our understanding of retroviral replication and cancer. Avian retroviruses are continuing to evolve and have great economic importance in the poultry industry worldwide. The aim of this review is to provide a broad overview of the genome, pathology, and replication of avian retroviruses. Notable gaps in our current knowledge are highlighted, and areas where avian retroviruses differ from other retrovirus are also emphasized. PMID:24011707

  11. Replicated Composite Optics Development

    NASA Technical Reports Server (NTRS)

    Engelhaupt, Darell

    1997-01-01

    Advanced optical systems for applications such as grazing incidence Wolter I x-ray mirror assemblies require extraordinary mirror surfaces in ten-ns of fine surface finish and figure. The impeccable mirror surface is on the inside of the rotational mirror form. One practical method of producing devices with these requirements is to first fabricate an exterior surface for the optical device then replicate that surface to have the inverse component with lightweight characteristics. The replicate optic is not better than the master or mandrel from which it is made. This task is a continuance of previous studies to identify methods and materials for forming these extremely low roughness optical components.

  12. The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

    PubMed Central

    DeSmet, Marsha; Kanginakudru, Sriramana; Rietz, Anne; Wu, Wai-Hong; Roden, Richard

    2016-01-01

    The origin recognition complex (ORC) coordinates a series of events that lead to initiation of DNA strand duplication. As a nuclear double stranded DNA plasmid, the papillomavirus (PV) genome resembles a mini-chromosome in infected cells. To initiate its replication, the viral E2 protein binds to and recruits the E1 DNA helicase at the viral origin. PV genome replication program exhibits three stages: initial amplification from a single genome upon infection to a few copies per cell, a cell cycle linked maintenance phase, and a differentiation dependent late stage where the genome is amplified to thousands of copies. Involvement of ORC or other pre-replication complex (pre-RC) factors has not been described. We report that human PV (HPV) and bovine PV (BPV-1) E2 proteins bind to ORC2, however, ORC2 was not detected at the viral origin. Depletion of ORC2 enhanced PV replication in a transient replication model and in keratinocytes stably maintaining viral episomes, while there was no effect on copy number in a cell line with integrated HPV genomes. Consistent with this, occupancy of E1 and E2 at the viral origin increased following ORC2 silencing. These data imply that ORC2 is not necessary for activation of the PV origin by E1 and E2 but instead suppresses E2 replicative function. Furthermore, we observed that over-expression of HPV E2 decreased ORC2 occupation at two known mammalian origins of replication, suggesting that E2 restricts pre-ORC assembly that could otherwise compete for host replication complexes necessary for viral genome amplification. We infer that the ORC2 complex with E2 restricts viral replication in the maintenance phase of the viral replication program and that elevated levels of E2 that occur during the differentiation dependent amplification stage subvert ORC loading and hence DNA synthesis at cellular origins. PMID:27701460

  13. Early detection of cognitive impairment in patients with obstructive sleep apnea syndrome: an event-related potential study.

    PubMed

    Zhang, Xi; Wang, Yuping; Li, Shunwei; Huang, Xizhen; Cui, Lili

    2002-06-01

    Event-related potentials (ERPs) were recorded to visual stimuli in a task that required matching the shape and serial position of the probes against previously memorized items. The effects of hypoxia on ERP were investigated in 24 patients with obstructive sleep apnea syndrome (OSAS) and a matched control group. N2b-late positive-going (LPC) components were elicited by probes that identically matched the memorized items (no-conflict condition). In contrast, N270-LPC and N270-N430-LPC components were elicited by probes having low-conflict and high-conflict with the memory set. Conflict ERP effect decreased in mild, while both no-conflict and conflict ERP effects decreased in amplitude in severe OSAS patients. Conflict ERPs associated with processing of conflicting information are more vulnerable than no-conflict ERPs to hypoxic cerebral damage.

  14. Mutations altering the gammaretrovirus endoproteolytic motif affect glycosylation of the envelope glycoprotein and early events of the virus life cycle.

    PubMed

    Argaw, Takele; Wilson, Carolyn A

    2015-01-15

    Previously, we found that mutation of glutamine to proline in the endoproteolytic cleavage signal of the PERV-C envelope (RQKK to RPKK) resulted in non-infectious vectors. Here, we show that RPKK results in a non-infectious vector when placed in not only a PERV envelope, but also the envelope of a related gammaretrovirus, FeLV-B. The amino acid substitutions do not prevent envelope precursor cleavage, viral core and genome assembly, or receptor binding. Rather, the mutations result in the formation of hyperglycosylated glycoprotein and a reduction in the reverse transcribed minus strand synthesis and undetectable 2-LTR circular DNA in cells exposed to vectors with these mutated envelopes. Our findings suggest novel functions associated with the cleavage signal sequence that may affect trafficking through the glycosylation machinery of the cell. Further, the glycosylation status of the envelope appears to impact post-binding events of the viral life cycle, either membrane fusion, internalization, or reverse transcription.

  15. The record of Tethyan planktonic foraminifera at the early Paleogene hyperthermal events and Middle Eocene Climatic Optimum in northeastern Italy: are they comparable?

    NASA Astrophysics Data System (ADS)

    Luciani, Valeria; Giusberti, Luca; Agnini, Claudia; Fornaciari, Eliana; Rio, Domenico

    2010-05-01

    The early Paleogene is one of the more climatically and evolutionary dynamic periods in the Earth history that records a pronounced warming trend peaking in the Early Eocene, and a successive composite transition towards the modern icehouse world. Ever increasingly scientific attention is dedicated to definitely comprehend timing, nature and characters of the complex, non-linear evolution of the Paleogene climate. Several complete and expanded Paleogene successions (Forada, Possagno, Alano, Farra), with a sound magneto-biochronostratigraphic and stable isotope record crop out in the Venetian Southern Alps (Northeast Italy). Recent studies (Giusberti et. al., 2007; Luciani et al., 2007; Agnini et al., 2008) and unpublished data document the presence in these section of the main short-lived warming events (hyperthermals) of the Eocene (Paleocene-Eocene Thermal Maximum, PETM, ca 55 Ma, Eocene Layer of Mysterious Origin (ELMO, ca 53,6 Ma), X-event (ca 52.5 Ma), of the Early Eocene Climatic Optimum (EECO, ca 50-52 Ma) and of the Middle Eocene Climatic Optimum (MECO, ca 40 Ma; Zachos et al., 2001. 2008). All these events are typified by marked negative shifts in δ13C curves that correspond to carbonate decrease related to rise of the carbonate compensation depth in turn induced by large introduction in the ocean-atmosphere system of CO2. Common features to the warming events are pronounced and complex changes in planktonic foraminiferal assemblages, indicating strong environmental perturbations that perfectly parallel the variations of the stable isotope curves in all the examined events. These strict correspondences indicate close cause-effect relationships between changes in environmental conditions and modifications of the assemblages. Our analysis shows that the most striking variations are recorded by the PETM and MECO assemblages that reflect highly perturbed environments. The ELMO, X-event and EECO exhibit planktic foraminiferal responses that are similar to

  16. A Protocolised Once a Day Modified Early Warning Score (MEWS) Measurement Is an Appropriate Screening Tool for Major Adverse Events in a General Hospital Population

    PubMed Central

    Ludikhuize, Jeroen; Kramer, Mark H. H.

    2016-01-01

    Background The Modified Early Warning Score (MEWS) was developed to timely recognise clinically deteriorating hospitalised patients. However, the ability of the MEWS in predicting serious adverse events (SAEs) in a general hospital population has not been examined prospectively. The aims were to (1) analyse protocol adherence to a MEWS protocol in a real-life setting and (2) to determine the predictive value of protocolised daily MEWS measurement on SAEs: death, cardiac arrests, ICU-admissions and readmissions. Methods All adult patients admitted to 6 hospital wards in October and November 2015 were included. MEWS were checked each morning by the research team. For each critical score (MEWS ≥ 3), the clinical staff was inquired about the actions performed. 30-day follow-up for SAEs was performed to compare between patients with and without a critical score. Results 1053 patients with 3673 vital parameter measurements were included, 200 (19.0%) had a critical score. The protocol adherence was 89.0%. 18.2% of MEWS were calculated wrongly. Patients with critical scores had significant higher rates of unplanned ICU admissions [7.0% vs 1.3%, p < 0.001], in-hospital mortality [6.0% vs 0.8%, p < 0.001], 30-day readmission rates [18.6% vs 10.8%, p < 0.05], and a longer length of stay [15.65 (SD: 15.7 days) vs 6.09 (SD: 6.9), p < 0.001]. Specificity of MEWS related to composite adverse events was 83% with a negative predicting value of 98.1%. Conclusions Protocol adherence was high, even though one-third of the critical scores were calculated wrongly. Patients with a MEWS ≥ 3 experienced significantly more adverse events. The negative predictive value of early morning MEWS < 3 was 98.1%, indicating the reliability of this score as a screening tool. PMID:27494719

  17. Observations of an early Agulhas current retroflection event in 2001: A temporary cessation of inter-ocean exchange south of Africa?

    NASA Astrophysics Data System (ADS)

    van Aken, H. M.; Lutjeharms, J. R. E.; Rouault, M.; Whittle, C.; de Ruijter, W. P. M.

    2013-02-01

    The exchange of heat and salt between the South Indian Ocean and South Atlantic Ocean, at the southern terminus of the Agulhas current, forms a crucial link in the global ocean circulation. It has been surmised that upstream retroflections in this current could produce temporary interruptions to the exchange, but that their impact would depend on the vertical extent of such retroflections and on their duration. The fortuitous presence at sea of a research vessel has now enabled us to investigate such an episode at subsurface levels in combination with remote sensing of the sea surface. We present here the first in situ evidence that an upstream or early retroflection can extend to a depth of well over 750 m and last for 5 months. This event was likely triggered upstream by the happenstance of two Natal Pulses, large cyclonic eddies inshore of the Agulhas current. These eddies short-circuited the Agulhas with its Return current, leading to the shedding of three large Agulhas rings in quick succession. The arrival of a third cyclonic eddy when the Retroflection was still quite retracted did not lead to another ring shedding event. The resulting early retroflection may have had the effect of stalling the shedding of Agulhas rings and their motion towards the Cape Basin. However, these early retroflections are too scarce to allow generic statements on their generation or consequences, and the relation with large-scale environmental factors. It is likely that the observed withdrawal of the retroflection into the Transkei Basin is a fortuitous result of a series of contingent interactions.

  18. Absence of major vegetation and palaeoatmospheric pCO 2 changes associated with oceanic anoxic event 1a (Early Aptian, SE France)

    NASA Astrophysics Data System (ADS)

    Heimhofer, Ulrich; Hochuli, Peter A.; Herrle, Jens O.; Andersen, Nils; Weissert, Helmut

    2004-07-01

    The deposition of organic-rich sediments during the late Early Aptian Oceanic Anoxic Event (OAE) 1a has been interpreted to result in a major decrease of palaeoatmospheric CO 2 concentrations, accompanied by significant changes in the terrestrial flora. In order to test this hypothesis, the OAE 1a interval in the Vocontian Basin (SE France) has been studied with a combined approach including stable carbon isotopes, organic geochemistry and palynology. To estimate changes in palaeoatmospheric CO 2 levels across the OAE 1a, the δ13C composition of presumed algal biomarkers (low molecular weight n-alkanes, steranes) and of bulk carbonate carbon are used. Our results yield estimated Early Aptian carbon dioxide partial pressure ( pCO 2) values three to four times the preindustrial level and only a moderate drop across the black shale event. This moderate drop in pCO 2 is supported by palynological results. The frequency patterns of climate-sensitive sporomorphs (incl. pteridophyte spores, bisaccate pollen and Classopollis spp.) display only minor fluctuations throughout the studied section and indicate relatively stable patterns of terrestrial vegetation during and after formation of the OAE 1a black shale. The occurrence of a characteristic Early Aptian carbon isotope pattern across the OAE 1a interval permits accurate chemostratigraphic correlation with the well-studied Livello Selli interval of the Cismon record (N Italy). The contemporaneous formation of individual black shale layers at both sites indicates that transient episodes of dysoxic-anoxic bottom waters prevailed over large areas in the W Tethys Ocean independent of depositional setting. Comparison of the palynological data from the two locations displays significant differences in the frequency patterns of bisaccate pollen. The contrasting pollen spectra are interpreted to reflect prominent changes in the palaeoceanographic current patterns and/or selective sorting due to sea-level rise rather than

  19. High-Throughput Tag-Sequencing Analysis of Early Events Induced by Ochratoxin A in HepG-2 Cells.

    PubMed

    Zhang, Yu; Qi, Xiaozhe; Zheng, Juanjuan; Luo, YunBo; Huang, Kunlun; Xu, Wentao

    2016-01-01

    Ochratoxin A (OTA) is produced by fungi of the species Aspergillus and Penicillium. OTA has displayed hepatotoxicity in mammals. Although recent studies have indicated that OTA influences liver function, little is known regarding its impact on differential early liver toxicity. In this study, we report high-throughput tag-sequencing (Tag-seq) analysis of the transcriptome using Solexa Analyzer platform after 4 h of OTA treatment on HepG-2 cells. The analyses of differentially expressed genes revealed the substantial changes. A total of 21,449 genes were identified and quantified, with 2726 displaying significantly altered expression levels. Expression level data were then integrated with a network of gene-gene interactions, and biological pathways to obtain a systems-level view of changes in the transcriptome that occur with OTA resistance. Our data suggest that OTA exposure leads to an imbalance in zinc finger expression and shed light on splicing factor and mitochondrial-based mechanisms. PMID:26377828

  20. High-Throughput Tag-Sequencing Analysis of Early Events Induced by Ochratoxin A in HepG-2 Cells.

    PubMed

    Zhang, Yu; Qi, Xiaozhe; Zheng, Juanjuan; Luo, YunBo; Huang, Kunlun; Xu, Wentao

    2016-01-01

    Ochratoxin A (OTA) is produced by fungi of the species Aspergillus and Penicillium. OTA has displayed hepatotoxicity in mammals. Although recent studies have indicated that OTA influences liver function, little is known regarding its impact on differential early liver toxicity. In this study, we report high-throughput tag-sequencing (Tag-seq) analysis of the transcriptome using Solexa Analyzer platform after 4 h of OTA treatment on HepG-2 cells. The analyses of differentially expressed genes revealed the substantial changes. A total of 21,449 genes were identified and quantified, with 2726 displaying significantly altered expression levels. Expression level data were then integrated with a network of gene-gene interactions, and biological pathways to obtain a systems-level view of changes in the transcriptome that occur with OTA resistance. Our data suggest that OTA exposure leads to an imbalance in zinc finger expression and shed light on splicing factor and mitochondrial-based mechanisms.

  1. Muscle Tissue Damage Induced by the Venom of Bothrops asper: Identification of Early and Late Pathological Events through Proteomic Analysis

    PubMed Central

    Herrera, Cristina; Macêdo, Jéssica Kele A.; Feoli, Andrés; Escalante, Teresa; Rucavado, Alexandra; Gutiérrez, José María; Fox, Jay W.

    2016-01-01

    The time-course of the pathological effects induced by the venom of the snake Bothrops asper in muscle tissue was investigated by a combination of histology, proteomic analysis of exudates collected in the vicinity of damaged muscle, and immunodetection of extracellular matrix proteins in exudates. Proteomic assay of exudates has become an excellent new methodological tool to detect key biomarkers of tissue alterations for a more integrative perspective of snake venom-induced pathology. The time-course analysis of the intracellular proteins showed an early presence of cytosolic and mitochondrial proteins in exudates, while cytoskeletal proteins increased later on. This underscores the rapid cytotoxic effect of venom, especially in muscle fibers, due to the action of myotoxic phospholipases A2, followed by the action of proteinases in the cytoskeleton of damaged muscle fibers. Similarly, the early presence of basement membrane (BM) and other extracellular matrix (ECM) proteins in exudates reflects the rapid microvascular damage and hemorrhage induced by snake venom metalloproteinases. The presence of fragments of type IV collagen and perlecan one hour after envenoming suggests that hydrolysis of these mechanically/structurally-relevant BM components plays a key role in the genesis of hemorrhage. On the other hand, the increment of some ECM proteins in the exudate at later time intervals is likely a consequence of the action of endogenous matrix metalloproteinases (MMPs) or of de novo synthesis of ECM proteins during tissue remodeling as part of the inflammatory reaction. Our results offer relevant insights for a more integrative and systematic understanding of the time-course dynamics of muscle tissue damage induced by B. asper venom and possibly other viperid venoms. PMID:27035343

  2. Non-Verbal Reasoning Ability and Academic Achievement as Moderators of the Relation between Adverse Life Events and Emotional and Behavioural Problems in Early Adolescence: The Importance of Moderator and Outcome Specificity

    ERIC Educational Resources Information Center

    Flouri, Eirini; Tzavidis, Nikos

    2011-01-01

    This study was carried out to model the functional form of the effect of contextual risk (number of adverse life events) on emotional and behavioural problems in early adolescence, and to test how intelligence and academic achievement compare as moderators of this effect. The effect of number of adverse life events on emotional and behavioural…

  3. Pre-sowing Seed Treatments in Direct-seeded Early Rice: Consequences for Emergence, Seedling Growth and Associated Metabolic Events under Chilling Stress

    PubMed Central

    Wang, Weiqin; Chen, Qian; Hussain, Saddam; Mei, Junhao; Dong, Huanglin; Peng, Shaobing; Huang, Jianliang; Cui, Kehui; Nie, Lixiao

    2016-01-01

    Double direct-seeding for double rice cropping is a simplified, labor saving, and efficient cropping system to improve multiple-crop index and total rice production in central China. However, poor crop establishment of direct-seeded early rice due to chilling stress is the main obstacle to wide spread of this system. A series of experiments were conducted to unravel the effects of pre-sowing seed treatments on emergence, seedling growth and associated metabolic events of direct-seeded early rice under chilling stress. Two seed priming treatments and two seed coating treatments were used in all the experiments. A non-treated control treatment was also maintained for comparison. In both the field and growth chamber studies, seed priming with selenium or salicylic acid significantly enhanced the emergence and seedling growth of rice compared with non-treated control. Nevertheless, such positive effects were not apparent for seed coating treatments. Better emergence and vigorous seedling growth of rice after seed priming was associated with enhanced α-amylase activity, higher soluble sugars contents, and greater respiration rate in primed rice seedlings under chilling stress. Taking together, these findings may provide new avenues for understanding and advancing priming-induced chilling tolerance in direct-seeded early rice in double rice cropping system. PMID:26782108

  4. Pre-sowing Seed Treatments in Direct-seeded Early Rice: Consequences for Emergence, Seedling Growth and Associated Metabolic Events under Chilling Stress.

    PubMed

    Wang, Weiqin; Chen, Qian; Hussain, Saddam; Mei, Junhao; Dong, Huanglin; Peng, Shaobing; Huang, Jianliang; Cui, Kehui; Nie, Lixiao

    2016-01-01

    Double direct-seeding for double rice cropping is a simplified, labor saving, and efficient cropping system to improve multiple-crop index and total rice production in central China. However, poor crop establishment of direct-seeded early rice due to chilling stress is the main obstacle to wide spread of this system. A series of experiments were conducted to unravel the effects of pre-sowing seed treatments on emergence, seedling growth and associated metabolic events of direct-seeded early rice under chilling stress. Two seed priming treatments and two seed coating treatments were used in all the experiments. A non-treated control treatment was also maintained for comparison. In both the field and growth chamber studies, seed priming with selenium or salicylic acid significantly enhanced the emergence and seedling growth of rice compared with non-treated control. Nevertheless, such positive effects were not apparent for seed coating treatments. Better emergence and vigorous seedling growth of rice after seed priming was associated with enhanced α-amylase activity, higher soluble sugars contents, and greater respiration rate in primed rice seedlings under chilling stress. Taking together, these findings may provide new avenues for understanding and advancing priming-induced chilling tolerance in direct-seeded early rice in double rice cropping system.

  5. Replicated spectrographs in astronomy

    NASA Astrophysics Data System (ADS)

    Hill, Gary J.

    2014-06-01

    As telescope apertures increase, the challenge of scaling spectrographic astronomical instruments becomes acute. The next generation of extremely large telescopes (ELTs) strain the availability of glass blanks for optics and engineering to provide sufficient mechanical stability. While breaking the relationship between telescope diameter and instrument pupil size by adaptive optics is a clear path for small fields of view, survey instruments exploiting multiplex advantages will be pressed to find cost-effective solutions. In this review we argue that exploiting the full potential of ELTs will require the barrier of the cost and engineering difficulty of monolithic instruments to be broken by the use of large-scale replication of spectrographs. The first steps in this direction have already been taken with the soon to be commissioned MUSE and VIRUS instruments for the Very Large Telescope and the Hobby-Eberly Telescope, respectively. MUSE employs 24 spectrograph channels, while VIRUS has 150 channels. We compare the information gathering power of these replicated instruments with the present state of the art in more traditional spectrographs, and with instruments under development for ELTs. Design principles for replication are explored along with lessons learned, and we look forward to future technologies that could make massively-replicated instruments even more compelling.

  6. SIMS Replications in Ontario.

    ERIC Educational Resources Information Center

    Russell, Howard

    Replication of the Second International Mathematics Study (SIMS) in Ontario, Canada, is described and assessed. The curriculum and testing program covers numerical methods, geometry, and algebra. Whereas classical studies focused on mean scores of a system's students and on percentages of teachers for opportunity to learn (OTL), SIMS aggregates…

  7. Frog Virus 3 DNA Replication Occurs in Two Stages

    PubMed Central

    Goorha, R.

    1982-01-01

    Viral DNA synthesis in frog virus 3 (FV3)-infected cells occurs both in the nucleus and in the cytoplasm (Goorha et al., Virology 84:32-51, 1978). Relationships between viral DNA molecules synthesized in these two compartments and their role in the virus replication were examined. The data presented here suggest that (i) FV3 DNA replicated in two stages and (ii) nucleus and cytoplasm were the sites of stages 1 and 2 of DNA replication, respectively. Stages 1 and 2 were further distinguished by their temporal appearance during infection and by the sizes of the replicating DNA as determined by sedimentation in neutral sucrose gradients. In stage 1, replicating molecules, between the size of unit and twice the unit length, were produced early in infection (2 h postinfection). In contrast, stage 2 of DNA replication occurred only after 3 h postinfection, and replicating molecules were large concatemers. Results of pulse-chase experiments showed that the concatemeric DNA served as the precursor for the production of mature FV3 DNA. Denaturation of concatemeric DNA with alkali or digestion with S1 nuclease reduced it to less than genome size molecules, indicating the presence of extensive single-stranded regions. Analysis of replicating DNA by equilibrium centrifugation in CsCl gradients after a pulse-chase suggested that these single-stranded regions were subsequently repaired. Based on these and previous data, a scheme of FV3 replication is presented. According to this scheme, FV3 utilizes the nucleus for early transcription and stage 1 of DNA replication. The viral DNA is then transported to the cytoplasm, where it participates in stage 2 DNA replication to form a concatemeric replication complex. The processing of concatemers to produce mature viral DNA and virus assembly also occurs in the cytoplasm. This mode of replication is strikingly different from any other known DNA virus. PMID:7109033

  8. Astrochronology of the Valanginian-Hauterivian stages (Early Cretaceous): Chronological relationships between the Paraná-Etendeka large igneous province and the Weissert and the Faraoni events

    NASA Astrophysics Data System (ADS)

    Martinez, Mathieu; Deconinck, Jean-François; Pellenard, Pierre; Riquier, Laurent; Company, Miguel; Reboulet, Stéphane; Moiroud, Mathieu

    2015-08-01

    The Geological Time Scale shows large uncertainties on durations and ages of Berriasian to Albian stages (Early Cretaceous), which impact climate and paleoceanographic reconstructions. Here, we provide a new astrochronology of the Hauterivian Stage anchored on (1) recent biostratigraphically well-constrained published radio-isotopic dates, and (2) a previously published astrochronology of the Valanginian Stage. A new duration of the Hauterivian Stage is assessed here at 5.93 ± 0.41 myr. The retained age model, anchored on a latest CA-ID-TIMS U-Pb age from a tuff level in the Hauterivian of the Neuquén Basin (Argentina), dates the base of the Valanginian Stage at - 137.05 ± 1.0 Ma, the base of the Hauterivian Stage at - 131.96 ± 1.0 Ma, and the top of the Hauterivian Stage at - 126.02 ± 1.0 Ma. In addition, the onset of the mid-Valanginian Weissert Event is dated at - 135.22 ± 1.0 Ma and the onset of the Faraoni Event at - 126.73 ± 1.0 Ma. The duration of the mid-Valanginian carbon-isotope excursion, associated to the Weissert Event, is assessed at 5.85 myr, with a rapid phase of increasing δ13C values (0.60 myr), a phase of stable δ13C values (1.48 myr), and smooth decrease in δ13C values (3.77 myr). The calibration provided here highlights that the onset of the activity of the Paraná-Etendeka province and the start of the Weissert Event coincided, suggesting that the Paraná-Etendeka province may have played a major role on the climatic and oceanographic changes during the mid-Valanginian.

  9. Early event-related brain potentials and hemispheric asymmetries reveal mind-wandering while reading and predict comprehension.

    PubMed

    Broadway, James M; Franklin, Michael S; Schooler, Jonathan W

    2015-04-01

    The electroencephalogram (EEG) of mind-wandering (MW) was examined in event-related potentials (ERPs) and pre-stimulus alpha (8-12 Hz), over lateral-posterior sites of left and right brain hemispheres, while individuals read text passages. After controlling for individual differences in general intelligence (g), P1-asymmetry was greater (right-minus- left) and N1 amplitudes were more negative, when individuals were not MW (i.e., they were reading attentively). Approximately 82% of variance in reading comprehension was accounted for by the predictors: g, pre-stimulus alpha, left- and right-hemisphere P1, and left-hemisphere N1 (when individuals were not MW). Together, individual differences in MW-sensitive ERPs uniquely accounted for approximately 38% of the variance in reading comprehension, over and above prediction by g and pre-stimulus alpha. The within-person effect of MW on P1-asymmetry was estimated to account for an additional 4.6% of criterion variance. Implications for EEG/ERP research into attention, language processing, hemispheric asymmetries, and individual differences are discussed.

  10. An event-related potential study of older children with an early history of failure to thrive.

    PubMed

    Dykman, R A; Ackerman, P T; Loizou, P C; Casey, P H

    2000-01-01

    Elementary and junior high school children (n = 13), who were diagnosed with nonorganic failure to thrive (FTT) as infants and toddlers, were compared with a normal control group (n = 14) on visual event-related potentials (ERPs) elicited during a primed lexical decision task. Positive stimuli were real words that were identical to the priming stimuli; negative stimuli were nonpronounceable letter strings. Although the groups did not differ in word-list reading level, the former FTT group had slower reaction (decision) times and did not show ERP evidence of priming in the N400 epoch. Anterior sites yielded better separation of the real words and letter strings than posterior sites. A late anterior component between 500 msec to 650 msec poststimulus onset showed the largest condition effect for both groups. The control group had a larger negative going late anterior component to words than the FTT group. The combined reaction time and ERP findings point to less automatized word recognition in the FTT group. PMID:11280964

  11. Early folding events during light harvesting complex II assembly in vitro monitored by pulsed electron paramagnetic resonance.

    PubMed

    Fehr, Niklas; García-Rubio, Inés; Jeschke, Gunnar; Paulsen, Harald

    2016-06-01

    Efficient energy transfer in the major light harvesting complex II (LHCII) of green plants is facilitated by the precise alignment of pigments due to the protein matrix they are bound to. Much is known about the import of the LHCII apoprotein into the chloroplast via the TOC/TIC system and its targeting to the thylakoid membrane but information is sparse about when and where the pigments are bound and how this is coordinated with protein folding. In vitro, the LHCII apoprotein spontaneously folds and binds its pigments if the detergent-solubilized protein is combined with a mixture of chlorophylls a and b and carotenoids. In the present work, we employed this approach to study apoprotein folding and pigment binding in a time-resolved manner by using pulsed electron paramagnetic resonance (EPR). Intra-molecular distances were measured before folding, after 255 ms and 40 s folding time in the absence of cryoprotectant, and in the fully folded and assembled LHCII. In accordance with earlier results, the most of the folding of the three membrane-spanning alpha helices precedes their apposition into the final tertiary structure. However, their formation follows different kinetics, partially extending into the final phase of LHCII formation during which much of the condensation of the pigment-protein structure occurs, presumably governed by the binding of chlorophyll b. A rough timetable is proposed to sort partial events into the LHCII formation process. PMID:27063475

  12. Transantarctic disjunctions in Schistochilaceae (Marchantiophyta) explained by early extinction events, post-Gondwanan radiations and palaeoclimatic changes.

    PubMed

    Sun, Yu; He, Xiaolan; Glenny, David

    2014-07-01

    The liverworts are the first diverging land plant group with origins in the Ordovician. The family Schistochilaceae exhibits diverse morphology and widely disjunct geographic ranges within the Southern Hemisphere. The family has been presented as a classic example of Gondwanan biogeographic distribution, with extant species ranges resulting from vicariance events. In this study, we present results that elucidate the origin and diversification of Schistochilaceae. We conducted a comprehensive time-calibrated, molecular-based phylogenetic analysis and different approaches for ancestral range inference of the family. Schistochilaceae is inferred to have originated in the Late Cretaceous, in an ancestral area including southern South America, West Antarctica and New Zealand. Despite a family origin at c. 100Ma, most of the diversification of Schistochilaceae occurred in New Zealand after the 80Ma opening of the Tasman Sea that isolated New Zealand from the rest of Gondwana. Most dispersals were transoceanic. The northward migration of the Schistochilaceae is probably linked with the spread of temperate vascular plant forest ecosystems that have Late Cretaceous southern origins and have maintained suitable environments for the family throughout the Cenozoic. The distribution and biogeographic history of the family is very similar to that of Nothofagaceae. PMID:24680916

  13. Mutations altering the gammaretrovirus endoproteolytic motif affect glycosylation of the envelope glycoprotein and early events of the virus life cycle

    SciTech Connect

    Argaw, Takele; Wilson, Carolyn A.

    2015-01-15

    Previously, we found that mutation of glutamine to proline in the endoproteolytic cleavage signal of the PERV-C envelope (RQKK to RPKK) resulted in non-infectious vectors. Here, we show that RPKK results in a non-infectious vector when placed in not only a PERV envelope, but also the envelope of a related gammaretrovirus, FeLV-B. The amino acid substitutions do not prevent envelope precursor cleavage, viral core and genome assembly, or receptor binding. Rather, the mutations result in the formation of hyperglycosylated glycoprotein and a reduction in the reverse transcribed minus strand synthesis and undetectable 2-LTR circular DNA in cells exposed to vectors with these mutated envelopes. Our findings suggest novel functions associated with the cleavage signal sequence that may affect trafficking through the glycosylation machinery of the cell. Further, the glycosylation status of the envelope appears to impact post-binding events of the viral life cycle, either membrane fusion, internalization, or reverse transcription. - Highlights: • Env cleavage signal impacts infectivity of gammaretroviruses. • Non-infectious mutants have hyper-glycosylated envelope that bind target cells. • Non-infectious mutants have defects in the formation of the double-stranded DNA. • Env cleavage motif has functions beyond cleavage of the env precursor.

  14. Initiation and early evolution of the Franklin magmatic event preserved in the 720 Ma Natkusiak Formation, Victoria Island, Canadian Arctic

    NASA Astrophysics Data System (ADS)

    Williamson, Nicole M. B.; Ootes, Luke; Rainbird, Robert H.; Bédard, Jean H.; Cousens, Brian

    2016-03-01

    Our understanding of the onset and evolution of flood basalt volcanism is rooted in the study of the character and internal architecture of its eruptive products. Neoproterozoic continental flood basalts of the ca. 720 Ma Franklin magmatic event are preserved as the Natkusiak Formation and are exposed within the Minto Inlier on Victoria Island, Northwest Territories, Canada. The 200 m volcanic succession evaluated in this study has features similar to those of other continental flood basalt provinces and consists of four volcanic units: a basal unit of laterally discontinuous flows with evidence for lava-sediment interactions, a mafic volcaniclastic deposit emplaced as a mass flow, a quartz-rich volcanic sandstone that records the re-establishment of small river channels, and a unit of thick, high-titanium tholeiitic sheet flows that mark the onset of the main phase of flood volcanism. The basal units show marked lateral thickness variations that imply the existence of paleotopography during their eruption and/or deposition. In addition, two newly discovered volcanic vent complexes within the Natkusiak succession preserve the products of explosive, vent-forming basaltic pyroclastic fall eruptions. Differences in major element geochemistry between the basal and upper basaltic flow units, in conjunction with the lithological characteristics of each volcanic unit, are used to correlate the units on a scale of over 100 km from the south of the Minto Inlier to the north.

  15. Transantarctic disjunctions in Schistochilaceae (Marchantiophyta) explained by early extinction events, post-Gondwanan radiations and palaeoclimatic changes.

    PubMed

    Sun, Yu; He, Xiaolan; Glenny, David

    2014-07-01

    The liverworts are the first diverging land plant group with origins in the Ordovician. The family Schistochilaceae exhibits diverse morphology and widely disjunct geographic ranges within the Southern Hemisphere. The family has been presented as a classic example of Gondwanan biogeographic distribution, with extant species ranges resulting from vicariance events. In this study, we present results that elucidate the origin and diversification of Schistochilaceae. We conducted a comprehensive time-calibrated, molecular-based phylogenetic analysis and different approaches for ancestral range inference of the family. Schistochilaceae is inferred to have originated in the Late Cretaceous, in an ancestral area including southern South America, West Antarctica and New Zealand. Despite a family origin at c. 100Ma, most of the diversification of Schistochilaceae occurred in New Zealand after the 80Ma opening of the Tasman Sea that isolated New Zealand from the rest of Gondwana. Most dispersals were transoceanic. The northward migration of the Schistochilaceae is probably linked with the spread of temperate vascular plant forest ecosystems that have Late Cretaceous southern origins and have maintained suitable environments for the family throughout the Cenozoic. The distribution and biogeographic history of the family is very similar to that of Nothofagaceae.

  16. Event-related potential study of intentional and incidental retrieval of item and source memory during early childhood.

    PubMed

    Robey, Alison; Riggins, Tracy

    2016-07-01

    The event related potential (ERP) technique is a useful methodology for studying neural changes underlying memory development during childhood. However, systematic comparisons of differences in memory tasks and retrieval demands are lacking. To address this gap, the present study explored the effects of memory task (i.e., item versus source) and retrieval paradigm (i.e., intentional versus incidental) on 4- to 5-year-old children's memory performance and associated electrophysiological responses. Children were familiarized with items in a play-like setting and then asked to retrieve item or source memory details while their brain activity was recorded (intentional retrieval) or while they passively viewed images of the items with no explicit task (incidental retrieval). Memory assessments for the incidental groups followed ERP recording. Analyses of the ERP data suggested that the brain's response during intentional retrieval of source information differed from the other three conditions. These results are discussed within a two-component framework of memory development (e.g., Shing et al., 2010), and implications for future methodological decisions are presented. © 2016 Wiley Periodicals, Inc. Dev Psychobiol 58: 556-567, 2016.

  17. Functional Centromeres Determine the Activation Time of Pericentric Origins of DNA Replication in Saccharomyces cerevisiae

    PubMed Central

    Pohl, Thomas J.; Brewer, Bonita J.; Raghuraman, M. K.

    2012-01-01

    The centromeric regions of all Saccharomyces cerevisiae chromosomes are found in early replicating domains, a property conserved among centromeres in fungi and some higher eukaryotes. Surprisingly, little is known about the biological significance or the mechanism of early centromere replication; however, the extensive conservation suggests that it is important for chromosome maintenance. Do centromeres ensure their early replication by promoting early activation of nearby origins, or have they migrated over evolutionary time to reside in early replicating regions? In Candida albicans, a neocentromere contains an early firing origin, supporting the first hypothesis but not addressing whether the new origin is intrinsically early firing or whether the centromere influences replication time. Because the activation time of individual origins is not an intrinsic property of S. cerevisiae origins, but is influenced by surrounding sequences, we sought to test the hypothesis that centromeres influence replication time by moving a centromere to a late replication domain. We used a modified Meselson-Stahl density transfer assay to measure the kinetics of replication for regions of chromosome XIV in which either the functional centromere or a point-mutated version had been moved near origins that reside in a late replication region. We show that a functional centromere acts in cis over a distance as great as 19 kb to advance the initiation time of origins. Our results constitute a direct link between establishment of the kinetochore and the replication initiation machinery, and suggest that the proposed higher-order structure of the pericentric chromatin influences replication initiation. PMID:22589733

  18. Functional centromeres determine the activation time of pericentric origins of DNA replication in Saccharomyces cerevisiae.

    PubMed

    Pohl, Thomas J; Brewer, Bonita J; Raghuraman, M K

    2012-01-01

    The centromeric regions of all Saccharomyces cerevisiae chromosomes are found in early replicating domains, a property conserved among centromeres in fungi and some higher eukaryotes. Surprisingly, little is known about the biological significance or the mechanism of early centromere replication; however, the extensive conservation suggests that it is important for chromosome maintenance. Do centromeres ensure their early replication by promoting early activation of nearby origins, or have they migrated over evolutionary time to reside in early replicating regions? In Candida albicans, a neocentromere contains an early firing origin, supporting the first hypothesis but not addressing whether the new origin is intrinsically early firing or whether the centromere influences replication time. Because the activation time of individual origins is not an intrinsic property of S. cerevisiae origins, but is influenced by surrounding sequences, we sought to test the hypothesis that centromeres influence replication time by moving a centromere to a late replication domain. We used a modified Meselson-Stahl density transfer assay to measure the kinetics of replication for regions of chromosome XIV in which either the functional centromere or a point-mutated version had been moved near origins that reside in a late replication region. We show that a functional centromere acts in cis over a distance as great as 19 kb to advance the initiation time of origins. Our results constitute a direct link between establishment of the kinetochore and the replication initiation machinery, and suggest that the proposed higher-order structure of the pericentric chromatin influences replication initiation.

  19. W Phase Inversion and Tsunami Inundation Modeling for Tsunami Early Warning: Case Study for the 2011 Tohoku Event

    NASA Astrophysics Data System (ADS)

    Gusman, Aditya Riadi; Tanioka, Yuichiro

    2014-07-01

    Centroid moment tensor solutions for the 2011 Tohoku earthquake are determined by W phase inversions using 5 and 10 min data recorded by the Full Range Seismograph Network of Japan (F-net). By a scaling relation of moment magnitude to rupture area and an assumption of rigidity of 4 × 1010 N m-2, simple rectangular earthquake fault models are estimated from the solutions. Tsunami inundations in the Sendai Plain, Minamisanriku, Rikuzentakata, and Taro are simulated using the estimated fault models. Then the simulated tsunami inundation area and heights are compared with the observations. Even the simulated tsunami heights and inundations from the W phase solution that used only 5 min data are considerably similar to the observations. The results are improved when using 10 min of W phase data. These show that the W phase solutions are reliable to be used for tsunami inundation modeling. Furthermore, the technique that combines W phase inversion and tsunami inundation modeling can produce results that have sufficient accuracy for tsunami early warning purposes.

  20. Putative alternative polyadenylation (APA) events in the early interaction of Salmonella enterica Typhimurium and human host cells.

    PubMed

    Afonso-Grunz, Fabian

    2015-12-01

    The immune response of epithelial cells upon infection is mediated by changing activity levels of a variety of proteins along with changes in mRNA, and also ncRNA abundance. Alternative polyadenylation (APA) represents a mechanism that diversifies gene expression similar to alternative splicing. T-cell activation, neuronal activity, development and several human diseases including viral infections involve APA, but at present it remains unclear if this mechanism is also implicated in the response to bacterial infections. Our recently published study of interacting Salmonella enterica Typhimurium and human host cells includes genome-wide expression profiles of human epithelial cells prior and subsequent to infection with the invasive pathogen. The generated dataset (GEO accession number: GSE61730) covers several points of time post infection, and one of these interaction stages was additionally profiled with MACE-based dual 3'Seq, which allows for identification of polyadenylation (PA) sites. The present study features the polyadenylation landscape in early interacting cells based on this data, and provides a comparison of the identified PA sites with those of a corresponding 3P-Seq dataset of non-interacting cells. Differential PA site usage of FTL, PRDX1 and VAPA results in transcription of mRNA isoforms with distinct sets of miRNA and protein binding sites that influence processing, localization, stability, and translation of the respective mRNA. APA of these candidate genes consequently harbors the potential to modulate the host cell response to bacterial infection.

  1. CCR4 Controls the Suppressive Effects of Regulatory T Cells on Early and Late Events during Severe Sepsis

    PubMed Central

    Molinaro, Raphael; Pecli, Cyntia; Guilherme, Rafael F.; Alves-Filho, José Carlos; Cunha, Fernando Q.; Canetti, Claudio; Kunkel, Steven L.; Bozza, Marcelo T.; Benjamim, Claudia F.

    2015-01-01

    Sepsis is a deadly disease characterized by an overwhelming release of inflammatory mediators and the activation of different types of cells. This altered state of cell activation, termed leukocyte reprogramming, contributes to patient outcome. However, the understanding of the process underlying sepsis and the role of regulatory T cells (Tregs) in sepsis remains to be elucidated. In this study, we investigated the role of CCR4, the CCL17/CCL22 chemokine receptor, in the innate and acquired immune responses during severe sepsis and the role of Tregs in effecting the outcome. In contrast with wild-type (WT) mice subjected to cecal ligation and puncture (CLP) sepsis, CCR4-deficient (CCR4-/-) septic mice presented an increased survival rate, significant neutrophil migration toward the infection site, a low bacterial count in the peritoneum, and reduced lung inflammation and serum cytokine levels. Thus, a better early host response may favor an adequate long-term response. Consequently, the CCR4-/- septic mice were not susceptible to secondary fungal infection, in contrast with the WT septic mice. Furthermore, Tregs cells from the CCR4-/- septic mice showed reduced suppressive effects on neutrophil migration (both in vivo and in vitro), lymphocyte proliferation and ROS production from activated neutrophils, in contrast with what was observed for Tregs from the WT septic mice. These data show that CCR4 is involved in immunosuppression after severe sepsis and suggest that CCR4+ Tregs negatively modulate the short and long-term immune responses. PMID:26197455

  2. Event-related potential evidence for the early activation of literal meaning during comprehension of conventional lexical metaphors.

    PubMed

    Lu, Aitao; Zhang, John X

    2012-07-01

    Among different types of metaphors, lexical metaphors are special in that they have been highly lexicalized and often suggested to be processed like non-metaphorical words. The present study examined two types of Chinese metaphorical words which are conceptualized through body parts. One has both a metaphorical meaning and a literal meaning actively in use, with the former dominant over the latter, referred to as the Met+Lit words. The other has only metaphorical meaning, referred to as Met-only words. In two experiments, lexical metaphor words were presented following a body-related picture and participants judged whether the picture and word were semantically related (Experiment 1) or made lexical decision on the word ignoring the picture (Experiment 2). The N400 ERP responses showed a clear semantic priming effect for the Met+Lit words compared with the non-ambiguous neutral words, with latencies comparable to that in Met-only words in both experiments. The results were interpreted to indicate that the literal meaning as a subordinate meaning was activated during the early comprehension of conventional lexical metaphors, supporting the notion of dual access to metaphorical meaning and literal meaning in metaphor processing.

  3. Biomarkers Provide Clues to Early Events in the Pathogenesis of Breast Implant-Associated Anaplastic Large Cell Lymphoma.

    PubMed

    Kadin, Marshall E; Deva, Anand; Xu, Haiying; Morgan, John; Khare, Pranay; MacLeod, Roderick A F; Van Natta, Bruce W; Adams, William P; Brody, Garry S; Epstein, Alan L

    2016-07-01

    Almost 200 women worldwide have been diagnosed with breast implant-associated anaplastic large cell lymphoma (BIA-ALCL). The unique location and specific lymphoma type strongly suggest an etio-pathologic link between breast implants and BIA-ALCL. It is postulated that chronic inflammation via bacterial infection may be an etiological factor. BIA-ALCL resembles primary cutaneous ALCL (pcALCL) in morphology, activated T-cell phenotype, and indolent clinical course. Gene expression array analysis, flow cytometry, and immunohistochemistry were used to study pcALCL and BIA-ALCL cell lines. Clinical samples were also studied to characterize transcription factor and cytokine profiles of tumor cells and surrounding lymphocytes. BIA-ALCL and pcALCL were found to have common expression of transcription factors SOCS3, JunB, SATB1, and a cytokine profile suggestive of a Th1 phenotype. Similar patterns were observed in a CD30+ cutaneous lymphoproliferative disorder (LPD). The patterns of cytokine and transcription factor expression suggest that BIA-ALCL is likely to arise from chronic bacterial antigen stimulation of T-cells. Further analysis of cytokine and transcription factor profiles may allow early detection and treatment of BIA-ALCL leading to better prognosis and survival. LEVEL OF EVIDENCE 5: Risk. PMID:26979456

  4. DNA replication and transcription in mammalian mitochondria.

    PubMed

    Falkenberg, Maria; Larsson, Nils-Göran; Gustafsson, Claes M

    2007-01-01

    The mitochondrion was originally a free-living prokaryotic organism, which explains the presence of a compact mammalian mitochondrial DNA (mtDNA) in contemporary mammalian cells. The genome encodes for key subunits of the electron transport chain and RNA components needed for mitochondrial translation. Nuclear genes encode the enzyme systems responsible for mtDNA replication and transcription. Several of the key components of these systems are related to proteins replicating and transcribing DNA in bacteriophages. This observation has led to the proposition that some genes required for DNA replication and transcription were acquired together from a phage early in the evolution of the eukaryotic cell, already at the time of the mitochondrial endosymbiosis. Recent years have seen a rapid development in our molecular understanding of these machineries, but many aspects still remain unknown.

  5. Replicating Cardiovascular Condition-Birth Month Associations.

    PubMed

    Li, Li; Boland, Mary Regina; Miotto, Riccardo; Tatonetti, Nicholas P; Dudley, Joel T

    2016-01-01

    Independent replication is vital for study findings drawn from Electronic Health Records (EHR). This replication study evaluates the relationship between seasonal effects at birth and lifetime cardiovascular condition risk. We performed a Season-wide Association Study on 1,169,599 patients from Mount Sinai Hospital (MSH) to compute phenome-wide associations between birth month and CVD. We then evaluated if seasonal patterns found at MSH matched those reported at Columbia University Medical Center. Coronary arteriosclerosis, essential hypertension, angina, and pre-infarction syndrome passed phenome-wide significance and their seasonal patterns matched those previously reported. Atrial fibrillation, cardiomyopathy, and chronic myocardial ischemia had consistent patterns but were not phenome-wide significant. We confirm that CVD risk peaks for those born in the late winter/early spring among the evaluated patient populations. The replication findings bolster evidence for a seasonal birth month effect in CVD. Further study is required to identify the environmental and developmental mechanisms. PMID:27624541

  6. Replicating Cardiovascular Condition-Birth Month Associations

    PubMed Central

    Li, Li; Boland, Mary Regina; Miotto, Riccardo; Tatonetti, Nicholas P.; Dudley, Joel T.

    2016-01-01

    Independent replication is vital for study findings drawn from Electronic Health Records (EHR). This replication study evaluates the relationship between seasonal effects at birth and lifetime cardiovascular condition risk. We performed a Season-wide Association Study on 1,169,599 patients from Mount Sinai Hospital (MSH) to compute phenome-wide associations between birth month and CVD. We then evaluated if seasonal patterns found at MSH matched those reported at Columbia University Medical Center. Coronary arteriosclerosis, essential hypertension, angina, and pre-infarction syndrome passed phenome-wide significance and their seasonal patterns matched those previously reported. Atrial fibrillation, cardiomyopathy, and chronic myocardial ischemia had consistent patterns but were not phenome-wide significant. We confirm that CVD risk peaks for those born in the late winter/early spring among the evaluated patient populations. The replication findings bolster evidence for a seasonal birth month effect in CVD. Further study is required to identify the environmental and developmental mechanisms. PMID:27624541

  7. Replicating Cardiovascular Condition-Birth Month Associations.

    PubMed

    Li, Li; Boland, Mary Regina; Miotto, Riccardo; Tatonetti, Nicholas P; Dudley, Joel T

    2016-01-01

    Independent replication is vital for study findings drawn from Electronic Health Records (EHR). This replication study evaluates the relationship between seasonal effects at birth and lifetime cardiovascular condition risk. We performed a Season-wide Association Study on 1,169,599 patients from Mount Sinai Hospital (MSH) to compute phenome-wide associations between birth month and CVD. We then evaluated if seasonal patterns found at MSH matched those reported at Columbia University Medical Center. Coronary arteriosclerosis, essential hypertension, angina, and pre-infarction syndrome passed phenome-wide significance and their seasonal patterns matched those previously reported. Atrial fibrillation, cardiomyopathy, and chronic myocardial ischemia had consistent patterns but were not phenome-wide significant. We confirm that CVD risk peaks for those born in the late winter/early spring among the evaluated patient populations. The replication findings bolster evidence for a seasonal birth month effect in CVD. Further study is required to identify the environmental and developmental mechanisms.

  8. Late Carboniferous-early Permian events in the Trans-European Suture Zone: Tectonic and acid magmatic evidence from Poland

    NASA Astrophysics Data System (ADS)

    Żelaźniewicz, A.; Oberc-Dziedzic, T.; Fanning, C. M.; Protas, A.; Muszyński, A.

    2016-04-01

    The Trans-European Suture Zone (TESZ) links the East and West European Platforms. It is concealed under Meso-Cenozoic cover. Available seismic data show that the lower crustal layer in the TESZ is an attenuated, 200 km wide, SW margin of Baltica. The attenuation occurred when Rodinia broke-up, which gave rise to evolution of the thinned, thus relatively unstable margin of Baltica. It accommodated accretions during Phanerozoic events. We focus on acid magmatism, specifically granitoid, observed close to the SW border of the TESZ in Poland. This border is defined by the Dolsk Fault Zone (DFZ) and the Kraków-Lubliniec Fault Zone (KLFZ) on which dextral wrenching developed as a result of the Variscan collision between Laurussia and Gondwana. The granitoids at the DFZ and KLFZ were dated at 300 Ma. In the Variscan foreland that overlaps the TESZ, orogenic thickening continued to 307-306 Ma, possibly contributed to melting of the thickened upper continental crust (εNd300 = - 6.0 to - 4.5) and triggered the tectonically controlled magmatism. The wrenching on the TESZ border faults caused tensional openings in the basement, which promoted magmatic centers with extrusions of rhyolites and extensive ignimbrites. The Chrzypsko-Paproć and Małopolska magmatic centers were developed at the DFZ and KLFZ, respectively. The magmatic edifices commenced at 302 Ma with relatively poorly evolved granites, which carried both suprasubduction and anorogenic signatures, then followed by more evolved volcanic rocks (up to 293 Ma). Their geochemistry and inherited zircons suggest that the felsic magmas were mainly derived from upper crustal rocks, with some mantle additions, which included Sveconorwegian and older Baltican components. The complex TESZ, with Baltica basement in the lower crust, was susceptible to transient effects of mantle upwelling that occurred by the end of the Variscan orogeny and resulted in an episode of the "flare-up" magmatism in the North German-Polish Basin.

  9. Late Carboniferous-early Permian events in the Trans-European Suture Zone: Tectonic and acid magmatic evidence from Poland

    NASA Astrophysics Data System (ADS)

    Żelaźniewicz, A.; Oberc-Dziedzic, T.; Fanning, C. M.; Protas, A.; Muszyński, A.

    2016-04-01

    The Trans-European Suture Zone (TESZ) links the East and West European Platforms. It is concealed under Meso-Cenozoic cover. Available seismic data show that the lower crustal layer in the TESZ is an attenuated, ~ 200 km wide, SW margin of Baltica. The attenuation occurred when Rodinia broke-up, which gave rise to evolution of the thinned, thus relatively unstable margin of Baltica. It accommodated accretions during Phanerozoic events. We focus on acid magmatism, specifically granitoid, observed close to the SW border of the TESZ in Poland. This border is defined by the Dolsk Fault Zone (DFZ) and the Kraków-Lubliniec Fault Zone (KLFZ) on which dextral wrenching developed as a result of the Variscan collision between Laurussia and Gondwana. The granitoids at the DFZ and KLFZ were dated at ~ 300 Ma. In the Variscan foreland that overlaps the TESZ, orogenic thickening continued to ~ 307-306 Ma, possibly contributed to melting of the thickened upper continental crust (εNd300 = - 6.0 to - 4.5) and triggered the tectonically controlled magmatism. The wrenching on the TESZ border faults caused tensional openings in the basement, which promoted magmatic centers with extrusions of rhyolites and extensive ignimbrites. The Chrzypsko-Paproć and Małopolska magmatic centers were developed at the DFZ and KLFZ, respectively. The magmatic edifices commenced at ~ 302 Ma with relatively poorly evolved granites, which carried both suprasubduction and anorogenic signatures, then followed by more evolved volcanic rocks (up to 293 Ma). Their geochemistry and inherited zircons suggest that the felsic magmas were mainly derived from upper crustal rocks, with some mantle additions, which included Sveconorwegian and older Baltican components. The complex TESZ, with Baltica basement in the lower crust, was susceptible to transient effects of mantle upwelling that occurred by the end of the Variscan orogeny and resulted in an episode of the "flare-up" magmatism in the North German

  10. Exogenous γ-aminobutyric Acid (GABA) Application Improved Early Growth, Net Photosynthesis, and Associated Physio-Biochemical Events in Maize

    PubMed Central

    Li, Wu; Liu, Jianhua; Ashraf, Umair; Li, Gaoke; Li, Yuliang; Lu, Wenjia; Gao, Lei; Han, Fuguang; Hu, Jianguang

    2016-01-01

    γ-aminobutyric acid (GABA) is an endogenous signaling molecule and involved in growth regulations and plant development, however, a little information is available on the consequences of exogenous GABA application on growth, development, and associated physio-biochemical processes in maize. The present study examined the GABA-induced regulations in early growth, net photosynthetic rate, gas exchange, osmoregulation, and enzymatic activities in three maize cultivars, i.e., Yuecainuo 6, Zhengtian 68, and Yuecainuo 2. Two levels of GABA, i.e., 0 mg L-1 and 50 mg L-1, in solution form, with total application volume of 100 ml per pot containing 15 maize seedlings were exogenously applied. Results revealed that exogenous GABA application improved seedling growth in terms of seedling length and biomass accumulation in all maize cultivars at both 3 and 7 days after treatment (DAT). It also promoted net photosynthesis and variably affected gas exchange attributes, i.e., stomatal conductance (Gs), intercellular CO2 concentration (Ci), and transpiration rate (Tr), as well as leaves SPAD value. Furthermore, lipid peroxidation [in terms of malondialdehyde (MDA)] under GABA treated maize seedlings were also remained variable; however, osmolyte accumulation (protein and proline) and activities of anti-oxidants enzymes, i.e., super-oxide dismutase and peroxidase were also affected differently at both 3 and 7 DAT in all maize cultivars. Furthermore, enzymes involved in nitrogen metabolism, e.g., nitrate reductase and glutamine synthetase were improved. These results suggest the involvement of GABA in various physio-metablical mechanisms which might lead to improvement in morphological growth of maize. In future, research is still needed at molecular and genetic levels to unravel the involvement of GABA-mediated regulations in growth and its associated physio-biochemical mechanisms. PMID:27446149

  11. Carcinogen exposure differentially modulates RAR-beta promoter hypermethylation, an early and frequent event in mouse lung carcinogenesis.

    PubMed

    Vuillemenot, Brian R; Pulling, Leah C; Palmisano, William A; Hutt, Julie A; Belinsky, Steven A

    2004-04-01

    The retinoic acid receptor beta (RAR-beta) gene encodes one of the primary receptors for retinoic acid, an important signaling molecule in lung growth, differentiation and carcinogenesis. RAR-beta has been shown to be down-regulated by methylation in human lung cancer. We have used previously lung tumors induced in mice to evaluate the timing and effect of specific carcinogen exposures on targeting genes altered in human lung cancer. These studies were extended to characterize the role of methylation of the RAR-beta gene in murine lung cancers. After treatment with the demethylating agent 5-aza-2'-deoxycytidine (DAC), RAR-beta was re-expressed in silenced cell lines or expressed at a higher rate than without DAC, supporting methylation as the inactivating mechanism. Bisulfite sequencing detected dense methylation in the area of the CpG island that contained the 5' untranslated region and the first translated exon in non-expressing cell lines, compared with minimal and heterogeneous methylation in normal mouse lung. Methylation-specific PCR revealed that this gene is targeted differentially by carcinogen exposures with the detection of methylated alleles in virtually all primary tumors associated with cigarette smoke or 4-methylnitrosamino-1-(3-pyridyl)-butanone (NNK) in contrast to half of tumors induced by methylene chloride or vinyl carbamate. RAR-beta methylation was also detected in 54% of preneoplastic hyperplasias induced by treatment with NNK. Bisulfite sequencing of both premalignant and malignant lesions detected dense methylation in the same area observed in cell lines, substantiating that this gene is functionally inactivated at the earliest histologic stage of adenocarcinoma development. These studies demonstrate that aberrant methylation of RAR-beta is an early and common alteration in murine lung tumors induced by several environmentally relevant exposures. PMID:14656941

  12. Root Secreted Metabolites and Proteins Are Involved in the Early Events of Plant-Plant Recognition Prior to Competition

    PubMed Central

    Badri, Dayakar V.; De-la-Peña, Clelia; Lei, Zhentian; Manter, Daniel K.; Chaparro, Jacqueline M.; Guimarães, Rejane L.; Sumner, Lloyd W.; Vivanco, Jorge M.

    2012-01-01

    The mechanism whereby organisms interact and differentiate between others has been at the forefront of scientific inquiry, particularly in humans and certain animals. It is widely accepted that plants also interact, but the degree of this interaction has been constricted to competition for space, nutrients, water and light. Here, we analyzed the root secreted metabolites and proteins involved in early plant neighbor recognition by using Arabidopsis thaliana Col-0 ecotype (Col) as our focal plant co-cultured in vitro with different neighbors [A. thaliana Ler ecotype (Ler) or Capsella rubella (Cap)]. Principal component and cluster analyses revealed that both root secreted secondary metabolites and proteins clustered separately between the plants grown individually (Col-0, Ler and Cap grown alone) and the plants co-cultured with two homozygous individuals (Col-Col, Ler-Ler and Cap-Cap) or with different individuals (Col-Ler and Col-Cap). In particularly, we observed that a greater number of defense- and stress- related proteins were secreted when our control plant, Col, was grown alone as compared to when it was co-cultured with another homozygous individual (Col-Col) or with a different individual (Col-Ler and Col-Cap). However, the total amount of defense proteins in the exudates of the co-cultures was higher than in the plant alone. The opposite pattern of expression was identified for stress-related proteins. These data suggest that plants can sense and respond to the presence of different plant neighbors and that the level of relatedness is perceived upon initial interaction. Furthermore, the role of secondary metabolites and defense- and stress-related proteins widely involved in plant-microbe associations and abiotic responses warrants reassessment for plant-plant interactions. PMID:23056382

  13. Characterization of early events involved in human dendritic cell maturation induced by sensitizers: Cross talk between MAPK signalling pathways

    SciTech Connect

    Trompezinski, Sandra; Migdal, Camille; Tailhardat, Magalie; Le Varlet, Beatrice; Courtellemont, Pascal; Haftek, Marek; Serres, Mireille

    2008-08-01

    Dendritic cells (DCs), efficient-antigen presenting cells play an important role in initiating and regulating immune responses. DC maturation following exposure to nickel or DNCB induced an up-regulation of phenotypic markers and inflammatory cytokine secretion. Early intracellular mechanisms involved in DC maturation required to be precise. To address this purpose, DCs derived from human monocytes were treated with sensitizers (nickel, DNCB or thimerosal) in comparison with an irritant (SDS). Our data confirming the up-regulation of CD86, CD54 and cytokine secretion (IL-8 and TNF{alpha}) induced by sensitizers but not by SDS, signalling transduction involved in DC maturation was investigated using these chemicals. Kinase activity measurement was assessed using two new sensitive procedures (Face{sup TM} and CBA) requiring few cells. SDS did not induce changes in signalling pathways whereas NiSO{sub 4}, DNCB and thimerosal markedly activated p38 MAPK and JNK, in contrast Erk1/2 phosphorylation was completely inhibited by DNCB or thimerosal and only activated by nickel. A pre-treatment with p38 MAPK inhibitor (SB203580) suppressed Erk1/2 inhibition induced by DNCB or thimerosal demonstrating a direct interaction between p38 MAPK and Erk1/2. A pre-treatment with an antioxidant, N-acetyl-L-cysteine (NAC) markedly reduced Erk1/2 inhibition and p38 MAPK phosphorylation induced by DNCB and thimerosal, suggesting a direct activation of p38 MAPK via an oxidative stress and a regulation of MAPK signalling pathways depending on chemicals. Because of a high sensitivity of kinase activity measurements, these procedures will be suitable for weak or moderate sensitizer screening.

  14. Exogenous γ-aminobutyric Acid (GABA) Application Improved Early Growth, Net Photosynthesis, and Associated Physio-Biochemical Events in Maize.

    PubMed

    Li, Wu; Liu, Jianhua; Ashraf, Umair; Li, Gaoke; Li, Yuliang; Lu, Wenjia; Gao, Lei; Han, Fuguang; Hu, Jianguang

    2016-01-01

    γ-aminobutyric acid (GABA) is an endogenous signaling molecule and involved in growth regulations and plant development, however, a little information is available on the consequences of exogenous GABA application on growth, development, and associated physio-biochemical processes in maize. The present study examined the GABA-induced regulations in early growth, net photosynthetic rate, gas exchange, osmoregulation, and enzymatic activities in three maize cultivars, i.e., Yuecainuo 6, Zhengtian 68, and Yuecainuo 2. Two levels of GABA, i.e., 0 mg L(-1) and 50 mg L(-1), in solution form, with total application volume of 100 ml per pot containing 15 maize seedlings were exogenously applied. Results revealed that exogenous GABA application improved seedling growth in terms of seedling length and biomass accumulation in all maize cultivars at both 3 and 7 days after treatment (DAT). It also promoted net photosynthesis and variably affected gas exchange attributes, i.e., stomatal conductance (Gs), intercellular CO2 concentration (Ci), and transpiration rate (Tr), as well as leaves SPAD value. Furthermore, lipid peroxidation [in terms of malondialdehyde (MDA)] under GABA treated maize seedlings were also remained variable; however, osmolyte accumulation (protein and proline) and activities of anti-oxidants enzymes, i.e., super-oxide dismutase and peroxidase were also affected differently at both 3 and 7 DAT in all maize cultivars. Furthermore, enzymes involved in nitrogen metabolism, e.g., nitrate reductase and glutamine synthetase were improved. These results suggest the involvement of GABA in various physio-metablical mechanisms which might lead to improvement in morphological growth of maize. In future, research is still needed at molecular and genetic levels to unravel the involvement of GABA-mediated regulations in growth and its associated physio-biochemical mechanisms.

  15. Early events in the pathogenesis of chronic obstructive pulmonary disease. Smoking-induced reprogramming of airway epithelial basal progenitor cells.

    PubMed

    Shaykhiev, Renat; Crystal, Ronald G

    2014-12-01

    The airway epithelium is the primary site of the earliest pathologic changes induced by smoking, contributing to the development of chronic obstructive pulmonary disease (COPD). The normal human airway epithelium is composed of several major cell types, including differentiated ciliated and secretory cells, intermediate undifferentiated cells, and basal cells (BC). BC contain the stem/progenitor cell population responsible for maintenance of the normally differentiated airway epithelium. Although inflammatory and immune processes play a significant role in the pathogenesis of COPD, the earliest lesions include hyperplasia of the BC population, suggesting that the disease may start with this cell type. Apart from BC hyperplasia, smoking induces a number of COPD-relevant airway epithelial remodeling phenotypes that are likely initiated in the BC population, including mucous cell hyperplasia, squamous cell metaplasia, epithelial-mesenchymal transition, altered ciliated and nonmucous secretory cell differentiation, and suppression of junctional barrier integrity. Significant progress has been recently made in understanding the biology of human airway BC, including gene expression features, stem/progenitor, and other functions, including interaction with other airway cell types. Accumulating evidence suggests that human airway BC function as both sensors and cellular sources of various cytokines and growth factors relevant to smoking-associated airway injury, as well as the origin of various molecular and histological phenotypes relevant to the pathogenesis of COPD. In the context of these considerations, we suggest that early BC-specific smoking-induced molecular changes are critical to the pathogenesis of COPD, and these represent a candidate target for novel therapeutic approaches to prevent COPD progression in susceptible individuals.

  16. Exogenous γ-aminobutyric Acid (GABA) Application Improved Early Growth, Net Photosynthesis, and Associated Physio-Biochemical Events in Maize.

    PubMed

    Li, Wu; Liu, Jianhua; Ashraf, Umair; Li, Gaoke; Li, Yuliang; Lu, Wenjia; Gao, Lei; Han, Fuguang; Hu, Jianguang

    2016-01-01

    γ-aminobutyric acid (GABA) is an endogenous signaling molecule and involved in growth regulations and plant development, however, a little information is available on the consequences of exogenous GABA application on growth, development, and associated physio-biochemical processes in maize. The present study examined the GABA-induced regulations in early growth, net photosynthetic rate, gas exchange, osmoregulation, and enzymatic activities in three maize cultivars, i.e., Yuecainuo 6, Zhengtian 68, and Yuecainuo 2. Two levels of GABA, i.e., 0 mg L(-1) and 50 mg L(-1), in solution form, with total application volume of 100 ml per pot containing 15 maize seedlings were exogenously applied. Results revealed that exogenous GABA application improved seedling growth in terms of seedling length and biomass accumulation in all maize cultivars at both 3 and 7 days after treatment (DAT). It also promoted net photosynthesis and variably affected gas exchange attributes, i.e., stomatal conductance (Gs), intercellular CO2 concentration (Ci), and transpiration rate (Tr), as well as leaves SPAD value. Furthermore, lipid peroxidation [in terms of malondialdehyde (MDA)] under GABA treated maize seedlings were also remained variable; however, osmolyte accumulation (protein and proline) and activities of anti-oxidants enzymes, i.e., super-oxide dismutase and peroxidase were also affected differently at both 3 and 7 DAT in all maize cultivars. Furthermore, enzymes involved in nitrogen metabolism, e.g., nitrate reductase and glutamine synthetase were improved. These results suggest the involvement of GABA in various physio-metablical mechanisms which might lead to improvement in morphological growth of maize. In future, research is still needed at molecular and genetic levels to unravel the involvement of GABA-mediated regulations in growth and its associated physio-biochemical mechanisms. PMID:27446149

  17. Multifaceted Regulation of Translational Readthrough by RNA Replication Elements in a Tombusvirus

    PubMed Central

    Cimino, Peter A.; Nicholson, Beth L.; Wu, Baodong; Xu, Wei; White, K. Andrew

    2011-01-01

    Translational readthrough of stop codons by ribosomes is a recoding event used by a variety of viruses, including plus-strand RNA tombusviruses. Translation of the viral RNA-dependent RNA polymerase (RdRp) in tombusviruses is mediated using this strategy and we have investigated this process using a variety of in vitro and in vivo approaches. Our results indicate that readthrough generating the RdRp requires a novel long-range RNA-RNA interaction, spanning a distance of ∼3.5 kb, which occurs between a large RNA stem-loop located 3'-proximal to the stop codon and an RNA replication structure termed RIV at the 3'-end of the viral genome. Interestingly, this long-distance RNA-RNA interaction is modulated by mutually-exclusive RNA structures in RIV that represent a type of RNA switch. Moreover, a different long-range RNA-RNA interaction that was previously shown to be necessary for viral RNA replicase assembly was also required for efficient readthrough production of the RdRp. Accordingly, multiple replication-associated RNA elements are involved in modulating the readthrough event in tombusviruses and we propose an integrated mechanistic model to describe how this regulatory network could be advantageous by (i) providing a quality control system for culling truncated viral genomes at an early stage in the replication process, (ii) mediating cis-preferential replication of viral genomes, and (iii) coordinating translational readthrough of the RdRp with viral genome replication. Based on comparative sequence analysis and experimental data, basic elements of this regulatory model extend to other members of Tombusviridae, as well as to viruses outside of this family. PMID:22174683

  18. Inhomogeneous DNA replication kinetics is associated with immune system response

    NASA Astrophysics Data System (ADS)

    Bechhoefer, John; Gauthier, Michel G.; Norio, Paolo

    2013-03-01

    In eukaryotic organisms, DNA replication is initiated at ``origins,'' launching ``forks'' that spread bidirectionally to replicate the genome. The distribution and firing rate of these origins and the fork progression velocity form the ``replication program.'' Previous models of DNA replication in eukaryotes have assumed firing rates and replication fork velocities to be homogeneous across the genome. But large variations in origin activity and fork velocity do occur. Here, we generalize our replication model to allow for arbitrary spatial variation of initiation rates and fork velocities in a given region of the genome. We derive and solve rate equations for the forks and replication probability, to obtain the mean-field replication program. After testing the model on simulations, we analyze the changes in replication program that occur during B cell development in the mouse. B cells play a major role in the adaptive immune system by producing the antibodies. We show that the process of cell differentiation is associated with a change in replication program, where the zones of high origin initiation rates located in the immunoglobulin heavy-chain locus shift their position as the locus prepares to undergo the recombination events responsible for generating antibody specificity. This work was funded by HSFP and NSERC-Canada (MGG and JB) and by NIH-NIGMS grant R01GM080606 (PN).

  19. Evidence for Proterozoic and late Cretaceous-early Tertiary ore-forming events in the Coeur d'Alene district, Idaho and Montana

    USGS Publications Warehouse

    Leach, D.L.; Hofstra, A.H.; Church, S.E.; Snee, L.W.; Vaughn, R.B.; Zartman, R.E.

    1998-01-01

    New 40Ar/39Ar age spectra on sericite and lead isotope data on tetrahedrite, siderite, galena, bournonite, and stibnite, together with previously published isotopic, geochemical, and geologic studies provide evidence for two major vein-forming events in the Coeur d'Alene district and surrounding area of the Belt basin. The data suggest that the zinc- and lead-rich veins (e.g., Bunker Hill and Star-Morning mines) formed in the Proterozoic (1.0 Ga), whereas the silver-rich veins (e.g., Silver belt mines), antimony veins (e.g., US Antimony mine), and gold-bearing quartz veins (Murry subdistrict) formed in Late Cretaceous to early Tertiary time.

  20. Molecular evolution of glutamine synthetase II: Phylogenetic evidence of a non-endosymbiotic gene transfer event early in plant evolution

    PubMed Central

    2010-01-01

    Background Glutamine synthetase (GS) is essential for ammonium assimilation and the biosynthesis of glutamine. The three GS gene families (GSI, GSII, and GSIII) are represented in both prokaryotic and eukaryotic organisms. In this study, we examined the evolutionary relationship of GSII from eubacterial and eukaryotic lineages and present robust phylogenetic evidence that GSII was transferred from γ-Proteobacteria (Eubacteria) to the Chloroplastida. Results GSII sequences were isolated from four species of green algae (Trebouxiophyceae), and additional green algal (Chlorophyceae and Prasinophytae) and streptophyte (Charales, Desmidiales, Bryophyta, Marchantiophyta, Lycopodiophyta and Tracheophyta) sequences were obtained from public databases. In Bayesian and maximum likelihood analyses, eubacterial (GSIIB) and eukaryotic (GSIIE) GSII sequences formed distinct clades. Both GSIIB and GSIIE were found in chlorophytes and early-diverging streptophytes. The GSIIB enzymes from these groups formed a well-supported sister clade with the γ-Proteobacteria, providing evidence that GSIIB in the Chloroplastida arose by horizontal gene transfer (HGT). Bayesian relaxed molecular clock analyses suggest that GSIIB and GSIIE coexisted for an extended period of time but it is unclear whether the proposed HGT happened prior to or after the divergence of the primary endosymbiotic lineages (the Archaeplastida). However, GSIIB genes have not been identified in glaucophytes or red algae, favoring the hypothesis that GSIIB was gained after the divergence of the primary endosymbiotic lineages. Duplicate copies of the GSIIB gene were present in Chlamydomonas reinhardtii, Volvox carteri f. nagariensis, and Physcomitrella patens. Both GSIIB proteins in C. reinhardtii and V. carteri f. nagariensis had N-terminal transit sequences, indicating they are targeted to the chloroplast or mitochondrion. In contrast, GSIIB proteins of P. patens lacked transit sequences, suggesting a cytosolic

  1. Replicators, lineages, and interactors.

    PubMed

    Taylor, Daniel J; Bryson, Joanna J

    2014-06-01

    The target article argues that whole groups can act as interactors in an evolutionary process. We believe that Smaldino's discussion would be advanced by a more thorough analysis of the appropriate replicators and lineages for this model. We show that cultural evolution is necessarily a separate process from cultural group selection, and we also illustrate that the two processes may influence each other as demonstrated by an agent-based model of communicating food-processing skills. PMID:24970423

  2. Circulating Endothelial Cells and Endothelial Function predict Major Adverse Cardiac Events and Early Adverse Left Ventricular Remodeling in Patients with ST-Segment Elevation Myocardial Infarction

    PubMed Central

    Magdy, Abdel Hamid; Bakhoum, Sameh; Sharaf, Yasser; Sabry, Dina; El-Gengehe, Ahmed T; Abdel-Latif, Ahmed

    2016-01-01

    Endothelial progenitor cells (EPCs) and circulating endothelial cells (CECs) are mobilized from the bone marrow and increase in the early phase after ST-elevation myocardial infarction (STEMI). The aim of this study was to assess the prognostic significance of CECs and indices of endothelial dysfunction in patients with STEMI. In 78 patients with acute STEMI, characterization of CD34+/VEGFR2+ CECs, and indices of endothelial damage/dysfunction such as brachial artery flow mediated dilatation (FMD) were determined. Blood samples for CECs assessment and quantification were obtained within 24 hours of admission and FMD was assessed during the index hospitalization. At 30 days follow up, the primary composite end point of major cardiac adverse events (MACE) consisting of all-cause mortality, recurrent non-fatal MI, or heart failure and the secondary endpoint of early adverse left ventricular (LV) remodeling were analyzed. The 17 patients (22%) who developed MACE had significantly higher CEC level (P = 0.004), vWF level (P =0.028), and significantly lower FMD (P = 0.006) compared to the remaining patients. Logistic regression analysis showed that CECs level and LV ejection fraction were independent predictors of MACE. The areas under the receiver operating characteristic curves (ROC) for CEC level, FMD, and the logistic model with both markers were 0.73, 0.75, and 0.82 respectively for prediction of the MACE. The 16 patients who developed the secondary endpoint had significantly higher CEC level compared to remaining patients (p =0.038). In conclusion, increased circulating endothelial cells and endothelial dysfunction predicted the occurrence of major adverse cardiac events and adverse cardiac remodeling in patients with STEMI. PMID:26864952

  3. Remote Correlation of Paleoceanographic Events in the Northern Parts of Bering and Barents Seas during the Termination I and Early Holocene

    NASA Astrophysics Data System (ADS)

    Ivanova, E. V.; Ovsepyan, E.; Murdmaa, I.; de Vernal, A.; Risebrobakken, B.; Seitkalieva, E.; Radionova, E.; Alekhina, G.

    2014-12-01

    The Barents and Bering seas are closely linked to the High Arctic and to the THC by marine gateways as well as by land-sea and ocean-atmosphere interactions. Our multi-proxy time series demonstrate that these remote seas exhibited dramatic changes during the deglaciation through a succession of global and regional paleoceanographic events including the beginning of Termination I (BT1), Heinrich-1 or Oldest Dryas (OD), Bølling-Allerød (B/A), Younger Dryas (YD) and early Holocene (EH). In the NW Barents Sea, the increased subsurface-to-bottom Atlantic water inflow via the Kvitøya-Erik Eriksen trough (cores S 2519 and S 2528) is inferred at the late OD, late B/A and late YD/EH transition. These events are generally coupled with the strengthened AMOC. A remarkable sea surface warming and sea ice retreat are documented at ~ 13 ka BP. Surface warming and strong Atlantic water inflow were followed by intense iceberg calving in the Erik Eriksen Trough as indicated by the high IRD content of Core S-2519. The rock fragments are unsorted and mainly angular suggesting their ice-rafted (likely iceberg-rafted) origin. Svalbard glaciers apparently derived the material dominated by black schistous mudstones, hard limestones with coral remains, fine-grained sandstones from nearby islands, and icebergs spread it in the Kvitøya-Erik Eriksen Trough during the early deglaciation. The ice rafted coarse terrigenous material supply during the BT1 is also suggested for the NW Bering Sea. In the NW Pacific, NW Bering Sea and Sea of Okhotsk, surface bioproductivity peaked at B/A and EH mainly due to the global warming, enhanced nutrient supply by surface currents from the flooded northeastern shelf, intensified vertical mixing and water exchange through the opened straits. Oxygen-depleted bottom water at intermediate depths characterized several locations including the NW Bering Sea (Core SO201-2-85KL).

  4. A New Replicator: A theoretical framework for analysing replication

    PubMed Central

    2010-01-01

    Background Replicators are the crucial entities in evolution. The notion of a replicator, however, is far less exact than the weight of its importance. Without identifying and classifying multiplying entities exactly, their dynamics cannot be determined appropriately. Therefore, it is importance to decide the nature and characteristics of any multiplying entity, in a detailed and formal way. Results Replication is basically an autocatalytic process which enables us to rest on the notions of formal chemistry. This statement has major implications. Simple autocatalytic cycle intermediates are considered as non-informational replicators. A consequence of which is that any autocatalytically multiplying entity is a replicator, be it simple or overly complex (even nests). A stricter definition refers to entities which can inherit acquired changes (informational replicators). Simple autocatalytic molecules (and nests) are excluded from this group. However, in turn, any entity possessing copiable information is to be named a replicator, even multicellular organisms. In order to deal with the situation, an abstract, formal framework is presented, which allows the proper identification of various types of replicators. This sheds light on the old problem of the units and levels of selection and evolution. A hierarchical classification for the partition of the replicator-continuum is provided where specific replicators are nested within more general ones. The classification should be able to be successfully applied to known replicators and also to future candidates. Conclusion This paper redefines the concept of the replicator from a bottom-up theoretical approach. The formal definition and the abstract models presented can distinguish between among all possible replicator types, based on their quantity of variable and heritable information. This allows for the exact identification of various replicator types and their underlying dynamics. The most important claim is that

  5. Complexity transmission during replication

    PubMed Central

    Davis, Brian K.

    1979-01-01

    The transmission of complexity during DNA replication has been investigated to clarify the significance of this molecular property in a deterministic process. Complexity was equated with the amount of randomness within an ordered molecular structure and measured by the entropy of a posteriori probabilities for discrete (monomer sequences, atomic bonds) and continuous (torsion angle sequences) structural parameters in polynucleotides, proteins, and ligand molecules. A theoretical analysis revealed that sequence complexity decreases during transmission from DNA to protein. It was also found that sequence complexity limits the attainable complexity in the folding of a polypeptide chain and that a protein cannot interact with a ligand moiety of higher complexity. The analysis indicated, furthermore, that in any deterministic molecular process a cause possesses more complexity than its effect. This outcome broadly complies with Curie's symmetry principle. Results from an analysis of an extensive set of experimental data are presented; they corroborate these findings. It is suggested, therefore, that complexity governs the direction of order—order molecular transformations. Two biological implications are (i) replication of DNA in a stepwise, repetitive manner by a polymerase appears to be a necessary consequence of structural constraints imposed by complexity, and (ii) during evolution, increases in complexity had to involve a nondeterministic mechanism. This latter requirement apparently applied also to development of the first replicating system on earth. PMID:287070

  6. Demonstration of a Novel Synchrophasor-based Situational Awareness System: Wide Area Power System Visualization, On-line Event Replay and Early Warning of Grid Problems

    SciTech Connect

    Rosso, A.

    2012-12-31

    Since the large North Eastern power system blackout on August 14, 2003, U.S. electric utilities have spent lot of effort on preventing power system cascading outages. Two of the main causes of the August 14, 2003 blackout were inadequate situational awareness and inadequate operator training In addition to the enhancements of the infrastructure of the interconnected power systems, more research and development of advanced power system applications are required for improving the wide-area security monitoring, operation and planning in order to prevent large- scale cascading outages of interconnected power systems. It is critically important for improving the wide-area situation awareness of the operators or operational engineers and regional reliability coordinators of large interconnected systems. With the installation of large number of phasor measurement units (PMU) and the related communication infrastructure, it will be possible to improve the operators’ situation awareness and to quickly identify the sequence of events during a large system disturbance for the post-event analysis using the real-time or historical synchrophasor data. The purpose of this project was to develop and demonstrate a novel synchrophasor-based comprehensive situational awareness system for control centers of power transmission systems. The developed system named WASA (Wide Area Situation Awareness) is intended to improve situational awareness at control centers of the power system operators and regional reliability coordinators. It consists of following main software modules: • Wide-area visualizations of real-time frequency, voltage, and phase angle measurements and their contour displays for security monitoring. • Online detection and location of a major event (location, time, size, and type, such as generator or line outage). • Near-real-time event replay (in seconds) after a major event occurs. • Early warning of potential wide-area stability problems. The system has been

  7. Reworked pyroclastic beds in the early Miocene of Patagonia: Reaction in response to high sediment supply during explosive volcanic events

    NASA Astrophysics Data System (ADS)

    Cuitiño, José I.; Scasso, Roberto A.

    2013-05-01