Physical Characterization of Gemini Surfactant-Based Synthetic Vectors for the Delivery of Linear Covalently Closed (LCC) DNA Ministrings

PubMed Central

Sum, Chi Hong; Nafissi, Nafiseh; Slavcev, Roderick A.; Wettig, Shawn

2015-01-01

In combination with novel linear covalently closed (LCC) DNA minivectors, referred to as DNA ministrings, a gemini surfactant-based synthetic vector for gene delivery has been shown to exhibit enhanced delivery and bioavailability while offering a heightened safety profile. Due to topological differences from conventional circular covalently closed (CCC) plasmid DNA vectors, the linear topology of LCC DNA ministrings may present differences with regards to DNA interaction and the physicochemical properties influencing DNA-surfactant interactions in the formulation of lipoplexed particles. In this study, N,N-bis(dimethylhexadecyl)-α,ω-propanediammonium(16-3-16)gemini-based synthetic vectors, incorporating either CCC plasmid or LCC DNA ministrings, were characterized and compared with respect to particle size, zeta potential, DNA encapsulation, DNase sensitivity, and in vitro transgene delivery efficacy. Through comparative analysis, differences between CCC plasmid DNA and LCC DNA ministrings led to variations in the physical properties of the resulting lipoplexes after complexation with 16-3-16 gemini surfactants. Despite the size disparities between the plasmid DNA vectors (CCC) and DNA ministrings (LCC), differences in DNA topology resulted in the generation of lipoplexes of comparable particle sizes. The capacity for ministring (LCC) derived lipoplexes to undergo complete counterion release during lipoplex formation contributed to improved DNA encapsulation, protection from DNase degradation, and in vitro transgene delivery. PMID:26561857

Sequence Analysis of the Cryptic Plasmid pMG101 from Rhodopseudomonas palustris and Construction of Stable Cloning Vectors

PubMed Central

Inui, Masayuki; Roh, Jung Hyeob; Zahn, Kenneth; Yukawa, Hideaki

2000-01-01

A 15-kb cryptic plasmid was obtained from a natural isolate of Rhodopseudomonas palustris. The plasmid, designated pMG101, was able to replicate in R. palustris and in closely related strains of Bradyrhizobium japonicum and phototrophic Bradyrhizobium species. However, it was unable to replicate in the purple nonsulfur bacterium Rhodobacter sphaeroides and in Rhizobium species. The replication region of pMG101 was localized to a 3.0-kb SalI-XhoI fragment, and this fragment was stably maintained in R. palustris for over 100 generations in the absence of selection. The complete nucleotide sequence of this fragment revealed two open reading frames (ORFs), ORF1 and ORF2. The deduced amino acid sequence of ORF1 is similar to sequences of Par proteins, which mediate plasmid stability from certain plasmids, while ORF2 was identified as a putative rep gene, coding for an initiator of plasmid replication, based on homology with the Rep proteins of several other plasmids. The function of these sequences was studied by deletion mapping and gene disruptions of ORF1 and ORF2. pMG101-based Escherichia coli-R. palustris shuttle cloning vectors pMG103 and pMG105 were constructed and were stably maintained in R. palustris growing under nonselective conditions. The ability of plasmid pMG101 to replicate in R. palustris and its close phylogenetic relatives should enable broad application of these vectors within this group of α-proteobacteria. PMID:10618203

High-efficiency transformation of Pichia stipitis based on its URA3 gene and a homologous autonomous replication sequence, ARS2.

PubMed Central

Yang, V W; Marks, J A; Davis, B P; Jeffries, T W

1994-01-01

This paper describes the first high-efficiency transformation system for the xylose-fermenting yeast Pichia stipitis. The system includes integrating and autonomously replicating plasmids based on the gene for orotidine-5'-phosphate decarboxylase (URA3) and an autonomous replicating sequence (ARS) element (ARS2) isolated from P. stipitis CBS 6054. Ura- auxotrophs were obtained by selecting for resistance to 5-fluoroorotic acid and were identified as ura3 mutants by transformation with P. stipitis URA3. P. stipitis URA3 was cloned by its homology to Saccharomyces cerevisiae URA3, with which it is 69% identical in the coding region. P. stipitis ARS elements were cloned functionally through plasmid rescue. These sequences confer autonomous replication when cloned into vectors bearing the P. stipitis URA3 gene. P. stipitis ARS2 has features similar to those of the consensus ARS of S. cerevisiae and other ARS elements. Circular plasmids bearing the P. stipitis URA3 gene with various amounts of flanking sequences produced 600 to 8,600 Ura+ transformants per micrograms of DNA by electroporation. Most transformants obtained with circular vectors arose without integration of vector sequences. One vector yielded 5,200 to 12,500 Ura+ transformants per micrograms of DNA after it was linearized at various restriction enzyme sites within the P. stipitis URA3 insert. Transformants arising from linearized vectors produced stable integrants, and integration events were site specific for the genomic ura3 in 20% of the transformants examined. Plasmids bearing the P. stipitis URA3 gene and ARS2 element produced more than 30,000 transformants per micrograms of plasmid DNA. Autonomously replicating plasmids were stable for at least 50 generations in selection medium and were present at an average of 10 copies per nucleus. Images PMID:7811063

Improvement of a yeast self-excising integrative vector by prevention of expression leakage of the intronated Cre recombinase gene during plasmid maintenance in Escherichia coli.

PubMed

Agaphonov, Michael O

2017-12-01

The use of plasmids possessing a regulatable gene coding for a site-specific recombinase together with its recognition sequences significantly facilitates genome manipulations since it allows self-excision of the portion of the genetic construct integrated into the host genome. Stable maintenance of such plasmids in Escherichia coli, which is used for plasmid preparation, requires prevention of recombinase synthesis in this host, which can be achieved by interrupting the recombinase gene with an intron. Based on this approach, Saccharomyces cerevisiae and Hansenula polymorpha self-excising vectors possessing intronated gene for Cre recombinase and its recognition sites (LoxP) were previously constructed. However, this work shows instability of the H. polymorpha vectors during plasmid maintenance in E. coli cells. This could be due to recombination between the loxP sites caused by residual expression of the cre gene. Prevention of translation reinitiation on an internal methionine codon completely solved this problem. A similar modification was made in a self-excising vector designed for S. cerevisiae. Apart from substantial improvement of yeast self-excising vectors, the obtained results also narrow down the essential part of Cre sequence. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Puromycin-resistant lentiviral control shRNA vector, pLKO.1 induces unexpected cellular differentiation of P19 embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanungo, Jyotshna

RNA silencing is used as a common method for investigating loss-of-function effects of genes of interest. In mammalian cells, RNA interference (RNAi) or RNA silencing can be achieved by transient siRNA (small or short interfering RNA) transfection or by stable shRNA (short hairpin RNA) systems. Various vectors are used for efficient delivery of shRNA. Lentiviral vectors offer an efficient delivery system for stable and long-term expression of the shRNA in mammalian cells. The widely used lentiviral pLKO.1 plasmid vector is very popular in RNAi studies. A large RNAi database, a TRC (the RNAi Consortium) library, was established based on themore » pLKO.1-TRC plasmid vector. This plasmid (also called pLKO.1-puro) has a puromycin-resistant gene for selection in mammalian cells along with designs for generating lentiviral particles as well for RNA silencing. While using the pLKO.1-puro TRC control shRNA plasmid for transfection in murine P19 embryonic stem (ES) cells, it was unexpectedly discovered that this plasmid vector induced robust endodermal differentiation. Since P19 ES cells are pluripotent and respond to external stimuli that have the potential to alter the phenotype and thus its stemness, other cell types used in RNA silencing studies do not display the obvious effect and therefore, may affect experiments in subtle ways that would go undetected. This study for the first time provides evidence that raises concern and warrants extreme caution while using the pLKO.1-puro control shRNA vector because of its unexpected non-specific effects on cellular integrity. - Highlights: • In P19 ES cells the pLKO.1-puro lentiviral control shRNA vector induced endodermal differentiation. • P19 ES cells harboring the pCDNA3 plasmid vector retained their stem-ness as opposed to those harboring the pLKO.1-puro vector. • P19 ES cells can serve as a sensor to determine vector safety. • Extreme caution is warranted while using the widely used pLKO.1-puro lentiviral vector for experimental and therapeutic designs.« less

Tightly-wound miniknot vectors for gene therapy: a potential improvement over supercoiled minicircle DNA.

PubMed

Tolmachov, Oleg E

2010-04-01

Minimized derivatives of bacterial plasmids with removed bacterial backbones are promising vectors for the efficient delivery and for the long-term expression of therapeutic genes. The absence of the bacterial plasmid backbone, a known inducer of innate immune response and a known silencer of transgene expression, provides a partial explanation for the high efficiency of gene transfer using minimized DNA vectors. Supercoiled minicircle DNA is a type of minimized DNA vector obtained via intra-plasmid recombination in bacteria. Minicircle vectors seem to get an additional advantage from their physical compactness, which reduces DNA damage due to the mechanical stress during gene delivery. An independent topological means for DNA compression is knotting, with some knotted DNA isoforms offering superior compactness. I propose that, firstly, knotted DNA can be a suitable compact DNA form for the efficient transfection of a range of human cells with therapeutic genes, and, secondly, that knotted minimized DNA vectors without bacterial backbones ("miniknot" vectors) can surpass supercoiled minicircle DNA vectors in the efficiency of therapeutic gene delivery. Crucially, while the introduction of a single nick to a supercoiled DNA molecule leads to the loss of the compact supercoiled status, the introduction of nicks to knotted DNA does not change knotting. Tight miniknot vectors can be readily produced by the direct action of highly concentrated type II DNA topoisomerase on minicircle DNA or, alternatively, by annealing of the 19-base cohesive ends of the minimized vectors confined within the capsids of Escherichia coli bacteriophage P2 or its satellite bacteriophage P4. After reaching the nucleoplasm of the target cell, the knotted DNA is expected to be unknotted through type II topoisomerase activity and thus to become available for transcription, chromosomal integration or episomal maintenance. The hypothesis can be tested by comparing the gene transfer efficiency achieved with the proposed miniknot vectors, the minicircle vectors described previously, knotted plasmid vectors and standard plasmid vectors. Tightly-wound miniknots can be particularly useful in the gene administration procedures involving considerable forces acting on vector DNA: aerosol inhalation, jet-injection, electroporation, particle bombardment and ultrasound DNA transfer. (c) 2009 Elsevier Ltd. All rights reserved.

A novel packaging system for the generation of helper-free oncolytic MVM vector stocks.

PubMed

Brandenburger, A; Russell, S

1996-10-01

MVM-based autonomous parvoviral vectors have been shown to target the expression of heterologous genes in neoplastic cells and are therefore of interest for cancer gene therapy. The traditional method for production of parvoviral vectors requires the cotransfection of vector and helper plasmids into MVM-permissive cell lines, but recombination between the cotransfected plasmids invariably gives rise to vector stocks that are heavily contaminated with wild-type MVM. Therefore, to minimise recombination between the vector and helper genomes we have utilised a cell line in which the MVM helper functions are expressed inducibly from a modified MVM genome that is stably integrated into the host cell chromosome. Using this MVM packaging cell line, we could reproducibly generate MVM vector stocks that contained no detectable helper virus.

Development of a chromosome-plasmid balanced lethal system for Lactobacillus acidophilus with thyA gene as selective marker.

PubMed

Fu, X; Xu, J G

2000-01-01

A chromosome-plasmid balanced lethal gene delivery system for Lactobacillus acidophilus based on the thyA gene was developed. The selected L. acidophilus DOM La strain carries a mutated thyA gene and has an obligate requirement for thymidine. This strain can be used as a host for the constructed shuttle vector pFXL03, lacking antibiotic-resistant markers but having the wild-type thyA gene from L. casei which complements the thyA chromosomal mutation. The vector also contains the replicon region from plasmid pUC19 and that of the Lactococcus plasmid pWV01, which allows the transfer between Escherichia coli, L. casei and L. acidophilus. Eight unique restriction sites (i.e., PstI, HindIII, SphI, SalI, AccI, XbaI, KpnI and SacI) are available for cloning. After 40-time transfers in modified MRS medium, no plasmid loss was observed. The vector pFXL03 is potentially useful as a food-grade vaccine delivery system for L. acidophilus.

Epidemiology of Epstein-Barr virus, cytomegalovirus, and Kaposi's sarcoma-associated herpesvirus infections in peripheral blood leukocytes revealed by a multiplex PCR assay.

PubMed

Nishiwaki, Morie; Fujimuro, Masahiro; Teishikata, Yasuhiro; Inoue, Hisanori; Sasajima, Hitoshi; Nakaso, Kazuhiro; Nakashima, Kenji; Sadanari, Hidetaka; Yamamoto, Tomohiro; Fujiwara, Yoshie; Ogawa, Naoki; Yokosawa, Hideyoshi

2006-12-01

A multiplex polymerase chain reaction (PCR) has been developed for the simultaneous detection of Epstein-Barr virus (EBV), cytomegalovirus (CMV), and Kaposi's sarcoma-associated herpesvirus (KSHV) in a clinical sample. Primers of multiplex PCR were designed to amplify specific regions of the EBV EBNA1, CMV IE2, and KSHV LANA genes. This multiplex PCR assay was found to have detection sensitivities of 1-10 copies of purified viral DNA cloned into the plasmid. To assess diagnostic and pre-clinical applications with this method, we utilized KSHV-positive primary effusion lymphoma (PEL) cells, EBV-positive Burkitt's lymphoma cells, CMV-infected fibroblast cells, and clinically prepared peripheral blood leukocytes (PBLs) that had been infected with viruses. We found that this multiplex PCR assay has high sensitivity and specificity for simultaneous detection of EBV, CMV, and KSHV genomes in a single amplification from a clinical material. Using this multiplex PCR assay, we investigated the prevalence of EBV, CMV, and KSHV in PBL samples from normal Japanese randomly selected. KSHV, EBV, and CMV genomes were detected in samples from 2 (0.2%), 377 (39.5%), and 27 (2.8%) of the 953 blood donors, respectively. Interestingly, both EBV and CMV genomes were detected in samples from all KSHV-positive donors. (c) 2006 Wiley-Liss, Inc.

Epstein-Barr virus WZhet DNA can induce lytic replication in epithelial cells in vitro, although WZhet is not detectable in many human tissues in vivo.

PubMed

Ryan, Julie L; Jones, Richard J; Elmore, Sandra H; Kenney, Shannon C; Miller, George; Schroeder, Jane C; Gulley, Margaret L

2009-01-01

WZhet is a rearranged and partially deleted form of the Epstein-Barr virus (EBV) genome in which the BamH1W region becomes juxtaposed with and activates BZLF1, resulting in constitutive viral replication. We tested whether WZhet induces viral replication in epithelial cells, and we studied its prevalence in a wide range of lesional tissues arising in vivo. A quantitative real-time PCR assay targeting EBV WZhet DNA was developed to measure this recombinant form of the EBV genome. WZhet DNA was undetectable in any of 324 plasma or paraffin-embedded tissue samples from patients with EBV-associated and EBV-negative disorders. These included specimens from patients with Hodgkin or non-Hodgkin lymphoma, post-transplant lymphoproliferation, nasopharyngeal or gastric adenocarcinoma, and infectious mononucleosis. However, WZhet DNA was detected in vitro in EBV-infected AGS gastric cancer cells. Additionally, transient transfection of infected AGS gastric cancer cells showed that viral replication could be induced by a WZhet plasmid. This is the first evidence that WZhet induces the EBV lytic cycle in an epithelial cell line. Our negative findings in natural settings suggest that WZhet is a defective viral product that thrives in the absence of a host immune system but is rarely present in vivo. Copyright 2009 S. Karger AG, Basel.

Reprint of "versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16".

PubMed

Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra

2014-12-20

The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.

Versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16.

PubMed

Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra

2014-09-30

The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96 h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.

Engineering new mycobacterial vaccine design for HIV–TB pediatric vaccine vectored by lysine auxotroph of BCG

PubMed Central

Saubi, Narcís; Gea-Mallorquí, Ester; Ferrer, Pau; Hurtado, Carmen; Sánchez-Úbeda, Sara; Eto, Yoshiki; Gatell, Josep M; Hanke, Tomáš; Joseph, Joan

2014-01-01

In this study, we have engineered a new mycobacterial vaccine design by using an antibiotic-free plasmid selection system. We assembled a novel Escherichia coli (E. coli)–mycobacterial shuttle plasmid p2auxo.HIVA, expressing the HIV-1 clade A immunogen HIVA. This shuttle vector employs an antibiotic resistance-free mechanism for plasmid selection and maintenance based on glycine complementation in E. coli and lysine complementation in mycobacteria. This plasmid was first transformed into glycine auxotroph of E. coli strain and subsequently transformed into lysine auxotroph of Mycobacterium bovis BCG strain to generate vaccine BCG.HIVA2auxo. We demonstrated that the episomal plasmid p2auxo.HIVA was stable in vivo over a 7-week period and genetically and phenotypically characterized the BCG.HIVA2auxo vaccine strain. The BCG.HIVA2auxo vaccine in combination with modified vaccinia virus Ankara (MVA). HIVA was safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. Polyfunctional HIV-1-specific CD8+ T cells, which produce interferon-γ and tumor necrosis factor-α and express the degranulation marker CD107a, were induced. Thus, we engineered a novel, safer, good laboratory practice–compatible BCG-vectored vaccine using prototype immunogen HIVA. This antibiotic-free plasmid selection system based on “double” auxotrophic complementation might be a new mycobacterial vaccine platform to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective response soon after birth. PMID:26015961

The tunable pReX expression vector enables optimizing the T7-based production of membrane and secretory proteins in E. coli.

PubMed

Kuipers, Grietje; Karyolaimos, Alexandros; Zhang, Zhe; Ismail, Nurzian; Trinco, Gianluca; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem

2017-12-16

To optimize the production of membrane and secretory proteins in Escherichia coli, it is critical to harmonize the expression rates of the genes encoding these proteins with the capacity of their biogenesis machineries. Therefore, we engineered the Lemo21(DE3) strain, which is derived from the T7 RNA polymerase-based BL21(DE3) protein production strain. In Lemo21(DE3), the T7 RNA polymerase activity can be modulated by the controlled co-production of its natural inhibitor T7 lysozyme. This setup enables to precisely tune target gene expression rates in Lemo21(DE3). The t7lys gene is expressed from the pLemo plasmid using the titratable rhamnose promoter. A disadvantage of the Lemo21(DE3) setup is that the system is based on two plasmids, a T7 expression vector and pLemo. The aim of this study was to simplify the Lemo21(DE3) setup by incorporating the key elements of pLemo in a standard T7-based expression vector. By incorporating the gene encoding the T7 lysozyme under control of the rhamnose promoter in a standard T7-based expression vector, pReX was created (ReX stands for Regulated gene eXpression). For two model membrane proteins and a model secretory protein we show that the optimized production yields obtained with the pReX expression vector in BL21(DE3) are similar to the ones obtained with Lemo21(DE3) using a standard T7 expression vector. For another secretory protein, a c-type cytochrome, we show that pReX, in contrast to Lemo21(DE3), enables the use of a helper plasmid that is required for the maturation and hence the production of this heme c protein. Here, we created pReX, a T7-based expression vector that contains the gene encoding the T7 lysozyme under control of the rhamnose promoter. pReX enables regulated T7-based target gene expression using only one plasmid. We show that with pReX the production of membrane and secretory proteins can be readily optimized. Importantly, pReX facilitates the use of helper plasmids. Furthermore, the use of pReX is not restricted to BL21(DE3), but it can in principle be used in any T7 RNAP-based strain. Thus, pReX is a versatile alternative to Lemo21(DE3).

Enhanced gene disruption by programmable nucleases delivered by a minicircle vector.

PubMed

Dad, A-B K; Ramakrishna, S; Song, M; Kim, H

2014-11-01

Targeted genetic modification using programmable nucleases such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) is of great value in biomedical research, medicine and biotechnology. Minicircle vectors, which lack extraneous bacterial sequences, have several advantages over conventional plasmids for transgene delivery. Here, for the first time, we delivered programmable nucleases into human cells using transient transfection of a minicircle vector and compared the results with those obtained using a conventional plasmid. Surrogate reporter assays and T7 endonuclease analyses revealed that cells in the minicircle vector group displayed significantly higher mutation frequencies at the target sites than those in the conventional plasmid group. Quantitative PCR and reverse transcription-PCR showed higher vector copy number and programmable nuclease transcript levels, respectively, in 293T cells after minicircle versus conventional plasmid vector transfection. In addition, tryphan blue staining and flow cytometry after annexin V and propidium iodide staining showed that cell viability was also significantly higher in the minicircle group than in the conventional plasmid group. Taken together, our results show that gene disruption using minicircle vector-mediated delivery of ZFNs and TALENs is a more efficient, safer and less toxic method than using a conventional plasmid, and indicate that the minicircle vector could serve as an advanced delivery method for programmable nucleases.

[Construction, identification and expression of three kinds of shuttle plasmids of adenovirus expression vector of hepatitis C virus structure gene].

PubMed

Cao, Yi-zhan; Hao, Chun-qiu; Feng, Zhi-hua; Zhou, Yong-xing; Li, Jin-ge; Jia, Zhan-sheng; Wang, Ping-zhong

2003-02-01

To construct three recombinant shuttle plasmids of adenovirus expression vector which can express hepatitis C virus(HCV) different structure genes(C, C+E1, C+E1+E2) in order to pack adenovirus expression vectors which can express HCV different structure gene effectively. The different HCV structure genes derived from the plasmid pBRTM/HCV1-3011 by using polymerase chain reaction (PCR) were inserted into the backward position of cytomegalovirus(CMV) immediate early promotor element of shuttle plasmid(pAd.CMV-Link.1) of adenovirus expression vector respectively, then the three recombinant plasmids (pAd.HCV-C, pAd.HCV-CE1, pAd.HCV-S) were obtained. The recombinant plasmids were identified by endonuclease, PCR and sequencing. HCV structure genes were expressed transiently with Lipofectamine 2000 coated in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. Insert DNAs of the three recombinant plasmids' were confirmed to be HCV different structure genes by endonuclease, PCR and sequencing. The three recombinant plasmids can express HCV structure gene (C, C+E1, C+E1+E2) transiently in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. The three recombinant shuttle plasmids of adenovirus expression vector can express HCV structure gene(C, C+E1, C+E1+E2) transiently. This should be useful to pack adenovirus expression vector which can express HCV structure genes.

Epstein-Barr virus (EBV) recombinants: use of positive selection markers to rescue mutants in EBV-negative B-lymphoma cells.

PubMed Central

Wang, F; Marchini, A; Kieff, E

1991-01-01

The objective of these experiments was to develop strategies for creation and identification of recombinant mutant Epstein-Barr viruses (EBV). EBV recombinant molecular genetics has been limited to mutations within a short DNA segment deleted from a nontransforming EBV and an underlying strategy which relies on growth transformation of primary B lymphocytes for identification of recombinants. Thus, mutations outside the deletion or mutations which affect transformation cannot be easily recovered. In these experiments we investigated whether a toxic drug resistance gene, guanine phosphoribosyltransferase or hygromycin phosphotransferase, driven by the simian virus 40 promoter can be recombined into the EBV genome and can function to identify B-lymphoma cells infected with recombinant virus. Two different strategies were used to recombine the drug resistance marker into the EBV genome. Both utilized transfection of partially permissive, EBV-infected B95-8 cells and positive selection for cells which had incorporated a functional drug resistance gene. In the first series of experiments, B95-8 clones were screened for transfected DNA that had recombined into the EBV genome. In the second series of experiments, the transfected drug resistance marker was linked to the plasmid and lytic EBV origins so that it was maintained as an episome and could recombine with the B95-8 EBV genome during virus replication. The recombinant EBV from either experiment could be recovered by infection and toxic drug selection of EBV-negative B-lymphoma cells. The EBV genome in these B-lymphoma cells is frequently an episome. Virus genes associated with latent infection of primary B lymphocytes are expressed. Expression of Epstein-Barr virus nuclear antigen 2 (EBNA-2) and the EBNA-3 genes is variable relative to that of EBNA-1, as is characteristic of some naturally infected Burkitt tumor cells. Moreover, the EBV-infected B-lymphoma cells are often partially permissive for early replicative cycle gene expression and virus replication can be induced, in contrast to previously reported in vitro infected B-lymphoma cells. These studies demonstrate that dominant selectable markers can be inserted into the EBV genome, are active in the context of the EBV genome, and can be used to recover recombinant EBV in B-lymphoma cells. This system should be particularly useful for recovering EBV genomes with mutations in essential transforming genes. Images PMID:1848303

Epstein-Barr virus (EBV) recombinants: use of positive selection markers to rescue mutants in EBV-negative B-lymphoma cells.

PubMed

Wang, F; Marchini, A; Kieff, E

1991-04-01

The objective of these experiments was to develop strategies for creation and identification of recombinant mutant Epstein-Barr viruses (EBV). EBV recombinant molecular genetics has been limited to mutations within a short DNA segment deleted from a nontransforming EBV and an underlying strategy which relies on growth transformation of primary B lymphocytes for identification of recombinants. Thus, mutations outside the deletion or mutations which affect transformation cannot be easily recovered. In these experiments we investigated whether a toxic drug resistance gene, guanine phosphoribosyltransferase or hygromycin phosphotransferase, driven by the simian virus 40 promoter can be recombined into the EBV genome and can function to identify B-lymphoma cells infected with recombinant virus. Two different strategies were used to recombine the drug resistance marker into the EBV genome. Both utilized transfection of partially permissive, EBV-infected B95-8 cells and positive selection for cells which had incorporated a functional drug resistance gene. In the first series of experiments, B95-8 clones were screened for transfected DNA that had recombined into the EBV genome. In the second series of experiments, the transfected drug resistance marker was linked to the plasmid and lytic EBV origins so that it was maintained as an episome and could recombine with the B95-8 EBV genome during virus replication. The recombinant EBV from either experiment could be recovered by infection and toxic drug selection of EBV-negative B-lymphoma cells. The EBV genome in these B-lymphoma cells is frequently an episome. Virus genes associated with latent infection of primary B lymphocytes are expressed. Expression of Epstein-Barr virus nuclear antigen 2 (EBNA-2) and the EBNA-3 genes is variable relative to that of EBNA-1, as is characteristic of some naturally infected Burkitt tumor cells. Moreover, the EBV-infected B-lymphoma cells are often partially permissive for early replicative cycle gene expression and virus replication can be induced, in contrast to previously reported in vitro infected B-lymphoma cells. These studies demonstrate that dominant selectable markers can be inserted into the EBV genome, are active in the context of the EBV genome, and can be used to recover recombinant EBV in B-lymphoma cells. This system should be particularly useful for recovering EBV genomes with mutations in essential transforming genes.

Modulation of Epstein–Barr Virus Nuclear Antigen 2-dependent transcription by protein arginine methyltransferase 5

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Cheng-Der; Cheng, Chi-Ping; Fang, Jia-Shih

Highlights: ► Catalytic active PRMT5 substantially binds to the EBNA2 RG domain. ► PRMT5 augments the EBNA2-dependent transcription. ► PRMT5 triggers the symmetric dimethylation of the EBNA2 RG domain. ► PRMT5 enhances the promoter occupancy of EBNA2 on its target promoters. -- Abstract: Epstein–Barr Virus Nuclear Antigen (EBNA) 2 features an Arginine–Glycine repeat (RG) domain at amino acid positions 335–360, which is a known target for protein arginine methyltransferaser 5 (PRMT5). In this study, we performed protein affinity pull-down assays to demonstrate that endogenous PRMT5 derived from lymphoblastoid cells specifically associated with the protein bait GST-E2 RG. Transfection of amore » plasmid expressing PRMT5 induced a 2.5- to 3-fold increase in EBNA2-dependent transcription of both the LMP1 promoter in AKATA cells, which contain the EBV genome endogenously, and a Cp-Luc reporter plasmid in BJAB cells, which are EBV negative. Furthermore, we showed that there was a 2-fold enrichment of EBNA2 occupancy in target promoters in the presence of exogenous PRMT5. Taken together, we show that PRMT5 triggers the symmetric dimethylation of EBNA2 RG domain to coordinate with EBNA2-mediated transcription. This modulation suggests that PRMT5 may play a role in latent EBV infection.« less

Saccharomyces cerevisiae Shuttle vectors.

PubMed

Gnügge, Robert; Rudolf, Fabian

2017-05-01

Yeast shuttle vectors are indispensable tools in yeast research. They enable cloning of defined DNA sequences in Escherichia coli and their direct transfer into Saccharomyces cerevisiae cells. There are three types of commonly used yeast shuttle vectors: centromeric plasmids, episomal plasmids and integrating plasmids. In this review, we discuss the different plasmid systems and their characteristic features. We focus on their segregational stability and copy number and indicate how to modify these properties. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Food-grade host/vector expression system for Lactobacillus casei based on complementation of plasmid-associated phospho-beta-galactosidase gene lacG.

PubMed

Takala, T M; Saris, P E J; Tynkkynen, S S H

2003-01-01

A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.

Ultraviolet mutagenesis in a plasmid vector replicated in lymphoid cells from patient with the melanoma-prone disorder dysplastic nevus syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seetharam, S.; Waters, H.L.; Seidman, M.M.

The hereditary dysplastic nevus syndrome (DNS) is an autosomal dominant disorder in which affected individuals have increased numbers of dysplastic (premalignant) nevi and a greater than 100-fold increased risk of developing cutaneous melanoma. Epstein-Barr virus-transformed lymphoblastoid cell lines from patients with hereditary DNS have been shown to be hypermutable to UV radiation. To examine the mechanism involved in this UV hypermutability, we used a shuttle vector plasmid, pZ189, which carries a 160-base pair marker gene, supF, and can replicate in human cells. pZ189 was treated with UV radiation and transfected into DNS6BE, a lymphoblastoid cell line from a patient withmore » hereditary DNS. Plasmid survival after UV was similar with the DNS6BE line and with a lymphoblastoid cell line from a normal donor. Plasmid mutation frequency was greater with the DNS line in accord with the DNS cellular hypermutability. Base sequence analysis was performed on 69 mutated plasmids recovered from the DNS line. There were significantly more plasmids with single base substitution mutations (P less than 0.01) in comparison to UV-treated plasmids passed through normal fibroblasts. pZ189 hypermutability and an increased frequency of single base substitutions was previously found with a cell line from a melanoma-prone xeroderma pigmentosum patient. These differences may be related to the increased melanoma susceptibility in both DNS and xeroderma pigmentosum.« less

Rational plasmid design and bioprocess optimization to enhance recombinant adeno-associated virus (AAV) productivity in mammalian cells.

PubMed

Emmerling, Verena V; Pegel, Antje; Milian, Ernest G; Venereo-Sanchez, Alina; Kunz, Marion; Wegele, Jessica; Kamen, Amine A; Kochanek, Stefan; Hoerer, Markus

2016-02-01

Viral vectors used for gene and oncolytic therapy belong to the most promising biological products for future therapeutics. Clinical success of recombinant adeno-associated virus (rAAV) based therapies raises considerable demand for viral vectors, which cannot be met by current manufacturing strategies. Addressing existing bottlenecks, we improved a plasmid system termed rep/cap split packaging and designed a minimal plasmid encoding adenoviral helper function. Plasmid modifications led to a 12-fold increase in rAAV vector titers compared to the widely used pDG standard system. Evaluation of different production approaches revealed superiority of processes based on anchorage- and serum-dependent HEK293T cells, exhibiting about 15-fold higher specific and volumetric productivity compared to well-established suspension cells cultivated in serum-free medium. As for most other viral vectors, classical stirred-tank bioreactor production is thus still not capable of providing drug product of sufficient amount. We show that manufacturing strategies employing classical surface-providing culture systems can be successfully transferred to the new fully-controlled, single-use bioreactor system Integrity(TM) iCELLis(TM) . In summary, we demonstrate substantial bioprocess optimizations leading to more efficient and scalable production processes suggesting a promising way for flexible large-scale rAAV manufacturing. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

“Direct cloning in Lactobacillus plantarum: Electroporation with non-methylated plasmid DNA enhances transformation efficiency and makes shuttle vectors obsolete”

PubMed Central

2012-01-01

Background Lactic acid bacteria (LAB) play an important role in agricultural as well as industrial biotechnology. Development of improved LAB strains using e.g. library approaches is often limited by low transformation efficiencies wherefore one reason could be differences in the DNA methylation patterns between the Escherichia coli intermediate host for plasmid amplification and the final LAB host. In the present study, we examined the influence of DNA methylation on transformation efficiency in LAB and developed a direct cloning approach for Lactobacillus plantarum CD033. Therefore, we propagated plasmid pCD256 in E. coli strains with different dam/dcm-methylation properties. The obtained plasmid DNA was purified and transformed into three different L. plantarum strains and a selection of other LAB species. Results Best transformation efficiencies were obtained using the strain L. plantarum CD033 and non-methylated plasmid DNA. Thereby we achieved transformation efficiencies of ~ 109 colony forming units/μg DNA in L. plantarum CD033 which is in the range of transformation efficiencies reached with E. coli. Based on these results, we directly transformed recombinant expression vectors received from PCR/ligation reactions into L. plantarum CD033, omitting plasmid amplification in E. coli. Also this approach was successful and yielded a sufficient number of recombinant clones. Conclusions Transformation efficiency of L. plantarum CD033 was drastically increased when non-methylated plasmid DNA was used, providing the possibility to generate expression libraries in this organism. A direct cloning approach, whereby ligated PCR-products where successfully transformed directly into L. plantarum CD033, obviates the construction of shuttle vectors containing E. coli-specific sequences, as e.g. a ColEI origin of replication, and makes amplification of these vectors in E. coli obsolete. Thus, plasmid constructs become much smaller and occasional structural instability or mutagenesis during E. coli propagation is excluded. The results of our study provide new genetic tools for L. plantarum which will allow fast, forward and systems based genetic engineering of this species. PMID:23098256

Back to basics: pBR322 and protein expression systems in E. coli.

PubMed

Balbás, Paulina; Bolívar, Francisco

2004-01-01

The extensive variety of plasmid-based expression systems in E. coli resulted from the fact that there is no single strategy for achieving maximal expression of every cloned gene. Although a number of strategies have been implemented to deal with problems associated to gene transcription and translation, protein folding, secretion, location, posttranslational modifications, particularities of different strains, and the like and more integrated processes have been developed, the basic plasmid-borne elements and their interaction with the particular host strain will influence the overall expression system and final productivity. Plasmid vector pBR322 is a well-established multipurpose cloning vector in laboratories worldwide, and a large number of derivatives have been created for specific applications and research purposes, including gene expression in its natural host, E. coli, and few other bacteria. The early characterization of the molecule, including its nucleotide sequence, replication and maintenance mechanisms, and determination of its coding regions, accounted for its success, not only as a universal cloning vector, but also as a provider of genes and an origin of replication for other intraspecies vectors. Since the publication of the aforementioned reviews, novel discoveries pertaining to these issues have appeared in the literature that deepen the understanding of the plasmid's features, behavior, and impact in gene expression systems, as well as some important strain characteristics that affect plasmid replication and stability. The objectives of this review include updating and discussing the new information about (1) the replication and maintenance of pBR322; (2) the host-related modulation mechanisms of plasmid replication; (3) the effects of growth rate on replication control, stability, and recombinant gene expression; (4) ways for plasmid amplification and elimination. Finally, (5) a summary of novel ancillary studies about pBR322 is presented.

The Minimal Replicator of Epstein-Barr Virus oriP

PubMed Central

Yates, John L.; Camiolo, Sarah M.; Bashaw, Jacqueline M.

2000-01-01

oriP is a 1.7-kb region of the Epstein-Barr virus (EBV) chromosome that supports the replication and stable maintenance of plasmids in human cells. oriP contains two essential components, called the DS and the FR, both of which contain multiple binding sites for the EBV-encoded protein, EBNA-1. The DS appears to function as the replicator of oriP, while the FR acts in conjunction with EBNA-1 to prevent the loss of plasmids from proliferating cells. Because of EBNA-1's role in stabilizing plasmids through the FR, it has not been entirely clear to what extent EBNA-1 might be required for replication from oriP per se, and a recent study has questioned whether EBNA-1 has any direct role in replication. In the present study we found that plasmids carrying oriP required EBNA-1 to replicate efficiently even when assayed only 2 days after plasmids were introduced into the cell lines 143B and 293. Significantly, using 293 cells it was demonstrated that the plasmid-retention function of EBNA-1 and the FR did not contribute significantly to the accumulation of replicated plasmids, and the DS supported efficient EBNA-1-dependent replication in the absence of the FR. The DS contains two pairs of closely spaced EBNA-1 binding sites, and a previous study had shown that both sites within either pair are required for activity. However, it was unclear from previous work what additional sequences within the DS might be required. We found that each “half” of the DS, including a pair of closely spaced EBNA-1 binding sites, had significant replicator activity when the other half had been deleted. The only significant DNA sequences that the two halves of the DS share in common, other than EBNA-1 binding sites, is a 9-bp sequence that is present twice in the “left half” and once in the “right half.” These nonamer repeats, while not essential for activity, contributed significantly to the activity of each half of the DS. Two thymines occur at unique positions within EBNA-1 binding sites 1 and 4 at the DS and become sensitive to oxidation by permanganate when EBNA-1 binds, but mutation of each to the consensus base, adenine, actually improved the activity of each half of the DS slightly. In conclusion, the DS of oriP is an EBNA-1-dependent replicator, and its minimal active core appears to be simply two properly spaced EBNA-1 binding sites. PMID:10775587

A New Suite of Plasmid Vectors for Fluorescence-Based Imaging of Root Colonizing Pseudomonads

DOE PAGES

Wilton, Rosemarie; Ahrendt, Angela J.; Shinde, Shalaka; ...

2018-02-01

In the terrestrial ecosystem, plant-microbe symbiotic associations are ecologically and economically important processes. To better understand these associations at structural and functional levels, different molecular and biochemical tools are applied. In this study, we have constructed a suite of vectors that incorporates several new elements into the rhizosphere stable, broad-host vector pME6031. The new vectors are useful for studies requiring multi-color tagging and visualization of plant-associated, Gram negative bacterial strains such as Pseudomonas plant growth promotion and biocontrol strains. A number of genetic elements, including constitutive promoters and signal peptides that target secretion to the periplasm, have been evaluated. Severalmore » next generation fluorescent proteins, namely mTurquoise2, mNeonGreen, mRuby2, DsRed-Express2 and E2-Crimson have been incorporated into the vectors for whole cell labeling or protein tagging. Secretion of mTurquoise2 and mNeonGreen into the periplasm of Pseudomonas fluorescens SBW25 has also been demonstrated, providing a vehicle for tagging proteins in the periplasmic compartment. A higher copy number version of select plasmids has been produced by introduction of a previously described repA mutation, affording an increase in protein expression levels. The utility of these plasmids for fluorescence-based imaging is demonstrated by root colonization of Solanum lycopersicum seedlings by P. fluorescens SBW25 in a hydroponic growth system. As a result, the plasmids are stably maintained during root colonization in the absence of selective pressure for more than two weeks.« less

A New Suite of Plasmid Vectors for Fluorescence-Based Imaging of Root Colonizing Pseudomonads

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilton, Rosemarie; Ahrendt, Angela J.; Shinde, Shalaka

In the terrestrial ecosystem, plant-microbe symbiotic associations are ecologically and economically important processes. To better understand these associations at structural and functional levels, different molecular and biochemical tools are applied. In this study, we have constructed a suite of vectors that incorporates several new elements into the rhizosphere stable, broad-host vector pME6031. The new vectors are useful for studies requiring multi-color tagging and visualization of plant-associated, Gram negative bacterial strains such as Pseudomonas plant growth promotion and biocontrol strains. A number of genetic elements, including constitutive promoters and signal peptides that target secretion to the periplasm, have been evaluated. Severalmore » next generation fluorescent proteins, namely mTurquoise2, mNeonGreen, mRuby2, DsRed-Express2 and E2-Crimson have been incorporated into the vectors for whole cell labeling or protein tagging. Secretion of mTurquoise2 and mNeonGreen into the periplasm of Pseudomonas fluorescens SBW25 has also been demonstrated, providing a vehicle for tagging proteins in the periplasmic compartment. A higher copy number version of select plasmids has been produced by introduction of a previously described repA mutation, affording an increase in protein expression levels. The utility of these plasmids for fluorescence-based imaging is demonstrated by root colonization of Solanum lycopersicum seedlings by P. fluorescens SBW25 in a hydroponic growth system. As a result, the plasmids are stably maintained during root colonization in the absence of selective pressure for more than two weeks.« less

Promiscuous plasmid replication in thermophiles: Use of a novel hyperthermophilic replicon for genetic manipulation of Clostridium thermocellum at its optimum growth temperature

DOE Office of Scientific and Technical Information (OSTI.GOV)

Groom, Joseph; Chung, Daehwan; Olson, Daniel G.

2016-01-29

Clostridium thermocellum is a leading candidate for the consolidated bioprocessing of lignocellulosic biomass for the production of fuels and chemicals. A limitation to the engineering of this strain is the availability of stable replicating plasmid vectors for homologous and heterologous expression of genes that provide improved and/or novel pathways for fuel production. Current vectors relay on replicons from mesophilic bacteria and are not stable at the optimum growth temperature of C. thermocellum. To develop more thermostable genetic tools for C. thermocellum, we constructed vectors based on the hyperthermophilic Caldicellulosiruptor bescii replicon pBAS2. Autonomously replicating shuttle vectors based on pBAS2 reproduciblymore » transformed C. thermocellum at 60 °C and were maintained in multiple copy. Promoters, selectable markers and plasmid replication proteins from C. bescii were functional in C. thermocellum. Phylogenetic analyses of the proteins contained on pBAS2 revealed that the replication initiation protein RepL is unique among thermophiles. Lastly, these results suggest that pBAS2 may be a broadly useful replicon for other thermophilic Firmicutes.« less

Advanced Design of Dumbbell-shaped Genetic Minimal Vectors Improves Non-coding and Coding RNA Expression.

PubMed

Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker

2016-09-01

Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.

Genetic control of ColE1 plasmid stability that is independent of plasmid copy number regulation.

PubMed

Standley, Melissa S; Million-Weaver, Samuel; Alexander, David L; Hu, Shuai; Camps, Manel

2018-06-16

ColE1-like plasmid vectors are widely used for expression of recombinant genes in E. coli. For these vectors, segregation of individual plasmids into daughter cells during cell division appears to be random, making them susceptible to loss over time when no mechanisms ensuring their maintenance are present. Here we use the plasmid pGFPuv in a recA relA strain as a sensitized model to study factors affecting plasmid stability in the context of recombinant gene expression. We find that in this model, plasmid stability can be restored by two types of genetic modifications to the plasmid origin of replication (ori) sequence: point mutations and a novel 269 nt duplication at the 5' end of the plasmid ori, which we named DAS (duplicated anti-sense) ori. Combinations of these modifications produce a range of copy numbers and of levels of recombinant expression. In direct contradiction with the classic random distribution model, we find no correlation between increased plasmid copy number and increased plasmid stability. Increased stability cannot be explained by reduced levels of recombinant gene expression either. Our observations would be more compatible with a hybrid clustered and free-distribution model, which has been recently proposed based on detection of individual plasmids in vivo using super-resolution fluorescence microscopy. This work suggests a role for the plasmid ori in the control of segregation of ColE1 plasmids that is distinct from replication initiation, opening the door for the genetic regulation of plasmid stability as a strategy aimed at enhancing large-scale recombinant gene expression or bioremediation.

Development of inducer-free expression plasmids based on IPTG-inducible promoters for Bacillus subtilis.

PubMed

Tran, Dinh Thi Minh; Phan, Trang Thi Phuong; Huynh, Thanh Kieu; Dang, Ngan Thi Kim; Huynh, Phuong Thi Kim; Nguyen, Tri Minh; Truong, Tuom Thi Tinh; Tran, Thuoc Linh; Schumann, Wolfgang; Nguyen, Hoang Duc

2017-07-25

Besides Escherichia coli, Bacillus subtilis is an important bacterial species for the production of recombinant proteins. Recombinant genes are inserted into shuttle expression vectors which replicate in both E. coli and in B. subtilis. The ligation products are first transformed into E. coli cells, analyzed for correct insertions, and the correct recombinant plasmids are then transformed into B. subtilis. A major problem using E. coli cells can be the strong basal level of expression of the recombinant protein which may interfere with the stability of the cells. To minimize this problem, we developed strong expression vectors being repressed in E. coli and inducer-free in B. subtilis. In general, induction of IPTG-inducible expression vectors is determined by the regulatory lacI gene encoding the LacI repressor in combination with the lacO operator on the promoter. To investigate the inducer-free properties of the vectors, we constructed inducer-free expression plasmids by removing the lacI gene and characterized their properties. First, we examined the ability to repress a reporter gene in E. coli, which is a prominent property facilitating the construction of the expression vectors carrying a target gene. The β-galactosidase (bgaB gene) basal levels expressed from Pgrac01-bgaB could be repressed at least twice in the E. coli cloning strain. Second, the inducer-free production of BgaB from four different plasmids with the Pgrac01 promoter in B. subtilis was investigated. As expected, BgaB expression levels of inducer-free constructs are at least 37 times higher than that of the inducible constructs in the absence of IPTG, and comparable to those in the presence of the inducer. Third, using efficient IPTG-inducible expression vectors containing the strong promoter Pgrac100, we could convert them into inducer-free expression plasmids. The BgaB production levels from the inducer-free plasmid in the absence of the inducer were at least 4.5 times higher than that of the inducible vector using the same promoter. Finally, we used gfp as a reporter gene in combination with the two promoters Pgrac01 and Pgrac100 to test the new vector types. The GFP expression levels could be repressed at least 1.5 times for the Pgrac01-gfp+ inducer-free construct in E. coli. The inducer-free constructs Pgrac01-gfp+ and Pgrac100-gfp+ allowed GFP expression at high levels from 23 × 10 4 to 32 × 10 4 RFU units and 9-13% of total intracellular proteins. We could reconfirm the two major advantages of the new inducer-free expression plasmids: (1) Strong repression of the target gene expression in the E. coli cloning strain, and (2) production of the target protein at high levels in B. subtilis in the absence of the inducer. We propose a general strategy to generate inducer-free expression vector by using IPTG-inducible vectors, and more specifically we developed inducer-free expression plasmids using IPTG-inducible promoters in the absence of the LacI repressor. These plasmids could be an excellent choice for high-level production of recombinant proteins in B. subtilis without the addition of inducer and at the same time maintaining a low basal level of the recombinant proteins in E. coli. The repression of the recombinant gene expression would facilitate cloning of genes that potentially inhibit the growth of E. coli cloning strains. The inducer-free expression plasmids will be extended versions of the current available IPTG-inducible expression vectors for B. subtilis, in which all these vectors use the same cognate promoters. These inducer-free and previously developed IPTG-inducible expression plasmids will be a useful cassette to study gene expression at a small scale up to a larger scale up for the production of recombinant proteins.

Comparative Sequence Analysis of Plasmids from Lactobacillus delbrueckii and Construction of a Shuttle Cloning Vector▿

PubMed Central

Lee, Ju-Hoon; Halgerson, Jamie S.; Kim, Jeong-Hwan; O'Sullivan, Daniel J.

2007-01-01

While plasmids are very commonly associated with the majority of the lactic acid bacteria, they are only very rarely associated with Lactobacillus delbrueckii, with only four characterized to date. In this study, the complete sequence of a native plasmid, pDOJ1, from a strain of Lactobacillus delbrueckii subsp. bulgaricus was determined. It consisted of a circular DNA molecule of 6,220 bp with a G+C content of 44.6% and a characteristic ori and encoded six open reading frames (ORFs), of which functions could be predicted for three—a mobilization (Mob) protein, a transposase, and a fused primase-helicase replication protein. Comparative analysis of pDOJ1 and the other available L. delbrueckii plasmids (pLBB1, pJBL2, pN42, and pLL1212) revealed a very similar organization and amino acid identities between 85 and 98% for the putative proteins of all six predicted ORFs from pDOJ1, reflecting a common origin for L. delbrueckii plasmids. Analysis of the fused primase-helicase replication gene found a similar fused organization only in the theta replicating group B plasmids from Streptococcus thermophilus. This observation and the ability of the replicon to function in S. thermophilus support the idea that the origin of plasmids in L. delbrueckii was likely from S. thermophilus. This may reflect the close association of these two species in dairy fermentations, particularly yogurt production. As no vector based on plasmid replicons from L. delbrueckii has previously been constructed, an Escherichia coli-L. delbrueckii shuttle cloning vector, pDOJ4, was constructed from pDOJ1, the p15A ori, the chloramphenicol resistance gene of pCI372, and the lacZ polylinker from pUC18. This cloning vector was successfully introduced into E. coli, L. delbrueckii subsp. bulgaricus, S. thermophilus, and Lactococcus lactis. This shuttle cloning vector provides a new tool for molecular analysis of Lactobacillus delbrueckii and other lactic acid bacteria. PMID:17526779

Characterization of Endogenous Plasmids from Lactobacillus salivarius UCC118▿ †

PubMed Central

Fang, Fang; Flynn, Sarah; Li, Yin; Claesson, Marcus J.; van Pijkeren, Jan-Peter; Collins, J. Kevin; van Sinderen, Douwe; O'Toole, Paul W.

2008-01-01

The genome of Lactobacillus salivarius UCC118 comprises a 1.83-Mb chromosome, a 242-kb megaplasmid (pMP118), and two smaller plasmids of 20 kb (pSF118-20) and 44 kb (pSF118-44). Annotation and bioinformatic analyses suggest that both of the smaller plasmids replicate by a theta replication mechanism. Furthermore, it appears that they are transmissible, although neither possesses a complete set of conjugation genes. Plasmid pSF118-20 encodes a toxin-antitoxin system composed of pemI and pemK homologs, and this plasmid could be cured when PemI was produced in trans. The minimal replicon of pSF118-20 was determined by deletion analysis. Shuttle vector derivatives of pSF118-20 were generated that included the replication region (pLS203) and the replication region plus mobilization genes (pLS208). The plasmid pLS203 was stably maintained without selection in Lactobacillus plantarum, Lactobacillus fermentum, and the pSF118-20-cured derivative strain of L. salivarius UCC118 (strain LS201). Cloning in pLS203 of genes encoding luciferase and green fluorescent protein, and expression from a constitutive L. salivarius promoter, demonstrated the utility of this vector for the expression of heterologous genes in Lactobacillus. This study thus expands the knowledge base and vector repertoire of probiotic lactobacilli. PMID:18390685

Epstein-Barr virus nuclear antigen-1 is highly colocalized with interphase chromatin and its newly replicated regions in particular.

PubMed

Ito, Sayuri; Gotoh, Eisuke; Ozawa, Shigeru; Yanagi, Kazuo

2002-10-01

Epstein-Barr virus (EBV) nuclear antigen-1 (EBNA-1), which binds to both the EBV origin of replication (oriP) and metaphase chromosomes, is essential for the replication/retention and segregation/partition of oriP-containing plasmids. Here the chromosomal localization of EBNA-1 fused to green fluorescent protein (GFP-EBNA-1) is examined by confocal microscopy combined with a 'premature chromosome condensation' (PCC) procedure. Analyses show that GFP-EBNA-1 expressed in living cells that lack oriP plasmids is associated with cellular chromatin that has been condensed rapidly by the PCC procedure into identifiable forms that are unique to each phase of interphase as well as metaphase chromosomes. Studies of cellular chromosomal DNAs labelled with BrdU or Cy3-dUTP indicate that GFP-EBNA-1 colocalizes highly with the labelled, newly replicated regions of interphase chromatin in cells. These results suggest that EBNA-1 is associated not only with cellular metaphase chromosomes but also with condensing chromatin/chromosomes and probably with interphase chromatin, especially with its newly replicated regions.

Development of a Novel Escherichia coli-Kocuria Shuttle Vector Using the Cryptic pKPAL3 Plasmid from K. palustris IPUFS-1 and Its Utilization in Producing Enantiopure (S)-Styrene Oxide.

PubMed

Toda, Hiroshi; Itoh, Nobuya

2017-01-01

The novel cryptic pKPAL3 plasmid was isolated from the Gram-positive microorganism Kocuria palustris IPUFS-1 and characterized in detail. pKPAL3 is a circular plasmid that is 4,443 bp in length. Open reading frame (ORF) and homology search analyses indicated that pKPAL3 possesses four ORFs; however, there were no replication protein coding genes predicted in the plasmid. Instead, there were two nucleotide sequence regions that showed significant identities with untranslated regions of K. rhizophila DC2201 (NBRC 103217) genomic sequences, and these sequences were essential for autonomous replication of pKPAL3 in Kocuria cells. Based on these findings, we constructed the novel Escherichia coli - Kocuria shuttle vectors pKITE301 (kanamycin resistant) and pKITE303 (thiostrepton resistant) from pKPAL3. The copy numbers of the constructed shuttle vectors were estimated to be 20 per cell, and they exhibited low segregation stability in Kocuria transformant cells in the absence of antibiotics. Moreover, constructed vectors showed compatibility with the other K. rhizophila shuttle vector pKITE103. We successfully expressed multiple heterologous genes, including the styrene monooxygenase gene from Rhodococcus sp. ST-10 ( rhsmo ) and alcohol dehydrogenase gene from Leifsonia sp. S749 ( lsadh ), in K . rhizophila DC2201 using the pKITE301P and pKITE103P vectors under the control of the glyceraldehyde 3-phosphate dehydrogenase ( gapdh ) promotor. The RhSMO-LSADH co-expressing K. rhizophila was used as a biocatalyst in an organic solvent-water biphasic reaction system to efficiently convert styrene into ( S )-styrene oxide with 99% ee in the presence of 2-propanol as a hydrogen donor. The product concentration of the reaction in the organic solvent reached 235 mM after 30 h under optimum conditions. Thus, we demonstrated that this novel shuttle vector is useful for developing biocatalysts based on organic solvent-tolerant Kocuria cells.

Construction and production of oncotropic vectors, derived from MVM(p), that share reduced sequence homology with helper plasmids.

PubMed

Clément, Nathalie; Velu, Thierry; Brandenburger, Annick

2002-09-01

The production of currently available vectors derived from autonomous parvoviruses requires the expression of capsid proteins in trans, from helper sequences. Cotransfection of a helper plasmid always generates significant amounts of replication-competent virus (RCV) that can be reduced by the integration of helper sequences into a packaging cell line. Although stocks of minute virus of mice (MVM)-based vectors with no detectable RCV could be produced by transfection into packaging cells; the latter appear after one or two rounds of replication, precluding further amplification of the vector stock. Indeed, once RCVs become detectable, they are efficiently amplified and rapidly take over the culture. Theoretically RCV-free vector stocks could be produced if all homology between vector and helper DNA is eliminated, thus preventing homologous recombination. We constructed new vectors based on the structure of spontaneously occurring defective particles of MVM. Based on published observations related to the size of vectors and the sequence of the viral origin of replication, these vectors were modified by the insertion of foreign DNA sequences downstream of the transgene and by the introduction of a consensus NS-1 nick site near the origin of replication to optimize their production. In one of the vectors the inserted fragment of mouse genomic DNA had a synergistic effect with the modified origin of replication in increasing vector production.

Construction of small plasmid vectors for use in genetic improvement of the extremely acidophilic Acidithiobacillus caldus.

PubMed

Meng, Jianzhou; Wang, Huiyan; Liu, Xiangmei; Lin, Jianqun; Pang, Xin; Lin, Jianqiang

2013-10-01

The genetic improvement of biomining bacteria including Acidithiobacillus caldus could facilitate the bioleaching process of sulfur-containing minerals. However, the available vectors for use in A. caldus are very scanty and limited to relatively large broad-host-range IncQ plasmids. In this study, a set of small, mobilizable plasmid vectors (pBBR1MCS-6, pMSD1 and pMSD2) were constructed based on plasmid pBBR1MCS-2, which does not belong to the IncQ, IncW, or IncP groups. The function of the tac promoter on 5.8-kb pMSD2 was determined by inserting a kanamycin-resistant reporter gene. The resulting recombinant pMSD2-Km was successfully transferred by conjugation into A. caldus MTH-04 with transfer frequency of 1.38±0.64×10(-5). The stability and plasmid copy number of pMSD2-Km in A. caldus MTH-04 were 75±2.7% and 5-6 copies per cell, respectively. By inserting an arsABC operon into pMSD2, an arsenic-resistant recombinant pMSD2-As was constructed and transferred into A. caldus MTH-04 by conjugation. The arsenic tolerance of A. caldus MTH-04 containing pMSD2-As was obviously increased up to 45mM of NaAsO2. These vectors could be applied in genetic improvement of A. caldus as well as other bioleaching bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.

3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

PubMed

Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

2008-09-01

We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

Quantifying and resolving multiple vector transformants in S. cerevisiae plasmid libraries.

PubMed

Scanlon, Thomas C; Gray, Elizabeth C; Griswold, Karl E

2009-11-20

In addition to providing the molecular machinery for transcription and translation, recombinant microbial expression hosts maintain the critical genotype-phenotype link that is essential for high throughput screening and recovery of proteins encoded by plasmid libraries. It is known that Escherichia coli cells can be simultaneously transformed with multiple unique plasmids and thusly complicate recombinant library screening experiments. As a result of their potential to yield misleading results, bacterial multiple vector transformants have been thoroughly characterized in previous model studies. In contrast to bacterial systems, there is little quantitative information available regarding multiple vector transformants in yeast. Saccharomyces cerevisiae is the most widely used eukaryotic platform for cell surface display, combinatorial protein engineering, and other recombinant library screens. In order to characterize the extent and nature of multiple vector transformants in this important host, plasmid-born gene libraries constructed by yeast homologous recombination were analyzed by DNA sequencing. It was found that up to 90% of clones in yeast homologous recombination libraries may be multiple vector transformants, that on average these clones bear four or more unique mutant genes, and that these multiple vector cells persist as a significant proportion of library populations for greater than 24 hours during liquid outgrowth. Both vector concentration and vector to insert ratio influenced the library proportion of multiple vector transformants, but their population frequency was independent of transformation efficiency. Interestingly, the average number of plasmids born by multiple vector transformants did not vary with their library population proportion. These results highlight the potential for multiple vector transformants to dominate yeast libraries constructed by homologous recombination. The previously unrecognized prevalence and persistence of multiply transformed yeast cells have important implications for yeast library screens. The quantitative information described herein should increase awareness of this issue, and the rapid sequencing approach developed for these studies should be widely useful for identifying multiple vector transformants and avoiding complications associated with cells that have acquired more than one unique plasmid.

Sequential cloning of chromosomes

DOEpatents

Lacks, Sanford A.

1995-07-18

A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism's chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes.

Electrotransformation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis with Various Plasmids

PubMed Central

Serror, Pascale; Sasaki, Takashi; Ehrlich, S. Dusko; Maguin, Emmanuelle

2002-01-01

We describe, for the first time, a detailed electroporation procedure for Lactobacillus delbrueckii. Three L. delbrueckii strains were successfully transformed. Under optimal conditions, the transformation efficiency was 104 transformants per μg of DNA. Using this procedure, we identified several plasmids able to replicate in L. delbrueckii and integrated an integrative vector based on phage integrative elements into the L. delbrueckii subsp. bulgaricus chromosome. These vectors provide a good basis for developing molecular tools for L. delbrueckii and open the field of genetic studies in L. delbrueckii. PMID:11772607

Gene Suppression of Mouse Testis In Vivo Using Small Interfering RNA Derived from Plasmid Vectors

PubMed Central

Takizawa, Takami; Ishikawa, Tomoko; Kosuge, Takuji; Mizuguchi, Yoshiaki; Sato, Yoko; Koji, Takehiko; Araki, Yoshihiko; Takizawa, Toshihiro

2012-01-01

We evaluated whether inhibiting gene expression by small interfering RNA (siRNA) can be used for an in vivo model using a germ cell-specific gene (Tex101) as a model target in mouse testis. We generated plasmid-based expression vectors of siRNA targeting the Tex101 gene and transfected them into postnatal day 10 mouse testes by in vivo electroporation. After optimizing the electroporation conditions using a vector transfected into the mouse testis, a combination of high- and low-voltage pulses showed excellent transfection efficiency for the vectors with minimal tissue damage, but gene suppression was transient. Gene suppression by in vivo electroporation may be helpful as an alternative approach when designing experiments to unravel the basic role of testicular molecules. PMID:22489107

[Cloning and gene expression in lactic acid bacteria].

PubMed

Bondarenko, V M; Beliavskaia, V A

2000-01-01

The possibility of using the genera Lactobacillus and Lactococcus as vector representatives is widely discussed at present. The prospects of the construction of recombinant bacteria are closely connected with the solution of a number of problems: the level of the transcription of cloned genes, the effectiveness of the translation of heterologous mRNA, the stability of protein with respect to bacterial intracellular proteases, the method by protein molecules leave the cell (by secretion or as the result of lysis). To prevent segregation instability, the construction of vector molecules on the basis of stable cryptic plasmids found in wild strains of lactic acid bacteria was proposed. High copying plasmids with low molecular weight were detected in L. plantarum and L. pentosus strains. Several plasmids with molecular weights of 1.7, 1.8 and 2.3 kb were isolated from bacterial cells to be used as the basis for the construction of vector molecules. Genes of chloramphenicol- and erythromycin-resistance from Staphylococcus aureus plasmids were used as marker genes ensuring cell transformation. The vector plasmids thus constructed exhibited high transformation activity in the electroporation of different strains, including L. casei, L. plantarum, L. acidophilus, L. fermentum and L. brevis which could be classified with the replicons of a wide circle of hosts. But the use of these plasmids was limited due to the risk of the uncontrolled dissemination of recombinant plasmids. L. acidophilus were also found to have strictly specific plasmids with good prospects of being used as the basis for the creation of vectors, incapable of dissemination. In addition to the search of strain-specific plasmids, incapable of uncontrolled gene transmission, the use of chromosome-integrated heterologous genes is recommended in cloning to ensure the maximum safety.

Evaluation of Measles Vaccine Virus as a Vector to Deliver Respiratory Syncytial Virus Fusion Protein or Epstein-Barr Virus Glycoprotein gp350

PubMed Central

Mok, Hoyin; Cheng, Xing; Xu, Qi; Zengel, James R; Parhy, Bandita; Zhao, Jackie; Wang, C. Kathy; Jin, Hong

2012-01-01

Live attenuated recombinant measles vaccine virus (MV) Edmonston-Zagreb (EZ) strain was evaluated as a viral vector to express the ectodomains of fusion protein of respiratory syncytial virus (RSV F) or glycoprotein 350 of Epstein-Barr virus (EBV gp350) as candidate vaccines for prophylaxis of RSV and EBV. The glycoprotein gene was inserted at the 1st or the 3rd position of the measles virus genome and the recombinant viruses were generated. Insertion of the foreign gene at the 3rd position had a minimal impact on viral replication in vitro. RSV F or EBV gp350 protein was secreted from infected cells. In cotton rats, EZ-RSV F and EZ-EBV gp350 induced MV- and insert-specific antibody responses. In addition, both vaccines also induced insert specific interferon gamma (IFN-γ) secreting T cell response. EZ-RSV F protected cotton rats from pulmonary replication of RSV A2 challenge infection. In rhesus macaques, although both EZ-RSV F and EZ-EBV gp350 induced MV specific neutralizing antibody responses, only RSV F specific antibody response was detected. Thus, the immunogenicity of the foreign antigens delivered by measles vaccine virus is dependent on the nature of the insert and the animal models used for vaccine evaluation. PMID:22383906

Identification of Essential Genetic Baculoviral Elements for Recombinant Protein Expression by Transactivation in Sf21 Insect Cells.

PubMed

Bleckmann, Maren; Schürig, Margitta; Chen, Fang-Fang; Yen, Zen-Zen; Lindemann, Nils; Meyer, Steffen; Spehr, Johannes; van den Heuvel, Joop

2016-01-01

The Baculovirus Expression Vector System (BEVS) is widely used to produce high amounts of recombinant proteins. Nevertheless, generating recombinant baculovirus in high quality is rather time-consuming and labor-intensive. Alternatively, virus-free expression in insect cells did not achieve similar expression levels for most proteins so far. The transactivation method is a promising approach for protein expression in Sf21 cells. It combines advantages of BEVS and plasmid-based expression by activating strong virus-dependent promoters on a transfected plasmid by baculoviral coinfection. Here, we identified expression elements required for transactivation. Therefore, we designed several vectors comprising different viral promoters or promoter combinations and tested them for eGFP expression using the automated BioLector microcultivation system. Remarkably, only the combination of the very late promoter p10 together with the homologous region 5 (hr5) could boost expression during transactivation. Other elements, like p10 alone or the late viral promoter polH, did not respond to transactivation. A new combination of hr5 and p10 with the strongest immediate early OpMNPV viral promoter OpIE2 improved the yield of eGFP by ~25% in comparison to the previous applied hr5-IE1-p10 expression cassette. Furthermore, we observed a strong influence of the transcription termination sequence and vector backbone on the level of expression. Finally, the expression levels for transactivation, BEVS and solely plasmid-based expression were compared for the marker protein eGFP, underlining the potential of transactivation for fast recombinant protein expression in Sf21 cells. In conclusion, essential elements for transactivation could be identified. The optimal elements were applied to generate an improved vector applicable in virus-free plasmid-based expression, transactivation and BEVS.

Versatile plasmid-based expression systems for Gram-negative bacteria--General essentials exemplified with the bacterium Ralstonia eutropha H16.

PubMed

Gruber, Steffen; Schwab, Helmut; Koefinger, Petra

2015-12-25

The Gram-negative bacterium Escherichia coli is currently the most efficient and widely used prokaryotic host for recombinant protein and metabolite production. However, due to some limitations and to various interesting features of other Gram-negative bacteria efficient vector systems applicable to a broad range are desired. Basic building blocks for plasmid-based vectors include besides the need for a suitable selection marker in the first line a proper replication and maintenance system. In addition to these basic requirements, further elements are needed for Gram-negative bacteria beyond E. coli, such as Pseudomonas pudita, Ralstonia eutropha, Burkholderia glumae or Acinetobacter sp.. Established building blocks have to be adapted and new building blocks providing the desired functions need to be identified and exploited. This minireview addresses so far described and used genetic elements for broad host range replication, efficient plasmid maintenance, and conjugative plasmid transfer as well as expression elements and protein secretion signals. The industrially important bacterium R. eutropha H16 was chosen as a model organism to provide specific data on the effectivity and utility of building blocks based on such genetic elements. Copyright © 2015 Elsevier B.V. All rights reserved.

Plasmid vectors for Xylella fastidiosa utilizing a toxin-antitoxin system for plasmid stability in the absence of antibiotic selection

USDA-ARS?s Scientific Manuscript database

The phytopathogen Xylella fastidiosa causes disease in a variety of important crop and landscape plants. Functional genetic studies have led to a broader understanding of virulence mechanisms used by this pathogen in the grapevine host. Plasmid shuttle vectors are important tools in studies of bacte...

Construction of new cloning, lacZ reporter and scarless-markerless suicide vectors for genetic studies in Aggregatibacter actinomycetemcomitans

PubMed Central

Juárez-Rodríguez, María Dolores; Torres-Escobar, Ascención; Demuth, Donald R.

2013-01-01

To elucidate the putative function of a gene, effective tools are required for genetic characterization that facilitate its inactivation, deletion or modification on the bacterial chromosome. In the present study, the nucleotide sequence of the Escherichia coli/Aggregatibacter actinomycetemcomitans shuttle vector pYGK was determined, allowing us to redesign and construct a new shuttle cloning vector, pJT4, and promoterless lacZ transcriptional/translational fusion plasmids, pJT3 and pJT5. Plasmids pJT4 and pJT5 contain the origin of replication necessary to maintain shuttle vector replication. In addition, a new suicide vector, pJT1, was constructed for the generation of scarless and markerless deletion mutations of genes in the oral pathogen A. actinomycetemcomitans. Plasmid pJT1 is a pUC-based suicide vector that is counter-selectable for sucrose sensitivity. This vector does not leave antibiotic markers or scars on the chromosome after gene deletion and thus provides the option to combine several mutations in the same genetic background. The effectiveness of pJT1 was demonstrated by the construction of A. actinomycetemcomitans isogenic qseB single deletion (ΔqseB) mutant and lsrRK double deletion mutants (ΔlsrRK). These new vectors may offer alternatives for genetic studies in A. actinomycetemcomitans and other members of the HACEK (Haemophilus spp., A. actinomycetemcomitans, Cardiobacterium hominis, Eikenella corrodens, and Kingella kingae) group of Gram-negative bacteria. PMID:23353051

The 2-micron plasmid as a nonselectable, stable, high copy number yeast vector

NASA Technical Reports Server (NTRS)

Ludwig, D. L.; Bruschi, C. V.

1991-01-01

The endogenous 2-microns plasmid of Saccharomyces cerevisiae has been used extensively for the construction of yeast cloning and expression plasmids because it is a native yeast plasmid that is able to be maintained stably in cells at high copy number. Almost invariably, these plasmid constructs, containing some or all 2-microns sequences, exhibit copy number levels lower than 2-microns and are maintained stably only under selective conditions. We were interested in determining if there was a means by which 2-microns could be utilized for vector construction, without forfeiting either copy number or nonselective stability. We identified sites in the 2-microns plasmid that could be used for the insertion of genetic sequences without disrupting 2-microns coding elements and then assessed subsequent plasmid constructs for stability and copy number in vivo. We demonstrate the utility of a previously described 2-microns recombination chimera, pBH-2L, for the manipulation and transformation of 2-microns as a pure yeast plasmid vector. We show that the HpaI site near the STB element in the 2-microns plasmid can be utilized to clone yeast DNA of at least 3.9 kb with no loss of plasmid stability. Additionally, the copy number of these constructs is as high as levels reported for the endogenous 2-microns.

Sequential cloning of chromosomes

DOEpatents

Lacks, S.A.

1995-07-18

A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism`s chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes. 9 figs.

Live, attenuated Salmonella typhimurium vectoring Campylobacter antigens.

PubMed

Sizemore, Donata R; Warner, Beth; Lawrence, Julie; Jones, Amy; Killeen, Kevin P

2006-05-01

We describe the evaluation of three live, attenuated deltaphoP/Q Salmonella enteric serovar Typhimurium strains expressing PEB1 minus its signal sequence (PEB1-ss) from three different plasmids: a pBR-based asd plasmid, an arabinose-based runaway plasmid, which each expressed PEB1-ss in the bacterial cytosol, and a PEB1::HlyA fusion plasmid that directs secretion of PEB1-ss into the extracellular milieu. Serum IgG responses specific for PEB1-ss were induced by pBR-derived and runaway plasmids, with 100 and 90% seroconversion, respectively, at a 1:500 dilution of anti-sera as measured by Western blot analysis, while the PEB1-ss::HlyA fusion plasmid induced serum IgG in only 20% of the mice. Although significant levels of anti-PEB serum IgG were induced, no protection against oral Campylobacter jejuni challenge was observed.

PSI:Biology-Materials Repository: A Biologist’s Resource for Protein Expression Plasmids

PubMed Central

Cormier, Catherine Y.; Park, Jin G.; Fiacco, Michael; Steel, Jason; Hunter, Preston; Kramer, Jason; Singla, Rajeev; LaBaer, Joshua

2011-01-01

The Protein Structure Initiative:Biology-Materials Repository (PSI:Biology-MR; MR; http://psimr.asu.edu) sequence-verifies, annotates, stores, and distributes the protein expression plasmids and vectors created by the Protein Structure Initiative (PSI). The MR has developed an informatics and sample processing pipeline that manages this process for thousands of samples per month from nearly a dozen PSI centers. DNASU (http://dnasu.asu.edu), a freely searchable database, stores the plasmid annotations, which include the full-length sequence, vector information, and associated publications for over 130,000 plasmids created by our laboratory, by the PSI and other consortia, and by individual laboratories for distribution to researchers worldwide. Each plasmid links to external resources, including the PSI Structural Biology Knowledgebase (http://sbkb.org), which facilitates cross-referencing of a particular plasmid to additional protein annotations and experimental data. To expedite and simplify plasmid requests, the MR uses an expedited material transfer agreement (EP-MTA) network, where researchers from network institutions can order and receive PSI plasmids without institutional delays. Currently over 39,000 protein expression plasmids and 78 empty vectors from the PSI are available upon request from DNASU. Overall, the MR’s repository of expression-ready plasmids, its automated pipeline, and the rapid process for receiving and distributing these plasmids more effectively allows the research community to dissect the biological function of proteins whose structures have been studied by the PSI. PMID:21360289

8-Methoxypsoralen photoinduced plasmid-chromosome recombination in Saccharomyces cerevisiae using a centromeric vector.

PubMed Central

Meira, L B; Henriques, J A; Magaña-Schwencke, N

1995-01-01

The characterization of a new system to study the induction of plasmid-chromosome recombination is described. Single-stranded and double-stranded centromeric vectors bearing 8-methoxypsoralen photoinduced lesions were used to transform a wild-type yeast strain bearing the leu2-3,112 marker. Using the SSCP methodology and DNA sequencing, it was demonstrated that repair of the lesions in plasmid DNA was mainly due to conversion of the chromosomal allele to the plasmid DNA. Images PMID:7784218

Multiple point mutations in a shuttle vector propagated in human cells: evidence for an error-prone DNA polymerase activity.

PubMed

Seidman, M M; Bredberg, A; Seetharam, S; Kraemer, K H

1987-07-01

Mutagenesis was studied at the DNA-sequence level in human fibroblast and lymphoid cells by use of a shuttle vector plasmid, pZ189, containing a suppressor tRNA marker gene. In a series of experiments, 62 plasmids were recovered that had two to six base substitutions in the 160-base-pair marker gene. Approximately 20-30% of the mutant plasmids that were recovered after passing ultraviolet-treated pZ189 through a repair-proficient human fibroblast line contained these multiple mutations. In contrast, passage of ultraviolet-treated pZ189 through an excision-repair-deficient (xeroderma pigmentosum) line yielded only 2% multiple base substitution mutants. Introducing a single-strand nick in otherwise unmodified pZ189 adjacent to the marker, followed by passage through the xeroderma pigmentosum cells, resulted in about 66% multiple base substitution mutants. The multiple mutations were found in a 160-base-pair region containing the marker gene but were rarely found in an adjacent 170-base-pair region. Passing ultraviolet-treated or nicked pZ189 through a repair-proficient human B-cell line also yielded multiple base substitution mutations in 20-33% of the mutant plasmids. An explanation for these multiple mutations is that they were generated by an error-prone polymerase while filling gaps. These mutations share many of the properties displayed by mutations in the immunoglobulin hypervariable regions.

Improved methods of AAV-mediated gene targeting for human cell lines using ribosome-skipping 2A peptide

PubMed Central

Karnan, Sivasundaram; Ota, Akinobu; Konishi, Yuko; Wahiduzzaman, Md; Hosokawa, Yoshitaka; Konishi, Hiroyuki

2016-01-01

The adeno-associated virus (AAV)-based targeting vector has been one of the tools commonly used for genome modification in human cell lines. It allows for relatively efficient gene targeting associated with 1–4-log higher ratios of homologous-to-random integration of targeting vectors (H/R ratios) than plasmid-based targeting vectors, without actively introducing DNA double-strand breaks. In this study, we sought to improve the efficiency of AAV-mediated gene targeting by introducing a 2A-based promoter-trap system into targeting constructs. We generated three distinct AAV-based targeting vectors carrying 2A for promoter trapping, each targeting a GFP-based reporter module incorporated into the genome, PIGA exon 6 or PIGA intron 5. The absolute gene targeting efficiencies and H/R ratios attained using these vectors were assessed in multiple human cell lines and compared with those attained using targeting vectors carrying internal ribosome entry site (IRES) for promoter trapping. We found that the use of 2A for promoter trapping increased absolute gene targeting efficiencies by 3.4–28-fold and H/R ratios by 2–5-fold compared to values obtained with IRES. In CRISPR-Cas9-assisted gene targeting using plasmid-based targeting vectors, the use of 2A did not enhance the H/R ratios but did upregulate the absolute gene targeting efficiencies compared to the use of IRES. PMID:26657635

Generation of Marker- and/or Backbone-Free Transgenic Wheat Plants via Agrobacterium-Mediated Transformation.

PubMed

Wang, Gen-Ping; Yu, Xiu-Dao; Sun, Yong-Wei; Jones, Huw D; Xia, Lan-Qin

2016-01-01

Horizontal transfer of antibiotic resistance genes to animals and vertical transfer of herbicide resistance genes to the weedy relatives are perceived as major biosafety concerns in genetically modified (GM) crops. In this study, five novel vectors which used gusA and bar as a reporter gene and a selection marker gene, respectively, were constructed based on the pCLEAN dual binary vector system. Among these vectors, 1G7B and 5G7B carried two T-DNAs located on two respective plasmids with 5G7B possessing an additional virGwt gene. 5LBTG154 and 5TGTB154 carried two T-DNAs in the target plasmid with either one or double right borders, and 5BTG154 carried the selectable marker gene on the backbone outside of the T-DNA left border in the target plasmid. In addition, 5BTG154, 5LBTG154, and 5TGTB154 used pAL154 as a helper plasmid which contains Komari fragment to facilitate transformation. These five dual binary vector combinations were transformed into Agrobacterium strain AGL1 and used to transform durum wheat cv Stewart 63. Evaluation of the co-transformation efficiencies, the frequencies of marker-free transgenic plants, and integration of backbone sequences in the obtained transgenic lines indicated that two vectors (5G7B and 5TGTB154) were more efficient in generating marker-free transgenic wheat plants with no or minimal integration of backbone sequences in the wheat genome. The vector series developed in this study for generation of marker- and/or backbone-free transgenic wheat plants via Agrobacterium -mediated transformation will be useful to facilitate the creation of "clean" GM wheat containing only the foreign genes of agronomic importance.

Description of two new plasmids isolated from Francisella philomiragia strains and construction of shuttle vectors for the study of Francisella tularensis.

PubMed

Le Pihive, E; Blaha, D; Chenavas, S; Thibault, F; Vidal, D; Valade, E

2009-11-01

Francisella tularensis is the causative agent of tularemia, a zoonotic disease often transmitted to humans by infected animals. The lack of useful specific genetic tools has long hampered the study of F. tularensis subspecies. We identified and characterized two new plasmids, pF242 and pF243, isolated from Francisella philomiragia strains ATCC 25016 and ATCC 25017, respectively. Sequence analysis revealed that pF242 and pF243 are closely related to pC194 and pFNL10 plasmids, respectively. Two generations of pF242- and pF243-based shuttle vectors, harboring several antibiotic resistance markers, were developed. We used the first generation to compare transformation efficiencies in two virulent F. tularensis subspecies. We found that electroporation was more efficient than cryotransformation: almost all vectors tested were successfully introduced by electroporation into Francisella strains with a high level of efficiency. The second generation of shuttle vectors, containing a multiple cloning site and/or gfp gene downstream of Francisella groES promotor, was used for GFP production in F. tularensis. The development of new shuttle vectors offers new perspectives in the genetic manipulation of F. tularensis, helping to elucidate the mechanisms underlying its virulence.

Plasmid DNA Delivery: Nanotopography Matters.

PubMed

Song, Hao; Yu, Meihua; Lu, Yao; Gu, Zhengying; Yang, Yannan; Zhang, Min; Fu, Jianye; Yu, Chengzhong

2017-12-20

Plasmid DNA molecules with unique loop structures have widespread bioapplications, in many cases relying heavily on delivery vehicles to introduce them into cells and achieve their functions. Herein, we demonstrate that control over delicate nanotopography of silica nanoparticles as plasmid DNA vectors has significant impact on the transfection efficacy. For silica nanoparticles with rambutan-, raspberry-, and flower-like morphologies composed of spike-, hemisphere-, and bowl-type subunit nanotopographies, respectively, the rambutan-like nanoparticles with spiky surfaces demonstrate the highest plasmid DNA binding capability and transfection efficacy of 88%, higher than those reported for silica-based nanovectors. Moreover, it is shown that the surface spikes of rambutan nanoparticles provide a continuous open space to bind DNA chains via multivalent interactions and protect the gene molecules sheltered in the spiky layer against nuclease degradation, exhibiting no significant transfection decay. This unique protection feature is in great contrast to a commercial transfection agent with similar transfection performance but poor protection capability against enzymatic cleavage. Our study provides new understandings in the rational design of nonviral vectors for efficient gene delivery.

Development of a Novel Escherichia coli–Kocuria Shuttle Vector Using the Cryptic pKPAL3 Plasmid from K. palustris IPUFS-1 and Its Utilization in Producing Enantiopure (S)-Styrene Oxide

PubMed Central

Toda, Hiroshi; Itoh, Nobuya

2017-01-01

The novel cryptic pKPAL3 plasmid was isolated from the Gram-positive microorganism Kocuria palustris IPUFS-1 and characterized in detail. pKPAL3 is a circular plasmid that is 4,443 bp in length. Open reading frame (ORF) and homology search analyses indicated that pKPAL3 possesses four ORFs; however, there were no replication protein coding genes predicted in the plasmid. Instead, there were two nucleotide sequence regions that showed significant identities with untranslated regions of K. rhizophila DC2201 (NBRC 103217) genomic sequences, and these sequences were essential for autonomous replication of pKPAL3 in Kocuria cells. Based on these findings, we constructed the novel Escherichia coli–Kocuria shuttle vectors pKITE301 (kanamycin resistant) and pKITE303 (thiostrepton resistant) from pKPAL3. The copy numbers of the constructed shuttle vectors were estimated to be 20 per cell, and they exhibited low segregation stability in Kocuria transformant cells in the absence of antibiotics. Moreover, constructed vectors showed compatibility with the other K. rhizophila shuttle vector pKITE103. We successfully expressed multiple heterologous genes, including the styrene monooxygenase gene from Rhodococcus sp. ST-10 (rhsmo) and alcohol dehydrogenase gene from Leifsonia sp. S749 (lsadh), in K. rhizophila DC2201 using the pKITE301P and pKITE103P vectors under the control of the glyceraldehyde 3-phosphate dehydrogenase (gapdh) promotor. The RhSMO–LSADH co-expressing K. rhizophila was used as a biocatalyst in an organic solvent–water biphasic reaction system to efficiently convert styrene into (S)-styrene oxide with 99% ee in the presence of 2-propanol as a hydrogen donor. The product concentration of the reaction in the organic solvent reached 235 mM after 30 h under optimum conditions. Thus, we demonstrated that this novel shuttle vector is useful for developing biocatalysts based on organic solvent-tolerant Kocuria cells. PMID:29230202

Single inverted terminal repeats of the Junonia coenia Densovirus promotes somatic chromosomal integration of vector plasmids in insect cells and supports high efficiency expression

USDA-ARS?s Scientific Manuscript database

Plasmids that contain a disrupted genome of the Junonia coenia densovirus (JcDNV) integrate into the chromosomes of the somatic cells of insects. When subcloned individually, both the P9 inverted terminal repeat (P9-ITR) and the P93-ITR promote the chromosomal integration of vector plasmids in insec...

Restricted ultraviolet mutational spectrum in a shuttle vector propagated in xeroderma pigmentosum cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bredberg, A.; Kraemer, K.H.; Seidman, M.M.

1986-11-01

A shuttle vector plasmid, pZ189, carrying a bacterial suppressor tRNA marker gene, was treated with ultraviolet radiation and propagated in cultured skin cells from a patient with the skin-cancer-prone, DNA repair-deficient disease xeroderma pigmentosum and in repair-proficient cells. After replication in the human cells, progeny plasmids were purified. Plasmid survival and mutations inactivating the marker gene were scored by transforming an indicator strain of Escherichia coli carrying a suppressible amber mutation in the beta-galactosidase gene. Plasmid survival in the xeroderma pigmentosum cells was less than that of pZ189 harvested from repair-proficient human cells. The point-mutation frequency in the 150-base-pair tRNAmore » marker gene increased up to 100-fold with ultraviolet dose. Sequence analysis of 150 mutant plasmids revealed that mutations were infrequent at potential thymine-thymine dimer sites. Ninety-three percent of the mutant plasmids from the xeroderma pigmentosum cells showed G X C----A X T transitions, compared to 73% in the normal cells (P less than 0.002). There were significantly fewer transversions (P less than 0.002) (especially G X C----T X A) and multiple base substitutions (P less than 0.00001) than when pZ189 was passaged in repair-proficient cells. The subset of mutational changes that are common to ultraviolet-treated plasmids propagated in both repair-proficient and xeroderma pigmentosum skin cells may be associated with the development of ultraviolet-induced skin cancer in humans.« less

Adenovirus Vector Pseudotyping in Fiber-Expressing Cell Lines: Improved Transduction of Epstein-Barr Virus-Transformed B Cells

PubMed Central

Von Seggern, Dan J.; Huang, Shuang; Fleck, Shonna Kaye; Stevenson, Susan C.; Nemerow, Glen R.

2000-01-01

While adenovirus (Ad) gene delivery vectors are useful in many gene therapy applications, their broad tropism means that they cannot be directed to a specific target cell. There are also a number of cell types involved in human disease which are not transducible with standard Ad vectors, such as Epstein-Barr virus (EBV)-transformed B lymphocytes. Adenovirus binds to host cells via the viral fiber protein, and Ad vectors have previously been retargeted by modifying the fiber gene on the viral chromosome. This requires that the modified fiber be able to bind to the cell in which the vector is grown, which prevents truly specific vector targeting. We previously reported a gene delivery system based on a fiber gene-deleted Ad type 5 (Ad5) vector (Ad5.βgal.ΔF) and packaging cells that express the viral fiber protein. Expression of different fibers in packaging cells will allow Ad retargeting without modifying the viral chromosome. Importantly, fiber proteins which can no longer bind to the producer cells can also be used. Using this approach, we generated for the first time pseudotyped Ad5.βgal.ΔF particles containing either the wild-type Ad5 fiber protein or a chimeric fiber with the receptor-binding knob domain of the Ad3 fiber. Particles equipped with the chimeric fiber bound to the Ad3 receptor rather than the coxsackievirus-adenovirus receptor protein used by Ad5. EBV-transformed B lymphocytes were infected efficiently by the Ad3-pseudotyped particles but poorly by virus containing the Ad5 fiber protein. The strategy described here represents a broadly applicable method for targeting gene delivery to specific cell types. PMID:10590124

Development of transgenic strains for the biological control of the Mexican fruit fly, Anastrepha ludens

USDA-ARS?s Scientific Manuscript database

The Mexican fruit fly, Anastrepha ludens, is a highly significant agricultural pest species that has been genetically transformed with a piggyBac¬-based transposon vector system using independent vector and transposase helper plasmids. Estimated germ-line transformation frequencies were approximate...

[Construction and expression analysis of the zebrafish heart-specific transgenetic vector based on Tol2 transposable element].

PubMed

Chen, Tingfang; Luo, Na; Xie, Huaping; Wu, Xiushan; Deng, Yun

2010-02-01

In an effort to generate a desired expression construct for making heart-specific expression transgenic zebrafish, a Tol2 plasmid, which can drive EGFP reporter gene specifically expressed in the heart, was modified using subcloning technology. An IRES fragment bearing multiple cloning site (MCS) was amplified directly from pIRES2-EGFP plasmid and was inserted between the CMLC2 promoter and EGFP fragment of the pDestTol2CG vector. This recombinant expression plasmid pTol2-CMLC2-IRES-EGFP can drive any interested gene specifically expressed in the zebrafish heart along with EGFP reporter gene. To test the effectiveness of this new expression plasmid, we constructed pTol2-CMLC2-RED-IRES-EGFP plasmid by inserting another reporter gene DsRed-Monome into MCS downstream of the CMLC2 promoter and injected this transgenic recombinant plasmid into one-cell stage embryos of zebrafish. Under fluorescence microscope, both the red fluorescence and the green fluorescence produced by pTol2-CMLC2-RED-IRES-EGFP were detected specifically in the heart tissue in the same expression pattern. This novel expression construct pTol2-CMLC2-IRES-EGFP will become an important tool for our research on identifying heart development candidate genes' function using zebrafish as a model.

Generation of HIV-1 based bi-cistronic lentiviral vectors for stable gene expression and live cell imaging.

PubMed

Sehgal, Lalit; Budnar, Srikanth; Bhatt, Khyati; Sansare, Sneha; Mukhopadhaya, Amitabha; Kalraiya, Rajiv D; Dalal, Sorab N

2012-10-01

The study of protein-protein interactions, protein localization, protein organization into higher order structures and organelle dynamics in live cells, has greatly enhanced the understanding of various cellular processes. Live cell imaging experiments employ plasmid or viral vectors to express the protein/proteins of interest fused to a fluorescent protein. Unlike plasmid vectors, lentiviral vectors can be introduced into both dividing and non dividing cells, can be pseudotyped to infect a broad or narrow range of cells, and can be used to generate transgenic animals. However, the currently available lentiviral vectors are limited by the choice of fluorescent protein tag, choice of restriction enzyme sites in the Multiple Cloning Sites (MCS) and promoter choice for gene expression. In this report, HIV-1 based bi-cistronic lentiviral vectors have been generated that drive the expression of multiple fluorescent tags (EGFP, mCherry, ECFP, EYFP and dsRed), using two different promoters. The presence of a unique MCS with multiple restriction sites allows the generation of fusion proteins with the fluorescent tag of choice, allowing analysis of multiple fusion proteins in live cell imaging experiments. These novel lentiviral vectors are improved delivery vehicles for gene transfer applications and are important tools for live cell imaging in vivo.

Design of a Retrovirus-Derived Vector for Expression and Transduction of Exogenous Genes in Mammalian Cells

PubMed Central

Perkins, Archibald S.; Kirschmeier, Paul T.; Gattoni-Celli, Sebastiano; Weinstein, I. Bernard

1983-01-01

We have developed a transfection vector for animal cells that contains long terminal repeat (LTR) sequences to promote expression. Plasmid p101/101, a derivative of plasmid pBR322 containing the complete Moloney murine sarcoma virus genome, was cut with restriction enzymes and religated so that both the 5′ and 3′ LTRs were retained and all but about 700 base pairs of the intervening viral sequences were removed. To test this vector, the Escherichia coli gene gpt was cloned into a unique PstI site, between the two LTRs, with guanine and cytosine tailing, a method that can be generalized for insertion of any DNA segment into this vector. When DNA from recombinant plasmids in which the gpt gene was inserted in the same transcriptional polarity as the LTR sequences was transfected onto murine or rat fibroblast cultures, we obtained a high yield of Gpt+ colonies. However, plasmid constructs with the gpt gene in the opposite polarity were virtually devoid of activity. With gpt in the proper orientation, restriction enzyme cuts within the LTRs or between the 5′ LTR and the gpt gene reduced transfection by more than 98%, whereas a cut between the gpt gene and the 3′ LTR gave an 80% reduction in activity. Thus, both 5′ and 3′ LTR sequences are essential for optimal gpt expression, although the 5′ LTR appears to play a more important role. When the LTR-gpt plasmid was transfected onto murine leukemia virus-infected mouse fibroblasts, we obtained evidence that RNA copies became pseudotyped into viral particles which could transfer the Gpt+ phenotype into rodent cells with extremely high efficiency. This vector should prove useful for high-efficiency transduction of a variety of genes in mammalian cells. Images PMID:6308426

Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria

PubMed Central

Taton, Arnaud; Unglaub, Federico; Wright, Nicole E.; Zeng, Wei Yue; Paz-Yepes, Javier; Brahamsha, Bianca; Palenik, Brian; Peterson, Todd C.; Haerizadeh, Farzad; Golden, Susan S.; Golden, James W.

2014-01-01

Inspired by the developments of synthetic biology and the need for improved genetic tools to exploit cyanobacteria for the production of renewable bioproducts, we developed a versatile platform for the construction of broad-host-range vector systems. This platform includes the following features: (i) an efficient assembly strategy in which modules released from 3 to 4 donor plasmids or produced by polymerase chain reaction are assembled by isothermal assembly guided by short GC-rich overlap sequences. (ii) A growing library of molecular devices categorized in three major groups: (a) replication and chromosomal integration; (b) antibiotic resistance; (c) functional modules. These modules can be assembled in different combinations to construct a variety of autonomously replicating plasmids and suicide plasmids for gene knockout and knockin. (iii) A web service, the CYANO-VECTOR assembly portal, which was built to organize the various modules, facilitate the in silico construction of plasmids, and encourage the use of this system. This work also resulted in the construction of an improved broad-host-range replicon derived from RSF1010, which replicates in several phylogenetically distinct strains including a new experimental model strain Synechocystis sp. WHSyn, and the characterization of nine antibiotic cassettes, four reporter genes, four promoters, and a ribozyme-based insulator in several diverse cyanobacterial strains. PMID:25074377

Formation of AAV Single Stranded DNA Genome from a Circular Plasmid in Saccharomyces cerevisiae

PubMed Central

Cervelli, Tiziana; Backovic, Ana; Galli, Alvaro

2011-01-01

Adeno-associated virus (AAV)-based vectors are promising tools for targeted transfer in gene therapy studies. Many efforts have been accomplished to improve production and purification methods. We thought to develop a simple eukaryotic system allowing AAV replication which could provide an excellent opportunity for studying AAV biology and, more importantly, for AAV vector production. It has been shown that yeast Saccharomyces cerevisiae is able to replicate and form the capsid of many viruses. We investigated the ability of the yeast Saccharomyces cerevisiae to carry out the replication of a recombinant AAV (rAAV). When a plasmid containing a rAAV genome in which the cap gene was replaced with the S. cerevisiae URA3 gene, was co-transformed in yeast with a plasmid expressing Rep68, a significant number of URA3+ clones were scored (more than 30-fold over controls). Molecular analysis of low molecular weight DNA by Southern blotting revealed that single stranded DNA is formed and that the plasmid is entirely replicated. The ssDNA contains the ITRs, URA3 gene and also vector sequences suggesting the presence of two distinct molecules. Its formation was dependent on Rep68 expression and ITR. These data indicate that DNA is not obtained by the canonical AAV replication pathway. PMID:21853137

Formation of AAV single stranded DNA genome from a circular plasmid in Saccharomyces cerevisiae.

PubMed

Cervelli, Tiziana; Backovic, Ana; Galli, Alvaro

2011-01-01

Adeno-associated virus (AAV)-based vectors are promising tools for targeted transfer in gene therapy studies. Many efforts have been accomplished to improve production and purification methods. We thought to develop a simple eukaryotic system allowing AAV replication which could provide an excellent opportunity for studying AAV biology and, more importantly, for AAV vector production. It has been shown that yeast Saccharomyces cerevisiae is able to replicate and form the capsid of many viruses. We investigated the ability of the yeast Saccharomyces cerevisiae to carry out the replication of a recombinant AAV (rAAV). When a plasmid containing a rAAV genome in which the cap gene was replaced with the S. cerevisiae URA3 gene, was co-transformed in yeast with a plasmid expressing Rep68, a significant number of URA3(+) clones were scored (more than 30-fold over controls). Molecular analysis of low molecular weight DNA by Southern blotting revealed that single stranded DNA is formed and that the plasmid is entirely replicated. The ssDNA contains the ITRs, URA3 gene and also vector sequences suggesting the presence of two distinct molecules. Its formation was dependent on Rep68 expression and ITR. These data indicate that DNA is not obtained by the canonical AAV replication pathway.

Transformation of Saccharomyces cerevisiae and Schizosaccharomyces pombe with linear plasmids containing 2 micron sequences.

PubMed Central

Guerrini, A M; Ascenzioni, F; Tribioli, C; Donini, P

1985-01-01

Linear plasmids were constructed by adding telomeres prepared from Tetrahymena pyriformis rDNA to a circular hybrid Escherichia coli-yeast vector and transforming Saccharomyces cerevisiae. The parental vector contained the entire 2 mu yeast circle and the LEU gene from S. cerevisiae. Three transformed clones were shown to contain linear plasmids which were characterized by restriction analysis and shown to be rearranged versions of the desired linear plasmids. The plasmids obtained were imperfect palindromes: part of the parental vector was present in duplicated form, part as unique sequences and part was absent. The sequences that had been lost included a large portion of the 2 mu circle. The telomeres were approximately 450 bp longer than those of T. pyriformis. DNA prepared from transformed S. cerevisiae clones was used to transform Schizosaccharomyces pombe. The transformed S. pombe clones contained linear plasmids identical in structure to their linear parents in S. cerevisiae. No structural re-arrangements or integration into S. pombe was observed. Little or no telomere growth had occurred after transfer from S. cerevisiae to S. pombe. A model is proposed to explain the genesis of the plasmids. Images Fig. 1. Fig. 2. Fig. 4. PMID:3896773

Efficient generation of rat induced pluripotent stem cells using a non-viral inducible vector.

PubMed

Merkl, Claudia; Saalfrank, Anja; Riesen, Nathalie; Kühn, Ralf; Pertek, Anna; Eser, Stefan; Hardt, Markus Sebastian; Kind, Alexander; Saur, Dieter; Wurst, Wolfgang; Iglesias, Antonio; Schnieke, Angelika

2013-01-01

Current methods of generating rat induced pluripotent stem cells are based on viral transduction of pluripotency inducing genes (Oct4, Sox2, c-myc and Klf4) into somatic cells. These activate endogenous pluripotency genes and reprogram the identity of the cell to an undifferentiated state. Epigenetic silencing of exogenous genes has to occur to allow normal iPS cell differentiation. To gain more control over the expression of exogenous reprogramming factors, we used a novel doxycycline-inducible plasmid vector encoding Oct4, Sox2, c-Myc and Klf4. To ensure efficient and controlled generation of iPS cells by plasmid transfection we equipped the reprogramming vector with a bacteriophage φC31 attB site and used a φC31 integrase expression vector to enhance vector integration. A series of doxycycline-independent rat iPS cell lines were established. These were characterized by immunocytochemical detection of Oct4, SSEA1 and SSEA4, alkaline phosphatase staining, methylation analysis of the endogenous Oct4 promoter and RT-PCR analysis of endogenous rat pluripotency genes. We also determined the number of vector integrations and the extent to which reprogramming factor gene expression was controlled. Protocols were developed to generate embryoid bodies and rat iPS cells demonstrated as pluripotent by generating derivatives of all three embryonic germ layers in vitro, and teratoma formation in vivo. All data suggest that our rat iPS cells, generated by plasmid based reprogramming, are similar to rat ES cells. Methods of DNA transfection, protein transduction and feeder-free monolayer culture of rat iPS cells were established to enable future applications.

Analysis of point mutations in an ultraviolet-irradiated shuttle vector plasmid propagated in cells from Japanese xeroderma pigmentosum patients in complementation groups A and F

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yagi, T.; Tatsumi-Miyajima, J.; Sato, M.

1991-06-15

To assess the contribution to mutagenesis by human DNA repair defects, a UV-treated shuttle vector plasmid, pZ189, was passed through fibroblasts derived from Japanese xeroderma pigmentosum (XP) patients in two different DNA repair complementation groups (A and F). Patients with XP have clinical and cellular UV hypersensitivity, increased frequency of skin cancer, and defects in DNA repair. The XP DNA repair defects represented by complementation groups A (XP-A) and F (XP-F) are more common in Japan than in Europe or the United States. In comparison to results with DNA repair-proficient human cells (W138-VA13), UV-treated pZ189 passed through the XP-A (XP2OS(SV))more » or XP-F (XP2YO(SV)) cells showed fewer surviving plasmids (XP-A less than XP-F) and a higher frequency of mutated plasmids (XP-A greater than XP-F). Base sequence analysis of more than 200 mutated plasmids showed the major type of base substitution mutation to be the G:C----A:T transition with all three cell lines. The XP-A and XP-F cells revealed a higher frequency of G:C----A:T transitions and a lower frequency of transversions among plasmids with single or tandem mutations and a lower frequency of plasmids with multiple point mutations compared to the normal line. The spectrum of mutations in pZ189 with the XP-A cells was similar to that with the XP-F cells. Seventy-six to 91% of the single base substitution mutations occurred at G:C base pairs in which the 5{prime}-neighboring base of the cytosine was thymine or cytosine. These studies indicate that the DNA repair defects in Japanese XP patients in complementation groups A and F result in different frequencies of plasmid survival and mutagenesis but in similar types of mutagenic abnormalities despite marked differences in clinical features.« less

Ultra-low background DNA cloning system.

PubMed

Goto, Kenta; Nagano, Yukio

2013-01-01

Yeast-based in vivo cloning is useful for cloning DNA fragments into plasmid vectors and is based on the ability of yeast to recombine the DNA fragments by homologous recombination. Although this method is efficient, it produces some by-products. We have developed an "ultra-low background DNA cloning system" on the basis of yeast-based in vivo cloning, by almost completely eliminating the generation of by-products and applying the method to commonly used Escherichia coli vectors, particularly those lacking yeast replication origins and carrying an ampicillin resistance gene (Amp(r)). First, we constructed a conversion cassette containing the DNA sequences in the following order: an Amp(r) 5' UTR (untranslated region) and coding region, an autonomous replication sequence and a centromere sequence from yeast, a TRP1 yeast selectable marker, and an Amp(r) 3' UTR. This cassette allowed conversion of the Amp(r)-containing vector into the yeast/E. coli shuttle vector through use of the Amp(r) sequence by homologous recombination. Furthermore, simultaneous transformation of the desired DNA fragment into yeast allowed cloning of this DNA fragment into the same vector. We rescued the plasmid vectors from all yeast transformants, and by-products containing the E. coli replication origin disappeared. Next, the rescued vectors were transformed into E. coli and the by-products containing the yeast replication origin disappeared. Thus, our method used yeast- and E. coli-specific "origins of replication" to eliminate the generation of by-products. Finally, we successfully cloned the DNA fragment into the vector with almost 100% efficiency.

Tightly regulated, high-level expression from controlled copy number vectors based on the replicon of temperate phage N15.

PubMed

Mardanov, Andrey V; Strakhova, Taisia S; Smagin, Vladimir A; Ravin, Nikolai V

2007-06-15

A new Escherichia coli host/vector system has been developed to allow a dual regulation of both the plasmid copy number and gene expression. The new pN15E vectors are low copy number plasmids based on the replicon of temperate phage N15, comprising the repA replicase gene and cB repressor gene, controlling the plasmid copy number. Regulation of pN15E copy number is achieved through arabinose-inducible expression of phage N15 antirepressor protein, AntA, whose gene was integrated into the chromosome of the host strain under control of the PBAD promoter. The host strain also carried phage N15 partition operon, sop, allowing stable inheritance of pN15E vectors in the absence of selection pressure. In the first vector, pN15E4, the same PBAD promoter controls expression of a cloned gene. The second vector, pN15E6, carries the phage T5 promoter with a double lac operator repression module thus allowing independent regulation of promoter activity and copy number. Using the lacZ gene to monitor expression in these vectors, we show that the ratio of induction/repression can be about 7600-fold for pN15E4 and more than 15,000-fold for pN15E6. The low copy number of these vectors ensures very low basal level of expression allowing cloning genes encoding toxic products that was demonstrated by the stable maintenance of a gene encoding a restriction endonuclease in pN15E4. The tight control of transcription and the potential to regulate gene activities quantitatively over wide ranges will open up new approaches in the study of gene function in vivo and controlled expression of heterologous genes.

Molecular Characterization of Heterologous HIV-1gp120 Gene Expression Disruption in Mycobacterium bovis BCG Host Strain: A Critical Issue for Engineering Mycobacterial Based-Vaccine Vectors

PubMed Central

Joseph, Joan; Fernández-Lloris, Raquel; Pezzat, Elías; Saubi, Narcís; Cardona, Pere-Joan; Mothe, Beatriz; Gatell, Josep Maria

2010-01-01

Mycobacterium bovis Bacillus Calmette-Guérin (BCG) as a live vector of recombinant bacterial vaccine is a promising system to be used. In this study, we evaluate the disrupted expression of heterologous HIV-1gp120 gene in BCG Pasteur host strain using replicative vectors pMV261 and pJH222. pJH222 carries a lysine complementing gene in BCG lysine auxotrophs. The HIV-1 gp120 gene expression was regulated by BCG hsp60 promoter (in plasmid pMV261) and Mycobacteria spp. α-antigen promoter (in plasmid pJH222). Among 14 rBCG:HIV-1gp120 (pMV261) colonies screened, 12 showed a partial deletion and two showed a complete deletion. However, deletion was not observed in all 10 rBCG:HIV-1gp120 (pJH222) colonies screened. In this study, we demonstrated that E. coli/Mycobacterial expression vectors bearing a weak promoter and lysine complementing gene in a recombinant lysine auxotroph of BCG could prevent genetic rearrangements and disruption of HIV 1gp120 gene expression, a key issue for engineering Mycobacterial based vaccine vectors. PMID:20617151

A novel, easy and rapid method for constructing yeast two-hybrid vectors using In-Fusion technology.

PubMed

Yu, Deshui; Liao, Libing; Zhang, Ju; Zhang, Yi; Xu, Kedong; Liu, Kun; Li, Xiaoli; Tan, Guangxuan; Chen, Ran; Wang, Yulu; Liu, Xia; Zhang, Xuan; Han, Xiaomeng; Wei, Zhangkun; Li, Chengwei

2018-05-01

Yeast two-hybrid systems are powerful tools for analyzing interactions between proteins. Vector construction is an essential step in yeast two-hybrid experiments, which require bait and prey plasmids. In this study, we modified the multiple cloning site sequence of the yeast plasmid pGADT7 by site-directed mutagenesis PCR to generate the pGADT7-In vector, which resulted in an easy and rapid method for constructing yeast two-hybrid vectors using the In-Fusion cloning technique. This method has three key advantages: only one pair of primers and one round of PCR are needed to generate bait and prey plasmids for each gene, it is restriction endonuclease- and ligase-independent, and it is fast and easily performed.

Development of plasmid vector and electroporation condition for gene transfer in sporogenic lactic acid bacterium, Bacillus coagulans.

PubMed

Rhee, Mun Su; Kim, Jin-Woo; Qian, Yilei; Ingram, L O; Shanmugam, K T

2007-07-01

Bacillus coagulans is a sporogenic lactic acid bacterium that ferments glucose and xylose, major components of plant biomass, a potential feedstock for cellulosic ethanol. The temperature and pH for optimum rate of growth of B. coagulans (50 to 55 degrees C, pH 5.0) are very similar to that of commercially developed fungal cellulases (50 degrees C; pH 4.8). Due to this match, simultaneous saccharification and fermentation (SSF) of cellulose to products by B. coagulans is expected to require less cellulase than needed if the SSF is conducted at a sub-optimal temperature, such as 30 degrees C, the optimum for yeast, the main biocatalyst used by the ethanol industry. To fully exploit B. coagulans as a platform organism, we have developed an electroporation method to transfer plasmid DNA into this genetically recalcitrant bacterium. We also constructed a B. coagulans/E. coli shuttle vector, plasmid pMSR10 that contains the rep region from a native plasmid (pMSR0) present in B. coagulans strain P4-102B. The native plasmid, pMSR0 (6823bp), has 9 ORFs, and replicates by rolling-circle mode of replication. Plasmid pNW33N, developed for Geobacillus stearothermophilus, was also transformed into this host and stably maintained while several other Bacillus/Escherichia coli shuttle vector plasmids were not transformed into B. coagulans. The transformation efficiency of B. coagulans strain P4-102B using the plasmids pNW33N or pMSR10 was about 1.5x10(16) per mole of DNA. The availability of shuttle vectors and an electroporation method is expected to aid in genetic and metabolic engineering of B. coagulans.

Genetic manipulation of Bacillus methanolicus, a gram-positive, thermotolerant methylotroph.

PubMed Central

Cue, D; Lam, H; Dillingham, R L; Hanson, R S; Flickinger, M C

1997-01-01

We report the fist genetic transformation system, shuttle vectors, and integrative vectors for the thermotolerant, methylotrophic bacterium Bacillus methanolicus. By using a polyethylene glycol-mediated transformation procedure, we have successfully transformed B. methanolicus with both integrative and multicopy plasmids. For plasmids with a single BmeTI recognition site, dam methylation of plasmid DNA (in vivo or in vitro) was found to enhance transformation efficiency from 7- to 11-fold. Two low-copy-number Escherichia coli-B, methanolicus shuttle plasmids, pDQ507 and pDQ508, are described. pDQ508 caries the replication origin cloned from a 17-kb endogenous B. methanolicus plasmid, pBM1. pDQ507 carries a cloned B. methanolicus DNA fragment, pmr-1, possibly of chromosomal origin, that supports maintenance of pDQ507 as a circular, extrachromosomal DNA molecule. Deletion analysis of pDQ507 indicated two regions required for replication, i.e., a 90-bp AT-rich segment containing a 46-bp imperfect, inverted repeat sequence and a second region 65% homologous to the B. subtilis dpp operon. We also evaluated two E. coli-B. subtilis vectors, pEN1 and pHP13, for use as E. coli-B. methanolicus shuttle vectors. The plasmids pHP13, pDQ507, and pDQ508 were segregationally and structurally stable in B. methanolicus for greater than 60 generations of growth under nonselective conditions; pEN1 was segregationally unstable. Single-stranded plasmid DNA was detected in B. methanolicus transformants carrying either pEN1, pHP13, or pDQ508, suggesting that pDQ508, like the B. subtilis plasmids, is replicated by a rolling-circle mechanism. These studies provide the basic tools for the genetic manipulation of B. methanolicus. PMID:9097439

Genetic manipulation of Bacillus methanolicus, a gram-positive, thermotolerant methylotroph.

PubMed

Cue, D; Lam, H; Dillingham, R L; Hanson, R S; Flickinger, M C

1997-04-01

We report the fist genetic transformation system, shuttle vectors, and integrative vectors for the thermotolerant, methylotrophic bacterium Bacillus methanolicus. By using a polyethylene glycol-mediated transformation procedure, we have successfully transformed B. methanolicus with both integrative and multicopy plasmids. For plasmids with a single BmeTI recognition site, dam methylation of plasmid DNA (in vivo or in vitro) was found to enhance transformation efficiency from 7- to 11-fold. Two low-copy-number Escherichia coli-B, methanolicus shuttle plasmids, pDQ507 and pDQ508, are described. pDQ508 caries the replication origin cloned from a 17-kb endogenous B. methanolicus plasmid, pBM1. pDQ507 carries a cloned B. methanolicus DNA fragment, pmr-1, possibly of chromosomal origin, that supports maintenance of pDQ507 as a circular, extrachromosomal DNA molecule. Deletion analysis of pDQ507 indicated two regions required for replication, i.e., a 90-bp AT-rich segment containing a 46-bp imperfect, inverted repeat sequence and a second region 65% homologous to the B. subtilis dpp operon. We also evaluated two E. coli-B. subtilis vectors, pEN1 and pHP13, for use as E. coli-B. methanolicus shuttle vectors. The plasmids pHP13, pDQ507, and pDQ508 were segregationally and structurally stable in B. methanolicus for greater than 60 generations of growth under nonselective conditions; pEN1 was segregationally unstable. Single-stranded plasmid DNA was detected in B. methanolicus transformants carrying either pEN1, pHP13, or pDQ508, suggesting that pDQ508, like the B. subtilis plasmids, is replicated by a rolling-circle mechanism. These studies provide the basic tools for the genetic manipulation of B. methanolicus.

EMMA: An Extensible Mammalian Modular Assembly Toolkit for the Rapid Design and Production of Diverse Expression Vectors.

PubMed

Martella, Andrea; Matjusaitis, Mantas; Auxillos, Jamie; Pollard, Steven M; Cai, Yizhi

2017-07-21

Mammalian plasmid expression vectors are critical reagents underpinning many facets of research across biology, biomedical research, and the biotechnology industry. Traditional cloning methods often require laborious manual design and assembly of plasmids using tailored sequential cloning steps. This process can be protracted, complicated, expensive, and error-prone. New tools and strategies that facilitate the efficient design and production of bespoke vectors would help relieve a current bottleneck for researchers. To address this, we have developed an extensible mammalian modular assembly kit (EMMA). This enables rapid and efficient modular assembly of mammalian expression vectors in a one-tube, one-step golden-gate cloning reaction, using a standardized library of compatible genetic parts. The high modularity, flexibility, and extensibility of EMMA provide a simple method for the production of functionally diverse mammalian expression vectors. We demonstrate the value of this toolkit by constructing and validating a range of representative vectors, such as transient and stable expression vectors (transposon based vectors), targeting vectors, inducible systems, polycistronic expression cassettes, fusion proteins, and fluorescent reporters. The method also supports simple assembly combinatorial libraries and hierarchical assembly for production of larger multigenetic cargos. In summary, EMMA is compatible with automated production, and novel genetic parts can be easily incorporated, providing new opportunities for mammalian synthetic biology.

[Construction of plant expression plasmid of chimera SBR-CT delta A1].

PubMed

Mai, Sui; Ling, Junqi

2003-08-01

The purpose of this study is to construct plant expression plasmid containing the gene encoding chimera SBR-CT delta A1. The target gene fragment P2, including the gene-encoded chimera SBR-CT delta A1 (3,498-5,378 bp), was obtained by standard PCR amplification. The PCR products were ligated with pGEM-easy vector through TA clone to form plasmid pTSC. The plasmid pTSC and plasmid pPOKII were digested by restricted endonuclease BamHI and KpnI, and the digested products were extracted and purified for recombination. Then the purified P2 and plasmid pPOKII were recombined by T4 DNA ligase to form recombinant plasmid pROSC; inserting bar gene into the plasmid and form pROSB plasmid. The recombined plasmids were isolated and identified by restricted endonuclease cutting and Sanger dideoxy DNA sequencing. P2 gene was linked to pPOKII plasmid and formed recombinant plasmid pROSC. The DNA sequence and orientation were corrected. And bar gene was inserted into pPOSC and form recombinant plasmid pROSB. Plant expression vector pROSC and pROSB containing the gene encoding chimera SBR-CT delta A1, which may provide useful experiment foundation for further study on edible vaccine against caries have been successfully constructed.

Longevity of rAAV vector and plasmid DNA in blood after intramuscular injection in nonhuman primates: implications for gene doping.

PubMed

Ni, W; Le Guiner, C; Gernoux, G; Penaud-Budloo, M; Moullier, P; Snyder, R O

2011-07-01

Legitimate uses of gene transfer technology can benefit from sensitive detection methods to determine vector biodistribution in pre-clinical studies and in human clinical trials, and similar methods can detect illegitimate gene transfer to provide sports-governing bodies with the ability to maintain fairness. Real-time PCR assays were developed to detect a performance-enhancing transgene (erythropoietin, EPO) and backbone sequences in the presence of endogenous cellular sequences. In addition to developing real-time PCR assays, the steps involved in DNA extraction, storage and transport were investigated. By real-time PCR, the vector transgene is distinguishable from the genomic DNA sequence because of the absence of introns, and the vector backbone can be identified by heterologous gene expression control elements. After performance of the assays was optimized, cynomolgus macaques received a single dose by intramuscular (IM) injection of plasmid DNA, a recombinant adeno-associated viral vector serotype 1 (rAAV1) or a rAAV8 vector expressing cynomolgus macaque EPO. Macaques received a high plasmid dose intended to achieve a significant, but not life-threatening, increase in hematocrit. rAAV vectors were used at low doses to achieve a small increase in hematocrit and to determine the limit of sensitivity for detecting rAAV sequences by single-step PCR. DNA extracted from white blood cells (WBCs) was tested to determine whether WBCs can be collaterally transfected by plasmid or transduced by rAAV vectors in this context, and can be used as a surrogate marker for gene doping. We demonstrate that IM injection of a conventional plasmid and rAAV vectors results in the presence of DNA that can be detected at high levels in blood before rapid elimination, and that rAAV genomes can persist for several months in WBCs.

Rational Development of A Polycistronic Plasmid with A CpG-Free Bacterial Backbone as A Potential Tool for Direct Reprogramming.

PubMed

Dormiani, Kianoush; Mir Mohammad Sadeghi, Hamid; Sadeghi-Aliabadi, Hojjat; Forouzanfar, Mahboobeh; Baharvand, Hossein; Ghaedi, Kamran; Nasr-Esfahani, Mohammad Hossein

2017-01-01

Induced pluripotent stem cells are generated from somatic cells by direct reprogramming. These reprogrammed pluripotent cells have different applications in biomedical fields such as regenerative medicine. Although viral vectors are widely used for efficient reprogramming, they have limited applications in the clinic due to the risk for immunogenicity and insertional mutagenesis. Accordingly, we designed and developed a small, non-integrating plasmid named pLENSO/Zeo as a 2A-mediated polycistronic expression vector. In this experimental study, we developed a single plasmid which includes a single expression cassette containing open reading frames of human LIN28, NANOG, SOX2 and OCT4 along with an EGFP reporter gene. Each reprogramming factor is separated by an intervening sequence that encodes a 2A self-processing peptide. The reprogramming cassette is located downstream of a CMV promoter. The vector is easily propagated in the E. coli GT115 strain through a CpG-depleted vector backbone. We evaluated the stability of the constructed vector bioinformatically, and its ability to stoichiometric expression of the reprogramming factors using quantitative molecular methods analysis after transient transfection into HEK293 cells. In the present study, we developed a nonviral episomal vector named pLENSO/ Zeo. Our results demonstrated the general structural stability of the plasmid DNA. This relatively small vector showed concomitant, high-level expression of the four reprogramming factors with similar titers, which are considered as the critical parameters for efficient and consistent reprogramming. According to our experimental results, this stable extrachromosomal plasmid expresses reliable amounts of four reprogramming factors simultaneously. Consequently, these promising results encouraged us to evaluate the capability of pLENSO/Zeo as a simple and feasible tool for generation of induced pluripotent stem cells from primary cells in the future.

A Simple And Rapid Minicircle DNA Vector Manufacturing System

PubMed Central

Kay, Mark A; He, Cheng-Yi; Chen, Zhi-Ying

2010-01-01

Minicircle DNA vectors consisting of a circular expression cassette devoid of the bacterial plasmid DNA backbone provides several advantages including sustained transgene expression in quiescent cells/tissues. Their use has been limited by labor-intensive production. We report on a strategy for making multiple genetic modifications in E.coli to construct a producer strain that stably expresses a set of inducible minicircle-assembly enzymes, the øC31-integrase and I-SceI homing-endonuclease. This bacterial strain is capable of producing highly purified minicircle yields in the same time frame as routine plasmid DNA. It is now feasible for minicircle DNA vectors to replace routine plasmids in mammalian transgene expression studies. PMID:21102455

New multifunctional Escherichia coli-Streptomyces shuttle vectors allowing blue-white screening on XGal plates.

PubMed

Wehmeier, U F

1995-11-07

Four new shuttle vectors for Escherichia coli (Ec) and Streptomyces, pUWL218, pUWL219, pUWL-SK and pUWL-KS, which permit recognition of recombinant (re-) plasmids on XGal plates in Ec, were constructed. These vectors contain the replication functions of the Streptomyces wide-host-range multicopy plasmid pIJ101, the tsr gene conferring resistance to thiostrepton in Streptomyces, the ColEI origin of replication from the pUC plasmids for replication in Ec and the bla gene conferring resistance to ampicillin in Ec. They possess multiple cloning sites with a number of unique restriction sites and allow direct sequencing of re-derivatives using the pUC sequencing primers.

pTcGW plasmid vectors 1.1 version: a versatile tool for Trypanosoma cruzi gene characterisation

PubMed Central

Kugeratski, Fernanda G; Batista, Michel; Inoue, Alexandre Haruo; Ramos, Bruno Dias; Krieger, Marco Aurelio; Marchini/, Fabricio K

2015-01-01

The functional characterisation of thousands of Trypanosoma cruzi genes remains a challenge. Reverse genetics approaches compatible with high-throughput cloning strategies can provide the tool needed to tackle this challenge. We previously published the pTcGW platform, composed by plasmid vectors carrying different options of N-terminal fusion tags based on Gateway® technology. Here, we present an improved 1.1 version of pTcGW vectors, which is characterised by a fully flexible structure allowing an easy customisation of each element of the vectors in a single cloning step. Additionally, both N and C-terminal fusions are available with new tag options for protein complexes purification. Three of the newly created vectors were successfully used to determine the cellular localisation of four T. cruzi proteins. The 1.1 version of pTcGW platform can be used in a variety of assays, such as protein overexpression, identification of protein-protein interaction and protein localisation. This powerful and versatile tool allows adding valuable functional information to T. cruzi genes and is freely available for scientific community. PMID:26200713

Modulation of ColE1-like Plasmid Replication for Recombinant Gene Expression

PubMed Central

Camps, Manel

2010-01-01

ColE1-like plasmids constitute the most popular vectors for recombinant protein expression. ColE1 plasmid replication is tightly controlled by an antisense RNA mechanism that is highly dynamic, tuning plasmid metabolic burden to the physiological state of the host. Plasmid homeostasis is upset upon induction of recombinant protein expression because of non-physiological levels of expression and because of the frequently biased amino acid composition of recombinant proteins. Disregulation of plasmid replication is the main cause of collapse of plasmid-based expression systems because of a simultaneous increase in the metabolic burden (due to increased average copy number) and in the probability of generation of plasmid-free cells (due to increased copy number variation). Interference between regulatory elements of co-resident plasmids causes comparable effects on plasmid stability (plasmid incompatibility). Modulating plasmid copy number for recombinant gene expression aims at achieving a high gene dosage while preserving the stability of the expression system. Here I present strategies targeting plasmid replication for optimizing recombinant gene expression. Specifically, I review approaches aimed at modulating the antisense regulatory system (as well as their implications for plasmid incompatibility) and innovative strategies involving modulation of host factors, of R-loop formation, and of the timing of recombinant gene expression. PMID:20218961

Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR.

PubMed

Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz

2017-01-01

Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future.

Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR

PubMed Central

Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz

2017-01-01

Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future. PMID:28085908

Plasmids of corynebacteria.

PubMed

Deb, J K; Nath, N

1999-06-01

Corynebacteria are pleomorphic, asporogenous, Gram-positive bacteria. Included in this group are nonpathogenic soil corynebacteria, which are widely used for the industrial production of amino acids and detergents, and in biotransformation of steroids. Other members of this group are plant and animal pathogens. This review summarizes the current information available about the plasmids of corynebacteria. The emphasis is mainly on the small plasmids, which have been used for construction of vectors for expression of genes in these bacteria. Moreover, considerable information is now available on their nucleotide sequence, gene organization and modes of replication, which would make it possible to further manipulate these plasmids. Other plasmid properties, such as incompatibility and host range, are also discussed. Finally, use of these plasmids as cloning vectors for the expression of heterologous proteins using corynebacteria as hosts is also summarized to highlight the potential of these bacteria as hosts for recombinant DNA.

Engineered Saccharomyces cerevisiae strain for improved xylose utilization with a three-plasmid SUMO yeast expression system

USDA-ARS?s Scientific Manuscript database

A three-plasmid yeast expression system utilizing the portable small ubiquitin-like modifier (SUMO) vector set combined with the efficient endogenous yeast protease Ulp1 was developed for production of large amounts of soluble functional protein in Saccharomyces cerevisiae. Each vector has a differ...

Mapping EBNA-1 Domains Involved in Binding to Metaphase Chromosomes

PubMed Central

Marechal, Vincent; Dehee, Axelle; Chikhi-Brachet, Roxane; Piolot, Tristan; Coppey-Moisan, Maité; Nicolas, Jean-Claude

1999-01-01

The Epstein-Barr virus (EBV) genome can persist in dividing human B cells as multicopy circular episomes. Viral episomes replicate in synchrony with host cell DNA and are maintained at a relatively constant copy number for a long time. Only two viral elements, the replication origin OriP and the EBNA-1 protein, are required for the persistence of viral genomes during latency. EBNA-1 activates OriP during the S phase and may also contribute to the partition and/or retention of viral genomes during mitosis. Indeed, EBNA-1 has been shown to interact with mitotic chromatin. Moreover, viral genomes are noncovalently associated with metaphase chromosomes. This suggests that EBNA-1 may facilitate the anchorage of viral genomes on cellular chromosomes, thus ensuring proper partition and retention. In the present paper, we have investigated the chromosome-binding activity of EBV EBNA-1, herpesvirus papio (HVP) EBNA-1, and various derivatives of EBV EBNA-1, fused to a variant of the green fluorescent protein. The results show that binding to metaphase chromosomes is a common property of EBV and HVP EBNA-1. Further studies indicated that at least three independent domains (CBS-1, -2, and -3) mediate EBNA-1 binding to metaphase chromosomes. In agreement with the anchorage model, two of these domains mapped to a region that has been previously demonstrated to be required for the long-term persistence of OriP-containing plasmids. PMID:10196336

SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans.

PubMed

Schwartz, Matthew L; Jorgensen, Erik M

2016-04-01

In principle, clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 allows genetic tags to be inserted at any locus. However, throughput is limited by the laborious construction of repair templates and guide RNA constructs and by the identification of modified strains. We have developed a reagent toolkit and plasmid assembly pipeline, called "SapTrap," that streamlines the production of targeting vectors for tag insertion, as well as the selection of modified Caenorhabditis elegans strains. SapTrap is a high-efficiency modular plasmid assembly pipeline that produces single plasmid targeting vectors, each of which encodes both a guide RNA transcript and a repair template for a particular tagging event. The plasmid is generated in a single tube by cutting modular components with the restriction enzyme SapI, which are then "trapped" in a fixed order by ligation to generate the targeting vector. A library of donor plasmids supplies a variety of protein tags, a selectable marker, and regulatory sequences that allow cell-specific tagging at either the N or the C termini. All site-specific sequences, such as guide RNA targeting sequences and homology arms, are supplied as annealed synthetic oligonucleotides, eliminating the need for PCR or molecular cloning during plasmid assembly. Each tag includes an embedded Cbr-unc-119 selectable marker that is positioned to allow concurrent expression of both the tag and the marker. We demonstrate that SapTrap targeting vectors direct insertion of 3- to 4-kb tags at six different loci in 10-37% of injected animals. Thus SapTrap vectors introduce the possibility for high-throughput generation of CRISPR/Cas9 genome modifications. Copyright © 2016 by the Genetics Society of America.

A plasmid-based reverse genetics system for influenza A virus.

PubMed Central

Pleschka, S; Jaskunas, R; Engelhardt, O G; Zürcher, T; Palese, P; García-Sastre, A

1996-01-01

A reverse genetics system for negative-strand RNA viruses was first successfully developed for influenza viruses. This technology involved the transfection of in vitro-reconstituted ribonucleoprotein (RNP) complexes into influenza virus-infected cells. We have now developed a method that allows intracellular reconstitution of RNP complexes from plasmid-based expression vectors. Expression of a viral RNA-like transcript is achieved from a plasmid containing a truncated human polymerase I (polI) promoter and a ribozyme sequence that generates the desired 3' end by autocatalytic cleavage. The polI-driven plasmid is cotransfected into human 293 cells with polII-responsive plasmids that express the viral PB1, PB2, PA, and NP proteins. This exclusively plasmid-driven system results in the efficient transcription and replication of the viral RNA-like reporter and allows the study of cis- and trans-acting signals involved in the transcription and replication of influenza virus RNAs. Using this system, we have also been able to rescue a synthetic neuraminidase gene into a recombinant influenza virus. This method represents a convenient alternative to the previously established RNP transfection system. PMID:8648766

A stable shuttle vector system for efficient genetic complementation of Helicobacter pylori strains by transformation and conjugation.

PubMed

Heuermann, D; Haas, R

1998-03-01

A versatile plasmid shuttle vector system was constructed, which is useful for genetic complementation of Helicobacter pylori strains or mutants with cloned genes of homologous or heterologous origin. The individual plasmid vectors consist of the minimal essential genetic elements, including an origin of replication for Escherichia coli, a H. pylori-specific replicon originally identified on a small cryptic H. pylori plasmid, an oriT sequence and a multiple cloning site. Shuttle plasmid pHel2 carries a chloramphenicol resistance cassette (catGC) and pHel3 contains a kanamycin resistance gene (aphA-3) as the selectable marker; both are functional in E. coli and H. pylori. The shuttle plasmids were introduced into the H. pylori strain P1 by natural transformation. A efficiency of 7.0 x 10(-7) and 4.7 x 10(-7) transformants per viable recipient was achieved with pHel2 and pHel3, respectively, and both vectors showed stable, autonomous replication in H. pylori. An approximately 100-fold higher H. pylori transformation rate was obtained when the shuttle vectors for transformation were isolated from the homologous H. pylori strain, rather than E. coli, indicating that DNA restriction and modification mechanisms play a crucial role in plasmid transformation. Interestingly, both shuttle vectors could also be mobilized efficiently from E. coli into different H. pylori recipients, with pHel2 showing an efficiency of 2.0 x 10(-5) transconjugants per viable H. pylori P1 recipient. Thus, DNA restriction seems to be strongly reduced or absent during conjugal transfer. The functional complementation of a recA-deficient H. pylori mutant by the cloned H. pylori recA+ gene, and the expression of the heterologous green fluorescent protein (GFP) in H. pylori demonstrate the general usefulness of this system, which will significantly facilitate the molecular analysis of H. pylori virulence factors in the future.

Deletion of the Clostridium thermocellum recA gene reveals that it is required for thermophilic plasmid replication but not plasmid integration at homologous DNA sequences.

PubMed

Groom, Joseph; Chung, Daehwan; Kim, Sun-Ki; Guss, Adam; Westpheling, Janet

2018-05-28

A limitation to the engineering of cellulolytic thermophiles is the availability of functional, thermostable (≥ 60 °C) replicating plasmid vectors for rapid expression and testing of genes that provide improved or novel fuel molecule production pathways. A series of plasmid vectors for genetic manipulation of the cellulolytic thermophile Caldicellulosiruptor bescii has recently been extended to Clostridium thermocellum, another cellulolytic thermophile that very efficiently solubilizes plant biomass and produces ethanol. While the C. bescii pBAS2 replicon on these plasmids is thermostable, the use of homologous promoters, signal sequences and genes led to undesired integration into the bacterial chromosome, a result also observed with less thermostable replicating vectors. In an attempt to overcome undesired plasmid integration in C. thermocellum, a deletion of recA was constructed. As expected, C. thermocellum ∆recA showed impaired growth in chemically defined medium and an increased susceptibility to UV damage. Interestingly, we also found that recA is required for replication of the C. bescii thermophilic plasmid pBAS2 in C. thermocellum, but it is not required for replication of plasmid pNW33N. In addition, the C. thermocellum recA mutant retained the ability to integrate homologous DNA into the C. thermocellum chromosome. These data indicate that recA can be required for replication of certain plasmids, and that a recA-independent mechanism exists for the integration of homologous DNA into the C. thermocellum chromosome. Understanding thermophilic plasmid replication is not only important for engineering of these cellulolytic thermophiles, but also for developing genetic systems in similar new potentially useful non-model organisms.

Deletion of the Clostridium thermocellum recA Gene Reveals that it is Required for Thermophilic Plasmid Replication but not Plasmid Integration at Homologous DNA Sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chung, Daehwan; Groom, Joseph; Kim, Sun-Ki

A limitation to the engineering of cellulolytic thermophiles is the availability of functional, thermostable (>/= 60 degrees C) replicating plasmid vectors for rapid expression and testing of genes that provide improved or novel fuel molecule production pathways. A series of plasmid vectors for genetic manipulation of the cellulolytic thermophile Caldicellulosiruptor bescii has recently been extended to Clostridium thermocellum, another cellulolytic thermophile that very efficiently solubilizes plant biomass and produces ethanol. While the C. bescii pBAS2 replicon on these plasmids is thermostable, the use of homologous promoters, signal sequences and genes led to undesired integration into the bacterial chromosome, a resultmore » also observed with less thermostable replicating vectors. In an attempt to overcome undesired plasmid integration in C. thermocellum, a deletion of recA was constructed. As expected, C. thermocellum ..delta..recA showed impaired growth in chemically defined medium and an increased susceptibility to UV damage. Interestingly, we also found that recA is required for replication of the C. bescii thermophilic plasmid pBAS2 in C. thermocellum, but it is not required for replication of plasmid pNW33N. In addition, the C. thermocellum recA mutant retained the ability to integrate homologous DNA into the C. thermocellum chromosome. These data indicate that recA can be required for replication of certain plasmids, and that a recA-independent mechanism exists for the integration of homologous DNA into the C. thermocellum chromosome. Understanding thermophilic plasmid replication is not only important for engineering of these cellulolytic thermophiles, but also for developing genetic systems in similar new potentially useful non-model organisms.« less

Method: low-cost delivery of the cotton leaf crumple virus-induced gene silencing system

PubMed Central

2012-01-01

Background We previously developed a virus-induced gene silencing (VIGS) vector for cotton from the bipartite geminivirusCotton leaf crumple virus (CLCrV). The original CLCrV VIGS vector was designed for biolistic delivery by a gene gun. This prerequisite limited the use of the system to labs with access to biolistic equipment. Here we describe the adaptation of this system for delivery by Agrobacterium (Agrobacterium tumefaciens). We also describe the construction of two low-cost particle inflow guns. Results The biolistic CLCrV vector was transferred into two Agrobacterium binary plasmids. Agroinoculation of the binary plasmids into cotton resulted in silencing and GFP expression comparable to the biolistic vector. Two homemade low-cost gene guns were used to successfully inoculate cotton (G. hirsutum) and N. benthamiana with either the CLCrV VIGS vector or the Tomato golden mosaic virus (TGMV) VIGS vector respectively. Conclusions These innovations extend the versatility of CLCrV-based VIGS for analyzing gene function in cotton. The two low-cost gene guns make VIGS experiments affordable for both research and teaching labs by providing a working alternative to expensive commercial gene guns. PMID:22853641

Liposomal lipid and plasmid DNA delivery to B16/BL6 tumors after intraperitoneal administration of cationic liposome DNA aggregates.

PubMed

Reimer, D L; Kong, S; Monck, M; Wyles, J; Tam, P; Wasan, E K; Bally, M B

1999-05-01

The transfer of plasmid expression vectors to cells is essential for transfection after administration of lipid-based DNA formulations (lipoplexes). A murine i.p. B16/BL6 tumor model was used to characterize DNA delivery, liposomal lipid delivery, and gene transfer after regional (i.p.) administration of free plasmid DNA and DNA lipoplexes. DNA lipoplexes were prepared using cationic dioleoyldimethylammonium chloride/dioleoylphosphatidylethanolamine (50:50 mol ratio) liposomes mixed with plasmid DNA (1 microgram DNA/10 nmol lipid). The plasmid used contained the chloramphenicol acetyltransferase gene and chloramphenicol acetyltransferase expression (mU/g tumor) was measured to estimate transfection efficiency. Tumor-associated DNA and liposomal lipid levels were measured to estimate the efficiency of lipid-mediated DNA delivery to tumors. Plasmid DNA delivery was estimated using [3H]-labeled plasmid as a tracer, dot blot analysis, and/or Southern analysis. Liposomal lipid delivery was estimated using [14C]-dioleoylphosphatidylethanolamine as a liposomal lipid marker. Gene expression in the B16/BL6 tumors was highly variable, with values ranging from greater than 2,000 mU/g tumor to less than 100 mU/g tumor. There was a tendency to observe enhanced transfection in small (<250 mg) tumors. Approximately 18% of the injected dose of DNA was associated with these small tumors 2 h after i.p. administration. Southern analysis of extracted tumor DNA indicated that plasmid DNA associated with tumors was intact 24 h after administration. DNA and associated liposomal lipid are efficiently bound to tumors after regional administration; however, it is unclear whether delivery is sufficient to abet internalization and appropriate subcellular localization of the expression vector.

Epstein-Barr virus recombinants from overlapping cosmid fragments.

PubMed

Tomkinson, B; Robertson, E; Yalamanchili, R; Longnecker, R; Kieff, E

1993-12-01

Five overlapping type 1 Epstein-Barr virus (EBV) DNA fragments constituting a complete replication- and transformation-competent genome were cloned into cosmids and transfected together into P3HR-1 cells, along with a plasmid encoding the Z immediate-early activator of EBV replication. P3HR-1 cells harbor a type 2 EBV which is unable to transform primary B lymphocytes because of a deletion of DNA encoding EBNA LP and EBNA 2, but the P3HR-1 EBV can provide replication functions in trans and can recombine with the transfected cosmids. EBV recombinants which have the type 1 EBNA LP and 2 genes from the transfected EcoRI-A cosmid DNA were selectively and clonally recovered by exploiting the unique ability of the recombinants to transform primary B lymphocytes into lymphoblastoid cell lines. PCR and immunoblot analyses for seven distinguishing markers of the type 1 transfected DNAs identified cell lines infected with EBV recombinants which had incorporated EBV DNA fragments beyond the transformation marker-rescuing EcoRI-A fragment. Approximately 10% of the transforming virus recombinants had markers mapping at 7, 46 to 52, 93 to 100, 108 to 110, 122, and 152 kbp from the 172-kbp transfected genome. These recombinants probably result from recombination among the transfected cosmid-cloned EBV DNA fragments. The one recombinant virus examined in detail by Southern blot analysis has all the polymorphisms characteristic of the transfected type 1 cosmid DNA and none characteristic of the type 2 P3HR-1 EBV DNA. This recombinant was wild type in primary B-lymphocyte infection, growth transformation, and lytic replication. Overall, the type 1 EBNA 3A gene was incorporated into 26% of the transformation marker-rescued recombinants, a frequency which was considerably higher than that observed in previous experiments with two-cosmid EBV DNA cotransfections into P3HR-1 cells (B. Tomkinson and E. Kieff, J. Virol. 66:780-789, 1992). Of the recombinants which had incorporated the marker-rescuing cosmid DNA fragment and the fragment encoding the type 1 EBNA 3A gene, most had incorporated markers from at least two other transfected cosmid DNA fragments, indicating a propensity for multiple homologous recombinations. The frequency of incorporation of the nonselected transfected type 1 EBNA 3C gene, which is near the end of two of the transfected cosmids, was 26% overall, versus 3% in previous experiments using transfections with two EBV DNA cosmids. In contrast, the frequency of incorporation of a 12-kb EBV DNA deletion which was near the end of two of the transfected cosmids was only 13%.(ABSTRACT TRUNCATED AT 400 WORDS)

Construction of promoter-probe shuttle vectors for Escherichia coli and corynebacteria on the basis of promoterless alpha-amylase gene.

PubMed

Ugorcáková, J; Bukovská, G; Timko, J

2000-01-01

We constructed new promoter-probe vectors for E. coli and corynebacteria based on the promoterless alpha-amylase gene originating from Bacillus subtilis. Vectors pJUPAE1 and pJUPAE2 are suitable for isolation of transcriptionally active fragments from plasmids, phages or genomic DNA. alpha-Amylase activity can be easily visually detected on agar plates containing a chromogenic substrate, or by direct measurement of alpha-amylase activity.

A novel Streptomyces spp. integration vector derived from the S. venezuelae phage, SV1.

PubMed

Fayed, Bahgat; Younger, Ellen; Taylor, Gabrielle; Smith, Margaret C M

2014-05-30

Integrating vectors based on the int/attP loci of temperate phages are convenient and used widely, particularly for cloning genes in Streptomyces spp. We have constructed and tested a novel integrating vector based on g27, encoding integrase, and attP site from the phage, SV1. This plasmid, pBF3 integrates efficiently in S. coelicolor and S. lividans but surprisingly fails to generate stable integrants in S. venezuelae, the natural host for phage SV1. pBF3 promises to be a useful addition to the range of integrating vectors currently available for Streptomyces molecular genetics.

Isolation of a novel plasmid from Couchioplanes caeruleus and construction of two plasmid vectors for gene expression in Actinoplanes missouriensis.

PubMed

Jang, Moon-Sun; Fujita, Azusa; Ikawa, Satomi; Hanawa, Keitaro; Yamamura, Hideki; Tamura, Tomohiko; Hayakawa, Masayuki; Tezuka, Takeaki; Ohnishi, Yasuo

2015-01-01

To date, no plasmid vector has been developed for the rare actinomycete Actinoplanes missouriensis. Moreover, no small circular plasmid has been reported to exist in the genus Actinoplanes. Here, a novel plasmid, designated pCAZ1, was isolated from Couchioplanes caeruleus subsp. azureus via screening for small circular plasmids in Actinoplanes (57 strains) and Couchioplanes (2 strains). Nucleotide sequencing revealed that pCAZ1 is a 5845-bp circular molecule with a G + C content of 67.5%. The pCAZ1 copy number was estimated at 30 per chromosome. pCAZ1 contains seven putative open reading frames, one of which encodes a protein containing three motifs conserved among plasmid-encoded replication proteins that are involved in the rolling-circle mechanism of replication. Detection of single-stranded DNA intermediates in C. caeruleus confirmed that pCAZ1 replicates by this mechanism. The ColE1 origin from pBluescript SK(+) and the oriT sequence with the apramycin resistance gene aac(3)IV from pIJ773 were inserted together into pCAZ1, to construct the Escherichia coli-A. missouriensis shuttle vectors, pCAM1 and pCAM2, in which the foreign DNA fragment was inserted into pCAZ1 in opposite directions. pCAM1 and pCAM2 were successfully transferred to A. missouriensis through the E. coli-mediated conjugative transfer system. The copy numbers of pCAM1 and pCAM2 in A. missouriensis were estimated to be one and four per chromosome, respectively. Thus, these vectors can be used as effective genetic tools for homologous and heterologous gene expression studies in A. missouriensis. Copyright © 2014 Elsevier Inc. All rights reserved.

Copy number variability of expression plasmids determined by cell sorting and Droplet Digital PCR.

PubMed

Jahn, Michael; Vorpahl, Carsten; Hübschmann, Thomas; Harms, Hauke; Müller, Susann

2016-12-19

Plasmids are widely used for molecular cloning or production of proteins in laboratory and industrial settings. Constant modification has brought forth countless plasmid vectors whose characteristics in terms of average plasmid copy number (PCN) and stability are rarely known. The crucial factor determining the PCN is the replication system; most replication systems in use today belong to a small number of different classes and are available through repositories like the Standard European Vector Architecture (SEVA). In this study, the PCN was determined in a set of seven SEVA-based expression plasmids only differing in the replication system. The average PCN for all constructs was determined by Droplet Digital PCR and ranged between 2 and 40 per chromosome in the host organism Escherichia coli. Furthermore, a plasmid-encoded EGFP reporter protein served as a means to assess variability in reporter gene expression on the single cell level. Only cells with one type of plasmid (RSF1010 replication system) showed a high degree of heterogeneity with a clear bimodal distribution of EGFP intensity while the others showed a normal distribution. The heterogeneous RSF1010-carrying cell population and one normally distributed population (ColE1 replication system) were further analyzed by sorting cells of sub-populations selected according to EGFP intensity. For both plasmids, low and highly fluorescent sub-populations showed a remarkable difference in PCN, ranging from 9.2 to 123.4 for ColE1 and from 0.5 to 11.8 for RSF1010, respectively. The average PCN determined here for a set of standardized plasmids was generally at the lower end of previously reported ranges and not related to the degree of heterogeneity. Further characterization of a heterogeneous and a homogeneous population demonstrated considerable differences in the PCN of sub-populations. We therefore present direct molecular evidence that the average PCN does not represent the true number of plasmid molecules in individual cells.

Efficient Sleeping Beauty DNA Transposition From DNA Minicircles

PubMed Central

Sharma, Nynne; Cai, Yujia; Bak, Rasmus O; Jakobsen, Martin R; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm

2013-01-01

DNA transposon-based vectors have emerged as new potential delivery tools in therapeutic gene transfer. Such vectors are now showing promise in hematopoietic stem cells and primary human T cells, and clinical trials with transposon-engineered cells are on the way. However, the use of plasmid DNA as a carrier of the vector raises safety concerns due to the undesirable administration of bacterial sequences. To optimize vectors based on the Sleeping Beauty (SB) DNA transposon for clinical use, we examine here SB transposition from DNA minicircles (MCs) devoid of the bacterial plasmid backbone. Potent DNA transposition, directed by the hyperactive SB100X transposase, is demonstrated from MC donors, and the stable transfection rate is significantly enhanced by expressing the SB100X transposase from MCs. The stable transfection rate is inversely related to the size of circular donor, suggesting that a MC-based SB transposition system benefits primarily from an increased cellular uptake and/or enhanced expression which can be observed with DNA MCs. DNA transposon and transposase MCs are easily produced, are favorable in size, do not carry irrelevant DNA, and are robust substrates for DNA transposition. In accordance, DNA MCs should become a standard source of DNA transposons not only in therapeutic settings but also in the daily use of the SB system. PMID:23443502

Vector-based RNA interference against vascular endothelial growth factor-A significantly limits vascularization and growth of prostate cancer in vivo.

PubMed

Wannenes, Francesca; Ciafré, Silvia Anna; Niola, Francesco; Frajese, Gaetano; Farace, Maria Giulia

2005-12-01

RNA interference technology is emerging as a very potent tool to obtain a cellular knockdown of a desired gene. In this work we used vector-based RNA interference to inhibit vascular endothelial growth factor (VEGF) expression in prostate cancer in vitro and in vivo. We demonstrated that transduction with a plasmid carrying a small interfering RNA targeting all isoforms of VEGF, dramatically impairs the expression of this growth factor in the human prostate cancer cell line PC3. As a consequence, PC3 cells loose their ability to induce one of the fundamental steps of angiogenesis, namely the formation of a tube-like network in vitro. Most importantly, our "therapeutic" vector is able to impair tumor growth rate and vascularization in vivo. We show that a single injection of naked plasmid in developing neoplastic mass significantly decreases microvessel density in an androgen-refractory prostate xenograft and is able to sustain a long-term slowing down of tumor growth. In conclusion, our results confirm the basic role of VEGF in the angiogenic development of prostate carcinoma, and suggest that the use of our vector-based RNA interference approach to inhibit angiogenesis could be an effective tool in view of future gene therapy applications for prostate cancer.

Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii

PubMed Central

Oh, Man Hwan; Lee, Je Chul; Kim, Jungmin

2015-01-01

The traditional markerless gene deletion technique based on overlap extension PCR has been used for generating gene deletions in multidrug-resistant Acinetobacter baumannii. However, the method is time-consuming because it requires restriction digestion of the PCR products in DNA cloning and the construction of new vectors containing a suitable antibiotic resistance cassette for the selection of A. baumannii merodiploids. Moreover, the availability of restriction sites and the selection of recombinant bacteria harboring the desired chimeric plasmid are limited, making the construction of a chimeric plasmid more difficult. We describe a rapid and easy cloning method for markerless gene deletion in A. baumannii, which has no limitation in the availability of restriction sites and allows for easy selection of the clones carrying the desired chimeric plasmid. Notably, it is not necessary to construct new vectors in our method. This method utilizes direct cloning of blunt-end DNA fragments, in which upstream and downstream regions of the target gene are fused with an antibiotic resistance cassette via overlap extension PCR and are inserted into a blunt-end suicide vector developed for blunt-end cloning. Importantly, the antibiotic resistance cassette is placed outside the downstream region in order to enable easy selection of the recombinants carrying the desired plasmid, to eliminate the antibiotic resistance cassette via homologous recombination, and to avoid the necessity of constructing new vectors. This strategy was successfully applied to functional analysis of the genes associated with iron acquisition by A. baumannii ATCC 19606 and to ompA gene deletion in other A. baumannii strains. Consequently, the proposed method is invaluable for markerless gene deletion in multidrug-resistant A. baumannii. PMID:25746991

Construction of shuttle vectors capable of conjugative transfer from Escherichia coli to nitrogen-fixing filamentous cyanobacteria.

PubMed Central

Wolk, C P; Vonshak, A; Kehoe, P; Elhai, J

1984-01-01

Wild-type cyanobacteria of the genus Anabaena are capable of oxygenic photosynthesis, differentiation of cells called heterocysts at semiregular intervals along the cyanobacterial filaments, and aerobic nitrogen fixation by the heterocysts. To foster analysis of the physiological processes characteristic of these cyanobacteria, we have constructed a family of shuttle vectors capable of replication and selection in Escherichia coli and, in unaltered form, in several strains of Anabaena. Highly efficient conjugative transfer of these vectors from E. coli to Anabaena is dependent upon the presence of broad host-range plasmid RP-4 and of helper plasmids. The shuttle vectors contain portions of plasmid pBR322 required for replication and mobilization, with sites for Anabaena restriction enzymes deleted; cyanobacterial replicon pDU1, which lacks such sites; and determinants for resistance to chloramphenicol, streptomycin, neomycin, and erythromycin. Images PMID:6324204

Multiple Antibiotic Resistance Plasmids Allow Scalable,
PCR-Mediated DNA Manipulation and Near-Zero Background Cloning

PubMed Central

Arnak, Remigiusz; Altun, Burcin; Tosato, Valentina

2016-01-01

Summary We have constructed two plasmids that can be used for cloning as templates for PCR- -based gene disruption, mutagenesis and the construction of DNA chromosome translocation cassettes. To our knowledge, these plasmids are the first vectors that confer resistance to ampicillin, kanamycin and hygromycin B in bacteria, and to geneticin (G418) and hygromycin B in Saccharomyces cerevisiae simultaneously. The option of simultaneously using up to three resistance markers provides a highly stringent control of recombinant selection and the almost complete elimination of background resistance, while unique restriction sites allow easy cloning of chosen genetic material. Moreover, we successfully used these new vectors as PCR templates for the induction of chromosome translocation in budding yeast by the bridge-induced translocation system. Cells in which translocation was induced carried chromosomal rearrangements as expected and exhibited resistance to both, G418 and hygromycin B. These features make our constructs very handy tools for many molecular biology applications. PMID:27956856

Vectorology and Factor Delivery in Induced Pluripotent Stem Cell Reprogramming

PubMed Central

2014-01-01

Induced pluripotent stem cell (iPSC) reprogramming requires sustained expression of multiple reprogramming factors for a limited period of time (10–30 days). Conventional iPSC reprogramming was achieved using lentiviral or simple retroviral vectors. Retroviral reprogramming has flaws of insertional mutagenesis, uncontrolled silencing, residual expression and re-activation of transgenes, and immunogenicity. To overcome these issues, various technologies were explored, including adenoviral vectors, protein transduction, RNA transfection, minicircle DNA, excisable PiggyBac (PB) transposon, Cre-lox excision system, negative-sense RNA replicon, positive-sense RNA replicon, Epstein-Barr virus-based episomal plasmids, and repeated transfections of plasmids. This review provides summaries of the main vectorologies and factor delivery systems used in current reprogramming protocols. PMID:24625220

The p40 Subunit of Interleukin (IL)-12 Promotes Stabilization and Export of the p35 Subunit

PubMed Central

Jalah, Rashmi; Rosati, Margherita; Ganneru, Brunda; Pilkington, Guy R.; Valentin, Antonio; Kulkarni, Viraj; Bergamaschi, Cristina; Chowdhury, Bhabadeb; Zhang, Gen-Mu; Beach, Rachel Kelly; Alicea, Candido; Broderick, Kate E.; Sardesai, Niranjan Y.; Pavlakis, George N.; Felber, Barbara K.

2013-01-01

IL-12 is a 70-kDa heterodimeric cytokine composed of the p35 and p40 subunits. To maximize cytokine production from plasmid DNA, molecular steps controlling IL-12p70 biosynthesis at the posttranscriptional and posttranslational levels were investigated. We show that the combination of RNA/codon-optimized gene sequences and fine-tuning of the relative expression levels of the two subunits within a cell resulted in increased production of the IL-12p70 heterodimer. We found that the p40 subunit plays a critical role in enhancing the stability, intracellular trafficking, and export of the p35 subunit. This posttranslational regulation mediated by the p40 subunit is conserved in mammals. Based on these findings, dual gene expression vectors were generated, producing an optimal ratio of the two subunits, resulting in a ∼1 log increase in human, rhesus, and murine IL-12p70 production compared with vectors expressing the wild type sequences. Such optimized DNA plasmids also produced significantly higher levels of systemic bioactive IL-12 upon in vivo DNA delivery in mice compared with plasmids expressing the wild type sequences. A single therapeutic injection of an optimized murine IL-12 DNA plasmid showed significantly more potent control of tumor development in the B16 melanoma cancer model in mice. Therefore, the improved IL-12p70 DNA vectors have promising potential for in vivo use as molecular vaccine adjuvants and in cancer immunotherapy. PMID:23297419

Design and construction of functional AAV vectors.

PubMed

Gray, John T; Zolotukhin, Serge

2011-01-01

Using the basic principles of molecular biology and laboratory techniques presented in this chapter, researchers should be able to create a wide variety of AAV vectors for both clinical and basic research applications. Basic vector design concepts are covered for both protein coding gene expression and small non-coding RNA gene expression cassettes. AAV plasmid vector backbones (available via AddGene) are described, along with critical sequence details for a variety of modular expression components that can be inserted as needed for specific applications. Protocols are provided for assembling the various DNA components into AAV vector plasmids in Escherichia coli, as well as for transferring these vector sequences into baculovirus genomes for large-scale production of AAV in the insect cell production system.

GeneGuard: A modular plasmid system designed for biosafety.

PubMed

Wright, Oliver; Delmans, Mihails; Stan, Guy-Bart; Ellis, Tom

2015-03-20

Synthetic biology applications in biosensing, bioremediation, and biomining envision the use of engineered microbes beyond a contained laboratory. Deployment of such microbes in the environment raises concerns of unchecked cellular proliferation or unwanted spread of synthetic genes. While antibiotic-resistant plasmids are the most utilized vectors for introducing synthetic genes into bacteria, they are also inherently insecure, acting naturally to propagate DNA from one cell to another. To introduce security into bacterial synthetic biology, we here took on the task of completely reformatting plasmids to be dependent on their intended host strain and inherently disadvantageous for others. Using conditional origins of replication, rich-media compatible auxotrophies, and toxin-antitoxin pairs we constructed a mutually dependent host-plasmid platform, called GeneGuard. In this, replication initiators for the R6K or ColE2-P9 origins are provided in trans by a specified host, whose essential thyA or dapA gene is translocated from a genomic to a plasmid location. This reciprocal arrangement is stable for at least 100 generations without antibiotic selection and is compatible for use in LB medium and soil. Toxin genes ζ or Kid are also employed in an auxiliary manner to make the vector disadvantageous for strains not expressing their antitoxins. These devices, in isolation and in concert, severely reduce unintentional plasmid propagation in E. coli and B. subtilis and do not disrupt the intended E. coli host's growth dynamics. Our GeneGuard system comprises several versions of modular cargo-ready vectors, along with their requisite genomic integration cassettes, and is demonstrated here as an efficient vector for heavy-metal biosensors.

Transfection of embryonated Muscovy duck eggs with a recombinant plasmid is suitable for rescue of infectious Muscovy duck parvovirus.

PubMed

Wang, Jianye; Huang, Yu; Ling, Jueyi; Wang, Zhixiang; Zhu, Guoqiang

2017-12-01

For members of the family Parvoviridae, rescue of infectious virus from recombinant plasmid is usually done in cultured cells. In this study, the whole genome of the pathogenic Muscovy duck parvovirus (MDPV) strain YY was cloned into the pBluescript II (SK) vector, generating recombinant plasmid pYY. With the aid of a transfection reagent, pYY plasmid was inoculated into 11-day-old embryonated Muscovy duck eggs via the chorioallantoic membrane route, resulting in the successful rescue of infectious virus and death of the embryos. The rescued virus exhibited pathogenicity in Muscovy ducklings similar to that of its parental strain, as evaluated based on the mortality rate. The results demonstrate that plasmid transfection in embryonated Muscovy duck eggs is a convenient and efficacious method for rescue of infectious MDPV in comparison to transfection of primary cells, which is somewhat time-consuming and laborious.

[Construction of recombinant lentiviral vector of Tie2-RNAi and its influence on malignant melanoma cells in vitro].

PubMed

Shan, Xiu-ying; Liu, Zhao-liang; Wang, Biao; Guo, Guo-xiang; Wang, Mei-shui; Zhuang, Fu-lian; Cai, Chuan-shu; Zhang, Ming-feng; Zhang, Yan-ding

2011-07-01

To construct lentivector carrying Tie2-Small interfering RNA (SiRNA), so as to study its influence on malignant melanoma cells. Recombinant plasmid pSilencer 1.0-U6-Tie2-siRNA and plasmid pNL-EGFP were digested with XbaI, ligated a target lentiviral transfer plasmid of pNL-EGFP-U6-Tie2-I or pNL-EGFP-U6-Tie2-II, and then the electrophoresis clones was sequenced. Plasmids of pNL-EGFP-U6-Tie2-I and pNL-EGFP-U6-Tie2-II were constructed and combined with pVSVG and pHelper, respectively, to constitute lentiviral vector system of three plasmids. The Lentiviral vector system was transfected into 293T cell to produce pNL-EGFP-U6-Tie2- I and pNL-EGFP-U6-Tie2-II lentivirus. Then the supernatant was collected to determine the titer. Malignant melanoma cells were infected by both lentiviruses and identified by Realtime RT-PCR to assess inhibitory efficiency. The recombinant lentiviral vectors of Tie2-RNAi were constructed successfully which were analyzed with restriction enzyme digestion and identified by sequencing. And the titer of lentiviral vector was 8.8 x 10(3)/ml, which was determined by 293T cell. The results of Realtime RT-PCR demonstrated that the lentiviral vectors of Tie2-RNAi could infect malignant melanoma cells and inhibit the expression of Tie2 genes in malignant melanoma cells (P<0.01). There was no significant difference in the expression level (P>0.05) between the two lentiviral vectors of Tie2-RNAi. Lentivector carrying Tie2-SiRNA can be constructed successfully and inhibit the expression of Tie2 gene in vitro significantly. The study will supply the theory basis for the further research on the inhibition of tumor growth in vivo.

Persistence of transferable extended-spectrum-β-lactamase resistance in the absence of antibiotic pressure.

PubMed

Cottell, Jennifer L; Webber, Mark A; Piddock, Laura J V

2012-09-01

The treatment of infections caused by antibiotic-resistant bacteria is one of the great challenges faced by clinicians in the 21st century. Antibiotic resistance genes are often transferred between bacteria by mobile genetic vectors called plasmids. It is commonly believed that removal of antibiotic pressure will reduce the numbers of antibiotic-resistant bacteria due to the perception that carriage of resistance imposes a fitness cost on the bacterium. This study investigated the ability of the plasmid pCT, a globally distributed plasmid that carries an extended-spectrum-β-lactamase (ESBL) resistance gene (bla(CTX-M-14)), to persist and disseminate in the absence of antibiotic pressure. We investigated key attributes in plasmid success, including conjugation frequencies, bacterial-host growth rates, ability to cause infection, and impact on the fitness of host strains. We also determined the contribution of the bla(CTX-M-14) gene itself to the biology of the plasmid and host bacterium. Carriage of pCT was found to impose no detectable fitness cost on various bacterial hosts. An absence of antibiotic pressure and inactivation of the antibiotic resistance gene also had no effect on plasmid persistence, conjugation frequency, or bacterial-host biology. In conclusion, plasmids such as pCT have evolved to impose little impact on host strains. Therefore, the persistence of antibiotic resistance genes and their vectors is to be expected in the absence of antibiotic selective pressure regardless of antibiotic stewardship. Other means to reduce plasmid stability are needed to prevent the persistence of these vectors and the antibiotic resistance genes they carry.

Identification of facultatively heterotrophic, N/sub 2/-fixing cyanobacteria able to receive plasmid vectors from Escherichia coli by conjugation. [Anabaena spp; Nostoc

DOE Office of Scientific and Technical Information (OSTI.GOV)

Flores, E.; Wolk, C.P.

1985-06-01

Plasmid vectors transferable by conjugation from Escherichia coli to obligately photoautotrophic strains of Anabaena spp. are also transferred to and maintained in heterotrophic, filamentous cyanobacteria of the genus Nostoc. These organisms can be used for the genetic analysis of oxygenic photosynthesis, chromatic adaptation, nitrogen fixation, and heterocyst development.

Therapies based on targeting EBV lytic replication for EBV-associated malignancies.

PubMed

Li, Hongde; Hu, Jianmin; Luo, Xiangjian; Bode, Ann M; Dong, Zigang; Cao, Ya

2018-05-11

In recent years, EBV lytic infection has been shown to significantly contribute to carcinogenesis. Thus, therapies aimed at targeting the EBV lytic cycle have been developed as novel strategies for treatment of EBV-associated diseases malignancies. In this review, focusing on the viral lytic proteins, we describe recent advances regarding the involvement of the EBV lytic cycle in carcinogenesis. Moreover, we further discuss two distinct EBV lytic cycle-targeted therapeutic strategies against EBV-induced malignancies: One of the strategies involves inhibition of the EBV lytic cycle by natural compounds known to have anti-EBV properties; another one is to intentionally induce EBV lytic replication in combination with nucleotide analogues. Recent advances in EBV lytic-based strategies are beginning to show promise in the treatment and/or prevention of EBV-related tumors. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Plasmid P1 replication: negative control by repeated DNA sequences.

PubMed Central

Chattoraj, D; Cordes, K; Abeles, A

1984-01-01

The incompatibility locus, incA, of the unit-copy plasmid P1 is contained within a fragment that is essentially a set of nine 19-base-pair repeats. One or more copies of the fragment destabilizes the plasmid when present in trans. Here we show that extra copies of incA interfere with plasmid DNA replication and that a deletion of most of incA increases plasmid copy number. Thus, incA is not essential for replication but is required for its control. When cloned in a high-copy-number vector, pieces of the incA fragment that each contain only three repeats destabilize P1 plasmids efficiently. This result makes it unlikely that incA specifies a regulatory product. Our in vivo results suggest that the repeating DNA sequence itself negatively controls replication by titrating a P1-determined protein, RepA, that is essential for replication. Consistent with this hypothesis is the observation that the RepA protein binds to the incA fragment in vitro. Images PMID:6387706

The construction of a synthetic Escherichia coli trp promoter and its use in the expression of a synthetic interferon gene.

PubMed Central

Windass, J D; Newton, C R; De Maeyer-Guignard, J; Moore, V E; Markham, A F; Edge, M D

1982-01-01

An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector. We have also joined the fragment to a synthetic IFN-alpha 1 gene, using synthetic oligonucleotides to generate a completely natural, highly efficient bacterial translation initiation signal on the promoter proximal side of the IFN gene. Plasmids carrying this construction enable E. coli cells to express IFN-alpha 1 almost constitutively and with significantly higher efficiency than from a lacUV5 promoter based system. Images PMID:6184675

pLS010 plasmid vector

DOEpatents

Lacks, Sanford A.; Balganesh, Tanjore S.

1988-01-01

Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb malM gene fragment ligated to a 4.4 Kb T.sub.c r DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems.

A Peptide-based Vector for Efficient Gene Transfer In Vitro and In Vivo

PubMed Central

Lehto, Taavi; Simonson, Oscar E; Mäger, Imre; Ezzat, Kariem; Sork, Helena; Copolovici, Dana-Maria; Viola, Joana R; Zaghloul, Eman M; Lundin, Per; Moreno, Pedro MD; Mäe, Maarja; Oskolkov, Nikita; Suhorutšenko, Julia; Smith, CI Edvard; Andaloussi, Samir EL

2011-01-01

Finding suitable nonviral delivery vehicles for nucleic acid–based therapeutics is a landmark goal in gene therapy. Cell-penetrating peptides (CPPs) are one class of delivery vectors that has been exploited for this purpose. However, since CPPs use endocytosis to enter cells, a large fraction of peptides remain trapped in endosomes. We have previously reported that stearylation of amphipathic CPPs, such as transportan 10 (TP10), dramatically increases transfection of oligonucleotides in vitro partially by promoting endosomal escape. Therefore, we aimed to evaluate whether stearyl-TP10 could be used for the delivery of plasmids as well. Our results demonstrate that stearyl-TP10 forms stable nanoparticles with plasmids that efficiently enter different cell-types in a ubiquitous manner, including primary cells, resulting in significantly higher gene expression levels than when using stearyl-Arg9 or unmodified CPPs. In fact, the transfection efficacy of stearyl-TP10 almost reached the levels of Lipofectamine 2000 (LF2000), however, without any of the observed lipofection-associated toxicities. Most importantly, stearyl-TP10/plasmid nanoparticles are nonimmunogenic, mediate efficient gene delivery in vivo, when administrated intramuscularly (i.m.) or intradermally (i.d.) without any associated toxicity in mice. PMID:21343913

Construction of novel shuttle expression vectors for gene expression in Bacillus subtilis and Bacillus pumilus.

PubMed

Shao, Huanhuan; Cao, Qinghua; Zhao, Hongyan; Tan, Xuemei; Feng, Hong

2015-01-01

A native plasmid (pSU01) was detected by genome sequencing of Bacillus subtilis strain S1-4. Two pSU01-based shuttle expression vectors pSU02-AP and pSU03-AP were constructed enabling stable replication in B. subtilis WB600. These vectors contained the reporter gene aprE, encoding an alkaline protease from Bacillus pumilus BA06. The expression vector pSU03-AP only possessed the minimal replication elements (rep, SSO, DSO) and exhibited more stability on structure, suggesting that the rest of the genes in pSU01 (ORF1, ORF2, mob, hsp) were unessential for the structural stability of plasmid in B. subtilis. In addition, recombinant production of the alkaline protease was achieved more efficiently with pSU03-AP whose copy number was estimated to be more than 100 per chromosome. Furthermore, pSU03-AP could also be used to transform and replicate in B. pumilus BA06 under selective pressure. In conclusion, pSU03-AP is expected to be a useful tool for gene expression in Bacillus subtilis and B. pumilus.

New ΦBT1 site-specific integrative vectors with neutral phenotype in Streptomyces.

PubMed

Gonzalez-Quiñonez, Nathaly; López-García, María Teresa; Yagüe, Paula; Rioseras, Beatriz; Pisciotta, Annalisa; Alduina, Rosa; Manteca, Ángel

2016-03-01

Integrative plasmids are one of the best options to introduce genes in low copy and in a stable form into bacteria. The ΦC31-derived plasmids constitute the most common integrative vectors used in Streptomyces. They integrate at different positions (attB and pseudo-attB sites) generating different mutations. The less common ΦBT1-derived vectors integrate at the unique attB site localized in the SCO4848 gene (S. coelicolor genome) or their orthologues in other streptomycetes. This work demonstrates that disruption of SCO4848 generates a delay in spore germination. SCO4848 is co-transcribed with SCO4849, and the spore germination phenotype is complemented by SCO4849. Plasmids pNG1-4 were created by modifying the ΦBT1 integrative vector pMS82 by introducing a copy of SCO4849 under the control of the promoter region of SCO4848. pNG2 and pNG4 also included a copy of the P ermE * in order to facilitate gene overexpression. pNG3 and pNG4 harboured a copy of the bla gene (ampicillin resistance) to facilitate selection in E. coli. pNG1-4 are the only integrative vectors designed to produce a neutral phenotype when they are integrated into the Streptomyces genome. The experimental approach developed in this work can be applied to create phenotypically neutral integrative plasmids in other bacteria.

Development of Genetically Stable Escherichia coli Strains for Poly(3-Hydroxypropionate) Production

PubMed Central

Gao, Yongqiang; Liu, Changshui; Ding, Yamei; Sun, Chao; Zhang, Rubing; Xian, Mo; Zhao, Guang

2014-01-01

Poly(3-hydroxypropionate) (P3HP) is a biodegradable and biocompatible thermoplastic. In our previous study, a pathway for P3HP production was constructed in recombinant Esecherichia coli. Seven exogenous genes in P3HP synthesis pathway were carried by two plasmid vectors. However, the P3HP production was severely suppressed by strain instability due to plasmid loss. In this paper, two strategies, chromosomal gene integration and plasmid addiction system (PAS) based on amino acid anabolism, were applied to construct a genetically stable strain. Finally, a combination of those two methods resulted in the best results. The resultant strain carried a portion of P3HP synthesis genes on chromosome and the others on plasmid, and also brought a tyrosine-auxotrophy based PAS. In aerobic fed-batch fermentation, this strain produced 25.7 g/L P3HP from glycerol, about 2.5-time higher than the previous strain with two plasmids. To the best of our knowledge, this is the highest P3HP production from inexpensive carbon sources. PMID:24837211

A novel dual vector coexpressing PhiX174 lysis E gene and staphylococcal nuclease A gene on the basis of lambda promoter pR and pL, respectively.

PubMed

Fu, Lixia; Lu, Chengping

2013-06-01

Bacterial ghost is a novel vaccine platform, and its safe and efficient production depends largely upon a suitable and functional vector. In this study, a series of temperature-inducible plasmids, carrying Phix174 lysis gene E and/or staphylococcal nuclease A (SNA) gene, were constructed and evaluated in Escherichia coli. The results showed that the direct product of SNA (pBV220-SNA) could degrade the plasmid and genomic DNA of E. coli while the fusion product of gene E and partial Cro gene (pKF396M-2) lost the ability to lyse the host strain. The insertion of enhancer T7g10 elements and Shine-Dalgarno box (ESD) between them (pKF396M-3) could resume the function of gene E. Using plasmid pKF396M-4 with gene E and SNA, respectively, under the immediate control of promoter pR and pL, the remnant plasmids and genomic DNA of E. coli were eliminated, and the rates of inactivation increased by two orders of magnitude over that obtained with the exclusive use of E-mediated lysis plasmid. By substituting these two genes with customized multiple cloning sites sequences, the plasmid could be modified to a dual expression vector (pKF396M-5).

AAVS1-Targeted Plasmid Integration in AAV Producer Cell Lines.

PubMed

Luo, Yuxia; Frederick, Amy; Martin, John M; Scaria, Abraham; Cheng, Seng H; Armentano, Donna; Wadsworth, Samuel C; Vincent, Karen A

2017-06-01

Adeno-associated virus (AAV) producer cell lines are created via transfection of HeLaS3 cells with a single plasmid containing three components (the vector sequence, the AAV rep and cap genes, and a selectable marker gene). As this plasmid contains both the cis (Rep binding sites) and trans (Rep protein encoded by the rep gene) elements required for site-specific integration, it was predicted that plasmid integration might occur within the AAVS1 locus on human chromosome 19 (chr19). The objective of this study was to investigate whether integration in AAVS1 might be correlated with vector yield. Plasmid integration sites within several independent cell lines were assessed via Southern, fluorescence in situ hybridization (FISH) and PCR analyses. In the Southern analyses, the presence of fragments detected by both rep- and AAVS1-specific probes suggested that for several mid- and high-producing lines, plasmid DNA had integrated into the AAVS1 locus. Analysis with puroR and AAVS1-specific probes suggested that integration in AAVS1 was a more widespread phenomenon. High-producing AAV2-secreted alkaline phosphatase (SEAP) lines (masterwell 82 [MW82] and MW278) were evaluated via FISH using probes specific for the plasmid, AAVS1, and a chr19 marker. FISH analysis detected two plasmid integration sites in MW278 (neither in AAVS1), while a total of three sites were identified in MW82 (two in AAVS1). An inverse PCR assay confirmed integration within AAVS1 for several mid- and high-producing lines. In summary, the FISH, Southern, and PCR data provide evidence of site-specific integration of the plasmid within AAVS1 in several AAV producer cell lines. The data also suggest that integration in AAVS1 is a general phenomenon that is not necessarily restricted to high producers. The results also suggest that plasmid integration within the AAVS1 locus is not an absolute requirement for a high vector yield.

pLS101 plasmid vector

DOEpatents

Lacks, S.A.; Balganesh, T.S.

1985-02-19

Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb ma1M gene fragment ligated to a 4.4 Kb Tcr DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems. 5 figs., 2 tabs.

Identification of three extra-chromosomal replicons in Leptospira pathogenic strain and development of new shuttle vectors.

PubMed

Zhu, Weinan; Wang, Jin; Zhu, Yongzhang; Tang, Biao; Zhang, Yunyi; He, Ping; Zhang, Yan; Liu, Boyu; Guo, Xiaokui; Zhao, Guoping; Qin, Jinhong

2015-02-15

The genome of pathogenic Leptospira interrogans contains two chromosomes. Plasmids and prophages are known to play specific roles in gene transfer in bacteria and can potentially serve as efficient genetic tools in these organisms. Although plasmids and prophage remnants have recently been reported in Leptospira species, their characteristics and potential applications in leptospiral genetic transformation systems have not been fully evaluated. Three extrachromosomal replicons designated lcp1 (65,732 bp), lcp2 (56,757 bp), and lcp3 (54,986 bp) in the L. interrogans serovar Linhai strain 56609 were identified through whole genome sequencing. All three replicons were stable outside of the bacterial chromosomes. Phage particles were observed in the culture supernatant of 56609 after mitomycin C induction, and lcp3, which contained phage-related genes, was considered to be an inducible prophage. L. interrogans-Escherichia coli shuttle vectors, constructed with the predicted replication elements of single rep or rep combined with parAB loci from the three plasmids were shown to successfully transform into both saprophytic and pathogenic Leptospira species, suggesting an essential function for rep genes in supporting auto-replication of the plasmids. Additionally, a wide distribution of homologs of the three rep genes was identified in L. interrogans isolates, and correlation tests showed that the transformability of the shuttle vectors in L. interrogans isolates depended, to certain extent, on genetic compatibility between the rep sequences of both plasmid and host. Three extrachromosomal replicons co-exist in L. interrogans, one of which we consider to be an inducible prophage. The vectors constructed with the rep genes of the three replicons successfully transformed into saprophytic and pathogenic Leptospira species alike, but this was partly dependent on genetic compatibility between the rep sequences of both plasmid and host.

[Construction of a plant effective expression vector containing the gene of hepatitis B virus surface antigen].

PubMed

Lin, Bing-Ying; Jin, Zhi-Qiang; Li, Mei

2006-11-01

To construct a plant effective expression vector driven by a fruit specific promoter for the expression of hepatitis B virus surface antigen (HBsAg), to further improve the expression of exogenous gene in plant, and to prepare for the development of an effective anti-hepatitis vaccine. Tomato fruit-specific promoters' gene 2A12 and E8 were respectively introduced to pBPFOmega7 to form pB2A12 and pBE8. The DNA fragment containing HBsAg-s gene from plasmid YEP-HBs was inserted respectively into pB2A12 and pBE8 to form pB2A12-HBs and pBE8-HBs. The fragment containing "p35S+2A12+Omega+HBsAg-s+Tnos" of the pB2A12-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the reconstructed plant binary expression plasmid pCAM2A12-HBs, and the fragment containing "p35S+E8+Omega+HBsAg-s+Tnos" of the pBE8-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the plasmid pCAME8-HBs. The inserted gene HBsAg and fruit-specific promoters in the reconstructed plant binary expression vectors were confirmed by sequencing. Then, pCAM2A12-HBs and pCAME8-HBs were directly introduced into Agrobacterium tumefaciens strain EHA105. Digestion with restriction enzymes proved that all recombinant vectors had the inserts with expected length of the target fragments, and the sequencing results were confirmed correct. In this study, plant expression vector containing HBsAg gene driven by fruit specific promoter and CaMV35s promoter was successfully constructed.

Structural and physiological studies of the Escherichia coli histidine operon inserted into plasmid vectors.

PubMed Central

Bruni, C B; Musti, A M; Frunzio, R; Blasi, F

1980-01-01

A fragment of deoxyribonucleic acid 5,300 base paris long and containing the promoter-proximal portion of the histidine operon of Escherichia coli K-12, has been cloned in plasmid pBR313 (plasmids pCB2 and pCB3). Restriction mapping, partial nucleotide sequencing, and studies on functional expression in vivo and on protein synthesis in minicells have shown that the fragment contains the regulatory region of the operon, the hisG, hisD genes, and part of the hisC gene. Another plasmid (pCB5) contained the hisG gene and part of the hisD gene. Expression of the hisG gene in the latter plasmid was under control of the tetracycline promoter of the pBR313 plasmid. The in vivo expression of the two groups of plasmids described above, as well as their effect on the expression of the histidine genes not carried by the plasmids but present on the host chromosome, has been studied. The presence of multiple copies of pCB2 or pCB3, but not of pCB5, prevented derepression of the chromosomal histidine operon. Possible interpretations of this phenomenon are discussed. Images PMID:6246067

Characterization of a minimal pKW2124 replicon from Weissella cibaria KLC140 and its application for the construction of the Weissella expression vector pKUCm1

PubMed Central

Ku, Hye-Jin; Park, Myeong Soo; Lee, Ju-Hoon

2015-01-01

A 2.1-kb plasmid was previously isolated from Weissella cibaria KLC140 in kimchi and cloned into pUC19 along with the slpA and gfp genes, resulting in an 8.6-kb pKWCSLGFP construct for use as a novel surface display vector. To reduce the size of the vector, the minimal replicon of pKW2124 was determined. The pKW2124 plasmid contains a putative origin of replication (ori), a potential ribosomal binding site (RBS), and the repA gene encoding a plasmid replication protein. To conduct the minimal replicon experiment, four different PCR products (MR1, ori+RBS+repA; MR2, RBS+repA; MR2’, repA; MR3, fragment of repA) were obtained and cloned into pUC19 (pKUCm1, pKUCm2, pKUCm2’, and pKUCm3, respectively) containing the chloramphenicol acetyltransferase (CAT) gene. These constructed vectors were electroporated into W. confusa ATCC 10881 with different transformation efficiencies of 1.5 × 105 CFU/μg, 1.3 × 101 CFU/μg, and no transformation, respectively, suggesting that the putative ori, RBS, and repA gene are essential for optimum plasmid replication. Subsequent segregational plasmid stability testing of pKUCm1 and pKUCm2 showed that the vector pKUCm1 is highly stable up to 100 generations but pKUCm2 was completely lost after 60 generations, suggesting that the putative ori may be important for plasmid stability in the host strain. In addition, a host range test of pKUCm1 revealed that it has a broad host range spectrum including Weissella, Lactococcus, Leuconostoc, and even Lactobacillus. To verify the application of pKUCm1, the β-galactosidase gene and its promoter region from W. cibaria KSD1 were cloned in the vector, resulting in pKUGal. Expression of the β-galactosidase gene was confirmed using blue-white screening after IPTG induction. The small and stable pKUGal vector will be useful for gene transfer, expression, and manipulation in the Weissella genome and in other lactic acid bacteria. PMID:25691882

Exploiting translational coupling for the selection of cells producing toxic recombinant proteins from expression vectors.

PubMed

Tagliavia, Marcello; Cuttitta, Angela

2016-01-01

High rates of plasmid instability are associated with the use of some expression vectors in Escherichia coli, resulting in the loss of recombinant protein expression. This is due to sequence alterations in vector promoter elements caused by the background expression of the cloned gene, which leads to the selection of fast-growing, plasmid-containing cells that do not express the target protein. This phenomenon, which is worsened when expressing toxic proteins, results in preparations containing very little or no recombinant protein, or even in clone loss; however, no methods to prevent loss of recombinant protein expression are currently available. We have exploited the phenomenon of translational coupling, a mechanism of prokaryotic gene expression regulation, in order to select cells containing plasmids still able to express recombinant proteins. Here we designed an expression vector in which the cloned gene and selection marker are co-expressed. Our approach allowed for the selection of the recombinant protein-expressing cells and proved effective even for clones encoding toxic proteins.

Genetic modification of bone-marrow mesenchymal stem cells and hematopoietic cells with human coagulation factor IX-expressing plasmids.

PubMed

Sam, Mohammad Reza; Azadbakhsh, Azadeh Sadat; Farokhi, Farrah; Rezazadeh, Kobra; Sam, Sohrab; Zomorodipour, Alireza; Haddad-Mashadrizeh, Aliakbar; Delirezh, Nowruz; Mokarizadeh, Aram

2016-05-01

Ex-vivo gene therapy of hemophilias requires suitable bioreactors for secretion of hFIX into the circulation and stem cells hold great potentials in this regard. Viral vectors are widely manipulated and used to transfer hFIX gene into stem cells. However, little attention has been paid to the manipulation of hFIX transgene itself. Concurrently, the efficacy of such a therapeutic approach depends on determination of which vectors give maximal transgene expression. With this in mind, TF-1 (primary hematopoietic lineage) and rat-bone marrow mesenchymal stem cells (BMSCs) were transfected with five hFIX-expressing plasmids containing different combinations of two human β-globin (hBG) introns inside the hFIX-cDNA and Kozak element and hFIX expression was evaluated by different methods. In BMSCs and TF-1 cells, the highest hFIX level was obtained from the intron-less and hBG intron-I,II containing plasmids respectively. The highest hFIX activity was obtained from the cells that carrying the hBG intron-I,II containing plasmids. BMSCs were able to produce higher hFIX by 1.4 to 4.7-fold increase with activity by 2.4 to 4.4-fold increase compared to TF-1 cells transfected with the same constructs. BMSCs and TF-1 cells could be effectively bioengineered without the use of viral vectors and hFIX minigene containing hBG introns could represent a particular interest in stem cell-based gene therapy of hemophilias. Copyright © 2016 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

A replicative plasmid vector allows efficient complementation of pathogenic Leptospira strains.

PubMed

Pappas, Christopher J; Benaroudj, Nadia; Picardeau, Mathieu

2015-05-01

Leptospirosis, an emerging zoonotic disease, remains poorly understood because of a lack of genetic manipulation tools available for pathogenic leptospires. Current genetic manipulation techniques include insertion of DNA by random transposon mutagenesis and homologous recombination via suicide vectors. This study describes the construction of a shuttle vector, pMaORI, that replicates within saprophytic, intermediate, and pathogenic leptospires. The shuttle vector was constructed by the insertion of a 2.9-kb DNA segment including the parA, parB, and rep genes into pMAT, a plasmid that cannot replicate in Leptospira spp. and contains a backbone consisting of an aadA cassette, ori R6K, and oriT RK2/RP4. The inserted DNA segment was isolated from a 52-kb region within Leptospira mayottensis strain 200901116 that is not found in the closely related strain L. mayottensis 200901122. Because of the size of this region and the presence of bacteriophage-like proteins, it is possible that this region is a result of a phage-related genomic island. The stability of the pMaORI plasmid within pathogenic strains was tested by passaging cultures 10 times without selection and confirming the presence of pMaORI. Concordantly, we report the use of trans complementation in the pathogen Leptospira interrogans. Transformation of a pMaORI vector carrying a functional copy of the perR gene in a null mutant background restores the expression of PerR and susceptibility to hydrogen peroxide comparable to that of wild-type cells. In conclusion, we demonstrate the replication of a stable plasmid vector in a large panel of Leptospira strains, including pathogens. The shuttle vector described will expand our ability to perform genetic manipulation of Leptospira spp. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

A plasmid toolkit for cloning chimeric cDNAs encoding customized fusion proteins into any Gateway destination expression vector

PubMed Central

2013-01-01

Background Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. Results We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit’s component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. Conclusions We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins. PMID:23957834

A plasmid toolkit for cloning chimeric cDNAs encoding customized fusion proteins into any Gateway destination expression vector.

PubMed

Buj, Raquel; Iglesias, Noa; Planas, Anna M; Santalucía, Tomàs

2013-08-20

Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit's component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins.

Genome-Based Genetic Tool Development for Bacillus methanolicus: Theta- and Rolling Circle-Replicating Plasmids for Inducible Gene Expression and Application to Methanol-Based Cadaverine Production.

PubMed

Irla, Marta; Heggeset, Tonje M B; Nærdal, Ingemar; Paul, Lidia; Haugen, Tone; Le, Simone B; Brautaset, Trygve; Wendisch, Volker F

2016-01-01

Bacillus methanolicus is a thermophilic methylotroph able to overproduce amino acids from methanol, a substrate not used for human or animal nutrition. Based on our previous RNA-seq analysis a mannitol inducible promoter and a putative mannitol activator gene mtlR were identified. The mannitol inducible promoter was applied for controlled gene expression using fluorescent reporter proteins and a flow cytometry analysis, and improved by changing the -35 promoter region and by co-expression of the mtlR regulator gene. For independent complementary gene expression control, the heterologous xylose-inducible system from B. megaterium was employed and a two-plasmid gene expression system was developed. Four different replicons for expression vectors were compared with respect to their copy number and stability. As an application example, methanol-based production of cadaverine was shown to be improved from 11.3 to 17.5 g/L when a heterologous lysine decarboxylase gene cadA was expressed from a theta-replicating rather than a rolling-circle replicating vector. The current work on inducible promoter systems and compatible theta- or rolling circle-replicating vectors is an important extension of the poorly developed B. methanolicus genetic toolbox, valuable for genetic engineering and further exploration of this bacterium.

Genome-Based Genetic Tool Development for Bacillus methanolicus: Theta- and Rolling Circle-Replicating Plasmids for Inducible Gene Expression and Application to Methanol-Based Cadaverine Production

PubMed Central

Irla, Marta; Heggeset, Tonje M. B.; Nærdal, Ingemar; Paul, Lidia; Haugen, Tone; Le, Simone B.; Brautaset, Trygve; Wendisch, Volker F.

2016-01-01

Bacillus methanolicus is a thermophilic methylotroph able to overproduce amino acids from methanol, a substrate not used for human or animal nutrition. Based on our previous RNA-seq analysis a mannitol inducible promoter and a putative mannitol activator gene mtlR were identified. The mannitol inducible promoter was applied for controlled gene expression using fluorescent reporter proteins and a flow cytometry analysis, and improved by changing the -35 promoter region and by co-expression of the mtlR regulator gene. For independent complementary gene expression control, the heterologous xylose-inducible system from B. megaterium was employed and a two-plasmid gene expression system was developed. Four different replicons for expression vectors were compared with respect to their copy number and stability. As an application example, methanol-based production of cadaverine was shown to be improved from 11.3 to 17.5 g/L when a heterologous lysine decarboxylase gene cadA was expressed from a theta-replicating rather than a rolling-circle replicating vector. The current work on inducible promoter systems and compatible theta- or rolling circle-replicating vectors is an important extension of the poorly developed B. methanolicus genetic toolbox, valuable for genetic engineering and further exploration of this bacterium. PMID:27713731

Direct Cloning of Yeast Genes from an Ordered Set of Lambda Clones in Saccharomyces Cerevisiae by Recombination in Vivo

PubMed Central

Erickson, J. R.; Johnston, M.

1993-01-01

We describe a technique that facilitates the isolation of yeast genes that are difficult to clone. This technique utilizes a plasmid vector that rescues lambda clones as yeast centromere plasmids. The source of these lambda clones is a set of clones whose location in the yeast genome has been determined by L. Riles et al. in 1993. The Esherichia coli-yeast shuttle plasmid carries URA3, ARS4 and CEN6, and contains DNA fragments from the lambda vector that flank the cloned yeast insert. When yeast is cotransformed with linearized plasmid and lambda clone DNA, Ura(+) transformants are obtained by a recombination event between the lambda clone and the plasmid vector that generates an autonomously replicating plasmid containing the cloned yeast DNA sequences. Genes whose genetic map positions are known can easily be identified and recovered in this plasmid by testing only those lambda clones that map to the relevant region of the yeast genome for their ability to complement the mutant phenotype. This technique facilitates the isolation of yeast genes that resist cloning either because (1) they are underrepresented in yeast genomic libraries amplified in E. coli, (2) they provide phenotypes that are too marginal to allow selection of the gene by genetic complementation or (3) they provide phenotypes that are laborious to score. We demonstrate the utility of this technique by isolating three genes, GAL83, SSN2 and MAK7, each of which presents one of these problems for cloning. PMID:8514124

Genetic transformation of a clinical (genital tract), plasmid-free isolate of Chlamydia trachomatis: engineering the plasmid as a cloning vector.

PubMed

Wang, Yibing; Kahane, Simona; Cutcliffe, Lesley T; Skilton, Rachel J; Lambden, Paul R; Persson, Kenneth; Bjartling, Carina; Clarke, Ian N

2013-01-01

Our study had three objectives: to extend the plasmid-based transformation protocol to a clinical isolate of C. trachomatis belonging to the trachoma biovar, to provide "proof of principle" that it is possible to "knock out" selected plasmid genes (retaining a replication competent plasmid) and to investigate the plasticity of the plasmid. A recently developed, plasmid-based transformation protocol for LGV isolates of C. trachomatis was modified and a plasmid-free, genital tract C. trachomatis isolate from Sweden (SWFP-) was genetically transformed. Transformation of this non-LGV C. trachomatis host required a centrifugation step, but the absence of the natural plasmid removed the need for plaque purification of transformants. Transformants expressed GFP, were penicillin resistant and iodine stain positive for accumulated glycogen. The transforming plasmid did not recombine with the host chromosome. A derivative of pGFP::SW2 carrying a deletion of the plasmid CDS5 gene was engineered. CDS5 encodes pgp3, a protein secreted from the inclusion into the cell cytoplasm. This plasmid (pCDS5KO) was used to transform C. trachomatis SWFP-, and established that pgp3 is dispensable for plasmid function. The work shows it is possible to selectively delete segments of the chlamydial plasmid, and this is the first step towards a detailed molecular dissection of the role of the plasmid. The 3.6 kb β-galactosidase cassette was inserted into the deletion site of CDS5 to produce plasmid placZ-CDS5KO. Transformants were penicillin resistant, expressed GFP and stained for glycogen. In addition, they expressed β-galactosidase showing that the lacZ cassette was functional in C. trachomatis. An assay was developed that allowed the visualisation of individual inclusions by X-gal staining. The ability to express active β-galactosidase within chlamydial inclusions is an important advance as it allows simple, rapid assays to measure directly chlamydial infectivity without the need for plaquing, fluorescence or antibody staining.

Vectors for co-expression of an unrestricted number of proteins

PubMed Central

Scheich, Christoph; Kümmel, Daniel; Soumailakakis, Dimitri; Heinemann, Udo; Büssow, Konrad

2007-01-01

A vector system is presented that allows generation of E. coli co-expression clones by a standardized, robust cloning procedure. The number of co-expressed proteins is not limited. Five ‘pQLink’ vectors for expression of His-tag and GST-tag fusion proteins as well as untagged proteins and for cloning by restriction enzymes or Gateway cloning were generated. The vectors allow proteins to be expressed individually; to achieve co-expression, two pQLink plasmids are combined by ligation-independent cloning. pQLink co-expression plasmids can accept an unrestricted number of genes. As an example, the co-expression of a heterotetrameric human transport protein particle (TRAPP) complex from a single plasmid, its isolation and analysis of its stoichiometry are shown. pQLink clones can be used directly for pull-down experiments if the proteins are expressed with different tags. We demonstrate pull-down experiments of human valosin-containing protein (VCP) with fragments of the autocrine motility factor receptor (AMFR). The cloning method avoids PCR or gel isolation of restriction fragments, and a single resistance marker and origin of replication are used, allowing over-expression of rare tRNAs from a second plasmid. It is expected that applications are not restricted to bacteria, but could include co-expression in other hosts such as Bacluovirus/insect cells. PMID:17311810

Ultrasound-targeted hepatic delivery of factor IX in hemophiliac mice.

PubMed

Anderson, C D; Moisyadi, S; Avelar, A; Walton, C B; Shohet, R V

2016-06-01

Ultrasound-targeted microbubble destruction (UTMD) was used to direct the delivery of plasmid and transposase-based vectors encoding human factor IX (hFIX) to the livers of hemophilia B (FIX-/-) mice. The DNA vectors were incorporated into cationic lipid microbubbles, injected intravenously, and transfected into hepatocytes by acoustic cavitation of the bubbles as they transited the liver. Ultrasound parameters were identified that produced transfection of hepatocytes in vivo without substantial damage or bleeding in the livers of the FIX-deficient mice. These mice were treated with a conventional expression plasmid, or one containing a piggyBac transposon construct, and hFIX levels in the plasma and liver were evaluated at multiple time points after UTMD. We detected hFIX in the plasma by western blotting from mice treated with either plasmid during the 12 days after UTMD, and in the hepatocytes of treated livers by immunofluorescence. Reductions in clotting time and improvements in the percentage of FIX activity were observed for both plasmids, conventional (4.15±1.98%), and transposon based (2.70±.75%), 4 to 5 days after UTMD compared with untreated FIX (-/-) control mice (0.92±0.78%) (P=0.001 and P=0.012, respectively). Reduced clotting times persisted for both plasmids 12 days after treatment (reflecting percentage FIX activity of 3.12±1.56%, P=0.02 and 3.08±0.10%, P=0.001, respectively). Clotting times from an additional set of mice treated with pmGENIE3-hFIX were evaluated for long-term effects and demonstrated a persistent reduction in average clotting time 160 days after a single treatment. These data suggest that UTMD could be a minimally invasive, nonviral approach to enhance hepatic FIX expression in patients with hemophilia.

Cloning of a Recombinant Plasmid Encoding Thiol-Specific Antioxidant Antigen (TSA) Gene of Leishmania majorand Expression in the Chinese Hamster Ovary Cell Line.

PubMed

Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi

2012-01-01

TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.

DNASU plasmid and PSI:Biology-Materials repositories: resources to accelerate biological research

PubMed Central

Seiler, Catherine Y.; Park, Jin G.; Sharma, Amit; Hunter, Preston; Surapaneni, Padmini; Sedillo, Casey; Field, James; Algar, Rhys; Price, Andrea; Steel, Jason; Throop, Andrea; Fiacco, Michael; LaBaer, Joshua

2014-01-01

The mission of the DNASU Plasmid Repository is to accelerate research by providing high-quality, annotated plasmid samples and online plasmid resources to the research community through the curated DNASU database, website and repository (http://dnasu.asu.edu or http://dnasu.org). The collection includes plasmids from grant-funded, high-throughput cloning projects performed in our laboratory, plasmids from external researchers, and large collections from consortia such as the ORFeome Collaboration and the NIGMS-funded Protein Structure Initiative: Biology (PSI:Biology). Through DNASU, researchers can search for and access detailed information about each plasmid such as the full length gene insert sequence, vector information, associated publications, and links to external resources that provide additional protein annotations and experimental protocols. Plasmids can be requested directly through the DNASU website. DNASU and the PSI:Biology-Materials Repositories were previously described in the 2010 NAR Database Issue (Cormier, C.Y., Mohr, S.E., Zuo, D., Hu, Y., Rolfs, A., Kramer, J., Taycher, E., Kelley, F., Fiacco, M., Turnbull, G. et al. (2010) Protein Structure Initiative Material Repository: an open shared public resource of structural genomics plasmids for the biological community. Nucleic Acids Res., 38, D743–D749.). In this update we will describe the plasmid collection and highlight the new features in the website redesign, including new browse/search options, plasmid annotations and a dynamic vector mapping feature that was developed in collaboration with LabGenius. Overall, these plasmid resources continue to enable research with the goal of elucidating the role of proteins in both normal biological processes and disease. PMID:24225319

Hybrid Adeno-Associated Viral Vectors Utilizing Transposase-Mediated Somatic Integration for Stable Transgene Expression in Human Cells

PubMed Central

Zhang, Wenli; Solanki, Manish; Müther, Nadine; Ebel, Melanie; Wang, Jichang; Sun, Chuanbo; Izsvak, Zsuzsanna; Ehrhardt, Anja

2013-01-01

Recombinant adeno-associated viral (AAV) vectors have been shown to be one of the most promising vectors for therapeutic gene delivery because they can induce efficient and long-term transduction in non-dividing cells with negligible side-effects. However, as AAV vectors mostly remain episomal, vector genomes and transgene expression are lost in dividing cells. Therefore, to stably transduce cells, we developed a novel AAV/transposase hybrid-vector. To facilitate SB-mediated transposition from the rAAV genome, we established a system in which one AAV vector contains the transposon with the gene of interest and the second vector delivers the hyperactive Sleeping Beauty (SB) transposase SB100X. Human cells were infected with the AAV-transposon vector and the transposase was provided in trans either by transient and stable plasmid transfection or by AAV vector transduction. We found that groups which received the hyperactive transposase SB100X showed significantly increased colony forming numbers indicating enhanced integration efficiencies. Furthermore, we found that transgene copy numbers in transduced cells were dose-dependent and that predominantly SB transposase-mediated transposition contributed to stabilization of the transgene. Based on a plasmid rescue strategy and a linear-amplification mediated PCR (LAM-PCR) protocol we analysed the SB100X-mediated integration profile after transposition from the AAV vector. A total of 1840 integration events were identified which revealed a close to random integration profile. In summary, we show for the first time that AAV vectors can serve as template for SB transposase mediated somatic integration. We developed the first prototype of this hybrid-vector system which with further improvements may be explored for treatment of diseases which originate from rapidly dividing cells. PMID:24116154

Transformation of Schwanniomyces occidentalis with an ADE2 gene cloned from S. occidentalis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klein, R.D.; Favreau, M.A.

1988-12-01

We have developed an efficient transformation system for the industrial yeast Schwanniomyces occidentalis (formerly Schwanniomyces castellii). The transformation system is based on ade2 mutants of S. occidentalis deficient for phosphoribosylaminoimidazole carboxylase that were generated by mutagenesis. As a selectable marker, we isolated and characterized the S. occidentalis ADE2 gene by complementation in an ade2 strain of Saccharomyces cerevisiae. S. occidentalis was transformed with the recombinant plasmid pADE, consisting of a 4.5-kilobase-pair (kbp) DNA fragment from S. occidentalis containing the ADE2 gene inserted into the S. cerevisiae expression vector pYcDE8 by a modification of the spheroplasting procedure of Beggs. Intact plasmidsmore » were recovered in Escherichia coli from whole-cell lysates of ADE+ transformants, indicating that plasmids were replicating autonomously. High-molecular-mass species of pADE2 were found by Southern hybridization analysis of intact genomic DNA preparations. The shift to higher molecular mass of these plasmids during electrophoresis in the presence ethidium bromide after exposure to shortwave UV suggests that they exist in a supercoiled form in the transformed host. Subclones of the 4.5-kbp insert indicated that ADE2-complementing activity and sequences conferring autonomous replication in S. occidentalis were located within a 2.7-kbp EcoRI-SphI fragment. Plasmids containing this region cloned into the bacterial vector pUC19 complemented ade2 mutants of S. occidentalis with efficiencies identical to those of the original plasmid pADE.« less

pYEMF, a pUC18-derived XcmI T-vector for efficient cloning of PCR products.

PubMed

Gu, Jingsong; Ye, Chunjiang

2011-03-01

A 1330-bp DNA sequence with two XcmI cassettes was inserted into pUC18 to construct an efficient XcmI T-vector parent plasmid, pYEMF. The large size of the inserted DNA fragment improved T-vector cleavage efficiency, and guaranteed good separation of the molecular components after restriction digestion. The pYEMF-T-vector generated from parent plasmid pYEMF permits blue/white colony screening; cloning efficiency analysis showed that most white colonies (>75%) were putative transformants which carried the cloning product. The sequence analysis and design approach presented here will facilitate applications in the fields of molecular biology and genetic engineering.

Practical utilization of recombinant AAV vector reference standards: focus on vector genomes titration by free ITR qPCR.

PubMed

D'Costa, Susan; Blouin, Veronique; Broucque, Frederic; Penaud-Budloo, Magalie; François, Achille; Perez, Irene C; Le Bec, Christine; Moullier, Philippe; Snyder, Richard O; Ayuso, Eduard

2016-01-01

Clinical trials using recombinant adeno-associated virus (rAAV) vectors have demonstrated efficacy and a good safety profile. Although the field is advancing quickly, vector analytics and harmonization of dosage units are still a limitation for commercialization. AAV reference standard materials (RSMs) can help ensure product safety by controlling the consistency of assays used to characterize rAAV stocks. The most widely utilized unit of vector dosing is based on the encapsidated vector genome. Quantitative polymerase chain reaction (qPCR) is now the most common method to titer vector genomes (vg); however, significant inter- and intralaboratory variations have been documented using this technique. Here, RSMs and rAAV stocks were titered on the basis of an inverted terminal repeats (ITRs) sequence-specific qPCR and we found an artificial increase in vg titers using a widely utilized approach. The PCR error was introduced by using single-cut linearized plasmid as the standard curve. This bias was eliminated using plasmid standards linearized just outside the ITR region on each end to facilitate the melting of the palindromic ITR sequences during PCR. This new "Free-ITR" qPCR delivers vg titers that are consistent with titers obtained with transgene-specific qPCR and could be used to normalize in-house product-specific AAV vector standards and controls to the rAAV RSMs. The free-ITR method, including well-characterized controls, will help to calibrate doses to compare preclinical and clinical data in the field.

Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.

PubMed

Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W

2010-08-01

The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

Survey of Navy Funded Marine Mammal Research and Studies FY 00-01

DTIC Science & Technology

2001-05-10

protein of canine distemper virus as a reporter system in order to evaluate 103 the humoral response to DNA-mediated vaccination in cetaceans. If...PCR/ RT PCR, DNA cloning and sequencing, etc. Efforts are ongoing to design and clone a vector encoding Canine Distemper Virus, a virus closely...alternative plasmid as our reporter gene delivery vector. This alternate plasmid will encode for Canine Distemper virus genes, closely related to

Rapid modification of the pET-28 expression vector for ligation independent cloning using homologous recombination in Saccharomyces cerevisiae

PubMed Central

Gay, Glen; Wagner, Drew T.; Keatinge-Clay, Adrian T.; Gay, Darren C.

2014-01-01

The ability to rapidly customize an expression vector of choice is a valuable tool for any researcher involved in high-throughput molecular cloning for protein overexpression. Unfortunately, it is common practice to amend or neglect protein targets if the gene that encodes the protein of interest is incompatible with the multiple-cloning region of a preferred expression vector. To address this issue, a method was developed to quickly exchange the multiple-cloning region of the popular expression plasmid pET-28 with a ligation-independent cloning cassette, generating pGAY-28. This cassette contains dual inverted restriction sites that reduce false positive clones by generating a linearized plasmid incapable of self-annealing after a single restriction-enzyme digest. We also establish that progressively cooling the vector and insert leads to a significant increase in ligation-independent transformation efficiency, demonstrated by the incorporation of a 10.3 kb insert into the vector. The method reported to accomplish plasmid reconstruction is uniquely versatile yet simple, relying on the strategic placement of primers combined with homologous recombination of PCR products in yeast. PMID:25304917

Adeno-associated virus vectors can be efficiently produced without helper virus.

PubMed

Matsushita, T; Elliger, S; Elliger, C; Podsakoff, G; Villarreal, L; Kurtzman, G J; Iwaki, Y; Colosi, P

1998-07-01

The purpose of this work was to develop an efficient method for the production of adeno-associated virus (AAV) vectors in the absence of helper virus. The adenovirus regions that mediate AAV vector replication were identified and assembled into a helper plasmid. These included the VA, E2A and E4 regions. When this helper plasmid was cotransfected into 293 cells, along with plasmids encoding the AAV vector, and rep and cap genes, AAV vector was produced as efficiently as when using adenovirus infection as a source of help. CMV-driven constructs expressing the E4orf6 and the 72-M(r), E2A proteins were able to functionally replace the E4 and E2A regions, respectively. Therefore the minimum set of genes required to produce AAV helper activity equivalent to that provided by adenovirus infection consists of, or is a subset of, the following genes: the E4orf6 gene, the 72-M(r), E2A protein gene, the VA RNA genes and the E1 region. AAV vector preparations made with adenovirus and by the helper virus-free method were essentially indistinguishable with respect to particle density, particle to infectivity ratio, capsimer ratio and efficiency of muscle transduction in vivo. Only AAV vector preparations made by the helper virus-free method were not reactive with anti-adenovirus sera.

Orpheus recombination : a comprehensive bacteriophage system for murine targeting vector construction by transplacement.

PubMed

Woltjen, Knut; Ito, Kenichi; Tsuzuki, Teruhisa; Rancourt, Derrick E

2008-01-01

In recent years, methods to address the simplification of targeting vector (TV) construction have been developed and validated. Based on in vivo recombination in Escherichia coli, these protocols have reduced dependence on restriction endonucleases, allowing the fabrication of complex TV constructs with relative ease. Using a methodology based on phage-plasmid recombination, we have developed a comprehensive TV construction protocol dubbed Orpheus recombination (ORE). The ORE system addresses all necessary requirements for TV construction; from the isolation of genespecific regions of homology to the deposition of selection/disruption cassettes. ORE makes use of a small recombination plasmid, which bears positive and negative selection markers and a cloned homologous "probe" region. This probe plasmid may be introduced into and excised from phage-borne murine genomic clones by two rounds of single crossover recombination. In this way, desired clones can be specifically isolated from a heterogeneous library of phage. Furthermore, if the probe region contains a designed mutation, it may be deposited seamlessly into the genomic clone. The complete removal of operational sequences allows unlimited repetition of the procedure to customize and finalize TVs within a few weeks. Successful gene-specific clone isolation, point mutations, large deletions, cassette insertions, and finally coincident clone isolation and mutagenesis have all been demonstrated with this method.

Deletions at short direct repeats and base substitutions are characteristic mutations for bleomycin-induced double- and single-strand breaks, respectively, in a human shuttle vector system

NASA Technical Reports Server (NTRS)

Dar, M. E.; Jorgensen, T. J.

1995-01-01

Using the radiomimetic drug, bleomycin, we have determined the mutagenic potential of DNA strand breaks in the shuttle vector pZ189 in human fibroblasts. The bleomycin treatment conditions used produce strand breaks with 3'-phosphoglycolate termini as > 95% of the detectable dose-dependent lesions. Breaks with this end group represent 50% of the strand break damage produced by ionizing radiation. We report that such strand breaks are mutagenic lesions. The type of mutation produced is largely determined by the type of strand break on the plasmid (i.e. single versus double). Mutagenesis studies with purified DNA forms showed that nicked plasmids (i.e. those containing single-strand breaks) predominantly produce base substitutions, the majority of which are multiples, which presumably originate from error-prone polymerase activity at strand break sites. In contrast, repair of linear plasmids (i.e. those containing double-strand breaks) mainly results in deletions at short direct repeat sequences, indicating the involvement of illegitimate recombination. The data characterize the nature of mutations produced by single- and double-strand breaks in human cells, and suggests that deletions at direct repeats may be a 'signature' mutation for the processing of DNA double-strand breaks.

Dextran and protamine-based solid lipid nanoparticles as potential vectors for the treatment of X-linked juvenile retinoschisis.

PubMed

Delgado, Diego; del Pozo-Rodríguez, Ana; Solinís, Maria Ángeles; Avilés-Triqueros, Marcelino; Weber, Bernhard H F; Fernández, Eduardo; Gascón, Alicia R

2012-04-01

The goal of the present study was to analyze the potential application of nonviral vectors based on solid lipid nanoparticles (SLN) for the treatment of ocular diseases by gene therapy, specifically X-linked juvenile retinoschisis (XLRS). Vectors were prepared with SLN, dextran, protamine, and a plasmid (pCMS-EGFP or pCEP4-RS1). Formulations were characterized and the in vitro transfection capacity as well as the cellular uptake and the intracellular trafficking were studied in ARPE-19 cells. Formulations were also tested in vivo in Wistar rat eyes, and the efficacy was studied by monitoring the expression of enhanced green fluorescent protein (EGFP) after intravitreal, subretinal, and topical administration. The presence of dextran and protamine in the SLN improved greatly the expression of retinoschisin and EGFP in ARPE-19 cells. The nuclear localization signals of protamine, its ability to protect the DNA, and a shift in the entry mechanism from caveola-mediated to clathrin-mediated endocytosis promoted by the dextran, justify the increase in transfection. After ocular administration of the dextran-protamine-DNA-SLN complex to rat eyes, we detected the expression of EGFP in various types of cells depending on the administration route. Our vectors were also able to transfect corneal cells after topical application. We have demonstrated the potential usefulness of our nonviral vectors loaded with XLRS1 plasmid and provided evidence for their potential application for the management or treatment of degenerative retinal disorders as well as ocular surface diseases.

Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.

PubMed

Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei

2015-08-01

DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

Isolation and characterization of novel mutations in the pSC101 origin that increase copy number

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thompson, Mitchell G.; Sedaghatian, Nima; Barajas, Jesus F.

pSC101 is a narrow host range, low-copy plasmid commonly used for genetically manipulating Escherichia coli. As a byproduct of a genetic screen for a more sensitive lactam biosensor, we identified multiple novel mutations that increase the copy number of plasmids with the pSC101 origin. All mutations identified in this study occurred on plasmids which also contained at least one mutation localized to the RepA protein encoded within the origin. Homology modelling predicts that many of these mutations occur within the dimerization interface of RepA. Mutant RepA resulted in plasmid copy numbers between ~31 and ~113 copies/cell, relative to ~5 copies/cellmore » in wild-type pSC101 plasmids. Combining the mutations that were predicted to disrupt multiple contacts on the dimerization interface resulted in copy numbers of ~500 copies/cell, while also attenuating growth in host strains. Fluorescent protein production expressed from an arabinose-inducible promoter on mutant origin derived plasmids did correlate with copy number. Plasmids harboring RepA with one of two mutations, E83K and N99D, resulted in fluorescent protein production similar to that from p15a- (~20 copies/cell) and ColE1- (~31 copies/cell) based plasmids, respectively. The mutant copy number variants retained compatibility with p15a, pBBR, and ColE1 origins of replication. Thus, these pSC101 variants may be useful in future metabolic engineering efforts that require medium or high-copy vectors compatible with p15a- and ColE1-based plasmids.« less

Isolation and characterization of novel mutations in the pSC101 origin that increase copy number

DOE PAGES

Thompson, Mitchell G.; Sedaghatian, Nima; Barajas, Jesus F.; ...

2018-01-25

pSC101 is a narrow host range, low-copy plasmid commonly used for genetically manipulating Escherichia coli. As a byproduct of a genetic screen for a more sensitive lactam biosensor, we identified multiple novel mutations that increase the copy number of plasmids with the pSC101 origin. All mutations identified in this study occurred on plasmids which also contained at least one mutation localized to the RepA protein encoded within the origin. Homology modelling predicts that many of these mutations occur within the dimerization interface of RepA. Mutant RepA resulted in plasmid copy numbers between ~31 and ~113 copies/cell, relative to ~5 copies/cellmore » in wild-type pSC101 plasmids. Combining the mutations that were predicted to disrupt multiple contacts on the dimerization interface resulted in copy numbers of ~500 copies/cell, while also attenuating growth in host strains. Fluorescent protein production expressed from an arabinose-inducible promoter on mutant origin derived plasmids did correlate with copy number. Plasmids harboring RepA with one of two mutations, E83K and N99D, resulted in fluorescent protein production similar to that from p15a- (~20 copies/cell) and ColE1- (~31 copies/cell) based plasmids, respectively. The mutant copy number variants retained compatibility with p15a, pBBR, and ColE1 origins of replication. Thus, these pSC101 variants may be useful in future metabolic engineering efforts that require medium or high-copy vectors compatible with p15a- and ColE1-based plasmids.« less

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Plasmid-encoded hygromycin B resistance: the sequence of hygromycin B phosphotransferase gene and its expression in Escherichia coli and Saccharomyces cerevisiae.

PubMed

Gritz, L; Davies, J

1983-11-01

The plasmid-borne gene hph coding for hygromycin B phosphotransferase (HPH) in Escherichia coli has been identified and its nucleotide sequence determined. The hph gene is 1026 nucleotides long, coding for a protein with a predicted Mr of 39 000. The hph gene was placed in a shuttle plasmid vector, downstream from the promoter region of the cyc 1 gene of Saccharomyces cerevisiae, and an hph construction containing a single AUG in the 5' noncoding region allowed direct selection following transformation in yeast and in E. coli. Thus the hph gene can be used in cloning vectors for both pro- and eukaryotes.

A series of vectors to construct lacZ fusions for the study of gene expression in Schizosaccharomyces pombe.

PubMed

Lafuente, M J; Petit, T; Gancedo, C

1997-12-22

We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.

Construction and Characterization of an in-vivo Linear Covalently Closed DNA Vector Production System

PubMed Central

2012-01-01

Background While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. Results We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called “Super Sequence”, and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc—linear covalently closed (Tel/TelN-cell), or mini ccc—circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 105 fold lower viability than that seen with the ccc counterpart. Conclusion We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of “minicircle” DNA vectors and virtually eliminate the potential for undesirable vector integration events. PMID:23216697

Construction and characterization of an in-vivo linear covalently closed DNA vector production system.

PubMed

Nafissi, Nafiseh; Slavcev, Roderick

2012-12-06

While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called "Super Sequence", and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc--linear covalently closed (Tel/TelN-cell), or mini ccc--circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 10(5) fold lower viability than that seen with the ccc counterpart. We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of "minicircle" DNA vectors and virtually eliminate the potential for undesirable vector integration events.

Mitochondrial Gene Therapy: Advances in Mitochondrial Gene Cloning, Plasmid Production, and Nanosystems Targeted to Mitochondria.

PubMed

Coutinho, Eduarda; Batista, Cátia; Sousa, Fani; Queiroz, João; Costa, Diana

2017-03-06

Mitochondrial gene therapy seems to be a valuable and promising strategy to treat mitochondrial disorders. The use of a therapeutic vector based on mitochondrial DNA, along with its affinity to the site of mitochondria, can be considered a powerful tool in the reestablishment of normal mitochondrial function. In line with this and for the first time, we successfully cloned the mitochondrial gene ND1 that was stably maintained in multicopy pCAG-GFP plasmid, which is used to transform E. coli. This mitochondrial-gene-based plasmid was encapsulated into nanoparticles. Furthermore, the functionalization of nanoparticles with polymers, such as cellulose or gelatin, enhances their overall properties and performance for gene therapy. The fluorescence arising from rhodamine nanoparticles in mitochondria and a fluorescence microscopy study show pCAG-GFP-ND1-based nanoparticles' cell internalization and mitochondria targeting. The quantification of GFP expression strongly supports this finding. This work highlights the viability of gene therapy based on mitochondrial DNA instigating further in vitro research and clinical translation.

Broad-host-range plasmids for red fluorescent protein labeling of gram-negative bacteria for use in the zebrafish model system.

PubMed

Singer, John T; Phennicie, Ryan T; Sullivan, Matthew J; Porter, Laura A; Shaffer, Valerie J; Kim, Carol H

2010-06-01

To observe real-time interactions between green fluorescent protein-labeled immune cells and invading bacteria in the zebrafish (Danio rerio), a series of plasmids was constructed for the red fluorescent protein (RFP) labeling of a variety of fish and human pathogens. The aim of this study was to create a collection of plasmids that would express RFP pigments both constitutively and under tac promoter regulation and that would be nontoxic and broadly transmissible to a variety of Gram-negative bacteria. DNA fragments encoding the RFP dimeric (d), monomeric (m), and tandem dimeric (td) derivatives d-Tomato, td-Tomato, m-Orange, and m-Cherry were cloned into the IncQ-based vector pMMB66EH in Escherichia coli. Plasmids were mobilized into recipient strains by conjugal mating. Pigment production was inducible in Escherichia coli, Pseudomonas aeruginosa, Edwardsiella tarda, and Vibrio (Listonella) anguillarum strains by isopropyl-beta-d-thiogalactopyranoside (IPTG) treatment. A spontaneous mutant exconjugant of P. aeruginosa PA14 was isolated that expressed td-Tomato constitutively. Complementation analysis revealed that the constitutive phenotype likely was due to a mutation in lacI(q) carried on pMMB66EH. DNA sequence analysis confirmed the presence of five transitions, four transversions, and a 2-bp addition within a 14-bp region of lacI. Vector DNA was purified from this constitutive mutant, and structural DNA sequences for RFP pigments were cloned into the constitutive vector. Exconjugants of P. aeruginosa, E. tarda, and V. anguillarum expressed all pigments in an IPTG-independent fashion. Results from zebrafish infectivity studies indicate that RFP-labeled pathogens will be useful for the study of real-time interactions between host cells of the innate immune system and the infecting pathogen.

[Experimental study of human umbilical cord blood derived stromal cells transfected with recombinant adenoviral vector co-expressing VCAM-1 and GFP].

PubMed

Zhang, Xi; Si, Ying-Jian; Chen, Xing-Hua; Liu, Yao; Gao, Li; Gao, Lei; Peng, Xian-Gui; Wang, Qing-Yu

2008-06-01

This study was aimed to investigate the effect of vcam-1 gene-modified human umbilical cord blood derived stromal cells (CBDSCs) on hematopoietic regulation so as to establish the experimental foundation for further study. The target gene vcam-1 was cloned into the shuttle plasmid with the report gene GFP. The recombinant shuttle plasmid was transformed into BJ5183 bacteria to recombine with backbone vector pAdeasy-l, and the recombinant adenoviral vector ad-vcam-1-gfp was confirmed after transfection with CBDSCs. The results indicated that two fragments of about 9 kb and 2 kb were obtained after digestion of recombinant plasmid pAdTrack-vcam-1 with NotIand XhoI, and single fragment of 600 bp was obtained after amplification with PCR; two fragments of about 31 kb and 4 kb were obtained after digestion of recombinant plasmid pad-vcam-1-gfp with PacI, which suggested a successful homologous recombination. The expression of vcam-1 gene in ad-vcam-1-gfp transfected CBDSCs could be detected by immunocytochemistry, RT-PCR and fluorescent microscopy. It is concluded that the recombinant adenoviral vector ad-vcam-1-gfp has been constructed successfully, and the expression of vcam-1 is up-regulated in CBDSCs transfected by gene ad-vcam-1-gfp.

The evolution of heart gene delivery vectors.

PubMed

Wasala, Nalinda B; Shin, Jin-Hong; Duan, Dongsheng

2011-10-01

Gene therapy holds promise for treating numerous heart diseases. A key premise for the success of cardiac gene therapy is the development of powerful gene transfer vehicles that can achieve highly efficient and persistent gene transfer specifically in the heart. Other features of an ideal vector include negligible toxicity, minimal immunogenicity and easy manufacturing. Rapid progress in the fields of molecular biology and virology has offered great opportunities to engineer various genetic materials for heart gene delivery. Several nonviral vectors (e.g. naked plasmids, plasmid lipid/polymer complexes and oligonucleotides) have been tested. Commonly used viral vectors include lentivirus, adenovirus and adeno-associated virus. Among these, adeno-associated virus has shown many attractive features for pre-clinical experimentation in animal models of heart diseases. We review the history and evolution of these vectors for heart gene transfer. Copyright © 2011 John Wiley & Sons, Ltd.

The evolution of heart gene delivery vectors

PubMed Central

Wasala, Nalinda B.; Shin, Jin-Hong; Duan, Dongsheng

2012-01-01

Gene therapy holds promise for treating numerous heart diseases. A key premise for the success of cardiac gene therapy is the development of powerful gene transfer vehicles that can achieve highly efficient and persistent gene transfer specifically in the heart. Other features of an ideal vector include negligible toxicity, minimal immunogenicity and easy manufacturing. Rapid progress in the fields of molecular biology and virology has offered great opportunities to engineer various genetic materials for heart gene delivery. Several nonviral vectors (e.g. naked plasmids, plasmid lipid/polymer complexes and oligonucleotides) have been tested. Commonly used viral vectors include lentivirus, adenovirus and adeno-associated virus. Among these, adeno-associated virus has shown many attractive features for pre-clinical experimentation in animal models of heart diseases. We review the history and evolution of these vectors for heart gene transfer. PMID:21837689

Characterization of a Theta-Type Plasmid from Lactobacillus sakei: a Potential Basis for Low-Copy-Number Vectors in Lactobacilli

PubMed Central

Alpert, Carl-Alfred; Crutz-Le Coq, Anne-Marie; Malleret, Christine; Zagorec, Monique

2003-01-01

The complete nucleotide sequence of the 13-kb plasmid pRV500, isolated from Lactobacillus sakei RV332, was determined. Sequence analysis enabled the identification of genes coding for a putative type I restriction-modification system, two genes coding for putative recombinases of the integrase family, and a region likely involved in replication. The structural features of this region, comprising a putative ori segment containing 11- and 22-bp repeats and a repA gene coding for a putative initiator protein, indicated that pRV500 belongs to the pUCL287 subfamily of theta-type replicons. A 3.7-kb fragment encompassing this region was fused to an Escherichia coli replicon to produce the shuttle vector pRV566 and was observed to be functional in L. sakei for plasmid replication. The L. sakei replicon alone could not support replication in E. coli. Plasmid pRV500 and its derivative pRV566 were determined to be at very low copy numbers in L. sakei. pRV566 was maintained at a reasonable rate over 20 generations in several lactobacilli, such as Lactobacillus curvatus, Lactobacillus casei, and Lactobacillus plantarum, in addition to L. sakei, making it an interesting basis for developing vectors. Sequence relationships with other plasmids are described and discussed. PMID:12957947

Construction of pTM series plasmids for gene expression in Brucella species.

PubMed

Tian, Mingxing; Qu, Jing; Bao, Yanqing; Gao, Jianpeng; Liu, Jiameng; Wang, Shaohui; Sun, Yingjie; Ding, Chan; Yu, Shengqing

2016-04-01

Brucellosis, the most common widespread zoonotic disease, is caused by Brucella spp., which are facultative, intracellular, Gram-negative bacteria. With the development of molecular biology techniques, more and more virulence-associated factors have been identified in Brucella spp. A suitable plasmid system is an important tool to study virulence genes in Brucella. In this study, we constructed three constitutive replication plasmids (pTM1-Cm, pTM2-Amp, and pTM3-Km) using the replication origin (rep) region derived from the pBBR1-MCS vector. Also, a DNA fragment containing multiple cloning sites (MCSs) and a terminator sequence derived from the pCold vector were produced for complementation of the deleted genes. Besides pGH-6×His, a plasmid containing the groE promoter of Brucella spp. was constructed to express exogenous proteins in Brucella with high efficiency. Furthermore, we constructed the inducible expression plasmid pZT-6×His, containing the tetracycline-inducible promoter pzt1, which can induce expression by the addition of tetracycline in the Brucella culture medium. The constructed pTM series plasmids will play an important role in the functional investigation of Brucella spp. Copyright © 2016 Elsevier B.V. All rights reserved.

In vitro expression of erythropoietin by transfected human mesenchymal stromal cells.

PubMed

Mok, P-L; Cheong, S-K; Leong, C-F; Othman, A

2008-01-01

Mesenchymal stromal cells (MSC) are pluripotent progenitor cells that can be found in human bone marrow (BM). These cells have low immunogenicity and could suppress alloreactive T-cell responses. In the current study, MSC were tested for their capacity to carry and deliver the erythropoietin (EPO) gene in vitro. Expanded BM MSC was transfected with EPO-encoded plasmid pMCV1.2 and EPO-encoded MIDGE (minimalistic immunologically defined gene expression) vector by electroporation. The expressed EPO was used to induce hematopoietic stem cells (HSC) into erythroid colonies. The results showed that the MIDGE vector was more effective and stable than the plasmid (pMCV1.2) in delivering EPO gene into MSC. The supernatants containing EPO obtained from the transfected cell culture were able to induce the differentiation of HSC into erythroid colonies. MSC hold promise as a cell factory for the production of biologic molecules, and MIDGE vector is more effective and stable than the plasmid in nucleofection involving the EPO gene.

Abnormal ultraviolet mutagenic spectrum in plasmid DNA replicated in cultured fibroblasts from a patient with the skin cancer-prone disease, xeroderma pigmentosum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seetharam, S.; Protic-Sabljic, M.; Seidman, M.M.

1987-12-01

A shuttle vector plasmid, pZ189, was utilized to assess the types of mutations that cells from a patient with xeroderma pigmentosum, complementation group D, introduce into ultraviolet (UV) damaged, replicating DNA. Patients with xeroderma pigmentosum have clinical and cellular UV hypersensitivity, increased frequency of sun-induced skin cancer, and deficient DNA repair. In comparison to UV-treated pZ189 replicated in DNA repair-proficient cells, there were fewer surviving plasmids, a higher frequency of plasmids with mutations, fewer plasmids with two or more mutations in the marker gene, and a new mutagenic hotspot. The major type of base substitution mutation was the G:C tomore » A:T transition with both cell lines. These results, together with similar findings published earlier with cells from a xeroderma pigmentosum patient in complementation group A, suggest that isolated G:C to A:T somatic mutations may be particularly important in generation of human skin cancer by UV radiation.« less

Molecular cloning and production of caprine recombinant Oct4 protein for generation induced pluripotent stem cells.

PubMed

Singhal, Dinesh K; Singhal, Raxita; Malik, Hruda N; Singh, Surender; Kumar, Sudarshan; Kaushik, Jai K; Mohanty, Ashok K; Malakar, Dhruba

2015-12-01

Oct4, pluripotency marker and transcription factor, expresses in embryonic stem cells. It plays a pivotal role in determination of stem cells fate. Up and down regulation of Oct4 causes differentiation of embryonic stem cells. It is one of the main transcription factors which remained concerned in every study related to induced pluripotent stem cell. Here, we report the production of goat Oct4 protein using plasmid and lentiviral based vectors. Firstly, Oct4 ORF was cloned in pAcGFP1-N1 plasmid vector and positive clones were screened with colony PCR. Oct4 was over-expressed in CHO-K1 cell line and expression was confirmed by observing green florescent protein expression in CHO-K1 cells. Secondly, Oct4 lentiviral expression construct has been prepared using pLenti-gw vector. Oct4 ORF was cloned into pLenti4/V5-DEST vector and viral particles were produced in 293FT cells. Oct4 viral particles were used to infect goat fibroblast cells. Oct4 expression was observed and confirmed in transfected goat fibroblast cells using RT-PCR. Detection of Oct4 protein in western blotting assay affirmed the capacity of over-expression of our Oct4 lentiviral vector. The lentiviral expression construct and recombinant Oct4 protein may be used for reprogramming of somatic cell into induced pluripotent stem cell.

Efficient and sustained IGF-1 expression in the adipose tissue-derived stem cells mediated via a lentiviral vector.

PubMed

Chen, Ting; Huang, Dangsheng; Chen, Guanghui; Yang, Tingshu; Yi, Jun; Tian, Miao

2015-02-01

The adipose tissue-derived stem cells (ADSCs) represent a significant area of the cell therapy. Genetic modification of ADSCs may further improve their therapeutic potential. Here, we aimed to generate a lentiviral vector expressing insulin-like growth factor-I (IGF-1) and investigate the impact of IGF-1 transduction on the properties of cultured ADSCs. Isolated rat ADSCs were assessed by flow cytometric analysis. IGF-1 was cloned and inserted into the pLenO-DCE plasmid to acquire pLenO-DCE-IGF-1 plasmid. Lentivirus was enveloped with pRsv-REV, pMDlg-pRRE and pMD2G plasmids in 293T cells. The ADSCs were transfected with the vectors. And then IGF-1-induced anti-apoptosis was evaluated by annexin V-FITC. Besides, proliferation of cells was detected by MTT assay and EdU. Moreover, Akt phosphorylation was evaluated by Western blotting analysis. Stable expression of IGF-1 in ADSCs was confirmed. ADSCs were positive for CD90 and CD29, but negative for CD31, CD34 and CD45. The transduction of IGF-1 to the ADSCs caused a dramatic increase in P-Akt expression. Over-expression of IGF-1 in ADSCs could improve the paracine of IGF-1 in a time-dependent manner, but could not promote the proliferation of ADSCs. This study indicated that lentiviral vectors offered a promising mean of delivering IGF-1 to the ADSCs. Lentiviral-mediated over-expression of therapeutic IGF-1 gene in ADSCs could prolong the anti-apoptosis effect of IGF-1, which might be induced by the activation of the PI3K/Akt pathway. And our data would improve the efficacy of ADSC-based therapies.

A cell engineering strategy to enhance supercoiled plasmid DNA production for gene therapy.

PubMed

Hassan, Sally; Keshavarz-Moore, Eli; Ward, John

2016-09-01

With the recent revival of the promise of plasmid DNA vectors in gene therapy, a novel synthetic biology approach was used to enhance the quantity, (yield), and quality of the plasmid DNA. Quality was measured by percentage supercoiling and supercoiling density, as well as improving segregational stability in fermentation. We examined the hypothesis that adding a Strong Gyrase binding Site (SGS) would increase DNA gyrase-mediated plasmid supercoiling. SGS from three different replicons, (the Mu bacteriophage and two plasmids, pSC101 and pBR322) were inserted into the plasmid, pUC57. Different sizes of these variants were transformed into E. coli DH5α, and their supercoiling properties and segregational stability measured. A 36% increase in supercoiling density was found in pUC57-SGS, but only when SGS was derived from the Mu phage and was the larger sized version of this fragment. These results were also confirmed at fermentation scale. Total percentage supercoiled monomer was maintained to 85-90%. A twofold increase in plasmid yield was also observed for pUC57-SGS in comparison to pUC57. pUC57-SGS displayed greater segregational stability than pUC57-cer and pUC57, demonstrating a further potential advantage of the SGS site. These findings should augment the potential of plasmid DNA vectors in plasmid DNA manufacture. Biotechnol. Bioeng. 2016;113: 2064-2071. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc.

Bacteriophage-based vectors for site-specific insertion of DNA in the chromosome of Corynebacteria.

PubMed

Oram, Mark; Woolston, Joelle E; Jacobson, Andrew D; Holmes, Randall K; Oram, Diana M

2007-04-15

In Corynebacterium diphtheriae, diphtheria toxin is encoded by the tox gene of some temperate corynephages such as beta. beta-like corynephages are capable of inserting into the C. diphtheriae chromosome at two specific sites, attB1 and attB2. Transcription of the phage-encoded tox gene, and many chromosomally encoded genes, is regulated by the DtxR protein in response to Fe(2+) levels. Characterizing DtxR-dependent gene regulation is pivotal in understanding diphtheria pathogenesis and mechanisms of iron-dependent gene expression; although this has been hampered by a lack of molecular genetic tools in C. diphtheriae and related Coryneform species. To expand the systems for genetic manipulation of C. diphtheriae, we constructed plasmid vectors capable of integrating into the chromosome. These plasmids contain the beta-encoded attP site and the DIP0182 integrase gene of C. diphtheriae NCTC13129. When these vectors were delivered to the cytoplasm of non-lysogenic C. diphtheriae, they integrated into either the attB1 or attB2 sites with comparable frequency. Lysogens were also transformed with these vectors, by virtue of the second attB site. An integrated vector carrying an intact dtxR gene complemented the mutant phenotypes of a C. diphtheriae DeltadtxR strain. Additionally, strains of beta-susceptible C. ulcerans, and C. glutamicum, a species non-permissive for beta, were each transformed with these vectors. This work significantly extends the tools available for targeted transformation of both pathogenic and non-pathogenic Corynebacterium species.

Cloning-independent plasmid construction for genetic studies in streptococci

PubMed Central

Xie, Zhoujie; Qi, Fengxia; Merritt, Justin

2013-01-01

Shuttle plasmids are among the few routinely utilized tools in the Streptococcus mutans genetic system that still require the use of classical cloning methodologies and intermediate hosts for genetic manipulation. Accordingly, it typically requires considerably less time and effort to introduce mutations onto the S. mutans chromosome than it does to construct shuttle vectors for expressing genes in trans. Occasionally, shuttle vector constructs also exhibit toxicity in E. coli, which prevents their proper assembly. To circumvent these limitations, we modified a prolonged overlap extension PCR (POE-PCR) protocol to facilitate direct plasmid assembly in S. mutans. Using solely PCR, we created the reporter vector pZX7, which contains a single minimal streptococcal replication origin and harbors a spectinomycin resistance cassette and the gusA gene encoding β-glucuronidase. We compared the efficiency of pZX7 assembly using multiple strains of S. mutans and were able to obtain from 5×103 – 2×105 CFU/μg PCR product. Likewise, we used pZX7 to further demonstrate that Streptococcus sanguinis and Streptococcus gordonii are also excellent hosts for cloning-independent plasmid assembly, which suggests that this system is likely to function in numerous other streptococci. Consequently, it should be possible to completely forgo the use of E. coli – Streptococcus shuttle vectors in many streptococcal species, thereby decreasing the time and effort required to assemble constructs and eliminating any toxicity issues associated with intermediate hosts. PMID:23673081

Cloning-independent plasmid construction for genetic studies in streptococci.

PubMed

Xie, Zhoujie; Qi, Fengxia; Merritt, Justin

2013-08-01

Shuttle plasmids are among the few routinely utilized tools in the Streptococcus mutans genetic system that still require the use of classical cloning methodologies and intermediate hosts for genetic manipulation. Accordingly, it typically requires considerably less time and effort to introduce mutations onto the S. mutans chromosome than it does to construct shuttle vectors for expressing genes in trans. Occasionally, shuttle vector constructs also exhibit toxicity in Escherichia coli, which prevents their proper assembly. To circumvent these limitations, we modified a prolonged overlap extension PCR (POE-PCR) protocol to facilitate direct plasmid assembly in S. mutans. Using solely PCR, we created the reporter vector pZX7, which contains a single minimal streptococcal replication origin and harbors a spectinomycin resistance cassette and the gusA gene encoding β-glucuronidase. We compared the efficiency of pZX7 assembly using multiple strains of S. mutans and were able to obtain from 5 × 10³ to 2 × 10⁵ CFU/μg PCR product. Likewise, we used pZX7 to further demonstrate that Streptococcus sanguinis and Streptococcus gordonii are also excellent hosts for cloning-independent plasmid assembly, which suggests that this system is likely to function in numerous other streptococci. Consequently, it should be possible to completely forgo the use of E. coli-Streptococcus shuttle vectors in many streptococcal species, thereby decreasing the time and effort required to assemble constructs and eliminating any toxicity issues associated with intermediate hosts. Copyright © 2013 Elsevier B.V. All rights reserved.

Ultrashort laser pulse cell manipulation using nano- and micro- materials

NASA Astrophysics Data System (ADS)

Schomaker, Markus; Killian, Doreen; Willenbrock, Saskia; Diebold, Eric; Mazur, Eric; Bintig, Willem; Ngezahayo, Anaclet; Nolte, Ingo; Murua Escobar, Hugo; Junghanß, Christian; Lubatschowski, Holger; Heisterkamp, Alexander

2010-08-01

The delivery of extra cellular molecules into cells is essential for cell manipulation. For this purpose genetic materials (DNA/RNA) or proteins have to overcome the impermeable cell membrane. To increase the delivery efficiency and cell viability of common methods different nano- and micro material based approaches were applied. To manipulate the cells, the membrane is in contact with the biocompatible material. Due to a field enhancement of the laser light at the material and the resulting effect the cell membrane gets perforated and extracellular molecules can diffuse into the cytoplasm. Membrane impermeable dyes, fluorescent labelled siRNA, as well as plasmid vectors encoded for GFP expression were used as an indicator for successful perforation or transfection, respectively. Dependent on the used material, perforation efficiencies over 90 % with a cell viability of about 80 % can be achieved. Additionally, we observed similar efficiencies for siRNA transfection. Due to the larger molecule size and the essential transport of the DNA into the nucleus cells are more difficult to transfect with GFP plasmid vectors. Proof of principle experiments show promising and adequate efficiencies by applying micro materials for plasmid vector transfection. For all methods a weakly focused fs laser beam is used to enable a high manipulation throughput for adherent and suspension cells. Furthermore, with these alternative optical manipulation methods it is possible to perforate the membrane of sensitive cell types such as primary and stem cells with a high viability.

Efficient production of antibody Fab fragment by transient gene expression in insect cells.

PubMed

Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki

2017-08-01

Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

The Aspartate-Semialdehyde Dehydrogenase of Edwardsiella ictaluri and Its Use as Balanced-Lethal System in Fish Vaccinology

PubMed Central

Santander, Javier; Xin, Wei; Yang, Zhao; Curtiss, Roy

2010-01-01

asdA mutants of Gram-negative bacteria have an obligate requirement for diaminopimelic acid (DAP), which is an essential constituent of the peptidoglycan layer of the cell wall of these organisms. In environments deprived of DAP, i.e., animal tissues, they will undergo lysis. Deletion of the asdA gene has previously been exploited to develop antibiotic-sensitive strains of live attenuated recombinant bacterial vaccines. Introduction of an Asd+ plasmid into a ΔasdA mutant makes the bacterial strain plasmid-dependent. This dependence on the Asd+ plasmid vector creates a balanced-lethal complementation between the bacterial strain and the recombinant plasmid. E. ictaluri is an enteric Gram-negative fish pathogen that causes enteric septicemia in catfish. Because E. ictaluri is a nasal/oral invasive intracellular pathogen, this bacterium is a candidate to develop a bath/oral live recombinant attenuated Edwardsiella vaccine (RAEV) for the catfish aquaculture industry. As a first step to develop an antibiotic-sensitive RAEV strain, we characterized and deleted the E. ictaluri asdA gene. E. ictaluri ΔasdA01 mutants exhibit an absolute requirement for DAP to grow. The asdA gene of E. ictaluri was complemented by the asdA gene from Salmonella. Several Asd+ expression vectors with different origins of replication were transformed into E. ictaluri ΔasdA01. Asd+ vectors were compatible with the pEI1 and pEI2 E. ictaluri native plasmids. The balanced-lethal system was satisfactorily evaluated in vivo. Recombinant GFP, PspA, and LcrV proteins were synthesized by E. ictaluri ΔasdA01 harboring Asd+ plasmids. Here we constructed a balanced-lethal system, which is the first step to develop an antibiotic-sensitive RAEV for the aquaculture industry. PMID:21209920

The aspartate-semialdehyde dehydrogenase of Edwardsiella ictaluri and its use as balanced-lethal system in fish vaccinology.

PubMed

Santander, Javier; Xin, Wei; Yang, Zhao; Curtiss, Roy

2010-12-29

asdA mutants of gram-negative bacteria have an obligate requirement for diaminopimelic acid (DAP), which is an essential constituent of the peptidoglycan layer of the cell wall of these organisms. In environments deprived of DAP, i.e., animal tissues, they will undergo lysis. Deletion of the asdA gene has previously been exploited to develop antibiotic-sensitive strains of live attenuated recombinant bacterial vaccines. Introduction of an Asd(+) plasmid into a ΔasdA mutant makes the bacterial strain plasmid-dependent. This dependence on the Asd(+) plasmid vector creates a balanced-lethal complementation between the bacterial strain and the recombinant plasmid. E. ictaluri is an enteric gram-negative fish pathogen that causes enteric septicemia in catfish. Because E. ictaluri is a nasal/oral invasive intracellular pathogen, this bacterium is a candidate to develop a bath/oral live recombinant attenuated Edwardsiella vaccine (RAEV) for the catfish aquaculture industry. As a first step to develop an antibiotic-sensitive RAEV strain, we characterized and deleted the E. ictaluri asdA gene. E. ictaluri ΔasdA01 mutants exhibit an absolute requirement for DAP to grow. The asdA gene of E. ictaluri was complemented by the asdA gene from Salmonella. Several Asd(+) expression vectors with different origins of replication were transformed into E. ictaluri ΔasdA01. Asd(+) vectors were compatible with the pEI1 and pEI2 E. ictaluri native plasmids. The balanced-lethal system was satisfactorily evaluated in vivo. Recombinant GFP, PspA, and LcrV proteins were synthesized by E. ictaluri ΔasdA01 harboring Asd(+) plasmids. Here we constructed a balanced-lethal system, which is the first step to develop an antibiotic-sensitive RAEV for the aquaculture industry.

In vitro excision of adeno-associated virus DNA from recombinant plasmids: Isolation of an enzyme fraction from HeLa cells that cleaves DNA at poly(G) sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gottlieb, J.; Muzyczka, N.

1988-06-01

When circular recombinant plasmids containing adeno-associated virus (AAV) DNA sequences are transfected into human cells, the AAV provirus is rescued. Using these circular AAV plasmids as substrates, the authors isolated an enzyme fraction from HeLa cell nuclear extracts that excises intact AAV DNA in vitro from vector DNA and produces linear DNA products. The recognition signal for the enzyme is a polypurine-polypyrimidine sequence which is at least 9 residues long and rich in G . C base pairs. Such sequences are present in AAV recombinant plasmids as part of the first 15 base pairs of the AAV terminal repeat andmore » in some cases as the result of cloning the AAV genome by G . C tailing. The isolated enzyme fraction does not have significant endonucleolytic activity on single-stranded or double-stranded DNA. Plasmid DNA that is transfected into tissue culture cells is cleaved in vivo to produce a pattern of DNA fragments similar to that seen with purified enzyme in vitro. The activity has been called endo R for rescue, and its behavior suggests that it may have a role in recombination of cellular chromosomes.« less

[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

PubMed

Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

1985-11-01

The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

Spectrum of Epstein-Barr virus-associated diseases in recipients of allogeneic hematopoietic stem cell transplantation.

PubMed

Xuan, Li; Jiang, Xinmiao; Sun, Jing; Zhang, Yu; Huang, Fen; Fan, Zhiping; Guo, Xutao; Dai, Min; Liu, Can; Yu, Guopan; Zhang, Xian; Wu, Meiqing; Huang, Xiaojun; Liu, Qifa

2013-09-01

Epstein-Barr virus (EBV) infection may result in a spectrum of diseases in recipients of transplant. The aim of this study is to investigate the incidence, clinical characteristics, and prognosis of the spectrum of EBV-associated diseases in recipients of allogeneic hematopoietic stem cell transplantation (allo-HSCT). A total of 263 recipients undergoing allo-HSCT were prospectively enrolled. The blood EBV-DNA loads were regularly monitored by quantitative real-time polymerase chain reaction. The 3-year cumulative incidence of total EBV-associated diseases, posttransplantation lymphoproliferative diseases (PTLD), EBV fever, and EBV end-organ diseases (pneumonia, encephalitis/myelitis, and hepatitis) were 15.6%±2.5%, 9.9%±2.0%, 3.3%±1.3%, and 3.3%±1.2% (2.2%±1.0%, 1.6%±0.8%, and 0.9%±0.6%), respectively. Fever was the most common symptom of EBV-associated diseases. Patients with PTLD had better response rate to rituximab-based treatments compared with those with EBV end-organ diseases (including PTLD accompanied by EBV end-organ diseases) (P=0.014). The 3-year overall survival was 37.3%±13.7%, 100.0%, and 0.0%±0.0% in patients with PTLD, EBV fever, and EBV end-organ diseases (P=0.001). EBV-associated diseases other than PTLD are not rare in the recipients of allo-HSCT. The clinical manifestations of EBV end-organ diseases are similar to PTLD. EBV end-organ diseases had poorer response to rituximab-based therapy compared with PTLD.

High-frequency transformation of a methylotrophic yeast, Candida boidinii, with autonomously replicating plasmids which are also functional in Saccharomyces cerevisiae.

PubMed

Sakai, Y; Goh, T K; Tani, Y

1993-06-01

We have developed a transformation system which uses autonomous replicating plasmids for a methylotrophic yeast, Candida boidinii. Two autonomous replication sequences, CARS1 and CARS2, were newly cloned from the genome of C. boidinii. Plasmids having both a CARS fragment and the C. boidinii URA3 gene transformed C. boidinii ura3 cells to Ura+ phenotype at frequencies of up to 10(4) CFU/micrograms of DNA. From Southern blot analysis, CARS plasmids seemed to exist in polymeric forms as well as in monomeric forms in C. boidinii cells. The C. boidinii URA3 gene was overexpressed in C. boidinii on these CARS vectors. CARS1 and CARS2 were found to function as an autonomous replicating element in Saccharomyces cerevisiae as well. Different portions of the CARS1 sequence were needed for autonomous replicating activity in C. boidinii and S. cerevisiae. C. boidinii could also be transformed with vectors harboring a CARS fragment and the S. cerevisiae URA3 gene.

[Effect of endonuclease G depletion on plasmid DNA uptake and levels of homologous recombination in hela cells].

PubMed

Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y

2016-01-01

Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.

Construction of Stable Fluorescent Reporter Plasmids for Use in Staphylococcus aureus

PubMed Central

Rodriguez, Michelle D.; Paul, Zubin; Wood, Charles E.; Rice, Kelly C.; Triplett, Eric W.

2017-01-01

Here, the genes encoding three different fluorescent proteins were cloned into the stably maintained Staphylococcus aureus shuttle vector pKK30. The resulting plasmids were transformed into two S. aureus strains; SH1000 and RN4220. Stability assays illustrated that the three recombinant plasmids retained near 100% maintenance in vitro for 160 generations. S. aureus strain SH1000 expressing green fluorescent protein was then inoculated in an ovine model and in vivo stability for 6 days was demonstrated. In essence, these reporter plasmids represent a useful set of tools for dynamic imaging studies in S. aureus. These three reporter plasmids are available through BEI Resources. PMID:29312199

Construction of Stable Fluorescent Reporter Plasmids for Use in Staphylococcus aureus.

PubMed

Rodriguez, Michelle D; Paul, Zubin; Wood, Charles E; Rice, Kelly C; Triplett, Eric W

2017-01-01

Here, the genes encoding three different fluorescent proteins were cloned into the stably maintained Staphylococcus aureus shuttle vector pKK30. The resulting plasmids were transformed into two S. aureus strains; SH1000 and RN4220. Stability assays illustrated that the three recombinant plasmids retained near 100% maintenance in vitro for 160 generations. S. aureus strain SH1000 expressing green fluorescent protein was then inoculated in an ovine model and in vivo stability for 6 days was demonstrated. In essence, these reporter plasmids represent a useful set of tools for dynamic imaging studies in S. aureus . These three reporter plasmids are available through BEI Resources.

Methods for Gene Transfer to the Central Nervous System

PubMed Central

Kantor, Boris; Bailey, Rachel M.; Wimberly, Keon; Kalburgi, Sahana N.; Gray, Steven J.

2015-01-01

Gene transfer is an increasingly utilized approach for research and clinical applications involving the central nervous system (CNS). Vectors for gene transfer can be as simple as an unmodified plasmid, but more commonly involve complex modifications to viruses to make them suitable gene delivery vehicles. This chapter will explain how tools for CNS gene transfer have been derived from naturally occurring viruses. The current capabilities of plasmid, retroviral, adeno-associated virus, adenovirus, and herpes simplex virus vectors for CNS gene delivery will be described. These include both focal and global CNS gene transfer strategies, with short- or long-term gene expression. As is described in this chapter, an important aspect of any vector is the cis-acting regulatory elements incorporated into the vector genome that control when, where, and how the transgene is expressed. PMID:25311922

Enhanced Eradication of Lymphoma by Tumor-Specific Cytotoxic T Cells Secreting an Engineered Tumor-Specific Immunotoxin

DTIC Science & Technology

2008-06-01

verified the insertion of the genes in our expression plasmids and in our lentivirus vectors. Transduction/selection of the 293T with mutated E2F... mutation created in this gene is located in the PEA targeted region of EF-2, it prevents the interaction of these 2 proteins and thus the cell death...We have cloned this mutated elongation factor in an expression vector and in a lentivirus plasmid also encoding a marker gene . The mEF-2-lentivirus

Cell Cycle Dependent Regulation of Human Progesterone Receptor in Breast Cancer

DTIC Science & Technology

2004-10-01

wt PR or S400A PR (0.01-1.0 [tg each), CDK2 (ljig), and PRE-2x-TATA-luc reporter plasmid (lig) along with Renilla plasmid (10ng) as a control for...8 hours prior to treatment. Cells were collected following treatment with 10 nM R5020 or ETOH vehicle control for 18 hrs. Luciferase and renilla ...reporter, a renilla reporter construct as a transfection control, either wt PR-B or S400A mutant PR-B, and control parental vector or a vector encoding an

Therapeutic Benefits and Adverse Effects of Combined Proangiogenic Gene Therapy in Mouse Critical Leg Ischemia.

PubMed

Lebas, Benoît; Galley, Julien; Renaud-Gabardos, Edith; Pujol, Françoise; Lenfant, Françoise; Garmy-Susini, Barbara; Chaufour, Xavier; Prats, Anne-Catherine

2017-04-01

Critical leg ischemia (CLI) represents the ultimate stage of peripheral arterial disease. Despite current surgery advances, patients with CLI have limited therapeutic options. Therapeutic angiogenesis thus appears as a powerful approach, aiming to stimulate vessel formation by angiogenic molecules administration. In this context, combined gene therapy has been proved to be the most efficient. The present study aims to compare, in a preclinical mouse model, the therapeutic benefit of a combination of 2 angiogenic factors fibroblast growth factor 2 (FGF2) and Cyr61 using plasmid and viral vectors, able to generate short- or long-term transgene expression in the leg, respectively. Two therapeutic genes, FGF2 and Cyr61, were introduced into internal ribosome entry site-based expression vectors (FGFiCyr) allowing co-expression of the 2 transgenes. The proangiogenic plasmid pC-FGFiCyr was assessed by intramuscular administration followed by electrotransfer into ischemic legs. To generate long-term transgene expression, the FGFiCyr bicistronic cassette was introduced into an adenoassociated virus-derived vector (rAAV). The rAAV treatment was performed either before or immediately after surgery. Therapeutic effects were analyzed by laser Doppler imaging, clinical score, and angiography. The plasmid pC-FGFiCyr improved revascularization, reperfusion, and clinical score. Surprisingly, when AAV-FGFiCyr was injected 21 or 28 days before surgery, the proangiogenic rAAV was drastically deleterious on all measured parameters. In contrast, when administrated shortly after surgery, AAV-FGFiCyr generated therapeutic benefits, with a significantly better clinical score than after treatment with the plasmid. Therapeutic effects of the angiogenic combination FGF2-Cyr61 is observed with short-term transgene expression, but the treatment is significantly more efficient when a long-term expression viral vector is used. However, the rAAV-FGFiCyr generated therapeutic benefit only when injected in an ischemic leg, whereas the same dose of rAAV exhibited deleterious effects when administrated to healthy animals. These data may contribute to the understanding of the moderate success of proangiogenic treatments in CLI gene therapy clinical assays. Copyright © 2016 Elsevier Inc. All rights reserved.

pHg/pSILBAγ vector system for efficient gene silencing in homobasidiomycetes: optimization of ihpRNA – triggering in the mycorrhizal fungus Laccaria bicolor

PubMed Central

Kemppainen, Minna J.; Pardo, Alejandro G.

2010-01-01

Summary pSILBAγ silencing vector was constructed for efficient RNA silencing triggering in the model mycorrhizal fungus Laccaria bicolor. This cloning vector carries the Agaricus bisporus gpdII promoter, two multiple cloning sites separated by a L. bicolor nitrate reductase intron and the Aspergillus nidulans trpC terminator. pSILBAγ allows an easy oriented two‐step PCR cloning of hairpin sequences to be expressed in basidiomycetes. With one further cloning step into pHg, a pCAMBIA1300‐based binary vector carrying a hygromycin resistance cassette, the pHg/pSILBAγ plasmid is used for Agrobacterium‐mediated transformation. The pHg/pSILBAγ system results in predominantly single integrations of RNA silencing triggering T‐DNAs in the fungal genome and the integration sites of the transgenes can be resolved by plasmid rescue. pSILBAγ construct and two other pSILBA plasmid variants (pSILBA and pSILBAα) were evaluated for their capacity to silence Laccaria nitrate reductase gene. While all pSILBA variants tested resulted in up to 65–76% of transformants with reduced growth on nitrate, pSILBAγ produced the highest number (65%) of strongly affected fungal strains. The strongly silenced phenotype was shown to correlate with T‐DNA integration in transcriptionally active genomic sites. pHg/pSILBAγ was shown to produce T‐DNAs with minimum CpG methylation in transgene promoter regions which assures the maximum silencing trigger production in Laccaria. Methylation of the target endogene was only slight in RNA silencing triggered with constructs carrying an intronic spacer hairpin sequence. The silencing capacity of the pHg/pSILBAγ was further tested with Laccaria inositol‐1,4,5‐triphosphate 5‐phosphatase gene. Besides its use in silencing triggering, the herein described plasmid system can also be used for transgene expression in Laccaria. pHg/pSILBAγ silencing system is optimized for L. bicolor but it should be highly useful also for other homobasidiomycetes, group of fungi currently lacking molecular tools for RNA silencing. PMID:21255319

Optimal Cloning of PCR Fragments by Homologous Recombination in Escherichia coli

PubMed Central

Jacobus, Ana Paula; Gross, Jeferson

2015-01-01

PCR fragments and linear vectors containing overlapping ends are easily assembled into a propagative plasmid by homologous recombination in Escherichia coli. Although this gap-repair cloning approach is straightforward, its existence is virtually unknown to most molecular biologists. To popularize this method, we tested critical parameters influencing the efficiency of PCR fragments cloning into PCR-amplified vectors by homologous recombination in the widely used E. coli strain DH5α. We found that the number of positive colonies after transformation increases with the length of overlap between the PCR fragment and linear vector. For most practical purposes, a 20 bp identity already ensures high-cloning yields. With an insert to vector ratio of 2:1, higher colony forming numbers are obtained when the amount of vector is in the range of 100 to 250 ng. An undesirable cloning background of empty vectors can be minimized during vector PCR amplification by applying a reduced amount of plasmid template or by using primers in which the 5′ termini are separated by a large gap. DpnI digestion of the plasmid template after PCR is also effective to decrease the background of negative colonies. We tested these optimized cloning parameters during the assembly of five independent DNA constructs and obtained 94% positive clones out of 100 colonies probed. We further demonstrated the efficient and simultaneous cloning of two PCR fragments into a vector. These results support the idea that homologous recombination in E. coli might be one of the most effective methods for cloning one or two PCR fragments. For its simplicity and high efficiency, we believe that recombinational cloning in E. coli has a great potential to become a routine procedure in most molecular biology-oriented laboratories. PMID:25774528

Production and purification of non replicative canine adenovirus type 2 derived vectors.

PubMed

Szelechowski, Marion; Bergeron, Corinne; Gonzalez-Dunia, Daniel; Klonjkowski, Bernard

2013-12-03

Adenovirus (Ad) derived vectors have been widely used for short or long-term gene transfer, both for gene therapy and vaccine applications. Because of the frequent pre-existing immunity against the classically used human adenovirus type 5, canine adenovirus type 2 (CAV2) has been proposed as an alternative vector for human gene transfer. The well-characterized biology of CAV2, together with its ease of genetic manipulation, offer major advantages, notably for gene transfer into the central nervous system, or for inducing a wide range of protective immune responses, from humoral to cellular immunity. Nowadays, CAV2 represents one of the most appealing nonhuman adenovirus for use as a vaccine vector. This protocol describes a simple method to construct, produce and titer recombinant CAV2 vectors. After cloning the expression cassette of the gene of interest into a shuttle plasmid, the recombinant genomic plasmid is obtained by homologous recombination in the E. coli BJ5183 bacterial strain. The resulting genomic plasmid is then transfected into canine kidney cells expressing the complementing CAV2-E1 genes (DK-E1). A viral amplification enables the production of a large viral stock, which is purified by ultracentrifugation through cesium chloride gradients and desalted by dialysis. The resulting viral suspension routinely has a titer of over 10(10) infectious particles per ml and can be directly administrated in vivo.

Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae

DOEpatents

Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.

1991-03-26

A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 figure.

Cercosporin-deficient mutants by plasmid tagging in the asexual fungus Cercospora nicotianae.

PubMed

Chung, K-R; Ehrenshaft, M; Wetzel, D K; Daub, M E

2003-11-01

We have successfully adapted plasmid insertion and restriction enzyme-mediated integration (REMI) to produce cercosporin toxin-deficient mutants in the asexual phytopathogenic fungus Cercospora nicotianae. The use of pre-linearized plasmid or restriction enzymes in the transformation procedure significantly decreased the transformation frequency, but promoted a complicated and undefined mode of plasmid integration that leads to mutations in the C. nicotianae genome. Vector DNA generally integrated in multiple copies, and no increase in single-copy insertion was observed when enzymes were added to the transformation mixture. Out of 1873 transformants tested, 39 putative cercosporin toxin biosynthesis ( ctb) mutants were recovered that showed altered levels of cercosporin production. Seven ctb mutants were recovered using pre-linearized plasmids without the addition of enzymes, and these were considered to be non-REMI mutants. The correlation between a specific insertion and a mutant phenotype was confirmed using rescued plasmids as gene disruption vectors in the wild-type strain. Six out of fifteen rescued plasmids tested yielded cercosporin-deficient transformants when re-introduced into the wild-type strain, suggesting a link between the insertion site and the cercosporin-deficient phenotype. Sequence analysis of a fragment flanking the insert site recovered from one insertion mutant showed it to be disrupted in sequences with high homology to the acyl transferase domain of polyketide synthases from other fungi. Disruption of this polyketide synthase gene ( CTB1) using a rescued plasmid resulted in mutants that were defective in cercosporin production. Thus, we provide the first molecular evidence that cercosporin is synthesized via a polyketide pathway as previously hypothesized.

Manipulation for plasmid elimination by transforming synthetic competitors diversifies lactococcus lactis starters applicable to food products.

PubMed

Kobayashi, Miho; Nomura, Masaru; Kimoto, Hiromi

2007-11-01

This study was designed selectively to eliminate a theta-plasmid from Lactococcus lactis strains by transforming synthetic competitors. A shuttle vector for Escherichia coli and L. lactis, pDB1, was constructed by ligating a partial replicon of pDR1-1B, which is a 7.3 kb theta-plasmid in L. lactis DRC1, with an erythromycin resistance gene into pBluescript II KS(+). This versatile vector was used to construct competitors to common lactococcal theta-plasmids. pDB1 contains the 5' half of the replication origin and the 3' region of repB of pDR1-1B, but lacks the 1.1-kb region normally found between these two segments. A set of primers, Pv3 and Pv4, was designed to amplify the 1.1-kb middle parts of the general theta-replicons of lactococcal plasmids. When the PCR products were cloned into the Nru I and Xho I sites of pDB1, synthetic replicons were constructed and replication activity was restored. A number of theta-plasmids in L. lactis ssp. lactis and cremoris were eliminated selectively by transforming the synthetic competitors. These competitors were easily eliminated by subculture for a short time in the absence of selection. The resulting variants contained no exogenous DNA and are suitable for food products, since part of the phenotype was altered without altering other plasmids indispensable for fermentation.

A novel bicistronic sensor vector for detecting caspase-3 activation.

PubMed

Vagner, Tatyana; Mouravlev, Alexandre; Young, Deborah

2015-01-01

Apoptosis is involved in pathological cell death of a wide range of human diseases. One of the most important biochemical markers of apoptosis is activation of caspase-3. Ability to detect caspase-3 activation early in the pathological process is important for determining the timing for interfering with apoptosis initiation and prevention of cell damage. Techniques allowing detection of caspase-3 activity at a single cell level show increased sensitivity, compared to biochemical assays; therefore, we developed a novel bicistronic caspase-3 sensor vector enabling detection of caspase-3 activity in individual cells. We employed green fluorescent protein (GFP) as a reporter for caspase-3 activation in our constructs and assessed the functionality of the generated constructs in transiently transfected Neuro2A and HEK293 cells under basal conditions and following application of okadaic acid (OA) or staurosporine (STS) to induce apoptosis. To ensure responsiveness of the new sensor vector to active caspase-3, we co-transfected the sensor with plasmid(s) overexpressing active caspase-3 and quantified GFP fluorescence using a plate reader. We observed an increase in GFP expression in cells transfected with the new bicistronic caspase-3 sensor in response to both OA and STS. We also showed a significant increase in GFP fluorescence intensity in cells co-expressing the sensor with the plasmid(s) encoding active caspase-3. We generated a novel bicistronic caspase-3 sensor vector which relies on a transcription factor/response element system. The obtained sensor combines high sensitivity of the single cell level detection with the possibility of automated quantification. Copyright © 2015 Elsevier Inc. All rights reserved.

[Construction of a general AAV vector regulated by minimal and artificial hypoxic-responsive element].

PubMed

Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying

2011-03-01

To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed. The AAV effectually regulated by the minimal HRE inserted into anterior extremity of CMV promoter. The vector is successfully constructed and it has important theoretical and practical value in the synteresis and therapy of ischemia angiocardiopathy and cerebrovascular disease.

Transformation of Rhodococcus fascians by High-Voltage Electroporation and Development of R. fascians Cloning Vectors

PubMed Central

Desomer, Jan; Dhaese, Patrick; Montagu, Marc Van

1990-01-01

The analysis of the virulence determinants of phytopathogenic Rhodococcus fascians has been hampered by the lack of a system for introducing exogenous DNA. We investigated the possibility of genetic transformation of R. fascians by high-voltage electroporation of intact bacterial cells in the presence of plasmid DNA. Electrotransformation in R. fascians D188 resulted in transformation frequencies ranging from 105/μg of DNA to 107/μg of DNA, depending on the DNA concentration. The effects of different electrical parameters and composition of electroporation medium on transformation efficiency are presented. By this transformation method, a cloning vector (pRF28) for R. fascians based on an indigenous 160-kilobase (chloramphenicol and cadmium resistance-encoding) plasmid pRF2 from strain NCPPB 1675 was developed. The origin of replication and the chloramphenicol resistance gene on pRF28 were used to construct cloning vectors that are capable of replication in R. fascians and Escherichia coli. The electroporation method presented was efficient enough to allow detection of the rare integration of replication-deficient pRF28 derivatives in the R. fascians D188 genome via either homologous or illegitimate recombination. Images PMID:16348290

Mobilome and genetic modification of bifidobacteria.

PubMed

Guglielmetti, S; Mayo, B; Álvarez-Martín, P

2013-06-01

Until recently, proper development of molecular studies in Bifidobacterium species has been hampered by growth difficulties, because of their exigent nutritive requirements, oxygen sensitivity and lack of efficient genetic tools. These studies, however, are critical to uncover the cross-talk between bifidobacteria and their hosts' cells and to prove unequivocally the supposed beneficial effects provided through the endogenous bifidobacterial populations or after ingestion as probiotics. The genome sequencing projects of different bifidobacterial strains have provided a wealth of genetic data that will be of much help in deciphering the molecular basis of the physiological properties of bifidobacteria. To this end, the purposeful development of stable cloning and expression vectors based on robust replicons - either from temperate phages or resident plasmids - is still needed. This review addresses the current knowledge on the mobile genetic elements of bifidobacteria (prophages, plasmids and transposons) and summarises the different types of vectors already available, together with the transformation procedures for introducing DNA into the cells. It also covers recent molecular studies performed with such vectors and incipient results on the genetic modification of these organisms, establishing the basis that would allow the use of bifidobacteria for future biotechnological applications.

Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae

DOEpatents

Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.

1987-08-28

A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of /und Streptococcus/ /und pneumoniae/. Plasmid pSM22, the vector containing the pneumococcal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 fig., 1 tab.

[Construction of the eukaryotic recombinant vector and expression of the outer membrane protein LipL32 gene from Leptospira serovar Lai].

PubMed

Huang, Bi; Bao, Lang; Zhong, Qi; Shang, Zheng-ling; Zhang, Hui-dong; Zhang, Ying

2008-02-01

To construct the eukaryotic experssion vector of LipL32 gene from Leptospira serovar Lai and express the recombinant plasmid in COS-7 cell. The LipL32 gene was amplified from Leptospira strain 017 genomic DNA by PCR and cloned into pcDNA3.1, through restriction nuclease enzyme digestion. Then the recombinant plasmid was transformed into E.coli DH5alpha. After identified by nuclease digestion, PCR and sequencing analysis, the recombinant vector was transfected into COS-7 cell with lipsome. The expression of the target gene was detected by RT-PCR and Western blot. The eukaryotic experssion vector pcDNA3.1-LipL32 was successfully constructed and stably expressed in COS-7 cell. The eukaryotic recombinant vector of outer membrane protein LipL32 gene from Leptospira serovar Lai can be expressed in mammalian cell, which provides an experimental basis for the application of the Leptospira DNA vaccine.

Bacteriophage-based Vectors for Site-specific Insertion of DNA in the Chromosome of Corynebacteria

PubMed Central

Oram, Mark; Woolston, Joelle E.; Jacobson, Andrew D.; Holmes, Randall K.; Oram, Diana M.

2007-01-01

In Corynebacterium diphtheriae, diphtheria toxin is encoded by the tox gene of some temperate corynephages such as β. β-like corynephages are capable of inserting into the C. diphtheriae chromosome at two specific sites, attB1 and attB2. Transcription of the phage-encoded tox gene, and many chromosomally-encoded genes, is regulated by the DtxR protein in response to Fe2+ levels. Characterizing DtxR-dependent gene regulation is pivotal in understanding diphtheria pathogenesis and mechanisms of iron-dependent gene expression; although this has been hampered by a lack of molecular genetic tools in C. diphtheriae and related Coryneform species. To expand the systems for genetic manipulation of C. diphtheriae, we constructed plasmid vectors capable of integrating into the chromosome. These plasmids contain the β-encoded attP site and the DIP0182 integrase gene of C. diphtheriae NCTC13129. When these vectors were delivered to the cytoplasm of non-lysogenic C. diphtheriae, they integrated into either the attB1 or attB2 sites with comparable frequency. Lysogens were also transformed with these vectors, by virtue of the second attB site. An integrated vector carrying an intact dtxR gene complemented the mutant phenotypes of a C. diphtheriae ΔdtxR strain. Additionally, strains of β-susceptible C. ulcerans, and C. glutamicum, a species non-permissive for β, were each transformed with these vectors. This work significantly extends the tools available for targeted transformation of both pathogenic and non-pathogenic Corynebacterium species. PMID:17275217

Novel Minicircle Vector for Gene Therapy in Murine Myocardial Infarction

PubMed Central

Huang, Mei; Chen, ZhiYing; Hu, Shijun; Jia, Fangjun; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Kay, Mark A.; Wu, Joseph C.

2011-01-01

Background Conventional plasmids for gene therapy produce low-level and short-term gene expression. In this study, we develop a novel non-viral vector which robustly and persistently expresses the hypoxia inducible factor-1 alpha (HIF-1α) therapeutic gene in the heart, leading to functional benefits following myocardial infarction (MI). Methods and Results We first created minicircles carrying double fusion (MC-DF) reporter gene consisting of firefly luciferase and enhanced green fluorescent protein (Fluc-eGFP) for noninvasive measurement of transfection efficiency. Mouse C2C12 myoblasts and normal FVB mice were used for in vitro and in vivo confirmation, respectively. Bioluminescence imaging (BLI) showed stable minicircle gene expression in the heart for >12 weeks and the activity level was 5.6±1.2 fold stronger than regular plasmid at day 4 (P<0.01). Next, we created minicircles carrying hypoxia inducible factor-1 alpha (MC-HIF-1α) therapeutic gene for treatment of MI. Adult FVB mice underwent LAD ligation and were injected intramyocardially with (1) MC-HIF-1α, (2) regular plasmid carrying HIF-1α (PL-HIF-1α) as positive control, and (3) PBS as negative control (n=10/group). Echocardiographic study showed a significantly greater improvement of left ventricular ejection fraction (LVEF) in the minicircle group (51.3%±3.6%) compared to regular plasmid group (42.3%±4.1%) and saline group (30.5%±2.8%) at week 4 (P<0.05 for both). Histology demonstrated increased neoangiogenesis in both treatment groups. Finally, Western blot showed minicircles express >50% higher HIF-1α level than regular plasmid. Conclusion Taken together, this is the first study to demonstrate that minicircles can significantly improve transfection efficiency, duration of transgene expression, and cardiac contractility. Given the serious drawbacks associated with most viral vectors, we believe this novel non-viral vector can be of great value for cardiac gene therapy protocols. PMID:19752373

[Construction and function identification of luciferase reporter gene vectors containing SNPs in NFKBIA gene 3'UTR].

PubMed

Yang, Shuo; Li, Jia-li; Bi, Hui-chang; Zhou, Shou-ning; Liu, Xiao-man; Zeng, Hang; Hu, Bing-fang; Huang, Min

2016-01-01

This study aims to investigate the function of two SNPs (rs8904C > T and rs696G >A) in 3' untranslated region (3'UTR) of NFKBIA gene by constructing luciferase reporter gene. A patient's genomic DNA with rs8904 CC and rs696 GA genotype was used as the PCR template. Full-length 3'UTR of NFKBIA gene was amplified by different primers. After sequencing validation, these fragments were inserted to the luciferase reporter vector, pGL3-promoter to construct recombinant plasmids containing four kinds of haplotypes, pGL3-rs8904C/rs696G, pGL3-rs8904C/rs696A, pGL3-rs8904T/rs696G and pGL3-rs8904T/rs696A. Then these plasmids were transfected into LS174T cells and the luciferase activity was detected. Compared with pGL3-vector transfected cells (negative control), the luciferase activity of the four kinds of recombinant plasmids was significantly decreased (P < 0.001). For rs696G > A, the luciferase activity of the recombinant plasmids containing A allele (pGL3-rs8904C/rs696A and pGL3-rs8904T/rs696A) was about 45.1% (P < 0.05) and 56.1% (P < 0.001) lower than those containing G allele (pGL3-rs8904C/rs696G and pGL3-rs8904T/rs696G), respectively. For rs8904C > T, there were no significant differences in the luciferase activity between the recombinant plasmids containing T allele and those with C allele. Together, the luciferase reporter gene vectors containing SNPs in NFKBIA gene 3'UTR were constructed successfully and rs696G > A could decrease the luciferase activity while rs8904C >T didn't have much effect on the luciferase activity.

Site-specific integration of Streptomyces PhiC31 integrase-based vectors in the chromosome of Rhodococcus equi.

PubMed

Hong, Yang; Hondalus, Mary K

2008-10-01

Streptomyces PhiC31-based site-specific integration was used to transform the facultative intracellular pathogen Rhodococcus equi. The transformation efficiency of vectors incorporating the PhiC31 integrase and attP sites was comparable to that of replication plasmids using the same electroporation procedure. A single attB integration site was identified within an ORF encoding a pirin-like protein, which deviates slightly from the consensus sequence of Streptomyces attB sites. Vector integration was stably maintained in the R. equi chromosome for as many as 100 generations during unselected passage in vitro. In addition, integration does not appear to affect the replication of bacteria inside macrophages. Finally, this integration system was also used to successfully complement an R. equi mutant.

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis

PubMed Central

Santangeloyz, K.S.; Bertoneyz, A.L.

2011-01-01

summary Objective To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Methods Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RTPCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2−ΔΔCT) method. Results Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P= 0.0045) or >90% (P= 0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Conclusions Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. PMID:21945742

Viral load and clinical disease enhancement associated with a lentivirus cytotoxic T lymphocyte vaccine regimen

PubMed Central

Mealey, Robert H.; Leib, Steven R.; Littke, Matt H.; Wagner, Bettina; Horohov, David W.; McGuire, Travis C.

2009-01-01

Effective DNA-based vaccines against lentiviruses will likely induce CTL against conserved viral proteins. Equine infectious anemia virus (EIAV) infects horses worldwide, and serves as a useful model for lentiviral immune control. Although attenuated live EIAV vaccines have induced protective immune responses, DNA-based vaccines have not. In particular, DNA-based vaccines have had limited success in inducing CTL responses against intracellular pathogens in the horse. We hypothesized that priming with a codon-optimized plasmid encoding EIAV Gag p15/p26 with co-administration of a plasmid encoding an equine IL-2/IgG fusion protein as a molecular adjuvant, followed by boosting with a vaccinia vector expressing Gag p15/p26, would induce protective Gag-specific CTL responses. Although the regimen induced Gag-specific CTL in four of seven vaccinated horses, CTL were not detected until after the vaccinia boost, and protective effects were not observed in EIAV challenged vaccinates. Unexpectedly, vaccinates had significantly higher viral loads and more severe clinical disease, associated with the presence of vaccine-induced CTL. It was concluded that 1.) further optimization of the timing and route of DNA immunization was needed for efficient CTL priming in vivo, 2.) co-administration of the IL-2/IgG plasmid did not enhance CTL priming by the Gag p15/p26 plasmid, 3.) vaccinia vectors are useful for lentivirus-specific CTL induction in the horse, 4.) Gag-specific CTL alone are either insufficient or a more robust Gag-specific CTL response is needed to limit EIAV viremia and clinical disease, and 5.) CTL-inducing vaccines lacking envelope immunogens can result in lentiviral disease enhancement. Although the mechanisms for enhancement associated with this vaccine regimen remain to be elucidated, these results have important implications for development of lentivirus T cell vaccines. PMID:19368787

Insect cell transformation vectors that support high level expression and promoter assessment in insect cell culture

USDA-ARS?s Scientific Manuscript database

A somatic transformation vector, pDP9, was constructed that provides a simplified means of producing permanently transformed cultured insect cells that support high levels of protein expression of foreign genes. The pDP9 plasmid vector incorporates DNA sequences from the Junonia coenia densovirus th...

Enhancing magnetic nanoparticle-based DNA transfection: Intracellular-active cassette features

NASA Astrophysics Data System (ADS)

Vernon, Matthew Martin

Efficient plasmid DNA transfection of embryonic stem cells, mesenchymal stem cells, neural cell lines and the majority of primary cell lines is a current challenge in gene therapy research. Magnetic nanoparticle-based DNA transfection is a gene vectoring technique that is promising because it is capable of outperforming most other non-viral transfection methods in terms of both transfection efficiency and cell viability. The nature of the DNA vector implemented depends on the target cell phenotype, where the particle surface chemistry and DNA binding/unbinding kinetics of the DNA carrier molecule play a critical role in the many steps required for successful gene transfection. Accordingly, Neuromag, an iron oxide/polymer nanoparticle optimized for transfection of neural phenotypes, outperforms many other nanoparticles and lipidbased DNA carriers. Up to now, improvements to nanomagnetic transfection techniques have focused mostly on particle functionalization and transfection parameter optimization (cell confluence, growth media, serum starvation, magnet oscillation parameters, etc.). None of these parameters are capable of assisting the nuclear translocation of delivered plasmid DNA once the particle-DNA complex is released from the endosome and dissociates in the cell's cytoplasm. In this study, incorporation of a DNA targeting sequence (DTS) feature in the transfecting plasmid DNA confers improved nuclear translocation, demonstrating significant improvement in nanomagnetic transfection efficiency in differentiated SH-SY5Y neuroblastoma cells. Other parameters, such as days in vitro, are also found to play a role and represent potential targets for further optimization.

The ability of a collagen/calcium phosphate scaffold to act as its own vector for gene delivery and to promote bone formation via transfection with VEGF(165).

PubMed

Keeney, Michael; van den Beucken, Jeroen J J P; van der Kraan, Peter M; Jansen, John A; Pandit, Abhay

2010-04-01

Collagen/calcium phosphate scaffolds have been used for bone reconstruction due to their inherent similarities to the bone extracellular matrix. Calcium phosphate alone has also been used as a non-viral vector for gene delivery. The aim of this study was to determine the capability of a collagen/calcium phosphate scaffold to deliver naked plasmid DNA and mediate transfection in vivo. The second goal of the study was to deliver a plasmid encoding vascular endothelial growth factor(165) (pVEGF(165)) to promote angiogenesis, and hence bone formation, in a mouse intra-femoral model. The delivery of naked plasmid DNA resulted in a 7.6-fold increase in mRNA levels of beta-Galactosidase compared to the delivery of plasmid DNA complexed with a partially degraded PAMAM dendrimer (dPAMAM) in a subcutaneous murine model. When implanted in a muirne intra-femoral model, the delivery of pVEGF(165) resulted in a 2-fold increase in bone volume at the defect site relative to control scaffolds without pVEGF(165). It was concluded that a collagen/calcium phosphate scaffold can mediate transfection without the use of additional transfection vectors and can promote bone formation in a mouse model via the delivery of pVEGF(165). 2009 Elsevier Ltd. All rights reserved.

Cell-Penetrating Peptide-Mediated Delivery of Cas9 Protein and Guide RNA for Genome Editing.

PubMed

Suresh, Bharathi; Ramakrishna, Suresh; Kim, Hyongbum

2017-01-01

The clustered, regularly interspaced, short palindromic repeat (CRISPR)-associated (Cas) system represents an efficient tool for genome editing. It consists of two components: the Cas9 protein and a guide RNA. To date, delivery of these two components has been achieved using either plasmid or viral vectors or direct delivery of protein and RNA. Plasmid- and virus-free direct delivery of Cas9 protein and guide RNA has several advantages over the conventional plasmid-mediated approach. Direct delivery results in shorter exposure time at the cellular level, which in turn leads to lower toxicity and fewer off-target mutations with reduced host immune responses, whereas plasmid- or viral vector-mediated delivery can result in uncontrolled integration of the vector sequence into the host genome and unwanted immune responses. Cell-penetrating peptide (CPP), a peptide that has an intrinsic ability to translocate across cell membranes, has been adopted as a means of achieving efficient Cas9 protein and guide RNA delivery. We developed a method for treating human cell lines with CPP-conjugated recombinant Cas9 protein and CPP-complexed guide RNAs that leads to endogenous gene disruption. Here we describe a protocol for preparing an efficient CPP-conjugated recombinant Cas9 protein and CPP-complexed guide RNAs, as well as treatment methods to achieve safe genome editing in human cell lines.

Construction of a Schizosaccharomyces pombe gene bank in a yeast bacterial shuttle vector and its use to isolate genes by complementation.

PubMed

Beach, D; Piper, M; Nurse, P

1982-01-01

A gene bank of partial Sau3A restriction fragments of S. pombe DNA has been constructed in the plasmid vector, pDB248', which is capable of high frequency transformation of S. pombe. Procedures are described which enable plasmids to be recovered from S. pombe by their reintroduction into E. coli. These methods have been used to detect the S. pombe genes lys 1+, ade 6+ and his 2+ in the gene bank by complementation of mutant gene functions, and to physically isolate the lys 1+ gene.

Attenuated Shigella as a DNA Delivery Vehicle for DNA-Mediated Immunization

NASA Astrophysics Data System (ADS)

Sizemore, Donata R.; Branstrom, Arthur A.; Sadoff, Jerald C.

1995-10-01

Direct inoculation of DNA, in the form of purified bacterial plasmids that are unable to replicate in mammalian cells but are able to direct cell synthesis of foreign proteins, is being explored as an approach to vaccine development. Here, a highly attenuated Shigella vector invaded mammalian cells and delivered such plasmids into the cytoplasm of cells, and subsequent production of functional foreign protein was measured. Because this Shigella vector was designed to deliver DNA to colonic mucosa, the method is a potential basis for oral and other mucosal DNA immunization and gene therapy strategies.

Toward DNA-based Security Circuitry: First Step - Random Number Generation.

PubMed

Bogard, Christy M; Arazi, Benjamin; Rouchka, Eric C

2008-08-10

DNA-based circuit design is an area of research in which traditional silicon-based technologies are replaced by naturally occurring phenomena taken from biochemistry and molecular biology. Our team investigates the implications of DNA-based circuit design in serving security applications. As an initial step we develop a random number generation circuitry. A novel prototype schema employs solid-phase synthesis of oligonucleotides for random construction of DNA sequences. Temporary storage and retrieval is achieved through plasmid vectors.

Stable transformation of a mosquito cell line results in extraordinarily high copy numbers of the plasmid.

PubMed Central

Monroe, T J; Muhlmann-Diaz, M C; Kovach, M J; Carlson, J O; Bedford, J S; Beaty, B J

1992-01-01

Stable incorporation of high copy numbers (greater than 10,000 per cell) of a plasmid vector containing a gene conferring resistance to the antibiotic hygromycin was achieved in a cell line derived from the Aedes albopictus mosquito. Plasmid sequences were readily observed by ethidium bromide staining of cellular DNA after restriction endonuclease digestion and agarose gel electrophoresis. The plasmid was demonstrated by in situ hybridization to be present in large arrays integrated in metaphase chromosomes and in minute and double-minute replicating elements. In one subclone, approximately 60,000 copies of the plasmid were organized in a large array that resembles a chromosome, morphologically and in the segregation of its chromatids during anaphase. The original as well as modified versions of the plasmid were rescued by transformation of Escherichia coli using total cellular DNA. Southern blot analyses of recovered plasmids indicate the presence of mosquito-derived sequences. Images PMID:1631052

Correction of the Middle Eastern M712T mutation causing GNE myopathy by trans-splicing.

PubMed

Tal-Goldberg, Tzukit; Lorain, Stéphanie; Mitrani-Rosenbaum, Stella

2014-06-01

GNE myopathy is a rare neuromuscular autosomal recessive disease, resulting from mutations in the gene UDP N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE). The most frequent mutation is the single homozygous missense mutation, M712T-the Middle Eastern mutation-located ten amino acids before the end of the protein. We have used an adeno-associated virus (AAV)-based trans-splicing (TS) vector as a gene therapy tool to overcome this mutation by replacing the mutated last exon of GNE by the wild-type exon while preserving the natural endogenous regulatory machinery. We have designed relevant plasmids directed either to mouse or to human GNE. Following transfection of C2C12 murine muscle cells with the mouse TS vectors, we have been able to detect by nested RT-PCR trans-spliced molecules carrying the wild-type exon 12 of GNE. Similarly, transfection of HEK293 human cells with the human-directed TS vectors resulted in the generation of trans-spliced human GNE RNA molecules. Furthermore, infection of primary muscle cells from a GNE myopathy patient carrying the homozygous M712T mutation, with an AAV8-based viral vector carrying a human-directed TS construct, resulted in the generation of wild-type GNE transcripts in addition to the mutated ones. These studies provide a proof of concept that the TS approach could be used to partially correct the Middle Eastern mutation in GNE myopathy patients. These results provide the basis for in vivo research in animal models using the AAV platform with TS plasmids as a potential genetic therapy for GNE myopathy.

Characterization of Epstein-Barr virus (EBV) BZLF1 gene promoter variants and comparison of cellular gene expression profiles in Japanese patients with infectious mononucleosis, chronic active EBV infection, and EBV-associated hemophagocytic lymphohistiocytosis.

PubMed

Imajoh, Masayuki; Hashida, Yumiko; Murakami, Masanao; Maeda, Akihiko; Sato, Tetsuya; Fujieda, Mikiya; Wakiguchi, Hiroshi; Daibata, Masanori

2012-06-01

Epstein-Barr virus (EBV) genotypes can be distinguished based on gene sequence differences in EBV nuclear antigens 2, 3A, 3B, and 3C, and the BZLF1 promoter zone (Zp). EBV subtypes and BZLF1 Zp variants were examined in Japanese patients with infectious mononucleosis, chronic active EBV infection, and EBV-associated hemophagocytic lymphohistiocytosis. The results of EBV typing showed that samples of infectious mononucleosis, chronic active EBV infection, and EBV-associated hemophagocytic lymphohistiocytosis all belonged to EBV type 1. However, sequencing analysis of BZLF1 Zp found three polymorphic Zp variants in the same samples. The Zp-P prototype and the Zp-V3 variant were both detected in infectious mononucleosis and chronic active EBV infection. Furthermore, a novel variant previously identified in Chinese children with infectious mononucleosis, Zp-V1, was also found in 3 of 18 samples of infectious mononucleosis, where it coexisted with the Zp-P prototype. This is the first evidence that the EBV variant distribution in Japanese patients resembles that found in other Asian patients. The expression levels of 29 chronic active EBV infection-associated cellular genes were also compared in the three EBV-related disorders, using quantitative real-time reverse transcription polymerase chain reaction analysis. Two upregulated genes, RIPK2 and CDH9, were identified as common specific markers for chronic active EBV infection in both in vitro and in vivo studies. RIPK2 activates apoptosis and autophagy, and could be responsible for the pathogenesis of chronic active EBV infection. Copyright © 2012 Wiley Periodicals, Inc.

One pyrimidine dimer inactivates expression of a transfected gene in xeroderma pigmentosum cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Protic-Sabljic, M.; Kraemer, K.H.

1985-10-01

The authors have developed a host cell reactivation assay of DNA repair utilizing UV-treated plasmid vectors. The assay primarily reflects cellular repair of transcriptional activity of damaged DNA measured indirectly as enzyme activity of the transfected genes. They studied three plasmids (pSV2cat, 5020 base pairs; pSV2catSVgpt, 7268 base pairs; and pRSVcat, 5027 base pairs) with different sizes and promoters carrying the bacterial cat gene (CAT, chloramphenicol acetyltransferase) in a construction that permits cat expression in human cells. All human simian virus 40-transformed cells studied expressed high levels of the transfected cat gene. UV treatment of the plasmids prior to transfectionmore » resulted in differential decrease in CAT activity in different cell lines. With pSV2catSVgpt, UV inactivation of CAT expression was greater in the xeroderma pigmentosum group A and D lines than in the other human cell lines tested. The D0 of the CAT inactivation curve was 50 J X m-2 for pSV2cat and for pRSVcat in the xeroderma pigmentosum group A cells. The similarity of the D0 data in the xeroderma pigmentosum group A cells for three plasmids of different size and promoters implies they all have similar UV-inactivation target size. UV-induced pyrimidine dimer formation in the plasmids was quantified by assay of the number of UV-induced T4 endonuclease V-sensitive sites. In the most sensitive xeroderma pigmentosum cells, with all three plasmids, one UV-induced pyrimidine dimer inactivates a target of about 2 kilobases, close to the size of the putative CAT mRNA.« less

Comparison of two automated instruments for Epstein-Barr virus serology in a large adult hospital and implementation of an Epstein-Barr virus nuclear antigen-based testing algorithm.

PubMed

Al Sidairi, Hilal; Binkhamis, Khalifa; Jackson, Colleen; Roberts, Catherine; Heinstein, Charles; MacDonald, Jimmy; Needle, Robert; Hatchette, Todd F; LeBlanc, Jason J

2017-11-01

Serology remains the mainstay for diagnosis of Epstein-Barr virus (EBV) infection. This study compared two automated platforms (BioPlex 2200 and Architect i2000SR) to test three EBV serological markers: viral capsid antigen (VCA) immunoglobulins of class M (IgM), VCA immunoglobulins of class G (IgG) and EBV nuclear antigen-1 (EBNA-1) IgG. Using sera from 65 patients at various stages of EBV disease, BioPlex demonstrated near-perfect agreement for all EBV markers compared to a consensus reference. The agreement for Architect was near-perfect for VCA IgG and EBNA-1 IgG, and substantial for VCA IgM despite five equivocal results. Since the majority of testing in our hospital was from adults with EBNA-1 IgG positive results, post-implementation analysis of an EBNA-based algorithm showed advantages over parallel testing of the three serologic markers. This small verification demonstrated that both automated systems for EBV serology had good performance for all EBV markers, and an EBNA-based testing algorithm is ideal for an adult hospital.

Facile Recovery of Individual High-Molecular-Weight, Low-Copy-Number Natural Plasmids for Genomic Sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, L.E.; Detter, C,; Barrie, K.

2006-06-01

Sequencing of the large (>50 kb), low-copy-number (<5 per cell) plasmids that mediate horizontal gene transfer has been hindered by the difficulty and expense of isolating DNA from individual plasmids of this class. We report here that a kit method previously devised for purification of bacterial artificial chromosomes (BACs) can be adapted for effective preparation of individual plasmids up to 220 kb from wild gram-negative and gram-positive bacteria. Individual plasmid DNA recovered from less than 10 ml of Escherichia coli, Staphylococcus, and Corynebacterium cultures was of sufficient quantity and quality for construction of highcoverage libraries, as shown by sequencing fivemore » native plasmids ranging in size from 30 kb to 94 kb. We also report recommendations for vector screening to optimize plasmid sequence assembly, preliminary annotation of novel plasmid genomes, and insights on mobile genetic element biology derived from these sequences. Adaptation of this BAC method for large plasmid isolation removes one major technical hurdle to expanding our knowledge of the natural plasmid gene pool.« less

Immunization With Fc-Based Recombinant Epstein–Barr Virus gp350 Elicits Potent Neutralizing Humoral Immune Response in a BALB/c Mice Model

PubMed Central

Zhao, Bingchun; Zhang, Xiao; Krummenacher, Claude; Song, Shuo; Gao, Ling; Zhang, Haojiong; Xu, Miao; Feng, Lin; Feng, Qisheng; Zeng, Musheng; Xu, Yuting; Zeng, Yixin

2018-01-01

Epstein–Barr virus (EBV) was the first human virus proved to be closely associated with tumor development, such as lymphoma, nasopharyngeal carcinoma, and EBV-associated gastric carcinoma. Despite many efforts to develop prophylactic vaccines against EBV infection and diseases, no candidates have succeeded in effectively blocking EBV infection in clinical trials. Previous investigations showed that EBV gp350 plays a pivotal role in the infection of B-lymphocytes. Nevertheless, using monomeric gp350 proteins as antigens has not been effective in preventing infection. Multimeric forms of the antigen are more potently immunogenic than monomers; however, the multimerization elements used in previous constructs are not approved for human clinical trials. To prepare a much-needed EBV prophylactic vaccine that is potent, safe, and applicable, we constructed an Fc-based form of gp350 to serve as a dimeric antigen. Here, we show that the Fc-based gp350 antigen exhibits dramatically enhanced immunogenicity compared with wild-type gp350 protein. The complete or partial gp350 ectodomain was fused with the mouse IgG2a Fc domain. Fusion with the Fc domain did not impair gp350 folding, binding to a conformation-dependent neutralizing antibody (nAb) and binding to its receptor by enzyme-linked immunosorbent assay and surface plasmon resonance. Specific antibody titers against gp350 were notably enhanced by immunization with gp350-Fc dimers compared with gp350 monomers. Furthermore, immunization with gp350-Fc fusion proteins elicited potent nAbs against EBV. Our data strongly suggest that an EBV gp350 vaccine based on Fc fusion proteins may be an efficient candidate to prevent EBV infection in clinical applications. PMID:29765376

Non-viral gene delivery strategies for cancer therapy, tissue engineering and regenerative medicine

NASA Astrophysics Data System (ADS)

Bhise, Nupura S.

Gene therapy involves the delivery of deoxyribonucleic acid (DNA) into cells to override or replace a malfunctioning gene for treating debilitating genetic diseases, including cancer and neurodegenerative diseases. In addition to its use as a therapeutic, it can also serve as a technology to enable regenerative medicine strategies. The central challenge of the gene therapy research arena is developing a safe and effective delivery agent. Since viral vectors have critical immunogenic and tumorogenic safety issues that limit their clinical use, recent efforts have focused on developing non-viral biomaterial based delivery vectors. Cationic polymers are an attractive class of gene delivery vectors due to their structural versatility, ease of synthesis, biodegradability, ability to self-complex into nanoparticles with negatively charged DNA, capacity to carry large cargo, cellular uptake and endosomal escape capacity. In this thesis, we hypothesized that developing a biomaterial library of poly(betaamino esters) (PBAE), a newer class of cationic polymers consisting of biodegradable ester groups, would allow investigating vector design parameters and formulating effective non-viral gene delivery strategies for cancer drug delivery, tissue engineering and stem cell engineering. Consequently, a high-throughput transfection assay was developed to screen the PBAE-based nanoparticles in hard to transfect fibroblast cell lines. To gain mechanistic insights into the nanoparticle formulation process, biophysical properties of the vectors were characterized in terms of molecular weight (MW), nanoparticle size, zeta potential and plasmid per particle count. We report a novel assay developed for quantifying the plasmid per nanoparticle count and studying its implications for co-delivery of multiple genes. The MW of the polymers ranged from 10 kDa to 100 kDa, nanoparticle size was about 150 run, zeta potential was about 30 mV in sodium acetate buffer (25 mM, pH 5) and 30 to 100 plasmids were associated with a single polymeric nanoparticle. To develop PBAE vectors for application in cancer drug delivery and 3-D tissue engineered cultures, the gene delivery efficacy of PBAE nanoparticles was evaluated in mammary epithelial cells used as a model for studying normal development of mammary gland as well as the events that lead to development of breast cancer. We investigated how small molecular changes to the end-capping terminal group of the polymer and changes to the polymer MW affect gene delivery in 2-D mammary cell culture compared to 3-D primary organotypic cultured mouse mammary tissue. We reported that the polymers synthesized here are more effective for gene delivery than FuGENERTM HD, one of the leading commercially available reagents for non-viral gene delivery. We also highlighted that transfection of the 3-D organotypic cultures is more difficult than transfection of 2-D cultures, but likely models some of the key challenges for in vivo gene therapy more closely than 2-D cultures. Finally, we evaluated the use of PBAE nanotechnology for genetic manipulation of stem cell fate for regenerative medicine applications. We developed a PBAE nanoparticle based non-viral protocol and compared it with an electroporation based approach to deliver episomal plasmids encoding reprogramming factors for derivation of human induced pluripotent stem cells (hiPSC). The hiPSCs generated using these approaches can be differentiated into specific cell types for in vitro disease modeling and drug screening, specifically to study retinal degeneration.

Cyanobacterium sp. host cell and vector for production of chemical compounds in cyanobacterial cultures

DOEpatents

Piven, Irina; Friedrich, Alexandra; Duhring, Ulf; Uliczka, Frank; Baier, Kerstin; Inaba, Masami; Shi, Tuo; Wang, Kui; Enke, Heike; Kramer, Dan

2014-09-30

A cyanobacterial host cell, Cyanobacterium sp., that harbors at least one recombinant gene for the production of a chemical compounds is provided, as well as vectors derived from an endogenous plasmid isolated from the cell.

Cyanobacterium sp. host cell and vector for production of chemical compounds in Cyanobacterial cultures

DOEpatents

Piven, Irina; Friedrich, Alexandra; Duhring, Ulf; Uliczka, Frank; Baier, Kerstin; Inaba, Masami; Shi, Tuo; Wang, Kui; Enke, Heike; Kramer, Dan

2016-04-19

A cyanobacterial host cell, Cyanobacterium sp., that harbors at least one recombinant gene for the production of a chemical compounds is provided, as well as vectors derived from an endogenous plasmid isolated from the cell.

Expression of hygromycin B resistance in oyster culinary-medicinal mushroom, Pleurotus ostreatus (Jacq.:Fr.)P. Kumm. (higher Basidiomycetes) using three gene expression systems.

PubMed

Dong, Xiaoya; Zhang, Ke; Gao, Yuqian; Qi, Yuancheng; Shen, Jinwen; Qiu, Liyou

2012-01-01

Three hygromycin B phosphotransferase (hph) gene expression systems for culinary-medicinal Oyster mushroom, Pleurotus ostreatus, plasmid pSHC, pAN7-1, and pBHt1 were evaluated through PEG/CaCl(2)-mediated protoplast transformation. Plasmid pSHC is a newly constructed hph gene expression system, composed of Escherichia coli hph gene, the P. ostreatus sdi promoter, and the CaMV35S terminator. The vector pAN7-1 was commonly used for integrative transformation in filamentous fungi. Plasmid pBHtl is a T-DNA binary vector, usually introduced into fungi by Agrobacterium-mediated transformation. The results showed that plasmids pSHC, pAN7-1, and pBHt1 were all integrated into the host chromosomes and expressed hygromycin B resistance in P. ostreatus. pAN7-1 had the highest transformation efficiency and hph gene expression level, pSHC the second, and pBHt1 the lowest. Growth rates of the transformants on plates containing hygromycin B were in correspondence with their hph gene expression levels. To our knowledge, this is the first report on integrated transformation of plasmid pAN7-1 and pBHt1 in P. ostreatus.

Nonviral vectors for cancer gene therapy: prospects for integrating vectors and combination therapies.

PubMed

Ohlfest, John R; Freese, Andrew B; Largaespada, David A

2005-12-01

Gene therapy has the potential to improve the clinical outcome of many cancers by transferring therapeutic genes into tumor cells or normal host tissue. Gene transfer into tumor cells or tumor-associated stroma is being employed to induce tumor cell death, stimulate anti-tumor immune response, inhibit angiogenesis, and control tumor cell growth. Viral vectors have been used to achieve this proof of principle in animal models and, in select cases, in human clinical trials. Nevertheless, there has been considerable interest in developing nonviral vectors for cancer gene therapy. Nonviral vectors are simpler, more amenable to large-scale manufacture, and potentially safer for clinical use. Nonviral vectors were once limited by low gene transfer efficiency and transient or steadily declining gene expression. However, recent improvements in plasmid-based vectors and delivery methods are showing promise in circumventing these obstacles. This article reviews the current status of nonviral cancer gene therapy, with an emphasis on combination strategies, long-term gene transfer using transposons and bacteriophage integrases, and future directions.

Optimization of supercoiled HPV-16 E6/E7 plasmid DNA purification with arginine monolith using design of experiments.

PubMed

Almeida, A M; Queiroz, J A; Sousa, F; Sousa, A

2015-01-26

The progress of DNA vaccines is dependent on the development of suitable chromatographic procedures to successfully purify genetic vectors, such as plasmid DNA. Human Papillomavirus is associated with the development of tumours due to the oncogenic power of E6 and E7 proteins, produced by this virus. The supercoiled HPV-16 E6/E7 plasmid-based vaccine was recently purified with the arginine monolith, with 100% of purity, but only 39% of recovery was achieved. Therefore, the present study describes the application of experimental design tools, a newly explored methodology in preparative chromatography, in order to improve the supercoiled plasmid DNA recovery with the arginine monolith, maintaining the high purity degree. In addition, the importance and influence of pH in the pDNA retention to the arginine ligand was also demonstrated. The Composite Central Face design was validated and the recovery of the target molecule was successfully improved from 39% to 83.5%, with an outstanding increase of more than double, while maintaining 100% of purity. Copyright © 2014 Elsevier B.V. All rights reserved.

Characterization of new plasmids from methylotrophic bacteria.

PubMed

Brenner, V; Holubová, I; Benada, O; Hubácek, J

1991-07-01

Several tens of methanol-utilizing bacterial strains isolated from soil were screened for the presence of plasmids. From the obligate methylotroph Methylomonas sp. strain R103a plasmid pIH36 (36 kb) was isolated and its restriction map was constructed. In pink-pigmented facultative methylotrophs (PPFM), belonging to the genus Methylobacterium four plasmids were detected: plasmids pIB200 (200 kb) and pIB14 (14 kb) in the strain R15d and plasmids pWU14 (14 kb) and pWU7 (7.8 kb) in the strain M17. Because of the small size and the presence of several unique REN sites (HindIII, EcoRI, NcoI), plasmid pWU7 was chosen for the construction of a vector for cloning in methylotrophs. Cointegrates pKWU7A and pKWU7B were formed between pWU7 and the E. coli plasmid pK19 Kmr, which were checked for conjugative transfer from E. coli into the methylotrophic host.

The use of the replication region of plasmid pRS7 from Oenococcus oeni as a putative tool to generate cloning vectors for lactic acid bacteria.

PubMed

Rodríguez, M Carmen; Alegre, M Teresa; Martín, M Cruz; Mesas, Juan M

2015-01-01

A chimeric plasmid, pRS7Rep (6.1 kb), was constructed using the replication region of pRS7, a large plasmid from Oenococcus oeni, and pEM64, a plasmid derived from pIJ2925 and containing a gene for resistance to chloramphenicol. pRS7Rep is a shuttle vector that replicates in Escherichia coli using its pIJ2925 component and in lactic acid bacteria (LAB) using the replication region of pRS7. High levels of transformants per µg of DNA were obtained by electroporation of pRS7Rep into Pediococcus acidilactici (1.5 × 10(7)), Lactobacillus plantarum (5.7 × 10(5)), Lactobacillus casei (2.3 × 10(5)), Leuconostoc citreum (2.7 × 10(5)), and Enterococcus faecalis (2.4 × 10(5)). A preliminary optimisation of the technical conditions of electrotransformation showed that P. acidilactici and L. plantarum are better transformed at a later exponential phase of growth, whereas L. casei requires the early exponential phase for better electrotransformation efficiency. pRS7Rep contains single restriction sites useful for cloning purposes, BamHI, XbaI, SalI, HincII, SphI and PstI, and was maintained at an acceptable rate (>50%) over 100 generations without selective pressure in L. plantarum, but was less stable in L. casei and P. acidilactici. The ability of pRS7Rep to accept and express other genes was assessed. To the best of our knowledge, this is the first time that the replication region of a plasmid from O. oeni has been used to generate a cloning vector. Copyright © 2014 Elsevier Inc. All rights reserved.

Mutagenesis and Genome Engineering of Epstein-Barr Virus in Cultured Human Cells by CRISPR/Cas9.

PubMed

Yuen, Kit-San; Chan, Chi-Ping; Kok, Kin-Hang; Jin, Dong-Yan

2017-01-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR associated protein 9 nuclease (Cas9) system is a powerful genome-editing tool for both chromosomal and extrachromosomal DNA. DNA viruses such as Epstein-Barr virus (EBV), which undergoes episomal replication in human cells, can be effectively edited by CRISPR/Cas9. We have demonstrated targeted editing of the EBV genome by CRISPR/Cas9 in several lines of EBV-infected cells. CRISPR/Cas9-based mutagenesis and genome engineering of EBV provides a new method for genetic analysis, which has some advantages over bacterial artificial chromosome-based recombineering. This approach might also prove useful in the cure of EBV infection. In this chapter, we use the knockout of the BART promoter as an example to detail the experimental procedures for construction of recombinant EBV in human cells.

Estimated breeding values for canine hip dysplasia radiographic traits in a cohort of Australian German Shepherd dogs.

PubMed

Wilson, Bethany J; Nicholas, Frank W; James, John W; Wade, Claire M; Thomson, Peter C

2013-01-01

Canine hip dysplasia (CHD) is a serious and common musculoskeletal disease of pedigree dogs and therefore represents both an important welfare concern and an imperative breeding priority. The typical heritability estimates for radiographic CHD traits suggest that the accuracy of breeding dog selection could be substantially improved by the use of estimated breeding values (EBVs) in place of selection based on phenotypes of individuals. The British Veterinary Association/Kennel Club scoring method is a complex measure composed of nine bilateral ordinal traits, intended to evaluate both early and late dysplastic changes. However, the ordinal nature of the traits may represent a technical challenge for calculation of EBVs using linear methods. The purpose of the current study was to calculate EBVs of British Veterinary Association/Kennel Club traits in the Australian population of German Shepherd Dogs, using linear (both as individual traits and a summed phenotype), binary and ordinal methods to determine the optimal method for EBV calculation. Ordinal EBVs correlated well with linear EBVs (r = 0.90-0.99) and somewhat well with EBVs for the sum of the individual traits (r = 0.58-0.92). Correlation of ordinal and binary EBVs varied widely (r = 0.24-0.99) depending on the trait and cut-point considered. The ordinal EBVs have increased accuracy (0.48-0.69) of selection compared with accuracies from individual phenotype-based selection (0.40-0.52). Despite the high correlations between linear and ordinal EBVs, the underlying relationship between EBVs calculated by the two methods was not always linear, leading us to suggest that ordinal models should be used wherever possible. As the population of German Shepherd Dogs which was studied was purportedly under selection for the traits studied, we examined the EBVs for evidence of a genetic trend in these traits and found substantial genetic improvement over time. This study suggests the use of ordinal EBVs could increase the rate of genetic improvement in this population.

Bacterial plasmid transfer under space flight conditions: The Mobilisatsia experience

NASA Astrophysics Data System (ADS)

de Boever, P.; Ilyin, V.; Mahillon, J.; Mergeay, M.

Background Microorganisms are subject to a genetic evolution which may lead to the capacity to colonize new environments and to cause infections Central players in this evolutionary process are mobile genetic elements phages plasmids and transposons The latter help to mobilize and reorganize genes be it within a given genome intragenomic mobility or between bacterial cells intercellular mobility Confined environment and space flight related factors such as microgravity and cosmic radiation may influence the frequency with which mobile genetic elements are exchanged between microorganisms Aim Within the frame of the Mobilisatsia experiment a triparental microbial plasmid transfer was promoted aboard the International Space Station ISS The efficiency of the plasmid exchange process was compared with a synchronously performed ground control experiment An experiment was carried out with well-characterized Gram-negative test strains and one experiment was done with Gram-positive test strains Results The experiment took place during the Soyouz Mission 8 to the ISS from April 19th until April 30th 2004 Liquid cultures of the bacterial strains Cupriavidus metallidurans AE815 final recipient Escherichia coli CM1962 carrying a mobilisable vector with a nickel-resistance marker and E coli CM140 carrying the Broad Host Range plasmid RP4 for the Gram-negative experiment and Bacillus thuringiensis Bti AND931 carrying the conjugative plasmid pXO16 Bti 4Q7 with mobilisable vector pC194 carrying a resistance to chloramphenicol and Bti GBJ002

Epstein-Barr virus in oral shedding of children with multiple sclerosis

PubMed Central

Yea, Carmen; Tellier, Raymond; Chong, Patrick; Westmacott, Garrett; Marrie, Ruth Ann; Bar-Or, Amit

2013-01-01

Objective: To investigate Epstein-Barr virus (EBV) oral shedding frequency and EBV genetic diversity in pediatric patients with multiple sclerosis (MS). Methods: This was a prospective case-control study. We used PCR-based assays to detect viral DNA in the monthly mouth swabs of 22 pediatric patients with MS and 77 age- and sex-matched healthy controls. EBV-positive samples were further analyzed for sequence variation in the EBV BCRF1 (ebvIL-10) gene using direct DNA sequencing methods, and in the EBV LMP1 gene by mass spectrometry. Results: Nineteen of the 22 (86.4%) children with MS were seropositive for remote EBV infection compared to 35 out of 77 (45.5%) healthy controls (p = 0.008). Baseline analysis of mouth swabs revealed a higher proportion of EBV-positive samples from EBV-seropositive patients with MS compared to EBV-seropositive healthy controls (52.6% vs 20%, p = 0.007). Longitudinal analysis of monthly swabs revealed average EBV detection rates of 50.6% in patients with MS and 20.4% in controls (p = 0.01). The oral shedding frequencies of Herpesviruses herpes simplex virus–1, cytomegalovirus, human herpesvirus (HHV)-6, and HHV-7 did not differ between groups. Changes in the predominant EBV genetic variants were detected more frequently in patients with MS; however, no specific EBV genetic variant was preferentially associated with MS. Conclusion: Children with MS demonstrate abnormally increased rates of EBV viral reactivation and a broader range of genetic variants, suggesting a selective impairment in their immunologic control of EBV. PMID:24014504

[Construction of the superantigen SEA transfected laryngocarcinoma cells].

PubMed

Ji, Xiaobin; Jingli, J V; Liu, Qicai; Xie, Jinghua

2013-04-01

To construct an eukaryotic expression vectors containing superantigen staphylococcal enterotoxin A (SEA) gene, and to identify its expression in laryngeal squamous carcinoma cells. SEA full-length gene fragment was obtained from ATCC13565 genome of the staphylococcus, referencing standard strains producing SEA. Coding sequence of SEA was artificially synthetized. Than, SEA gene fragments was subcloned into eukaryotic expression vector pIRES-EGFP. The recombinant plasmid pSEA-IRES-EGFP was constructed and was transfected to laryngocarcinoma Hep-2 cells. Resistant clones were screened by G418. The expression of SEA in laryngocarcinoma cells was identified with ELISA and RT-PCR method. The subclone of artificially synthetized SEA gene was subclone to eukaryotic expression vector pires-EGFP. Flanking sequence confirmed that SEA sequence was fully identical to the coding sequence of standard staphylococcus strains ATCC13565 in Genbank. After recombinant plasmid transfected to laryngocarcinoma cells, the resistant clones was obtained after screening for two weeks. The clones were selected. The specific gene fragment was obtained by RT-PCR amplification. ELISA assay confirmed that the content of SEA protein in supernatant fluid of cell culture had reached about Pg level. The recombinant eukaryotic expression vector containing superantigen SEA gene is successfully constructed, and is capable of effective expression and continued secretion of SEA protein in laryngochrcinoma Hep-2 cells after recombinant plasmid transfected to laryngocarcinoma cells.

EGCG debilitates the persistence of EBV latency by reducing the DNA binding potency of nuclear antigen 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Ya-Lin; Tsai, Hsing-Lyn; Peng, Chih-Wen, E-mail: pengcw@mail.tcu.edu.tw

Highlights: Black-Right-Pointing-Pointer Two cell-based reporter platforms were established for screening of EBNA1 inhibitors. Black-Right-Pointing-Pointer EGCG acts as an inhibitor to block EBNA1 binding with the cognate oriP sequence. Black-Right-Pointing-Pointer EGCG debilitates EBNA1-dependent transcription enhancement and episome maintenance. Black-Right-Pointing-Pointer EGCG impairs persistence of EBV latency. Black-Right-Pointing-Pointer EGCG is a potent anti-EBV agent for targeting the latent cascade of EBV. -- Abstract: Because the expression of EBNA1 is prevalent in all EBV-associated tumors, it has become one of the most attractive drug targets for the discovery of anti-EBV compounds. In a cell-based reporter system, EBNA1 consistently upregulated the transcription of an oriP-Lucmore » mini-EBV episome by 6- to 8-fold. The treatment of cells with 50 {mu}M EGCG effectively blocked the binding of EBNA1 to oriP-DNA both in vivo and in vitro, which led to the abrogation of EBNA1-dependent episome maintenance and transcriptional enhancement. Importantly, the anti-EBNA1 effects caused by EGCG ultimately impaired the persistence of EBV latent infection. Our data suggest that the inhibition of EBNA1 activity by EGCG could be a promising starting point for the development of new protocols for anti-EBV therapy.« less

Functional characterization of replication and stability factors of an incompatibility group P-1 plasmid from Xylella fastidiosa.

PubMed

Lee, Min Woo; Rogers, Elizabeth E; Stenger, Drake C

2010-12-01

Xylella fastidiosa strain riv11 harbors a 25-kbp plasmid (pXF-RIV11) belonging to the IncP-1 incompatibility group. Replication and stability factors of pXF-RIV11 were identified and used to construct plasmids able to replicate in X. fastidiosa and Escherichia coli. Replication in X. fastidiosa required a 1.4-kbp region from pXF-RIV11 containing a replication initiation gene (trfA) and the adjacent origin of DNA replication (oriV). Constructs containing trfA and oriV from pVEIS01, a related IncP-1 plasmid of the earthworm symbiont Verminephrobacter eiseniae, also were competent for replication in X. fastidiosa. Constructs derived from pXF-RIV11 but not pVEIS01 replicated in Agrobacterium tumefaciens, Xanthomonas campestris, and Pseudomonas syringae. Although plasmids bearing replication elements from pXF-RIV11 or pVEIS01 could be maintained in X. fastidiosa under antibiotic selection, removal of selection resulted in plasmid extinction after 3 weekly passages. Addition of a toxin-antitoxin addiction system (pemI/pemK) from pXF-RIV11 improved plasmid stability such that >80 to 90% of X. fastidiosa cells retained plasmid after 5 weekly passages in the absence of antibiotic selection. Expression of PemK in E. coli was toxic for cell growth, but toxicity was nullified by coexpression of PemI antitoxin. Deletion of N-terminal sequences of PemK containing the conserved motif RGD abolished toxicity. In vitro assays revealed a direct interaction of PemI with PemK, suggesting that antitoxin activity of PemI is mediated by toxin sequestration. IncP-1 plasmid replication and stability factors were added to an E. coli cloning vector to constitute a stable 6.0-kbp shuttle vector (pXF20-PEMIK) suitable for use in X. fastidiosa.

Construction of a food-grade cloning vector for Lactobacillus plantarum and its utilization in a food model.

PubMed

Rattanachaikunsopon, Pongsak; Phumkhachorn, Parichat

2012-01-01

The development of Lactobacillus plantarum to be used in starter cultures in the food industry has been limited because of the lack of a food-grade cloning vector for the bacterium. In this study, the plasmid pFLP1 was constructed by joining 2 DNA fragments derived from food-approved organisms. The 5.2-kb BamHI/KpnI DNA fragment of pRV566 containing the theta-type replicon of Lactobacillus sakei was ligated to the BamHI/KpnI DNA fragment of a 2.9-kb lactococcal cadmium resistance determinant amplified from pND918. The 8.1-kb newly constructed plasmid could transform L. plantarum N014, a bacteriocin-producing bacteria originally isolated from nham, a traditional Thai fermented sausage. The resulting transformant, L. plantarum N014-FLP, and its parent strain were shown to be very similar in growth rate and bacteriocin activity. In addition, the plasmid was very stable in its host bacteria under nonselective pressure for 100 generations in MRS medium and for 5 days in a nham model. These results suggest that pFLP1 is a potential food-grade cloning vector for L. plantarum.

Partial Least Squares Based Gene Expression Analysis in EBV- Positive and EBV-Negative Posttransplant Lymphoproliferative Disorders.

PubMed

Wu, Sa; Zhang, Xin; Li, Zhi-Ming; Shi, Yan-Xia; Huang, Jia-Jia; Xia, Yi; Yang, Hang; Jiang, Wen-Qi

2013-01-01

Post-transplant lymphoproliferative disorder (PTLD) is a common complication of therapeutic immunosuppression after organ transplantation. Gene expression profile facilitates the identification of biological difference between Epstein-Barr virus (EBV) positive and negative PTLDs. Previous studies mainly implemented variance/regression analysis without considering unaccounted array specific factors. The aim of this study is to investigate the gene expression difference between EBV positive and negative PTLDs through partial least squares (PLS) based analysis. With a microarray data set from the Gene Expression Omnibus database, we performed PLS based analysis. We acquired 1188 differentially expressed genes. Pathway and Gene Ontology enrichment analysis identified significantly over-representation of dysregulated genes in immune response and cancer related biological processes. Network analysis identified three hub genes with degrees higher than 15, including CREBBP, ATXN1, and PML. Proteins encoded by CREBBP and PML have been reported to be interact with EBV before. Our findings shed light on expression distinction of EBV positive and negative PTLDs with the hope to offer theoretical support for future therapeutic study.

Attenuated Salmonella enterica serovar Typhi and Shigella flexneri 2a strains mucosally deliver DNA vaccines encoding measles virus hemagglutinin, inducing specific immune responses and protection in cotton rats.

PubMed

Pasetti, Marcela F; Barry, Eileen M; Losonsky, Genevieve; Singh, Mahender; Medina-Moreno, Sandra M; Polo, John M; Ulmer, Jeffrey; Robinson, Harriet; Sztein, Marcelo B; Levine, Myron M

2003-05-01

Measles remains a leading cause of child mortality in developing countries. Residual maternal measles antibodies and immunologic immaturity dampen immunogenicity of the current vaccine in young infants. Because cotton rat respiratory tract is susceptible to measles virus (MV) replication after intranasal (i.n.) challenge, this model can be used to assess the efficacy of MV vaccines. Pursuing a new measles vaccine strategy that might be effective in young infants, we used attenuated Salmonella enterica serovar Typhi CVD 908-htrA and Shigella flexneri 2a CVD 1208 vaccines to deliver mucosally to cotton rats eukaryotic expression plasmid pGA3-mH and Sindbis virus-based DNA replicon pMSIN-H encoding MV hemagglutinin (H). The initial i.n. dose-response with bacterial vectors alone identified a well-tolerated dosage (1 x 10(9) to 7 x 10(9) CFU) and a volume (20 micro l) that elicited strong antivector immune responses. Animals immunized i.n. on days 0, 28, and 76 with bacterial vectors carrying DNA plasmids encoding MV H or immunized parenterally with these naked DNA vaccine plasmids developed MV plaque reduction neutralizing antibodies and proliferative responses against MV antigens. In a subsequent experiment of identical design, cotton rats were challenged with wild-type MV 1 month after the third dose of vaccine or placebo. MV titers were significantly reduced in lung tissue of animals immunized with MV DNA vaccines delivered either via bacterial live vectors or parenterally. Since attenuated serovar Typhi and S. flexneri can deliver measles DNA vaccines mucosally in cotton rats, inducing measles immune responses (including neutralizing antibodies) and protection, boosting strategies can now be evaluated in animals primed with MV DNA vaccines.

Modulating ectopic gene expression levels by using retroviral vectors equipped with synthetic promoters.

PubMed

Ferreira, Joshua P; Peacock, Ryan W S; Lawhorn, Ingrid E B; Wang, Clifford L

2011-12-01

The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evaluation using plasmid vectors integrated at a single site in the genome revealed that these various synthetic promoters were capable of expression levels spanning a 40-fold range. Retroviral vectors were equipped with the synthetic promoters and evaluated for their ability to reproduce the graded expression demonstrated by plasmid integration. A vector with a self-inactivating long terminal repeat could neither reproduce the full range of expression levels nor produce stable expression. Using a second vector design, the different synthetic promoters enabled stable expression over a broad range of expression levels in different cell lines. The online version of this article (doi:10.1007/s11693-011-9089-0) contains supplementary material, which is available to authorized users.

[Prokaryotic expression and histological localization of the Taenia solium CDC37 gene].

PubMed

Huang, Jiang; Li, Bo; Dai, Jia-Lin; Zhang, Ai-Hua

2013-02-01

To express Taenia solium gene encoding cell division cycle 37 protein (TsCDC37) and investigate its antigenicity and localization in adults of Taenia solium. The complete coding sequence of TsCDC37 was amplified by PCR based on the recombinant plasmid clone from the cDNA library of adult Taenia solium. The PCR product was cloned into a prokaryotic expression vector pET-28a (+). The recombinant expression plasmid was identified by PCR, double endonuclease digestion and sequencing. The recombinant plasmid was transformed into E. coli BL21/DE3 and followed by expression of the protein induced by IPTG. The mice were immunized subcutaneously with purified recombinant TsCDC37 formulated in Freund's adjuvant. The antigenicity of the recombinant protein was examined by Western blotting. The localization of TsCDC37 in adult worms was demonstrated by immunofluorescent technique. The recombinant expression vector was constructed successfully. The recombinant protein was about M(r) 52 000, it was then purified and specifically recognized by immuno sera of SD rats and sera from patients infected with Taenia solium, Taenia saginata or Taenia asiatica. The immunofluorescence assay revealed that TsCDC37 located at the tegument of T. solium adult and the eggs. TsCDC37 gene has been expressed with immunoreactivity. The recombinant protein is mainly expressed in tegument and egg, and is a common antigen of the three human taenia cestodes.

A convenient method of preparing gene vector for real time monitoring transfection process based on the quantum dots

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Hai-Li; Zhang, Ming-Zhen; Li, Xiang-Yong

2012-11-15

Highlights: ► An easy and direct way to prepare QDs–DNA complexes was developed. ► Surface charge of QDs was tuned with different ratio of amino and glycolate. ► Transfection efficiency was dependent on the surface zeta potentials of QDs. ► Cellular toxicity of this gene vectors is much lower than commercial liposome. ► Whole intracellular behavior of QDs–DNA complexes can be monitored in real time. -- Abstract: Nanoparticle carrier has been developed by combining water-soluble quantum dots and plasmid DNA expressed enhanced green fluorescent protein (EGFP) in a convenient and direct way. First the QDs with different surface charges weremore » obtained by coating with amino and carboxyl terminals at different ratios. Then plasmid DNA was conjugated to QDs via electrostatic interaction. The resultant QDs–DNA complexes showed enhanced resistance to DNase I digestion. The following transfection experiments demonstrated that the transfection efficiency was dependent on the surface charges on QDs. The real time imaging of the transfection process showed that the nanoparticles experienced binding, penetrating the cell membrane and entering cytoplasm in the first 6 h of transfection. The green fluorescence of EGFP began to appear after 18 h transfection and plasmid DNA was fully expressed in the following 6 h. This new QDs–DNA platform showed great potential as new gene delivery carrier.« less

[Inhibiting target gene expression and controlling growth of Epstein-Barr virus transformed cells by antisense RNA transcripts].

PubMed

Chen, Jian-jing; Raab-Traub, Nancy; Yao, Qing-yun; Zhang, Feng; Huang, Mei-ling; Kuang, Zhu-ji; Zhang, Xiao-shi; Ye, Yan-li; Gu, Li

2002-01-01

The latent membrane protein gene (LMP) of Epstein-Barr virus (EBV) was thought to play an important role in the carcinogenesis of nasopharyngeal carcinoma (NPC). In this study, the authors investigated the effects of antisense RNA (AsRNA) on LMP for down regulating at the target gene over expression in EBV transformed lymphoid cells, and set up an antisense system to inhibit LMP expression. Constructing the single strand antisense transcription system in vitro, the authors have got large amount of AsRNA. Designing and setting up an antisense tracing system in situ (ATSIS), the authors could observe the living particles of AsRNA/sense RNA duplex dimer. With time lapse phase-contrast microscopy, the agglutination phenotype on living cells was easily detected by MTT test, the inhibition rate on EBV transformed cells was calculated. LMP 1.9 fragment ligated into pGEM vector in reverse orientation have been constructed and produced a plentiful amount of AsLMPmRNA which could incorporated into both B95-8 and C1936 cell lines by endophagocytosis and formed the duplex dimer of As/Sense RNA. This particles have been visualized in situ when labelling 35S isotope by ATSIS. When AsLMPmRNA acted as agents for specific inhibition to LMP over expression, the transform phenotype of cell agglutination have been suppressed and MTT particle formatin was apparently reduced both two EBV tansformed cell lines. AsLMPmRNA targets at sense strand have a high effectiveness of down-regulation on EBV-LMP overexpression. This down regulating function of LMP and growth inhibition on transformed cell is demonstrated by the antisenes tracing system in situ (ATSIS). The results provide a clue to overcome the latent EBV infection in human bodies all living long time and to prevent it inducing NPC in high incidence area by antisense strategies.

[The induction of neovascularization in chorioallantoic membrane of chicken embryos transfected by a recombinant plasmid containing human angiogenin gene].

PubMed

Avdeeva, S V; Khaĭdarova, N V; Logunov, D Iu; Neugodova, G L; Sevast'ianova, G A; Tarantul, V Z; Naroditskiĭ, B S

2003-01-01

A method was elaborated to evaluate the biological activity of expression products of gene in the plasmid vectors, which are crucial for the synthesis of growth factor of blood vessels. It was proven as possible that the chrioallantonic membrane (CAM) of chicken's embryos could be transfected by recombinant plasmids containing both the reporter and target genes. The efficiency of CAM transfection was assessed by a plasmid carrying the reporter gene of green fluorescent protein (GFP). Finally, it was demonstrated that, at an infiltration of the recombinant plasmid containing the human angiogenine gene, its expression products induce the neovascularization in the CAM cells of chicken's embryos and stimulate an accretion in vessels of the 1st, 2nd and 3d orders.

Hypoxia-response plasmid vector producing bcl-2 shRNA enhances the apoptotic cell death of mouse rectum carcinoma.

PubMed

Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro

2010-01-01

Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].

[Construction of the lentiviral expression vector for anti-p185(erbB2) mouse/human chimeric antibody].

PubMed

Liu, Fang; Li, Li; Zhang, Wei; Wang, Qi

2013-04-01

This research was to construct the lentiviral expression vector for anti- p185(erbB2) mouse/human chimeric antibody and to determine the expression of the chimeric antibody gene in 293T cells transfected with this vector. The genes (vL and vH) coding light and heavy chain of variable regions of anti-p185(erbB2) mAb and the constant regions of human IgG1 (kappa and gamma1) were cloned with PCR method. The target genes were assembled by three-primers PCR method to obtain the chimeric light chain (L) and the chimeric heavy chain (H). Both chains inserted into the down stream and upper stream of IRES gene of the plasmid pVAX1/IRES respectively. We digested the plasmid pVAX1/ H-IRES-L with endoenzyme and subcloned H-IRES-L into the lentiviral vector pWPI. The enzyme digestion and sequence analysis showed that the lentiviral expression vector pWPI/H-IRES-L was constructed correctly. Then, it was transfected into 293T cells and after 48h, GFP protein expression in 293T cells were detected by fluorescent microscope and the chimeric antibody expression was detected by RT-PCR and direct ELISA. The results showed that after 293T cells were transfected with recombination plasmid, both light and heavy chains of the chimeric antibody genes could express together. The chimeric antibody expressed could bind to p185(erbB2) specifically. This research may lay a sound foundation for further study of anti-p185(erbB2) engineered antibody.

An epidemiologic study of index and family infectious mononucleosis and adult Hodgkin's disease (HD): evidence for a specific association with EBV+ve HD in young adults.

PubMed

Alexander, Freda E; Lawrence, Davia J; Freeland, June; Krajewski, Andrew S; Angus, Brian; Taylor, G Malcolm; Jarrett, Ruth F

2003-11-01

Infectious mononucleosis (IM) is an established risk factor for Hodgkin's disease (HD). A substantial minority (33%) of cases of HD have Epstein-Barr virus (EBV) DNA within the malignant cells (are EBV+ve). It is unclear whether risk after IM applies specifically to EBV+ve HD. We report the results of a population-based case-control study of HD in adults (n = 408 cases of classical HD, 513 controls) aged 16-74 years; the case series included 113 EBV+ve and 243 EBV+ve HD. Analyses compared total HD, EBV+ve HD and EBV-ve HD with the controls and EBV+ve HD with EBV-ve HD cases using, mainly, logistic regression. Regression analyses were adjusted for gender, age-group and socioeconomic status, and were performed for the whole age range and separately for young (< 35 years) and old adults (> or = 35 years); formal tests of effect modification by age were included. For the young adults, reported IM in index or relative was strongly and significantly associated with EBV+ve HD when compared to controls (odds ratio [OR] = 2.94, 95% confidence interval [CI]: 1.08-7.98 and OR = 5.22, 95% CI: 2.15-12.68, respectively). These results may be interpreted as indications that late first exposure to EBV increases risk of HD, especially in young adults; this applies primarily to EBV+ve HD. Copyright 2003 Wiley-Liss, Inc.

Epstein-Barr Virus Sequence Variation—Biology and Disease

PubMed Central

Tzellos, Stelios; Farrell, Paul J.

2012-01-01

Some key questions in Epstein-Barr virus (EBV) biology center on whether naturally occurring sequence differences in the virus affect infection or EBV associated diseases. Understanding the pattern of EBV sequence variation is also important for possible development of EBV vaccines. At present EBV isolates worldwide can be grouped into Type 1 and Type 2, a classification based on the EBNA2 gene sequence. Type 1 EBV is the most prevalent worldwide but Type 2 is common in parts of Africa. Type 1 transforms human B cells into lymphoblastoid cell lines much more efficiently than Type 2 EBV. Molecular mechanisms that may account for this difference in cell transformation are now becoming clearer. Advances in sequencing technology will greatly increase the amount of whole EBV genome data for EBV isolated from different parts of the world. Study of regional variation of EBV strains independent of the Type 1/Type 2 classification and systematic investigation of the relationship between viral strains, infection and disease will become possible. The recent discovery that specific mutation of the EBV EBNA3B gene may be linked to development of diffuse large B cell lymphoma illustrates the importance that mutations in the virus genome may have in infection and human disease. PMID:25436768

Genetic manipulation of clostridium acetobutylicum for enhanced butanol production

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blaschek, H.P.; Holt, S.

Recent developments in the genetic manipulation of the acetone-butanol-ethanol fermentation microorganism, Clostridium acetobutylicum will be discussed. This specifically involves the characterization of an M13-like genetic system for C. acetobutylicum based on the pCAK1 phagemid, as well as the development of a plasmid-based vector based on the indigenous pDM11 plasmid recovered from C. acetobutylicum NCIB 6443. In addition, a macrorestriction map of the C. acetobutylicum ATCC 824 genome was constructed by utilizing two-dimensional transverse alternating field electrophoresis combined with reciprocal enzyme digestions and hybridization with previously cloned genes. We also describe the genetic engineering of a C. acetobutylicum strain with amplifiedmore » encloglucanase activity and to development and characterization of C. acetobutylicum hyper-amylolytic mutants with enhanced potential for commercial processes and evaluate their ability to produce butanol under batch and continuous culture conditions.« less

[Epstein-Barr virus associated gastric carcinoma: the genetic alteration and the expression of CD44 variant].

PubMed

Chong, J M; Fukayama, M

1997-02-01

Epstein-Barr virus (EBV), a ubiquitous human herpes virus, was recently identified in 2-16% of gastric carcinomas. EBV-encoded small RNA was found in nearly all of the carcinoma cells even at the intramucosal stage. EBV in EBV associated gastric carcinoma (EBVaGC) is monoclonal based on Southern blot hybridization using probes adjacent to the unique terminal repeat of EBV-DNA. Furthermore, the genetic pathway of this carcinogenesis is different of EBVaGC: deletion of 5q and/or 17p and microsatellite instability are extremely rare in EBVaGC, in contrast to their high frequency in EBV-negative carcinomas. We also examined the relationship between the expression of CD44 variants and EBVaGC, and found the expression of CD44 variants was significantly correlated with EBV-etiology.

Plasmids from Food Lactic Acid Bacteria: Diversity, Similarity, and New Developments

PubMed Central

Cui, Yanhua; Hu, Tong; Qu, Xiaojun; Zhang, Lanwei; Ding, Zhongqing; Dong, Aijun

2015-01-01

Plasmids are widely distributed in different sources of lactic acid bacteria (LAB) as self-replicating extrachromosomal genetic materials, and have received considerable attention due to their close relationship with many important functions as well as some industrially relevant characteristics of the LAB species. They are interesting with regard to the development of food-grade cloning vectors. This review summarizes new developments in the area of lactic acid bacteria plasmids and aims to provide up to date information that can be used in related future research. PMID:26068451

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis.

PubMed

Santangelo, K S; Bertone, A L

2011-12-01

To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RT-PCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2(-ΔΔCT)) method. Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P=0.0045) or >90% (P=0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. Copyright © 2011 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

Electrotransfer of Plasmid Vector DNA into Muscle

NASA Astrophysics Data System (ADS)

Miyazaki, Satsuki; Miyazaki, Jun-Ichi

Wolff et al. (1990) first reported that plasmid DNA injected into skeletal muscle is taken up by muscle cells and the genes in the plasmid are expressed for more than two months thereafter, although the transfected DNA does not usually undergo chromosomal integration (Wolff et al., 1991, 1992). However, the relatively low expression levels attained by this method have hampered its applications for uses other than as a DNA vaccine (Davis et al., 1995). There are a number of reports analyzing the conditions that affect the efficiency of gene transfer by intramuscular DNA injection and assessing the fine structures of expression plasmid vectors that may affect expression levels (Davis et al., 1993; Liang et al., 1996; Norman et al., 1997). Furthermore, various attempts were done to improve the efficiency of gene transfer by intramus cular DNA injection. Consequently, regenerating muscle was shown to produce 80-fold or more protein than did normal muscle, following injection of an expression plas-mid. Muscle regeneration was induced by treatment with cardiotoxin or bupivacaine (Wells, 1993; Vitadello et al., 1994). We previously demonstrated that by combining a strong promoter and bupivacaine pretreatment intramuscular injection of an IL-5 expression plasmid results in IL-5 production in muscle at a level sufficient to induce marked proliferation of eosinophils in the bone marrow and eosinophil infiltration of various organs (Tokui et al., 1997). It was also reported that a single intramuscular injection of an erythropoietin expression plasmid produced physiologically significant elevations in serum erythropoietin levels and increased hematocrits in adult mice (Tripathy et al., 1996). Hematocrits in these animals remained elevated at >60% for at least 90 days after a single injection. However, improvements to this method have not been sufficient to extend its applications including clinical use.

Plasmid-mediated resistance to protein biosynthesis inhibitors in staphylococci.

PubMed

Schwarz, Stefan; Fessler, Andrea T; Hauschild, Tomasz; Kehrenberg, Corinna; Kadlec, Kristina

2011-12-01

Protein biosynthesis inhibitors (PBIs) represent powerful antimicrobial agents for the control of bacterial infections. In staphylococci, numerous resistance genes are known to be involved in resistance to PBIs, most of which mediate resistance to a specific class/subclass of PBIs, though a few genes do confer a multidrug resistance phenotype-up to five classes/subclasses of PBIs. Plasmids play a key role in the dissemination of PBI resistance among staphylococci, as they primarily carry plasmid-borne PBI resistance genes; however, plasmids also can be vectors for transposon-borne PBI resistance genes. Small plasmids that carry single PBI resistance genes are widespread among staphylococci of human and animal origin. Various mechanisms exist by which they can recombine, form cointegrates, or integrate into chromosomal DNA or larger plasmids. We provide an overview of the current knowledge of plasmid-mediated PBI resistance in staphylococci, with particular reference to the currently known PBI resistance genes, their association with mobile genetic elements, and the recombination/integration processes that control their mobility. © 2011 New York Academy of Sciences.

Gene Amplification by PCR and Subcloning into a GFP-Fusion Plasmid Expression Vector as a Molecular Biology Laboratory Course

ERIC Educational Resources Information Center

Bornhorst, Joshua A.; Deibel, Michael A.; Mulnix, Amy B.

2004-01-01

A novel experimental sequence for the advanced undergraduate laboratory course has been developed at Earlham College. Utilizing recent improvements in molecular techniques for a time-sensitive environment, undergraduates were able to create a chimera of a selected gene and green fluorescent protein (GFP) in a bacterial expression plasmid over the…

Vaccines against Botulism.

PubMed

Sundeen, Grace; Barbieri, Joseph T

2017-09-02

Botulinum neurotoxins (BoNT) cause the flaccid paralysis of botulism by inhibiting the release of acetylcholine from motor neurons. There are seven serotypes of BoNT (A-G), with limited therapies, and no FDA approved vaccine for botulism. An investigational formalin-inactivated penta-serotype-BoNT/A-E toxoid vaccine was used to vaccinate people who are at high risk of contracting botulism. However, this formalin-inactivated penta-serotype-BoNT/A-E toxoid vaccine was losing potency and was discontinued. This article reviews the different vaccines being developed to replace the discontinued toxoid vaccine. These vaccines include DNA-based, viral vector-based, and recombinant protein-based vaccines. DNA-based vaccines include plasmids or viral vectors containing the gene encoding one of the BoNT heavy chain receptor binding domains (HC). Viral vectors reviewed are adenovirus, influenza virus, rabies virus, Semliki Forest virus, and Venezuelan Equine Encephalitis virus. Among the potential recombinant protein vaccines reviewed are HC, light chain-heavy chain translocation domain, and chemically or genetically inactivated holotoxin.

Vaccines against Botulism

PubMed Central

Sundeen, Grace; Barbieri, Joseph T.

2017-01-01

Botulinum neurotoxins (BoNT) cause the flaccid paralysis of botulism by inhibiting the release of acetylcholine from motor neurons. There are seven serotypes of BoNT (A-G), with limited therapies, and no FDA approved vaccine for botulism. An investigational formalin-inactivated penta-serotype-BoNT/A-E toxoid vaccine was used to vaccinate people who are at high risk of contracting botulism. However, this formalin-inactivated penta-serotype-BoNT/A-E toxoid vaccine was losing potency and was discontinued. This article reviews the different vaccines being developed to replace the discontinued toxoid vaccine. These vaccines include DNA-based, viral vector-based, and recombinant protein-based vaccines. DNA-based vaccines include plasmids or viral vectors containing the gene encoding one of the BoNT heavy chain receptor binding domains (HC). Viral vectors reviewed are adenovirus, influenza virus, rabies virus, Semliki Forest virus, and Venezuelan Equine Encephalitis virus. Among the potential recombinant protein vaccines reviewed are HC, light chain-heavy chain translocation domain, and chemically or genetically inactivated holotoxin. PMID:28869493

A universal mini-vector and an annealing of PCR products (APP)-based cloning strategy for convenient molecular biological manipulations.

PubMed

Liu, Xia; Li, Tuoping; Hart, Darren J; Gao, Song; Wang, Hongling; Gao, Herui; Xu, Shumin; Zhang, Yifeng; Liu, Yifei; An, Yingfeng

2018-03-18

Currently, the most widely used strategies for molecular cloning are sticky-end ligation-based cloning, TA cloning, blunt-end ligation-based cloning and ligase-independent cloning. In this study we have developed a novel mini-vector pANY1 which can simultaneously meet the requirements of all these cloning strategies. In addition, the selection of appropriate restriction digestion sites is difficult in some cases because of the presence of internal sites. In this study, an annealing of PCR products (APP)-based sticky-end cloning strategy was introduced to avoid this issue. Additionally, false positives occur during molecular cloning, which increases the workload of isolating positive clones. The plasmid pANY1 contains a ccdB cassette between multiple cloning sites, which efficiently avoids these false positives. Therefore, this mini-vector should serve as a useful tool with wide applications in biosciences, agriculture, food technologies, etc. Copyright © 2018 Elsevier Inc. All rights reserved.

Scarless genome editing and stable inducible expression vectors for Geobacter sulfurreducens

DOE PAGES

Chan, Chi Ho; Levar, Caleb E.; Zacharoff, Lori; ...

2015-08-07

Metal reduction by members of the Geobacteraceae is encoded by multiple gene clusters, and the study of extracellular electron transfer often requires biofilm development on surfaces. Genetic tools that utilize polar antibiotic cassette insertions limit mutant construction and complementation. In addition, unstable plasmids create metabolic burdens that slow growth, and the presence of antibiotics such as kanamycin can interfere with the rate and extent of Geobacter biofilm growth. We report here genetic system improvements for the model anaerobic metal-reducing bacterium Geobacter sulfurreducens. A motile strain of G. sulfurreducens was constructed by precise removal of a transposon interrupting the fgrM flagellarmore » regulator gene using SacB/sucrose counterselection, and Fe(III) citrate reduction was eliminated by deletion of the gene encoding the inner membrane cytochrome imcH. We also show that RK2-based plasmids were maintained in G. sulfurreducens for over 15 generations in the absence of antibiotic selection in contrast to unstable pBBR1 plasmids. Therefore, we engineered a series of new RK2 vectors containing native constitutive Geobacter promoters, and modified one of these promoters for VanR-dependent induction by the small aromatic carboxylic acid vanillate. Inducible plasmids fully complemented Δ imcH mutants for Fe(III) reduction, Mn(IV) oxide reduction, and growth on poised electrodes. A real-time, high-throughput Fe(III) citrate reduction assay is described that can screen numerous G. sulfurreducens strain constructs simultaneously and shows the sensitivity of imcH expression by the vanillate system. Lastly, these tools will enable more sophisticated genetic studies in G. sulfurreducens without polar insertion effects or need for multiple antibiotics.« less

A Bivalent Typhoid Live Vector Vaccine Expressing both Chromosome- and Plasmid-Encoded Yersinia pestis Antigens Fully Protects against Murine Lethal Pulmonary Plague Infection

PubMed Central

Wang, Jin Yuan; Carrasco, Jose A.; Lloyd, Scott A.; Mellado-Sanchez, Gabriela; Diaz-McNair, Jovita; Franco, Olga; Buskirk, Amanda D.; Nataro, James P.; Pasetti, Marcela F.

2014-01-01

Live attenuated bacteria hold great promise as multivalent mucosal vaccines against a variety of pathogens. A major challenge of this approach has been the successful delivery of sufficient amounts of vaccine antigens to adequately prime the immune system without overattenuating the live vaccine. Here we used a live attenuated Salmonella enterica serovar Typhi strain to create a bivalent mucosal plague vaccine that produces both the protective F1 capsular antigen of Yersinia pestis and the LcrV protein required for secretion of virulence effector proteins. To reduce the metabolic burden associated with the coexpression of F1 and LcrV within the live vector, we balanced expression of both antigens by combining plasmid-based expression of F1 with chromosomal expression of LcrV from three independent loci. The immunogenicity and protective efficacy of this novel vaccine were assessed in mice by using a heterologous prime-boost immunization strategy and compared to those of a conventional strain in which F1 and LcrV were expressed from a single low-copy-number plasmid. The serum antibody responses to lipopolysaccharide (LPS) induced by the optimized bivalent vaccine were indistinguishable from those elicited by the parent strain, suggesting an adequate immunogenic capacity maintained through preservation of bacterial fitness; in contrast, LPS titers were 10-fold lower in mice immunized with the conventional vaccine strain. Importantly, mice receiving the optimized bivalent vaccine were fully protected against lethal pulmonary challenge. These results demonstrate the feasibility of distributing foreign antigen expression across both chromosomal and plasmid locations within a single vaccine organism for induction of protective immunity. PMID:25332120

Identification and characterization of plasmids from the western aster yellows mycoplasmalike organism.

PubMed Central

Kuske, C R; Kirkpatrick, B C

1990-01-01

Supercoiled double-stranded DNA molecules (plasmids) were isolated from plants infected with three laboratory strains of western aster yellows mycoplasma-like organism (AY-MLO) by using cesium chloride-ethidium bromide density gradients. Southern blot analysis, using plasmids from the severe strain of AY-MLO (SAY-MLO) as the probe, identified at least four plasmids in celery, aster, and periwinkle plants and in Macrosteles severini leafhopper vectors infected with either the dwarf AY-MLO, Tulelake AY-MLO, or SAY-MLO strain. Plasmids were also detected in two California field isolates of AY-MLO but not in plants infected with the beet leafhopper-transmitted virescence agent, western X, or elm yellows MLOs. SAY-MLO plasmids were 5.2, 4.9, 3.4, and 1.7 kilobase pairs in size. Plasmids isolated from dwarf AY- and Tulelake AY-MLOs were 7.4, 5.1, 3.5, and 1.7 kilobase pairs in size. No evidence was obtained for integration of SAY-MLO plasmids into the MLO chromosome. Images FIG. 1 FIG. 2 FIG. 3 FIG. 4 FIG. 5 PMID:2307660

Cationic amino acid based lipids as effective nonviral gene delivery vectors for primary cultured neurons.

PubMed

Aoshima, Yumiko; Hokama, Ryosuke; Sou, Keitaro; Sarker, Satya Ranjan; Iida, Kabuto; Nakamura, Hideki; Inoue, Takafumi; Takeoka, Shinji

2013-12-18

The delivery of specific genes into neurons offers a potent approach for treatment of diseases as well as for the study of neuronal cell biology. Here we investigated the capabilities of cationic amino acid based lipid assemblies to act as nonviral gene delivery vectors in primary cultured neurons. An arginine-based lipid, Arg-C3-Glu2C14, and a lysine-based lipid, Lys-C3-Glu2C14, with two different types of counterion, chloride ion (Cl-) and trifluoroacetic acid (TFA-), were shown to successfully mediate transfection of primary cultured neurons with plasmid DNA encoding green fluorescent protein. Among four types of lipids, we optimized their conditions such as the lipid-to-DNA ratio and the amount of pDNA and conducted a cytotoxicity assay at the same time. Overall, Arg-C3-Glu2C14 with TFA- induced a rate of transfection in primary cultured neurons higher than that of Lys-C3-Glu2C14 using an optimal weight ratio of lipid-to-plasmid DNA of 1. Moreover, it was suggested that Arg-C3-Glu2C14 with TFA- showed the optimized value higher than that of Lipofectamine2000 in experimental conditions. Thus, Arg-C3-Glu2C14 with TFA- is a promising candidate as a reliable transfection reagent for primary cultured neurons with a relatively low cytotoxicity.

Cationic Amino Acid Based Lipids as Effective Nonviral Gene Delivery Vectors for Primary Cultured Neurons

PubMed Central

2013-01-01

The delivery of specific genes into neurons offers a potent approach for treatment of diseases as well as for the study of neuronal cell biology. Here we investigated the capabilities of cationic amino acid based lipid assemblies to act as nonviral gene delivery vectors in primary cultured neurons. An arginine-based lipid, Arg-C3-Glu2C14, and a lysine-based lipid, Lys-C3-Glu2C14, with two different types of counterion, chloride ion (Cl–) and trifluoroacetic acid (TFA–), were shown to successfully mediate transfection of primary cultured neurons with plasmid DNA encoding green fluorescent protein. Among four types of lipids, we optimized their conditions such as the lipid-to-DNA ratio and the amount of pDNA and conducted a cytotoxicity assay at the same time. Overall, Arg-C3-Glu2C14 with TFA– induced a rate of transfection in primary cultured neurons higher than that of Lys-C3-Glu2C14 using an optimal weight ratio of lipid-to-plasmid DNA of 1. Moreover, it was suggested that Arg-C3-Glu2C14 with TFA– showed the optimized value higher than that of Lipofectamine2000 in experimental conditions. Thus, Arg-C3-Glu2C14 with TFA– is a promising candidate as a reliable transfection reagent for primary cultured neurons with a relatively low cytotoxicity. PMID:24087930

Genetic conditions of joint Nordic genetic evaluations of lifetime competition performance in warmblood sport horses.

PubMed

Viklund, Å; Furre, S; Eriksson, S; Vangen, O; Philipsson, J

2015-08-01

Breeding programmes for warmblood sport horses are similar in the Nordic countries Sweden, Denmark, Finland and Norway, and stallions of same origin are used. The aim was to investigate whether a joint Nordic genetic evaluation based on lifetime competition performance is feasible and beneficial for breeding competitive sport horses in the Nordic countries. Results for almost 45,000 horses in show jumping and 30,000 horses in dressage were available. The larger populations in Sweden and Denmark contributed with 85% of the results. Heritabilities and genetic correlations between performances in the different countries were estimated, and comparisons of accuracies of estimated breeding values (EBVs) and number of stallions with EBVs based on national or joint data were studied. The heritabilities ranged between 0.25 and 0.42 for show jumping and between 0.14 and 0.55 for dressage. The genetic correlations between competition performances in the Nordic countries were estimated to 0.63-1.00. EBVs based on joint data increased accuracies for EBVs for stallions by 38-81% and increased the number of available stallions with EBVs by 40-288%, compared to EBVs based on national data only. A joint Nordic genetic evaluation for sport horses is recommended. © 2015 Blackwell Verlag GmbH.

Prognostic Value of Plasma Epstein-Barr Virus DNA for Local and Regionally Advanced Nasopharyngeal Carcinoma Treated With Cisplatin-Based Concurrent Chemoradiotherapy in Intensity-Modulated Radiotherapy Era.

PubMed

Chen, Wen-Hui; Tang, Lin-Quan; Guo, Shan-Shan; Chen, Qiu-Yan; Zhang, Lu; Liu, Li-Ting; Qian, Chao-Nan; Guo, Xiang; Xie, Dan; Zeng, Mu-Sheng; Mai, Hai-Qiang

2016-02-01

This study aimed to evaluate the prognostic value of plasma Epstein-Barr Virus DNA (EBV DNA) for local and regionally advanced nasopharyngeal carcinoma (NPC) patients treated with concurrent chemoradiotherapy in intensity-modulated radiotherapy (IMRT) era.In this observational study, 404 nonmetastatic local and regionally advanced NPC patients treated with IMRT and cisplatin-based concurrent chemotherapy were recruited. Blood samples were collected before treatment for examination of plasma EBV DNA levels. We evaluated the association of pretreatment plasma EBV DNA levels with progression-free survival rate (PFS), distant metastasis-free survival rate (DMFS), and overall survival rate (OS).Compared to patients with an EBV DNA level < 4000  copies/mL, patients with an EBV DNA ≥ 4000  copies/mL had a lower rate of 3-year PFS (76%, 95% CI [68-84]) versus (93%, 95% CI [90-96], P < 0.001), DMFS (83%, 95% CI [76-89]) versus (97%, 95% CI [94-99], P < 0.001), and OS (85%, 95% CI [78-92]) versus (98%, 95% CI [95-100], P < 0.001). Multivariate analysis showed that pretreatment EBV DNA levels (HR = 3.324, 95% CI, 1.80-6.138, P < 0.001) and clinical stage (HR = 1.878, 95% CI, 1.036-3.404, P = 0.038) were the only independent factor associated with PFS, pretreatment EBV DNA level was the only significant factor to predict DMFS (HR = 6.292, 95% CI, 2.647-14.956, P < 0.001), and pretreatment EBV DNA levels (HR = 3.753, 95% CI, 1.701-8.284, P < 0.001) and clinical stage (HR = 2.577, 95% CI, 1.252-5.050, P = 0.010) were significantly associated with OS. In subgroup analysis, higher plasma EBV DNA levels still predicted a worse PFS, DMFS, and OS for the patients stage III or stage IVa-b, compared with those with low EBV DNA levels.Elevated plasma EBV DNA was still effective prognostic biomarker for local and regionally advanced NPC patients treated with IMRT and cisplatin-based concurrent chemotherapy. Future ramdomized clinical trials are needed to further evaluate whether plasma EBV DNA levels could be applied to guide concurrent chemotherapy regimen for local and regionally advanced NPC patients.

Cloning and Sequencing of Defective Particles Derived from the Autonomous Parvovirus Minute Virus of Mice for the Construction of Vectors with Minimal cis-Acting Sequences

PubMed Central

Clément, Nathalie; Avalosse, Bernard; El Bakkouri, Karim; Velu, Thierry; Brandenburger, Annick

2001-01-01

The production of wild-type-free stocks of recombinant parvovirus minute virus of mice [MVM(p)] is difficult due to the presence of homologous sequences in vector and helper genomes that cannot easily be eliminated from the overlapping coding sequences. We have therefore cloned and sequenced spontaneously occurring defective particles of MVM(p) with very small genomes to identify the minimal cis-acting sequences required for DNA amplification and virus production. One of them has lost all capsid-coding sequences but is still able to replicate in permissive cells when nonstructural proteins are provided in trans by a helper plasmid. Vectors derived from this particle produce stocks with no detectable wild-type MVM after cotransfection with new, matched, helper plasmids that present no homology downstream from the transgene. PMID:11152501

Reverse Genetics of Newcastle Disease Virus.

PubMed

Cardenas-Garcia, Stivalis; Afonso, Claudio L

2017-01-01

Reverse genetics allows for the generation of recombinant viruses or vectors used in functional studies, vaccine development, and gene therapy. This technique enables genetic manipulation and cloning of viral genomes, gene mutation through site-directed mutagenesis, along with gene insertion or deletion, among other studies. An in vitro infection-based system including the highly attenuated vaccinia virus Ankara strain expressing the T7 RNA polymerase from bacteriophage T7, with co-transfection of three helper plasmids and a full-length cDNA plasmid, was successfully developed to rescue genetically modified Newcastle disease viruses in 1999. In this chapter, the materials and the methods involved in rescuing Newcastle disease virus (NDV) from cDNA, utilizing site-directed mutagenesis and gene replacement techniques, are described in detail.

Robust one-Tube Ω-PCR Strategy Accelerates Precise Sequence Modification of Plasmids for Functional Genomics

PubMed Central

Chen, Letian; Wang, Fengpin; Wang, Xiaoyu; Liu, Yao-Guang

2013-01-01

Functional genomics requires vector construction for protein expression and functional characterization of target genes; therefore, a simple, flexible and low-cost molecular manipulation strategy will be highly advantageous for genomics approaches. Here, we describe a Ω-PCR strategy that enables multiple types of sequence modification, including precise insertion, deletion and substitution, in any position of a circular plasmid. Ω-PCR is based on an overlap extension site-directed mutagenesis technique, and is named for its characteristic Ω-shaped secondary structure during PCR. Ω-PCR can be performed either in two steps, or in one tube in combination with exonuclease I treatment. These strategies have wide applications for protein engineering, gene function analysis and in vitro gene splicing. PMID:23335613

Cloning of Pf3, a filamentous bacteriophage of Pseudomonas aeruginosa, into the pBD214 vector of Bacillus subtilis.

PubMed Central

Putterman, D G; Gryczan, T J; Dubnau, D; Day, L A

1983-01-01

The genome of Pf3, a filamentous single-stranded DNA bacteriophage of Pseudomonas aeruginosa (a gram-negative organism) was cloned into pBD214, a plasmid cloning vector of Bacillus subtilis (a gram-positive organism). Cloning in the gram-positive organism was done to avoid anticipated lethal effects. The entire Pf3 genome was inserted in each orientation at a unique Bc/I site within a thymidylate synthetase gene (from B. subtilis phage beta 22) on the plasmid. Additional clones were made by inserting EcoRI fragments of Pf3 DNA into a unique EcoRI site within this gene. Images PMID:6306273

Molecular cloning and expression in streptomyces lividans of a hygromycin B phosphotransferase gene from Streptomyces hygroscopicus.

PubMed

Malpartida, F; Zalacaín, M; Jiménez, A; Davies, J

1983-11-30

The gene encoding the phosphotransferase enzyme that modifies hygromycin B in its producing organism Streptomyces hygroscopicus, has been cloned in the Streptomyces vector pIJ41. Two plasmids, pFM4 and pFM6, containing 2.1 and 19.6 kb inserts of Streptomyces hygroscopicus DNA, respectively, which express the modifying enzyme, have been isolated. A 3.1 kb PstI restriction fragment from pFM4 was inserted in the Streptomyces vector pIJ350 and the resulting plasmids, pMZ11.1 and pMZ11.2, express the hygromycin B-resistance phenotype. The utility of this dominant marker for cloning experiments is discussed in the text.

Expression Plasmids for Use in Candida glabrata

PubMed Central

Zordan, Rebecca E.; Ren, Yuxia; Pan, Shih-Jung; Rotondo, Giuseppe; Peñas, Alejandro De Las; Iluore, Joseph; Cormack, Brendan P.

2013-01-01

We describe a series of CEN/ARS episomal plasmids containing different Candida glabrata promoters, allowing for a range of constitutive or regulated expression of proteins in C. glabrata. The set of promoters includes three constitutive promoters (EGD2pr, HHT2pr, PDC1pr), two macrophage/phagocytosis-induced promoters (ACO2pr, LYS21pr), and one nutritionally regulated promoter (MET3pr). Each promoter was cloned into two plasmid backbones that differ in their selectable marker, URA3, or the dominant-selectable NAT1 gene, which confers resistance to the drug nourseothricin. Expression from the 12 resulting plasmids was assessed using GFP as a reporter and flow cytometry or quantitative reverse-transcription polymerase chain reaction to assess expression levels. Together this set of plasmids expands the toolkit of expression vectors available for use with C. glabrata. PMID:23934995

Role for a region of helically unstable DNA within the Epstein-Barr virus latent cycle origin of DNA replication oriP in origin function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Polonskaya, Zhanna; Benham, Craig J.; Hearing, Janet

The minimal replicator of the Epstein-Barr virus (EBV) latent cycle origin of DNA replication oriP is composed of two binding sites for the Epstein-Barr virus nuclear antigen-1 (EBNA-1) and flanking inverted repeats that bind the telomere repeat binding factor TRF2. Although not required for minimal replicator activity, additional binding sites for EBNA-1 and TRF2 and one or more auxiliary elements located to the right of the EBNA-1/TRF2 sites are required for the efficient replication of oriP plasmids. Another region of oriP that is predicted to be destabilized by DNA supercoiling is shown here to be an important functional component ofmore » oriP. The ability of DNA fragments of unrelated sequence and possessing supercoiled-induced DNA duplex destabilized (SIDD) structures, but not fragments characterized by helically stable DNA, to substitute for this component of oriP demonstrates a role for the SIDD region in the initiation of oriP-plasmid DNA replication.« less

Plasmid Vectors and Molecular Building Blocks for the Development of Genetic Manipulation Tools for Trypanosoma cruzi

PubMed Central

Bouvier, León A.; Cámara, María de los Milagros; Canepa, Gaspar E.; Miranda, Mariana R.; Pereira, Claudio A.

2013-01-01

The post genomic era revealed the need for developing better performing, easier to use and more sophisticated genetic manipulation tools for the study of Trypanosoma cruzi, the etiological agent of Chagas disease. In this work a series of plasmids that allow genetic manipulation of this protozoan parasite were developed. First of all we focused on useful tools to establish selection strategies for different strains and which can be employed as expression vectors. On the other hand molecular building blocks in the form of diverse selectable markers, modifiable fluorescent protein and epitope-tag coding sequences were produced. Both types of modules were harboured in backbone molecules conceived to offer multiple construction and sub-cloning strategies. These can be used to confer new properties to already available genetic manipulation tools or as starting points for whole novel designs. The performance of each plasmid and building block was determined independently. For illustration purposes, some simple direct practical applications were conducted. PMID:24205392

Optical polarization observations in Hogg 22 and NGC 6204

NASA Astrophysics Data System (ADS)

Martínez, R.; Vergne, M. M.; Feinstein, C.

2004-06-01

We present new (UBVRI) multicolor linear polarimetric data for 22 of the brightest stars in the area of the open clusters Hogg 22 and NGC 6204 to study the properties of the ISM (interstellar medium) toward these clusters and between them. The new data were incorporated in our data set of previous observations (Waldhausen et al. \\cite{waldhausen}), resulting in 28 observed stars in the region. Our data yield for NGC 6204 a mean polarization percentage of Pλ_max˜1.8%, close to the polarization value produced by the ISM with normal efficiency (Pλ_max ˜ 5 EB-V) with a color excess of EB-V =0.51. Meanwhile for Hogg 22, located behind NGC 6204, the mean polarization is Pλ_max˜ 2.15%, lower than the expected value for the observed color excess of EB-V =0.68 (Forbes et al. 1996) and the average efficiency of polarization for the interstellar dust. The mean angle of the polarization vectors of Hogg 22 is θ=44.9 °, which agrees with the expected angle produce by dust particles aligned in the direction of the Galactic Plane (θ=48°), while for NGC 6204 a lower value, θ=33.7 °, was found. Therefore, we believe that Hogg 22 is depolarized by the same dust that is polarizing NGC 6204, due to different orientations of the dust particles (and magnetic fields) that polarize the starlight. Based on observations obtanined at Complejo Astronómico El Leoncito (CASLEO), operated under agreement between the CONICET and the National Universities of La Plata, Córdoba, and San Juan, Argentina.

Rule-Based Design of Plant Expression Vectors Using GenoCAD.

PubMed

Coll, Anna; Wilson, Mandy L; Gruden, Kristina; Peccoud, Jean

2015-01-01

Plant synthetic biology requires software tools to assist on the design of complex multi-genic expression plasmids. Here a vector design strategy to express genes in plants is formalized and implemented as a grammar in GenoCAD, a Computer-Aided Design software for synthetic biology. It includes a library of plant biological parts organized in structural categories and a set of rules describing how to assemble these parts into large constructs. Rules developed here are organized and divided into three main subsections according to the aim of the final construct: protein localization studies, promoter analysis and protein-protein interaction experiments. The GenoCAD plant grammar guides the user through the design while allowing users to customize vectors according to their needs. Therefore the plant grammar implemented in GenoCAD will help plant biologists take advantage of methods from synthetic biology to design expression vectors supporting their research projects.

High-level fluorescence labeling of gram-positive pathogens.

PubMed

Aymanns, Simone; Mauerer, Stefanie; van Zandbergen, Ger; Wolz, Christiane; Spellerberg, Barbara

2011-01-01

Fluorescence labeling of bacterial pathogens has a broad range of interesting applications including the observation of living bacteria within host cells. We constructed a novel vector based on the E. coli streptococcal shuttle plasmid pAT28 that can propagate in numerous bacterial species from different genera. The plasmid harbors a promoterless copy of the green fluorescent variant gene egfp under the control of the CAMP-factor gene (cfb) promoter of Streptococcus agalactiae and was designated pBSU101. Upon transfer of the plasmid into streptococci, the bacteria show a distinct and easily detectable fluorescence using a standard fluorescence microscope and quantification by FACS-analysis demonstrated values that were 10-50 times increased over the respective controls. To assess the suitability of the construct for high efficiency fluorescence labeling in different gram-positive pathogens, numerous species were transformed. We successfully labeled Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus dysgalactiae subsp. equisimilis, Enterococcus faecalis, Enterococcus faecium, Streptococcus mutans, Streptococcus anginosus and Staphylococcus aureus strains utilizing the EGFP reporter plasmid pBSU101. In all of these species the presence of the cfb promoter construct resulted in high-level EGFP expression that could be further increased by growing the streptococcal and enterococcal cultures under high oxygen conditions through continuous aeration.

Targeted Knock-Down of miR21 Primary Transcripts Using snoMEN Vectors Induces Apoptosis in Human Cancer Cell Lines.

PubMed

Ono, Motoharu; Yamada, Kayo; Avolio, Fabio; Afzal, Vackar; Bensaddek, Dalila; Lamond, Angus I

2015-01-01

We have previously reported an antisense technology, 'snoMEN vectors', for targeted knock-down of protein coding mRNAs using human snoRNAs manipulated to contain short regions of sequence complementarity with the mRNA target. Here we characterise the use of snoMEN vectors to target the knock-down of micro RNA primary transcripts. We document the specific knock-down of miR21 in HeLa cells using plasmid vectors expressing miR21-targeted snoMEN RNAs and show this induces apoptosis. Knock-down is dependent on the presence of complementary sequences in the snoMEN vector and the induction of apoptosis can be suppressed by over-expression of miR21. Furthermore, we have also developed lentiviral vectors for delivery of snoMEN RNAs and show this increases the efficiency of vector transduction in many human cell lines that are difficult to transfect with plasmid vectors. Transduction of lentiviral vectors expressing snoMEN targeted to pri-miR21 induces apoptosis in human lung adenocarcinoma cells, which express high levels of miR21, but not in human primary cells. We show that snoMEN-mediated suppression of miRNA expression is prevented by siRNA knock-down of Ago2, but not by knock-down of Ago1 or Upf1. snoMEN RNAs colocalise with Ago2 in cell nuclei and nucleoli and can be co-immunoprecipitated from nuclear extracts by antibodies specific for Ago2.

Novel Epstein-Barr virus-like particles incorporating gH/gL-EBNA1 or gB-LMP2 induce high neutralizing antibody titers and EBV-specific T-cell responses in immunized mice

PubMed Central

Perez, Elizabeth M.; Foley, Joslyn; Tison, Timelia; Silva, Rute; Ogembo, Javier Gordon

2017-01-01

Previous Epstein-Barr virus (EBV) prophylactic vaccines based on the major surface glycoprotein gp350/220 as an immunogen have failed to block viral infection in humans, suggesting a need to target other viral envelope glycoproteins. In this study, we reasoned that incorporating gH/gL or gB, critical glycoproteins for viral fusion and entry, on the surface of a virus-like particle (VLP) would be more immunogenic than gp350/220 for generating effective neutralizing antibodies to prevent viral infection of both epithelial and B cell lines. To boost the humoral response and trigger cell-mediated immunity, EBV nuclear antigen 1 (EBNA1) and latent membrane protein 2 (LMP2), intracellular latency proteins expressed in all EBV-infected cells, were also included as critical components of the polyvalent EBV VLP. gH/gL-EBNA1 and gB-LMP2 VLPs were efficiently produced in Chinese hamster ovary cells, an FDA-approved vehicle for mass-production of biologics. Immunization with gH/gL-EBNA1 and gB-LMP2 VLPs without adjuvant generated both high neutralizing antibody titers in vitro and EBV-specific T-cell responses in BALB/c mice. These data demonstrate that EBV glycoprotein(s)-based VLPs have excellent immunogenicity, and represent a potentially safe vaccine that will be invaluable not only in preventing EBV infection, but importantly, in preventing and treating the 200,000 cases of EBV-associated cancers that occur globally every year. PMID:27926486

The vector homology problem in diagnostic nucleic acid hybridization of clinical specimens.

PubMed Central

Ambinder, R F; Charache, P; Staal, S; Wright, P; Forman, M; Hayward, S D; Hayward, G S

1986-01-01

Nucleic acid hybridization techniques using cloned probes are finding application in assays of clinical specimens in research and diagnostic laboratories. The probes that we and others have used are recombinant plasmids composed of viral inserts and bacterial plasmid vectors such as pBR322. We suspected that there was material homologous to pBR322 present in many clinical samples. because hybridization occurred in samples which lacked evidence of virus by other techniques. If the presence of this vector-homologous material was unrecognized, hybridization in the test sample might erroneously be interpreted as indicating the presence of viral sequences. In this paper we demonstrate specific hybridization of labeled pBR322 DNA with DNA from various clinical samples. Evidence is presented that nonspecific probe trapping could not account for this phenomenon. In mixing experiments, it is shown that contamination of clinical samples with bacteria would explain such a result. Approaches tested to circumvent this problem included the use of isolated insert probes, alternate cloning vectors, and cold competitor pBR322 DNA in prehybridization and hybridization mixes. None proved entirely satisfactory. We therefore emphasize that it is essential that all hybridization detection systems use a control probe of the vector alone in order to demonstrate the absence of material with vector homology in the specimen tested. Images PMID:3013928

Assessment of the Mobilizable Vector Plasmids pSUP202 and pSUP404.2 as Genetic Tools for the Predatory Bacterium Bdellovibrio bacteriovorus

PubMed Central

Roschanski, Nicole

2010-01-01

Bdellovibrio and like organisms (BALOs) form the group of predatory bacteria which require Gram-negative bacteria as prey. Genetic studies with Bdellovibrio bacteriovorus can be performed with vectors which are introduced into the predator via conjugation. The usefulness of the two vectors pSUP202 and pSUP404.2 as genetic tools were assessed. Both vectors were transferable into B. bacteriovorus by conjugative matings with an Escherichia coli K12 strain as donor. The transfer frequency was higher for vector pSUP404.2 (approx. 10−1–10−4) as for pSUP202 (approx. 10−5–10−6). Vector pSUP202 with a pMB1 origin is unstable in the predatory bacterium, whereas pSUP404.2 is stably maintained in the absence of selective antibiotics. pSUP404.2 harbors two plasmid replicons, the p15A ori and the RSF1010 replication region The copy number of pSUP404.2 was determined by quantitative PCR in B. bacteriovorus and averages seven copies per genome. pSUP404.2 harbors two resistance genes (chloramphenicol and kanamycin) which can be used for cloning either by selection for transconjugants or by insertional inactivation. PMID:20824276

Response and survival benefit with chemoimmunotherapy in Epstein-Barr virus-positive diffuse large B-cell lymphoma.

PubMed

Beltran, Brady E; Quiñones, Pilar; Morales, Domingo; Malaga, Jose M; Chavez, Julio C; Sotomayor, Eduardo M; Castillo, Jorge J

2018-02-01

Epstein-Barr virus (EBV)-positive diffuse large B-cell lymphoma (DLBCL) is a haematologic malignancy with poor prognosis when treated with chemotherapy. We evaluated response and survival benefits of chemoimmunotherapy in EBV-positive DLBCL patients. A total of 117 DLBCL patients were included in our retrospective analysis; 33 were EBV-positive (17 treated with rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone [R-CHOP] and 16 with CHOP), and 84 were EBV-negative (all treated with R-CHOP). The outcomes of interest were complete response (CR) and overall survival (OS) in EBV-positive DLBCL patients (R-CHOP versus CHOP) and in DLBCL patients treated with R-CHOP (EBV-positive vs EBV-negative). There were no differences in the clinical characteristics between EBV-positive and EBV-negative DLBCL patients. Among EBV-positive DLBCL patients, R-CHOP was associated with higher odds of CR (OR 3.14, 95% CI 0.75-13.2; P = .10) and better OS (hazard ratio 0.30, 95% confidence interval [CI] 0.09-0.94; P = .04). There were no differences in CR rate (OR 0.52, 95% CI 0.18-1.56; P = .25) or OS (hazard ratio 0.93, 95% CI 0.32-2.67; P = .89) between EBV-positive and EBV-negative DLBCL patients treated with R-CHOP. Based on our study, the addition of rituximab to CHOP is associated with improved response and survival in EBV-positive DLBCL patients. Epstein-Barr virus status does not seem to affect response or survival in DLBCL patients treated with R-CHOP. Copyright © 2017 John Wiley & Sons, Ltd.

Protein Structure Initiative Material Repository: an open shared public resource of structural genomics plasmids for the biological community

PubMed Central

Cormier, Catherine Y.; Mohr, Stephanie E.; Zuo, Dongmei; Hu, Yanhui; Rolfs, Andreas; Kramer, Jason; Taycher, Elena; Kelley, Fontina; Fiacco, Michael; Turnbull, Greggory; LaBaer, Joshua

2010-01-01

The Protein Structure Initiative Material Repository (PSI-MR; http://psimr.asu.edu) provides centralized storage and distribution for the protein expression plasmids created by PSI researchers. These plasmids are a resource that allows the research community to dissect the biological function of proteins whose structures have been identified by the PSI. The plasmid annotation, which includes the full length sequence, vector information and associated publications, is stored in a freely available, searchable database called DNASU (http://dnasu.asu.edu). Each PSI plasmid is also linked to a variety of additional resources, which facilitates cross-referencing of a particular plasmid to protein annotations and experimental data. Plasmid samples can be requested directly through the website. We have also developed a novel strategy to avoid the most common concern encountered when distributing plasmids namely, the complexity of material transfer agreement (MTA) processing and the resulting delays this causes. The Expedited Process MTA, in which we created a network of institutions that agree to the terms of transfer in advance of a material request, eliminates these delays. Our hope is that by creating a repository of expression-ready plasmids and expediting the process for receiving these plasmids, we will help accelerate the accessibility and pace of scientific discovery. PMID:19906724

Structural similarity and distribution of small cryptic plasmids of Lactobacillus curvatus and L. sake.

PubMed

Vogel, R F; Lohmann, M; Weller, A N; Hugas, M; Hammes, W P

1991-11-15

Plasmid profiles of strains of Lactobacillus curvatus and L. sake isolated from meat or sauerkraut were analysed to investigate plasmid homology and distribution in relation to the ecology of these organisms in fermenting foods. A hybridisation probe was constructed by cloning of pLc2, a cryptic, 2.6-kbp plasmid from L. curvatus LTH683, into the Escherichia coli plasmid pRV50. In Southern hybridisations with the digoxygenine labeled pLc2 probe, pLc2-related small plasmids were frequently detected in meat-borne strains of L. casei subsp. pseudoplantarum, L. curvatus, L. sake, L. alimentarius, L. farciminis and L. halotolerans and in L. curvatus and L. sake isolated from sauerkraut. Among 27 Lactobacillus type strains originally isolated from habitats other than meat this type of homology was detected only with plasmids of L. buchneri and L. mali. Restriction-enzyme mapping of six small cryptic plasmids from L. curvatus and L. sake revealed strong structural homology but no similarity to previously characterized plasmids of lactobacilli. The presence of a variable region in addition to a conserved one and the occurrence of deletions during cloning of pLc2 suggest that vectors derived from these plasmids are likely to be structurally unstable.

Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

PubMed

Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

2014-11-01

Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.

Optimization of a one-step heat-inducible in vivo mini DNA vector production system.

PubMed

Nafissi, Nafiseh; Sum, Chi Hong; Wettig, Shawn; Slavcev, Roderick A

2014-01-01

While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called "Super Sequences" that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼ 90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics.

Optimization of a One-Step Heat-Inducible In Vivo Mini DNA Vector Production System

PubMed Central

Wettig, Shawn; Slavcev, Roderick A.

2014-01-01

While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called “Super Sequences” that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics. PMID:24586704

Prospective studies of infectious mononucleosis in university students

PubMed Central

Grimm, Jennifer M; Schmeling, David O; Dunmire, Samantha K; Knight, Jennifer A; Mullan, Beth D; Ed, Julie A; Brundage, Richard C; Hogquist, Kristin A; Balfour, Henry H

2016-01-01

We performed an intensive prospective study designed to obtain as much data as possible on the incubation and early illness periods of primary Epstein–Barr virus (EBV) infection. Undergraduate students who lacked EBV antibody and oral EBV DNA (EBV-naive) were seen every 2 weeks during their freshman year. Clinical and behavioral data, oral washes and venous blood were obtained. EBV antibodies were quantified by enzyme immunoassay and viral loads by PCR. During a median 8 months of observation, 14/85 subjects experienced primary EBV infections (24 cases/100 person-years). The only significant risk factor for acquisition of EBV infection was deep kissing (P=0.02). Eleven subjects had infectious mononucleosis with a median duration of 21 days. Two subjects were hospitalized. Infections were initially identified in 12 subjects by finding EBV DNA in oral cells before onset of symptoms and in 2 subjects by symptom reporting. EBV DNA and viral capsid antigen (VCA) IgM and gp350 IgG antibodies were present in the blood before onset of illness. To provide a more robust evaluation of primary EBV infection in undergraduate university students, we combined data on risk factors and antibody responses from this and an earlier study that used the exact same clinical and laboratory methods. The observation that the only significant risk factor for acquisition of EBV infection was deep kissing was confirmed. Most importantly, higher amounts of gp350 antibody correlated significantly with a lower severity of infectious mononucleosis (P<0.0001), which strengthens the rationale for a gp350-based prophylactic EBV vaccine. PMID:27588199

Prospective studies of infectious mononucleosis in university students.

PubMed

Grimm, Jennifer M; Schmeling, David O; Dunmire, Samantha K; Knight, Jennifer A; Mullan, Beth D; Ed, Julie A; Brundage, Richard C; Hogquist, Kristin A; Balfour, Henry H

2016-08-01

We performed an intensive prospective study designed to obtain as much data as possible on the incubation and early illness periods of primary Epstein-Barr virus (EBV) infection. Undergraduate students who lacked EBV antibody and oral EBV DNA (EBV-naive) were seen every 2 weeks during their freshman year. Clinical and behavioral data, oral washes and venous blood were obtained. EBV antibodies were quantified by enzyme immunoassay and viral loads by PCR. During a median 8 months of observation, 14/85 subjects experienced primary EBV infections (24 cases/100 person-years). The only significant risk factor for acquisition of EBV infection was deep kissing (P=0.02). Eleven subjects had infectious mononucleosis with a median duration of 21 days. Two subjects were hospitalized. Infections were initially identified in 12 subjects by finding EBV DNA in oral cells before onset of symptoms and in 2 subjects by symptom reporting. EBV DNA and viral capsid antigen (VCA) IgM and gp350 IgG antibodies were present in the blood before onset of illness. To provide a more robust evaluation of primary EBV infection in undergraduate university students, we combined data on risk factors and antibody responses from this and an earlier study that used the exact same clinical and laboratory methods. The observation that the only significant risk factor for acquisition of EBV infection was deep kissing was confirmed. Most importantly, higher amounts of gp350 antibody correlated significantly with a lower severity of infectious mononucleosis (P<0.0001), which strengthens the rationale for a gp350-based prophylactic EBV vaccine.

Reverse Genetics for Mammalian Orthoreovirus.

PubMed

Stuart, Johnasha D; Phillips, Matthew B; Boehme, Karl W

2017-01-01

Reverse genetics allows introduction of specific alterations into a viral genome. Studies performed with mutant viruses generated using reverse genetics approaches have contributed immeasurably to our understanding of viral replication and pathogenesis, and also have led to development of novel vaccines and virus-based vectors. Here, we describe the reverse genetics system that allows for production and recovery of mammalian orthoreovirus, a double-stranded (ds) RNA virus, from plasmids that encode the viral genome.

Epstein-Barr virus (EBV)–encoded small RNA is released from EBV-infected cells and activates signaling from toll-like receptor 3

PubMed Central

Iwakiri, Dai; Zhou, Li; Samanta, Mrinal; Matsumoto, Misako; Ebihara, Takashi; Seya, Tsukasa; Imai, Shosuke; Fujieda, Mikiya; Kawa, Keisei

2009-01-01

Epstein-Barr virus–encoded small RNA (EBER) is nonpolyadenylated, noncoding RNA that forms stem-loop structure by intermolecular base-pairing, giving rise to double-stranded RNA (dsRNA)–like molecules, and exists abundantly in EBV-infected cells. Here, we report that EBER induces signaling from the Toll-like receptor 3 (TLR3), which is a sensor of viral double-stranded RNA (dsRNA) and induces type I IFN and proinflammatory cytokines. A substantial amount of EBER, which was sufficient to induce signaling from TLR3, was released from EBV-infected cells, and the majority of the released EBER existed as a complex with a cellular EBER-binding protein La, suggesting that EBER was released from the cells by active secretion of La. Sera from patients with infectious mononucleosis (IM), chronic active EBV infection (CAEBV), and EBV-associated hemophagocytic lymphohistiocytosis (EBV-HLH), whose general symptoms are caused by proinflammatory cytokines contained EBER, and addition of RNA purified from the sera into culture medium induced signaling from TLR3 in EBV-transformed lymphocytes and peripheral mononuclear cells. Furthermore, DCs treated with EBER showed mature phenotype and antigen presentation capacity. These findings suggest that EBER, which is released from EBV-infected cells, is responsible for immune activation by EBV, inducing type I IFN and proinflammatory cytokines. EBER-induced activation of innate immunity would account for immunopathologic diseases caused by active EBV infection. PMID:19720839

Performance of the architect EBV antibody panel for determination of Epstein-Barr virus infection stage in immunocompetent adolescents and young adults with clinical suspicion of infectious mononucleosis.

PubMed

Guerrero-Ramos, Alvaro; Patel, Mauli; Kadakia, Kinjal; Haque, Tanzina

2014-06-01

The Architect EBV antibody panel is a new chemiluminescence immunoassay system used to determine the stage of Epstein-Barr virus (EBV) infection based on the detection of IgM and IgG antibodies to viral capsid antigen (VCA) and IgG antibodies against Epstein-Barr nuclear antigen 1 (EBNA-1). We evaluated its diagnostic accuracy in immunocompetent adolescents and young adults with clinical suspicion of infectious mononucleosis (IM) using the RecomLine EBV IgM and IgG immunoblots as the reference standard. In addition, the use of the antibody panel in a sequential testing algorithm based on initial EBNA-1 IgG analysis was assessed for cost-effectiveness. Finally, we investigated the degree of cross-reactivity of the VCA IgM marker during other primary viral infections that may present with an EBV IM-like picture. High sensitivity (98.3% [95% confidence interval {CI}, 90.7 to 99.7%]) and specificity (94.2% [95% CI, 87.9 to 97.8%]) were found after testing 162 precharacterized archived serum samples. There was perfect agreement between the use of the antibody panel in sequential and parallel testing algorithms, but substantial cost savings (23%) were obtained with the sequential strategy. A high rate of reactive VCA IgM results was found in primary cytomegalovirus (CMV) infections (60.7%). In summary, the Architect EBV antibody panel performs satisfactorily in the investigation of EBV IM in immunocompetent adolescents and young adults, and the application of an EBNA-1 IgG-based sequential testing algorithm is cost-effective in this diagnostic setting. Concomitant testing for CMV is strongly recommended to aid in the interpretation of EBV serological patterns. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Performance of the Architect EBV Antibody Panel for Determination of Epstein-Barr Virus Infection Stage in Immunocompetent Adolescents and Young Adults with Clinical Suspicion of Infectious Mononucleosis

PubMed Central

Patel, Mauli; Kadakia, Kinjal; Haque, Tanzina

2014-01-01

The Architect EBV antibody panel is a new chemiluminescence immunoassay system used to determine the stage of Epstein-Barr virus (EBV) infection based on the detection of IgM and IgG antibodies to viral capsid antigen (VCA) and IgG antibodies against Epstein-Barr nuclear antigen 1 (EBNA-1). We evaluated its diagnostic accuracy in immunocompetent adolescents and young adults with clinical suspicion of infectious mononucleosis (IM) using the RecomLine EBV IgM and IgG immunoblots as the reference standard. In addition, the use of the antibody panel in a sequential testing algorithm based on initial EBNA-1 IgG analysis was assessed for cost-effectiveness. Finally, we investigated the degree of cross-reactivity of the VCA IgM marker during other primary viral infections that may present with an EBV IM-like picture. High sensitivity (98.3% [95% confidence interval {CI}, 90.7 to 99.7%]) and specificity (94.2% [95% CI, 87.9 to 97.8%]) were found after testing 162 precharacterized archived serum samples. There was perfect agreement between the use of the antibody panel in sequential and parallel testing algorithms, but substantial cost savings (23%) were obtained with the sequential strategy. A high rate of reactive VCA IgM results was found in primary cytomegalovirus (CMV) infections (60.7%). In summary, the Architect EBV antibody panel performs satisfactorily in the investigation of EBV IM in immunocompetent adolescents and young adults, and the application of an EBNA-1 IgG-based sequential testing algorithm is cost-effective in this diagnostic setting. Concomitant testing for CMV is strongly recommended to aid in the interpretation of EBV serological patterns. PMID:24695777

Integration of narrow-host-range vectors from Escherichia coli into the genomes of amino acid-producing corynebacteria after intergeneric conjugation.

PubMed

Mateos, L M; Schäfer, A; Kalinowski, J; Martin, J F; Pühler, A

1996-10-01

Conjugative transfer of mobilizable derivatives of the Escherichia coli narrow-host-range plasmids pBR322, pBR325, pACYC177, and pACYC184 from E. coli to species of the gram-positive genera Corynebacterium and Brevibacterium resulted in the integration of the plasmids into the genomes of the recipient bacteria. Transconjugants appeared at low frequencies and reproducibly with a delay of 2 to 3 days compared with matings with replicative vectors. Southern analysis of corynebacterial transconjugants and nucleotide sequences from insertion sites revealed that integration occurs at different locations and that different parts of the vector are involved in the process. Integration is not dependent on indigenous insertion sequence elements but results from recombination between very short homologous DNA segments (8 to 12 bp) present in the vector and in the host DNA. In the majority of the cases (90%), integration led to cointegrate formation, and in some cases, deletions or rearrangements occurred during the recombination event. Insertions were found to be quite stable even in the absence of selective pressure.

[Prokaryotic expression, purification and antigenicity identification of recombinant human survivin protein].

PubMed

Yin, Xiaotao; Wang, Wei; Tian, Renli; Xu, Yuanji; Yan, Jinqi; Zhang, Wei; Gao, Jiangping; Yu, Jiyun

2013-08-01

To construct a prokaryotic expression plasmid pET28a-survivin, optimize the recombinant protein expression conditions in E.coli, and purify the survivin recombinant protein and identify its antigenicity. Survivin cDNA segment was amplified by PCR and cloned into prokaryotic expression vector pET28a(+) to construct the recombinant expression vector pET28a-survivin. The expression vector was transformed into BL21 (DE3) and the fusion protein survivin/His was induced by IPTG. The fusion protein was purified through Ni affinity chromatography. The antigenicity of the purified survivin protein was identified by Western blotting and ELISA. The recombinant expression vector was verified successfully by BamHI and HindIII. The fusion protein induced by IPTG was obtained with Mr; about 24 000. The purity of the purified protein reached 90% by SDS-PAGE analysis. And the antigenicity of the survivin protein was validated by Western blotting and ELISA. The prokaryotic expression plasmid pET28a-survivin was successfully constructed and the survivin protein was expressed and purified in E.coli. The antigenicity of the purified survivin protein was demonstrated desirable.

Integration of narrow-host-range vectors from Escherichia coli into the genomes of amino acid-producing corynebacteria after intergeneric conjugation.

PubMed Central

Mateos, L M; Schäfer, A; Kalinowski, J; Martin, J F; Pühler, A

1996-01-01

Conjugative transfer of mobilizable derivatives of the Escherichia coli narrow-host-range plasmids pBR322, pBR325, pACYC177, and pACYC184 from E. coli to species of the gram-positive genera Corynebacterium and Brevibacterium resulted in the integration of the plasmids into the genomes of the recipient bacteria. Transconjugants appeared at low frequencies and reproducibly with a delay of 2 to 3 days compared with matings with replicative vectors. Southern analysis of corynebacterial transconjugants and nucleotide sequences from insertion sites revealed that integration occurs at different locations and that different parts of the vector are involved in the process. Integration is not dependent on indigenous insertion sequence elements but results from recombination between very short homologous DNA segments (8 to 12 bp) present in the vector and in the host DNA. In the majority of the cases (90%), integration led to cointegrate formation, and in some cases, deletions or rearrangements occurred during the recombination event. Insertions were found to be quite stable even in the absence of selective pressure. PMID:8824624

[Construction and expression of a eukaryotic expression vector containing human CR2-Fc fusion protein].

PubMed

Li, Xinxin; Wu, Zhihao; Zhang, Chuanfu; Jia, Leili; Song, Hongbin; Xu, Yuanyong

2014-01-01

To construct a eukaryotic expression vector containing human complement receptor 2 (CR2)-Fc and express the CR2-Fc fusion protein in Chinese hamster ovary (CHO) cells. The extracellular domain of human CR2 and IgG1 Fc were respectively amplified, ligated and inserted into the eukaryotic expression vector PCI-neo. After verified by restriction enzyme digestion and sequencing, the recombinant plasmid was transfected into CHO K1 cells. The ones with stable expression of the fusion protein were obtained by means of G418 selection. The expression of the CR2-Fc fusion protein was detected and confirmed by SDS-PAGE and Western blotting. Restriction enzyme digestion and sequencing demonstrated that the recombinant plasmid was valid. SDS-PAGE showed that relative molecular mass (Mr;) of the purified product was consistent with the expected value. Western blotting further proved the single band at the same position. We constructed the eukaryotic expression vector of CR2-Fc/PCI-neo successfully. The obtained fusion protein was active and can be used for the further study of the role in HIV control.

CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

PubMed

Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

2017-06-25

Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

[Obtaining marker-free transgenic soybean plants with optimal frequency by constructing three T-DNAs binary vector].

PubMed

Ye, Xing-Guo; Qin, Hua

2007-01-01

Obtaining marker-free plants with high efficiency will benefit the environmental release of transgenic crops. To achieve this point, a binary vector pNB35SVIP1 with three T-DNAs was constructed by using several mediate plasmids, in which one copy of bar gene expression cassette and two copies of VIP1 gene expression cassette were included. EHA101 Agrobacterium strain harboring the final construct was applied to transform soybean (Glycine max) cotyledon nodes. Through 2 - 3 months regeneration and selection on 3 - 5mg/L glufosinate containing medium, transgenic soybean plants were confirmed to be obtained at 0.83% - 3.16%, and co-transformation efficiency of both gene in the same individual reached up to 86.4%, based on southern blot test. By the analysis of PCR, southern blot and northern blot combining with leaf painting of herbicide in T1 progenies, 41 plants were confirmed to be eliminated of bar gene with the frequency of 7.6% . Among the T1 populations tested, the loss of the alien genes happened in 22.7% lines, the silence of bar gene took place in 27.3% lines, and VIP1 gene silence existed in 37.1% marker-free plants. The result also suggested that the plasmid with three T-DNAs might be an ideal vector to generate maker-free genetic modified organism.

The Tol2 transposon system mediates the genetic engineering of T-cells with CD19-specific chimeric antigen receptors for B-cell malignancies.

PubMed

Tsukahara, T; Iwase, N; Kawakami, K; Iwasaki, M; Yamamoto, C; Ohmine, K; Uchibori, R; Teruya, T; Ido, H; Saga, Y; Urabe, M; Mizukami, H; Kume, A; Nakamura, M; Brentjens, R; Ozawa, K

2015-02-01

Engineered T-cell therapy using a CD19-specific chimeric antigen receptor (CD19-CAR) is a promising strategy for the treatment of advanced B-cell malignancies. Gene transfer of CARs to T-cells has widely relied on retroviral vectors, but transposon-based gene transfer has recently emerged as a suitable nonviral method to mediate stable transgene expression. The advantages of transposon vectors compared with viral vectors include their simplicity and cost-effectiveness. We used the Tol2 transposon system to stably transfer CD19-CAR into human T-cells. Normal human peripheral blood lymphocytes were co-nucleofected with the Tol2 transposon donor plasmid carrying CD19-CAR and the transposase expression plasmid and were selectively propagated on NIH3T3 cells expressing human CD19. Expanded CD3(+) T-cells with stable and high-level transgene expression (~95%) produced interferon-γ upon stimulation with CD19 and specifically lysed Raji cells, a CD19(+) human B-cell lymphoma cell line. Adoptive transfer of these T-cells suppressed tumor progression in Raji tumor-bearing Rag2(-/-)γc(-/-) immunodeficient mice compared with control mice. These results demonstrate that the Tol2 transposon system could be used to express CD19-CAR in genetically engineered T-cells for the treatment of refractory B-cell malignancies.

Advances in Non-Viral DNA Vectors for Gene Therapy

PubMed Central

Hardee, Cinnamon L.; Arévalo-Soliz, Lirio Milenka; Hornstein, Benjamin D.; Zechiedrich, Lynn

2017-01-01

Uses of viral vectors have thus far eclipsed uses of non-viral vectors for gene therapy delivery in the clinic. Viral vectors, however, have certain issues involving genome integration, the inability to be delivered repeatedly, and possible host rejection. Fortunately, development of non-viral DNA vectors has progressed steadily, especially in plasmid vector length reduction, now allowing these tools to fill in specifically where viral or other non-viral vectors may not be the best options. In this review, we examine the improvements made to non-viral DNA gene therapy vectors, highlight opportunities for their further development, address therapeutic needs for which their use is the logical choice, and discuss their future expansion into the clinic. PMID:28208635

Role of IncP-1β Plasmids pWDL7::rfp and pNB8c in Chloroaniline Catabolism as Determined by Genomic and Functional Analyses

PubMed Central

Król, J. E.; Penrod, J. T.; McCaslin, H.; Rogers, L. M.; Yano, H.; Stancik, A. D.; Dejonghe, W.; Brown, C. J.; Parales, R. E.; Wuertz, S.

2012-01-01

Broad-host-range catabolic plasmids play an important role in bacterial degradation of man-made compounds. To gain insight into the role of these plasmids in chloroaniline degradation, we determined the first complete nucleotide sequences of an IncP-1 chloroaniline degradation plasmid, pWDL7::rfp and its close relative pNB8c, as well as the expression pattern, function, and bioaugmentation potential of the putative 3-chloroaniline (3-CA) oxidation genes. Based on phylogenetic analysis of backbone proteins, both plasmids are members of a distinct clade within the IncP-1β subgroup. The plasmids are almost identical, but whereas pWDL7::rfp carries a duplicate inverted catabolic transposon, Tn6063, containing a putative 3-CA oxidation gene cluster, dcaQTA1A2BR, pNB8c contains only a single copy of the transposon. No genes for an aromatic ring cleavage pathway were detected on either plasmid, suggesting that only the upper 3-CA degradation pathway was present. The dcaA1A2B gene products expressed from a high-copy-number vector were shown to convert 3-CA to 4-chlorocatechol in Escherichia coli. Slight differences in the dca promoter region between the plasmids and lack of induction of transcription of the pNB8c dca genes by 3-CA may explain previous findings that pNB8C does not confer 3-CA transformation. Bioaugmentation of activated sludge with pWDL7::rfp accelerated removal of 3-CA, but only in the presence of an additional carbon source. Successful bioaugmentation requires complementation of the upper pathway genes with chlorocatechol cleavage genes in indigenous bacteria. The genome sequences of these plasmids thus help explain the molecular basis of their catabolic activities. PMID:22101050

An adenovirus prime/plasmid boost strategy for induction of equipotent immune responses to two dengue virus serotypes.

PubMed

Khanam, Saima; Rajendra, Pilankatta; Khanna, Navin; Swaminathan, Sathyamangalam

2007-02-15

Dengue is a public health problem of global significance for which there is neither an effective antiviral therapy nor a preventive vaccine. It is a mosquito-borne viral disease, caused by dengue (DEN) viruses, which are members of the Flaviviridae family. There are four closely related serotypes, DEN-1, DEN-2, DEN-3 and DEN-4, each of which is capable of causing disease. As immunity to any one serotype can potentially sensitize an individual to severe disease during exposure to a heterologous serotype, the general consensus is that an effective vaccine should be tetravalent, that is, it must be capable of affording protection against all four serotypes. The current strategy of creating tetravalent vaccine formulations by mixing together four monovalent live attenuated vaccine viruses has revealed the phenomenon of viral interference leading to the manifestation of immune responses biased towards a single serotype. This work stems from the emergence of (i) the DEN virus envelope (E) domain III (EDIII) as the most important region of the molecule from a vaccine perspective and (ii) the adenovirus (Ad) as a promising vaccine vector platform. We describe the construction of a recombinant, replication-defective Ad (rAd) vector encoding a chimeric antigen made of in-frame linked EDIIIs of DEN virus serotypes 2 and 4. Using this rAd vector, in conjunction with a plasmid vector encoding the same chimeric bivalent antigen, in a prime-boost strategy, we show that it is possible to elicit equipotent neutralizing and T cell responses specific to both DEN serotypes 2 and 4. Our data support the hypothesis that a DEN vaccine targeting more than one serotype may be based on a single DNA-based vector to circumvent viral interference. This work lays the foundation for developing a single Ad vector encoding EDIIIs of all four DEN serotypes to evoke a balanced immune response against each one of them. Thus, this work has implications for the development of safe and effective tetravalent dengue vaccines.

Vaccination of plasmid DNA encoding ORF81 gene of CJ strains of KHV provides protection to immunized carp.

PubMed

Zhou, Jingxiang; Xue, Jiangdong; Wang, Qiuju; Zhu, Xia; Li, Xingwei; Lv, Wenliang; Zhang, Dongming

2014-06-01

In order to construct the recombinant plasmid of pIRES-ORF81, the nucleic acid isolated from Koi herpes virus-CJ (KHV-CJ) strains was used as a template to insert the ORF81 gene fragments amplified by PCR into the pIRES-neo, a kind of eukaryotic expression vector. Using Western blotting analysis, it was verified that ORF81 gene protein can be expressed correctly by pIRES-ORF81, after MFC cells were transfected. The recombinant plasmid pIRES-ORF81 was set into three immunization dose gradients: 1, 10, and 50 μg/carp. Empty plasmid group, PBS group, and blank control group were set simultaneously. Giving intramuscular injections to healthy carps with an average body mass of 246 ± 20 g, indirect ELISA was used to regularly determine antibody levels after three times immunization injection. Neutralizing antibodies were detected by neutralization assay. The results of inoculation tests showed that the pIRES-ORF81 recombinant plasmid can induce the production of carp-specific antibodies. The differences of immune effect between the three different doses of immune gradients were not significant (P > 0.05), but they can induce the production of neutralizing antibodies. After 25 d of inoculation, carp mortality of pIRES-neo empty vector treatment groups was 85%, while the carp mortality of eukaryotic expression recombinant plasmid pIRES-ORF81 injected with three different doses of immune gradients was 20, 17.5, and 12.5%, respectively. Differences in comparison to the control group were highly significant (P < 0.01). However, histopathological section of immunohistochemistry organization revealed no significant changes. It demonstrated that the DNA vaccine pIRES-ORF81 constructed in the experiment displayed a good protective effect against KHV, which had the potential to industrial applications.

Epstein-Barr virus strains and variations: Geographic or disease-specific variants?

PubMed

Neves, Marco; Marinho-Dias, Joana; Ribeiro, Joana; Sousa, Hugo

2017-03-01

The Epstein-Barr Virus (EBV) is associated with the development of several diseases, including infectious mononucleosis (IM), Burkitt's Lymphoma (BL), Nasopharyngeal Carcinoma, and other neoplasias. The publication of EBV genome 1984 led to several studies regarding the identification of different viral strains. Currently, EBV is divided into EBV type 1 (B95-8 strain) and EBV type 2 (AG876 strain), also known as type A and type B, which have been distinguished based upon genetic differences in the Epstein-Barr nuclear antigens (EBNAs) sequence. Several other EBV strains have been described in the past 10 years considering variations on EBV genome, and many have attempted to clarify if these variations are ethnic or geographically correlated, or if they are disease related. Indeed, there is an increasing interest to describe possible specific disease associations, with emphasis on different malignancies. These studies aim to clarify if these variations are ethnic or geographically correlated, or if they are disease related, thus being important to characterize the epidemiologic genetic distribution of EBV strains on our population. Here, we review the current knowledge on the different EBV strains and variants and its association with different diseases. J. Med. Virol. 89:373-387, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Seroepidemiology of Epstein-Barr virus and cytomegalovirus among Israeli male young adults.

PubMed

Levine, Hagai; Balicer, Ran D; Rozhavski, Vladi; Halperin, Tamar; Shreberk, Michal; Davidovitch, Nadav; Huerta-Hartal, Michael; Ankol, Omer E

2012-11-01

To assess the seroprevalence and seroconversion of Epstein-Barr virus (EBV) and cytomegalovirus (CMV) Immunoglobulin G (IgG) antibodies and identify associated socioeconomic and smoking variables among male young adults in Israel, to explore health disparities and aid prevention efforts. A population-based seroprevalence study of EBV and CMV IgG antibodies in a systematic sample of Israeli males upon recruitment to mandatory military service during 1994-2004. Associations between socioeconomic and smoking variables and the seroprevalence of EBV/CMV were evaluated, controlling for possible confounders. A subset of seronegative subjects was assessed for seroconversion upon discharge from military service. Overall seroprevalence rates were 87% for EBV and 59% for CMV. An association between the seroprevalence of EBV and CMV was observed. Seroconversion was 56% for EBV as compared with 31% for CMV. Lower paternal education was found to be associated with both EBV and CMV seroprevalence. Lower socioeconomic status, North African origin, and urban residence were found to be associated with CMV seropositivity, as was smoking for EBV seropositivity. Socioeconomic disparities exist in the seroprevalence rates of CMV and EBV among Israeli male young adults. The results of the study could aid public health efforts and determine target populations when a vaccine becomes available. Copyright © 2012 Elsevier Inc. All rights reserved.

A possible link between the Epstein-Barr virus infection and autoimmune thyroid disorders.

PubMed

Dittfeld, Anna; Gwizdek, Katarzyna; Michalski, Marek; Wojnicz, Romuald

2016-01-01

The Epstein-Barr virus (EBV), also known as human herpesvirus 4, is a member of the Herpesviridae virus family. EBV infection can cause infectious mononucleosis (IM) in the lytic phase of EBV's life cycle. Past EBV infection is associated with lymphomas, and may also result in certain allergic and autoimmune diseases. Although potential mechanisms of autoimmune diseases have not been clearly elucidated, both genetic and environmental factors, such as infectious agents, are considered to be responsible for their development. In addition, EBV modifies the host immune response. The worldwide prevalence of autoimmune diseases shows how common this pathogen is. Normally, the virus stays in the body and remains dormant throughout life. However, this is not always the case, and a serious EBV-related illness may develop later in life. This explains the chronic course of autoimmune diseases that is often accompanied by exacerbations of symptoms. Based on the present studies, EBV infection can cause autoimmune diseases, such as systemic lupus erythematosus (SLE), multiple sclerosis (MS), rheumatoid arthritis (RA), Sjögren's syndrome, and autoimmune hepatitis. The EBV has also been reported in patients with autoimmune thyroid disorders. Although EBV is not the only agent responsible for the development of autoimmune thyroid diseases, it can be considered a contributory factor.

Contamination of sequence databases with adaptor sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoshikawa, Takeo; Sanders, A.R.; Detera-Wadleigh, S.D.

Because of the exponential increase in the amount of DNA sequences being added to the public databases on a daily basis, it has become imperative to identify sources of contamination rapidly. Previously, contaminations of sequence databases have been reported to alert the scientific community to the problem. These contaminations can be divided into two categories. The first category comprises host sequences that have been difficult for submitters to manage or control. Examples include anomalous sequences derived from Escherichia coli, which are inserted into the chromosomes (and plasmids) of the bacterial hosts. Insertion sequences are highly mobile and are capable ofmore » transposing themselves into plasmids during cloning manipulation. Another example of the first category is the infection with yeast genomic DNA or with bacterial DNA of some commercially available cDNA libraries from Clontech. The second category of database contamination is due to the inadvertent inclusion of nonhost sequences. This category includes incorporation of cloning-vector sequences and multicloning sites in the database submission. M13-derived artifacts have been common, since M13-based vectors have been widely used for subcloning DNA fragments. Recognizing this problem, the National Center for Biotechnology Information (NCBI) started to screen, in April 1994, all sequences directly submitted to GenBank, against a set of vector data retrieved from GenBank by use of key-word searches, such as {open_quotes}vector.{close_quotes} In this report, we present evidence for another sequence artifact that is widespread but that, to our knowledge, has not yet been reported. 11 refs., 1 tab.« less

Protection from ischemic heart injury by a vigilant heme oxygenase-1 plasmid system.

PubMed

Tang, Yao Liang; Tang, Yi; Zhang, Y Clare; Qian, Keping; Shen, Leping; Phillips, M Ian

2004-04-01

Although human heme oxygenase-1 (hHO-1) could provide a useful approach for cellular protection in the ischemic heart, constitutive overexpression of hHO-1 may lead to unwanted side effects. To avoid this, we designed a hypoxia-regulated hHO-1 gene therapy system that can be switched on and off. This vigilant plasmid system is composed of myosin light chain-2v promoter and a gene switch that is based on an oxygen-dependent degradation domain from the hypoxia inducible factor-1-alpha. The vector can sense ischemia and switch on the hHO-1 gene system, specifically in the heart. In an in vivo experiment, the vigilant hHO-1 plasmid or saline was injected intramyocardially into myocardial infarction mice or sham operation mice. After gene transfer, expression of hHO-1 was only detected in the ischemic heart treated with vigilant hHO-1 plasmids. Masson trichrome staining showed significantly fewer fibrotic areas in vigilant hHO-1 plasmids-treated mice compared with saline control (43.0%+/-4.8% versus 62.5%+/-3.3%, P<0.01). The reduction of interstitial fibrosis is accompanied by an increase in myocardial hHO-1 expression in peri-infarct border areas, concomitant with higher Bcl-2 levels and lower Bax, Bak, and caspase 3 levels in the ischemic myocardium compared with saline control. By use of a cardiac catheter, heart from vigilant hHO-1 plasmids-treated mice showed improved recovery of contractile and diastolic performance after myocardial infarction compared with saline control. This study documents the beneficial regulation and therapeutic potential of vigilant plasmid-mediated hHO-1 gene transfer. This novel gene transfer strategy can provide cardiac-specific protection from future repeated bouts of ischemic injury.

Proposed categorization of pathological states of EBV-associated T/natural killer-cell lymphoproliferative disorder (LPD) in children and young adults: overlap with chronic active EBV infection and infantile fulminant EBV T-LPD.

PubMed

Ohshima, Koichi; Kimura, Hiroshi; Yoshino, Tadashi; Kim, Chul Woo; Ko, Young H; Lee, Seung-Suk; Peh, Suat-Cheng; Chan, John K C

2008-04-01

EBV-associated T/natural killer (NK)-cell lymphoproliferative disorder (EBV-T/NK LPD) of children and young adults is generally referred to with the blanket nosological term of severe chronic active EBV infection (CAEBV). This disease is rare, associated with high morbidity and mortality, and appears to be more prevalent in East Asian countries. But because there is no grading or categorization system for CAEBV, pathologists and clinicians often disagree regarding diagnosis and therapy. EBV-T/NK LPD includes polyclonal, oligoclonal, and monoclonal proliferation of cytotoxic T and/or NK cells. Moreover, a unique disease previously described as infantile fulminant EBV-associated T-LPD has been identified and overlaps with EBV-T/NK LPD. In the present review a clinicopathological categorization of EBV-T/NK LPD is proposed, based on pathological evaluation and molecular data, as follows: (i) category A1, polymorphic LPD without clonal proliferation of EBV-infected cells; (ii) category A2, polymorphic LPD with clonality; (iii) category A3, monomorphic LPD (T-cell or NK cell lymphoma/leukemia) with clonality; and (iv) category B, monomorphic LPD (T-cell lymphoma) with clonality and fulminant course. Categories A1, A2, and A3 possibly constitute a continuous spectrum and together are equivalent to CAEBV. Category B is the exact equivalent of infantile fulminant EBV-associated T-LPD. It is expected that this categorization system will provide a guide for the better understanding of this disorder. This proposal was approved at the third meeting of the Asian Hematopathology Association (Nagoya, 2006).

Tailor-made gene silencing of Staphylococcus aureus clinical isolates by CRISPR interference

PubMed Central

Sato’o, Yusuke; Hisatsune, Junzo; Yu, Liansheng; Sakuma, Tetsushi; Yamamoto, Takashi

2018-01-01

Preparing the genetically modified organisms have required much time and labor, making it the rate-limiting step but CRISPR/Cas9 technology appearance has changed this difficulty. Although reports on CRISPR/Cas9 technology such as genome editing and CRISPR interference (CRISPRi) in eukaryotes increased, those in prokaryotes especially in Staphylococci were limited. Thus, its potential in the bacteriology remains unexplored. This is attributed to ecological difference between eukaryotes and prokaryotes. Here, we constructed a novel CRISPRi plasmid vector, pBACi for Staphylococcus aureus. The transformation efficiency of S. aureus was ~104 CFU/μg DNA using a vector extracted from dcm negative, which encoded one of DNA modification genes, E. coli. Further, pBACi was introduced into various clinical isolates including that not accepting the conventional temperature-sensitive vector. dcas9 in the vector was expressed throughout the growth phases of S. aureus and this vector decreased various gene mRNA expressions based on the crRNA targeting sequences and altered the knockdown strains’ phenotypes. The targeted genes included various virulence and antibiotic resistant genes. Bioinformatics suggest this vector can be introduced into wide range of low-GC Gram-positive bacteria. Because this new CRISPR/Cas9-based vector can easily prepare knockdown strains, we believe the novel vector will facilitate the characterization of the function of genes from S. aureus and other Gram-positive bacteria. PMID:29377933

Testing plasmid stability of Escherichia coli using the Continuously Operated Shaken BIOreactor System.

PubMed

Sieben, Michaela; Steinhorn, Gregor; Müller, Carsten; Fuchs, Simone; Ann Chin, Laura; Regestein, Lars; Büchs, Jochen

2016-11-01

Plasmids are common vectors to genetically manipulate Escherichia coli or other microorganisms. They are easy to use and considerable experience has accumulated on their application in heterologous protein production. However, plasmids can be lost during cell growth, if no selection pressure like, e.g., antibiotics is used, hampering the production of the desired protein and endangering the economic success of a biotechnological production process. Thus, in this study the Continuously Operated Shaken BIOreactor System (COSBIOS) is applied as a tool for fast parallel testing of strain stability and operation conditions and to evaluate measures to counter such plasmid loss. In specific, by applying various ampicillin concentrations, the lowest effective ampicillin dosage is investigated to secure plasmid stability while lowering adverse ecological effects. A significant difference was found in the growth rates of plasmid-bearing and plasmid-free cells. The undesired plasmid-free cells grew 30% faster than the desired plasmid-bearing cells. During the testing of plasmid stability without antibiotics, the population fraction of plasmid-bearing cells rapidly decreased in continuous culture to zero within the first 48 h. An initial single dosage of ampicillin did not prevent plasmid loss. By contrast, a continuous application of a low dosage of 10 µg/mL ampicillin in the feed medium maintained plasmid stability in the culture. Consequently, the COSBIOS is an apt reactor system for measuring plasmid stability and evaluating methods to enhance this stability. Hence, decreased production of heterologous protein can be prevented. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:1418-1425, 2016. © 2016 American Institute of Chemical Engineers.

Current preventive strategies and management of Epstein-Barr virus-related post-transplant lymphoproliferative disease in solid organ transplantation in Europe. Results of the ESGICH Questionnaire-based Cross-sectional Survey.

PubMed

San-Juan, R; Manuel, O; Hirsch, H H; Fernández-Ruiz, M; López-Medrano, F; Comoli, P; Caillard, S; Grossi, P; Aguado, J M

2015-06-01

There is limited clinical evidence on the utility of the monitoring of Epstein-Barr virus (EBV) DNAemia in the pre-emptive management of post-transplant lymphoproliferative disease (PTLD) in solid organ transplant (SOT) recipients. We investigated current preventive measures against EBV-related PTLD through a web-based questionnaire sent to 669 SOT programmes in 35 European countries. This study was performed on behalf of the ESGICH study group from the European Society of Clinical Microbiology and Infectious Diseases. A total of 71 SOT programmes from 15 European countries participated in the study. EBV serostatus of the recipient is routinely obtained in 69/71 centres (97%) and 64 (90%) have access to EBV DNAemia assays. EBV monitoring is routinely used in 85.9% of the programmes and 77.4% reported performing pre-emptive treatment for patients with significant EBV DNAemia levels. Pre-emptive treatment for EBV DNAemia included reduction of immunosuppression in 50.9%, switch to mammalian target of rapamycin inhibitors in 30.9%, and use of rituximab in 14.5% of programmes. Imaging by whole-body 18-fluoro-deoxyglucose positron emission tomography (FDG-PET) is used in 60.9% of centres to rule out PTLD and complemented computer tomography is used in 50%. In 10.9% of centres, FDG-PET is included in the first-line diagnostic workup in patients with high-risk EBV DNAemia. Despite the lack of definitive evidence, EBV load measurements are frequently used in Europe to guide diagnostic workup and pre-emptive reduction of immunosuppression. We need prospective and controlled studies to define the impact of EBV monitoring in reducing the risk of PTLD in SOT recipients. Copyright © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

APOBEC3-mediated hypermutation of retroviral vectors produced from some retrovirus packaging cell lines.

PubMed

Miller, A D; Metzger, M J

2011-05-01

APOBEC3 proteins are packaged into retrovirus virions and can hypermutate retroviruses during reverse transcription. We found that HT-1080 human fibrosarcoma cells hypermutate retroviruses, and that the HT-1080 cell-derived FLYA13 retrovirus packaging cells also hypermutate a retrovirus vector produced using these cells. We found no hypermutation of the same vector produced by the mouse cell-derived packaging line PT67 or by human 293 cells transfected with the vector and retrovirus packaging plasmids. We expect that avoidance of vector hypermutation will be particularly important for vectors used in gene therapy, wherein mutant proteins might stimulate deleterious immune responses.

Comparison of immune responses to different foot-and-mouth disease genetically engineered vaccines in guinea pigs.

PubMed

Yao, Qingxia; Qian, Ping; Huang, Qinfeng; Cao, Yi; Chen, Huanchun

2008-01-01

The P12A3C gene from FMDV (serotype O) encoding the capsid precursor protein, and the highly immunogenic gene FHG, which encodes multiple epitopes of FMDV capsid proteins, were inserted into eukaryotic expression vectors to compare different candidate genetically engineered vaccines for foot-and-mouth disease (FMD). A modified live pseudorabies virus (MLPRV) was also used to deliver P12A3C. Guinea pigs were inoculated intramuscularly with the candidate vaccines to compare the ability to elicit immunity of the DNA vector and a live viral vector. An indirect enzyme-linked immunosorbent assay (iELISA), virus-neutralization test and lymphoproliferation assay were used to detect antibody and cellular responses. The group immunized with P12A3C delivered by MLPRV produced significantly greater antibody and cellular responses indicating that MLPRV has a greater ability to mediate exogenous gene delivery than the plasmid DNA vector. Comparison of the immune responses induced by P12A3C and FHG, which were both mediated by DNA plasmids, showed that FHG and P12A3C elicited similar cellular responses, while P12A3C induced higher antibody levels, suggesting that P12A3C is a more powerful immunogen than FHG. In challenge experiments, guinea pigs vaccinated with P12A3C delivered by MLPRV were protected fully from FMDV challenge, whereas guinea pigs vaccinated with P12A3C or FHG delivered by DNA plasmid were only protected partially. This study provides a basis for future construction of a genetically engineered vaccine for FMDV.

Synthesis and evaluation of cationic nanomicelles for in vitro and in vivo gene delivery

NASA Astrophysics Data System (ADS)

Mandke, Rhishikesh Subhash

The goal of proposed study was to contribute towards the development of a nano size, high efficiency and low toxicity non-viral polymeric vector for gene delivery in vitro and in vivo. A series of fatty acid grafted low-molecular-weight chitosan (N-acyl LMWCs) were synthesized, purified and characterized for their physicochemical properties using various analytical techniques such as infrared spectroscopy, elemental analysis and dynamic light scattering. The formulation parameters including pH, sonication duration, and filtration altered the physicochemical characteristics of N-acyl LMWC nanomicelles. The acyl chain length and degree of unsaturation in fatty acids also had an impact on the physicochemical properties and the transfection efficiency of nanomicelles. N-acyl LMWC nanomicelles showed efficient in vitro transfection as visualized and quantified using a reporter plasmid (encoding green fluorescent protein), and therapeutic plasmids (encoding for interleukin-4 and interleukin-10), respectively. The in vitro transfection efficiencies of N-acyl LMWCs with 18:1 and 18:2 grafts (oleic and linoleic acids) were comparable with FuGENERTM HD (marketed non-viral vector) but were ˜8-fold and 35-fold higher as compared to LMWC and naked DNA, respectively. The in vivo transfection efficiency of N-acyl LMWC to deliver plasmids individually encoding IL-4 and IL-10 as well as a bicistronic plasmid encoding both IL-4 and IL-10 was studied in a multiple, low-dose streptozotocin induced diabetic mouse model. The transfection efficiency of pDNA/N-acyl LMWC polyplexes injected via intramuscular route showed significant improvement (p<0.05) over passive (naked DNA) or positive (FuGENE HD) controls. Additionally, a sustained and efficient expression of IL-4 and IL-10 was observed, accompanied by a reduction in interferon-gamma (INF-gamma), and tumor necrosis factor-alpha (TNF-alpha) levels. The pancreas of pDNA/N-acyl LMWC polyplex treated animals exhibited protection from streptozotocin-induced insulitis and the delivery systems were biocompatible. Histological studies revealed that there were no signs of chronic inflammation at the injection site. The bicistronic plasmid exhibited significantly (p<0.05) greater expression of IL-4 and IL-10, and demonstrated the feasibility of bicistronic IL-4/IL-10 plasmid/N-acyl LMWC nanomicelles-based polyplexes as an efficient and biocompatible system for the prevention of autoimmune diabetes.

Mutations of amino acids in the DNA-recognition domain of Epstein-Barr virus ZEBRA protein alter its sub-nuclear localization and affect formation of replication compartments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, Richard; Heston, Lee; Shedd, Duane

ZEBRA, a transcription factor and DNA replication protein encoded by the Epstein-Barr virus (EBV) BZLF1 gene, plays indispensable roles in the EBV lytic cycle. We recently described the phenotypes of 46 single amino acid substitutions introduced into the DNA-recognition region of ZEBRA [Heston, L., El-Guindy, A., Countryman, J., Dela Cruz, C., Delecluse, H.J., and Miller, G. 2006]. The 27 DNA-binding-proficient mutants exhibited distinct defects in their ability to activate expression of the kinetic classes of viral genes. Four phenotypic variants could be discerned: wild-type, defective at activating Rta, defective at activating early genes, and defective at activating late genes. Heremore » we analyze the distribution of ZEBRA within the nucleus and the localization of EA-D (the viral DNA polymerase processivity factor), an indicator of the development of replication compartments, in representatives of each phenotypic group. Plasmids encoding wild-type (WT) and mutant ZEBRA were transfected into 293 cells containing EBV-bacmids. WT ZEBRA protein was diffusely and smoothly distributed throughout the nucleus, sparing nucleoli, and partially recruited to globular replication compartments. EA-D induced by WT ZEBRA was present diffusely in some cells and concentrated in globular replication compartments in other cells. The distribution of ZEBRA and EA-D proteins was identical to WT following transfection of K188R, a mutant with a conservative change. The distribution of S186A mutant ZEBRA protein, defective for activation of Rta and EA-D, was identical to WT, except that the mutant ZEBRA was never found in globular compartments. Co-expression of Rta with S186A mutant rescued diffuse EA-D but not globular replication compartments. The most striking observation was that several mutant ZEBRA proteins defective in activating EA-D (R179A, K181A and A185V) and defective in activating lytic viral DNA replication and late genes (Y180E and K188A) were localized to numerous punctate foci. The speckled appearance of R179A and Y180E was more regular and clearly defined in EBV-positive than in EBV-negative 293 cells. The Y180E late-mutant induced EA-D, but prevented EA-D from localizing to globular replication compartments. These results show that individual amino acids within the basic domain influence localization of the ZEBRA protein and its capacity to induce EA-D to become located in mature viral replication compartments. Furthermore, these mutant ZEBRA proteins delineate several stages in the processes of nuclear re-organization which accompany lytic EBV replication.« less

A method to facilitate and monitor expression of exogenous genes in the rat kidney using plasmid and viral vectors

PubMed Central

Corridon, Peter R.; Rhodes, George J.; Leonard, Ellen C.; Basile, David P.; Gattone, Vincent H.; Bacallao, Robert L.

2013-01-01

Gene therapy has been proposed as a novel alternative to treat kidney disease. This goal has been hindered by the inability to reliably deliver transgenes to target cells throughout the kidney, while minimizing injury. Since hydrodynamic forces have previously shown promising results, we optimized this approach and designed a method that utilizes retrograde renal vein injections to facilitate transgene expression in rat kidneys. We show, using intravital fluorescence two-photon microscopy, that fluorescent albumin and dextrans injected into the renal vein under defined conditions of hydrodynamic pressure distribute broadly throughout the kidney in live animals. We found injection parameters that result in no kidney injury as determined by intravital microscopy, histology, and serum creatinine measurements. Plasmids, baculovirus, and adenovirus vectors, designed to express EGFP, EGFP-actin, EGFP-occludin, EGFP-tubulin, tdTomato-H2B, or RFP-actin fusion proteins, were introduced into live kidneys in a similar fashion. Gene expression was then observed in live and ex vivo kidneys using two-photon imaging and confocal laser scanning microscopy. We recorded widespread fluorescent protein expression lasting more than 1 mo after introduction of transgenes. Plasmid and adenovirus vectors provided gene transfer efficiencies ranging from 50 to 90%, compared with 10–50% using baculovirus. Using plasmids and adenovirus, fluorescent protein expression was observed 1) in proximal and distal tubule epithelial cells; 2) within glomeruli; and 3) within the peritubular interstitium. In isolated kidneys, fluorescent protein expression was observed from the cortex to the papilla. These results provide a robust approach for gene delivery and the study of protein function in live mammal kidneys. PMID:23467422

Optimized Pan-species and Speciation Duplex Real-time PCR Assays for Plasmodium Parasites Detection in Malaria Vectors

PubMed Central

Sandeu, Maurice Marcel; Moussiliou, Azizath; Moiroux, Nicolas; Padonou, Gilles G.; Massougbodji, Achille; Corbel, Vincent; Tuikue Ndam, Nicaise

2012-01-01

Background An accurate method for detecting malaria parasites in the mosquito’s vector remains an essential component in the vector control. The Enzyme linked immunosorbent assay specific for circumsporozoite protein (ELISA-CSP) is the gold standard method for the detection of malaria parasites in the vector even if it presents some limitations. Here, we optimized multiplex real-time PCR assays to accurately detect minor populations in mixed infection with multiple Plasmodium species in the African malaria vectors Anopheles gambiae and Anopheles funestus. Methods Complementary TaqMan-based real-time PCR assays that detect Plasmodium species using specific primers and probes were first evaluated on artificial mixtures of different targets inserted in plasmid constructs. The assays were further validated in comparison with the ELISA-CSP on 200 field caught Anopheles gambiae and Anopheles funestus mosquitoes collected in two localities in southern Benin. Results The validation of the duplex real-time PCR assays on the plasmid mixtures demonstrated robust specificity and sensitivity for detecting distinct targets. Using a panel of mosquito specimen, the real-time PCR showed a relatively high sensitivity (88.6%) and specificity (98%), compared to ELISA-CSP as the referent standard. The agreement between both methods was “excellent” (κ = 0.8, P<0.05). The relative quantification of Plasmodium DNA between the two Anopheles species analyzed showed no significant difference (P = 0, 2). All infected mosquito samples contained Plasmodium falciparum DNA and mixed infections with P. malariae and/or P. ovale were observed in 18.6% and 13.6% of An. gambiae and An. funestus respectively. Plasmodium vivax was found in none of the mosquito samples analyzed. Conclusion This study presents an optimized method for detecting the four Plasmodium species in the African malaria vectors. The study highlights substantial discordance with traditional ELISA-CSP pointing out the utility of employing an accurate molecular diagnostic tool for detecting malaria parasites in field mosquito populations. PMID:23285168

RNA interference mediated in human primary cells via recombinant baculoviral vectors.

PubMed

Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T

2005-04-01

The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.

Enhanced immune response and protective efficacy of a Treponema pallidum Tp92 DNA vaccine vectored by chitosan nanoparticles and adjuvanted with IL-2.

PubMed

Zhao, Feijun; Wu, Yimou; Zhang, Xiaohong; Yu, Jian; Gu, Weiming; Liu, Shuangquan; Zeng, Tiebing; Zhang, Yuejun; Wang, Shiping

2011-10-01

In this study, the immune-modulatory and protective efficacy of using an interleukin-2 (IL-2) expression plasmid as a genetic adjuvant and chitosan (CS) nanoparticles as vectors to enhance a Tp92 DNA vaccine candidate were investigated in a Treponema pallidum (Tp) rabbit challenge model. CS vectoring of pTp92 or pIL-2 were both demonstrated to augment anti-Tp92 antibody levels induced by pTp92 DNA vaccines. Interestingly, the combination of CS vectored Tp92 and pIL-2 led to the greatest enhancements of anti-Tp92 antibodies and T-cell proliferation (p < 0.05). At week 10 after the first immunization, 15 of the 18 rabbits in each group were challenged with Tp Nichols strain and monitored for skin lesions and ulcer lesions. Ratios of positive skin lesions and ratios of ulcer lesions in groups immunized with pTp92 were significantly lower than those of the empty vector or PBS groups (p < 0.05), demonstrating that pTp92 immunization elicited significant protective efficacy against the Tp Nichols strain challenge. CS vectored and pIL-2 adjuvanted pTp92 immunized animals exhibited the lowest rates of positive skin and ulcer lesions. Male New Zealand white rabbits were randomly assigned to groups (n = 18/group) and immunized intramuscularly with pTp92 based plasmid DNA constructs (100 μg of DNA/rabbit/immunization). Two weeks before Tp challenge (Week 8), three rabbits from each group were used to determine cytokine measurements and fifteen rabbits from each group were used for Tp challenge studies. Intramuscular injection of pTp92 induced strong humoral and cellular immune responses and conferred protection from Tp challenge in rabbits. The use of CS as a pTp92 vector or pIL-2 as an adjuvant achieved a superior level of protective efficacy against Tp challenge, however CS vectored, IL-2 adjuvanted pTp92 immunization conferred the highest level of protective efficacy.

A novel approach to investigate the uptake and internalization of Escherichia coli O157:H7 in spinach cultivated in soil and hydroponic media

USDA-ARS?s Scientific Manuscript database

Internalization of E. coli O157:H7 into spinach plants through root uptake is a potential route of contamination. A Tn7-based plasmid vector was used to insert the green fluorescent protein (gfp) gene into the attTn7 site in the E. coli chromosome. Three gfp-labeled E. coli inocula, O157:H7 strains ...

In vivo and in vitro cloning and phenotype characterization of tellurite resistance determinant conferred by plasmid pTE53 of a clinical isolate of Escherichia coli.

PubMed

Burian, J; Tu, N; Kl'ucár, L; Guller, L; Lloyd-Jones, G; Stuchlík, S; Fejdi, P; Siekel, P; Turna, J

1998-01-01

A determinant encoding resistance against potassium tellurite (Te(r)) was discovered in a clinical isolate of Escherichia coli strain KL53. The strain formed typical black colonies on solid LB medium with tellurite. The determinant was located on a large conjugative plasmid designated pTE53. Electron-dense particles were observed in cells harboring pTE53 by electron microscopy. X-Ray identification analysis identified these deposits as elemental tellurium and X-ray diffraction analysis showed patterns typical of crystalline structures. Comparison with JCPDS 4-0554 (Joint Committee on Powder Diffraction Standards) reference data confirmed that these crystals were pure tellurium crystals. In common with other characterized Te(r) determinants, accumulation studies with radioactively labeled tellurite showed that reduced uptake of tellurite did not contribute to the resistance mechanism. Tellurite accumulation rates for E. coli strain AB1157 harboring pTE53 were twice higher than for the plasmid-free host strain. In addition, no efflux mechanism was detected. The potassium tellurite resistance determinant of plasmid pTE53 was cloned using both in vitro and in vivo techniques in low-copy-number vectors pACYC184 and mini-Mu derivative pPR46. Cloning of the functional Te(r) determinant into high-copy cloning vectors pTZ19R and mini-Mu derivatives pBEf and pJT2 was not successful. During in vivo cloning experiments, clones with unusual "white colony" phenotypes were found on solid LB with tellurite. All these clones were Mucts62 lysogens. Their tellurite resistance levels were in the same order as the wild type strains. Clones with the "white" phenotype had a 3.6 times lower content of tellurium than the tellurite-reducing strain. Transformation of a "white" mutant with a recombinant pACYC184 based Te(r) plasmid did not change the phenotype. However, when one clone was cured from Mucts62 the "white" phenotype reverted to the wild-type "black" phenotype. It was suggested that the "white" phenotype was the result of an insertional inactivation of an unknown chromosomal gene by Mucts62, which reduced the tellurite uptake.

Epstein–Barr Virus-Positive T/NK-Cell Lymphoproliferative Disorders Manifested as Gastrointestinal Perforations and Skin Lesions

PubMed Central

Xiao, Hai-Juan; Li, Ji; Song, Hong-Mei; Li, Zheng-Hong; Dong, Mei; Zhou, Xiao-Ge

2016-01-01

Abstract Systemic Epstein–Barr virus (EBV)-positive T-cell lymphoproliferative disorders (LPDs) of childhood is a highly aggressive EBV-positive T/natural killer (NK)-cell LPD, which emerges in the background of chronic active EBV infection (CAEBV) or shortly after primary acute EBV infection. The clinical presentations of CAEBV are varied; patients with atypical manifestations are easily misdiagnosed. We described a 14-year-old boy suffering from digestive disorders and intermittent fever for 1 year and 9 months, whose conditions worsened and skin lesions occurred 2 months before hospitalization. He was diagnosed as inflammatory bowel diseases (IBD) and treated accordingly. His other clinical features, hepatosplenomegaly, lymphadenopathy, anemia, hypoalbuminemia, and elevated inflammatory marks, were found in hospitalization. The boy suffered from repeatedly spontaneous intestinal perforations shortly after hospitalization and died of intestinal hemorrhea. The pathological results of intestine and skin both showed EBV-positive T/NK-cell LPD (lymphoma stage). There are rare studies reporting gastrointestinal perforations in EBV-positive T/NK-cell LPD, let alone repeatedly spontaneous perforations. Based on the clinical features and pathological results of this patient, the disease progressed from CAEBV (T-cell type) to systemic EBV-positive T-cell LPD of childhood (lymphoma). Not all the patients with CAEBV could have unusual patterns of anti-EBV antibodies. However, the presence of high EBV loads (EBV-encoded early small ribonucleic acid (RNA) (EBER) in affected tissues and/or EBV deoxyribonucleic acid (DNA) in peripheral blood) is essential for diagnosing CAEBV. Maybe because of his less common clinical features for CAEBV and negative anti-EBV antibodies, the boy was not diagnosed correctly. We should have emphasized the test for EBER or EBV-DNA. Meanwhile, for the IBD patients whose manifestations were not typical, and whose conditions were not improved by suitable therapies against IBD, infectious and malignant diseases should be considered. PMID:26844502

Epstein-Barr Virus-Positive T/NK-Cell Lymphoproliferative Disorders Manifested as Gastrointestinal Perforations and Skin Lesions: A Case Report.

PubMed

Xiao, Hai-Juan; Li, Ji; Song, Hong-Mei; Li, Zheng-Hong; Dong, Mei; Zhou, Xiao-Ge

2016-02-01

Systemic Epstein-Barr virus (EBV)-positive T-cell lymphoproliferative disorders (LPDs) of childhood is a highly aggressive EBV-positive T/natural killer (NK)-cell LPD, which emerges in the background of chronic active EBV infection (CAEBV) or shortly after primary acute EBV infection. The clinical presentations of CAEBV are varied; patients with atypical manifestations are easily misdiagnosed. We described a 14-year-old boy suffering from digestive disorders and intermittent fever for 1 year and 9 months, whose conditions worsened and skin lesions occurred 2 months before hospitalization. He was diagnosed as inflammatory bowel diseases (IBD) and treated accordingly. His other clinical features, hepatosplenomegaly, lymphadenopathy, anemia, hypoalbuminemia, and elevated inflammatory marks, were found in hospitalization. The boy suffered from repeatedly spontaneous intestinal perforations shortly after hospitalization and died of intestinal hemorrhea. The pathological results of intestine and skin both showed EBV-positive T/NK-cell LPD (lymphoma stage).There are rare studies reporting gastrointestinal perforations in EBV-positive T/NK-cell LPD, let alone repeatedly spontaneous perforations. Based on the clinical features and pathological results of this patient, the disease progressed from CAEBV (T-cell type) to systemic EBV-positive T-cell LPD of childhood (lymphoma). Not all the patients with CAEBV could have unusual patterns of anti-EBV antibodies. However, the presence of high EBV loads (EBV-encoded early small ribonucleic acid (RNA) (EBER) in affected tissues and/or EBV deoxyribonucleic acid (DNA) in peripheral blood) is essential for diagnosing CAEBV. Maybe because of his less common clinical features for CAEBV and negative anti-EBV antibodies, the boy was not diagnosed correctly. We should have emphasized the test for EBER or EBV-DNA. Meanwhile, for the IBD patients whose manifestations were not typical, and whose conditions were not improved by suitable therapies against IBD, infectious and malignant diseases should be considered.

Cationic Lipid-Nucleic Acid Complexes for Gene Delivery And Silencing: Pathways And Mechanisms for Plasmid Dna And Sirna

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ewert, K.K.; Zidovska, A.; Ahmad, A.

2012-07-17

Motivated by the promises of gene therapy, there is great interest in developing non-viral lipid-based vectors for therapeutic applications due to their low immunogenicity, low toxicity, ease of production, and the potential of transferring large pieces of DNA into cells. In fact, cationic liposome (CL) based vectors are among the prevalent synthetic carriers of nucleic acids (NAs) currently used in gene therapy clinical trials worldwide. These vectors are studied both for gene delivery with CL-DNA complexes and gene silencing with CL-siRNA (short interfering RNA) complexes. However, their transfection efficiencies and silencing efficiencies remain low compared to those of engineered viralmore » vectors. This reflects the currently poor understanding of transfection-related mechanisms at the molecular and self-assembled levels, including a lack of knowledge about interactions between membranes and double stranded NAs and between CL-NA complexes and cellular components. In this review we describe our recent efforts to improve the mechanistic understanding of transfection by CL-NA complexes, which will help to design optimal lipid-based carriers of DNA and siRNA for therapeutic gene delivery and gene silencing.« less

Recombinant plasmids for encoding restriction enzymes DpnI and DpnII of streptococcus pneumontae

DOEpatents

Lacks, Sanford A.

1990-01-01

Chromosomal DNA cassettes containing genes encoding either the DpnI or DpnII restriction endonucleases from Streptococcus pneumoniae are cloned into a streptococcal vector, pLS101. Large amounts of the restriction enzymes are produced by cells containing the multicopy plasmids, pLS202 and pLS207, and their derivatives pLS201, pLS211, pLS217, pLS251 and pLS252.

Recombinant plasmids for encoding restriction enzymes DpnI and DpnII of Streptococcus pneumontae

DOEpatents

Lacks, S.A.

1990-10-02

Chromosomal DNA cassettes containing genes encoding either the DpnI or DpnII restriction endonucleases from Streptococcus pneumoniae are cloned into a streptococcal vector, pLS101. Large amounts of the restriction enzymes are produced by cells containing the multicopy plasmids, pLS202 and pLS207, and their derivatives pLS201, pLS211, pLS217, pLS251 and pLS252. 9 figs.

Introduction to the ultrasound targeted microbubble destruction technique.

PubMed

Walton, Chad B; Anderson, Cynthia D; Boulay, Rachel; Shohet, Ralph V

2011-06-12

In UTMD, bioactive molecules, such as negatively charged plasmid DNA vectors encoding a gene of interest, are added to the cationic shells of lipid microbubble contrast agents. In mice these vector-carrying microbubbles can be administered intravenously or directly to the left ventricle of the heart. In larger animals they can also be infused through an intracoronary catheter. The subsequent delivery from the circulation to a target organ occurs by acoustic cavitation at a resonant frequency of the microbubbles. It seems likely that the mechanical energy generated by the microbubble destruction results in transient pore formation in or between the endothelial cells of the microvasculature of the targeted region. As a result of this sonoporation effect, the transfection efficiency into and across the endothelial cells is enhanced, and transgene-encoding vectors are deposited into the surrounding tissue. Plasmid DNA remaining in the circulation is rapidly degraded by nucleases in the blood, which further reduces the likelihood of delivery to non-sonicated tissues and leads to highly specific target-organ transfection.

Molecular cloning and expression in Saccharomyces cerevisiae and Neurospora crassa of the invertase gene from Neurospora crassa.

PubMed

Carú, M; Cifuentes, V; Pincheira, G; Jiménez, A

1989-10-01

A plasmid (named pCN2) carrying a 7.6 kb BamHI DNA insert was isolated from a Neurospora crassa genomic library raised in the yeast vector YRp7. Saccharomyces cerevisiae suco and N. crassa inv strains transformed with pNC2 were able to grow on sucrose-based media and expressed invertase activity. Saccharomyces cerevisiae suco (pNC2) expressed a product which immunoreacted with antibody raised against purified invertase from wild type N. crassa, although S. cerevisiae suc+ did not. The cloned DNA hybridized with a 7.6 kb DNA fragment from BamHI-restricted wild type N. crassa DNA. Plasmid pNC2 transformed N. crassa Inv- to Inv+ by integration either near to the endogenous inv locus (40% events) or at other genomic sites (60% events). It appears therefore that the cloned DNA piece encodes the N. crassa invertase enzyme. A 3.8 kb XhoI DNA fragment, derived from pNC2, inserted in YRp7, in both orientation, was able to express invertase activity in yeast, suggesting that it contains an intact invertase gene which is not expressed from a vector promoter.

[Experimental study on human periodontal ligament cells transfected with human amelogenin gene].

PubMed

Yu, Guang; Shu, Rong; Sun, Ying; Cheng, Lan; Song, Zhong-Chen; Zhang, Xiu-Li

2008-02-01

To construct the recombinant lentiviral vector of human amelogenin gene, infect human periodontal ligament cells with the recombinant lentivirus, and evaluate the feasibility of applying modified PDLCs as seeds for a further periodontal reconstruction. The mature peptide of hAm cDNA was cloned and linked into the vector plasmid, the recombinant plasmid FUAmW was confirmed by double enzyme digestion and sequence analysis. Recombinant lentivirus was prepared from 293T cells by polytheylenimine (PEI)-mediated transient cotransfection. The hPDLCs and 293T cells were infected with the generated lentivirus. The infection efficiency was analysed by detection of green fluorescence protein (GFP) with fluorescent microscope and flow cytometer 72 hours later. The expression of hAm gene was detected by reverse transcription polymerase chain reaction (RT-PCR). The sequence of inserted fragment in recombinant plasmid was identical to the hAm sequence reported in Genebank. Green fluorescence was visible under fluorescent microscope, FCM assay showed that positive percentage was 69.46% and 33.99% in 293T and hPDLCs, respectively. The targeted gene was obtained in the experimental groups by RT-PCR. The recombinan lentiviral vector of hAm gene is constructed successfully and it could be transfected into cultured hPDLCs. hAm gene and seed cells may be used for further study in the fields periodontal tissue engineering. Supported by National Natural Science Foundation of China (Grant No. 30672315).

Robust RNAi enhancement via human Argonaute-2 overexpression from plasmids, viral vectors and cell lines

PubMed Central

Börner, Kathleen; Niopek, Dominik; Cotugno, Gabriella; Kaldenbach, Michaela; Pankert, Teresa; Willemsen, Joschka; Zhang, Xian; Schürmann, Nina; Mockenhaupt, Stefan; Serva, Andrius; Hiet, Marie-Sophie; Wiedtke, Ellen; Castoldi, Mirco; Starkuviene, Vytaute; Erfle, Holger; Gilbert, Daniel F.; Bartenschlager, Ralf; Boutros, Michael; Binder, Marco; Streetz, Konrad; Kräusslich, Hans-Georg; Grimm, Dirk

2013-01-01

As the only mammalian Argonaute protein capable of directly cleaving mRNAs in a small RNA-guided manner, Argonaute-2 (Ago2) is a keyplayer in RNA interference (RNAi) silencing via small interfering (si) or short hairpin (sh) RNAs. It is also a rate-limiting factor whose saturation by si/shRNAs limits RNAi efficiency and causes numerous adverse side effects. Here, we report a set of versatile tools and widely applicable strategies for transient or stable Ago2 co-expression, which overcome these concerns. Specifically, we engineered plasmids and viral vectors to co-encode a codon-optimized human Ago2 cDNA along with custom shRNAs. Furthermore, we stably integrated this Ago2 cDNA into a panel of standard human cell lines via plasmid transfection or lentiviral transduction. Using various endo- or exogenous targets, we demonstrate the potential of all three strategies to boost mRNA silencing efficiencies in cell culture by up to 10-fold, and to facilitate combinatorial knockdowns. Importantly, these robust improvements were reflected by augmented RNAi phenotypes and accompanied by reduced off-targeting effects. We moreover show that Ago2/shRNA-co-encoding vectors can enhance and prolong transgene silencing in livers of adult mice, while concurrently alleviating hepatotoxicity. Our customizable reagents and avenues should broadly improve future in vitro and in vivo RNAi experiments in mammalian systems. PMID:24049077

Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

PubMed Central

Yoon, Ju-Yeon; Cho, In-Sook; Choi, Gug-Seoun; Choi, Seung-Kook

2014-01-01

Chrysanthemum stunt viroid (CSVd), a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1) were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants. PMID:25288987

[Construction of thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene].

PubMed

Wei, Qing; Liu, Yi-Min; Wang, Hui; Zhao, Xiao-Lin; Ren, Tie-ling; Xiao, Yong-mei

2006-09-01

To construct Thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene and to provide scientific base for deeply researching on the function of cytochrome 1A1 gene (CYP1A1) and the mechanism of carcinogenesis. According to cDNA sequence of human CYP1A1 gene, universal primers (Pm3/Pm4) and mutant primers (Pt15/Pt16 and Pt17/Pt18) containing restriction enzyme site and mutation site were designed. The first set of primers involving Pm3/Pt16 and Pm3/Pt18 amplified a forward 1.5kb fragment from pGEM-T-CYP1A1 plasmid. The second set of primers involving Pt15/Pm4 and Pt17/Pm4 amplified a reverse 177-bp fragment from 10ng pGEM-T-CYP1A1 plasmid. The third set of primers involving Pm3/Pm4 amplified a 1.5kb fragment from the fomer PCR amplifications. The third PCR products were separated, purified and recovered from 1% agarose gel, then inserted into pMD-T vector. Subsequently the conjunct products were transformed into E. coil strain DH-5alpha., then the single clone was screened out and plasmids were extracted from such clone finally verified by restriction endonuclease analysis and sequencing. A 1.5kb fragment of tricycle PCR amplifications were digested by restriction endonucleases (BamHI and SailI) and sequenced bidirectionally by universal primers(T7p and SP6). The results verified that the cloned fragment including Asn461 and Val462 mutant site had 99.9% homology with the human cDNA of CYP1A1 gene in Genebank. The objective fragment containing Asn461 and Va462 mutant site with cDNA of the CYP1A1 gene has been successfully constructed in this experiment.

Phage display vectors for in vivo recombination of immunoglobulin heavy and light chain genes to make large combinatorial libraries.

PubMed

Tsurushita, N; Fu, H; Warren, C

1996-06-12

New phage display vectors for in vivo recombination of immunoglobulin (Ig) heavy (VH) and light (VL) chain variable genes, to make single-chain Fv fragments (scFv), were constructed. The VH and VL genes of monoclonal antibody (mAb) EP-5C7, which binds to both human E- and P-selectin, were cloned into a pUC19-derived plasmid vector, pCW93, and a pACYC184-derived phagemid vector, pCW99, respectively. Upon induction of Cre recombinase (phage P1 recombinase), the VH and VL genes were efficiently recombined into the same plasmid via the two loxP sites (phage P1 recombination sites), one located downstream from a VH gene in pCW93 and another upstream from a VL gene in pCW99. In the resulting phagemid, the loxP sequence also encodes a polypeptide linker connecting the VH and VL domains to form a scFv of EP-5C7. Whether expressed on the phage surface or as a soluble form, the EP-5C7 scFv showed specific binding to human E- and P-selectin. This phagemid vector system provides a way to recombine VH and VL gene libraries efficiently in vivo to make extremely large Ig combinatorial libraries.

Genetic alteration of Mycobacterium smegmatis to improve mycobacterium-mediated transfer of plasmid DNA into mammalian cells and DNA immunization.

PubMed

Mo, Yongkai; Quanquin, Natalie M; Vecino, William H; Ranganathan, Uma Devi; Tesfa, Lydia; Bourn, William; Derbyshire, Keith M; Letvin, Norman L; Jacobs, William R; Fennelly, Glenn J

2007-10-01

Mycobacteria target and persist within phagocytic monocytes and are strong adjuvants, making them attractive candidate vectors for DNA vaccines. We characterized the ability of mycobacteria to deliver transgenes to mammalian cells and the effects of various bacterial chromosomal mutations on the efficiency of transfer in vivo and in vitro. First, we observed green fluorescent protein expression via microscopy and fluorescence-activated cell sorting analysis after infection of phagocytic and nonphagocytic cell lines by Mycobacterium smegmatis or M. bovis BCG harboring a plasmid encoding the fluorescence gene under the control of a eukaryotic promoter. Next, we compared the efficiencies of gene transfer using M. smegmatis or BCG containing chromosomal insertions or deletions that cause early lysis, hyperconjugation, or an increased plasmid copy number. We observed a significant-albeit only 1.7-fold-increase in the level of plasmid transfer to eukaryotic cells infected with M. smegmatis hyperconjugation mutants. M. smegmatis strains that overexpressed replication proteins (Rep) of pAL5000, a plasmid whose replicon is incorporated in many mycobacterial constructs, generated a 10-fold increase in plasmid copy number and 3.5-fold and 3-fold increases in gene transfer efficiency to HeLa cells and J774 cells, respectively. Although BCG strains overexpressing Rep could not be recovered, BCG harboring a plasmid with a copy-up mutation in oriM resulted in a threefold increase in gene transfer to J774 cells. Moreover, M. smegmatis strains overexpressing Rep enhanced gene transfer in vivo compared with a wild-type control. Immunization of mice with mycobacteria harboring a plasmid (pgp120(h)(E)) encoding human immunodeficiency virus gp120 elicited gp120-specific CD8 T-cell responses among splenocytes and peripheral blood mononuclear cells that were up to twofold (P < 0.05) and threefold (P < 0.001) higher, respectively, in strains supporting higher copy numbers. The magnitude of these responses was approximately one-half of that observed after intramuscular immunization with pgp120(h)(E). M. smegmatis and other nonpathogenic mycobacteria are promising candidate vectors for DNA vaccine delivery.

High-Level Fluorescence Labeling of Gram-Positive Pathogens

PubMed Central

Aymanns, Simone; Mauerer, Stefanie; van Zandbergen, Ger; Wolz, Christiane; Spellerberg, Barbara

2011-01-01

Fluorescence labeling of bacterial pathogens has a broad range of interesting applications including the observation of living bacteria within host cells. We constructed a novel vector based on the E. coli streptococcal shuttle plasmid pAT28 that can propagate in numerous bacterial species from different genera. The plasmid harbors a promoterless copy of the green fluorescent variant gene egfp under the control of the CAMP-factor gene (cfb) promoter of Streptococcus agalactiae and was designated pBSU101. Upon transfer of the plasmid into streptococci, the bacteria show a distinct and easily detectable fluorescence using a standard fluorescence microscope and quantification by FACS-analysis demonstrated values that were 10–50 times increased over the respective controls. To assess the suitability of the construct for high efficiency fluorescence labeling in different gram-positive pathogens, numerous species were transformed. We successfully labeled Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus dysgalactiae subsp. equisimilis, Enterococcus faecalis, Enterococcus faecium, Streptococcus mutans, Streptococcus anginosus and Staphylococcus aureus strains utilizing the EGFP reporter plasmid pBSU101. In all of these species the presence of the cfb promoter construct resulted in high-level EGFP expression that could be further increased by growing the streptococcal and enterococcal cultures under high oxygen conditions through continuous aeration. PMID:21731607

Construction of upp deletion mutant strains of Lactobacillus casei and Lactococcus lactis based on counterselective system using temperature-sensitive plasmid.

PubMed

Song, Li; Cui, Hongyu; Tang, Lijie; Qiao, Xinyuan; Liu, Min; Jiang, Yanping; Cui, Wen; Li, Yijing

2014-07-01

Integration plasmids are often used in constructing chromosomal mutations, as it enables the alternation of genes at any location by integration or replacement. Food-grade integration vectors can integrate into the host genome without introducing any selectable markers or residual bases, and the recombination often happens in non-coding region. In this study we used the temperature-sensitive pWV01 replicon to construct 2 chloramphenicol-resistant integration plasmids (pGBHC32-upp) containing the uracil phosphoribosyl transferase (upp) gene as a counterselective marker for Lactobacillus casei (L. casei) ATCC393 and Lactococcus lactis (L. lactis) MG1363. We then ligated the designed homologous arms to the pGBHC32-upp plasmids to allow their integration to the bacterial chromosome, and selected upp deletion mutants of L. casei ATCC393 and L. lactis MG1363 in the presence of 5-fluorouracil (5-FU). Analysis of genetic stability, growth curve, carbon utilization and scanning electronic microscopy showed that, except for 5-FU resistance, there were no significant differences between the wild type and mutant lactic acid bacteria. The integration system and the upp deletion strains could be used in the insertion or deletion of genes at any location of the chromosome of both L. casei ATCC 393 and L. lactis MG1363, and the homologous recombination would not introduce any selectable markers or residual bases. These mutant strains can be further investigated for heterologous protein expression and construction of a live mucosal vaccine carrier. Copyright © 2014 Elsevier B.V. All rights reserved.

pSW2, a Novel Low-Temperature-Inducible Gene Expression Vector Based on a Filamentous Phage of the Deep-Sea Bacterium Shewanella piezotolerans WP3.

PubMed

Yang, Xin-Wei; Jian, Hua-Hua; Wang, Feng-Ping

2015-08-15

A low-temperature-inducible protein expression vector (pSW2) based on a filamentous phage (SW1) of the deep-sea bacterium Shewanella piezotolerans WP3 was constructed. This vector replicated stably in Escherichia coli and Shewanella species, and its copy number increased at low temperatures. The pSW2 vector can be utilized as a complementation plasmid in WP3, and it can also be used for the production of complex cytochromes with multiple heme groups, which has the potential for application for metal ion recovery or bioremediation. Promoters of low-temperature-inducible genes in WP3 were fused into the vector to construct a series of vectors for enhancing protein expression at low temperature. The maximum green fluorescent protein intensity was obtained when the promoter for the hfq gene was used. The WP3/pSW2 system can efficiently produce a patatin-like protein (PLP) from a metagenomic library that tends to form inclusion bodies in E. coli. The yields of PLP in the soluble fraction were 8.3 mg/liter and 4.7 mg/liter of culture at 4°C and 20°C, respectively. Moreover, the pSW2 vector can be broadly utilized in other Shewanella species, such as S. oneidensis and S. psychrophila. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Klebsiella pneumoniae Carbapenemase (KPC)-Producing K. pneumoniae at a Single Institution: Insights into Endemicity from Whole-Genome Sequencing

PubMed Central

Stoesser, Nicole; Sheppard, Anna E.; Pankhurst, Louise; Giess, Adam; Yeh, Anthony J.; Didelot, Xavier; Turner, Stephen D.; Sebra, Robert; Kasarskis, Andrew; Peto, Tim; Crook, Derrick; Sifri, Costi D.

2015-01-01

The global emergence of Klebsiella pneumoniae carbapenemase-producing K. pneumoniae (KPC-Kp) multilocus sequence type ST258 is widely recognized. Less is known about the molecular and epidemiological details of non-ST258 K. pneumoniae in the setting of an outbreak mediated by an endemic plasmid. We describe the interplay of blaKPC plasmids and K. pneumoniae strains and their relationship to the location of acquisition in a U.S. health care institution. Whole-genome sequencing (WGS) analysis was applied to KPC-Kp clinical isolates collected from a single institution over 5 years following the introduction of blaKPC in August 2007, as well as two plasmid transformants. KPC-Kp from 37 patients yielded 16 distinct sequence types (STs). Two novel conjugative blaKPC plasmids (pKPC_UVA01 and pKPC_UVA02), carried by the hospital index case, accounted for the presence of blaKPC in 21/37 (57%) subsequent cases. Thirteen (35%) isolates represented an emergent lineage, ST941, which contained pKPC_UVA01 in 5/13 (38%) and pKPC_UVA02 in 6/13 (46%) cases. Seven (19%) isolates were the epidemic KPC-Kp strain, ST258, mostly imported from elsewhere and not carrying pKPC_UVA01 or pKPC_UVA02. Using WGS-based analysis of clinical isolates and plasmid transformants, we demonstrate the unexpected dispersal of blaKPC to many non-ST258 lineages in a hospital through spread of at least two novel blaKPC plasmids. In contrast, ST258 KPC-Kp was imported into the institution on numerous occasions, with other blaKPC plasmid vectors and without sustained transmission. Instead, a newly recognized KPC-Kp strain, ST941, became associated with both novel blaKPC plasmids and spread locally, making it a future candidate for clinical persistence and dissemination. PMID:25561339

Utilization of RNA polymerase I promoter and terminator sequences to develop a DNA transfection system for the study of hepatitis C virus internal ribosomal entry site-dependent translation.

PubMed

Oem, Jae-Ku; Xiang, Zhonghua; Zhou, Yan; Babiuk, Lorne A; Liu, Qiang

2007-09-01

Hepatitis C virus (HCV) causes severe liver diseases in a large population worldwide. HCV protein translation is controlled by an internal ribosomal entry site (IRES) within the 5'-untranslated region (UTR). HCV IRES-dependent translation is critical for HCV-associated pathogenesis. To develop a plasmid DNA transfection system by using RNA polymerase I promoter and terminator sequences for studying HCV IRES-dependent translation. A gene cassette containing HCV 5'-UTR, Renilla luciferase reporter gene, and HCV 3'-UTR was inserted between RNA polymerase I promoter and terminator sequences. HCV IRES-directed translation was determined by luciferase assay after transfection. Transfection of the RNA polymerase I-HCV IRES plasmid into human hepatoma Huh-7 and HepG2 cells resulted in luciferase gene expression. Deletion of the IIIf domain in HCV IRES dramatically reduced luciferase activity. Our results indicated that the plasmid vector system-based on RNA polymerase I promoter and terminator sequences represents an effective approach for the study of HCV IRES-dependent translation.

Development of SYBR Green I Based Real-Time RT-PCR Assay for Specific Detection of Watermelon silver mottle Virus.

PubMed

Rao, Xueqin; Sun, Jie

2015-09-01

Watermelon silver mottle virus (WSMoV), which belongs to the genus Tospovirus , causes significant loss in Cucurbitaceae plants. Development of a highly sensitive and reliable detection method for WSMoV. Recombinant plasmids for targeting the sequence of nucleocapsid protein gene of WSMoV were constructed. SYBR Green I real-time PCR was established and evaluated with standard recombinant plasmids and 27 watermelon samples showing WSMoV infection symptoms. The recombinant plasmid was used as template for SYBR Green I real-time PCR to generate standard and melting curves. Melting curve analysis indicated no primer-dimers and non-specific products in the assay. No cross-reaction was observed with Capsicum chlorosis virus (genus Tospovirus ) and Cucumber mosaic virus (genus Cucumovirus). Repeatability tests indicated that inter-assay variability of the Ct values was 1.6%. A highly sensitive, reliable and rapid detection method of SYBR Green I real-time PCR for timely detection of WSMoV plants and vector thrips was established, which will facilitate disease forecast and control.

Molecular cloning and physical mapping of the genome of fish lymphocystis disease virus.

PubMed

Darai, G; Delius, H; Clarke, J; Apfel, H; Schnitzler, P; Flügel, R M

1985-10-30

A defined and complete gene library of the fish lymphocystis disease virus (FLDV) genome was established. FLDV DNA was cleaved with EcoRI, BamHI, EcoRI/BamHI and EcoRI/HindIII and the resulting fragments were inserted into the corresponding sites of the pACYC184 or pAT153 plasmid vectors using T4 DNA ligase. Since FLDV DNA is highly methylated at CpG sequences (Darai et al., 1983; Wagner et al., 1985), an Escherichia coli GC-3 strain was required to amplify the recombinant plasmids harboring the FLDV DNA fragments. Bacterial colonies harboring recombinant plasmids were selected. All cloned fragments were individually identified by digestion of the recombinant plasmid DNA with different restriction enzymes and screened by hybridization of recombinant plasmid DNA to viral DNA. This analysis revealed that sequences representing 100% of the viral genome were cloned. Using these recombinant plasmids, the physical maps of the genome were constructed for BamHI, EcoRI, BestEII, and PstI restriction endonucleases. Although the FLDV genome is linear, due to circular permutation the restriction maps are circular.

Tailor-made fibroblast-specific and antibiotic-free interleukin 12 plasmid for gene electrotransfer-mediated cancer immunotherapy.

PubMed

Kamensek, Urska; Tesic, Natasa; Sersa, Gregor; Kos, Spela; Cemazar, Maja

2017-01-01

Electrotransfer mediated delivery of interleukin-12 (IL-12) gene, encoded on a plasmid vector, has already been demonstrated to have a potent antitumor efficacy and great potential for clinical application. In the present study, our aim was to construct an optimized IL-12-encoding plasmid that is safe from the regulatory point of view. In light of previous studies demonstrating that IL-12 should be released in a tumor localized manner for optimal efficacy, the strong ubiquitous promoter was replaced with a weak endogenous promoter of the collagen 2 gene, which is specific for fibroblasts. Next, to comply with increasing regulatory demands for clinically used plasmids, the expression cassette was cloned in a plasmid lacking the antibiotic resistance gene. The constructed fibroblast-specific and antibiotic-free IL-12 plasmid was demonstrated to support low IL-12 expression after gene electrotransfer in selected cell lines. Furthermore, the removal of antibiotic resistance did not affect the plasmid expression profile and lowered its cytotoxicity. With optimal IL-12 expression and minimal transgene non-specific effects, i.e., low cytotoxicity, the constructed plasmid could be especially valuable for different modern immunological approaches to achieve localized boosting of the host's immune system. Copyright © 2016 Elsevier Inc. All rights reserved.

An 'instant gene bank' method for gene cloning by mutant complementation.

PubMed

Gems, D; Aleksenko, A; Belenky, L; Robertson, S; Ramsden, M; Vinetski, Y; Clutterbuck, A J

1994-02-01

We describe a new method of gene cloning by complementation of mutant alleles which obviates the need for construction of a gene library in a plasmid vector in vitro and its amplification in Escherichia coli. The method involves simultaneous transformation of mutant strains of the fungus Aspergillus nidulans with (i) fragmented chromosomal DNA from a donor species and (ii) DNA of a plasmid without a selectable marker gene, but with a fungal origin of DNA replication ('helper plasmid'). Transformant colonies appear as the result of the joining of chromosomal DNA fragments carrying the wild-type copies of the mutant allele with the helper plasmid. Joining may occur either by ligation (if the helper plasmid is in linear form) or recombination (if it is cccDNA). This event occurs with high efficiency in vivo, and generates an autonomously replicating plasmid cointegrate. Transformants containing Penicillium chrysogenum genomic DNA complementing A. nidulans niaD, nirA and argB mutations have been obtained. While some of these cointegrates were evidently rearranged or consisted only of unaltered replicating plasmid, in other cases plasmids could be recovered into E. coli and were subsequently shown to contain the selected gene. The utility of this "instant gene bank" technique is demonstrated here by the molecular cloning of the P. canescens trpC gene.

Prevalence of human papillomavirus and Epstein-Barr virus DNA in Chinese children with tonsillar and/or adenoidal hypertrophy.

PubMed

Xue, Xiao-cheng; Chen, Xiao-ping; Yao, Wen-hao; Zhang, Yi; Sun, Guang-bin; Tan, Xue-jun

2014-06-01

Tonsillar and adenoidal hypertrophy are prevalent otolaryngologic disorders in children, but their pathogenesis is largely unknown. The presence of human papillomavirus (HPV) and Epstein-Barr virus (EBV) DNA in 146 tonsil and/or adenoid tissue specimens from 104 Chinese children with tonsillar and/or adenoidal hypertrophy were screened using flow-through hybridization gene-chip technology and real-time fluorescence-based quantitative PCR. Then, the relationships between the prevalence of the viruses and other clinical characteristics of tonsillar and/or adenoidal hypertrophy were analyzed. No patient had HPV DNA. EBV DNA was detected in 19/42 (45.2%) tonsil tissues and 72/104 (69.2%) adenoid tissue specimens (P < 0.05). EBV DNA was not related to the patients' age, gender, disease course, or nationality, but children positive for EBV were less likely to snore; 14/15 (93.3%) patients who did not snore and 59/89 (66.3%) patients who snored were EBV positive. EBV DNA, but not HPV DNA was detected in Chinese children with tonsillar and/or adenoidal hypertrophy. Adenoid tissues might more susceptible than tonsil tissues to EBV infection. In addition, EBV infection did not aggravate snoring in patients with tonsillar and/or adenoidal hypertrophy. © 2014 Wiley Periodicals, Inc.

A possible link between the Epstein-Barr virus infection and autoimmune thyroid disorders

PubMed Central

Gwizdek, Katarzyna; Michalski, Marek; Wojnicz, Romuald

2016-01-01

The Epstein-Barr virus (EBV), also known as human herpesvirus 4, is a member of the Herpesviridae virus family. EBV infection can cause infectious mononucleosis (IM) in the lytic phase of EBV’s life cycle. Past EBV infection is associated with lymphomas, and may also result in certain allergic and autoimmune diseases. Although potential mechanisms of autoimmune diseases have not been clearly elucidated, both genetic and environmental factors, such as infectious agents, are considered to be responsible for their development. In addition, EBV modifies the host immune response. The worldwide prevalence of autoimmune diseases shows how common this pathogen is. Normally, the virus stays in the body and remains dormant throughout life. However, this is not always the case, and a serious EBV-related illness may develop later in life. This explains the chronic course of autoimmune diseases that is often accompanied by exacerbations of symptoms. Based on the present studies, EBV infection can cause autoimmune diseases, such as systemic lupus erythematosus (SLE), multiple sclerosis (MS), rheumatoid arthritis (RA), Sjögren’s syndrome, and autoimmune hepatitis. The EBV has also been reported in patients with autoimmune thyroid disorders. Although EBV is not the only agent responsible for the development of autoimmune thyroid diseases, it can be considered a contributory factor. PMID:27833448

Sequence and immunogenicity of a clinically approved novel measles virus vaccine vector

PubMed Central

Zuniga, Amando; Liniger, Mathias; Morin, Teldja Neige Azzouz; Marty, René R.; Wiegand, Marian; Ilter, Orhan; Weibel, Sara; Billeter, Martin A.; Knuchel, Marlyse C.; Naim, Hussein Y.

2013-01-01

The measles virus vaccine (MVbv) is a clinically certified and well-tolerated vaccine strain that has been given both parenterally and mucosally. It has been extensively used in children and has proven to be safe and effective in eliciting protective immunity. This specific strain was therefore chosen to generate a measles viral vector. The genome of the commercial MVbv vaccine strain was isolated, sequenced and a plasmid, p(+)MVb, enabling transcription of the viral antigenome and rescue of MVb, was constructed. Phylogenic and phenotypic analysis revealed that MVbv and the rescued MVb constitute another evolutionary branch within the hitherto classified measles vaccines. Plasmid p(+)MVb was modified by insertion of artificial MV-type transcription units (ATUs) for the generation of recombinant viruses (rMVb) expressing additional proteins. Replication characteristics and immunogenicity of rMVb vectors were similar to the parental MVbv and to other vaccine strains. The expression of the additional proteins was stable over 10 serial virus transfers, which corresponds to an amplification greater than 1020. The excellent safety record and its efficient application as aerosol may add to the usefulness of the derived vectors. PMID:23324616

Biophysical characterization of an integrin-targeted lipopolyplex gene delivery vector.

PubMed

Mustapa, M Firouz Mohd; Bell, Paul C; Hurley, Christopher A; Nicol, Alastair; Guénin, Erwann; Sarkar, Supti; Writer, Michele J; Barker, Susie E; Wong, John B; Pilkington-Miksa, Michael A; Papahadjopoulos-Sternberg, Brigitte; Shamlou, Parviz Ayazi; Hailes, Helen C; Hart, Stephen L; Zicha, Daniel; Tabor, Alethea B

2007-11-13

Nonviral gene delivery vectors now show good therapeutic potential: however, detailed characterization of the composition and macromolecular organization of such particles remains a challenge. This paper describes experiments to elucidate the structure of a ternary, targeted, lipopolyplex synthetic vector, the LID complex. This consists of a lipid component, Lipofectin (L) (1:1 DOTMA:DOPE), plasmid DNA (D), and a dual-function, cationic peptide component (I) containing DNA condensation and integrin-targeting sequences. Fluorophore-labeled lipid, peptide, and DNA components were used to formulate the vector, and the stoichiometry of the particles was established by fluorescence correlation spectroscopy (FCS). The size of the complex was measured by FCS, and the sizes of LID, L, LD, and ID complexes were measured by dynamic light scattering (DLS). Fluorescence quenching experiments and freeze-fracture electron microscopy were then used to demonstrate the arrangement of the lipid, peptide, and DNA components within the complex. These experiments showed that the cationic portion of the peptide, I, interacts with the plasmid DNA, resulting in a tightly condensed DNA-peptide inner core; this is surrounded by a disordered lipid layer, from which the integrin-targeting sequence of the peptide partially protrudes.

CRISPR/Cas9-Assisted Transformation-Efficient Reaction (CRATER) for Near-Perfect Selective Transformation

NASA Technical Reports Server (NTRS)

Rothschild, Lynn J.; Greenberg, Daniel T.; Takahashi, Jack R.; Thompson, Kirsten A.; Maheshwari, Akshay J.; Kent, Ryan E.; McCutcheon, Griffin; Shih, Joseph D.; Calvet, Charles; Devlin, Tyler D.;

Pullulan-protamine as efficient haemocompatible gene delivery vector: synthesis and in vitro characterization.

PubMed

Priya, S S; Rekha, M R; Sharma, Chandra P

2014-02-15

Biodegradable non-viral vectors with good transfection efficiency is essential for successful gene delivery. The purpose of this study was to design a non-viral vector by conjugating protamine to pullulan and elucidate the potential use of pullulan protamine conjugate (PPA) as an effective, non toxic and haemocompatible gene delivery system. The particle size and surface charge were measured using Nanosizer. Derivatization was confirmed by NMR, FTIR and DSC analyses. Acid base titration revealed the buffering behaviour of the conjugate. The protection of DNA from nuclease enzyme and interaction of plasma components on the stability of nanoplexes were also analysed. The uptake studies confirmed the plasmid delivery into the nucleus and the inhibitor studies determined the uptake mechanism. Transfection experiments revealed the capability of PPA to cellular uptake in C6 cells and facilitate high gene expression. Thus, PPA proves to be a promising non-viral vector. Copyright © 2013 Elsevier Ltd. All rights reserved.

DIY series of genetic cassettes useful in construction of versatile vectors specific for Alphaproteobacteria.

PubMed

Dziewit, Lukasz; Adamczuk, Marcin; Szuplewska, Magdalena; Bartosik, Dariusz

2011-08-01

We have developed a DIY (Do It Yourself) series of genetic cassettes, which facilitate construction of novel versatile vectors for Alphaproteobacteria. All the cassettes are based on defined genetic modules derived from three natural plasmids of Paracoccus aminophilus JCM 7686. We have constructed over 50 DIY cassettes, which differ in structure and specific features. All of them are functional in eight strains representing three orders of Alphaproteobacteria: Rhodobacterales, Rhizobiales and Caulobacterales. Besides various replication and stabilization systems, many of the cassettes also contain selective markers appropriate for Alphaproteobacteria (40 cassettes) and genetic modules responsible for mobilization for conjugal transfer (24 cassettes). All the DIY cassettes are bordered by different types of polylinkers, which facilitate vector construction. Using these DIY cassettes, we have created a set of compatible Escherichia coli-Alphaproteobacteria mobilizable shuttle vectors (high or low copy number in E. coli), which will greatly assist the genetic manipulation of Alphaproteobacteria. Copyright © 2011 Elsevier B.V. All rights reserved.

Facile Construction of Random Gene Mutagenesis Library for Directed Evolution Without the Use of Restriction Enzyme in Escherichia coli.

PubMed

Kim, Jae-Eung; Huang, Rui; Chen, Hui; You, Chun; Zhang, Y-H Percival

2016-09-01

A foolproof protocol was developed for the construction of mutant DNA library for directed protein evolution. First, a library of linear mutant gene was generated by error-prone PCR or molecular shuffling, and a linear vector backbone was prepared by high-fidelity PCR. Second, the amplified insert and vector fragments were assembled by overlap-extension PCR with a pair of 5'-phosphorylated primers. Third, full-length linear plasmids with phosphorylated 5'-ends were self-ligated with T4 ligase, yielding circular plasmids encoding mutant variants suitable for high-efficiency transformation. Self-made competent Escherichia coli BL21(DE3) showed a transformation efficiency of 2.4 × 10(5) cfu/µg of the self-ligated circular plasmid. Using this method, three mutants of mCherry fluorescent protein were found to alter their colors and fluorescent intensities under visible and UV lights, respectively. Also, one mutant of 6-phosphorogluconate dehydrogenase from a thermophilic bacterium Moorella thermoacetica was found to show the 3.5-fold improved catalytic efficiency (kcat /Km ) on NAD(+) as compared to the wild-type. This protocol is DNA-sequence independent, and does not require restriction enzymes, special E. coli host, or labor-intensive optimization. In addition, this protocol can be used for subcloning the relatively long DNA sequences into any position of plasmids. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Application of methylation in improving plasmid transformation into Helicobacter pylori.

PubMed

Zhao, Huilin; Xu, Linlin; Rong, Qianyu; Xu, Zheng; Ding, Yunfei; Zhang, Ying; Wu, Yulong; Li, Boqing; Ji, Xiaofei

2018-05-23

Helicobacter pylori is an important gastrointestinal pathogen. Its strains possess different levels of powerful restriction modification systems, which are significant barriers to genetic tools used for studying the role of functional genes in its pathogenesis. Methylating vectors in vitro was reported as an alternative to overcome this barrier in several bacteria. In this study we used two H. pylori-E. coli shuttle plasmids and several single/double-crossover homologous recombination gene-targeting plasmids, to test the role of methylation in H. pylori transformation. According to our results, transformants could be obtained only after shuttle plasmids were methylated before transformation. It is helpful in gene complementation and over-expression although at a low frequency. The frequency of gene-targeting transformation was also increased after methylation, especially for the single-crossover recombination plasmids, the transformants of which could only be obtained after methylation. For the double-crossover recombination targeting plasmids, the initial yield of transformants was 0.3-0.8 × 10 2 CFUs per microgram plasmid DNA. With the help of methylation, the yield was increased to 0.4-1.3 × 10 2 CFUs per microgram plasmid DNA. These results suggest that in vitro methylation can improve H. pylori transformation by different plasmids, which will benefit the pathogenic mechanism research. Copyright © 2018. Published by Elsevier B.V.

A yeast-based assay identifies drugs that interfere with immune evasion of the Epstein-Barr virus.

PubMed

Voisset, Cécile; Daskalogianni, Chrysoula; Contesse, Marie-Astrid; Mazars, Anne; Arbach, Hratch; Le Cann, Marie; Soubigou, Flavie; Apcher, Sébastien; Fåhraeus, Robin; Blondel, Marc

2014-04-01

Epstein-Barr virus (EBV) is tightly associated with certain human cancers, but there is as yet no specific treatment against EBV-related diseases. The EBV-encoded EBNA1 protein is essential to maintain viral episomes and for viral persistence. As such, EBNA1 is expressed in all EBV-infected cells, and is highly antigenic. All infected individuals, including individuals with cancer, have CD8(+) T cells directed towards EBNA1 epitopes, yet the immune system fails to detect and destroy cells harboring the virus. EBV immune evasion depends on the capacity of the Gly-Ala repeat (GAr) domain of EBNA1 to inhibit the translation of its own mRNA in cis, thereby limiting the production of EBNA1-derived antigenic peptides presented by the major histocompatibility complex (MHC) class I pathway. Here we establish a yeast-based assay for monitoring GAr-dependent inhibition of translation. Using this assay we identify doxorubicin (DXR) as a compound that specifically interferes with the GAr effect on translation in yeast. DXR targets the topoisomerase-II-DNA complexes and thereby causes genomic damage. We show, however, that the genotoxic effect of DXR and various analogs thereof is uncoupled from the effect on GAr-mediated translation control. This is further supported by the observation that etoposide and teniposide, representing another class of topoisomerase-II-DNA targeting drugs, have no effect on GAr-mediated translation control. DXR and active analogs stimulate, in a GAr-dependent manner, EBNA1 expression in mammalian cells and overcome GAr-dependent restriction of MHC class I antigen presentation. These results validate our approach as an effective high-throughput screening assay to identify drugs that interfere with EBV immune evasion and, thus, constitute candidates for treating EBV-related diseases, in particular EBV-associated cancers.

CD95 (Fas) ligand expression of Epstein-Barr virus (EBV)-infected lymphocytes: a possible mechanism of immune evasion in chronic active EBV infection.

PubMed

Ohshima, K; Suzumiya, J; Sugihara, M; Nagafuchi, S; Ohga, S; Kikuchi, M

1999-01-01

The Epstein-Barr virus (EBV) induces infectious mononucleosis (IM) and can be associated with chronic active EBV infection (CAEBV). Cytotoxic T lymphocytes (CTL) play an important role in excluding EBV-infected cells. Two cytotoxic mechanisms of CTL have been demonstrated: one perforin/granzyme-based and the other Fas (CD95)/Fas ligand (FasL)-based. To clarify these two pathways in CAEBV, we analyzed six patients with CAEBV and four patients with IM using immunohistochemical staining of the lymph nodes. In both CAEBV and IM, CD8+ T-cells increased in number, but CD56+ natural killer cells were rare. In four of six cases with CAEBV, approximately half the lymphocytes were positive for T cell-restricted intracellular antigens (TIA-1), which were recognized by the cytolytic granules of CTL. In IM, the number of TIA-1 positive cells was smaller than that in CAEBV. Fas-positive lymphocytes were frequently encountered in both CAEBV and IM. However, FasL-positive lymphocytes increased in three of six patients with CAEBV, but not in patients with IM. Except for one case with CAEBV, the number of perforin- and/or granzyme-positive cells was small in number in both CAEBV and IM cases. In double-staining FasL and EBV in situ hybridization, FasL-positive EBV-infected lymphocytes were detected in CAEBV but not in IM. In CAEBV, the Fas/FasL pathway and not perforin pathways appears to play an important role in the pathogenesis. The data suggest that EBV-infected lymphocytes may evade immune attack through the expression of FasL.

An Implementation-Focused Bio/Algorithmic Workflow for Synthetic Biology.

PubMed

Goñi-Moreno, Angel; Carcajona, Marta; Kim, Juhyun; Martínez-García, Esteban; Amos, Martyn; de Lorenzo, Víctor

2016-10-21

As synthetic biology moves away from trial and error and embraces more formal processes, workflows have emerged that cover the roadmap from conceptualization of a genetic device to its construction and measurement. This latter aspect (i.e., characterization and measurement of synthetic genetic constructs) has received relatively little attention to date, but it is crucial for their outcome. An end-to-end use case for engineering a simple synthetic device is presented, which is supported by information standards and computational methods and focuses on such characterization/measurement. This workflow captures the main stages of genetic device design and description and offers standardized tools for both population-based measurement and single-cell analysis. To this end, three separate aspects are addressed. First, the specific vector features are discussed. Although device/circuit design has been successfully automated, important structural information is usually overlooked, as in the case of plasmid vectors. The use of the Standard European Vector Architecture (SEVA) is advocated for selecting the optimal carrier of a design and its thorough description in order to unequivocally correlate digital definitions and molecular devices. A digital version of this plasmid format was developed with the Synthetic Biology Open Language (SBOL) along with a software tool that allows users to embed genetic parts in vector cargoes. This enables annotation of a mathematical model of the device's kinetic reactions formatted with the Systems Biology Markup Language (SBML). From that point onward, the experimental results and their in silico counterparts proceed alongside, with constant feedback to preserve consistency between them. A second aspect involves a framework for the calibration of fluorescence-based measurements. One of the most challenging endeavors in standardization, metrology, is tackled by reinterpreting the experimental output in light of simulation results, allowing us to turn arbitrary fluorescence units into relative measurements. Finally, integration of single-cell methods into a framework for multicellular simulation and measurement is addressed, allowing standardized inspection of the interplay between the carrier chassis and the culture conditions.

Differential cellular targets of Epstein-Barr virus (EBV) infection between acute EBV-associated hemophagocytic lymphohistiocytosis and chronic active EBV infection.

PubMed

Kasahara, Y; Yachie, A; Takei, K; Kanegane, C; Okada, K; Ohta, K; Seki, H; Igarashi, N; Maruhashi, K; Katayama, K; Katoh, E; Terao, G; Sakiyama, Y; Koizumi, S

2001-09-15

Unusual Epstein-Barr virus (EBV) infection into T or natural killer cells plays a pivotal role in the pathogenesis of acute EBV-associated hemophagocytic lymphohistiocytosis (EBV-HLH) and chronic active EBV infection (CAEBV). The precise frequency and localization of EBV genome in lymphocyte subpopulations especially within T-cell subpopulations are unclear in these EBV-related disorders. This study analyzed the frequency of EBV-infected cells in circulating lymphocyte subpopulations from 4 patients with acute EBV-HLH and 4 with CAEBV. EBV- encoded small RNA-1 in situ hybridization examination of peripheral blood lymphocytes showed a significantly higher frequency of EBV-infected cells of 1.0% to 13.4% in EBV-HLH and 1.6% to 25.6% in CAEBV, respectively. The patterns of EBV infection in lymphocyte subpopulations were quite different between acute EBV-HLH and CAEBV. EBV infection was predominant in CD8(+) T cells in all EBV-HLH patients, whereas the dominant EBV-infected cell populations were non-CD8(+) lymphocyte subpopulations in CAEBV patients. Phenotypical analysis revealed that EBV-infected cell populations from both EBV-HLH and CAEBV were activated. There was no predominance of any EBV substrain of latent membrane protein-1, EBV-associated nuclear antigen (EBNA)-1, and EBNA-2 genes between the 2 abnormal EBV-associated disorders, and self-limited acute infectious mononucleosis. These results showing differential virus-cell interactions between acute EBV-HLH and CAEBV indicated different pathogenic mechanisms against EBV infection between the 2 EBV-associated diseases, which accounts for the difference in clinical manifestations between the 2 diseases.

Comparison of Current Regulatory Status for Gene-Based Vaccines in the U.S., Europe and Japan

PubMed Central

Nakayama, Yoshikazu; Aruga, Atsushi

2015-01-01

Gene-based vaccines as typified by plasmid DNA vaccines and recombinant viral-vectored vaccines are expected as promising solutions against infectious diseases for which no effective prophylactic vaccines exist such as HIV, dengue virus, Ebola virus and malaria, and for which more improved vaccines are needed such as tuberculosis and influenza virus. Although many preclinical and clinical trials have been conducted to date, no DNA vaccines or recombinant viral-vectored vaccines expressing heterologous antigens for human use have yet been licensed in the U.S., Europe or Japan. In this research, we describe the current regulatory context for gene-based prophylactic vaccines against infectious disease in the U.S., Europe, and Japan. We identify the important considerations, in particular, on the preclinical assessments that would allow these vaccines to proceed to clinical trials, and the differences on the regulatory pathway for the marketing authorization in each region. PMID:26344953

Nanoparticles complexed with gene vectors to promote proliferation of human vascular endothelial cells.

PubMed

Li, Qian; Shi, Changcan; Zhang, Wencheng; Behl, Marc; Lendlein, Andreas; Feng, Yakai

2015-06-03

Amphiphilic block copolymers containing biodegradable hydrophobic segments of depsipeptide based copolymers have been synthesized and explored as gene carriers for enhancing proliferation of endothelial cells in vitro. These polymers form nanoparticles (NPs) with positive charges on their surface, which could condense recombinant plasmids of enhanced green fluorescent protein plasmid and ZNF580 gene (pEGFP-ZNF580) and protect them against DNase I. ZNF580 gene is efficiently transported into EA.hy926 cells to promote their proliferation, whereby the transfection efficiency of NPs/pEGFP-ZNF580 is approximately similar to that of Lipofectamine 2000. These results indicate that the NPs might have potential as a carrier for pEGFP-ZNF580, which could support endothelialization of cardiovascular implants. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Construction of CRISPR Libraries for Functional Screening.

PubMed

Carstens, Carsten P; Felts, Katherine A; Johns, Sarah E

2018-01-01

Identification of gene function has been aided by the ability to generate targeted gene knockouts or transcriptional repression using the CRISPR/CAS9 system. Using pooled libraries of guide RNA expression vectors that direct CAS9 to a specific genomic site allows identification of genes that are either enriched or depleted in response to a selection scheme, thus linking the affected gene to the chosen phenotype. The quality of the data generated by the screening is dependent on the quality of the guide RNA delivery library with regards to error rates and especially evenness of distribution of the guides. Here, we describe a method for constructing complex plasmid libraries based on pooled designed oligomers with high representation and tight distributions. The procedure allows construction of plasmid libraries of >60,000 members with a 95th/5th percentile ratio of less than 3.5.

Development of an adenoviral vector with robust expression driven by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajgelman, Marcio C.; Biotechnology Program, Biomedical Sciences Institute, University of Sao Paulo; Millennium Institute-Gene Therapy Network, Ministry of Science and Technology

2008-02-05

Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG servedmore » as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.« less

Rapid Assembly of Customized TALENs into Multiple Delivery Systems

PubMed Central

Zhang, Zhengxing; Zhang, Siliang; Huang, Xin; Orwig, Kyle E.; Sheng, Yi

2013-01-01

Transcriptional activator-like effector nucleases (TALENs) have become a powerful tool for genome editing. Here we present an efficient TALEN assembly approach in which TALENs are assembled by direct Golden Gate ligation into Gateway® Entry vectors from a repeat variable di-residue (RVD) plasmid array. We constructed TALEN pairs targeted to mouse Ddx3 subfamily genes, and demonstrated that our modified TALEN assembly approach efficiently generates accurate TALEN moieties that effectively introduce mutations into target genes. We generated “user friendly” TALEN Entry vectors containing TALEN expression cassettes with fluorescent reporter genes that can be efficiently transferred via Gateway (LR) recombination into different delivery systems. We demonstrated that the TALEN Entry vectors can be easily transferred to an adenoviral delivery system to expand application to cells that are difficult to transfect. Since TALENs work in pairs, we also generated a TALEN Entry vector set that combines a TALEN pair into one PiggyBac transposon-based destination vector. The approach described here can also be modified for construction of TALE transcriptional activators, repressors or other functional domains. PMID:24244669

Construction of a novel shuttle vector for use in Gluconobacter oxydans.

PubMed

Zhang, Lin; Lin, Jinping; Ma, Yushu; Wei, Dongzhi; Sun, Ming

2010-11-01

A shuttle vector pZL1 which can replicate both in Gluconobacter oxydans and Escherichia coli was constructed based on G. oxydans DSM2003 cryptic plasmid pGOX3, a homology of G. oxydans 621H pGOX3, and E. coli cloning vector pUC18. It was found to be stably maintained in G. oxydans during the serial subcultures in the absence of antibiotic pressure for 144 h. With pGOX3 as the reference sample, the relative copy number of pZL1 in G. oxydans is 13 determined by real-time fluorescence quantitative PCR (qPCR). The copy number of pZL1 is much higher than pBBR1MCS5 in E. coli. The vector pZL1 contains six commonly used restriction endonuclease sites, HindIII, SalI, XbaI, BamHI, SmaI, KpnI, and SacI, and is easy to manipulate in molecular biology experiments. The shuttle vector was used to express a reporter protein wasabi successfully in G. oxydans DSM2003 under the control of the tufB promoter.

Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense.

PubMed

Horiuchi, Yuki; Laskaratou, Danai; Sliwa, Michel; Ruckebusch, Cyril; Hatori, Kuniyuki; Mizuno, Hideaki; Hotta, Jun-Ichi

2018-01-26

Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT) 14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense . We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein "ember" from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 10⁵ M -1 ·cm -1 . The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.

Characterization of the cryptic plasmid pOfk55 from Legionella pneumophila and construction of a pOfk55-derived shuttle vector.

PubMed

Nishida, Takashi; Watanabe, Kenta; Tachibana, Masato; Shimizu, Takashi; Watarai, Masahisa

2017-03-01

In this study, a cryptic plasmid pOfk55 from Legionella pneumophila was isolated and characterized. pOfk55 comprised 2584bp with a GC content of 37.3% and contained three putative open reading frames (ORFs). orf1 encoded a protein of 195 amino acids and the putative protein shared 39% sequence identity with a putative plasmid replication protein RepL. ORF1 was needed for replication in L. pneumophila but pOfk55 did not replicate in Escherichia coli. orf2 and orf3 encoded putative hypothetical proteins of 114 amino acids and 78 amino acids, respectively, but the functions of the putative proteins ORF2 and OFR3 are not clear. The transfer mechanism for pOfk55 was independent on the type IVB secretion system in the original host. A L. pneumophila-E. coli shuttle vector, pNT562 (5058bp, Km R ), was constructed by In-Fusion Cloning of pOfk55 with a kanamycin-resistance gene from pUTmini-Tn5Km and the origin of replication from pBluescript SK(+) (pNT561). Multiple cloning sites from pBluescript SK(+) as well as the tac promoter region and lacI gene from pAM239-GFP were inserted into pNT561 to construct pNT562. The transformation efficiency of pNT562 in L. pneumophila strains ranged from 1.6×10 1 to 1.0×10 5 CFU/ng. The relative number of pNT562 was estimated at 5.7±1.0 copies and 73.6% of cells maintained the plasmid after 1week in liquid culture without kanamycin. A green fluorescent protein (GFP) expression vector, pNT563, was constructed by ligating pNT562 with the gfpmut3 gene from pAM239-GFP. pNT563 was introduced into L. pneumophila Lp02 and E. coli DH5α, and both strains expressed GFP successfully. These results suggest that the shuttle vector is useful for genetic studies in L. pneumophila. Copyright © 2017 Elsevier Inc. All rights reserved.

Broad-spectrum anti-tumor and anti-metastatic DNA vaccine based on p62-encoding vector

PubMed Central

Sherman, Michael Y.; Gabai, Vladimir; Kiselev, Oleg; Komissarov, Andrey; Grudinin, Mikhail; Shartukova, Maria; Romanovskaya-Romanko, Ekaterina A.; Kudryavets, Yuri; Bezdenezhnykh, Natalya; Lykhova, Oleksandra; Semesyuk, Nadiia; Concetti, Antonio; Tsyb, Anatoly; Filimonova, Marina; Makarchuk, Victoria; Yakubovsky, Raisa; Chursov, Andrey; Shcherbinina, Vita; Shneider, Alexander

2013-01-01

Autophagy plays an important role in neoplastic transformation of cells and in resistance of cancer cells to radio- and chemotherapy. p62 (SQSTM1) is a key component of autophagic machinery which is also involved in signal transduction. Although recent empirical observations demonstrated that p62 is overexpressed in variety of human tumors, a mechanism of p62 overexpression is not known. Here we report that the transformation of normal human mammary epithelial cells with diverse oncogenes (RAS, PIK3CA and Her2) causes marked accumulation of p62. Based on this result, we hypothesized that p62 may be a feasible candidate to be an anti-cancer DNA vaccine. Here we performed a preclinical study of a novel DNA vaccine encoding p62. Intramuscularly administered p62-encoding plasmid induced anti-p62 antibodies and exhibited strong antitumor activity in four models of allogeneic mouse tumors – B16 melanoma, Lewis lung carcinoma (LLC), S37 sarcoma, and Ca755 breast carcinoma. In mice challenged with Ca755 cells, p62 treatment had dual effect: inhibited tumor growth in some mice and prolonged life in those mice which developed tumor size similar to control. P62-encoding plasmid has demonstrated its potency both as a preventive and therapeutic vaccine. Importantly, p62 vaccination drastically suppressed metastasis formation: in B16 melanoma where tumor cells where injected intravenously, and in LLC and S37 sarcoma with spontaneous metastasis. Overall, we conclude that a p62-encoding vector(s) constitute(s) a novel, effective broad-spectrum antitumor and anti-metastatic vaccine feasible for further development and clinical trials. PMID:24121124

Genetic engineering in Actinoplanes sp. SE50/110 - development of an intergeneric conjugation system for the introduction of actinophage-based integrative vectors.

PubMed

Gren, Tetiana; Ortseifen, Vera; Wibberg, Daniel; Schneiker-Bekel, Susanne; Bednarz, Hanna; Niehaus, Karsten; Zemke, Till; Persicke, Marcus; Pühler, Alfred; Kalinowski, Jörn

2016-08-20

The α-glucosidase inhibitor acarbose is used for treatment of diabetes mellitus type II, and is manufactured industrially with overproducing derivatives of Actinoplanes sp. SE50/110, reportedly obtained by conventional mutagenesis. Despite of high industrial significance, only limited information exists regarding acarbose metabolism, function and regulation of these processes, due to the absence of proper genetic engineering methods and tools developed for this strain. Here, a basic toolkit for genetic engineering of Actinoplanes sp. SE50/110 was developed, comprising a standardized protocol for a DNA transfer through Escherichia coli-Actinoplanes intergeneric conjugation and applied for the transfer of ϕC31, ϕBT1 and VWB actinophage-based integrative vectors. Integration sites, occurring once per genome for all vectors, were sequenced and characterized for the first time in Actinoplanes sp. SE50/110. Notably, in case of ϕC31 based vector pSET152, the integration site is highly conserved, while for ϕBT1 and the VWB based vectors pRT801 and pSOK804, respectively, no sequence similarities to those in other bacteria were detected. The studied plasmids were proven to be stable and neutral with respect to strain morphology and acarbose production, enabling future use for genetic manipulations of Actinoplanes sp. SE50/110. To further broaden the spectrum of available tools, a GUS reporter system, based on the pSET152 derived vector, was also established in Actinoplanes sp. SE50/110. Copyright © 2016 Elsevier B.V. All rights reserved.

A human parvovirus, adeno-associated virus, as a eucaryotic vector: Transient expression and encapsidation of the procaryotic gene for chloramphenicol acetyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tratschin, J.D.; West, M.H.P.; Sandbank, T.

1984-10-01

The authors have used the defective human parvovirus adeno-associated virus (AAV) as a novel eurocaryotic vector (parvector) for the expression of a foreign gene in human cells. The recombinant, pAV2, contains the AAV genome in a pBR322-derived bacterial plasmid. When pAV2 is transfected into human cells together with helper adenovirus particles, the AAV genome is rescued from the recombinant plasmid and replicated to produce infectious AAV particles at high efficiency. To create a vector, we inserted a procaryotic sequence coding for chloramphenicol acetyltransferase (CAT) into derivatives of pAV2 following either of the AAV promoters p/sub 40/ (pAVHiCAT) and p/sub 19/more » (pAVBcCAT). When transfected into human 293 cells or HeLa cells, pAVHiCAT expressed CAT activity in the absence of adenovirus. In the presence of adenovirus, this vector produced increased amounts of CAT activity and the recombinant AAV-CAT genome was replicated. In 293 cells, pAVBcCAT expressed a similar amount of CAT activity in the absence or presence of adenovirus and the recombinant AAV-CAT genome was not replicated. In HeLa cells, pAVBcCAT expressed low levels of CAT activity, but this level was elevated by coinfection with adenovirus particles or by cotransfection with a plasmid which expressed the adenovirus early region 1A (E1A) product. The E1A product is a transcriptional activator and is expressed in 293 cells. Thus, expression from two AAV promoters is differentially regulated: expression from p/sub 19/ is increased by E1A, whereas p/sub 40/ yields high levels of constitutive expression in the absence of E1A. Both AAV vectors were packaged into AAV particles by complementation with wild-type AAV and yielded CAT activity when subsequently infected into cells in the presence of adenovirus.« less

Transfection using hydroxyapatite nanoparticles in the inner ear via an intact round window membrane in chinchilla

NASA Astrophysics Data System (ADS)

Wu, Xuewen; Ding, Dalian; Jiang, Haiyan; Xing, Xiaowei; Huang, Suping; Liu, Hong; Chen, Zhedong; Sun, Hong

2012-01-01

Hydroxyapatite nanoparticles (nHAT) are known to have excellent biocompatibility, and have attracted increasing attention as new candidates of non-viral vectors for gene therapy. In our previous studies, nHAT carrying a therapeutic gene and a reporter gene were successfully transfected into the spiral ganglion neurons in the inner ear of guinea pigs in vivo as well as in the cultured cell lines, although the transfection efficiencies were never higher than 30%. In this study, the surface modification of nHAT with polyethylenimine (PEI) was made (PEI-nHAT, diameter = 73.09 ± 27.32 nm) and a recombinant plasmid carrying enhanced green fluorescent protein (EGFP) gene and neurotrophin-3 (NT-3) gene was constructed as pEGFPC2-NT3. The PEI modified nHAT and the recombinant plasmid was then connected to form the nHAT-based vector-gene complex (PEI-nHAT-pEGFPC2-NT3). This complex was then placed onto the intact round window membranes of the chinchillas for inner ear transfection. Auditory brainstem response (ABR) was tested to evaluate auditory function. Green fluorescence of EGFP was observed using confocal microscopy 48 h after administering vector-gene complexes. There was no significant threshold shift in tone burst-evoked ABR at any tested frequency. Abundant, condensed green fluorescence was found in dark cells on both sides of the crista and around the macula of the utricle. Scattered EGFP signals were also detected in vestibular hair cells, some Schwann cells in the cochlear spiral ganglion region, some outer pillar cells in the organ of Corti, and a few cells in the stria vascularis. The density of green fluorescence-marked cells was obviously higher in the vestibular dark cell area than in other areas of the inner ear, suggesting that vestibular dark cells may have the ability to actively engulf the nHAT-based vector-gene complexes. Considering the high transfection efficiency in the vestibular system, PEI-nHAT may be a potential vector for gene therapy of inner ear diseases, especially vestibular disorders, and deserves further study.

Practical Integration-Free Episomal Methods for Generating Human Induced Pluripotent Stem Cells.

PubMed

Kime, Cody; Rand, Tim A; Ivey, Kathryn N; Srivastava, Deepak; Yamanaka, Shinya; Tomoda, Kiichiro

2015-10-06

The advent of induced pluripotent stem (iPS) cell technology has revolutionized biomedicine and basic research by yielding cells with embryonic stem (ES) cell-like properties. The use of iPS-derived cells for cell-based therapies and modeling of human disease holds great potential. While the initial description of iPS cells involved overexpression of four transcription factors via viral vectors that integrated within genomic DNA, advances in recent years by our group and others have led to safer and higher quality iPS cells with greater efficiency. Here, we describe commonly practiced methods for non-integrating induced pluripotent stem cell generation using nucleofection of episomal reprogramming plasmids. These methods are adapted from recent studies that demonstrate increased hiPS cell reprogramming efficacy with the application of three powerful episomal hiPS cell reprogramming factor vectors and the inclusion of an accessory vector expressing EBNA1. Copyright © 2015 John Wiley & Sons, Inc.

Strong viral associations with SLE among Filipinos

PubMed Central

Vista, Evan S; Weisman, Michael H; Ishimori, Mariko L; Chen, Hua; Bourn, Rebecka L; Bruner, Ben F; Hamijoyo, Laniyati; Tanangunan, Robelle D; Gal, Noga J; Robertson, Julie M; Harley, John B; Guthridge, Joel M; Navarra, Sandra V; James, Judith A

2017-01-01

Objectives Epstein-Barr virus (EBV) is considered an important environmental factor in SLE aetiology, but the relationship between SLE and EBV in the Filipino population is unknown. We tested associations between SLE, lupus-associated autoantibodies and seropositivity for EBV and other herpes viruses in the Filipino population. Methods Sera from Filipino patients with SLE (n=233), unaffected first-degree relatives (FDRs, n=543) and unrelated controls (n=221) were tested for antibodies against EBV, cytomegalovirus (CMV) and herpes simplex viruses (HSV-1 and HSV-2) by standardised ELISAs. Humoral specificity against EBV nuclear antigen (EBNA)-1 was compared by solid-phase epitope mapping. Autoantibodies were detected by a bead-based multiplex assay. Results were analysed by Fisher's exact test, Student's t-test, χ2 test and one-way analysis of variance, as appropriate for the question. Results Filipino patients with SLE had increased seroprevalence and elevated antibody concentrations against EBV viral capsid antigen (EBV-VCA), CMV, HSV-1 and HSV-2 compared with unrelated controls (p<0.05). Seropositivity for anti-EBV early antigen (EA), a marker of EBV reactivation, was dramatically increased in patients with SLE compared with unrelated controls (92.3% vs 40.4%; OR 17.15(95% CI 10.10, 30.66), p<0.0001) or unaffected FDRs (49.4%; OR 12.04(7.42, 20.74), p<0.0001), despite similar seroprevalence of EBV-VCA in patients and FDRs. In patients with SLE, EBV-EA seropositivity correlated with lupus-associated autoantibodies (p<0.001), most notably with autoantibodies against dsDNA, chromatin, Sm, SmRNP and RNP A (p<0.01). Patient and unrelated control sera reacted to the highly repetitive glycine and alanine domain of EBNA-1. An epitope spanning EBNA-1410-420 was identified in sera of patients with SLE and showed limited binding by FDR and control sera. Conclusions Filipino patients with SLE have elevated prevalence and concentrations of antibodies against EBV, CMV, HSV-1 and HSV-2 antigens, along with altered anti-EBNA-1 specificities. EBV reactivation is more common among Filipino patients with SLE compared with healthy Filipinos and may contribute to SLE pathogenesis in this population. PMID:29214036

[Determination of plasma EBV DNA in 91 children with EBV-associated diseases].

PubMed

Duan, Hong-Mei; Yao, Yao; Xie, Zheng-De; Yan, Jing; Hu, Ying-Hui; Yao, Yuan; Zhou, Ling; Shen, Kun-Ling

2009-11-01

To determine the plasma level of Epstein Barr virus (EBV) DNA in children with EBV associated diseases, and to investigate the dynamic changes of EBV DNA level after initial infection as well as the relationship between EBV DNA level and the diseases severity. The subjects consisted of 73 children with primary EBV infection (infectious mononucleosis, pneumonia,etc.) and 18 children with severe EBV-associated diseases (chronic active EBV infection, hemophagocytic lymphohistiocytosis, etc.). The plasma EBV DNA level was detected by a real-time PCR assay. The plasma EBV DNA level decreased with the infection time in children with primary EBV infection. Two weeks after infection, plasma EBV DNA was almost undetectable. The positive rate of plasma EBV DNA in children with severe EBV associated diseases increased significantly when compared with that in children with primary EBV infection (89% vs 16%; p<0.05). The level of EBV replication may be reduced with the infection time. Dynamic determination of blood EBV DNA is useful for the evaluation of disease severity in children with EBV infection.

An overview of the infection of CMV, HSV 1/2 and EBV in Mexican patients with glioblastoma multiforme.

PubMed

Zavala-Vega, Sergio; Castro-Escarpulli, Graciela; Hernández-Santos, Hector; Salinas-Lara, Citlatepetl; Palma, Icela; Mejía-Aranguré, Juan Manuel; Gelista-Herrera, Noemí; Rembao-Bojorquez, Daniel; Ochoa, Sara A; Cruz-Córdova, Ariadnna; Xicohtencatl-Cortes, Juan; Uribe-Gutiérrez, Gabriel; Arellano-Galindo, José

2017-03-01

Several risk factors are involved in glioblastoma, including cytomegalovirus (CMV). This research was carried out to determine the rate of CMV infection, as well as HSV 1/2 and EBV in brain tissue, in patients with glioblastomamultiforme (GBM). The tissues were tested using immunohistochemistry, PCR, in situ hybridization and real-time PCR. At least, one HHV was detected in 21/29 (72%) patients as follows: single infections with HSV-1/2 in 4/21 (19%), EBV in 6/21 (28.6%) and CMV in 1/21 (4.8%). Mixed viral infection, HSV-1/2 and EBV were detected in 4/21 patients (19%), CMV and EBV in 5/21 (23.8%), and HSV-1/2, EBV, and CMV in 1/21. The CMV viral load ranged from 3×10 2 to 4.33×10 5 genome/100ng of tissue. Genotype based on CMV gB was 3/7 where 2/3 was gB1 and 1/3 gB4. HSV, EBV and CMV were frequently found in brain tissues, more in mix in a population reported as highly seropositive. Copyright © 2017 Elsevier GmbH. All rights reserved.

CUX1/Wnt signaling regulates Epithelial Mesenchymal Transition in EBV infected epithelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Malizia, Andrea P.; Lacey, Noreen; Walls, Dermot

Idiopathic pulmonary fibrosis (IPF) is a refractory and lethal interstitial lung disease characterized by alveolar epithelial cells apoptosis, fibroblast proliferation and extra-cellular matrix protein deposition. EBV, localised to alveolar epithelial cells of pulmonary fibrosis patients is associated with a poor prognosis. A strategy based on microarray-differential gene expression analysis to identify molecular drivers of EBV-associated lung fibrosis was utilized. Alveolar epithelial cells were infected with EBV to identify genes whose expression was altered following TGF{beta}1-mediated lytic phase. EBV lytic reactivation by TGF{beta}1 drives a selective alteration in CUX1 variant (a) (NCBI accession number NM{sub 1}81552) expression, inducing activation of non-canonicalmore » Wnt pathway mediators, implicating it in Epithelial Mesenchymal Transition (EMT), the molecular event underpinning scar production in tissue fibrosis. The role of EBV in EMT can be attenuated by antiviral strategies and inhibition of Wnt signaling by using All-Trans Retinoic Acids (ATRA). Activation of non-canonical Wnt signaling pathway by EBV in epithelial cells suggests a novel mechanism of EMT via CUX1 signaling. These data present a framework for further description of the link between infectious agents and fibrosis, a significant disease burden.« less

Post-treatment plasma EBV-DNA positivity predicts early relapse and poor prognosis for patients with extranodal NK/T cell lymphoma in the era of asparaginase.

PubMed

Wang, Liang; Wang, Hua; Wang, Jing-hua; Xia, Zhong-jun; Lu, Yue; Huang, Hui-qiang; Jiang, Wen-qi; Zhang, Yu-jing

2015-10-06

Circulating Epstein-Barr virus (EBV) DNA is a biomarker of EBV-associated malignancies. Its prognostic value in early stage NK/T-cell lymphoma (NKTCL) in the era of asparaginase was investigated. 68 patients were treated with a median of 4 cycles of asparaginase-based chemotherapy followed by a median of 54.6 Gy (range 50-60 Gy) radiation. The amount of EBV-DNA was prospectively measured in both pretreatment and post-treatment plasma samples by real-time quantitative PCR. At the end of treatment, complete response (CR) rate was 79.4%, and overall response rate (ORR) was 88.2%. Patients with negative pretreatment EBV-DNA had a higher CR rate (96.0% vs. 69.8%, p = 0.023). The 3-year progression-free survival (PFS) rate and overall survival (OS) rate was 71% and 83%, respectively. In multivariate survival analysis, post-treatment EBV-DNA positivity and treatment response (non-CR) were prognostic factors for both worse PFS and OS (p < 0.05). Local tumor invasion was also a prognostic factor for worse OS (p = 0.010). In patients with CR, post-treatment EBV-DNA positivity correlated with inferior PFS and OS (both p < 0.0001). In patients with positive pretreatment EBV-DNA, negative post-treatment EBV-DNA correlated with better PFS and OS (both p < 0.0001). These findings indicate that post-treatment EBV-DNA positivity can predict early relapse and poor prognosis for patients with early stage NKTCL in the era of asparaginase, and may be used as an indicator of minimal residual disease.

A Modular Lentiviral and Retroviral Construction System to Rapidly Generate Vectors for Gene Expression and Gene Knockdown In Vitro and In Vivo

PubMed Central

Geiling, Benjamin; Vandal, Guillaume; Posner, Ada R.; de Bruyns, Angeline; Dutchak, Kendall L.; Garnett, Samantha; Dankort, David

2013-01-01

The ability to express exogenous cDNAs while suppressing endogenous genes via RNAi represents an extremely powerful research tool with the most efficient non-transient approach being accomplished through stable viral vector integration. Unfortunately, since traditional restriction enzyme based methods for constructing such vectors are sequence dependent, their construction is often difficult and not amenable to mass production. Here we describe a non-sequence dependent Gateway recombination cloning system for the rapid production of novel lentiviral (pLEG) and retroviral (pREG) vectors. Using this system to recombine 3 or 4 modular plasmid components it is possible to generate viral vectors expressing cDNAs with or without inhibitory RNAs (shRNAmirs). In addition, we demonstrate a method to rapidly produce and triage novel shRNAmirs for use with this system. Once strong candidate shRNAmirs have been identified they may be linked together in tandem to knockdown expression of multiple targets simultaneously or to improve the knockdown of a single target. Here we demonstrate that these recombinant vectors are able to express cDNA and effectively knockdown protein expression using both cell culture and animal model systems. PMID:24146852

Profiling of EBV-Encoded microRNAs in EBV-Associated Hemophagocytic Lymphohistiocytosis.

PubMed

Zhou, Chen; Xie, Zhengde; Gao, Liwei; Liu, Chunyan; Ai, Junhong; Zhang, Li; Shen, Kunling

2015-10-01

Epstein-Barr virus-associated hemophagocytic lymphohistiocytosis (EBV-HLH) is a life-threatening complication of EBV infection. MicroRNAs (miRNAs) were small non-coding RNA, and EBV could encode miRNAs that are involved in the progression of infection. However, the profiles of EBV-miRNAs in EBV-HLH were unknown. Here, we aimed to profile the expression of EBV-miRNAs in children with EBV-HLH by analyzing 44 known EBV-miRNAs, encoded within the BamHI fragment H rightward open reading frame 1 (BHRF1) and the BamHI-A region rightward transcript (BART), in plasma and cellular targets by real-time quantitative PCR. The study included 15 children with EBV-HLH, 15 children with infectious mononucleosis (IM), and 15 healthy controls. CD8(+) T cells were found to be the cellular target of EBV infection in EBV-HLH, while CD19(+) B cells were infected with EBV in IM. We also found the greater levels of several miRNAs encoded by BART in EBV-HLH, compared to those in IM and healthy controls, whereas the levels of BHRF1 miRNAs were lower than those in IM. The profile and pattern of EBV-miRNAs in EBV-HLH indicated that EBV could display type II latency in EBV-HLH. Importantly, the level of plasma miR-BART16-1 continued decreasing during the whole chemotherapy, suggesting that plasma miR-BART16-1 could be a potential biomarker for monitoring EBV-HLH progression. The pathogenesis of EBV-HLH might be attributed to the abundance of EBV-miRNAs in EBV-HLH. These findings help elucidate the roles of EBV miRNAs in EBV-HLH, enabling the understanding of the basis of this disease and providing clues for its treatment.

Generation of Footprint-Free Induced Pluripotent Stem Cells from Human Fibroblasts Using Episomal Plasmid Vectors.

PubMed

Ovchinnikov, Dmitry A; Sun, Jane; Wolvetang, Ernst J

2015-01-01

Human induced pluripotent stem cells (hiPSCs) have provided novel insights into the etiology of disease and are set to transform regenerative medicine and drug screening over the next decade. The generation of human iPSCs free of a genetic footprint of the reprogramming process is crucial for the realization of these potential uses. Here we describe in detail the generation of human iPSC from control and disease-carrying individuals' fibroblasts using episomal plasmids.

Production of Enterocin P, an Antilisterial Pediocin-Like Bacteriocin from Enterococcus faecium P13, in Pichia pastoris

PubMed Central

Gutiérrez, Jorge; Criado, Raquel; Martín, María; Herranz, Carmen; Cintas, Luis M.; Hernández, Pablo E.

2005-01-01

The gene encoding mature enterocin P (EntP), an antimicrobial peptide from Enterococcus faecium P13, was cloned into the pPICZαA expression vector to generate plasmid pJC31. This plasmid was integrated into the genome of P. pastoris X-33, and EntP was heterologously secreted from the recombinant P. pastoris X-33t1 derivative at a higher production and antagonistic activity than from E. faecium P13. PMID:15980385

Yin and Yang of Heparanase in Breast Tumor Initiation

DTIC Science & Technology

2013-04-01

of heparanase in cancer metastasis and angiogenesis. Int J Biochem Cell Biol 38: 2018 -2039, 2006 2. Gotte M, Yip GW: Heparanase, hyaluronan, and...into a RCAS vector digested with a PacI and Cla I. The plasmid was designated RCAS-C. An oligonucleotide containing a Myc tag sequence (atg gaa...ligated into Not I/PacI- digested RCAS-C. The following plasmid designated as RCAS-8C was used to transfected DF-1 cells to generate RCAS-8C virus

Yin and Yang of Heparanase in Breast Cancer Initiation

DTIC Science & Technology

2014-09-01

significance of heparanase in cancer metastasis and angiogenesis. Int J Biochem Cell Biol 38: 2018 -2039, 2006 2. Gotte M, Yip GW: Heparanase...Methods Plasmids. The C-terminus of the HPR1 gene (encoding amino acid 413-543) was cloned into a RCAS vector digested with a PacI and Cla I. An...contained a cleaved Pac I site. This fragment was directly ligated into Not I/PacI- digested RCAS-C. The following plasmid designated as RCAS-8C was used

Epstein-Barr Virus-Specific Humoral Immune Responses in Health and Disease.

PubMed

Middeldorp, Jaap M

2015-01-01

Epstein-Barr virus (EBV) is widely distributed in the world and associated with a still increasing number of acute, chronic, malignant and autoimmune disease syndromes. Humoral immune responses to EBV have been studied for diagnostic, pathogenic and protective (vaccine) purposes. These studies use a range of methodologies, from cell-based immunofluorescence testing to antibody-diversity analysis using immunoblot and epitope analysis using recombinant or synthetic peptide-scanning. First, the individual EBV antigen complexes (VCA , MA, EA(D), EA(R) and EBNA) are defined at cellular and molecular levels, providing a historic overview. The characteristic antibody responses to these complexes in health and disease are described, and differences are highlighted by clinical examples. Options for EBV vaccination are briefly addressed. For a selected number of immunodominant proteins, in particular EBNA1, the interaction with human antibodies is further detailed at the epitope level, revealing interesting insights for structure, function and immunological aspects, not considered previously. Humoral immune responses against EBV-encoded tumour antigens LMP1, LMP2 and BARF1 are addressed, which provide novel options for targeted immunotherapy. Finally, some considerations on EBV-linked autoimmune diseases are given, and mechanisms of antigen mimicry are briefly discussed. Further analysis of humoral immune responses against EBV in health and disease in carefully selected patient cohorts will open new options for understanding pathogenesis of individual EBV-linked diseases and developing targeted diagnostic and therapeutic approaches.

Chronic active Epstein-Barr virus infection with marked pericardial effusion successfully treated with allogeneic peripheral blood stem cell transplantation.

PubMed

Matsui, Shinichiro; Takeda, Yusuke; Isshiki, Yusuke; Yamazaki, Atsuko; Nakao, Sanshiro; Takaishi, Koji; Nagao, Yuhei; Hasegawa, Nagisa; Togasaki, Emi; Shimizu, Ryoh; Kawajiri, Chika; Sakai, Shio; Mimura, Naoya; Takeuchi, Masahiro; Ohwada, Chikako; Sakaida, Emiko; Iseki, Tohru; Imadome, Ken-Ichi; Nakaseko, Chiaki

2016-05-01

A 23-year-old woman presented with a persistent fever and shortness of breath. Computed tomography showed marked pericardial effusion, hepatosplenomegaly, and cervical and mediastinal lymph node swelling. Epstein-Barr virus (EBV) antibody titers were abnormally elevated, and the copy number of EBV-DNA was increased in peripheral blood. Based on these observations, she was diagnosed with chronic active EBV infection (CAEBV). The EBV-infected cells in her peripheral blood were CD4(+)T lymphocytes. Fever and pericardial effusion improved following treatment with a combination of prednisolone, etoposide, and cyclosporine; however, peripheral blood EBV-DNA levels remained high. The patient underwent allogeneic peripheral blood stem cell transplantation from an EBV-seronegative, HLA-matched sibling donor, with fludarabine and melphalan conditioning. The post-transplantation course was uneventful, except for mild skin acute graft-versus-host disease (grade 2). EBV-DNA became undetectable in peripheral blood 98 days post transplantation. She has since been in good health without disease recurrence. CAEBV is a potentially fatal disease caused by persistent EBV infection of T lymphocytes or natural killer cells, thus requiring prompt treatment and allogeneic transplantation. Pericardial effusion is rarely observed in CAEBV and can impede its diagnosis. Therefore, we should be aware that patients may present with marked pericardial effusion as an initial manifestation of CAEBV.

Cloning of cellulase genes from acidothermus cellulolyticus

DOEpatents

Lastick, deceased, Stanley M.; Tucker, Melvin P.; Grohmann, Karel

1996-01-01

A process is described for moving fragments that code for cellulase activity from the genome of A. cellulolyticus to several plasmid vectors and the subsequent expression of active cellulase acitivty in E. coli.

Construction of heat-inducible expression vector of Corynebacterium glutamicum and C. ammoniagenes: fusion of lambda operator with promoters isolated from C. ammoniagenes.

PubMed

Park, Jong-Uk; Jo, Jae-Hyung; Kim, Young-Ji; Chung, So-Sun; Lee, Jin-Ho; Lee, Hyune Hwan

2008-04-01

The heat-inducible expression vectors for Corynebacterium glutamicum and C. ammoniagenes were constructed by using the lambdaOL1 and the cryptic promoters, CJ1 and CJ4 that express genes constitutively in C. ammoniagenes.. Although the promoters were isolated from C. ammoniagenes, CJ1 and CJ4 were also active in C. glutamicum. To construct vectors, the OL1 from the lambdaPL promoter was isolated and fused to the CJ1 and CJ4 promoters by recombinant PCR. The resulting artificial promoters, CJ1O and CJ4O, which have one lambdaOL1, and CJ1OX2, which has two successive lambdaOL1, were fused to the green fluorescent protein (GFP) gene followed by subcloning into pCES208. The expression of GFP in the corynebacteria harboring the vectors was regulated successfully by the temperature sensitive cI857 repressor. Among them, C. ammoniagenes harboring plasmid pCJ1OX2G containing GFP fused to CJ1OX2 showed more GFP than the other ones and the expression was tightly regulated by the repressor. To construct the generally applicable expression vector using the plasmid pCJ1OX2G, the His-tag, enterokinase (EK) moiety, and the MCS were inserted in front of the GFP gene. Using the vector, the expression of pyrR from C. glutamicum was tried by temperature shift-up. The results indicated that the constructed vectors (pCeHEMG) can be successfully used in the expression and regulation of foreign genes in corynebacteria.

Folic acid-decorated polyamidoamine dendrimer mediates selective uptake and high expression of genes in head and neck cancer cells.

PubMed

Xu, Leyuan; Kittrell, Shannon; Yeudall, W Andrew; Yang, Hu

2016-11-01

Folic acid (FA)-decorated polyamidoamine dendrimer G4 (G4-FA) was synthesized and studied for targeted delivery of genes to head and neck cancer cells expressing high levels of folate receptors (FRs). Cellular uptake, targeting specificity, cytocompatibility and transfection efficiency were evaluated. G4-FA competes with free FA for the same binding site. G4-FA facilitates the cellular uptake of DNA plasmids in a FR-dependent manner and selectively delivers plasmids to FR-high cells, leading to enhanced gene expression. G4-FA is a suitable vector to deliver genes selectively to head and neck cancer cells. The fundamental understandings of G4-FA as a vector and its encouraging transfection results for head and neck cancer cells provided support for its further testing in vivo.

Gene transfer with a vector expressing Maxi-K from a smooth muscle-specific promoter restores erectile function in the aging rat.

PubMed

Melman, A; Biggs, G; Davies, K; Zhao, W; Tar, M T; Christ, G J

2008-03-01

Previous reports have demonstrated that gene transfer with the alpha, or pore-forming, subunit of the human Maxi-K channel (hSlo) restores the decline in erectile capacity observed in established rat models of diabetes and aging. Preliminary data from a human clinical trial also showed safety and potential efficacy in 11 men treated with the same plasmid construct expressing the Maxi-K channel. In all instances, the original plasmid was driven by the heterologous cytomegalovirus promoter which is broadly active in a wide variety of cell and tissue types. To more precisely determine the contribution of the corporal myocyte to the observed physiological effects in vivo, we report here our initial work using a distinct vector (pSMAA-hSlo) in which hSlo gene expression was driven off the mouse smooth muscle alpha-actin (SMAA) promoter. Specifically, older rats, with diminished erectile capacity, were given a single intracorporal injection with either 100 mug pVAX-hSlo or 10, 100 or 1000 mug pSMAA-hSlo, or vector or vehicle alone. Significantly increased intracavernous pressure (ICP) responses to cavernous nerve stimulation were observed for all doses of both plasmids encoding hSlo, relative to control injections. These data confirm and extend previous observations to document that smooth muscle cell-specific expression of hSlo in corporal tissue is both necessary and sufficient to restore erectile function in aging rats.

Plasmids of Carotenoid-Producing Paracoccus spp. (Alphaproteobacteria) - Structure, Diversity and Evolution

PubMed Central

Maj, Anna; Dziewit, Lukasz; Czarnecki, Jakub; Wlodarczyk, Miroslawa; Baj, Jadwiga; Skrzypczyk, Grazyna; Giersz, Dorota; Bartosik, Dariusz

2013-01-01

Plasmids are components of many bacterial genomes. They enable the spread of a large pool of genetic information via lateral gene transfer. Many bacterial strains contain mega-sized replicons and these are particularly common in Alphaproteobacteria. Considerably less is known about smaller alphaproteobacterial plasmids. We analyzed the genomes of 14 such plasmids residing in 4 multireplicon carotenoid-producing strains of the genus Paracoccus (Alphaproteobacteria): P. aestuarii DSM 19484, P. haeundaensis LG P-21903, P. marcusii DSM 11574 and P. marcusii OS22. Comparative analyses revealed mosaic structures of the plasmids and recombinational shuffling of diverse genetic modules involved in (i) plasmid replication, (ii) stabilization (including toxin-antitoxin systems of the relBE/parDE, tad-ata, higBA, mazEF and toxBA families) and (iii) mobilization for conjugal transfer (encoding relaxases of the MobQ, MobP or MobV families). A common feature of the majority of the plasmids is the presence of AT-rich sequence islets (located downstream of exc1-like genes) containing genes, whose homologs are conserved in the chromosomes of many bacteria (encoding e.g. RelA/SpoT, SMC-like proteins and a retron-type reverse transcriptase). The results of this study have provided insight into the diversity and plasticity of plasmids of Paracoccus spp., and of the entire Alphaproteobacteria. Some of the identified plasmids contain replication systems not described previously in this class of bacteria. The composition of the plasmid genomes revealed frequent transfer of chromosomal genes into plasmids, which significantly enriches the pool of mobile DNA that can participate in lateral transfer. Many strains of Paracoccus spp. have great biotechnological potential, and the plasmid vectors constructed in this study will facilitate genetic studies of these bacteria. PMID:24260361

The reversed terminator of octopine synthase gene on the Agrobacterium Ti plasmid has a weak promoter activity in prokaryotes.

PubMed

Shao, Jun-Li; Long, Yue-Sheng; Chen, Gu; Xie, Jun; Xu, Zeng-Fu

2010-06-01

Agrobacterium tumefaciens transfers DNA from its Ti plasmid to plant host cells. The genes located within the transferred DNA of Ti plasmid including the octopine synthase gene (OCS) are expressed in plant host cells. The 3'-flanking region of OCS gene, known as OCS terminator, is widely used as a transcriptional terminator of the transgenes in plant expression vectors. In this study, we found the reversed OCS terminator (3'-OCS-r) could drive expression of hygromycin phosphotransferase II gene (hpt II) and beta-glucuronidase gene in Escherichia coli, and expression of hpt II in A. tumefaciens. Furthermore, reverse transcription-polymerase chain reaction analysis revealed that an open reading frame (ORF12) that is located downstream to the 3'-OCS-r was transcribed in A. tumefaciens, which overlaps in reverse with the coding region of the OCS gene in octopine Ti plasmid.

Study of the genetics and regulation of methane oxidation. Progress report, first year, August 1, 1980-July 31, 1981. [Methylobacterium ethanolicum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The plasmids present in M. ethanolicum have been characterized as to size, relatedness, and curing rate. Auxotrophs have been isolated and are being tested for the ability of several plasmids to promote mobilization of these markers. A cloning vector has been identified which can be used not only to clone the genes of interest but to isolate mutants in these genes and place a selectable marker on each of the plasmids. Isolation of a series of methane and methanol mutants, determination of which of the plasmids carries the mtn gene(s), and identification of methane-specific proteins on two-dimensonal O'Farrell gels shouldmore » all be completed shortly. In addition, the cloning of the methane genes and development of a genetic system should be well underway. A more detailed appraisal of future experiments is presented in the accompanying renewal proposal. (ERB)« less

Porphyromonas endodontalis reactivates latent Epstein-Barr virus.

PubMed

Makino, K; Takeichi, O; Imai, K; Inoue, H; Hatori, K; Himi, K; Saito, I; Ochiai, K; Ogiso, B

2018-06-01

To determine whether Porphyromonas endodontalis can reactivate latent Epstein-Barr virus (EBV). The concentrations of short-chain fatty acids (SCFAs) in P. endodontalis culture supernatants were determined using high-performance liquid chromatography. A promoter region of BamHI fragment Z leftward open reading frame 1 (BZLF-1), which is a transcription factor that controls the EBV lytic cycle, was cloned into luciferase expression vectors. Then, the luciferase assay was performed using P. endodontalis culture supernatants. Histone acetylation using Daudi cells treated with P. endodontalis culture supernatants was examined using Western blotting. BZLF-1 mRNA and BamHI fragment Z EB replication activator (ZEBRA) protein were also detected quantitatively using real-time polymerase chain reaction (PCR) and Western blotting. Surgically removed periapical granulomas were examined to detect P. endodontalis, EBV DNA, and BZLF-1 mRNA expression using quantitative real-time PCR. Statistical analysis using Steel tests was performed. The concentrations of n-butyric acid in P. endodontalis culture supernatants were significantly higher than those of other SCFAs (P=0.0173). Using B-95-8-221 Luc cells treated with P. endodontalis culture supernatants, the luciferase assay demonstrated that P. endodontalis induced BZLF-1 expression. Hyperacetylation of histones was also observed with the culture supernatants. BZLF-1 mRNA and ZEBRA protein were expressed by Daudi cells in a dose-dependent manner after the treatment with P. endodontalis culture supernatants. P. endodontalis and BZLF-1 in periapical granulomas were also detected. The expression levels of BZLF-1 mRNA were similar to the numbers of P. endodontalis cells in each specimen. n-butyric acid produced by P. endodontalis reactivated latent EBV. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

The effect of eukaryotic expression vectors and adjuvants on DNA vaccines in chickens using an avian influenza model.

PubMed

Suarez, D L; Schultz-Cherry, S

2000-01-01

Vaccination of poultry with naked plasmid DNA has been successfully demonstrated with several different poultry pathogens, but the technology needs to be further developed before it can be practically implemented. Many different methods can conceivably enhance the efficacy of DNA vaccines, and this report examines the use of different eukaryotic expression vectors with different promoters and different adjuvants to express the influenza hemagglutinin protein. Four different promoters in five different plasmids were used to express the hemagglutinin protein of an H5 avian influenza virus, including two different immediate early cytomegaloviruses (CMVs), Rous sarcoma virus, chicken actin, and simian virus 40 promoters. All five constructs expressed detectable hemagglutinin protein in cell culture, but the pCI-neo HA plasmid with the CMV promoter provided the best response in chickens when vaccinated intramuscularly at 1 day of age on the basis of antibody titer and survivability after challenge with a highly pathogenic avian influenza virus at 6 wk postinoculation. A beneficial response was observed in birds boostered at 3 wk of age, in birds given larger amounts of DNA, and with the use of multiple injection sites to administer the vaccine. With the use of the pCI-neo construct, the effects of different adjuvants designed to increase the uptake of plasmid DNA, including 25% sucrose, diethylaminoethyl dextran, calcium phosphate, polybrene, and two different cationic liposomes, were examined. Both liposomes tested enhanced antibody titers as compared with the positive controls, but the other chemical adjuvants decreased the antibody response as compared with the control chickens that received just the plasmid alone. The results observed are promising for continued studies, but continued improvements in vaccine response and reduced costs are necessary before the technology can be commercially developed.

Increased proliferation of endothelial cells with overexpression of soluble TNF-alpha receptor I gene.

PubMed

Sugano, Masahiro; Tsuchida, Keiko; Tomita, Hideharu; Makino, Naoki

2002-05-01

Vascular endothelial growth factor (VEGF) can overcome a potential anti-angiogenic effect of TNF-alpha by inhibiting endothelial apoptosis induced by this cytokine. Soluble TNF-alpha receptor I (sTNFRI) is an extracellular domain of TNFRI and antagonizes the activity of TNF-alpha. Here we report that sTNFRI is able to stimulate the growth of endothelial cells not by antagonizing TNF-alpha. Exogenously added recombinant human sTNFRI stimulated significantly more cell growth of human umbilical venous endothelial cells (HUVEC) with a low dose (50-200 pg/ml) compared with smooth muscle cells. In contrast, monoclonal antibody against TNF-alpha did not stimulate growth of human HUVEC. The sTNFRI expression plasmid (pcDNA3.1 plasmid) was introduced into the cell culture using OPTI-MEM, lipofectin and transferrin. Growth of HUVEC transfected with sTNFRI vector also increased significantly compared with those transfected with control vector. HUVEC transfected with sTNFRI vector increased the extracellular domain of TNFRI mRNA levels, but did not affect the intracellular domain of TNFRI mRNA levels. Accumulation of sTNFRI significantly increased in conditioned medium from HUVEC transfected with sTNFRI vector compared with those transfected with control vector. HUVEC transfected with sTNFRI vector not only increased sTNFRI but also prevented shedding of sTNFRI from TNFRI. The TNF-alpha -induced internucleosomic fragmentation was also significantly prevented in HUVEC transfected with sTNFRI vector compared with those transfected with control vector. These results suggest that instead of growth factors such as VEGF, local transfection of the sTNFRI gene may have potential therapeutic value in vascular diseases in which TNF-alpha is also usually highly expressed.

Genomic Analysis and Isolation of RNA Polymerase II Dependent Promoters from Spodoptera frugiperda.

PubMed

Bleckmann, Maren; Fritz, Markus H-Y; Bhuju, Sabin; Jarek, Michael; Schürig, Margitta; Geffers, Robert; Benes, Vladimir; Besir, Hüseyin; van den Heuvel, Joop

2015-01-01

The Baculoviral Expression Vector System (BEVS) is the most commonly used method for high expression of recombinant protein in insect cells. Nevertheless, expression of some target proteins--especially those entering the secretory pathway--provides a severe challenge for the baculovirus infected insect cells, due to the reorganisation of intracellular compounds upon viral infection. Therefore, alternative strategies for recombinant protein production in insect cells like transient plasmid-based expression or stable expression cell lines are becoming more popular. However, the major bottleneck of these systems is the lack of strong endogenous polymerase II dependent promoters, as the strong baculoviral p10 and polH promoters used in BEVS are only functional in presence of the viral transcription machinery during the late phase of infection. In this work we present a draft genome and a transcriptome analysis of Sf21 cells for the identification of the first known endogenous Spodoptera frugiperda promoters. Therefore, putative promoter sequences were identified and selected because of high mRNA level or in analogy to other strong promoters in other eukaryotic organism. The chosen endogenous Sf21 promoters were compared to early viral promoters for their efficiency to trigger eGFP expression using transient plasmid based transfection in a BioLector Microfermentation system. Furthermore, promoter activity was not only shown in Sf21 cells but also in Hi5 cells. The novel endogenous Sf21 promoters were ranked according to their activity and expand the small pool of available promoters for stable insect cell line development and transient plasmid expression in insect cells. The best promoter was used to improve plasmid based transient transfection in insect cells substantially.

Networking in microbes: conjugative elements and plasmids in the genus Alteromonas.

PubMed

López-Pérez, Mario; Ramon-Marco, Nieves; Rodriguez-Valera, Francisco

2017-01-05

To develop evolutionary models for the free living bacterium Alteromonas the genome sequences of isolates of the genus have been extensively analyzed. However, the main genetic exchange drivers in these microbes, conjugative elements (CEs), have not been considered in detail thus far. In this work, CEs have been searched in several complete Alteromonas genomes and their sequence studied to understand their role in the evolution of this genus. Six genomes are reported here for the first time. We have found nine different plasmids of sizes ranging from 85 to 600 Kb, most of them were found in a single strain. Networks of gene similarity could be established among six of the plasmids that were also connected with another cluster of plasmids found in Shewanella strains. The cargo genes found in these plasmids included cassettes found before in chromosome flexible genomic islands of Alteromonas strains. We describe also the plasmids pAMCP48-600 and pAMCP49-600, the largest found in Alteromonas thus far (ca. 600 Kb) and containing all the hallmarks to be classified as chromids. We found in them some housekeeping genes and a cluster that code for an exocellular polysaccharide. They could represent the transport vectors for the previously described replacement flexible genomic islands. Integrative and conjugative elements (ICEs) were more common than plasmids and showed similar patterns of variation with cargo genes coding for components of additive flexible genomic islands. A nearly identical ICE was found in A. mediterranea MED64 and Vibrio cholera AHV1003 isolated from a human pathogen, indicating the potential exchange of these genes across phylogenetic distances exceeding the family threshold. We have seen evidence of how CEs can be vectors to transfer gene cassettes acquired in the chromosomal flexible genomic islands, both of the additive and replacement kind. These CEs showed evidence of how genetic material is exchanged among members of the same species but also (albeit less frequently) across genus and family barriers. These gradients of exchange frequency are probably one of the main drivers of species origin and maintenance in prokaryotes and also provide these taxa with large genetic diversity.

Plasmid-Mediated Antimicrobial Resistance in Staphylococci and Other Firmicutes.

PubMed

Schwarz, Stefan; Shen, Jianzhong; Wendlandt, Sarah; Fessler, Andrea T; Wang, Yang; Kadlec, Kristina; Wu, Cong-Ming

2014-12-01

In staphylococci and other Firmicutes, resistance to numerous classes of antimicrobial agents, which are commonly used in human and veterinary medicine, is mediated by genes that are associated with mobile genetic elements. The gene products of some of these antimicrobial resistance genes confer resistance to only specific members of a certain class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into any of three major categories: active efflux, enzymatic inactivation, and modification/replacement/protection of the target sites of the antimicrobial agents. Among the mobile genetic elements that carry such resistance genes, plasmids play an important role as carriers of primarily plasmid-borne resistance genes, but also as vectors for nonconjugative and conjugative transposons that harbor resistance genes. Plasmids can be exchanged by horizontal gene transfer between members of the same species but also between bacteria belonging to different species and genera. Plasmids are highly flexible elements, and various mechanisms exist by which plasmids can recombine, form cointegrates, or become integrated in part or in toto into the chromosomal DNA or into other plasmids. As such, plasmids play a key role in the dissemination of antimicrobial resistance genes within the gene pool to which staphylococci and other Firmicutes have access. This chapter is intended to provide an overview of the current knowledge of plasmid-mediated antimicrobial resistance in staphylococci and other Firmicutes.

Epstein-Barr virus (EBV) load in cerebrospinal fluid and peripheral blood of patients with EBV-associated central nervous system diseases after allogeneic hematopoietic stem cell transplantation.

PubMed

Liu, Q-F; Ling, Y-W; Fan, Z-P; Jiang, Q-L; Sun, J; Wu, X-L; Zhao, J; Wei, Q; Zhang, Y; Yu, G-P; Wu, M-Q; Feng, R

2013-08-01

To evaluate the diagnostic and prognostic utility of monitoring the Epstein-Barr virus (EBV) load in the cerebrospinal fluid (CSF) and peripheral blood for the patients with EBV-associated central nervous system (CNS) diseases after allogeneic hematopoietic stem cell transplantation (allo-HSCT), 172 patients undergoing allo-HSCT were enrolled in the study. The EBV DNA levels of blood were monitored regularly in recipients of transplants for 3 years post transplantation. The EBV DNA levels of CSF were monitored in patients with EBV-associated CNS diseases before the treatment and at different points following the treatment. Post-transplant EBV-associated diseases developed in 27 patients, including 12 patients with EBV-associated CNS diseases. The 3-year cumulative incidences of EBV-associated diseases and EBV-associated CNS diseases were 19.5 ± 3.5% and 8.6 ± 2.4%, respectively. Patients with EBV-associated diseases showed higher loads of EBV DNA in their blood compared with patients with EBV DNA-emia. No difference was seen between the EBV DNA levels of blood in patients with CNS involvement and patients without CNS involvement. The EBV DNA loads of blood increased 3-14 days before the clinical manifestations of EBV-associated diseases emerged. The EBV DNA loads of CSF were higher than that of blood in patients with EBV-associated CNS diseases. In 12 patients with EBV-associated CNS diseases, EBV DNA levels were declining in both blood and CSF with the control of diseases, and the EBV DNA loads of CSF decreased faster than that of blood in 5 patients who responded to treatment, and the EBV DNA levels of CSF increased in 5 patients who were unresponsive to treatment. On multivariate analysis, the use of anti-thymocyte globulin and intensified conditioning regimens were independent risk factors for EBV-associated diseases and EBV-associated CNS diseases. EBV-associated CNS diseases are not rare after allo-HSCT. The EBV DNA loads of CSF could act as an important indicator, but the EBV DNA loads of blood could not, for the diagnosis, prognosis, and therapeutic evaluation of EBV-associated CNS diseases. © 2013 John Wiley & Sons A/S.

Helper-Free Foamy Virus Vectors

PubMed Central

TROBRIDGE, GRANT D.; RUSSELL, DAVID W.

2010-01-01

Retroviral vectors based on human foamy virus (HFV) have been developed and show promise as gene therapy vehicles. Here we describe a method for the production of HFV vector stocks free of detectable helper virus. The helper and vector plasmid constructs used both lack the HFV bel genes, so recombination between these constructs cannot create a wild-type virus. A fusion promoter that combines portions of the cytomegalovirus (CMV) immediate-early and HFV long terminal repeat (LTR) promoters was used to drive expression of both the helper and vector constructs. The CMV–LTR fusion promoter allows for HFV vector production in the absence of the Bel-1 trans-activator protein, which would otherwise be necessary for efficient transcription from the HFV LTR. Vector stocks containing either neomycin phosphotransferase or alkaline phosphatase reporter genes were produced by transient transfection at titers greater than 105 transducing units/ml. G418-resistant BHK-21 cells obtained by transduction with neo vectors contained randomly integrated HFV vector proviruses without detectable deletions or rearrangements. The vector stocks generated were free of replication-competent retrovirus (RCR), as determined by assays for LTR trans-activation and a marker rescue assay developed here for the detection of Bel-independent RCR. OVERVIEW SUMMARY Vectors based on human foamy virus have been developed but low titers and the presence of replication-competent retrovirus (RCR) in vector stocks have prevented their use in preclinical animal experiments. We have developed a transient transfection method that can be used to produce replication-incompetent HFV vector stocks at titers greater than 105/ml, and that does not produce contaminating RCR. The use of CMV-HFV LTR fusion promoters in the helper and vector constructs has circumvented the requirement for the HFV Bel-1 trans-activator protein. Consequently, the potential for generating wild-type HFV by recombination between helper and vector constructs during vector production has been eliminated. Here we describe HFV vector production using this Bel-independent system. PMID:9853518

Spacecraft Environment May Reduce Resistance To Infection

NASA Technical Reports Server (NTRS)

Pierson, Duane L.; Ott, C. Mark; Castro, V. A.; Leal, Melanie; Mehta, Satish K.

2006-01-01

Living and working in a spacecraft exposes the crew to a unique environment. This environment includes microgravity, increased radiation, chemical and biological contamination, and a variety of stressors. Disturbances in this balance are often manifested by diminished immunity in astronauts/cosmonauts. Reactivation of Epstein- Barr virus (EBV), cytomegalovirus (CMV), and varicella-zoster virus (VZV) has been used as an indicator of immune status. Reactivation of EBV and VZV were detected and quantified in saliva. CMV was measured in urine. The DNA was extracted using a Qiagen Inc. kit and viral DNA was detected by real time polymerase chain reaction (PCR) based assay with Taqman 7700 (PE Biosystems). Patterns of Epstein-Barr virus (EBV) reactivation in 32 astronauts and 18 healthy age-matched control subjects were characterized by quantifying EBV shedding. Saliva samples were collected before, during, and after 10 space shuttle missions of 5 to 14 d duration. Of 1398 saliva specimens from 32 astronauts, 314 (23%) were positive for EBV DNA. Examination by flight phase showed that 29% of the saliva specimens collected from 28 astronauts before flight were positive for EBV DNA, as were 16% of those collected from 25 astronauts during flight and 16% of those collected after flight from 23 astronauts. The mean number of EBV copies/mL from samples taken during the flights was 417, ten-fold greater (p < 0.05) than the copies from the preflight (40) and post flight (44) phases. In contrast, the control subjects shed EBV DNA with a frequency of 3.7% and mean EBV copies of 40 per mL of saliva. Ten days before flight and on landing day, titers of antibody to EBV viral capsid antigen were significantly (p < 0.05) greater than baseline levels. Increases in the number of viral copies and in the amount of EBV-specific antibody were consistent with EBV reactivation before, during, and after space flight. Similarly, CMV and VZV reactivation increased in response to space flight conditions. Data indicates that space flight is a unique stress environment that may produce stress-induced changes in the host-microbe relationship resulting in increased risk of infection.

Cloning systems for Rhodococcus and related bacteria

DOEpatents

Finnerty, W.R.; Singer, M.E.

1990-08-28

A plasmid transformation system for Rhodococcus was developed using an Escherichia coli-Rhodococcus shuttle plasmid. Rhodococcus sp. H13-A contains three cryptic indigenous plasmids, designated pMVS100, pMVS200 and pMVS300, of 75, 19.5 and 13.4 kilobases (Kb), respectively. A 3.8 Kb restriction fragment of pMVS300 was cloned into pIJ30, a 6.3 Kb pBR322 derivative, containing the E. coli origin of replication (ori) and ampicillin resistance determinant (bla) as well as a Streptomyces gene for thiostrepton resistance, tsr. The resulting 10.1 Kb recombinant plasmid, designated pMVS301, was isolated from E. coli DH1 (pMVS301) and transformed into Rhodococcus sp. AS-50, a derivative of strain H13-A, by polyethylene glycol-assisted transformation of Rhodococcus protoplasts and selection for thiostrepton-resistant transformants. This strain was deposited with the ATCC on Feb. 1, 1988 and assigned ATCC 53719. The plasmid contains the Rhodococcus origin of replication. The plasmid and derivatives thereof can therefore be used to introduce nucleic acid sequences to and from Rhodococcus for subsequent expression and translation into protein. The isolated origin of replication can also be used in the construction of new vectors. 2 figs.

Cloning systems for Rhodococcus and related bacteria

DOEpatents

Finnerty, William R.; Singer, Mary E.

1990-01-01

A plasmid transformation system for Rhodococcus was developed using an Escherichia coli-Rhodococcus shuttle plasmid. Rhodococcus sp. H13-A contains three cryptic indigenous plasmids, designated pMVS100, pMVS200 and pMVS300, of 75, 19.5 and 13.4 kilobases (Kb), respectively. A 3.8 Kb restriction fragment of pMVS300 was cloned into pIJ30, a 6.3 Kb pBR322 derivative, containing the E. coli origin of replication (ori) and ampicillin resistance determinant (bla) as well as a Streptomyces gene for thiostrepton resistance, tsr. The resulting 10.1 Kb recombinant plasmid, designated pMVS301, was isolated from E. coli DH1 (pMVS301) and transformed into Rhodococcus sp. AS-50, a derivative of strain H13-A, by polyethylene glycol-assisted transformation of Rhodococcus protoplasts and selection for thiostrepton-resistant transformants. This strain was deposited with the ATCC on Feb. 1, 1988 and assigned ATCC 53719. The plasmid contains the Rhodococcus origin of replication. The plasmid and derivatives thereof can therefore be used to introduce nucleic acid sequences to and from Rhodococcus for subsequent expression and translation into protein. The isolated origin of replication can also be used in the construction of new vectors.

Cloning of cellulase genes from Acidothermus cellulolyticus

DOEpatents

Lastick, S.M.; Tucker, M.P.; Grohmann, K.

1996-05-07

A process is described for moving fragments that code for cellulase activity from the genome of A. cellulolyticus to several plasmid vectors and the subsequent expression of active cellulase activity in E. coli. 5 figs.

Epstein-Barr Virus Type 2 Infects T Cells in Healthy Kenyan Children.

PubMed

Coleman, Carrie B; Daud, Ibrahim I; Ogolla, Sidney O; Ritchie, Julie A; Smith, Nicholas A; Sumba, Peter O; Dent, Arlene E; Rochford, Rosemary

2017-09-15

The 2 strains of Epstein-Barr virus (EBV), EBV type 1 (EBV-1) and EBV-2, differ in latency genes, suggesting that they use distinct mechanisms to establish latency. We previously reported that EBV-2 infects T cells in vitro. In this study, we tested the possibility that EBV-2 infects T cells in vivo. Purified T-cell fractions isolated from children positive for EBV-1 or EBV-2 and their mothers were examined for the presence of EBV and for EBV type. We detected EBV-2 in all T-cell samples obtained from EBV-2-infected children at 12 months of age, with some children retaining EBV-2-positive T cells through 24 months of age, suggesting that EBV-2 persists in T cells. We were unable to detect EBV-2 in T-cell samples from mothers but could detect EBV-2 in samples of their breast milk and saliva. These data suggest that EBV-2 uses T cells as an additional latency reservoir but that, over time, the frequency of infected T cells may drop below detectable levels. Alternatively, EBV-2 may establish a prolonged transient infection in the T-cell compartment. Collectively, these novel findings demonstrate that EBV-2 infects T cells in vivo and suggest EBV-2 may use the T-cell compartment to establish latency. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Characterization of variants in the promoter of BZLF1 gene of EBV in nonmalignant EBV-associated diseases in Chinese children.

PubMed

Jin, Yingkang; Xie, Zhengde; Lu, Gen; Yang, Shuang; Shen, Kunling

2010-05-10

Diseases associated with Epstein-Barr virus (EBV) infections, such as infectious mononucleosis (IM), EBV-associated hemophagocytic lymphohistiocytosis (EBV-HLH) and chronic active EBV infection (CAEBV) are not rare in Chinese children. The association of type 1 or type 2 EBV and variants of the EBV BZLF1 promoter zone (Zp) with these diseases is unclear. The objective of this study was to investigate the relationship between EBV genotypes (Zp variants and EBV type 1 and 2) and the clinical phenotypes of EBV-associated diseases in Chinese children. The Zp region was directly sequenced in 206 EBV-positive DNA samples from the blood of patients with IM, EBV-HLH, CAEBV, and healthy controls. Type 1 or type 2 EBV was examined by PCR for EBNA2 and EBNA3C subtypes. Four polymorphic Zp variants were identified: Zp-P, Zp-V3, Zp-P4 and Zp-V1, a new variant. The Zp-V3 variant was significantly associated with CAEBV (P 0.05). Type 1 EBV and BZLF1 Zp-P of EBV were the predominant genotypes in nonmalignant EBV associated diseases in Chinese children and Zp-V3 variant may correlates with the developing of severe EBV infection diseases, such as CAEBV and EBV-HLH.

Characterization of variants in the promoter of BZLF1 gene of EBV in nonmalignant EBV-associated diseases in Chinese children

PubMed Central

2010-01-01

Background Diseases associated with Epstein-Barr virus (EBV) infections, such as infectious mononucleosis (IM), EBV-associated hemophagocytic lymphohistiocytosis (EBV-HLH) and chronic active EBV infection (CAEBV) are not rare in Chinese children. The association of type 1 or type 2 EBV and variants of the EBV BZLF1 promoter zone (Zp) with these diseases is unclear. Results The objective of this study was to investigate the relationship between EBV genotypes (Zp variants and EBV type 1 and 2) and the clinical phenotypes of EBV-associated diseases in Chinese children. The Zp region was directly sequenced in 206 EBV-positive DNA samples from the blood of patients with IM, EBV-HLH, CAEBV, and healthy controls. Type 1 or type 2 EBV was examined by PCR for EBNA2 and EBNA3C subtypes. Four polymorphic Zp variants were identified: Zp-P, Zp-V3, Zp-P4 and Zp-V1, a new variant. The Zp-V3 variant was significantly associated with CAEBV (P ≤ 0.01). The frequency of co-infection with Zp variants was higher in patients with CAEBV and EBV-HLH, compared with IM and healthy controls, mostly as Zp-P+V3 co-infection. Type 1 EBV was predominant in all categories (81.3-95%) and there was no significant difference in the frequency of the EBV types 1 and 2 in different categories (P > 0.05). Conclusions Type 1 EBV and BZLF1 Zp-P of EBV were the predominant genotypes in nonmalignant EBV associated diseases in Chinese children and Zp-V3 variant may correlates with the developing of severe EBV infection diseases, such as CAEBV and EBV-HLH. PMID:20459737

Alternative reverse genetics system for influenza viruses based on a synthesized swine 45S rRNA promoter.

PubMed

Wang, Kai; Huang, Qi; Yang, Zhiwei; Qi, Kezong; Liu, Hongmei; Chen, Hongjun

2017-08-01

We generated an alternative reverse genetics (RG) system based on a synthesized swine 45S rRNA promoter to rescue the H3N2 subtype swine influenza virus. All eight flanking segment cassettes of A/swine/Henan/7/2010 (H3N2) were amplified with ambisense expression elements from RG plasmids. All segments were then recombined with the pHC2014 vector, which contained the synthesized swine 45S rRNA promoter (spol1) and its terminal sequence (t1) in a pcDNA3 backbone. As a result, we obtained a set of RG plasmids carrying the corresponding eight-segment cassettes. We efficiently generated the H3N2 virus after transfection into 293T/PK15, PK15, and 293T cells. The efficiency of spol1-driven influenza virus rescue in PK15 cells was similar to that in 293T cells by titration using the human pol1 RG system. Our approach suggests that an alternative spol1-based RG system can produce influenza viruses.

The phage integrase vector pIPI03 allows RecA-independent, site-specific labelling of Staphylococcus lugdunensis strains.

PubMed

Heilbronner, Simon; Monk, Ian R; Foster, Timothy J

2013-11-01

Staphylococcus lugdunensis is a coagulase negative staphylococcus that is a commensal of man and an opportunistic pathogen. A site-specific integrative plasmid for the use in S. lugdunensis was constructed and validated. The integrase gene ccrB of bacteriophage ϕSL01 together with its attachment site was cloned into the thermosensitive plasmid pIMAY. The resulting plasmid pIPI03 integrated RecA-independently, site-specifically and irreversibly into the S. lugdunensis chromosome. Two IPTG-inducible antibiotic resistance determinants were cloned into pIPI03 and the derivatives were used to construct strains suitable for competitive growth experiments in both in vitro and in vivo. Copyright © 2013 Elsevier Inc. All rights reserved.

Enhanced animal growth via ligand-regulated GHRH myogenic-injectable vectors

NASA Technical Reports Server (NTRS)

Draghia-Akli, Ruxandra; Malone, P. Brandon; Hill, Leigh Anne; Ellis, Kenneth M.; Schwartz, Robert J.; Nordstrom, Jeffrey L.

2002-01-01

Regulated animal growth occurred following a single electroporated injection of a mixture of two plasmids (10 microg of DNA), one expressing the GeneSwitch regulator protein, the other an inducible growth hormone releasing hormone (GHRH) gene, into the tibialis anterior muscles of adult SCID mice. Administration of the ligand mifepristone (MFP) up-regulated GHRH expression, as shown by elevations of IGF-I levels, and when MFP dosing was withdrawn, IGF-I returned to baseline levels. Five cycles of IGF-I induction were observed during a five-month period. Chronic MFP dosing for 25 days increased lean body mass, weight gain, and bone mineral density significantly compared with non-MFP treated controls. In summary, long-term drug-regulated GHRH expression was achieved following plasmid-based gene therapy, and chronic induction of GHRH expression in adult animals led to improvements in weight gain and body composition.

Enhanced animal growth via ligand-regulated GHRH myogenic-injectable vectors.

PubMed

Draghia-Akli, Ruxandra; Malone, P Brandon; Hill, Leigh Anne; Ellis, Kenneth M; Schwartz, Robert J; Nordstrom, Jeffrey L

2002-03-01

Regulated animal growth occurred following a single electroporated injection of a mixture of two plasmids (10 microg of DNA), one expressing the GeneSwitch regulator protein, the other an inducible growth hormone releasing hormone (GHRH) gene, into the tibialis anterior muscles of adult SCID mice. Administration of the ligand mifepristone (MFP) up-regulated GHRH expression, as shown by elevations of IGF-I levels, and when MFP dosing was withdrawn, IGF-I returned to baseline levels. Five cycles of IGF-I induction were observed during a five-month period. Chronic MFP dosing for 25 days increased lean body mass, weight gain, and bone mineral density significantly compared with non-MFP treated controls. In summary, long-term drug-regulated GHRH expression was achieved following plasmid-based gene therapy, and chronic induction of GHRH expression in adult animals led to improvements in weight gain and body composition.

Complete genetic analysis of plasmids carrying mcr-1 and other resistance genes in an Escherichia coli isolate of animal origin.

PubMed

Li, Ruichao; Xie, Miaomiao; Lv, Jingzhang; Wai-Chi Chan, Edward; Chen, Sheng

2017-03-01

To investigate the genetic features of three plasmids recovered from an MCR-1 and ESBL-producing Escherichia coli strain, HYEC7, and characterize the transmission mechanism of mcr-1 . The genetic profiles of three plasmids were determined by PCR, S1-PFGE, Southern hybridization and WGS analysis. The ability of the mcr-1 -bearing plasmid to undergo conjugation was also assessed. The mcr-1 -bearing transposon Tn 6330 was characterized by PCR and DNA sequencing. Complete sequences of three plasmids were obtained. A non-conjugative phage P7-like plasmid, pHYEC7- mcr1 , was found to harbour the mcr-1 -bearing transposon Tn 6330 , which could be excised from the plasmid by generating a circular intermediate harbouring mcr-1 and the IS Apl1 element. The insertion of the circular intermediate into another plasmid, pHYEC7-IncHI2, could form pHNSHP45-2, the original IncHI2-type mcr-1 -carrying plasmid that was reported. The third plasmid, pHYEC7-110, harboured two replicons, IncX1 and IncFIB, and comprised multiple antimicrobial resistance mobile elements, some of which were shared by pHYEC7-IncHI2. The Tn 6330 element located in the phage-like plasmid pHYEC7- mcr1 could be excised from the plasmid and formed a circular intermediate that could be integrated into plasmids containing the IS Apl1 element. This phenomenon indicated that Tn 6330 is a key element responsible for widespread dissemination of mcr-1 among various types of plasmids and bacterial chromosomes. The dissemination rate of such an element may be further enhanced upon translocation into phage-like vectors, which may also be transmitted via transduction events. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

A Plasmodium vivax Plasmid DNA- and Adenovirus-Vectored Malaria Vaccine Encoding Blood-Stage Antigens AMA1 and MSP142 in a Prime/Boost Heterologous Immunization Regimen Partially Protects Aotus Monkeys against Blood-Stage Challenge.

PubMed

Obaldia, Nicanor; Stockelman, Michael G; Otero, William; Cockrill, Jennifer A; Ganeshan, Harini; Abot, Esteban N; Zhang, Jianfeng; Limbach, Keith; Charoenvit, Yupin; Doolan, Denise L; Tang, De-Chu C; Richie, Thomas L

2017-04-01

Malaria is caused by parasites of the genus Plasmodium , which are transmitted to humans by the bites of Anopheles mosquitoes. After the elimination of Plasmodium falciparum , it is predicted that Plasmodium vivax will remain an important cause of morbidity and mortality outside Africa, stressing the importance of developing a vaccine against P. vivax malaria. In this study, we assessed the immunogenicity and protective efficacy of two P. vivax antigens, apical membrane antigen 1 (AMA1) and the 42-kDa C-terminal fragment of merozoite surface protein 1 (MSP1 42 ) in a plasmid recombinant DNA prime/adenoviral (Ad) vector boost regimen in Aotus monkeys. Groups of 4 to 5 monkeys were immunized with plasmid DNA alone, Ad alone, prime/boost regimens with each antigen, prime/boost regimens with both antigens, and empty vector controls and then subjected to blood-stage challenge. The heterologous immunization regimen with the antigen pair was more protective than either antigen alone or both antigens delivered with a single vaccine platform, on the basis of their ability to induce the longest prepatent period and the longest time to the peak level of parasitemia, the lowest peak and mean levels of parasitemia, the smallest area under the parasitemia curve, and the highest self-cure rate. Overall, prechallenge MSP1 42 antibody titers strongly correlated with a decreased parasite burden. Nevertheless, a significant proportion of immunized animals developed anemia. In conclusion, the P. vivax plasmid DNA/Ad serotype 5 vaccine encoding blood-stage parasite antigens AMA1 and MSP1 42 in a heterologous prime/boost immunization regimen provided significant protection against blood-stage challenge in Aotus monkeys, indicating the suitability of these antigens and this regimen for further development. Copyright © 2017 American Society for Microbiology.

Clinical evaluation of a quantitative real time polymerase chain reaction assay for diagnosis of primary Epstein-Barr virus infection in children.

PubMed

Pitetti, Raymond D; Laus, Stella; Wadowsky, Robert M

2003-08-01

Epstein-Barr virus (EBV) infectious mononucleosis is often diagnosed based on characteristic clinical features and either a positive heterophil antibody test or serology, both of which can be unreliable in young children. Real time quantitative PCR assays that measure EBV DNA load in serum or plasma are highly sensitive in young children, but serum and plasma contain inhibitors of PCR which must be removed by DNA extraction techniques. A real time TaqMan PCR assay was designed and evaluated for simultaneously measuring EBV DNA load and validating the removal of PCR inhibitors from serum samples. A serum sample was available from patients classified serologically as primary EBV infection (n = 28), EBV-seronegative (n = 25) and EBV-seropositive (n = 26). Patients were classified as having EBV infectious mononucleosis if they had specified clinical findings and > or =10% atypical lymphocytes in peripheral blood or had a positive Monospot test result. DNA was purified by a spin column method and tested in PCR reactions with primers for EBV DNA polymerase gene and internal control targets. Amplification of the two PCR products was measured in real time with separate TaqMan DNA probes labeled with various fluorescent reporters. The mean age of study patients was 9 years, 4 months. Twenty-one (75%) of the patients in the primary EBV infection group, one (4%) of the seronegatives and none of the seropositives had detectable EBV DNA. Within the primary infection group, those with detectable virus were more likely than those without detectable virus to have evidence of lymphadenopathy (14 of 16 vs.1 of 5; P = 0.011), higher mean atypical (11.7 vs.0.9%; P = 0.002) and absolute atypical (1.5 vs.0.1 x 109/l; P = 0.004) lymphocyte count, higher mean absolute lymphocyte count (4.7 vs.2.3 x 109/l; P = 0.026) and higher mean aspartate aminotransferase value (119.8 vs.37.3 IU/l; P = 0.036). Ten patients, all in the primary infection group, had EBV infectious mononucleosis, and all had positive PCR results. No sample contained PCR inhibitors. A real time TaqMan PCR assay allows rapid identification of patients with primary EBV infection and those with EBV infectious mononucleosis.

Transposon-containing DNA cloning vector and uses thereof

DOEpatents

Berg, C.M.; Berg, D.E.; Wang, G.

1997-07-08

The present invention discloses a rapid method of restriction mapping, sequencing or localizing genetic features in a segment of deoxyribonucleic acid (DNA) that is up to 42 kb in size. The method in part comprises cloning of the DNA segment in a specialized cloning vector and then isolating nested deletions in either direction in vivo by intramolecular transposition into the cloned DNA. A plasmid has been prepared and disclosed. 4 figs.

Transposon-containing DNA cloning vector and uses thereof

DOEpatents

Berg, Claire M.; Berg, Douglas E.; Wang, Gan

1997-01-01

The present invention discloses a rapid method of restriction mapping, sequencing or localizing genetic features in a segment of deoxyribonucleic acid (DNA) that is up to 42 kb in size. The method in part comprises cloning of the DNA segment in a specialized cloning vector and then isolating nested deletions in either direction in vivo by intramolecular transposition into the cloned DNA. A plasmid has been prepared and disclosed.

Progress in directed energy control of vectors for microbes and other cells

NASA Astrophysics Data System (ADS)

Kiel, Johnathan L.; Parker, Jill E.; Holwitt, Eric A.; Vivekananda, Jeeva; Sloan, Mark A.; Stribling, Lucille J. V.

2004-07-01

Biosynthetic semiconductor, diazoluminomelanin (DALM), is a polymer of tyrosine, luminol, and nitrite. DALM has a very large cross section of absorption for light from ultraviolet to radio frequencies. This polymer can be made efficiently in a genetically engineered E.coli, JM109/pIC2ORNR1.1 (ATCC# 69905). We have been pursuing ways to couple electromagnetic radiation to vectors using this polymer. DNA capture elements (DCEs; formerly aptamers) have made this possible. We incorporated DCEs into the plasmid of this E. coli to direct binding to whatever microbe or cell desired and to produce DALM attached to the plasmid DNA. Using two other vectors pSV2neoNR101 or pSV2neoNR8005 (ATCC # 69617 and 69618, respectively), both propagated in the E. coli host HB101, we have also inserted genes necessary for DALM production into animal and human cell lines (mouse monocytic leukemia: ATCC # CRL- 11771, -11772, -1173, mouse mammary adenocarcinoma: ATCC# CRL-12184, -12185; and human carcinoma of the cervix: ATCC # CRL-12510). The DCE/DALM vectors can be used to tag target cells, detectable by broad-spectrum light absorbance, luminescence, or fluorescence. DCE/DALM can further be activated with light, microwave energy, or by oxidative chemistry to kill the targeted microbes or other cells.

Homologous Recombination-Independent Large Gene Cassette Knock-in in CHO Cells Using TALEN and MMEJ-Directed Donor Plasmids

PubMed Central

Sakuma, Tetsushi; Takenaga, Mitsumasa; Kawabe, Yoshinori; Nakamura, Takahiro; Kamihira, Masamichi; Yamamoto, Takashi

2015-01-01

Gene knock-in techniques have rapidly evolved in recent years, along with the development and maturation of genome editing technology using programmable nucleases. We recently reported a novel strategy for microhomology-mediated end-joining-dependent integration of donor DNA by using TALEN or CRISPR/Cas9 and optimized targeting vectors, named PITCh (Precise Integration into Target Chromosome) vectors. Here we describe TALEN and PITCh vector-mediated integration of long gene cassettes, including a single-chain Fv-Fc (scFv-Fc) gene, in Chinese hamster ovary (CHO) cells, with comparison of targeting and cloning efficiency among several donor design and culture conditions. We achieved 9.6-kb whole plasmid integration and 7.6-kb backbone-free integration into a defined genomic locus in CHO cells. Furthermore, we confirmed the reasonable productivity of recombinant scFv-Fc protein of the knock-in cells. Using our protocol, the knock-in cell clones could be obtained by a single transfection and a single limiting dilution using a 96-well plate, without constructing targeting vectors containing long homology arms. Thus, the study described herein provides a highly practical strategy for gene knock-in of large DNA in CHO cells, which accelerates high-throughput generation of cell lines stably producing any desired biopharmaceuticals, including huge antibody proteins. PMID:26473830

Homologous Recombination-Independent Large Gene Cassette Knock-in in CHO Cells Using TALEN and MMEJ-Directed Donor Plasmids.

PubMed

Sakuma, Tetsushi; Takenaga, Mitsumasa; Kawabe, Yoshinori; Nakamura, Takahiro; Kamihira, Masamichi; Yamamoto, Takashi

2015-10-09

Gene knock-in techniques have rapidly evolved in recent years, along with the development and maturation of genome editing technology using programmable nucleases. We recently reported a novel strategy for microhomology-mediated end-joining-dependent integration of donor DNA by using TALEN or CRISPR/Cas9 and optimized targeting vectors, named PITCh (Precise Integration into Target Chromosome) vectors. Here we describe TALEN and PITCh vector-mediated integration of long gene cassettes, including a single-chain Fv-Fc (scFv-Fc) gene, in Chinese hamster ovary (CHO) cells, with comparison of targeting and cloning efficiency among several donor design and culture conditions. We achieved 9.6-kb whole plasmid integration and 7.6-kb backbone-free integration into a defined genomic locus in CHO cells. Furthermore, we confirmed the reasonable productivity of recombinant scFv-Fc protein of the knock-in cells. Using our protocol, the knock-in cell clones could be obtained by a single transfection and a single limiting dilution using a 96-well plate, without constructing targeting vectors containing long homology arms. Thus, the study described herein provides a highly practical strategy for gene knock-in of large DNA in CHO cells, which accelerates high-throughput generation of cell lines stably producing any desired biopharmaceuticals, including huge antibody proteins.

Plasmid-encoded biosynthetic genes alleviate metabolic disadvantages while increasing glucose conversion to shikimate in an engineered Escherichia coli strain.

PubMed

Rodriguez, Alberto; Martínez, Juan A; Millard, Pierre; Gosset, Guillermo; Portais, Jean-Charles; Létisse, Fabien; Bolivar, Francisco

2017-06-01

Metabolic engineering strategies applied over the last two decades to produce shikimate (SA) in Escherichia coli have resulted in a battery of strains bearing many expression systems. However, the effects that these systems have on the host physiology and how they impact the production of SA are still not well understood. In this work we utilized an engineered E. coli strain to determine the consequences of carrying a vector that promotes SA production from glucose with a high-yield but that is also expected to impose a significant cellular burden. Kinetic comparisons in fermentors showed that instead of exerting a negative effect, the sole presence of the plasmid increased glucose consumption without diminishing the growth rate. By constitutively expressing a biosynthetic operon from this vector, the more active glycolytic metabolism was exploited to redirect intermediates toward the production of SA, which further increased the glucose consumption rate and avoided excess acetate production. Fluxomics and metabolomics experiments revealed a global remodeling of the carbon and energy metabolism in the production strain, where the increased SA production reduced the carbon available for oxidative and fermentative pathways. Moreover, the results showed that the production of SA relies on a specific setup of the pentose phosphate pathway, where both its oxidative and non-oxidative branches are strongly activated to supply erythrose-4-phosphate and balance the NADPH requirements. This work improves our understanding of the metabolic reorganization observed in E. coli in response to the plasmid-based expression of the SA biosynthetic pathway. Biotechnol. Bioeng. 2017;114: 1319-1330. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Novel Epstein-Barr virus-like particles incorporating gH/gL-EBNA1 or gB-LMP2 induce high neutralizing antibody titers and EBV-specific T-cell responses in immunized mice.

PubMed

Perez, Elizabeth M; Foley, Joslyn; Tison, Timelia; Silva, Rute; Ogembo, Javier Gordon

2017-03-21

Previous Epstein-Barr virus (EBV) prophylactic vaccines based on the major surface glycoprotein gp350/220 as an immunogen have failed to block viral infection in humans, suggesting a need to target other viral envelope glycoproteins. In this study, we reasoned that incorporating gH/gL or gB, critical glycoproteins for viral fusion and entry, on the surface of a virus-like particle (VLP) would be more immunogenic than gp350/220 for generating effective neutralizing antibodies to prevent viral infection of both epithelial and B cell lines. To boost the humoral response and trigger cell-mediated immunity, EBV nuclear antigen 1 (EBNA1) and latent membrane protein 2 (LMP2), intracellular latency proteins expressed in all EBV-infected cells, were also included as critical components of the polyvalent EBV VLP. gH/gL-EBNA1 and gB-LMP2 VLPs were efficiently produced in Chinese hamster ovary cells, an FDA-approved vehicle for mass-production of biologics. Immunization with gH/gL-EBNA1 and gB-LMP2 VLPs without adjuvant generated both high neutralizing antibody titers in vitro and EBV-specific T-cell responses in BALB/c mice. These data demonstrate that will be invaluable not only in preventing EBV infection, but importantly, in preventing and treating the 200,000 cases of EBV-associated cancers that occur globally every year.

Defining the expression hierarchy of latent T-cell epitopes in Epstein-Barr virus infection with TCR-like antibodies

PubMed Central

Sim, Adrian Chong Nyi; Too, Chien Tei; Oo, Min Zin; Lai, Junyun; Eio, Michelle Yating; Song, Zhenying; Srinivasan, Nalini; Tan, Diane Ai Lin; Pang, Shyue Wei; Gan, Shu Uin; Lee, Kok Onn; Loh, Thomas Kwok Seng; Chen, Jianzhu; Chan, Soh Ha; MacAry, Paul Anthony

2013-01-01

Epstein-Barr virus (EBV) is a gamma herpesvirus that causes a life-long latent infection in human hosts. The latent gene products LMP1, LMP2A and EBNA1 are expressed by EBV-associated tumors and peptide epitopes derived from these can be targeted by CD8 Cytotoxic T-Lymphocyte (CTL) lines. Whilst CTL-based methodologies can be utilized to infer the presence of specific latent epitopes, they do not allow a direct visualization or quantitation of these epitopes. Here, we describe the characterization of three TCR-like monoclonal antibodies (mAbs) targeting the latent epitopes LMP1125–133, LMP2A426–434 or EBNA1562–570 in association with HLA-A0201. These are employed to map the expression hierarchy of endogenously generated EBV epitopes. The dominance of EBNA1562–570 in association with HLA-A0201 was consistently observed in cell lines and EBV-associated tumor biopsies. These data highlight the discordance between MHC-epitope density and frequencies of associated CTL with implications for cell-based immunotherapies and/or vaccines for EBV-associated disease. PMID:24240815

[A Case of Acute Acalculous Cholecystitis During Infectious Mononucleosis Caused by the Epstein-Barr Virus in a Young Woman].

PubMed

Ono, Shiro; Kobayashi, Tadanao; Nishio, Kenji

2016-05-01

Infection with the Epstein-Barr virus (EBV) is a common disease and is mainly asymptomatic during childhood, whereas infectious mononucleosis with clinical signs such as fever, pharyngitis, lymphadenopathy and hepatosplenomegaly often occurs in adolescents and adults with primary infection. Acalculous cholecystitis has been reported as a rare complication. We report herein a case of acalculous cholecystitis accompanied by infectious mononucleosis by EBV, which was treated successfully by medical treatment. A 33-year-old woman who had been admitted by fever, pharyngitis and lymphadenopathy developed a right upper quadrant pain, that was diagnosed as acalculous cholecystitis based on an imaging study. Antibiotic treatment did not resolve the symptoms, and surgical intervention was considered. We diagnosed her as having infectious mononucleosis based on a typical physical presentation and seropositivity for the EBV viral capsid antigen, suggesting that the acalculous cholecystatis might have been a complication of the EBV infection. After the administration of glucocorticoid and acyclovir, the patient became afebrile and the abdominal pain disappeared. Though acalculous cholecystitis rarely accompanies infectious mononucleosis caused by EBV, clinicians should be aware of this complication to avoid unnecessary cholecystectomy.

A case of chronic active Epstein-Barr virus infection mimicking adult-onset Still's disease.

PubMed

Yoshioka, Katsunobu; Fukushima, Hiroko; Ishii, Naomi; Kita, Akiko; Hanioka, Yusuke; Minami, Mieko; Inoue, Takeshi; Yamagami, Keiko

2013-01-01

An 83-year-old man was diagnosed with adult-onset Still's disease (AOSD) based on clinical and laboratory findings. However, glucocorticoid had little effect. Epstein-Barr virus (EBV)-DNA was detected in peripheral blood, and autopsy findings confirmed a diagnosis of chronic active EBV infection (CAEBV). CAEBV mimics AOSD, and the presence of articular involvement and leukocytosis does not exclude the possibility of CAEBV. CAEBV should be included in the differential diagnosis of AOSD, and measurement of EBV-DNA is essential.

Hyaluronic acid synthase-2 gene transfer into the joints of Beagles by use of recombinant adeno-associated viral vectors.

PubMed

Kyostio-Moore, Sirkka; Berthelette, Patricia; Cornell, Cathleen Sookdeo; Nambiar, Bindu; Figueiredo, Monica Dias

2018-05-01

OBJECTIVE To evaluate gene transfer of recombinant adeno-associated viral (rAAV) vectors with AAV2 or AAV5 capsid and encoding hyaluronic acid (HA) synthase-2 (HAS2) into joints of healthy dogs. ANIMALS 22 purpose-bred Beagles. PROCEDURES Plasmid expression cassettes encoding canine HAS2 (cHAS2) were assessed in vitro for concentration and molecular size of secreted HA. Thereafter, rAAV2-cHAS2 vectors at 3 concentrations and rAAV5-cHAS2 vectors at 1 concentration were each administered intra-articularly into the left stifle joint of 5 dogs; 2 dogs received PBS solution instead. Synovial fluid HA concentration and serum and synovial fluid titers of neutralizing antibodies against AAV capsids were measured at various points. Dogs were euthanized 28 days after treatment, and cartilage and synovium samples were collected for vector DNA and mRNA quantification and histologic examination. RESULTS Cell transfection with plasmids encoding cHAS2 resulted in an increase in production and secretion of HA in vitro. In vivo, the rAAV5-cHAS2 vector yielded uniform genome transfer and cHAS2 expression in collected synovium and cartilage samples. In contrast, rAAV2-cHAS2 vectors were detected inconsistently in synovium and cartilage samples and failed to produce clear dose-related responses. Histologic examination revealed minimal synovial inflammation in joints injected with rAAV vectors. Neutralizing antibodies against AAV capsids were detected in serum and synovial fluid samples from all vector-treated dogs. CONCLUSIONS AND CLINICAL RELEVANCE rAAV5-mediated transfer of the gene for cHAS2 into healthy joints of dogs by intra-articular injection appeared safe and resulted in vector-derived cHAS2 production by synoviocytes and chondrocytes. Whether this treatment may increase HA production by synoviocytes and chondrocytes in osteoarthritic joints remains to be determined.

Epstein-Barr Virus in Gastric Carcinoma

PubMed Central

Nishikawa, Jun; Yoshiyama, Hironori; Iizasa, Hisashi; Kanehiro, Yuichi; Nakamura, Munetaka; Nishimura, Junichi; Saito, Mari; Okamoto, Takeshi; Sakai, Kouhei; Suehiro, Yutaka; Yamasaki, Takahiro; Oga, Atsunori; Yanai, Hideo; Sakaida, Isao

2014-01-01

The Epstein-Barr virus (EBV) is detected in about 10% of gastric carcinoma cases throughout the world. In EBV-associated gastric carcinoma, all tumor cells harbor the clonal EBV genome. Gastric carcinoma associated with EBV has distinct clinicopathological features, occurs predominately in men and in younger-aged individuals, and presents a generally diffuse histological type. Most cases of EBV-associated gastric carcinoma exhibit a histology rich in lymphocyte infiltration. The immunological reactiveness in the host may represent a relatively preferable prognosis in EBV-positive cases. This fact highlights the important role of EBV in the development of EBV-associated gastric carcinoma. We have clearly proved direct infection of human gastric epithelialcells by EBV. The infection was achieved by using a recombinant EBV. Promotion of growth by EBV infection was observed in the cells. Considerable data suggest that EBV may directly contribute to the development of EBV-associated GC. This tumor-promoting effect seems to involve multiple mechanisms, because EBV affects several host proteins and pathways that normally promote apoptosis and regulate cell proliferation. PMID:25386788

Biochemistry and genetics of autotrophy in Methanococcus. Progress report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Whitman, W.B.

In the last two years of this research, the most exciting results have come from the work on the genetics of methanococci. First, the author demonstrated that the cryptic plasmid from Methanococcus maripaludis C5, pURB500, could be transformed into Methanococcus maripaludis JJ. Strain JJ is the type strain of M. maripaludis and has only about 65% DNA:DNA hybridization to strain C5. Because of the low relatedness of these strains, it was not obvious that pURB500 could be transferred between them. This goal was achieved by first transforming strain C5 with a series of suicide plasmids containing the pac cassette, whichmore » possessed the selectable puromycin resistance marker, and different cloned fragments of pURB500. From the puromycin-resistant transformants, a plasmid was isolated that transformed strain JJ. However, when this plasmid was electroporated into E. coli, only rearrangement products were obtained that contained small portions of the original pURB500. These plasmids no longer transformed Methanococcus. While these experiments did not yield a shuttle vector, they demonstrated that pURB500 could replicate in strain JJ.« less

Immune Efficacy of a Genetically Engineered Vaccine against Lymphocystis Disease Virus: Analysis of Different Immunization Strategies

PubMed Central

Zheng, Fengrong; Sun, Xiuqin; Wu, Xing'an; Liu, Hongzhan; Li, Jiye; Wu, Suqi; Zhang, Jinxing

2011-01-01

Here, we report the construction of a vaccine against lymphocystis disease virus (LCDV) using nucleic acid vaccination technology. A fragment of the major capsid protein encoding gene from an LCDV isolated from China (LCDV-cn) was cloned into an eukaryotic expression vector pEGFP-N2, yielding a recombinant plasmid pEGFP-N2-LCDV-cn0.6 kb. This plasmid was immediately expressed after liposomal transfer into the Japanese flounder embryo cell line. The recombinant plasmid was inoculated into Japanese flounder via two routes (intramuscular injection and hypodermic injection) at three doses (0.1, 5, and 15 μg), and then T-lymphopoiesis in different tissues and antibodies raised against LCDV were evaluated. The results indicated that this recombinant plasmid induced unique humoral or cell-mediated immune responses depending on the inoculation route and conferred immune protection. Furthermore, the humoral immune responses and protective effects were significantly increased at higher vaccine doses via the two injection routes. Plasmid pEGFP-N2-LCDV0.6 kb is therefore a promising vaccine candidate against LCDV in Japanese flounder. PMID:21789044

Epstein–Barr Virus Infection and Gastric Cancer

PubMed Central

Chen, Xin-Zu; Chen, Hongda; Castro, Felipe A.; Hu, Jian-Kun; Brenner, Hermann

2015-01-01

Abstract Epstein–Barr virus (EBV) infection is found in a subset of gastric cancers. Previous reviews have exclusively focused on EBV-encoded small RNA (EBER) positivity in gastric cancer tissues, but a comprehensive evaluation of other type of studies is lacking. We searched the PubMed database up to September, 2014, and performed a systematic review. We considered studies comparing EBV nucleic acids positivity in gastric cancer tissue with positivity in either adjacent non-tumor tissue of cancer patients or non-tumor mucosa from healthy individuals, patients with benign gastric diseases, or deceased individuals. We also considered studies comparing EBV antibodies in serum from cancer patients and healthy controls. Selection of potentially eligible studies and data extraction were performed by 2 independent reviewers. Due to the heterogeneity of studies, we did not perform formal meta-analysis. Forty-seven studies (8069 cases and 1840 controls) were identified. EBER positivity determined by in situ hybridization (ISH) was significantly higher in cancer tissues (range 5.0%–17.9%) than in adjacent mucosa from the same patients or biopsies from all control groups (almost 0%). High EBV nuclear antigen-1 (EBNA-1) positivity by PCR was found in gastric cancer tissues, but most were not validated by ISH or adjusted for inflammatory severity and lymphocyte infiltration. Only 4 studies tested for EBV antibodies, with large variation in the seropositivities of different antibodies in both cases and controls, and did not find an association between EBV seropositivity and gastric cancer. In summary, tissue-based ISH methods strongly suggest an association between EBV infection and gastric cancer, but PCR method alone is invalid to confirm such association. Very limited evidence from serological studies and the lack of novel antibodies warrant further investigations to identify potential risk factors of EBV for gastric cancer. PMID:25997049

Xeroderma pigmentosum variant cells are less likely than normal cells to incorporate dAMP opposite photoproducts during replication of UV-irradiated plasmids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Y.C.; Maher, V.M.; McCormich, J.J.

1991-09-01

Xeroderma pigmentosum (XP) variant patients show the clinical characteristics of the disease, with increased frequencies of skin cancer, but their cells have a normal, or nearly normal, rate of nucleotide excision repair of UV-induced DNA damage and are only slightly more sensitive than normal cells to the cytotoxic effect of UV radiation. However, they are significantly more sensitive to its mutagenic effect. To examine the mechanisms responsible for this hypermutability, the authors transfected an XP variant cell line with a UV-irradiated (at 254 nm) shuttle vector carrying the {sup F} gene as a target for mutations, allowed replication of themore » plasmid, determined the frequency and spectrum of mutations induced, and compared the results with those obtained previously when irradiated plasmids carrying the same target gene replicated in a normal cell line. The frequency of mutants increased linearly with dose, but with a slope 5 times steeper than that seen with normal cells. Sequence analysis of the {sup F} gene showed that 52 of 53 independent mutants generated in the XP variant cells contained base substitutions, with 62 of 64 of the substitutions involving a dipyrimidine.« less

Rational design of gene-based vaccines.

PubMed

Barouch, Dan H

2006-01-01

Vaccine development has traditionally been an empirical discipline. Classical vaccine strategies include the development of attenuated organisms, whole killed organisms, and protein subunits, followed by empirical optimization and iterative improvements. While these strategies have been remarkably successful for a wide variety of viruses and bacteria, these approaches have proven more limited for pathogens that require cellular immune responses for their control. In this review, current strategies to develop and optimize gene-based vaccines are described, with an emphasis on novel approaches to improve plasmid DNA vaccines and recombinant adenovirus vector-based vaccines. Copyright 2006 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Kinetics of Epstein-Barr virus load and virus-specific CD8+ T cells in acute infectious mononucleosis.

PubMed

Hoshino, Yo; Nishikawa, Kazuo; Ito, Yoshinori; Kuzushima, Kiyotaka; Kimura, Hiroshi

2011-03-01

During the convalescent phase of acute infectious mononucleosis (AIM), Epstein-Barr virus (EBV) load shrinks rapidly in association with a rapid decline in the number of EBV-specific CD8(+) T cells. The actual contribution of EBV-specific CD8(+) T cells in reducing EBV load, however, is not known. To clarify the impact of EBV-specific CD8(+) T cells on the contraction of EBV load in AIM, we estimated half-lives of both EBV load and EBV-specific CD8(+) T cells. Blood was serially taken from five pediatric patients with AIM during the convalescent period, including the very early phase, and both EBV load and EBV-specific CD8(+) T cell numbers were assayed. EBV load declined rapidly (half-life 1.5 d) during the first 2 weeks after onset of symptoms. This half-life was seven-fold shorter than that reported for CD27(+) memory B cells. Subsequently, the EBV load declined much more slowly, with a half-life of 38.7 d. EBV-specific CD8(+) T cell numbers also declined concomitantly with the decrease in EBV load. The half-life of EBV-specific CD8(+) T cells during first 2 weeks was 2.9 d. The number of EBV-specific CD8(+) T cells and the rate of change of viral load correlated significantly (R(2) ≥ 0.8; p ≤ 0.02). The short half-life of EBV load, together with the strong correlation between the number of EBV-specific CD8(+) T cells and the rate of change of viral load indicates an active role for EBV-specific CD8(+) T cells in elimination of EBV in AIM. Copyright © 2010 Elsevier B.V. All rights reserved.

Pediatric epstein-barr virus carriers with or without tonsillar enlargement may substantially contribute to spreading of the virus.

PubMed

Hug, Martina; Dorner, Marcus; Fröhlich, Franziska Zucol; Gysin, Claudine; Neuhaus, Diego; Nadal, David; Berger, Christoph

2010-10-15

Human-to-human transmission of the persistent infection establishing Epstein-Barr virus (EBV) occurs via saliva. Tonsils act as important portal of entry and exit of EBV. The contagiousness of pediatric EBV carriers and the role played by tonsillar enlargement (TE) are not known. We compared EBV shedding in mouthwash samples from pediatric EBV carriers with or without TE to that in mouthwash samples from pediatric patients with infectious mononucleosis (IM), the symptomatic form of primary infection if delayed after the age of 5 years. EBV DNA was quantified by polymerase chain reaction, and contagiousness was assessed using the cord lymphocyte transformation assay. EBV carriers with TE shed EBV DNA at an almost similar frequency (although in lower amounts) as pediatric patients with acute IM but more frequently (P <.001) and in higher amounts (P = .038) than EBV carriers without TE. EBV DNA levels in mouthwash samples from EBV carriers with TE mirrored levels in tonsils and gradually declined after tonsillectomy. Almost half of the mouthwash samples from pediatric EBV carriers contained infectious EBV. Pediatric EBV carriers--in particular, those with TE-may considerably contribute to the spreading of EBV in industrialized countries.

Transformation of Sordaria macrospora to hygromycin B resistance: characterization of transformants by electrophoretic karyotyping and tetrad analysis.

PubMed

Walz, M; Kück, U

1995-12-01

The ascomycete Sordaria macrospora was transformed using different plasmid molecules containing the bacterial hygromycin B resistance gene (hph) under the control of different expression signals. The highest transformation frequency was obtained with vector pMW1. On this plasmid molecule, expression of the hph gene is directed by the upstream region of the isopenicillin N synthetase gene (pcbC) from the deuteromycete Acremonium chrysogenum. Southern analysis suggests that the vector copies are integrated as tandem repeats into the S. macrospora chromosomes and that duplicated sequences are most probably not inactivated by methylation during meiosis. Furthermore, the hygromycin B resistance (hygR) is not correlated with the number of integrated vector molecules. Electrophoretic karyotyping was used to further characterize S. macrospora transformants. Five chromosomal bands were separated by pulsed-field gel electrophoresis (PFGE) representing seven chromosomes with a total genome size of 39.5Mb. Hybridization analysis revealed ectopic integration of vector DNA into different chromosomes. In a few transformants, major rearrangements were detected. Transformants were sexually propagated to analyze the fate of the heterologous vector DNA. Although the hygR phenotype is stably maintained during mitosis, about a third of all lines tested showed loss of the resistance marker gene after meiosis. However, as was concluded from electrophoretic karyotyping, the resistant spores showed a Mendelian segregation of the integrated vector molecules in at least three consecutive generations. Our data indicate that heterologous marker genes can be used for transformation tagging, or the molecular mapping of chromosomal loci in S. macrospora.

Low intrathecal antibody production despite high seroprevalence of Epstein-Barr virus in multiple sclerosis: a review of the literature.

PubMed

Ruprecht, Klemens; Wildemann, Brigitte; Jarius, Sven

2018-02-01

Patients with multiple sclerosis (MS) frequently have an intrathecal production of antibodies to different common viruses, which can be detected by elevated antiviral antibody indices (AIs). There is a strong and consistent association of MS and Epstein-Barr virus (EBV) infection. To systematically compare the frequencies of intrathecal antibody production to EBV, measles virus, rubella virus, varicella zoster virus (VZV) and herpes simplex virus (HSV) in patients with MS. Review of the English and German literature on the frequencies of intrathecal immunoglobulin (Ig)G antibody production, as defined by an elevated AI, to EBV, measles virus, rubella virus, VZV and HSV in adult and pediatric patients with MS. In nine original studies identified, the frequencies of an intrathecal production of antibodies to Epstein-Barr nuclear antigen-1 (33/340, 9.7%), EBV viral capsid antigen (12/279, 4.3%) and antigens from EBV-infected cell lines (14/90, 15.6%) in adult patients with MS were clearly lower (p ≤ 0.03 for all pairwise comparisons) than the frequencies of an intrathecal production of antibodies to measles virus (612/922, 66.4%), rubella virus (521/922, 56.5%), VZV (470/922, 51%; data from 17 original studies) and HSV (78/291, 26.8%; data from 6 original studies). Though based on a lower number of original studies and patients, findings in children with MS were essentially similar. As in adults and children with MS the seroprevalence of EBV is higher than the seroprevalences of the other investigated viruses, the lower frequency of elevated EBV AIs became even more pronounced after correction of the frequencies of elevated antiviral AIs for the seroprevalences of the respective viruses. Given the very high seroprevalence of EBV in MS, the frequency of intrathecally produced antibodies to EBV in patients with MS is paradoxically low compared to that of other common viruses. These findings are compatible with the recently proposed hypothesis that in individuals going on to develop MS antiviral antibody-producing cells may invade the brain predominantly at the time of and triggered by acute primary EBV infection, before anti-EBV IgG producing cells have yet occurred.

Breeding value prediction for production traits in layer chickens using pedigree or genomic relationships in a reduced animal model.

PubMed

Wolc, Anna; Stricker, Chris; Arango, Jesus; Settar, Petek; Fulton, Janet E; O'Sullivan, Neil P; Preisinger, Rudolf; Habier, David; Fernando, Rohan; Garrick, Dorian J; Lamont, Susan J; Dekkers, Jack C M

2011-01-21

Genomic selection involves breeding value estimation of selection candidates based on high-density SNP genotypes. To quantify the potential benefit of genomic selection, accuracies of estimated breeding values (EBV) obtained with different methods using pedigree or high-density SNP genotypes were evaluated and compared in a commercial layer chicken breeding line. The following traits were analyzed: egg production, egg weight, egg color, shell strength, age at sexual maturity, body weight, albumen height, and yolk weight. Predictions appropriate for early or late selection were compared. A total of 2,708 birds were genotyped for 23,356 segregating SNP, including 1,563 females with records. Phenotypes on relatives without genotypes were incorporated in the analysis (in total 13,049 production records).The data were analyzed with a Reduced Animal Model using a relationship matrix based on pedigree data or on marker genotypes and with a Bayesian method using model averaging. Using a validation set that consisted of individuals from the generation following training, these methods were compared by correlating EBV with phenotypes corrected for fixed effects, selecting the top 30 individuals based on EBV and evaluating their mean phenotype, and by regressing phenotypes on EBV. Using high-density SNP genotypes increased accuracies of EBV up to two-fold for selection at an early age and by up to 88% for selection at a later age. Accuracy increases at an early age can be mostly attributed to improved estimates of parental EBV for shell quality and egg production, while for other egg quality traits it is mostly due to improved estimates of Mendelian sampling effects. A relatively small number of markers was sufficient to explain most of the genetic variation for egg weight and body weight.

[Aggressive primary cutaneous B-cell lymphomas and novel EBV+ entities].

PubMed

Lamos, C; Dippel, E

2017-09-01

Primary cutaneous large B‑cell lymphomas (PCBLT), EBV-positive large B‑cell lymphomas, not otherwise specified (EBV+ DLBCL, NOS), and primary cutaneous intravascular large B‑cell lymphomas (PCIVLBL) are recognized as cutaneous lymphomas with intermediate to poor prognosis. Differentiation from indolent B‑cell lymphomas or other pathologies of the skin can be complex, both clinically and histologically, but vital for the outcome of the patient. The combination of immunotherapy and polychemotherapy regimens, such as R‑CHOP, has led to significant improvements in prognosis, especially in diffuse large B‑cell lymphomas. Therapeutic decisions need to be individually made for each patient, ideally within an interdisciplinary tumor conference. Immunosenescence may be an important factor in the pathogenesis of EBV+ DLBCL, NOS in elderly individuals. Their prognosis is less favorable than that of patients with EBV-negative PCBLT, whereby this has been observed particularly in elderly patients. One third of patients with PCIVLBL progress to systemic disease. The occurrence of nodal manifestation is rarely observed. Symptoms may vary depending on the organ system involved. Currently there are no evidence-based therapy recommendations due to the rarity of the disease. EBV-positive mucocutaneous ulcer is a new provisional category in the current WHO classification for lymphoid neoplasms. It has been segregated from EBV+ DLBCL, NOS due to its self-limiting course and good response to conservative therapy.

Generation of recombinant rotaviruses expressing fluorescent proteins using an optimized reverse genetics system.

PubMed

Komoto, Satoshi; Fukuda, Saori; Ide, Tomihiko; Ito, Naoto; Sugiyama, Makoto; Yoshikawa, Tetsushi; Murata, Takayuki; Taniguchi, Koki

2018-04-18

An entirely plasmid-based reverse genetics system for rotaviruses was established very recently. We improved the reverse genetics system to generate recombinant rotavirus by transfecting only 11 cDNA plasmids for its 11 gene segments under the condition of increasing the ratio of the cDNA plasmids for NSP2 and NSP5 genes. Utilizing this highly efficient system, we then engineered infectious recombinant rotaviruses expressing bioluminescent (NanoLuc luciferase) and fluorescent (EGFP and mCherry) reporters. These recombinant rotaviruses expressing reporters remained genetically stable during serial passages. Our reverse genetics approach and recombinant rotaviruses carrying reporter genes will be great additions to the tool kit for studying the molecular virology of rotavirus, and for developing future next-generation vaccines and expression vectors. IMPORTANCE Rotavirus is one of the most important pathogens causing severe gastroenteritis in young children worldwide. In this paper, we describe a robust and simple reverse genetics system based on only rotavirus cDNAs, and its application for engineering infectious recombinant rotaviruses harboring bioluminescent (NanoLuc) and fluorescent (EGFP and mCherry) protein genes. This highly efficient reverse genetics system and recombinant RVAs expressing reporters could be powerful tools for the study of different aspects of rotavirus replication. Furthermore, they may be useful for next-generation vaccine production for this medically important virus. Copyright © 2018 American Society for Microbiology.

Epstein-Barr virus-infected B cells expanding in germinal centers of infectious mononucleosis patients do not participate in the germinal center reaction.

PubMed

Kurth, Julia; Hansmann, Martin-Leo; Rajewsky, Klaus; Küppers, Ralf

2003-04-15

To assess the impact of the germinal center (GC) reaction on viral spread in Epstein-Barr virus (EBV) infection, we isolated EBV(+) GC B cells from the tonsils of two infectious mononucleosis patients, sequenced their rearranged V genes, and determined expression of the EBV latency genes EBV nuclear antigen 2 and latent membrane protein 1. Most EBV(+) GC B cells belonged to clones of cells harboring somatically mutated V gene rearrangements. Ongoing somatic hypermutation, the hallmark of the GC reaction, was seen only in uninfected GC B cell clones, not in EBV(+) B cell clones. Thus, in infectious mononucleosis, GC and/or memory B cells are directly infected by EBV and expand without somatic hypermutation, whereas the GC passage of EBV-infected naive B cells does not contribute detectably to the generation of infected memory B cells, the main reservoir of EBV during persistence. Most, if not all, EBV-infected cells in GCs exhibited an unusual EBV gene expression pattern in that they were positive for EBV nuclear antigen 2 but negative for latent membrane protein 1. Although the three main types of EBV-associated B cell lymphomas (Burkitt's, Hodgkin's, and posttransplant lymphomas) presumably are derived from GC B cells, EBV(+) GC B cells resembling these EBV(+) GC B cell lymphomas in terms of EBV gene expression and somatic hypermutation pattern could not be identified.

DNA compaction into new DNA vectors based on cyclodextrin polymer: surface enhanced Raman spectroscopy characterization.

PubMed

Burckbuchler, V; Wintgens, V; Lecomte, S; Percot, A; Leborgne, C; Danos, O; Kichler, A; Amiel, C

2006-04-05

The ability of DNA to bind polycation yielding polyplexes is widely used in nonviral gene delivery. The aim of the present study was to evaluate the DNA compaction with a new DNA vector using Raman spectroscopy. The polyplexes result from an association of a beta-cyclodextrin polymer (polybeta-CD), an amphiphilic cationic connector (DC-Chol or adamantane derivative Ada2), and DNA. The charge of the polymeric vector is effectively controlled by simple addition of cationic connector in the medium. We used surface enhanced Raman spectroscopy (SERS) to characterize this ternary complex, monitoring the accessibility of adenyl residues to silver colloids. The first experiments were performed using model systems based on polyA (polyadenosine monophosphate) well characterized by SERS. This model was then extended to plasmid DNA to study polybeta-CD/Ada2/DNA and polybeta-CD/DC-Chol/DNA polyplexes. The SERS spectra show a decrease of signal intensity when the vector/DNA charge ratio (Z+/-) increases. At the highest ratio (Z+/- = 10) the signal is 6-fold and 3-fold less intense than the DNA reference signal for Ada2 and DC-Chol polyplexes, respectively. Thus adenyl residues have a reduced accessibility as DNA is bound to the vector. Moreover, the SERS intensity variations are in agreement with gel electrophoresis and zeta potential experiments on the same systems. The overall study clearly demonstrates that the cationic charges neutralizing the negative charges of DNA result in the formation of stable polyplexes. In vitro transfection efficiency of those DNA vectors are also presented and compared to the classical DC-Chol lipoplexes (DC-Chol/DNA). The results show an increase of the transfection efficiency 2-fold higher with our vector based on polybeta-CD. Copyright 2005 Wiley Periodicals, Inc.

A hospital based pilot study on Epstein-Barr virus in suspected infectious mononucleosis pediatric patients in India.

PubMed

Janani, Madhuravasal Krishnan; Malathi, Jambulingam; Appaswamy, Andal; Singha, Nishi Rani; Madhavan, Hajib Nariharirao

2015-10-29

Infectious mononucleosis (IM) caused by the Epstein-Barr virus (EBV) is commonly diagnosed by detection of antibodies in the patient's sera. Differentiation of acute from chronic and differential diagnosis of EBV-induced IM from IM-like syndrome caused by human cytomegalovirus (CMV) is important. The objective of this study was to standardize and use polymerase chain reaction (PCR) for diagnosis of EBV and evaluate it against enzyme-linked immunosorbent assay (ELISA). ELISA for detection of IgM and IgG antibodies to viral capsid antigen (VCA) and PCR targeting the VCA and EBNA1 gene of EBV and mtrII gene of CMV were performed on180 peripheral blood samples collected from 180 patients with suspected IM. The analytical sensitivity of PCR was evaluated against that of ELISA. Using the standard serological profile as the reference, the EBV-VCA gene was detected in 41 (95%) of 45 samples collected from patients with early primary infections, in 41 (54%) of 75 with recent primary infections, and in7 (17%) of 39 with past infections. The result of VCA PCR was statistically significant in virus detection during early or primary stage of infection. Nineteen (49%) EBV-seropositive samples were positive for CMV by PCR. All control samples tested negative for both VCA and EBNA1by PCR. VCA PCR is sensitive for the detection of EBV DNA in the early or primary stage of infection and can be considered a reliable method to rule out the cross-reactivity and differential diagnosis of EBV-induced IM from IM-like syndrome.

Streptomyces griseus streptomycin phosphotransferase: expression of its gene in Escherichia coli and sequence homology with other antibiotic phosphotransferases and with eukaryotic protein kinases.

PubMed

Lim, C K; Smith, M C; Petty, J; Baumberg, S; Wootton, J C

1989-12-01

The aphD gene of Streptomyces griseus, encoding a streptomycin 6-phosphotransferase (SPH), was sub-cloned in the pBR322-based expression vector pRK9 (which contains the Serratia marcescens trp promoter) with selection for expression of streptomycin resistance in Escherichia coli. Two hybrid plasmids, pCKL631 and pCKL711, were isolated which conferred resistance. Both contained a approximately 2 kbp fragment already suspected to include aphD. The properties of in vitro deletion derivatives of these plasmids were consistent with the presumed location of aphD. In vitro deletion of a sequence including most of the trp promoter largely, but not quite completely, abolished the ability of the plasmid to confer streptomycin resistance, confirming that expression was indeed principally from the trp promoter. A polypeptide of approximately 34.5 kDa was present in minicells containing plasmids that conferred streptomycin resistance, but was absent when the plasmids contained in vitro deletions removing streptomycin resistance. Part of the fragment was sequenced and an open reading frame corresponding to aphD identified. A computer-assisted comparison of the deduced SPH sequence with those of other antibiotic phosphotransferases suggested a common structure A-B-C-D-E, where B and D were conserved between all sequences compared while A, C and E divided between the streptomycin and hygromycin B phosphotransferases on one hand and kanamycin/neomycin ones on the other. A composite sequence data base was searched for homologues to consensus matrices constructed from five approximately 12-residue subsequences within blocks B and D. For one subsequence, corresponding to the N-terminal portion of block D, those sequences from the database that yielded the highest homology scores comprised almost entirely either antibiotic phosphotransferases or eukaryotic protein kinases. Possible evolutionary implications of this homology, previously described by other groups, are discussed.

An efficient procedure for marker-free mutagenesis of S. coelicolor by site-specific recombination for secondary metabolite overproduction.

PubMed

Zhang, Bo; Zhang, Lin; Dai, Ruixue; Yu, Meiying; Zhao, Guoping; Ding, Xiaoming

2013-01-01

Streptomyces bacteria are known for producing important natural compounds by secondary metabolism, especially antibiotics with novel biological activities. Functional studies of antibiotic-biosynthesizing gene clusters are generally through homologous genomic recombination by gene-targeting vectors. Here, we present a rapid and efficient method for construction of gene-targeting vectors. This approach is based on Streptomyces phage φBT1 integrase-mediated multisite in vitro site-specific recombination. Four 'entry clones' were assembled into a circular plasmid to generate the destination gene-targeting vector by a one-step reaction. The four 'entry clones' contained two clones of the upstream and downstream flanks of the target gene, a selectable marker and an E. coli-Streptomyces shuttle vector. After targeted modification of the genome, the selectable markers were removed by φC31 integrase-mediated in vivo site-specific recombination between pre-placed attB and attP sites. Using this method, part of the calcium-dependent antibiotic (CDA) and actinorhodin (Act) biosynthetic gene clusters were deleted, and the rrdA encoding RrdA, a negative regulator of Red production, was also deleted. The final prodiginine production of the engineered strain was over five times that of the wild-type strain. This straightforward φBT1 and φC31 integrase-based strategy provides an alternative approach for rapid gene-targeting vector construction and marker removal in streptomycetes.

Oxidative damage in DNA bases revealed by UV resonant Raman spectroscopy.

PubMed

D'Amico, Francesco; Cammisuli, Francesca; Addobbati, Riccardo; Rizzardi, Clara; Gessini, Alessandro; Masciovecchio, Claudio; Rossi, Barbara; Pascolo, Lorella

2015-03-07

We report on the use of the UV Raman technique to monitor the oxidative damage of deoxynucleotide triphosphates (dATP, dGTP, dCTP and dTTP) and DNA (plasmid vector) solutions. Nucleotide and DNA aqueous solutions were exposed to hydrogen peroxide (H2O2) and iron containing carbon nanotubes (CNTs) to produce Fenton's reaction and induce oxidative damage. UV Raman spectroscopy is shown to be maximally efficient to reveal changes in the nitrogenous bases during the oxidative mechanisms occurring on these molecules. The analysis of Raman spectra, supported by numerical computations, revealed that the Fenton's reaction causes an oxidation of the nitrogenous bases in dATP, dGTP and dCTP solutions leading to the production of 2-hydroxyadenine, 8-hydroxyguanine and 5-hydroxycytosine. No thymine change was revealed in the dTTP solution under the same conditions. Compared to single nucleotide solutions, plasmid DNA oxidation has resulted in more radical damage that causes the breaking of the adenine and guanine aromatic rings. Our study demonstrates the advantage of using UV Raman spectroscopy for rapidly monitoring the oxidation changes in DNA aqueous solutions that can be assigned to specific nitrogenous bases.

The gene therapy of collagen-induced arthritis in rats by intramuscular administration of the plasmid encoding TNF-binding domain of variola virus CrmB protein.

PubMed

Shchelkunov, S N; Taranov, O S; Tregubchak, T V; Maksyutov, R A; Silkov, A N; Nesterov, A E; Sennikov, S V

2016-07-01

Wistar rats with collagen-induced arthritis were intramuscularly injected with the recombinant plasmid pcDNA/sTNF-BD encoding the sequence of the TNF-binding protein domain of variola virus CrmB protein (VARV sTNF-BD) or the pcDNA3.1 vector. Quantitative analysis showed that the histopathological changes in the hind-limb joints of rats were most severe in the animals injected with pcDNA3.1 and much less severe in the group of rats injected with pcDNA/sTNF-BD, which indicates that gene therapy of rheumatoid arthritis is promising in the case of local administration of plasmids governing the synthesis of VARV immunomodulatory proteins.

Zn(II)-dipicolylamine-based metallo-lipids as novel non-viral gene vectors.

PubMed

Su, Rong-Chuan; Liu, Qiang; Yi, Wen-Jing; Zhao, Zhi-Gang

2017-08-01

In this study, a series of Zn(II)-dipicolylamine (Zn-DPA) based cationic lipids bearing different hydrophobic tails (long chains, α-tocopherol, cholesterol or diosgenin) were synthesized. Structure-activity relationship (SAR) of these lipids was studied in detail by investigating the effects of several structural aspects including the type of hydrophobic tails, the chain length and saturation degree. In addition, several assays were used to study their interactions with plasmid DNA, and results reveal that these lipids could condense DNA into nanosized particles with appropriate size and zeta-potentials. MTT-based cell viability assays showed that lipoplexes 5 had low cytotoxicity. The in vitro gene transfection studies showed the hydrophobic tails clearly affected the TE, and hexadecanol-containing lipid 5b gives the best TE, which was 2.2 times higher than bPEI 25k in the presence of 10% serum. The results not only demonstrate that these lipids might be promising non-viral gene vectors, but also afford us clues for further optimization of lipidic gene delivery materials.

Infectious mononucleosis accompanied by clonal proliferation of EBV-infected cells and infection of CD8-positive cells.

PubMed

Arai, Ayako; Yamaguchi, Takeshi; Komatsu, Honami; Imadome, Ken-Ichi; Kurata, Morito; Nagata, Kaoru; Miura, Osamu

2014-01-01

A 22-year-old male was admitted for a sustained fever of 2 months, lymphadenopathy, and liver dysfunction. Anti-VCA-IgM antibody was positive, with elevated Epstein-Barr virus (EBV)-DNA load in the peripheral blood. Liver biopsy revealed infiltration of CD8-positive and EBV-positive cells. Most peripheral blood mononuclear cells (PBMCs) were also positive for CD8, and showed detectable levels of EBV-DNA. Monoclonal proliferation of EBV-infected cells was detected in the PBMCs by Southern blotting for EBV-terminal repeat (EBV-TR). Although EBV-positive T-cell lymphoproliferative disease (EBV-T-LPD) was suspected, the symptoms spontaneously resolved within 12 months. Anti-VCA-IgM antibody and the clonal band of EBV-TR were negative 1 year after the onset, while anti-EBNA antibody was positive. The final diagnosis was thus confirmed as infectious mononucleosis (IM). Our results indicate that EBV-infected CD8-positive cells and clonal proliferation of EBV-infected cells may be temporally detected in IM. EBV-T-LPDs should be carefully excluded in such cases.

[Overexpression of SEPP1 inhibits the proliferation and induces cell cycle G2/M arrest of 786-O and 769-P human renal carcinoma cells].

PubMed

Liu, Kan; Zhao, Chaofei; Chen, Jianwen; Wu, Shengpan; Yao, Yuanxin; Wu, Chong; Luo, Guoxiong; Zhang, Xu

2016-06-01

Objective To establish selenoprotein P, plasma 1 (SEPP1) gene recombinant lentiviral vector and investigate the effect of SEPP1 on the proliferation of human clear cell renal cell carcinoma (ccRCC) cells. Methods cDNA sequence of SEPP1 was cloned from the total cDNA of HEK293T cells by PCR. Then, the cDNA fragment was combined with the pLV-EGFP(2A)Puro vector and the constructed plasmid pLV-EGFP(2A)Puro-SEPP1 was transfected into HEK293T cells for packaging the virus. Forty-eight hours after transfected with the virus supernatant, the level of SEPP1 protein in 769-P and 786-O cells were tested by Western blotting. Cells were divided into recombinant lentivirus-infected cells, empty vector lentivirus-infected cells and the blank control cells. Cell proliferation rate was detected by MTS assay, colony forming ability was evaluated by plate clony formation assay and cell cycle change was assayed by flow cytometry after transfected with pLV-EGFP(2A)Puro-SEPP1 or empty pLV-EGFP(2A)Puro vector. Results Enzyme digestion analysis and DNA sequencing showed that the recombinant plasmid pLV-EGFP(2A)Puro-SEPP1 was constructed successfully. After being infected by the virus supernatant, the 786-O and 769-P cells expressed EGFP. Compared with the empty vector group and the blank control group, expression level of SEPP1 in the experimental group was much higher. The cell proliferative ability was inhibited in the cells overexpressing SEPP1, and the colony forming ability of SEPP1-overexpressed cells evidently decreased. Cell cycle was arrested in G2/M phase in 786-O cells overexpressing SEPP1. Conclusion The recombinant plasmid pLV-EGFP(2A)Puro-SEPP1 has been constructed successfully. Overexpression of SEPP1 could significantly reduce the proliferation rate of 786-O and 769P cells, and cause G2/M phase arrest of 786-O cells.

Epstein–Barr virus and multiple sclerosis: potential opportunities for immunotherapy

PubMed Central

Pender, Michael P; Burrows, Scott R

2014-01-01

Multiple sclerosis (MS) is a common chronic inflammatory demyelinating disease of the central nervous system (CNS) causing progressive disability. Many observations implicate Epstein–Barr virus (EBV) in the pathogenesis of MS, namely universal EBV seropositivity, high anti-EBV antibody levels, alterations in EBV-specific CD8+ T-cell immunity, increased spontaneous EBV-induced transformation of peripheral blood B cells, increased shedding of EBV from saliva and accumulation of EBV-infected B cells and plasma cells in the brain. Several mechanisms have been postulated to explain the role of EBV in the development of MS including cross-reactivity between EBV and CNS antigens, bystander damage to the CNS by EBV-specific CD8+ T cells, activation of innate immunity by EBV-encoded small RNA molecules in the CNS, expression of αB-crystallin in EBV-infected B cells leading to a CD4+ T-cell response against oligodendrocyte-derived αB-crystallin and EBV infection of autoreactive B cells, which produce pathogenic autoantibodies and provide costimulatory survival signals to autoreactive T cells in the CNS. The rapidly accumulating evidence for a pathogenic role of EBV in MS provides ground for optimism that it might be possible to prevent and cure MS by effectively controlling EBV infection through vaccination, antiviral drugs or treatment with EBV-specific cytotoxic CD8+ T cells. Adoptive immunotherapy with in vitro-expanded autologous EBV-specific CD8+ T cells directed against viral latent proteins was recently used to treat a patient with secondary progressive MS. Following the therapy, there was clinical improvement, decreased disease activity on magnetic resonance imaging and reduced intrathecal immunoglobulin production. PMID:25505955

Minichromosome assembly of non-integrated plasmid DNA transfected into mammalian cells.

PubMed Central

Reeves, R; Gorman, C M; Howard, B

1985-01-01

The nucleoprotein structures formed on various plasmid expression vectors transfected into mammalian cells by both the calcium phosphate and DEAE-dextran methods have been studied. We demonstrate by a variety of means that mammalian cells are capable of rapidly assembling non-integrated circular plasmids (both replicating and non-replicating) into typical "minichromosomes" containing nucleosomes with a 190 bp repetitive spacing. Treatment of recipient cells with sodium butyrate for a short period of time (12-16 h) immediately following transfection markedly increased the DNase I digestion sensitivity of the newly assembled plasmid chromatin. Furthermore, minichromosomes isolated from such butyrate-treated cells are depleted in histone H1 and contain highly acetylated forms of histone H4. These findings are entirely consistent with our earlier speculation (Gorman et al., Nucleic Acids Res. 11, 1044; 1983) that appropriate butyrate treatment might stimulate transient expression of newly transfected genes by facilitating their assembly into an "active" type of chromatin structure. Images PMID:3859838

Infection frequency of Epstein-Barr virus in subgingival samples from patients with different periodontal status and its correlation with clinical parameters*

PubMed Central

Wu, Yan-min; Yan, Jie; Chen, Li-li; Sun, Wei-lian; Gu, Zhi-yuan

2006-01-01

Objective: To detect the infection frequencies of different genotypes of Epstein-Barr virus (EBV) in subgingival samples from chronic periodontitis (CP) patients, and to discuss the correlation between infection with EBV and clinical parameters. Methods: Nested-PCR assay was used to detect EBV-1 and EBV-2 in subgingival samples from 65 CP patients, 65 gingivitis patients and 24 periodontally healthy individuals. The amplicons were further identified by restriction fragment length polymorphism analysis (RFLP) with endonucleases Afa I and Stu I. Clinical parameters mainly included bleeding on probing (BOP), probing depth (PD), attachment loss (AL) in six sites of the dentition. Results: In CP patients, gingivitis and periodontally healthy individuals, the infection frequencies were 47.7%, 24.6% and 16.7% for EBV-1, and 15.4%, 7.7% and 0% for EBV-2, respectively. In 2 out of the 65 CP patients co-infection of EBV-1 and EBV-2 was found. The positive rate of EBV-1 in chronic periodontitis patients was higher than that in gingivitis patients (P=0.01) and periodontally healthy individuals (P=0.01). But no significant difference was shown in EBV-1 frequency between gingivitis patients and healthy individuals (P>0.05) or in EBV-2 frequency among the three groups (P>0.05). In CP patients, higher mean BOP value was found in EBV-1 or EBV-2 positive patients than that in EBV negative ones (P<0.01), but with no statistical difference in the mean PD or AL value between EBV positive and negative patients (P>0.05). After initial periodontal treatment, 12 out of the 21 EBV-1 positive CP patients did not show detectable EBV-1 in subgingival samples. Conclusion: nPCR plus RFLP analysis is a sensitive, specific and stable method to detect EBV-1 and EBV-2 in subgingival samples. Subgingival infection with EBV-1 is closely associated with chronic periodontitis. Infection of EBV in subgingival samples was correlated with BOP. PMID:17048301

A novel process of viral vector barcoding and library preparation enables high-diversity library generation and recombination-free paired-end sequencing

PubMed Central

Davidsson, Marcus; Diaz-Fernandez, Paula; Schwich, Oliver D.; Torroba, Marcos; Wang, Gang; Björklund, Tomas

2016-01-01

Detailed characterization and mapping of oligonucleotide function in vivo is generally a very time consuming effort that only allows for hypothesis driven subsampling of the full sequence to be analysed. Recent advances in deep sequencing together with highly efficient parallel oligonucleotide synthesis and cloning techniques have, however, opened up for entirely new ways to map genetic function in vivo. Here we present a novel, optimized protocol for the generation of universally applicable, barcode labelled, plasmid libraries. The libraries are designed to enable the production of viral vector preparations assessing coding or non-coding RNA function in vivo. When generating high diversity libraries, it is a challenge to achieve efficient cloning, unambiguous barcoding and detailed characterization using low-cost sequencing technologies. With the presented protocol, diversity of above 3 million uniquely barcoded adeno-associated viral (AAV) plasmids can be achieved in a single reaction through a process achievable in any molecular biology laboratory. This approach opens up for a multitude of in vivo assessments from the evaluation of enhancer and promoter regions to the optimization of genome editing. The generated plasmid libraries are also useful for validation of sequencing clustering algorithms and we here validate the newly presented message passing clustering process named Starcode. PMID:27874090

Development of a Targeted anti-HER2 scFv Chimeric Peptide for Gene Delivery into HER2-Positive Breast Cancer Cells.

PubMed

Cheraghi, Roya; Nazari, Mahboobeh; Alipour, Mohsen; Majidi, Asia; Hosseinkhani, Saman

2016-12-30

Chimeric polymers are known as suitable carriers for gene delivery. Certain properties are critical for a polymer to be used as a gene delivery vector. A new polymer was designed for the targeted delivery of genes into breast cancer cell lines, based on MPG peptide. It is composed of different functional domains, including HIV gp41, nuclear localization sequence of SV40 T-antigen, two C-terminus repeats of histone H1, and the scFv of anti-HER2 antibody. The results demonstrated that the vector can effectively condense plasmid DNA into nanoparticles with an average size of 250nm. Moreover, fusion of the scFv portion to the carrier brought about the specific recognition of HER2. Overall, the transfection efficiency of the vector demonstrated that it could deliver the desired gene into BT-474 HER2-positive breast cancer cells. Copyright © 2016 Elsevier B.V. All rights reserved.

Association of GATA2 Deficiency With Severe Primary Epstein-Barr Virus (EBV) Infection and EBV-associated Cancers

PubMed Central

Cohen, Jeffrey I.; Dropulic, Lesia; Hsu, Amy P.; Zerbe, Christa S.; Krogmann, Tammy; Dowdell, Kennichi; Hornung, Ronald L.; Lovell, Jana; Hardy, Nancy; Hickstein, Dennis; Cowen, Edward W.; Calvo, Katherine R.; Pittaluga, Stefania; Holland, Steven M.

2016-01-01

Background. Most patients infected with Epstein-Barr virus (EBV) are asymptomatic, have nonspecific symptoms, or have self-limiting infectious mononucleosis. EBV, however, may result in severe primary disease or cancer. Methods. We report EBV diseases associated with GATA2 deficiency at one institution and describe the hematology, virology, and cytokine findings. Results. Seven patients with GATA2 deficiency developed severe EBV disease. Three presented with EBV infectious mononucleosis requiring hospitalization, 1 had chronic active EBV disease (B-cell type), 1 had EBV-associated hydroa vacciniforme–like lymphoma with hemophagocytic lymphohistiocytosis, and 2 had EBV-positive smooth muscle tumors. Four of the 7 patients had severe warts and 3 had disseminated nontuberculous mycobacterial infections. All of the patients had low numbers of monocytes, B cells, CD4 T cells, and natural killer cells. All had elevated levels of EBV in the blood; 2 of 3 patients tested had expression of the EBV major immediate-early gene in the blood indicative of active EBV lytic infection. Mean plasma levels of tumor necrosis factor α, interferon γ, and interferon gamma-induced protein 10 were higher in patients with GATA2 deficiency than in controls. Conclusions. GATA2 is the first gene associated with EBV hydroa vacciniforme–like lymphoma. GATA2 deficiency should be considered in patients with severe primary EBV infection or EBV-associated cancer, especially in those with disseminated nontuberculous mycobacterial disease and warts. PMID:27169477

Long-term and stable correction of uremic anemia by intramuscular injection of plasmids containing hypoxia-regulated system of erythropoietin expression

PubMed Central

Wang, Yarong; Du, Dewei; Li, Zhanting; Wei, Junxia; Yang, Angang

2012-01-01

Relative deficiency in production of glycoprotein hormone erythropoietin (Epo) is a major cause of renal anemia. This study planned to investigate whether the hypoxia-regulated system of Epo expression, constructed by fusing Epo gene to the chimeric phosphoglycerate kinase (PGK) hypoxia response elements (HRE) in combination with cytomegalovirus immediate-early (CMV IE) basal gene promoter and delivered by plasmid intramuscular injection, might provide a long-term physiologically regulated Epo secretion expression to correct the anemia in adenine-induced uremic rats. Plasmid vectors (pHRE-Epo) were synthesized by fusing human Epo cDNA to the HRE/CMV promoter. Hypoxia-inducible activity of this promoter was evaluated first in vitro and then in vivo in healthy and uremic rats (n = 30 per group). The vectors (pCMV-Epo) in which Epo expression was directed by a constitutive CMV gene promoter served as control. ANOVA and Student's t-test were used to analyze between-group differences. A high-level expression of Epo was induced by hypoxia in vitro and in vivo. Though both pHRE-Epo and pCMV-Epo corrected anemia, the hematocrit of the pCMV-Epo-treated rats exceeded the normal (P < 0.05), but that of the pHRE-Epo-treated rats didn't. Hypoxia-regulated system of Epo gene expression constructed by fusing Epo to the HRE/CMV promoter and delivered by plasmid intramuscular injection may provide a long-term and stable Epo expression and secretion in vivo to correct the anemia in adenine-induced uremic rats. PMID:22990115

Utilization of Virus ϕCh1 Elements To Establish a Shuttle Vector System for Halo(alkali)philic Archaea via Transformation of Natrialba magadii

PubMed Central

Mayrhofer-Iro, M.; Ladurner, A.; Meissner, C.; Derntl, C.; Reiter, M.; Haider, F.; Dimmel, K.; Rössler, N.; Klein, R.; Baranyi, U.; Scholz, H.

2013-01-01

In the study described here, we successfully developed a transformation system for halo(alkali)philic members of the Archaea. This transformation system comprises a series of Natrialba magadii/Escherichia coli shuttle vectors based on a modified method to transform halophilic members of the Archaea and genomic elements of the N. magadii virus ϕCh1. The shuttle vector pRo-5, based on the repH-containing region of ϕCh1, stably replicated in E. coli and N. magadii and in several halophilic and haloalkaliphilic members of the Archaea not transformable so far. The ϕCh1 operon ORF53/ORF54 (repH) was essential for pRo-5 replication and was thus identified as the minimal replication origin. The plasmid allowed homologous and heterologous gene expression, as exemplified by the expression of ϕCh1 ORF3452, which encodes a structural protein, and the reporter gene bgaH of Haloferax lucentense in N. magadii. The new transformation/vector system will facilitate genetic studies within N. magadii and other haloalkaliphilic archaea and will allow the detailed characterization of the gene functions of N. magadii virus ϕCh1 in their extreme environments. PMID:23416999

Modulation of an ultraviolet mutational hotspot in a shuttle vector Xeroderma cells.

PubMed Central

Seetharam, S; Seidman, M M

1991-01-01

Ultraviolet mutagenesis of the shuttle vector plasmid pZ189 in Xeroderma Pigmentosum cells yields a mutational pattern marked by hotspots at photoproduct sites on both strands of the supF marker gene. In order to test the influence of strand orientation on the appearance of hotspots the mutagenesis study was repeated on a vector with the supF gene in the inverted orientation. We recovered a pattern the same as that in the earlier work and conclude that the nature of the DNA polymerase involved in the replication of specific strands is not a primary determinant of hotspot occurrence in this system. One of the hotspots lies in an 8 base palindrome while the corresponding site on the other strand was not a hotspot. These results were obtained with calcium phosphate transfection of the UV treated vector. When DEAE dextran was used as a transfection agent both sites in the palindrome were hotspots. In a mixing experiment the calcium phosphate pattern was recovered. Our data suggest that the sequence determinants of mutational probability at these two sites lie outside the 8 bases of the palindrome and that mutagenesis at one, but not the other, site is sensitive to perturbation of cellular calcium levels. PMID:2027767

DNAVaxDB: the first web-based DNA vaccine database and its data analysis

PubMed Central

2014-01-01

Since the first DNA vaccine studies were done in the 1990s, thousands more studies have followed. Here we report the development and analysis of DNAVaxDB (http://www.violinet.org/dnavaxdb), the first publically available web-based DNA vaccine database that curates, stores, and analyzes experimentally verified DNA vaccines, DNA vaccine plasmid vectors, and protective antigens used in DNA vaccines. All data in DNAVaxDB are annotated from reliable resources, particularly peer-reviewed articles. Among over 140 DNA vaccine plasmids, some plasmids were more frequently used in one type of pathogen than others; for example, pCMVi-UB for G- bacterial DNA vaccines, and pCAGGS for viral DNA vaccines. Presently, over 400 DNA vaccines containing over 370 protective antigens from over 90 infectious and non-infectious diseases have been curated in DNAVaxDB. While extracellular and bacterial cell surface proteins and adhesin proteins were frequently used for DNA vaccine development, the majority of protective antigens used in Chlamydophila DNA vaccines are localized to the inner portion of the cell. The DNA vaccine priming, other vaccine boosting vaccination regimen has been widely used to induce protection against infection of different pathogens such as HIV. Parasitic and cancer DNA vaccines were also systematically analyzed. User-friendly web query and visualization interfaces are available in DNAVaxDB for interactive data search. To support data exchange, the information of DNA vaccines, plasmids, and protective antigens is stored in the Vaccine Ontology (VO). DNAVaxDB is targeted to become a timely and vital source of DNA vaccines and related data and facilitate advanced DNA vaccine research and development. PMID:25104313

Non-viral vectors based on magnetoplexes, lipoplexes and polyplexes for VEGF gene delivery into central nervous system cells.

PubMed

Villate-Beitia, Ilia; Puras, Gustavo; Soto-Sánchez, Cristina; Agirre, Mireia; Ojeda, Edilberto; Zarate, Jon; Fernández, Eduardo; Pedraz, José Luis

2017-04-15

Nanotechnology based non-viral vectors hold great promise to deliver therapeutic genes into the central nervous system (CNS) in a safe and controlled way. Vascular endothelial growth factor (VEGF) is a potential therapeutic gene candidate for CNS disorders due to its specific roles in brain angiogenesis and neuroprotection. In this work, we elaborated three different non-viral vectors based on magnetic, cationic lipid and polymeric nanoparticles complexed to the phVEGF165aIRESGFP plasmid, which codifies the VEGF protein -extracellular- and the green fluorescent protein (GFP) -intracellular-. Nanoparticles and corresponding nanoplexes -magnetoplexes, lipoplexes and polyplexes- were characterized in terms of size, zeta potential, polydispersity index, morphology and ability to bind, release and protect DNA. Transfection efficiencies of nanoplexes were measured in terms of percentage of GFP expressing cells, mean fluorescent intensity (MFI) and VEGF (ng/ml) production in HEK293, C6 and primary neuronal culture cells. Magnetoplexes showed the highest transfection efficiencies in C6, followed by lipoplexes, and in primary neuronal culture cells, followed by polyplexes. Lipoplexes were the most efficient in HEK293 cells, followed by magnetoplexes. The biological activity of VEGF was confirmed by its proliferative effect in HUVEC cells. Overall, these results provide new insights for VEGF gene delivery into CNS cells using non-viral vectors. Copyright © 2017. Published by Elsevier B.V.

Persistent Epstein-Barr viral load in Epstein-Barr viral naïve pediatric heart transplant recipients: Risk of late-onset post-transplant lymphoproliferative disease.

PubMed

Das, Bibhuti; Morrow, Robert; Huang, Rong; Fixler, David

2016-12-24

To examine the risk of late-onset post-transplant lymphoproliferative disorder (PTLD) in the presence of persisting high Epstein-Barr virus (EBV) in EBV naïve pediatric heart transplant (HT) recipients. A retrospective review of the medical records of the 145 pediatric HT recipients who had serial EBV viral load monitoring at our center was performed. We defined EBV naive patients whose EBV serology either IgM or IgG in the blood were negative at the time of HT and excluded passive transmission from mother to child in subjects less than 6 mo of age. PTLD was diagnosed in 8 out of 145 patients (5.5%); 6/91 (6.5%) in those who were EBV seropositive and 2/54 (3.7%) in the EBV naïve group at the time of HT ( P = 0.71). We found 32/145 (22%) patients with persistently high EBV load during continuing follow-up; 20/91 (22%) in EBV seropositive group vs 12/54 (22%) in EBV naïve group ( P = 0.97). There was no significant association between pre-HT serostatus and EBV load after transplant ( P > 0.05). In the EBV seropositive group, PTLD was diagnosed in 15% (3/20) of patients with high EBV vs 4.2% (3/71) of patients with low or undetectable EBV load ( P = 0.14) whereas in EBV naïve patients 8.3% (1/12) of those with high EBV load and 2.3% (1/42) with low or undetectable EBV load ( P = 0.41). There was a highly significant association between occurrence of PTLD in those with high EBV load and duration of follow up (4.3 ± 3.9 years) after HT by Cochran-Armitage test for the entire cohort ( P = 0.005). At least one episode of acute rejection occurred in 72% (23/32) of patients with high EBV vs 36% (41/113) patients with low or undetectable EBV after HT ( P < 0.05). There is an association between persistently high EBV load during post-HT follow up and the occurrence of late-onset PTLD in pediatric HT recipients irrespective of serostatus at the time of transplant. The occurrence of allograft rejection increased in patients with high EBV load presumably due to reduction in immunosuppression.

Construction and applications of exon-trapping gene-targeting vectors with a novel strategy for negative selection.

PubMed

Saito, Shinta; Ura, Kiyoe; Kodama, Miho; Adachi, Noritaka

2015-06-30

Targeted gene modification by homologous recombination provides a powerful tool for studying gene function in cells and animals. In higher eukaryotes, non-homologous integration of targeting vectors occurs several orders of magnitude more frequently than does targeted integration, making the gene-targeting technology highly inefficient. For this reason, negative-selection strategies have been employed to reduce the number of drug-resistant clones associated with non-homologous vector integration, particularly when artificial nucleases to introduce a DNA break at the target site are unavailable or undesirable. As such, an exon-trap strategy using a promoterless drug-resistance marker gene provides an effective way to counterselect non-homologous integrants. However, constructing exon-trapping targeting vectors has been a time-consuming and complicated process. By virtue of highly efficient att-mediated recombination, we successfully developed a simple and rapid method to construct plasmid-based vectors that allow for exon-trapping gene targeting. These exon-trap vectors were useful in obtaining correctly targeted clones in mouse embryonic stem cells and human HT1080 cells. Most importantly, with the use of a conditionally cytotoxic gene, we further developed a novel strategy for negative selection, thereby enhancing the efficiency of counterselection for non-homologous integration of exon-trap vectors. Our methods will greatly facilitate exon-trapping gene-targeting technologies in mammalian cells, particularly when combined with the novel negative selection strategy.

Neutralizing Antibodies Induced by Gene-Based Hydrodynamic Injection Have a Therapeutic Effect in Lethal Influenza Infection

PubMed Central

Yamazaki, Tatsuya; Nagashima, Maria; Ninomiya, Daisuke; Ainai, Akira; Fujimoto, Akira; Ichimonji, Isao; Takagi, Hidekazu; Morita, Naoko; Murotani, Kenta; Hasegawa, Hideki; Chiba, Joe; Akashi-Takamura, Sachiko

2018-01-01

The influenza virus causes annual epidemics and occasional pandemics and is thus a major public health problem. Development of vaccines and antiviral drugs is essential for controlling influenza virus infection. We previously demonstrated the use of vectored immune-prophylaxis against influenza virus infection. We generated a plasmid encoding neutralizing IgG monoclonal antibodies (mAbs) against A/PR/8/34 influenza virus (IAV) hemagglutinin (HA). We then performed electroporation of the plasmid encoding neutralizing mAbs (EP) in mice muscles and succeeded in inducing the expression of neutralizing antibodies in mouse serum. This therapy has a prophylactic effect against lethal IAV infection in mice. In this study, we established a new method of passive immunotherapy after IAV infection. We performed hydrodynamic injection of the plasmid encoding neutralizing mAbs (HD) involving rapid injection of a large volume of plasmid-DNA solution into mice via the tail vein. HD could induce neutralizing antibodies in the serum and in several mucosal tissues more rapidly than in EP. We also showed that a single HD completely protected the mice even after infection with a lethal dose of IAV. We also established other isotypes of anti-HA antibody (IgA, IgM, IgD, and IgE) and showed that like anti-HA IgG, anti-HA IgA was also effective at combating upper respiratory tract IAV infection. Passive immunotherapy with HD could thus provide a new therapeutic strategy targeting influenza virus infection. PMID:29416543

Unveiling Another Missing Piece in EBV-Driven Lymphomagenesis: EBV-Encoded MicroRNAs Expression in EBER-Negative Burkitt Lymphoma Cases.

PubMed

Mundo, Lucia; Ambrosio, Maria R; Picciolini, Matteo; Lo Bello, Giuseppe; Gazaneo, Sara; Del Porro, Leonardo; Lazzi, Stefano; Navari, Mohsen; Onyango, Noel; Granai, Massimo; Bellan, Cristiana; De Falco, Giulia; Gibellini, Davide; Piccaluga, Pier P; Leoncini, Lorenzo

2017-01-01

Epstein-Barr virus (EBV) is a gammaherpesvirus linked to a number of lymphoid and epithelial malignancies, including Burkitt lymphoma (BL) in which its frequency ranges from 30% in sporadic cases to 100% in the endemic ones. The possible contribution of EBV to BL pathogenesis is largely unknown. It has been suggested that EBV may be associated with all of the cases, including those diagnosed as EBV negative by a mechanism of hit-and-run . Early during oncogenesis, viral genes are essential for initiating disease. Progressively, viral genome is lost to escape the immune system and host mutations accumulate in proto-oncogenic cell. The main problem with the hit-and-run hypothesis is the lack of evidence in primary tumors. The routine methods applied to detect the virus [i.e., immunohistochemistry and EBV-encoded RNAs (EBER) in situ hybridization (ISH)] have a low specificity and accuracy. The aim of this study was to identify the most suitable method to detect EBV infection in pathology samples by applying conventional and non-conventional methods (i.e., EBV-microRNAs detection and EBV viral load measurement). We investigated a total of 10 cases and we found that all the samples ( n = 6) diagnosed as EBV negative by immunohistochemistry and EBER-ISH demonstrated the presence of EBV-microRNAs and EBV genome. This points at the possibility that EBV might have contributed to lymphomagenesis in all our patients, and propose microRNAs detection as the most specific and sensitive tool to recognize EBV vestiges. It is worth noting that our data would have considerable implications for EBV-related diseases control. By using anti-EBV vaccines, one could potentially prevent also some cancers less suspected of a viral origin because of viral genome loss.

Unveiling Another Missing Piece in EBV-Driven Lymphomagenesis: EBV-Encoded MicroRNAs Expression in EBER-Negative Burkitt Lymphoma Cases

PubMed Central

Mundo, Lucia; Ambrosio, Maria R.; Picciolini, Matteo; Lo Bello, Giuseppe; Gazaneo, Sara; Del Porro, Leonardo; Lazzi, Stefano; Navari, Mohsen; Onyango, Noel; Granai, Massimo; Bellan, Cristiana; De Falco, Giulia; Gibellini, Davide; Piccaluga, Pier P.; Leoncini, Lorenzo

2017-01-01

Epstein–Barr virus (EBV) is a gammaherpesvirus linked to a number of lymphoid and epithelial malignancies, including Burkitt lymphoma (BL) in which its frequency ranges from 30% in sporadic cases to 100% in the endemic ones. The possible contribution of EBV to BL pathogenesis is largely unknown. It has been suggested that EBV may be associated with all of the cases, including those diagnosed as EBV negative by a mechanism of hit-and-run. Early during oncogenesis, viral genes are essential for initiating disease. Progressively, viral genome is lost to escape the immune system and host mutations accumulate in proto-oncogenic cell. The main problem with the hit-and-run hypothesis is the lack of evidence in primary tumors. The routine methods applied to detect the virus [i.e., immunohistochemistry and EBV-encoded RNAs (EBER) in situ hybridization (ISH)] have a low specificity and accuracy. The aim of this study was to identify the most suitable method to detect EBV infection in pathology samples by applying conventional and non-conventional methods (i.e., EBV-microRNAs detection and EBV viral load measurement). We investigated a total of 10 cases and we found that all the samples (n = 6) diagnosed as EBV negative by immunohistochemistry and EBER-ISH demonstrated the presence of EBV-microRNAs and EBV genome. This points at the possibility that EBV might have contributed to lymphomagenesis in all our patients, and propose microRNAs detection as the most specific and sensitive tool to recognize EBV vestiges. It is worth noting that our data would have considerable implications for EBV-related diseases control. By using anti-EBV vaccines, one could potentially prevent also some cancers less suspected of a viral origin because of viral genome loss. PMID:28298901

E1A promoter of bovine adenovirus type 3.

PubMed

Xing, Li; Tikoo, Suresh Kumar

2006-12-01

Conserved motifs of eukaryotic gene promoters, such as TATA box and CAAT box sequences, of E1A of human adenoviruses (e.g human adenovirus 5) lie between the left inverted terminal repeat (ITR) and the ATG of E1A. However, analysis of the left end of the bovine adenovirus 3 (BAdV-3) genome revealed that the conserved sequences of the E1A promoter are present only in the ITR. As such, the promoter activity of ITR was tested in the context of a BAdV-3 vector or a plasmid-based system. Different regions of the left end of the BAdV-3 genome initiated transcription of the red fluorescent protein gene in a plasmid-based system. Moreover, BAdV-3 mutants in which the open reading frame of E1A was placed immediately downstream of the ITR produced E1A transcript and could be propagated in non-E1A-complementing Madin-Darby bovine kidney cells. These results suggest that the left ITR contains the sole BAdV-3 E1A promoter.

Construction of a novel gene bank of Bacillus subtilis using a low copy number vector in Escherichia coli.

PubMed

Hasnain, S; Thomas, C M

1986-07-01

Low copy number vector plasmid pCT571 was constructed to clone Bacillus subtilis genomic fragments in Escherichia coli. pCT571 confers KmR, TcR and CmR in E. coli and CmR in B. subtilis. It has unique restriction sites within the KmR and TcR markers to allow screening for recombinant plasmids by insertional inactivation of these genes. It contains the pSC101 replicon and replicates normally at six to eight copies per chromosome equivalent in E. coli. It also contains oriVRK2, which when supplied with the product of the trfA gene of RK2 in trans, allows pCT571 to replicate at 35-40 copies per chromosome equivalent. A B. subtilis gene bank was created by cloning partially Sau3A-digested and size-fractionated fragments of B. subtilis chromosomal DNA into the BamHI site of pCT571. DNA from 1097 KmR TcS transformants was extracted and analysed electrophoretically as supercoiled DNA and after digesting with EcoRI or EcoRI and SalI. Approximately 1000 hybrid plasmids were found with reasonably sized B. subtilis fragments. The mean size of the inserts in pCT571 is 8 kb, ranging from 4 to 20 kb in different plasmids. The gene bank covers most of the B. subtilis chromosome, as demonstrated by the results of screening the gene bank for selectable nutritional markers in E. coli and B. subtilis. Hybrid plasmids which complement E. coli mutants for arg, his, lys, met, pdx, pyr and thr markers were identified from the gene bank. In B. subtilis the presence of argC, cysA, dal, hisA, ilvA, leuA, lys, metB, metC, phe, purA, purB, thr and trpC was established by transformation experiments. The effects of copy number on cloning and long-term maintenance in the bacterial strains were also investigated. At high copy number some hybrid plasmids cannot be maintained at all, while others show an increased rate of structural deletions and rearrangements.

Part I: Minicircle vector technology limits DNA size restrictions on ex vivo gene delivery using nanoparticle vectors: Overcoming a translational barrier in neural stem cell therapy.

PubMed

Fernandes, Alinda R; Chari, Divya M

2016-09-28

Genetically engineered neural stem cell (NSC) transplant populations offer key benefits in regenerative neurology, for release of therapeutic biomolecules in ex vivo gene therapy. NSCs are 'hard-to-transfect' but amenable to 'magnetofection'. Despite the high clinical potential of this approach, the low and transient transfection associated with the large size of therapeutic DNA constructs is a critical barrier to translation. We demonstrate for the first time that DNA minicircles (small DNA vectors encoding essential gene expression components but devoid of a bacterial backbone, thereby reducing construct size versus conventional plasmids) deployed with magnetofection achieve the highest, safe non-viral DNA transfection levels (up to 54%) reported so far for primary NSCs. Minicircle-functionalized magnetic nanoparticle (MNP)-mediated gene delivery also resulted in sustained gene expression for up to four weeks. All daughter cell types of engineered NSCs (neurons, astrocytes and oligodendrocytes) were transfected (in contrast to conventional plasmids which usually yield transfected astrocytes only), offering advantages for targeted cell engineering. In addition to enhancing MNP functionality as gene delivery vectors, minicircle technology provides key benefits from safety/scale up perspectives. Therefore, we consider the proof-of-concept of fusion of technologies used here offers high potential as a clinically translatable genetic modification strategy for cell therapy. Copyright © 2016 Elsevier B.V. All rights reserved.

Association of GATA2 Deficiency With Severe Primary Epstein-Barr Virus (EBV) Infection and EBV-associated Cancers.

PubMed

Cohen, Jeffrey I; Dropulic, Lesia; Hsu, Amy P; Zerbe, Christa S; Krogmann, Tammy; Dowdell, Kennichi; Hornung, Ronald L; Lovell, Jana; Hardy, Nancy; Hickstein, Dennis; Cowen, Edward W; Calvo, Katherine R; Pittaluga, Stefania; Holland, Steven M

2016-07-01

Most patients infected with Epstein-Barr virus (EBV) are asymptomatic, have nonspecific symptoms, or have self-limiting infectious mononucleosis. EBV, however, may result in severe primary disease or cancer. We report EBV diseases associated with GATA2 deficiency at one institution and describe the hematology, virology, and cytokine findings. Seven patients with GATA2 deficiency developed severe EBV disease. Three presented with EBV infectious mononucleosis requiring hospitalization, 1 had chronic active EBV disease (B-cell type), 1 had EBV-associated hydroa vacciniforme-like lymphoma with hemophagocytic lymphohistiocytosis, and 2 had EBV-positive smooth muscle tumors. Four of the 7 patients had severe warts and 3 had disseminated nontuberculous mycobacterial infections. All of the patients had low numbers of monocytes, B cells, CD4 T cells, and natural killer cells. All had elevated levels of EBV in the blood; 2 of 3 patients tested had expression of the EBV major immediate-early gene in the blood indicative of active EBV lytic infection. Mean plasma levels of tumor necrosis factor α, interferon γ, and interferon gamma-induced protein 10 were higher in patients with GATA2 deficiency than in controls. GATA2 is the first gene associated with EBV hydroa vacciniforme-like lymphoma. GATA2 deficiency should be considered in patients with severe primary EBV infection or EBV-associated cancer, especially in those with disseminated nontuberculous mycobacterial disease and warts. Published by Oxford University Press for the Infectious Diseases Society of America 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Quantitative analysis of cell-free Epstein-Barr virus DNA in the plasma of patients with peripheral T-cell and NK-cell lymphomas and peripheral T-cell proliferative diseases.

PubMed

Suwiwat, Supaporn; Pradutkanchana, Jintana; Ishida, Takafumi; Mitarnun, Winyou

2007-12-01

The level of circulating EBV DNA is a prognostic marker in patients with some EBV-associated malignant diseases. To investigate the presence and nature of Epstein-Barr virus (EBV) DNA in the plasma and to evaluate the correlation of plasma concentrations of EBV DNA with the EBV genomic status in peripheral blood T-cells and neoplastic cells and with the clinical outcome of patients with peripheral T-cell and NK-cell lymphomas (PTCL) and peripheral T-cell proliferative diseases (PTPD). EBV DNA in the plasma of 45 patients and 45 controls was measured using real-time PCR. The presence of the EBV genome in the isolated peripheral blood lymphocytes (CD3+ and CD3- cells) was analysed by PCR. Detection of EBV-encoded early RNA (EBER) in corresponding tumor tissues was carried out using in situ hybridization. DNase I digestion was applied to plasma samples to detect naked EBV DNA. Cell-free EBV DNA was detected in 32/38 (84%) of PTCL patients and 5/7 (71%) of PTPD patients, but not in the controls. Patients with EBV genome in peripheral blood CD3+ cells and EBV genome (EBER) in the tumor cells, compared to those without these findings, had significantly higher plasma EBV DNA levels. The majority of circulating EBV DNA molecules was naked form. The plasma EBV DNA levels were not related to survival. The concentration of EBV DNA in the plasma was not a prognostic marker in PTCL and PTPD patients.

Analysis of Epstein-Barr Virus Genomes and Expression Profiles in Gastric Adenocarcinoma.

PubMed

Borozan, Ivan; Zapatka, Marc; Frappier, Lori; Ferretti, Vincent

2018-01-15

Epstein-Barr virus (EBV) is a causative agent of a variety of lymphomas, nasopharyngeal carcinoma (NPC), and ∼9% of gastric carcinomas (GCs). An important question is whether particular EBV variants are more oncogenic than others, but conclusions are currently hampered by the lack of sequenced EBV genomes. Here, we contribute to this question by mining whole-genome sequences of 201 GCs to identify 13 EBV-positive GCs and by assembling 13 new EBV genome sequences, almost doubling the number of available GC-derived EBV genome sequences and providing the first non-Asian EBV genome sequences from GC. Whole-genome sequence comparisons of all EBV isolates sequenced to date (85 from tumors and 57 from healthy individuals) showed that most GC and NPC EBV isolates were closely related although American Caucasian GC samples were more distant, suggesting a geographical component. However, EBV GC isolates were found to contain some consistent changes in protein sequences regardless of geographical origin. In addition, transcriptome data available for eight of the EBV-positive GCs were analyzed to determine which EBV genes are expressed in GC. In addition to the expected latency proteins (EBNA1, LMP1, and LMP2A), specific subsets of lytic genes were consistently expressed that did not reflect a typical lytic or abortive lytic infection, suggesting a novel mechanism of EBV gene regulation in the context of GC. These results are consistent with a model in which a combination of specific latent and lytic EBV proteins promotes tumorigenesis. IMPORTANCE Epstein-Barr virus (EBV) is a widespread virus that causes cancer, including gastric carcinoma (GC), in a small subset of individuals. An important question is whether particular EBV variants are more cancer associated than others, but more EBV sequences are required to address this question. Here, we have generated 13 new EBV genome sequences from GC, almost doubling the number of EBV sequences from GC isolates and providing the first EBV sequences from non-Asian GC. We further identify sequence changes in some EBV proteins common to GC isolates. In addition, gene expression analysis of eight of the EBV-positive GCs showed consistent expression of both the expected latency proteins and a subset of lytic proteins that was not consistent with typical lytic or abortive lytic expression. These results suggest that novel mechanisms activate expression of some EBV lytic proteins and that their expression may contribute to oncogenesis. Copyright © 2018 American Society for Microbiology.

The need and challenges for development of an Epstein-Barr virus vaccine

PubMed Central

Cohen, Jeffrey I.; Mocarski, Edward S.; Raab-Traub, Nancy; Corey, Lawrence; Nabel, Gary J.

2012-01-01

Epstein-Barr virus (EBV) is the major cause of infectious mononucleosis and is associated with several malignancies including nasopharyngeal carcinoma, gastric carcinoma, Hodgkin lymphoma, Burkitt lymphoma, and lymphoma after organ or stem cell transplant. A candidate vaccine containing soluble EBV glycoprotein gp350 protected cottontop tamarins from EBV lymphoma after challenge with EBV. In the only phase 2 trial of an EBV vaccine in humans, soluble gp350 in alum and monophosphoryl lipid A adjuvant reduced the rate of infectious mononucleosis in EBV seronegative adults, but did not affect the rate of EBV infection. A peptide vaccine corresponding to EBV latency proteins has been tested in a small number of adults to prevent infectious mononucleosis. Some of the barriers to development of an EBV vaccine include (a) whether additional viral proteins in addition to gp350 would be more effective for preventing mononucleosis or EBV malignancies, (b) the difficulty of performing clinical trials to prevent EBV associated malignancies in the absence of good surrogate markers for tumor development, and the long period of time between primary EBV infection and development of many EBV tumors, (c) the lack of knowledge of immune correlates for protection against EBV infection and disease, (d) the limitations in animal models to study protection against EBV infection and disease, and (e) the need for additional information on the economic and societal burden of infectious mononucleosis to assess the cost-benefit of a prophylactic vaccine. PMID:23598481

Lymphocytic Arteritis in Epstein-Barr Virus Vulvar Ulceration (Lipschütz Disease): A Report of 7 Cases.

PubMed

Barrett, Mary M; Sangüeza, Martin; Werner, Betina; Kutzner, Heinz; Carlson, John A

2015-09-01

Epstein-Barr virus (EBV) infection can rarely present as painful genital ulcers, mostly in young female adolescents. Typically diagnosed by clinical findings, EBV vulvar ulceration (EBVVU) is rarely biopsied. Herein, the authors report the histopathology in 8 biopsies from 7 EBVVU patients, all serologically confirmed for acute (4/7) or reactivated-chronic (3/7) EBV infection. The 7 women all presented with 1 or more painful, punched-out vulvar ulcers. Only patients with acute EBV infection showed other clinical findings: fever and/or atypical lymphocytosis affected 75% (3/4); lymphadenopathy in 50%; and malaise/fatigue, dysuria and/or hepatomegaly in 25%. All reactivated-chronic EBVVU had a solitary ulcer, and 2 had history of a similar episode of vulvar ulceration (aphthosis). Histopathologically, lymphocytic arteritis was identified in 88% (7/8); a submucosal scar was found in the eighth specimen. Other histopathologies included venulitis (62%), endarteritis obliterans (38%), thrombosis (25%), neutrophilic sebaceous adenitis (25%), and mucosal lymphoid hyperplasia (12%). Dense angiocentric CD3 CD4 T-cell lymphocyte-predominant infiltrates were found, regionally or diffusely. In 2 specimens, neutrophils compromised half of the infiltrate. Minor components of CD8, CD20, and CD30 lymphocytes, CD123 plasmacytoid monocytes, CD68 macrophages, and plasma cells were present. Small-vessel endothelium and smooth muscle adjacent to the ulcers faintly expressed cytoplasmic EBV latent membrane protein-1 (LMP1). In situ hybridization for early EBV mRNA (EBER) identified rare solitary or scattered clustered positive lymphocytes in 38%. Polymerase chain reaction for EBV DNA was positive in one EBER positive biopsy. EBV infection has been documented in muscular vessel vasculitis. Based on the aforementioned, EBVVU appears to be the consequence of localized lymphocytic arteritis.

High frequency of EBV association and 30-bp deletion in the LMP-1 gene in CD56 lymphomas of the upper aerodigestive tract.

PubMed

Tai, Yan-Chin; Kim, Lian-Hua; Peh, Suat-Cheng

2004-03-01

Natural killer (NK)/T-cell lymphomas are frequently associated with Epstein-Barr virus (EBV), and usually lack TCR gene rearrangement. Studies from Asia have reported frequent deletion in the LMP-1 gene in EBV-associated nasopharyngeal carcinoma (NPC). The present study aims to investigate LMP-1 and TCRgamma gene status in upper aerodigestive tract lymphomas. A total of 43 cases were classified into T-, B-, and NK/T-cell tumors based on the phenotype expressions of CD3(+)/CD20(-)/CD56(-), CD3(-)/CD20(+)/CD56(-), and CD3(+)/CD20(-)/CD56(+), respectively. The presence of EBV in the tumor was confirmed by EBV early RNA-in situ hybridization. LMP-1 gene deletion and TCR gamma gene rearrangement were analyzed by polymerase chain reaction on paraffin-embedded tissues. There were 20 NK/T-, eight T-, and 15 B-cell phenotype lymphomas in the present series, and EBV was detected in 19 (95%), two (25%), and three (20%) cases in the respective groups. All EBV+ cases carried 30-bp deletion in the LMP-1 gene, and two of the NK/T-cell cases were infected by both the wild type and deleted strains. Five (25%) of the NK/T-cell phenotype lymphomas showed rearranged TCR gamma gene. The present study revealed a high frequency of EBV association, and a high frequency of 30-bp deletion in the LMP-1 gene in the virus in the present series of lymphoma. The NK/T-phenotype lymphomas are comprised of both NK-cell and cytotoxic T-lymphocyte-derived tumors.

Establishment and characterization of a novel Hodgkin lymphoma cell line, AM-HLH, carrying the Epstein-Barr virus genome integrated into the host chromosome.

PubMed

Hayashida, Masahiko; Daibata, Masanori; Tagami, Erika; Taguchi, Takahiro; Maekawa, Fumiyo; Takeoka, Kayo; Fukutsuka, Katsuhiro; Shimomura, Daiki; Hayashi, Takamasa; Iwatani, Yoshinori; Ohno, Hitoshi

2017-12-01

We describe the establishment and characterization of a cell line, AM-HLH, obtained from a patient with Epstein-Barr virus-positive (EBV + ) nodular sclerosis-type Hodgkin lymphoma (HL). The cells were positive for CD2 and CD30 and negative for CD15. The immunoglobulin heavy- and κ light-chain genes were rearranged. The karyotype was of the triploid range. Southern blotting using the EBV terminal repeat probe detected 3 hybridizing bands that were identical to those of the parental HL material. The cells expressed EBV-encoded RNAs as well as latent genes (EBNA1, EBNA2, LMP1, and LMP2A) and lytic genes (BZLF1 and BALF2). Fluorescence in situ hybridization (FISH) with the cosmid pJB8 clone containing a fragment of EBV DNA as a probe revealed multiple hybridization signals at a marker chromosome. Additional FISH using whole chromosome painting and centromere probes in combination with multicolor FISH determined that multiple EBV copies were clustered within the chromosome 20 materials of the marker chromosome. Culture supernatants of AM-HLH contained IL-10 as measured by the bead-based immunoassay. It is possible that an integrated EBV genome and cellular genes on chromosome 20 were coamplified, leading to the enhanced expression of genes involved in cell growth control. The AM-HLH cell line will be useful to clarify the role of cytokines in the development of EBV + HL. Copyright © 2016 John Wiley & Sons, Ltd.

Epstein-Barr virus-positive gastric cancer: a distinct molecular subtype of the disease?

PubMed

Jácome, Alexandre Andrade Dos Anjos; Lima, Enaldo Melo de; Kazzi, Ana Izabela; Chaves, Gabriela Freitas; Mendonça, Diego Cavalheiro de; Maciel, Marina Mara; Santos, José Sebastião Dos

2016-04-01

Approximately 90% of the world population is infected by Epstein-Barr virus (EBV). Usually, it infects B lymphocytes, predisposing them to malignant transformation. Infection of epithelial cells occurs rarely, and it is estimated that about to 10% of gastric cancer patients harbor EBV in their malignant cells. Given that gastric cancer is the third leading cause of cancer-related mortality worldwide, with a global annual incidence of over 950,000 cases, EBV-positive gastric cancer is the largest group of EBV-associated malignancies. Based on gene expression profile studies, gastric cancer was recently categorized into four subtypes; EBV-positive, microsatellite unstable, genomically stable and chromosomal instability. Together with previous studies, this report provided a more detailed molecular characterization of gastric cancer, demonstrating that EBV-positive gastric cancer is a distinct molecular subtype of the disease, with unique genetic and epigenetic abnormalities, reflected in a specific phenotype. The recognition of characteristic molecular alterations in gastric cancer allows the identification of molecular pathways involved in cell proliferation and survival, with the potential to identify therapeutic targets. These findings highlight the enormous heterogeneity of gastric cancer, and the complex interplay between genetic and epigenetic alterations in the disease, and provide a roadmap to implementation of genome-guided personalized therapy in gastric cancer. The present review discusses the initial studies describing EBV-positive gastric cancer as a distinct clinical entity, presents recently described genetic and epigenetic alterations, and considers potential therapeutic insights derived from the recognition of this new molecular subtype of gastric adenocarcinoma.

EBV-driven B-cell lymphoproliferative disorders: from biology, classification and differential diagnosis to clinical management

PubMed Central

Ok, Chi Young; Li, Ling; Young, Ken H

2015-01-01

Epstein–Barr virus (EBV) is a ubiquitous herpesvirus, affecting >90% of the adult population. EBV targets B-lymphocytes and achieves latent infection in a circular episomal form. Different latency patterns are recognized based on latent gene expression pattern. Latent membrane protein-1 (LMP-1) mimics CD40 and, when self-aggregated, provides a proliferation signal via activating the nuclear factor-kappa B, Janus kinase/signal transducer and activator of transcription, phosphoinositide 3-kinase/Akt (PI3K/Akt) and mitogen-activated protein kinase pathways to promote cellular proliferation. LMP-1 also induces BCL-2 to escape from apoptosis and gives a signal for cell cycle progression by enhancing cyclin-dependent kinase 2 and phosphorylation of retinoblastoma (Rb) protein and by inhibiting p16 and p27. LMP-2A blocks the surface immunoglobulin-mediated lytic cycle reactivation. It also activates the Ras/PI3K/Akt pathway and induces Bcl-xL expression to promote B-cell survival. Recent studies have shown that ebv-microRNAs can provide extra signals for cellular proliferation, cell cycle progression and anti-apoptosis. EBV is well known for association with various types of B-lymphocyte, T-lymphocyte, epithelial cell and mesenchymal cell neoplasms. B-cell lymphoproliferative disorders encompass a broad spectrum of diseases, from benign to malignant. Here we review our current understanding of EBV-induced lymphomagenesis and focus on biology, diagnosis and management of EBV-associated B-cell lymphoproliferative disorders. PMID:25613729