[Relationship between hyperuricemia and primary nephrotic syndrome in children].

PubMed

Xiao, Huijie; Li, Qian; Wang, Fang; Yao, Yong; Zhong, Xuhui

2014-11-01

To analyze the relationship between hyperuricemia and primary nephrotic syndrome in childhood. A retrospective study was carried out in 107 children with primary nephrotic syndrome. The clinical data were analyzed with statistical methods to identify the related factors with hyperuricemia. The morbidity of hyperuricemia in children with primary nephrotic syndrome was 45% (48/107). Compared to those in normal serum uric acid group, the incidence of hypertension (33%, 16/48), serum triglyceride [2.59(1.62-3.87) mmol/L], creatinine [43.85(33.38-56.38)mmol/L], urea [6.11(3.77-8.40)mmol/L] and blood uric acid/creatinine ratio [9.30(7.03-12.72)] increased while creatinine clearance rate [141.74(103.57-160.97)ml/(min·1.73 (2))] decreased in hyperuricemia group. Hyperuricemia in children with primary nephrotic syndrome correlated with the increase of serum creatinine, urea and blood uric acid/creatinine ratio, the decrease of creatinine clearance rate and the occurance of hypertension.

[Single center survey of the relationship between pregnancy anemia and prepregnancy lifestyle].

PubMed

Akase, Tomoko; Hihara, Emiko; Uematsu, Kazuko; Kodaka, Masanobu; Akase, Tomohide; Tashiro, Shin-Ichi

2008-07-01

Physiologically, anemia often occurs during pregnancy because of an increase in circulating plasma volume. Pregnancy anemia is found prenatally in 50-75% of women. Based on the present survey performed in our obstetrics and gynecology ward, 52% of women experienced anemia during their pregnancy. This suggests that normal physiological changes due to pregnancy alone are not the only factors contributing to pregnancy anemia. Therefore to study the influence of lifestyle on pregnancy anemia, we investigated prepregnancy lifestyles on the assumption that the accumulation of several factors over a long period is usually the cause of anemia. The present results suggest that (i) the probability of anemia is slight in late pregnancy, if a normal Hb concentration is maintained in early pregnancy; (ii) the menstrual cycle is involved in the onset of anemia during early pregnancy; (iii) the number of meals taken and the level of alcohol consumption influence Hb concentration in late pregnancy. We believe that these findings provide a useful information source for advising patients on avoiding pregnancy anemia, which we can also use as guidance for outpatients at puberty. In conclusion, to prevent pregnancy anemia it is important to keep a regular menstrual cycle before pregnancy, and to take 3 meals/day and abstain from alcohol before and during pregnancy.

Hippocampal Morphology and Distinguishing Late-Onset From Early-Onset Elderly Depression

PubMed Central

Ballmaier, Martina; Narr, Katherine L.; Toga, Arthur W.; Elderkin-Thompson, Virginia; Thompson, Paul M.; Hamilton, Liberty; Haroon, Ebrahim; Pham, Daniel; Heinz, Andreas; Kumar, Anand

2010-01-01

Objective Despite evidence for hippocampal abnormalities in elderly depression, it is unknown whether these changes are regionally specific. This study used three-dimensional mapping techniques to identify regional hippocampal abnormalities in early- and late-onset depression. Neuropsychological correlates of hippocampal morphology were also investigated. Method With high-resolution magnetic resonance imaging, hippocampal morphology was compared among elderly patients with early- (N=24) and late-onset (N=22) depression and comparison subjects (N=34). Regional structural abnormalities were identified by comparing distances, measured from homologous hippocampal surface points to the central core of each individual’s hippocampal surface model, between groups. Results Hippocampal volumes differed between depressed patients and comparison subjects but not between patients with early- and late-onset depression. However, statistical mapping results showed that regional surface contractions were significantly pronounced in late-compared to early-onset depression in the anterior of the subiculum and lateral posterior of the CA1 subfield in the left hemisphere. Significant shape differences were observed bilaterally in anterior CA1–CA3 subfields and the subiculum in patients in relation to comparison subjects. These results were similar when each disease group was separately compared to comparison subjects. Hippocampal surface contractions significantly correlated with memory measures among late- but not early-onset depressed patients or comparison subjects. Conclusions More pronounced regional volume deficits and their associations with memory in late-onset depression may suggest that these patients are more likely to develop cognitive impairment over time than individuals with early-onset depression. Mapping regional hippocampal abnormalities and their cognitive correlates may help guide research in defining risk profiles and treatment strategies. PMID:17986679

Adverse Housing Conditions and Early-Onset Delinquency.

PubMed

Jackson, Dylan B; Newsome, Jamie; Lynch, Kellie R

2017-09-01

Housing constitutes an important health resource for children. Research has revealed that, when housing conditions are unfavorable, they can interfere with child health, academic performance, and cognition. Little to no research, however, has considered whether adverse housing conditions and early-onset delinquency are significantly associated with one another. This study explores the associations between structural and non-structural housing conditions and delinquent involvement during childhood. Data from the Fragile Families and Child Wellbeing Study (FFCWS) were employed in this study. Each adverse housing condition was significantly associated with early-onset delinquency. Even so, disarray and deterioration were only significantly linked to early delinquent involvement in the presence of health/safety hazards. The predicted probability of early-onset delinquency among children exposed to housing risks in the presence of health/safety hazards was nearly three times as large as the predicted probability of early-onset delinquency among children exposed only to disarray and/or deterioration, and nearly four times as large as the predicted probability of early-onset delinquency among children exposed to none of the adverse housing conditions. The findings suggest that minimizing housing-related health/safety hazards among at-risk subsets of the population may help to alleviate other important public health concerns-particularly early-onset delinquency. Addressing household health/safety hazards may represent a fruitful avenue for public health programs aimed at the prevention of early-onset delinquency. © Society for Community Research and Action 2017.

Gout and hyperuricemia.

PubMed

Wortmann, Robert L

2002-05-01

Gout continues to be a health problem around the world despite the availability of effective therapies. Although the prevalence is influenced by genetic factors, the associations of alcohol consumption, obesity, and hypertension appear to be partially responsible for the increased prevalence of gout and hyperuricemia in African and Oriental countries. The association between hyperuricemia and cardiovascular disease seems linked to insulin resistance. This relation, in part, explains the common coexistence of hyperlipidemia and glucose intolerance in patients with gout. Accordingly, it is recommended that one pay more attention to dietary manipulation in patients with gout in addition to managing hypertension, obesity, and other medical problems. Although acute gout attacks can be treated, eliminating gout requires effective removal of urate from the body. Allopurinol remains a dominant urate-lowering agent, however its use may be limited by allergic reactions. Uricosuric agents are also effective urate-lowering agents and provide an alternative to allopurinol. Strategies to treat patients who are sensitive to allopurinol continue to evolve.

Physical Function, Hyperuricemia, and Gout in Older Adults.

PubMed

Burke, Bridget Teevan; Köttgen, Anna; Law, Andrew; Windham, Beverly Gwen; Segev, Dorry; Baer, Alan N; Coresh, Josef; McAdams-DeMarco, Mara A

2015-12-01

Gout prevalence is high in older adults and those affected are at risk of physical disability, yet it is unclear whether they have worse physical function. We studied gout, hyperuricemia, and physical function in 5,819 older adults (age ≥65 years) attending the 2011-2013 Atherosclerosis Risk in Communities Study visit, a prospective US population-based cohort. Differences in lower extremity function (Short Physical Performance Battery [SPPB] and 4-meter walking speed) and upper extremity function (grip strength) by gout status and by hyperuricemia prevalence were estimated in adjusted ordinal logistic regression (SPPB) and linear regression (walking speed and grip strength) models. Lower scores or times signify worse function. The prevalence of poor physical performance (first quartile) by gout and hyperuricemia was estimated using adjusted modified Poisson regression. Ten percent of participants reported a history of gout and 21% had hyperuricemia. There was no difference in grip strength by history of gout (P = 0.77). Participants with gout performed worse on the SPPB test; they had 0.77 times (95% confidence interval [95% CI] 0.65, 0.90, P = 0.001) the prevalence odds of a 1-unit increase in SPPB score and were 1.18 times (95% CI 1.07, 1.32, P = 0.002) more likely to have poor SPPB performance. Participants with a history of gout had slower walking speed (mean difference -0.03; 95% CI -0.05, -0.01, P < 0.001) and were 1.19 times (95% CI 1.06, 1.34, P = 0.003) more likely to have poor walking speed. Similarly, SPPB score and walking speed, but not grip strength, were worse in participants with hyperuricemia. Older adults with gout and hyperuricemia are more likely to have worse lower extremity, but not upper extremity, function. © 2015, American College of Rheumatology.

[Hyperuricemia and gene mutations: a case report].

PubMed

Tattoli, Fabio; Falconi, Daniela; De Prisco, Ornella; Maurizio, Gherzi; Marazzi, Federico; Marengo, Marita; Serra, Ilaria; Tamagnone, Michela; Cordero di Montezemolo, Luca; Pasini, Barbara; Formica, Marco

2017-06-01

Hyperuricemia is frequently found in nephrology. The case presented may be useful to clarify some pathogenetic aspects. It is a patient of 18 years, hyperuricaemic. Non-consanguineous parents, hyperuricemia in the paternal line, not neuropsychiatric disorders in the family. Delay in neuromotor acquisitions, average intellectual disabilities, anxiety disorder, obsessive-compulsive personality traits. Normal renal function and renal ultrasound. Evidence of hyperuricemia in 2015. Never gouty episodes and / or lithiasis, initiated allopurinol 100 mg on alternate days, with no side effects, urea in the control range, slightly below normal uricuria. Given the complex clinical, he carried out a genetic analysis of array-CGH. He showed a deletion on the short arm of chromosome 3 (3p12.3) and a duplication of the long arm of chromosome 1 (19q13-42). The deletion 3p12.3 (paternal inheritance), involves the ROBO2 gene. Duplication 19q13.42, (maternal inheritance), includes NLRP12, DPRX, ZNF331 genes. The ROBO2 gene with its mutation, is associated with vesicoureteral reflux. The NLRP12 gene encodes proteins called "Nalps", forming a subfamily of proteins "CATERPILLAR". Many "Nalps" as well as the "Nalps 12" have an N-terminal domain (DYP) with a purin. Since uric acid is a byproduct of purine metabolism, considered the familiarity, we believe that we can hypothesize that the mutations found. In particular those concerning the NLRP-12 gene, may have a role in the presence of hyperuricemia. We believe that in patients with hyperuricemia, associated with a particular impairment of neurological picture, it is likely that there is a subtended common genetic deficiency. Copyright by Società Italiana di Nefrologia SIN, Rome, Italy.

Fetal-onset Congenital Dyserythropoietic Anemia Type 1 due to a Novel Mutation With Severe Iron Overload and Severe Cholestatic Liver Disease.

PubMed

Chin, Hui-Lin; Lee, Le Ye; Koh, Pei Lin

2018-04-17

We report a rare case of severe congenital dyserythropoietic anemia type 1 with fetal onset. Our patient presented with fetal hydrops from 19 weeks of gestation, requiring multiple intrauterine transfusions. At birth, she had severe hemolytic anemia with severe jaundice, and was subsequently transfusion dependent. She eventually developed severe iron overload and fulminant liver failure before her demise at 5 months of age. Genetic testing revealed a novel mutation in CDAN1.

Relationship between lifestyle choices and hyperuricemia in Chinese men and women.

PubMed

Liu, Li; Lou, Shanshan; Xu, Ke; Meng, Zhaowei; Zhang, Qing; Song, Kun

2013-02-01

We aimed to explore correlations between lifestyle choices and hyperuricemia in a large Chinese population, emphasizing the differences from opposite sex. Ten thousand four hundred fifty subjects were randomly recruited from Tianjin municipality in China. Hyperuricemia was defined as serum uric acid >420 μmol/L for men and >360 μmol/L for women. Demographic data, highest education degree, work type, commuting means, smoking and drinking status, exercise frequency, and quantitative assessments of dietary factors were collected. Anthropometric measurements and fasting blood tests were performed. Statistical analyses were conducted. Total hyperuricemic prevalence was 12.89 %, with male significantly higher than female. Body mass index, waist circumference, serum indices, and age displayed high correlation coefficients, and most lifestyle factors also showed significant correlations as well. Binary logistic regression models showed odds ratio of developing hyperuricemia were much greater in males than in females by eating habits. However, physical activity-related lifestyle choices tended to cast much greater influences on the likelihood of hyperuricemia in females. Lifestyle choices and hyperuricemia are closely related. For males, eating habits have greater influences on the likelihood of developing hyperuricemia. For females, lifestyle factors like work type, commuting method, and exercise have such effects.

Lost human capital from early-onset chronic depression.

PubMed

Berndt, E R; Koran, L M; Finkelstein, S N; Gelenberg, A J; Kornstein, S G; Miller, I M; Thase, M E; Trapp, G A; Keller, M B

2000-06-01

Chronic depression starts at an early age for many individuals and could affect their accumulation of "human capital" (i.e., education, higher amounts of which can broaden occupational choice and increase earnings potential). The authors examined the impact, by gender, of early- (before age 22) versus late-onset major depressive disorder on educational attainment. They also determined whether the efficacy and sustainability of antidepressant treatments and psychosocial outcomes vary by age at onset and quantified the impact of early- versus late-onset, as well as never-occurring, major depressive disorder on expected lifetime earnings. The authors used logistic and multivariate regression methods to analyze data from a three-phase, multicenter, double-blind, randomized trial that compared sertraline and imipramine treatment of 531 patients with chronic depression aged 30 years and older. These data were integrated with U.S. Census Bureau data on 1995 earnings by age, educational attainment, and gender. Early-onset major depressive disorder adversely affected the educational attainment of women but not of men. No significant difference in treatment responsiveness by age at onset was observed after 12 weeks of acute treatment or, for subjects rated as having responded, after 76 weeks of maintenance treatment. A randomly selected 21-year-old woman with early-onset major depressive disorder in 1995 could expect future annual earnings that were 12%-18% lower than those of a randomly selected 21-year-old woman whose onset of major depressive disorder occurred after age 21 or not at all. Early-onset major depressive disorder causes substantial human capital loss, particularly for women. Detection and effective treatment of early-onset major depressive disorder may have substantial economic benefits.

Disease evolution in late-onset and early-onset systemic lupus erythematosus.

PubMed

Aljohani, R; Gladman, D D; Su, J; Urowitz, M B

2017-10-01

Objective The objective of this study was to compare clinical features, disease activity, and outcome in late-onset versus early-onset systemic lupus erythematosus (SLE) over 5 years of follow up Method Patients with SLE since 1970 were followed prospectively according to standard protocol and tracked on a computerized database. Patients entering the cohort within one year of diagnosis constitute the inception cohort. Patients with late-onset (age at diagnosis ≥50) disease were identified and matched 1:2 based on gender and first clinic visit (±5) years with patients with early-onset disease (age at diagnosis 18-40 years). Results A total of 86 patients with late-onset disease (84.9% female, 81.4% Caucasian, mean age at SLE diagnosis ± SD 58.05 ± 7.30) and 169 patients with early-onset disease (86.4% female, 71% Caucasian, mean age at SLE diagnosis ± SD 27.80 ± 5.90) were identified. At enrollment, late-onset SLE patients had a lower total number of American College of Rheumatology (ACR) criteria, with less renal and neurologic manifestations. Mean SLE Disease Activity Index 2000 (SLEDAI-2K) scores were lower in late-onset SLE, especially renal features and anti-dsDNA positivity. Over 5 years, mean SLEDAI-2K scores decreased in both groups, while mean Systemic Lupus International Collaborating Clinics/ACR Damage Index (SDI) scores increased more significantly in the late-onset group; they developed more cardiovascular, renal, and ocular damage, and had higher prevalence of cardiovascular risk factors. Conclusion Although the late-onset SLE group had a milder presentation and less active disease, with the evolution of disease, they developed more organ damage likely as a consequence of cardiovascular risk factors and aging.

[The relationship between smoking and hyperuricemia in Chinese residents].

PubMed

Chen, H G; Sheng, L T; Wan, Z Z; Wang, X C; Lin, Y H; Wang, Y X; Pan, X F; Pan, A

2018-05-06

Objective: To explore the relationship between smoking and hyperuricemia in Chinese residents. Methods: Based on data from the China Health and Nutrition Survey (CHNS), residents with blood samples provided in the 2009 round (including information of socio-demographic factors, lifestyle behaviors, medical history, and laboratory examinations etc.) were selected as the participants in the current analysis. Unconditional logistic regression models were utilized to compute the ORs and corresponding 95% CIs for assessing the relationship between smoking and hyperuricemia. Results: Among the 8 785 subjects, 1 435 had hyperuricemia with a prevalence rate of 16.3%, consisting of 886 men and 549 women with prevalence rates of 21.6% (886/4 110) and 11.7% (549/4 675) , respectively. Compared with never smokers, the adjusted OR (95% CI ) for hyperuricemia was 0.83 (0.70-0.98) among current smokers, 0.77 (0.63-0.94) among current smokers with 20-39 years of smoking, and 0.79 (0.65-0.97) among current smokers with 11-20 cigarettes per day. When stratified by gender and compared with non-smoker, the adjusted OR (95% CI ) for hyperuricemia among current smokers compared with never smokers was 0.83 (0.70-0.98) among men, while no significant association was found in female current smokers ( OR= 0.73, 95% CI: 0.42-1.26, P= 0.260). Conclusion: In Chinese residents, there is an inverse association between smoking and hyperuricemia prevalence, and this association may be related to duration and intensity of smoking among current smokers. The findings need to be validated in large prospective cohort studies.

Genetics Home Reference: early-onset primary dystonia

MedlinePlus

... such as seizures or a loss of intellectual function (dementia). Early-onset primary dystonia does not affect a person's intelligence. On ... of torsinA. The altered protein's effect on the function of nerve cells in the brain ... with early-onset primary dystonia do not have a loss of nerve ...

Prevalence of anemia and micronutrient deficiencies in early pregnancy in rural Bangladesh, the MINIMat trial.

PubMed

Lindström, Emma; Hossain, Mohammad B; Lönnerdal, Bo; Raqib, Rubhana; El Arifeen, Shams; Ekström, Eva-Charlotte

2011-01-01

To describe the prevalence of anemia and micronutrient deficiencies as well as their determinants in early pregnancy. Baseline data from a population-based randomized intervention trial. The study was conducted in Matlab, a sub-district in rural Bangladesh from 1 January to 31 December 2002. Pregnant women (n= 740) were enrolled in approximately week 14 in pregnancy. Data were collected using questionnaires, physical examinations and laboratory analyses of blood samples for concentrations of hemoglobin, ferritin, zinc, folate and vitamin B-12. Covariates associated with anemia and micronutrient deficiencies in bivariate analyses were evaluated in multivariate logistic regression models adjusting for potential confounders. Anemia was present in 28% of the women, 55% were zinc deficient, 46% were vitamin B-12 deficient and 18% were folate deficient. Anemia was not associated with iron deficiency but rather with vitamin B-12 deficiency. Infestation with Ascaris was highly prevalent (67%) and associated with both folate and vitamin B-12 deficiency. Anemia and micronutrient deficiencies all varied significantly with season. The high prevalences of zinc and vitamin B-12 deficiencies in early pregnancy are a concern, as it could lead to adverse pregnancy outcomes and increased health risks for both mother and child. The prevalence of iron deficiency was low, but as this was during early pregnancy, the women might develop iron deficiency and consequently iron deficiency anemia as the pregnancy progresses. © 2010 The Authors Acta Obstetricia et Gynecologica Scandinavica© 2010 Nordic Federation of Societies of Obstetrics and Gynecology.

Genetic Risk Score Analysis in Early-Onset Bipolar Disorder

PubMed Central

Croarkin, Paul E.; Luby, Joan L.; Cercy, Kelly; Geske, Jennifer R.; Veldic, Marin; Simonson, Matthew; Joshi, Paramjit T.; Wagner, Karen Dineen; Walkup, John T.; Nassan, Malik M.; Cuellar-Barboza, Alfredo B.; Casuto, Leah; McElroy, Susan L.; Jensen, Peter S.; Frye, Mark A.; Biernacka, Joanna M.

2018-01-01

Objective In this study, we performed a candidate genetic risk score (GRS) analysis of early-onset bipolar disorder. Method Treatment of Early Age Mania (TEAM) study enrollment and sample collection took place from 2003–2008. Mayo Clinic Bipolar Biobank samples were collected from 2009–2013. Genotyping and analyses for the present study took place from 2013–2014. The diagnosis of bipolar disorder was based on Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, Text Revision criteria. Eight single-nucleotide polymorphisms (SNPs), previously reported in genome-wide association studies to be associated with bipolar disorder, were chosen for GRS analysis in early-onset bipolar disease. These SNPs map to 3 genes: CACNA1C (calcium channel, voltage-dependent, L type, alpha 1C subunit), ANK3 (ankyrin-3, node of Ranvier [ankyrin G]), and ODZ4 (teneurin transmembrane protein 4 [formerly “odz, odd Oz/ten-m homolog 4 {Drosophila}, ODZ4”]). The 8 candidate SNPs were genotyped in patients from the TEAM study (n=69), adult patients with bipolar disorder (n=732) including a subset with early-onset illness [n=192]), and healthy controls (n=776). GRS analyses were performed comparing early-onset cases with controls. In addition, associations of early-onset BD with individual SNPs and haplotypes were explored. Results GRS analysis revealed associations of the risk score with early-onset bipolar disorder (P=.01). Gene-level haplotype analysis comparing TEAM patients with controls suggested association of early-onset bipolar disorder with a CACNA1C haplotype (global test, P=.01). At the level of individual SNPs, comparison of TEAM cases with healthy controls provided nominally significant evidence for association of SNP rs10848632 in CACNA1C with early-onset bipolar disorder (P=.017), which did not remain significant after correction for multiple comparisons. Conclusion These preliminary analyses suggest that previously identified bipolar disorder risk loci

Genetic Risk Score Analysis in Early-Onset Bipolar Disorder.

PubMed

Croarkin, Paul E; Luby, Joan L; Cercy, Kelly; Geske, Jennifer R; Veldic, Marin; Simonson, Matthew; Joshi, Paramjit T; Wagner, Karen Dineen; Walkup, John T; Nassan, Malik M; Cuellar-Barboza, Alfredo B; Casuto, Leah; McElroy, Susan L; Jensen, Peter S; Frye, Mark A; Biernacka, Joanna M

In this study, we performed a candidate genetic risk score (GRS) analysis of early-onset bipolar disorder (BD). Treatment of Early Age Mania (TEAM) study enrollment and sample collection took place from 2003 to 2008. Mayo Clinic Bipolar Biobank samples were collected from 2009 to 2013. Genotyping and analyses for the present study took place from 2013 to 2014. The diagnosis of BD was based on Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, Text Revision criteria. Eight single-nucleotide polymorphisms (SNPs), previously reported in genome-wide association studies to be associated with BD, were chosen for GRS analysis in early-onset bipolar disease. These SNPs map to 3 genes: CACNA1C (calcium channel, voltage-dependent, L type, alpha 1C subunit), ANK3 (ankyrin-3, node of Ranvier [ankyrin G]), and ODZ4 (teneurin transmembrane protein 4 [formerly "odz, odd Oz/10-m homolog 4 {Drosophila}, ODZ4"]). The 8 candidate SNPs were genotyped in patients from the TEAM study (n = 69); adult patients with BD (n = 732), including a subset with early-onset illness (n = 192); and healthy controls (n = 776). GRS analyses were performed to compare early-onset cases with controls. In addition, associations of early-onset BD with individual SNPs and haplotypes were explored. GRS analysis revealed associations of the risk score with early-onset BD (P = .01). Gene-level haplotype analysis comparing TEAM patients with controls suggested association of early-onset BD with a CACNA1C haplotype (global test, P = .01). At the level of individual SNPs, comparison of TEAM cases with healthy controls provided nominally significant evidence for association of SNP rs10848632 in CACNA1C with early-onset BD (P = .017), which did not remain significant after correction for multiple comparisons. These preliminary analyses suggest that previously identified BD risk loci, especially CACNA1C, have a role in early-onset BD, possibly with stronger effects than for late-onset BD. �

Hemolytic disease of the fetus and newborn with late-onset anemia due to anti-M: a case report and review of the Japanese literature.

PubMed

Yasuda, Hiroyasu; Ohto, Hitoshi; Nollet, Kenneth E; Kawabata, Kinuyo; Saito, Shunnichi; Yagi, Yoshihito; Negishi, Yutaka; Ishida, Atsushi

2014-01-01

Hemolytic disease of the fetus and newborn (HDFN) attributed to M/N-incompatibility varies from asymptomatic to lethally hydropic. Case reports are rare, and the clinical significance of anti-M is not completely understood. A challenging case of HDFN due to anti-M prompted an investigation of the Japanese literature, in order to characterize the clinical spectrum of M/N-incompatibility pregnancies in Japan and report results to English-language readers. Japanese reports of HDFN attributed to M/N incompatibility were compiled. Abstracted data include maternal antibody titers at delivery, fetal direct antiglobulin test, hemoglobin, total bilirubin, reticulocyte count at birth, and therapeutic interventions. We investigated characteristics of HDFN due to M/N-incompatible pregnancies in Japan after encountering a case of severe HDFN along with late-onset anemia in an infant born to a woman carrying IgG anti-M with a titer of 1. In total, thirty-three babies with HDFN due to anti-M and one due to anti-N have been reported in Japan since 1975. The median maternal antibody titer was 64 at delivery and was 16 or less in 10 of 34 women (29%). Five of 34 babies (15%) were stillborn or died as neonates. Twenty-one of 29 survivors (72%) had severe hemolytic anemia and/or hydrops fetalis. The reticulocyte count of neonates with anemia stayed below the reference interval. Sixteen (55%) developed late-onset anemia and 14 (48%) were transfused with M-negative RBCs. Significant positive correlation (P < .05) between the hemoglobin value and the reticulocyte count within 4 days of birth was obtained in 16 babies with anti-M HDFN. In the Japanese population, 21 of 34 cases of M/N-incompatible HDFN (72%) have manifested as severe hemolytic anemia and/or hydrops fetalis. Low reticulocyte count in neonates with late-onset anemia is consistent with suppressed erythropoiesis due to anti-M. © 2013.

Evidence for a genetic etiology of early-onset delinquency.

PubMed

Taylor, J; Iacono, W G; McGue, M

2000-11-01

Age at onset of antisocial behavior discriminates persistent and transitory offenders. The authors proposed that early-onset delinquency has an underlying genetic influence that manifests in problems related to inhibition, whereas late-onset delinquency is more environmentally mediated. To test these notions, they selected 36 early starters, 86 late starters, and 25 nondelinquent controls from a large sample of 11-year-old twins and compared them on several measures related to inhibition and a peer group measure. As expected, early starters had more psychological, behavioral, and emotional problems related to inhibition than late starters and controls. A longitudinal analysis indicated an increase an antisocial behavior among peers of late starters shortly before their delinquency onset. Family history data and a twin analysis provided evidence of greater genetic influence on early-onset than late-onset delinquency.

Hyperuricemia Is a Risk Factor for the Onset of Impaired Fasting Glucose in Men with a High Plasma Glucose Level: A Community-Based Study

PubMed Central

Miyake, Teruki; Kumagi, Teru; Furukawa, Shinya; Hirooka, Masashi; Kawasaki, Keitarou; Koizumi, Mitsuhito; Todo, Yasuhiko; Yamamoto, Shin; Abe, Masanori; Kitai, Kohichiro; Matsuura, Bunzo; Hiasa, Yoichi

2014-01-01

Background It is not clear whether elevated uric acid is a risk factor for the onset of impaired fasting glucose after stratifying by baseline fasting plasma glucose levels. We conducted a community-based retrospective longitudinal cohort study to clarify the relationship between uric acid levels and the onset of impaired fasting glucose, according to baseline fasting plasma glucose levels. Methods We enrolled 6,403 persons (3,194 men and 3,209 women), each of whom was 18–80 years old and had >2 annual check-ups during 2003–2010. After excluding persons who had fasting plasma glucose levels ≥6.11 mM and/or were currently taking anti-diabetic agents, the remaining 5,924 subjects were classified into quartiles according to baseline fasting plasma glucose levels. The onset of impaired fasting glucose was defined as fasting plasma glucose ≥6.11 mM during the observation period. Results In the quartile groups, 0.9%, 2.1%, 3.4%, and 20.2% of the men developed impaired fasting glucose, respectively, and 0.1%, 0.3%, 0.5%, and 5.6% of the women developed impaired fasting glucose, respectively (P trend <0.001). After adjusting for age, body mass index, systolic blood pressure, triacylglycerols, high density lipoprotein-cholesterol, creatinine, fatty liver, family history of diabetes, alcohol consumption, and current smoking, uric acid levels were positively associated with onset of impaired fasting glucose in men with highest-quartile fasting plasma glucose levels (adjusted hazard ratio, 1.003; 95% confidence interval, 1.0001–1.005, P = 0.041). Conclusions Among men with high fasting plasma glucose, hyperuricemia may be independently associated with an elevated risk of developing impaired fasting glucose. PMID:25237894

Relationship between hyperuricemia and dietary risk factors in Chinese adults: a cross-sectional study.

PubMed

Li, Xue; Song, Peige; Li, Junping; Wang, Peiyu; Li, Guowei

2015-12-01

Previous studies focusing on identification of dietary risk factors for hyperuricemia reported controversial findings. Moreover, evidence for relationship between hyperuricemia and eating and cooking habits remained scanty. The purpose of this study was to evaluate the associations between hyperuricemia and dietary risk factors. A cross-sectional study was conducted among 1583 participants in a Beijing community. Face-to-face interviews were conducted using questionnaires. Anthropometric measurements and biochemical tests were also performed. The prevalence of hyperuricemia was 14.1 % (20.2 % for males and 7.4 % for females). Among the 1372 subjects included for analysis, 720 (52.5 %) were males and the mean age was 37.7 years. For males, statistically significant associations between hyperuricemia and tea intake, breakfast and midnight snack consumption were found, with an odds ratio of 0.56 (high vs. low), 2.14 (often vs. always) and 0.52 (rarely vs. always), respectively. Smoking, fatty liver disease, triglyceride, low-density lipoprotein cholesterol and fasting blood glucose were significantly related to increased serum uric acid (SUA), with a coefficient of 20.06, 11.52, 7.29, 18.97 and 13.37 on SUA, respectively. For females, no statistically significant associations between hyperuricemia and dietary risk factors were observed. In summary, hyperuricemia is highly prevalent among the adult participants in this Chinese community, especially for men. High tea intake and consuming midnight snack rarely are significantly related to decreased risk of hyperuricemia, while often-eating breakfast is associated with increased risk of hyperuricemia compared with always-eating breakfast in males. Further prospective studies are needed to confirm the findings and to establish dietary recommendations for the prevention and treatment of hyperuricemia.

Chorioamnionitis and Culture-Confirmed, Early-Onset Neonatal Infections

PubMed Central

Hansen, Nellie I.; Schrag, Stephanie J.; Hale, Ellen; Van Meurs, Krisa; Sánchez, Pablo J.; Cantey, Joseph B.; Faix, Roger; Poindexter, Brenda; Goldberg, Ronald; Bizzarro, Matthew; Frantz, Ivan; Das, Abhik; Benitz, William E.; Shane, Andi L.; Higgins, Rosemary; Stoll, Barbara J.

2016-01-01

BACKGROUND: Current guidelines for prevention of neonatal group B streptococcal disease recommend diagnostic evaluations and empirical antibiotic therapy for well-appearing, chorioamnionitis-exposed newborns. Some clinicians question these recommendations, citing the decline in early-onset group B streptococcal disease rates since widespread intrapartum antibiotic prophylaxis implementation and potential antibiotic risks. We aimed to determine whether chorioamnionitis-exposed newborns with culture-confirmed, early-onset infections can be asymptomatic at birth. METHODS: Multicenter, prospective surveillance for early-onset neonatal infections was conducted during 2006–2009. Early-onset infection was defined as isolation of a pathogen from blood or cerebrospinal fluid collected ≤72 hours after birth. Maternal chorioamnionitis was defined by clinical diagnosis in the medical record or by histologic diagnosis by placental pathology. Hospital records of newborns with early-onset infections born to mothers with chorioamnionitis were reviewed retrospectively to determine symptom onset. RESULTS: Early-onset infections were diagnosed in 389 of 396 586 live births, including 232 (60%) chorioamnionitis-exposed newborns. Records for 229 were reviewed; 29 (13%) had no documented symptoms within 6 hours of birth, including 21 (9%) who remained asymptomatic at 72 hours. Intrapartum antibiotic prophylaxis exposure did not differ significantly between asymptomatic and symptomatic infants (76% vs 69%; P = .52). Assuming complete guideline implementation, we estimated that 60 to 1400 newborns would receive diagnostic evaluations and antibiotics for each infected asymptomatic newborn, depending on chorioamnionitis prevalence. CONCLUSIONS: Some infants born to mothers with chorioamnionitis may have no signs of sepsis at birth despite having culture-confirmed infections. Implementation of current clinical guidelines may result in early diagnosis, but large numbers of uninfected

Japanese guideline for the management of hyperuricemia and gout: second edition.

PubMed

Yamanaka, Hisashi

2011-12-01

Gout is a urate deposition disease caused by persistent hyperuricemia. Because gout patients present with a variety of clinical symptoms, it is necessary to have a guideline for the standard management and care of gout and hyperuricemia. The Japanese Society of Gout and Nucleic Acid Metabolism, a scientific society committed to study nucleic acid metabolism and related diseases, established the first edition of the "Guideline for the Management of Hyperuricemia and Gout" in 2002, and published the revised version in January 2010. This second edition is not only evidence based on a search of systemic literature, but also includes consensus levels by a Delphi exercise to determine the strength of the recommendations. A draft version of this guideline was reviewed by internal and external reviewers as well as a patient. In this guideline, key messages from each chapter are listed as statements together with the evidence level, consensus level, and strength of the recommendation. In this proceeding, several selected chapters on the clinical management of gout and hyperuricemia are described. We hope this guideline is appropriately used for the standard management and care of patients with hyperuricemia and gout in daily practice.

Association of complementation group and mutation type with clinical outcome in fanconi anemia. European Fanconi Anemia Research Group.

PubMed

Faivre, L; Guardiola, P; Lewis, C; Dokal, I; Ebell, W; Zatterale, A; Altay, C; Poole, J; Stones, D; Kwee, M L; van Weel-Sipman, M; Havenga, C; Morgan, N; de Winter, J; Digweed, M; Savoia, A; Pronk, J; de Ravel, T; Jansen, S; Joenje, H; Gluckman, E; Mathew, C G

2000-12-15

Fanconi anemia (FA) is a clinically and genetically heterogeneous disorder. Clinical care is complicated by variable age at onset and severity of hematologic symptoms. Recent advances in the molecular biology of FA have allowed us to investigate the relationship between FA genotype and the nature and severity of the clinical phenotype. Two hundred forty-five patients from all 7 known complementation groups (FA-A to FA-G) were studied. Mutations were detected in one of the cloned FANC genes in 169 patients; in the remainder the complementation group was assigned by cell fusion or Western blotting. A range of qualitative and quantitative clinical parameters was compared for each complementation group and for different classes of mutation. Significant phenotypic differences were found. FA-G patients had more severe cytopenia and a higher incidence of leukemia. Somatic abnormalities were less prevalent in FA-C, but more common in the rare groups FA-D, FA-E, and FA-F. In FA-A, patients homozygous for null mutations had an earlier onset of anemia and a higher incidence of leukemia than those with mutations producing an altered protein. In FA-C, there was a later age of onset of aplastic anemia and fewer somatic abnormalities in patients with the 322delG mutation, but there were more somatic abnormalities in patients with IVS4 + 4A --> T. This study indicates that FA patients with mutations in the FANCG gene and patients homozygous for null mutations in FANCA are high-risk groups with a poor hematologic outcome and should be considered as candidates both for frequent monitoring and early therapeutic intervention. (Blood. 2000;96:4064-4070)

Gender, body mass index, and PPARγ polymorphism are good indicators in hyperuricemia prediction for Han Chinese.

PubMed

Lee, Ming-Fen; Liou, Tsan-Hon; Wang, Weu; Pan, Wen-Harn; Lee, Wei-Jei; Hsu, Chung-Tan; Wu, Suh-Fen; Chen, Hsin-Hung

2013-01-01

Hyperuricemia is closely associated with obesity and metabolic abnormalities, which is also an independent risk factor for cardiovascular diseases. The PPARγ gene, which is linked to obesity and metabolic abnormalities in Han Chinese, might be considered a top candidate gene that is involved in hyperuricemia. This study recruited 457 participants, aged 20-40 years old, to investigate the associations of the PPARγ gene and metabolic parameters with hyperuricemia. Three tag-single nucleotide polymorphisms, rs2292101, rs4684846, and rs1822825, of the PPARγ gene were selected to explore their association with hyperuricemia. Risk genotypes on rs1822825 of the PPARγ gene exhibited statistical significance with hyperuricemia (odds ratio: 1.9; 95% confidence interval: 1.05-3.57). Although gender, body mass index (BMI), serum total cholesterol concentration, or protein intake per day were statistically associated with hyperuricemia, the combination of BMI, gender, and rs1822825, rather than that of age, serum lipid profile, blood pressure, and protein intake per day, satisfied the predictability for hyperuricemia (sensitivity: 69.3%; specificity: 83.7%) in Taiwan-born obese Han Chinese. BMI, gender, and the rs1822825 polymorphism in the PPARγ gene appeared good biomarkers in hyperuricemia; therefore, these powerful indicators may be included in the prediction of hyperuricemia to increase the accuracy of the analysis.

Early-onset obsessive-compulsive disorder and personality disorders in adulthood.

PubMed

Maina, Giuseppe; Albert, Umberto; Salvi, Virginio; Pessina, Enrico; Bogetto, Filippo

2008-03-15

Obsessive-compulsive disorder (OCD) often emerges in childhood or adolescence. The aim of the present study was to evaluate whether adult patients with prepuberal onset differ from subjects with later onset in terms of personality disorder comorbidity. The Structured Clinical Interview for DSM-IV Axis II Disorders was used to assess 148 patients with a principal diagnosis of OCD according to the Structured Clinical Interview for DSM-IV Axis I Disorders. The following two subgroups of subjects were selected according to the age at onset of symptomatology: patients with an early-onset (< or =10 years), and patients with a later onset (> or =17 years). Of the 148 patients screened for the present study, 33 (22.3%) had an early onset and 1369 (46.6%) had a later onset. With regard to personality disorders, early-onset patients showed more OC personality disorders (OCPD) than later onset patients. Our finding suggests that OCD in childhood increases the risk for developing OCPD in adulthood, or that early-onset OCD and OCPD share a common pathogenesis.

Aging, not menopause, is associated with higher prevalence of hyperuricemia among older women.

PubMed

Krishnan, Eswar; Bennett, Mihoko; Chen, Linjun

2014-11-01

This work aims to study the associations, if any, of hyperuricemia, gout, and menopause status in the US population. Using multiyear data from the National Health and Nutrition Examination Survey, we performed unmatched comparisons and one to three age-matched comparisons of women aged 20 to 70 years with and without hyperuricemia (serum urate ≥6 mg/dL). Analyses were performed using survey-weighted multiple logistic regression and conditional logistic regression, respectively. Overall, there were 1,477 women with hyperuricemia. Age and serum urate were significantly correlated. In unmatched analyses (n = 9,573 controls), postmenopausal women were older, were heavier, and had higher prevalence of renal impairment, hypertension, diabetes, and hyperlipidemia. In multivariable regression, after accounting for age, body mass index, glomerular filtration rate, and diuretic use, menopause was associated with hyperuricemia (odds ratio, 1.36; 95% CI, 1.05-1.76; P = 0.002). In corresponding multivariable regression using age-matched data (n = 4,431 controls), the odds ratio for menopause was 0.94 (95% CI, 0.83-1.06). Current use of hormone therapy was not associated with prevalent hyperuricemia in both unmatched and matched analyses. Age is a better statistical explanation for the higher prevalence of hyperuricemia among older women than menopause status.

Intrauterine growth restriction and placental gene expression in severe preeclampsia, comparing early-onset and late-onset forms.

PubMed

Nevalainen, Jaana; Skarp, Sini; Savolainen, Eeva-Riitta; Ryynänen, Markku; Järvenpää, Jouko

2017-10-26

To evaluate placental gene expression in severe early- or late-onset preeclampsia with intrauterine growth restriction compared to controls. Chorionic villus sampling was conducted after cesarean section from the placentas of five women with early- or late-onset severe preeclampsia and five controls for each preeclampsia group. Microarray analysis was performed to identify gene expression differences between the groups. Pathway analysis showed over-representation of gene ontology (GO) biological process terms related to inflammatory and immune response pathways, platelet development, vascular development, female pregnancy and reproduction in early-onset preeclampsia. Pathways related to immunity, complement and coagulation cascade were overrepresented in the hypergeometric test for the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. Ten genes (ABI3BP, C7, HLA-G, IL2RB, KRBOX1, LRRC15, METTL7B, MPP5, RFLNB and SLC20A) had a ≥±1 fold expression difference in severe early-onset preeclampsia group compared to early controls. There were 362 genes that had a ≥±1 fold expression difference in severe early-onset preeclampsia group compared to late-onset preeclampsia group including ABI3BP, C7, HLA-G and IL2RB. There are significant differences in placental gene expression between severe early- and late-onset preeclampsia when both are associated with intrauterine growth restriction. ABI3BP, C7, HLA-G and IL2RB might contribute to the development of early form of severe preeclampsia.

Obstetrical outcomes in patients with early onset gestational diabetes.

PubMed

Gupta, Simi; Dolin, Cara; Jadhav, Ashwin; Chervenak, Judith; Timor-Tritsch, Ilan; Monteagudo, Ana

2016-01-01

The objective of this study was to characterize patients with early onset gestational diabetes and compare outcomes to patients diagnosed with standard gestational diabetes and pregestational diabetes. This is a retrospective cohort study of patients diagnosed with gestational or pregestational diabetes. All patients received a glucose challenge test at their first prenatal visit to diagnose early onset gestational diabetes and were recommended to have postpartum glucose tolerance tests to detect undiagnosed type 2 diabetes. Outcomes were compared between patients with early onset gestational diabetes and both standard gestational diabetes and pregestational diabetes with p < 0.05 was used for significance. Four hundred and twenty-four patients met the inclusion criteria. Nine percent of the patients with early onset gestational diabetes were found to have undiagnosed type 2 diabetes based on postpartum testing and 91% to have resolution in the postpartum period. No patient with early onset gestational diabetes and resolution in the postpartum period had abnormal screening for renal or ophthalmologic disease, but 5% had abnormal fetal echocardiograms. These patients were more likely to require pharmacotherapy for glycemic control than patients with standard gestational diabetes and less likely than patients with pregestational diabetes (55% versus 39% versus 81%). Most patients diagnosed with early onset gestational diabetes do not have undiagnosed type 2 diabetes but do have unique characteristics and obstetrical outcomes.

Early Reticulocytosis and Anemia Are Associated with Abnormal and Conditional Transcranial Doppler Velocities in Children with Sickle Cell Anemia.

PubMed

Meier, Emily Riehm; Fasano, Ross M; Estrada, Monica; He, Jianping; Luban, Naomi L C; McCarter, Robert

2016-02-01

To improve prediction of sickle cell anemia severity at an early age, we evaluated whether absolute reticulocyte count (ARC) or hemoglobin (Hb) levels during early infancy (2-6 months of age) in patients with sickle cell anemia predict the risk of later developing an abnormal (abTCD) or conditional (cdTCD) Transcranial Doppler (TCD). We used chart review to identify 121 consecutive patients who underwent TCD screening and had steady state ARC and Hb levels recorded between 2 and 6 months of age. Cox regression analysis was used to determine the relationship between ARC, Hb levels, and risk of developing cdTCD/abTCD over time. Mean ARC in early infancy was highest and mean Hb lowest in those children with abTCDs and cdTCDs. Cox regression analysis revealed that those subjects with an ARC ≥200 K/μL in early infancy had nearly 3 times the risk of having an abTCD/cdTCD than the group with an ARC <200 K/μL, and patients with a Hb <8.5 g/dL had 2.7 times the risk of having an abTCD/cdTCD. These data suggest that both elevated ARC and low baseline Hb during early infancy are associated with an increased risk of developing a cdTCD or abTCD later in childhood. Copyright © 2016 Elsevier Inc. All rights reserved.

Age at onset of DSM-IV pathological gambling in a non-treatment sample: Early- versus later-onset.

PubMed

Black, Donald W; Shaw, Martha; Coryell, William; Crowe, Raymond; McCormick, Brett; Allen, Jeff

2015-07-01

Pathological gambling (PG) is a prevalent and impairing public health problem. In this study we assessed age at onset in men and women with PG and compared the demographic and clinical picture of early- vs. later-onset individuals. We also compared age at onset in PG subjects and their first-degree relatives with PG. Subjects with DSM-IV PG were recruited during the conduct of two non-treatment clinical studies. Subjects were evaluated with structured interviews and validated questionnaires. Early-onset was defined as PG starting prior to age 33years. Age at onset of PG in the 255 subjects ranged from 8 to 80years with a mean (SD) of 34.0 (15.3) years. Men had an earlier onset than women. 84% of all subjects with PG had developed the disorder by age 50years. Early-onset subjects were more likely to be male, to prefer action games, and to have substance use disorders, antisocial personality disorder, attention deficit/hyperactivity disorder, trait impulsiveness, and social anxiety disorder. Later-onset was more common in women and was associated with a preference for slots and a history of sexual abuse. Age at onset of PG is bimodal and differs for men and women. Early-onset PG and later-onset PG have important demographic and clinical differences. The implications of the findings are discussed. Copyright © 2015 Elsevier Inc. All rights reserved.

HOMA-IR and the risk of hyperuricemia: a prospective study in non-diabetic Japanese men.

PubMed

Nakamura, Koshi; Sakurai, Masaru; Miura, Katsuyuki; Morikawa, Yuko; Nagasawa, Shin-Ya; Ishizaki, Masao; Kido, Teruhiko; Naruse, Yuchi; Nakashima, Motoko; Nogawa, Kazuhiro; Suwazono, Yasushi; Nakagawa, Hideaki

2014-10-01

To examine the relation of insulin resistant status determined by homeostasis model assessment of insulin resistance (HOMA-IR) with the risk of incident hyperuricemia. The study participants included 2071 Japanese men without hyperuricemia and diabetes, aged 35-54 years. The participants had undergone annual heath examinations for 6 years to compare incident hyperuricemia (serum uric acid >416.4μmol/L (7.0mg/dL) and/or taking medication for hyperuricemia) in four groups based on quartiles of baseline HOMA-IR. During follow-up there were 331 incident cases of hyperuricemia. The hazard ratios for hyperuricemia, compared with HOMA-IR ≤0.66, were 1.42 (95% confidence interval 1.02-1.98) for HOMA-IR 0.67-0.98, 1.20 (0.86-1.68) for HOMA-IR 0.99-1.49 and 1.44 (1.04-1.98) for HOMA-IR ≥1.50 after adjustment for baseline serum uric acid, creatinine, hypercholesterolemia and hypertension status, age, alcohol intake, and smoking and exercise habits. The hazard ratio associated with an increase of one standard deviation in lnHOMA-IR (1.85 as one geometric standard deviation of HOMA-IR) was 1.14 (1.03-1.28) (p for trend=0.02). Increased HOMA-IR independently predicted the subsequent development of hyperuricemia. Insulin resistance itself or compensatory hyperinsulinemia may contribute to the development of hyperuricemia. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Unusual early-onset Huntingtons disease.

PubMed

Vargas, Antonio P; Carod-Artal, Francisco J; Bomfim, Denise; Vázquez-Cabrera, Carolina; Dantas-Barbosa, Carmela

2003-06-01

Huntington's disease is an autosomal dominant progressive neurodegenerative disorder characterized by involuntary movements, cognitive decline, and behavioral disorders leading to functional disability. In contrast to patients with adult onset, in which chorea is the major motor abnormality, children often present with spasticity, rigidity, and significant intellectual decline associated with a more rapidly progressive course. An unusual early-onset Huntington's disease case of an 11-year-old boy with severe hypokinetic/rigid syndrome appearing at the age of 2.5 years is presented. Clinical diagnosis was confirmed by polymerase chain reaction study of the expanded IT-15 allele with a compatible size of 102 cytosine-adenosine-guanosine repeats L-Dopa mildly ameliorated rigidity, bradykinesia, and dystonia. We conclude that Huntington's disease should be included in the differential diagnoses of regressive syndromes of early childhood.

Pearson marrow pancreas syndrome in patients suspected to have Diamond-Blackfan anemia.

PubMed

Gagne, Katelyn E; Ghazvinian, Roxanne; Yuan, Daniel; Zon, Rebecca L; Storm, Kelsie; Mazur-Popinska, Magdalena; Andolina, Laura; Bubala, Halina; Golebiowska, Sydonia; Higman, Meghan A; Kalwak, Krzysztof; Kurre, Peter; Matysiak, Michal; Niewiadomska, Edyta; Pels, Salley; Petruzzi, Mary Jane; Pobudejska-Pieniazek, Aneta; Szczepanski, Tomasz; Fleming, Mark D; Gazda, Hanna T; Agarwal, Suneet

2014-07-17

Pearson marrow pancreas syndrome (PS) is a multisystem disorder caused by mitochondrial DNA (mtDNA) deletions. Diamond-Blackfan anemia (DBA) is a congenital hypoproliferative anemia in which mutations in ribosomal protein genes and GATA1 have been implicated. Both syndromes share several features including early onset of severe anemia, variable nonhematologic manifestations, sporadic genetic occurrence, and occasional spontaneous hematologic improvement. Because of the overlapping features and relative rarity of PS, we hypothesized that some patients in whom the leading clinical diagnosis is DBA actually have PS. Here, we evaluated patient DNA samples submitted for DBA genetic studies and found that 8 (4.6%) of 173 genetically uncharacterized patients contained large mtDNA deletions. Only 2 (25%) of the patients had been diagnosed with PS on clinical grounds subsequent to sample submission. We conclude that PS can be overlooked, and that mtDNA deletion testing should be performed in the diagnostic evaluation of patients with congenital anemia. © 2014 by The American Society of Hematology.

[Fanconi Anemia, Complementation Group D1 Caused by Biallelic Mutations of BRCA2 Gene--Case Report].

PubMed

Puchmajerová, A; Švojgr, K; Novotná, D; Macháčková, E; Sumerauer, D; Smíšek, P; Kodet, R; Kynčl, M; Křepelová, A; Foretová, L

2016-01-01

Fanconi anemia is a rare autosomal recessive disorder, clinically and genetically heterogeneous, characterized by typical clinical features, such as short stature, microcephaly, skeletal abnormalities, abnormal skin pigmentations, developmental delay and congenital heart, kidney anomalies etc. Pancytopenia leading to bone marrow failure occurs in the first decade. Patients with Fanconi anemia have a high risk of hematologic malignancies and solid tumors. The diagnosis of Fanconi anemia is based on cytogenetic testing for increased rates of spontaneous chromosomal breakage and increased sensitivity to diepoxybutane or mitomycin C. Fanconi anemia is a heterogeneous disorder, at least 15 complementation groups are described, and 15 genes in which mutations are responsible for all of the 15 Fanconi anemia complementation groups have been identified. Unlike other Fanconi anemia complementation groups, for complementation group D1 (FANCD1), the bone marrow failure is not a typical feature, but early-onset leukemia and specific solid tumors, most often medulloblastoma and Wilms tumor, are typical for this complementation group.

Sildenafil citrate therapy for severe early-onset intrauterine growth restriction.

PubMed

von Dadelszen, P; Dwinnell, S; Magee, L A; Carleton, B C; Gruslin, A; Lee, B; Lim, K I; Liston, R M; Miller, S P; Rurak, D; Sherlock, R L; Skoll, M A; Wareing, M M; Baker, P N

2011-04-01

Sildenafil citrate therapy for severe early-onset intrauterine growth restriction. BJOG 2011;118:624-628. Currently, there is no effective therapy for severe early-onset intrauterine growth restriction (IUGR). Sildenafil citrate vasodilates the myometrial arteries isolated from women with IUGR-complicated pregnancies. Women were offered Sildenafil (25 mg three times daily until delivery) if their pregnancy was complicated by early-onset IUGR [abdominal circumference (AC)< 5th percentile] and either the gestational age was <25(+0) weeks or an estimate of the fetal weight was <600 g (excluding known fetal anomaly/syndrome and/or planned termination). Sildenafil treatment was associated with increased fetal AC growth [odds ratio, 12.9; 95% confidence interval (CI), 1.3, 126; compared with institutional Sildenafil-naive early-onset IUGR controls]. Randomised controlled trial data are required to determine whether Sildenafil improves perinatal outcomes for early-onset IUGR-complicated pregnancies. © 2011 The Authors BJOG An International Journal of Obstetrics and Gynaecology © 2011 RCOG.

Pathophysiology and laboratory diagnosis of pernicious anemia.

PubMed

Toh, Ban-Hock

2017-02-01

Pernicious anemia is the hematologic manifestation of chronic atrophic gastritis affecting the corpus of the stomach that denudes the gastric mucosa of gastric parietal cells. Asymptomatic autoimmune gastritis, a chronic inflammatory disease of the gastric mucosa, precedes the onset of corpus atrophy by 10-20 years. The gastritis arises from activation of pathologic Th1 CD4 T cells to gastric H/K ATPase that is normally resident on gastric mucosal secretory membranes. The onset of autoimmune gastritis is marked by circulating parietal cell antibody to gastric H/K ATPase. Gastric parietal cells produce two essential biologics: intrinsic factor and HCl acid. Pernicious anemia is a consequence of intrinsic factor loss and neutralizing intrinsic factor antibody that impairs cobalamin absorption. Acid loss leads to iron deficiency anemia that precedes cobalamin-deficient pernicious anemia by 20 years. Laboratory diagnosis rests on parietal cell antibody with or without intrinsic factor antibody, cobalamin-deficient megaloblastic anemia and elevated serum gastrin from loss of acid secretion. Autoimmune gastritis is associated with autoimmune thyroiditis and type 1 diabetes mellitus.

Theory of Mind differences in older patients with early-onset and late-onset paranoid schizophrenia.

PubMed

Smeets-Janssen, M M J; Meesters, P D; Comijs, H C; Eikelenboom, P; Smit, J H; de Haan, L; Beekman, A T F; Stek, M L

2013-11-01

Theory of Mind (ToM) is considered an essential element of social cognition. In younger schizophrenia patients, ToM impairments have extensively been demonstrated. It is not clear whether similar impairments can be found in older schizophrenia patients and if these impairments differ between older patients with early-onset and late-onset schizophrenia. Theory of Mind abilities were assessed using the Hinting Task in 15 older patients (age 60 years and older) with early-onset paranoid schizophrenia, 15 older patients with late-onset paranoid schizophrenia and 30 healthy controls. ANCOVA was performed to test differences between groups. Analyses were adjusted for level of education. Effect sizes, partial eta squared (ε(2) ), were computed as an indication of the clinical relevance of the findings. Patients with early-onset schizophrenia scored significantly lower on the Hinting Task (mean 16.1; SD 4.3) compared with patients with late-onset schizophrenia (mean 18.6; SD 1.5) and with healthy controls (mean 19.0; SD 1.4). The effect size of this difference was large (ε(2)  = 0.2). These results suggest that ToM functioning may be a protective factor modulating the age at onset of psychosis. Further studies into the relationship between social cognition and onset age of psychosis are warranted. Copyright © 2013 John Wiley & Sons, Ltd.

Sweetened beverages intake, hyperuricemia and metabolic syndrome: the Mexico City Diabetes Study.

PubMed

López-Molina, Rubén; Parra-Cabrera, Socorro; López-Ridaura, Ruy; González-Villalpando, María E; Ferrannini, Ele; González-Villalpando, Clicerio

2013-12-01

OBJECTIVE. To determine prevalence of hyperuricemia and its relation with intake of sweetened beverages (SB) and metabolic syndrome (MS) in low income urban Mexican population. MATERIALS AND METHODS. A cross-sectional analysis of The Mexico City Diabetes Study, a prospective population-based investigation (1 173 participants) was performed. We used logistic regression, adjusted by pertinent variables. We determined prevalence of hyperuricemia and explored associations of uric acid levels with MS and intake of SB. RESULTS. Prevalence of hyperuricemia was 26.5 and 19.8% in males and females respectively. In an adjusted multivariate model, body mass index, waist circumference, and triglyceride were higher as uric acid quartiles increased (p<0.005-0.001). The odds ratio for MS was 1.48 for 3rd uric acid quartile and 2.03 for 4th quartile. Higher consumption of SB was associated with higher uric acid levels (p<0.001). CONCLUSION. Prevalence of hyperuricemia is high. Potential association with intake of SB, resulting in metabolic alterations should be considered.

Hyperuricemia and metabolic syndrome in type 2 diabetes mellitus patients at Hawassa university comprehensive specialized hospital, South West Ethiopia.

PubMed

Woyesa, Shiferaw Bekele; Hirigo, Agete Tadewose; Wube, Temesgen Bizuayehu

2017-12-12

. Therefore, regular health information about life style modification, early diagnosis and treatment for hyperuricemia and metabolic syndrome are essential to reduce hyperuricemia and metabolic syndrome in type 2 diabetic patients.

Comparing Characteristics of Early-Onset Injection Drug Users to Those With Late-Onset Injection in Kermanshah, Iran.

PubMed

Jorjoran Shushtari, Zahra; Noroozi, Alireza; Mirzazadeh, Ali; Ahounbar, Elahe; Hajbi, Ahmad; Najafi, Mohammad; Bazrafshan, Ali; Farhadi, Mohammad Hossin; Farhoudian, Ali; Higgs, Peter; Shahboulagh, Farahnaz Mohammadi; Waye, Katherine; Noroozi, Mehdi

2017-05-12

Characteristics and behaviors of early-onset injection drug users are under studied topics in Iran. This study aimed to identify and compare the demographic characteristics as well as the drug using behaviors of early-onset and late-onset injection drug users in Kermanshah, West Iran. In this cross-sectional study using snowball and convenience sampling, we recruited 450 people during the Fall of 2014 from two drop in centers in Kermanshah, Iran. We collected data through face-to-face interviews. Early-onset injection is defined as whether the person reported their first injection at 22 years of age or younger. Subsequently, late-onset injection is defined as 23 years of age or older. We compared the characteristics of the two groups through both univariate and multiple logistic analyses. Overall, 54% (CI 95%: 44.3%, 62.2%) were early injectors. After controlling for low socioeconomic status, initiation of drug use at a young age, multiple drug use and methamphetamine use were all significantly associated with a higher likelihood of early-onset injection. Additionally, early-onset injection was associated with recent syringe borrowing (OR = 2.6, p = 0.001), recent syringe lending (OR = 1.4, p = 0.01), recent cooker sharing (OR = 3.2, p = 0.01) and injecting two or more times a day (OR = 2.2, p = 0.04). Early-onset injectors were more likely to report a lower socioeconomic status, initiation of first drug use at a younger age, using methamphetamine alongside polydrug use, and engaging in higher risk taking behaviors like borrowing needles. With these associations, the study emphasizes the need for drug-prevention programs to focus on the transition to injection drug use at younger ages.

Losartan alleviates hyperuricemia-induced atherosclerosis in a rabbit model.

PubMed

Zheng, Hongchao; Li, Ning; Ding, Yueyou; Miao, Peizhi

2015-01-01

To investigate the mechanisms underlying the therapeutic effects of losartan on hyperuricemia-induced aortic atherosclerosis, in an experimental rabbit model. Male rabbits (n = 48) were divided into control, hyperuricemia (HU), hypercholesterolemia + hyperuricemia (HC + HU) and high-purine with 30-mg/kg/d losartan (HU + losartan) groups. Serum uric acid (UA) and plasma renin and angiotensin II activities were determined. Aortic tissue specimens were analyzed for histological changes and proliferating cell nuclear antigen (PCNA). Liver tissues were sampled for quantitative analyses of liver low-density lipoprotein receptor (LDLR) mRNA and protein via reverse transcription polymerase chain reaction and western blotting. After 12 weeks, serum UA and plasma renin and plasma angiotensin II activities were enhanced in the HU and HU + HC groups (P < 0.001) compared to the control, whereas in the HU + losartan group plasma renin activity was not different and serum UA concentrations as well as plasma angiotensin II activity were moderately enhanced (P < 0.05). Smooth muscle cell (SMC) PCNA expression increased strongly in the HU and HU + HC groups (P < 0.001), but was less pronounced in the HU + losartan group. In contrast, transcription and expression of LDLR mRNA and protein were significantly higher in the control and HU + losartan groups compared to the HU and HU + HC groups. Both the HU and HU + HC groups had elevated intima thickness and intima areas compared to the control and HU + losartan groups. Losartan can alleviate experimental atherosclerosis induced by hyperuricemia.

[Long-term Follow-up of Patients with Hepatitis-Associated Aplastic Anemia].

PubMed

You, Ya-Hong; Meng, Xian-Bin; Li, Xing-Xin; Ge, Mei-Li; Nie, Neng; Huang, Jin-Bo; Zhang, Jing; Huang, Zhen-Dong; Shao, Ying-Qi; Shi, Jun; Zheng, Yi-Zhou

2017-08-01

To explore the clinical characteristic, therapeutic efficacy and prognosis of patients with hepatitis-associated aplasitc anemia (HAAA). the clinical data and labrotatory examination results of 30 cases of HAAA were analyzed retrospectively, the 6-month response ratio and overall survival (OS) were assessed. HAAA most commonly occured in males, with the occurence rate of males and females was 4:1, the median onset age was 16 (4-43) years old, HAAA oriented focus on sever aplastic anemia (SAA)(4 cases,13%) and very sever aplastic anemia (VSAA)(22 cases,73%). Aplastic anemia (AA) could be seen on occurence of hepatitis (accompanied aplastic anemia) (7 cases,23%), or after the onset of hepatits (delayed aplastic anemia) (23 cases,77%), but more often occured in the latter. Statistical analysis showed that when compared with the patients of delayed aplastic anemia, patients accompanied aplastic anemia possesses lower levels of glutamic-pyruvic transaminase(ALT), aspertate aminotransferase (AST) and total bilirubin (TBIL)(P=0.042,0.012,0.001), and possessed a more obvious lymphoid cell disorder when AA occured, with more lower peripheral blood CD19 + B cells proportion (P=0.046) and more obvious imbalance of CD4 + /CD8 + ratio, but the difference was no statistical significant (P=0538). Factors affecting the 6-month respose were the severity of AA (P=0.044), the peak level of bilirubin of hepatitis (P=0.006) and the propotion of mature monocyte in bone marrow (P=0.034). The long-term follow-up showed that the 2-year OS of HAAA was 64.3±9.2%, the 6-month curative efficacy significantly affect the prognosis (P<0.001). HAAA more often occur in young male, HAAA is mainly SAA and VSAA and mostly non-A-C hepatitis associated aplastic anemia, patients usually have a high incidence of early infection. Patients acompanied with aplastic anemia possess more obvious immunological derangement; the treatment efficacy for HAAA is poor, patients who haven't obtained 6-month response

Late onset dysthymic disorder and major depression differ from early onset dysthymic disorder and major depression in elderly outpatients.

PubMed

Devanand, D P; Adorno, Elizabeth; Cheng, Jocelyn; Burt, Tal; Pelton, G H Gregory H; Roose, S P Steven P; Sackeim, H A Harold A

2004-03-01

Age of onset may affect clinical features and prognosis in elderly patients with major depression (MDD), but there is a lack of such data in elderly patients with dysthymic disorder (DD) and systematic comparisons of late onset MDD and DD have not been conducted. In a Late Life Depression Clinic, patients > or = 60 years old who met DSM-III-R or DSM-IV criteria for MDD or DD were studied. The 24-item Hamilton Rating Scale for Depression (HRSD) and SCID-P were completed, family history was obtained, and medical illnesses were assessed. In the total sample (n=370; 211 MDD and 159 DD), compared to early onset patients, late onset (onset > or =60 years) patients had a higher rate of cardiovascular disease (chi(2)=4.12, df=1, P<0.05), lower rate of anxiety disorder (chi(2)=4.19, df=1, P<0.05), and a lower rate of family history of affective disorder (chi(2)=9.37, df=1, P<0.002). Late onset DD patients were more likely to have cardiovascular disease than early onset DD patients (chi(2)=5.63, df=1, P<0.02), but the rate of cardiovascular disease did not differ between late and early onset MDD patients (chi(2)=0.35, df=1, P<0.6). Late onset MDD patients were less likely to have a family history of affective disorder than early onset MDD patients (chi(2)=10.71, df=1, P<0.001). Prevalence of anxiety disorders did not differ between the early and late onset MDD patients (chi(2)=0.07, df=1, P<0.79), but was more common in the early onset DD compared to the late onset DD patients (17.98% versus 4.29%, chi(2)=6.98, df=1, P<0.01). Late onset DD did not differ from late onset MDD in the rates of cardiovascular disease, anxiety disorders, and family history of affective disorder. Excluding patients with double depression (n=32) did not alter the cardiovascular or family history findings, but the difference in anxiety disorders between early and late onset DD patients was no longer significant. Academic clinic sample results may not generalize to community populations. In the

Renal Oxidative Stress Induced by Long-Term Hyperuricemia Alters Mitochondrial Function and Maintains Systemic Hypertension

PubMed Central

Cristóbal-García, Magdalena; García-Arroyo, Fernando E.; Arellano-Buendía, Abraham S.; Madero, Magdalena; Rodríguez-Iturbe, Bernardo; Pedraza-Chaverrí, José; Zazueta, Cecilia; Johnson, Richard J.; Sánchez Lozada, Laura-Gabriela

2015-01-01

We addressed if oxidative stress in the renal cortex plays a role in the induction of hypertension and mitochondrial alterations in hyperuricemia. A second objective was to evaluate whether the long-term treatment with the antioxidant Tempol prevents renal oxidative stress, mitochondrial alterations, and systemic hypertension in this model. Long-term (11-12 weeks) and short-term (3 weeks) effects of oxonic acid induced hyperuricemia were studied in rats (OA, 750 mg/kg BW), OA+Allopurinol (AP, 150 mg/L drinking water), OA+Tempol (T, 15 mg/kg BW), or vehicle. Systolic blood pressure, renal blood flow, and vascular resistance were measured. Tubular damage (urine N-acetyl-β-D-glucosaminidase) and oxidative stress markers (lipid and protein oxidation) along with ATP levels were determined in kidney tissue. Oxygen consumption, aconitase activity, and uric acid were evaluated in isolated mitochondria from renal cortex. Short-term hyperuricemia resulted in hypertension without demonstrable renal oxidative stress or mitochondrial dysfunction. Long-term hyperuricemia induced hypertension, renal vasoconstriction, tubular damage, renal cortex oxidative stress, and mitochondrial dysfunction and decreased ATP levels. Treatments with Tempol and allopurinol prevented these alterations. Renal oxidative stress induced by hyperuricemia promoted mitochondrial functional disturbances and decreased ATP content, which represent an additional pathogenic mechanism induced by chronic hyperuricemia. Hyperuricemia-related hypertension occurs before these changes are evident. PMID:25918583

Discrete β-adrenergic mechanisms regulate early and late erythropoiesis in erythropoietin-resistant anemia.

PubMed

Hasan, Shirin; Mosier, Michael J; Szilagyi, Andrea; Gamelli, Richard L; Muthumalaiappan, Kuzhali

2017-10-01

Anemia of critical illness is resistant to exogenous erythropoietin. Packed red blood cells transfusions is the only treatment option, and despite related cost and morbidity, there is a need for alternate strategies. Erythrocyte development can be divided into erythropoietin-dependent and erythropoietin-independent stages. We have shown previously that erythropoietin-dependent development is intact in burn patients and the erythropoietin-independent early commitment stage, which is regulated by β1/β2-adrenergic mechanisms, is compromised. Utilizing the scald burn injury model, we studied erythropoietin-independent late maturation stages and the effect of β1/β2, β-2, or β-3 blockade in burn mediated erythropoietin-resistant anemia. Burn mice were randomized to receive daily injections of propranolol (nonselective β1/β2 antagonist), nadolol (long-acting β1/β2 antagonist), butoxamine (selective β2 antagonist), or SR59230A (selective β3 antagonist) for 6 days after burn. Total bone marrow cells were characterized as nonerythroid cells, early and late erythroblasts, nucleated orthochromatic erythroblasts and enucleated reticulocyte subsets using CD71, Ter119, and Syto-16 by flow cytometry. Multipotential progenitors were probed for MafB expressing cells. Although propranolol improved early and late erythroblasts, only butoxamine and selective β3-antagonist administrations were positively reflected in the peripheral blood hemoglobin and red blood cells count. While burn impeded early commitment and late maturation stages, β1/β2 antagonism increased the early erythroblasts through commitment stages via β2 specific MafB regulation. β3 antagonism was more effective in improving overall red blood cells through late maturation stages. The study unfolds novel β2 and β3 adrenergic mechanisms orchestrating erythropoietin resistant anemia after burn, which impedes both the early commitment stage and the late maturation stages, respectively. Copyright © 2017

Early changes of the anemia phenomenon in male 100-km ultramarathoners.

PubMed

Chiu, Yu-Hui; Lai, Jiun-I; Wang, Shih-Hao; How, Chorng-Kuang; Li, Li-Hua; Kao, Wei-Fong; Yang, Chen-Chang; Chen, Ray-Jade

2015-02-01

Sports anemia is a widely observed phenomenon after prolonged running. There are various factors that contribute to sports anemia, including hemodilution, exercise-induced oxidative stress, iron deficiency, gastrointestinal bleeding, hematuria, and hemolysis resulting from foot-strike and/or from compression of contracting muscles on capillaries. Until now, there has been no published report that describes the overall hematological, urinary, and fecal consequences in Asian male ultramarathoners after a 100-km (62.5-mile) ultramarathon event. A total of 25 male runners were recruited into our study. Blood was drawn 1 week before, immediately after, and then 24 hours subsequent to the race. Hematological samples were analyzed for the anemia phenomenon. Additionally, urinary and fecal samples were collected before and after the race for detection of occult blood. The blood hemoglobin and erythropoietin values of the recruited runners showed a statistically significant rise in the immediate post-race values and a rapid drop in values at 24 hours post-race. Blood concentrations of red blood cells and hematocrit were significantly lower at 24 hours post-race compared with pre-race. The white blood cell count, interleukin-6, tumor necrosis factor-alpha, high-sensitivity C-reactive protein, and ferritin all showed significant increases both immediately after and 24 hours post-race compared with pre-race hematological values. There were immediate decreases of both haptoglobin and iron, as well as an increase of total iron-binding capacity levels in post-race blood tests. For both urinary and fecal samples, there was a statistically significant difference between the pre- and post-race results in occult blood. Running a 100-km ultramarathon will induce substantial sports anemia, and oxidative stress response, hemolysis, hematuria, and gastrointestinal bleeding are typical factors that contribute to its onset. Copyright © 2014. Published by Elsevier Taiwan.

Value of three-dimensional speckle tracking echocardiography to assess left ventricular function in hyperuricemia patients.

PubMed

Zhang, Xiaojie; Lu, Qing; Zhang, Zhuojun; Chen, Yongle; Wang, Yanan; Wang, Youngshi; Li, Zheng; Jiang, Lindi

2018-05-22

To assess the value of three-dimensional speckle tracking echocardiography (3D STE) in evaluating the left ventricular (LV) function in hyperuricemia patients. We enrolled 15 healthy controls and 40 hyperuricemia patients and collected and analyzed full-volume 3D STE images of the left ventricle in the apical four-chamber heart view. Laboratory tests and 3D STE parameters, including left ventricular ejection fraction, left ventricular end-diastolic volume, left ventricular end-systolic volume, stroke volume (SV), global longitudinal strain (GLS), and global circumferential strain (GCS), were compared between hyperuricemia patients and healthy controls. Hyperuricemia patients exhibited higher body mass index (24.70 ± 2.9 vs. 21.83 ± 2.4 kg/m 2 , p = 0.001), C-reactive protein (5.82 ± 9.4 vs. 1.12 ± 1.8 g/L, p = 0.012), alanine transaminase (34.26 ± 26.6 vs. 17.60 ± 13.0 U/L, p = 0.011), aspartate transaminase (24.90 ± 11.3 vs. 17.70 ± 4.1 U/L, p = 0.001), blood urea nitrogen (5.11 ± 1.6 vs. 4.18 ± 0.6 mmol/L, p = 0.046), and serum creatinine (90.25 ± 14.6 vs. 77.93 ± 10.8 μmol/L, p = 0.006) levels, as well as a lower estimated glomerular filtration rate (87.87 ± 16.5 vs. 103.64 ± 11.3 mL/min/1.73m 2 , p = 0.002). The 3D STE parameters reflecting LV function, including SV (54.71 ± 9.6 vs. 61.92 ± 14.4 mL, p = 0.024), GLS (- 20.51 ± 4.0 vs. - 23.20 ± 4.0%, p = 0.019), and GCS (- 31.30 ± 5.0 vs. - 35.65 ± 2.5%, p = 0.000), were significantly decreased in hyperuricemia patients. Furthermore, GCS was significantly correlated with the serum uric acid (sUA) level even after adjustment of confounding variables like age, body mass index, and serum creatinine. 3D STE is a novel technique for recognizing the early decline in LV function, with GLS and GCS serving as reliable indicators, in hyperuricemia patients. Moreover

Sweetened beverage consumption and the risk of hyperuricemia in Mexican adults: a cross-sectional study

PubMed Central

2014-01-01

Background The prevalence of hyperuricemia has doubled worldwide during the last few decades. The substantial increase in sweetened beverage (SB) consumption has also coincided with the secular trend of hyperuricemia. Recent studies do show that the consumption of SB can induce hyperuricemia. However, the association between SB and hyperuricemia remains unclear. The aim of this study was to evaluate the association between SB consumption and levels of uric acid in Mexican adults. Methods We performed a cross-sectional analysis of data from selected adults participating in the baseline assessment of the Health Workers Cohort Study. A total of 6,705 participants of both sexes between ages 18 and 70 years were included. SB intake was estimated using a validated semi-quantitative food frequency questionnaire. Biochemical and anthropometric information was collected using standard procedures. Hyperuricemia was defined as uric acid levels ≥ 7.0 mg/dL in men and ≥ 5.8 mg/dL in women. The association of interest was assessed by multiple logistic regression models. Results The odds ratios (OR) for hyperuricemia in men who consume 0.5-1 SB/day was 1.59 (95% CI; 1.05-2.40) and 2.29 (95% CI; 1.55-3.38) for those who consume ≥3 SB/day when compared to men who consume less than half a SB/day. In women, the OR for hyperuricemia for those who consume >1.0- < 3.0 SB/day was 1.33 (95% CI; 1.04-1.70) and 1.35 (95% CI; 1.04-1.75) for those who consume ≥3 SB/day when compared to women who consume less than half a SB/day, independent of other covariables. Men and women with high SB consumption and a body mass index (BMI) ≥ 25 Kg/m2 had greater risk for hyperuricemia than men and women with low SB consumption and normal BMI < 25 Kg/m2. Conclusions Our findings suggest that the consumption of SB is associated with an increased risk of hyperuricemia in Mexican adults. However, longitudinal research is needed to confirm the association between SB intake and

ABCG2 contributes to the development of gout and hyperuricemia in a genome-wide association study.

PubMed

Chen, Chung-Jen; Tseng, Chia-Chun; Yen, Jeng-Hsien; Chang, Jan-Gowth; Chou, Wen-Cheng; Chu, Hou-Wei; Chang, Shun-Jen; Liao, Wei-Ting

2018-02-16

Although many genome-wide association studies (GWASs) of hyperuricemia or gout have been reported, the related genetic factors and the mechanisms from hyperuricemia to gouty attack remain unclear. This study aimed to identify genetic factors and pathogenesis of gout from hyperuricemia by genome-wide association study (GWAS). 747 gout patients, 747 hyperuricemia and 2071 age-matched controls were recruited and analyzed with Affymetrix 650 K chip to find the related genetic variants. The functions of the related genes were investigated in an endothelial cell (EC) with urate crystal stimulation. The GWAS results showed 36 SNPs to be strongly associated with gout compared to controls (all p-values < 10 -7 ). Whereas the rs2231142 in ABCG2 gene had significant associations between gout and controls, between gout and hyperuricemia, and between hyperuricemia and controls (all p-values < 10 -7 ), and the ORs were 4.34, 3.37 and 2.15 (all p-values < 0.001) after adjustment of potential confounders, respectively. The cell model showed significantly higher IL-8 release from EC combined with ABCG2 knockdown. We concluded that ABCG2 gene contributed to hyperuricemia but also gout, and that it was involved in the inflammation dysregulation via augmented IL-8 release in EC.

Blood-Based Biomarkers of Early-Onset Breast Cancer

DTIC Science & Technology

2015-10-01

n=51). The women with early-onset breast cancer were disease and treatment free for at least 6 months at time of blood donation . Cases and controls...were age matched to age at blood donation . 2. KEYWORDS: biomarkers, early-onset breast cancer, expression profiling, risk-assessment, breast cancer...matched controls. This prospectively collected cohort consists of blood donated to blood banks ~15 years ago and subsequently linked to the California

[Early-onset and late-onset male hypogonadotropic hypogonadism and osteoporosis].

PubMed

Okada, Hiroshi; Shin, Takeshi; Kobori, Yoshitomo

2016-07-01

Hypogonadism is classified into two major clinical entities, namely early-onset hypogonadism and late-onset hypogonadism. The former is characterized by the malfunction of hypothalamo-pituitary-gonadal(testicular)axis or by the primary hypofunction of testes(e.g. Klinefelter's syndrome). The latter is summarized as LOH syndrome which is attributed to the dropped level of bioavailable testosterone. In these diseases testosterone is the key molecule which may cause various symptoms relating not only to physical health but also to mental or psychologic health. In this review issues concerning bone health in these disease are described.

Early childhood predictors of early onset of smoking: a birth prospective study.

PubMed

Hayatbakhsh, Reza; Mamun, Abdullah A; Williams, Gail M; O'Callaghan, Michael J; Najman, Jake M

2013-10-01

Early onset of smoking is associated with subsequent abuse of other substances and development of negative health outcomes. This study aimed to examine early life predictors of onset of smoking in an Australian young cohort. Data were from the Mater Hospital and University of Queensland Study of Pregnancy (MUSP), a population-based prospective birth cohort study (1981-2012). The present study is based on a cohort of 3714 young adults who self-reported smoking status and age of onset of smoking at the 21-year follow-up. Of these, data were available for 3039 on early childhood factors collected between the baseline and 14-year follow-up of the study. Of 3714 young adults, 49.6% (49.9% males and 49.3% females) reported having ever smoked cigarettes. For those who had ever smoked, mean and median ages at first smoke were 15.5 and 16.0years, respectively. In multivariate Cox proportional hazard analysis mother's education, change in maternal marital status, maternal cigarette smoking and alcohol consumption, maternal depression and child externalizing when the child was 5years statistically significantly predicted early onset of smoking. The data suggest that individuals exposed to personal and environmental risk factors during the early stage of childhood are at increased risk of initiation to cigarette smoking at an earlier age. Identification of the pathways of association between these early life factors and initiation to cigarette smoking may help reduce risk of tobacco smoking in adolescents and its adverse consequences. Copyright © 2013 Elsevier Ltd. All rights reserved.

Association Between Hyperuricemia and Major Adverse Cardiac Events in Patients with Acute Myocardial Infarction.

PubMed

Ranjith, Naresh; Myeni, Nomcebo N; Sartorius, Ben; Mayise, Chamsanqua

2017-02-01

To investigate the association between hyperuricemia and major adverse cardiac events (MACE) in patients with acute myocardial infarction (AMI). Consecutive patients admitted with AMI to the Coronary Care Unit at R. K. Khan Hospital (Durban, South Africa) between the years 2006 and 2014 were included. Demographic data, including clinical and biochemical information stored in an electronic database, were obtained from all patients. A total of 2683 patients were studied, of whom 65% were males. The mean age of the participants was 57.1 ± 11.5 years, with 79% presenting with ST elevation myocardial infarction. Sixty-one percent were smokers, 59% had diabetes mellitus, 52% had hypertension, and 58% presented with a family history of premature coronary artery disease. Twenty-six percent (n = 690) had hyperuricemia, were older (59 ± 12.1 vs. 56.5 ± 11.2 years) and more likely to present with hypertension (P < 0.001), lower ejection fraction (P < 0.001), and higher median creatinine levels (P < 0.001). A significantly greater proportion of patients with hyperuricemia experienced MACE (45% vs. 30%, P < 0.001). In both sexes, considerable heterogeneity for risk factors and clinical events was noted in individuals with hyperuricemia. Multivariable analyses for risk factors associated with mortality suggest that hyperuricemia conferred a significantly increased risk of mortality after adjustment [odds ratio (OR) 1.7 (95% confidence interval 1.0-2.8); P = 0.042]. A significant increasing risk trend for MACE was observed for increasing tertiles of serum uric acid concentrations above normal (P < 0.001), particularly for cardiac failure (P < 0.001) and death (P = 0.006). Hyperuricemia is significantly associated with hypertension, renal dysfunction, MACE, and independently confers a higher risk of mortality in patients with AMI. Significant heterogeneity was found by gender for risk factors and clinical events in individuals

Losartan alleviates hyperuricemia-induced atherosclerosis in a rabbit model

PubMed Central

Zheng, Hongchao; Li, Ning; Ding, Yueyou; Miao, Peizhi

2015-01-01

Objective: To investigate the mechanisms underlying the therapeutic effects of losartan on hyperuricemia-induced aortic atherosclerosis, in an experimental rabbit model. Methods: Male rabbits (n = 48) were divided into control, hyperuricemia (HU), hypercholesterolemia + hyperuricemia (HC + HU) and high-purine with 30-mg/kg/d losartan (HU + losartan) groups. Serum uric acid (UA) and plasma renin and angiotensin II activities were determined. Aortic tissue specimens were analyzed for histological changes and proliferating cell nuclear antigen (PCNA). Liver tissues were sampled for quantitative analyses of liver low-density lipoprotein receptor (LDLR) mRNA and protein via reverse transcription polymerase chain reaction and western blotting. Results: After 12 weeks, serum UA and plasma renin and plasma angiotensin II activities were enhanced in the HU and HU + HC groups (P < 0.001) compared to the control, whereas in the HU + losartan group plasma renin activity was not different and serum UA concentrations as well as plasma angiotensin II activity were moderately enhanced (P < 0.05). Smooth muscle cell (SMC) PCNA expression increased strongly in the HU and HU + HC groups (P < 0.001), but was less pronounced in the HU + losartan group. In contrast, transcription and expression of LDLR mRNA and protein were significantly higher in the control and HU + losartan groups compared to the HU and HU + HC groups. Both the HU and HU + HC groups had elevated intima thickness and intima areas compared to the control and HU + losartan groups. Conclusions: Losartan can alleviate experimental atherosclerosis induced by hyperuricemia. PMID:26617751

Febuxostat improves endothelial function in hemodialysis patients with hyperuricemia: A randomized controlled study.

PubMed

Tsuruta, Yuki; Kikuchi, Kan; Tsuruta, Yukio; Sasaki, Yuko; Moriyama, Takahito; Itabashi, Mitsuyo; Takei, Takashi; Uchida, Keiko; Akiba, Takashi; Tsuchiya, Ken; Nitta, Kosaku

2015-10-01

Endothelial dysfunction is often found in both hyperuricemia and hemodialysis patients. Recent studies have shown that treating hyperuricemia with allopurinol improves endothelial dysfunction. This study is performed to assess the effect of febuxostat on endothelial dysfunction in hemodialysis patients with hyperuricemia. We randomly assigned 53 hemodialysis patients with hyperuricemia to a febuxostat (10 mg daily) group and a control group and measured flow-mediated dilation, serum uric acid (UA) levels, systolic and diastolic blood pressure, malondialdehyde-modified low-density lipoprotein (MDA-LDL), and highly sensitive C-reactive protein (hsCRP) at baseline and at the end of a 4-week study period. Flow-mediated dilation increased from 5.3% ± 2.4% to 8.9% ± 3.6% in the febuxostat group but did not change significantly in the control group. Treatment with febuxostat resulted in a significant decrease in serum UA level and a significant decrease in MDA-LDL compared with baseline, but no significant difference was observed in hsCRP level or blood pressure. No significant differences were observed in the control group. Febuxostat improved endothelial dysfunction and reduced serum UA levels and oxidative stress in hemodialysis patients with hyperuricemia. © 2015 International Society for Hemodialysis.

Hyperuricemia is associated with low cardiorespiratory fitness levels and excess weight in schoolchildren.

PubMed

Reis, Luiza N; Renner, Jane D P; Reuter, Cézane P; Horta, Jorge A; Paiva, Dulciane N; Valim, Andréia R de M; Sehn, Ana P; de Mello, Elza D; Burgos, Miria S

To evaluate the possible association between hyperuricemia and cardiorespiratory fitness levels/nutritional profile, grouped into a single variable, in schoolchildren. Cross-sectional study of 2335 students from Elementary schools, aged 7-17 years of both genders, stratified by conglomerates of a municipality in Southern Brazil. Body mass index (BMI) was calculated and cardiorespiratory fitness (CRF) was assessed by the 6-minute run/walk test. The BMI and CRF were grouped into a single variable, considering: (1) low and normal weight/fit; (2) low and normal weight/unfit; (3) overweight-obesity/fit; (4) overweight-obesity/unfit. The Poisson regression (prevalence ratio, PR) was used for the association between hyperuricemia and BMI/CRF ratio with 95% confidence intervals and differences were considered significant when p<0.05. There is an association, although subtle, between the presence of hyperuricemia with low levels of CRF and the presence of excess weight, when grouped into a single variable. Boys and girls with this condition have higher prevalence of hyperuricemia (PR: 1.07; p=0.007 for boys; PR: 1.10; p<0.001 for girls). Together, excess weight and low levels of cardiorespiratory fitness are associated with the presence of hyperuricemia in schoolchildren. Copyright © 2017 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

Intraspinal anomalies in early-onset idiopathic scoliosis.

PubMed

Pereira, E A C; Oxenham, M; Lam, K S

2017-06-01

In the United Kingdom, lower incidences of intraspinal abnormalities in patients with early onset idiopathic scoliosis have been observed than in studies in other countries. We aimed to determine the rates of these abnormalities in United Kingdom patients diagnosed with idiopathic scoliosis before the age of 11 years. This retrospective study of patients attending an urban scoliosis clinic identified 71 patients satisfying a criteria of: clinical diagnosis of idiopathic scoliosis; age of onset ten years and 11 months or less; MRI screening for intraspinal abnormalities. United Kingdom census data combined with patient referral data was used to calculate incidence. Mean age at diagnosis was six years with 39 right-sided and 32 left-sided curves. Four patients (5.6%) were found to have intraspinal abnormalities on MRI. These consisted of: two combined Arnold-Chiari type 1 malformations with syrinx; one syrinx with a low lying conus; and one isolated syrinx. Overall annual incidence of early onset idiopathic scoliosis was one out of 182 000 (0.0006%). This study reports the lowest rates to date of intraspinal anomalies in patients with early onset idiopathic scoliosis, adding to knowledge regarding current incidences of these abnormalities as well as any geographical variation in the nature of the disease. Cite this article: Bone Joint J 2017;99-B:829-33. ©2017 The British Editorial Society of Bone & Joint Surgery.

Genetics Home Reference: early-onset glaucoma

MedlinePlus

... called a syndrome. If glaucoma appears before the age of 5 without other associated abnormalities, it is called primary congenital glaucoma. Other individuals experience early onset of primary open-angle glaucoma, the most ...

Early onset obsessive-compulsive disorder with and without tics.

PubMed

de Mathis, Maria Alice; Diniz, Juliana B; Shavitt, Roseli G; Torres, Albina R; Ferrão, Ygor A; Fossaluza, Victor; Pereira, Carlos; Miguel, Eurípedes; do Rosario, Maria Conceicão

2009-07-01

Research suggests that obsessive-compulsive disorder (OCD) is not a unitary entity, but rather a highly heterogeneous condition, with complex and variable clinical manifestations. The aims of this study were to compare clinical and demographic characteristics of OCD patients with early and late age of onset of obsessive-compulsive symptoms (OCS); and to compare the same features in early onset OCD with and without tics. The independent impact of age at onset and presence of tics on comorbidity patterns was investigated. Three hundred and thirty consecutive outpatients meeting Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition criteria for OCD were evaluated: 160 patients belonged to the "early onset" group (EOG): before 11 years of age, 75 patients had an "intermediate onset" (IOG), and 95 patients were from the "late onset" group (LOG): after 18 years of age. From the 160 EOG, 60 had comorbidity with tic disorders. The diagnostic instruments used were: the Yale-Brown Obsessive Compulsive Scale and the Dimensional Yale-Brown Obsessive Compulsive Scale (DY-BOCS), Yale Global Tics Severity Scale, and Structured Clinical Interview for DSM-IV Axis I Disorders-patient edition. Statistical tests used were: Mann-Whitney, full Bayesian significance test, and logistic regression. The EOG had a predominance of males, higher frequency of family history of OCS, higher mean scores on the "aggression/violence" and "miscellaneous" dimensions, and higher mean global DY-BOCS scores. Patients with EOG without tic disorders presented higher mean global DY-BOCS scores and higher mean scores in the "contamination/cleaning" dimension. The current results disentangle some of the clinical overlap between early onset OCD with and without tics.

Patients with late-adult-onset ulcerative colitis have better outcomes than those with early onset disease.

PubMed

Ha, Christina Y; Newberry, Rodney D; Stone, Christian D; Ciorba, Matthew A

2010-08-01

The influence of age on the presentation, clinical course, and therapeutic response of patients with adult-onset ulcerative colitis (UC) is understudied. Given potential age-related differences in risk factors and immune function, we sought to determine if disease behavior or clinical outcomes differed between patients diagnosed with UC in later versus earlier stages of adulthood. We performed a retrospective cohort study of 295 patients with UC seen at a tertiary care center from 2001 to 2008. Adult subjects newly diagnosed with UC between the ages of 18 and 30 years were defined as early onset, those newly diagnosed at age 50 or older were defined as late onset. The 2 groups were analyzed for differences in medication use and clinical end points, including disease extent, severity at the time of diagnosis, and steroid-free clinical remission at 1 year after disease onset. Disease extent and symptom severity were similar between groups at the time of diagnosis. One year after diagnosis, more patients in the late-onset group achieved steroid-free clinical remission (64% vs 49%; P = .01). Among those who required systemic steroid therapy, more late-onset patients achieved steroid-free remission by 1 year (50% vs 32%; P = .01). Former smoking status was a more common risk factor in the late-onset cohort (P < .001), whereas more early onset patients had a positive family history (P = .008). Patients with early and late-adult-onset UC have similar initial clinical presentations, but differ in disease risk factors. Late-onset patients have better responses to therapy 1 year after diagnosis. Copyright 2010 AGA Institute. Published by Elsevier Inc. All rights reserved.

Prevalence of hyperuricemia and its correlates in rural Northeast Chinese population: from lifestyle risk factors to metabolic comorbidities.

PubMed

Yu, Shasha; Yang, Hongmei; Guo, Xiaofan; Zhang, Xingang; Zhou, Ying; Ou, Qiaoyun; Zheng, Liqiang; Sun, Yingxian

2016-05-01

The increasing trend of hyperuricemia in urban areas of China has been noted in the past decade. However, the prevalence of hyperuricemia in rural China has not been extensively investigated. We aimed to estimate the prevalence and risk factors of hyperuricemia and the associated comorbidities in rural Northeast China. This survey was conducted from July 2012 to August 2013. In this study, a total of 11,576 residents from the rural Northeast China were randomly selected and examined. Hyperuricemia was defined as serum uric acid ≥416 μmol/l in men and ≥357 μmol/l in women. Data regarding the demographic and lifestyle characteristics and the blood biochemical indexes of these participants were collected by well-trained personnel. The prevalence of hyperuricemia was 10.9 % and was more prevalent in men than in women (15.0 vs. 7.3 %, P < 0.001). Multivariate logistic regression models revealed that besides age, hyperuricemia in men was associated with ethnic minority [OR (95 %): 0.683 (0.472,0.989)], physical activity [moderate, OR (95 %): 0.716 (0.596,0.859); high, OR (95 %): 0.527 (0.354,0.786)], current smoking [OR(95 %):1.380 (1.179,1.616)], and current drinking [OR(95 %):0.705 (0.603,0.825)], while in women was only associated with ethnic minority [OR(95 %):0.485 (0.262,0.896)]. After adjusting for possible confounders, hyperuricemia was related to different subtypes of cardiometabolic comorbidities in both gender like abdominal obesity, general obesity, hypertriglyceridemia, hypertension, hypercholesterolemia, and low HDL-C. Besides, in women only, hyperuricemia was related to diabetes and high LDL-C. Hyperuricemia was common among residents living in rural Northeast China especially among men. Ethnic minority, physical activity, current smoking, and drinking contributed to hyperuricemia in this population.

Early Onset Obesity and Risk of Metabolic Syndrome Among Chilean Adolescents

PubMed Central

Pacheco, Lorena Sonia; Blanco, Estela; Burrows, Raquel; Reyes, Marcela; Lozoff, Betsy

2017-01-01

Introduction Obesity and metabolic syndrome (MetS) indicators have increased globally among the pediatric population. MetS indicators in the young elevate their risk of cardiovascular disease and metabolic disorders later in life. This study examined early onset obesity as a risk factor for MetS risk in adolescence. Methods A cohort of Chilean participants (N = 673) followed from infancy was assessed at age 5 years and in adolescence (mean age, 16.8 y). Adiposity was measured at both time points; blood pressure and fasting blood samples were assessed in adolescence only. Early onset obesity was defined as a World Health Organization z score of 2 standard deviations (SDs) or more for body mass index (BMI) at age 5 years. We used linear regression to examine the association between early onset obesity and adolescent MetS risk z score, adjusting for covariates. Results Eighteen percent of participants had early onset obesity, and 50% of these remained obese in adolescence. Mean MetS risk z score in adolescence was significantly higher among those with early onset obesity than among those without (1.0; SD, 0.8 vs 0.2; SD, 0.8 [P < .001]). In the multivariable model, early onset obesity independently contributed to a higher MetS risk score in adolescence (β = 0.27, P < .001), controlling for obesity status at adolescence and sex, and explained 39% of the variance in MetS risk. Conclusion Early onset obesity as young as age 5 years relates to higher MetS risk. PMID:29023232

Management of Gout and Hyperuricemia in CKD.

PubMed

Vargas-Santos, Ana Beatriz; Neogi, Tuhina

2017-09-01

Hyperuricemia and gout, the clinical manifestation of monosodium urate crystal deposition, are common in patients with chronic kidney disease (CKD). Although the presence of CKD poses additional challenges in gout management, effective urate lowering is possible for most patients with CKD. Initial doses of urate-lowering therapy are lower than in the non-CKD population, whereas incremental dose escalation is guided by regular monitoring of serum urate levels to reach the target level of <6mg/dL (or <5mg/dL for patients with tophi). Management of gout flares with presently available agents can be more challenging due to potential nephrotoxicity and/or contraindications in the setting of other common comorbid conditions. At present, asymptomatic hyperuricemia is not an indication for urate-lowering therapy, though emerging data may support a potential renoprotective effect. Copyright © 2017 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.

Early Onset Recurrent Subtype of Adolescent Depression: Clinical and Psychosocial Correlates

ERIC Educational Resources Information Center

Hammen, Constance; Brennan, Patricia A.; Keenan-Miller, Danielle; Herr, Nathaniel R.

2008-01-01

Background: Evaluated trajectories of adolescent depression and their correlates in a longitudinal study of a community sample: early onset (by age 15) with major depression (MDE) recurrence between 15 and 20; early onset with no recurrence; later onset of major depression after age 15 with and without recurrence by 20; and never-depressed.…

Early onset marijuana use is associated with learning inefficiencies.

PubMed

Schuster, Randi Melissa; Hoeppner, Susanne S; Evins, A Eden; Gilman, Jodi M

2016-05-01

Verbal memory difficulties are the most widely reported and persistent cognitive deficit associated with early onset marijuana use. Yet, it is not known what memory stages are most impaired in those with early marijuana use. Forty-eight young adults, aged 18-25, who used marijuana at least once per week and 48 matched nonusing controls (CON) completed the California Verbal Learning Test, Second Edition (CVLT-II). Marijuana users were stratified by age of initial use: early onset users (EMJ), who started using marijuana at or before age 16 (n = 27), and late onset marijuana user group (LMJ), who started using marijuana after age 16 (n = 21). Outcome variables included trial immediate recall, total learning, clustering strategies (semantic clustering, serial clustering, ratio of semantic to serial clustering, and total number of strategies used), delayed recall, and percent retention. Learning improved with repetition, with no group effect on the learning slope. EMJ learned fewer words overall than LMJ or CON. There was no difference between LMJ and CON in total number of words learned. Reduced overall learning mediated the effect on reduced delayed recall among EMJ, but not CON or LMJ. Learning improved with greater use of semantic versus serial encoding, but this did not vary between groups. EMJ was not related to delayed recall after adjusting for encoding. Young adults reporting early onset marijuana use had learning weaknesses, which accounted for the association between early onset marijuana use and delayed recall. No amnestic effect of marijuana use was observed. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

Early-onset Alzheimer's Disease Phenotypes: Neuropsychology and Neural Networks

ClinicalTrials.gov

2017-05-11

Alzheimer Disease, Early Onset; Alzheimer Disease; Alzheimer Disease, Late Onset; Dementia, Alzheimer Type; Logopenic Progressive Aphasia; Primary Progressive Aphasia; Visuospatial/Perceptual Abilities; Posterior Cortical Atrophy; Executive Dysfunction; Corticobasal Degeneration; Ideomotor Apraxia

Early intervention for late-onset ornithine transcarbamylase deficiency.

PubMed

Fujisawa, Daisuke; Mitsubuchi, Hiroshi; Matsumoto, Shirou; Iwai, Masanori; Nakamura, Kimitoshi; Hoshide, Ryuji; Harada, Nawomi; Yoshino, Makoto; Endo, Fumio

2015-01-01

We report the case of a family with late-onset ornithine transcarbamylase deficiency (OTCD). Several family members had died from OTCD, and the c.221G>A, p.Lys221Lys mutation was detected at the 3' end of exon 6 of OTC in the X-chromosome of some members. We provided genetic counseling on pregnancy, delivery, and neonate management to a 4th-generation female carrier and decided on metabolic management of her child from birth. Two male patients were diagnosed with late-onset OTCD on the basis of blood amino acid and genetic analysis, and they received arginine supplementation from the asymptomatic, early neonatal period. These children grew and developed normally, without decompensation. Patients with late-onset OTCD can and should be diagnosed and treated in the early neonatal period, especially those from families already diagnosed with late-onset OTCD, and family members must be provided with genetic counseling. © 2015 Japan Pediatric Society.

Febuxostat for hyperuricemia in patients with advanced chronic kidney disease.

PubMed

Akimoto, Tetsu; Morishita, Yoshiyuki; Ito, Chiharu; Iimura, Osamu; Tsunematsu, Sadao; Watanabe, Yuko; Kusano, Eiji; Nagata, Daisuke

2014-01-01

Febuxostat is a nonpurine xanthine oxidase (XO) inhibitor, which recently received marketing approval. However, information regarding the experience with this agent among advanced chronic kidney disease (CKD) patients is limited. In the current study, we investigated the effects of oral febuxostat in patients with advanced CKD with asymptomatic hyperuricemia. We demonstrated, for the first time, that not only the serum levels of uric acid (UA) but also those of 8-hydroxydeoxyguanosine, an oxidative stress marker, were significantly reduced after six months of febuxostat treatment, with no adverse events. These results encouraged us to pursue further investigations regarding the clinical impact of lowering the serum UA levels with febuxostat in advanced CKD patients in terms of concomitantly reducing oxidative stress via the blockade of XO. More detailed studies with a larger number of subjects and assessments of the effects of multiple factors affecting hyperuricemia, such as age, sex, and dietary habits, would shed light on the therapeutic challenges of treating asymptomatic hyperuricemia in patients with various stages of CKD.

Differential Neurodevelopmental Trajectories in Patients With Early-Onset Bipolar and Schizophrenia Disorders

PubMed Central

Arango, Celso

2014-01-01

Schizophrenia and bipolar disorders share not only clinical features but also some risk factors such as genetic markers and childhood adversity, while other risk factors such as urbanicity and obstetric complications seem to be specific to schizophrenia. An intriguing question is whether the well-established abnormal neurodevelopment present in many children and adolescents who eventually develop schizophrenia is also present in bipolar patients. The literature on adult bipolar patients is controversial. We report data on a subgroup of patients with pediatric-onset psychotic bipolar disorder who seem to share some developmental trajectories with patients with early-onset schizophrenia. These early-onset psychotic bipolar patients have low intelligence quotient, more neurological signs, reduced frontal gray matter at the time of their first psychotic episode, and greater brain changes than healthy controls in a pattern similar to early-onset schizophrenia cases. However, patients with early-onset schizophrenia seem to have more social impairment, developmental abnormalities (eg, language problems), and lower academic achievement in childhood than early-onset bipolar patients. We suggest that some of these abnormal developmental trajectories are more related to the phenotypic features (eg, early-onset psychotic symptoms) of these 2 syndromes than to categorically defined Diagnostic and Statistical Manual of Mental Disorders disorders. PMID:24371326

Urate-Lowering Agents in Asymptomatic Hyperuricemia: Role of Urine Sediment Analysis and Musculoskeletal Ultrasound.

PubMed

Viggiano, Davide; Gigliotti, Giuseppe; Vallone, Gianfranco; Giammarino, Anna; Nigro, Michelangelo; Capasso, Giovambattista

2018-01-01

Current urate-lowering therapy (ULT) includes three direct acting drugs (allopurinol, febuxostat, Rasburicase) and at least four 'indirect' drugs with other important targets (canagliflozin, losartan, fenofibrate and sevelamer). Moreover, the alcalinization of urines using bicarbonate can be used to dissolve urate crystals and the clinician may discontinue several drugs are known to increase serum levels of uric acid, such as diuretics, aspirin, cyclosporine, theophylline, mycophenolate and ACE inhibitors. While there is a consensus to start ULT in cases of symptomatic hyperuricemia (gout, urate-nephrolithiasis), the very frequent conditions of asymptomatic hyperuricemia remains a major conundrum. The effect of asymptomatic hyperuricemia on kidney function has had fluctuating positions over decades. The conflicting results might indicate: (i) the presence of counterbalancing positive and negative effects on kidney function of both serum uric acid and urate-lowering agents, (ii) the presence of a subpopulation of patients, as yet unidentified, which could truly benefit from a urate-lowering therapy. Therefore, today the treatment of asymptomatic hyperuricemia is not recommended nor excluded by current guidelines. Here we suggest that a possible guide for the treatment of asymptomatic hyperuricemia might be the presence of urate crystals in the urine sediment and/or signs of asymptomatic articular damage by urates, identified by musculo-skeletal ultrasound. Moreover, a watchful analysis of the trend in creatinine/eGFR, proteinuria or urate levels might also guide the clinician. Initiation of ULT and follow-up in cases of asymptomatic hyperuricemia should consider urine sediment analysis, musculoskeletal ultrasound and trends in creatinine, proteinuria and serum urate levels. © 2018 The Author(s). Published by S. Karger AG, Basel.

Differentiating early-onset persistent versus childhood-limited conduct problem youth.

PubMed

Barker, Edward D; Maughan, Barbara

2009-08-01

Among young children who demonstrate high levels of conduct problems, less than 50% will continue to exhibit these problems into adolescence. Such developmental heterogeneity presents a serious challenge for intervention and diagnostic screening in early childhood. The purpose of the present study was to inform diagnostic screening and preventive intervention efforts by identifying youths whose conduct problems persist. The authors examined 1) the extent to which early-onset persistent versus childhood-limited trajectories can be identified from repeated assessments of childhood and early-adolescent conduct problems and 2) how prenatal and early postnatal risks differentiate these two groups. To identify heterogeneity in early-onset conduct problems, the authors used data from a large longitudinal population-based cohort of children followed from the prenatal period to age 13. Predictive risk factors examined were prenatal and postnatal measures of maternal distress (anxiety, depression), emotional and practical support, and family and child characteristics (from birth to 4 years of age). Findings revealed a distinction between early-onset persistent versus childhood-limited conduct problems in youths. Robust predictors of the early-onset persistent trajectory were maternal anxiety during pregnancy (32 weeks gestation), partner cruelty to the mother (from age 0 to 4 years), harsh parenting, and higher levels of child undercontrolled temperament. Sex differences in these risks were not identified. Interventions aiming to reduce childhood conduct problems should address prenatal risks in mothers and early postnatal risks in both mothers and their young children.

Treatment of Early Onset Schizophrenia: Recent Trends, Challenges and Future Considerations

PubMed Central

Vyas, Nora S.; Gogtay, Nitin

2012-01-01

Early onset schizophrenia (onset before adulthood) is a rare, severe, and chronic form of schizophrenia. The clinical presentation of schizophrenia at this unusually early age of onset has been associated with premorbid developmental abnormalities, poor response to neuroleptic treatment, greater admission rates, and poor prognosis. This is a brief, condensed review of current treatment strategies for the early onset population highlighting the need for novel treatment strategies for these generally treatment-refractory cases. Based on the current literature, second-generation antipsychotics remain the mainstay of treatment, although current medications provide suboptimal response at best. Based on the adult literature, combining antipsychotic treatment with psychotherapeutic intervention may be a more comprehensive treatment strategy. Indeed, early detection, identification of relevant biomarkers, coupled with advancing knowledge of the neurochemical and neuroanatomic pathways may help design informed and novel treatment strategies. PMID:22485097

[Mutations of amyloid precursor protein in early-onset familial Alzheimer's disease].

PubMed

Naruse, S; Tsuji, S; Miyatake, T

1992-09-01

Genetic linkage studies of familial Alzheimer's disease (FAD) have suggested that some form of early-onset FAD is linked to proximal long arm of chromosome 21. It has been also suggested that some form of late-onset FAD is linked to long arm of chromosome 19. Goate et al have identified a mis-sense mutation (Val to Ile) in exon 17 of the amyloid precursor protein (APP) gene in 2 of 16 early-onset FAD families, and have shown that the FAD locus in an FAD family is tightly linked to the mis-sense mutation. To determine if the mis-sense mutation is observed in different ethnic origine, we have studied some early-onset FAD families. Two early-onset FAD families showed the existence of the mutation. As the mutation has been identified in different ethnic origine and the mutation has not been observed in normal individuals, it strengthen hypothesis that the mutation is pathogenic. Recently, Val to Phe and Val to Gly mutations have been also identified at the same codon (Codon 717) of the APP gene.

Genetic Determinism of Primary Early-Onset Osteoarthritis.

PubMed

Aury-Landas, Juliette; Marcelli, Christian; Leclercq, Sylvain; Boumédiene, Karim; Baugé, Catherine

2016-01-01

Osteoarthritis (OA) is the most common joint disease worldwide. A minority of cases correspond to familial presentation characterized by early-onset forms which are genetically heterogeneous. This review brings a new point of view on the molecular basis of OA by focusing on gene mutations causing early-onset OA (EO-OA). Recently, thanks to whole-exome sequencing, a gain-of-function mutation in the TNFRSF11B gene was identified in two distant family members with EO-OA, opening new therapeutic perspectives for OA. Indeed, unraveling the molecular basis of rare Mendelian OA forms will improve our understanding of molecular processes involved in OA pathogenesis and will contribute to better patient diagnosis, management, and therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

Co-Occurring Problems of Early Onset Persistent, Childhood Limited, and Adolescent Onset Conduct Problem Youth

ERIC Educational Resources Information Center

Barker, Edward D.; Oliver, Bonamy R.; Maughan, Barbara

2010-01-01

Background: It is increasingly recognized that youth who follow early onset persistent (EOP), childhood limited (CL) and adolescent onset (AO) trajectories of conduct problems show somewhat varying patterns of risk (in childhood) and adjustment problems (in adolescence and adulthood). Little, however, is known about how other adjustment problems…

Decision making and executive function in male adolescents with early-onset or adolescence-onset conduct disorder and control subjects.

PubMed

Fairchild, Graeme; van Goozen, Stephanie H M; Stollery, Sarah J; Aitken, Michael R F; Savage, Justin; Moore, Simon C; Goodyer, Ian M

2009-07-15

Although conduct disorder (CD) is associated with an increased susceptibility to substance use disorders, little is known about decision-making processes or reward mechanisms in CD. This study investigated decision making under varying motivational conditions in CD. Performances on the Risky Choice Task (RCT) and the Wisconsin Card Sorting Test (WCST) were assessed in 156 adolescents (84 control subjects, 34 with adolescence-onset CD, and 38 with early-onset CD). The RCT was performed twice, once under normal motivational conditions and once under conditions of increased motivation and psychosocial stress. Increased motivation and stress led to more cautious decision making and changes in framing effects on the RCT in all groups, although such effects were least pronounced in the early-onset CD group. Participants from both CD subgroups selected the risky choice more frequently than control subjects. Under normal motivational conditions, early-onset CD participants chose the risky choice more frequently in trials occurring after small gains, relative to control subjects and adolescence-onset CD participants. Following adjustment for IQ differences, the groups did not differ significantly in terms of WCST performance. Differences in decision making between control subjects and individuals with CD suggest that the balance between sensitivity to reward and punishment is shifted in this disorder, particularly the early-onset form. Our data on modulation of decision making according to previous outcomes suggest altered reward mechanisms in early-onset CD. The WCST data suggest that impairments in global executive function do not underlie altered decision making in CD.

Diagnosis and prognosis of early-onset intrahepatic cholestasis of pregnancy: a prospective study.

PubMed

Lin, Jing; Gu, Wei; Hou, Yanyan

2017-11-07

To explore the gestational age of early-onset intrahepatic cholestasis (ICP) of pregnancy, and to analyze the relationship between the clinical biochemical indices and pregnancy outcomes in order to arrive at a reasonable diagnosis and administer appropriate treatment. This is a retrospective clinical study. We selected 47,260 pregnant women who received prenatal care and underwent childbirth at the International Peace Maternity and Child Health Hospital affiliated to Shanghai Jiao Tong University from January 2014 to December 2016 for participating in this study. Of these 47,260 women, 407 developed ICP. To calculate the gestational week cutoff between early- and late-onset ICP by the receiver-operating characteristic (ROC) curve and Youden's index. Two independent samples t tests and chi square test were used to compare the differences in biochemical indices and pregnancy outcomes between the two groups. We found that 34 weeks is the most appropriate cutoff gestational age for the diagnosis of early-onset ICP. Early-onset ICP is characterized by early onset, long disease duration and a higher incidence of preterm labor, fetal distress, and fetal low birth weight compared to late-onset ICP. Thirty-four weeks is the most appropriate cutoff gestational age for the diagnosis of early-onset ICP. And to reduce the adverse pregnancy outcomes in cases of early-onset ICP, we suggest prolonging gestation up to 37 weeks as far as possible before selecting iatrogenic birth.

Specific Intellectual Deficits in Children with Early Onset Diabetes Mellitus.

ERIC Educational Resources Information Center

Rovet, Joanne F.; And Others

1988-01-01

Compares 27 children with early onset diabetes (EOD) with 24 children with late onset diabetes (LOD) and 30 sibling controls in performance on tests of intellectual functioning and school achievement. Results revealed that duration of illness, age of onset, and hypoglycemic convulsions significantly predicted spatial ability. (Author/RWB)

[Relationship between hyperuricemia and prognosis in patients with heart failure of coronary heart disease after revascularization].

PubMed

Peng, D; Wang, S P; Zhao, D H; Fan, Q C; Shu, J; Liu, J H

2018-05-08

Objective: To explore the effect of hyperuricemia on prognosis in patients with heart failure of coronary heart disease (CHD) after revascularization. Methods: A single-center retrospective study of all subjects who underwent percutaneous coronary intervention (PCI) or coronary artery bypass grafting (CABG) as revascularization for CHD at Beijing Anzhen Hospital, Capital Medical University, between January 2005 and December 2014 was performed.Patients were divided into two groups by with or without hyperuricemia.The average follow-up was 1 818 d. Results: The Logistic regression analysis revealed that hyperuricemia was independent risk factors of readmission of heart failure( P =0.018, OR =1.499, 95% CI 1.071-2.098). The Cox regression analysis revealed that hyperuricemia was independent risk factor of all-cause mortality( P =0.002, RR =1.520, 95% CI 1.166-1.982), cardiovascular ( CV ) mortality( P =0.001, RR =1.811, 95% CI 1.279-2.566), heart failure mortality( P =0.006, RR =2.151, 95% CI 1.247-3.711). Conclusions: There is negative correlation between level of uric acid and left ventricular ejection fraction (LVEF). The patients with heart failure of coronary heart disease complicated with hyperuricemia have high risk of readmission of heart failure, all-cause mortality, CV mortality andheart failure mortality than patients with normal uric acid level. Hyperuricemia is an independent risk factor for patients with heart failure of coronary heart disease after revascularization.

Efficacy and safety of losartan in treatment of hyperuricemia and posttransplantation erythrocytosis: results of a prospective, open, randomized, case-control study.

PubMed

Zhu, X; Chen, J; Han, F; Cheng, M; Xu, L; Zhang, L; Ding, X; Le, Y

2009-11-01

Hyperuricemia and posttransplantation erythrocytosis (PTE) are frequent complications after kidney transplantation and are important risk factors for cardiovascular events. Losartan decreases serum uric acid and hemoglobin (Hb) concentrations and may be a useful agent for treatment of hyperuricemia and PTE. To evaluate the influence of losartan on serum creatinine (SCr), serum uric acid, and hemoglobin (Hb) concentrations in patients after kidney transplantation and to evaluate the safety profile of losartan in these patients. Sixty-six Han Chinese patients (43 men and 23 women; mean [SD] age, 40.45 [11.50] years) were enrolled in the study. All patients had undergone a first cadaveric donor kidney transplantation at least 3 months previously and had stable graft function with SCr concentration less than 176.8 micromol/L and Hb concentration greater than 110 g/L. The patients were divided into 2 groups (losartan group, n = 34; and control group, n = 32) according to the odevity of patient identification number. Patients in the losartan group received losartan, 50 mg/d; patients in the control group did not receive losartan. Each patient was followed up for 6 months. Nine patients in the losartan group and 5 patients in the control group dropped out because of acute renal insufficiency, anemia, acute rejection, or poor compliance. The serum uric acid concentration in the losartan group continuously decreased at months 1, 2, 3, and 6 (P = .12, P = .01, P = .04, and P = .005 compared with baseline, and P = .02, P = .003, P = .02, and P = .006 compared with control), especially in the patients with hyperuricemia (P = .02, P < .001, P = .003, and P < .001 compared with baseline, and P = .02, P = .002, P = .02, and P = .002 compared with control). The Hb level in the losartan group decreased significantly at months 1, 2, 3, and 6 (P = .003, P < .001, P = .004, and P = 0.02 compared with baseline, and P = .001, P < .001, P = .001, and P = .005 compared with control

Risk Factors for Early-Onset Peritonitis in Southern Chinese Peritoneal Dialysis Patients.

PubMed

Wu, Haishan; Huang, Rong; Yi, Chunyan; Wu, Juan; Guo, Qunying; Zhou, Qian; Yu, Xueqing; Yang, Xiao

♦ BACKGROUND: Early peritonitis was confirmed to be associated with a higher risk of early technique failure. However, literature concerning peritonitis within the first 3 months of peritoneal dialysis (PD) initiation is scarce. The present study was to investigate risk factors associated with early-onset peritonitis in PD patients. ♦ METHODS: In this retrospective observational cohort study, all incident PD patients from January 1, 2006, to December 31, 2013, were recruited and followed up until December 31, 2014. According to time-to-first episode of peritonitis, patients were divided into early-onset (≤ 3 months) peritonitis and late-onset (> 3 months) peritonitis. Baseline demographic, clinical, and laboratory data, as well as episodes of peritonitis, were collected. Risk factors associated with early-onset peritonitis were evaluated using logistic regression model. ♦ RESULTS: Of 1,690 patients on PD, 503 (29.8%) developed at least 1 episode of peritonitis and 118 (7.0%) patients presented the first episodes of peritonitis within the first 3 months. A multivariate logistic analysis showed that higher body mass index (BMI) (odds ratio [OR] 1.08, 95% confidence interval [CI] 1.01 - 1.15, p = 0.034), hypoalbuminemia (OR 1.75, 95% CI 1.11 - 2.78, p = 0.017), and catheter exit-site infection (OR 4.14, 95% CI 2.45 - 7.00, p < 0.001) were risk factors independently associated with early-onset peritonitis. Compared to those with late-onset, patients with early-onset peritonitis had a higher overall peritonitis rate (0.76 vs 0.38 per patient-year, p < 0.001) and worse technique survival (p < 0.001), while patient survival did not differ significantly between the 2 groups during the long-term follow-up (p > 0.05). ♦ CONCLUSIONS: Higher BMI, hypoalbuminemia, and catheter exit-site infection were the risk factors associated with early-onset peritonitis in PD patients. Copyright © 2016 International Society for Peritoneal Dialysis.

[Intravenous ferric carboxymaltose-associated hypophosphatemia in patients with iron deficiency anemia. A common side effect].

PubMed

Sánchez González, Rebeca; Ternavasio-de la Vega, Hugo Guillermo; Moralejo Alonso, Leticia; Inés Revuelta, Sandra; Fuertes Martín, Aurelio

2015-08-07

To determine the frequency, severity, time of onset and factors associated with the development of hypophosphatemia (HF) in patients with iron deficiency anemia treated with intravenous ferric carboxymatose (ivFCM). Retrospective cohort study in patients iron deficiency anemia who received ivFCM and had an a prior and subsequent determination of serum phosphate. We carried out a comparative analysis between baseline and post-ivFCM levels of serum phosphate. In order to identify variables independently associated with HF a logistic regression analysis was also performed. One hundred twenty-five patients were included. HF frequency was 58%. The median time to onset of HF was 18 days. Age, baseline ferritin levels and baseline phosphate levels were independently associated with the development of HF. The risk of HF in patients with baseline phosphate levels ≤ 3.1mg/dl was 67% higher than patients with ≥ 3.7 mg/dl. ivFCM-associated HF is a frequent, early and, sometimes, prolonged effect in patients with iron deficiency anemia. Serum phosphate levels should be monitored after ivFCM administration, especially in older patients and in those with lower baseline phosphate or ferritin levels. Copyright © 2014 Elsevier España, S.L.U. All rights reserved.

An update on the genetic architecture of hyperuricemia and gout.

PubMed

Merriman, Tony R

2015-04-10

Genome-wide association studies that scan the genome for common genetic variants associated with phenotype have greatly advanced medical knowledge. Hyperuricemia is no exception, with 28 loci identified. However, genetic control of pathways determining gout in the presence of hyperuricemia is still poorly understood. Two important pathways determining hyperuricemia have been confirmed (renal and gut excretion of uric acid with glycolysis now firmly implicated). Major urate loci are SLC2A9 and ABCG2. Recent studies show that SLC2A9 is involved in renal and gut excretion of uric acid and is implicated in antioxidant defense. Although etiological variants at SLC2A9 are yet to be identified, it is clear that considerable genetic complexity exists at the SLC2A9 locus, with multiple statistically independent genetic variants and local epistatic interactions. The positions of implicated genetic variants within or near chromatin regions involved in transcriptional control suggest that this mechanism (rather than structural changes in SLC2A9) is important in regulating the activity of SLC2A9. ABCG2 is involved primarily in extra-renal uric acid under-excretion with the etiological variant influencing expression. At the other 26 loci, probable causal genes can be identified at three (PDZK1, SLC22A11, and INHBB) with strong candidates at a further 10 loci. Confirmation of the causal gene will require a combination of re-sequencing, trans-ancestral mapping, and correlation of genetic association data with expression data. As expected, the urate loci associate with gout, although inconsistent effect sizes for gout require investigation. Finally, there has been no genome-wide association study using clinically ascertained cases to investigate the causes of gout in the presence of hyperuricemia. In such a study, use of asymptomatic hyperurcemic controls would be expected to increase the ability to detect genetic associations with gout.

[Advance in treatment of hyperuricemia by Chinese medicine based on uric acid transporterome].

PubMed

Zhou, Qi; Liu, Shu-min

2015-11-01

With the development of the quality of life, the morbidity of hyperuricemia is increasing year by year. At the same time, it appears that this disease attacks the young people currently. As the study of pathogenesis of hyperuricemia advanced, a series of uric acid transporters were found during this process. Meanwhile, the definition of transporterome was proposed. They were divided into three groups according to the functions: reabsorption proteins, excretion proteins and skeleton proteins. At moment, the drugs for hyperuricmia mainly include uric acid composition inhibitors and uric acid excretion promoters. Since the excretion of uric acid plays a leading role during the process of attack of hyperurecimia, it makes sense to explore Chinese medicines with clear mechanism targeting the transporterome. Therefore, this paper would focus on transporterome and summarize the mechanisms of Chinese medicines in treating hyperuricemia.

Correlates and prevalence of hypogonadism in patients with early- and late-onset type 2 diabetes.

PubMed

Li, Y; Zhang, M; Liu, X; Cui, W; Rampersad, S; Li, F; Lin, Z; Yang, P; Li, H; Sheng, C; Cheng, X; Qu, S

2017-07-01

This study aims to compare the prevalence of hypogonadism between male patients with early-onset type 2 diabetes mellitus (T2DM) and late-onset type 2 diabetes. A total of 122 male patients with early-onset T2DM (diagnosis age ≤40 years) and 100 male patients with late-onset T2DM (diagnosis age >40 years) were recruited from our in-patient department between 1 January 2013 and 28 December 2015. Serum FSH, LH, testosterone, lipid profile, uric acid, HbA1c, and beta-cell function were determined in blood samples. The diagnosis of hypogonadism was based on the levels of LH, FSH, and total testosterone. The mean onset age was 29.86 ± 6.31 and 54.47 ± 9.97 years old in the early-onset group and late-onset group, respectively. Compared with late-onset T2DM, those with early-onset T2DM had a higher proportion of new-onset diabetes, were more likely to be obese, and had worse glycemic control, lipid control, and lower sex hormone-binding globulin (SHBG). The prevalence of hypogonadism was much higher in the early-onset group than in the late-onset group (48.0% vs. 26.7%, p < 0.05). The rate of secondary hypogonadism in the early-onset group and late-onset group were 44.3% and 25.0%, respectively (p < 0.05). Obesity, waist circumference, and SHBG were significantly associated with serum total testosterone level in all, early-onset, and late-onset T2DM. Both all and early-onset T2DM groups had positive correlations between total testosterone and fasting C-peptide, total cholesterol, triglycerides, and uric acid. Our results indicate that in a population of admission to a large urban hospital in China, the prevalence of hypogonadism was higher in the patients with early-onset T2DM than that of late-onset T2DM. This prevalence might be attributable to greater obesity, worse lipid control, and lower SHBG levels in those patients. © 2017 American Society of Andrology and European Academy of Andrology.

Early identification of 'acute-onset' chronic inflammatory demyelinating polyneuropathy.

PubMed

Sung, Jia-Ying; Tani, Jowy; Park, Susanna B; Kiernan, Matthew C; Lin, Cindy Shin-Yi

2014-08-01

Distinguishing patients with acute-onset chronic inflammatory demyelinating polyneuropathy from acute inflammatory demyelinating polyneuropathy prior to relapse is often challenging at the onset of their clinical presentation. In the present study, nerve excitability tests were used in conjunction with the clinical phenotype and disease staging, to differentiate between patients with acute-onset chronic inflammatory demyelinating polyneuropathy and patients with acute inflammatory demyelinating polyneuropathy at an early stage, with the aim to better guide treatment. Clinical assessment, staging and nerve excitability tests were undertaken on patients initially fulfilling the diagnostic criteria of acute inflammatory demyelinating polyneuropathy soon after symptom onset and their initial presentation. Patients were subsequently followed up for minimum of 12 months to determine if their clinical presentations were more consistent with acute-onset chronic inflammatory demyelinating polyneuropathy. Clinical severity as evaluated by Medical Research Council sum score and Hughes functional grading scale were not significantly different between the two cohorts. There was no difference between the time of onset of initial symptoms and nerve excitability test assessment between the two cohorts nor were there significant differences in conventional nerve conduction study parameters. However, nerve excitability test profiles obtained from patients with acute inflammatory demyelinating polyneuropathy demonstrated abnormalities in the recovery cycle of excitability, including significantly reduced superexcitability (P < 0.001) and prolonged relative refractory period (P < 0.01), without changes in threshold electrotonus. In contrast, in patients with acute-onset chronic inflammatory demyelinating polyneuropathy, a different pattern occurred with the recovery cycle shifted downward (increased superexcitability, P < 0.05; decreased subexcitability, P < 0.05) and increased

Whole Exome Analysis of Early Onset Alzheimer’s Disease

DTIC Science & Technology

2015-04-01

autosomal recessive early-onset Parkinson’s disease and juvenile Parkinson disease , Parkin has been shown to promote intracellular Abeta1–42 clearance [15... Parkinsonism . Conclusions Mutations were found in 6/50 families. The presence of an APOE-4 allele may account for disease status in one affected non...AD_________________ Award Number: W81XWH-12-1-0013 TITLE: Whole Exome Analysis of Early Onset Alzheimer’s Disease PRINCIPAL INVESTIGATOR

Are early-onset cannabis smokers at an increased risk of depression spells?

PubMed

Fairman, Brian J; Anthony, James C

2012-04-01

A recent research focus is a set of hypothesized adult-onset mental health disturbances possibly due to early-onset cannabis use (EOCU, onset <18 years). We seek to estimate the suspected EOCU-associated excess odds of experiencing an incident depression spell during adulthood, with comparisons to never cannabis smokers and those with delayed cannabis onset (i.e., not starting to smoke cannabis until adulthood). The National Surveys on Drug Use and Health (NSDUH) assess non-institutionalized community-dwelling residents of the United States after probability sampling each year. In aggregate, the NSDUH analytical sample included 173,775 adult participants from survey years 2005-2009 (74-76% of designated respondents). Standardized computer-assisted interviews collected information on background determinants, age of first cannabis use, and depression spell onset. Logistic regression was used to estimate EOCU-depression spell associations in the form of odds ratios, with statistical adjustment for sex, age, race/ethnicity, years of cannabis involvement, tobacco cigarette onset, and alcohol onset. About 1 in 10 experienced a depression spell during adulthood, and both early-onset and adult-onset cannabis smokers had a modest excess odds of a depression spell compared to never cannabis smokers, even with covariate adjustment (OR=1.7 and 1.8, respectively; both p<0.001). Estimates for early- and adult-onset cannabis smokers did not statistically differ from one another. Shared diathesis that might influence both EOCU and adult-onset depression spell is controlled no more than partially, as will be true until essentially all known early-life shared vulnerabilities are illuminated. Cannabis smoking initiated at any age signals a modest increased risk of a spell of depression in adulthood, even when adjusted for suspected confounding variables studied here. Delaying cannabis onset until adulthood does not appear to diminish the cannabis-associated risk. Copyright © 2011

Are early-onset cannabis smokers at an increased risk of depression spells?

PubMed Central

Fairman, Brian J.; Anthony, James C.

2012-01-01

Background A recent research focus is a set of hypothesized adult-onset mental health disturbances possibly due to early-onset cannabis use (EOCU, onset <18 years). We seek to estimate the suspected EOCU-associated excess odds of experiencing an incident depression spell during adulthood, with comparisons to never cannabis smokers and those with delayed cannabis onset (i.e., not starting to smoke cannabis until adulthood). Methods The National Surveys on Drug Use and Health (NSDUH) assess non-institutionalized community-dwelling residents of the United States after probability sampling each year. In aggregate, the NSDUH analytical sample included 173,775 adult participants from survey years 2005–2009 (74–76% of designated respondents). Standardized computer-assisted interviews collected information on background determinants, age of first cannabis use, and depression spell onset. Logistic regression was used to estimate EOCU-depression spell associations in the form of odds ratios, with statistical adjustment for sex, age, race/ethnicity, years of cannabis involvement, tobacco cigarette onset, and alcohol onset. Results About 1 in 10 experienced a depression spell during adulthood, and both early-onset and adult-onset cannabis smokers had a modest excess odds of a depression spell compared to never cannabis smokers, even with covariate adjustment (OR = 1.7 & 1.8, respectively; both p<0.001). Estimates for early- and adult-onset cannabis smokers did not statistically differ from one another. Limitations Shared diathesis that might influence both EOCU and adult-onset depression spell is controlled no more than partially, as will be true until essentially all known early-life shared vulnerabilities are illuminated. Conclusion Cannabis smoking initiated at any age signals a modest increased risk of a spell of depression in adulthood, even when adjusted for suspected confounding variables studied here. Delaying cannabis onset until adulthood does not appear to

Key goals and indicators for successful aging of adults with early-onset disability.

PubMed

LaPlante, Mitchell P

2014-01-01

Substantial improvements have occurred in the longevity of several groups of individuals with early-onset disabilities, with many now surviving to advanced ages. This paper estimates the population of adults aging with early-onset disabilities at 12-15 million persons. Key goals for the successful aging of adults with early-onset disabilities are discussed, emphasizing reduction in risks for aging-related chronic disease and secondary conditions, while promoting social participation and independence. However, indicators suggest that elevated risk factors for aging-related chronic diseases, including smoking, obesity, and inactivity, as well as barriers to prevention and the diminished social and economic situation of adults with disabilities are continuing impediments to successful aging that must be addressed. Increased provider awareness that people with early-onset disabilities are aging and can age successfully and the integration of disability and aging services systems are transformative steps that will help adults with early-onset disability to age more successfully. Copyright © 2014 Elsevier Inc. All rights reserved.

Mutations of maturity-onset diabetes of the young (MODY) genes in Thais with early-onset type 2 diabetes mellitus.

PubMed

Plengvidhya, Nattachet; Boonyasrisawat, Watip; Chongjaroen, Nalinee; Jungtrakoon, Prapaporn; Sriussadaporn, Sutin; Vannaseang, Sathit; Banchuin, Napatawn; Yenchitsomanus, Pa-thai

2009-06-01

Six known genes responsible for maturity-onset diabetes of the young (MODY) were analysed to evaluate the prevalence of their mutations in Thai patients with MODY and early-onset type 2 diabetes. Fifty-one unrelated probands with early-onset type 2 diabetes, 21 of them fitted into classic MODY criteria, were analysed for nucleotide variations in promoters, exons, and exon-intron boundaries of six known MODY genes, including HNF-4alpha, GCK, HNF-1alpha, IPF-1, HNF-1beta, and NeuroD1/beta2, by the polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) method followed by direct DNA sequencing. Missense mutations or mutations located in regulatory region, which were absent in 130 chromosomes of non-diabetic controls, were classified as potentially pathogenic mutations. We found that mutations of the six known MODY genes account for a small proportion of classic MODY (19%) and early-onset type 2 diabetes (10%) in Thais. Five of these mutations are novel including GCK R327H, HNF-1alpha P475L, HNF-1alphaG554fsX556, NeuroD1-1972 G > A and NeuroD1 A322N. Mutations of IPF-1 and HNF-1beta were not identified in the studied probands. Mutations of the six known MODY genes may not be a major cause of MODY and early-onset type 2 diabetes in Thais. Therefore, unidentified genes await discovery in a majority of Thai patients with MODY and early-onset type 2 diabetes.

[Clinical characteristics and renal uric acid excretion in early-onset gout patients].

PubMed

Li, Q H; Liang, J J; Chen, L X; Mo, Y Q; Wei, X N; Zheng, D H; Dai, L

2018-03-01

Objective: To investigate clinical characteristics and renal uric acid excretion in early-onset gout patients. Methods: Consecutive inpatients with primary gout were recruited between 2013 and 2017. The patients with gout onset younger than 30 were defined as early-onset group while the others were enrolled as control group. Clinical characteristics and uric acid (UA) indicators were compared between two groups. Results: Among 202 recruited patients, the early-onset group included 36 patients (17.8%). Compared with control group, the early-onset group presented more patients with obesity [13 patients (36.1%) vs. 22 patients (13.3%), P< 0.05], significantly higher serum UA level [(634±124)μmol/L vs.(527±169)μmol/L] and glomerular load of UA[(7.2±2.8)mg·min(-1)·1.73m(-2) vs. (4.4±2.2)mg·min(-1)·1.73m(-2)] and estimated glomerular filtration rate (GFR) [(83±21)ml·min(-1)·1.73m(-2) vs. (67±21)ml·min(-1)·1.73m(-2)] (all P< 0.05), lower fractional excretion of UA [4.4% (3.4%,6.1%) vs. 7.2% (5.2%,9.6%), P< 0.05], whereas 24h urinary UA excretion was comparable [(2 788±882)μmol/1.73m(2) vs. (2 645±1 140)μmol/1.73m(2), P= 0.274]. Subgroup analysis of patients without chronic kidney disease showed significantly lower fractional excretion of UA in the early-onset group [4.5%(3.3%,6.1%) vs. 6.7% (5.1%,8.7%), P< 0.05]. Logistic regression analysis showed that obesity ( OR= 3.25) and fractional excretion of UA less than 7% ( OR= 9.01, all P< 0.05) were risk factors of gout early onset. Conclusion: The gout patients with early-onset younger than 30 present high serum and glomerular load of uric acid which might be due to obesity and relative under-excretion of renal uric acid.

Characterization of Early Partial Seizure Onset: Frequency, Complexity and Entropy

PubMed Central

Jouny, Christophe C.; Bergey, Gregory K.

2011-01-01

Objective A clear classification of partial seizures onset features is not yet established. Complexity and entropy have been very widely used to describe dynamical systems, but a systematic evaluation of these measures to characterize partial seizures has never been performed. Methods Eighteen different measures including power in frequency bands up to 300Hz, Gabor atom density (GAD), Higuchi fractal dimension (HFD), Lempel-Ziv complexity, Shannon entropy, sample entropy, and permutation entropy, were selected to test sensitivity to partial seizure onset. Intracranial recordings from forty-five patients with mesial temporal, neocortical temporal and neocortical extratemporal seizure foci were included (331 partial seizures). Results GAD, Lempel-Ziv complexity, HFD, high frequency activity, and sample entropy were the most reliable measures to assess early seizure onset. Conclusions Increases in complexity and occurrence of high-frequency components appear to be commonly associated with early stages of partial seizure evolution from all regions. The type of measure (frequency-based, complexity or entropy) does not predict the efficiency of the method to detect seizure onset. Significance Differences between measures such as GAD and HFD highlight the multimodal nature of partial seizure onsets. Improved methods for early seizure detection may be achieved from a better understanding of these underlying dynamics. PMID:21872526

Hyper-Uricemia and Gouty Access in the Adult Population of the Southeast of Gabon: Biochemical Aspects.

PubMed

Ndong Atome, Guy Roger; Ngoua Meye Misso, Rick-Leonid; Sima Obiang, Cédric; Onanga, Richard; Nkogue Mba, Dieudonné

2018-03-08

Gout is caused by a chronic hyperuricemia whose complications are not currently well evaluated in Africa. The aim of this study was to determine the prevalence and risk factors of hyperuricemia and gout in 85 patients recruited. A total of 26 cases of hyperuricemia, i.e., 30.6% of the study population, with 12 cases of gout and seven cases of gouty access. In this population, hyperuricemia was proportional to age ( p -value < 10 -4, OR = 2.6), but it was more prevalent in men, 23.5% versus 7.1% for women ( p -value = 0.0047). In addition, none of these women showed signs of a gouty affection. Consumption of alcohol (OR = 13) and nucleoprotein-rich foods, obesity (BMI 30 kg/m²; OR = 6), family history of gout (OR = 6.8), as well as diseases such as high blood pressure (associated with taking diuretics; OR = 1.7), renal insufficiency (OR = 4.4) and diabetes ( p < 0.049) were the main factors of the diseases associated with gout and hyperuricemia in this population. The biochemical role of these factors may increase and/or decrease the processes of synthesis and/or elimination of uric acid by acting on metabolites involved in the regulation of urate production.

Hyper-Uricemia and Gouty Access in the Adult Population of the Southeast of Gabon: Biochemical Aspects

PubMed Central

Ndong Atome, Guy Roger; Ngoua Meye Misso, Rick-Leonid; Sima Obiang, Cédric; Onanga, Richard; Nkogue Mba, Dieudonné

2018-01-01

Gout is caused by a chronic hyperuricemia whose complications are not currently well evaluated in Africa. The aim of this study was to determine the prevalence and risk factors of hyperuricemia and gout in 85 patients recruited. A total of 26 cases of hyperuricemia, i.e., 30.6% of the study population, with 12 cases of gout and seven cases of gouty access. In this population, hyperuricemia was proportional to age (p-value < 10−4, OR = 2.6), but it was more prevalent in men, 23.5% versus 7.1% for women (p-value = 0.0047). In addition, none of these women showed signs of a gouty affection. Consumption of alcohol (OR = 13) and nucleoprotein-rich foods, obesity (BMI 30 kg/m2; OR = 6), family history of gout (OR = 6.8), as well as diseases such as high blood pressure (associated with taking diuretics; OR = 1.7), renal insufficiency (OR = 4.4) and diabetes (p < 0.049) were the main factors of the diseases associated with gout and hyperuricemia in this population. The biochemical role of these factors may increase and/or decrease the processes of synthesis and/or elimination of uric acid by acting on metabolites involved in the regulation of urate production. PMID:29518007

CDKL5 and ARX mutations in males with early-onset epilepsy.

PubMed

Mirzaa, Ghayda M; Paciorkowski, Alex R; Marsh, Eric D; Berry-Kravis, Elizabeth M; Medne, Livija; Alkhateeb, Asem; Grix, Art; Wirrell, Elaine C; Powell, Berkley R; Nickels, Katherine C; Burton, Barbara; Paras, Andrea; Kim, Katherine; Chung, Wendy; Dobyns, William B; Das, Soma

2013-05-01

Mutations in CDKL5 and ARX are known causes of early-onset epilepsy and severe developmental delay in males and females. Although numerous males with ARX mutations associated with various phenotypes have been reported in the literature, the majority of CDKL5 mutations have been identified in females with a phenotype characterized by early-onset epilepsy, severe global developmental delay, absent speech, and stereotypic hand movements. To date, only 10 males with CDKL5 mutations have been reported. Our retrospective study reports on the clinical, neuroimaging, and molecular findings of 18 males with early-onset epilepsy caused by either CDKL5 or ARX mutations. These 18 patients include eight new males with CDKL5 mutations and 10 with ARX mutations identified through sequence analysis of 266 and 346 males, respectively, at our molecular diagnostic laboratory. Our large dataset therefore expands on the number of reported males with CDKL5 mutations and highlights that aberrations of CDKL5 and ARX combined are an important consideration in the genetic forms of early-onset epilepsy in boys. Copyright © 2013 Elsevier Inc. All rights reserved.

CDKL5 and ARX mutations in males with early-onset epilepsy

PubMed Central

Mirzaa, Ghayda M.; Paciorkowski, Alex R.; Marsh, Eric D.; Berry-Kravis, Elizabeth M.; Medne, Livija; Grix, Art; Wirrell, Elaine C.; Powell, Berkley R.; Nickels, Katherine C.; Burton, Barbara; Paras, Andrea; Kim, Katherine; Chung, Wendy; Dobyns, William B.; Das, Soma

2013-01-01

Mutations in CDKL5 and ARX are known causes of early-onset epilepsy and severe developmental delay in males and females. While numerous males with ARX mutations associated with various phenotypes have been reported in the literature, the majority of CDKL5 mutations have been identified in females with a phenotype characterized by early-onset epilepsy, severe global developmental delay, absent speech, and stereotypic hand movements. To date, only ten males with CDKL5 mutations have been reported. Our retrospective study reports on the clinical, neuroimaging and molecular findings of 18 males with early-onset epilepsy caused by either CDKL5 or ARX mutations. The 18 patients include eight new males with CDKL5 mutations and ten with ARX mutations identified through sequence analysis of 266 and 346 males, respectively, at our molecular diagnostic laboratory. Our large data set therefore expands on the number of reported males with CDKL5 mutations and highlights that aberrations of CDKL5 and ARX combined are an important consideration in the genetic forms of early-onset epilepsy. PMID:23583054

The association between hyperuricemia and betel nut chewing in Taiwanese men: a cross-sectional study.

PubMed

Tai, Tsai-Sung; Hsu, Chih-Cheng; Pai, Hsiang-Chu; Liu, Wen-Hsin; Hsu, Yueh-Han

2013-12-05

Studies have associated betel nut chewing with cancers, metabolic syndrome, cardiovascular disorders, chronic kidney disease, and proteinuria. This study investigated whether hyperuricemia is associated with betel nut chewing in men who participated in a health check-up program. From hospital records, we identified a total of 11,991 men who participated in the health check-up program from 2003 to 2009. They were divided into hyperuricemic group and non-hyperuricemic group. Laboratory tests, medical history, and status of cigarette smoking, alcohol consumption, and betel nut chewing were compared between the 2 groups. We calculated odds ratio (OR) and 95% confidence interval (CI) of hyperuricemia in association with betel nut consumption and other factors. Compared with the non-hyperuricemic group, the hyperuricemic group was slightly older (59.4 vs. 58.6 years) but less prevalent with betel nut use (11.8 vs. 13.6%, p = 0.003). Multivariable logistic regression analysis showed that hyperuricemia was negatively associated with betel nut chewing (OR 0.75, 95% CI 0.66-0.84), older age (OR 0.84, 95% CI 0.77-0.93), and diabetes mellitus (OR 0.57, 95% CI 0.50-0.64). On the other hand, hyperuricemia was positively associated with body mass index (OR 1.75, 95% CI 1.62-1.90), drinking (OR 1.36, 95% CI 1.25-1.49), hypertension (OR 1.41, 95% CI 1.30-1.52), mixed hyperlipidemia (OR 1.84, 95% CI 1.33-2.54), chronic kidney disease (OR 3.28, 95% CI 2.94-3.65), and proteinuria (OR 1.22, 95% CI 1.08-1.38). Smoking, hypercholesterolemia, and hypertriglyceridemia had no significant association with hyperuricemia. Our data suggest that betel nut chewing is negatively associated with hyperuricemia.

Early onset dementia in New Zealand Pacific boxers: a case series.

PubMed

Payman, Vahid; Yates, Susan; Cullum, Sarah

2018-05-04

To describe the biopsychosocial characteristics of a series of Pacific men living in South Auckland with a history of boxing presenting with early onset dementia. We discuss the history of boxing in Pacific people and the possibility of increased risk of early onset dementia in New Zealand Pacific men compared to their European counterparts. We reviewed the files of Pacific men with a history of amateur or professional boxing who presented to our memory and older adult mental health services with early onset dementia over a 45-month period. We gathered relevant information to construct a biopsychosocial paradigm as possible explanation of this phenomenon. We identified a series of eight New Zealand Pacific men with early onset dementia and with a history of boxing. Alcohol was a contributing factor in seven of the eight cases, and vascular risk factors in five. Historical, cultural and socio-economic factors underpin the attraction of some Pacific men to boxing as a sport. Given that New Zealand Pacific peoples may have an earlier onset of dementia than their European counterparts, further research is required to establish whether boxing is a contributory factor. Sports physicians should advise young New Zealand Pacific boxers about the long-term risks associated with their sport.

Relevance of the hygiene hypothesis to early vs. late onset allergic rhinitis.

PubMed

Matheson, M C; Walters, E H; Simpson, J A; Wharton, C L; Ponsonby, A-L; Johns, D P; Jenkins, M A; Giles, G G; Hopper, J L; Abramson, M J; Dharmage, S C

2009-03-01

The hygiene hypothesis proposes that reduced exposure to infections in early life increases the risk of developing allergic conditions including allergic rhinitis. We examined the association between markers of the hygiene hypothesis and allergic rhinitis that developed before 7 years of age and allergic rhinitis that developed after 7 years of age. The Tasmanian Longitudinal Health Study (TAHS) is a population-based cohort (n=8583) study of respiratory disease. Participants have been followed from 7 to 44 years of age. Information on potential risk factors, allergies and respiratory symptoms was collected longitudinally. Using multi-nomial logistic regression, exposure to siblings, infections, tonsillectomy and farm residence during childhood were examined as risk factors for allergic rhinitis that developed before or after 7 years of age. All analyses were adjusted for gender, maternal and paternal atopy, mother's age at participant's birth, paternal socio-economic status in 1968 and personal socio-economic status in 2004. Greater cumulative exposure to siblings before the age of 2 years was strongly inversely associated with early onset allergic rhinitis (<1 year sib exposure: OR=0.6, 95% CI 0.3-1.0; 1-3 years sib exposure: OR=0.6, 95% CI 0.4-0.9; >3 years sib exposure: OR=0.4, 95% CI 0.3-0.8) less so with later onset allergic rhinitis. The risk of early onset allergic rhinitis decreased with increasing viral infections (OR=0.7, 95% CI 0.5-0.9) during childhood. Having a tonsillectomy before 7 years of age increased the risk of early onset allergic rhinitis (OR=1.7, 95% CI 1.2-2.5). None of these factors was associated with later onset allergic rhinitis. Exposures relevant to the hygiene hypothesis were important predictors for the development of early onset but less so for later onset allergic rhinitis. The exact mechanisms by which siblings and infections protect against allergic rhinitis are unclear. The stronger findings for earlier onset allergic rhinitis

Hyperuricemia and the risk of ischemic stroke in patients with atrial fibrillation--could it refine clinical risk stratification in AF?

PubMed

Chao, Tze-Fan; Liu, Chia-Jen; Chen, Su-Jung; Wang, Kang-Ling; Lin, Yenn-Jiang; Chang, Shih-Lin; Lo, Li-Wei; Hu, Yu-Feng; Tuan, Ta-Chuan; Chen, Tzeng-Ji; Tsao, Hsuan-Ming; Chen, Shih-Ann

2014-01-01

Although hyperuricemia has been reported to be a risk factor of stroke, the relationship between hyperuricemia and stroke in patients with atrial fibrillation (AF) remains uncertain. The goal of the present study was to investigate whether hyperuricemia could potentially refine clinical risk stratification in AF. This study used the "National Health Insurance Research Database" in Taiwan. A total of 7601 AF patients who did not receive antiplatelet agents or oral anticoagulants were identified as the study population. Hyperuricemia was defined as having at least one episode of gout attack necessitating long-term treatment with uric acid-lowering agents. The association between hyperuricemia and ischemic stroke was analyzed. During the follow up of 3.0±2.7 years, 1116 patients (14.7%) experienced ischemic stroke with an annual rate of around 4.9%. Hyperuricemia significantly predicts stroke, with a hazard ratio (HR) of 1.280 after adjusting for CHA2DS2-VASc score and other comorbidities. Among the 376 patients with a CHA2DS2VASc score of 0, hyperuricemia can further stratify them into 2 groups with different stroke rates (7.1% versus 1.3%, p=0.020). The adjusted HR of hyperuricemia in predicting ischemic stroke diminished from 7.491 for patients with a CHA2DS2-VASc score of 0 to 1.659 for those with a score of 3, and became insignificant for patients with a score ≥4. Hyperuricemia was a significant risk factor of stroke which could potentially refine the clinical risk stratification in AF. It deserves a prospective trial to investigate whether it would change the current strategy for stroke preventions using oral anticoagulants. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Increased genetic vulnerability to smoking at CHRNA5 in early-onset smokers.

PubMed

Hartz, Sarah M; Short, Susan E; Saccone, Nancy L; Culverhouse, Robert; Chen, LiShiun; Schwantes-An, Tae-Hwi; Coon, Hilary; Han, Younghun; Stephens, Sarah H; Sun, Juzhong; Chen, Xiangning; Ducci, Francesca; Dueker, Nicole; Franceschini, Nora; Frank, Josef; Geller, Frank; Gubjartsson, Daniel; Hansel, Nadia N; Jiang, Chenhui; Keskitalo-Vuokko, Kaisu; Liu, Zhen; Lyytikäinen, Leo-Pekka; Michel, Martha; Rawal, Rajesh; Rosenberger, Albert; Scheet, Paul; Shaffer, John R; Teumer, Alexander; Thompson, John R; Vink, Jacqueline M; Vogelzangs, Nicole; Wenzlaff, Angela S; Wheeler, William; Xiao, Xiangjun; Yang, Bao-Zhu; Aggen, Steven H; Balmforth, Anthony J; Baumeister, Sebastian E; Beaty, Terri; Bennett, Siiri; Bergen, Andrew W; Boyd, Heather A; Broms, Ulla; Campbell, Harry; Chatterjee, Nilanjan; Chen, Jingchun; Cheng, Yu-Ching; Cichon, Sven; Couper, David; Cucca, Francesco; Dick, Danielle M; Foroud, Tatiana; Furberg, Helena; Giegling, Ina; Gu, Fangyi; Hall, Alistair S; Hällfors, Jenni; Han, Shizhong; Hartmann, Annette M; Hayward, Caroline; Heikkilä, Kauko; Hewitt, John K; Hottenga, Jouke Jan; Jensen, Majken K; Jousilahti, Pekka; Kaakinen, Marika; Kittner, Steven J; Konte, Bettina; Korhonen, Tellervo; Landi, Maria-Teresa; Laatikainen, Tiina; Leppert, Mark; Levy, Steven M; Mathias, Rasika A; McNeil, Daniel W; Medland, Sarah E; Montgomery, Grant W; Muley, Thomas; Murray, Tanda; Nauck, Matthias; North, Kari; Pergadia, Michele; Polasek, Ozren; Ramos, Erin M; Ripatti, Samuli; Risch, Angela; Ruczinski, Ingo; Rudan, Igor; Salomaa, Veikko; Schlessinger, David; Styrkársdóttir, Unnur; Terracciano, Antonio; Uda, Manuela; Willemsen, Gonneke; Wu, Xifeng; Abecasis, Goncalo; Barnes, Kathleen; Bickeböller, Heike; Boerwinkle, Eric; Boomsma, Dorret I; Caporaso, Neil; Duan, Jubao; Edenberg, Howard J; Francks, Clyde; Gejman, Pablo V; Gelernter, Joel; Grabe, Hans Jörgen; Hops, Hyman; Jarvelin, Marjo-Riitta; Viikari, Jorma; Kähönen, Mika; Kendler, Kenneth S; Lehtimäki, Terho; Levinson, Douglas F; Marazita, Mary L; Marchini, Jonathan; Melbye, Mads; Mitchell, Braxton D; Murray, Jeffrey C; Nöthen, Markus M; Penninx, Brenda W; Raitakari, Olli; Rietschel, Marcella; Rujescu, Dan; Samani, Nilesh J; Sanders, Alan R; Schwartz, Ann G; Shete, Sanjay; Shi, Jianxin; Spitz, Margaret; Stefansson, Kari; Swan, Gary E; Thorgeirsson, Thorgeir; Völzke, Henry; Wei, Qingyi; Wichmann, H-Erich; Amos, Christopher I; Breslau, Naomi; Cannon, Dale S; Ehringer, Marissa; Grucza, Richard; Hatsukami, Dorothy; Heath, Andrew; Johnson, Eric O; Kaprio, Jaakko; Madden, Pamela; Martin, Nicholas G; Stevens, Victoria L; Stitzel, Jerry A; Weiss, Robert B; Kraft, Peter; Bierut, Laura J

2012-08-01

Recent studies have shown an association between cigarettes per day (CPD) and a nonsynonymous single-nucleotide polymorphism in CHRNA5, rs16969968. To determine whether the association between rs16969968 and smoking is modified by age at onset of regular smoking. Primary data. Available genetic studies containing measures of CPD and the genotype of rs16969968 or its proxy. Uniform statistical analysis scripts were run locally. Starting with 94,050 ever-smokers from 43 studies, we extracted the heavy smokers (CPD >20) and light smokers (CPD ≤10) with age-at-onset information, reducing the sample size to 33,348. Each study was stratified into early-onset smokers (age at onset ≤16 years) and late-onset smokers (age at onset >16 years), and a logistic regression of heavy vs light smoking with the rs16969968 genotype was computed for each stratum. Meta-analysis was performed within each age-at-onset stratum. Individuals with 1 risk allele at rs16969968 who were early-onset smokers were significantly more likely to be heavy smokers in adulthood (odds ratio [OR] = 1.45; 95% CI, 1.36-1.55; n = 13,843) than were carriers of the risk allele who were late-onset smokers (OR = 1.27; 95% CI, 1.21-1.33, n = 19,505) (P = .01). These results highlight an increased genetic vulnerability to smoking in early-onset smokers.

Association analysis between genetic variants in interleukin genes among different populations with hyperuricemia in Xinjiang Autonomous Region

PubMed Central

Zhang, Bei; Sun, Yuping; Li, Yuanyuan; Yu, Jiahui; Wang, Tingting; Xia, He; Li, Changgui; Liu, Shiguo; Yao, Hua

2015-01-01

To investigate whether functional variants of five interleukin genes (IL-1β, IL-10, IL-8, IL-18 and IL-18RAP) are associated with susceptibility to hyperuricemia among different nationalities (including Uygur, Kazak and Han populations) in the Xinjiang Autonomous Region of China. A total of 884 hyperuricemia patients and 1316 matched controls were recruited from the First Affiliated Hospital of Xinjiang Medical University in Urumqi. After genotyping of rs4073 in IL-8, rs16944 in IL-1, rs187238 in IL-18, rs1800871 in IL-10 and rs13015714 in IL-18RAP by TaqMan allele discrimination assays, an association analysis was performed using the χ2 test as well as a genotype-phenotype analysis. For the Uygur population, IL-8 rs4073, IL-18 rs187238 and IL-18RAP rs130154 polymorphisms were all associated with hyperuricemia (P<0.001 by genotype and P=0.008, OR 0.802 by allele for IL-8; P=0.01 by genotype and P=0.006, OR 1.332 by allele for IL-18 rs187238; P=0.007 by genotype and P=0.005, OR 1.27 by allele for IL-18RAP rs130154). For the Kazak population, only IL-18 rs187238 showed statistical significance with hyperuricemia (P=0.002 by genotype and P=0.007, OR 1.823 by allele). However, no differences were found between the five SNPs and hyperuricemia among the Han population. This study demonstrated genetic polymorphisms of different interleukin genes related to hyperuricemia vary in different nationalities in the Xinjiang Autonomous Region because of different geographical environments. IL-8, IL-1RL1 and IL-18 might be involved in the development of hyperuricemia in the Uygur population, whereas only IL-18 might be involved in the Kazak population. PMID:26722554

Operational Thought in Alzheimer's Disease Early Onset and SDAT.

ERIC Educational Resources Information Center

Emery, Olga B.; Breslau, Lawrence D.

For more than a decade it has been convention to assume that senile dementia Alzheimer's type (SDAT) and Alzheimer's disease early onset represent a unitary disease process with only an onset difference. This assumption has been neither confirmed nor disconfirmed. To address this issue, a study was conducted which analyzed the dissolution of…

The clinical and histopathological characteristics of early-onset basal cell carcinoma in Asians.

PubMed

Yang, M Y; Kim, J M; Kim, G W; Mun, J H; Song, M; Ko, H C; Kim, B S; Kim, H S; Kim, M B

2017-01-01

Basal cell carcinoma (BCC) is by far the most common cancer in white populations. In addition, recent reports have demonstrated an increasing incidence of BCC in Korea. We have observed a significant number of early-onset BCC cases in which the disease occurred in patients younger than 50 years. To investigate the clinicopathological characteristics of early-onset BCC in an Asian population, specifically in Koreans. One hundred and five patients with early-onset BCC were enrolled from a total of 1047 BCC patients who underwent surgery between January 1997 and December 2014 (942 patients over the age of 50 years were designated as the control group). Early-onset BCC accounted for 10.03% of all 1047 cases and the incidence over time displayed an incremental trend. The early-onset group displayed similar results as the control group, with a predominance of female BCC patients and the majority of tumours displaying the following characteristics: small in size, occurring in sun-exposed areas and belonging to the noduloulcerative clinical subtype and nodular histopathological subtype. In comparison with a previous study in a Western population, the incidence of the disease in non-exposed areas of the body, as well as the proportion of tumours of the superficial histological subtype, were lower in Asian patients. Although the clinicopathological characteristics of BCC are well-known, these characteristics have not been determined for early-onset BCC in an Asian population. Therefore, this study is the first report on early-onset BCC in Asians, specifically in a Korean patient group. © 2016 European Academy of Dermatology and Venereology.

Genetics of hyperuricemia and gout: implications for the present and future.

PubMed

George, Ronald L; Keenan, Robert T

2013-02-01

Gout is the most common inflammatory arthropathy and occurs in the setting of elevated serum urate levels. Gout is also known to be associated with multiple comorbidities including cardiovascular disease and the metabolic syndrome. Recent advances in research have increased our understanding and improved our knowledge of the pathophysiology of gout. Genome-wide association studies have permitted the identification of several new and common genetic factors that contribute to hyperuricemia and gout. Most of these are involved with the renal urate transport system (the uric acid transportasome), generally considered the most influential regulator of serum urate homeostasis. Thus far, SCL22A12, SCL2A9, and GLUT9 have been found to have the greatest variation and most influence on serum urate levels. However, genetics are only a part of the explanation in the development of hyperuricemia and gout. As results have been mixed, the role of known urate influential genes in gout's associated comorbidities remains unclear. Regardless, GWAS findings have expanded our understanding of the pathophysiology of hyperuricemia and gout, and will likely play a role in the development of future therapies and treatment of this ancient disease.

Association of brain-derived neurotrophic factor (BDNF) Val66Met polymorphism with early-onset bipolar disorder.

PubMed

Nassan, Malik; Croarkin, Paul E; Luby, Joan L; Veldic, Marin; Joshi, Paramjit T; McElroy, Susan L; Post, Robert M; Walkup, John T; Cercy, Kelly; Geske, Jennifer R; Wagner, Karen D; Cuellar-Barboza, Alfredo B; Casuto, Leah; Lavebratt, Catharina; Schalling, Martin; Jensen, Peter S; Biernacka, Joanna M; Frye, Mark A

2015-09-01

Brain-derived neurotrophic factor (BDNF) Val66Met (rs6265) functional polymorphism has been implicated in early-onset bipolar disorder. However, results of studies are inconsistent. We aimed to further explore this association. DNA samples from the Treatment of Early Age Mania (TEAM) and Mayo Clinic Bipolar Disorder Biobank were investigated for association of rs6265 with early-onset bipolar disorder. Bipolar cases were classified as early onset if the first manic or depressive episode occurred at age ≤19 years (versus adult-onset cases at age >19 years). After quality control, 69 TEAM early-onset bipolar disorder cases, 725 Mayo Clinic bipolar disorder cases (including 189 early-onset cases), and 764 controls were included in the analysis of association, assessed with logistic regression assuming log-additive allele effects. Comparison of TEAM cases with controls suggested association of early-onset bipolar disorder with the rs6265 minor allele [odds ratio (OR) = 1.55, p = 0.04]. Although comparison of early-onset adult bipolar disorder cases from the Mayo Clinic versus controls was not statistically significant, the OR estimate indicated the same direction of effect (OR = 1.21, p = 0.19). When the early-onset TEAM and Mayo Clinic early-onset adult groups were combined and compared with the control group, the association of the minor allele rs6265 was statistically significant (OR = 1.30, p = 0.04). These preliminary analyses of a relatively small sample with early-onset bipolar disorder are suggestive that functional variation in BDNF is implicated in bipolar disorder risk and may have a more significant role in early-onset expression of the disorder. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Childhood Risk Factors for Early-Onset Drinking*

PubMed Central

Donovan, John E.; Molina, Brooke S. G.

2011-01-01

Objective: There is relatively little research on the childhood antecedent predictors of early-onset alcohol use. This study examined an array of psychosocial variables assessed at age 10 and reflecting Problem Behavior Theory as potential antecedent risk factors for the initiation of alcohol use at age 14 or younger. Method: A sample of 452 children (238 girls) ages 8 or 10 and their families was drawn from Allegheny County, PA, using targeted-age directory sampling and random-digit dialing procedures. Children and parents were interviewed using computer-assisted interviews. Logistic regression analyses were used to examine the age-10 univariate and multivariate predictors of the initiation of alcohol use by age 14 or younger. Results: Twenty-five percent of the sample reported having more than a sip or a taste of alcohol in their life by age 14. Sex, race, and age cohort did not relate to early drinking status. Children with two parents were less likely to initiate drinking early. Early initiation of drinking related significantly to an array of antecedent risk factors (personality, social environment, and behavioral) assessed at age 10 that reflect psychosocial proneness for problem behavior. In the multivariate model, the variables most predictive of early-onset drinking were having a single parent, sipping or tasting alcohol by age 10, having parents who also started drinking at an early age, and parental drinking frequency. Conclusions: Initiation of alcohol use by age 14 reflects childhood psychosocial proneness to engage in problem behavior as measured by Problem Behavior Theory and having a family environment conducive to alcohol use. PMID:21906502

Early Onset Malignancies - Genomic Study of Cancer Disparities

Cancer.gov

The Early Onset Malignancies Initiative studies the genomic basis of six cancers that develop at an earlier age, occur in higher rates, and are typically more aggressive in certain minority populations.

Early onset type 2 diabetes: risk factors, clinical impact and management

PubMed Central

Idris, Iskandar

2014-01-01

Early onset type 2 diabetes mellitus (T2DM) is increasingly prevalent with a significant impact on the individual, healthcare service delivery and planning. The individuals are likely to be obese, lead a sedentary lifestyle, have a strong family history of T2DM, be of black and minority ethnic (BME) origin and come from a less affluent socioeconomic group. They have a heightened risk of developing microvascular and macrovascular complications, often at an earlier stage and with greater frequency than seen in type 1 diabetes. As such, early and aggressive risk factor management is warranted. Early onset T2DM is complex and impacts on service delivery with a need for multidisciplinary care of complications and comorbidities’, in addition to adequate educational and psychological support. This review on the impact of early onset T2DM provides the latest insights into this emerging epidemic. PMID:25364491

Evidence for possible non-canonical pathway(s) driven early-onset colorectal cancer in India

PubMed Central

Raman, Ratheesh; Kotapalli, Viswakalyan; Adduri, Raju; Gowrishankar, Swarnalata; Bashyam, Leena; Chaudhary, Ajay; Vamsy, Mohana; Patnaik, Sujith; Srinivasulu, Mukta; Sastry, Regulagadda; Rao, Subramanyeshwar; Vasala, Anjayneyulu; Kalidindi, NarasimhaRaju; Pollack, Jonathan; Murthy, Sudha; Bashyam, Murali

2012-01-01

Two genetic instability pathways viz. chromosomal instability, driven primarily by APC mutation induced deregulated Wnt signaling, and microsatellite instability (MSI) caused by mismatch repair (MMR) inactivation, together account for greater than 90% of late-onset colorectal cancer. Our understanding of early-onset sporadic CRC is however comparatively limited. In addition, most seminal studies have been performed in the western population and analyses of tumorigenesis pathway(s) causing CRC in developing nations have been rare. We performed a comparative analysis of early and late-onset CRC from India with respect to common genetic aberrations including Wnt, KRAS and p53 (constituting the classical CRC progression sequence) in addition to MSI. Our results revealed the absence of Wnt and MSI in a significant proportion of early-onset as against late-onset CRC in India. In addition, KRAS mutation frequency was significantly lower in early-onset CRC indicating that a significant proportion of CRC in India may follow tumorigenesis pathways distinct from the classical CRC progression sequence. Our study has therefore revealed the possible existence of non-canonical tumorigenesis pathways in early-onset CRC in India. PMID:23168910

Treatment of Early-Onset Schizophrenia Spectrum Disorders (TEOSS): Rationale, Design, and Methods

ERIC Educational Resources Information Center

McClellan, Jon; Sikich, Linmarie; Findling, Robert L.; Frazier, Jean A.; Vitiello, Benedetto; Hlastala, Stefanie A.; Williams, Emily; Ambler, Denisse; Hunt-Harrison, Tyehimba; Maloney, Ann E.; Ritz, Louise; Anderson, Robert; Hamer, Robert M.; Lieberman, Jeffrey A.

2007-01-01

Objective: The Treatment of Early Onset Schizophrenia Spectrum Disorders Study is a publicly funded clinical trial designed to compare the therapeutic benefits, safety, and tolerability of risperidone, olanzapine, and molindone in youths with early-onset schizophrenia spectrum disorders. The rationale, design, and methods of the Treatment of Early…

Management of Anemia of Inflammation in the Elderly

PubMed Central

Macciò, Antonio; Madeddu, Clelia

2012-01-01

Anemia of any degree is recognized as a significant independent contributor to morbidity, mortality, and frailty in elderly patients. Among the broad types of anemia in the elderly a peculiar role seems to be played by the anemia associated with chronic inflammation, which remains the most complex form of anemia to treat. The origin of this nonspecific inflammation in the elderly has not yet been clarified. It seems more plausible that the oxidative stress that accompanies ageing is the real cause of chronic inflammation of the elderly and that the same oxidative stress is actually a major cause of this anemia. The erythropoietic agents have the potential to play a therapeutic role in this patient population. Despite some promising results, rHuEPO does not have a specific indication for the treatment of anemia in the elderly. Moreover, concerns about their side effects have spurred the search for alternatives. Considering the etiopathogenetic mechanisms of anemia of inflammation in the elderly population, an integrated nutritional/dietetic approach with nutraceuticals that can manipulate oxidative stress and related inflammation may prevent the onset of this anemia and its negative impact on patients' performance and quality of life. PMID:23091709

Common variants at five new loci associated with early-onset inflammatory bowel disease.

PubMed

Imielinski, Marcin; Baldassano, Robert N; Griffiths, Anne; Russell, Richard K; Annese, Vito; Dubinsky, Marla; Kugathasan, Subra; Bradfield, Jonathan P; Walters, Thomas D; Sleiman, Patrick; Kim, Cecilia E; Muise, Aleixo; Wang, Kai; Glessner, Joseph T; Saeed, Shehzad; Zhang, Haitao; Frackelton, Edward C; Hou, Cuiping; Flory, James H; Otieno, George; Chiavacci, Rosetta M; Grundmeier, Robert; Castro, Massimo; Latiano, Anna; Dallapiccola, Bruno; Stempak, Joanne; Abrams, Debra J; Taylor, Kent; McGovern, Dermot; Silber, Gary; Wrobel, Iwona; Quiros, Antonio; Barrett, Jeffrey C; Hansoul, Sarah; Nicolae, Dan L; Cho, Judy H; Duerr, Richard H; Rioux, John D; Brant, Steven R; Silverberg, Mark S; Taylor, Kent D; Barmuda, M Michael; Bitton, Alain; Dassopoulos, Themistocles; Datta, Lisa Wu; Green, Todd; Griffiths, Anne M; Kistner, Emily O; Murtha, Michael T; Regueiro, Miguel D; Rotter, Jerome I; Schumm, L Philip; Steinhart, A Hillary; Targan, Stephen R; Xavier, Ramnik J; Libioulle, Cécile; Sandor, Cynthia; Lathrop, Mark; Belaiche, Jacques; Dewit, Olivier; Gut, Ivo; Heath, Simon; Laukens, Debby; Mni, Myriam; Rutgeerts, Paul; Van Gossum, André; Zelenika, Diana; Franchimont, Denis; Hugot, J P; de Vos, Martine; Vermeire, Severine; Louis, Edouard; Cardon, Lon R; Anderson, Carl A; Drummond, Hazel; Nimmo, Elaine; Ahmad, Tariq; Prescott, Natalie J; Onnie, Clive M; Fisher, Sheila A; Marchini, Jonathan; Ghori, Jilur; Bumpstead, Suzannah; Gwillam, Rhian; Tremelling, Mark; Delukas, Panos; Mansfield, John; Jewell, Derek; Satsangi, Jack; Mathew, Christopher G; Parkes, Miles; Georges, Michel; Daly, Mark J; Heyman, Melvin B; Ferry, George D; Kirschner, Barbara; Lee, Jessica; Essers, Jonah; Grand, Richard; Stephens, Michael; Levine, Arie; Piccoli, David; Van Limbergen, John; Cucchiara, Salvatore; Monos, Dimitri S; Guthery, Stephen L; Denson, Lee; Wilson, David C; Grant, Straun F A; Daly, Mark; Silverberg, Mark S; Satsangi, Jack; Hakonarson, Hakon

2009-12-01

The inflammatory bowel diseases (IBD) Crohn's disease and ulcerative colitis are common causes of morbidity in children and young adults in the western world. Here we report the results of a genome-wide association study in early-onset IBD involving 3,426 affected individuals and 11,963 genetically matched controls recruited through international collaborations in Europe and North America, thereby extending the results from a previous study of 1,011 individuals with early-onset IBD. We have identified five new regions associated with early-onset IBD susceptibility, including 16p11 near the cytokine gene IL27 (rs8049439, P = 2.41 x 10(-9)), 22q12 (rs2412973, P = 1.55 x 10(-9)), 10q22 (rs1250550, P = 5.63 x 10(-9)), 2q37 (rs4676410, P = 3.64 x 10(-8)) and 19q13.11 (rs10500264, P = 4.26 x 10(-10)). Our scan also detected associations at 23 of 32 loci previously implicated in adult-onset Crohn's disease and at 8 of 17 loci implicated in adult-onset ulcerative colitis, highlighting the close pathogenetic relationship between early- and adult-onset IBD.

Risk of early-onset prostate cancer associated with occupation in the Nordic countries.

PubMed

Barry, Kathryn Hughes; Martinsen, Jan Ivar; Alavanja, Michael C R; Andreotti, Gabriella; Blair, Aaron; Hansen, Johnni; Kjærheim, Kristina; Koutros, Stella; Lynge, Elsebeth; Sparèn, Pär; Tryggvadottir, Laufey; Weiderpass, Elisabete; Berndt, Sonja I; Pukkala, Eero

2017-12-01

Early-onset prostate cancer is often more aggressive and may have a different aetiology than later-onset prostate cancer, but has been relatively little studied to date. We evaluated occupation in relation to early- and later-onset prostate cancer in a large pooled study. We used occupational information from census data in five Nordic countries from 1960 to 1990. We identified prostate cancer cases diagnosed from 1961 to 2005 by linkage of census information to national cancer registries and calculated standardised incidence ratios (SIRs) separately for men aged 30-49 and those aged 50 or older. We also conducted separate analyses by period of follow-up, 1961-1985 and 1986-2005, corresponding to pre- and post-prostate-specific antigen (PSA) screening. For early-onset prostate cancer (n = 1521), we observed the highest SIRs for public safety workers (e.g. firefighters) (SIR = 1.71, 95% confidence interval [CI]: 1.23-2.31) and military personnel (SIR = 1.97, 95% CI: 1.31-2.85). These SIRs were significantly higher than the SIRs for later-onset disease (for public safety workers, SIR = 1.10, 95% CI: 1.07-1.14 and for military personnel, SIR = 1.09, 95% CI: 1.05-1.13; p heterogeneity  = 0.005 and 0.002, respectively). Administrators and technical workers also demonstrated significantly increased risks for early-onset prostate cancer, but the SIRs did not differ from those of later-onset disease (p heterogeneity >0.05). While our early-onset finding for public safety workers was restricted to the post-PSA period, that for military personnel was restricted to the pre-PSA period. Our results suggest that occupational exposures, particularly for military personnel, may be associated with early-onset prostate cancer. Further evaluation is needed to explain these findings. Copyright © 2017 Elsevier Ltd. All rights reserved.

Verbal and Academic Skills in Children with Early-Onset Type 1 Diabetes

ERIC Educational Resources Information Center

Hannonen, Riitta; Komulainen, Jorma; Eklund, Kenneth; Tolvanen, Asko; Riikonen, Raili; Ahonen, Timo

2010-01-01

Aim: Basic verbal and academic skills can be adversely affected by early-onset diabetes, although these skills have been studied less than other cognitive functions. This study aimed to explore the mechanism of learning deficits in children with diabetes by assessing basic verbal and academic skills in children with early-onset diabetes and in…

Early-Onset Bipolar Spectrum Disorders: Diagnostic Issues

ERIC Educational Resources Information Center

Danner, Stephanie; Fristad, Mary A.; Arnold, L. Eugene; Youngstrom, Eric A.; Birmaher, Boris; Horwitz, Sarah M.; Demeter, Christine; Findling, Robert L.; Kowatch, Robert A.

2009-01-01

Since the mid 1990s, early-onset bipolar spectrum disorders (BPSDs) have received increased attention in both the popular press and scholarly press. Rates of diagnosis of BPSD in children and adolescents have increased in inpatient, outpatient, and primary care settings. BPSDs remain difficult to diagnose, particularly in youth. The current…

Early Onset Marijuana Use Is Associated with Learning Inefficiencies

PubMed Central

Schuster, Randi Melissa; Hoeppner, Susanne S.; Evins, A. Eden; Gilman, Jodi M.

2016-01-01

Objective Verbal memory difficulties are the most widely reported and persistent cognitive deficit associated with early-onset marijuana use. Yet, it is not known what memory stages are most impaired in those with early marijuana use. Method Forty-eight young adults, aged 18–25, who used marijuana at least once per week and 48 matched non-using controls (CON) completed the California Verbal Learning Test, Second Edition (CVLT-II). Marijuana users were stratified by age of initial use: ‘early onset’ users (EMJ), who started using marijuana at or before age 16 (n = 27), and ‘late onset’ marijuana user group (LMJ), who started using marijuana after age 16 (n = 21). Outcome variables included trial immediate recall, total learning, clustering strategies (semantic clustering, serial clustering, ratio of semantic to serial clustering, and total number of strategies used), delayed recall, and percent retention. Results Learning improved with repetition, with no group effect on the learning slope. EMJ learned fewer words overall than LMJ or CON. There was no difference between LMJ and CON in total number of words learned. Reduced overall learning mediated the effect on reduced delayed recall among EMJ, but not CON or LMJ. Learning improved with greater use of semantic versus serial encoding, but this did not vary between groups. EMJ was not related to delayed recall after adjusting for encoding. Conclusions Young adults reporting early onset marijuana use had learning weaknesses, which accounted for the association between early onset marijuana use and delayed recall. No amnestic effect of marijuana use was observed. PMID:26986749

Converging approaches to understanding early onset familial Alzheimer disease: A First Nation study

PubMed Central

Cabrera, Laura Y; Beattie, B Lynn; Dwosh, Emily; Illes, Judy

2015-01-01

Objectives: In 2007, a novel pathogenic genetic mutation associated with early onset familial Alzheimer disease was identified in a large First Nation family living in communities across British Columbia, Canada. Building on a community-based participatory study with members of the Nation, we sought to explore the impact and interplay of medicalization with the Nation’s knowledge and approaches to wellness in relation to early onset familial Alzheimer disease. Methods: We performed a secondary content analysis of focus group discussions and interviews with 48 members of the Nation between 2012 and 2013. The analysis focused specifically on geneticization, medicalization, and traditional knowledge of early onset familial Alzheimer disease, as these themes were prominent in the primary analysis. Results: We found that while biomedical explanations of disease permeate the knowledge and understanding of early onset familial Alzheimer disease, traditional concepts about wellness are upheld simultaneously. Conclusion: The analysis brings the theoretical framework of “two-eyed seeing” to the case of early onset familial Alzheimer disease for which the contributions of different ways of knowing are embraced, and in which traditional and western ways complement each other on the path of maintaining wellness in the face of progressive neurologic disease. PMID:27092264

Early-onset facioscapulohumeral muscular dystrophy type 1 with some atypical features.

PubMed

Dorobek, Małgorzata; van der Maarel, Silvère M; Lemmers, Richard J L F; Ryniewicz, Barbara; Kabzińska, Dagmara; Frants, Rune R; Gawel, Malgorzata; Walecki, Jerzy; Hausmanowa-Petrusewicz, Irena

2015-04-01

Facioscapulohumeral muscular dystrophy cases with facial weakness before the age of 5 and signs of shoulder weakness by the age of 10 are defined as early onset. Contraction of the D4Z4 repeat on chromosome 4q35 is causally related to facioscapulohumeral muscular dystrophy type 1, and the residual size of the D4Z4 repeat shows a roughly inverse correlation with the severity of the disease. Contraction of the D4Z4 repeat on chromosome 4q35 is believed to induce a local change in chromatin structure and consequent transcriptional deregulation of 4qter genes. We present early-onset cases in the Polish population that amounted to 21% of our total population with facioscapulohumeral muscular dystrophy. More than 27% of them presented with severe phenotypes (wheelchair dependency). The residual D4Z4 repeat sizes ranged from 1 to 4 units. In addition, even within early-onset facioscapulohumeral muscular dystrophy type 1 phenotypes, some cases had uncommon features (head drop, early disabling contractures, progressive ptosis, and respiratory insufficiency and cardiomyopathy). © The Author(s) 2014.

Early onset epilepsy is associated with increased mortality: a population-based study

PubMed Central

Moseley, Brian D.; Wirrell, Elaine C.; Wong-Kisiel, Lily C.; Nickels, Katherine

2013-01-01

SUMMARY We examined mortality in early onset (age <12 months) epilepsy in a population-based group of children. Children with early onset epilepsy were significantly more likely to die (case fatality, CF 8/60 versus 8/407, p<0.001; mortality rate, MR 14.5/1000 versus 2/1000 person years; standardized mortality ratio, SMR 22.25 versus 5.67). Mortality was greater in children with malignant neonatal (age <1 month) epilepsy (CF 4/12 versus 12/450, p<0.001; MR 54/1000 person years versus 2.7/1000 person year; SMR 46.55 versus 7.22). Given that only 1/8 early onset epilepsy deaths was seizure-related, mortality appears to be more affected by underlying etiology. PMID:23582606

Development and initial validation of the Classification of Early-Onset Scoliosis (C-EOS).

PubMed

Williams, Brendan A; Matsumoto, Hiroko; McCalla, Daren J; Akbarnia, Behrooz A; Blakemore, Laurel C; Betz, Randal R; Flynn, John M; Johnston, Charles E; McCarthy, Richard E; Roye, David P; Skaggs, David L; Smith, John T; Snyder, Brian D; Sponseller, Paul D; Sturm, Peter F; Thompson, George H; Yazici, Muharrem; Vitale, Michael G

2014-08-20

Early-onset scoliosis is a heterogeneous condition, with highly variable manifestations and natural history. No standardized classification system exists to describe and group patients, to guide optimal care, or to prognosticate outcomes within this population. A classification system for early-onset scoliosis is thus a necessary prerequisite to the timely evolution of care of these patients. Fifteen experienced surgeons participated in a nominal group technique designed to achieve a consensus-based classification system for early-onset scoliosis. A comprehensive list of factors important in managing early-onset scoliosis was generated using a standardized literature review, semi-structured interviews, and open forum discussion. Three group meetings and two rounds of surveying guided the selection of classification components, subgroupings, and cut-points. Initial validation of the system was conducted using an interobserver reliability assessment based on the classification of a series of thirty cases. Nominal group technique was used to identify three core variables (major curve angle, etiology, and kyphosis) with high group content validity scores. Age and curve progression ranked slightly lower. Participants evaluated the cases of thirty patients with early-onset scoliosis for reliability testing. The mean kappa value for etiology (0.64) was substantial, while the mean kappa values for major curve angle (0.95) and kyphosis (0.93) indicated almost perfect agreement. The final classification consisted of a continuous age prefix, etiology (congenital or structural, neuromuscular, syndromic, and idiopathic), major curve angle (1, 2, 3, or 4), and kyphosis (-, N, or +) variables, and an optional progression modifier (P0, P1, or P2). Utilizing formal consensus-building methods in a large group of surgeons experienced in treating early-onset scoliosis, a novel classification system for early-onset scoliosis was developed with all core components demonstrating

Neural abnormalities in early-onset and adolescence-onset conduct disorder.

PubMed

Passamonti, Luca; Fairchild, Graeme; Goodyer, Ian M; Hurford, Georgina; Hagan, Cindy C; Rowe, James B; Calder, Andrew J

2010-07-01

Conduct disorder (CD) is characterized by severe antisocial behavior that emerges in childhood (early-onset CD [EO-CD]) or adolescence (adolescence-onset CD [AO-CD]). Early-onset CD is proposed to have a neurodevelopmental basis, whereas AO-CD is thought to emerge owing to social mimicry of deviant peers. However, this developmental taxonomic theory is debated after reports of neuropsychological impairments in both CD subtypes. A critical, although unaddressed, issue is whether these subtypes present similar or distinct neurophysiological profiles. Hence, we investigated neurophysiological responses to emotional and neutral faces in regions associated with antisocial behavior (ie, the amygdala, ventromedial prefrontal cortex, insula, and orbitofrontal cortex) in individuals with EO-CD and AO-CD and in healthy control subjects. To investigate whether EO-CD and AO-CD subjects show neurophysiological abnormalities. Case-control study. Government research institute, university department. Seventy-five male adolescents and young adults aged 16 to 21 years, including 27 with EO-CD, 25 with AO-CD, and 23 healthy controls. Main Outcome Measure Neural activations measured by functional magnetic resonance imaging while participants viewed angry, sad, and neutral faces. Comparing angry vs neutral faces, participants with both CD subtypes displayed reduced responses in regions associated with antisocial behavior compared with controls; differences between the CD subtypes were not significant. Comparing each expression with fixation baseline revealed an abnormal (increased) amygdala response to neutral but not angry faces in both groups of CD relative to controls. For sad vs neutral faces, reduced amygdala activation was observed in EO-CD relative to AO-CD and control participants. Comparing each expression with fixation revealed hypoactive amygdala responses to sadness in individuals with EO-CD relative to AO-CD participants and controls. These findings were not accounted for

Early-onset dementias: diagnostic and etiological considerations

PubMed Central

2013-01-01

This paper summarizes the body of literature about early-onset dementia (EOD) that led to recommendations from the Fourth Canadian Consensus Conference on the Diagnosis and Treatment of Dementia. A broader differential diagnosis is required for EOD compared with late-onset dementia. Delays in diagnosis are common, and the social impact of EOD requires special care teams. The etiologies underlying EOD syndromes should take into account family history and comorbid diseases, such as cerebrovascular risk factors, that may influence the clinical presentation and age at onset. For example, although many EODs are more likely to have Mendelian genetic and/or metabolic causes, the presence of comorbidities may drive the individual at risk for late-onset dementia to manifest the symptoms at an earlier age, which contributes further to the observed heterogeneity and may confound diagnostic investigation. A personalized medicine approach to diagnosis should therefore be considered depending on the age at onset, clinical presentation, and comorbidities. Genetic counseling and testing as well as specialized biochemical screening are often required, especially in those under the age of 40 and in those with a family history of autosomal dominant or recessive disease. Novel treatments in the drug development pipeline for EOD, such as genetic forms of Alzheimer's disease, should target the specific pathogenic cascade implicated by the mutation or biochemical defect. PMID:24565469

Early-Onset Physical Frailty in Adults with Diabesity and Peripheral Neuropathy.

PubMed

Tuttle, Lori J; Bittel, Daniel C; Bittel, Adam J; Sinacore, David R

2017-12-07

Diabesity (obesity and diabetes mellitus) has been identified as a potential contributor to early-onset frailty. Impairments contributing to early onset of physical frailty in this population are not well understood, and there is little evidence of the impact of peripheral neuropathy on frailty. The purpose of this study was to determine impairments that contribute to early-onset physical frailty in individuals with diabesity and peripheral neuropathy. We studied 105 participants, 82 with diabesity and peripheral neuropathy (57 years of age, body mass index [BMI] 31 kg/m 2 ); 13 with diabesity only (53 years of age, BMI 34 kg/m 2 ) and 10 obese controls (67 years of age, BMI 32 kg/m 2 ). Peripheral neuropathy was determined using Semmes Weinstein monofilaments; physical frailty was classified using the 9-item, modified Physical Performance Test; and knee extension and ankle plantarflexion peak torques were measured using isokinetic dynamometry. Participants with diabesity and peripheral neuropathy were 7.4 times more likely to be classified as physically frail. Impairments in lower-extremity function were associated with classification of frailty. Individuals with diabesity and peripheral neuropathy are particularly likely to be classified as frail. Earlier identification and interventions aimed at improving lower-extremity function may be important to mitigate the early-onset functional decline. Copyright © 2017 Diabetes Canada. Published by Elsevier Inc. All rights reserved.

The impact of early-onset cannabis use on functional brain correlates of working memory.

PubMed

Becker, Benjamin; Wagner, Daniel; Gouzoulis-Mayfrank, Euphrosyne; Spuentrup, Elmar; Daumann, Jörg

2010-08-16

Cannabis is the most commonly used illicit drug. Prevalence rates are particularly high among adolescents. Neuropsychological studies have identified cannabis-associated memory deficits, particularly linked to an early onset of use. However, it remains unclear, whether the age of onset accounts for altered cortical activation patterns usually observed in cannabis users. Functional magnetic resonance imaging was used to examine cortical activation during verbal working memory challenge in (1) early-onset (onset before the age of sixteen; n=26) and (2) late-onset cannabis users (age at onset at least sixteen; n=17). Early-onset users showed increased activation in the left superior parietal lobe. Correlational analyses confirmed the association between an earlier start of use and increased activity. Contrariwise neither cumulative dose, frequency nor time since last use was significantly associated with cortical activity. Our findings suggest that an early start of cannabis use is associated with increased cortical activation in adult cannabis users, possibly reflecting suboptimal cortical efficiency during cognitive challenge. The maturing brain might be more vulnerable to the harmful effects of cannabis use. However, due to a lack of a non-using control group we cannot exclude alternative interpretations. Copyright (c) 2010 Elsevier Inc. All rights reserved.

Effect and mechanism of dioscin from Dioscorea spongiosa on uric acid excretion in animal model of hyperuricemia.

PubMed

Zhang, Yi; Jin, Lijun; Liu, Jinchang; Wang, Wei; Yu, Haiyang; Li, Jian; Chen, Qian; Wang, Tao

2018-03-25

Dioscin, a spirostane glycoside, the rhizoma of Dioscorea septemloba (Diocoreacea) is used for diuresis, rheumatism, and joints pain. Given the poor solubility and stability of Dioscin, we proposed a hypothesis that Dioscin's metabolite(s) are the active substance(s) in vivo to contribute to the reducing effects on serum uric acid levels. The aim of this study is to identify the active metabolite(s) of Dioscin in vivo and to explore the mechanism of its antihyperuricemic activity. After oral administration of Dioscin in potassium oxonate (PO) induced hyperuricemia rats and adenine-PO induced hyperuricemia mice models, serum uric acid and creatinine levels, clearance of uric acid and creatinine, fractional excretion of uric acid, and renal pathological lesions were determined were used to evaluate the antihyperuricemic effects. Renal glucose transporter-9 (GLUT-9) and organic anion transporter-1 (OAT-1) expressions were analyzed by western blotting method. Renal uric acid excretion was evaluated using stably urate transporter-1 (URAT-1) transfected human epithelial kidney cell line. Intestinal uric acid excretion was evaluated by measuring the transcellular transport of uric acid in HCT116 cells. In hyperuricemia rats, both 25 and 50mg/kg of oral Dioscin decreased serum uric acid levels over 4h. In the hyperuricemia mice, two weeks treatment of Dioscin significantly decreased serum uric acid and creatinine levels, increased clearance of uric acid and creatinine, increased fractional excretion of uric acid, and reduced renal pathological lesions caused by hyperuricemia. In addition, renal GLUT -9 was significantly down-regulated and OAT-1 was up-regulated in Dioscin treated hyperuricemia mice. Dioscin's metabolite Tigogenin significantly inhibited uric acid re-absorption via URAT1 from 10 to 100μM. Diosgenin and Tigogenin increased uric acid excretion via ATP binding cassette subfamily G member 2 (ABCG2). Decreasing effect of Dioscin on serum uric acid level and

Treatment of early-onset schizophrenia spectrum disorders (TEOSS): rationale, design, and methods.

PubMed

McClellan, Jon; Sikich, Linmarie; Findling, Robert L; Frazier, Jean A; Vitiello, Benedetto; Hlastala, Stefanie A; Williams, Emily; Ambler, Denisse; Hunt-Harrison, Tyehimba; Maloney, Ann E; Ritz, Louise; Anderson, Robert; Hamer, Robert M; Lieberman, Jeffrey A

2007-08-01

The Treatment of Early Onset Schizophrenia Spectrum Disorders Study is a publicly funded clinical trial designed to compare the therapeutic benefits, safety, and tolerability of risperidone, olanzapine, and molindone in youths with early-onset schizophrenia spectrum disorders. The rationale, design, and methods of the Treatment of Early Onset Schizophrenia Spectrum Disorders Study are described. Using a randomized, double-blind, parallel-group design at four sites, youths with EOSS (ages 8-19 years) were assigned to an 8-week acute trial of risperidone (0.5-6.0 mg/day), olanzapine (2.5-20 mg/day), or molindone (10-140 mg/day). Responders continued double-blind treatment for 44 weeks. The primary outcome measure was responder status at 8 weeks, defined by a 20% reduction in baseline Positive and Negative Symptom Scale scores plus ratings of significant improvement on the Clinical Global Impressions. Secondary outcome measures included assessments of psychopathology, functional impairment, quality of life, and medication safety. An intent-to-treat analytic plan was used. From February 2002 to May 2006, 476 youths were screened, 173 were further evaluated, and 119 were randomized. Several significant study modifications were required to address safety, the use of adjunctive medications, and the termination of the olanzapine treatment arm due to weight gain. The Treatment of Early Onset Schizophrenia Spectrum Disorders Study will inform clinical practice regarding the use of antipsychotic medications for youths with early-onset schizophrenia spectrum disorders. Important safety concerns emerged during the study, including higher than anticipated rates of suicidality and problems tapering thymoleptic agents before randomization.

Distinct breast cancer subtypes in women with early-onset disease across races

PubMed Central

Singh, Mandeep; Ding, Yi; Zhang, Li-Ying; Song, Dong; Gong, Yun; Adams, Sylvia; Ross, Dara S; Wang, Jin-Hua; Grover, Shruti; Doval, Dinesh Chandra; Shao, Charles; He, Zi-Li; Chang, Victor; Chin, Warren W; Deng, Fang-Ming; Singh, Baljit; Zhang, David; Xu, Ru-Liang; Lee, Peng

2014-01-01

Background: Racial disparities among breast cancer (BCa) patients are known but not well studied in early-onset BCa. We analyzed molecular subtypes in early-onset BCa across five major races. Methods: A total of 2120 cases were included from non-Hispanic White (NHW), African American (AA) and Hispanic, Chinese and Indian. Based on ER, PR and HER-2 status, BCa was classified into 4 intrinsic subtypes as Luminal A, Luminal B, HER2/neu overexpression and Triple negative BCa (TNBC) subtypes. Data was stratified according to race and age as younger/early-onset group (40-years and younger) and older group (50-years and older). Results: In early-onset BCa, incidence of TNBC was significantly higher (p = 0.0369) in Indian women followed by AA, Hispanic, NHW and Chinese women. Incidence of Her2 over-expression subtype also was highest in Indian women, followed by Hispanic, Chinese, AA and NHW women. In contrast, Luminal B subtype was most significantly higher in AA women (p = 0.0000) followed by NHW (p = 0.0002), Chinese (p = 0.0003), Hispanic (0.0128) and Indian (p = 0.0468) women. Luminal A subtype was most significantly reduced in Indian women (p = 0.0113) followed by Hispanic, AA, NHW and Chinese women. These results were based on statistical analysis with the mean of older group populations. Conclusions: These results show significant disparities in receptor subtypes across races. This study will contribute in developing optimal clinical trial protocols and personalized management strategies for early-onset BCa patients. PMID:25057437

Screening and Treatment for Early-Onset Gestational Diabetes Mellitus: a Systematic Review and Meta-analysis.

PubMed

Immanuel, Jincy; Simmons, David

2017-10-02

We conducted a systematic review to evaluate the current evidence for screening and treatment for early-onset gestational diabetes mellitus (GDM) RECENT FINDINGS: Many of the women with early GDM in the first trimester do not have evidence of hyperglycemia at 24-28 weeks' gestation. A high proportion (15-70%) of women with GDM can be detected early in pregnancy depending on the setting, criteria used and screening strategy. However, there remains no good evidence for any of the diagnostic criteria for early-onset GDM. In a meta-analysis of 13 cohort studies, perinatal mortality (relative risk (RR) 3.58 [1.91, 6.71]), neonatal hypoglycemia (RR 1.61 [1.02, 2.55]), and insulin use (RR 1.71 [1.45, 2.03]) were greater among early-onset GDM women compared to late-onset GDM women, despite treatment. Considering the high likelihood of benefit from treatment, there is an urgent need for randomized controlled trials that investigate any benefits and possible harms of treatment of early-onset GDM.

Cross-Over Trial of Febuxostat and Topiroxostat for Hyperuricemia With Cardiovascular Disease (TROFEO Trial).

PubMed

Sezai, Akira; Obata, Kazuaki; Abe, Keisuke; Kanno, Sakie; Sekino, Hisakuni

2017-10-25

We previously reported that febuxostat was more effective for hyperuricemia than allopurinol. The efficacy, however, of topiroxostat (a novel xanthine oxidase reductase inhibitor similar to febuxostat), for hyperuricemia is unknown.Methods and Results:Patients with cardiovascular disease and hyperuricemia, in whom serum uric acid (s-UA) was controlled at ≤6 mg/dL, were eligible for enrollment. Fifty-five patients were randomized to receive either febuxostat or topiroxostat for 6 months and were switched to the other drug for the following 6 months. The primary endpoint was s-UA. Secondary endpoints included serum creatinine, estimated glomerular filtration rate, urinary albumin, cystatin-C, oxidized low-density lipoprotein, eicosapentaenoic acid/arachidonic acid ratio, lipid biomarkers, high-sensitivity C-reactive protein and B-type natriuretic protein. Although s-UA level was similar for both drugs, significantly more patients required dose escalation during treatment with topiroxostat. There were no differences in renal function, inflammatory and lipid markers between the 2 drugs. A biomarker of oxidative stress was significantly lower after 3 months of febuxostat compared with topiroxostat. Febuxostat causes more marked and more rapid reduction of s-UA than topiroxostat. With regard to the antioxidant effect, febuxostat was superior to topiroxostat after 3 months. The renal protective and anti-inflammatory effects of both drugs were also similar after 6 months of treatment. Thus, both of these agents were similarly effective for hyperuricemia in patients with cardiovascular disease.

Mothers' experience of caring for a child with early onset scoliosis: A qualitative descriptive study.

PubMed

Lauder, Bonnie; Sinclair, Peter M; Maguire, Jane

2018-04-01

This study aimed to identify and describe the experience of parents of children diagnosed with early onset scoliosis living in Australia. Chronic childhood disease has a major impact on health-related quality of life. Caring for a child with a chronic illness is well documented but the specific experiences of parents who care for children with early onset scoliosis, a rare but devastating illness, has not been explored. Numerous studies have described the interrelated psychological, financial, social, physical and logistical factors that impact the experience of the caregiver role with various diseases, but in the case of early onset scoliosis, limited studies have been conducted about the parental experience. A qualitative descriptive design was used. A snowball sampling technique assisted in the recruitment. Parents invited to the study included mothers, fathers and guardians. Data were collected through semistructured interviews and transcribed verbatim. Transcripts were analysed thematically. Data collection complied with the Consolidated criteria for reporting qualitative research guidelines. Twelve mothers of children with early onset scoliosis were interviewed, as only mothers consented to participate. Four major themes emerged: emotional rollercoaster ride, a lack of resources, money talks and pervasive burden. Factors that impacted on the participants' ability to confront, manage and endure caring for a child with early onset scoliosis emerged from the data. The findings suggest there are multiple factors that influence the experience of mothers' caring for a child with early onset scoliosis. The recognition and appropriate management of these factors by healthcare professionals have the potential to improve the quality of life of parents who care for a child with early onset scoliosis. Healthcare professionals have first-line contact with parents of children with early onset scoliosis and are well placed to provide parents with evidence-based education

The Dietary Fructose:Vitamin C Intake Ratio Is Associated with Hyperuricemia in African-American Adults.

PubMed

Zheng, Zihe; Harman, Jane L; Coresh, Josef; Köttgen, Anna; McAdams-DeMarco, Mara A; Correa, Adolfo; Young, Bessie A; Katz, Ronit; Rebholz, Casey M

2018-03-01

A high fructose intake has been shown to be associated with increased serum urate concentration, whereas ascorbate (vitamin C) may lower serum urate by competing with urate for renal reabsorption. We assessed the combined association, as the fructose:vitamin C intake ratio, and the separate associations of dietary fructose and vitamin C intakes on prevalent hyperuricemia. We conducted cross-sectional analyses of dietary intakes of fructose and vitamin C and serum urate concentrations among Jackson Heart Study participants, a cohort of African Americans in Jackson, Mississippi, aged 21-91 y. In the analytic sample (n = 4576), multivariable logistic regression was used to examine the separate associations of dietary intakes of fructose and vitamin C and the fructose:vitamin C intake ratio with prevalent hyperuricemia (serum urate ≥7 mg/dL), after adjusting for age, sex, smoking, waist circumference, systolic blood pressure, estimated glomerular filtration rate, diuretic medication use, vitamin C supplement use, total energy intake, alcohol consumption, and dietary intake of animal protein. Analyses for individual dietary factors (vitamin C, fructose) were adjusted for the other dietary factor. In the fully adjusted model, there were 17% greater odds of hyperuricemia associated with a doubling of the fructose:vitamin C intake ratio (OR: 1.17; 95% CI: 1.08, 1.28), 20% greater odds associated with a doubling of fructose intake (OR: 1.20; 95% CI: 1.08, 1.34), and 13% lower odds associated with a doubling of vitamin C intake (OR: 0.87; 95% CI: 0.78, 0.97). Dietary fructose and the fructose:vitamin C intake ratio were more strongly associated with hyperuricemia among men than women (P-interaction ≤ 0.04). Dietary intakes of fructose and vitamin C are associated with prevalent hyperuricemia in a community-based population of African Americans.

Brain Structure Changes Visualized in Early- and Late-Onset Blind Subjects

PubMed Central

Leporé, Natasha; Voss, Patrice; Lepore, Franco; Chou, Yi-Yu; Fortin, Madeleine; Gougoux, Frédéric; Lee, Agatha D.; Brun, Caroline; Lassonde, Maryse; Madsen, Sarah K.; Toga, Arthur W.; Thompson, Paul M.

2009-01-01

We examine 3D patterns of volume differences in the brain associated with blindness, in subjects grouped according to early and late onset. Using tensor-based morphometry, we map volume reductions and gains in 16 early-onset (EB) and 16 late-onset (LB) blind adults (onset <5 and >14 years old, respectively) relative to 16 matched sighted controls. Each subject’s structural MRI was fluidly registered to a common template. Anatomical differences between groups were mapped based on statistical analysis of the resulting deformation fields revealing profound deficits in primary and secondary visual cortices for both blind groups. Regions outside the occipital lobe showed significant hypertrophy, suggesting widespread compensatory adaptations. EBs but not LBs showed deficits in the splenium and hypertrophy in the isthmus. Gains in the isthmus and non-occipital white matter were more widespread in the EBs. These differences may reflect regional alterations in late neurodevelopmental processes, such as myelination, that continue into adulthood. PMID:19643183

Distinct 18F-AV-1451 tau PET retention patterns in early- and late-onset Alzheimer's disease.

PubMed

Schöll, Michael; Ossenkoppele, Rik; Strandberg, Olof; Palmqvist, Sebastian; Jögi, Jonas; Ohlsson, Tomas; Smith, Ruben; Hansson, Oskar

2017-09-01

Patients with Alzheimer's disease can present with different clinical phenotypes. Individuals with late-onset Alzheimer's disease (>65 years) typically present with medial temporal lobe neurodegeneration and predominantly amnestic symptomatology, while patients with early-onset Alzheimer's disease (<65 years) exhibit greater neocortical involvement associated with a clinical presentation including dyspraxia, executive dysfunction, or visuospatial impairment. We recruited 20 patients with early-onset Alzheimer's disease, 21 with late-onset Alzheimer's disease, three with prodromal early-onset Alzheimer's disease and 13 with prodromal late-onset Alzheimer's disease, as well as 30 cognitively healthy elderly controls, that had undergone 18F-AV-1451 tau positron emission tomography and structural magnetic resonance imaging to explore whether early- and late-onset Alzheimer's disease exhibit differential regional tau pathology and atrophy patterns. Strong associations of lower age at symptom onset with higher 18F-AV-1451 uptake were observed in several neocortical regions, while higher age did not yield positive associations in neither patient group. Comparing patients with early-onset Alzheimer's disease with controls resulted in significantly higher 18F-AV-1451 retention throughout the neocortex, while comparing healthy controls with late-onset Alzheimer's disease patients yielded a distinct pattern of higher 18F-AV-1451 retention, predominantly confined to temporal lobe regions. When compared against each other, the early-onset Alzheimer's disease group exhibited greater uptake than the late-onset group in prefrontal and premotor, as well as in inferior parietal cortex. These preliminary findings indicate that age may constitute an important contributor to Alzheimer's disease heterogeneity highlighting the potential of tau positron emission tomography to capture phenotypic variation across patients with Alzheimer's disease. © The Author (2017). Published by Oxford

Neurocognition in Early-Onset Schizophrenia and Schizoaffective Disorders

ERIC Educational Resources Information Center

Hooper, Stephen R.; Giuliano, Anthony J.; Youngstrom, Eric A.; Breiger, David; Sikich, Linmarie; Frazier, Jean A.; Findling, Robert L.; McClellan, Jon; Hamer, Robert M.; Vitiello, Benedetto; Lieberman, Jeffrey A.

2010-01-01

Objective: We examined the neuropsychological functioning of youth enrolled in the NIMH funded trial, Treatment of Early-Onset Schizophrenia Spectrum Disorders (TEOSS). We compared the baseline neuropsychological functioning of youth with schizophrenia (SZ, n = 79) to those with schizoaffective disorder (SA, n = 40), and examined the relationship…

[Therapeutic approach to postoperative anemia].

PubMed

Bisbe Vives, E; Moltó, L

2015-06-01

Postoperative anemia is a common finding in patients who undergo major surgery, and it can affect early rehabilitation and the return to daily activities. Allogeneic blood transfusion is still the most widely used method for restoring hemoglobin levels rapidly and effectively. However, the potential risks of transfusions have led to the review of this practice and to a search for alternative measures for treating postoperative anemia. The early administration of intravenous iron appears to improve the evolution of postoperative hemoglobin levels and reduce allogeneic transfusions, especially in patients with significant iron deficiency or anemia. What is not clear is whether this treatment heavily influences rehabilitation and quality of life. There is a lack of well-designed, sufficiently large, randomized prospective studies to determine whether postoperative or perioperative intravenous iron treatment, with or without recombinant erythropoietin, has a role in the recovery from postoperative anemia, in reducing transfusions and morbidity rates and in improving exercise capacity and quality of life. Copyright © 2015 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.

Severe combined immunodeficiency (SCID) presenting with neonatal aplastic anemia.

PubMed

Scott, Angela; Glover, Jason; Skoda-Smith, Suzanne; Torgerson, Troy R; Xu, Min; Burroughs, Lauri M; Woolfrey, Ann E; Fleming, Mark D; Shimamura, Akiko

2015-11-01

Aplastic anemia in the neonate is rare. We report a case of severe combined immunodeficiency (SCID) presenting with neonatal aplastic anemia. This report highlights the importance of considering SCID early in the evaluation of neonatal aplastic anemia prior to the development of infectious complications. © 2015 Wiley Periodicals, Inc.

Subclinical carotid atherosclerosis and hyperuricemia in relation to renal impairment in a rural Japanese population: the Nagasaki Islands study.

PubMed

Shimizu, Yuji; Sato, Shimpei; Koyamatsu, Jun; Yamanashi, Hirotomo; Tamai, Mami; Kadota, Koichiro; Arima, Kazuhiko; Yamasaki, Hironori; Takamura, Noboru; Aoyagi, Kiyoshi; Maeda, Takahiro

2014-04-01

The influence of hyperuricemia on atherosclerosis is controversial. Subclinical carotid atherosclerosis can be defined in two ways in terms of mean and maximum carotid intima-media thickness (CIMT): one with mean CIMT≥1.1 mm and the other with maximum CIMT≥1.1 mm. However, no studies have been reported of the association between hyperuricemia and subclinical carotid atherosclerosis while taking the two different ways of classification into account. We conducted a cross-sectional study of 4133 subjects (1492 men and 2641 women) aged 30-89 years undergoing general health check-ups. For analysis of various associations, we calculated the multivariable odds ratios (ORs) for the two ways classifications of subclinical carotid atherosclerosis in relation to hyperuricemia. Hyperuricemia-related renal impairment constitutes a significant marker for subclinical carotid atherosclerosis with mean CIMT≥1.1 mm for both men and women, while hyperuricemia per se was found to be beneficially associated with risk of subclinical carotid atherosclerosis with maximum CIMT≥1.1 mm for men. The classical cardiovascular risk factors without adjustment for glomerular filtration rate (GFR) of ORs for subclinical carotid atherosclerosis (mean CIMT≥1.1 mm) and subclinical carotid atherosclerosis (maximum CIMT≥1.1 mm) were 2.20(1.10-4.22) and 0.84(0.63-1.13) for men and 2.12(1.02-4.38) and 0.92(0.66-1.27) for women. After further adjustment for GFR, the corresponding values were 1.54(0.74-3.20) and 0.67(0.49-0.92) for men and 1.32(0.61-2.88) and 0.80(0.57-1.12) for women. Hyperuricemia-related renal impairment is a significant marker for subclinical carotid atherosclerosis for both men and women, while hyperuricemia per se may be inversely associated with subclinical carotid atherosclerosis for men as seen in a rural community-dwelling Japanese population. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

ASSESSMENT OF OXIDATIVE STRESS IN EARLY AND LATE ONSET PRE-ECLAMPSIA AMONG GHANAIAN WOMEN.

PubMed

Tetteh, P W; Adu-Bonsaffoh, K; Antwi-Boasiako, C; Antwi, D A; Gyan, B; Obed, S A

2015-01-01

Pre-eclampsia is a multisystem pregnancy-related disorder with multiple theories regarding its aetiology resulting in lack of reliable screening tests and well-established measures for primary prevention. However, oxidative stress is increasingly being implicated in the pathogenesi of pre-eclampsia although conflicting findings have been reported. To determine and compare the levels of oxidative stress in early and late onset pre-eclampsia by measuring urinary excretion of isoprostane and total antioxidant power (TAP) in a cohort of pre-eclamptic women at Korle Bu Teaching Hospital. This was a cross-sectional study conducted at Korle-Bu Teaching Hospital, Accra, Ghana involving pre-eclamptic women between the ages 18 and 45 years who gave written informed consent. Urinary isoprostane levels were determined using an enzyme-linked immunosorbent assay (ELISA) kit whereas the Total Anti-oxidant Power in urine samples was determined using Total Antioxidant Power Colorimetric Microplate Assay kit. The data obtained were analyzed using MEGASTAT statistical software package. We included 102 pre-eclamptic women comprising 68 (66.7%) and 34 (33.3%) with early-onset and late-onset pre-eclampsia respectively. There were no statistically significant differences between the mean maternal age, haematological indices, serum ALT, AST, ALT, albumin, urea, creatinine uric acid and total protein at the time of diagnosis. The mean gestational age at diagnosis of early and late onset pre-eclampsia were 31.65 ± 0.41 and 38.03 ± 0.21 respectively (p ˂ 0.001). Also, there were statistically significant differences between the diastolic blood pressure (BP), systolic BP and mean arterial pressure (MAP) at diagnosis of pre-eclampsia in the two categories. The mean urinary Isoprostane excretion was significantly higher in the early onset pre-eclamptic group (3.04 ± 0.34 ng/mg Cr) compared to that of the late onset pre-eclamptic group (2.36 ± 0.45 ng/mg Cr), (p=0.019). Urinary total

Serum levels of GDF15 are reduced in preeclampsia and the reduction is more profound in late-onset than early-onset cases.

PubMed

Chen, Qi; Wang, Yao; Zhao, Min; Hyett, Jonathan; da Silva Costa, Fabricio; Nie, Guiying

2016-07-01

Preeclampsia is a pregnancy specific disorder affecting 3-5% of pregnancies worldwide. It is clinically divided into early-onset and late-onset subtypes. Placental factors are involved in the pathogenesis of preeclampsia. Growth differentiation factor 15 (GDF15), a protein of the transforming growth factor beta superfamily, is highly expressed in the placenta. However, it is unclear whether the circulating levels of GDF15 are altered in preeclampsia at the time of or prior to disease presentation. Serum samples across three trimesters from 29 healthy pregnancies, third trimester sera from 34 women presenting with preeclampsia (early-onset n=16, late-onset n=18) and 66 gestation-age-matched controls, and sera at 11-13weeks of pregnancy from women who later did (n=36) or did not (n=33) develop late-onset preeclampsia, were examined for GDF15 by ELISA. Serum GDF15 levels increased significantly with gestation in normal pregnancy. Serum GDF15 was significantly reduced in the third trimester in women presenting with preeclampsia compared to their gestation-age-matched controls. This reduction was apparent in both early-onset and late-onset subtypes, but it was more profound in late-onset cases. At 11-13weeks of gestation, however, serum levels of GDF15 were similar between women who subsequently did and did not develop late-onset preeclampsia. Serum GDF15 increased with gestation age, reaching the highest level in the third trimester. Serum GDF15 was significantly reduced in the third trimester in women presenting with preeclampsia, especially in late-onset cases. However, serum GDF15 was not altered in the first trimester in women destined to develop late-onset preeclampsia. Copyright © 2016 Elsevier Ltd. All rights reserved.

Indoor tanning and risk of early-onset basal cell carcinoma

PubMed Central

Ferrucci, Leah M.; Cartmel, Brenda; Molinaro, Annette M.; Leffell, David J.; Bale, Allen E.; Mayne, Susan T.

2011-01-01

Background Despite a rise in incidence of basal cell carcinoma (BCC) among young people and the ubiquity of indoor tanning in this population, few epidemiologic studies have investigated this exposure-disease relationship. Objective Evaluate the association between indoor tanning and early-onset BCC. Methods BCC cases (n=376) and controls with minor benign skin conditions (n=390) under age 40 were identified through Yale Dermatopathology. Participants provided information on ever indoor tanning, age of initiation, frequency, duration, burns while tanning, and type of tanning device during an in-person interview. We calculated odds ratios (OR) and 95% confidence intervals (CI) using multivariate logistic regression with never indoor tanners as the referent group. Results Ever indoor tanning was associated with a 69% increased risk of early-onset BCC (95% CI=1.15-2.48). This association was stronger among women (OR=2.14, 95% CI=1.31-3.47), for multiple BCCs (OR=2.16, 95% CI=1.26-3.70), and for BCCs on the trunk and extremities (OR=2.81, 95% CI=1.57-5.02). Risk increased dose-dependently with years used regular indoor tanning devices (p-trend=0.003), number of overall burns (p-trend=<0.001) and burns to biopsy site (p-trend=<0.001) from indoor tanning. Approximately one-quarter (27%) of early-onset BCCs (or 43% among women) could be prevented if individuals never tanned indoors. Limitations Potential recall bias of indoor tanning by cases and generalizability of the control population suggest replication in other studies is warranted. Conclusions Indoor tanning was a strong risk factor for early-onset BCC, particularly among women. Indoor tanning should continue to be targeted by both policy-based and behavioral interventions, as the impact on BCC-associated morbidity may be substantial. PMID:22153793

Early Onset Diabetes - Genetic And Hormonal Analysis In Pakistani Population.

PubMed

Wahid, Maryam; Kamran, Mohammad

2016-01-01

Mitochondrial DNA mutation and hormonal imbalance is involved in the pathogenesis of early onset diabetes but data is lacking in Pakistani population. The study was planned to delineate the clinical presentation of early onset diabetes with possible hormonal and genetic etiological factors and aascertain the possible etiological role of insulin and glucagon in these patients either on oral hypoglycaemic or subcutaneous insulin therapy. Retrospective, analytical case control study with conventional sampling technique carried at Centre for Research in Experimental and Applied Medicine (CREAM) affiliated with the department of Biochemistry and Molecular Biology, Army Medical College Rawalpindi from Dec 2006 to July 2011. Study included the patients (20-35 years of age) with early onset diabetes on oral hypoglycemic (n=240), insulin therapy (n=280), and compared with non-diabetic healthy controls (n=150). A fragment surrounding tRNALeu (UUR) gene was amplified by AmpliTaq from mtDNA which was extracted from peripheral blood leucocytes. Then it was subjected to restriction endonucleases, ApaI for A3242G mutation and HaeIII for G3316A mutation detection. Plasma glucose, glycosylated Hb, osmolality, insulin and glucagon levels along with ABGs analysis was also done. Non diabetic controls comprised of 51% males and 49% females, diabetics on oral hypoglycemic 60% males and 40 % females and on insulin therapy 54% males and 46% females. Insulin dependent diabetics had statistically significant hyperglucagonemia, acidemia and bicarbonate deficit. MtDNA A3242G and G3316A mutations were not detected. relative hyperglucagonemia and acidemia in Insulin dependent diabetics was a potent threat leading to DKA. The absence of two mtDNA mutations in ND1 gene rules out the possibility of involvement of these mutations in early onset diabetes in Pakistani population.

Does theory of mind performance differ in children with early-onset and regressive autism?

PubMed

Matthews, Nicole L; Goldberg, Wendy A; Lukowski, Angela F; Osann, Kathryn; Abdullah, Maryam M; Ly, Agnes R; Thorsen, Kara; Spence, M Anne

2012-01-01

A deficit in theory of mind (ToM), or the ability to infer the mental states of others, has been implicated as one of the major characteristics of Autism Spectrum Disorder (ASD); however, little attention has been devoted to possible differences in ToM ability within ASD. The current study examined ToM performance in children with early-onset autism and regressive autism in comparison to typically developing children. Results indicated that children in the regressive autism group performed significantly better than the early-onset autism group on the non-verbal appearance-reality task. Additionally, Fisher's exact tests indicated a pattern of lowest scores in the early-onset group and highest scores in the typically developing group, whereas the regressive autism group tended to score in between the early-onset and typically developing groups. The apparent heterogeneity in ToM performance within ASD could account for the lack of universality in ToM ability found in previous studies. © 2011 Blackwell Publishing Ltd.

Variants of early-onset restrictive eating disturbances in middle childhood.

PubMed

Kurz, Susanne; van Dyck, Zoé; Dremmel, Daniela; Munsch, Simone; Hilbert, Anja

2016-01-01

This study sought to determine the factor structure of the newly developed self-report screening questionnaire Eating Disturbances in Youth-Questionnaire (EDY-Q) as well as to report the distribution of variants of early-onset restrictive eating disturbances characteristic of avoidant/restrictive food intake disorder (ARFID) in a middle childhood population sample. Using the EDY-Q, a total of 1,444 children aged 8-13 years were screened in elementary schools in Switzerland via self-report. The factor analysis of the 12 items covering ARFID related symptoms was performed using a principal component analysis (PCA). The PCA showed a four factor solution, with clear allocation to the scales covering three variants of early-onset restrictive eating disturbances and weight problems. Inadequate overall food intake was reported by 19.3% of the children, a limited accepted amount of food by 26.1%, and food avoidance based on a specific underlying fear by 5.0%. The postulated factor structure of the EDY-Q was confirmed, further supporting the existence of distinct variants of early-onset restrictive eating disturbances. Avoidant/restrictive eating behavior seems to be a common experience in middle childhood, but results have to be confirmed using validated interviews. © 2015 Wiley Periodicals, Inc.

Different Alterations of Cerebral Regional Homogeneity in Early-Onset and Late-Onset Parkinson's Disease

PubMed Central

Sheng, Ke; Fang, Weidong; Zhu, Yingcheng; Shuai, Guangying; Zou, Dezhi; Su, Meilan; Han, Yu; Cheng, Oumei

2016-01-01

HIGHLIGHTS Eighteen EOPD, 21 LOPD and 37 age-matched normal control subjects participated in the resting state fMRI scans.Age at onset of PD modulates the distribution of cerebral regional homogeneity during resting state.Disproportionate putamen alterations are more prominent in PD patients with a younger age of onset. Objective: Early-onset Parkinson's disease (EOPD) is distinct from late-onset PD (LOPD) as it relates to the clinical profile and response to medication. The objective of current paper is to investigate whether characteristics of spontaneous brain activity in the resting state are associated with the age of disease onset. Methods: We assessed the correlation between neural activity and age-at-onset in a sample of 39 PD patients (18 EOPD and 21 LOPD) and 37 age-matched normal control subjects. Regional homogeneity (ReHo) approaches were employed using ANOVA with two factors: PD and age. Results: In the comparisons between LOPD and EOPD, EOPD revealed lower ReHo values in the right putamen and higher ReHo values in the left superior frontal gyrus. Compared with age-matched control subjects, EOPD exhibited lower ReHo values in the right putamen and higher ReHo values in the left inferior temporal gyrus; However, LOPD showed lower ReHo values in the right putamen and left insula. The ReHo values were negatively correlated with the UPDRS total scores in the right putamen in LOPD, but a correlation between the ReHo value and UPDRS score was not detected in EOPD. Conclusions: Our findings support the notion that age at onset is associated with the distribution of cerebral regional homogeneity in the resting state and suggest that disproportionate putamen alterations are more prominent in patients with a younger age of onset. PMID:27462265

CDKL5 mutations in boys with severe encephalopathy and early-onset intractable epilepsy.

PubMed

Elia, M; Falco, M; Ferri, R; Spalletta, A; Bottitta, M; Calabrese, G; Carotenuto, M; Musumeci, S A; Lo Giudice, M; Fichera, M

2008-09-23

To search for CDKL5 gene mutations in boys presenting with severe early-onset encephalopathy and intractable epilepsy, a clinical picture very similar to that already described in girls with CDKL5 mutations. Eight boys (age range 3-16 years, mean age 8.5 years, SD 4.38) with severe or profound mental retardation and early-onset intractable seizures were selected for CDKL5 gene mutation screening by denaturing high-performance liquid chromatography analysis. We found three unrelated boys carrying three different missense mutations of the CDKL5 gene: c.872G>A (p.C291Y), c.863C>T (p.T288I), and c.533G>C (p.R178P). They presented early-onset, polymorphous, and drug-resistant seizures, mostly myoclonic and tonic or spasms. EEG showed epileptiform abnormalities which were multifocal during wakefulness, and pseudoperiodic bisynchronous during sleep. This study describes three boys carrying CDKL5 missense mutations and their detailed clinical and EEG data, and indicates that CDKL5 gene mutations may represent a cause of severe or profound mental retardation and early-onset intractable seizures, also in boys. Screening for CDKL5 mutations is strongly recommended in individuals with these clinical features.

Stabilization in early adult-onset myopia with corneal refractive therapy.

PubMed

González-Méijome, José M; Carracedo, Gonzalo; Lopes-Ferreira, Daniela; Faria-Ribeiro, Miguel A; Peixoto-de-Matos, Sofia C; Queirós, António

2016-02-01

To describe the stabilization of early adult-onset myopia in three university students after initiating orthokeratology treatment with corneal refractive therapy contact lenses. Three Caucasian early adult-onset progressing myopic subjects (1 male, 2 females) were fitted with corneal refractive therapy lenses to correct myopia between -1.50 and -2.50 D of sphere using Paragon CRT (Paragon Vision Sciences, Mesa, AZ) lenses for overnight orthokeratology. The pre-treatment refractive history from 2005 as well as refraction and axial length after treatment onset are reported over a period of 3 years between December 2009 and January 2013 with an additional year of follow-up after treatment discontinuation (January-December 2013). The peripheral refractive patterns and topographic changes are also reported individually. Treatment was successful in all three subjects achieving uncorrected visual acuity of 20/20 or better monocularly. During a period of 3 years of follow-up the subjects did not experience progression in their refractive error, nor in their axial length (measured during the last 2 years of treatment and 1 year after discontinuation). Furthermore, the subjects recovered to their baseline refraction and did not progressed further over the following year after lens wear discontinuation. We cannot attribute a causative effect to the orthokeratology treatment alone as underlying mechanism for myopia stabilization in this 3 patients. However, the present report points to the possibility of stabilization of early adult-onset myopia progression in young adults using corneal refractive therapy treatment. Copyright © 2015 Elsevier Ltd. All rights reserved.

Global and Temporal Cortical Folding in Patients with Early-Onset Schizophrenia

ERIC Educational Resources Information Center

Penttila, Jani; Paillere-Martinot, Marie-Laure; Martinot, Jean-Luc; Mangin, Jean-Francois; Burke, Lisa; Corrigall, Richard; Frangou, Sophia; Cachia, Arnaud

2008-01-01

Disturbances in the temporal lobes and alterations in cortical folding in adult on-set schizophrenia are studied using magnetic resonance T1 images of 51 patients. The study showed that patients with early on-set schizophrenia had lower global sulcal indices in both hemispheres and the left collateral sulcus has a lower sulcal index irrespective…

Atypical antipsychotics in the treatment of early-onset schizophrenia

PubMed Central

Hrdlicka, Michal; Dudova, Iva

2015-01-01

Atypical antipsychotics (AAPs) have been successfully used in early-onset schizophrenia (EOS). This review summarizes the randomized, double-blind, controlled studies of AAPs in EOS, including clozapine, risperidone, olanzapine, aripiprazole, paliperidone, quetiapine, and ziprasidone. No significant differences in efficacy between AAPs were found, with the exception of clozapine and ziprasidone. Clozapine demonstrated superior efficacy in treatment-resistant patients with EOS, whereas ziprasidone failed to demonstrate efficacy in the treatment of EOS. Our review also focuses on the onset of action and weight gain associated with AAPs. The data on onset of action of AAPs in pediatric psychiatry are scanty and inconsistent. Olanzapine appears to cause the most significant weight gain in patients with EOS, while ziprasidone and aripiprazole seem to cause the least. PMID:25897226

Early- versus late-onset obsessive-compulsive disorder: investigating genetic and clinical correlates.

PubMed

Hemmings, Sîan M J; Kinnear, Craig J; Lochner, Christine; Niehaus, Dana J H; Knowles, James A; Moolman-Smook, Johanna C; Corfield, Valerie A; Stein, Dan J

2004-09-30

There is increasing evidence that obsessive-compulsive disorder (OCD) is mediated by genetic factors. Although the precise mechanism of inheritance is unclear, recent evidence has pointed towards the involvement of the serotonergic and dopaminergic systems in the disorder's development. Furthermore, early-onset OCD appears to be a subtype that exhibits distinct clinical features and that is associated with greater familial loading. In the present investigation, South African OCD patients (n=252) were stratified according to age of onset and were clinically assessed. Additionally, selected variants in genes encoding serotonergic and dopaminergic components were investigated in a Caucasian OCD subset (n=180). This subgroup was further stratified to evaluate the role that these candidate genes may play in the genetically homogeneous Afrikaner subset (n=80). Analysis of the clinical data revealed an association between early age of onset and an increased frequency of tics, Tourette's disorder, and trichotillomania (TTM). The genetic studies yielded statistically significant results when the allelic distributions of genetic variants in the dopamine receptor type 4 gene (DRD4) were analysed in the Caucasian OCD cohort. These data support a role for the dopaminergic system, which may be relevant to the development of early-onset OCD.

Early Identification of Autism: Early Characteristics, Onset of Symptoms, and Diagnostic Stability

ERIC Educational Resources Information Center

Webb, Sara Jane; Jones, Emily J. H.

2009-01-01

In the first year of life, infants who later go on to develop autistic spectrum disorders (ASD) may exhibit subtle disruptions in social interest and attention, communication, temperament, and head circumference growth that occur prior to the onset of clinical symptoms. These disruptions may reflect the early course of ASD development and may also…

Double-blind comparison of first- and second-generation antipsychotics in early-onset schizophrenia and schizo-affective disorder: findings from the treatment of early-onset schizophrenia spectrum disorders (TEOSS) study.

PubMed

Sikich, Linmarie; Frazier, Jean A; McClellan, Jon; Findling, Robert L; Vitiello, Benedetto; Ritz, Louise; Ambler, Denisse; Puglia, Madeline; Maloney, Ann E; Michael, Emily; De Jong, Sandra; Slifka, Karen; Noyes, Nancy; Hlastala, Stefanie; Pierson, Leslie; McNamara, Nora K; Delporto-Bedoya, Denise; Anderson, Robert; Hamer, Robert M; Lieberman, Jeffrey A

2008-11-01

Atypical (second-generation) antipsychotics are considered standard treatment for children and adolescents with early-onset schizophrenia and schizoaffective disorder. However, the superiority of second-generation antipsychotics over first-generation antipsychotics has not been demonstrated. This study compared the efficacy and safety of two second-generation antipsychotics (olanzapine and risperidone) with a first-generation antipsychotic (molindone) in the treatment of early-onset schizophrenia and schizoaffective disorder. This double-blind multisite trial randomly assigned pediatric patients with early-onset schizophrenia and schizoaffective disorder to treatment with either olanzapine (2.5-20 mg/day), risperidone (0.5-6 mg/day), or molindone (10-140 mg/day, plus 1 mg/day of benztropine) for 8 weeks. The primary outcome was response to treatment, defined as a Clinical Global Impression (CGI) improvement score of 1 or 2 and >or=20% reduction in Positive and Negative Syndrome Scale (PANSS) total score after 8 weeks of treatment. In total, 119 youth were randomly assigned to treatment. Of these subjects, 116 received at least one dose of treatment and thus were available for analysis. No significant differences were found among treatment groups in response rates (molindone: 50%; olanzapine: 34%; risperidone: 46%) or magnitude of symptom reduction. Olanzapine and risperidone were associated with significantly greater weight gain. Olanzapine showed the greatest risk of weight gain and significant increases in fasting cholesterol, low density lipoprotein, insulin, and liver transaminase levels. Molindone led to more self-reports of akathisia. Risperidone and olanzapine did not demonstrate superior efficacy over molindone for treating early-onset schizophrenia and schizoaffective disorder. Adverse effects were frequent but differed among medications. The results question the nearly exclusive use of second-generation antipsychotics to treat early-onset schizophrenia

Coexistence of pernicious anemia and myasthenia gravis--a rare combination of autoimmune diseases in Taiwan.

PubMed

Chang, Kuo-Hsuan; Lyu, Rong-Kuo; Ro, Long-Sun; Wu, Yih-Ru; Chen, Chiung-Mei

2006-11-01

About 5-10% of patients with myasthenia gravis concomitantly have other autoimmune diseases. However, the coexistence of myasthenia gravis and pernicious anemia is rare. Here, we report a 73-year-old Taiwanese woman who developed myasthenia gravis 5 months after the onset of pernicious anemia. Her myasthenic and pernicious anemia symptoms markedly improved after pyridostigmine, prednisolone and hydroxocobalamine treatment. It is important to recognize concurrence of myasthenia gravis and pernicious anemia in the same patient because the therapeutic results for both diseases are rewarding.

Social Status of Adolescents with an Early Onset of Externalizing Behavior: The SNARE Study

ERIC Educational Resources Information Center

Franken, Aart; Harakeh, Zeena; Veenstra, Rene; Vollebergh, Wilma; Dijkstra, Jan Kornelis

2017-01-01

This study investigated the social status (i.e., popularity, likeability, and friendships) of adolescents with an early onset of externalizing behavior (i.e., alcohol use, tobacco use, and antisocial behavior). Building on Moffitt's dual-taxonomy model, it was hypothesized that early onset adolescents were more popular, but not necessarily more…

Anemia as a risk factor for chronic kidney disease.

PubMed

Iseki, K; Kohagura, K

2007-11-01

Chronic kidney disease (CKD) is an important and leading cause of end-stage renal disease (ESRD) and moreover, plays a role in the morbidity and mortality due to cardiovascular disease, infection, and cancer. Anemia develops during the early stages of CKD and is common in patients with ESRD. Anemia is an important cause of left ventricular hypertrophy and congestive heart failure. Correction of anemia by erthyropoiesis-stimulating agent (ESA) has been shown to improve survival in patients with congestive heart failure. Anemia is counted as one of the non-conventional risk factors associated with CKD. Hypoxia is one of the common mechanisms of CKD progression. Treatment by ESA is expected to improve quality of life, survival, and prevent the CKD progression. Several clinical studies have shown the beneficial effects of anemia correction on renal outcomes. However, recent prospective trials both in ESRD and in CKD stages 3 and 4 failed to confirm the beneficial effects of correcting anemia on survival. Similarly, treatment of other risk factors such as hyperlipidemia by statin showed no improvement in the survival of dialysis patients. Given the high prevalence of anemia in ESRD and untoward effects of anemia in CKD stages 3 and 4, appropriate and timely intervention on renal anemia using ESA is required for practicing nephrologists and others involved in the care of high-risk population. Lessons from the recent studies are to correct renal anemia (hemoglobin <10 g/dl not hemoglobin > or =13 g/dl). Early intervention for renal anemia is a part of the treatment option in the prevention clinic. In this study, clinical significance of anemia management in patients with CKD is discussed.

Thiamine-responsive megaloblastic anemia: early diagnosis may be effective in preventing deafness.

PubMed

Onal, Hasan; Bariş, Safa; Ozdil, Mine; Yeşil, Gözde; Altun, Gürkan; Ozyilmaz, Isa; Aydin, Ahmet; Celkan, Tiraje

2009-01-01

Thiamine-responsive megaloblastic anemia syndrome is an autosomal recessive disorder characterized by diabetes mellitus, megaloblastic anemia and sensorineural hearing loss. Mutations in the SLC19A2 gene, encoding a high-affinity thiamine transporter protein, THTR-1, are responsible for the clinical features associated with thiamine-responsive megaloblastic anemia syndrome in which treatment with pharmacological doses of thiamine correct the megaloblastic anemia and diabetes mellitus. The anemia can recur when thiamine is withdrawn. Thiamine may be effective in preventing deafness if started before two months. Our patient was found homozygous for a mutation, 242insA, in the nucleic acid sequence of exon B, with insertion of an adenine introducing a stop codon at codon 52 in the high-affinity thiamine transporter gene, SLC19A2, on chromosome 1q23.3.

Anemia and the onset of gout in a population-based cohort of adults: Atherosclerosis Risk in Communities study

PubMed Central

2012-01-01

Introduction There is a growing prevalence of gout in the US and worldwide. Gout is a recognized risk factor for cardiovascular disease (CVD). It is unclear whether other risk factors for CVD are also associated with increased risk of gout. Anemia is one such CVD risk factor. No studies have evaluated the relationship between anemia and gout. We tested whether anemia was associated with incident gout independent of comorbid conditions in Atherosclerosis Risk in the Communities. Methods This population-based cohort recruited 15,792 individuals in 1987 to 1989 from four US communities and contained nine years of follow-up. Anemia was defined as hemoglobin <13.5 g/dL for men and <12 g/dL for women. Using a Cox Proportional Hazards model, we estimated the hazard ratio (HR) and confidence intervals (CI) of incident gout by baseline anemia, adjusted for confounders (sex, race, estimated glomerular filtration rate, body mass index and alcohol intake) and clinical factors (coronary heart disease, congestive heart failure, diabetes, hypertension, diuretic use and serum urate level). Results Among the 10,791 participants, 10% had anemia at baseline. There were 271 cases of incident gout. Patients with anemia had a two-fold increased risk of developing gout over nine years (HR = 2.01, 95% CI: 1.46, 2.76). Anemia was associated with incident gout independent of known gout risk factors, confounders and clinical risk factors (HR = 1.73, 95% CI: 1.24, 2.41). This association persisted after additionally adjusting for serum urate level (HR = 1.83, 95% CI: 1.30, 2.57). Conclusion We identified anemia as a novel risk factor for gout. Anemia was associated with an approximately two-fold increased risk of gout-independent kidney function and serum urate. These findings suggest that anemia is a risk factor for gout on par with other chronic conditions such as obesity and diabetes. The biological mechanism linking anemia to gout remains unclear. PMID:22906142

Anemia and the onset of gout in a population-based cohort of adults: Atherosclerosis Risk in Communities study.

PubMed

McAdams-DeMarco, Mara A; Maynard, Janet W; Coresh, Josef; Baer, Alan N

2012-08-20

There is a growing prevalence of gout in the US and worldwide. Gout is a recognized risk factor for cardiovascular disease (CVD). It is unclear whether other risk factors for CVD are also associated with increased risk of gout. Anemia is one such CVD risk factor. No studies have evaluated the relationship between anemia and gout. We tested whether anemia was associated with incident gout independent of comorbid conditions in Atherosclerosis Risk in the Communities. This population-based cohort recruited 15,792 individuals in 1987 to 1989 from four US communities and contained nine years of follow-up. Anemia was defined as hemoglobin <13.5 g/dL for men and <12 g/dL for women. Using a Cox Proportional Hazards model, we estimated the hazard ratio (HR) and confidence intervals (CI) of incident gout by baseline anemia, adjusted for confounders (sex, race, estimated glomerular filtration rate, body mass index and alcohol intake) and clinical factors (coronary heart disease, congestive heart failure, diabetes, hypertension, diuretic use and serum urate level). Among the 10,791 participants, 10% had anemia at baseline. There were 271 cases of incident gout. Patients with anemia had a two-fold increased risk of developing gout over nine years (HR = 2.01, 95% CI: 1.46, 2.76). Anemia was associated with incident gout independent of known gout risk factors, confounders and clinical risk factors (HR = 1.73, 95% CI: 1.24, 2.41). This association persisted after additionally adjusting for serum urate level (HR = 1.83, 95% CI: 1.30, 2.57). We identified anemia as a novel risk factor for gout. Anemia was associated with an approximately two-fold increased risk of gout-independent kidney function and serum urate. These findings suggest that anemia is a risk factor for gout on par with other chronic conditions such as obesity and diabetes. The biological mechanism linking anemia to gout remains unclear.

Cognitive ability in young adulthood predicts risk of early-onset dementia in Finnish men.

PubMed

Rantalainen, Ville; Lahti, Jari; Henriksson, Markus; Kajantie, Eero; Eriksson, Johan G; Räikkönen, Katri

2018-06-06

To test if the Finnish Defence Forces Basic Intellectual Ability Test scores at 20.1 years predicted risk of organic dementia or Alzheimer disease (AD). Dementia was defined as inpatient or outpatient diagnosis of organic dementia or AD risk derived from Hospital Discharge or Causes of Death Registers in 2,785 men from the Helsinki Birth Cohort Study, divided based on age at first diagnosis into early onset (<65 years) or late onset (≥65 years). The Finnish Defence Forces Basic Intellectual Ability Test comprises verbal, arithmetic, and visuospatial subtests and a total score (scores transformed into a mean of 100 and SD of 15). We used Cox proportional hazard models and adjusted for age at testing, childhood socioeconomic status, mother's age at delivery, parity, participant's birthweight, education, and stroke or coronary heart disease diagnosis. Lower cognitive ability total and verbal ability (hazard ratio [HR] per 1 SD disadvantage >1.69, 95% confidence interval [CI] 1.01-2.63) scores predicted higher early-onset any dementia risk across the statistical models; arithmetic and visuospatial ability scores were similarly associated with early-onset any dementia risk, but these associations weakened after covariate adjustments (HR per 1 SD disadvantage >1.57, 95% CI 0.96-2.57). All associations were rendered nonsignificant when we adjusted for participant's education. Cognitive ability did not predict late-onset dementia risk. These findings reinforce previous suggestions that lower cognitive ability in early life is a risk factor for early-onset dementia. © 2018 American Academy of Neurology.

Early-Onset Psychosis in Youth with Intellectual Disability

ERIC Educational Resources Information Center

Friedlander, R. I.; Donnelly, T.

2004-01-01

Accurate diagnosis of psychotic disorders may be very difficult in youth with intellectual disabilities. The authors reviewed the assessment, treatment and follow-up of 21 youths with ID referred because of early onset of psychotic symptoms. Just over one half of the patients had a diagnosis of schizophrenia or schizo-affective disorder. One third…

Mapping callosal morphology in early- and late-onset elderly depression: an index of distinct changes in cortical connectivity.

PubMed

Ballmaier, Martina; Kumar, Anand; Elderkin-Thompson, Virginia; Narr, Katherine L; Luders, Eileen; Thompson, Paul M; Hojatkashani, Cornelius; Pham, Daniel; Heinz, Andreas; Toga, Arthur W

2008-06-01

There is some evidence of corpus callosum abnormalities in elderly depression, but it is not known whether these deficits are region-specific or differ based on age at onset of depression. Twenty-four patients with early-onset depression (mean age = 68.00, SD+/-5.83), 22 patients with late-onset depression (mean age = 74.50, SD+/-8.09) and 34 elderly control subjects (mean age = 72.38; SD+/-6.93) were studied. Using 3D MRI data, novel mesh-based geometrical modeling methods were applied to compare the midsagittal thickness of the corpus callosum at high spatial resolution between groups. Neuropsychological correlates of midsagittal callosal area differences were additionally investigated in a subsample of subjects. Depressed patients exhibited significant callosal thinning in the genu and splenium compared to controls. Significant callosal thinning was restricted to the genu in early-onset patients, but patients with late-onset depression exhibited significant callosal thinning in both the genu and splenium relative to controls. The splenium of the corpus callosum was also significantly thinner in subjects with late- vs early-onset depression. Genu and splenium midsagittal areas significantly correlated with memory and attention functioning among late-onset depressed patients, but not early-onset depressed patients or controls. Circumscribed structural alterations in callosal morphology may distinguish late- from early-onset depression in the elderly. These findings suggest distinct abnormalities of cortical connectivity in late- and early-onset elderly depression with possible influence on the course of illness. Patients with a late onset of depression may be at higher risk of illness progression and eventually dementia conversion than early-onset depression, with potentially important implications for research and therapy.

[Treatment of early onset scoliosis : How far can we go?].

PubMed

Studer, D; Hasler, C C; Schulze, A

2015-11-01

Recently, inconsistent definitions of early onset scoliosis (EOS) and a wide variety of treatment options have been observed. To clearly define the term EOS, to depict non-operative and operative treatment options, and to present the limitations of the boundaries of these techniques. Review of the literature, including conference presentations and expert opinions, in addition to personal experiences. Early onset scoliosis (EOS) refers to spine deformity that is present before 10 years of age, regardless of etiology. All existing operative treatment options share a high risk of complications. Therefore, non-operative treatment should act as a time-buying approach to postpone surgery. Awareness of treatment options and their specific indications, in addition to respecting each patient's individual needs and feasibilities, are crucial for the optimal outcome.

Genomic Influences on Hyperuricemia and Gout.

PubMed

Merriman, Tony

2017-08-01

Genome-wide association studies (GWAS) have identified nearly 30 loci associated with urate concentrations that also influence the subsequent risk of gout. The ABCG2 Q141 K variant is highly likely to be causal and results in internalization of ABCG2, which can be rescued by drugs. Three other GWAS loci contain uric acid transporter genes, which are also highly likely to be causal. However identification of causal genes at other urate loci is challenging. Finally, relatively little is known about the genetic control of progression from hyperuricemia to gout. Only 4 small GWAS have been published for gout. Copyright © 2017 Elsevier Inc. All rights reserved.

Fructose intake and risk of gout and hyperuricemia: a systematic review and meta-analysis of prospective cohort studies.

PubMed

Jamnik, Joseph; Rehman, Sara; Blanco Mejia, Sonia; de Souza, Russell J; Khan, Tauseef A; Leiter, Lawrence A; Wolever, Thomas M S; Kendall, Cyril W C; Jenkins, David J A; Sievenpiper, John L

2016-10-03

The prevalence of hyperuricemia and gout has increased in recent decades. The role of dietary fructose in the development of these conditions remains unclear. To conduct a systematic review and meta-analysis of prospective cohort studies investigating the association fructose consumption with incident gout and hyperuricemia. MEDLINE, EMBASE and the Cochrane Library were searched (through September 2015). We included prospective cohort studies that assessed fructose consumption and incident gout or hyperuricemia. 2 independent reviewers extracted relevant data and assessed study quality using the Newcastle-Ottawa Scale. We pooled natural-log transformed risk ratios (RRs) using the generic inverse variance method. Interstudy heterogeneity was assessed (Cochran Q statistic) and quantified (I 2 statistic). The overall quality of the evidence was assessed using the Grading of Recommendations Assessment, Development and Evaluation (GRADE) approach. 2 studies involving 125 299 participants and 1533 cases of incident gout assessed the association between fructose consumption and incident gout over an average of 17 years of follow-up. No eligible studies assessed incident hyperuricemia as an outcome. Fructose consumption was associated with an increase in the risk of gout (RR=1.62, 95% CI 1.28 to 2.03, p<0.0001) with no evidence of interstudy heterogeneity (I 2 =0%, p=0.33) when comparing the highest (>11.8% to >11.9% total energy) and lowest (<6.9% to <7.5% total energy) quantiles of consumption. Despite a dose-response gradient, the overall quality of evidence as assessed by GRADE was low, due to indirectness. There were only two prospective cohort studies involving predominantly white health professionals that assessed incident gout, and none assessed hyperuricemia. Fructose consumption was associated with an increased risk of developing gout in predominantly white health professionals. More prospective studies are necessary to understand better the role of fructose

Early-onset absence epilepsy aggravated by valproic acid: a video-EEG report.

PubMed

Belcastro, Vincenzo; Caraballo, Roberto Horacio; Romeo, Antonino; Striano, Pasquale

2013-12-01

Early-onset absence epilepsy refers to patients with absence seizures beginning before age 4 and comprises a heterogeneous group of epilepsies. Onset of absence seizures in the first year of life is very rare. We report a boy with absence seizures with onset at age 11 months, whose seizures increased in frequency after the introduction of valproic acid (VPA) treatment and substantially improved upon cessation of treatment. The mechanism of seizure worsening did not involve VPA toxicity, encephalopathy, Glut-1 deficiency or overdosage, and the reason for absence seizure aggravation remained unclear. The patient showed complete control of absence seizures with levetiracetam treatment and the course was benign, both in terms of seizure control and neuropsychological aspects. The similar overall electroclinical picture and outcome between children with early-onset absences and those with CAE support the view that these conditions are a continuum within the wide spectrum of IGE. [Published with video sequences].

Associations of personal and family preeclampsia history with the risk of early-, intermediate- and late-onset preeclampsia.

PubMed

Boyd, Heather A; Tahir, Hassaan; Wohlfahrt, Jan; Melbye, Mads

2013-12-01

Preeclampsia encompasses multiple conditions of varying severity. We examined the recurrence and familial aggregation of preeclampsia by timing of onset, which is a marker for severity. We ascertained personal and family histories of preeclampsia for women who delivered live singletons in Denmark in 1978-2008 (almost 1.4 million pregnancies). Using log-linear binomial regression, we estimated risk ratios for the associations between personal and family histories of preeclampsia and the risk of early-onset (before 34 weeks of gestation, which is typically the most severe), intermediate-onset (at 34-36 weeks of gestation), and late-onset (after 36 weeks of gestation) preeclampsia. Previous early-, intermediate-, or late-onset preeclampsia increased the risk of recurrent preeclampsia with the same timing of onset 25.2 times (95% confidence interval (CI): 21.8, 29.1), 19.7 times (95% CI: 17.0, 22.8), and 10.3 times (95% CI: 9.85, 10.9), respectively, compared with having no such history. Preeclampsia in a woman's family was associated with a 24%-163% increase in preeclampsia risk, with the strongest associations for early- and intermediate-onset preeclampsia in female relatives. Preeclampsia in the man's family did not affect a woman's risk of early-onset preeclampsia and was only weakly associated with her risks of intermediate- and late-onset preeclampsia. Early-onset preeclampsia appears to have the largest genetic component, whereas environmental factors likely contribute most to late-onset preeclampsia. The role of paternal genes in the etiology of preeclampsia appears to be limited.

[Hyperuricemia in systemic lupus erythematosus: is it associated with the neuropsychiatric manifestations of the disease?

PubMed

Sheikh, Mahdi; Movassaghi, Shafieh; Khaledi, Mohammad; Moghaddassi, Maryam

2015-07-17

To assess the association between hyperuricemia and different neuropsychiatric manifestations and stroke risk factors in systematic lupus erythematosus (SLE) patients. This study was conducted on 204 SLE patients who were admitted to a tertiary referral center. A standardized questionnaire was completed for all the participants and the medical records were reviewed regarding the occurrence of arterial or venous thrombotic events, stroke, seizure, depression, headache, psychosis, and peripheral neuropathy. In addition blood samples were drawn to obtain serum uric acid, triglyceride (TG), high-density lipoprotein (HDL) cholesterol, low-density lipoprotein (LDL) cholesterol, and total cholesterol levels. Hyperuricemia (serum uric acid ≥ 6mg/dl for women and ≥ 7mg/dl for men) was detected in 16.1% of SLE patients and was significantly associated with the occurrence of stroke (OR, 2.38; 95%CI, 1.2-7.24), and peripheral neuropathy (OR, 3.49; 95% CI, 1.52-12.23), independent of hypertension and hyperlipidemia. Hyperuricemia was also significantly associated with hypertension (OR, 7.76; 95% CI, 2.72-15.76), hyperlipidemia (OR, 5.05; 95% CI, 1.59-11.32), and history of arterial thrombosis (OR, 4.95; 95% CI, 1.98-15.34), independent of age and body mass index. Hyperuricemia in SLE patients is independently associated with the occurrence of stroke and peripheral neuropathy. It is also independently associated with hypertension, hyperlipidemia, and history of arterial thrombosis, which are the major stroke and myocardial infarction risk factors in SLE patients. Copyright © 2015 Elsevier Editora Ltda. All rights reserved.

Hyperuricemia in systemic lupus erythematosus: is it associated with the neuropsychiatric manifestations of the disease?

PubMed

Sheikh, Mahdi; Movassaghi, Shafieh; Khaledi, Mohammad; Moghaddassi, Maryam

To assess the association between hyperuricemia and different neuropsychiatric manifestations and stroke risk factors in systematic lupus erythematosus (SLE) patients. This study was conducted on 204 SLE patients who were admitted to a tertiary referral center. A standardized questionnaire was completed for all the participants and the medical records were reviewed regarding the occurrence of arterial or venous thrombotic events, stroke, seizure, depression, headache, psychosis, and peripheral neuropathy. In addition blood samples were drawn to obtain serum uric acid, triglyceride (TG), high-density lipoprotein (HDL) cholesterol, low-density lipoprotein (LDL) cholesterol, and total cholesterol levels. Hyperuricemia (serum uric acid ≥6mg/dl for women and ≥7mg/dl for men) was detected in 16.1% of SLE patients and was significantly associated with the occurrence of stroke (OR, 2.38; 95%CI, 1.2-7.24), and peripheral neuropathy (OR, 3.49; 95% CI, 1.52-12.23), independent of hypertension and hyperlipidemia. Hyperuricemia was also significantly associated with hypertension (OR, 7.76; 95% CI, 2.72-15.76), hyperlipidemia (OR, 5.05; 95% CI, 1.59-11.32), and history of arterial thrombosis (OR, 4.95; 95% CI, 1.98-15.34), independent of age and body mass index. Hyperuricemia in SLE patients is independently associated with the occurrence of stroke and peripheral neuropathy. It is also independently associated with hypertension, hyperlipidemia, and history of arterial thrombosis, which are the major stroke and myocardial infarction risk factors in SLE patients. Copyright © 2015 Elsevier Editora Ltda. All rights reserved.

The consumption of fish cooked by different methods was related to the risk of hyperuricemia in Japanese adults: A 3-year follow-up study.

PubMed

Ren, Z; Huang, C; Momma, H; Cui, Y; Sugiyama, S; Niu, K; Nagatomi, R

2016-09-01

Fish consumption is a recognized risk factor for elevated serum uric acid (UA) levels, hyperuricemia, and gout. However, the relationship between the consumption of fish cooked by different methods and the risk of hyperuricemia is unclear. Therefore, we aimed to investigate the relationship between the consumption of fish cooked by different methods and the risk of hyperuricemia in Japanese adults. A 3-year follow-up study was conducted with 424 Japanese adults aged 29-74 years. Fish consumption was assessed using a validated self-administered dietary history questionnaire, and hyperuricemia was defined as serum UA ≥7 mg/dL in men and ≥6 mg/dL in women or the use of any anti-gout treatment. During the 3-year follow-up period, we documented 30 newly diagnosed cases of hyperuricemia. After adjusting for potential confounders, multivariate logistic regressions analysis revealed a significant positive relationship between the risk of hyperuricemia and raw (sashimi and sushi) or roasted fish consumption, but not boiled or fried fish consumption. The odds ratios (95% CI) for hyperuricemia with increasing raw fish consumption were 1.00 (reference), 2.51 (0.85, 7.39), and 3.46 (1.07, 11.14) (P for trend: 0.036). Similarly, the odds ratios (95% CI) with increasing roasted fish consumption were 1.00 (reference), 3.00 (0.75, 11.89), and 5.17 (1.30, 20.62) (P for trend: 0.018). This 3-year follow-up study showed that the consumption of raw or roasted fish, but not boiled or fried fish, was related with a higher risk of hyperuricemia in Japanese adults. Copyright © 2016 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier B.V. All rights reserved.

Exome Sequencing Frequently Reveals the Cause of Early-Onset Chronic Kidney Disease

PubMed Central

Vivante, Asaf; Hildebrandt, Friedhelm

2016-01-01

The primary causes of chronic kidney disease (CKD) in children differ from those of adult onset CKD. In the United States the most common diagnostic groups of CKD that manifests before 25 years of age are: i) congenital anomalies of the kidneys and urinary tract (CAKUT) (49.1%), ii) steroid-resistant nephrotic syndrome (SRNS) (10.4%), iii) chronic glomerulonephritis (8.1%), and iv) renal cystic ciliopathies (5.3 %), encompassing >70% of CKD together. Recent findings suggest that early-onset CKD is caused by mutations in any one of over 200 different monogenic genes. High-throughput sequencing has very recently rendered identification of causative mutations in this high number of genes feasible. Molecular genetic diagnostics in early onset-CKD (before the age of 25 years) will, i) provide patients and families with a molecular genetic diagnosis, ii) generate new insights into diseases mechanisms, iii) allow etiology-based classification of patient cohorts for clinical studies and, iv) may have consequences for personalized treatment and prevention of CKD. In this review, we will discuss the implications of next-generation sequencing for clinical genetic diagnostics and discovery of novel genes in early-onset CKD. We also delineate the resulting opportunities for deciphering disease mechanisms and therapeutic implications. PMID:26750453

Early-Onset Bipolar Disorder: Characteristics and Outcomes in the Clinic.

PubMed

Connor, Daniel F; Ford, Julian D; Pearson, Geraldine S; Scranton, Victoria L; Dusad, Asha

2017-12-01

To assess patient characteristics and clinician-rated outcomes for children diagnosed with early-onset bipolar disorder in comparison to a depressive disorders cohort from a single clinic site. To assess predictors of bipolar treatment response. Medical records from 714 consecutive pediatric patients evaluated and treated at an academic tertiary child and adolescent psychiatry clinic between 2006 and 2012 were reviewed. Charts of bipolar children (n = 49) and children with depressive disorders (n = 58) meeting study inclusion/exclusion criteria were compared on variables assessing clinical characteristics, treatments, and outcomes. Outcomes were assessed by using pre- and post-Clinical Global Impressions (CGI)-Severity and Children's Global Assessment Scale (CGAS) scores, and a CGI-Improvement score ≤2 at final visit determined responder status. Bipolar outcome predictors were assessed by using multiple linear regression. Clinic prevalence rates were 6.9% for early-onset bipolar disorder and 1.5% for very early-onset bipolar disorder. High rates of comorbid diagnoses, symptom severity, parental stress, and child high-risk behaviors were found in both groups. The bipolar cohort had higher rates of aggression and higher lifetime systems of care utilization. The final CGI and CGAS outcomes for unipolar depression patients differed statistically significantly from those for the bipolar cohort, reflecting better clinical status and more improvement at outcome for the depression patients. Both parent-reported Child Behavior Checklist total T-score at clinic admission and the number of lifetime systems-of-care for the child were significantly and inversely associated with improvement for the bipolar cohort. Early-onset bipolar disorder is a complex and heterogeneous psychiatric disorder. Evidence-based treatment should emphasize psychopharmacology with adjunctive family and individual psychotherapy. Strategies to improve engagement in treatment may be especially

Comparison of Neuropsychological Functioning Between Adults With Early- and Late-Onset DSM-5 ADHD.

PubMed

Lin, Yu-Ju; Gau, Susan Shur-Fen

2017-09-01

We aimed to compare the visually dependent neuropsychological functioning among adults with Diagnostic and Statistical Manual of Mental Disorders (5th ed.; DSM-5) ADHD who recalled symptom onset by and after age 7 and non-ADHD controls. We divided the participants, aged 17 to 40 years, into three groups-(a) ADHD, onset <7 years (early-onset, n = 142); (b) ADHD, onset between 7 and <12 years (late-onset, n = 41); (c) non-ADHD controls ( n = 148)-and compared their neuropsychological functioning, measured by the Cambridge Neuropsychological Testing Automated Battery. Both ADHD groups had deficits in attention and signal detectability, spatial working memory, and short-term spatial memory, but only the early-onset group showed deficits in alertness, set-shifting, and planning after controlling for age, sex, and psychiatric comorbidities. There was no statistical difference between the two ADHD groups in neuropsychological functioning. DSM-5 criteria for diagnosing adult ADHD are not too lax regarding neuropsychological functioning.

Whole Exome Analysis of Early Onset Alzheimer’s Disease

DTIC Science & Technology

2016-04-01

Early Onset Alzheimer’s Disease 5a. CONTRACT NUMBER W81XWH-12-1-0013 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR( S ) Margaret A. Pericak...relationship between SORL1, AD, and Parkinsonism . 16 Appendix V: ABCA7 Frameshift Deletion Associated with Alzheimer’s Disease in African Americans...onset Alzheimer disease identified using whole-exome sequencing G. W. Beecham1, B. W. Kunkle1, B. Vardarajan2, P. L. Whitehead1, S . Rolati1, E. R

Evidence for apolipoprotein E {epsilon}4 association in early-onset Alzheimer`s patients with late-onset relatives

DOE Office of Scientific and Technical Information (OSTI.GOV)

Perez-Tur, J.; Delacourte, A.; Chartier-Harlin, M.C.

1995-12-18

Recently several reports have extended the apolipoprotein E (APOE) {epsilon}4 association found in late-onset Alzheimer`s disease (LOAD) patients to early-onset (EO) AD patients. We have studied this question in a large population of 119 EOAD patients (onset {<=}60 years) in which family history was carefully assessed and in 109 controls. We show that the APOE {epsilon}A allele frequency is increased only in the subset of patients who belong to families where LOAD secondary cases are present. Our sampling scheme permits us to demonstrate that, for an individual, bearing at least one {epsilon}4 allele increases both the risk of AD beforemore » age 60 and the probability of belonging to a family with late-onset affected subjects. Our results suggest that a subset of EOAD cases shares a common determinism with LOAD cases. 19 refs., 3 tabs.« less

Parental and Child Characteristics Related to Early-Onset Disordered Eating: A Systematic Review.

PubMed

Larsen, Pernille Stemann; Strandberg-Larsen, Katrine; Micali, Nadia; Andersen, Anne-Marie Nybo

2015-01-01

After participating in this activity, learners should be better able to: Evaluate the evidence regarding parental and child characteristics related to early-onset disordered eating. Eating disorders are rare in children, but disordered eating is common. Understanding the phenomenology of disordered eating in childhood can aid prevention of full-blown eating disorders. The purpose of this review is to systematically extract and synthesize the evidence on parental and child characteristics related to early-onset disordered eating. Systematic searches were conducted in PubMED/MEDLINE, EMBASE, and PsycInfo using the following search terms: eating disorder, disordered eating, problem eating, anorexia nervosa, bulimia nervosa, binge eating, child, preadolescent, and early onset. Studies published from 1990 to 2013 addressing parental and child characteristics of disordered eating in children aged 6 to 12 years were eligible for inclusion. The search was restricted to studies with cross-sectional, case-control, or longitudinal designs, studies in English, and with abstracts available. Forty-four studies fit these criteria. Most studies were based on community samples with a cross-sectional design. The included studies varied considerably in size, instruments used to assess early-onset disordered eating, and parental and child characteristics investigated. Important determinants included the following: higher body weight, previously reported disordered eating, body dissatisfaction, depression, parental disordered eating, and parental comments/concerns about child's weight and eating. The findings were inconsistent for sex, age, socioeconomic status, ethnicity, self-esteem/worth, and parental body weight. In conclusion, characteristics related to early-onset disordered eating have mainly been explored with a cross-sectional design. Full understanding of causal pathways will require good-quality longitudinal studies designed to address the influence of parental eating

Incidence of early-onset sepsis in infants born to women with clinical chorioamnionitis.

PubMed

Randis, Tara M; Rice, Madeline Murguia; Myatt, Leslie; Tita, Alan T N; Leveno, Kenneth J; Reddy, Uma M; Varner, Michael W; Thorp, John M; Mercer, Brian M; Dinsmoor, Mara J; Ramin, Susan M; Carpenter, Marshall W; Samuels, Philip; Sciscione, Anthony; Tolosa, Jorge E; Saade, George; Sorokin, Yoram

2018-05-23

To determine the frequency of sepsis and other adverse neonatal outcomes in women with a clinical diagnosis of chorioamnionitis. We performed a secondary analysis of a multi-center placebo-controlled trial of vitamins C/E to prevent preeclampsia in low risk nulliparous women. Clinical chorioamnionitis was defined as either the "clinical diagnosis" of chorioamnionitis or antibiotic administration during labor because of an elevated temperature or uterine tenderness in the absence of another cause. Early-onset neonatal sepsis was categorized as "suspected" or "confirmed" based on a clinical diagnosis with negative or positive blood, urine or cerebral spinal fluid cultures, respectively, within 72 h of birth. Adjusted odds ratios (ORs) and 95% confidence intervals (CIs) were estimated by logistic regression. Data from 9391 mother-infant pairs were analyzed. The frequency of chorioamnionitis was 10.3%. Overall, 6.6% of the neonates were diagnosed with confirmed (0.2%) or suspected (6.4%) early-onset sepsis. Only 0.7% of infants born in the setting of chorioamnionitis had culture-proven early-onset sepsis versus 0.1% if chorioamnionitis was not present. Clinical chorioamnionitis was associated with both suspected [OR 4.01 (3.16-5.08)] and confirmed [OR 4.93 (1.65-14.74)] early-onset neonatal sepsis, a need for resuscitation within the first 30 min after birth [OR 2.10 (1.70-2.61)], respiratory distress [OR 3.14 (2.16-4.56)], 1 min Apgar score of ≤3 [OR 2.69 (2.01-3.60)] and 4-7 [OR 1.71 (1.43-2.04)] and 5 min Apgar score of 4-7 [OR 1.67 (1.17-2.37)] (vs. 8-10). Clinical chorioamnionitis is common and is associated with neonatal morbidities. However, the vast majority of exposed infants (99.3%) do not have confirmed early-onset sepsis.

Postpartum anemia II: prevention and treatment.

PubMed

Milman, Nils

2012-02-01

This review focuses on the prevention and treatment of anemia in women who have just given childbirth (postpartum anemia). The problem of anemia both prepartum and postpartum is far more prevalent in developing countries than in the Western societies. The conditions for mother and child in the postpartum, nursing, and lactation period should be as favorable as possible. Many young mothers have a troublesome life due to iron deficiency and iron deficiency anemia (IDA) causing a plethora of symptoms including fatigue, physical disability, cognitive problems, and psychiatric disorders. Routine screening for postpartum anemia should be considered as part of the national maternal health programs. Major causes of postpartum anemia are prepartum iron deficiency and IDA in combination with excessive blood losses at delivery. Postpartum anemia should be defined as a hemoglobin level of <110 g/l at 1 week postpartum and <120 g/l at 8 weeks postpartum. Bleeding exceeding normal blood losses of approximately 300 ml may lead to rapid depletion of body iron reserves and may, unless treated, elicit long-standing iron deficiency and IDA in the postpartum period. The prophylaxis of postpartum anemia should begin already in early pregnancy in order to ensure a good iron status prior to delivery. The most reliable way to obtain this goal is to give prophylactic oral ferrous iron supplements 30-50 mg daily from early pregnancy and take obstetric precautions in pregnancies at risk for complications. In the treatment of slight-to-moderate postpartum IDA, the first choice should be oral ferrous iron 100 to 200 mg daily; it is essential to analyze hemoglobin after approximately 2 weeks in order to check whether treatment works. In severe IDA, intravenous ferric iron in doses ranging from 800 to 1,500 mg should be considered as first choice. In a few women with severe anemia and blunted erythropoiesis due to infection and/or inflammation, additional recombinant human

Early-onset lymphoproliferation and autoimmunity caused by germline STAT3 gain-of-function mutations

PubMed Central

Vogel, Tiphanie P.; Forbes, Lisa; Ma, Chi A.; Stray-Pedersen, Asbjørg; Niemela, Julie E.; Lyons, Jonathan J.; Engelhardt, Karin R.; Zhang, Yu; Topcagic, Nermina; Roberson, Elisha D. O.; Matthews, Helen; Verbsky, James W.; Dasu, Trivikram; Vargas-Hernandez, Alexander; Varghese, Nidhy; McClain, Kenneth L.; Karam, Lina B.; Nahmod, Karen; Makedonas, George; Mace, Emily M.; Sorte, Hanne S.; Perminow, Gøri; Rao, V. Koneti; O’Connell, Michael P.; Price, Susan; Su, Helen C.; Butrick, Morgan; McElwee, Joshua; Hughes, Jason D.; Willet, Joseph; Swan, David; Xu, Yaobo; Santibanez-Koref, Mauro; Slowik, Voytek; Dinwiddie, Darrell L.; Ciaccio, Christina E.; Saunders, Carol J.; Septer, Seth; Kingsmore, Stephen F.; White, Andrew J.; Cant, Andrew J.; Hambleton, Sophie

2015-01-01

Germline loss-of-function mutations in the transcription factor signal transducer and activator of transcription 3 (STAT3) cause immunodeficiency, whereas somatic gain-of-function mutations in STAT3 are associated with large granular lymphocytic leukemic, myelodysplastic syndrome, and aplastic anemia. Recently, germline mutations in STAT3 have also been associated with autoimmune disease. Here, we report on 13 individuals from 10 families with lymphoproliferation and early-onset solid-organ autoimmunity associated with 9 different germline heterozygous mutations in STAT3. Patients exhibited a variety of clinical features, with most having lymphadenopathy, autoimmune cytopenias, multiorgan autoimmunity (lung, gastrointestinal, hepatic, and/or endocrine dysfunction), infections, and short stature. Functional analyses demonstrate that these mutations confer a gain-of-function in STAT3 leading to secondary defects in STAT5 and STAT1 phosphorylation and the regulatory T-cell compartment. Treatment targeting a cytokine pathway that signals through STAT3 led to clinical improvement in 1 patient, suggesting a potential therapeutic option for such patients. These results suggest that there is a broad range of autoimmunity caused by germline STAT3 gain-of-function mutations, and that hematologic autoimmunity is a major component of this newly described disorder. Some patients for this study were enrolled in a trial registered at www.clinicaltrials.gov as #NCT00001350. PMID:25359994

[Acute Hyperuricemia and Kidney Injury after Three Cycles of Dose-Dense Chemotherapy for Retroperitoneal Choriocarcinoma -- A Case Report].

PubMed

Sakai, Hitomi; Matsuda, Masanori; Kadokura, Genmu; Katsumata, Noriyuki

2016-02-01

A 32 year-old man was diagnosed with retroperitoneal choriocarcinoma with metastasis to the lungs and liver. One cycle of modified BEP regimen did not sufficiently decrease the hCG. Therefore, we chose the GETUG 13 protocol of dose dense chemotherapy. After 6 days of cisplatin administration(3 cycles), he was diagnosed with acute hyperuricemia and kidney injury. He was treated with intravenous hydration and rasburicase. The hyperuricemia improved after a few days.

Functional neuroanatomical associations of working memory in early-onset Alzheimer's disease.

PubMed

Kobylecki, Christopher; Haense, Cathleen; Harris, Jennifer M; Stopford, Cheryl L; Segobin, Shailendra H; Jones, Matthew; Richardson, Anna M T; Gerhard, Alexander; Anton-Rodriguez, José; Thompson, Jennifer C; Herholz, Karl; Snowden, Julie S

2018-01-01

To characterize metabolic correlates of working memory impairment in clinically defined subtypes of early-onset Alzheimer's disease. Established models of working memory suggest a key role for frontal lobe function, yet the association in Alzheimer's disease between working memory impairment and visuospatial and language symptoms suggests that temporoparietal neocortical dysfunction may be responsible. Twenty-four patients with predominantly early-onset Alzheimer's disease were clinically classified into groups with predominantly amnestic, multidomain or visual deficits. Patients underwent neuropsychological evaluation focused on the domains of episodic and working memory, T1-weighted magnetic resonance imaging and brain fluorodeoxyglucose positron emission tomography. Fluorodeoxyglucose positron emission tomography data were analysed by using a region-of-interest approach. Patients with multidomain and visual presentations performed more poorly on tests of working memory compared with amnestic Alzheimer's disease. Working memory performance correlated with glucose metabolism in left-sided temporoparietal, but not frontal neocortex. Carriers of the apolipoprotein E4 gene showed poorer episodic memory and better working memory performance compared with noncarriers. Our findings support the hypothesis that working memory changes in early-onset Alzheimer's disease are related to temporoparietal rather than frontal hypometabolism and show dissociation from episodic memory performance. They further support the concept of subtypes of Alzheimer's disease with distinct cognitive profiles due to prominent neocortical dysfunction early in the disease course. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Deficits in Facial Expression Recognition in Male Adolescents with Early-Onset or Adolescence-Onset Conduct Disorder

ERIC Educational Resources Information Center

Fairchild, Graeme; Van Goozen, Stephanie H. M.; Calder, Andrew J.; Stollery, Sarah J.; Goodyer, Ian M.

2009-01-01

Background: We examined whether conduct disorder (CD) is associated with deficits in facial expression recognition and, if so, whether these deficits are specific to the early-onset form of CD, which emerges in childhood. The findings could potentially inform the developmental taxonomic theory of antisocial behaviour, which suggests that…

The Prevalence of the Risk Factors for Atherosclerosis among Type 2 Diabetic Patients Is Greater in the Progressive Stages of Chronic Kidney Disease

PubMed Central

Ito, Hiroyuki; Antoku, Shinichi; Furusho, Masahide; Shinozaki, Masahiro; Abe, Mariko; Mifune, Mizuo; Togane, Michiko; Ito, Kiyoko; Sanaka, Tsutomu

2013-01-01

Background/Aims The prevalence of the risk factors for atherosclerosis, other than diabetes mellitus, among type 2 diabetic patients with different stages of chronic kidney disease (CKD) determined by glomerular filtration rate (GFR) was investigated. Methods The prevalence of ten risk factors (age ≥65 years, history of smoking, male gender, obesity, albuminuria, hypertension, hypercholesterolemia, hypo-HDL-cholesterolemia, hyperuricemia and anemia) was determined in 2,107 Japanese type 2 diabetic patients with different stages of CKD (six stages according to GFR). Results The risk factors for age ≥65 years and male gender were found in 49 and 62% of the study subjects, respectively. The percentages of subjects with a current history of smoking, obesity, albuminuria, hypertension, hypercholesterolemia, hypo-HDL-cholesterolemia, hyperuricemia and anemia were 35, 44, 47, 70, 61, 13, 21 and 26%, respectively. The prevalence of age ≥65 years, male gender, albuminuria, hypertension, hypo-HDL-cholesterolemia, hyperuricemia and anemia was greater in the later stages of GFR, whereas the prevalence of hypercholesterolemia and obesity did not differ between stages. The prevalence of a current history of smoking was lower in the later stages of GFR. The cumulative number of risk factors increased from 3.1 to 6.8 in the later stages of GFR. Conclusion Among type 2 diabetic patients with CKD, the total number of risk factors increases with the progression of renal dysfunction. It is important to pay attention to newly recognized risk factors for hyperuricemia and anemia, in addition to hypertension, albuminuria and hypo-HDL-cholesterolemia, in monitoring diabetic patients with later stages of CKD. PMID:23904855

The common single-nucleotide polymorphism rs2681472 is associated with early-onset preeclampsia in Northern Han Chinese women.

PubMed

Wan, Ji-Peng; Wang, Hong; Li, Chang-Zhong; Zhao, Han; You, Li; Shi, Dong-Hong; Sun, Xiu-Hua; Lv, Hong; Wang, Fei; Wen, Ze-Qing; Wang, Xie-Tong; Chen, Zi-Jiang

2014-11-01

Preeclampsia, characterized by hypertension and proteinuria, remains a leading cause of maternal morbidity and mortality. Recently, a genome-wide association study (GWAS) identified the single-nucleotide polymorphism, rs2681472, as a new hypertension susceptibility genetic variant. The purpose of this study was to evaluate the association between preeclampsia and rs268172 in a Northern Han Chinese population. We genotyped 1218 unrelated Northern Han Chinese women, including 515 patients with preeclampsia and 703 healthy controls. No significant differences were detected in the allele frequencies between patients and controls (P = .23). When patients were divided into early-onset and late-onset preeclampsia according to gestational age of disease onset, the allele frequencies significantly differed between controls and patients with early-onset preeclampsia (P = .02). Genotype frequencies also were significantly different between controls and patients early-onset preeclampsia when data were analyzed under additive (P = .03) and dominant (P = .009) models. We replicated this association in an independent Northern Han Chinese population and observed a significant difference in the allele frequencies between patients with early-onset preeclampsia and controls (P = .011). We report that rs2681472 is associated with early-onset preeclampsia in Northern Han Chinese women. © The Author(s) 2014.

[Analysis of gene mutation of early onset epileptic spasm with unknown reason].

PubMed

Yang, X; Pan, G; Li, W H; Zhang, L M; Wu, B B; Wang, H J; Zhang, P; Zhou, S Z

2017-11-02

Objective: To summarize the gene mutation of early onset epileptic spasm with unknown reason. Method: In this prospective study, data of patients with early onset epileptic spasm with unknown reason were collected from neurological department of Children's Hospital of Fudan University between March 2016 and December 2016. Patients with known disorders such as infection, metabolic, structural, immunological problems and known genetic mutations were excluded. Patients with genetic disease that can be diagnosed by clinical manifestations and phenotypic characteristics were also excluded. Genetic research methods included nervous system panel containing 1 427 epilepsy genes, whole exome sequencing (WES), analysis of copy number variation (CNV) and karyotype analysis of chromosome. The basic information, phenotypes, genetic results and the antiepileptic treatment of patients were analyzed. Result: Nine of the 17 cases with early onset epileptic spasm were boys and eight were girls. Patients' age at first seizure onset ranged from 1 day after birth to 8 months (median age of 3 months). The first hospital visit age ranged from 1 month to 2 years (median age of 4.5 months). The time of following-up ranged from 8 months to 3 years and 10 months. All the 17 patients had early onset epileptic spasm. Video electroencephalogram was used to monitor the spasm seizure. Five patients had Ohtahara syndrome, 10 had West syndrome, two had unclear classification. In 17 cases, 10 of them had detected pathogenic genes. Nine cases had point mutations, involving SCN2A, ARX, UNC80, KCNQ2, and GABRB3. Except one case of mutations in GABRB3 gene have been reported, all the other cases had new mutations. One patient had deletion mutation in CDKL5 gene. One CNV case had 6q 22.31 5.5MB repeats. Ten cases out of 17 were using 2-3 antiepileptic drugs (AEDs) and the drugs had no effect. Seven cases used adrenocorticotropic hormone (ACTH) and prednisone besides AEDs (a total course for 8 weeks

Early-onset scoliosis: current treatment.

PubMed

Cunin, V

2015-02-01

Early-onset scoliosis, which appears before the age of 10, can be due to congenital vertebral anomalies, neuromuscular diseases, scoliosis-associated syndromes, or idiopathic causes. It can have serious consequences for lung development and significantly reduce the life expectancy compared to adolescent scoliosis. Extended posterior fusion must be avoided to prevent the crankshaft phenomenon, uneven growth of the trunk and especially restrictive lung disease. Conservative (non-surgical) treatment is used first. If this fails, fusionless surgery can be performed to delay the final fusion procedure until the patient is older. The gold standard delaying surgical treatment is the implantation of growing rods as described by Moe and colleagues in the mid-1980s. These rods, which are lengthened during short surgical procedures at regular intervals, curb the scoliosis progression until the patient reaches an age where fusion can be performed. Knowledge of this technique and its complications has led to several mechanical improvements being made, namely use of rods that can be distracted magnetically on an outpatient basis, without the need for anesthesia. Devices based on the same principle have been designed that preferentially attach to the ribs to specifically address chest wall and spine dysplasia. The second category of surgical devices consists of rods used to guide spinal growth that do not require repeated surgical procedures. The third type of fusionless surgical treatment involves slowing the growth of the scoliosis convexity to help reduce the Cobb angle. The indications are constantly changing. Improvements in surgical techniques and greater surgeon experience may help to reduce the number of complications and make this lengthy treatment acceptable to patients and their family. Long-term effects of surgery on the Cobb angle have not been compared to those involving conservative "delaying" treatments. Because the latter has fewer complications associated with

Cognitive Development in Infantile-Onset Pompe Disease Under Very Early Enzyme Replacement Therapy.

PubMed

Lai, Chih-Jou; Hsu, Ting-Rong; Yang, Chia-Feng; Chen, Shyi-Jou; Chuang, Ya-Chin; Niu, Dau-Ming

2016-12-01

Most patients with infantile-onset Pompe disease die in early infancy before beginning enzyme replacement therapy, which has made it difficult to evaluate the impact of Pompe disease on cognitive development. Patients with infantile-onset Pompe disease can survive with enzyme replacement therapy, and physicians can evaluate cognitive development in these patients. We established an effective newborn screening program with quick clinical diagnostic criteria. Cognitive and motor development were evaluated using the Bayley Scales of Infant and Toddler Development-Third Edition at 6, 12, and 24 months of age. The patients who were treated very early demonstrate normal cognitive development with no significant change in cognition during this period (P = .18 > .05). The cognitive development was positively correlated with motor development (r = 0.533, P = .011). The results indicated that very early enzyme replacement therapy could protect cognitive development in patients with infantile-onset Pompe disease up to 24 months of age. © The Author(s) 2016.

Polygenic risk score of sporadic late-onset Alzheimer's disease reveals a shared architecture with the familial and early-onset forms.

PubMed

Cruchaga, Carlos; Del-Aguila, Jorge L; Saef, Benjamin; Black, Kathleen; Fernandez, Maria Victoria; Budde, John; Ibanez, Laura; Deming, Yuetiva; Kapoor, Manav; Tosto, Giuseppe; Mayeux, Richard P; Holtzman, David M; Fagan, Anne M; Morris, John C; Bateman, Randall J; Goate, Alison M; Harari, Oscar

2018-02-01

To determine whether the extent of overlap of the genetic architecture among the sporadic late-onset Alzheimer's Disease (sLOAD), familial late-onset AD (fLOAD), sporadic early-onset AD (sEOAD), and autosomal dominant early-onset AD (eADAD). Polygenic risk scores (PRSs) were constructed using previously identified 21 genome-wide significant loci for LOAD risk. We found that there is an overlap in the genetic architecture among sEOAD, fLOAD, and sLOAD. The highest association of the PRS and risk (odds ratio [OR] = 2.27; P = 1.29 × 10 -7 ) was observed in sEOAD, followed by fLOAD (OR = 1.75; P = 1.12 × 10 -7 ) and sLOAD (OR = 1.40; P = 1.21 × 10 -3 ). The PRS was associated with cerebrospinal fluid ptau 181 -Aβ 42 on eADAD (P = 4.36 × 10 -2 ). Our analysis confirms that the genetic factors identified for LOAD modulate risk in sLOAD and fLOAD and also sEOAD cohorts. Specifically, our results suggest that the burden of these risk variants is associated with familial clustering and earlier onset of AD. Although these variants are not associated with risk in the eADAD, they may be modulating age at onset. Copyright © 2017 the Alzheimer's Association. Published by Elsevier Inc. All rights reserved.

Association between anemia and bronchopulmonary dysplasia in preterm infants

PubMed Central

Duan, Jun; Kong, Xiangyong; Li, Qiuping; Hua, Shaodong; Zhang, Sheng; Zhang, Xiaoying; Feng, Zhichun

2016-01-01

Anemia is commonly seen in preterm infants. It may reduce the capacity of hemoglobin to transport oxygen throughout the body and may result in tissue and organ dysfunction. This study aimed to investigate the effect of anemia on the development of bronchopulmonary dysplasia (BPD) in preterm infants. 243 infants who were admitted to BaYi Children’s Hospital Affiliated to Clinical Medical College in Beijing Military General Hospital with gestational age (GA) less than 32 weeks from February, 2014 to February, 2015 were included in the study. Maternal and infant data were recorded. Multivarariate logistic regression analysis was performed to determine the association between anemia and BPD. Of 243 preterm infants, the incidence of anemia was higher in BPD patients than non-BPD patients (p < 0.001). Mean Hct in BPD patients was lower than non-BPD patients at different time points in 1d, 7d, 14d, and 21d. Controlling for other confounding factors, early anemia was associated with an increased risk of BPD. Number of transfusions is also a significant risk factor for BPD (p = 0.001). Therefore, prevention and treatment of early anemia is necessary and reducing number of transfusions may reduce the incidence of BPD in preterm infants. PMID:26936610

Deferred and immediate imitation in regressive and early onset autism

PubMed Central

Rogers, Sally J.; Young, Gregory S.; Cook, Ian; Giolzetti, Angelo; Ozonoff, Sally

2010-01-01

Deferred imitation has long held a privileged position in early cognitive development, considered an early marker of representational thought with links to language development and symbolic processes. Children with autism have difficulties with several abilities generally thought to be related to deferred imitation: immediate imitation, language, and symbolic play. However, few studies have examined deferred imitation in early autism. The present study examined both deferred, spontaneous imitation and immediate, elicited imitation on a set of carefully matched tasks in 36 young children with autism: 16 with early onset autism, 20 with regressive autism and two contrast groups, younger typically developing children (n = 20) and age matched children with significant developmental delays (n = 21). Analyses of co-variance controlling for differences in verbal mental age revealed significant main effects for task, but no main effect of group and no interaction of task by group. Deferred imitation scores were lower than immediate imitation scores for all groups. Imitation performance was related to overall intellectual functioning for all groups, and there were moderate and significant relations between imitation in the immediate elicited condition and in the spontaneous deferred condition for all groups. Finally, there were no differences between onset subgroups in imitation scores, suggesting that the two share a similar phenotype involving both types of imitation. PMID:18221343

First impression at stroke onset plays an important role in early hospital arrival.

PubMed

Iguchi, Yasuyuki; Wada, Kuniyasu; Shibazaki, Kensaku; Inoue, Takeshi; Ueno, Yuji; Yamashita, Shinji; Kimura, Kazumi

2006-01-01

Treatment for acute ischemic stroke should be administered as soon as possible after symptom onset. The aim of this study was to investigate whether or not the patient's and bystander's first impression at stroke onset was associated with hospital arrival time. To investigate the factors influencing the prehospital delay, we prospectively interviewed consecutive stroke patients and bystanders about their first impression at the stroke onset and assessed the methods of transportation, and clinical characteristics. Early arrival was defined as a hospital arrival of within 2 h from stroke onset. One hundred thirty patients were enrolled: 82% were ischemic stroke and 18% were cerebral hemorrhage. The median interval between symptom onset and the hospital arrival was 7.5 h and 30% of patients presented within 2 h of stroke onset. First impression of stroke (odds ratios [OR] 4.56, 95% confidence interval [CI] 1.54-13.5, p=0.006), presence of consciousness disturbance (OR 4.29, CI 1.39-13.3, p=0.011), arrival through other facilities (OR 0.25, CI 0.08-0.76, p=0.015), a history of diabetes (OR 0.23, CI 0.06-0.80, p=0.028) and nocturnal onset (OR 0.19, CI 0.04-0.88, p=0.042) independently contributed to the early arrival. The first impression of patients and bystanders at stroke onset is important in order to reach hospital earlier in Japan. Public educational systems such as those, which advertise stroke warning signs, are necessary.

Maternal left ventricular hypertrophy and diastolic dysfunction and brain natriuretic peptide concentration in early- and late-onset pre-eclampsia.

PubMed

Borges, V T M; Zanati, S G; Peraçoli, M T S; Poiati, J R; Romão-Veiga, M; Peraçoli, J C; Thilaganathan, B

2018-04-01

Pre-eclampsia (PE) is associated with maternal cardiac remodeling and diastolic dysfunction. The aim of this study was to assess and compare maternal left ventricular structure and diastolic function and levels of brain natriuretic peptide (BNP) in women with early-onset (< 34 weeks' gestation) vs those with late-onset (≥ 34 weeks' gestation) PE. This was a prospective, cross-sectional, observational study of 30 women with early-onset PE, 32 with late-onset PE and 23 normotensive controls. Maternal cardiac structure and diastolic function were assessed by echocardiography and plasma levels of BNP were measured by enzyme immunoassay. Early- and late-onset PE were associated with increased left ventricular mass index and relative wall thickness compared with normotensive controls. In women with early-onset PE, the prevalence of concentric hypertrophy (40%) and diastolic dysfunction (23%) was also significantly higher (both P < 0.05) compared with women with late-onset PE (16% for both). Maternal serum BNP levels were significantly higher (P < 0.05) in women with early-onset PE and correlated with relative wall thickness and left ventricular mass index. Early-onset PE is associated with more severe cardiac impairment than is late-onset PE, as evidenced by an increased prevalence of concentric hypertrophy, diastolic dysfunction and higher levels of BNP. These findings suggest that early-onset PE causes greater myocardial damage, increasing the risk of both peripartum and postpartum cardiovascular morbidity. Although these cardiovascular effects are easily identified by echocardiographic parameters and measuring BNP, further studies are needed to assess their clinical utility. Copyright © 2017 ISUOG. Published by John Wiley & Sons Ltd. Copyright © 2017 ISUOG. Published by John Wiley & Sons Ltd.

Early onset marfan syndrome: Atypical clinical presentation of two cases

PubMed Central

Ozyurt, A; Baykan, A; Argun, M; Pamukcu, O; Halis, H; Korkut, S; Yuksel, Z; Gunes, T; Narin, N

2015-01-01

Early onset Marfan Syndrome (eoMFS) is a rare, severe form of Marfan Syndrome (MFS). The disease has a poor prognosis and most patients present with resistance to heart failure treatment during the newborn period. This report presents two cases of eoMFS with similar clinical features diagnosed in the newborn period and who died at an early age due to the complications related to the involvement of the cardiovascular system. PMID:26929908

Early-onset Major Depressive Disorder in men is associated with childlessness.

PubMed

Yates, William R; Meller, William H; Lund, Brian C; Thurber, Steve; Grambsch, Patricia L

2010-07-01

The self-reported number of children was compared for men and women from the National Epidemiologic Survey of Alcoholism and Related Conditions Survey (NESARC). Subjects with a diagnosis of major depressive disorder or bipolar disorder were compared to those without an axis I disorder. The effect of age, gender, marriage and diagnostic status on number of children was completed using multivariate analyses. Men with a history of major depressive disorder but not bipolar disorder reported higher rates of childlessness and lower mean number of children. This reduced number of children was related to an early age of onset of MDD. Thirty percent of men with an age of onset of MDD before 22 were childless compared to only 18.9% of men without an axis I disorder (Odds ratio=1.82, 95% CI=1.45-2.27). No effect of mood disorder on number of children was found in women with major depression or bipolar disorder. This study suggests that an early age of onset of major depressive disorder contributes to childlessness in men.

Functional Connectivity of the Amygdala in Early Childhood Onset Depression

PubMed Central

Luking, Katherine R.; Repovs, Grega; Belden, Andy C.; Gaffrey, Michael S.; Botteron, Kelly N.; Luby, Joan L.; Barch, Deanna M.

2011-01-01

Objective Adult major depressive disorder (MDD) is associated with reduced cortico-limbic functional connectivity thought to indicate decreased top-down control of emotion. However, it is unclear whether such connectivity alterations are also present in early childhood onset MDD. Method Fifty-one children ages 7–11 years, prospectively studied since preschool age, completed resting state fMRI and were assigned to four groups: 1) C-MDD (N=13) personal history of early childhood onset MDD; 2) M-MDD (N=11) a maternal history of affective disorders; 3) CM-MDD (N=13) both maternal and early childhood onset MDD or 4) CON (N=14) without either a personal or maternal history. We used seed-based resting state functional connectivity (rsfcMRI) analysis in an independent sample of adults to identify networks showing both positive (e.g., limbic regions) and negative (e.g., dorsal frontal/parietal regions) connectivity with the amygdala. These regions were then used in ROI based analyses of our child sample. Results We found a significant interaction between maternal affective disorder history and the child's MDD history for both positive and negative rsfcMRI networks. Specifically, when copared to CON, we found reduced connectivity between the amygdala and the “Negative Network” in children with C-MDD, M-MDD and CM-MDD. Children with either C-MDD or a maternal history of MDD (but not CM-MDD) displayed reduced connectivity between the amygdala and the “Positive Network”. Conclusions Our finding of an attenuated relationship between the amygdala, a region affected in MDD and involved in emotion processing, and cognitive control regions is consistent with a hypothesis of altered regulation of emotional processing in C-MDD suggesting developmental continuity of this alteration into early childhood. PMID:21961777

Clinical and molecular characterization of KCNT1-related severe early-onset epilepsy

PubMed Central

Nair, Umesh; Malhotra, Sony; Meyer, Esther; Trump, Natalie; Gazina, Elena V.; Papandreou, Apostolos; Ngoh, Adeline; Ackermann, Sally; Ambegaonkar, Gautam; Appleton, Richard; Desurkar, Archana; Eltze, Christin; Kneen, Rachel; Kumar, Ajith V.; Lascelles, Karine; Montgomery, Tara; Ramesh, Venkateswaran; Samanta, Rajib; Scott, Richard H.; Tan, Jeen; Whitehouse, William; Poduri, Annapurna; Scheffer, Ingrid E.; Chong, W.K. “Kling”; Cross, J. Helen; Topf, Maya; Petrou, Steven

2018-01-01

Objective To characterize the phenotypic spectrum, molecular genetic findings, and functional consequences of pathogenic variants in early-onset KCNT1 epilepsy. Methods We identified a cohort of 31 patients with epilepsy of infancy with migrating focal seizures (EIMFS) and screened for variants in KCNT1 using direct Sanger sequencing, a multiple-gene next-generation sequencing panel, and whole-exome sequencing. Additional patients with non-EIMFS early-onset epilepsy in whom we identified KCNT1 variants on local diagnostic multiple gene panel testing were also included. When possible, we performed homology modeling to predict the putative effects of variants on protein structure and function. We undertook electrophysiologic assessment of mutant KCNT1 channels in a xenopus oocyte model system. Results We identified pathogenic variants in KCNT1 in 12 patients, 4 of which are novel. Most variants occurred de novo. Ten patients had a clinical diagnosis of EIMFS, and the other 2 presented with early-onset severe nocturnal frontal lobe seizures. Three patients had a trial of quinidine with good clinical response in 1 patient. Computational modeling analysis implicates abnormal pore function (F346L) and impaired tetramer formation (F502V) as putative disease mechanisms. All evaluated KCNT1 variants resulted in marked gain of function with significantly increased channel amplitude and variable blockade by quinidine. Conclusions Gain-of-function KCNT1 pathogenic variants cause a spectrum of severe focal epilepsies with onset in early infancy. Currently, genotype-phenotype correlations are unclear, although clinical outcome is poor for the majority of cases. Further elucidation of disease mechanisms may facilitate the development of targeted treatments, much needed for this pharmacoresistant genetic epilepsy. PMID:29196579

Early Onset Substance Use in Adolescents with Depressive, Conduct, and Comorbid Symptoms

ERIC Educational Resources Information Center

Stone, Andrea L.; Vander Stoep, Ann; McCauley, Elizabeth

2016-01-01

This study investigates whether co-occurring depressive and conduct symptoms in early adolescence are associated with an elevated occurrence of early onset substance. Five hundred twenty-one sixth graders were assessed for depressive symptoms and conduct problems and underwent five substance use assessments during middle school. Logistic…

Risk factors for incident hyperuricemia during mid-adulthood in African American and White men and women enrolled in the ARIC cohort study

PubMed Central

2013-01-01

Background Increased serum urate levels are associated with poor outcomes including but not limited to gout. It is unclear whether serum urate levels are the sole predictor of incident hyperuricemia or whether demographic and clinical risk factors also predict the development of hyperuricemia. The goal of this study was to identify risk factors for incident hyperuricemia over 9 years in a population-based study, ARIC. Methods ARIC recruited individuals from 4 US communities; 8,342 participants who had urate levels <7.0 mg/dL were included in this analysis. Risk factors (including baseline, 3-year, and change in urate level over 3 years) for 9-year incident hyperuricemia (urate level of >7.0 g/dL) were identified using an AIC-based selection approach in a modified Poisson regression model. Results The 9-year cumulative incidence of hyperuricemia was 4%; men = 5%; women = 3%; African Americans = 6% and whites = 3%. The adjusted model included 9 predictors for incident hyperuricemia over 9 years: male sex (RR = 1.73 95% CI: 1.36-2.21), African-American race (RR = 1.79 95% CI: 1.37-2.33), smoking (RR = 1.27, 95% CI: 0.97-1.67), hyperuricemia after accounting for demographic and clinical risk factors. Conclusion Demographic and clinical risk factors that are routinely collected as part of regular medical care are jointly associated with the development of

Prevalence of hyperuricemia and relation of serum uric acid with cardiovascular risk factors in a developing country

PubMed Central

Conen, D; Wietlisbach, V; Bovet, P; Shamlaye, C; Riesen, W; Paccaud, F; Burnier, M

2004-01-01

Background The prevalence of hyperuricemia has rarely been investigated in developing countries. The purpose of the present study was to investigate the prevalence of hyperuricemia and the association between uric acid levels and the various cardiovascular risk factors in a developing country with high average blood pressures (the Seychelles, Indian Ocean, population mainly of African origin). Methods This cross-sectional health examination survey was based on a population random sample from the Seychelles. It included 1011 subjects aged 25 to 64 years. Blood pressure (BP), body mass index (BMI), waist circumference, waist-to-hip ratio, total and HDL cholesterol, serum triglycerides and serum uric acid were measured. Data were analyzed using scatterplot smoothing techniques and gender-specific linear regression models. Results The prevalence of a serum uric acid level >420 μmol/L in men was 35.2% and the prevalence of a serum uric acid level >360 μmol/L was 8.7% in women. Serum uric acid was strongly related to serum triglycerides in men as well as in women (r = 0.73 in men and r = 0.59 in women, p < 0.001). Uric acid levels were also significantly associated but to a lesser degree with age, BMI, blood pressure, alcohol and the use of antihypertensive therapy. In a regression model, triglycerides, age, BMI, antihypertensive therapy and alcohol consumption accounted for about 50% (R2) of the serum uric acid variations in men as well as in women. Conclusions This study shows that the prevalence of hyperuricemia can be high in a developing country such as the Seychelles. Besides alcohol consumption and the use of antihypertensive therapy, mainly diuretics, serum uric acid is markedly associated with parameters of the metabolic syndrome, in particular serum triglycerides. Considering the growing incidence of obesity and metabolic syndrome worldwide and the potential link between hyperuricemia and cardiovascular complications, more emphasis should be put on the

[The relationship between accommodative accuracy at different near-work distances and early-onset myopia].

PubMed

Yu, Q W; Zhang, P; Zhou, S B; Hu, Y; Ji, M X; Luo, Y C; You, H L; Yao, Z X

2016-07-01

To observe the accommodative accuracy of children with early-onset myopia at different near-work distances, and discuss the relationship between accommodative accuracy and early-onset myopia. This was a case-control study. Thirty-seven emmetropic children, 41 early-onset myopic children without correction, and 39 early-onset myopic children with spectacles, aged 7 to 13 years, were included. Measures of refractive errors and accommodative accuracy at four near-work distances, including 50 cm, 40 cm, 30 cm, and 20 cm, were made using the binocular fusion cross cylinder (FCC) of an automatic phoropter. Most candidates showed accommodative lags, including the children with emmetropia. The ratio of lags in all candidates at different near-work distances was 75.21% (50 cm), 87.18% (40 cm), 92.31% (30 cm), and 98.29% (20 cm), respectively. All accommodative accuracies became worse, and the accommodative lag ratio and values of FCC increased, along with the shortening of the distance. The difference in accommodative accuracy among groups was statistically significant at 30 cm (χ(2)=7.852, P= 0.020) and 20 cm (χ(2)=6.480, P=0.039). The values of FCC among groups were significantly different at 30 cm (F=3.626, P=0.030) and 20 cm (F=3.703, P=0.028), but not at 50 cm and 40 cm (P>0.05). In addition, the FCC values of 30 cm and 20 cm had a statistically significant difference between myopic children without correction [(1.25±0.44) D and (1.76±0.43) D] and emmetropic children [(0.95±0.52) D and (1.41±0.58) D] (P=0.012, 0.008). The correlation between diopters of myopia and accommodative accuracy at different nearwork distances was not statistically significant (P>0.05). However, the correlation between diopters of myopia and the accommodative lag value (FCC) at 20 cm was statistically significant (r=0.246, P=0.028). The closer the near-work distance is, the worse the accommodative accuracy is. This is more significant in early-onset myopia, especially myopia without

Assessing the Clinical Role of Genetic Markers of Early-Onset Prostate Cancer Among High-Risk Men Enrolled in Prostate Cancer Early Detection

PubMed Central

Hughes, Lucinda; Zhu, Fang; Ross, Eric; Gross, Laura; Uzzo, Robert G.; Chen, David Y. T.; Viterbo, Rosalia; Rebbeck, Timothy R.; Giri, Veda N.

2011-01-01

Background Men with familial prostate cancer (PCA) and African American men are at risk for developing PCA at younger ages. Genetic markers predicting early-onset PCA may provide clinically useful information to guide screening strategies for high-risk men. We evaluated clinical information from six polymorphisms associated with early-onset PCA in a longitudinal cohort of high-risk men enrolled in PCA early detection with significant African American participation. Methods Eligibility criteria include ages 35–69 with a family history of PCA or African American race. Participants undergo screening and biopsy per study criteria. Six markers associated with early-onset PCA (rs2171492 (7q32), rs6983561 (8q24), rs10993994 (10q11), rs4430796 (17q12), rs1799950 (17q21), and rs266849 (19q13)) were genotyped. Cox models were used to evaluate time to PCA diagnosis and PSA prediction for PCA by genotype. Harrell’s concordance index was used to evaluate predictive accuracy for PCA by PSA and genetic markers. Results 460 participants with complete data and ≥1 follow-up visit were included. 56% were African American. Among African American men, rs6983561 genotype was significantly associated with earlier time to PCA diagnosis (p=0.005) and influenced prediction for PCA by the PSA (p<0.001). When combined with PSA, rs6983561 improved predictive accuracy for PCA compared to PSA alone among African American men (PSA= 0.57 vs. PSA+rs6983561=0.75, p=0.03). Conclusions Early-onset marker rs6983561 adds potentially useful clinical information for African American men undergoing PCA risk assessment. Further study is warranted to validate these findings. Impact Genetic markers of early-onset PCA have potential to refine and personalize PCA early detection for high-risk men. PMID:22144497

The cortical damage, early relapses, and onset of the progressive phase in multiple sclerosis.

PubMed

Scalfari, Antonio; Romualdi, Chiara; Nicholas, Richard S; Mattoscio, Miriam; Magliozzi, Roberta; Morra, Aldo; Monaco, Salvatore; Muraro, Paolo A; Calabrese, Massimiliano

2018-05-16

To investigate the relationship among cortical radiologic changes, the number of early relapses (ERs), and the long-term course of multiple sclerosis (MS). In this cohort study, we assessed the number of cortical lesions (CLs) and white matter (WM) lesions and the cortical thickness (Cth) at clinical onset and after 7.9 mean years among 219 patients with relapsing remitting (RR) MS with 1 (Low-ER), 2 (Mid-ER), and ≥3 (High-ER) ERs during the first 2 years. Kaplan-Meier and Cox regression analyses investigated early factors influencing the risk of secondary progressive (SP) MS. Fifty-nine patients (27%) converted to SPMS in 6.1 mean years. A larger number of CLs at onset predicted a higher risk of SPMS (hazard ratio [HR] 2.16, 4.79, and 12.3 for 2, 5, and 7 CLs, respectively, p < 0.001) and shorter latency to progression. The High-ER compared to the Low-ER and Mid-ER groups had a larger volume of WM lesions and CLs at onset, accrued more CLs, experienced more severe cortical atrophy over time, and entered the SP phase more rapidly. In the multivariate model, older age at onset (HR 1.97, p < 0.001), a larger baseline CL (HR 2.21, p = 0.005) and WM lesion (HR 1.32, p = 0.03) volume, early changes of global Cth (HR 1.36, p = 0.03), and ≥3 ERs (HR 6.08, p < 0.001) independently predicted a higher probability of SP. Extensive cortical damage at onset is associated with florid inflammatory clinical activity and predisposes to a rapid occurrence of the progressive phase. Age at onset, the number of early attacks, and the extent of baseline focal cortical damage can identify groups at high risk of progression who may benefit from more active therapy. © 2018 American Academy of Neurology.

The Use of Cannabis as a Predictor of Early Onset of Bipolar Disorder and Suicide Attempts

PubMed Central

Leite, Rafaela Torres Portugal; Nogueira, Sarah de Oliveira; do Nascimento, João Paulo Rodrigues; de Lima, Laisa Soares; da Nóbrega, Taís Bastos; Virgínio, Mariana da Silva; Moreno, Lucas Monte da Costa; Sampaio, Bruno Henrique Barbosa; Souza, Fábio Gomes de Matos e

2015-01-01

Introduction. Bipolar disorder (BD) implies risk of suicide. The age at onset (AAO) of BD carries prognostic significance. Substance abuse may precede the onset of BD and cannabis is the most common illicit drug used. The main goal of this study is to review the association of cannabis use as a risk factor for early onset of BD and for suicide attempts. Materials and Methods. PubMed database was searched for articles using key words “bipolar disorder,” “suicide attempts,” “cannabis,” “marijuana,” “early age at onset,” and “early onset.” Results. The following percentages in bipolar patients were found: suicide attempts 3.6–42%; suicide attempts and substance use 5–60%; suicide attempts and cannabis use 15–42%. An early AAO was associated with cannabis misuse. The mean age of the first manic episode in individuals with and without BD and cannabis use disorder (CUD) was 19.5 and 25.1 years, respectively. The first depressive episode was at 18.5 and 24.4 years, respectively. Individuals misusing cannabis showed increased risk of suicide. Discussion. Cannabis use is associated with increased risk of suicide attempts and with early AAO. However, the effect of cannabis at the AAO and suicide attempts is not clear. PMID:26097750

Circulatory nucleosome levels are significantly increased in early and late-onset preeclampsia.

PubMed

Zhong, Xiao Yan; Gebhardt, Stefan; Hillermann, Renate; Tofa, Kashefa Carelse; Holzgreve, Wolfgang; Hahn, Sinuhe

2005-08-01

Elevations in circulatory DNA, as measured by real-time PCR, have been observed in pregnancies with manifest preeclampsia. Recent reports have indicated that circulatory nucleosome levels are elevated in the periphery of cancer patients. We have now examined whether circulatory nucleosome levels are similarly elevated in cases with preeclampsia. Maternal plasma samples were prepared from 17 cases with early onset preeclampsia (<34 weeks gestation) with 14 matched normotensive controls, as well as 15 cases late-onset preeclampsia (>34 weeks gestation) with 10 matched normotensive controls. Levels of circulatory nucleosomes were quantified by commercial ELISA (enzyme-linked immunosorbant assay). The level of circulatory nucleosomes was significantly elevated in both study preeclampsia groups, compared to the matched normotensive control group (p = 0.000 and p = 0.001, respectively). Our data suggests that preeclampsia is associated with the elevated presence of circulatory nucleosomes, and that this phenomenon occurs in both early- and late-onset forms of the disorder. Copyright 2005 John Wiley & Sons, Ltd.

Study protocol: EXERcise and cognition in sedentary adults with early-ONset dementia (EXERCISE-ON).

PubMed

Hooghiemstra, Astrid M; Eggermont, Laura H P; Scheltens, Philip; van der Flier, Wiesje M; Bakker, Jet; de Greef, Mathieu H G; Koppe, Peter A; Scherder, Erik J A

2012-08-16

Although the development of early-onset dementia is a radical and invalidating experience for both patient and family there are hardly any non-pharmacological studies that focus on this group of patients. One type of a non-pharmacological intervention that appears to have a beneficial effect on cognition in older persons without dementia and older persons at risk for dementia is exercise. In view of their younger age early-onset dementia patients may be well able to participate in an exercise program. The main aim of the EXERCISE-ON study is to assess whether exercise slows down the progressive course of the symptoms of dementia. One hundred and fifty patients with early-onset dementia are recruited. After completion of the baseline measurements, participants living within a 50 kilometre radius to one of the rehabilitation centres are randomly assigned to either an aerobic exercise program in a rehabilitation centre or a flexibility and relaxation program in a rehabilitation centre. Both programs are applied three times a week during 3 months. Participants living outside the 50 kilometre radius are included in a feasibility study where participants join in a daily physical activity program set at home making use of pedometers. Measurements take place at baseline (entry of the study), after three months (end of the exercise program) and after six months (follow-up). Primary outcomes are cognitive functioning; psychomotor speed and executive functioning; (instrumental) activities of daily living, and quality of life. Secondary outcomes include physical, neuropsychological, and rest-activity rhythm measures. The EXERCISE-ON study is the first study to offer exercise programs to patients with early-onset dementia. We expect this study to supply evidence regarding the effects of exercise on the symptoms of early-onset dementia, influencing quality of life. The present study is registered within The Netherlands National Trial Register (ref: NTR2124).

Psychological differences between early- and late-onset psoriasis: a study of personality traits, anxiety and depression in psoriasis.

PubMed

Remröd, C; Sjöström, K; Svensson, A

2013-08-01

Onset of psoriasis may occur at any age. Early negative experiences often influence personality development, and may lead to physical disease, anxiety and depression in adulthood. Knowledge about onset of psoriasis and psychopathology is limited. To examine whether patients with early-onset psoriasis differ psychologically from patients with late-onset psoriasis, regarding personality traits, anxiety and depression. A descriptive cross-sectional study was conducted among 101 consecutively recruited outpatients with psoriasis. A psychosocial interview was performed followed by self-assessment of validated questionnaires: Swedish Universities Scales of Personality (SSP), Spielberger State-Trait Anxiety Inventory and Beck Depression Inventory. Psoriasis severity was assessed by the Psoriasis Area and Severity Index. Patients with early-onset psoriasis (age < 20 years) were significantly more anxious and depressed than patients with late-onset psoriasis. In multiple linear regression models, younger age at onset of psoriasis was a significant determinant of higher scores of four personality traits: SSP-embitterment, -trait irritability, -mistrust and -verbal trait aggression. Our results indicate that early detection of psychological vulnerability when treating children and adolescents with psoriasis seems to be of great importance. Traits of psychological vulnerability and pessimistic personality traits were found to be significantly associated with the early onset of psoriasis, but not with disease duration in this study. These traits may be seen as a consequence of psoriasis, and/or as individual traits modulating and impairing clinical course and efforts to cope with psoriasis. © 2013 The Authors BJD © 2013 British Association of Dermatologists.

EARLY ONSET OF DELINQUENCY AND THE TRAJECTORY OF ALCOHOL-IMPAIRED DRIVING AMONG YOUNG MALES*

PubMed Central

Zhang, Lening; Wieczorek, William F.; Welte, John W.

2011-01-01

Building upon the literature in developmental and life-course criminology, the present study assesses the possible association of age onset of delinquency with the trajectory of alcohol-impaired driving using data collected from the three waves of the Buffalo Longitudinal Survey of Young Men (BLSYM). It is argued that as a unique form of delinquency, alcohol-impaired driving among adolescents may be better understood in a broad context of adolescent delinquency involvement. The study adopts the general approach for the analysis of early onset of delinquency and criminal careers in developmental and life-course criminology and hypothesizes that early onset of delinquency is associated with a higher growth of alcohol-impaired driving over time among adolescents when age onsets of alcohol-impaired driving, drinking, and drug use are controlled. Our analysis with the HLM growth modeling method provides support for the hypothesis. Respondents who had an early start in delinquency were likely to have a faster growth of alcohol-impaired driving over the three waves of BLSYM, which implies that these respondents were likely to have a longer path of alcohol-impaired driving in their transition to adulthood. The implication of this finding is discussed. PMID:21831528

Prognosis and response to laser treatment of early-onset hypertrophic port-wine stains (PWS).

PubMed

Passeron, Thierry; Salhi, Aicha; Mazer, Jean-Michel; Lavogiez, Céline; Mazereeuw-Hautier, Juliette; Galliot, Chrystèle; Collet-Villette, Anne-Marie; Labreze, Christine; Boon, Laurence; Hardy, Jean-Philippe; Fayard, Virginie; Livideanu, Cristina Bulai; Toubel, Gérard; Georgescou, Gabriela; Gral, Nathalie; Maza, Aude; Lacour, Jean-Philippe

2016-07-01

There is limited information regarding early development of soft-tissue and/or bone hypertrophy with facial port-wine stains (PWS). We sought to characterize patients with hypertrophic PWS presenting during childhood. Patients with a facial PWS and underlying hypertrophy that developed before the age of 18 years were included in a multicenter retrospective study. Age at onset of the hypertrophy, its location, association with odontologic problems, presence of other associated complications, and response to laser treatment were recorded. A total of 98 patients were included. The mean age at onset of hypertrophy, retrieved for 77 of 98 patients, was 5.6 years. The hypertrophy was congenital in 26%. Odontologic problems were noted in 39.8% of cases. Other complications, including cataract, asymmetric development of the maxillary bone, and speech delay/disorders, were reported in 18.4%. In all, 67 patients received laser treatment. Only 3% achieved complete or nearly complete clearance of the PWS. As only cases of PWS with early-onset hypertrophy were included, we were unable to calculate the prevalence of this manifestation. PWS with early-onset hypertrophy are associated with a high rate of complications and a poor response to laser treatment. Periodic monitoring is recommended for early detection and treatment of complications. Copyright © 2016 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

Alcohol intake and early-onset basal cell carcinoma in a case-control study

PubMed Central

Zhang, Y; Ferrucci, L.M.; Cartmel, B.; Molinaro, A.M.; Leffell, D.J.; Bale, A.E.; Mayne, S.T.

2014-01-01

Background Previous epidemiologic studies of overall alcohol intake and basal cell carcinoma (BCC) are inconsistent, with some evidence for differences by type of alcoholic beverage. While alcohol may enhance the carcinogenicity of ultraviolet (UV) light, this has not been evaluated in existing epidemiologic studies. Objective To evaluate alcohol intake in relation to early-onset BCC, and explore potential interactions with UV exposure. Methods BCC cases (n=380) and controls with benign skin conditions (n=390) under age 40 were identified through Yale Dermatopathology. Participants provided information on lifetime alcohol intake, including type of beverage during an in-person interview. Self-report data on indoor tanning and outdoor sunbathing were used to categorize UV exposure. We calculated odds ratios (OR) and 95% confidence intervals (CI) using unconditional multivariate logistic regression in the full sample and in women only. Results There was no statistically significant association between lifetime alcohol intake and early-onset BCC overall (above median intake vs. no regular alcohol intake OR 1.10, 95% CI 0.69-1.73) or in women only (OR 1.21, 95% CI 0.73-2.01). Similarly, intake of red wine, white wine, beer or hard liquor and mixed drinks was not associated with early-onset BCC. In exploratory analyses, we saw limited evidence for an interaction (pinteraction=0.003), with highest risk for high alcohol and high UV exposures, especially in women, but subgroup risk estimates had wide and overlapping confidence intervals. Conclusions Overall, we did not observe any clear association between lifetime alcohol intake and early-onset BCC. PMID:25059635

Early Onset Bipolar Spectrum Disorder: Psychopharmacological, Psychological, and Educational Management

ERIC Educational Resources Information Center

McIntosh, David E.; Trotter, Jeffrey S.

2006-01-01

Although published research continues to advocate medication as the first line of treatment for early onset bipolar spectrum disorder (EOBSD; N. Lofthouse & M.A. Fristad, 2004), preliminary research demonstrating the utility of cognitive, cognitive-behavioral, and psychoeducational therapies is promising. It appears as if future treatment of EOBSD…

[Neuropsychiatric manifestations ushering pernicious anemia].

PubMed

Mrabet, S; Ellouze, F; Ellini, S; Mrad, M F

2015-12-01

Biermer disease or pernicious anemia is an autoimmune atrophic gastritis characterized by the lack of secretion of gastric intrinsic factor. This leads to an insufficient absorption of vitamin B12 in the ileum. Clinical manifestations are mainly hematologic. Neuropsychiatric manifestations are known but are less frequent especially early in the disease. Inaugural neuropsychiatric arrays are rare and various thus making diagnosis difficult. In this article, we report through two clinical cases different neuropsychiatric manifestations revealing pernicious anemia. Mrs. C.O., aged 56, presented after surgery for gallstones, an acute psychiatric array associated with gait disorders. She had no history of neurological or psychiatric problems. The psychiatric interview revealed delirious syndrome, depressive symptoms and anxiety. Neurological examination noted a flaccid paraplegia with peripheral neuropathic syndrome and myoclonus in the upper limbs. At the full blood count, a macrocytosis (VGM: 112.2fl) without anemia was found. The level of vitamin B12 in the blood was low. Cerebro-spinal MRI was suggestive of a neuro-Biermer and showed hyper signal in the cervical cord on T2-weighted sagittal section. In axial section, hyper signal appears at the posterior columns in the form of V. There were no brain abnormalities. A sensorimotor axonal polyneuropathy was diagnosed. The patient received vitamin B12 intramuscularly for ten days associated with neuroleptic treatment. Mrs. R.M., aged 40, was brought to the psychiatry consultation for acute behavioral disorders progressively worsening over a month. An anxiety syndrome, depressive syndrome and delirious syndrome were identified. Neurological examination showed a posterior cordonal syndrome with quadripyramidal syndrome. Full blood count showed a macrocytic anemia. Serum B12 level was collapsed. Cerebro-spinal MRI was normal. She received vitamin B12 with clinical and biological improvement. Features of pernicious anemia

Early vs late age at onset frontotemporal dementia and frontotemporal lobar degeneration.

PubMed

Seo, Sang Won; Thibodeau, Marie-Pierre; Perry, David C; Hua, Alice; Sidhu, Manu; Sible, Isabel; Vargas, Jose Norberto S; Gaus, Stephanie E; Rabinovici, Gil D; Rankin, Katherine D; Boxer, Adam L; Kramer, Joel H; Rosen, Howard J; Gorno-Tempini, Maria Luisa; Grinberg, Lea T; Huang, Eric J; DeArmond, Stephen J; Trojanowski, John Q; Miller, Bruce L; Seeley, William W

2018-03-20

To examine clinicopathologic correlations in early vs late age at onset frontotemporal dementia (FTD) and frontotemporal lobar degeneration (FTLD). All patients were clinically evaluated and prospectively diagnosed at the UCSF Memory and Aging Center. Two consecutive series were included: (1) patients with a clinically diagnosed FTD syndrome who underwent autopsy (cohort 1) and (2) patients with a primary pathologic diagnosis of FTLD, regardless of the clinical syndrome (cohort 2). These series were divided by age at symptom onset (cutoff 65 years). In cohort 1, 48 (25.3%) were 65 years or older at symptom onset. Pathologic causes of behavioral variant FTD (bvFTD) were similar in the early age at onset (EO) and late age at onset (LO) bvFTD groups. In corticobasal syndrome (CBS), however, the most common pathologic substrate differed according to age at onset: progressive supranuclear palsy (42.9%) in LO-CBS and Alzheimer disease (AD; 40.7%) in EO-CBS. In cohort 2, 57 (28.4%) were classified as LO-FTLD. Regarding FTLD major molecular classes, FTLD with transactive response DNA-binding protein of 43 kDa was most common in EO-FTLD (44.4%), whereas FTLD-tau (58.3%) was most common in LO-FTLD. Antemortem diagnosis of a non-FTD syndrome, usually AD-type dementia, was more frequent in LO-FTLD than EO-FTLD (19.3% vs 7.7%, p = 0.017). LO-FTLD was also associated with more prevalent comorbid pathologic changes. Of these, moderate to severe AD neuropathologic change and argyrophilic grain disease were overrepresented among patients who received an antemortem diagnosis of AD-type dementia. Patients with FTD and FTLD often develop symptoms after age 65, and age at onset represents an important consideration when making antemortem neuropathologic predictions. © 2018 American Academy of Neurology.

Early-onset restrictive eating disturbances in primary school boys and girls.

PubMed

Kurz, Susanne; van Dyck, Zoé; Dremmel, Daniela; Munsch, Simone; Hilbert, Anja

2015-07-01

This study sought to determine the distribution of early-onset restrictive eating disturbances characteristic of the new DSM-5 diagnosis, avoidant/restrictive food intake disorder (ARFID) in middle childhood, as well as to evaluate the screening instrument, Eating Disturbances in Youth-Questionnaire (EDY-Q). A total of 1,444 8- to 13-year-old children were screened in regular schools (3rd to 6th grade) in Switzerland using the self-report measure EDY-Q, consisting of 12 items based on the DSM-5 criteria for ARFID. 46 children (3.2%) reported features of ARFID in the self-rating. Group differences were found for body mass index, with underweight children reporting features of ARFID more often than normal and overweight children. The EDY-Q revealed good psychometric properties, including adequate discriminant and convergent validity. Early-onset restrictive eating disturbances are commonly reported in middle childhood. Because of possible negative short- and long-term impact, early detection is essential. Further studies with structured interviews and parent reports are needed to confirm this study's findings.

Lower Pre-Treatment T Cell Activation in Early- and Late-Onset Tuberculosis-Associated Immune Reconstitution Inflammatory Syndrome

PubMed Central

Goovaerts, Odin; Jennes, Wim; Massinga-Loembé, Marguerite; Ondoa, Pascale; Ceulemans, Ann; Vereecken, Chris; Worodria, William; Mayanja-Kizza, Harriet; Colebunders, Robert; Kestens, Luc

2015-01-01

Background Tuberculosis-associated immune reconstitution inflammatory syndrome (TB-IRIS) is an inflammatory complication in HIV-TB co-infected patients receiving antiretroviral therapy (ART). The role of disturbed T cell reconstitution in TB-IRIS is not well understood. We investigated T cell activation and maturation profiles in patients who developed TB-IRIS at different intervals during ART. Methods Twenty-two HIV-TB patients who developed early-onset TB-IRIS and 10 who developed late-onset TB-IRIS were matched for age, sex and CD4 count to equal numbers of HIV-TB patients who did not develop TB-IRIS. Flow cytometry analysis was performed on fresh blood, drawn before and after ART initiation and during TB-IRIS events. T cell activation and maturation was measured on CD4+ and CD8+ T cells using CD45RO, CD38, HLA-DR, CCR7 and CD27 antibodies. Results CD8+ T cell activation before ART was decreased in both early-onset (77% vs. 82%, p = 0.014) and late-onset (71% vs. 83%, p = 0.012) TB-IRIS patients compared to non-IRIS controls. After ART initiation, the observed differences in T cell activation disappeared. During late-onset, but not early-onset TB-IRIS, we observed a skewing from memory to terminal effector CD4+ and CD8+ T cell populations (p≤0.028). Conclusion Our data provide evidence of reduced CD8+ T cell activation before ART as a common predisposing factor of early- and late-onset TB-IRIS. The occurrence of TB-IRIS itself was not marked by an over-activated CD8+ T cell compartment. Late- but not early-onset TB-IRIS was characterized by a more terminally differentiated T cell phenotype. PMID:26208109

Comparison of early versus late onset familial Mediterranean fever.

PubMed

Yasar Bilge, Nazife Sule; Sari, Ismail; Solmaz, Dilek; Senel, Soner; Emmungil, Hakan; Kilic, Levent; Yilmaz Oner, Sibel; Yildiz, Fatih; Yilmaz, Sedat; Ersozlu Bozkirli, Duygu; Aydin Tufan, Muge; Yilmaz, Sema; Yazisiz, Veli; Pehlivan, Yavuz; Bes, Cemal; Yildirim Cetin, Gozde; Erten, Sukran; Gonullu, Emel; Sahin, Fezan; Akar, Servet; Aksu, Kenan; Kalyoncu, Umut; Direskeneli, Haner; Erken, Eren; Sayarlioglu, Mehmet; Cınar, Muhammed; Kasifoglu, Timucin

2018-04-01

Familial Mediterranean fever (FMF) is the most common autoinflammatory disease. One of the common characteristics of this disease is its young age predominance. Nearly 90% of patients experience disease flares during early adult age periods. Currently there are limited data for the comparison of early versus late onset FMF and therefore the primary aim of this study was to investigate these two subsets with regard to their certain demographic, clinical and genetic differences. Early (≤ 20 years, Group 1) and late (> 20 years, Group 2) onset FMF patients were identified from the national FMF registry that involves 2246 patients from 15 adult rheumatology clinics located in different geographical areas of Turkey. Of the 2246 patients, 1633 (72.7%) were aged ≤ 20 years old (Group 1) and the remaining 613 were older than 20 years (Group 2). Delay in diagnosis was longer in Group 1 and fever, peritonitis, pleuritis, erysipelas-like erythema (ELE), arthritis, family history of FMF and amyloidosis were more common in Group 1. On the other hand, sex distribution, rates of amyloidosis, vasculitis and kidney failure were not different between the groups. Among patients with available genotypes, homozygous and heterozygous M694V mutations were significantly higher and heterozygous E148Q mutation was significantly lower in Group 1 compared to Group 2. Patients with FMF whose symptoms start before 20 years of age seem to have severe symptoms and M694V mutation may be responsible for the early expression of the disease. © 2018 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

Vasoactive agents for the prediction of early- and late-onset preeclampsia in a high-risk cohort

PubMed Central

2013-01-01

Background To evaluate the soluble fms-like tyrosine kinase-1 (sFlt-1), placental growth factor (PlGF), and sFlt-1/PlGF ratio for the prediction of early- and late-onset preeclampsia in a high-risk cohort. Methods We studied serial serum samples collected prospectively at 12 + 0 - 14 + 0, 18 + 0 - 20 + 0, and 26 + 0 - 28 + 0 weeks + days of gestation in 6 women who developed early-onset preeclampsia (before 34 weeks of gestation) and in 21 women who developed late-onset preeclampsia (after 34 weeks of gestation) with automated ElecSys 2010 immunoanalyzer (Roche Diagnostics, Germany). Twenty-six high-risk women and 53 women without risk factors with normal pregnancies served as controls. Results Serum PlGF concentrations were lower at 18 + 0 to 20 + 0, and 26 + 0 to 28 + 0 weeks of gestation in women who developed early-onset preeclampsia compared to women who developed late-onset preeclampsia and to controls (p < 0.05 for all comparisons). At 18 + 0 to 20 + 0 weeks of gestation area under the receiver-operating characteristic curve (AUC) for serum PlGF was 99.8% (p = 0.0007, 95% CI 99.0-100.0). At 26 + 0 to 28 + 0 weeks of gestation serum sFlt-1/PlGF ratio explicitly detects those women who developed early-onset preeclampsia (AUC 100.0%, p = 0.0007, 95% CI 100–100). Amongst women with late-onset preeclampsia, those who developed severe form of the disease (N = 8) had significantly higher serum sFlt-1 concentrations at all three timepoints (p = 0.004, p = 0.006, and p = 0.003, respectively) compared to women with non-severe form (N = 13). Conclusions Low serum PlGF concentration predicts early-onset preeclampsia from the second trimester and elevated serum sFlt-1/PlGF ratio from 26 to 28 weeks of gestation. Elevated serum sFlt-1 concentration in the first trimester in women who later develop late-onset, severe preeclampsia may suggest different etiology compared to the late-onset

Alcohol intake and early-onset basal cell carcinoma in a case-control study.

PubMed

Zhang, Y; Ferrucci, L M; Cartmel, B; Molinaro, A M; Leffell, D J; Bale, A E; Mayne, S T

2014-12-01

Previous epidemiological studies of overall alcohol intake and basal cell carcinoma (BCC) are inconsistent, with some evidence for differences by type of alcoholic beverage. While alcohol may enhance the carcinogenicity of ultraviolet (UV) radiation, this has not been evaluated in existing epidemiological studies. To evaluate alcohol intake in relation to early-onset BCC, and explore potential interactions with UV exposure. Basal cell carcinoma cases (n = 380) and controls with benign skin conditions (n = 390) under 40 years of age were identified through Yale Dermatopathology. Participants provided information on lifetime alcohol intake, including type of beverage, during an in-person interview. Self-reported data on indoor tanning and outdoor sunbathing were used to categorize UV exposure. We calculated odds ratios (OR) and 95% confidence intervals (CIs) using unconditional multivariate logistic regression in the full sample and in women only. There was no statistically significant association between lifetime alcohol intake and early-onset BCC overall [above median intake vs. no regular alcohol intake (OR 1·10, 95% CI 0·69-1·73)] or in women only (OR 1·21, 95% CI 0·73-2·01). Similarly, intake of red wine, white wine, beer or spirits and mixed drinks was not associated with early-onset BCC. In exploratory analyses, we saw limited evidence for an interaction (P(interaction) = 0·003), with highest risk for high alcohol and high UV exposures, especially in women, but subgroup risk estimates had wide and overlapping CIs. Overall, we did not observe any clear association between lifetime alcohol intake and early-onset BCC. © 2014 British Association of Dermatologists.

Functional Connectivity of the Amygdala in Early-Childhood-Onset Depression

ERIC Educational Resources Information Center

Luking, Katherine R.; Repovs, Grega; Belden, Andy C.; Gaffrey, Michael S.; Botteron, Kelly N.; Luby, Joan L.; Barch, Deanna M.

2011-01-01

Objective: Adult major depressive disorder (MDD) is associated with reduced cortico-limbic functional connectivity thought to indicate decreased top-down control of emotion. However, it is unclear whether such connectivity alterations are also present in early-childhood-onset MDD. Method: A total of 51 children 7 through 11 years of age who had…

Two-Year Diagnostic Stability in Early-Onset First-Episode Psychosis

ERIC Educational Resources Information Center

Castro-Fornieles, Josefina; Baeza, Immaculada; de la Serna, Elena; Gonzalez-Pinto, Ana; Parellada, Mara; Graell, Montserrat; Moreno, Dolores; Otero, Soraya; Arango, Celso

2011-01-01

Background: Only one study has used a prospective method to analyze the diagnostic stability of first psychotic episodes in children and adolescents. The Child and Adolescent First-Episode Psychosis Study (CAFEPS) is a 2-year, prospective longitudinal study of early-onset first episodes of psychosis (EO-FEP). Aim: To describe diagnostic stability…

A girl with early-onset epileptic encephalopathy associated with microdeletion involving CDKL5.

PubMed

Saitsu, Hirotomo; Osaka, Hitoshi; Nishiyama, Kiyomi; Tsurusaki, Yoshinori; Doi, Hiroshi; Miyake, Noriko; Matsumoto, Naomichi

2012-05-01

Recent studies have shown that aberrations of CDKL5 in female patients cause early-onset intractable seizures, severe developmental delay or regression, and Rett syndrome-like features. We report on a Japanese girl with early-onset epileptic encephalopathy, hypotonia, developmental regression, and Rett syndrome-like features. The patient showed generalized tonic seizures, and later, massive myoclonus induced by phone and light stimuli. Brain magnetic resonance imaging showed no structural brain anomalies but cerebral atrophy. Electroencephalogram showed frontal dominant diffuse poly spikes and waves. Through copy number analysis by genomic microarray, we found a microdeletion at Xp22.13. A de novo 137-kb deletion, involving exons 5-21 of CDKL5, RS1, and part of PPEF1 gene, was confirmed by quantitative PCR and breakpoint specific PCR analyses. Our report suggests that the clinical features associated with CDKL5 deletions could be implicated in Japanese patients, and that genetic testing of CDKL5, including both sequencing and deletion analyses, should be considered in girls with early-onset epileptic encephalopathy and RTT-like features. Copyright © 2011 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Early onset of delinquency and the trajectory of alcohol-impaired driving among young males.

PubMed

Zhang, Lening; Wieczorek, William F; Welte, John W

2011-12-01

Building upon the literature in developmental and life-course criminology, the present study assesses the possible association of age onset of delinquency with the trajectory of alcohol-impaired driving using data collected from the three waves of the Buffalo Longitudinal Survey of Young Men (BLSYM). It is argued that as a unique form of delinquency, alcohol-impaired driving among adolescents may be better understood in a broad context of adolescent delinquency involvement. The study adopts the general approach for the analysis of early onset of delinquency and criminal careers in developmental and life-course criminology and hypothesizes that early onset of delinquency is associated with a higher growth of alcohol-impaired driving over time among adolescents when age onsets of alcohol-impaired driving, drinking, and drug use are controlled. Our analysis with the HLM growth modeling method provides support for the hypothesis. Respondents who had an early start in delinquency were likely to have a faster growth of alcohol-impaired driving over the three waves of BLSYM, which implies that these respondents were likely to have a longer path of alcohol-impaired driving in their transition to adulthood. The implication of this finding is discussed. Copyright © 2011 Elsevier Ltd. All rights reserved.

Linkage of early-onset osteoarthritis and chondrocalcinosis to human chromosome 8q

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baldwin, C.T.; Farrer, L.A.; Adair, R.

Calcium pyrophosphate-deposition disease (CPDD), also called {open_quotes}chondrocalcinosis{close_quotes} or {open_quotes}pseudogout{close_quotes}, is a disorder characterized by the deposition of calcium-containing crystals in joint tissue, which leads to arthritis-like symptoms. The presence of these crystals in joint tissue is a common finding in the elderly, and, in this population, there is a poor correlation with joint pain. In contrast, early-onset CPDD has been described in several large families in which the disease progresses to severe degenerative osteoarthritis (OA). In these families, an autosomal dominant mode of inheritance is observed, with an age at onset between the 2nd and 5th decades of life. Inmore » this report, we describe a large New England family with early-onset CPDD and severe degenerative OA. We found genetic linkage between the disease in this family and chromosome 8q, with a multipoint lod score of 4.06. These results suggest that a defective gene at this location causes the disease in this family. 29 refs., 2 figs., 1 tab.« less

Recent discoveries in the molecular pathogenesis of the inherited bone marrow failure syndrome Fanconi anemia.

PubMed

Mamrak, Nicholas E; Shimamura, Akiko; Howlett, Niall G

2017-05-01

Fanconi anemia (FA) is a rare autosomal and X-linked genetic disease characterized by congenital abnormalities, progressive bone marrow failure (BMF), and increased cancer risk during early adulthood. The median lifespan for FA patients is approximately 33years. The proteins encoded by the FA genes function together in the FA-BRCA pathway to repair DNA damage and to maintain genome stability. Within the past two years, five new FA genes have been identified-RAD51/FANCR, BRCA1/FANCS, UBE2T/FANCT, XRCC2/FANCU, and REV7/FANCV-bringing the total number of disease-causing genes to 21. This review summarizes the discovery of these new FA genes and describes how these proteins integrate into the FA-BRCA pathway to maintain genome stability and critically prevent early-onset BMF and cancer. Copyright © 2016 Elsevier Ltd. All rights reserved.

Rasburicase improves hyperuricemia in patients with acute kidney injury secondary to rhabdomyolysis caused by ecstasy intoxication and exertional heat stroke.

PubMed

Lin, Pei-Yi; Lin, Chun-Chen; Liu, Hsi-Che; Lee, Ming-Dar; Lee, Hung-Chang; Ho, Che-Sheng; Chiu, Nan-Chang; Peng, Chun-Chih; Huang, Fu-Yuan; Tsai, Jeng-Daw

2011-11-01

To report the successful use of rasburicase in two children with hyperuricemia secondary to severe rhabdomyolysis. : Case report. Pediatric intensive care unit in a freestanding quaternary hospital. Two pediatric patients with severe rhabdomyolysis and hyperuricemia caused by ecstasy intoxication and exertional heat stroke. Use of a single low dose (6 mg) of rasburicase, a urate oxidase enzyme. Rasburicase was administered on the first and second hospital days with a single low dose of 6 mg (0.086 mg/kg in patient A and 0.092 mg/kg in patient B). Within 24 hrs, the levels of serum uric acid in both patients decreased dramatically, and their creatinine levels decreased and urine output increased concurrently. Continuous improvements in the uric acid levels, creatinine levels, and urine output were noted during hospitalization. Rasburicase seems to be a safe and effective drug for improving hyperuricemia in patients with rhabdomyolysis and renal failure.

Study protocol: EXERcise and Cognition In Sedentary adults with Early-ONset dementia (EXERCISE-ON)

PubMed Central

2012-01-01

Background Although the development of early-onset dementia is a radical and invalidating experience for both patient and family there are hardly any non-pharmacological studies that focus on this group of patients. One type of a non-pharmacological intervention that appears to have a beneficial effect on cognition in older persons without dementia and older persons at risk for dementia is exercise. In view of their younger age early-onset dementia patients may be well able to participate in an exercise program. The main aim of the EXERCISE-ON study is to assess whether exercise slows down the progressive course of the symptoms of dementia. Methods/Design One hundred and fifty patients with early-onset dementia are recruited. After completion of the baseline measurements, participants living within a 50 kilometre radius to one of the rehabilitation centres are randomly assigned to either an aerobic exercise program in a rehabilitation centre or a flexibility and relaxation program in a rehabilitation centre. Both programs are applied three times a week during 3 months. Participants living outside the 50 kilometre radius are included in a feasibility study where participants join in a daily physical activity program set at home making use of pedometers. Measurements take place at baseline (entry of the study), after three months (end of the exercise program) and after six months (follow-up). Primary outcomes are cognitive functioning; psychomotor speed and executive functioning; (instrumental) activities of daily living, and quality of life. Secondary outcomes include physical, neuropsychological, and rest-activity rhythm measures. Discussion The EXERCISE-ON study is the first study to offer exercise programs to patients with early-onset dementia. We expect this study to supply evidence regarding the effects of exercise on the symptoms of early-onset dementia, influencing quality of life. Trial registration The present study is registered within The Netherlands

Childhood abuse and late-life depression: Mediating effects of psychosocial factors for early- and late-onset depression.

PubMed

Wielaard, Ilse; Hoyer, Mathijs; Rhebergen, Didi; Stek, Max L; Comijs, Hannie C

2018-03-01

Childhood abuse makes people vulnerable to developing depression, even in late life. Psychosocial factors that are common in late life, such as loneliness or lack of a partner, may explain this association. Our aim was to investigate whether the association between childhood abuse and depression in older adults can be explained by psychosocial factors. Cross-sectional data were derived from the Netherlands Study of Depression in Older Persons (aged 60-93), including 132 without lifetime depression, 242 persons with an early-onset depression (<60 years), and 125 with a late-onset (≥60 years) depression. Childhood abuse (yes/no) and a frequency-based childhood abuse index were included. Multinomial regression and multivariable mediation analyses were used to examine the association between childhood abuse and the onset of depression, and the influence of loneliness, social network, and partner status. Multinomial regression analyses showed a significant association between childhood abuse and the childhood abuse index with early- and late-onset depression. Multivariable mediation analyses showed that the association between childhood abuse and early-onset depression was partly mediated by social network size and loneliness. This was particularly present for emotional neglect and psychological abuse, but not for physical and sexual abuse. No psychosocial mediators were found for the association between childhood abuse and late-onset depression. A smaller social network and feelings of loneliness mediate the association between childhood abuse and early-onset depression in older adults. Our findings show the importance of detecting childhood abuse as well as the age at depression onset and mapping of relevant psychosocial factors in the treatment of late-life depression. Copyright © 2018 John Wiley & Sons, Ltd.

Maturation, Peer Context, and Indigenous Girls' Early-Onset Substance Use

ERIC Educational Resources Information Center

Walls, Melissa L.; Whitbeck, Les B.

2011-01-01

This article examines a biosocial model of the impact of puberty on indigenous girls' early-onset substance use by considering the potential mediating role of peer context (i.e., mixed-sex peer groups and substance use prototypes) on the puberty and substance use relationship. Data include responses from 360 girls of a common indigenous cultural…

Anti-Rh(c), "little c," isoimmunization: the role of rHuEpo in preventing late anemia.

PubMed

Zuppa, Antonio A; Cardiello, Valentina; Alighieri, Giovanni; Cota, Francesco; D'Antuono, Annamaria; Riccardi, Riccardo; Catenazzi, Piero; Romagnoli, Costantino

2013-08-01

The overall prevalence of non-Rh-D isoimmunization seems to lie between 0.15% and 1.1%. Anti-Rh(c) alloimmunization, "little c," occurs in 0.07% of pregnancies and shows a quite broad clinical presentation. Late anemia is a frequent problem occurring in the setting of isoimmunization. It occurs more frequently after intrauterine blood transfusions or exsanguinotransfusion, and it can be thought as a hyporegenerative anemia. The authors describe the use of human recombinant erythropoietin in preventing late anemia in a case of anti-Rh(c) isoimmunization. The use of human recombinant erythropoietin is a valid tool for preventing late-onset anemia due to either anti-Rh-D or non-anti-Rh-D isoimmunization.

Birdshot Retinochoroidopathy: Differences in Clinical Characteristics between Patients with Early and Late Age of Onset.

PubMed

Silpa-Archa, Sukhum; Cao, Jennifer H; Boonsopon, Sutasinee; Lee, Joan; Preble, Janine M; Foster, C Stephen

2017-10-01

To describe differences in the clinical characteristics of birdshot retinochoroidopathy (BSRC) patients diagnosed early and later in life. This is a retrospective cohort study. Age was primarily analyzed and 50 years of age at diagnosis was selected as a cut-off point. A total of 144 patients (288 eyes) were included; 68 with early-onset and 76 with late-onset BSRC. The younger group had a statistically significant higher rate of more severe iritis (p = 0.04); an average number of non-steroidal immunosuppressants and biologic agents (NSIB) (p = 0.04); and a prolonged time to initiation of NSIB (p = 0.01). There were only four patients (3%) who had >0.5+ cells in the anterior chamber. Patients with early-onset BSRC carried a higher risk for anterior segment inflammation, had a more prolonged delay to initiation of treatment with NSIB, and required a greater number of NSIBs to achieve remission.

Hyperuricemia and the risk for coronary heart disease morbidity and mortality a systematic review and dose-response meta-analysis

NASA Astrophysics Data System (ADS)

Li, Min; Hu, Xiaolan; Fan, Yingli; Li, Kun; Zhang, Xiaowei; Hou, Wenshang; Tang, Zhenyu

2016-01-01

Considerable controversy exists regarding the association between hyperuricemia and coronary heart disease (CHD). Therefore, we performed a systematic review and dose-response meta-analysis of prospective studies to examine the controversy. Prospective cohort studies with relative risks (RRs) and 95% confidence intervals (CIs) for CHD according to serum uric acid levels in adults were eligible. A random-effects model was used to compute the pooled risk estimate. The search yielded 29 prospective cohort studies (n = 958410 participants). Hyperuricemia was associated with increased risk of CHD morbidity (adjusted RR 1.13; 95% CI 1.05 to 1.21) and mortality (adjusted RR 1.27; 95% CI 1.16 to 1.39). For each increase of 1 mg/dl in uric acid level, the pooled multivariate RR of CHD mortality was 1.13 (95% CI 1.06 to 1.20). Dose-response analysis indicated that the combined RR of CHD mortality for an increase of 1 mg uric acid level per dl was 1.02 (95% CI 0.84 to 1.24) without heterogeneity among males (P = 0.879, I2 = 0%) and 2.44 (95% CI 1.69 to 3.54) without heterogeneity among females (P = 0.526, I2 = 0%). The increased risk of CHD associated with hyperuricemia was consistent across most subgroups. Hyperuricemia may increase the risk of CHD events, particularly CHD mortality in females.

Efficacy and safety of febuxostat, a novel nonpurine selective inhibitor of xanthine oxidase for the treatment of hyperuricemia in kidney transplant recipients.

PubMed

Tojimbara, T; Nakajima, I; Yashima, J; Fuchinoue, S; Teraoka, S

2014-01-01

Febuxostat, a novel nonpurine selective inhibitor of xanthine oxidase, is a potential alternative to allopurinol for patients with hyperuricemia. In this study, we evaluated the efficacy and safety of febuxostat for the management of hyperuricemia in renal transplant recipients. Between June 2012 and January 2013, a total of 22 renal transplant recipients (56 ± 10 years old) with hyperuricemia were enrolled in this study. All patients underwent de novo kidney transplantation, except for 1 patient, who received a second kidney transplant. Ten patients receiving allopurinol and 3 patients receiving benzbromarone were converted to febuxostat at doses of 10-20 mg/d. In the remaining 9 patients, who did not have a history of other urate-lowering medications, febuxostat was initiated at a dose of 10 mg/d. Uric acid levels after initiation of febuxostat were significantly lower than before treatment (5.7 ± 0.7 mg/mL vs 8.0 ± 0.8 mg/mL; P < .001). At last follow-up visit, 16 of the 22 patients (73%) achieved uric acid levels of ≤ 6.0 mg/dL, despite the low dosage of febuxostat. All patients were maintained on febuxostat without serious adverse events, except for 1 patient, who discontinued febuxostat because of numbness in the arms. Low-dose febuxostat is a promising alternative to allopurinol or benzbromarone for the treatment of hyperuricemia in kidney transplant recipients. The long-term urate-lowering efficacy and safety of febuxostat with regard to renal function in kidney transplant recipients with hyperuricemia requires further investigation. Copyright © 2014 Elsevier Inc. All rights reserved.

Early-Onset Obsessive-Compulsive Disorder: A Subgroup with a Specific Clinical and Familial Pattern?

ERIC Educational Resources Information Center

Chabane, Nadia; Delorme, Richard; Millet, Bruno; Mouren, Marie-Christine; Leboyer, Marion; Pauls, David

2005-01-01

Background: The familial nature of obsessive-compulsive disorder (OCD) has been previously demonstrated. The identification of candidate symptoms such as age at onset may help to disentangle the clinical and genetic heterogeneity of the disorder. In this study, the specificity of early-onset OCD was investigated, focusing on the effect of gender,…

Depression and Anxiety Symptoms: Onset, Developmental Course and Risk Factors during Early Childhood

ERIC Educational Resources Information Center

Cote, Sylvana M.; Boivin, Michel; Liu, Xuecheng; Nagin, Daniel S.; Zoccolillo, Mark; Tremblay, Richard E.

2009-01-01

Background: Depressive and anxiety disorders are among the top ten leading causes of disabilities. We know little, however, about the onset, developmental course and early risk factors for depressive and anxiety symptoms (DAS). Objective: Model the developmental trajectories of DAS during early childhood and to identify risk factors for atypically…

Functional and Radiographic Outcomes Following Growth-Sparing Management of Early-Onset Scoliosis.

PubMed

Johnston, Charles E; Tran, Dong-Phuong; McClung, Anna

2017-06-21

In this study, we sought to evaluate radiographic, functional, and quality-of-life outcomes of patients who have completed growth-sparing management of early-onset scoliosis. This prospective study involved patients with early-onset scoliosis who underwent growth-sparing treatment and either "final" fusion or observation for ≥2 years since the last lengthening procedure. Demographics, radiographic parameters, pulmonary function test (PFT) values, and scores of patient-reported assessments (Early-Onset Scoliosis Questionnaire [EOSQ] and Scoliosis Research Society [SRS]-30) were obtained. At the most recent follow-up, patients performed 2 additional functional outcome tests: step-activity monitoring and a treadmill exercise-tolerance test. Twelve patients were evaluated as "graduates" of growth-sparing management of early-onset scoliosis (mean of 37 months since the most recent surgery). The major scoliosis curve measurement averaged 88° before treatment and 47° at the most recent follow-up. T1-S1 height increased from a mean of 22.3 cm to 34.7 cm and T1-T12 height, from 13.3 to 22.3 cm. At the most recent follow-up, the mean forced expiratory volume in 1 second (FEV1) and forced vital capacity (FVC) as a percentage of the predicted volume were 52.1% and 55.3%, respectively, and were essentially unchanged from the earliest PFT that patients could perform (FEV1 = 53.8% of predicted and FVC = 53.5% of predicted). There was no difference between graduates and controls with respect to activity time or total steps in step-activity monitoring, and in the exercise-tolerance test, graduates walked at the same speed but at a higher heart rate and at a significantly higher (p <0.001) VO2 cost (rate of oxygen consumed per distance traveled). The EOSQ mean score was 102.2 of a possible 120 points, and the SRS mean score was 4.1 of a possible 5 points. A realistic long-term goal for the management of early-onset scoliosis appears to be spine elongation and maintenance of

Early onset of bilateral brachial plexopathy during mantle radiotherapy for Hodgkin's disease.

PubMed

Churn, M; Clough, V; Slater, A

2000-01-01

We report a case of brachial plexus neuropathy occurring in a 50-year-old man treated with standard mantle radiotherapy for early-stage Hodgkin's disease. A dose of 35 Gy in 20 fractions was given to the mantle field, following by a boost to the right side of the neck (8 Gy in four fractions). The onset of symptoms was early in the course of treatment and a gradual and almost full recovery was observed over 3 years after completion ofradiotherapy. The diagnosis was supported by electromyography. The temporal relationship of the radiotherapy and the onset of the brachial plexus neuropathy suggests a cause and effect, but this association is rarely reported after mantle radiotherapy. We review the aetiology of this condition and postulate possible mechanisms in this patient.

Alertness and cognitive control: Testing the early onset hypothesis.

PubMed

Schneider, Darryl W

2018-05-01

Previous research has revealed a peculiar interaction between alertness and cognitive control in selective-attention tasks: Congruency effects are larger on alert trials (on which an alerting cue is presented briefly in advance of the imperative stimulus) than on no-alert trials, despite shorter response times (RTs) on alert trials. One explanation for this finding is the early onset hypothesis, which is based on the assumptions that increased alertness shortens stimulus-encoding time and that cognitive control involves gradually focusing attention during a trial. The author tested the hypothesis in 3 experiments by manipulating alertness and stimulus quality (which were intended to shorten and lengthen stimulus-encoding time, respectively) in an arrow-based flanker task involving congruent and incongruent stimuli. Replicating past findings, the alerting manipulation led to shorter RTs but larger congruency effects on alert trials than on no-alert trials. The stimulus-quality manipulation led to longer RTs and larger congruency effects for degraded stimuli than for intact stimuli. These results provide mixed support for the early onset hypothesis, but the author discusses how data and theory might be reconciled if stimulus quality affects stimulus-encoding time and the rate of evidence accumulation in the decision process. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

Non-invasive Self-Care Anemia Detection during Pregnancy Using a Smartphone Camera

NASA Astrophysics Data System (ADS)

Anggraeni, M. D.; Fatoni, A.

2017-02-01

Indonesian maternal mortality rate is the highest in South East Asia. Postpartum hemorrhage is the major causes of maternal mortality in Indonesia. Anemia during pregnancy contributes significantly to postpartum hemorrhage. Early detection of anemia during pregnancy may save mothers from maternal death. This research aim to develop a non-invasive self-care anemia detection based on the palpebral color observation and using a smartphone camera. The color intensity (Red, Green, and Blue) was then measured using a Colorgrab software (Loomatix) and analyzed compared to the hemoglobin concentration of the samples, measured using standard Spectrophotometer method. The result showed that the red color intensity had a high correlation (R2=0.814) with a linear regression of y=14.486x + 50.228. This preliminary study may be used as anemia early detection which more objective compared to visual assessment usually performed.

Fatigue-induced early onset of anticipatory postural adjustments in non-fatigued muscles: support for a centrally mediated adaptation.

PubMed

Strang, Adam J; Berg, William P; Hieronymus, Mathias

2009-08-01

Muscle fatigue has been shown to result in early onset of anticipatory postural adjustments (APAs) relative to those produced in a non-fatigued state. This adaptation is thought to reflect an attempt to preserve postural stability during a focal movement performed in a fatigued state. It remains unclear, however, whether this adaptation is of central (e.g., central nervous system motor command) or peripheral (e.g., muscle contractile properties), origin. One way to confirm that this adaptation is centrally driven is to identify fatigued-induced early APA onsets in non-fatigued muscles. In this study, APAs were obtained using a rapid bilateral reaching maneuver and recorded via surface electromyography before and after conditions of rest (n = 25) or fatigue (n = 25). Fatigue was generated using isokinetic exercise of the right leg. Results showed that fatigue-induced early APA onsets occurred in fatigued and non-fatigued muscles, confirming that fatigue-induced early APA onset is a centrally mediated adaptation.

Recessive Twinkle mutations in early onset encephalopathy with mtDNA depletion.

PubMed

Hakonen, Anna H; Isohanni, Pirjo; Paetau, Anders; Herva, Riitta; Suomalainen, Anu; Lönnqvist, Tuula

2007-11-01

Twinkle is a mitochondrial replicative helicase, the mutations of which have been associated with autosomal dominant progressive external ophthalmoplegia (adPEO), and recessively inherited infantile onset spinocerebellar ataxia (IOSCA). We report here a new phenotype in two siblings with compound heterozygous Twinkle mutations (A318T and Y508C), characterized by severe early onset encephalopathy and signs of liver involvement. The clinical manifestations included hypotonia, athetosis, sensory neuropathy, ataxia, hearing deficit, ophthalmoplegia, intractable epilepsy and elevation of serum transaminases. The liver showed mtDNA depletion, whereas the muscle mtDNA was only slightly affected. Alpers-Huttenlocher syndrome has previously been associated with mutations of polymerase gamma, a replicative polymerase of mtDNA. We show here that recessive mutations of the close functional partner of the polymerase, the Twinkle helicase, can also manifest as early encephalopathy with liver involvement, a phenotype reminiscent of Alpers syndrome, and are a new genetic cause underlying tissue-specific mtDNA depletion.

Pregnancy Complications: Anemia

MedlinePlus

... online community Home > Complications & Loss > Pregnancy complications > Anemia Anemia E-mail to a friend Please fill in ... anemia at a prenatal care visit . What causes anemia? Usually, a woman becomes anemic (has anemia) because ...

Pernicious anemia associated with autoimmune hemolytic anemia and alopecia areata.

PubMed

Zafad, Saadia; Madani, Abdellah; Harif, Mhamed; Quessar, Asmaa; Benchekroun, Said

2007-12-01

We report a 16-year-old male with a combination of pernicious anemia, auto-immune hemolytic anemia and alopecia areata. Autoimmune hemolytic anemia coexisted with pernicious anemia but was diagnosed only when the anemia failed to respond to cobalamin therapy. Alopecia areata occurred 9 years later. 2007 Wiley-Liss, Inc

ABCC6 mutations and early onset stroke: Two cases of a typical Pseudoxanthoma Elasticum.

PubMed

Bertamino, Marta; Severino, Mariasavina; Grossi, Alice; Rusmini, Marta; Tortora, Domenico; Gandolfo, Carlo; Pederzoli, Silvia; Malattia, Clara; Picco, Paolo; Striano, Pasquale; Ceccherini, Isabella; Di Rocco, Maja

2018-04-12

Pseudoxanthoma elasticum (PXE) is a rare genetic disorder characterized by fragmented and mineralized elastic fibers in the mid-dermis of the skin, eye, digestive tract and cardiovascular system. Clinical presentation includes typical skin lesions, ocular angioid streaks, and multisystem vasculopathy. The age of onset varies considerably from infancy to old age, but the diagnosis is usually made in young adults due to frequent absence of pathognomonic skin and ocular manifestations in early childhood. We report two children with PXE presenting with isolated multisystem vasculopathy and early-onset stroke. In the first patient, diagnosis was delayed until typical dermatologic alterations appeared; in the second patient, next-generation sequencing (NGS) study led to early diagnosis and specific follow-up, underlying the crucial role in idiopathic pediatric stroke of early genetic testing using NGS-based panels. Copyright © 2018 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

Meta-analysis of treatment with rabbit and horse antithymocyte globulin for aplastic anemia.

PubMed

Hayakawa, Jin; Kanda, Junya; Akahoshi, Yu; Harada, Naonori; Kameda, Kazuaki; Ugai, Tomotaka; Wada, Hidenori; Ishihara, Yuko; Kawamura, Koji; Sakamoto, Kana; Ashizawa, Masahiro; Sato, Miki; Terasako-Saito, Kiriko; Kimura, Shun-Ichi; Kikuchi, Misato; Yamazaki, Rie; Kako, Shinichi; Kanda, Yoshinobu

2017-05-01

Aplastic anemia patients who received rabbit antithymocyte globulin exhibited response and survival rates inferior to those who received horse antithymocyte globulin in several studies. Therefore, we conducted a meta-analysis to compare rabbit and horse antithymocyte globulin as immunosuppressive therapy for aplastic anemia. We searched online databases for studies that compared antithymocyte globulin regimens as first-line treatment for aplastic anemia, including both randomized and non-randomized controlled trials. The early mortality rate at 3 months and overall response rate at 6 months were evaluated. Thirteen studies were included in the analysis. The risk ratio (RR) of early mortality for rabbit vs. horse antithymocyte globulin was 1.33 [95% confidence interval (CI) 0.69-2.57; P = 0.39], with significant heterogeneity. A sensitivity analysis suggested higher early mortality rate in patients who received rabbit antithymocyte globulin. The overall response rate was significantly higher in patients who received horse antithymocyte globulin (RR 1.27; 95% CI 1.05-1.54; P = 0.015). In conclusion, in aplastic anemia patients treated with ATG, early mortality rate was not significantly different in patients receiving horse or rabbit ATG, although a sensitivity analysis showed higher early mortality in the rabbit ATG group. Horse ATG was associated with significantly higher response rate than rabbit ATG.

Maternal Anemia in Benin: Prevalence, Risk Factors, and Association with Low Birth Weight

PubMed Central

Bodeau-Livinec, Florence; Briand, Valerie; Berger, Jacques; Xiong, Xu; Massougbodji, Achille; Day, Karen P.; Cot, Michel

2011-01-01

We studied the prevalence of anemia during pregnancy and its relationship with low birth weight (LBW; birth weight < 2,500 g) in Benin. We analyzed 1,508 observations from a randomized controlled trial conducted from 2005 to 2008 showing equivalence on the risk of LBW between two drugs for Intermittent Preventive Treatment of malaria during pregnancy (IPTp). Despite IPTp, helminth prophylaxis, and iron and folic acid supplementations, the proportions of women with severe anemia (hemoglobin [Hb] concentration < 80 g/L) and anemia (Hb < 110 g/L) were high throughout pregnancy: 3.9% and 64.7% during the second and 3.7% and 64.1% during the third trimester, but 2.5% and 39.6% at the onset of labor, respectively. Compared with women without anemia (Hb ≥ 110 g/L) during the third trimester, women with severe anemia (Hb < 80 g/L) were at higher risk of LBW after adjustment for potential confounding factors (prevalence ratio [PR] = 2.8; 95% confidence interval [1.4–5.6]). PMID:21896797

[Knowledge of Andalusian pediatricians and parents about early-onset tooth decay].

PubMed

González, E; Pérez-Hinojosa, S; Alarcón, J A; Peñalver, M A

2015-01-01

To determine the level of knowledge of pediatricians and parents from Andalucía (southern Spain) about early-onset tooth decay, and to assess if pediatricians provide information to parents about pediatric oral care and visits to the pediatric dentist. A random sample of 113 pediatricians and 112 parents with children under 3 years of age received an anonymous questionnaire comprising 14 items for pediatricians and 16 items for parents, grouped into five blocks: visits to the dentist, oral hygiene, caries, nutritional habits, and treatment of caries. The chi-squared test was used to assess differences between groups. Pediatricians showed deficiencies in their knowledge about visits to the dentist and treatment of caries, however their level of knowledge on oral hygiene, tooth decay and nutritional habits were adequate. Parents showed a low level of knowledge in all aspects of the study, mainly about the treatment of tooth decay. There were no significant differences between pediatricians and parents in the knowledge about visits to the dentist, however pediatricians had more knowledge than the parents about hygiene, tooth decay, nutritional habits and treatment (P<0.001). Most of the parents indicated that pediatricians did not provide them detailed information on oral care, and about the possibility of visiting a pediatric dentist. Andalusian pediatricians should improve their knowledge about early-onset tooth decay, and provide more information to parents about the oral care and the possibility of visiting a pediatric dentist. Parents have a very low level of knowledge about early-onset tooth decay, and particularly about treatment. Copyright © 2013 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.

Outcomes of subsequent pregnancy after first pregnancy with early-onset preeclampsia.

PubMed

van Rijn, Bas B; Hoeks, Lette B; Bots, Michiel L; Franx, Arie; Bruinse, Hein W

2006-09-01

The aim of this study was to report outcome of subsequent pregnancy after early-onset preeclampsia in first pregnancy, and to evaluate potential risk factors for recurrence of preeclampsia and preterm delivery. Reproductive follow-up data were obtained for women with a history of early-onset preeclampsia, resulting in delivery before 34 weeks of gestation at the University Medical Center Utrecht, The Netherlands, between July 1993 and September 2002. The relative contributions of demographic data, outcome variables of first pregnancy, and common thrombophilias to the recurrence risk of preeclampsia and preterm delivery in subsequent pregnancy, were estimated by Cox proportional hazard models. Subsequent pregnancy outcome data were available for 120 women. Overall, preeclampsia reoccurred in the second pregnancy in 30 women (25%). However, 6 women delivered before 34 weeks of gestation (5%), 20 women between 34 and 37 weeks of gestation (17%), and 94 women after 37 weeks of gestation (78%). Forty-one women (34%) had an uneventful pregnancy. Recurrence rates for preeclampsia or preterm delivery were not related to severity of first pregnancy complications, including delivery before 28 weeks of gestation, occurrence of hemolysis, elevated liver enzymes, and low platelet count syndrome, small-for-gestational age infants, and to hereditary or acquired thrombophilias. Chronic hypertension was related to a higher recurrence risk of preeclampsia in the second pregnancy (hazard ratio 2.1, 95% CI 1.0-4.4), and smoking was related to a higher recurrence risk of preterm birth (hazard ratio 2.4, 95% CI 1.1-5.6). Outcomes of subsequent pregnancy after first pregnancy with early-onset preeclampsia is generally favorable.

Gene expression profiling reveals different molecular patterns in G-protein coupled receptor signaling pathways between early- and late-onset preeclampsia.

PubMed

Liang, Mengmeng; Niu, Jianmin; Zhang, Liang; Deng, Hua; Ma, Jian; Zhou, Weiping; Duan, Dongmei; Zhou, Yuheng; Xu, Huikun; Chen, Longding

2016-04-01

Early-onset preeclampsia and late-onset preeclampsia have been regarded as two different phenotypes with heterogeneous manifestations; To gain insights into the pathogenesis of the two traits, we analyzed the gene expression profiles in preeclamptic placentas. A whole genome-wide microarray was used to determine the gene expression profiles in placental tissues from patients with early-onset (n = 7; <34 weeks), and late-onset (n = 8; >36 weeks) preeclampsia and their controls who delivered preterm (n = 5; <34 weeks) or at term (n = 5; >36 weeks). Genes were termed differentially expressed if they showed a fold-change ≥ 2 and q-value < 0.05. Quantitative real-time reverse transcriptase PCR was used to verify the results. Western blotting was performed to verify the expressions of secreted genes at the protein level. Six hundred twenty-seven genes were differentially expressed in early-compared with late-onset preeclampsia (177 genes were up-regulated and 450 were down-regulated). Gene ontology analysis identified significant alterations in several biological processes; the top two were immune response and cell surface receptor linked signal transduction. Among the cell surface receptor linked signal transduction-related, differentially expressed genes, those involved in the G-protein coupled receptor protein signaling pathway were significantly enriched. G-protein coupled receptor signaling pathway related genes, such as GPR124 and MRGPRF, were both found to be down-regulated in early-onset preeclampsia. The results were consistent with those of western blotting that the abundance of GPR124 was lower in early-onset compared with late-onset preeclampsia. The different gene expression profiles reflect the different levels of transcription regulation between the two conditions and supported the hypothesis that they are separate disease entities. Moreover, the G-protein coupled receptor signaling pathway related genes may contribute to the mechanism underlying early

Serum phosphorus and association with anemia among a large diverse population with and without chronic kidney disease

PubMed Central

Tran, Lac; Batech, Michael; Rhee, Connie M.; Streja, Elani; Kalantar-Zadeh, Kamyar; Jacobsen, Steven J.; Sim, John J.

2016-01-01

Background We hypothesized that phosphorus has an effect on anemia in both normal kidney function and early chronic kidney disease (CKD). We sought to determine whether higher phosphorus levels are associated with anemia in a large diverse population without CKD and early CKD. Methods This study is a historical population-based study within the Kaiser Permanente Southern California health system (1 January 1998 to 31 December 2013) among individuals aged 18 years and older with estimated glomerular filtration rate >30 mL/min/1.73 m2 and measurements of serum phosphorus, creatinine and hemoglobin. Individuals were excluded if they had secondary causes of anemia. Odds ratio (OR) estimated for moderate anemia defined as hemoglobin <11 g/dL for both sexes. Mild anemia was defined as <12 g/dL (females) and <13 g/dL (males). Results Among 155 974 individuals, 4.1% had moderate anemia and 12.9% had mild anemia. Serum phosphorus levels ≥3.5 mg/dL were associated with both mild and moderate anemia. Moderate anemia OR (95% confidence interval) was 1.16 (1.04–1.29) for every 0.5 mg/dL phosphorus increase and 1.26 (1.07–1.48) in the highest versus middle phosphorus tertile. Additional independent anemia risk factors, including female sex, Asian race, diabetes, low albumin and low iron saturation, were observed, but did not alter the anemia–phosphorus association. Conclusions Higher phosphorus levels were associated with a greater likelihood for anemia in a population with early CKD and normal kidney function. Phosphorus may be a biomarker for anemia and may affect aspects of hematopoiesis. PMID:26254460

Polycystic ovary syndrome and early-onset preeclampsia: reproductive manifestations of increased cardiovascular risk.

PubMed

Veltman-Verhulst, Susanne M; van Rijn, Bas B; Westerveld, H Egbertine; Franx, Arie; Bruinse, Hein W; Fauser, Bart C J M; Goverde, Angelique J

2010-01-01

Primary prevention of cardiovascular disease (CVD) in women is a major healthcare issue. Detection of premenopausal women with increased risk of CVD could enhance prevention strategies and reduce first event-related morbidity and mortality. In this study, we argue that an unfavorable metabolic constitution in women may present itself early in life as a reproductive complication, such as polycystic ovary syndrome (PCOS) and preeclampsia. We evaluated the cardiovascular risk of women with a history of early-onset preeclampsia and women with PCOS and assessed their need for implementation of early risk factor-reduction strategies. We performed a standardized evaluation of 240 women with a history of early-onset preeclampsia and 456 women diagnosed with PCOS for established major CVD risk factors. Metabolic syndrome characteristics were analyzed per body mass index category. Mean age was 30.6 and 29.0 years for women with preeclampsia and PCOS, respectively. High percentages of metabolic syndrome were found in both groups (preeclampsia group, 14.6%; and PCOS group, 18.4%), with an incidence of greater than 50% in both groups of women if body mass index was greater than 30 kg/m. Overall, more than 90% of the women qualified for either lifestyle or medical intervention according to the American Heart Association guideline for CVD prevention in women. Women with PCOS and early-onset preeclampsia already show an unfavorable cardiovascular risk profile with high need for lifestyle or medical intervention at a young age. We therefore recommend an active role of the gynecologist in routine screening and follow-up of women with reproductive conditions linked to future cardiovascular risk.

Renal manifestations of primary mitochondrial disorders

PubMed Central

Finsterer, Josef; Scorza, Fulvio

2017-01-01

The aim of the present review was to summarize and discuss previous findings concerning renal manifestations of primary mitochondrial disorders (MIDs). A literature review was performed using frequently used databases. The study identified that primary MIDs frequently present as mitochondrial multiorgan disorder syndrome (MIMODS) at onset or in the later course of the MID. Occasionally, the kidneys are affected in MIDs. Renal manifestations of MIDs include renal insufficiency, nephrolithiasis, nephrotic syndrome, renal cysts, renal tubular acidosis, Bartter-like syndrome, Fanconi syndrome, focal segmental glomerulosclerosis, tubulointerstitial nephritis, nephrocalcinosis, and benign or malign neoplasms. Among the syndromic MIDs, renal involvement has been most frequently reported in patients with mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes syndrome, Kearns-Sayre syndrome, Leigh syndrome and mitochondrial depletion syndromes. Only in single cases was renal involvement also reported in chronic progressive external ophthalmoplegia, Pearson syndrome, Leber's hereditary optic neuropathy, coenzyme-Q deficiency, X-linked sideroblastic anemia and ataxia, myopathy, lactic acidosis, and sideroblastic anemia, pyruvate dehydrogenase deficiency, growth retardation, aminoaciduria, cholestasis, iron overload, lactacidosis, and early death, and hyperuricemia, pulmonary hypertension, renal failure in infancy and alkalosis syndrome. The present study proposes that the frequency of renal involvement in MIDs is probably underestimated. Diagnosis of renal involvement follows general guidelines and treatment is symptomatic. Thus, renal manifestations of primary MIDs require recognition and appropriate management, as they determine the outcome of MID patients. PMID:28515908

The effect of coffee, tea, and caffeine consumption on serum uric acid and the risk of hyperuricemia in Korean Multi-Rural Communities Cohort.

PubMed

Bae, Jisuk; Park, Pil Sook; Chun, Byung-Yeol; Choi, Bo Youl; Kim, Mi Kyung; Shin, Min-Ho; Lee, Young-Hoon; Shin, Dong Hoon; Kim, Seong-Kyu

2015-02-01

Caffeine, a commonly consumed food constituent, is known to exert beneficial physiological effects in humans. There is a lack of comprehensive population data for the effects of caffeine intake on urate metabolism. Therefore, the aim of this study was to determine whether coffee, tea, and caffeine intake influences serum uric acid and the risk of hyperuricemia in the Korean Multi-Rural Communities Cohort. We enrolled 9,400 participants in this study. An assessment of various dietary intake amounts of substances such as coffee and tea was performed using a food frequency questionnaire. The content of caffeine was calculated from coffee (74 mg/cup) and tea (15 mg/cup) intake information from the past year. Multivariate logistic regression models, multiple linear regression models, and analysis of covariance were applied to identify any association of dietary intake with serum uric acid levels or the risk of hyperuricemia. No trends for coffee, tea, or caffeine intake were found according to each quintile with serum uric acid in males, although there were weak, marginally significant trends between the content of coffee and caffeine intake and serum uric acid level in females (p = 0.07 for both). Tea intake in males and caffeine intake in females were significantly different between non-hyperuricemia and hyperuricemia (p = 0.04 and p = 0.04, respectively). In addition, a significant association of serum uric acid level with tea intake in males (β = 0.0006, p = 0.02) and with tea intake and caffeine intake in females (β = 0.0003, p = 0.04 and β = 0.0006, p = 0.02, respectively) was observed. There was no effect of coffee, tea, or caffeine intake on the risk of hyperuricemia in either males or females. This study suggests that caffeine consumption might have an effect on serum uric acid in females. However, coffee, tea, and caffeine intake amounts were not associated with the risk of hyperuricemia.

A case report: a dog with acute onset of Hepatozoon canis infection.

PubMed

Sakuma, Masato; Nakahara, Yoshitaka; Suzuki, Hiroyuki; Uchimura, Masato; Sekiya, Zin; Setoguchi, Asuka; Endo, Yasuyuki

2009-06-01

We present a clinical overview of a dog with acute onset of Hepatozoon canis infection. A stray female beagle dog of unknown age was referred to Kagoshima University showing anemia. Blood tests revealed the presence of anemia, thrombocytopenia, hyperproteinemia, polyclonal gammopathy, hypoalbuminemia, and elevated creatine kinase and alkaline phosphatase activities. In addition, capsule-like organisms were detected in the cytoplasm of approximately 50% of neutrophils in blood smears. H. canis infection was confirmed by polymerase chain reaction and DNA sequencing analyses. Amplified DNA fragments revealed 100% identity to the 18S ribosomal RNA gene of H. canis. The clinical symptoms improved after the administration of antibiotics. Hepatozoonosis in dogs is rare, but veterinarians should be alert to its possible acute onset.

Novel CDKL5 Mutations in Czech Patients with Phenotypes of Atypical Rett Syndrome and Early-Onset Epileptic Encephalopathy.

PubMed

Záhoráková, D; Langová, M; Brožová, K; Laštůvková, J; Kalina, Z; Rennerová, L; Martásek, P

2016-01-01

The X-linked CDKL5 gene, which encodes cyclin-dependent kinase-like 5 protein, has been implicated in early-onset encephalopathy and atypical Rett syndrome with early-onset seizures. The CDKL5 protein is a kinase required for neuronal development and morphogenesis, but its precise functions are still largely unexplored. Individuals with CDKL5 mutations present with severe global developmental delay, intractable epilepsy, and Rett-like features. A clear genotype-phenotype correlation has not been established due to an insufficient number of reported cases. The aim of this study was to analyse the CDKL5 gene in Czech patients with early-onset seizures and Rett-like features. We performed mutation screening in a cohort of 83 individuals using high-resolution melting analysis, DNA sequencing and multiplex ligation- dependent probe amplification. Molecular analyses revealed heterozygous pathogenic mutations in three girls with severe intellectual disability and intractable epilepsy starting at the age of two months. All three identified mutations, c.637G>A, c.902_977+29del105, and c.1757_1758delCT, are novel, thus significantly extending the growing spectrum of known pathogenic CDKL5 sequence variants. Our results support the importance of genetic testing of the CDKL5 gene in patients with early-onset epileptic encephalopathy and Rett-like features with early-onset seizures. This is the first study referring to molecular defects of CDKL5 in Czech cases.

Effect of urate-lowering therapies on renal disease progression in patients with hyperuricemia.

PubMed

Levy, Gerald D; Rashid, Nazia; Niu, Fang; Cheetham, T Craig

2014-05-01

To evaluate the association between hyperuricemia and renal disease progression in a real-world, large observational database study. We conducted a population-based retrospective cohort study identifying 111,992 patients with hyperuricemia (> 7 mg/dl) from a large medical group. The final cohort were ≥ 18 years old, urate-lowering therapy (ULT)-naïve, and had the following laboratory results available: at least 1 glomerular filtration rate (GFR) level before the index date and at least 1 serum uric acid (sUA) level and GFR in the followup 36-month period. The cohort was categorized into 3 groups: never treated (NoTx), ULT time receiving therapy of < 80% (< 80%), and ULT time receiving therapy of ≥ 80% (≥ 80%). Outcomes were defined as a ≥ 30% reduction in GFR from baseline, dialysis, or GFR of ≤ 15 ml/min. A subanalysis of patients with sUA < 6 mg/dl at study conclusion was performed. Cox proportional hazards regression model determined factors associated with renal function decline. A total of 16,186 patients met inclusion criteria. There were 11,192 NoTx patients, 3902 with < 80% time receiving ULT, and 1092 with ≥ 80% time receiving ULT. Factors associated with renal disease progression were age, sex, hypertension, diabetes, congestive heart failure, hospitalizations, rheumatoid arthritis, and higher sUA at baseline. Time receiving therapy was not associated with renal outcomes. Patients who achieved sUA < 6 mg/dl had a 37% reduction in outcome events (p < 0.0001; HR 0.63, 95% CI: 0.5-0.78). Hyperuricemia is an independent risk factor for renal function decline. Patients treated with ULT who achieved sUA < 6 mg/dl on ULT showed a 37% reduction in outcome events.

Definition, clinical profile, microbiological spectrum, and prognostic factors of early-onset prosthetic valve endocarditis.

PubMed

López, Javier; Revilla, Ana; Vilacosta, Isidre; Villacorta, Eduardo; González-Juanatey, Carlos; Gómez, Itziar; Rollán, María Jesús; San Román, José Alberto

2007-03-01

There is no agreement in the best cutoff time to distinguish between early- and late- onset prosthetic valve endocarditis (PVE). Our objectives are to define early-onset PVE according to the microbiological spectrum and to analyse the profile and short-term prognosis of this entity. The microbiological profile of 172 non-drug users, who were patients with PVE, were compared according to the time elapsed from surgery among 640 endocarditis diagnosed between 1996 and 2004. There were no differences in the microbiological profile of patients with PVE occurred within 2 months of valve replacement and those accounting between 2 and 12 months. The proportion of coagulase-negative Staphylococci (CNS) was higher during the first year post-intervention (37 vs. 18%, P = 0.005) and Streptococci viridans were more common after 1 year (18 vs. 1%, P = 0.001). The percentage of methicilin-resistant CNS strains was higher before 1 year (77 vs. 30%, P = 0.004). Early-onset PVE represented 38% of all episodes of PVE, CNS being the most frequent isolated microorganisms (37%), most of them methicilin resistant (77%). In-hospital mortality of patients who needed urgent surgery was 46% and elective surgery 25%. Overall, in-hospital mortality was 38% and no differences were seen between surgical and medical groups (32 vs. 45%, P = 0.30). Periannular complications were associated with higher in-hospital mortality (60 vs. 27%, P = 0.007). According to the microbiological profile, the most appropriate cutoff time to distinguish between early- and late-onset PVE was 1 year. Methicilin-resistant CNS are the most frequent pathogens and periannular complications, the only risk factor for in-hospital mortality.

Psychiatric comorbidities of adults with early- and late-onset attention-deficit/hyperactivity disorder.

PubMed

Lin, Yu-Ju; Yang, Li-Kuang; Gau, Susan Shur-Fen

2016-06-01

We evaluated the psychiatric comorbidities in adults who were diagnosed with Diagnostic and Statistical Manual of Mental disorders, 5th edition attention-deficit/hyperactivity disorder as a function of recalled symptom onset before and after the age of 7 years and whether the childhood attention-deficit/hyperactivity disorder symptoms were associated with psychiatric comorbidities. In all, 214 adults who were diagnosed with Diagnostic and Statistical Manual of Mental disorders, 5th edition attention-deficit/hyperactivity disorder and 174 non-attention-deficit/hyperactivity disorder controls (aged 17-40 years) received psychiatric interviews to confirm their previous and current attention-deficit/hyperactivity disorder status and other psychiatric diagnoses. Demographics and risks of lifetime psychiatric disorders were compared among three groups: (1) attention-deficit/hyperactivity disorder, onset <7 years (early-onset); (2) attention-deficit/hyperactivity disorder, onset between 7 and 12 years (late-onset) and (3) non-attention-deficit/hyperactivity disorder controls. We also tested the effects of attention-deficit/hyperactivity disorder symptoms on the risk of later psychiatric comorbidities by Cox regression analyses. Regardless of the age of onset, attention-deficit/hyperactivity disorder was significantly associated with a wide range of psychiatric comorbidities. There were similar comorbid patterns between early- and late-onset attention-deficit/hyperactivity disorder. Regardless of attention-deficit/hyperactivity disorder diagnosis, increased severity of attention-deficit/hyperactivity disorder symptoms was associated with higher risks of oppositional defiant disorder, conduct disorder, dysthymia and sleep disorder but not major depression, which was associated with the attention-deficit/hyperactivity disorder diagnosis. Our findings suggest that elevating the threshold of age of onset to 12 years in Diagnostic and Statistical Manual of Mental

Early-onset Alzheimer's disease: nonamnestic subtypes and type 2 AD.

PubMed

Mendez, Mario F

2012-11-01

Patients with Alzheimer's disease (AD), the most prevalent neurodegenerative dementia, are usually elderly; however, ∼4-5% develop early-onset AD (EOAD) with onset before age 65. Most EOAD is sporadic, but about 5% of patients with EOAD have an autosomal dominant mutation such as Presenilin 1, Presenilin 2, or alterations in the Amyloid Precursor Protein gene. Although most Alzheimer's research has concentrated on older, late-onset AD (LOAD), there is much recent interest and research in EOAD. These recent studies indicate that EOAD is a heterogeneous disorder with significant differences from LOAD. From 22-64% of EOAD patients have a predominant nonamnestic syndrome presenting with deficits in language, visuospatial abilities, praxis, or other non-memory cognition. These nonamnestic patients may differ in several ways from the usual memory or amnestic patients. Patients with nonamnestic EOAD compared to typical amnestic AD have a more aggressive course, lack the apolipoprotein Eɛ4 (APOE ɛ4) susceptibility gene for AD, and have a focus and early involvement of non-hippocampal areas of brain, particularly parietal neocortex. These differences in the EOAD subtypes indicate differences in the underlying amyloid cascade, the prevailing pathophysiological theory for the development of AD. Together the results of recent studies suggest that nonamnestic subtypes of EOAD constitute a Type 2 AD distinct from the usual, typical disorder. In sum, the study of EOAD can reveal much about the clinical heterogeneity, predisposing factors, and neurobiology of this disease. Copyright © 2012 IMSS. Published by Elsevier Inc. All rights reserved.

Germline Mutations of Inhibins in Early-Onset Ovarian Epithelial Tumors

PubMed Central

Tournier, Isabelle; Marlin, Régine; Walton, Kelly; Charbonnier, Françoise; Coutant, Sophie; Théry, Jean-Christophe; Charbonnier, Camille; Spurrell, Cailyn; Vezain, Myriam; Ippolito, Lorena; Bougeard, Gaëlle; Roman, Horace; Tinat, Julie; Sabourin, Jean-Christophe; Stoppa-Lyonnet, Dominique; Caron, Olivier; Bressac-de Paillerets, Brigitte; Vaur, Dominique; King, Mary-Claire; Harrison, Craig; Frebourg, Thierry

2014-01-01

To identify novel genetic bases of early-onset epithelial ovarian tumors, we used the trio exome sequencing strategy in a patient without familial history of cancer who presented metastatic serous ovarian adenocarcinomas at 21 years of age. We identified a single de novo mutation (c.1157A>G/p.Asn386Ser) within the INHBA gene encoding the βA-subunit of inhibins/activins, which play a key role in ovarian development. In vitro, this mutation alters the ratio of secreted activins and inhibins. In a second patient with early-onset serous borderline papillary cystadenoma, we identified an unreported germline mutation (c.179G>T/p.Arg60Leu) of the INHA gene encoding the α-subunit, the partner of the βA-subunit. This mutation also alters the secreted activin/inhibin ratio, by disrupting both inhibin A and inhibin B biosynthesis. In a cohort of 62 cases, we detected an additional unreported germline mutation of the INHBA gene (c.839G>A/p.Gly280Glu). Our results strongly suggest that inhibin mutations contribute to the genetic determinism of epithelial ovarian tumors. PMID:24302632

Early-Onset Multiple Sclerosis in Isfahan, Iran: Report of the Demographic and Clinical Features of 221 Patients.

PubMed

Etemadifar, Masoud; Nourian, Sayed-Mohammadamin; Nourian, Niloofaralsadat; Abtahi, Seyed-Hossein; Sayahi, Farnaz; Saraf, Zahra; Fereidan-Esfahani, Mahboobeh

2016-06-01

It is estimated that early-onset multiple sclerosis multiple sclerosis (early-onset multiple sclerosis) approximately incorporates 3-5% of the multiple sclerosis population. In this report on early-onset multiple sclerosis, the authors aimed to define demographic, clinical and imaging features in a case-series of true-childhood multiple sclerosis and to compare its characteristics with juvenile multiple sclerosis. The authors inspected the records of multiple sclerosis patients who were registered by Isfahan MS Society. Clinical and demographic data of children with less than 16 years of age were reviewed retrospectively. Out of 4536 multiple sclerosis patients referred to the authors' center, 221 patients (4.8%) had multiple sclerosis starting at the age of 16 or less (11 true-childhood multiple sclerosis vs 210 juvenile-onset multiple sclerosis); the female to male ratio was 4.81:1. In the mean follow-up period of 6.2 years, 22 patients (10.5%) had positive family history of multiple sclerosis, 196 (88.6%) patients were classified as relapsing-remitting multiple sclerosis, the mean (± SD Expanded Disability Status Scale) was 1.5 ± 1.1 at the last evaluation. The most common initial presentation was optic nerve involvement (36.1%) and cerebellar sign and symptoms (14.6%). In all, 13 patients (5.8%) had experienced seizure in the course of multiple sclerosis. This study indicated that early-onset multiple sclerosis is not rare condition and overwhelmingly affects girls even at prepubertal onset. Physicians should consider multiple sclerosis in suspicious pediatric cases. © The Author(s) 2016.

Profile of cognitive deficits and associations with depressive symptoms and intelligence in chronic early-onset schizophrenia patients.

PubMed

Jepsen, Jens Richardt Møllegaard; Fagerlund, Birgitte; Pagsberg, Anne Katrine; Christensen, Anne Marie Raaberg; Nordentoft, Merete; Mortensen, Erik Lykke

2013-10-01

Cognitive deficits in several domains have been demonstrated in early-onset schizophrenia patients but their profile and relation to depressive symptoms and intelligence need further characterization. The purpose was to characterize the profile of cognitive deficits in chronic, early-onset schizophrenia patients, assess the potential associations with depressive symptom severity, and examine whether cognitive deficits within several domains reflect intelligence impairments. This study compared attention, visual-construction, aspects of visual and verbal memory, and executive functions in chronic, early-onset schizophrenia patients (mean age = 20.7 years) (N = 18) and healthy controls (N = 38). Schizophrenia diagnoses were established at the time of the patients' first clinical presentation during childhood or adolescence and were confirmed five years later. In the chronic phase of early-onset schizophrenia, significant deficits were observed in all specific cognitive functions. The profile of cognitive deficits was jagged, and visual-construction, attention, and one aspect of verbal memory (verbal stories recall) were differentially impaired. Deficits of visual recall, visual recognition, and executive functions were accounted for by deficits in intelligence, while this was not the case for deficits of verbal recall of stories or attention. No significant associations were observed between the severity of cognitive deficits and that of depressive symptoms. Chronic, early-onset schizophrenia is characterized by a broad and jagged profile of cognitive deficits. Deficits of attention and verbal recall of stories appear not to be accounted for by deficits in intelligence, and the severity of cognitive deficits seems independent from that of depressive symptoms. © 2013 The Scandinavian Psychological Associations.

Evaluation of intrapartum antibiotic prophylaxis for the prevention of early-onset group B streptococcal infection.

PubMed

Sakata, Hiroshi

2012-12-01

We retrospectively assessed the medical records of pregnant women who delivered at Asahikawa Kosei Hospital during a period of 3 years between January 2009 and December 2011 and their neonates. Our prophylactic measures against group B Streptococcus (GBS) infection are based on the Japanese guidelines. More specifically, we performed screening by examining bacterial cultures of vaginal-perianal swabs from pregnant women between gestational weeks 33 and 37. Then, sulbactam/ampicillin (SBT/ABPC) was given at a dose of 1.5 g through a drip intravenous infusion at delivery if pregnant women were screened positive for GBS. For neonates born to GBS carrier women, bacterial cultures of pharyngeal swabs, vernix caseosa, stool, and gastric juice were performed at birth. There were 2,399 deliveries and 2,499 births at our hospital. In 169 of the deliveries (175 of the births), GBS was isolated from specimens obtained from gestational weeks 33-37. According to delivery mode, there were 42 cases of cesarean section (45 births) and 127 cases of vaginal delivery (130 births). The GBS-positive neonates accounted for 4.1 % of all deliveries in pregnant women who tested positive for GBS at gestational weeks 33-37. In neonates born by vaginal delivery, the GBS-positive rate was 5.5 %. Of the 2,499 neonates born at our hospital during a period of 3 years, early-onset GBS infection occurred in 1 neonate. The incidence of early-onset GBS infection was 0.40 per 1,000 live births. From 1997 to 2001 (routine GBS screening of mothers was not performed), there were 2,097 deliveries and 2,166 births. Early-onset GBS infection occurred in 1 neonate during this period; thus, the incidence of early-onset GBS infection was 0.46 per 1,000 live births. There were no significant differences in the two periods. The present prophylactic measures such as screening of maternal GBS carriers and intrapartum antibiotic administration are inadequate to decrease the occurrence of early-onset GBS

New Predictive Model at 11+0 to 13+6 Gestational Weeks for Early-Onset Preeclampsia With Fetal Growth Restriction.

PubMed

Chang, Ying; Chen, Xu; Cui, Hong-Yan; Li, Xing; Xu, Ya-Ling

2017-05-01

The aim of the present study was to determine a predictive model for early-onset preeclampsia with fetal growth restriction (FGR) to be used at 11 +0 to 13 +6 gestational weeks, by combining the maternal serum level of pregnancy-associated plasma protein-A (PAPP-A), placental growth factor (PLGF), placental protein 13 (PP13), soluble endoglin (sEng), mean arterial pressure (MAP), and uterine artery Doppler. This was a retrospective cohort study of 4453 pregnant women. Uterine artery Doppler examination was conducted in the first trimester. Maternal serum PAPP-A, PLGF, PP13, and sEng were measured. Mean arterial pressure was obtained. Women were classified as with/without early-onset preeclampsia, and women with preeclampsia were classified as with/without FGR. Receiver operating characteristic analysis was performed to determine the value of the model. There were 30 and 32 pregnant women with early-onset preeclampsia with and without FGR. The diagnosis rate of early-onset preeclampsia with FGR was 67.4% using the predictive model when the false positive rate was set at 5% and 73.2% when the false positive rate was 10%. The predictive model (MAP, uterine artery Doppler measurements, and serum biomarkers) had some predictive value for the early diagnosis (11 +0 to 13 +6 gestational weeks) of early-onset preeclampsia with FGR.

Premature adrenarche: novel lessons from early onset androgen excess.

PubMed

Idkowiak, Jan; Lavery, Gareth G; Dhir, Vivek; Barrett, Timothy G; Stewart, Paul M; Krone, Nils; Arlt, Wiebke

2011-08-01

Adrenarche reflects the maturation of the adrenal zona reticularis resulting in increased secretion of the adrenal androgen precursor DHEA and its sulphate ester DHEAS. Premature adrenarche (PA) is defined by increased levels of DHEA and DHEAS before the age of 8 years in girls and 9 years in boys and the concurrent presence of signs of androgen action including adult-type body odour, oily skin and hair and pubic hair growth. PA is distinct from precocious puberty, which manifests with the development of secondary sexual characteristics including testicular growth and breast development. Idiopathic PA (IPA) has long been considered an extreme of normal variation, but emerging evidence links IPA to an increased risk of developing the metabolic syndrome (MS) and thus ultimately cardiovascular morbidity. Areas of controversy include the question whether IPA in girls is associated with a higher rate of progression to the polycystic ovary syndrome (PCOS) and whether low birth weight increases the risk of developing IPA. The recent discoveries of two novel monogenic causes of early onset androgen excess, apparent cortisone reductase deficiency and apparent DHEA sulphotransferase deficiency, support the notion that PA may represent a forerunner condition for PCOS. Future research including carefully designed longitudinal studies is required to address the apparent link between early onset androgen excess and the development of insulin resistance and the MS.

Effects of comorbidity and early age of onset in young people with Bipolar Disorder on self harming behaviour and suicide attempts.

PubMed

Moor, Stephanie; Crowe, Marie; Luty, Sue; Carter, Janet; Joyce, Peter R

2012-02-01

The age of the first episode of illness in Bipolar Disorder has been shown to be an important predictor of outcome with early onset, particularly onset before puberty, associated with greater comorbidity, a poorer quality of life and greatest impairment in functioning. Baseline data from a psychotherapy study was used to examine the prevalence of other comorbid psychiatric conditions and the impact of onset at an early age on both self harming behaviour and suicide attempts in young people with Bipolar Disorder. This study of 100 adolescents and young adults (aged 15-36 years) with Bipolar Disorder showed that comorbid conditions were very common, even at the start of their bipolar illness. Comorbidity increased as the age of onset decreased with very early onset (<13 years) patients bearing the greatest burden of disease. Greater comorbidity also significantly increased the risk of having self harmed and attempted suicide with high lethal intent. Self harming behaviour was predicted by having a lifetime diagnoses of Borderline Personality Disorder and Panic Disorder along with an early age of onset of Bipolar Disorder. In contrast, previous suicide attempts were predicted by greater comorbidity and not by very early (<13 years) age of onset. Copyright © 2011 Elsevier B.V. All rights reserved.

Anemia among Children Exposed to Polyparasitism in Coastal Kenya

PubMed Central

Cojulun, Alicia Chang; Bustinduy, Amaya L.; Sutherland, Laura J.; Mungai, Peter L.; Mutuku, Francis; Muchiri, Eric; Kitron, Uriel; King, Charles H.

2015-01-01

Anemia represents a substantial problem for children living in areas with limited resources and significant parasite burden. We performed a cross-sectional study of 254 Kenyan preschool- and early school-age children in a setting endemic for multiple chronic parasitic infections to explore mechanisms of their anemia. Complete venous blood cell counts revealed a high prevalence of local childhood anemia (79%). Evaluating the potential links between low hemoglobin and socioeconomic factors, nutritional status, hemoglobinopathy, and/or parasite infection, we identified age < 9 years (odds ratio [OR]: 12.0, 95% confidence interval [CI]: 4.4, 33) and the presence of asymptomatic malaria infection (OR: 6.8, 95% CI: 2.1, 22) as the strongest independent correlates of having anemia. A total of 130/155 (84%) of anemic children with iron studies had evidence of iron-deficiency anemia (IDA), 16% had non-IDA; 50/52 of additionally tested anemic children met soluble transferrin-receptor (sTfR) criteria for combined anemia of inflammation (AI) with IDA. Children in the youngest age group had the greatest odds of iron deficiency (OR: 10.0, 95% CI: 3.9, 26). Although older children aged 9–11 years had less anemia, they had more detectable malaria, Schistosoma infection, hookworm, and proportionately more non-IDA. Anemia in this setting appears multifactorial such that chronic inflammation and iron deficiency need to be addressed together as part of integrated management of childhood anemia. PMID:26324733

Association between polymorphisms in cancer-related genes and early onset of esophageal adenocarcinoma.

PubMed

Wu, I-Chen; Zhao, Yang; Zhai, Rihong; Liu, Geoffrey; Ter-Minassian, Monica; Asomaning, Kofi; Su, Li; Liu, Chen-Yu; Chen, Feng; Kulke, Matthew H; Heist, Rebecca S; Christiani, David C

2011-04-01

There is an increasing incidence of esophageal adenocarcinoma (EA) among younger people in the western populations. However, the association between genetic polymorphisms and the age of EA onset is unclear. In this study, 1330 functional/tagging single-nucleotide polymorphisms (SNPs) from 354 cancer-related genes were genotyped in 335 white EA patients. Twenty important SNPs that have the highest importance scores and lowest classification error rate were identified by the random forest algorithm to be associated with early onset of EA (age ≤ 55 years). Subsequent logistic regression analysis indicated that 10 SNPs (rs2070744 of NOS3, rs720321 of BCL2, rs17757541 of BCL2, rs11775256 of TNFRSF10A, rs1035142 of CASP8, rs2236302 of MMP14, rs4740363 of ABL1, rs696217 of GHRL, rs2445762 of CYP19A1, and rs11941492 of VEGFR2/KDR) were significantly associated with early onset of EA (≤55 vs >55 years, all P < .05 after adjusting for co-variates and false discovery rate). Among them, five SNPs in the NOS3, BCL2, TNFRSF10A, and CASP8 genes were known to be involved in apoptosis processes. In Kaplan-Meier analyses, rs2070744 of NOS3, rs720321 of BCL2, and rs1035142 of CASP8 were also significantly associated with early onset of EA. Moreover, there was a higher risk of developing EA at a younger age when one had more risk genotypes. In conclusion, polymorphisms in cancer-related genes, especially those in the apoptotic pathway, play an important role in the development of younger-aged EA in a dose-response manner.

Reduction of vitamin A deficiency and anemia in pregnancy after implementing proposed prenatal nutritional assistance.

PubMed

Barbosa Chagas, C; Ramalho, A; de Carvalho Padilha, P; Delia Libera, B; Saunders, C

2011-01-01

Micronutrient deficiency is an unquestionable public health problem, specially anemia and vitamin A deficiency (VAD). This is due to the collective dimension of these carencies, which reflects on morbimortality rates in the maternal and infant group. to evaluate the impact of a proposal for prenatal nutritional assistance, comparing the prevalence of anemia and VAD, in pre-intervention (GI) and intervention (GII) groups. this is a prospective intervention study in a cohort of pregnant women. The GI group was made up of 225 the GII group of 208 pregnant adults and their respective newborns, attended a Public Maternity Ward in Rio de Janeiro, Brazil. Concentration of hemoglobin was used to diagnose anemia and a standardized interview to diagnose night blindness (XN). after adjusting for confounding variables, through logistic regression, the protective effect of intervention at the onset of anemia (OR = 0.420; IC 95% = 0.251-0.702), with a significant reduction in prevalence, of 28.4% in the GI to 16.8% in the GII, also observed at the onset of XN (OR = 0.377; IC95% = 0.187- 0.759), with a reduction in prevalence of 18.7 % in the GI to 6.2% in the GII. Nutritional intervention has a beneficial effect on maternal health, reducing nutritional deficiencies most prevalent during pregnancy and the impact of these on the obstetric ailment.

Hemolytic anemia

MedlinePlus

Anemia - hemolytic ... bones that helps form all blood cells. Hemolytic anemia occurs when the bone marrow isn't making ... destroyed. There are several possible causes of hemolytic anemia. Red blood cells may be destroyed due to: ...

Difference in the action mechanism of radon inhalation and radon hot spring water drinking in suppression of hyperuricemia in mice

PubMed Central

Etani, Reo; Kataoka, Takahiro; Kanzaki, Norie; Sakoda, Akihiro; Tanaka, Hiroshi; Ishimori, Yuu; Mitsunobu, Fumihiro; Yamaoka, Kiyonori

2016-01-01

Although radon therapy is indicated for hyperuricemia, the underlying mechanisms of action have not yet been elucidated in detail. Therefore, we herein examined the inhibitory effects of radon inhalation and hot spring water drinking on potassium oxonate (PO)–induced hyperuricemia in mice. Mice inhaled radon at a concentration of 2000 Bq/m3 for 24 h or were given hot spring water for 2 weeks. Mice were then administrated PO at a dose of 500 mg/kg. The results obtained showed that serum uric acid levels were significantly increased by the administration of PO. Radon inhalation or hot spring water drinking significantly inhibited elevations in serum uric acid levels through the suppression of xanthine oxidase activity in the liver. Radon inhalation activated anti-oxidative functions in the liver and kidney. These results suggest that radon inhalation inhibits PO-induced hyperuricemia by activating anti-oxidative functions, while hot spring water drinking may suppress PO-induced elevations in serum uric acid levels through the pharmacological effects of the chemical compositions dissolved in it. PMID:27021217

Predictors of Early-Onset Permanent Hearing Loss in Malnourished Infants in Sub-Saharan Africa

ERIC Educational Resources Information Center

Olusanya, Bolajoko O.

2011-01-01

The objective of this study was to determine the predictors of early-onset permanent hearing loss (EPHL) among undernourished infants in a low-income country where routine screening for developmental disabilities in early childhood is currently unattainable. All infants attending four community-based clinics for routine immunization who met the…

Clinical features of early onset, familial Alzheimer`s disease linked to chromosome 14

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mullan, M.; Bennett, C.; Figueredo, C.

1995-02-27

Early onset familial Alzheimer`s disease (AD) has an autosomal dominant mode of inheritance. Two genes are responsible for the majority of cases of this subtype of AD. Mutations in the {beta}-amyloid precursor protein ({beta}APP) gene on chromosome 21 have been shown to completely cosegregate with the disease. We and others have previously described the clinical features of families with {beta}APP mutations at the codon 717 locus in an attempt to define the phenotype associated with a valine to isoleucine (Val {r_arrow} Ile) or a valine to glycine (Val {r_arrow} Gly) change. More recently, a second locus for very early onsetmore » disease has been localized to chromosome 14. The results of linkage studies in some families suggesting linkage to both chromosomes have been explained by the suggestion of a second (centromeric) locus on chromosome 21. Here we report the clinical features and genetic analysis of a British pedigree (F74) with early onset AD in which neither the {beta}APP locus nor any other chromosome 21 locus segregates with the disease, but in which good evidence is seen for linkage on the long arm of chromosome 14. In particular we report marker data suggesting that the chromosome 14 disease locus is close to D14S43 and D14S77. Given the likelihood that F74 represents a chromosome 14 linked family, we describe the clinical features and make a limited clinical comparison with the {beta}APP717 Val {r_arrow} Ile and {beta}APP717 Val {r_arrow} Gly encoded families that have been previously described. We conclude that although several previously reported clinical features occur to excess in early onset familial AD, no single clinical feature demarcates either the chromosome 14 or {beta}APP codon 717 mutated families except mean age of onset. 52 refs., 2 figs., 5 tabs.« less

Growing rod erosion through the lamina causing spinal cord compression in an 8-year-old girl with early-onset scoliosis.

PubMed

Abduljabbar, Fahad H; Waly, Feras; Nooh, Anas; Ouellet, Jean

2016-09-01

Early-onset scoliosis often occurs by the age of 5 years and is attributed to many structural abnormalities. Syndromic early-onset scoliosis is considered one of the most aggressive types of early-onset scoliosis. Treatment starts with serial casting and bracing, but eventually most of these patients undergo growth-sparing procedures, such as a single growing rod, dual growing rods, or a vertical expandable titanium prosthetic rib. This case report aimed to describe an unusual complication of erosion of a growing rod through the lamina that caused spinal cord compression in an 8-year-old girl with early-onset scoliosis. This is a case report. A retrospective chart review was used to describe the clinical course and radiographic findings of this case after rod erosion into the spinal canal. The patient underwent successful revision surgery removing the rod without neurologic complications. Patients with syndromic early-onset scoliosis are more prone to progressive curves and severe rotational deformity. We believe that the severe kyphotic deformity in addition to the dysplastic nature of the deformity in this population may predispose them to this unusual complication. Copyright © 2016 Elsevier Inc. All rights reserved.

Serial elongation-derotation-flexion casting for children with early-onset scoliosis.

PubMed

Canavese, Federico; Samba, Antoine; Dimeglio, Alain; Mansour, Mounira; Rousset, Marie

2015-12-18

Various early-onset spinal deformities, particularly infantile and juvenile scoliosis (JS), still pose challenges to pediatric orthopedic surgeons. The ideal treatment of these deformities has yet to emerge, as both clinicians and surgeons still face multiple challenges including preservation of thoracic motion, spine and cage, and protection of cardiac and lung growth and function. Elongation-derotation-flexion (EDF) casting is a technique that uses a custom-made thoracolumbar cast based on a three-dimensional correction concept. EDF can control progression of the deformity and - in some cases-coax the initially-curved spine to grow straighter by acting simultaneously in the frontal, sagittal and coronal planes. Here we provide a comprehensive review of how infantile and JS can affect normal spine and thorax and how serial EDF casting can be used to manage these spinal deformities. A fresh review of the literature helps fully understand the principles of the serial EDF casting technique and the effectiveness of conservative treatment in patients with early-onset spinal deformities, particularly infantile and juvenile scolisois.

Serial elongation-derotation-flexion casting for children with early-onset scoliosis

PubMed Central

Canavese, Federico; Samba, Antoine; Dimeglio, Alain; Mansour, Mounira; Rousset, Marie

2015-01-01

Various early-onset spinal deformities, particularly infantile and juvenile scoliosis (JS), still pose challenges to pediatric orthopedic surgeons. The ideal treatment of these deformities has yet to emerge, as both clinicians and surgeons still face multiple challenges including preservation of thoracic motion, spine and cage, and protection of cardiac and lung growth and function. Elongation-derotation-flexion (EDF) casting is a technique that uses a custom-made thoracolumbar cast based on a three-dimensional correction concept. EDF can control progression of the deformity and - in some cases-coax the initially-curved spine to grow straighter by acting simultaneously in the frontal, sagittal and coronal planes. Here we provide a comprehensive review of how infantile and JS can affect normal spine and thorax and how serial EDF casting can be used to manage these spinal deformities. A fresh review of the literature helps fully understand the principles of the serial EDF casting technique and the effectiveness of conservative treatment in patients with early-onset spinal deformities, particularly infantile and juvenile scolisois. PMID:26716089

Family history of skin cancer is associated with early-onset basal cell carcinoma independent of MC1R genotype.

PubMed

Berlin, Nicholas L; Cartmel, Brenda; Leffell, David J; Bale, Allen E; Mayne, Susan T; Ferrucci, Leah M

2015-12-01

As a marker of genetic susceptibility and shared lifestyle characteristics, family history of cancer is often used to evaluate an individual's risk for developing a particular malignancy. With comprehensive data on pigment characteristics, lifestyle factors, and melanocortin 1 receptor (MC1R) gene sequence, we sought to clarify the role of family history of skin cancer in early-onset basal cell carcinoma (BCC). Early onset BCC cases (n=376) and controls with benign skin conditions (n=383) under age 40 were identified through Yale dermatopathology. Self-report data on family history of skin cancer (melanoma and non-melanoma skin cancer), including age of onset in relatives, was available from a structured interview. Participants also provided saliva samples for sequencing of MC1R. A family history of skin cancer was associated with an increased risk of early-onset BCC (OR 2.49, 95% CI 1.80-3.45). In multivariate models, family history remained a strong risk factor for early-onset BCC after adjustment for pigment characteristics, UV exposure, and MC1R genotype (OR 2.41, 95% CI 1.74-3.35). Risk for BCC varied based upon the type and age of onset of skin cancer among affected relatives; individuals with a first-degree relative diagnosed with skin cancer prior to age 50 were at highest risk for BCC (OR 4.79, 95% CI 2.90-7.90). Even after taking into account potential confounding effects of MC1R genotype and various lifestyle factors that close relatives may share, family history of skin cancer remained strongly associated with early-onset BCC. Copyright © 2015. Published by Elsevier Ltd.

[Glycogen storage disease type Ⅰa: a rare cause of gout in adolescent and young adult patients].

PubMed

Xu, N; Huang, X M; Fang, W G; Zhang, Y; Qiu, Z Q; Zeng, X J

2018-04-01

Objective: To analyze the clinical features of secondary gout in glycogen storage disease type Ⅰa (GSD Ⅰa), so as to improve the awareness of this disease. Methods: The clinical features, laboratory findings, treatments and prognosis of 5 GSD Ⅰa patients with secondary gout who had been admitted to the Peking Union Medical College Hospital during 2006 to 2016 were collected and analyzed. GSD Ⅰa was confirmed by liver biopsy and genotyping. Results: Among the 5 patients (median age: 27 years), 3 were males and 2 were females. The mean age of gout onset was 17 ranging from 10 to 22 years old. The common manifestations of GSD included hepatomegaly since childhood, hypoglycemia, growth retardation, anemia, hyperlactacidemia and hyperlipidemia. All the 5 patients were complicated with gouty tophi and kidney stone. Gouty tophi and kidney stone were identified 3.8 years and 10.2 years after the first occurrence of articular symptoms, respectively. Renal damage occurred in 3 cases. All the patients underwent several therapeutic modalities including lifestyle intervention, allopurinol, and raw corn starch treatment. Conclusions: Determination of the presence of primary disease should be performed actively for young-onset gout with early occurrence of gouty tophi. GSD should be suspected if there exist clinical manifestations like hepatomegaly, recurrent hypoglycemia, growth retardation. Early management of hyperuricemia and gout in GSD patients is important to prevent complications and improve prognosis.

Neurocognitive Outcomes in the Treatment of Early-Onset Schizophrenia Spectrum Disorders Study

ERIC Educational Resources Information Center

Frazier, Jean A.; Giuliano, Anthony J.; Johnson, Jacqueline L.; Yakutis, Lauren; Youngstrom, Eric A.; Breiger, David; Sikich, Linmarie; Findling, Robert L.; McClellan, Jon; Hamer, Robert M.; Vitiello, Benedetto; Lieberman, Jeffrey A.; Hooper, Stephen R.

2012-01-01

Objective: To assess neurocognitive outcomes following antipsychotic intervention in youth enrolled in the National Institute of Mental Health (NIMH)-funded Treatment of Early-Onset Schizophrenia Spectrum Disorders (TEOSS). Method: Neurocognitive functioning of youth (ages 8 to 19 years) with schizophrenia or schizoaffective disorder was evaluated…

Polygenic risk score in postmortem diagnosed sporadic early-onset Alzheimer's disease.

PubMed

Chaudhury, Sultan; Patel, Tulsi; Barber, Imelda S; Guetta-Baranes, Tamar; Brookes, Keeley J; Chappell, Sally; Turton, James; Guerreiro, Rita; Bras, Jose; Hernandez, Dena; Singleton, Andrew; Hardy, John; Mann, David; Morgan, Kevin

2018-02-01

Sporadic early-onset Alzheimer's disease (sEOAD) exhibits the symptoms of late-onset Alzheimer's disease but lacks the familial aspect of the early-onset familial form. The genetics of Alzheimer's disease (AD) identifies APOEε4 to be the greatest risk factor; however, it is a complex disease involving both environmental risk factors and multiple genetic loci. Polygenic risk scores (PRSs) accumulate the total risk of a phenotype in an individual based on variants present in their genome. We determined whether sEOAD cases had a higher PRS compared to controls. A cohort of sEOAD cases was genotyped on the NeuroX array, and PRSs were generated using PRSice. The target data set consisted of 408 sEOAD cases and 436 controls. The base data set was collated by the International Genomics of Alzheimer's Project consortium, with association data from 17,008 late-onset Alzheimer's disease cases and 37,154 controls, which can be used for identifying sEOAD cases due to having shared phenotype. PRSs were generated using all common single nucleotide polymorphisms between the base and target data set, PRS were also generated using only single nucleotide polymorphisms within a 500 kb region surrounding the APOE gene. Sex and number of APOE ε2 or ε4 alleles were used as variables for logistic regression and combined with PRS. The results show that PRS is higher on average in sEOAD cases than controls, although there is still overlap among the whole cohort. Predictive ability of identifying cases and controls using PRSice was calculated with 72.9% accuracy, greater than the APOE locus alone (65.2%). Predictive ability was further improved with logistic regression, identifying cases and controls with 75.5% accuracy. Copyright © 2017 Elsevier Inc. All rights reserved.

Anemia--prevalence and risk factors in pregnancy.

PubMed

Bencaiova, Gabriela; Burkhardt, Tilo; Breymann, Christian

2012-09-01

To assess the prevalence of decreased iron stores and anemia in pregnant women. To determine whether the risk factors: socio-demographic background, age, BMI, and parity are associated with abnormal hemoglobin concentrations and/or abnormal iron status. A longitudinal study was carried out at the Department of Obstetrics, University Hospital of Zurich to establish the risk factors and prevalence of the decreased iron stores and anemia in early pregnancy. In order to determine the hematological parameters and ferritin levels, venous blood samples of 470 singleton pregnancies between 16 and 20 pregnancy weeks were collected. According to hemoglobin and iron status, the patients were divided into four groups: patients with iron deficiency anemia, patients with decreased iron stores, patients with anemia for other reasons and normal patients. The determinants socio-demographic background, age, BMI and parity were explored using multiple logistic regression analysis. The prevalence of decreased iron stores (ferritin<20 μg/l) was observed in 31.8% of subjects (149/470) and anemia (Hb<110 g/l) in 18.5% (87/470). The prevalence of iron deficiency anemia was higher among women coming from former Yugoslavia and developing countries (p=0.004 and p=0.012). In patients coming from developing countries, a significant increase of anemia for other reasons was observed (p=0.027) and in patients older than 30 years, a significant increase of decreased iron stores (p=0.018). In our study population with low parity, the prevalence of abnormal hemoglobin and abnormal iron status was 50.2% (236/470), and socio-demographic background was the most important risk factor of anemia. Copyright © 2012 European Federation of Internal Medicine. Published by Elsevier B.V. All rights reserved.

Whole Exome Analysis of Early Onset Alzheimer’s Disease

DTIC Science & Technology

2013-04-01

FTD), FTD with Parkinsonism , and early-onset Alzheimer Disease (EOAD)-like presentations. Using whole exome capture with subsequent sequencing, we...dementia. The MAPT R406W mutation is associated with EOAD-like symptoms and Parkinsonism without FTD, as well as distinct cognitive courses. KEY...OUTCOMES: Carney RM, Kohli MA, Kunkle BW, Naj AC, Gilbert JR, Züchner S, PERICAK-VANCE MA, Parkinsonism and distinct dementia patterns in a

Early-Onset Neonatal Sepsis

PubMed Central

Simonsen, Kari A.; Anderson-Berry, Ann L.; Delair, Shirley F.

2014-01-01

SUMMARY Early-onset sepsis remains a common and serious problem for neonates, especially preterm infants. Group B streptococcus (GBS) is the most common etiologic agent, while Escherichia coli is the most common cause of mortality. Current efforts toward maternal intrapartum antimicrobial prophylaxis have significantly reduced the rates of GBS disease but have been associated with increased rates of Gram-negative infections, especially among very-low-birth-weight infants. The diagnosis of neonatal sepsis is based on a combination of clinical presentation; the use of nonspecific markers, including C-reactive protein and procalcitonin (where available); blood cultures; and the use of molecular methods, including PCR. Cytokines, including interleukin 6 (IL-6), interleukin 8 (IL-8), gamma interferon (IFN-γ), and tumor necrosis factor alpha (TNF-α), and cell surface antigens, including soluble intercellular adhesion molecule (sICAM) and CD64, are also being increasingly examined for use as nonspecific screening measures for neonatal sepsis. Viruses, in particular enteroviruses, parechoviruses, and herpes simplex virus (HSV), should be considered in the differential diagnosis. Empirical treatment should be based on local patterns of antimicrobial resistance but typically consists of the use of ampicillin and gentamicin, or ampicillin and cefotaxime if meningitis is suspected, until the etiologic agent has been identified. Current research is focused primarily on development of vaccines against GBS. PMID:24396135

Identifying anomalously early spring onsets in the CESM large ensemble project

NASA Astrophysics Data System (ADS)

Labe, Zachary; Ault, Toby; Zurita-Milla, Raul

2017-06-01

Seasonal transitions from winter to spring impact a wide variety of ecological and physical systems. While the effects of early springs across North America are widely documented, changes in their frequency and likelihood under the combined influences of climate change and natural variability are poorly understood. Extremely early springs, such as March 2012, can lead to severe economical losses and agricultural damage when these are followed by hard freeze events. Here we use the new Community Earth System Model Large Ensemble project and Extended Spring Indices to simulate historical and future spring onsets across the United States and in the particular the Great Lakes region. We found a marked increase in the frequency of March 2012-like springs by midcentury in addition to an overall trend towards earlier spring onsets, which nearly doubles that of observational records. However, changes in the date of last freeze do not occur at the same rate, therefore, causing a potential increase in the threat of plant tissue damage. Although large-scale climate modes, such as the Pacific Decadal Oscillation, have previously dominated decadal to multidecadal spring onset trends, our results indicate a decreased role in natural climate variability and hence a greater forced response by the end of the century for modulating trends. Without a major reduction in greenhouse gas emissions, our study suggests that years like 2012 in the US could become normal by mid-century.

Anemia (For Teens)

MedlinePlus

... Staying Safe Videos for Educators Search English Español Anemia KidsHealth / For Teens / Anemia What's in this article? ... Enough Iron Print en español Anemia What Is Anemia? Lots of teens are tired. With all the ...

Early pubertal onset and its relationship with sexual risk taking, substance use and anti-social behaviour: a preliminary cross-sectional study

PubMed Central

2009-01-01

Background In many countries age at pubertal onset has declined substantially. Relatively little attention has been paid to how this decline may affect adolescent behaviours such as substance use, violence and unprotected sex and consequently impact on public health. Methods In the UK, two opportunistic samples (aged 16-45 years), paper-based (n = 976) and online (n = 1117), examined factors associated with earlier pubertal onset and whether earlier age of onset predicted sexual risk-taking, substance use and anti-social behaviours during early adolescence. Results Overall, 45.6% of females reported menarche ≤ 12 years and 53.3% of males were categorised as having pubertal onset ≤ 11 years. For both sexes earlier pubertal onset was associated with poorer parental socio-economic status. Other pre-pubertal predictors of early onset were being overweight, more childhood illnesses (females) and younger age at time of survey (males). For both sexes earlier puberty predicted having drunk alcohol, been drunk, smoked and used drugs <14 years as well as having a sexual debut and unprotected sex <16 years. Males with earlier pubertal onset were more likely to report fighting and aggressive responses to emotional upset during early adolescence while females were more likely to report being bullied and having taken more time off school. Conclusion Results provide sufficient evidence for changes in age of pubertal onset to be further explored as a potential influence on trends in adolescent risk behaviours. Further insight into the relationship between early puberty and both obesity and socio-economic status may help inform early interventions to tackle the development of risk behaviours and health inequalities during early adolescence. PMID:19958543

Early functional and morphological brain disturbances in late-onset intrauterine growth restriction.

PubMed

Starčević, Mirta; Predojević, Maja; Butorac, Dražan; Tumbri, Jasna; Konjevoda, Paško; Kadić, Aida Salihagić

2016-02-01

To determine whether the brain disturbances develop in late-onset intrauterine growth restriction (IUGR) before blood flow redistribution towards the fetal brain (detected by Doppler measurements in the middle cerebral artery and umbilical artery). Further, to evaluate predictive values of Doppler arterial indices and umbilical cord blood gases and pH for early functional and/or morphological brain disturbances in late-onset IUGR. This cohort study included 60 singleton term pregnancies with placental insufficiency caused late-onset IUGR (IUGR occurring after 34 gestational weeks). Umbilical artery resistance index (URI), middle cerebral artery resistance index (CRI), and cerebroumbilical (C/U) ratio (CRI/URI) were monitored once weekly. Umbilical blood cord samples (arterial and venous) were collected for the analysis of pO2, pCO2 and pH. Morphological neurological outcome was evaluated by cranial ultrasound (cUS), whereas functional neurological outcome by Amiel-Tison Neurological Assessment at Term (ATNAT). 50 fetuses had C/U ratio>1, and 10 had C/U ratio≤1; among these 10 fetuses, 9 had abnormal neonatal cUS findings and all 10 had non-optimal ATNAT. However, the total number of abnormal neurological findings was much higher. 32 neonates had abnormal cUS (53.37%), and 42 (70.00%) had non-optimal ATNAT. Furthermore, Doppler indices had higher predictive validity for early brain disturbances than umbilical cord blood gases and pH. C/U ratio had the highest predictive validity with threshold for adverse neurological outcome at value 1.13 (ROC analysis), i.e., 1.18 (party machine learning algorithm). Adverse neurological outcome at average values of C/U ratios>1 confirmed that early functional and/or structural brain disturbances in late-onset IUGR develop even before activation of fetal cardiovascular compensatory mechanisms, i.e., before Doppler signs of blood flow redistribution between the fetal brain and the placenta. Copyright © 2015 Elsevier Ireland Ltd

High-Definition transcranial direct current stimulation in early onset epileptic encephalopathy: a case study.

PubMed

Meiron, Oded; Gale, Rena; Namestnic, Julia; Bennet-Back, Odeya; David, Jonathan; Gebodh, Nigel; Adair, Devin; Esmaeilpour, Zeinab; Bikson, Marom

2018-01-01

Early onset epileptic encephalopathy is characterized by high daily seizure-frequency, multifocal epileptic discharges, severe psychomotor retardation, and death at infancy. Currently, there are no effective treatments to alleviate seizure frequency and high-voltage epileptic discharges in these catastrophic epilepsy cases. The current study examined the safety and feasibility of High-Definition transcranial direct current stimulation (HD-tDCS) in reducing epileptiform activity in a 30-month-old child suffering from early onset epileptic encephalopathy. HD-tDCS was administered over 10 intervention days spanning two weeks including pre- and post-intervention video-EEG monitoring. There were no serious adverse events or side effects related to the HD-tDCS intervention. Frequency of clinical seizures was not significantly reduced. However, interictal sharp wave amplitudes were significantly lower during the post-intervention period versus baseline. Vital signs and blood biochemistry remained stable throughout the entire study. These exploratory findings support the safety and feasibility of 4 × 1 HD-tDCS in early onset epileptic encephalopathy and provide the first evidence of HD-tDCS effects on paroxysmal EEG features in electroclinical cases under the age of 36 months. Extending HD-tDCS treatment may enhance electrographic findings and clinical effects.

Emerging functions of the Fanconi anemia pathway at a glance.

PubMed

Sumpter, Rhea; Levine, Beth

2017-08-15

Fanconi anemia (FA) is a rare disease, in which homozygous or compound heterozygous inactivating mutations in any of 21 genes lead to genomic instability, early-onset bone marrow failure and increased cancer risk. The FA pathway is essential for DNA damage response (DDR) to DNA interstrand crosslinks. However, proteins of the FA pathway have additional cytoprotective functions that may be independent of DDR. We have shown that many FA proteins participate in the selective autophagy pathway that is required for the destruction of unwanted intracellular constituents. In this Cell Science at a Glance and the accompanying poster, we briefly review the role of the FA pathway in DDR and recent findings that link proteins of the FA pathway to selective autophagy of viruses and mitochondria. Finally, we discuss how perturbations in FA protein-mediated selective autophagy may contribute to inflammatory as well as genotoxic stress. © 2017. Published by The Company of Biologists Ltd.

The CDKL5 disorder is an independent clinical entity associated with early-onset encephalopathy.

PubMed

Fehr, Stephanie; Wilson, Meredith; Downs, Jenny; Williams, Simon; Murgia, Alessandra; Sartori, Stefano; Vecchi, Marilena; Ho, Gladys; Polli, Roberta; Psoni, Stavroula; Bao, Xinhua; de Klerk, Nick; Leonard, Helen; Christodoulou, John

2013-03-01

The clinical understanding of the CDKL5 disorder remains limited, with most information being derived from small patient groups seen at individual centres. This study uses a large international data collection to describe the clinical profile of the CDKL5 disorder and compare with Rett syndrome (RTT). Information on individuals with cyclin-dependent kinase-like 5 (CDKL5) mutations (n=86) and females with MECP2 mutations (n=920) was sourced from the InterRett database. Available photographs of CDKL5 patients were examined for dysmorphic features. The proportion of CDKL5 patients meeting the recent Neul criteria for atypical RTT was determined. Logistic regression and time-to-event analyses were used to compare the occurrence of Rett-like features in those with MECP2 and CDKL5 mutations. Most individuals with CDKL5 mutations had severe developmental delay from birth, seizure onset before the age of 3 months and similar non-dysmorphic features. Less than one-quarter met the criteria for early-onset seizure variant RTT. Seizures and sleep disturbances were more common than in those with MECP2 mutations whereas features of regression and spinal curvature were less common. The CDKL5 disorder presents with a distinct clinical profile and a subtle facial, limb and hand phenotype that may assist in differentiation from other early-onset encephalopathies. Although mutations in the CDKL5 gene have been described in association with the early-onset variant of RTT, in our study the majority did not meet these criteria. Therefore, the CDKL5 disorder should be considered separate to RTT, rather than another variant.

[The associations between adenosine triphosphate binding cassette subfamily G member-2 single nucleotide polymorphism and hyperuricemia in a Chinese tertiary hospital faculty cohort].

PubMed

Zhang, B Q; Fang, W G; Zhang, Y; Liu, S F; Zeng, X J

2017-11-01

Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 μmol/L and females with serum uric acid> 359.6 μmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P <0.001), with an OR for hyperuricemia of 2.89 (95% CI 1.91-4.37, P <0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95% CI 1.94 - 4.62, P <0.001). Subgroup analysis showed that the ORs were 3.83 (95% CI 2.03-7.24, P <0.001) in male and 2.30 (95% CI 1.32-4.00, P =0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95% CI 1.02-10.29, P =0.047) in male and 3.06 (95% CI 1.37-6.84, P =0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95% CI 1

Is early-onset microsatellite and chromosomally stable colorectal cancer a hallmark of a genetic susceptibility syndrome?

PubMed

Kets, C M; van Krieken, J H J M; van Erp, P E J; Feuth, T; Jacobs, Y H A; Brunner, H G; Ligtenberg, M J L; Hoogerbrugge, N

2008-02-15

Most colorectal cancers show either microsatellite or chromosomal instability. A subset of colorectal cancers, especially those diagnosed at young age, is known to show neither of these forms of genetic instability and thus might have a distinct pathogenesis. Colorectal cancers diagnosed at young age are suggestive for hereditary predisposition. We investigate whether such early-onset microsatellite and chromosomally stable colorectal cancers are a hallmark of a genetic susceptibility syndrome. The ploidy status of microsatellite stable (familial) colorectal cancers of patients diagnosed before age 50 (n = 127) was analyzed in relation to the histopathological characteristics and family history. As a control the ploidy status of sporadic colorectal cancer, with normal staining of mismatch repair proteins, diagnosed at the age of 69 years or above (n = 70) was determined. A diploid DNA content was used as a marker for chromosomal stability. Within the group of patients with (familial) early onset microsatellite stable colorectal cancer the chromosomally stable tumors did not differ from chromosomally unstable tumors with respect to mean age at diagnosis, fulfillment of Amsterdam criteria or pathological characteristics. Segregation analysis did not reveal any family with microsatellite and chromosomally stable colorectal cancer in 2 relatives. The prevalence of microsatellite and chromosomally stable colorectal cancer was not significantly different for the early and late onset group (28 and 21%, respectively). We find no evidence that early-onset microsatellite and chromosomally stable colorectal cancer is a hallmark of a hereditary colorectal cancer syndrome. (c) 2007 Wiley-Liss, Inc.

Evidence for an agitated-aggressive syndrome in early-onset psychosis correlated with antisocial personality disorder, forensic history, and substance use disorder.

PubMed

Huber, Christian G; Hochstrasser, Lisa; Meister, Klara; Schimmelmann, Benno G; Lambert, Martin

2016-08-01

Agitation, aggression, and violence are increased in psychotic disorders. Additionally, an earlier age at onset may be associated with aggressive behavior. However, the relationship of age at onset, an agitated-aggressive syndrome as measured with the Positive And Negative Syndrome Scale for Schizophrenia - Excited Component (PANSS-EC), and its potential correlates in first-episode psychosis (FEP) has not been studied. This study assessed the association between age at onset, an agitated-aggressive syndrome, and its potential correlates in a prospective sample of 52 FEP patients with early-onset and adult-onset followed up for 12months. Twenty-six patients conformed to the criteria of early-onset psychosis. Early age at onset was associated with antisocial personality disorder (p=0.004; φc=0.39), a history of legal involvement (p=0.005; φc=0.39), and higher rates of lifetime substance use disorder (SUD; p=0.002; φc=0.42). Early-onset patients had significantly higher PANSS-EC scores over the course of observation (F(1,44.4)=5.39; p=0.025; d=0.656), but no significant group differences emerged for the remaining PANSS subscores. PANSS-EC scores were correlated positively with antisocial personality disorder and forensic history at 6weeks, 3months, 6months, and 12months, and with lifetime substance use disorder at 3months and 6months. Patients with early onset psychosis may have increased levels of agitation/aggressiveness, and, more likely, antisocial personality disorder, forensic history, and lifetime substance use disorder. These variables were linked to suicidality, aggressiveness, and involuntary treatment. Copyright © 2016 Elsevier B.V. All rights reserved.

Football and dementia: A qualitative investigation of a community based sports group for men with early onset dementia.

PubMed

Carone, Laura; Tischler, Victoria; Dening, Tom

2016-11-01

This study investigates the impact of a weekly group providing sport and physical activities for men with early onset dementia established by Notts County Football in the Community (NCFC). There were three aims: to investigate the effect of early onset dementia on individuals with the condition and their carers; to examine the perceptions of current levels of service provision for people with early onset dementia; and to analyse the impact of the group. Men with dementia (n = 5) attending the sessions, their carers (n = 5), NCFC coaching staff (n = 5) and people organizing/facilitating the sessions (n = 5) were interviewed. Semi-structured interviews explored the participants' experiences of dementia, their opinions on current service provisions and on the sessions. Data were analysed using thematic analysis. Four main themes were found: loss related to the condition of dementia and its impact on relationships ('Loss'); lack of age-appropriate services for people with early onset dementia ('Lack of Resources'); enjoyment and positive anticipation related to the group for all involved ('Enjoyment and Anticipation'); and 'the Notts County Effect' which attributed the success of the sessions to the strong brand of the football club, and to personalized service in a "dementia-free" environment. The NCFC sessions provided a safe low-cost intervention with positive effects upon quality of life for both people with early onset dementia, their carers and the staff involved. This suggests that the service may be valuable to a wider range of people living in different areas. © The Author(s) 2014.

Early-Onset Vemurafenib-Induced DRESS Syndrome.

PubMed

Munch, Marion; Peuvrel, Lucie; Brocard, Anabelle; Saint Jean, Mélanie; Khammari, Amir; Dreno, Brigitte; Quereux, Gaelle

2016-01-01

Vemurafenib is a BRAF inhibitor indicated in metastatic or unresectable melanoma in patients with BRAF mutations. Vemurafenib is frequently toxic, but the toxicity is often not serious. The third case of vemurafenib-induced drug rash with eosinophilia and systemic symptoms (DRESS) syndrome is reported herein. The case is unusual in that the onset was early, with symptoms emerging as of day 8 of treatment. Treatment of DRESS syndrome is not currently based on precise recommendations, but systemic corticosteroid therapy is effective in serious cases. Severe toxidermias under vemurafenib are exceptional; immediate discontinuation of treatment upon diagnosis is imperative. Switching from vemurafenib to dabrafenib then seems to constitute an interesting therapeutic alternative, since its efficacy is the same but with fewer cutaneous adverse reactions. This case highlights the importance of awareness of the risk of DRESS syndrome associated with vemurafenib and monitoring for warning signs from treatment initiation. © 2015 S. Karger AG, Basel.

Treatment of Early-Onset Schizophrenia Spectrum Disorders (TEOSS): Demographic and Clinical Characteristics

ERIC Educational Resources Information Center

Frazier, Jean A.; McClellan, Jon; Findling, Robert L.; Vitiello, Benedetto; Anderson, Robert; Zablotsky, Benjamin; Williams, Emily; McNamara, Nora K.; Jackson, Joseph A.; Ritz, Louise; Hlastala, Stefanie A.; Pierson, Leslie; Varley, Jennifer A.; Puglia, Madeline; Maloney, Ann E.; Ambler, Denisse; Hunt-Harrison, Tyehimba; Hamer, Robert M.; Noyes, Nancy; Lieberman, Jeffrey A.; Sikich, Linmarie

2007-01-01

Objective: We examined baseline demographic and clinical profiles of youths enrolled from 2001 to 2006 in the publicly funded multicenter, randomized controlled trial Treatment of Early-Onset Schizophrenia Spectrum Disorders. Method: Youths (8-19 years) with schizophrenia (SZ) and schizoaffective disorder were recruited at four academic sites.…

Neurological soft signs in juvenile patients with Asperger syndrome, early-onset psychosis, and healthy controls.

PubMed

Mayoral, María; Merchán-Naranjo, Jessica; Rapado, Marta; Leiva, Marta; Moreno, Carmen; Giráldez, Marisa; Arango, Celso; Parellada, Mara

2010-11-01

The study of neurological soft signs (NSS) in patients with Asperger syndrome may help us to elucidate the neurological basis of this disorder and to clarify its relationship with other neurodevelopmental disorders. The goal of this study was to compare the prevalence of NSS in a sample of patients with Asperger syndrome, early-onset psychosis and healthy controls. NSS were assessed by means of the Neurological Evaluation Scale in a sample of 29 patients with Asperger syndrome (mean age = 12.86 ± 2.58 years), 30 patients with first-episode early-onset psychoses (mean age 14.17 ± 1.02 years) and 30 healthy controls (mean age 12.33 ± 2.69 years). Significant group differences were found between Asperger syndrome patients and healthy controls both in all the Neurological Evaluation Scale subscales and in the Neurological Evaluation Scale total score. There were no significant differences between both groups of patients in any of the Neurological Evaluation Scale scores. NSS are more prevalent in Asperger syndrome than in healthy controls. The NSS profile was not disorder-specific in our samples of patients with Asperger syndrome and early-onset psychoses. © 2010 Blackwell Publishing Asia Pty Ltd.

Does Diagnostic Classification of Early-Onset Psychosis Change over Follow-Up?

ERIC Educational Resources Information Center

Fraguas, David; de Castro, Maria J.; Medina, Oscar; Parellada, Mara; Moreno, Dolores; Graell, Montserrat; Merchan-Naranjo, Jessica; Arango, Celso

2008-01-01

Objective: To examine the diagnostic stability and the functional outcome of patients with early-onset psychosis (EOP) over a 2-year follow-up period. Methods: A total of 24 patients (18 males (75%) and 6 females (25%), mean age [plus or minus] SD: 15.7 [plus or minus] 1.6 years) with a first episode of EOP formed the sample. Psychotic symptoms…

Pluripotent cell models of fanconi anemia identify the early pathological defect in human hemoangiogenic progenitors.

PubMed

Suzuki, Naoya M; Niwa, Akira; Yabe, Miharu; Hira, Asuka; Okada, Chihiro; Amano, Naoki; Watanabe, Akira; Watanabe, Ken-Ichiro; Heike, Toshio; Takata, Minoru; Nakahata, Tatsutoshi; Saito, Megumu K

2015-04-01

Fanconi anemia (FA) is a disorder of genomic instability characterized by progressive bone marrow failure (BMF), developmental abnormalities, and an increased susceptibility to cancer. Although various consequences in hematopoietic stem/progenitor cells have been attributed to FA-BMF, the quest to identify the initial pathological event is still ongoing. To address this issue, we established induced pluripotent stem cells (iPSCs) from fibroblasts of six patients with FA and FANCA mutations. An improved reprogramming method yielded iPSC-like colonies from all patients, and iPSC clones were propagated from two patients. Quantitative evaluation of the differentiation ability demonstrated that the differentiation propensity toward the hematopoietic and endothelial lineages is already defective in early hemoangiogenic progenitors. The expression levels of critical transcription factors were significantly downregulated in these progenitors. These data indicate that the hematopoietic consequences in FA patients originate from the early hematopoietic stage and highlight the potential usefulness of iPSC technology for elucidating the pathogenesis of FA-BMF. ©AlphaMed Press.

Long-term neurological outcome in children with early-onset epilepsy associated with tuberous sclerosis.

PubMed

Cusmai, Raffaella; Moavero, Romina; Bombardieri, Roberta; Vigevano, Federico; Curatolo, Paolo

2011-12-01

In tuberous sclerosis complex, early seizure onset is associated with high risk of intractable epilepsy and cognitive/behavioral impairment. We retrospectively evaluated the long-term outcome of 44 infants presenting with seizures in the first 12 months who received vigabatrin, and were followed up for at least 3.5 years. At the final evaluation 55% of patients were still having seizures, 80% had intellectual disability, and 30% had autism. Sixty-five percent of children who had been treated earlier with vigabatrin after seizure onset achieved seizure freedom, compared with 24% of subjects who received vigabatrin treatment later (P<0.01). Intellectual disability was present in 61% of the children treated early (group A) and in 100% of the children treated later (group B). Nine percent of group A and 52% of group B had autism (P≈0.001). A shorter gap between seizure onset and start of treatment could reduce the risk of epileptic encephalopathy, minimizing the deleterious effect of seizures, but is not able to completely reverse the tuberous sclerosis complex-associated cognitive impairment. Copyright © 2011 Elsevier Inc. All rights reserved.

Two Novel Mutations in the GDAP1 and PRX Genes in Early Onset Charcot-Marie-Tooth Syndrome

PubMed Central

Auer-Grumbach, M.; Fischer, C.; Papić, L.; John, E.; Plecko, B.; Bittner, R. E.; Bernert, G.; Pieber, T. R.; Miltenberger, G.; Schwarz, R.; Windpassinger, C.; Grill, F.; Timmerman, V.; Speicher, M. R.; Janecke, A. R.

2011-01-01

Autosomal recessive Charcot-Marie-Tooth syndrome (AR-CMT) is often characterised by an infantile disease onset and a severe phenotype. Mutations in the ganglioside-induced differentiation-associated protein 1 (GDAP1) gene are thought to be a common cause of AR-CMT. Mutations in the periaxin (PRX) gene are rare. They are associated with severe demyelination of the peripheral nerves and sometimes lead to prominent sensory disturbances. To evaluate the frequency of GDAP1 and PRX mutations in early onset CMT, we examined seven AR-CMT families and 12 sporadic CMT patients, all presenting with progressive distal muscle weakness and wasting. In one family also prominent sensory abnormalities and sensory ataxia were apparent from early childhood. In three families we detected four GDAP1 mutations (L58LfsX4, R191X, L239F and P153L), one of which is novel and is predicted to cause a loss of protein function. In one additional family with prominent sensory abnormalities a novel homozygous PRX mutation was found (A700PfsX17). No mutations were identified in 12 sporadic cases. This study suggests that mutations in the GDAP1 gene are a common cause of early-onset AR-CMT. In patients with early-onset demyelinating AR-CMT and severe sensory loss PRX is one of the genes to be tested. PMID:18504680

[Floppy baby with macrocytic anemia and vegan mother].

PubMed

Schlapbach, L J; Schütz, B; Nuoffer, J M; Brekenfeld, C; Müller, G; Fluri, S

2007-08-29

We report the case of a 7 month-old girl that presented with acute anemia, generalized muscular hypotonia and failure to thrive. Laboratory evaluation revealed cobalamin deficiency, due to a vegan diet of the mother. The clinical triad of an acquired floppy baby syndrome with megaloblastic anemia and failure to thrive is pathognomic for infantile cobalamin deficiency. Neurological abnormalities are often irreversible and may be associated with delayed myelinization in the MRI. A normal cobalamin level in maternal serum and absence of anemia do not exclude subclinical deficiency. If cobalamin deficiency is suspected, e.g. in pregnant women on vegan diet, urinary methylmalonic acid excretion and plasma homocysteine levels should be determined and cobalamin substitution should be started at an early stage to avoid potentially irreversible damage of the fetus.

Difference in the action mechanism of radon inhalation and radon hot spring water drinking in suppression of hyperuricemia in mice.

PubMed

Etani, Reo; Kataoka, Takahiro; Kanzaki, Norie; Sakoda, Akihiro; Tanaka, Hiroshi; Ishimori, Yuu; Mitsunobu, Fumihiro; Yamaoka, Kiyonori

2016-06-01

Although radon therapy is indicated for hyperuricemia, the underlying mechanisms of action have not yet been elucidated in detail. Therefore, we herein examined the inhibitory effects of radon inhalation and hot spring water drinking on potassium oxonate (PO)-induced hyperuricemia in mice. Mice inhaled radon at a concentration of 2000 Bq/m(3) for 24 h or were given hot spring water for 2 weeks. Mice were then administrated PO at a dose of 500 mg/kg. The results obtained showed that serum uric acid levels were significantly increased by the administration of PO. Radon inhalation or hot spring water drinking significantly inhibited elevations in serum uric acid levels through the suppression of xanthine oxidase activity in the liver. Radon inhalation activated anti-oxidative functions in the liver and kidney. These results suggest that radon inhalation inhibits PO-induced hyperuricemia by activating anti-oxidative functions, while hot spring water drinking may suppress PO-induced elevations in serum uric acid levels through the pharmacological effects of the chemical compositions dissolved in it. © The Author 2016. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

The CDKL5 disorder is an independent clinical entity associated with early-onset encephalopathy

PubMed Central

Fehr, Stephanie; Wilson, Meredith; Downs, Jenny; Williams, Simon; Murgia, Alessandra; Sartori, Stefano; Vecchi, Marilena; Ho, Gladys; Polli, Roberta; Psoni, Stavroula; Bao, Xinhua; de Klerk, Nick; Leonard, Helen; Christodoulou, John

2013-01-01

The clinical understanding of the CDKL5 disorder remains limited, with most information being derived from small patient groups seen at individual centres. This study uses a large international data collection to describe the clinical profile of the CDKL5 disorder and compare with Rett syndrome (RTT). Information on individuals with cyclin-dependent kinase-like 5 (CDKL5) mutations (n=86) and females with MECP2 mutations (n=920) was sourced from the InterRett database. Available photographs of CDKL5 patients were examined for dysmorphic features. The proportion of CDKL5 patients meeting the recent Neul criteria for atypical RTT was determined. Logistic regression and time-to-event analyses were used to compare the occurrence of Rett-like features in those with MECP2 and CDKL5 mutations. Most individuals with CDKL5 mutations had severe developmental delay from birth, seizure onset before the age of 3 months and similar non-dysmorphic features. Less than one-quarter met the criteria for early-onset seizure variant RTT. Seizures and sleep disturbances were more common than in those with MECP2 mutations whereas features of regression and spinal curvature were less common. The CDKL5 disorder presents with a distinct clinical profile and a subtle facial, limb and hand phenotype that may assist in differentiation from other early-onset encephalopathies. Although mutations in the CDKL5 gene have been described in association with the early-onset variant of RTT, in our study the majority did not meet these criteria. Therefore, the CDKL5 disorder should be considered separate to RTT, rather than another variant. PMID:22872100

Anemia and mortality in older persons: does the type of anemia affect survival?

PubMed

Shavelle, Robert M; MacKenzie, Ross; Paculdo, David R

2012-03-01

Anemia is a common condition among community-dwelling older adults. The present study investigates the effect of type of anemia on subsequent mortality. We analyzed data from participants of the Third National Health and Nutrition Survey who were aged ≥50 and had valid hemoglobin levels determined by laboratory measurement. Anemia was defined by World Health Organization criteria. 7,171 subjects met our inclusion criterion. Of those with anemia (n = 862, deaths = 491), 24% had nutritional anemia, 11% had anemia of chronic renal disease, 26% had anemia of chronic inflammation, and 39% had unexplained anemia. We found an overall relative risk (RR) for mortality of 1.8 (p < 0.001) comparing those with anemia to those without, after adjusting for age, sex, and race. After we controlled for a number of chronic medical conditions, the overall RR was 1.6. Compared to persons without anemia, we found the following RRs for the type of anemia: nutritional (2.34, p < 0.0001), chronic renal disease (1.70, p < 0.0001), chronic inflammation (1.48, p < 0.0001), and unexplained (1.26, p < 0.01). Anemia is common although not severe in older non-institutionalized adults. When compared with non-anemic older adults, those with nutritional anemia or anemia due to chronic renal disease have the highest mortality risk.

Malaria-Related Anemia in Patients from Unstable Transmission Areas in Colombia

PubMed Central

Lopez-Perez, Mary; Álvarez, Álvaro; Gutierrez, Juan B.; Moreno, Alberto; Herrera, Sócrates; Arévalo-Herrera, Myriam

2015-01-01

Information about the prevalence of malarial anemia in areas of low-malaria transmission intensity, like Latin America, is scarce. To characterize the malaria-related anemia, we evaluated 929 malaria patients from three sites in Colombia during 2011–2013. Plasmodium vivax was found to be the most prevalent species in Tierralta (92%), whereas P. falciparum was predominant in Tumaco (84%) and Quibdó (70%). Although severe anemia (hemoglobin < 7 g/dL) was almost absent (0.3%), variable degrees of non-severe anemia were observed in 36.9% of patients. In Tierralta, hemoglobin levels were negatively associated with days of illness. Moreover, in Tierralta and Quibdó, the number of previous malaria episodes and hemoglobin levels were positively associated. Both Plasmodium species seem to have similar potential to induce malarial anemia with distinct cofactors at each endemic setting. The target age in these low-transmission settings seems shifting toward adolescents and young adults. In addition, previous malaria experience seems to induce protection against anemia development. Altogether, these data suggest that early diagnosis and prompt treatment are likely preventing more frequent and serious malaria-related anemia in Colombia. PMID:25510719

Allelic association at the D14S43 locus in early onset Alzheimer`s disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brice, A.; Tardieu, S.; Campion, D.

1995-04-24

The D14S43 marker is closely linked to the major gene for early onset autosomal dominant Alzheimer`s disease on chromosome 14. Allelic frequencies at the D14S43 locus were compared in 113 familial and isolated cases of early onset Alzheimer`s disease (<60 years of age at onset) (EOAD) and 109 unaffected individuals of the same geographic origin. Allele 7 was significantly (P = 0.033) more frequent in type 1 EOAD patients (13.2%), defined by the presence of at least another first degree relative with EOAD, than in controls (4.1%). Since an autosomal dominant gene is probably responsible for type 1 patients, allelicmore » association may reflect linkage disequilibrium at the D14S43 locus. This would mean that some patients share a common ancestral mutation. However, since multiple tests were carried out, this result must be interpreted with caution, and needs confirmation in an independent sample. 16 refs., 2 tabs.« less

Bone marrow features in Pearson syndrome with neonatal onset: A case report and review of the literature.

PubMed

Tadiotto, Elisa; Maines, Evelina; Degani, Daniela; Balter, Rita; Bordugo, Andrea; Cesaro, Simone

2018-04-01

Pearson syndrome (PS) is a rare mitochondrial disorder that usually presents with transfusion-dependent macrocytic anemia, exocrine pancreatic dysfunction, and lactic acidosis. Typical bone marrow (BM) features are vacuolization in hematopoietic progenitors, hypocellularity, and ringed sideroblasts. At the neonatal age, PS may have a variable clinical onset. Moreover, there is little information about BM features at this age and the timing of their presentation. We report a neonatal case of PS that presented with refractory anemia and atypical BM features. We reviewed the BM findings in neonatal-onset PS cases to stress the importance and limitations of BM evaluation at this age. © 2017 Wiley Periodicals, Inc.

Problem drinking among Flemish students: beverage type, early drinking onset and negative personal & social consequences.

PubMed

De Bruyn, Sara; Wouters, Edwin; Ponnet, Koen; Van Damme, Joris; Maes, Lea; Van Hal, Guido

2018-02-12

Although alcohol is socially accepted in most Western societies, studies are clear about its associated negative consequences, especially among university and college students. Studies on the relationship between alcohol-related consequences and both beverage type and drinking onset, however, are scarce, especially in a European context. The aim of this research was, therefore, twofold: (1) What is the relationship between beverage type and the negative consequences experienced by students? and (2) Are these consequences determined by early drinking onset? We will examine these questions within the context of a wide range of alcohol-related consequences. The analyses are based on data collected by the inter-university project 'Head in the clouds?', measuring alcohol use among students in Flanders (Belgium). In total, a large dataset consisting of information from 19,253 anonymously participating students was available. Negative consequences were measured using a shortened version of the Core Alcohol and Drug Survey (CADS_D). Data were analysed using negative binomial regression. Results vary depending on the type of alcohol-related consequences: Personal negative consequences occur frequently among daily beer drinkers. However, a high rate of social negative consequences was recorded for both daily beer drinkers and daily spirits drinkers. Finally, early drinking onset was significantly associated with both personal and social negative consequences, and this association was especially strong between beer and spirits drinking onset and social negative consequences. Numerous negative consequences, both personal and social, are related to frequent beer and spirits drinking. Our findings indicate a close association between drinking beer and personal negative consequences as well as between drinking beer and/or spirits and social negative consequences. Similarly, early drinking onset has a major influence on the rates of both personal and social negative consequences

Early and Real-Time Detection of Seasonal Influenza Onset

PubMed Central

Marques-Pita, Manuel

2017-01-01

Every year, influenza epidemics affect millions of people and place a strong burden on health care services. A timely knowledge of the onset of the epidemic could allow these services to prepare for the peak. We present a method that can reliably identify and signal the influenza outbreak. By combining official Influenza-Like Illness (ILI) incidence rates, searches for ILI-related terms on Google, and an on-call triage phone service, Saúde 24, we were able to identify the beginning of the flu season in 8 European countries, anticipating current official alerts by several weeks. This work shows that it is possible to detect and consistently anticipate the onset of the flu season, in real-time, regardless of the amplitude of the epidemic, with obvious advantages for health care authorities. We also show that the method is not limited to one country, specific region or language, and that it provides a simple and reliable signal that can be used in early detection of other seasonal diseases. PMID:28158192

Early-onset schizophrenia: Symptoms and social class of origin.

PubMed

Gallagher, Bernard J; Jones, Brian J

2017-09-01

The genesis of schizophrenia is multifactorial, including biological and environmental risk factors. We tested for an interactive effect between early-onset schizophrenia (EOS) and social class of origins (socioeconomic status (SES)). Data were further analyzed for a possible connection to type of schizophrenic symptoms. Sampling/Methods: Data for the study are taken from the medical records of 642 patients from a large state hospital in the northeastern United States. Clinical assessments were divided into positive and negative symptomatology through application of the Scale for the Assessment of Negative Symptoms (SANS), the Scale for the Assessment of Positive Symptoms (SAPS) and the Positive and Negative Syndrome Scale (PANSS). Detailed information about age of onset and SES of origin was obtained through Social Service Assessment interviews. We uncovered a significant impact of EOS among the poor that elevates risk for negative symptomatology. Poor SES alone does not increase the likelihood of EOS, but it magnifies the deleterious effect of EOS on negative symptoms. Future research on these variables may inform the relative contribution of each.

[Iron deficiency anemia and pregnancy. Prevention and treatment].

PubMed

Beucher, G; Grossetti, E; Simonet, T; Leporrier, M; Dreyfus, M

2011-05-01

To assess the effectiveness and the safety of prevention and treatment of iron deficiency anemia during pregnancy. French and English publications were searched using PubMed and Cochrane library. Early screening of iron deficiency by systematic examination and blood analysis seemed essential. Maternal and perinatal complications were correlated to the severity and to the mode of appearance of anemia. Systematic intakes of iron supplements seemed not to be recommended. In case of anemia during pregnancy, iron supplementation was not associated with a significant reduction in substantive maternal and neonatal outcomes. Oral iron supplementation increased blood parameters but exposed to digestive side effects. Women who received parenteral supplementation were more likely to have better hematological response but also severe potential side effects during pregnancy and in post-partum. The maternal tolerance of anemia motivated the choice between parenteral supplementation and blood transfusion. Large and methodologically strong trials are necessary to evaluate the effects of iron supplementation on maternal health and pregnancy outcomes. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

Mangiferin alleviates hypertension induced by hyperuricemia via increasing nitric oxide releases.

PubMed

Yang, Hua; Bai, Wenwei; Gao, Lihui; Jiang, Jun; Tang, Yingxi; Niu, Yanfen; Lin, Hua; Li, Ling

2018-06-06

Mangiferin, a natural glucosyl xanthone, was confirmed to be an effective uric acid (UA)- lowering agent with dual action of inhibiting production and promoting excretion of UA. In this study, we aimed to evaluate the effect of mangiferin on alleviating hypertension induced by hyperuricemia. Mangiferin (30, 60, 120 mg/kg) was administered intragastrically to hyperuricemic rats induced by gavage with potassium oxonate (750 mg/kg). Systolic blood pressure (SBP), serum levels of UA, nitric oxide (NO), C-reactionprotein (CRP) and ONOO - were measured. The mRNA and protein levels of endothelial nitric oxide synthase (eNOS), intercellular adhesion molecule-1 (ICAM-1), CRP were also analyzed. Human umbilical vein endothelial cells (HUVECs) were used in vitro studies. Administration of mangiferin significantly decreased the serum urate level and SBP at 8 weeks and last to 12 weeks. Further more, mangiferin could increase the release of NO and decrease the level of CRP in blood. In addition, mangiferin reversed the protein expression of eNOS, CRP, ICAM-1 and ONOO - in aortic segments in hyperuricemic rats. The results in vitro were consistent with the observed results in vivo. Taken together, these data suggested that mangiferin has played an important part in alleviating hypertension induced by hyperuricemia via increasing NO secretion and improving endothelial function. Copyright © 2018 The Authors. Production and hosting by Elsevier B.V. All rights reserved.

[Sickle cell anemia: experience in a center].

PubMed

Gómez-Chiari, M; Tusell Puigbert, J; Ortega Aramburu, J

2003-02-01

Sickle cell anemia is a structural hemoglobinopathy in which morphological and physical changes in erythrocytes cause vaso-occlusive episodes in various organs and tissues. The disease is common among blacks and the African population. As a result of the growing migratory flow, this is an emerging disease in Spain. To present the casuistics of a pediatric hospital: clinical onset, the most frequent features and complications, and treatment. We performed a retrospective study of 22 patients aged less than 18 years old diagnosed with sickle cell anemia between January 1985 and December 2001. Epidemiologic data, symptoms, complications, blood test results, treatment, and response were recorded. The mean age of the patients was 39 months. In 54 %, diagnosis was established before the age of 2 years. No differences were found in sex. The countries of origin were Gambia in 32 %, Morocco in 23 %, and Senegal in 18 % as well as other African and Central America countries; 53 % of the children were born in Spain. The most common complaint was vaso-occlusive pain localized in the abdomen (45 %). The most frequent complications were infections and 13.7 % suffered stroke. Twenty-eight percent of the patients diagnosed before the age of 2 years presented complications. Eleven patients received hydroxyurea for recurrent vaso-occlusive crises with favorable results; one patient underwent splenectomy and another received an allogenic bone marrow transplant from an HLA-identical brother with excellent results. This study reproduces the data described in the literature from countries with a high prevalence of the disease. Morbidity could be minimized by early diagnosis and preventive treatment and good healthcare. Given the increasing incidence of the disease, screening of black and African neonates and genetic counseling are recommended together with guidelines for prompt and appropriate treatment in primary health centers and emergency departments.

Facial emotion identification in early-onset and first-episode psychosis: a systematic review with meta-analysis.

PubMed

Barkl, Sophie J; Lah, Suncica; Harris, Anthony W F; Williams, Leanne M

2014-10-01

Patients with chronic schizophrenia are characterized by deficits in identifying facial expressions of emotion, and these deficits relate to impaired social and occupational function. It is not yet known if these deficits are trait-like and present at the onset of psychosis, preceding a subsequent diagnosis of schizophrenia. Our objective was to systematically review and analyze the extant literature to assess if there is a consistent profile of emotion identification problems in early-onset and first-episode psychosis. We conducted a systematic review and meta-analysis of 12 peer-reviewed studies of facial emotion identification in early-onset and first-episode psychosis, published between 1980 and March 2013. We examined the average mean difference between patients and controls on measures of facial emotion identification. Findings suggest that patients with early-onset and first-episode psychosis have impairment in identifying facial expressions of biologically salient emotion. Across the 12 studies, the onset of psychosis was distinguished by a generalized effect of significantly poorer accuracy for identifying facial expressions of emotion than healthy controls, and this difference had a substantial effect size (d=-0.88, N=378, 95% CI=-1.42 to -0.32). Within this general effect some emotions were also harder for patients to identify than others, with the magnitude of impairment found to be (i) large for disgust, fear and surprise, and (ii) medium for sadness, and happiness. No between groups mean differences were found for anger or neutral facial expressions. Deficits in facial emotion identification are evident at first onset of a psychotic episode. The findings suggest that, over and above a generalized deficit in identifying facial emotion, patients may find some emotions harder to identifying than others. This reflects findings with chronic schizophrenia populations and suggests that emotion identification impairment represents a trait susceptibility

Sensorineural hearing loss--a common finding in early-onset type 2 diabetes mellitus.

PubMed

Lerman-Garber, Israel; Cuevas-Ramos, Daniel; Valdés, Samantha; Enríquez, Lorena; Lobato, Marlette; Osornio, Melannie; Escobedo, Ana Rosa; Pascual-Ramos, Virginia; Mehta, Roopa; Ramírez-Anguiano, Jacqueline; Gómez-Pérez, Francisco J

2012-01-01

To evaluate the prevalence and potential associations of hearing impairment in patients 30 to 50 years old with diabetes diagnosed before age 40 years-early-onset type 2 diabetes mellitus (T2DM). The study cohorts consisted of 46 consecutive patients with early-onset T2DM and 47 age-matched control subjects with rheumatoid arthritis. All study subjects completed clinical, serologic, and auditory assessments. The patients with T2DM had a mean age of 42 ± 6 years and a mean disease duration of 11 ± 6 years. Microalbuminuria was present in 26.1%, proliferative retinopathy in 26.1%, and symptomatic peripheral neuropathy in 23.9%. The prevalence of unilateral or bilateral hearing loss was significantly higher in the patients with T2DM than in the patients with rheumatoid arthritis (21.7% versus 6.4%, respectively; P = .01). Most cases of hearing loss were mild and involved high or acute tones. After multivariate analysis with adjustment for age, there was a significant association between hearing loss and hemoglobin A1c (odds ratio, 1.3; 95% confidence interval, 1.02 to 1.81; P = .035). In the patients with T2DM, the lengthening of the brainstem response was not significantly increased; however, the wave morphologic features were abnormal and the reproducibility was poor in both ears in 11 patients (24%). Patients with early-onset T2DM and poor glycemic control have an increased prevalence of subclinical hearing loss and impaired auditory brainstem responses. Hearing impairment may be an underrecognized complication of diabetes.

Internet-Delivered, Family-Based Treatment for Early-Onset OCD: A Preliminary Case Series

PubMed Central

Comer, Jonathan S.; Furr, Jami M.; Cooper-Vince, Christine E.; Kerns, Caroline E.; Chan, Priscilla T.; Edson, Aubrey L.; Khanna, Muniya; Franklin, Martin E.; Garcia, Abbe M.; Freeman, Jennifer B.

2014-01-01

Given the burdens of early-onset obsessive-compulsive disorder (OCD), limitations in the broad availability and accessibility of evidence-based care for affected youth present serious public health concerns. The growing potential for technological innovations to transform care for the most traditionally remote and underserved families holds enormous promise. This article presents the rationale, key considerations, and a preliminary case series for a promising behavioral telehealth innovation in the evidence-based treatment of early-onset OCD. We developed an Internet-based format for the delivery of family-based treatment for early-onset OCD directly to families in their homes, regardless of their geographic proximity to a mental health facility. Videoteleconferencing (VTC) methods were used to deliver real-time cognitive-behavioral therapy centering on exposure and response prevention to affected families. Participants in the preliminary case series included 5 children between the ages of 4 and 8 (MAge = 6.5) who received the Internet-delivered treatment format. All youth completed a full treatment course, all showed OCD symptom improvements and global severity improvements from pre- to posttreatment, all showed at least partial diagnostic response, and 60% no longer met diagnostic criteria for OCD at posttreatment. No participants got worse, and all mothers characterized the quality of services received as “excellent.” The present work adds to a growing literature supporting the potential of VTC and related computer technology for meaningfully expanding the reach of supported treatments for OCD and lays the foundation for subsequent controlled evaluations to evaluate matters of efficacy and engagement relative to standard in-office evidence-based care. PMID:24295036

Serum Uric Acid, Hyperuricemia and Body Mass Index in Children and Adolescents with Intellectual Disabilities

ERIC Educational Resources Information Center

Lin, Jin-Ding; Lin, Pei-Ying; Lin, Lan-Ping; Hsu, Shang-Wei; Yen, Chia-Feng; Fang, Wen-Hui; Wu, Sheng-Ru; Chien, Wu-Chien; Loh, Ching-Hui; Chu, Cordia M.

2009-01-01

The aims of the preset study were to describe the profile of serum uric acid, the prevalence of hyperuricemia and its risk factors among children and adolescents with intellectual disabilities. We conducted a cross-sectional study of 941 children and adolescents with intellectual disabilities (aged 4-18 years) who participated in annual health…

Neurocognitive outcomes in the Treatment of Early-Onset Schizophrenia Spectrum Disorders study.

PubMed

Frazier, Jean A; Giuliano, Anthony J; Johnson, Jacqueline L; Yakutis, Lauren; Youngstrom, Eric A; Breiger, David; Sikich, Linmarie; Findling, Robert L; McClellan, Jon; Hamer, Robert M; Vitiello, Benedetto; Lieberman, Jeffrey A; Hooper, Stephen R

2012-05-01

To assess neurocognitive outcomes following antipsychotic intervention in youth enrolled in the National Institute of Mental Health (NIMH)-funded Treatment of Early-Onset Schizophrenia Spectrum Disorders (TEOSS). Neurocognitive functioning of youth (ages 8 to 19 years) with schizophrenia or schizoaffective disorder was evaluated in a four-site, randomized, double-blind clinical trial comparing molindone, olanzapine, and risperidone. The primary outcomes were overall group change from baseline in neurocognitive composite and six domain scores after 8 weeks and continued treatment up to 52 weeks. Age and sex were included as covariates in all analyses. Of 116 TEOSS participants, 77 (66%) had post-baseline neurocognitive data. No significant differences emerged in the neurocognitive outcomes of the three medication groups. Therefore, the three treatment groups were combined into one group to assess overall neurocognitive outcomes. Significant modest improvements were observed in the composite score and in three of six domain scores in the acute phase, and in four of six domain scores in the combined acute and maintenance phases. Partial correlation analyses revealed very few relationships among Positive and Negative Syndrome Scale (PANSS) baseline or change scores and neurocognition change scores. Antipsychotic intervention in youth with early-onset schizophrenia spectrum disorders (EOSS) led to modest improvement in measures of neurocognitive function. The changes in cognition were largely unrelated to baseline symptoms or symptom change. Small treatment effect sizes, easily accounted for by practice effects, highlight the critical need for the development of more efficacious interventions for the enduring neurocognitive deficits seen in EOSS. Clinical trial registry information-Treatment of Early-Onset Schizophrenia Spectrum Disorders (TEOSS); http://www.clinicaltrials.gov; NCT00053703. Copyright © 2012 American Academy of Child and Adolescent Psychiatry. Published

Anemia

MedlinePlus

If you have anemia, your blood does not carry enough oxygen to the rest of your body. The most common cause of anemia is not having enough ... rich protein that gives the red color to blood. It carries oxygen from the lungs to the ...

Premorbid Risk Factors for Major Depressive Disorder: Are They Associated With Early Onset and Recurrent Course?

PubMed Central

Wilson, Sylia; Vaidyanathan, Uma; Miller, Michael B.; McGue, Matt; Iacono, William G.

2014-01-01

Premorbid risk for major depressive disorder (MDD) and predictors of an earlier onset and recurrent course were examined in two studies in a large, community-based sample of parents and offspring, prospectively assessed from late childhood into adulthood. In Study 1 (N = 2,764 offspring and their parents), parental psychiatric status, offspring personality at age 11, and age-11 offspring internalizing and externalizing symptoms predicted the subsequent development of MDD, as did poor quality parent-child relationships, poor academic functioning, early pubertal development, and childhood maltreatment by age 11. Parental MDD and adult antisocial behavior, offspring negative emotionality and disconstraint, externalizing symptoms, and childhood maltreatment predicted an earlier onset of MDD, after accounting for course; lower positive emotionality, trait anxiety, and childhood maltreatment predicted recurrent MDD, after accounting for age of onset. In Study 2 (N = 7,146), we examined molecular genetic risk for MDD by extending recent reports of associations with glutamatergic system genes. We failed to confirm associations with MDD using either individual SNP-based tests or gene-based analyses. Overall, results speak to the pervasiveness of risk for MDD, as well as specific risk for early-onset MDD; risk for recurrent MDD appears to be largely a function of its often earlier onset. PMID:25422974

Pernicious Anemia with Autoimmune Hemolytic Anemia: A Case Report and Literature Review

PubMed Central

Manchandani, Raj Pal; Oneal, Patricia

2016-01-01

Pernicious anemia is a common cause of vitamin B12 deficiency. Here, we discuss a case of a young woman who presented with severe anemia along with a history of iron deficiency anemia. After a review of her clinical presentation and laboratory data, we identified an autoimmune hemolytic anemia and a concomitant pernicious anemia. The concurrence of both these hematological diagnoses in a patient is rare. PMID:27559485

Xp22.3 genomic deletions involving the CDKL5 gene in girls with early onset epileptic encephalopathy.

PubMed

Mei, Davide; Marini, Carla; Novara, Francesca; Bernardina, Bernardo D; Granata, Tiziana; Fontana, Elena; Parrini, Elena; Ferrari, Anna R; Murgia, Alessandra; Zuffardi, Orsetta; Guerrini, Renzo

2010-04-01

Mutations of the X-linked gene cyclin-dependent kinase-like 5 (CDKL5) cause an X-linked encephalopathy with early onset intractable epilepsy, including infantile spasms and other seizure types, and a Rett syndrome (RTT)-like phenotype. Very limited information is available on the frequency and phenotypic spectrum associated with CDKL5 deletions/duplications. We investigated the role of CDKL5 deletions/duplications in causing early onset intractable epilepsy of unknown etiology in girls. We studied 49 girls with early onset intractable epilepsy, with or without infantile spasms, and developmental impairment, for whom no etiologic factors were obvious after clinical examination, brain magnetic resonance imaging (MRI) and expanded screening for inborn errors of metabolism. We performed CDKL5 gene mutation analysis in all and multiplex ligation dependent probe amplification assay (MLPA) in those who were mutation negative. Custom Array-comparative genomic hybridization (CGH), breakpoint polymerase chain reaction (PCR) analysis, and X-inactivation studies were performed in patients in whom MLPA uncovered a genomic alteration. We found CDKL5 mutations in 8.2% (4 of 49) of patients and genomic deletions in 8.2% (4 of 49). Overall, abnormalities of the CDKL5 gene accounted for 16.3% (8 of 49) of patients. CDKL5 gene deletions are an under-ascertained cause of early onset intractable epilepsy in girls. Genetic testing of CDKL5, including both mutation and deletion/duplication analysis, should be considered in this clinical subgroup.

Genetics Home Reference: Fanconi anemia

MedlinePlus

... D1 Genetic Testing Registry: Fanconi anemia, complementation group D2 Genetic Testing Registry: Fanconi anemia, complementation group E ... ANEMIA, COMPLEMENTATION GROUP D1 FANCONI ANEMIA, COMPLEMENTATION GROUP D2 FANCONI ANEMIA, COMPLEMENTATION GROUP E FANCONI ANEMIA, COMPLEMENTATION ...

The Role of the Multiple Hormonal Dysregulation in the Onset of "Anemia of Aging": Focus on Testosterone, IGF-1, and Thyroid Hormones.

PubMed

Maggio, Marcello; De Vita, Francesca; Fisichella, Alberto; Lauretani, Fulvio; Ticinesi, Andrea; Ceresini, Graziano; Cappola, Anne; Ferrucci, Luigi; Ceda, Gian Paolo

2015-01-01

Anemia is a multifactorial condition whose prevalence increases in both sexes after the fifth decade of life. It is a highly represented phenomenon in older adults and in one-third of cases is "unexplained." Ageing process is also characterized by a "multiple hormonal dysregulation" with disruption in gonadal, adrenal, and somatotropic axes. Experimental studies suggest that anabolic hormones such as testosterone, IGF-1, and thyroid hormones are able to increase erythroid mass, erythropoietin synthesis, and iron bioavailability, underlining a potential role of multiple hormonal changes in the anemia of aging. Epidemiological data more consistently support an association between lower testosterone and anemia in adult-older individuals. Low IGF-1 has been especially associated with anemia in the pediatric population and in a wide range of disorders. There is also evidence of an association between thyroid hormones and abnormalities in hematological parameters under overt thyroid and euthyroid conditions, with limited data on subclinical statuses. Although RCTs have shown beneficial effects, stronger for testosterone and the GH-IGF-1 axis and less evident for thyroid hormones, in improving different hematological parameters, there is no clear evidence for the usefulness of hormonal treatment in improving anemia in older subjects. Thus, more clinical and research efforts are needed to investigate the hormonal contribution to anemia in the older individuals.

Levels of cytokines and microRNAs in individuals with asymptomatic hyperuricemia and ultrasonographic findings of gout: a bench-to-bedside approach.

PubMed

Estevez-Garcia, Irving O; Gallegos-Nava, Selma; Vera-Pérez, Erika; Silveira, Luis H; Ventura-Ríos, Lucio; Vancini, Gonzalo; Hernández-Díaz, Cristina; Sánchez-Muñoz, Fausto; Ballinas-Verdugo, Martha A; Gutierrez, Marwin; Pineda, Carlos; Rodriguez-Henriquez, Pedro; Castillo-Martínez, Diana; Amezcua-Guerra, Luis M

2018-02-18

To assess potential associations among serum cytokines and microRNA (miR) levels with ultrasound (US) findings suggestive of urate deposits in chronic asymptomatic hyperuricemia and gout. All participants underwent musculoskeletal US and measurements of serum IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12, IL-13, IFN-γ, TNF, MCP-1, and ENA-78, as well as miR-146a, miR-155, and miR-223 levels. Thirty individuals with asymptomatic hyperuricemia, 31 normouricemic controls, and 30 gouty patients were included. The frequency of synovitis and double contour sign using US was similar between asymptomatic hyperuricemia (67% and 27%, respectively) and gouty participants (77% and 27%), and each had a higher frequency than controls (45% and 0%). Serum IL-6 and IL-8 levels were similar between patients with asymptomatic hyperuricemia (69.7±73.4 and 18.5±25.6 pg/ml, respectively) and gout (75.8±47.6 and 24.4±31.7 pg/ml), and higher than controls (28.2±17.6 and 7.4±6.0 pg/ml). A similar distribution was observed for miR-155 levels (0.22±0.18, 0.20±0.14, and 0.08±0.04, respectively). Associations between morphostructural abnormalities suggestive of urate deposits (regardless of clinical diagnosis) and serum markers were assessed. Subjects with urate deposits had higher IL-6 (257.2 versus 47.0 pg/mL; P=0.005), IL-8 (73.2 versus 12.0 pg/mL; P=0.026), and miR-155 (0.21 versus 0.16; P=0.015) levels than those without deposition findings. In asymptomatic individuals with chronic hyperuricemia, the presence of synovitis and double contour sign by US may represent a subclinical manifestation of monosodium urate crystals nucleation, capable of triggering inflammatory pathways (IL-6 and IL-8) and mechanisms of intercellular communication (miR-155) similar to what is observed in gout. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

[Acute encephalopathy due to late-onset maple syrup urine disease in a school boy].

PubMed

Qu, Su-Qing; Yang, Li-Cai; Luan, Zuo; Du, Kan; Yang, Hui

2012-03-01

Maple syrup urine disease is a common amino acids metabolic disease. In most patients, onset occurs in the neonatal period and infancy. In this study, the case of a school boy with acute encephalopathy due to late-onset maple syrup urine disease is summarized. The boy (8.5 years) was admitted because of acute encephalopathy after suffering from infection for two days at the age of eight and a half years. Metabolic acidosis, hyperuricemia and decreased protein level in cerebrospinal fluid were found by general laboratory tests. Magnetic resonance imaging of the brain revealed signal intensity abnormalities in the bilateral cerebellum dentate nucleus, brainstem, thalamus, putamen, caudate nucleus and cortex of the cerebral hemispheres. On T1WI and T2WI scanning, hyperintensive signal was found. Blood leucine and valine were significantly elevated. Urinary 2-hydroxy isovaleric acid, 3-hydroxybutyric acid, 2-keto isovaleric acid, and 2-keto acid also increased. Both the blood amino acid and urine organic acid profiles led to the diagnosis of maple syrup urine disease. In the acute period, the patient was treated with a large dose of vitamin B1, glucose, L-carnitine and a protein-restrict diet. The patient's condition improved significantly after five days of treatment, and he recovered completely two days later. Afterwards, treatment with vitamin B1, L-carnitine and a protein-restrict diet (1 g/kg/day) was continued. One and a half months later, blood amino acids and urine organic acids returned to normal. Magnetic resonance imaging of the brain also indicated a great improvement. It was concluded that inborn metabolic disease should be considered in the patients with an onset similar to acute encephalopathy. Early diagnosis and proper treatment can prevent brain damage and improve prognosis.

Thyroid peroxidase antibodies during early gestation and the subsequent risk of first-onset postpartum depression: A prospective cohort study.

PubMed

Wesseloo, Richard; Kamperman, Astrid M; Bergink, Veerle; Pop, Victor J M

2018-01-01

During the postpartum period, women are at risk for the new onset of both auto-immune thyroid disorders and depression. The presence of thyroid peroxidase antibodies (TPO-ab) during early gestation is predictive for postpartum auto-immune thyroid dysfunction. The aim of this study was to investigate the association between TPO-ab status during early gestation and first-onset postpartum depression. Prospective cohort study (n = 1075) with follow-up during pregnancy up to one year postpartum. Thyroid function and TPO-ab status were measured during early gestation. Depressive symptomatology was assessed during each trimester and at four time points postpartum with the Edinburgh Depression Scale (EDS). Women with antenatal depression were not eligible for inclusion. Self-reported postpartum depression was defined with an EDS cut-off of ≥ 13. The cumulative incidence of self-reported first-onset depression in the first postpartum year was 6.3%. A positive TPO-ab status was associated with an increased risk for self-reported first-onset depression at four months postpartum (adjusted OR 3.8; 95% CI 1.3-11.6), but not at other postpartum time points. Prevalence rates of self-reported postpartum depression declined after four months postpartum in the TPO-ab positive group, but remained constant in the TPO-ab negative group. Depression was defined with a self-rating questionnaire (EDS). Women with an increased TPO-ab titer during early gestation are at increased risk for self-reported first-onset depression. The longitudinal pattern of self-reported postpartum depression in the TPO-ab positive group was similar to the typical course of postpartum TPO-ab titers changes. This suggests overlap in the etiology of first-onset postpartum depression and auto-immune thyroid dysfunction. Thyroid function should be evaluated in women with first-onset postpartum depression. Copyright © 2017 Elsevier B.V. All rights reserved.

From Bad to Worse: Anemia on Admission and Hospital-Acquired Anemia.

PubMed

Koch, Colleen G; Li, Liang; Sun, Zhiyuan; Hixson, Eric D; Tang, Anne S; Phillips, Shannon C; Blackstone, Eugene H; Henderson, J Michael

2017-12-01

Anemia at hospitalization is often treated as an accompaniment to an underlying illness, without active investigation, despite its association with morbidity. Development of hospital-acquired anemia (HAA) has also been associated with increased risk for poor outcomes. Together, they may further heighten morbidity risk from bad to worse. The aims of this study were to (1) examine mortality, length of stay, and total charges in patients with present-on-admission (POA) anemia and (2) determine whether these are exacerbated by development of HAA. In this cohort investigation, from January 1, 2009, to August 31, 2011, a total of 44,483 patients with POA anemia were admitted to a single health system compared with a reference group of 48,640 without POA anemia or HAA. Data sources included the University HealthSystem Consortium database and electronic medical records. Risk-adjustment methods included logistic and linear regression models for mortality, length of stay, and total charges. Present-on-admission anemia was defined by administrative coding. Hospital-acquired anemia was determined by changes in hemoglobin values from the electronic medical record. Approximately one-half of the patients experienced worsening of anemia with development of HAA. Risk for death and resource use increased with increasing severity of HAA. Those who developed severe HAA had 2-fold greater odds for death; that is, mild POA anemia with development of severe HAA resulted in greater mortality (odds ratio, 2.57; 95% confidence interval, 2.08-3.18; P < 0.001), increased length of stay (2.23; 2.16-2.31; P < 0.001), and higher charges (2.09; 2.03-2.15; P < 0.001). Present-on-admission anemia is associated with increased mortality and resource use. This risk is further increased from bad to worse when patients develop HAA. Efforts to address POA anemia and HAA deserve attention.

Genomic Analyses of Patients With Unexplained Early-Onset Scoliosis.

PubMed

Gao, Xiaochong; Gotway, Garrett; Rathjen, Karl; Johnston, Charles; Sparagana, Steven; Wise, Carol A

2014-09-01

To test for rare genetic mutations, a cohort of patients with unexplained early-onset scoliosis (EOS) was screened using high-density microarray genotyping. A cohort of patients with adolescent idiopathic scoliosis (AIS) was similarly screened and the results were compared. Patients with scoliosis in infancy or early childhood (EOS) are at high risk for progressive deformity and associated problems including respiratory compromise. Early-onset scoliosis is frequently associated with genetic disorders but many patients present with nonspecific clinical features and without an associated diagnosis. The authors hypothesized that EOS in these patients may be caused by rare genetic mutations detectable by next-generation genomic methods. The researchers identified 24 patients with unexplained EOS from pediatric orthopedic clinics. They genotyped them, along with 39 connecting family members, using the Illumina OmniExpress-12, version 1.0 beadchip. Resulting genotypes were analyzed for chromosomal changes, specifically copy number variation and absence of heterozygosity. They screened 482 adolescent idiopathic scoliosis (AIS) patients and 744 healthy controls, who were similarly genotyped with the same beadchip, for chromosomal changes identified in the EOS cohort. Copy number variation and absence of heterozygosity analyses revealed a genetic diagnosis of chromosome 15q24 microdeletion syndrome in 1 patient and maternal uniparental disomy of chromosome 14 in a second one. Prior genetic testing and clinical evaluations had been negative in both cases. A large novel chromosome 10 deletion was likely causal in a third EOS patient. These mutations identified in the EOS patients were absent in AIS patients and controls, and thus were not associated with AIS or found in asymptomatic individuals. These data underscore the usefulness of updated genetic evaluations including high-density microarray-based genotyping and other next-generation methods in patients with unexplained

Interstitial lung disease in an adult with Fanconi anemia: Clues to the pathogenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rubinstein, W.S.; Wenger, S.L.; Hoffman, R.M.

1997-03-31

We have studied a 38-year-old man with a prior diagnosis of Holt-Oram syndrome, who presented with diabetes mellitus. He had recently taken prednisone for idiopathic interstitial lung disease and trimethoprim-sulfamethoxazole for sinusitis. Thrombocytopenia progressed to pancytopenia. The patient had skeletal, cardiac, renal, cutaneous, endocrine, hepatic, neurologic, and hematologic manifestations of Fanconi anemia (FA). Chest radiographs showed increased interstitial markings at age 25, dyspnea began in his late 20s, and he stopped smoking at age 32. At age 38, computerized tomography showed bilateral upper lobe fibrosis, lower lobe honeycombing, and bronchiectasis. Pulmonary function tests, compromised at age 29, showed a moderatelymore » severe obstructive and restrictive pattern by age 38. Serum alpha-1 antitrypsin level was 224 (normal 85-213) mg/dL and PI phenotype was M1. Karyotype was 46,X-Y with a marked increase in chromosome aberrations induced in vitro by diepoxybutane. The early onset and degree of pulmonary disease in this patient cannot be fully explained by environmental or known genetic causes. The International Fanconi Anemia Registry (IFAR) contains no example of a similar pulmonary presentation. Gene-environment (ecogenetic) interactions in FA seem evident in the final phenotype. The pathogenic mechanism of lung involvement in FA may relate to oxidative injury and cytokine anomalies. 49 refs., 2 figs., 1 tab.« less

About Anemia (For Kids)

MedlinePlus

... Safe Videos for Educators Search English Español About Anemia KidsHealth / For Kids / About Anemia What's in this ... to every cell in your body. What Is Anemia? Anemia happens when a person doesn't have ...

Anemia - Multiple Languages

MedlinePlus

... Section Anemia - العربية (Arabic) Bilingual PDF Health Information Translations Bosnian (bosanski) Expand Section Anemia - bosanski (Bosnian) Bilingual PDF Health Information Translations Chinese, Simplified (Mandarin dialect) (简体中文) Expand Section Anemia - ...

[Anti-NMDA-receptor encephalitis: a new axis-III disorder in the differential diagnosis of childhood disintegrative disorder, early onset schizophrenia and late onset autism].

PubMed

Creten, C; van der Zwaan, S; Blankespoor, R J; Maatkamp, A; Klinkenberg, S; van Kranen-Mastenbroek, V H J M; Nicolai, J; Dhossche, D M; van Os, J; Schieveld, J N M

2012-01-01

Childhood disintegrative disorder (CDD), early onset schizophrenia (EOS), and late onset autism (LOA) often follow a similar course: initially, development is normal, then there is a sudden neuropsychiatric deterioration of social interaction and communication skills, which is combined with a decline in intelligence and reduction in daily activities. A 9-year-old boy was admitted to the paediatric ward with acute onset of secondary epileptic seizures. It was not long until the boy's symptoms resembled that of patients with cdd, eos and loa. Intensive tests led to the diagnosis of anti-NMDA-receptor encephalitis. Anti-NMDA-receptor encephalitis should be regarded as a possible organic cause underlying the syndromal presentation of CDD, EOS and LOA.

Characteristics of familial aggregation in early-onset Alzheimer`s disease: Evidence of subgroups

DOE Office of Scientific and Technical Information (OSTI.GOV)

Campion, D.; Martinez, M.; Babron, M.C.

1995-06-19

Characteristics of familial aggregation of Alzheimer`s Disease were studied in 92 families ascertained through a clinically diagnosed proband with an onset below age 60 years. In each family data were systematically collected on the sibships of the proband, of his father, and of his mother. A total of 926 relatives were included and 81% of the living relatives (i.e., 251 individuals) were directly examined. The estimated cumulative risk among first degree relatives was equal to 35% by age 89 years (95% confidence interval 22 to 47%). This result does not support the hypothesis that an autosomal dominant gene, fully penetrantmore » by age 90 years, is segregating within all these pedigrees. Despite the fact that all probands were selected for an onset before age 60 years it was shown that two types of families could be delineated with respect to age at onset among affected relatives: all secondary cases with an onset below age 60 years were contributed by a particular group of families (type 1 families), whereas all secondary cases with an onset after age 60 years were contributed by another group of families (type 2 families). Although genetic interpretation of these findings is not straightforward, they support the hypothesis of etiologic heterogeneity in the determinism of early-onset Alzheimer`s disease. 58 refs., 5 figs., 2 tabs.« less

How can machine-learning methods assist in virtual screening for hyperuricemia? A healthcare machine-learning approach.

PubMed

Ichikawa, Daisuke; Saito, Toki; Ujita, Waka; Oyama, Hiroshi

2016-12-01

Our purpose was to develop a new machine-learning approach (a virtual health check-up) toward identification of those at high risk of hyperuricemia. Applying the system to general health check-ups is expected to reduce medical costs compared with administering an additional test. Data were collected during annual health check-ups performed in Japan between 2011 and 2013 (inclusive). We prepared training and test datasets from the health check-up data to build prediction models; these were composed of 43,524 and 17,789 persons, respectively. Gradient-boosting decision tree (GBDT), random forest (RF), and logistic regression (LR) approaches were trained using the training dataset and were then used to predict hyperuricemia in the test dataset. Undersampling was applied to build the prediction models to deal with the imbalanced class dataset. The results showed that the RF and GBDT approaches afforded the best performances in terms of sensitivity and specificity, respectively. The area under the curve (AUC) values of the models, which reflected the total discriminative ability of the classification, were 0.796 [95% confidence interval (CI): 0.766-0.825] for the GBDT, 0.784 [95% CI: 0.752-0.815] for the RF, and 0.785 [95% CI: 0.752-0.819] for the LR approaches. No significant differences were observed between pairs of each approach. Small changes occurred in the AUCs after applying undersampling to build the models. We developed a virtual health check-up that predicted the development of hyperuricemia using machine-learning methods. The GBDT, RF, and LR methods had similar predictive capability. Undersampling did not remarkably improve predictive power. Copyright © 2016 Elsevier Inc. All rights reserved.

The effect of intrapartum antibiotics on early-onset neonatal sepsis in Dhaka, Bangladesh: a propensity score matched analysis

PubMed Central

2014-01-01

Background We estimate the effect of antibiotics given in the intrapartum period on early-onset neonatal sepsis in Dhaka, Bangladesh using propensity score techniques. Methods We followed 600 mother-newborn pairs as part of a cohort study at a maternity center in Dhaka. Some pregnant women received one dose of intravenous antibiotics during labor based on clinician discretion. Newborns were followed over the first seven days of life for early-onset neonatal sepsis defined by a modified version of the World Health Organization Young Infants Integrated Management of Childhood Illnesses criteria. Using propensity scores we matched women who received antibiotics with similar women who did not. A final logistic regression model predicting sepsis was run in the matched sample controlling for additional potential confounders. Results Of the 600 mother-newborn pairs, 48 mothers (8.0%) received antibiotics during the intrapartum period. Seventy-seven newborns (12.8%) were classified with early-onset neonatal sepsis. Antibiotics appeared to be protective (odds ratio 0.381, 95% confidence interval 0.115–1.258), however this was not statistically significant. The results were similar after adjusting for prematurity, wealth status, and maternal colonization status (odds ratio 0.361, 95% confidence interval 0.106–1.225). Conclusions Antibiotics administered during the intrapartum period may reduce the risk of early-onset neonatal sepsis in high neonatal mortality settings like Dhaka. PMID:24742087

A founder mutation in presenilin 1 causing early-onset Alzheimer disease in unrelated Caribbean Hispanic families.

PubMed

Athan, E S; Williamson, J; Ciappa, A; Santana, V; Romas, S N; Lee, J H; Rondon, H; Lantigua, R A; Medrano, M; Torres, M; Arawaka, S; Rogaeva, E; Song, Y Q; Sato, C; Kawarai, T; Fafel, K C; Boss, M A; Seltzer, W K; Stern, Y; St George-Hyslop, P; Tycko, B; Mayeux, R

2001-11-14

Genetic determinants of Alzheimer disease (AD) have not been comprehensively examined in Caribbean Hispanics, a population in the United States in whom the frequency of AD is higher compared with non-Hispanic whites. To identify variant alleles in genes related to familial early-onset AD among Caribbean Hispanics. Family-based case series conducted in 1998-2001 at an AD research center in New York, NY, and clinics in the Dominican Republic. Among 206 Caribbean Hispanic families with 2 or more living members with AD who were identified, 19 (9.2%) had at least 1 individual with onset of AD before the age of 55 years. The entire coding region of the presenilin 1 gene and exons 16 and 17 of the amyloid precursor protein gene were sequenced in probands from the 19 families and their living relatives. A G-to-C nucleotide change resulting in a glycine-alanine amino acid substitution at codon 206 (Gly206Ala) in exon 7 of presenilin 1 was observed in 23 individuals from 8 (42%) of the 19 families. A Caribbean Hispanic individual with the Gly206Ala mutation and early-onset familial disease was also found by sequencing the corresponding genes of 319 unrelated individuals in New York City. The Gly206Ala mutation was not found in public genetic databases but was reported in 5 individuals from 4 Hispanic families with AD referred for genetic testing. None of the members of these families were related to one another, yet all carriers of the Gly206Ala mutation tested shared a variant allele at 2 nearby microsatellite polymorphisms, indicating a common ancestor. No mutations were found in the amyloid precursor protein gene. The Gly206Ala mutation was found in 8 of 19 unrelated Caribbean Hispanic families with early-onset familial AD. This genetic change may be a prevalent cause of early-onset familial AD in the Caribbean Hispanic population.

Diagnosis of Fanconi anemia in patients with bone marrow failure

PubMed Central

Pinto, Fernando O.; Leblanc, Thierry; Chamousset, Delphine; Le Roux, Gwenaelle; Brethon, Benoit; Cassinat, Bruno; Larghero, Jérôme; de Villartay, Jean-Pierre; Stoppa-Lyonnet, Dominique; Baruchel, André; Socié, Gérard; Gluckman, Eliane; Soulier, Jean

2009-01-01

to be a reliable alternative method to evaluate Fanconi anemia phenotype in fibroblasts. This global strategy allowed early and accurate confirmation or rejection of Fanconi anemia diagnosis with immediate clinical impact for those who underwent hematopoietic stem cell transplant. PMID:19278965

Neurocognitive findings in Prader-Willi syndrome and early-onset morbid obesity.

PubMed

Miller, Jennifer; Kranzler, John; Liu, Yijun; Schmalfuss, Ilona; Theriaque, Douglas W; Shuster, Jonathan J; Hatfield, Ann; Mueller, O Thomas; Goldstone, Anthony P; Sahoo, Trilochan; Beaudet, Arthur L; Driscoll, Daniel J

2006-08-01

To examine whether early-onset morbid obesity is associated with cognitive impairment, neuropathologic changes, and behavioral problems. This case-control study compared head MRI scans and cognitive, achievement, and behavioral evaluations of subjects with Prader-Willi syndrome (PWS), early-onset morbid obesity (EMO), and normal-weight sibling control subjects from both groups. Head MRI was done on 17 PWS, 18 EMO, and 21 siblings, and cognitive, achievement, and behavioral evaluations were done on 19 PWS, 17 EMO, and 24 siblings. The mean General Intellectual Ability score of the EMO group was 77.4 +/- 17.8; PWS, 63.3 +/- 14.2; and control subjects, 106.4 +/- 13.0. Achievement scores for the three groups were EMO, 78.7 +/- 18.8; PWS, 71.2 +/- 17.0; and control subjects, 104.8 +/- 17.0. Significant negative behaviors and poor adaptive skills were found in the EMO group. White matter lesions were noted on brain MRI in 6 subjects with PWS and 5 with EMO. None of the normal-weight control subjects had these findings. Individuals with EMO have significantly lower cognitive function and more behavioral problems than control subjects with no history of childhood obesity. Both EMO and PWS subjects have white matter lesions on brain MRI that have not previously been described.

Maternal hyperuricemia in normotensive singleton pregnancy, a prenatal finding with continuous perinatal and postnatal effects, a prospective cohort study

PubMed Central

2014-01-01

Background To assess the association of maternal hyperuricemia with adverse pregnancy outcome and neonatal metabolic, neurologic and respiratory disturbances in normotensive singleton pregnant women. Method This prospective multicentric cohort study was conducted on 404 normotensive singleton pregnant women who were admitted for delivery in Vali-Asr and Akbar-Abadi teaching hospitals of Tehran University of Medical Sciences, Tehran, Iran. Upon enrollment maternal and umbilical sera were obtained for determining uric acid levels. 1 and 5 minutes Apgar scores, the need for neonatal resuscitation and neonatal intensive care unit (NICU) admission were recorded. In case of NICU admission a neonatal blood sample was drawn for determining uric acid, blood sugar and bilirubin levels. An intracranial ultrasound imaging was also carried out for the admittd neonates for detecting intraventricular hemorrhage. Results Maternal hyperuricemia (uric acid one standard deviation greater than the appropriate gestational age) was independently associated with preterm birth (odds ratio (OR), 3.17; 95% confidence interval (CI), 2.1 – 4.79), small for gestational age delivery (OR, 1.28; 95% CI, 1.04 – 2.57), NICU admission (OR, 1.65; 95% CI, 1.12 – 2.94) and neonatal IVH (OR, 8.14; 95% CI, 1.11 – 87.1). Conclusions Maternal hyperuricemia in normotensive singleton pregnant women is significantly associated with preterm and SGA delivery and the development of neonatal IVH. PMID:24636149

Persistent pulmonary hypertension of the newborn associated with severe congenital anemia of various etiologies.

PubMed

Landau, Danielle; Kapelushnik, Josef; Harush, Miri B; Marks, Kyla; Shalev, Hanna

2015-01-01

Among the many associated features of persistent pulmonary hypertension of the neonate (PPHN), severe congenital anemia has been described only occasionally and is not included in the list of conditions that may cause PPHN in the neonate. We describe the clinical course of a group of 12 full-term neonates with PPHN and congenital anemia due to congenital dyserythropoietic anemia (7/12), α thalasemia (1/12), Diamond-Blackfan (1/12), and epsilon gamma delta beta thalassemia (3/12). The association of congenital anemia and PPHN is more common than previously thought; it can exist with various etiologies and severity of anemia. Congenital anemia has not been described until now as a cause or risk factor for PPHN; it should be considered as such alone or in combination with other known causes to be recognized early and treated appropriately to improve outcome. In families with known cases of congenital anemia due to the above-mentioned diagnosis, closer prenatal follow-up should be offered to anticipate possible fetal distress and/or fetal anemia and PPHN after birth.

BRCA1 and BRCA2 mutation analysis of early-onset and familial breast cancer cases in Mexico.

PubMed

Ruiz-Flores, Pablo; Sinilnikova, Olga M; Badzioch, Michael; Calderon-Garcidueñas, A L; Chopin, Sandrine; Fabrice, Odefrey; González-Guerrero, J F; Szabo, Csilla; Lenoir, Gilbert; Goldgar, David E; Barrera-Saldaña, Hugo A

2002-12-01

The entire coding regions of BRCA1 and BRCA2 were screened for mutations by heteroduplex analysis in 51 Mexican breast cancer patients. One BRCA1 and one BRCA2 truncating mutation each was identified in the group of 32 (6%) early-onset breast cancer patients (< or =35 years). Besides these two likely deleterious mutations, eight rare variants of unknown significance, mostly in the BRCA2 gene, were detected in six of 32 (19%) early-onset breast cancer cases and in three of 17 (18%) site-specific breast cancer families, one containing a male breast cancer case. No mutations or rare sequence variants have been identified in two additional families including each an early-onset breast cancer case and an ovarian cancer patient. The two truncating mutations (BRCA1 3857delT; BRCA2 2663-2664insA) and six of the rare variants have never been reported before and may be of country-specific origin. The majority of the alterations appeared to be distinct, with only one of them being observed in more than one family. Copyright 2002 Wiley-Liss, Inc.

Early- and late-onset Alzheimer disease: Are they the same entity?

PubMed

Tellechea, P; Pujol, N; Esteve-Belloch, P; Echeveste, B; García-Eulate, M R; Arbizu, J; Riverol, M

2018-05-01

Early-onset Alzheimer disease (EOAD), which presents in patients younger than 65 years, has frequently been described as having different features from those of late-onset Alzheimer disease (LOAD). This review analyses the most recent studies comparing the clinical presentation and neuropsychological, neuropathological, genetic, and neuroimaging findings of both types in order to determine whether EOAD and LOAD are different entities or distinct forms of the same entity. We observed consistent differences between clinical findings in EOAD and in LOAD. Fundamentally, the onset of EOAD is more likely to be marked by atypical symptoms, and cognitive assessments point to poorer executive and visuospatial functioning and praxis with less marked memory impairment. Alzheimer-type features will be more dense and widespread in neuropathology studies, with structural and functional neuroimaging showing greater and more diffuse atrophy extending to neocortical areas (especially the precuneus). In conclusion, available evidence suggests that EOAD and LOAD are 2 different forms of a single entity. LOAD is likely to be influenced by ageing-related processes. Copyright © 2015 Sociedad Española de Neurología. Publicado por Elsevier España, S.L.U. All rights reserved.

Dopamine receptor gene d4 polymorphisms and early sexual onset: gender and environmental moderation in a sample of african-american youth.

PubMed

Kogan, Steven M; Lei, Man-Kit; Beach, Steven R H; Brody, Gene H; Windle, Michael; Lee, Sunbok; MacKillop, James; Chen, Yi-Fu

2014-08-01

Early sexual onset and its consequences disproportionately affect African-American youth, particularly male youth. The dopamine receptor D4 gene (DRD4) has been linked to sexual activity and other forms of appetitive behavior, particularly for male youth and in combination with environmental factors (gene × environment [G × E] effects). The differential susceptibility perspective suggests that DRD4 may exert this effect by amplifying the effects of both positive and negative environments. We hypothesized that DRD4 status would amplify the influence of both positive and negative neighborhood environments on early sexual onset among male, but not female, African-Americans. Hypotheses were tested with self-report, biospecimen, and census data from five prospective studies of male and female African-American youth in rural Georgia communities, N = 1,677. Early sexual onset was defined as intercourse before age 14. No significant G × E findings emerged for female youth. Male youth with a DRD4 long allele were more likely than those with two DRD4 short alleles to report early sexual onset in negative community environments and not to report early onset in positive community environments. Dopaminergic regulation of adolescent sexual behaviors may operate differently by gender. DRD4 operated as an environmental amplification rather than a vulnerability factor. Copyright © 2014 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.

Anemia in Chronic Kidney Disease

MedlinePlus

... Heart Disease Mineral & Bone Disorder Anemia in Chronic Kidney Disease What is anemia? Anemia is a condition ... they should. How is anemia related to chronic kidney disease? Anemia commonly occurs in people with chronic ...

Early-Onset Severe Encephalopathy with Epilepsy: The BRAT1 Gene Should Be Added to the List of Causes.

PubMed

van de Pol, Laura A; Wolf, Nicole I; van Weissenbruch, Mirjam M; Stam, Cornelie J; Weiss, Janneke M; Waisfisz, Quinten; Kevelam, Sietske H; Bugiani, Mariana; van de Kamp, Jiddeke M; van der Knaap, Marjo S

2015-12-01

A variety of pathologies can underlie early-onset severe encephalopathy with epilepsy. To aid the diagnostic process in such patients we present an overview of causes, including the rapidly expanding list of genes involved. When no explanation is found, whole-exome sequencing (WES) can be used in an attempt to identify gene defects in patients suspected to suffer from a genetic form. We describe three siblings, born to consanguineous parents, with a lethal severe epileptic encephalopathy with early-infantile onset, including their magnetic resonance imaging, electroencephalography and, in one case, neuropathological findings. Using WES a homozygous frameshift mutation in the BRAT1 gene, c.638dup p.(Val214Glyfs*189), was identified. We present our cases in the context of all published cases with mutations in the BRAT1 gene and conclude that BRAT1 should be added to the growing list of genes related to early-onset severe encephalopathy with epilepsy. Georg Thieme Verlag KG Stuttgart · New York.

Iron deficiency anemia

MedlinePlus

Anemia - iron deficiency ... iron from old red blood cells. Iron deficiency anemia develops when your body's iron stores run low. ... You may have no symptoms if the anemia is mild. Most of the time, ... slowly. Symptoms may include: Feeling weak or tired more often ...

Fanconi Syndrome Secondary to Deferasirox in Diamond-Blackfan Anemia: Case Series and Recommendations for Early Diagnosis.

PubMed

Papneja, Koyelle; Bhatt, Mihir D; Kirby-Allen, Melanie; Arora, Steven; Wiernikowski, John T; Athale, Uma H

2016-08-01

Deferasirox is an oral iron chelator used to treat patients with transfusion-related iron overload. We report, from two institutions, two children with Diamond-Blackfan anemia who developed Fanconi syndrome secondary to deferasirox administration, along with a review of the literature. The current recommendation for the laboratory monitoring of patients receiving deferasirox does not include serum electrolytes or urine analysis. Thus, despite routine clinic visits and bloodwork, these two patients presented with life-threatening electrolyte abnormalities requiring hospitalization. Hence, we propose the inclusion of serum electrolytes and urine analysis as part of routine monitoring to facilitate the early diagnosis of Fanconi syndrome in the context of high doses of deferasirox therapy. © 2016 Wiley Periodicals, Inc.

Association of ITPA polymorphisms rs6051702/rs1127354 instead of rs7270101/rs1127354 as predictor of ribavirin-associated anemia in chronic hepatitis C treated patients.

PubMed

D'Avolio, Antonio; De Nicolò, Amedeo; Cusato, Jessica; Ciancio, Alessia; Boglione, Lucio; Strona, Silvia; Cariti, Giuseppe; Troshina, Giulia; Caviglia, Gian Paolo; Smedile, Antonina; Rizzetto, Mario; Di Perri, Giovanni

2013-10-01

Functional variants rs7270101 and rs1127354 of inosine triphosphatase (ITPA) were recently found to protect against ribavirin (RBV)-induced hemolytic anemia. However, no definitive data are yet available on the role of no functional rs6051702 polymorphism. Since a simultaneous evaluation of the three ITPA SNPs for hemolytic anemia has not yet been investigated, we aimed to understand the contribution of each SNPs and its potential clinical use to predict anemia in HCV treated patients. A retrospective analysis included 379 HCV treated patients. The ITPA variants rs6051702, rs7270101 and rs1127354 were genotyped and tested for association with achieving anemia at week 4. We also investigated, using multivariate logistic regression, the impact of each single and paired associated polymorphism on anemia onset. All SNPs were associated with Hb decrease. The carrier of at least one variant allele in the functional ITPA SNPs was associated with a lower decrement of Hb, as compared to patients without a variant allele. In multivariate logistic regression analyses the carrier of a variant allele in the rs6051702/rs1127354 association (OR=0.11, p=1.75×10(-5)) and Hb at baseline (OR=1.51, p=1.21×10(-4)) were independently associated with protection against clinically significant anemia at week 4. All ITPA polymorphisms considered were shown to be significantly associated with anemia onset. A multivariate regression model based on ITPA genetic polymorphisms was developed for predicting the risk of anemia. Considering the characterization of pre-therapy anemia predictors, rs6051702 SNP in association to rs1127354 is more informative in order to avoid this relevant adverse event. Copyright © 2013 Elsevier B.V. All rights reserved.

The Potential Biomarkers to Identify the Development of Steatosis in Hyperuricemia

PubMed Central

He, Xiaojuan; Lu, Cheng; He, Bing; Niu, Xuyan; Xiao, Cheng; Xu, Gang; Bian, Zhaoxiang; Zu, Xianpeng; Zhang, Ge; Zhang, Weidong; Lu, Aiping

2016-01-01

Hyperuricemia (HU) often progresses to combine with non-alcoholic fatty liver disease (NAFLD) in the clinical scenario, which further exacerbates metabolic disorders; early detection of biomarkers, if obtained during the HU progression, may be beneficial for preventing its combination with NAFLD. This study aimed to decipher the biomarkers and mechanisms of the development of steatosis in HU. Four groups of subjects undergoing health screening, including healthy subjects, subjects with HU, subjects with HU combined with NAFLD (HU+NAFLD) and subjects with HU initially and then with HU+NAFLD one year later (HU→HU+NAFLD), were recruited in this study. The metabolic profiles of all subjects’ serum were analyzed by liquid chromatography quadruple time-of-flight mass spectrometry. The metabolomic data from subjects with HU and HU+NAFLD were compared, and the biomarkers for the progression from HU to HU+NAFLD were predicted. The metabolomic data from HU→HU+NAFLD subjects were collected for further verification. The results showed that the progression was associated with disturbances of phospholipase metabolism, purine nucleotide degradation and Liver X receptor/retinoic X receptor activation as characterized by up-regulated phosphatidic acid, cholesterol ester (18:0) and down-regulated inosine. These metabolic alterations may be at least partially responsible for the development of steatosis in HU. This study provides a new paradigm for better understanding and further prevention of disease progression. PMID:26890003

Combined deficiencies of 25-hydroxyvitamin D and anemia in preschool children with severe early childhood caries: A case-control study.

PubMed

Deane, Shannon; Schroth, Robert J; Sharma, Atul; Rodd, Celia

2018-05-01

Severe early childhood caries (S-ECC) is common and has adverse affects on children's health. Children with S-ECC have been shown to have anemia or vitamin D deficiency. No studies have assessed the presence of combined deficiencies with S-ECC. The purpose of our study was to examine whether those with S-ECC had a higher prevalence of combined anemia and low 25-hydroxyvitamin D (25(OH)D) compared to controls. Covariates associated with elevated parathyroid hormone (PTH), previously noted in S-ECC, were examined. This is a re-analyses of a previously described cross-sectional case-control study; data were collected between 2009 and 2011. Children with S-ECC were recruited on the day of dental surgery and controls from the community. Blood was drawn for complete blood count, ferritin, 25(OH)D and PTH. Families completed a questionnaire. A total of 266 children participated (S-ECC n=144); the mean age was 40.8 ± 14.1 months. Children with S-ECC were more likely to have low 25(OH)D, hemoglobin, elevated PTH or iron-deficiency anemia compared to controls. Significant differences between groups were seen for a combined deficiency of low hemoglobin (<110 g/L) and 25(OH)D < 50 nmol/L; controls 0/114 versus S-ECC 15/140 (P<0.001). In an adjusted regression model, PTH was negatively associated with 25(OH)D (P<0.001) and higher income (P<0.02); it was positively associated with less regular milk consumption (P=0.001). Combined deficiencies of vitamin D and anemia are more prevalent in children with S-ECC; the etiology remains unclear. A detailed diet history is key in those with S-ECC to assess risks for deficiencies.

The ecology of anemia: Anemia prevalence and correlated factors in adult indigenous women in Argentina.

PubMed

Goetz, Laura G; Valeggia, Claudia

2017-05-06

The Toba/Qom of Namqom are an indigenous community native to the Gran Chaco region of northern Argentina. Historically seminomadic foragers, the diet of peri-urban community members has rapidly changed from high-protein, high-fiber to hypercaloric, processed. This study aims to understand the impact of this nutritional transition on aspects of women's health by exploring the relationship between prevalence of anemia and current diet composition, place of birth, and reproductive history. We measured the capillary hemoglobin (Hb) levels of 153 adult women. Each participant was also given two interviews characterizing reproductive history and a 24-hour food recall. The average Hb level was 12.6 g/dL (range 5.8-15.7 g/dL). In our sample, 28% of participants were anemic and 31% were borderline anemic. Iron and vitamin C consumption were negatively associated with Hb levels. Body mass index was marginally associated with Hb levels. Being born in a peri-urban setting, a proxy for early Westernized diet was associated with higher risk of anemia, suggesting developmental experience may play a role. Pregnant and lactating women had lower Hb levels than menstruating and menopausal women. Age, height, parity, and age at first pregnancy were not found to be statistically significant predictors of anemia. Iron deficiency represents a serious health concern for women, particularly pregnant ones. Our results suggest that both past and current nutritional ecology variables may be associated with the risk of anemia. These findings inform public health interventions, since reproductive history may be more difficult to modify than current diet. © 2017 Wiley Periodicals, Inc.

Global development and adaptive behaviour in children with early-onset epilepsy: a population-based case-control study.

PubMed

Reilly, Colin; Atkinson, Patricia; Memon, Ayesha; Jones, Chloe; Dabydeen, Lyvia; Das, Krishna B; Gillberg, Christopher; Neville, Brian G R; Mahoney, J Matthew; Scott, Rod C

2018-06-03

There are limited population-based data on global development and adaptive behaviour in children with early-onset epilepsy. The aims of this study were: (1) to identify the prevalence of deficits in global development and adaptive behaviour experienced by children with early-onset epilepsy; (2) to identify factors associated with such deficits; and (3) to compare the relationship between measures of neurodevelopment in the group with epilepsy to a group without epilepsy who had other neurological or neurodevelopmental difficulties. The Sussex Early Epilepsy and Neurobehaviour study is a prospective, community-based study involving children (1-7y) with epilepsy. We undertook comprehensive psychological assessment with participants, including measures of global development and adaptive behaviour. We compared the children with epilepsy with a sex, age, and developmentally-matched group of children without epilepsy who had neurodevelopmental or neurological difficulties using correlation matrices. Forty-eight children (91% of the eligible population) with epilepsy underwent assessment. Seventy-one per cent of children displayed delayed global development (<2SD) and 56% showed significant deficits (<2SD) in adaptive behaviour. Our analysis revealed that non-white ethnicity and use of polytherapy were independently associated with decreased scores on measures of global development and adaptive behaviour. The correlations between measures of developmental functioning were higher in children with epilepsy than in those without. Children with early-onset epilepsy frequently have difficulties with global development and adaptive behaviour. The higher correlations between neurodevelopmental measures in children with epilepsy suggest that the profile in children with epilepsy is different. This may have significant implications for both neuropathology and interventions. Children with early-onset epilepsy are at significant risk of intellectual disability. Developmental

Aplastic anemia.

PubMed

Usuki, Kensuke

2016-01-01

Treatments of aplastic anemia are comprised of supportive therapy and aplastic anemia-specific therapy aimed at restoring hematopoiesis. Supportive therapies include transfusion, G-CSF, and the administration of iron chelation agents, as well as dealing specifically with individual symptoms. Aplastic anemia-specific treatments given with the aim of achieving hematopoietic recovery include immunosuppressive therapy, allogeneic hematopoietic stem cell transplantation, and anabolic hormone therapy. Although transplantation provides complete recovery of hematopoiesis (cure), there is a risk of death due to transplant-related complications. The most effective immunosuppressive therapy is a combination of anti-thymocyte globulin and cyclosporine. This treatment is also effective against the secondary, drug-induced and hepatitis-associated forms of aplastic anemia. In the management of aplastic anemia, a treatment is selected from among these options depending on the disease severity and the age of the individual case. The thrombopoietin receptor agonist eltrombopag appears to be effective and to provide tri-lineage recovery of hematopoiesis in some cases. Indications for its use are expected to expand in Japan.

Comparison of Growing Rod Instrumentation Versus Serial Cast Treatment for Early-Onset Scoliosis.

PubMed

Johnston, Charles E; McClung, Anna M; Thompson, George H; Poe-Kochert, Connie; Sanders, James O

2013-09-01

A comparison of 2 methods of early-onset scoliosis treatment using radiographic measures and complication rates. To determine whether a delaying tactic (serial casting) has comparable efficacy to a surgical method (insertion of growing rod instrumentation [GRI]) in the initial phase of early-onset deformity management. Serial casts are used in experienced centers to delay operative management of curves of surgical magnitude (greater than 50°) in children up to age 6 years. A total of 27 casted patients from 3 institutions were matched with 27 patients from a multicenter database according to age (within 6 months of each other), curve magnitude (within 10° of each other), and diagnosis. Outcomes were compared according to major curve magnitude, spine length (T1-S1), duration and number of treatment encounters, and complications. There was no difference in age (5.5 years) or initial curve magnitude (65°) between groups, which reflects the accuracy of the matching process. Six pairs of patients had neuromuscular diagnoses, 11 had idiopathic deformities, and 10 had syndromic scoliosis. Growing rod instrumentation patients had smaller curves (45.9° vs. 64.9°; p = .002) at follow-up, but there was no difference in absolute spine length (GRI = 32.0 cm; cast = 30.6 cm; p = .26), even though GRI patients had been under treatment for a longer duration (4.5 vs. 2.4 years; p < .0001) and had undergone a mean of 5.5 lengthenings compared with 4.0 casts. Growing rod instrumentation patients had a 44% complication rate, compared with 1 cast complication. Of 27 casted patients, 15 eventually had operative treatment after a mean delay of 1.7 years after casting. Cast treatment is a valuable delaying tactic for younger children with early-onset scoliosis. Spine deformity is adequately controlled, spine length is not compromised, and surgical complications associated with early GRI treatment are avoided. Copyright © 2013 Scoliosis Research Society. Published by Elsevier Inc

Potentially pathogenic germline CHEK2 c.319+2T>A among multiple early-onset cancer families.

PubMed

Dominguez-Valentin, Mev; Nakken, Sigve; Tubeuf, Hélène; Vodak, Daniel; Ekstrøm, Per Olaf; Nissen, Anke M; Morak, Monika; Holinski-Feder, Elke; Martins, Alexandra; Møller, Pål; Hovig, Eivind

2018-01-01

To study the potential contribution of genes other than BRCA1/2, PTEN, and TP53 to the biological and clinical characteristics of multiple early-onset cancers in Norwegian families, including early-onset breast cancer, Cowden-like and Li-Fraumeni-like syndromes (BC, CSL and LFL, respectively). The Hereditary Cancer Biobank from the Norwegian Radium Hospital was used to identify early-onset BC, CSL or LFL for whom no pathogenic variants in BRCA1/2, PTEN, or TP53 had been found in routine diagnostic DNA sequencing. Forty-four cancer susceptibility genes were selected and analyzed by our in-house designed TruSeq amplicon-based assay for targeted sequencing. Protein- and RNA splicing-dedicated in silico analyses were performed for all variants of unknown significance (VUS). Variants predicted as the more likely to affect splicing were experimentally analyzed by minigene assay. We identified a CSL individual carrying a variant in CHEK2 (c.319+2T>A, IVS2), here considered as likely pathogenic. Out of the five VUS (BRCA2, CDH1, CHEK2, MAP3K1, NOTCH3) tested in the minigene splicing assay, only NOTCH3 c.14090C>T (p.Ser497Leu) showed a significant effect on RNA splicing, notably by inducing partial skipping of exon 9. Among 13 early-onset BC, CSL and LFL patients, gene panel sequencing identified a potentially pathogenic variant in CHEK2 that affects a canonical RNA splicing signal. Our study provides new information on genetic loci that may affect the risk of developing cancer in these patients and their families, demonstrating that genes presently not routinely tested in molecular diagnostic settings may be important for capturing cancer predisposition in these families.

2014 CODEPEH recommendations: Early detection of late onset deafness, audiological diagnosis, hearing aid fitting and early intervention.

PubMed

Núñez-Batalla, Faustino; Jáudenes-Casaubón, Carmen; Sequí-Canet, Jose Miguel; Vivanco-Allende, Ana; Zubicaray-Ugarteche, Jose

2016-01-01

The latest scientific literature considers early diagnosis of deafness as the key element to define the educational and inclusive prognosis of the deaf child, because it allows taking advantage of the critical period of development (0-4 years). Highly significant differences exist between deaf people who have been stimulated early and those who have received late or improper intervention. Early identification of late-onset disorders requires special attention and knowledge on the part of every childcare professional. Programs and additional actions beyond neonatal screening should be designed and planed to ensure that every child with a significant hearing loss is detected early. For this purpose, the CODEPEH would like to highlight the need for continuous monitoring of children's auditory health. Consequently, CODEPEH has drafted the recommendations included in the present document. Copyright © 2015 Elsevier España, S.L.U. and Sociedad Española de Otorrinolaringología y Patología Cérvico-Facial. All rights reserved.

Impact of substance use on the onset and course of early psychosis.

PubMed

Verdoux, Hélène; Tournier, Marie; Cougnard, Audrey

2005-11-01

The strong comorbidity between psychosis and substance use is already identifiable in early psychosis, raising the question of the direction of the association between substance use and psychosis onset. It has long been considered that this association was explained by the self-medication hypothesis. This hypothesis has been recently challenged by several prospective studies carried out in population-based samples, showing a dose-response relationship between cannabis exposure and risk of psychosis. This association was independent from potential confounding factors such as exposure to other drugs and pre-existence of psychotic symptoms. As a large percentage of subjects from the general population is now exposed to this drug, even a small increase in the risk of adverse effects may have significant deleterious consequences for the health of the population. Hence, reducing exposure to cannabis may contribute to prevention of some incident cases of psychosis. Regarding prognosis, persistent substance misuse after the onset of psychosis has a deleterious impact on clinical outcome. Therapeutic programs for subjects with dual diagnosis should be implemented early in the course of psychosis to maximise their impact on the course of illness.

Reconceptualizing Early and Late Onset: A Life Course Analysis of Older Heroin Users

ERIC Educational Resources Information Center

Boeri, Miriam Williams; Sterk, Claire E.; Elifson, Kirk W.

2008-01-01

Purpose: Researchers' knowledge regarding older users of illicit drugs is limited despite the increasing numbers of users. In this article, we apply a life course perspective to gain a further understanding of older adult drug use, specifically contrasting early- and late-onset heroin users. Design and Methods: We collected qualitative data from…

In utero arsenic exposure induces early onset of atherosclerosis in ApoE−/− mice

PubMed Central

Srivastava, Sanjay; D’Souza, Stanley E.; Sen, Utpal; States, J. Christopher

2007-01-01

Consumption of arsenic contaminated drinking water has been linked to higher rates of coronary disease, stroke, and peripheral arterial disease. Recent evidence suggests that early life exposures may play a significant role in the onset of chronic adult diseases. To investigate the potential for in utero exposure to accelerate the onset of cardiovascular disease we exposed pregnant ApoE-knockout (ApoE−/−) mice to arsenic in their drinking water and examined the aortic trees of their male offspring for evidence of early disease 10 and 16 weeks after birth. Mice were maintained on normal chow after weaning. ApoE−/− mice are a commonly used model for atherogenesis and spontaneously develop atherosclerotic disease. Mice exposed to arsenic in utero showed a >2-fold increase in lesion formation in the aortic roots as well as the aortic arch compared to control mice at both 10 and 16 weeks of age. The mice exposed to arsenic also had a 20 – 40% decrease in total triglycerides, but no change in total cholesterol, phospholipids and total abundance of VLDL or HDL particles. Subfractionation of VLDL particles showed a decrease in large VLDL particles. In addition, the arsenic exposed mice showed a vasorelaxation defect in response to acetylcholine suggesting disturbance of endothelial cell signalling. These results indicate that in utero arsenic exposure induces an early onset of atherosclerosis in ApoE−/− mice without a hyperlipidemic diet and support the hypothesis that in utero arsenic exposure may be atherogenic in humans. PMID:17317095

The kidney in hyperuricemia and gout.

PubMed

Mount, David B

2013-03-01

Gout is a painful inflammatory arthritis associated with hyperuricemia, with a prevalence of almost 10 million in the USA. Reduced renal excretion of urate is the underlying hyperuricemic mechanism in the vast majority of gout patients; most of the genes that affect serum urate level (SUA) encode urate transporters or associated regulatory proteins. Acquired influences can also modulate SUA and renal urate excretion, sometimes precipitating acute gout. Coincidentally, the prevalence of renal comorbidities in gout - hypertension, chronic kidney disease (CKD), and nephrolithiasis - is very high. Recent advances in genetics and molecular physiology have greatly enhanced the understanding of renal reabsorption and secretion of filtered urate. Moreover, baseline SUA appears to be set by the net balance of absorption and secretion across epithelial cells in the kidney and intestine. There have also been substantial advances in the management of gout in patients with CKD. The stage is set for an increasingly molecular understanding of baseline and regulated urate transport by the kidney and intestine. The increasing prevalence of gout with CKD will be balanced by an expanding spectrum of therapeutic options for this important disease.

Anemia in Frailty

PubMed Central

Roy, Cindy N.

2010-01-01

Synopsis While anemia is regarded as a relatively common occurrence in older adults, the vigor with which the medical community should intervene to correct this common problem is disputed. Epidemiologic data clearly correlate anemia with functional decline, disability and mortality. Anemia may contribute to functional decline by restricting oxygen delivery to muscle, or to cognitive decline by restricting oxygen delivery to the brain. On the other hand, the erythron may be a separate target of the same biological mediators that influence deterioration of physiologic systems that contribute to weakness, functional and cognitive decline and mortality. Clinical trials aimed to treat anemia in older adults could assess whether physical performance is improved or whether mortality risk declines with improved hemoglobin, but sufficient evidence from such trials is currently lacking. With few guidelines regarding treatment for older adults and significant risk for adverse events associated with transfusion and erythroid stimulating agents (ESA), anemia often goes untreated or ignored in geriatric clinics. This article reviews the problem of anemia in older adults, with a particular emphasis on the frail elderly. We will review the gaps in our evidence base for the treatment of anemia in older adults and assess options for advancing the field. PMID:21093723

Hyperferritinemia increases the risk of hyperuricemia in HFE-hereditary hemochromatosis.

PubMed

Flais, Jérémy; Bardou-Jacquet, Edouard; Deugnier, Yves; Coiffier, Guillaume; Perdriger, Aleth; Chalès, Gérard; Ropert, Martine; Loréal, Olivier; Guggenbuhl, Pascal

2017-05-01

Hyperuricemia is becoming increasingly frequent in the population, and is known to be sometimes the cause of gout. The impact of uric acid is still not clearly understood, however. The iron metabolism may interact with the uric acid metabolism. The aim of this study was to examine the relationship between the serum uric acid and serum ferritin levels in a cohort of hemochromatosis patients who were homozygous for the HFE p.Cys282Tyr mutation. 738 patients with the HFE gene mutation Cys282Tyr in the homozygous state were included in the study. The variables measured during the initial evaluation were compared in univariate analysis by Student's t test. In multivariate analysis, linear stepwise regression was used. In the group of hyperuricemic patients, ferritinemia was significantly higher than in the group of non-hyperuricemic patients (1576.7±1387.4μg/l vs. 1095.63±1319.24μg/l, P<0.005). With multivariate analysis, only ferritin and BMI independently explained the uricemia (R 2 =0.258) after adjustment for age, glycemia and CRP. The correlation between uricemia and log(ferritin) with partial regression correlation coefficients was 0.307 (P<0.01). The increase in uricemia is associated with the increase in ferritin in a population of patients who were homozygous for the HFE gene mutation p.Cys282Tyr and this independently of factors commonly associated with hyperuricemia. The increase in uric acid associated with hyperferritinemia, could be a response to the visceral toxicity of excess non-transferrin bound iron linked to oxidative stress via the antioxidant properties of uric acid. Copyright © 2016 Société française de rhumatologie. Published by Elsevier SAS. All rights reserved.

Short communication: Associations between blood glucose concentration, onset of hyperketonemia, and milk production in early lactation dairy cows.

PubMed

Ruoff, J; Borchardt, S; Heuwieser, W

2017-07-01

The objectives of this study were to describe the associations between hypoglycemia and the onset of hyperketonemia (HYK) within the first 6 wk of lactation, to evaluate the effects of body condition score at calving on glucose concentration, and to study the effects of hypoglycemia on milk production. A total of 621 dairy cows from 6 commercial dairy farms in Germany were enrolled between 1 and 4 d in milk (DIM). Cows were tested twice weekly using an electronic handheld meter for glucose and β-hydroxybutyrate (BHB), respectively, for a period of 42 d. Hypoglycemia was defined as glucose concentration ≤2.2 mmol/L. Hyperketonemia was defined as a BHB concentration ≥1.2 mmol/L. The onset of HYK was described as early onset (first HYK event within the first 2 wk postpartum) and late onset (first HYK event in wk 3 to 6 postpartum). The effect of ketosis status on blood glucose within 42 DIM was evaluated using a generalized linear mixed model. No effect was observed of HYK on glucose concentration in primiparous cows. Multiparous cows with early-onset HYK had a lower glucose concentration (-0.21 mmol/L) compared with nonketotic cows. Overall, primiparous cows had a lower prevalence and incidence of hypoglycemia than multiparous cows. Hypoglycemia in multiparous cows was associated with higher first test-day milk production and 100 DIM milk production. In conclusion, hypoglycemia mainly occurred in multiparous cows with early-onset HYK, whereas primiparous cows were at a lower risk for hypoglycemia. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Parameters of oxidative metabolism in neonates suffering from sepsis and anemia.

PubMed

Sanodze, N; Uberi, N; Uberi, E; Kulumbegov, B

2006-11-01

Neonatal sepsis still remains as one of the actual problems in modern medicine due to its high morbidity and mortality rates determined by diagnostic difficulties and absence of sufficient evidence for effective therapy. Literature data have shown that essential role in pathogenesis of sepsis belongs to the cellular oxidation-reduction misballance and development of the oxidative stress. The aim of our work was to assess indices of pro- and antioxidant systems in term neonates with sepsis on the background of anemia and without it. A total of 41 neonates (17 male, 24 female) with the age range from 3 to 7 days, with early sepsis, and in 2003-2005 years treated at the department of neonates' therapy and intensive care unit of pediatric clinics of the Tbilisi State Medical University were under observation. The control group involved 17 practically healthy neonates of the same age range. In consequence of the analyses there was ascertained, that with anemia increases intensification free-radical oxidation process. At the same time, antioxidant system activity was not change significantly in the sepsis with anemia, than other one. Pathogenesis of anemia may was founded undergo hemolitic anemia results by oxidative stress. According to the results of investigations could be concluded that in case of anemia developed at neonatal sepsis supports intensify of oxidative stress and at the same time anemia is the result of the oxidative stress.

Predicting onset of cannabis use in early adolescence: the interrelation between high-intensity pleasure and disruptive behavior. The TRAILS Study.

PubMed

Creemers, Hanneke E; van Lier, Pol A C; Vollebergh, Wilma A M; Ormel, Johan; Verhulst, Frank C; Huizink, Anja C

2009-11-01

Increased knowledge about the mechanisms by which some individuals are at risk for early onset of cannabis use might contribute to the improvement of prevention efforts. We focus on the roles of early-adolescent high-intensity pleasure, disruptive behavior, and their interplay in the prediction of onset of cannabis use 2 years later. Data from 81% (n = 1,804) of the participants (51.9% girls) of the Tracking Adolescents' Individual Lives Survey (TRAILS), a prospective general population study in the north of The Netherlands, were analyzed. Measures included parent-reported high-intensity pleasure, and parent- and self-reported general disruptive behavior, attention-deficit hyperactivity, oppositional problems, and conduct problems (Child Behavior Checklist/6-18 and Youth Self-Report) at ages 10-12. Onset of cannabis use was assessed at age 12-14 by means of self-reports. Analyses were carried out in Mplus. Early adolescent high-intensity pleasure and disruptive behavior, mainly conduct problems and to some extent attention-deficit hyperactivity, predicted the onset of cannabis use in adolescence. Although we found some mediation by general disruptive behavior, conduct problems, and attention-deficit hyperactivity, the contribution of high-intensity pleasure in predicting the onset of cannabis use was found to be mainly independent from disruptive behavior. The unique contribution of both high-intensity pleasure and disruptive behavior points in the direction of different pathways toward onset of cannabis use.

Early-Onset Acute Recurrent and Chronic Pancreatitis Is Associated with PRSS1 or CTRC Gene Mutations.

PubMed

Giefer, Matthew J; Lowe, Mark E; Werlin, Steven L; Zimmerman, Bridget; Wilschanski, Michael; Troendle, David; Schwarzenberg, Sarah Jane; Pohl, John F; Palermo, Joseph; Ooi, Chee Y; Morinville, Veronique D; Lin, Tom K; Husain, Sohail Z; Himes, Ryan; Heyman, Melvin B; Gonska, Tanja; Gariepy, Cheryl E; Freedman, Steven D; Fishman, Douglas S; Bellin, Melena D; Barth, Bradley; Abu-El-Haija, Maisam; Uc, Aliye

2017-07-01

To assess whether the age of onset was associated with unique features or disease course in pediatric acute recurrent pancreatitis (ARP) or chronic pancreatitis (CP). Demographic and clinical information on children with ARP or CP was collected at INSPPIRE (INternational Study Group of Pediatric Pancreatitis: In Search for a CuRE) centers. The Cochran-Armitage trend test and Jonckheere-Terpstra test were used to examine for differences between pediatric age groups (<6, 6-11, and ≥12 years). Between September 2012 and March 2016, 342 children with ARP or CP were enrolled; 129 (38%) were <6 years of age at the time of first diagnosis of acute pancreatitis, 111 (32%) were 6-11 years of age, and 102 (30%) were ≥12 years of age. Early-onset disease was associated with mutations in cationic trypsinogen (PRSS1) (P < .01), chymotrypsin C (CTRC) (P = .01), family history of acute pancreatitis (P = .02), family history of CP (P < .01), biliary cysts (P = .04), or chronic renal failure (P = .02). Later-onset disease was more commonly present with hypertriglyceridemia (P = .04), ulcerative colitis (P = .02), autoimmune diseases (P < .0001), or medication use (P < .01). Children with later-onset disease also were more likely to visit the emergency department (P < .05) or have diabetes (P < .01). Early-onset pancreatitis is associated strongly with PRSS1 or CTRC mutations and family history of pancreatitis. Children with later-onset disease are more likely to have nongenetic risk factors. Future studies are needed to investigate whether the disease course, response to therapy, or clinical outcomes differ relative to the timing of disease onset. Copyright © 2017 Elsevier Inc. All rights reserved.

Aplastic Anemia

MedlinePlus

Aplastic anemia is a rare but serious blood disorder. If you have it, your bone marrow doesn't make ... blood cells. There are different types, including Fanconi anemia. Causes include Toxic substances, such as pesticides, arsenic, ...

Differential HIF and NOS responses to acute anemia: defining organ-specific hemoglobin thresholds for tissue hypoxia.

PubMed

Tsui, Albert K Y; Marsden, Philip A; Mazer, C David; Sled, John G; Lee, Keith M; Henkelman, R Mark; Cahill, Lindsay S; Zhou, Yu-Qing; Chan, Neville; Liu, Elaine; Hare, Gregory M T

2014-07-01

Tissue hypoxia likely contributes to anemia-induced organ injury and mortality. Severe anemia activates hypoxia-inducible factor (HIF) signaling by hypoxic- and neuronal nitric oxide (NO) synthase- (nNOS) dependent mechanisms. However, organ-specific hemoglobin (Hb) thresholds for increased HIF expression have not been defined. To assess organ-specific Hb thresholds for tissue hypoxia, HIF-α (oxygen-dependent degradation domain, ODD) luciferase mice were hemodiluted to mild, moderate, or severe anemia corresponding to Hb levels of 90, 70, and 50 g/l, respectively. HIF luciferase reporter activity, HIF protein, and HIF-dependent RNA levels were assessed. In the brain, HIF-1α was paradoxically decreased at mild anemia, returned to baseline at moderate anemia, and then increased at severe anemia. Brain HIF-2α remained unchanged at all Hb levels. Both kidney HIF-1α and HIF-2α increased earlier (Hb ∼70-90 g/l) in response to anemia. Liver also exhibited an early HIF-α response. Carotid blood flow was increased early (Hb ∼70, g/l), but renal blood flow remained relatively constant, only increased at Hb of 50 g/l. Anemia increased nNOS (brain and kidney) and endothelia NOS (eNOS) (kidney) levels. Whereas anemia-induced increases in brain HIFα were nNOS-dependent, our current data demonstrate that increased renal HIFα was nNOS independent. HIF-dependent RNA levels increased linearly (∼10-fold) in the brain. However, renal HIF-RNA responses (MCT4, EPO) increased exponentially (∼100-fold). Plasma EPO levels increased near Hb threshold of 90 g/l, suggesting that the EPO response is sensitive. Collectively, these observations suggest that each organ expresses a different threshold for cellular HIF/NOS hypoxia responses. This knowledge may help define the mechanism(s) by which the brain and kidney maintain oxygen homeostasis during anemia. Copyright © 2014 the American Physiological Society.

Case report of an atypical early onset X-linked retinoschisis in monozygotic twins.

PubMed

Murro, Vittoria; Caputo, Roberto; Bacci, Giacomo Maria; Sodi, Andrea; Mucciolo, Dario Pasquale; Bargiacchi, Sara; Giglio, Sabrina Rita; Virgili, Gianni; Rizzo, Stanislao

2017-02-24

X-linked Retinoschisis (XLRS) is one of the most common macular degenerations in young males, with a worldwide prevalence ranging from 1:5000 to 1:20000. Clinical diagnosis of XLRS can be challenging due to the highly variable phenotypic presentation and limited correlation has been identified between mutation type and disease severity or progression. We report the atypical early onset of XLRS in 3-month-old monozygotic twins. Fundus examination was characterized by severe bullous retinal schisis with pre-retinal and intraretinal haemorrhages. Molecular genetic analysis of the RS1 was performed and the c.288G > A (p. Trp96Ter) mutation was detected in both patients. Early onset XLRS is associated with a more progressive form of the disease, characterized by large bullous peripheral schisis involving the posterior pole, vascular abnormalities and haemorrhages. The availability of specific technology permitted detailed imaging of the clinical picture of unusual cases of XLRS. The possible relevance of modifying genes should be taken into consideration for the future development of XLRS gene therapy.

Escherichia coli early-onset sepsis: trends over two decades.

PubMed

Mendoza-Palomar, Natalia; Balasch-Carulla, Milena; González-Di Lauro, Sabina; Céspedes, Maria Concepció; Andreu, Antònia; Frick, Marie Antoinette; Linde, Maria Ángeles; Soler-Palacin, Pere

2017-09-01

Escherichia coli early-onset sepsis (EOS) is an important cause of mortality and morbidity in neonates, especially in preterm and very low birth weight (VLBW) newborns. The aim of our study was to evaluate potential changes in the clinical and microbiological characteristics of E. coli EOS in our setting. Epidemiological, clinical, and microbiological data from all neonates with proven E. coli EOS from January 1994 to December 2014 were retrospectively collected in a single tertiary care hospital in Barcelona (Spain). Seventy-eight E. coli EOS cases were analyzed. A slight increase in the incidence of E. coli EOS was observed during the study period. VLBW newborns remained the group with higher incidence (10.4 cases per 1000 live births) and mortality (35.3%). Systematic use of PCR increased E. coli EOS diagnosis, mainly in the term newborn group. There was an increase in resistant E. coli strains causing EOS, with especially high resistance to ampicillin and gentamicin (92.8 and 28.6%, respectively). Nonetheless, resistant strains were not associated with poorer clinical outcomes. There is an urgent need to reconsider the empirical therapy used in neonatal EOS, particularly in VLBW newborns. What is Known: • E. coli early-onset sepsis (EOS) and E. coli resistant strains have been described as overall stable but increasing in VLBW neonates (< 1.500 g) in previous studies. What is New: • Our study shows an increasing incidence of E. coli EOS in all age groups, overruling group B Streptoccocus for the last 10 years. E. coli resistant strains also increased equally in all age groups, with high resistance rates to our first line antibiotics (ampicillin and gentamicin). • Empiric antibiotic therapy of EOS, mainly in VLBW newborns, should be adapted to this new scenario.

Attention-deficit/hyperactivity disorder in adolescence predicts onset of major depressive disorder through early adulthood.

PubMed

Meinzer, Michael C; Lewinsohn, Peter M; Pettit, Jeremy W; Seeley, John R; Gau, Jeff M; Chronis-Tuscano, Andrea; Waxmonsky, James G

2013-06-01

The aim of this study was to examine the prospective relationship between a history of attention-deficit/hyperactivity disorder (ADHD) assessed in mid-adolescence and the onset of major depressive disorder (MDD) through early adulthood in a large school-based sample. A secondary aim was to examine whether this relationship was robust after accounting for comorbid psychopathology and psychosocial impairment. One thousand five hundred seven participants from the Oregon Adolescent Depression Project completed rating scales in adolescence and structured diagnostic interviews up to four times from adolescence to age 30. Adolescents with a lifetime history of ADHD were at significantly higher risk of MDD through early adulthood relative to those with no history of ADHD. ADHD remained a significant predictor of MDD after controlling for gender, lifetime history of other psychiatric disorders in adolescence, social and academic impairment in adolescence, stress and coping in adolescence, and new onset of other psychiatric disorders through early adulthood (hazard ratio, 1.81; 95% confidence interval, 1.04, 3.06). Additional significant, robust predictors of MDD included female gender, a lifetime history of an anxiety disorder, and poor coping skills in mid-adolescence, as well as the onset of anxiety, oppositional defiant disorder, and substance-use disorder after mid-adolescence. A history of ADHD in adolescence was associated with elevated risk of MDD through early adulthood and this relationship remained significant after controlling for psychosocial impairment in adolescence and co-occurring psychiatric disorders. Additional work is needed to identify the mechanisms of risk and to inform depression prevention programs for adolescents with ADHD. © 2013 Wiley Periodicals, Inc.

Comparison of microbial pattern in early and late onset neonatal sepsis in referral center Haji Adam Malik hospital Medan Indonesia

NASA Astrophysics Data System (ADS)

Hasibuan, B. S.

2018-03-01

Neonatal sepsis contributes a significant rate of infants mortality and morbidity. The pathogens are diverse from region to another and change time to time even in the same place. To analyze the microbial pattern in early and late onset neonatal sepsis andthe pattern of antibiotic resistance of the causative microbes at one of referral center hospital in Indonesia, Haji Adam Malik Hospital, a cross-sectional descriptive study was conducted on neonates with sepsis diagnosis proven with positive blood culture within one year period (2015-2016). Among 626 neonates admitted to perinatology unit, the total of 154 neonates was proven to have neonatal sepsis with positive blood culture with the incidence rate 24.6%. Seventy-nine (51.3%) neonates were diagnosed with early onset sepsis while 75 (48,7%) neonates had late-onset sepsis. Klebsiella pneumonia was the most commonly isolated organism in both early and late onset sepsis, encompassing 19.5% of cases. Periodic surveillance of the causative agents of neonatal sepsis is needed to implement the rational, empirical choice of antibiotic prescription while waiting for blood culture result to come out.

Epidemiology of early-onset dementia: a review of the literature

PubMed Central

Vieira, Renata Teles; Caixeta, Leonardo; Machado, Sergio; Silva, Adriana Cardoso; Nardi, Antonio Egidio; Arias-Carrión, Oscar; Carta, Mauro Giovanni

2013-01-01

Presenile Dementia or Early Onset Dementia (EOD) is a public health problem, it differs from Senile Dementia, and encloses a significant number of cases; nevertheless, it is still poorly understood and underdiagnosed. This study aims to review the prevalence and etiology of EOD, comparing EOD with Senile Dementia, as well as to show the main causes of EOD and their prevalence in population and non-population based studies. The computer-supported search used the following databases: Pubmed/Medline, ISI Web of Knowledge and Scielo. The search terms were alcohol-associated dementia, Alzheimer’s disease, dementia, Creutzfeldt-jakob disease, dementia with lewy bodies, early onset dementia, frontotemporal lobar degeneration, Huntington’s disease, mixed dementia, neurodegenerative disorders, Parkinson’s disease dementia, presenile dementia, traumatic brain injury, vascular dementia. Only papers published in English and conducted from 1985 up to 2012 were preferentially reviewed. Neurodegenerative diseases are the most common etiologies seen in EOD. Among the general population, the prevalence of EOD was found to range between 0 to 700 per 100.000 habitants in groups of 25-64 years old, with an increasing incidence with age. The progression of EOD was found to range between 8.3 to 22.8 new cases per 100.000 in those aged under 65 years. Alzheimer's disease (AD) is the major etiology, followed by Vascular Dementia (VaD) and Frontotemporal Lobar Degeneration (FTLD). A larger number of epidemiological studies to elucidate how environmental issues contribute to EOD are necessary, thus, we can collaborate in the planning and prevention of services toward dementia patients. PMID:23878613

Sickle cell anemia - resources

MedlinePlus

Resources - sickle cell anemia ... The following organizations are good resources for information on sickle cell anemia : American Sickle Cell Anemia Association -- www.ascaa.org US National Library of Medicine -- ghr.nlm. ...

The Role of the Multiple Hormonal Dysregulation in the Onset of “Anemia of Aging”: Focus on Testosterone, IGF-1, and Thyroid Hormones

PubMed Central

Maggio, Marcello; De Vita, Francesca; Fisichella, Alberto; Lauretani, Fulvio; Ticinesi, Andrea; Ceresini, Graziano; Cappola, Anne; Ferrucci, Luigi; Ceda, Gian Paolo

2015-01-01

Anemia is a multifactorial condition whose prevalence increases in both sexes after the fifth decade of life. It is a highly represented phenomenon in older adults and in one-third of cases is “unexplained.” Ageing process is also characterized by a “multiple hormonal dysregulation” with disruption in gonadal, adrenal, and somatotropic axes. Experimental studies suggest that anabolic hormones such as testosterone, IGF-1, and thyroid hormones are able to increase erythroid mass, erythropoietin synthesis, and iron bioavailability, underlining a potential role of multiple hormonal changes in the anemia of aging. Epidemiological data more consistently support an association between lower testosterone and anemia in adult-older individuals. Low IGF-1 has been especially associated with anemia in the pediatric population and in a wide range of disorders. There is also evidence of an association between thyroid hormones and abnormalities in hematological parameters under overt thyroid and euthyroid conditions, with limited data on subclinical statuses. Although RCTs have shown beneficial effects, stronger for testosterone and the GH-IGF-1 axis and less evident for thyroid hormones, in improving different hematological parameters, there is no clear evidence for the usefulness of hormonal treatment in improving anemia in older subjects. Thus, more clinical and research efforts are needed to investigate the hormonal contribution to anemia in the older individuals. PMID:26779261

The Etiology and Clinical Course of Chronic Pancreatitis in Children With Early Onset of the Disease.

PubMed

Wejnarska, Karolina; Kolodziejczyk, Elwira; Wertheim-Tysarowska, Katarzyna; Dadalski, Maciej; Sobczynska-Tomaszewska, Agnieszka; Kierkus, Jarosław; Bal, Jerzy; Rygiel, Agnieszka Magdalena; Oracz, Grzegorz

2016-12-01

The etiological factors of chronic pancreatitis (CP) in children differ from those in adults. To date, no study has assessed the clinical course of CP in young children. The aim of our study was to evaluate the etiology and the clinical presentation of the disease in children with disease onset before 5 years of age in comparison to later-onset of CP. A total of 276 children with CP, hospitalized from 1988 to 2015, were enrolled in the study. Data on presentation, diagnostic findings, and treatment were reviewed. Two hundred sixty patients were screened for the most frequent mutations in major pancreatitis-associated genes, such as cationic trypsinogen/serine protease gene (PRSS1), serine protease inhibitor, Kazal type 1 gene (SPINK1), and cystic fibrosis transmembrane conductance regulator gene (CFTR). The disease onset before the age of 5 years occurred in 51 patients (group 1), the later onset in 225 patients (group 2). We found no significant discrepancies in distribution of the etiological factors between groups. The youngest patients (group 1) had more pancreatitis episodes (median 5.0 vs 3.00; P < 0.05) and underwent surgeries more frequently (25.5% vs 8.9%; P < 0.05). It could be associated with significantly longer follow-up in early onset group (median 6 vs 4 years; P < 0.05). There were no differences in nutritional status or exocrine and endocrine pancreatic function. Early- and later-onset pancreatitis have similar etiological factors with predominance of gene mutations. The most frequent mutation found was p.Asn34Ser (N34S) in SPINK1 gene. The clinical presentation differed in number of pancreatitis episodes and frequency of surgeries.

Understanding Tobacco Use Onset Among African Americans

PubMed Central

Colby, Suzanne M.; Lu, Bo; Ferketich, Amy K.

2016-01-01

Introduction: Compared to the majority of non-Hispanic white (“white”) cigarette smokers, many African American smokers demonstrate a later age of initiation. The goal of the present study was to examine African American late-onset smoking (ie, regular smoking beginning at age 18 or later) and determine whether late-onset (vs. early-onset) smoking is protective in terms of quit rates and health outcomes. Methods: We used data from the National Survey of Midlife Development in the United States (MIDUS) because the wide age range of participants (20–75 at baseline) allowed the examination of smoking cessation and mortality incidence across the lifespan. Results: Consistent with previous research, results indicated a later average age of smoking onset among African Americans, compared to whites. Disentangling effects of race from age-of-onset, we found that the cessation rate among late-onset African American smokers was 33%, whereas rates for early-onset African American smokers and early- and late-onset white smokers ranged from 52% to 57%. Finally, results showed that among white, low-socioeconomic status (SES) smokers, the hazard rate for mortality was greater among early- versus late-onset smokers; in contrast, among African American smokers (both low- and high-SES) hazard rates for mortality did not significantly differ among early- versus late-onset smokers. Conclusions: Although late (vs. early) smoking onset may be protective for whites, the present results suggest that late-onset may not be similarly protective for African Americans. Tobacco programs and regulatory policies focused on prevention should expand their perspective to include later ages of initiation, in order to avoid widening tobacco-related health disparities. Implications: This study indicates that late-onset smoking is not only the norm among African American adult smokers, but that late- versus early-onset smoking (ie, delaying onset) does not appear to afford any benefits for African

A novel CDKL5 mutation in a 47,XXY boy with the early-onset seizure variant of Rett syndrome.

PubMed

Sartori, Stefano; Di Rosa, Gabriella; Polli, Roberta; Bettella, Elisa; Tricomi, Giovanni; Tortorella, Gaetano; Murgia, Alessandra

2009-02-01

Mutations of the cyclin-dependent kinase-like 5 gene (CDKL5), reported almost exclusively in female subjects, have been recently found to be the cause of a phenotype overlapping Rett syndrome with early-onset epileptic encephalopathy. We describe the first CDKL5 mutation detected in a male individual with 47,XXY karyotype. This previously unreported, de novo, mutation truncates the large CDKL5 COOH-terminal region, thought to be crucial for the proper sub-cellular localization of the CDKL5 protein. The resulting phenotype is characterized by a severe early-onset epileptic encephalopathy, global developmental delay, and profound intellectual and motor impairment with features reminiscent of Rett syndrome. In light of the data presented we discuss the possible phenotypic modulatory effects of the supernumerary wild type X allele and pattern of X chromosome inactivation and stress the importance of considering the causal involvement of CDKL5 in developmentally delayed males with early-onset seizures. (c) 2009 Wiley-Liss, Inc.

IRAK-M Is Involved in the Pathogenesis of Early-Onset Persistent Asthma

PubMed Central

Balaci, Lenuta ; Spada, Maria Cristina ; Olla, Nazario ; Sole, Gabriella ; Loddo, Laura ; Anedda, Francesca ; Naitza, Silvia ; Zuncheddu, Maria Antonietta ; Maschio, Andrea ; Altea, Daniele ; Uda, Manuela ; Pilia, Sabrina ; Sanna, Serena ; Masala, Marco ; Crisponi, Laura ; Fattori, Matilde ; Devoto, Marcella ; Doratiotto, Silvia ; Rassu, Stefania ; Mereu, Simonetta ; Giua, Enrico ; Cadeddu, Natalina Graziella ; Atzeni, Roberto ; Pelosi, Umberto ; Corrias, Adriano ; Perra, Roberto ; Torrazza, Pier Luigi ; Pirina, Pietro ; Ginesu, Francesco ; Marcias, Silvano ; Schintu, Maria Grazia ; Giacco, Gennaro Sergio Del ; Manconi, Paolo Emilio ; Malerba, Giovanni ; Bisognin, Andrea ; Trabetti, Elisabetta ; Boner, Attilio ; Pescollderungg, Lydia ; Pignatti, Pier Franco ; Schlessinger, David ; Cao, Antonio ; Pilia, Giuseppe 

2007-01-01

Asthma is a multifactorial disease influenced by genetic and environmental factors. In the past decade, several loci and >100 genes have been found to be associated with the disease in at least one population. Among these loci, region 12q13-24 has been implicated in asthma etiology in multiple populations, suggesting that it harbors one or more asthma susceptibility genes. We performed linkage and association analyses by transmission/disequilibrium test and case-control analysis in the candidate region 12q13-24, using the Sardinian founder population, in which limited heterogeneity of pathogenetic alleles for monogenic and complex disorders as well as of environmental conditions should facilitate the study of multifactorial traits. We analyzed our cohort, using a cutoff age of 13 years at asthma onset, and detected significant linkage to a portion of 12q13-24. We identified IRAK-M as the gene contributing to the linkage and showed that it is associated with early-onset persistent asthma. We defined protective and predisposing SNP haplotypes and replicated associations in an outbred Italian population. Sequence analysis in patients found mutations, including inactivating lesions, in the IRAK-M coding region. Immunohistochemistry of lung biopsies showed that IRAK-M is highly expressed in epithelial cells. We report that IRAK-M is involved in the pathogenesis of early-onset persistent asthma. IRAK-M, a negative regulator of the Toll-like receptor/IL-1R pathways, is a master regulator of NF-κB and inflammation. Our data suggest a mechanistic link between hyperactivation of the innate immune system and chronic airway inflammation and indicate IRAK-M as a potential target for therapeutic intervention against asthma. PMID:17503328

Blood center practice and education for blood donors with anemia

PubMed Central

Delaney, Meghan; Schellhase, Kenneth G.; Young, Staci; Geiger, Susan; Fink, Arlene; Mast, Alan E.

2013-01-01

BACKGROUND Anemia is an early indicator of many diseases, yet blood donors with low hematocrit (Hct) often receive inadequate information about its medical importance. We sought to understand the types of information that are and should be provided to these donors. STUDY DESIGN AND METHODS Two companion studies were performed. The first investigated blood center practices for care of donors with low Hct including deferral length, information provided, and cutoff values used when referring donors for medical attention. The second was a randomized prospective pilot study comparing behavior of deferred donors receiving an “older” pamphlet providing a list of iron-rich foods or a “newer” pamphlet providing descriptions of common causes of anemia and advice for seeking medical attention. RESULTS More than 70% of centers defer donors for 1 day. Only 6% defer donors for more than 2 weeks. Most centers provide written and/or verbal information about low Hct. Only 35% have a cutoff value defining significant anemia that requires additional medical attention. In the study of donors with low Hct, significant disease was identified within 3 months after deferral in 2 of 104 subjects: metastatic lung cancer and acute lymphocytic leukemia. Only donors receiving the newer pamphlet reported that it “definitely improved” their ability to speak with their doctor about anemia. CONCLUSIONS The diagnosis of anemia in blood donors may be an indicator of significant undiagnosed disease. There are wide variations in how centers care for and educate donors with anemia. Donors with anemia should be provided improved and consistent educational information. PMID:20977487

Temporal trend of anemia among reproductive-aged women in India.

PubMed

Bharati, Susmita; Pal, Manoranjan; Som, Suparna; Bharati, Premananda

2015-03-01

Anemia is one of the major leading nutritional deficiencies in India, and the most vulnerable groups are preschool and adolescent children and pregnant and lactating women. The main objective of the study is to determine the temporal trend of anemia among reproductive-aged women of age 15-49 years. The study uses data from second and third rounds of the National Family Health Surveys (NFHS-2, 1998-1999, and NFHS-3, 2005-2006), conducted by the International Institute for Population Sciences. The dependent variable was the status of anemia of women. The determining variables were type of residence, age group, religion and castes, educational status, marital status, and household standard of living index. Anemia was most prevalent in the east zone for both the periods. The changes at the all India level were not much, but the north-east zone improved very well, whereas the south zone deteriorated drastically. The occurrence of severely anemic women in India varied between 1% and 2%. The highest prevalence rates were observed among women who were 15 to 24 years of age, illiterate, from non-Christian scheduled tribes (STs), unmarried, and whose standard of living was low. Rates of anemia have increased over time except in the case of Buddhists, Parsees, Jains, and the STs. From the viewpoint of our study, illiteracy and low standard of living may be the main causes of anemia among women in India. It is also necessary to take appropriate steps to curb anemia in women in their early adulthood. © 2012 APJPH.

Co-occurring problems of early onset persistent, childhood limited, and adolescent onset conduct problem youth.

PubMed

Barker, Edward D; Oliver, Bonamy R; Maughan, Barbara

2010-11-01

It is increasingly recognized that youth who follow early onset persistent (EOP), childhood limited (CL) and adolescent onset (AO) trajectories of conduct problems show somewhat varying patterns of risk (in childhood) and adjustment problems (in adolescence and adulthood). Little, however, is known about how other adjustment problems differentially co-develop with the EOP, CL and AO trajectories across the childhood and adolescent years. Using data from the Avon Longitudinal Study of Parents and Children, an epidemiological, longitudinal cohort of boys and girls, we estimated growth curves for parent-reported hyperactivity, emotional difficulties, peer relational problems, and prosocial behaviors conditional on trajectories of conduct problems (i.e., EOP, CL and AO) from ages 4 to 13 years. At ages 7-8 years, DSM-IV-based diagnoses of conduct disorder, oppositional-defiant disorder, attention deficit/hyperactivity disorder (ADHD), anxiety, depression were examined by conduct problems trajectory. Overall, the development of hyperactivity, emotional difficulties, peer relational problems, and prosocial behaviors mirrored the development of conduct problems, showing similar trajectories. Results indicated that the problems of EOP youth were persistent across domains, CL youth showed decreased behavior problems while increasing in prosocial behaviors, and AO youth increased in adjustment problems after 10 years of age. © 2010 The Authors. Journal of Child Psychology and Psychiatry © 2010 Association for Child and Adolescent Mental Health.

Fanconi's Anemia Effect or Sickle Cell Anemia Effect: That is the Question.

PubMed

Unal, Sule; Chui, David H K; Gumruk, Fatma

2015-01-01

A 16-year-old boy who was diagnosed to have sickle cell anemia was referred to our center. The parental consanguinity, growth retardation and dysmorphic features prompted a search for possible Fanconi's Anemia (FA). The diepoxybutane (DEB) test was positive, confirming FA. The interaction of both diseases might account for his relatively mild phenotype in terms of both sickle cell anemia (or Hb S, HBB: c.20A > T) and FA. The high Hb F level that might be related to concomitant FA, may have caused a milder phenotype of sickle cell anemia, whereas nitric oxide (NO) depletion as a consequence of sickle cell anemia, may have caused a delay in the bone marrow failure of FA.

[The clinical significance of hepcidin detection in the patients with anemia and rheumatoid arthritis].

PubMed

Galushko, E A

2014-01-01

The prevalence of anemia in patients with rheumatoid arthritis (RA) varies from 30 to 70%. 25% of the cases are diagnosed within 1 year after onset of the disease. On the whole, anemia in RA is described as anemia of a chronic disease (ACD). Pathogenesis ofACD is a multifactor process underlain by an immune mechanism: cytokines and cells ofthe reticuloendothelial system cause changes in iron homeostasis, proliferation of erythroid precursors, erythropoietin production and lifespan of erythrocytes. The key pathogenetic factor is disordered iron metabolism. IL-6 increasing hepatic production acute-phase protein (hepcidin) is the most important cytokine involved in ACD pathogenesis. Hence the necessity to measure its serum level for differential diagnostics of anemic syndrome in patients with RA and the choice of effective basal therapy. Recent data on the therapeutic potency of tocilizumab (IL-6 receptor inhibitor) demonstrate not its safety and sustainable beneficial clinical effect in combination with the favourable action on hemoglobin profile and reduction offatigue.

Association Between Early-Onset Parkinson Disease and 22q11.2 Deletion Syndrome

PubMed Central

Butcher, Nancy J.; Kiehl, Tim-Rasmus; Hazrati, Lili-Naz; Chow, Eva W. C.; Rogaeva, Ekaterina; Lang, Anthony E.; Bassett, Anne S.

2015-01-01

IMPORTANCE Clinical case reports of parkinsonism co-occurring with hemizygous 22q11.2 deletions and the associated multisystem syndrome, 22q11.2 deletion syndrome (22q11.2DS), suggest that 22q11.2 deletions may lead to increased risk of early-onset Parkinson disease (PD). The frequency of PD and its neuropathological presentation remain unknown in this common genetic condition. OBJECTIVE To evaluate a possible association between 22q11.2 deletions and PD. DESIGN, SETTING, AND PARTICIPANTS An observational study of the occurrence of PD in the world’s largest cohort of well-characterized adults with a molecularly confirmed diagnosis of 22q11.2DS (n = 159 [6 with postmortem tissue]; age range, 18.1–68.6 years) was conducted in Toronto, Ontario, Canada. Rare postmortem brain tissue from individuals with 22q11.2DS and a clinical history of PD was investigated for neurodegenerative changes and compared with that from individuals with no history of a movement disorder. MAIN OUTCOMES AND MEASURES A clinical diagnosis of PD made by a neurologist and neuropathological features of PD. RESULTS Adults with 22q11.2DS had a significantly elevated occurrence of PD compared with standard population estimates (standardized morbidity ratio = 69.7; 95% CI, 19.0–178.5). All cases showed early onset and typical PD symptom pattern, treatment response, and course. All were negative for family history of PD and known pathogenic PD-related mutations. The common use of antipsychotics in patients with 22q11.2DS to manage associated psychiatric symptoms delayed diagnosis of PD by up to 10 years. Postmortem brain tissue revealed classic loss of midbrain dopaminergic neurons in all 3 postmortem 22q11.2DS-PD cases. Typical α-synuclein–positive Lewy bodies were present in the expected distribution in 2 cases but absent in another. CONCLUSIONS AND RELEVANCE These findings suggest that 22q11.2 deletions represent a novel genetic risk factor for early-onset PD with variable neuropathological

Fanconi Anemia Research Fund

MedlinePlus

... Publications Fundraising News What is the Fanconi Anemia Research Fund? Fanconi anemia is an inherited disease that can ... Lynn and Dave Frohnmayer started the Fanconi Anemia Research Fund, in 1989 to find effective treatments and ...

Early Onset Ageing and Service Preparation in People with Intellectual Disabilities: Institutional Managers' Perspective

ERIC Educational Resources Information Center

Lin, Jin-Ding; Wu, Chia-Ling; Lin, Pei-Ying; Lin, Lan-Ping; Chu, Cordia M.

2011-01-01

Although longevity among older adults with intellectual disabilities is increasing, there is limited information on their premature aging related health characteristics and how it may change with increasing age. The present paper provides information of the institutional manager's perception on early onset aging and service preparation for this…

Early-Onset Chronic Obstructive Pulmonary Disease Is Associated with Female Sex, Maternal Factors, and African American Race in the COPDGene Study

PubMed Central

Foreman, Marilyn G.; Zhang, Lening; Murphy, James; Hansel, Nadia N.; Make, Barry; Hokanson, John E.; Washko, George; Regan, Elizabeth A.; Crapo, James D.; Silverman, Edwin K.

2011-01-01

Rationale: The characterization of young adults who develop late-onset diseases may augment the detection of novel genes and promote new pathogenic insights. Methods: We analyzed data from 2,500 individuals of African and European ancestry in the COPDGene Study. Subjects with severe, early-onset chronic obstructive pulmonary disease (COPD) (n = 70, age < 55 yr, FEV1 < 50% predicted) were compared with older subjects with COPD (n = 306, age > 64 yr, FEV1 < 50% predicted). Measurements and Main Results: Subjects with severe, early-onset COPD were predominantly females (66%), P = 0.0004. Proportionally, early-onset COPD was seen in 42% (25 of 59) of African Americans versus 14% (45 of 317) of non-Hispanic whites, P < 0.0001. Other risk factors included current smoking (56 vs. 17%, P < 0.0001) and self-report of asthma (39 vs. 25%, P = 0.008). Maternal smoking (70 vs. 44%, P = 0.0001) and maternal COPD (23 vs. 12%, P = 0.03) were reported more commonly in subjects with early-onset COPD. Multivariable regression analysis found association with African American race, odds ratio (OR), 7.5 (95% confidence interval [CI], 2.3–24; P = 0.0007); maternal COPD, OR, 4.7 (95% CI, 1.3–17; P = 0.02); female sex, OR, 3.1 (95% CI, 1.1–8.7; P = 0.03); and each pack-year of smoking, OR, 0.98 (95% CI, 0.96–1.0; P = 0.03). Conclusions: These observations support the hypothesis that severe, early-onset COPD is prevalent in females and is influenced by maternal factors. Future genetic studies should evaluate (1) gene-by-sex interactions to address sex-specific genetic contributions and (2) gene-by-race interactions. PMID:21562134

Gene expression profiling at birth characterizing the preterm infant with early onset infection.

PubMed

Hilgendorff, Anne; Windhorst, Anita; Klein, Manuel; Tchatalbachev, Svetlin; Windemuth-Kieselbach, Christine; Kreuder, Joachim; Heckmann, Matthias; Gkatzoflia, Anna; Ehrhardt, Harald; Mysliwietz, Josef; Maier, Michael; Izar, Benjamin; Billion, Andre; Gortner, Ludwig; Chakraborty, Trinad; Hossain, Hamid

2017-02-01

Early onset infection (EOI) in preterm infants <32 weeks gestational age (GA) is associated with a high mortality rate and the development of severe acute and long-term complications. The pathophysiology of EOI is not fully understood and clinical and laboratory signs of early onset infections in this patient cohort are often not conclusive. Thus, the aim of this study was to identify signatures characterizing preterm infants with EOI by using genome-wide gene expression (GWGE) analyses from umbilical arterial blood of preterm infants. This prospective cohort study was conducted in preterm infants <32 weeks GA. GWGE analyses using CodeLink human microarrays were performed from umbilical arterial blood of preterm infants with and without EOI. GWGE analyses revealed differential expression of 292 genes in preterm infants with EOI as compared to infants without EOI. Infants with EOI could be further differentiated into two subclasses and were distinguished by the magnitude of the expression of genes involved in both neutrophil and T cell activation. A hallmark activity for both subclasses of EOI was a common suppression of genes involved in natural killer (NK) cell function, which was independent from NK cell numbers. Significant results were recapitulated in an independent validation cohort. Gene expression profiling may enable early and more precise diagnosis of EOI in preterm infants. Gene expression (GE) profiling at birth characterizes preterm infants with EOI. GE analysis indicates dysregulation of NK cell activity. NK cell activity at birth may be a useful marker to improve early diagnosis of EOI.

Impact of DNA testing for early-onset familial Alzheimer disease and frontotemporal dementia.

PubMed

Steinbart, E J; Smith, C O; Poorkaj, P; Bird, T D

2001-11-01

DNA testing of persons at risk for hereditary, degenerative neurologic diseases is relatively new. Only anecdotal reports of such testing in familial Alzheimer disease (FAD) exist, and little is know about the personal and social impact of such testing. In a descriptive, observational study, individuals at 50% risk for autosomal dominant, early-onset FAD or frontotemporal dementia with parkinsonism linked to chromosome 17 underwent DNA testing for the genetic mutations previously identified in affected family members. Individuals were followed up for (1/2) to 3 years and were interviewed regarding attitudes toward the testing process and the impact of the results. Twenty-one (8.4%) of 251 persons at risk for FAD or frontotemporal dementia requested genetic testing. The most common reasons for requesting testing were concern about early symptoms of dementia, financial or family planning, and relief from anxiety. Twelve individuals had positive DNA test results, and 6 of these had early symptoms of dementia; 8 had negative results; and 1 has not yet received results. Of 14 asymptomatic individuals completing testing, 13 believed the testing was beneficial. Two persons reported moderate anxiety and 1 reported moderate depression. As expected, persons with negative test results had happier experiences overall, but even they had to deal with ongoing anxiety and depression. Thus far, there have been no psychiatric hospitalizations, suicide attempts, or denials of insurance. Genetic testing in early-onset FAD and frontotemporal dementia can be completed successfully. Most individuals demonstrate effective coping skills and find the testing to be beneficial, but long-term effects remain unknown.

The Prevalence of Anemia and Moderate-Severe Anemia in the US Population (NHANES 2003-2012)

PubMed Central

2016-01-01

Since anemia is associated with poor health outcomes, the prevalence of anemia is a significant public health indicator. Even though anemia is primarily caused by iron deficiency, low oxygen-carrying capacity may result from other conditions such as chronic diseases, which remain a relevant health concern in the United States. However, studies examining current rates of anemia in the total US population and in more specific subgroups are limited. Data from five National Health and Nutrition Examination Surveys (NHANES) from 2003 to 2012 were analyzed to assess two outcomes: anemia and moderate-severe anemia, which were based upon serum hemoglobin levels (Hb) as per World Health Organization (WHO) definitions. Statistical analysis using SAS examined temporal trends and the prevalence of anemia among sexes, age groups, and races/ethnicities. The study estimated that an average of 5.6% of the U.S. population met the criteria for anemia and 1.5% for moderate-severe anemia during this 10-year period. High-risk groups such as pregnant women, elderly persons, women of reproductive age, non-Hispanic blacks, and Hispanics were identified, and relationships between multiple risk factors were examined. Rates of anemia in men increased monotonically with age, while that of women increased bimodally with peaks in age group 40–49 years and 80–85 years. The effect of risk factors was observed to compound. For instance, the prevalence of anemia in black women aged 80–85 years was 35.6%, 6.4 times higher than the population average. Moreover, anemia is a growing problem because of the increased prevalence of anemia (4.0% to 7.1%) and moderate-severe anemia (1.0% to 1.9%), which nearly doubled from 2003–2004 to 2011–2012. Thus, these results augment the current knowledge on anemia prevalence, severity, and distribution among subgroups in the US and raised anemia as an issue that requires urgent public health intervention. PMID:27846276

The Prevalence of Anemia and Moderate-Severe Anemia in the US Population (NHANES 2003-2012).

PubMed

Le, Chi Huu Hong

2016-01-01

Since anemia is associated with poor health outcomes, the prevalence of anemia is a significant public health indicator. Even though anemia is primarily caused by iron deficiency, low oxygen-carrying capacity may result from other conditions such as chronic diseases, which remain a relevant health concern in the United States. However, studies examining current rates of anemia in the total US population and in more specific subgroups are limited. Data from five National Health and Nutrition Examination Surveys (NHANES) from 2003 to 2012 were analyzed to assess two outcomes: anemia and moderate-severe anemia, which were based upon serum hemoglobin levels (Hb) as per World Health Organization (WHO) definitions. Statistical analysis using SAS examined temporal trends and the prevalence of anemia among sexes, age groups, and races/ethnicities. The study estimated that an average of 5.6% of the U.S. population met the criteria for anemia and 1.5% for moderate-severe anemia during this 10-year period. High-risk groups such as pregnant women, elderly persons, women of reproductive age, non-Hispanic blacks, and Hispanics were identified, and relationships between multiple risk factors were examined. Rates of anemia in men increased monotonically with age, while that of women increased bimodally with peaks in age group 40-49 years and 80-85 years. The effect of risk factors was observed to compound. For instance, the prevalence of anemia in black women aged 80-85 years was 35.6%, 6.4 times higher than the population average. Moreover, anemia is a growing problem because of the increased prevalence of anemia (4.0% to 7.1%) and moderate-severe anemia (1.0% to 1.9%), which nearly doubled from 2003-2004 to 2011-2012. Thus, these results augment the current knowledge on anemia prevalence, severity, and distribution among subgroups in the US and raised anemia as an issue that requires urgent public health intervention.

Management of Anemia in Patients with Inflammatory Bowel Disease (IBD).

PubMed

Patel, Dhruvan; Trivedi, Chinmay; Khan, Nabeel

2018-03-01

Anemia is the most common complication as well as an extra intestinal manifestation of inflammatory bowel disease (IBD). It is associated with a significant impact on patient's quality of life (QoL); as well it represents a common cause of frequent hospitalization, delay of hospital inpatient discharge and overall increased healthcare burden. In spite of all these, anemia is still often underdiagnosed and undertreated. Our aim in this review is to provide a pathway for physicians to help them achieve early diagnosis as well as timely and appropriate treatment of anemia which in turn would hopefully reduce the prevalence and subsequent complications of this condition among IBD patients. The etiology of anemia among IBD patients is most commonly due to iron deficiency anemia (IDA) followed by anemia of chronic disease. Despite this, more than a third of anemic ulcerative colitis (UC) patients are not tested for IDA and among those tested and diagnosed with IDA, a quarter are not treated with iron replacement therapy. A new algorithm has been validated to predict who will develop moderate to severe anemia at the time of UC diagnosis. While oral iron is effective for the treatment of mild iron deficiency-related anemia, the absorption of iron is influenced by chronic inflammatory states as a consequence of the presence of elevated levels of hepcidin. Also, it is important to recognize that ferritin is elevated in chronic inflammatory states and among patients with active IBD, ferritin levels less than 100 are considered to be diagnostic of iron deficiency. Newer formulations of intra-venous (IV) iron have a good safety profile and can be used for replenishment of iron stores and prevention of iron deficiency in the future. Routine screening for anemia is important among patients with IBD. The cornerstone for the accurate management of anemia in IBD patients lies in accurately diagnosing the type of anemia. All IBD patients with IDA should be considered appropriate for

Food and nutrition insecurity indicators associated with iron deficiency anemia in Brazilian children: a systematic review.

PubMed

André, Hercilio Paulino; Sperandio, Naiara; Siqueira, Renata Lopes de; Franceschini, Sylvia do Carmo Castro; Priore, Silvia Eloiza

2018-04-01

This study aimed to review food and nutrition insecurity indicators associated with iron deficiency anemia in Brazilian children below 5 years. We searched in electronic databases (SciELO, Lilacs, and Medline) and selected studies by titles, abstracts and full-text reading. Of the 1,023 studies analyzed, 11 fit the inclusion criteria. The results of the studies evidenced that iron deficiency anemia in Brazilian children was associated with sociodemographic and health indicators (male, age below 24 months, children of adolescent mothers, respiratory infections, diarrhea, low maternal schooling, parents' working conditions, nursery time, lack of basic sanitation, maternal anemia, lack of ferrous sulfate use by the mother and/or child and late onset of prenatal care), nutritional indicators (low birth weight, diet characteristics, such as the habit of milk consumption close to meals, low exclusive and full breastfeeding time) and economic indicators (low per capita income). The food and nutrition insecurity analyzed in this study from the perspective of different indicators is associated with iron deficiency anemia in children under 5 years in Brazil.

Early-Onset Central Diabetes Insipidus due to Compound Heterozygosity for AVP Mutations.

PubMed

Bourdet, Karine; Vallette, Sophie; Deladoëy, Johnny; Van Vliet, Guy

2016-01-01

Genetic cases of isolated central diabetes insipidus are rare, are mostly due to dominant AVP mutations and have a delayed onset of symptoms. Only 3 consanguineous pedigrees with a recessive form have been published. A boy with a negative family history presented polyuria and failure to thrive in the first months of life and was diagnosed with central diabetes insipidus. Magnetic resonance imaging showed a normal posterior pituitary signal. A molecular genetic analysis of the AVP gene showed that he had inherited a previously reported mutation from his Lebanese father and a novel A>G transition in the splice acceptor site of intron 1 (IVS1-2A>G) from his French-Canadian mother. Replacement therapy resulted in the immediate disappearance of symptoms and in weight gain. The early polyuria in recessive central diabetes insipidus contrasts with the delayed presentation in patients with monoallelic AVP mutations. This diagnosis needs to be considered in infants with very early onset of polyuria-polydipsia and no brain malformation, even if there is no consanguinity and regardless of whether the posterior pituitary is visible or not on imaging. In addition to informing family counseling, making a molecular diagnosis eliminates the need for repeated imaging studies. © 2015 S. Karger AG, Basel.

Fanconi anemia

MedlinePlus

Fanconi anemia is due to an abnormal gene that damages cells, which keeps them from repairing damaged DNA. To inherit Fanconi anemia, a person must get 1 copy of the abnormal gene from each parent. The condition is most often diagnosed in children between 2 ...

POLE and POLD1 screening in 155 patients with multiple polyps and early-onset colorectal cancer

PubMed Central

Esteban-Jurado, Clara; Giménez-Zaragoza, David; Muñoz, Jenifer; Franch-Expósito, Sebastià; Álvarez-Barona, Miriam; Ocaña, Teresa; Cuatrecasas, Miriam; Carballal, Sabela; López-Cerón, María; Marti-Solano, Maria; Díaz-Gay, Marcos; van Wezel, Tom; Castells, Antoni; Bujanda, Luis; Balmaña, Judith; Gonzalo, Victoria; Llort, Gemma; Ruiz-Ponte, Clara; Cubiella, Joaquín; Balaguer, Francesc; Aligué, Rosa; Castellví-Bel, Sergi

2017-01-01

Germline mutations in POLE and POLD1 have been shown to cause predisposition to colorectal multiple polyposis and a wide range of neoplasms, early-onset colorectal cancer being the most prevalent. In order to find additional mutations affecting the proofreading activity of these polymerases, we sequenced its exonuclease domain in 155 patients with multiple polyps or an early-onset colorectal cancer phenotype without alterations in the known hereditary colorectal cancer genes. Interestingly, none of the previously reported mutations in POLE and POLD1 were found. On the other hand, among the genetic variants detected, only two of them stood out as putative pathogenic in the POLE gene, c.1359 + 46del71 and c.1420G > A (p.Val474Ile). The first variant, detected in two families, was not proven to alter correct RNA splicing. Contrarily, c.1420G > A (p.Val474Ile) was detected in one early-onset colorectal cancer patient and located right next to the exonuclease domain. The pathogenicity of this change was suggested by its rarity and bioinformatics predictions, and it was further indicated by functional assays in Schizosaccharomyces pombe. This is the first study to functionally analyze a POLE genetic variant outside the exonuclease domain and widens the spectrum of genetic changes in this DNA polymerase that could lead to colorectal cancer predisposition. PMID:28423643

Early-onset neonatal sepsis is associated with a high heart rate during automatically selected stationary periods.

PubMed

Nguyen, Nga; Vandenbroucke, Laurent; Hernández, Alfredo; Pham, Tu; Beuchée, Alain; Pladys, Patrick

2017-05-01

This study examined the heart rate variability characteristics associated with early-onset neonatal sepsis in a prospective, observational controlled study. Eligible patients were full-term neonates hospitalised with clinical signs that suggested early-onset sepsis and a C-reactive protein of >10 mg/L. Sepsis was considered proven in cases of symptomatic septicaemia, meningitis, pneumonia or enterocolitis. Heart rate variability parameters (n = 16) were assessed from five-, 15- and 30-minute stationary sequences automatically selected from electrocardiographic recordings performed at admission and compared with a control group using the U-test with post hoc Benjamini-Yekutieli correction. Stationary sequences corresponded to the periods with the lowest changes of heart rate variability over time. A total of 40 full-term infants were enrolled, including 14 with proven sepsis. The mean duration of the cardiac cycle length was lower in the proven sepsis group than in the control group (n = 11), without other significant changes in heart rate variability parameters. These durations, measured in five-minute stationary periods, were 406 (367-433) ms in proven sepsis group versus 507 (463-522) ms in the control group (p < 0.05). Early-onset neonatal sepsis was associated with a high mean heart rate measured during automatically selected stationary periods. ©2017 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

A neonate with intestinal volvulus without malrotation exhibiting early jaundice with a suspected fetal onset.

PubMed

Hara, Kaori; Kinoshita, Mari; Kin, Takane; Arimitsu, Takeshi; Matsuzaki, Yohei; Ikeda, Kazushige; Tomita, Hiroshi; Fujino, Akihiro; Kuroda, Tatsuo

2015-01-01

Intestinal volvulus without malrotation is a rare disease that causes volvulus of the small intestine despite normal intestinal rotation and fixation. We encountered a neonate with this disease who developed early jaundice and was suspected to have a fetal onset. This patient was characterized by early jaundice complicating intestinal volvulus without malrotation and is considered to have exhibited reduced fetal movement and early jaundice as a result of volvulus, necrosis, and hemorrhage of the small intestine in the fetal period. If abdominal distention accompanied by early jaundice is noted in a neonate, intestinal volvulus without malrotation and associated intraabdominal hemorrhage should be suspected and promptly treated.

Iron deficiency anemia and megaloblastic anemia in obese patients.

PubMed

Arshad, Mahmoud; Jaberian, Sara; Pazouki, Abdolreza; Riazi, Sajedeh; Rangraz, Maryam Aghababa; Mokhber, Somayyeh

2017-03-01

The association between obesity and different types of anemia remained uncertain. The present study aimed to assess the relation between obesity parameters and the occurrence of iron deficiency anemia and also megaloblastic anemia among Iranian population. This cross-sectional study was performed on 1252 patients with morbid obesity that randomly selected from all patients referred to Clinic of obesity at Rasoul-e-Akram Hospital in 2014. The morbid obesity was defined according to the guideline as body mass index (BMI) equal to or higher than 40 kg/m2. Various laboratory parameters including serum levels of hemoglobin, iron, ferritin, folic acid, and vitamin B12 were assessed using the standard laboratory techniques. BMI was adversely associated with serum vitamin B12, but not associated with other hematologic parameters. The overall prevalence of iron deficiency anemia was 9.8%. The prevalence of iron deficiency anemia was independent to patients' age and also to body mass index. The prevalence of vitamin B12 deficiency was totally 20.9%. According to the multivariable logistic regression model, no association was revealed between BMI and the occurrence of iron deficiency anemia adjusting gender and age. A similar regression model showed that higher BMI could predict occurrence of vitamin B12 deficiency in morbid obese patients. Although iron deficiency is a common finding among obese patients, vitamin B12 deficiency is more frequent so about one-fifth of these patients suffer vitamin B12 deficiency. In fact, the exacerbation of obesity can result in exacerbation of vitamin B12 deficiency.

Increased regional cerebral blood flow but normal distribution of GABAA receptor in the visual cortex of subjects with early-onset blindness.

PubMed

Mishina, Masahiro; Senda, Michio; Kiyosawa, Motohiro; Ishiwata, Kiichi; De Volder, Anne G; Nakano, Hideki; Toyama, Hinako; Oda, Kei-ichi; Kimura, Yuichi; Ishii, Kenji; Sasaki, Touru; Ohyama, Masashi; Komaba, Yuichi; Kobayashi, Shirou; Kitamura, Shin; Katayama, Yasuo

2003-05-01

Before the completion of visual development, visual deprivation impairs synaptic elimination in the visual cortex. The purpose of this study was to determine whether the distribution of central benzodiazepine receptor (BZR) is also altered in the visual cortex in subjects with early-onset blindness. Positron emission tomography was carried out with [(15)O]water and [(11)C]flumazenil on six blind subjects and seven sighted controls at rest. We found that the CBF was significantly higher in the visual cortex for the early-onset blind subjects than for the sighted control subjects. However, there was no significant difference in the BZR distribution in the visual cortex for the subject with early-onset blindness than for the sighted control subjects. These results demonstrated that early visual deprivation does not affect the distribution of GABA(A) receptors in the visual cortex with the sensitivity of our measurements. Synaptic elimination may be independent of visual experience in the GABAergic system of the human visual cortex during visual development.

Prevalence and Spectrum of Germline Cancer Susceptibility Gene Mutations Among Patients With Early-Onset Colorectal Cancer

PubMed Central

Pearlman, Rachel; Frankel, Wendy L.; Swanson, Benjamin; Zhao, Weiqiang; Yilmaz, Ahmet; Miller, Kristin; Bacher, Jason; Bigley, Christopher; Nelsen, Lori; Goodfellow, Paul J.; Goldberg, Richard M.; Paskett, Electra; Shields, Peter G.; Freudenheim, Jo L.; Stanich, Peter P; Lattimer, Ilene; Arnold, Mark; Liyanarachchi, Sandya; Kalady, Matthew; Heald, Brandie; Greenwood, Carla; Paquette, Ian; Prues, Marla; Draper, David J.; Lindeman, Carolyn; Kuebler, J. Philip; Reynolds, Kelly; Brell, Joanna M.; Shaper, Amy A.; Mahesh, Sameer; Buie, Nicole; Weeman, Kisa; Shine, Kristin; Haut, Mitchell; Edwards, Joan; Bastola, Shyamal; Wickham, Karen; Khanduja, Karamjit S.; Zacks, Rosemary; Pritchard, Colin C.; Shirts, Brian H.; Jacobson, Angela; Allen, Brian; de la Chapelle, Albert; Hampel, Heather

2017-01-01

IMPORTANCE Hereditary cancer syndromes infer high cancer risks and require intensive cancer surveillance, yet the prevalence and spectrum of these conditions among unselected patients with early-onset colorectal cancer (CRC) is largely undetermined. OBJECTIVE To determine the frequency and spectrum of cancer susceptibility gene mutations among patients with early-onset CRC. DESIGN, SETTING, AND PARTICIPANTS Overall, 450 patients diagnosed with colorectal cancer younger than 50 years were prospectively accrued from 51 hospitals into the Ohio Colorectal Cancer Prevention Initiative from January 1, 2013, to June 20, 2016. Mismatch repair (MMR) deficiency was determined by microsatellite instability and/or immunohistochemistry. Germline DNA was tested for mutations in 25 cancer susceptibility genes using next-generation sequencing. MAIN OUTCOMES AND MEASURES Mutation prevalence and spectrum in patients with early-onset CRC was determined. Clinical characteristics were assessed by mutation status. RESULTS In total 450 patients younger than 50 years were included in the study, and 75 gene mutations were found in 72 patients (16%). Forty-eight patients (10.7%) had MMR-deficient tumors, and 40 patients (83.3%) had at least 1 gene mutation: 37 had Lynch syndrome (13, MLH1 [including one with constitutional MLH1 methylation]; 16, MSH2; 1, MSH2/monoallelic MUTYH; 2, MSH6; 5, PMS2); 1 patient had the APC c.3920T>A, p.I1307K mutation and a PMS2 variant; 9 patients (18.8%) had double somatic MMR mutations (including 2 with germline biallelic MUTYH mutations); and 1 patient had somatic MLH1 methylation. Four hundred two patients (89.3%) had MMR-proficient tumors, and 32 patients (8%) had at least 1 gene mutation: 9 had mutations in high-penetrance CRC genes (5, APC; 1, APC/PMS2; 2, biallelic MUTYH; 1, SMAD4); 13 patients had mutations in high- or moderate-penetrance genes not traditionally associated with CRC (3, ATM; 1, ATM/CHEK2; 2, BRCA1; 4, BRCA2; 1, CDKN2A; 2, PALB2); 10

Rare causes of early-onset dystonia-parkinsonism with cognitive impairment: a de novo PSEN-1 mutation.

PubMed

Carecchio, Miryam; Picillo, Marina; Valletta, Lorella; Elia, Antonio E; Haack, Tobias B; Cozzolino, Autilia; Vitale, Annalisa; Garavaglia, Barbara; Iuso, Arcangela; Bagella, Caterina F; Pappatà, Sabina; Barone, Paolo; Prokisch, Holger; Romito, Luigi; Tiranti, Valeria

2017-07-01

Mutations in PSEN1 are responsible for familial Alzheimer's disease (FAD) inherited as autosomal dominant trait, but also de novo mutations have been rarely reported in sporadic early-onset dementia cases. Parkinsonism in FAD has been mainly described in advanced disease stages. We characterized a patient presenting with early-onset dystonia-parkinsonism later complicated by dementia and myoclonus. Brain MRI showed signs of iron accumulation in the basal ganglia mimicking neurodegeneration with brain iron accumulation (NBIA) as well as fronto-temporal atrophy. Whole exome sequencing revealed a novel PSEN1 mutation and segregation within the family demonstrated the mutation arose de novo.We suggest considering PSEN1 mutations in cases of dystonia-parkinsonism with positive DAT-Scan, later complicated by progressive cognitive decline and cortical myoclonus even without a dominant family history.

Predictors of anemia in preschool children: Biomarkers Reflecting Inflammation and Nutritional Determinants of Anemia (BRINDA) project

PubMed Central

Aaron, Grant J; Huang, Jin; Varadhan, Ravi; Temple, Victor; Rayco-Solon, Pura; Macdonald, Barbara

2017-01-01

Background: A lack of information on the etiology of anemia has hampered the design and monitoring of anemia-control efforts. Objective: We aimed to evaluate predictors of anemia in preschool children (PSC) (age range: 6–59 mo) by country and infection-burden category. Design: Cross-sectional data from 16 surveys (n = 29,293) from the Biomarkers Reflecting Inflammation and Nutritional Determinants of Anemia (BRINDA) project were analyzed separately and pooled by category of infection burden. We assessed relations between anemia (hemoglobin concentration <110 g/L) and severe anemia (hemoglobin concentration <70 g/L) and individual-level (age, anthropometric measures, micronutrient deficiencies, malaria, and inflammation) and household-level predictors; we also examined the proportion of anemia with concomitant iron deficiency (defined as an inflammation-adjusted ferritin concentration <12 μg/L). Countries were grouped into 4 categories on the basis of risk and burden of infectious disease, and a pooled multivariable logistic regression analysis was conducted for each group. Results: Iron deficiency, malaria, breastfeeding, stunting, underweight, inflammation, low socioeconomic status, and poor sanitation were each associated with anemia in >50% of surveys. Associations between breastfeeding and anemia were attenuated by controlling for child age, which was negatively associated with anemia. The most consistent predictors of severe anemia were malaria, poor sanitation, and underweight. In multivariable pooled models, child age, iron deficiency, and stunting independently predicted anemia and severe anemia. Inflammation was generally associated with anemia in the high- and very high–infection groups but not in the low- and medium-infection groups. In PSC with anemia, 50%, 30%, 55%, and 58% of children had concomitant iron deficiency in low-, medium-, high-, and very high–infection categories, respectively. Conclusions: Although causal inference is limited by

Understanding Tobacco Use Onset Among African Americans.

PubMed

Roberts, Megan E; Colby, Suzanne M; Lu, Bo; Ferketich, Amy K

2016-04-01

Compared to the majority of non-Hispanic white ("white") cigarette smokers, many African American smokers demonstrate a later age of initiation. The goal of the present study was to examine African American late-onset smoking (ie, regular smoking beginning at age 18 or later) and determine whether late-onset (vs. early-onset) smoking is protective in terms of quit rates and health outcomes. We used data from the National Survey of Midlife Development in the United States (MIDUS) because the wide age range of participants (20-75 at baseline) allowed the examination of smoking cessation and mortality incidence across the lifespan. Consistent with previous research, results indicated a later average age of smoking onset among African Americans, compared to whites. Disentangling effects of race from age-of-onset, we found that the cessation rate among late-onset African American smokers was 33%, whereas rates for early-onset African American smokers and early- and late-onset white smokers ranged from 52% to 57%. Finally, results showed that among white, low-socioeconomic status (SES) smokers, the hazard rate for mortality was greater among early- versus late-onset smokers; in contrast, among African American smokers (both low- and high-SES) hazard rates for mortality did not significantly differ among early- versus late-onset smokers. Although late (vs. early) smoking onset may be protective for whites, the present results suggest that late-onset may not be similarly protective for African Americans. Tobacco programs and regulatory policies focused on prevention should expand their perspective to include later ages of initiation, in order to avoid widening tobacco-related health disparities. This study indicates that late-onset smoking is not only the norm among African American adult smokers, but that late- versus early-onset smoking (ie, delaying onset) does not appear to afford any benefits for African Americans in terms of cessation or mortality. These results

Potential role of gender specific effect of leptin receptor deficiency in an extended consanguineous family with severe early-onset obesity.

PubMed

Dehghani, Mohammad Reza; Mehrjardi, Mohammad Yahya Vahidi; Dilaver, Nafi; Tajamolian, Masoud; Enayati, Samaneh; Ebrahimi, Pirooz; Amoli, Mahsa M; Farooqi, Sadaf; Maroofian, Reza

2018-03-12

Congenital Leptin receptor (LEPR) deficiency is a rare genetic cause of early-onset morbid obesity characterised by severe early onset obesity, major hyperphagia, hypogonadotropic hypogonadism and immune and neuroendocrine/metabolic dysfunction. We identified a homozygous loss-of-function mutation, NM_002303.5:c.464 T > G; p.(Tyr155*), in the LEPR in an extended consanguineous family with multiple individuals affected by early-onset severe obesity and hyperphagia. Interestingly, the LEPR-deficient adult females have extremely high body mass index (BMI) with hypogonadal infertility, the BMI of the affected males began to decline around the onset of puberty (13-15 years) with fertility being preserved. These findings lead to the speculation that LEPR deficiency may have a gender-specific effect on the regulation of body weight. In order to elucidate gender-specific effects of LEPR deficiency on reproduction further investigations are needed. The limitations of this study are that our conclusion is based on observations of two males and two females. Further LEPR deficient males and females are required for comparison in order to support this finding more confidently. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

[Early onset scoliosis. What are the options?].

PubMed

Farrington, D M; Tatay-Díaz, A

2013-01-01

The prognosis of children with progressive early onset scoliosis has improved considerably due to recent advances in surgical and non-surgical techniques and the understanding of the importance of preserving the thoracic space. Improvements in existing techniques and development of new methods have considerably improved the management of this condition. Derotational casting can be considered in children with documented progression of a <60° curve without previous surgical treatment. Both single and dual growing rods are effective, but the latter seem to offer better results. Hybrid constructs may be a better option in children who require a low-profile proximal anchor. The vertical expandable prosthetic titanium rib (VEPTR(®)) appears to be beneficial for patients with congenital scoliosis and fused ribs, and thoracic Insufficiency Syndrome. Children with medical comorbidities who may not tolerate repeated lengthenings should be considered for Shilla or Luque Trolley technique. Growth modulation using shape memory alloy staples or other tethers seem promising for mild curves, although more research is required to define their precise indications. Copyright © 2013 SECOT. Published by Elsevier Espana. All rights reserved.

Early-onset obesity dysregulates pulmonary adipocytokine/insulin signaling and induces asthma-like disease in mice

PubMed Central

Dinger, Katharina; Kasper, Philipp; Hucklenbruch-Rother, Eva; Vohlen, Christina; Jobst, Eva; Janoschek, Ruth; Bae-Gartz, Inga; van Koningsbruggen-Rietschel, Silke; Plank, Christian; Dötsch, Jörg; Alejandre Alcázar, Miguel Angel

2016-01-01

Childhood obesity is a risk factor for asthma, but the molecular mechanisms linking both remain elusive. Since obesity leads to chronic low-grade inflammation and affects metabolic signaling we hypothesized that postnatal hyperalimentation (pHA) induced by maternal high-fat-diet during lactation leads to early-onset obesity and dysregulates pulmonary adipocytokine/insulin signaling, resulting in metabolic programming of asthma-like disease in adult mice. Offspring with pHA showed at postnatal day 21 (P21): (1) early-onset obesity, greater fat-mass, increased expression of IL-1β, IL-23, and Tnf-α, greater serum leptin and reduced glucose tolerance than Control (Ctrl); (2) less STAT3/AMPKα-activation, greater SOCS3 expression and reduced AKT/GSK3β-activation in the lung, indicative of leptin resistance and insulin signaling, respectively; (3) increased lung mRNA of IL-6, IL-13, IL-17A and Tnf-α. At P70 body weight, fat-mass, and cytokine mRNA expression were similar in the pHA and Ctrl, but serum leptin and IL-6 were greater, and insulin signaling and glucose tolerance impaired. Peribronchial elastic fiber content, bronchial smooth muscle layer, and deposition of connective tissue were not different after pHA. Despite unaltered bronchial structure mice after pHA exhibited significantly increased airway reactivity. Our study does not only demonstrate that early-onset obesity transiently activates pulmonary adipocytokine/insulin signaling and induces airway hyperreactivity in mice, but also provides new insights into metabolic programming of childhood obesity-related asthma. PMID:27087690

Tea, coffee, and caffeine and early-onset basal cell carcinoma in a case-control study

PubMed Central

Ferrucci, Leah M.; Cartmel, Brenda; Molinaro, Annette M.; Leffell, David J.; Bale, Allen E.; Mayne, Susan T.

2014-01-01

Objectives Tea and coffee are hypothesized to play a protective role in skin carcinogenesis via bioactive components, such as caffeine, yet the epidemiologic evidence is mixed. Existing data supports an inverse association with basal cell carcinoma (BCC) more so than for melanoma or squamous cell carcinoma. To understand if tea, coffee, and caffeine are related to early-onset BCC, we evaluated data from 767 non-Hispanic Whites under age 40 in a case-control study in Connecticut. Methods BCC cases (n=377) were identified through Yale's Dermatopathology database. Controls (n=390) were randomly sampled from individuals in the same database with benign skin diagnoses and frequency matched to cases on age, gender, and biopsy site. Subjects completed an in-person interview including assessment of caffeinated coffee and hot tea. We calculated multivariate odds ratios (OR) and 95% confidence intervals (CIs) with unconditional logistic regression for regular consumption and frequency and duration measures. Results Combined regular consumption of caffeinated coffee plus hot tea was inversely associated with early-onset BCC (OR=0.60, 95% CI=0.38–0.96). Those in the highest category of caffeine from these sources had a 43% reduced risk of BCC compared to non-consumers (OR=0.57, 95% CI=0.34–0.95, p-trend=0.037). Conclusions Our findings suggest a modest protective effect for caffeinated coffee plus tea in relation to early-onset BCC that may, in part, be due to caffeine. This study adds to the growing body of literature suggesting potential health benefits from these beverages. PMID:24841641

Tea, coffee, and caffeine and early-onset basal cell carcinoma in a case-control study.

PubMed

Ferrucci, Leah M; Cartmel, Brenda; Molinaro, Annette M; Leffell, David J; Bale, Allen E; Mayne, Susan T

2014-07-01

Tea and coffee are hypothesized to play a protective role in skin carcinogenesis through bioactive components, such as caffeine, yet the epidemiologic evidence is mixed. Existing data support an inverse association with basal cell carcinoma (BCC), more so than for melanoma or squamous cell carcinoma. To understand whether tea, coffee, and caffeine are related to early-onset BCC, we evaluated data from 767 non-Hispanic Whites under age 40 in a case-control study in Connecticut. BCC cases (n=377) were identified through Yale's Dermatopathology database. Controls (n=390) were randomly sampled from individuals in the same database with benign skin diagnoses and frequency matched to cases on age, sex, and biopsy site. Participants completed an in-person interview including assessment of caffeinated coffee and hot tea. We calculated multivariate odds ratios (ORs) and 95% confidence intervals (CIs) with unconditional logistic regression for regular consumption and frequency and duration measures. Combined regular consumption of caffeinated coffee plus hot tea was inversely associated with early-onset BCC (OR=0.60, 95% CI=0.38-0.96). Those in the highest category of caffeine from these sources had a 43% reduced risk of BCC compared with nonconsumers (OR=0.57, 95% CI=0.34-0.95, P-trend=0.037). Our findings suggest a modest protective effect for caffeinated coffee plus tea in relation to early-onset BCC that may, in part, be due to caffeine. This study adds to the growing body of literature suggesting potential health benefits from these beverages.

Cerebral sinovenous thrombosis associated with iron deficiency anemia secondary to severe menorrhagia: a case report.

PubMed

Corrales-Medina, Fernando F; Grant, Leon; Egas-Bejar, Daniela; Valdivia-Ascuna, Zoila; Rodriguez, Nidra; Mancias, Pedro

2014-09-01

Cerebral sinovenous thrombosis is a rare condition presenting with a wide spectrum of nonspecific symptoms that can make early diagnosis difficult. Cerebral sinovenous thrombosis has been associated with various etiologies. Iron deficiency anemia associated with cerebral sinovenous thrombosis in teenagers is rare. We present a teenage patient with complete thrombosis of the vein of Galen, straight sinus, and left internal cerebral vein associated with iron deficiency anemia due to severe menorrhagia. Mechanisms that can explain the association between iron deficiency anemia and thrombosis are discussed. © The Author(s) 2013.

Effects of anemia at different stages of gestation on infant outcomes.

PubMed

Menon, Kavitha C; Ferguson, Elaine L; Thomson, Christine D; Gray, Andrew R; Zodpey, Sanjay; Saraf, Abhay; Das, Prabir Kumar; Skeaff, Sheila A

2016-01-01

Maternal anemia is a public health challenge worldwide. The present study aims to explore the effects of maternal anemia at different stages of gestation on postnatal growth and neurobehavioral development in infants. A cohort of pregnant Indian women were followed from 13 to 22 wk gestation (i.e., second trimester; n = 211), 29 to 42 wk gestation (i.e., third trimester; n = 178); their infants were followed to ∼3 wk (n = 147) postpartum. Data collected included information on sociodemographic and health-related factors, including anemia (i.e., low hemoglobin status), maternal and infant anthropometric data, and infant neurobehavioral data. A mixed logistic regression model was used to examine the impact of anemia during pregnancy on maternal and infant outcomes (i.e., anthropometric growth parameters and infant neurobehavioral development). The prevalence of maternal anemia was 41% and 55% (P < 0.001), and iron deficiency anemia was 3.6% and 5.6%, respectively, in the second trimester and third trimester. Infants of pregnant women who were not anemic in the second trimester were 0.26 standard deviations (SD) heavier (P = 0.029), 0.50 SD taller (P = 0.001), and had 0.26 SD larger head circumference (P = 0.029) compared with infants of anemic pregnant women. Infants of pregnant women who were not anemic in the third trimester had orientation scores 3.88 higher (P = 0.004) than infants of women who were anemic. Our findings indicate that maternal anemia in the second trimester of gestation influences postnatal infant growth and underscores the necessity of alleviating anemia in young women in the early stages of gestation. Copyright © 2016 Elsevier Inc. All rights reserved.

[Hematological malignancy: management of anemia and leukopenia by primary care physicians].

PubMed

Burnand, J; Waeber, G; Duchosal, M A

2009-10-28

In hematological malignancies, the occurrence of anemia is very common and can have significant consequences on daily life. Treatment includes essentially red blood cell transfusions. The prescription of erythropoietic agents and/or iron is exceptionnal and often not registered in Switzerland. The onset of neutropenia is also frequently encountered and in some situations may require the prescription of myeloid growth factors. The purpose of this article is to focus on the current recommendations of these two issues for practitioners.

Renal abscess in a child with sickle cell anemia.

PubMed

Taksande, Amar M; Vilhekar, K Y

2009-03-01

Renal abscess is rare in children and the usual presenting features include fever, lumbar pain, abdominal pain and occasional flank mass. Renal ultrasonography facilitates an early diagnosis and helps in percutaneous drainage. We herewith report on a child with sickle cell anemia who developed a renal abscess.

Early-Onset LMNA-Associated Muscular Dystrophy with Later Involvement of Contracture.

PubMed

Lee, Younggun; Lee, Jung Hwan; Park, Hyung Jun; Choi, Young Chul

2017-10-01

The early diagnosis of LMNA-associated muscular dystrophy is important for preventing sudden arrest related to cardiac conduction block. However, diagnosing early-onset Emery-Dreifuss muscular dystrophy (EDMD) with later involvement of contracture and limb-girdle muscular dystrophy type 1B is often delayed due to heterogeneous clinical presentations. We aimed to determine the clinical features that contribute to a delayed diagnosis. We reviewed four patients who were recently diagnosed with LMNA-associated muscular dystrophy by targeted exome sequencing and who were initially diagnosed with nonspecific or other types of muscular dystrophy. Certain clinical features such as delayed contracture involvement and calf hypertrophy were found to contribute to a delayed diagnosis. Muscle biopsies were not informative for the diagnosis in these patients. Genetic testing of single or multiple genes is useful for confirming a diagnosis of LMNA-associated muscular dystrophy. Even EDMD patients could experience the later involvement of contracture, so clinicians should consider early genetic testing for patients with undiagnosed muscular dystrophy or laminopathy. Copyright © 2017 Korean Neurological Association