School and Community Screening Shows Malawi, Africa, to Have a High Prevalence of Latent Rheumatic Heart Disease.

PubMed

Sims Sanyahumbi, Amy; Sable, Craig A; Beaton, Andrea; Chimalizeni, Yamikani; Guffey, Danielle; Hosseinipour, Mina; Karlsten, Melissa; Kazembe, Peter N; Kennedy, Neil; Minard, Charles G; Penny, Daniel J

2016-12-01

Rheumatic heart disease (RHD) is the largest cardiac cause of morbidity and mortality in the world's youth. Early detection of RHD through echocardiographic screening in asymptomatic children may identify an early stage of disease, when secondary prophylaxis has the greatest chance of stopping disease progression. Latent RHD signifies echocardiographic evidence of RHD with no known history of acute rheumatic fever and no clinical symptoms. Determine the prevalence of latent RHD among children ages 5-16 in Lilongwe, Malawi. This is a cross-sectional study in which children ages 5 through 16 were screened for RHD using echocardiography. Screening was conducted in 3 schools and surrounding communities in the Lilongwe district of Malawi between February and April 2014. Children were diagnosed as having no, borderline, or definite RHD as defined by World Heart Federation criteria. The primary reader completed offline reads of all studies. A second reader reviewed all of the studies diagnosed as RHD, plus a selection of normal studies. A third reader served as tiebreaker for discordant diagnoses. The distribution of results was compared between gender, location, and age categories using Fisher's exact test. The prevalence of latent RHD was 3.4% (95% CI = 2.45, 4.31), with 0.7% definite RHD and 2.7% borderline RHD. There was no significant differences in prevalence between gender (P = .44), site (P = .6), urban vs. peri-urban (P = .75), or age (P = .79). Of those with definite RHD, all were diagnosed because of pathologic mitral regurgitation (MR) and 2 morphologic features of the mitral valve. Of those with borderline RHD, most met the criteria by having pathological MR (92.3%). Malawi has a high rate of latent RHD, which is consistent with other results from sub-Saharan Africa. This study strongly supports the need for a RHD prevention and control program in Malawi. © 2016 Wiley Periodicals, Inc.

Rheumatic Heart Disease in the Twenty-First Century.

PubMed

Woldu, Bethel; Bloomfield, Gerald S

2016-10-01

Rheumatic heart disease (RHD) is a chronic valvular disease resulting after severe or repetitive episodes of acute rheumatic fever (ARF), an autoimmune response to group A Streptococcus infection. RHD has been almost eliminated with improved social and health infrastructure in affluent countries while it remains a neglected disease with major cause of morbidity and mortality in many low- and middle-income countries, and resource-limited regions of high-income countries. Despite our evolving understanding of the pathogenesis of RHD, there have not been any significant advances to prevent or halt progression of disease in recent history. Long-term penicillin-based treatment and surgery remain the backbone of a RHD control program in the absence of an effective vaccine. The advent of echocardiographic screening algorithms has improved the accuracy of diagnosing RHD and has shed light on the enormous burden of disease. Encouragingly, this has led to a rekindled commitment from researchers in the most affected countries to advocate and take bold actions to end this disease of social inequality.

Inferencing Processes after Right Hemisphere Brain Damage: Effects of Contextual Bias

ERIC Educational Resources Information Center

Blake, Margaret Lehman

2009-01-01

Purpose: Comprehension deficits associated with right hemisphere brain damage (RHD) have been attributed to an inability to use context, but there is little direct evidence to support the claim. This study evaluated the effect of varying contextual bias on predictive inferencing by adults with RHD. Method: Fourteen adults with no brain damage…

Analysis of density and epitopes of D antigen on the surface of erythrocytes from DEL phenotypic individuals carrying the RHD1227A allele.

PubMed

Gu, Juan; Sun, An-Yuan; Wang, Xue-Dong; Shao, Chao-Peng; Li, Zheng; Huang, Li-Hua; Pan, Zhao-Lin; Wang, Qing-Ping; Sun, Guang-Ming

2014-04-01

The characteristics of the D antigen are important as they influence the immunogenicity of D variant cells. Several studies on antigenic sites have been reported in normal D positive, weak D and partial D cases, including a comprehensive analysis of DEL types in Caucasians. The aim of this study was to assess D antigen density and epitopes on the erythrocyte surface of Asian type DEL phenotypic individuals carrying the RHD1227A allele in the Chinese population. A total of 154 DEL phenotypic individuals carrying the RHD1227A allele were identified through adsorption and elution tests and polymerase chain reaction analysis with sequence-specific primers in the Chinese population. D antigen density on the erythrocyte surface of these individuals was detected using a flow cytometric method. An erythrocyte sample with known D antigen density was used as a standard. Blood samples from D-negative and D-positive individuals were used as controls. In addition, D antigen epitopes on the erythrocyte surface of DEL individuals carrying the RHD1227A allele were investigated with 18 monoclonal anti-D antibodies specific for different D antigen epitopes. The means of the median fluorescence intensity of D antigen on the erythrocyte membrane surface of D-negative, D-positive and DEL individuals were 2.14±0.25, 193.61±11.43 and 2.45±0.82, respectively. The DEL samples were estimated to have approximately 22 D antigens per cell. The samples from all 154 DEL individuals reacted positively with 18 monoclonal anti-D antibodies specific for different D antigen epitopes. In this study, D antigen density on the erythrocyte surface of DEL individuals carrying the RHD1227A allele was extremely low, there being only very few antigenic molecules per cell, but the D antigen epitopes were grossly complete.

Hypermethylation of brain natriuretic peptide gene is associated with the risk of rheumatic heart disease

PubMed Central

Li, Ni; Zheng, Dawei; Sun, Lebo; Shi, Huoshun; Zhu, Xiuying; Xu, Guodong; Wang, Qinning; Zhu, Caimin

2016-01-01

To investigate the contribution of brain natriuretic peptide (BNP) promoter DNA methylation to the risk of rheumatic heart disease (RHD) and the influence of warfarin anticoagulant therapy on BNP methylation levels for RHD patients after surgery. BNP methylation levels were determined by bisulfite pyrosequencing from plasma samples of RHD patients compared with healthy controls. Several factors influencing the RHD patients were included like age, smoking and cholesterol levels. A fragment of five CG sites (CpG1–5) in the promoter region of BNP gene was measured. BNP gene hypermethylation was found in CpG4 and CpG5 in RHD patients compared with non-RHD controls. A significant difference was also observed between RHD patients with long-term administration of warfarin and RHD patients who had recently undergone an operation. Moreover, single CpG4 and CpG5 analysis revealed a significant increase in methylation levels in men. BNP gene body hypermethylation is associated with the risk of RHD, and also influenced by the warfarin anticoagulant therapy of RHD patients after surgery, which could represent novel and promising targets for therapeutic development. PMID:27920275

An immunological perspective on rheumatic heart disease pathogenesis: more questions than answers.

PubMed

Bright, Philip David; Mayosi, Bongani M; Martin, William John

2016-10-01

Acute rheumatic fever (ARF) and the related rheumatic heart disease (RHD) are autoimmune diseases thought to be triggered by group A streptococcal (GAS) pharyngitis. RHD is a leading cause of mortality in the developing world. The strong epidemiological association between GAS throat infection and ARF is highly suggestive of causation, but does not exclude other infections as contributory. There is good evidence of both humoral and cellular autoreactivity and GAS/self cross-reactivity in established RHD. RHD pathogenesis could feasibly be triggered and driven by humoral and/or cellular molecular cross-reactivity between GAS and host cardiac tissues (molecular mimicry). However, good evidence of humoral pathogenicity is lacking and the specific triggering event for RHD remains unknown. It is likely that the critical immunological events leading to ARF/RHD occur at the point of contact between GAS and the immune system in the throat, strongly implicating the mucosal immune system in RHD pathogenesis. Additionally, there is circumstantial evidence that continued live GAS may play a role in ARF/RHD pathogenesis. We suggest that future avenues for study should include the exclusion of GAS components directly contributing to RHD pathogenesis; large genome-wide association studies of patients with RHD looking for candidate genes involved in RHD pathogenesis; genome-wide association studies of GAS from patients with ARF taken at diagnosis to look for characteristics of rheumatogenic strains; and performing case/control studies of GAS pharyngitis/ARF/patients with RHD, and controls to identify microbiological, immunological and environmental differences to elucidate RHD pathogenesis. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Acute rheumatic fever and rheumatic heart disease--priorities in prevention, diagnosis and management. A report of the CSANZ Indigenous Cardiovascular Health Conference, Alice Springs 2011.

PubMed

Rémond, M G W; Wheaton, G R; Walsh, W F; Prior, D L; Maguire, G P

2012-10-01

Three priority areas in the prevention, diagnosis and management of acute rheumatic fever (ARF) and rheumatic heart disease (RHD) were identified and discussed in detail: 1. Echocardiography and screening/diagnosis of RHD – Given the existing uncertainty it remains premature to advocate for or to incorporate echocardiographic screening for RHD into Australian clinical practice. Further research is currently being undertaken to evaluate the potential for echocardiography screening. 2. Secondary prophylaxis – Secondary prophylaxis (long acting benzathine penicillin injections) must be seen as a priority. Systems-based approaches are necessary with a focus on the development and evaluation of primary health care-based or led strategies incorporating effective health information management systems. Better/novel systems of delivery of prophylactic medications should be investigated. 3. Management of advanced RHD – National centres of excellence for the diagnosis, assessment and surgical management of RHD are required. Early referral for surgical input is necessary with multidisciplinary care and team-based decision making that includes patient, family, and local health providers. There is a need for a national RHD surgical register and research strategy for the assessment, intervention and long-term outcome of surgery and other interventions for RHD. Copyright © 2012 Australian and New Zealand Society of Cardiac and Thoracic Surgeons (ANZSCTS) and the Cardiac Society of Australia and New Zealand (CSANZ). Published by Elsevier B.V. All rights reserved.

Prevention and control of rheumatic heart disease: Overcoming core challenges in resource-poor environments.

PubMed

Dougherty, Scott; Beaton, Andrea; Nascimento, Bruno R; Zühlke, Liesl J; Khorsandi, Maziar; Wilson, Nigel

2018-01-01

Rheumatic heart disease (RHD) has long receded as a significant threat to public health in high-income countries. In low-resource settings, however, the specter of RHD remains unabated, as exemplified by recent data from the Global Burden of Diseases Study. There are many complex reasons for this ongoing global disparity, including inadequate data on disease burden, challenges in effective advocacy, ongoing poverty and inequality, and weak health systems, most of which predominantly affect developing nations. In this review, we discuss how each of these acts as a core challenge in RHD prevention and control. We then examine key lessons learnt from successful control programs in the past and highlight resources that have been developed to help create strong national RHD control programs.

Prevention and control of rheumatic heart disease: Overcoming core challenges in resource-poor environments

PubMed Central

Dougherty, Scott; Beaton, Andrea; Nascimento, Bruno R; Zühlke, Liesl J; Khorsandi, Maziar; Wilson, Nigel

2018-01-01

Rheumatic heart disease (RHD) has long receded as a significant threat to public health in high-income countries. In low-resource settings, however, the specter of RHD remains unabated, as exemplified by recent data from the Global Burden of Diseases Study. There are many complex reasons for this ongoing global disparity, including inadequate data on disease burden, challenges in effective advocacy, ongoing poverty and inequality, and weak health systems, most of which predominantly affect developing nations. In this review, we discuss how each of these acts as a core challenge in RHD prevention and control. We then examine key lessons learnt from successful control programs in the past and highlight resources that have been developed to help create strong national RHD control programs. PMID:29440834

Rheumatic heart disease across the Western Pacific: not just a Pacific Island problem.

PubMed

Abouzeid, Marian; Katzenellenbogen, Judith; Wyber, Rosemary; Watkins, David; Johnson, Timothy David; Carapetis, Jonathan

2017-01-01

Some of the highest recorded rheumatic heart disease (RHD) prevalence and mortality rates are from the World Health Organization's Western Pacific Region (WPR). RHD burden has been well documented in much of the WPR subregion of Oceania, but less is known about RHD outside the Pacific Islands and Australasia. We aimed to review RHD burden in WPR outside Oceania to identify countries with high RHD burden and those with contemporary data gaps. We searched the peer-reviewed literature for English-language primary studies published between 1980 and April 2017 that reported RHD prevalence or mortality in the 13 WPR countries/areas outside Oceania, and Taiwan. We also searched for official government reports and health indicator documents. Results were synthesised narratively and reported stratified by 2015 Human Development Index (HDI) level. 30 peer-reviewed publications fulfilling inclusion criteria were identified, representing nine countries/areas. RHD prevalence and mortality have fallen in association with economic development, particularly in very high HDI countries. In several countries that have undergone recent economic development, RHD persists particularly among older populations. In poorer WPR countries there is a persistent RHD burden, including in young populations. Some countries had no available data. Although RHD burden has declined in many high-resource settings across the WPR, in several poorer countries, the impact of RHD appears to continue. Elsewhere, insufficient contemporary data make it difficult to gauge the current status of RHD burden and control. Concerted efforts are needed to fill information gaps and implement action to address this avoidable disease.

World Heart Federation criteria for echocardiographic diagnosis of rheumatic heart disease--an evidence-based guideline.

PubMed

Reményi, Bo; Wilson, Nigel; Steer, Andrew; Ferreira, Beatriz; Kado, Joseph; Kumar, Krishna; Lawrenson, John; Maguire, Graeme; Marijon, Eloi; Mirabel, Mariana; Mocumbi, Ana Olga; Mota, Cleonice; Paar, John; Saxena, Anita; Scheel, Janet; Stirling, John; Viali, Satupaitea; Balekundri, Vijayalakshmi I; Wheaton, Gavin; Zühlke, Liesl; Carapetis, Jonathan

2012-02-28

Over the past 5 years, the advent of echocardiographic screening for rheumatic heart disease (RHD) has revealed a higher RHD burden than previously thought. In light of this global experience, the development of new international echocardiographic guidelines that address the full spectrum of the rheumatic disease process is opportune. Systematic differences in the reporting of and diagnostic approach to RHD exist, reflecting differences in local experience and disease patterns. The World Heart Federation echocardiographic criteria for RHD have, therefore, been developed and are formulated on the basis of the best available evidence. Three categories are defined on the basis of assessment by 2D, continuous-wave, and color-Doppler echocardiography: 'definite RHD', 'borderline RHD', and 'normal'. Four subcategories of 'definite RHD' and three subcategories of 'borderline RHD' exist, to reflect the various disease patterns. The morphological features of RHD and the criteria for pathological mitral and aortic regurgitation are also defined. The criteria are modified for those aged over 20 years on the basis of the available evidence. The standardized criteria aim to permit rapid and consistent identification of individuals with RHD without a clear history of acute rheumatic fever and hence allow enrollment into secondary prophylaxis programs. However, important unanswered questions remain about the importance of subclinical disease (borderline or definite RHD on echocardiography without a clinical pathological murmur), and about the practicalities of implementing screening programs. These standardized criteria will help enable new studies to be designed to evaluate the role of echocardiographic screening in RHD control.

Role of Natural Autoantibodies in Ugandans With Rheumatic Heart Disease and HIV☆

PubMed Central

Huck, Daniel M.; Okello, Emmy; Mirembe, Grace; Ssinabulya, Isaac; Zidar, David A.; Silverman, Gregg J.; Getu, Lelise; Nowacki, Amy S.; Calabrese, Leonard H.; Salata, Robert A.; Longenecker, Chris T.

2016-01-01

Background Rheumatic heart disease (RHD) and HIV are prevalent diseases in sub-Saharan Africa, but little is known about their potential interrelationships. The objective of this study was to assess the prevalence of protective natural autoantibodies among patients with RHD in Uganda, and to determine whether the levels of these autoantibodies are affected by HIV status. Methods Participants were grouped according to RHD and HIV status. The three control groups (RHD − HIV −, RHD − HIV +, RHD + HIV −) were age-matched to the RHD + HIV + participants. All participants underwent HIV testing and echocardiography to evaluate for RHD. Natural autoantibody levels reactive with phosphorylcholine (PC) and malondialdehyde (MDA) were measured. Findings We enrolled 220 participants; 21 with both RHD and HIV. Ages ranged from 10 to 60 years, with female predominance (144/220, 65%). After adjusting for age and gender, HIV infection and RHD were each associated with low IgM anti-PC (HIV: p < 0.0001 and RHD: p = 0.01). A distinct HIV ∗ RHD interaction was identified (p = 0.045) with increased IgG anti-MDA levels in HIV infected subjects without RHD, whereas IgG anti-MDA levels were decreased in HIV infected subjects with RHD. Interpretation We found that HIV and RHD are associated with alterations in natural autoantibody responses previously linked to an increased risk for atherosclerosis and autoimmune inflammatory disease. PMID:27077123

Weak D caused by a founder deletion in the RHD gene.

PubMed

Fichou, Yann; Chen, Jian-Min; Le Maréchal, Cédric; Jamet, Déborah; Dupont, Isabelle; Chuteau, Claude; Durousseau, Cécile; Loirat, Marie-Jeanne; Bailly, Pascal; Férec, Claude

2012-11-01

The RhD blood group system exemplifies a genotype-phenotype correlation by virtue of its highly polymorphic and immunogenic nature. Weak D phenotypes are generally thought to result from missense mutations leading to quantitative change of the D antigen in the red blood cell membrane or intracellularly. Different sets of polymerase chain reaction primers were designed to map and clone a deletion involving RHD Exon 10, which was found in approximately 3% of approximately 2000 RHD hemizygous subjects with D phenotype ambiguity. D antigen density was measured by flow cytometry. Transcript analysis was carried out by 3'-rapid amplification of complementary DNA ends. Haplotype analysis was performed by microsatellite genotyping. A 5405-bp deletion that removed nearly two-thirds of Intron 9 and almost all of Exon 10 of the RHD gene was characterized. It is predicted to result in the replacement of the last eight amino acids of the wild-type RhD protein by another four amino acids. The mean RhD antigen density from two deletion carriers was determined to be only 30. A consensus haplotype could be deduced from the deletion carriers based on the microsatellite genotyping data. The currently reported deletion was derived from a common founder. This deletion appears to represent not only the first large deletion associated with weak D but also the weakest of weak D alleles so far reported. This highly unusual genotype-phenotype relationship may be attributable to the additive effect of three distinct mechanisms that affect mRNA formation, mRNA stability, and RhD/ankyrin-R interaction, respectively. © 2012 American Association of Blood Banks.

Rheumatic heart disease in a developing country: Incidence and trend (Monastir; Tunisia: 2000-2013).

PubMed

Sriha Belguith, Asma; Koubaa Abdelkafi, Afifa; El Mhamdi, Sana; Ben Fredj, Manel; Abroug, Hela; Ben Salah, Arwa; Bouanene, Inès; Hassine, Fahima; Amara, Amal; Bhiri, Sana; Derbel, Abdelkarim; Gamra, Habib; Maatouk, Faouzi; Soltani, Mohamed Soussi

2017-02-01

The penicillin therapy of β hemolytic streptococcal pharyngitis has aided in the decrease of rheumatic heart disease (RHD) in developing countries. Tunisia is an endemic area, however, and incidence of RHD is weakly documented. We aimed at establishing the standardized incidence rate (SIR) of RHD in Monastir governorate and at determining RHD prevalence among hospitalized patients in two cardiology departments. From the regional register of Monastir Hospital morbidity, we have selected newly diagnosed patients with RHD, residents of Monastir, and hospitalized to the 2 cardiology departments between 2000 and 2013 (2001 not included). We studied 676 newly admitted patients. We estimate 1060 to be the number of new annual RHD cases in Tunisia. The SIR per 10 5 person-years was 10.97, being 9.3 in men and 19.1 in women, respectively. We have notified a negative trend of crude incidence rate/10 5 Inhabitants (Inh) (CIR) (r=-0.23, p<10 -3 ), and a strong positive correlation between age and CIR/10 5 Inh (r=0.989, p<10 -4 ). RHD lethality was 1%. We have registered 728 hospitalizations for RHD, representing 2.5% of all cardiology hospitalizations [95% CI: 2.3-2.7%], with a prevalence for 13.3% for women aged 15-29years. The median hospital stay was 9days (IQR: 5-15). Our results confirm the RHD incidence decrease, consistent with epidemiological transition in Tunisia. We have also emphasized on the close trend of RHD with age and the predominance of RHD among women especially at the procreation age. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Pre-Analytical Conditions in Non-Invasive Prenatal Testing of Cell-Free Fetal RHD

PubMed Central

Rieneck, Klaus; Krog, Grethe Risum; Nielsen, Leif Kofoed; Tabor, Ann; Dziegiel, Morten Hanefeld

2013-01-01

Background Non-invasive prenatal testing of cell-free fetal DNA (cffDNA) in maternal plasma can predict the fetal RhD type in D negative pregnant women. In Denmark, routine antenatal screening for the fetal RhD gene (RHD) directs the administration of antenatal anti-D prophylaxis only to women who carry an RhD positive fetus. Prophylaxis reduces the risk of immunization that may lead to hemolytic disease of the fetus and the newborn. The reliability of predicting the fetal RhD type depends on pre-analytical factors and assay sensitivity. We evaluated the testing setup in the Capital Region of Denmark, based on data from routine antenatal RHD screening. Methods Blood samples were drawn at gestational age 25 weeks. DNA extracted from 1 mL of plasma was analyzed for fetal RHD using a duplex method for exon 7/10. We investigated the effect of blood sample transportation time (n = 110) and ambient outdoor temperatures (n = 1539) on the levels of cffDNA and total DNA. We compared two different quantification methods, the delta Ct method and a universal standard curve. PCR pipetting was compared on two systems (n = 104). Results The cffDNA level was unaffected by blood sample transportation for up to 9 days and by ambient outdoor temperatures ranging from -10°C to 28°C during transport. The universal standard curve was applicable for cffDNA quantification. Identical levels of cffDNA were observed using the two automated PCR pipetting systems. We detected a mean of 100 fetal DNA copies/mL at a median gestational age of 25 weeks (range 10–39, n = 1317). Conclusion The setup for real-time PCR-based, non-invasive prenatal testing of cffDNA in the Capital Region of Denmark is very robust. Our findings regarding the transportation of blood samples demonstrate the high stability of cffDNA. The applicability of a universal standard curve facilitates easy cffDNA quantification. PMID:24204719

Pre-analytical conditions in non-invasive prenatal testing of cell-free fetal RHD.

PubMed

Clausen, Frederik Banch; Jakobsen, Tanja Roien; Rieneck, Klaus; Krog, Grethe Risum; Nielsen, Leif Kofoed; Tabor, Ann; Dziegiel, Morten Hanefeld

2013-01-01

Non-invasive prenatal testing of cell-free fetal DNA (cffDNA) in maternal plasma can predict the fetal RhD type in D negative pregnant women. In Denmark, routine antenatal screening for the fetal RhD gene (RHD) directs the administration of antenatal anti-D prophylaxis only to women who carry an RhD positive fetus. Prophylaxis reduces the risk of immunization that may lead to hemolytic disease of the fetus and the newborn. The reliability of predicting the fetal RhD type depends on pre-analytical factors and assay sensitivity. We evaluated the testing setup in the Capital Region of Denmark, based on data from routine antenatal RHD screening. Blood samples were drawn at gestational age 25 weeks. DNA extracted from 1 mL of plasma was analyzed for fetal RHD using a duplex method for exon 7/10. We investigated the effect of blood sample transportation time (n = 110) and ambient outdoor temperatures (n = 1539) on the levels of cffDNA and total DNA. We compared two different quantification methods, the delta Ct method and a universal standard curve. PCR pipetting was compared on two systems (n = 104). The cffDNA level was unaffected by blood sample transportation for up to 9 days and by ambient outdoor temperatures ranging from -10 °C to 28 °C during transport. The universal standard curve was applicable for cffDNA quantification. Identical levels of cffDNA were observed using the two automated PCR pipetting systems. We detected a mean of 100 fetal DNA copies/mL at a median gestational age of 25 weeks (range 10-39, n = 1317). The setup for real-time PCR-based, non-invasive prenatal testing of cffDNA in the Capital Region of Denmark is very robust. Our findings regarding the transportation of blood samples demonstrate the high stability of cffDNA. The applicability of a universal standard curve facilitates easy cffDNA quantification.

The WHF Roadmap for Reducing CV Morbidity and Mortality Through Prevention and Control of RHD.

PubMed

Palafox, Benjamin; Mocumbi, Ana Olga; Kumar, R Krishna; Ali, Sulafa K M; Kennedy, Elizabeth; Haileamlak, Abraham; Watkins, David; Petricca, Kadia; Wyber, Rosemary; Timeon, Patrick; Mwangi, Jeremiah

2017-03-01

Rheumatic heart disease (RHD) is a preventable non-communicable condition that disproportionately affects the world's poorest and most vulnerable. The World Heart Federation Roadmap for improved RHD control is a resource designed to help a variety of stakeholders raise the profile of RHD nationally and globally, and provide a framework to guide and support the strengthening of national, regional and global RHD control efforts. The Roadmap identifies the barriers that limit access to and uptake of proven interventions for the prevention and control of RHD. It also highlights a variety of established and promising solutions that may be used to overcome these barriers. As a general guide, the Roadmap is meant to serve as the foundation for the development of tailored plans of action to improve RHD control in specific contexts. Copyright © 2016 World Heart Federation (Geneva). Published by Elsevier B.V. All rights reserved.

Rheumatic heart disease: infectious disease origin, chronic care approach.

PubMed

Katzenellenbogen, Judith M; Ralph, Anna P; Wyber, Rosemary; Carapetis, Jonathan R

2017-11-29

Rheumatic heart disease (RHD) is a chronic cardiac condition with an infectious aetiology, causing high disease burden in low-income settings. Affected individuals are young and associated morbidity is high. However, RHD is relatively neglected due to the populations involved and its lower incidence relative to other heart diseases. In this narrative review, we describe how RHD care can be informed by and integrated with models of care developed for priority non-communicable diseases (coronary heart disease), and high-burden communicable diseases (tuberculosis). Examining the four-level prevention model (primordial through tertiary prevention) suggests primordial and primary prevention of RHD can leverage off existing tuberculosis control efforts, given shared risk factors. Successes in coronary heart disease control provide inspiration for similarly bold initiatives for RHD. Further, we illustrate how the Chronic Care Model (CCM), developed for use in non-communicable diseases, offers a relevant framework to approach RHD care. Systems strengthening through greater integration of services can improve RHD programs. Strengthening of systems through integration/linkages with other well-performing and resourced services in conjunction with policies to adopt the CCM framework for the secondary and tertiary prevention of RHD in settings with limited resources, has the potential to significantly reduce the burden of RHD globally. More research is required to provide evidence-based recommendations for policy and service design.

Outcomes of borderline rheumatic heart disease: A prospective cohort study.

PubMed

Bertaina, Geneviève; Rouchon, Bernard; Huon, Bertrand; Guillot, Nina; Robillard, Corinne; Noël, Baptiste; Nadra, Marie; Tribouilloy, Christophe; Marijon, Eloi; Jouven, Xavier; Mirabel, Mariana

2017-02-01

The advent of systematic screening for rheumatic heart disease (RHD) by echocardiography in endemic regions has led to a new entity: borderline RHD. The pathogenicity and natural history of borderline RHD needs to be addressed. The aim of this study was to assess the outcomes of children detected by echocardiography as having borderline RHD. Schoolchildren in 4th grade (i.e., aged 9-10years) who were prospectively echo-screened for RHD (2012-2014) in Nouméa, New Caledonia, were asked to participate. Children with borderline RHD according to consistent independent review by two cardiologists were included and followed-up in 2015. Among the 8684 schoolchildren screened, 49 were diagnosed with borderline RHD according to the Cardiologist clinically involved in the child's management plan. After independent review by two cardiologists, 25 children were consistently diagnosed with borderline RHD and included in the follow-up study. Overall, inter-observer agreement was moderate with diagnostic kappa values of 0.63 (95% CI 0.45-0.78). After a median follow-up of 23months (IQR (20.5-33.0), 15 children (60.0%) had stability of valvular lesions, 8 (32.0%) had normal findings according to the WHF criteria. Two children (8.0%) had definite RHD on the follow-up echocardiogram, but no clinical events or audible pathological murmur during the study period. No factor could be identified as prognostic of either stability or progression. Borderline RHD diagnosed by systematic screening in high-risk populations remains mostly unchanged at 2years follow-up. Diagnosis of borderline RHD may require two reviewers for consistency. Copyright © 2016. Published by Elsevier Ireland Ltd.

Imageability effects on sentence judgement by right-brain-damaged adults

PubMed Central

Lederer, Lisa Guttentag; Scott, April Gibbs; Tompkins, Connie A.; Dickey, Michael W.

2009-01-01

Background For decades researchers assumed visual image generation was the province of the right hemisphere. The lack of corresponding evidence was only recently noted, yet conflicting results still leave open the possibility that the right hemisphere plays a role. This study assessed imagery generation in adult participants with and without right hemisphere damage (RHD). Imagery was operationalised as the activation of representations retrieved from long-term memory similar to those that underlie sensory experience, in the absence of the usual sensory stimulation, and in the presence of communicative stimuli. Aims The primary aim of the study was to explore the widely held belief that there is an association between the right hemisphere and imagery generation ability. We also investigated whether visual and visuo-motor imagery generation abilities differ in adults with RHD. Methods & Procedures Participants included 34 adults with unilateral RHD due to cerebrovascular accident and 38 adults who served as non-brain-damaged (NBD) controls. To assess the potential effects of RHD on the processing of language stimuli that differ in imageability, participants performed an auditory sentence verification task. Participants listened to high- and low-imageability sentences from Eddy and Glass (1981) and indicated whether each sentence was true or false. The dependent measures for this task were performance accuracy and response times (RT). Outcomes & Results In general, accuracy was higher, and response time lower, for low-imagery than for high-imagery items. Although NBD participants’ RTs for low-imagery items were significantly faster than those for high-imagery items, this difference disappeared in the group with RHD. We confirmed that this result was not due to a speed–accuracy trade-off or to syntactic differences between stimulus sets. A post hoc analysis also suggested that the group with RHD was selectively impaired in motor, rather than visual, imagery generation. Conclusions The disproportionately high RT of participants with RHD in response to low-imagery items suggests that these items had other properties that made their verification difficult for this population. The nature and extent of right hemisphere patients’ deficits in processing different types of imagery should be considered. In addition, the capacity of adults with RHD to generate visual and motor imagery should be investigated separately in future studies. PMID:20054429

Improvement in rheumatic fever and rheumatic heart disease management and prevention using a health centre-based continuous quality improvement approach.

PubMed

Ralph, Anna P; Fittock, Marea; Schultz, Rosalie; Thompson, Dale; Dowden, Michelle; Clemens, Tom; Parnaby, Matthew G; Clark, Michele; McDonald, Malcolm I; Edwards, Keith N; Carapetis, Jonathan R; Bailie, Ross S

2013-12-18

Rheumatic heart disease (RHD) remains a major health concern for Aboriginal Australians. A key component of RHD control is prevention of recurrent acute rheumatic fever (ARF) using long-term secondary prophylaxis with intramuscular benzathine penicillin (BPG). This is the most important and cost-effective step in RHD control. However, there are significant challenges to effective implementation of secondary prophylaxis programs. This project aimed to increase understanding and improve quality of RHD care through development and implementation of a continuous quality improvement (CQI) strategy. We used a CQI strategy to promote implementation of national best-practice ARF/RHD management guidelines at primary health care level in Indigenous communities of the Northern Territory (NT), Australia, 2008-2010. Participatory action research methods were employed to identify system barriers to delivery of high quality care. This entailed facilitated discussion with primary care staff aided by a system assessment tool (SAT). Participants were encouraged to develop and implement strategies to overcome identified barriers, including better record-keeping, triage systems and strategies for patient follow-up. To assess performance, clinical records were audited at baseline, then annually for two years. Key performance indicators included proportion of people receiving adequate secondary prophylaxis (≥80% of scheduled 4-weekly penicillin injections) and quality of documentation. Six health centres participated, servicing approximately 154 people with ARF/RHD. Improvements occurred in indicators of service delivery including proportion of people receiving ≥40% of their scheduled BPG (increasing from 81/116 [70%] at baseline to 84/103 [82%] in year three, p = 0.04), proportion of people reviewed by a doctor within the past two years (112/154 [73%] and 134/156 [86%], p = 0.003), and proportion of people who received influenza vaccination (57/154 [37%] to 86/156 [55%], p = 0.001). However, the proportion receiving ≥80% of scheduled BPG did not change. Documentation in medical files improved: ARF episode documentation increased from 31/55 (56%) to 50/62 (81%) (p = 0.004), and RHD risk category documentation from 87/154 (56%) to 103/145 (76%) (p < 0.001). Large differences in performance were noted between health centres, reflected to some extent in SAT scores. A CQI process using a systems approach and participatory action research methodology can significantly improve delivery of ARF/RHD care.

SIX2 and BMP4 mutations associate with anomalous kidney development.

PubMed

Weber, Stefanie; Taylor, Jaclyn C; Winyard, Paul; Baker, Kari F; Sullivan-Brown, Jessica; Schild, Raphael; Knüppel, Tanja; Zurowska, Aleksandra M; Caldas-Alfonso, Alberto; Litwin, Mieczyslaw; Emre, Sevinc; Ghiggeri, Gian Marco; Bakkaloglu, Aysin; Mehls, Otto; Antignac, Corinne; Network, Escape; Schaefer, Franz; Burdine, Rebecca D

2008-05-01

Renal hypodysplasia (RHD) is characterized by reduced kidney size and/or maldevelopment of the renal tissue following abnormal organogenesis. Mutations in renal developmental genes have been identified in a subset of affected individuals. Here, we report the first mutations in BMP4 and SIX2 identified in patients with RHD. We detected 3 BMP4 mutations in 5 RHD patients, and 3 SIX2 mutations in 5 different RHD patients. Overexpression assays in zebrafish demonstrated that these mutations affect the function of Bmp4 and Six2 in vivo. Overexpression of zebrafish six2.1 and bmp4 resulted in dorsalization and ventralization, respectively, suggesting opposing roles in mesendoderm formation. When mutant constructs containing the identified human mutations were overexpressed instead, these effects were attenuated. Morpholino knockdown of bmp4 and six2.1 affected glomerulogenesis, suggesting specific roles for these genes in the formation of the pronephros. In summary, these studies implicate conserved roles for Six2 and Bmp4 in the development of the renal system. Defects in these proteins could affect kidney development at multiple stages, leading to the congenital anomalies observed in patients with RHD.

Rhesus factor modulation of effects of smoking and age on psychomotor performance, intelligence, personality profile, and health in Czech soldiers.

PubMed

Flegr, Jaroslav; Geryk, Jan; Volný, Jindra; Klose, Jiří; Cernochová, Dana

2012-01-01

Rhesus-positive and rhesus-negative persons differ in the presence-absence of highly immunogenic RhD protein on the erythrocyte membrane. This protein is a component of NH(3) or CO(2) pump whose physiological role is unknown. Several recent studies have shown that RhD positivity protects against effects of latent toxoplasmosis on motor performance and personality. It is not known, however, whether the RhD phenotype modifies exclusively the response of the body to toxoplasmosis or whether it also influences effects of other factors. In the present cohort study, we searched for the effects of age and smoking on performance, intelligence, personality and self-estimated health and wellness in about 3800 draftees. We found that the positive effect of age on performance and intelligence was stronger in RhD-positive soldiers, while the negative effect of smoking on performance and intelligence was of similar size regardless of the RhD phenotype. The effect of age on four Cattell's personality factors, i.e., dominance (E), radicalism (Q(1)), self-sentiment integration (Q(3)), and ergic tension (Q(4)), and on Cloninger's factor reward dependency (RD) was stronger for RhD-negative than RhD-positive subjects, while the effect of smoking on the number of viral and bacterial diseases was about three times stronger for RhD-negative than RhD-positive subjects. RhD phenotype modulates the influence not only of latent toxoplasmosis, but also of at least two other potentially detrimental factors, age and smoking, on human behavior and physiology. The negative effect of smoking on health (estimated on the basis of the self-rated number of common viral and bacterial diseases in the past year) was much stronger in RhD-negative than RhD-positive subjects. It is critically needed to confirm the differences in health response to smoking between RhD-positive and RhD-negative subjects by objective medical examination in future studies.

Ethical Review as a Tool for Enhancing Postgraduate Supervision and Research Outcomes in the Creative Arts

ERIC Educational Resources Information Center

Romano, Angela

2016-01-01

This article outlines the potential for Research Higher Degree (RHD) supervisors at universities and similar institutions to use ethical review as a constructive, dynamic tool in guiding RHD students in the timely completion of effective, innovative research projects. Ethical review involves a bureaucratized process for checking that researchers…

Sensitivity of fetal RHD screening for safe guidance of targeted anti-D immunoglobulin prophylaxis: prospective cohort study of a nationwide programme in the Netherlands.

PubMed

de Haas, Masja; Thurik, Florentine F; van der Ploeg, Catharina P B; Veldhuisen, Barbera; Hirschberg, Hoang; Soussan, Aicha Ait; Woortmeijer, Heleen; Abbink, Frithjofna; Page-Christiaens, Godelieve C M L; Scheffer, Peter G; Ellen van der Schoot, C

2016-11-07

 To determine the accuracy of non-invasive fetal testing for the RHD gene in week 27 of pregnancy as part of an antenatal screening programme to restrict anti-D immunoglobulin use to women carrying a child positive for RHD DESIGN:  Prospectively monitoring of fetal RHD testing accuracy compared with serological cord blood typing on introduction of the test. Fetal RHD testing was performed with a duplex real time quantitative polymerase chain reaction, with cell-free fetal DNA isolated from 1 mL of maternal plasma The study period was between 4 July 2011 and 7 October 2012. The proportion of women participating in screening was determined.  Nationwide screening programme, the Netherlands. Tests are performed in a centralised setting.  25 789 RhD negative pregnant women.  Sensitivity, specificity, false negative rate, and false positive rate of fetal RHD testing compared with serological cord blood typing; proportion of technical failures; and compliance to the screening programme.  A fetal RHD test result and serological cord blood result were available for 25 789 pregnancies. Sensitivity for detection of fetal RHD was 99.94% (95% confidence interval 99.89% to 99.97%) and specificity was 97.74% (97.43% to 98.02%). Nine false negative results for fetal RHD testing were registered (0.03%, 95% confidence interval 0.01% to 0.06%). In two cases these were due to technical failures. False positive fetal RHD testing results were registered for 225 samples (0.87%, 0.76% to 0.99%). Weak RhD expression was shown in 22 of these cases, justifying anti-D immunoglobulin use. The negative and positive predictive values were 99.91% (95% confidence interval 99.82% to 99.95%) and 98.60% (98.40% to 98.77%), respectively. More than 98% of the women participated in the screening programme.  Fetal RHD testing in week 27 of pregnancy as part of a national antenatal screening programme is highly reliable and can be used to target both antenatal and postnatal anti-D immunoglobulin use. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Clinical outcomes for young people with screening-detected and clinically-diagnosed rheumatic heart disease in Fiji.

PubMed

Engelman, Daniel; Mataika, Reapi L; Ah Kee, Maureen; Donath, Susan; Parks, Tom; Colquhoun, Samantha M; Carapetis, Jonathan R; Kado, Joseph H; Steer, Andrew C

2017-08-01

Echocardiographic screening is under consideration as a disease control strategy for rheumatic heart disease (RHD). However, clinical outcomes of young people with screening-detected RHD are unknown. We aimed to describe the outcomes for a cohort with screening-detected RHD, in comparison to patients with clinically-diagnosed RHD. A retrospective cohort study included all young people with screening-detected RHD in the Central Division of Fiji in the primary cohort. Screen-negative and clinically-diagnosed comparison groups were matched 1:1 to the primary cohort. Data were collected on mortality, clinical complications and healthcare utilisation from the electronic and paper health records and existing databases. Seventy participants were included in each group. Demographic characteristics of the groups were similar (median age 11years, 69% female, median follow-up 7years). There were nine (12.9%) RHD-related deaths in the clinically-diagnosed group and one (1.4%) in the screening-detected group (Incident Rate Ratio: 9.6, 95% CI 1.3-420.6). Complications of RHD were observed in 39 (55.7%) clinically-diagnosed cases, four (20%) screening-detected cases and one (1.4%) screen-negative case. There were significant differences in the cumulative complication curves of the groups (p<0.001). Rates of admission and surgery were highest in the clinically-diagnosed group, and higher in the screening-detected than screen-negative group. Young people with screening-detected RHD have worse health outcomes than screen-negative cases in Fiji. The prognosis of clinically-diagnosed RHD remains poor, with very high mortality and complication rates. Further studies in other settings will inform RHD screening policy. Comprehensive control strategies are required for disease prevention. Copyright © 2017 Elsevier B.V. All rights reserved.

Variability in disease burden and management of rheumatic fever and rheumatic heart disease in two regions of tropical Australia.

PubMed

Rémond, M G W; Severin, K L; Hodder, Y; Martin, J; Nelson, C; Atkinson, D; Maguire, G P

2013-04-01

Acute rheumatic fever (ARF) and rheumatic heart disease (RHD) contribute to Aboriginal Australian and Torres Strait Islander health disadvantage. At the time of this study, specialist ARF/RHD care in the Kimberley region of Western Australia was delivered by a broad range of providers. In contrast, in Far North Queensland (FNQ), a single-provider model was used as part of a coordinated RHD control programme. To review ARF/RHD management in the Kimberley and FNQ to ascertain whether differing models of service delivery are associated with different disease burden and patient care. An audit of ARF/RHD management. Classification and clinical management data were abstracted from health records, specialist letters, echocardiograms and regional registers using a standardised data collection tool. Four hundred and seven patients were identified, with 99% being Aboriginal and/or Torres Strait Islanders. ARF without RHD was seen in 0.4% of Aboriginal and/or Torres Strait Islander residents and RHD in 1.1%. The prevalence of RHD was similar in both regions but with more severe disease in the Kimberley. More FNQ RHD patients had specialist review within recommended time frames (67% vs 45%, χ(2) , P < 0.001). Of patients recommended benzathine penicillin secondary prophylaxis, 17.7% received ≥80% of scheduled doses in the preceding 12 months. Prescription and delivery of secondary prophylaxis was greater in FNQ. FNQ's single-provider model of specialist care and centralised RHD control programme were associated with improved patient care and may partly account for the fewer cases of severe disease and reduced surgical procedures and other interventions observed in this region. © 2012 The Authors; Internal Medicine Journal © 2012 Royal Australasian College of Physicians.

Molecular biology of Group A Streptococcus and its implications in vaccine strategies.

PubMed

Brahmadathan, N K

2017-01-01

Infections due to Streptococcus pyogenes and their complications are a problem of major concern in many countries, including India. Primary prophylaxis with benzathine penicillin is the key to control and prevent sequelae such as acute rheumatic fever and rheumatic heart disease (RF/RHD) or post-streptococcal glomerulonephritis (PSGN). Non-compliance to prophylaxis due to fear of injection and anaphylaxis is major issues in RF/RHD control in India and leads to continued high prevalence of infection and post-streptococcal sequelae. Differing reports on the efficacy of two weekly, three weekly or monthly injections raise questions on the actual dosages to be administered. Availability of more effective antibiotics with better dosages has replaced the use of penicillin; hence, companies are reluctant to manufacture penicillin preparations in India. It is in this context that a concept of a Group A streptococci vaccine is looked at and whether or not a globally designed vaccine will be useful in the Indian context. Modern molecular techniques and genomic analysis of S. pyogenes have identified many molecules as vaccine candidates among which the M-protein has attracted the most attention. High diversity of M (emm) types in endemic regions raises questions about the efficacy of such a vaccine. A recent 30-valent M-protein-based vaccine that elicits antibodies to homologous as well as non-vaccine M types looks promising. This review will discuss the genomics of S. pyogenes, the various candidate vaccine molecules and highlight their efficacy in the Indian context where control of post-streptococcal sequelae remains a challenge.

Production of Korean Idiomatic Utterances Following Left- and Right-Hemisphere Damage: Acoustic Studies

ERIC Educational Resources Information Center

Yang, Seung-yun; Van Lancker Sidtis, Diana

2016-01-01

Purpose: This study investigates the effects of left- and right-hemisphere damage (LHD and RHD) on the production of idiomatic or literal expressions utilizing acoustic analyses. Method: Twenty-one native speakers of Korean with LHD or RHD and in a healthy control (HC) group produced 6 ditropically ambiguous (idiomatic or literal) sentences in 2…

Improvement in rheumatic fever and rheumatic heart disease management and prevention using a health centre-based continuous quality improvement approach

PubMed Central

2013-01-01

Background Rheumatic heart disease (RHD) remains a major health concern for Aboriginal Australians. A key component of RHD control is prevention of recurrent acute rheumatic fever (ARF) using long-term secondary prophylaxis with intramuscular benzathine penicillin (BPG). This is the most important and cost-effective step in RHD control. However, there are significant challenges to effective implementation of secondary prophylaxis programs. This project aimed to increase understanding and improve quality of RHD care through development and implementation of a continuous quality improvement (CQI) strategy. Methods We used a CQI strategy to promote implementation of national best-practice ARF/RHD management guidelines at primary health care level in Indigenous communities of the Northern Territory (NT), Australia, 2008–2010. Participatory action research methods were employed to identify system barriers to delivery of high quality care. This entailed facilitated discussion with primary care staff aided by a system assessment tool (SAT). Participants were encouraged to develop and implement strategies to overcome identified barriers, including better record-keeping, triage systems and strategies for patient follow-up. To assess performance, clinical records were audited at baseline, then annually for two years. Key performance indicators included proportion of people receiving adequate secondary prophylaxis (≥80% of scheduled 4-weekly penicillin injections) and quality of documentation. Results Six health centres participated, servicing approximately 154 people with ARF/RHD. Improvements occurred in indicators of service delivery including proportion of people receiving ≥40% of their scheduled BPG (increasing from 81/116 [70%] at baseline to 84/103 [82%] in year three, p = 0.04), proportion of people reviewed by a doctor within the past two years (112/154 [73%] and 134/156 [86%], p = 0.003), and proportion of people who received influenza vaccination (57/154 [37%] to 86/156 [55%], p = 0.001). However, the proportion receiving ≥80% of scheduled BPG did not change. Documentation in medical files improved: ARF episode documentation increased from 31/55 (56%) to 50/62 (81%) (p = 0.004), and RHD risk category documentation from 87/154 (56%) to 103/145 (76%) (p < 0.001). Large differences in performance were noted between health centres, reflected to some extent in SAT scores. Conclusions A CQI process using a systems approach and participatory action research methodology can significantly improve delivery of ARF/RHD care. PMID:24350582

Awareness and distribution of ABO, Rhesus blood groups and haemoglobin phenotypes among medical undergraduates in a Nigerian university.

PubMed

Akingbola, T S; Yuguda, S; Akinyemi, O O; Olomu, S

2016-09-01

In the past two decades the Nigerian government and religious organisations have put more emphasis on knowing the haemoglobin electrophoresis of school children and intending couples respectively. Knowledge of the distribution of blood groups and haemoglobin electrophoretic patterns among young people is vital for the prevention of haemoglobinopathies in the population and for providing effective blood banking services. Therefore, this study was designed to assess the frequency and awareness of blood group and haemoglobinphenotypes among a new set of fourth year clinical medical and dental students of the University of Ibadan, Nigeria. Data, including socio-demographics, self- reported blood group and haemoglobin phenotypes, were obtained from 155 students using a self-administered questionnaire. The ABO, Rhesus (Rh) blood groups and haemoglobin electrophoresis were determined by the tile (slide) technique and cellulose acetate at alkaline phrespectively. Only 43.9% of the participants knew their blood groups while less than a third (29.7%) knew their haemoglobin phenotypes. knowledge of both their blood groups and haemoglobin phenotypes was documented in as low as 20.6% of the respondents. The frequency of haemoglobin AA, AS, AC and. CC were 78.0%, 16.8%, 3.9% and 1.3% respectively. Similarly, the distribution of blood groups were: 0 RhD positive - 47.8%;0 RhD negative- 1.9%;ARhD positive- 21.9%; A RhD negative - 1.3%; B RhD positive - 23.2%; B RhD negative -1.3% and AB RhD positive - 2.6%. No participant was AB RhD negative. Participants who bad previously donated blood and those who were females were more likely to know their blood groups and haemoglobin phenotypes respectively (p<0.05). Awareness of blood groups and haemoglobin phenotypes among the medical and dental students was poor. Documentation and routine screening for haemoglobinphenotypes as well as blood grouping, accompanied by appropriate counseling should be institutionalised in Nigeriantertiary institutions.

Rheumatic Heart Disease in Kerala: A Vanishing Entity? An Echo Doppler Study in 5-15-Years-Old School Children.

PubMed

Nair, Bigesh; Viswanathan, Sunitha; Koshy, A George; Gupta, Prabha Nini; Nair, Namita; Thakkar, Ashok

2015-01-01

Background. Early detection of subclinical rheumatic heart disease by use of echocardiography warrants timely implementation of secondary antibiotic prophylaxis and thereby prevents or retards its related complications. Objectives. The objective of this epidemiological study was to determine prevalence of RHD by echocardiography using World Heart Federation criteria in randomly selected school children of Trivandrum. Methods. This was a population-based cross-sectional screening study carried out in Trivandrum. A total of 2060 school children, 5-15 years, were randomly selected from five government and two private (aided) schools. All enrolled children were screened for RHD according to standard clinical and WHF criteria of echocardiography. Results. Echocardiographic examinations confirmed RHD in 5 children out of 146 clinically suspected cases. Thus, clinical prevalence was found to be 2.4 per 1000. According to WHF criteria of echocardiography, 12 children (12/2060) were diagnosed with RHD corresponding to echocardiographic prevalence of 5.83 cases per 1000. As per criteria, 6 children were diagnosed with definite RHD and 6 with borderline RHD. Conclusions. The results of the current study demonstrate that echocardiography is more sensitive and feasible in detecting clinically silent RHD. Our study, the largest school survey of south India till date, points towards declining prevalence of RHD (5.83/1000 cases) using WHF criteria in Kerala.

Frequencies and ethnic distribution of ABO and RhD blood groups in China: a population-based cross-sectional study.

PubMed

Liu, Jue; Zhang, Shikun; Wang, Qiaomei; Shen, Haiping; Zhang, Yiping; Liu, Min

2017-12-03

ABO and RhD blood groups are key factors affecting blood transfusion safety. The distribution of ABO and RhD blood groups varies globally, but limited data exist for ethnic distributions of these blood groups in Asian populations. We aimed to evaluate the distribution of ABO and RhD blood groups among Chinese ethnic groups. A population-based cross-sectional study. Data on ABO groups and ethnicities were obtained from the National Free Preconception Health Examination Project (NFPHEP) with participants from 220 counties of 31 provinces in China PARTICIPANTS: There were 3 832 034 participants aged 21-49 years who took part in the NFPHEP from January 2010 to December 2012 and were included in this study. The proportion of ABO and RhD blood groups among different ethnic groups was calculated. ABO and RhD blood distribution was significantly different among nine ethnic groups (P<0.001). Compared with other ethnic groups, the Yi group had more A phenotypes (34.0%), and the Manchu (33.7%) and Mongolian (33.3%) ethnic groups had more B phenotypes. The Zhuang group had the greatest proportion of O phenotypes (41.8%), followed by the Miao group (37.7%). AB phenotypes were more frequent in the Uygur ethnic group (10.6%) but lower in the Zhuang group (5.5%). Meanwhile, RhD negativity (RhD-) was greater in the Uygur group (3.3%) than in the Mongolian (0.3%) and Manchu ethnic groups (0.4%). O RhD- blood groups were more frequent in the Uygur group (0.8%) than in the other ethnic groups (0.1%-0.4%, P<0.001). ABO and RhD blood phenotypes vary across different ethnic groups in China. The diversity in the distribution of the ABO and RhD blood groups in different ethnic groups should be considered when developing rational and evidence-based strategies for blood collection and management. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

A review of outcome following valve surgery for rheumatic heart disease in Australia.

PubMed

Russell, E Anne; Tran, Lavinia; Baker, Robert A; Bennetts, Jayme S; Brown, Alex; Reid, Christopher M; Tam, Robert; Walsh, Warren F; Maguire, Graeme P

2015-09-23

Globally, rheumatic heart disease (RHD) remains an important cause of heart disease. In Australia it particularly affects younger Indigenous and older non-Indigenous Australians. Despite its impact there is limited understanding of the factors influencing outcome following surgery for RHD. The Australian and New Zealand Society of Cardiac and Thoracic Surgeons Cardiac Surgery Database was analysed to assess outcomes following surgical procedures for RHD and non-RHD valvular disease. The association with demographics, co-morbidities, pre-operative status, valve(s) affected and operative procedure was evaluated. Outcome of 1384 RHD and 15843 non-RHD valve procedures was analysed. RHD patients had longer ventilation, experienced fewer strokes and had more readmissions to hospital and anticoagulant complications. Mortality following RHD surgery at 30 days was 3.1% (95% CI 2.2 - 4.3), 5 years 15.3% (11.7 - 19.5) and 10 years 25.0% (10.7 - 44.9). Mortality following non-RHD surgery at 30 days was 4.3% (95% CI 3.9 - 4.6), 5 years 17.6% (16.4 - 18.9) and 10 years 39.4% (33.0 - 46.1). Factors independently associated with poorer longer term survival following RHD surgery included older age (OR1.03/additional year, 95% CI 1.01 - 1.05), concomitant diabetes (OR 1.7, 95% CI 1.1 - 2.5) and chronic kidney disease (1.9, 1.2 - 2.9), longer invasive ventilation time (OR 1.7 if greater than median value, 1.1- 2.9) and prolonged stay in hospital (1.02/additional day, 1.01 - 1.03). Survival in Indigenous Australians was comparable to that seen in non-Indigenous Australians. In a large prospective cohort study we have demonstrated survival following RHD valve surgery in Australia is comparable to earlier studies. Patients with diabetes and chronic kidney disease, were at particular risk of poorer long-term survival. Unlike earlier studies we did not find pre-existing atrial fibrillation, being an Indigenous Australian or the nature of the underlying valve lesion were independent predictors of survival.

Echocardiography screening for rheumatic heart disease in Ugandan schoolchildren.

PubMed

Beaton, Andrea; Okello, Emmy; Lwabi, Peter; Mondo, Charles; McCarter, Robert; Sable, Craig

2012-06-26

Historically, sub-Saharan Africa has had the highest prevalence rates of clinically detected rheumatic heart disease (RHD). Echocardiography-based screening improves detection of RHD in endemic regions. The newest screening guidelines (2006 World Health Organization/National Institutes of Health) have been tested across India and the Pacific Islands, but application in sub-Saharan Africa has, thus far, been limited to Mozambique. We used these guidelines to determine RHD prevalence in a large cohort of Ugandan school children, to identify risk factors for occult disease, and to assess the value of laboratory testing. Auscultation and portable echocardiography were used to screen randomly selected schoolchildren, 5 to 16 years of age, in Kampala, Uganda. Disease likelihood was defined as definite, probable, or possible in accordance with the 2006 National Institutes of Health/World Health Organization guidelines. Ninety-seven percent of eligible students received screening (4869 of 5006). Among them, 130 children (2.7%) had abnormal screening echocardiograms. Of those 130, secondary evaluation showed 72 (55.4%) with possible, probable, or definite RHD; 18 (13.8%) with congenital heart disease; and 40 (30.8%) with no disease. Echocardiography detected 3 times as many cases of RHD as auscultation: 72 (1.5%) versus 23 (0.5%; P<0.001). Children with RHD were older (10.1 versus 9.3 years; P=0.002). Most cases (98%) involved only the mitral valve. Lower socioeconomic groups had more RHD (2.7% versus 1.4%; P=0.036) and more advanced disease (64% versus 26%; P<0.001). Antistreptolysin O titers were elevated in children with definite RHD. This is one of the largest single-country childhood RHD prevalence studies and the first to be conducted in sub-Saharan Africa. Our data support inclusion of echocardiography in screening protocols, even in the most resource-constrained settings, and identify lower socioeconomic groups as most vulnerable. Longitudinal follow-up of children with echocardiographically diagnosed subclinical RHD is needed.

Rheumatic heart disease in Indigenous children in northern Australia: differences in prevalence and the challenges of screening.

PubMed

Roberts, Kathryn V; Maguire, Graeme P; Brown, Alex; Atkinson, David N; Remenyi, Bo; Wheaton, Gavin; Ilton, Marcus; Carapetis, Jonathan

2015-09-07

To compare regional differences in the prevalence of rheumatic heart disease (RHD) detected by echocardiographic screening in high-risk Indigenous Australian children, and to describe the logistical and other practical challenges of RHD screening. Cross-sectional screening survey performed between September 2008 and November 2010. Thirty-two remote communities in four regions of northern and central Australia. 3946 Aboriginal or Torres Strait Islander children aged 5-15 years. Portable echocardiography was performed by cardiac sonographers. Echocardiograms were recorded and reported offsite by a pool of cardiologists. RHD was diagnosed according to 2012 World Heart Federation criteria. The prevalence of definite RHD differed between regions, from 4.7/1000 in Far North Queensland to 15.0/1000 in the Top End of the Northern Territory. The prevalence of definite RHD was greater in the Top End than in other regions (odds ratio, 2.3; 95% CI, 1.2-4.6, P = 0.01). Fifty-three per cent of detected cases of definite RHD were new cases; the prevalence of new cases of definite RHD was 4.6/1000 for the entire sample and 7.0/1000 in the Top End. Evaluation of socioeconomic data suggests that the Top End group was the most disadvantaged in our study population. The prevalence of definite RHD in remote Indigenous Australian children is significant, with a substantial level of undetected disease. Important differences were noted between regions, with the Top End having the highest prevalence of definite RHD, perhaps explained by socioeconomic factors. Regional differences must be considered when evaluating the potential benefit of widespread echocardiographic screening in Australia.

Seven key actions to eradicate rheumatic heart disease in Africa: the Addis Ababa communiqué.

PubMed

Watkins, David; Zuhlke, Liesl; Engel, Mark; Daniels, Rezeen; Francis, Veronica; Shaboodien, Gasnat; Kango, Mabvuto; Abul-Fadl, Azza; Adeoye, Abiodun; Ali, Sulafa; Al-Kebsi, Mohammed; Bode-Thomas, Fidelia; Bukhman, Gene; Damasceno, Albertino; Goshu, Dejuma Yadeta; Elghamrawy, Alaa; Gitura, Bernard; Haileamlak, Abraham; Hailu, Abraha; Hugo-Hamman, Christopher; Justus, Steve; Karthikeyan, Ganesan; Kennedy, Neil; Lwabi, Peter; Mamo, Yoseph; Mntla, Pindile; Sutton, Chris; Mocumbi, Ana Olga; Mondo, Charles; Mtaja, Agnes; Musuku, John; Mucumbitsi, Joseph; Murango, Louis; Nel, George; Ogendo, Stephen; Ogola, Elijah; Ojji, Dike; Olunuga, Taiwo Olabisi; Redi, Mekia Mohammed; Rusingiza, Kamanzi Emmanuel; Sani, Mahmoud; Sheta, Sahar; Shongwe, Steven; van Dam, Joris; Gamra, Habib; Carapetis, Jonathan; Lennon, Diana; Mayosi, Bongani M

Acute rheumatic fever (ARF) and rheumatic heart disease (RHD) remain major causes of heart failure, stroke and death among African women and children, despite being preventable and imminently treatable. From 21 to 22 February 2015, the Social Cluster of the Africa Union Commission (AUC) hosted a consultation with RHD experts convened by the Pan-African Society of Cardiology (PASCAR) in Addis Ababa, Ethiopia, to develop a 'roadmap' of key actions that need to be taken by governments to eliminate ARF and eradicate RHD in Africa. Seven priority areas for action were adopted: (1) create prospective disease registers at sentinel sites in affected countries to measure disease burden and track progress towards the reduction of mortality by 25% by the year 2025, (2) ensure an adequate supply of high-quality benzathine penicillin for the primary and secondary prevention of ARF/RHD, (3) improve access to reproductive health services for women with RHD and other non-communicable diseases (NCD), (4) decentralise technical expertise and technology for diagnosing and managing ARF and RHD (including ultrasound of the heart), (5) establish national and regional centres of excellence for essential cardiac surgery for the treatment of affected patients and training of cardiovascular practitioners of the future, (6) initiate national multi-sectoral RHD programmes within NCD control programmes of affected countries, and (7) foster international partnerships with multinational organisations for resource mobilisation, monitoring and evaluation of the programme to end RHD in Africa. This Addis Ababa communiqué has since been endorsed by African Union heads of state, and plans are underway to implement the roadmap in order to end ARF and RHD in Africa in our lifetime.

Risk Factors of Rheumatic Heart Disease in Bangladesh: A Case-Control Study

PubMed Central

Riaz, Baizid Khoorshid; Karim, Md. Nazmul; Chowdhury, Kamrun Nahar; Chowdhury, Shahabul Huda; Rahman, Md. Ridwanur

2013-01-01

Not all cases of rheumatic fever (RF) end up as rheumatic heart disease (RHD). The fact raises the possibility of existence of a subgroup with characteristics that prevent RF patients from developing the RHD. The present study aimed at exploring the risk factors among patients with RHD. The study assessed the risk of RHD among people both with and without RF. In total, 103 consecutive RHD patients were recruited as cases who reported to the National Centre for Control of Rheumatic Fever and Heart Disease, Dhaka, Bangladesh. Of 309 controls, 103 were RF patients selected from the same centre, and the remaining 206 controls were selected from Shaheed Suhrawardy Medical College Hospital, who got admitted for other non-cardiac ailments. RHD was confirmed by auscultation and colour Doppler echocardiography. RF was diagnosed based on the modified Jones criteria. An unadjusted odds ratio was generated for each variable, with 95% confidence interval (CI), and only significant factors were considered candidate for multivariate analysis. Three separate binary logistic regression models were generated to assess the risk factors of RF, risk factors of RHD compared to non-rheumatic control patients, and risk factors of RHD compared to control with RF. RF and RHD shared almost a similar set of risk factors in the population. In general, age over 19 years was found to be protective of RF; however, age of the majority (62.1%) of the RHD cases was over 19 years. Women [odds ratio (OR)=2.2, 95% CI 1.1-4.3], urban resident (OR=3.1, 95% CI 1.2–8.4), dwellers in brick-built house (OR=3.6, 95% CI 1.6-8.1), having >2 siblings (OR=3.1, 95% CI 1.5- 6.3), offspring of working mothers (OR=7.6, 95% CI 2.0-24.2), illiterate mother (OR=2.6, 95% CI 1.2-5.8), and those who did not brush after taking meals (OR=2.5, 95% CI 1.0-6.3) were more likely to develop RF. However, more than 5 members in a family showed a reduced risk of RF. RHD shared almost a similar set of factors in general. More than three people sharing a room also showed an increased risk of RHD (OR=1.9, 95% CI 1.0-3.4), in addition to the risk factors of RF. Multivariate model also assessed the factors that may perpetuate RHD among RF patients. Overcrowding (OR=2.4, 95% CI 1.2-4.7) and illiteracy (OR=2.4, 95% CI 1.1-5.2) posed the risk of RHD in the RF patients. The study did not find new factors that might pose an increased risk, rather looked for the documented risk factors and how these operate in the population of Bangladesh. PMID:23617207

Rhesus Factor Modulation of Effects of Smoking and Age on Psychomotor Performance, Intelligence, Personality Profile, and Health in Czech Soldiers

PubMed Central

Flegr, Jaroslav; Geryk, Jan; Volný, Jindra; Klose, Jiří; Černochová, Dana

2012-01-01

Background Rhesus-positive and rhesus-negative persons differ in the presence-absence of highly immunogenic RhD protein on the erythrocyte membrane. This protein is a component of NH3 or CO2 pump whose physiological role is unknown. Several recent studies have shown that RhD positivity protects against effects of latent toxoplasmosis on motor performance and personality. It is not known, however, whether the RhD phenotype modifies exclusively the response of the body to toxoplasmosis or whether it also influences effects of other factors. Methodology/Principal Findings In the present cohort study, we searched for the effects of age and smoking on performance, intelligence, personality and self-estimated health and wellness in about 3800 draftees. We found that the positive effect of age on performance and intelligence was stronger in RhD-positive soldiers, while the negative effect of smoking on performance and intelligence was of similar size regardless of the RhD phenotype. The effect of age on four Cattell's personality factors, i.e., dominance (E), radicalism (Q1), self-sentiment integration (Q3), and ergic tension (Q4), and on Cloninger's factor reward dependency (RD) was stronger for RhD-negative than RhD-positive subjects, while the effect of smoking on the number of viral and bacterial diseases was about three times stronger for RhD-negative than RhD-positive subjects. Conclusions RhD phenotype modulates the influence not only of latent toxoplasmosis, but also of at least two other potentially detrimental factors, age and smoking, on human behavior and physiology. The negative effect of smoking on health (estimated on the basis of the self-rated number of common viral and bacterial diseases in the past year) was much stronger in RhD-negative than RhD-positive subjects. It is critically needed to confirm the differences in health response to smoking between RhD-positive and RhD-negative subjects by objective medical examination in future studies. PMID:23209579

VizieR Online Data Catalog: STAGGER-grid of 3D stellar models. V. (Chiavassa+, 2018)

NASA Astrophysics Data System (ADS)

Chiavassa, A.; Casagrande, L.; Collet, R.; Magic, Z.; Bigot, L.; Thevenin, F.; Asplund, M.

2018-01-01

Table B0: RHD simulations' stellar parameters, bolometric magnitude, and bolometric correction for Johnson-Cousins, 2MASS, SDSS (columns 13 to 17), and Gaia systems Table 4: RHD simulations' stellar parameters, bolometric magnitude, and bolometric correction for SkyMapper photometric system, and Stroemgren index b-y, m1=(v-b)-(b-y), and c1=(u-v)-(v-b) Table 5: RHD simulations' stellar parameters, bolometric magnitude, and bolometric correction for the HST-WFC3 in VEGA system Table 6: RHD simulations' stellar parameters, bolometric magnitude, and bolometric correction for the HST-WFC3 in ST system Table 7: RHD simulations' stellar parameters, bolometric magnitude, and bolometric correction for the HST-WFC3 in AB system (5 data files).

Changes in the expression of Th17 cell-associated cytokines in the development of rheumatic heart disease.

PubMed

Wen, Yun; Zeng, Zhiyu; Gui, Chun; Li, Lang; Li, Wenting

2015-01-01

Autoimmunity plays a critical role in the development of rheumatic heart disease (RHD). Recent studies have linked Th17 cells to the autoimmune mechanism associated with RHD. This study aimed to investigate changes in Th17 cell-related cytokine expression in acute and chronic RHD. We established a Lewis rat model of experimental RHD, which was induced by inactivated Group A streptococci and complete Freund's adjuvant. After 7- and 24-week intervention treatments, we measured serum levels of interleukin-17 (IL-17) and IL-6, key cytokines associated with Th17 cells, using a Luminex liquichip method, and levels of IL-17 and IL-6 in heart tissues using immunohistochemical assays. Moreover, expression levels of IL-17, IL-21, IL-6, and IL-23 in mitral valve tissues of human RHD patients were also measured using immunohistochemistry. Compared with the normal control group, serum IL-17 and IL-6 concentrations were significantly increased, and the expression levels of IL-17 and IL-6 in the mitral valve were also significantly increased in 7- or 24-week RHD rats (P<.017). Compared with the control group, expression of IL-17, IL-21, IL-6, and IL-23 in mitral valve tissues was significantly increased in RHD patients (P<.05). Our study suggested that the increased expression of Th17 cell-associated cytokines might play an important role in the pathogenesis and development of RHD. Copyright © 2015 Elsevier Inc. All rights reserved.

Cost-effectiveness of first trimester non-invasive fetal RHD screening for targeted antenatal anti-D prophylaxis in RhD-negative pregnant women: a model-based analysis.

PubMed

Neovius, M; Tiblad, E; Westgren, M; Kublickas, M; Neovius, K; Wikman, A

2016-07-01

To estimate the cost-effectiveness of first trimester non-invasive fetal RHD screening for targeted antenatal versus no routine antenatal anti-D prophylaxis (RAADP) or versus non-targeted RAADP. Model based on a population-based cohort study. The Swedish health service. Intervention subjects in the underlying cohort study were RhD-negative pregnant women receiving first trimester fetal RHD screening followed by targeted anti-D in 2010-2011 (n = 6723). Historical comparators were RhD-negative women who delivered in 2008-2009 when standard care did not include RAADP (n = 7099). Healthcare costs for the three strategies were included for the first and subsequent pregnancies. For the comparison with non-targeted RAADP, the immunisation rate was based on the observed rate for targeted therapy and adjusted downwards by removing the influence of false negatives. Additional cost per RhD immunisation averted. Compared with RAADP, targeted prophylaxis was associated with fewer immunisations (0.19 versus 0.46% per pregnancy) and lower costs (cost-savings of €32 per RhD-negative woman). The savings were from lower costs during pregnancy and delivery, and lower costs of future pregnancies through fewer immunisations. Non-targeted anti-D was estimated to result in 0.06% fewer immunisations and an additional €16 in cost-savings per mother, compared with targeted anti-D. Based on effect data from a population-based cohort study, targeted prophylaxis was associated with lower immunisation risk and costs versus no RAADP. Based on effect data from theoretical calculations, non-targeted RAADP was predicted to result in lower costs and immunisation risk compared with targeted prophylaxis. Fetal RHD screening and targeted prophylaxis resulted in lower immunisation risk and costs compared with no RAADP. © 2015 Royal College of Obstetricians and Gynaecologists.

Timing and severity of immunizing diseases in rabbits is controlled by seasonal matching of host and pathogen dynamics

PubMed Central

Wells, Konstans; Brook, Barry W.; Lacy, Robert C.; Mutze, Greg J.; Peacock, David E.; Sinclair, Ron G.; Schwensow, Nina; Cassey, Phillip; O'Hara, Robert B.; Fordham, Damien A.

2015-01-01

Infectious diseases can exert a strong influence on the dynamics of host populations, but it remains unclear why such disease-mediated control only occurs under particular environmental conditions. We used 16 years of detailed field data on invasive European rabbits (Oryctolagus cuniculus) in Australia, linked to individual-based stochastic models and Bayesian approximations, to test whether (i) mortality associated with rabbit haemorrhagic disease (RHD) is driven primarily by seasonal matches/mismatches between demographic rates and epidemiological dynamics and (ii) delayed infection (arising from insusceptibility and maternal antibodies in juveniles) are important factors in determining disease severity and local population persistence of rabbits. We found that both the timing of reproduction and exposure to viruses drove recurrent seasonal epidemics of RHD. Protection conferred by insusceptibility and maternal antibodies controlled seasonal disease outbreaks by delaying infection; this could have also allowed escape from disease. The persistence of local populations was a stochastic outcome of recovery rates from both RHD and myxomatosis. If susceptibility to RHD is delayed, myxomatosis will have a pronounced effect on population extirpation when the two viruses coexist. This has important implications for wildlife management, because it is likely that such seasonal interplay and disease dynamics has a strong effect on long-term population viability for many species. PMID:25566883

Handheld echocardiographic screening for rheumatic heart disease by non-experts.

PubMed

Ploutz, Michelle; Lu, Jimmy C; Scheel, Janet; Webb, Catherine; Ensing, Greg J; Aliku, Twalib; Lwabi, Peter; Sable, Craig; Beaton, Andrea

2016-01-01

Handheld echocardiography (HAND) has good sensitivity and specificity for rheumatic heart disease (RHD) when performed by cardiologists. However, physician shortages in RHD-endemic areas demand less-skilled users to make RHD screening practical. We examine nurse performance and interpretation of HAND using a simplified approach for RHD screening. Two nurses received training on HAND and a simplified screening approach. Consented students at two schools in Uganda were eligible for participation. A simplified approach (HAND performed and interpreted by a non-expert) was compared with the reference standard (standard portable echocardiography, performed and interpreted by experts according to the 2012 World Heart Federation guidelines). Reasons for false-positive and false-negative HAND studies were identified. A total of 1002 children were consented, with 956 (11.1 years, 41.8% male) having complete data for review. Diagnoses included: 913 (95.5%) children were classified normal, 32 (3.3%) borderline RHD and 11 (1.2%) definite RHD. The simplified approach had a sensitivity of 74.4% (58.8% to 86.5%) and a specificity of 78.8% (76.0% to 81.4%) for any RHD (borderline and definite). Sensitivity improved to 90.9% (58.7% to 98.5%) for definite RHD. Identification and measurement of erroneous colour jets was the most common reason for false-positive studies (n=164/194), while missed mitral regurgitation and shorter regurgitant jet lengths with HAND were the most common reasons for false-negative studies (n=10/11). Non-expert-led HAND screening programmes offer a potential solution to financial and workforce barriers that limit widespread RHD screening. Nurses trained on HAND using a simplified approach had reasonable sensitivity and specificity for RHD screening. Information on reasons for false-negative and false-positive screening studies should be used to inform future training protocols, which could lead to improved screening performance. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

World Heart Federation criteria for echocardiographic diagnosis of rheumatic heart disease—an evidence-based guideline

PubMed Central

Reményi, Bo; Wilson, Nigel; Steer, Andrew; Ferreira, Beatriz; Kado, Joseph; Kumar, Krishna; Lawrenson, John; Maguire, Graeme; Marijon, Eloi; Mirabel, Mariana; Mocumbi, Ana Olga; Mota, Cleonice; Paar, John; Saxena, Anita; Scheel, Janet; Stirling, John; Viali, Satupaitea; Balekundri, Vijayalakshmi I.; Wheaton, Gavin; Zühlke, Liesl; Carapetis, Jonathan

2017-01-01

Over the past 5 years, the advent of echocardiographic screening for rheumatic heart disease (RHD) has revealed a higher RHD burden than previously thought. In light of this global experience, the development of new international echocardiographic guidelines that address the full spectrum of the rheumatic disease process is opportune. Systematic differences in the reporting of and diagnostic approach to RHD exist, reflecting differences in local experience and disease patterns. The World Heart Federation echocardiographic criteria for RHD have, therefore, been developed and are formulated on the basis of the best available evidence. Three categories are defined on the basis of assessment by 2D, continuous-wave, and color-Doppler echocardiography: ‘definite RHD’, ‘borderline RHD’, and ‘normal’. Four subcategories of ‘definite RHD’ and three subcategories of ‘borderline RHD’ exist, to reflect the various disease patterns. The morphological features of RHD and the criteria for pathological mitral and aortic regurgitation are also defined. The criteria are modified for those aged over 20 years on the basis of the available evidence. The standardized criteria aim to permit rapid and consistent identification of individuals with RHD without a clear history of acute rheumatic fever and hence allow enrollment into secondary prophylaxis programs. However, important unanswered questions remain about the importance of subclinical disease (borderline or definite RHD on echocardiography without a clinical pathological murmur), and about the practicalities of implementing screening programs. These standardized criteria will help enable new studies to be designed to evaluate the role of echocardiographic screening in RHD control. PMID:22371105

Remodeling of Kv1.5 channel in right atria from Han Chinese patients with atrial fibrillation.

PubMed

Ou, Xian-hong; Li, Miao-ling; Liu, Rui; Fan, Xin-rong; Mao, Liang; Fan, Xue-hui; Yang, Yan; Zeng, Xiao-rong

2015-04-28

The incidence of atrial fibrillation (AF) in rheumatic heart diseases (RHD) is very high and increases with age. Occurrence and maintenance of AF are very complicated process accompanied by many different mechanisms. Ion-channel remodeling, including the voltage-gated potassium channel Kv1.5, plays an important role in the pathophysiology of AF. However, the changes of Kv1.5 channel expression in Han Chinese patients with RHD and AF remain poorly understood. The aim of the present study was to investigate whether the Kv1.5 channels of the right atria may be altered with RHD, age, and sex to contribute to AF. Right atrial appendages were obtained from 20 patients with normal cardiac functions who had undergone surgery, and 26 patients with AF. Subjects were picked from 4 groups: adult and aged patients in normal sinus rhythm (SR) and AF. Patients were divided into non-RHD and RHD groups or men and women groups in normal SR and AF, respectively. The expression of Kv1.5 protein and messenger RNA (mRNA) were measured using Western blotting and polymerase chain reaction (PCR) method, respectively. Compared with the SR group, the expression of Kv1.5 protein decreased significantly in the AF group. However, neither Kv1.5 protein nor KCNA5 mRNA had significant differences in adult and aged groups, non-RHD and RHD group, and men and women group of AF. The expression of Kv1.5 channel protein changes with AF but not with age, RHD, and sex in AF.

The clinical characteristics of adults with rheumatic heart disease in Yangon, Myanmar: An observational study.

PubMed

Myint, Nan Phyu Sin Toe; Aung, Ne Myo; Win, Myint Soe; Htut, Thu Ya; Ralph, Anna P; Cooper, David A; Nyein, Myo Lwin; Kyi, Mar Mar; Hanson, Josh

2018-01-01

Rheumatic heart disease (RHD) is a major cause of premature death in low and middle-income countries. The greatest barrier to RHD control is neglect of the disease in national health policies and a lack of prevalence data that might inform control efforts. Myanmar is making remarkable progress against many infectious diseases, but there are almost no data to define the clinical burden of RHD in the country. This prospective audit was performed in an adult medical ward of a tertiary-referral hospital in Yangon, to gain an insight into the prevalence of RHD in Myanmar. All patients admitted to the ward between May 1, 2016 and April 30, 2017 were eligible for enrolment. RHD was confirmed in 96 patients who were admitted on 134 occasions, representing 1.1% of the 12,172 adult medical admissions during the study period. This compared with 410 (3.4%) admissions with HIV and 14 (0.1%) with malaria. Patients with RHD had a median age of 44 years (interquartile range: 35-59); 70 (73%) were female. Only one patient had ever had surgery despite 79 (82%) meeting criteria for intervention; 54 (56%) patients were not receiving any regular clinician review. Prior to hospitalisation only 18 (19%) patients were receiving regular penicillin. Only 8 (19%) of the 42 women <50 years were using contraception. Of 49 patients who had been hospitalised previously, 22 (45%) were receiving no regular therapy. During the study three (3.1%) patients died, and 28 (29%) were lost to follow-up. Of the 65 (68%) alive and retained in care, 21 (32%) were still experiencing moderate-severe RHD-related symptoms at the study's end. There is a significant and unmet clinical burden of RHD in Myanmar. A national RHD programme would improve patient care, reducing morbidity and mortality from this preventable disease.

Choosing a Research Higher Degree Supervisor: A Framework for Nurses

ERIC Educational Resources Information Center

Abigail, Wendy; Hill, Pauline

2015-01-01

Nursing is a relatively new discipline in research with a small number of registered nurses holding a research higher degree (RHD). Entry into RHD study for nurses is often via a less direct route than the traditional bachelor's degree through honours to PhD pathway. The supervisor-candidate relationship is an important factor in RHD completions…

Abbreviated right-sided heart echocardiogram and the STOP-Bang questionnaire-a useful relationship for preoperative patient evaluation?

PubMed

Evans, Rebecca E; Zimmerman, Joshua; Shishido, Sonia; Heath, Elise; Bledsoe, Amber; Johnson, Ken

2016-05-01

The aims of this study were to (1) explore the incidence of right-sided heart dysfunction (RHD) and STOP-Bang questionnaire responses consistent with obstructive sleep apnea (OSA) and (2) assess the relationship between patients with STOP-Bang questionnaire responses consistent with OSA and echocardiographic findings suggestive of RHD. Observational study. Tertiary academic center preoperative clinic. Two hundred patients presenting for elective surgery to the University of Utah preoperative clinic. Abbreviated transthoracic right-sided echocardiogram and STOP-Bang questionnaire. Tricuspid annular plane systolic excursion, tissue Doppler-derived tricuspid lateral annular systolic velocity (S'), and the tricuspid inflow E wave to tricuspid annular tissue Doppler e' wave ratio (E/e') for the presence of RHD, as well as responses to STOP-Bang questionnaire. A total of 140 echocardiograms were analyzed after exclusion of participants with incomplete STOP-Bang questionnaires and inadequate images. Thirty-five patients (25%) reported 5 or more positive responses to the STOP-Bang questionnaire. Forty-six patients (35%) had abnormal right-sided heart measurements. Of the 35 patients with STOP-Bang scores 5 or greater, 11 (31%) had evidence of RHD. No correlation was observed between STOP-Bang scores and the echocardiography metrics of RHD. This preliminary study suggests that there are numerous sources of RHD, among one of which is sleep apnea, and/or the STOP-Bang questionnaire is not a sensitive tool for predicting RHD. We conclude that although the STOP-Bang questionnaire is easy to implement in a preoperative clinical setting, it is not useful in identifying patients at risk for RHD. Copyright © 2015 Elsevier Inc. All rights reserved.

Timing and severity of immunizing diseases in rabbits is controlled by seasonal matching of host and pathogen dynamics.

PubMed

Wells, Konstans; Brook, Barry W; Lacy, Robert C; Mutze, Greg J; Peacock, David E; Sinclair, Ron G; Schwensow, Nina; Cassey, Phillip; O'Hara, Robert B; Fordham, Damien A

2015-02-06

Infectious diseases can exert a strong influence on the dynamics of host populations, but it remains unclear why such disease-mediated control only occurs under particular environmental conditions. We used 16 years of detailed field data on invasive European rabbits (Oryctolagus cuniculus) in Australia, linked to individual-based stochastic models and Bayesian approximations, to test whether (i) mortality associated with rabbit haemorrhagic disease (RHD) is driven primarily by seasonal matches/mismatches between demographic rates and epidemiological dynamics and (ii) delayed infection (arising from insusceptibility and maternal antibodies in juveniles) are important factors in determining disease severity and local population persistence of rabbits. We found that both the timing of reproduction and exposure to viruses drove recurrent seasonal epidemics of RHD. Protection conferred by insusceptibility and maternal antibodies controlled seasonal disease outbreaks by delaying infection; this could have also allowed escape from disease. The persistence of local populations was a stochastic outcome of recovery rates from both RHD and myxomatosis. If susceptibility to RHD is delayed, myxomatosis will have a pronounced effect on population extirpation when the two viruses coexist. This has important implications for wildlife management, because it is likely that such seasonal interplay and disease dynamics has a strong effect on long-term population viability for many species. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

Theory of Mind in Adults with Right Hemisphere Damage: What's the Story?

ERIC Educational Resources Information Center

Weed, Ethan; McGregor, William; Nielsen, Jorgen Feldbaek; Roepstorff, Andreas; Frith, Uta

2010-01-01

Why do people with right hemisphere damage (RHD) have difficulty with pragmatics and communication? One hypothesis has been that pragmatic impairment in RHD is the result of an underlying impairment in Theory of Mind (ToM): the ability to infer the mental states of others. In previous studies evaluating ToM abilities in people with RHD,…

A NUMERICAL ALGORITHM FOR MODELING MULTIGROUP NEUTRINO-RADIATION HYDRODYNAMICS IN TWO SPATIAL DIMENSIONS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Swesty, F. Douglas; Myra, Eric S.

It is now generally agreed that multidimensional, multigroup, neutrino-radiation hydrodynamics (RHD) is an indispensable element of any realistic model of stellar-core collapse, core-collapse supernovae, and proto-neutron star instabilities. We have developed a new, two-dimensional, multigroup algorithm that can model neutrino-RHD flows in core-collapse supernovae. Our algorithm uses an approach similar to the ZEUS family of algorithms, originally developed by Stone and Norman. However, this completely new implementation extends that previous work in three significant ways: first, we incorporate multispecies, multigroup RHD in a flux-limited-diffusion approximation. Our approach is capable of modeling pair-coupled neutrino-RHD, and includes effects of Pauli blocking inmore » the collision integrals. Blocking gives rise to nonlinearities in the discretized radiation-transport equations, which we evolve implicitly in time. We employ parallelized Newton-Krylov methods to obtain a solution of these nonlinear, implicit equations. Our second major extension to the ZEUS algorithm is the inclusion of an electron conservation equation that describes the evolution of electron-number density in the hydrodynamic flow. This permits calculating deleptonization of a stellar core. Our third extension modifies the hydrodynamics algorithm to accommodate realistic, complex equations of state, including those having nonconvex behavior. In this paper, we present a description of our complete algorithm, giving sufficient details to allow others to implement, reproduce, and extend our work. Finite-differencing details are presented in appendices. We also discuss implementation of this algorithm on state-of-the-art, parallel-computing architectures. Finally, we present results of verification tests that demonstrate the numerical accuracy of this algorithm on diverse hydrodynamic, gravitational, radiation-transport, and RHD sample problems. We believe our methods to be of general use in a variety of model settings where radiation transport or RHD is important. Extension of this work to three spatial dimensions is straightforward.« less

A study on the association of TNF-α(-308), IL-6(-174), IL-10(-1082) and IL-1Ra(VNTR) gene polymorphisms with rheumatic heart disease in Pakistani patients.

PubMed

Rehman, Sadia; Akhtar, Naveed; Saba, Nusrat; Munir, Saeeda; Ahmed, Waqar; Mohyuddin, Aisha; Khanum, Azra

2013-02-01

Inflammation is an important contributor to the pathogenesis of rheumatic heart disease (RHD), a disorder of heart valves caused by a combination of immune, genetic and environmental factors. Cytokines are important mediators of inflammatory and immune responses. The aim of this study was to investigate the role of cytokine gene polymorphisms and their potential usefulness as biomarkers in RHD patients from Pakistan. We screened 150 RHD patients and 204 ethnically matched controls for tumor necrosis factor (TNF)-α(-308)G/A, interleukin (IL)-10(-1082) G/A, interleukin (IL)-6(-174) G/C and a variable number of tandem repeats (VNTRs) polymorphism of the IL-1Ra gene using polymerase chain reaction. The results showed that TNF-α(-308) A and IL-6(-174) G alleles were associated with susceptibility to RHD (p=0.000; OR=2.81; CI=1.5-5.14 and p=0.025; OR=1.50; CI=1.04-2.16 respectively). The TNF-α(-308) AA and GA genotypes were associated with susceptibility to RHD (p=0.012; OR=9.94; CI; 1.21-217.3 and p=0.046; OR=1.97; CI=0.98-3.97 respectively) while the GG genotype seemed to confer resistance (p=0.003; OR=0.39; CI=0.20-0.76). The GG genotype for IL-6(-174) was significantly associated with predisposition to RHD (p=0.015; OR=2.6; CI=1.17-5.85). The A1 (four repeats) and A2 (two repeats) alleles at the IL-1Ra VNTR polymorphism were associated with resistance and susceptibility to RHD respectively. However, this polymorphism deviated from Hardy-Weinberg equilibrium in both patients and controls in our population. TNF-α(-308) and IL-6(-174) polymorphisms may be useful markers for the identification of individuals susceptible to RHD in Pakistan. These individuals could be provided aggressive prophylactic intervention to prevent the morbidity and mortality associated with RHD. Copyright © 2012 Elsevier Ltd. All rights reserved.

Rheumatic heart disease: progress and challenges in India.

PubMed

Shah, Bela; Sharma, Meenakshi; Kumar, Rajesh; Brahmadathan, K N; Abraham, Vinod Joseph; Tandon, Rajan

2013-03-01

Rheumatic heart disease, a neglected disease, continues to be a burden in India and other developing countries. It is a result of an autoimmune sequalae in response to group A beta hemolytic streptococcus (GAS) infection of the pharynx. Acute rheumatic fever (RF), a multisystem inflammatory disease, is followed by rheumatic heart disease (RHD) and has manifestations of joints, skin and central nervous system involvement. A review of epidemiological studies indicates unchanged GAS pharyngitis and carrier rates in India. The apparent decline in RHD rates in India as indicated by the epidemiological studies has to be taken with caution as methodological differences exist among studies. Use of echocardiography increases case detection rates of RHD in population surveys. However, the significance of echo based diagnosis of carditis needs further evaluation to establish the significance. Research in this area through prospective follow up studies will have to be undertaken by the developing countries as the interest of developed countries in the disease has waned due the declined burden in their populations. Prevention of RHD is possible through treatment of GAS pharyngitis (primary prophylaxis) and continued antibiotic treatment for number of years in patients with history of RF to prevent recurrences (secondary prophylaxis). The cost effectiveness and practicality of secondary prophylaxis is well documented. The challenge to any secondary prophylaxis program for prevention of RF in India will be the availability of benzathine penicillin G and dissipation of fears of allergic reactions to penicillin among practitioners, general public and policy makers. The authors review here the progress and challenges in epidemiology, diagnosis and primary and secondary prevention of RF and RHD.

Coarse coding and discourse comprehension in adults with right hemisphere brain damage

PubMed Central

Tompkins, Connie A.; Scharp, Victoria L.; Meigh, Kimberly M.; Fassbinder, Wiltrud

2009-01-01

Background Various investigators suggest that some discourse-level comprehension difficulties in adults with right hemisphere brain damage (RHD) have a lexical-semantic basis. As words are processed, the intact right hemisphere arouses and sustains activation of a wide-ranging network of secondary or peripheral meanings and features—a phenomenon dubbed “coarse coding”. Coarse coding impairment has been postulated to underpin some prototypical RHD comprehension deficits, such as difficulties with nonliteral language interpretation, discourse integration, some kinds of inference generation, and recovery when a reinterpretation is needed. To date, however, no studies have addressed the hypothesised link between coarse coding deficit and discourse comprehension in RHD. Aims The current investigation examined whether coarse coding was related to performance on two measures of narrative comprehension in adults with RHD. Methods & Procedures Participants were 32 adults with unilateral RHD from cerebrovascular accident, and 38 adults without brain damage. Coarse coding was operationalised as poor activation of peripheral/weakly related semantic features of words. For the coarse coding assessment, participants listened to spoken sentences that ended in a concrete noun. Each sentence was followed by a spoken target phoneme string. Targets were subordinate semantic features of the sentence-final nouns that were incompatible with their dominant mental representations (e.g., “rotten” for apple). Targets were presented at two post-noun intervals. A lexical decision task was used to gauge both early activation and maintenance of activation of these weakly related semantic features. One of the narrative tasks assessed comprehension of implied main ideas and details, while the other indexed high-level inferencing and integration. Both comprehension tasks were presented auditorily. For all tasks, accuracy of performance was the dependent measure. Correlations were computed within the RHD group between both the early and late coarse coding measures and the two discourse measures. Additionally, ANCOVA and independent t-tests were used to compare both early and sustained coarse coding in subgroups of good and poor RHD comprehenders. Outcomes & Results The group with RHD was less accurate than the control group on all measures. The finding of coarse coding impairment (difficulty activating/sustaining activation of a word’s peripheral features) may appear to contradict prior evidence of RHD suppression deficit (prolonged activation for context-inappropriate meanings of words). However, the sentence contexts in this study were unbiased and thus did not provide an appropriate test of suppression function. Correlations between coarse coding and the discourse measures were small and nonsignificant. There were no differences in coarse coding between RHD comprehension subgroups on the high-level inferencing task. There was also no distinction in early coarse coding for subgroups based on comprehension of implied main ideas and details. But for these same subgroups, there was a difference in sustained coarse coding. Poorer RHD comprehenders of implied information from discourse were also poorer at maintaining activation for semantically distant features of concrete nouns. Conclusions This study provides evidence of a variant of the postulated link between coarse coding and discourse comprehension in RHD. Specifically, adults with RHD who were particularly poor at sustaining activation for peripheral semantic features of nouns were also relatively poor comprehenders of implied information from narratives. PMID:20037670

Varied distribution of RhD epitopes in the Indian population.

PubMed

Kulkarni, S S; Gupte, S C; Vasantha, K; Mohanty, D; Ghosh, K

2007-01-01

Inhabited by more than 4000 caste and tribal groups, India has an extremely heterogenous population. For thousands of years many tribal groups have practised endogamy and are practically genetically isolated. Traditionally, polyclonal anti-D reagent has been used for RhD typing; though monoclonal antibodies are increasingly being used. As a result, blood banks find it difficult to assign the RhD status to an increasing number of people. As monoclonal anti-D typing reagents may not detect all RhD antigen epitopes, we studied the RhD antigen epitope heterogeneity in different population groups in India. Red cells of 5315 RhD-positive individuals belonging to different castes and tribes of India were tested with 30 different epitope-specific monoclonal anti-D antibodies. No single monoclonal antibody could detect all RhD-positive red cells detected by polyclonal antisera. The highest proportion of D antigen was detected by LHM 76/55 and BRAD-8 (98%) monoclonal antibodies. We need to determine the correct mix of monoclonal antibodies that will detect nearly all RhD antigens detected by polyclonal anti-D sera. Similarly, before accepting monoclonal anti-D for therapeutic use, it would be necessary to determine the appropriate ones for use in the Indian population.

Signal transducers and activators of transcription (STATs) gene polymorphisms related with susceptibility to rheumatic heart disease in north Indian population.

PubMed

Gupta, Usha; Mir, Snober S; Srivastava, Apurva; Garg, Naveen; Agarwal, Surendra K; Pande, Shantanu; Mittal, Balraj

2014-09-01

Rheumatic heart disease (RHD) is the most serious complication of heart that comprises inflammatory reactions in heart valves. Cytokines play a critical role in triggering inflammatory reactions and they activate the Janus Kinase/Signal Transducers and Activators of Transcription (JAK/STAT) signaling pathway. Altered signals of STATs play important roles in the balance between proinflammatory and anti-inflammatory cytokines in inflammatory diseases. The aim of the present study was to investigate for the association of polymorphisms related with STAT genes, i.e. STAT3 (rs4796793 C/G) and STAT5b (rs6503691 C/T) with the pathogenesis of RHD. This case-control association study involved 300 healthy controls and 400 RHD patients from North Indian Population. We categorized RHD patients into two subgroups based on involvement of heart valves, mitral valve lesion alone (MVL), and combined valve lesions including mitral valve (CVL). Genotyping was done by RFLP/Taqman probes. We observed that STAT3 CG and GG genotypes were significantly associated with RHD (p=0.030 and p=0.014 respectively), STAT5b CT and TT genotypes were also significantly associated with RHD (p≤0.001). Haplotype analysis revealed that minor alleles of both the variants (Grs4796793Trs6503691) were significantly associated (p<0.0001) with increased risk of the disease susceptibility irrespective of gender or age of onset of the disease. However, the polymorphisms were not involved in severity of RHD as both MVL and CVL patients were equally affected. STAT Grs4796793Trs6503691 carriers may have reduced production of STAT3 leading to damage of heart valves. Thus, STAT genes polymorphisms may be useful markers for the identification of individuals with high risk of RHD in the susceptible population. Copyright © 2014 Elsevier B.V. All rights reserved.

Transfusion strategy for weak D type 4.0 based on RHD alleles and RH haplotypes in Tunisia

PubMed Central

Ouchari, Mouna; Srivastava, Kshitij; Romdhane, Houda; Yacoub, Saloua Jemni; Flegel, Willy Albert

2017-01-01

Background With more than 460 RHD alleles, this gene is the most complex and polymorphic among all blood group systems. The Tunisian population has the largest known prevalence of weak D type 4.0 alleles, occurring in 1 of 105 RH haplotypes. We aimed to establish a rationale for the transfusion strategy of weak D type 4.0 in Tunisia. Study design and methods Donors were randomly screened for the serological weak D phenotype. The RHD coding sequence and parts of the introns were sequenced. To establish the RH haplotype, the RHCE gene was tested for characteristic single nucleotide positions. Results We determined all RHD alleles and the RH haplotypes coding for the serologic weak D phenotype among 13,431 Tunisian donations. A serologic weak D phenotype was found in 67 individuals (0.50%). Among them, 60 carried a weak D type 4 allele: 53 weak D type 4.0, 6 weak D type 4.2.2 (DAR), and 1 weak D type 4.1. Another 4 donors had 1 variant allele each: DVII, weak D type 1, weak D type 3, and weak D type 100, while 3 donors showed a normal RHD sequence. The weak D type 4.0 was most often linked to RHCE*ceVS.04.01, weak D type 4.2.2 to RHCE*ceAR, and weak D type 4.1 to RHCE*ceVS.02, while the other RHD alleles were linked to one of the common RHCE alleles. Conclusions Among the weak D phenotypes in Tunisia, no novel RHD allele was found and almost 90% were caused by alleles of the weak D type 4 cluster, of which 88% represented the weak D type 4.0 allele. Based on established RH haplotypes for variant RHD and RHCE alleles and the lack of adverse clinical reports, we recommend D positive transfusions for patients with weak D type 4.0 in Tunisia. PMID:29193104

Transfusion strategy for weak D Type 4.0 based on RHD alleles and RH haplotypes in Tunisia.

PubMed

Ouchari, Mouna; Srivastava, Kshitij; Romdhane, Houda; Jemni Yacoub, Saloua; Flegel, Willy Albert

2018-02-01

With more than 460 RHD alleles, this gene is the most complex and polymorphic among all blood group systems. The Tunisian population has the largest known prevalence of weak D Type 4.0 alleles, occurring in one of 105 RH haplotypes. We aimed to establish a rationale for the transfusion strategy of weak D Type 4.0 in Tunisia. Donors were randomly screened for the serologic weak D phenotype. The RHD coding sequence and parts of the introns were sequenced. To establish the RH haplotype, the RHCE gene was tested for characteristic single-nucleotide positions. We determined all RHD alleles and the RH haplotypes coding for the serologic weak D phenotype among 13,431 Tunisian donations. A serologic weak D phenotype was found in 67 individuals (0.50%). Among them, 60 carried a weak D Type 4 allele: 53 weak D Type 4.0, six weak D Type 4.2.2 (DAR), and one weak D Type 4.1. An additional four donors had one variant allele each: DVII, weak D Type 1, weak D Type 3, and weak D type 100, while three donors showed a normal RHD sequence. The weak D Type 4.0 was most often linked to RHCE*ceVS.04.01, weak D Type 4.2.2 to RHCE*ceAR, and weak D Type 4.1 to RHCE*ceVS.02, while the other RHD alleles were linked to one of the common RHCE alleles. Among the weak D phenotypes in Tunisia, no novel RHD allele was found and almost 90% were caused by alleles of the weak D Type 4 cluster, of which 88% represented the weak D Type 4.0 allele. Based on established RH haplotypes for variant RHD and RHCE alleles and the lack of adverse clinical reports, we recommend D+ transfusions for patients with weak D Type 4.0 in Tunisia. © 2017 AABB.

Air pollution in early life and adult mortality from chronic rheumatic heart disease.

PubMed

Phillips, David I W; Osmond, Clive; Williams, Martin L; Jones, Alexander

2017-08-01

Chronic rheumatic heart disease (RHD) remains a globally important cause of heart disease. The reasons for the continuing high prevalence of this disease are obscure, but it may have its origins in the poor social and economic conditions with which the disease has been consistently and strongly linked. Mortality studies from the UK have suggested the importance of adverse environmental factors in early life; these studies demonstrated specific geographical associations between high rates of chest infection during infancy and subsequent RHD. They raised the possibility that early air pollution, which is known to be strongly linked with chest infection during infancy, may predispose to RHD. We related estimates of air pollution and social conditions developed by Daly in 1951-52 for 78 urban areas in England and Wales to their subsequent RHD mortality rates at ages 35-74 in men and women during 1993-2012. There were strong relationships between domestic air pollution and RHD [relative risk per standard deviation (SD) increase in pollution 1.168, 95% confidence interval (CI): 1.128 to 1.210, P < 0.001). Inclusion of published data on social class, education, crowding and population density in multiple regression analyses showed that the air pollution association was independent of these; only overcrowding was separately linked with RHD. We present the first evidence of an association between air pollution in early life and RHD. Although there are several limitations to this study, the strength and consistency of the results, together with their biological plausibility, suggest a causal link. This deserves attention because it may have important consequences for the control of RHD in resource-poor countries where widespread use of biomass fuels and domestic pollution remain a problem. © The Author 2016; all rights reserved. Published by Oxford University Press on behalf of the International Epidemiological Association

A Review of Acute Rheumatic Fever and Rheumatic Heart Disease Research in Malaysia.

PubMed

Hung, L C; Nadia, R

2016-06-01

A total of 39 titles related to rheumatic fever or rheumatic heart disease in Malaysia were found with online literature search dating back to their inceptions and through 2014. Additional publications from conference journals were included. Nine papers were selected based on clinical relevance and future research implications. There were no population-based studies on the incidence or prevalence of ARF or RHD. In the 1980s, the incidence of admission due to ARF ranged from 2 to 21.1 per 100 000 paediatric admission per year. The burden of disease was significant in the adult population; 74.5% of patients with RHD were female, of which 77.1% were in the reproductive age group of 15-45 years old. Rheumatic mitral valve disease constituted almost half (46.7%) of all mitral valve repairs, ranging from 44.8 - 55.8 patients per year from 1997 - 2003. From 2010-2012, mitral valve interventions increased to 184 per year, of which 85.7% were mitral valve repair. In children with ARF, 25.4% - 41.7% had past history of rheumatic fever or RHD. In patients with rheumatic mitral valve disease undergoing surgical or medical interventions, only 6% reported history of ARF, none had history of GABHS pharyngitis or antibiotic prophylaxis. Only 44.7% of patients with RHD on follow-up were on intramuscular benzathine penicillin prophylaxis. Overall, there is scarcity of publications on ARF and RHD in Malaysia. Priority areas for research include determination of the incidence and prevalence of ARF and RHD, identification of high-risk populations, evaluation on the implementation and adherence of secondary preventive measures, identification of subclinical RHD especially amongst the high-risk population, and a surveillance system to monitor and evaluate preventive measures, disease progression and outcomes.

Toxoplasma and reaction time: role of toxoplasmosis in the origin, preservation and geographical distribution of Rh blood group polymorphism.

PubMed

Novotná, M; Havlícek, J; Smith, A P; Kolbeková, P; Skallová, A; Klose, J; Gasová, Z; Písacka, M; Sechovská, M; Flegr, J

2008-09-01

The RhD protein which is the RHD gene product and a major component of the Rh blood group system carries the strongest blood group immunogen, the D-antigen. This antigen is absent in a significant minority of the human population (RhD-negatives) due to RHD deletion or alternation. The origin and persistence of this RhD polymorphism is an old evolutionary enigma. Before the advent of modern medicine, the carriers of the rarer allele (e.g. RhD-negative women in the population of RhD-positives or RhD-positive men in the population of RhD-negatives) were at a disadvantage as some of their children (RhD-positive children born to pre-immunized RhD-negative mothers) were at a higher risk of foetal or newborn death or health impairment from haemolytic disease. Therefore, the RhD-polymorphism should be unstable, unless the disadvantage of carriers of the locally less abundant allele is counterbalanced by, for example, higher viability of the heterozygotes. Here we demonstrated for the first time that among Toxoplasma-free subjects the RhD-negative men had faster reaction times than Rh-positive subjects and showed that heterozygous men with both the RhD plus and RhD minus alleles were protected against prolongation of reaction times caused by infection with the common protozoan parasite Toxoplasma gondii. Our results suggest that the balancing selection favouring heterozygotes could explain the origin and stability of the RhD polymorphism. Moreover, an unequal prevalence of toxoplasmosis in different countries could explain pronounced differences in frequencies of RhD-negative phenotype in geographically distinct populations.

Rheumatic Heart Disease-Attributable Mortality at Ages 5-69 Years in Fiji: A Five-Year, National, Population-Based Record-Linkage Cohort Study.

PubMed

Parks, Tom; Kado, Joseph; Miller, Anne E; Ward, Brenton; Heenan, Rachel; Colquhoun, Samantha M; Bärnighausen, Till W; Mirabel, Mariana; Bloom, David E; Bailey, Robin L; Tukana, Isimeli N; Steer, Andrew C

2015-01-01

Rheumatic heart disease (RHD) is considered a major public health problem in developing countries, although scarce data are available to substantiate this. Here we quantify mortality from RHD in Fiji during 2008-2012 in people aged 5-69 years. Using 1,773,999 records derived from multiple sources of routine clinical and administrative data, we used probabilistic record-linkage to define a cohort of 2,619 persons diagnosed with RHD, observed for all-cause mortality over 11,538 person-years. Using relative survival methods, we estimated there were 378 RHD-attributable deaths, almost half of which occurred before age 40 years. Using census data as the denominator, we calculated there were 9.9 deaths (95% CI 9.8-10.0) and 331 years of life-lost (YLL, 95% CI 330.4-331.5) due to RHD per 100,000 person-years, standardised to the portion of the WHO World Standard Population aged 0-69 years. Valuing life using Fiji's per-capita gross domestic product, we estimated these deaths cost United States Dollar $6,077,431 annually. Compared to vital registration data for 2011-2012, we calculated there were 1.6-times more RHD-attributable deaths than the number reported, and found our estimate of RHD mortality exceeded all but the five leading reported causes of premature death, based on collapsed underlying cause-of-death diagnoses. Rheumatic heart disease is a leading cause of premature death as well as an important economic burden in this setting. Age-standardised death rates are more than twice those reported in current global estimates. Linkage of routine data provides an efficient tool to better define the epidemiology of neglected diseases.

[Observation on gene polymorphism of Rh blood group in Chinese Han nationality].

PubMed

Lan, Jiong-Cai; Wang, Cong-Rong; Wei, Ya-Ming; Zhou, Hua-You; Cao, Qiong; Zhang, Yin-Ze; Jiang, KuReXi; Wu, Da-Lin; Liu, Zhong

2003-12-01

To observe the gene polymorphism of Rh blood group in unrelated random individuals and families for Chinese Han nationality, polymerase chain reaction-sequence specific primer (PCR-SSP) was used to amplify the Rh C/E gene, RhD gene, exons, intron 2 and 10, insert and Rh Box in 160 blood samples of RhD positive unrelated individuals and 71 samples of RhD negative unrelated individuals and 7 samples of families whose probands were RhD-negative. The results showed that RhD genes of RhD-negative individuals with C antigens were polymorphism, three forms were found for D exon including intact, partial deletion and complete deletion exons. Insert fragments and Rh Box were found in most cases of families whose probands were RhD-negative and its inheritance accorded with the Mendel's Law, and it did not affect the expression of RhD gene. "Normal" RhD exon 4 amplifying product was not found in all of the samples. It was concluded that gene structure of the RhD-negative in Chinese was polymorphism, intact, partial deletion and complete deletion exons were found in the individuals with C antigen and probably existed specific D (nf) Ce haplotype. The function of insert was uncertain. The Rh gene sequences of Chinese Han nationality are different from those of Caucasian and the Rh gene library based on Han nationality should be established.

Increased α-Actinin-2 Expression in the Atrial Myocardium of Patients with Atrial Fibrillation Related to Rheumatic Heart Disease.

PubMed

Zhang, Lei; Zhang, Nan; Tang, Xuejiao; Liu, Fajin; Luo, Suxin; Xiao, Hua

Atrial fibrosis, a marker of atrial structural remodeling, plays a critical role in atrial fibrillation (AF). α- Actinin-2 is associated with structural remodeling related to stretching. The transforming growth factor-β1 (TGF-β1)/Smad pathway plays an important role in atrial fibrosis. We investigated the effects of the TGF-β1/Smad signaling pathway on α-actinin-2 in atrial fibrosis in patients with AF. Forty-one right atrial specimens obtained from patients with rheumatic heart disease (RHD) were divided into a chronic (c)AF group, i.e. RHD + cAF (n = 29), and a sinus rhythm group, i.e. RHD + sinus rhythm (n = 12). Patients with congenital heart disease (CHD) and sinus rhythm who underwent heart surgery served as controls (n = 10). Fibrosis was assessed by histological examination, and expression of α-actinin-2, TGF-β1 and Smad2/phosphorylated Smad2 (p-Smad2) was evaluated by immunohistochemistry, quantitative real-time PCR and Western blotting. In rat atrial fibroblasts treated with TGF-β1, the collagen content was measured using hydroxyproline detection, and α-actinin-2 and p-Smad2 were evaluated by semiquantitative reverse-transcription PCR and Western blotting. The histology results revealed a significant increase in atrial fibrosis in AF patients. The collagen content, mRNA and protein expression levels of α-actinin-2 and the components of the TGF-β1/Smad signaling pathway were significantly gradually increased in the CHD + sinus rhythm, RHD + sinus rhythm and RHD + cAF groups (p < 0.05). The mRNA and protein levels of α-actinin-2 and TGF-β1 in RHD patients were positively correlated with the collagen volume fraction. A positive correlation between the expression of α-actinin-2 and TGF-β1 was also observed. In rat atrial fibroblasts treated with TGF-β1, the collagen content was greater than that in the control group (p < 0.05), and the expression levels of α- actinin-2 and p-Smad2 were also upregulated (p < 0.05). α-Actinin-2 expression was increased in the atrial tissues of patients with AF secondary to RHD. α-Actinin-2 was upregulated via the TGF-β1/Smad pathway in atrial fibroblasts, which suggests that it may be involved in TGF-β1/Smad pathway-induced atrial fibrosis in patients with AF. © 2016 S. Karger AG, Basel.

Cost-effectiveness of the management of rh-negative pregnant women.

PubMed

Duplantie, Julie; Gonzales, Odilon Martinez; Bois, Antoine; Nshimyumukiza, Léon; Gekas, Jean; Bujold, Emmanuel; Morin, Valérie; Vallée, Maud; Giguère, Yves; Gagné, Christian; Rousseau, François; Reinharz, Daniel

2013-08-01

The purpose of this study was to determine the most cost-effective option to prevent alloimmunization against the Rh factor. A virtual population of Rh-negative pregnant women in Quebec was built to simulate the cost-effectiveness of preventing alloimmunization. The model considered four options: (1) systematic use of anti-D immunoglobulin; (2) fetal Rh(D) genotyping; (3) immunological determination of the father's Rh type; (4) mixed screening: immunological determination of the father's Rh type, followed if positive by fetal Rh(D) genotyping. Two outcomes were considered, in addition to the estimated costs: (1) the number of babies without hemolytic disease, and (2) the number of surviving infants. In a first pregnancy, two options emerged as the most cost-effective options: systematic prophylaxis and immunological Rh typing of the father, with overlapping confidence intervals between them. In a second pregnancy, the results were similar. In all cases (first or second pregnancy or a combination of the two) fetal genotyping was not found to be a cost-effective option. Routine prophylaxis and immunological Rh typing of the father are the most cost-effective options for the prevention of Rh alloimmunization. Considering that immunological typing of the father would probably not be carried out by the majority of clinicians, routine prophylaxis remains the preferred option. However, this could change if the cost of Rh(D) fetal genotyping fell below $140 per sample.

Prevalence and prognostic value of echocardiographic screening for rheumatic heart disease

PubMed Central

Kotit, Susy; Said, Karim; ElFaramawy, Amr; Mahmoud, Hani; Phillips, David I W; Yacoub, Magdi H

2017-01-01

Objective Rheumatic heart disease (RHD) remains a major health problem in many low-income and middle-income countries. The use of echocardiographic imaging suggests that subclinical disease is far more widespread than previously appreciated, but little is known as to how these mild forms of RHD progress. We have determined the prevalence of subclinical RHD in a large group of schoolchildren in Aswan, Egypt and have evaluated its subsequent progression. Methods Echocardiographic screening was performed on 3062 randomly selected schoolchildren, aged 5–15 years, in Aswan, Egypt. Follow-up of children with a definite or borderline diagnosis of RHD was carried out 48–60 months later to determine how the valvular abnormalities altered and to evaluate the factors influencing progression. Results Sixty children were initially diagnosed with definite RHD (19.6 per 1000 children) and 35 with borderline disease (11.4 per 1000); most had mitral valve disease. Of the 72 children followed up progression was documented in 14 children (19.4%) and regression in 30 (41.7%) children. Boys had lower rates of progression while older children had lower rates of regression. Functional defects of the valve even in the presence of structural features were associated with lower rates of progression and higher rates of regression than structural changes. Conclusions RHD has a high prevalence in Egypt. Although a high proportion of the abnormalities originally detected persisted at follow-up, both progression and regression of valve lesions were demonstrated. PMID:29344370

Participation in research improves overall patient management: insights from the Global Rheumatic Heart Disease registry (REMEDY).

PubMed

Prendergast, E A; Perkins, S; Engel, M E; Cupido, B; Francis, V; Joachim, A; Al Kebsi, M; Bode-Thomas, F; Damasceno, A; Abul Fadl, A; El Sayed, A; Gitura, B; Kennedy, N; Ibrahim, A; Mucumbitsi, J; Adeoye, A M; Musuku, J; Okello, E; Olunuga, T; Sheta, S; Mayosi, B M; Zühlke, L J

Rheumatic heart disease (RHD) is a major public health problem in low- and middle-income countries (LIMCs), with a paucity of high-quality trial data to improve patient outcomes. Investigators felt that involvement in a recent large, observational RHD study impacted positively on their practice, but this was poorly defined. The purpose of this study was to document the experience of investigators and research team members from LMICs who participated in a prospective, multi-centre study, the global Rheumatic Heart Disease Registry (REMEDY), conducted in 25 centres in 14 countries from 2010 to 2012. We conducted an online survey of site personnel to identify and quantify their experiences. Telephone interviews were conducted with a subset of respondents to gather additional qualitative data. We asked about their experiences, positive and negative, and about any changes in RHD management practices resulting from their participation in REMEDY as a registry site. The majority of respondents in both the survey and telephone interviews indicated that participation as a registry site improved their management of RHD patients. Administrative changes included increased attention to follow-up appointments and details in patient records. Clinical changes included increased use of penicillin prophylaxis, and more frequent INR monitoring and contraceptive counselling. Our study demonstrates that participation in clinical research on RHD can have a positive impact on patient management. Furthermore, REMEDY has led to increased patient awareness and improved healthcare workers' knowledge and efficiency in caring for RHD patients.

Echocardiographic Screening of Rheumatic Heart Disease in American Samoa.

PubMed

Huang, Jennifer H; Favazza, Michael; Legg, Arthur; Holmes, Kathryn W; Armsby, Laurie; Eliapo-Unutoa, Ipuniuesea; Pilgrim, Thomas; Madriago, Erin J

2018-01-01

While rheumatic heart disease (RHD) is a treatable disease nearly eradicated in the United States, it remains the most common form of acquired heart disease in the developing world. This study used echocardiographic screening to determine the prevalence of RHD in children in American Samoa. Screening took place at a subset of local schools. Private schools were recruited and public schools underwent cluster randomization based on population density. We collected survey information and performed a limited physical examination and echocardiogram using the World Heart Federation protocol for consented school children aged 5-18 years old. Of 2200 students from two private high schools and two public primary schools, 1058 subjects consented and were screened. Overall, 133 (12.9%) children were identified as having either definite (3.5%) or borderline (9.4%) RHD. Of the patients with definitive RHD, 28 subjects had abnormal mitral valves with pathologic regurgitation, three mitral stenosis, three abnormal aortic valves with pathologic regurgitation, and seven borderline mitral and aortic valve disease. Of the subjects with borderline disease, 77 had pathologic mitral regurgitation, 12 pathologic aortic regurgitation, and 7 at least two features of mitral valve disease without pathologic regurgitation or stenosis. Rheumatic heart disease remains a major cause of morbidity and mortality worldwide. The prevalence of RHD in American Samoa (12.9%) is to date the highest reported in the world literature. Echocardiographic screening of school children is feasible, while reliance on murmur and Jones criteria is not helpful in identifying children with RHD.

Angiotensin-converting enzyme gene insertion/deletion polymorphism in Saudi patients with rheumatic heart disease

PubMed Central

Al-Harbi, Khalid M.; Almuzaini, Ibrahim S.; Morsy, Mohamed M.; Abdelaziz, Nada A.; Al-Balawi, Alia M.; Abdallah, Atiyeh M.

2015-01-01

Objectives: To investigate the association between angiotensin-converting enzyme (ACE) insertion/deletion (I/D) polymorphism and rheumatic heart disease (RHD) in Saudi patients. Methods: A case-control study was conducted in Saudi RHD patients. Genomic DNA was isolated from 99 RHD patients attending the Pediatric Cardiology Clinic at the Maternity and Children Hospital, Al-Madinah, Saudi Arabia from March 2013 to June 2014, and from 145 age- and gender-matched controls. Patient clinical records were reviewed to report major and minor modified Jones’ criteria for diagnosis. The diagnosis was confirmed by echocardiography. The ACE I/D polymorphism was identified by polymerase chain reaction. Results: A significant difference in ACE D allele carriage (DD+ID) distribution between RHD cases and controls was identified (p=0.02, odds ratio = 3.6, 95% confidence interval: 1.2-10.8). The D allele carriage was significantly associated with development of mitral valve lesions alone (p=0.03). Conclusion: The ACE I/D polymorphism is associated with an increased risk of RHD in the Saudi population. Further studies are needed to confirm our findings and to understand the molecular mechanisms underlying this association. PMID:25719581

Novel bivalent vectored vaccine for control of myxomatosis and rabbit haemorrhagic disease.

PubMed

Spibey, N; McCabe, V J; Greenwood, N M; Jack, S C; Sutton, D; van der Waart, L

2012-03-24

A novel, recombinant myxoma virus-rabbit haemorrhagic disease virus (RHDV) vaccine has been developed for the prevention of myxomatosis and rabbit haemorrhagic disease (RHD). A number of laboratory studies are described illustrating the safety and efficacy of the vaccine following subcutaneous administration in laboratory rabbits from four weeks of age onwards. In these studies, both vaccinated and unvaccinated control rabbits were challenged using pathogenic strains of RHD and myxoma viruses, and 100 per cent of the vaccinated rabbits were protected against both myxomatosis and RHD.

Rheumatic Heart Disease-Attributable Mortality at Ages 5–69 Years in Fiji: A Five-Year, National, Population-Based Record-Linkage Cohort Study

PubMed Central

Parks, Tom; Kado, Joseph; Miller, Anne E.; Ward, Brenton; Heenan, Rachel; Colquhoun, Samantha M.; Bärnighausen, Till W.; Mirabel, Mariana; Bloom, David E.; Bailey, Robin L.; Tukana, Isimeli N.; Steer, Andrew C.

2015-01-01

Background Rheumatic heart disease (RHD) is considered a major public health problem in developing countries, although scarce data are available to substantiate this. Here we quantify mortality from RHD in Fiji during 2008–2012 in people aged 5–69 years. Methods and Findings Using 1,773,999 records derived from multiple sources of routine clinical and administrative data, we used probabilistic record-linkage to define a cohort of 2,619 persons diagnosed with RHD, observed for all-cause mortality over 11,538 person-years. Using relative survival methods, we estimated there were 378 RHD-attributable deaths, almost half of which occurred before age 40 years. Using census data as the denominator, we calculated there were 9.9 deaths (95% CI 9.8–10.0) and 331 years of life-lost (YLL, 95% CI 330.4–331.5) due to RHD per 100,000 person-years, standardised to the portion of the WHO World Standard Population aged 0–69 years. Valuing life using Fiji’s per-capita gross domestic product, we estimated these deaths cost United States Dollar $6,077,431 annually. Compared to vital registration data for 2011–2012, we calculated there were 1.6-times more RHD-attributable deaths than the number reported, and found our estimate of RHD mortality exceeded all but the five leading reported causes of premature death, based on collapsed underlying cause-of-death diagnoses. Conclusions Rheumatic heart disease is a leading cause of premature death as well as an important economic burden in this setting. Age-standardised death rates are more than twice those reported in current global estimates. Linkage of routine data provides an efficient tool to better define the epidemiology of neglected diseases. PMID:26371755

Root hair-specific disruption of cellulose and xyloglucan in AtCSLD3 mutants, and factors affecting the post-rupture resumption of mutant root hair growth.

PubMed

Galway, Moira E; Eng, Ryan C; Schiefelbein, John W; Wasteneys, Geoffrey O

2011-05-01

The glycosyl transferase encoded by the cellulose synthase-like gene CSLD3/KJK/RHD7 (At3g03050) is required for cell wall integrity during root hair formation in Arabidopsis thaliana but it remains unclear whether it contributes to the synthesis of cellulose or hemicellulose. We identified two new alleles, root hair-defective (rhd) 7-1 and rhd7-4, which affect the C-terminal end of the encoded protein. Like root hairs in the previously characterized kjk-2 putative null mutant, rhd7-1 and rhd7-4 hairs rupture before tip growth but, depending on the growth medium and temperature, hairs are able to survive rupture and initiate tip growth, indicating that these alleles retain some function. At 21°C, the rhd7 tip-growing root hairs continued to rupture but at 5ºC, rupture was inhibited, resulting in long, wild type-like root hairs. At both temperatures, the expression of another root hair-specific CSLD gene, CSLD2, was increased in the rhd7-4 mutant but reduced in the kjk-2 mutant, suggesting that CSLD2 expression is CSLD3-dependent, and that CSLD2 could partially compensate for CSLD3 defects to prevent rupture at 5°C. Using a fluorescent brightener (FB 28) to detect cell wall (1 → 4)-β-glucans (primarily cellulose) and CCRC-M1 antibody to detect fucosylated xyloglucans revealed a patchy distribution of both in the mutant root hair cell walls. Cell wall thickness varied, and immunogold electron microscopy indicated that xyloglucan distribution was altered throughout the root hair cell walls. These cell wall defects indicate that CSLD3 is required for the normal organization of both cellulose and xyloglucan in root hair cell walls.

Congenital heart disease and rheumatic heart disease in Africa: recent advances and current priorities.

PubMed

Zühlke, Liesl; Mirabel, Mariana; Marijon, Eloi

2013-11-01

Africa has one of the highest prevalence of heart diseases in children and young adults, including congenital heart disease (CHD) and rheumatic heart disease (RHD). We present here an extensive review of recent data from the African continent highlighting key studies and information regarding progress in CHD and RHD since 2005. Main findings include evidence that the CHD burden is underestimated mainly due to the poor outcome of African children with CHD. The interest in primary prevention for RHD has been recently re-emphasised, and new data are available regarding echocardiographic screening for subclinical RHD and initiation of secondary prevention. There is an urgent need for comprehensive service frameworks to improve access and level of care and services for patients, educational programmes to reinforce the importance of prevention and early diagnosis and a relevant research agenda focusing on the African context.

Exome-wide Association Study Identifies GREB1L Mutations in Congenital Kidney Malformations.

PubMed

Sanna-Cherchi, Simone; Khan, Kamal; Westland, Rik; Krithivasan, Priya; Fievet, Lorraine; Rasouly, Hila Milo; Ionita-Laza, Iuliana; Capone, Valentina P; Fasel, David A; Kiryluk, Krzysztof; Kamalakaran, Sitharthan; Bodria, Monica; Otto, Edgar A; Sampson, Matthew G; Gillies, Christopher E; Vega-Warner, Virginia; Vukojevic, Katarina; Pediaditakis, Igor; Makar, Gabriel S; Mitrotti, Adele; Verbitsky, Miguel; Martino, Jeremiah; Liu, Qingxue; Na, Young-Ji; Goj, Vinicio; Ardissino, Gianluigi; Gigante, Maddalena; Gesualdo, Loreto; Janezcko, Magdalena; Zaniew, Marcin; Mendelsohn, Cathy Lee; Shril, Shirlee; Hildebrandt, Friedhelm; van Wijk, Joanna A E; Arapovic, Adela; Saraga, Marijan; Allegri, Landino; Izzi, Claudia; Scolari, Francesco; Tasic, Velibor; Ghiggeri, Gian Marco; Latos-Bielenska, Anna; Materna-Kiryluk, Anna; Mane, Shrikant; Goldstein, David B; Lifton, Richard P; Katsanis, Nicholas; Davis, Erica E; Gharavi, Ali G

2017-11-02

Renal agenesis and hypodysplasia (RHD) are major causes of pediatric chronic kidney disease and are highly genetically heterogeneous. We conducted whole-exome sequencing in 202 case subjects with RHD and identified diagnostic mutations in genes known to be associated with RHD in 7/202 case subjects. In an additional affected individual with RHD and a congenital heart defect, we found a homozygous loss-of-function (LOF) variant in SLIT3, recapitulating phenotypes reported with Slit3 inactivation in the mouse. To identify genes associated with RHD, we performed an exome-wide association study with 195 unresolved case subjects and 6,905 control subjects. The top signal resided in GREB1L, a gene implicated previously in Hoxb1 and Shha signaling in zebrafish. The significance of the association, which was p = 2.0 × 10 -5 for novel LOF, increased to p = 4.1 × 10 -6 for LOF and deleterious missense variants combined, and augmented further after accounting for segregation and de novo inheritance of rare variants (joint p = 2.3 × 10 -7 ). Finally, CRISPR/Cas9 disruption or knockdown of greb1l in zebrafish caused specific pronephric defects, which were rescued by wild-type human GREB1L mRNA, but not mRNA containing alleles identified in case subjects. Together, our study provides insight into the genetic landscape of kidney malformations in humans, presents multiple candidates, and identifies SLIT3 and GREB1L as genes implicated in the pathogenesis of RHD. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

An open-access, mobile compatible, electronic patient register for rheumatic heart disease ('eRegister') based on the World Heart Federation's framework for patient registers.

PubMed

van Dam, Joris; Musuku, John; Zühlke, Liesl J; Engel, Mark E; Nestle, Nick; Tadmor, Brigitta; Spector, Jonathan; Mayosi, Bongani M

2015-01-01

Rheumatic heart disease (RHD) remains a major disease burden in low-resource settings globally. Patient registers have long been recognised to be an essential instrument in RHD control and elimination programmes, yet to date rely heavily on paper-based data collection and non-networked data-management systems, which limit their functionality. To assess the feasibility and potential benefits of producing an electronic RHD patient register. We developed an eRegister based on the World Heart Federation's framework for RHD patient registers using CommCare, an open-source, cloud-based software for health programmes that supports the development of customised data capture using mobile devices. The resulting eRegistry application allows for simultaneous data collection and entry by field workers using mobile devices, and by providers using computer terminals in clinics and hospitals. Data are extracted from CommCare and are securely uploaded into a cloud-based database that matches the criteria established by the WHF framework. The application can easily be tailored to local needs by modifying existing variables or adding new ones. Compared with traditional paper-based data-collection systems, the eRegister reduces the risk of data error, synchronises in real-time, improves clinical operations and supports management of field team operations. The user-friendly eRegister is a low-cost, mobile, compatible platform for RHD treatment and prevention programmes based on materials sanctioned by the World Heart Federation. Readily adaptable to local needs, this paperless RHD patient register program presents many practical benefits.

Prophylactic penicillin by the full moon: a novel approach in Central Australia that may help to reduce the risk of rheumatic heart disease.

PubMed

Kearns, T M; Schultz, R; McDonald, V; Andrews, R M

2010-01-01

Uptake of penicillin prophylaxis to prevent recurrent rheumatic fever and its sequela rheumatic heart disease (RHD) is not optimal in the Northern Territory of Australia. The Full Moon Strategy (the Strategy) was introduced in the Central Australian region in June 2006 to improve the uptake of prophylactic penicillin: clients and healthcare workers were encouraged to use the full moon as a cue for the timing of the 4 weekly prophylactic penicillin injection. To determine the impact and effectiveness of the Strategy on knowledge and uptake of benzathine penicillin prophylaxis for clients at risk of RHD, and for primary healthcare workers in Central Australia. Clients at risk of RHD in four remote Aboriginal communities and the town camps of Alice Springs were identified from the RHD database. Consenting clients or their carers were interviewed about their knowledge of the Strategy and the health promotional tools used. Their healthcare records were then reviewed for prophylaxis uptake 2 years prior to and 2 years following the introduction of the Strategy. Primary healthcare workers in the four remote communities who were available at the time of the study visit were interviewed about their knowledge and use of the Strategy and the health promotional tools. Fifty RHD clients and 19 healthcare workers were interviewed. Most were aware of the flipchart but less than half knew of the calendar poster, hand-held card or radio advertisement. Prophylaxis uptake increased significantly from 47% in the 2 years prior to the introduction of the Strategy, to 57% 2 years after the Strategy was introduced. Introduction of the Strategy coincided with an improvement in uptake of prophylaxis but not around the time of the full moon. Uptake of benzathine penicillin remains inadequate and further innovative measures are needed to control rheumatic fever and its sequela in Aboriginal and Torres Strait Islander people.

S-nitrosoglutathione promotes cell wall remodelling, alters the transcriptional profile and induces root hair formation in the hairless root hair defective 6 (rhd6) mutant of Arabidopsis thaliana.

PubMed

Moro, Camila Fernandes; Gaspar, Marilia; da Silva, Felipe Rodrigues; Pattathil, Sivakumar; Hahn, Michael G; Salgado, Ione; Braga, Marcia Regina

2017-03-01

Nitric oxide (NO) exerts pleiotropic effects on plant development; however, its involvement in cell wall modification during root hair formation (RHF) has not yet been addressed. Here, mutants of Arabidopsis thaliana with altered root hair phenotypes were used to assess the involvement of S-nitrosoglutathione (GSNO), the primary NO source, in cell wall dynamics and gene expression in roots induced to form hairs. GSNO and auxin restored the root hair phenotype of the hairless root hair defective 6 (rhd6) mutant. A positive correlation was observed between increased NO production and RHF induced by auxin in rhd6 and transparent testa glabra (ttg) mutants. Deposition of an epitope within rhamnogalacturonan-I recognized by the CCRC-M2 antibody was delayed in root hair cells (trichoblasts) compared with nonhair cells (atrichoblasts). GSNO, but not auxin, restored the wild-type root glycome and transcriptome profiles in rhd6, modulating the expression of a large number of genes related to cell wall composition and metabolism, as well as those encoding ribosomal proteins, DNA and histone-modifying enzymes and proteins involved in post-translational modification. Our results demonstrate that NO plays a key role in cell wall remodelling in trichoblasts and suggest that it also participates in chromatin modification in root cells of A. thaliana. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Design of a potent antibiotic peptide based on the active region of human defensin 5.

PubMed

Wang, Cheng; Shen, Mingqiang; Gohain, Neelakshi; Tolbert, William D; Chen, Fang; Zhang, Naixin; Yang, Ke; Wang, Aiping; Su, Yongping; Cheng, Tianmin; Zhao, Jinghong; Pazgier, Marzena; Wang, Junping

2015-04-09

Human defensin 5 (HD5) is a broad-spectrum antibacterial peptide with a C-terminal active region. To promote the development of this peptide into an antibiotic, we initially substituted Glu21 with Arg because it is an electronegative residue located around the active region. Although detrimental to dimer formation, the E21R substitution markedly enhanced the antibacterial activity of HD5 and increased its ability to penetrate cell membranes, demonstrating that increasing the electropositive charge compensated for the effect of dimer disruption. Subsequently, a partial Arg scanning mutagenesis was performed, and Thr7 was selected for replacement with Arg to further strengthen the antibacterial activity. The newly designed peptide, T7E21R-HD5, exhibited potent antibacterial activity, even in saline and serum solutions. In contrast to monomeric E21R-HD5, T7E21R-HD5 assembled into an atypical dimer with parallel β strands, thus expanding the role of increasing electropositive charge in bactericidal activity and providing a useful guide for further defensin-derived antibiotic design.

Rheumatic Heart Disease Prophylaxis in Older Patients: A Register-Based Audit of Adherence to Guidelines

PubMed Central

Holland, James V; Hardie, Kate; de Dassel, Jessica; Ralph, Anna P

2018-01-01

Abstract Background Prevention of rheumatic heart disease (RHD) remains challenging in high-burden settings globally. After acute rheumatic fever (ARF), secondary antibiotic prophylaxis is required to prevent RHD. International guidelines on recommended durations of secondary prophylaxis differ, with scope for clinician discretion. Because ARF risk decreases with age, ongoing prophylaxis is generally considered unnecessary beyond approximately the third decade. Concordance with guidelines on timely cessation of prophylaxis is unknown. Methods We undertook a register-based audit to determine the appropriateness of antibiotic prophylaxis among clients aged ≥35 years in Australia’s Northern Territory. Data on demographics, ARF episode(s), RHD severity, prophylaxis type, and relevant clinical notes were extracted. The determination of guideline concordance was based on whether (1) national guidelines were followed; (2) a reason for departure from guidelines was documented; (3) lifelong continuation was considered appropriate in all cases of severe RHD. Results We identified 343 clients aged ≥35 years prescribed secondary prophylaxis. Guideline concordance was 39% according to national guidelines, 68% when documented reasons for departures from guidelines were included and 82% if patients with severe RHD were deemed to need lifelong prophylaxis. Shorter times since last echocardiogram or cardiologist review were associated with greater likelihood of guideline concordance (P < .001). The median time since last ARF was 5.9 years in the guideline-concordant group and 24.0 years in the nonconcordant group (P < .001). Thirty-two people had an ARF episode after age 40 years. Conclusions In this setting, appropriate discontinuation of RHD prophylaxis could be improved through timely specialist review to reduce unnecessary burden on clients and health systems.

An open-access mobile compatible electronic patient register for rheumatic heart disease (‘eRegister’) based on the World Heart Federation’s framework for patient registers

PubMed Central

van Dam, Joris; Tadmor, Brigitta; Spector, Jonathan; Musuku, John; Zühlke, Liesl J; Zühlke, Liesl J; Engel, Mark E; Mayosi, Bongani M; Nestle, Nick

2015-01-01

Summary Background Rheumatic heart disease (RHD) remains a major disease burden in low-resource settings globally. Patient registers have long been recognised to be an essential instrument in RHD control and elimination programmes, yet to date rely heavily on paper-based data collection and non-networked data-management systems, which limit their functionality. Objectives To assess the feasibility and potential benefits of producing an electronic RHD patient register. Methods We developed an eRegister based on the World Heart Federation’s framework for RHD patient registers using CommCare, an open-source, cloud-based software for health programmes that supports the development of customised data capture using mobile devices. Results The resulting eRegistry application allows for simultaneous data collection and entry by field workers using mobile devices, and by providers using computer terminals in clinics and hospitals. Data are extracted from CommCare and are securely uploaded into a cloud-based database that matches the criteria established by the WHF framework. The application can easily be tailored to local needs by modifying existing variables or adding new ones. Compared with traditional paper-based data-collection systems, the eRegister reduces the risk of data error, synchronises in real-time, improves clinical operations and supports management of field team operations. Conclusions The user-friendly eRegister is a low-cost, mobile, compatible platform for RHD treatment and prevention programmes based on materials sanctioned by the World Heart Federation. Readily adaptable to local needs, this paperless RHD patient register program presents many practical benefits. PMID:26444995

Resource allocation and funding challenges for regional local health departments in Nebraska.

PubMed

Chen, Li-Wu; Jacobson, Janelle; Roberts, Sara; Palm, David

2012-01-01

This study examined the mechanism of resource allocation among member counties and the funding challenges of regional health departments (RHDs) in Nebraska. DESIGN AND STUDY SETTING: In 2009, we conducted a qualitative case study of 2 Nebraska RHDs to gain insight into their experiences of making resource allocation decisions and confronting funding challenges. The 2 RHD sites were selected for this case study on the basis of their heterogeneity in terms of population distribution in member counties. Sixteen semistructured in-person interviews were conducted with RHD directors, staff, and board of health members. Interview data were coded and analyzed using NVivo qualitative analysis software (QSR International [Americas] Inc., Cambridge, MA). Our findings suggested that the directors of RHDs play an integral role in making resource allocation decisions on the basis of community needs, not on a formula or on individual county population size. Interviewees also reported that the size of the vulnerable population served by the RHD had a significant impact on the level of resources for RHD's programs. The RHD's decisions about resource allocation were also dependent on the amount and type of resources received from the state. Interviewees identified inadequacy and instability of funding as the 2 main funding challenges for their RHD. These challenges negatively impacted workforce capacity and the long-term sustainability of some programs. Regional health departments may not benefit from better leveraging resources and building a stronger structural capacity unless the issues of funding inadequacy and instability are addressed. Strategies that can be used by RHDs to address these funding challenges include seeking grants to support programs, leveraging existing resources, and building community partnerships to share resources. Future research is needed to identify RHDs' optimal workforce capacity, required funding level, and potential funding mechanisms.

Relevance and costs of RHD genotyping in women with a weak D phenotype.

PubMed

Laget, L; Izard, C; Durieux-Roussel, E; Gouvitsos, J; Dettori, I; Chiaroni, J; Ferrera-Tourenc, V

2018-06-01

For pregnant women, the serologic test results of D antigen will determine the frequency of RBC antibody detection as well as the indication for RhIG prophylaxis. RHD genotyping is the only method that may provide clear guidance on prophylaxis for women with a weak D phenotype. This analysis evaluated the economical implications of using RHD genotyping to guide RhIG prophylaxis among pregnant women with a serological weak D phenotype. We compared the costs of 2 strategies in a cohort of 273 women with weak D phenotype. In the first strategy, we did not perform genotyping and all women with weak D phenotypes were treated as if they were D-, thus considered to be a risk of RhD alloimmunization. These women all received the prophylactic follow up. In the second strategy, RHD genotyping was performed on all women with a serologic weak D phenotype. Then, the follow-up will be determined by phenotype deduced from genotype. On the studied cohort, the additional expense occurred by genotyping is 26,536 €. RHD Genotyping has highlighted 162 weak D Type 1, 2 3, that could safely be managed as D+ and 111 partial D to consider as D-. By comparing the 2 strategies, the savings generated by genotyping the patients of our cohort are € 12,046 for the follow up of one pregnancy. Knowing that in France, a woman has on average 2 pregnancies and that the genotyping is carried out only once, the savings generated for the following pregnancies would be € 38,581. Performing RHD genotyping for pregnant women with a weak D phenotype enables to clearly identify weak D type 1, 2 or 3 from the other variants at risk of alloimmunization. This analysis generates savings in terms of follow-up schedule of pregnant women and RhIG prophylaxis. It also allows saving of D- products for patient with a weak D type 1, 2 or 3 in case of a transfusion need. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

The assessment of pragmatics in Iranian patients with right brain damage

PubMed Central

Sobhani-Rad, Davood; Ghorbani, Askar; Ashayeri, Hassan; Jalaei, Shohereh; Mahmoodi-Bakhtiari, Behrooz

2014-01-01

Background: Pragmatics is appropriate use of language across a variety of social contexts that provides accurate interpretation of intentions. The occurrence of the right hemisphere lesions can interfere with pragmatic abilities, and particularly with the processing of nonliteral speech acts. Methods: Since the objective of this study was to assess different aspects of pragmatic competence in the right hemisphere damage (RHD) patients, 20 Iranian patients with right hemisphere lesions were examined by adult pragmatic profile (APP) and a novel checklist was introduced for Persian language speaking individuals. Meanwhile, 40 healthy adult individuals, who were age and gender matched with RHD patients, were considered as the control group. After obtaining video records, all subjects were evaluated for 35 pragmatic skills, including 24 verbal, 5 paralinguistic, and 6 nonverbal aspects, by a two-point scale system. Results: Studying RHD patients and their healthy counterparts revealed that the performance by participants with right hemisphere lesions exhibited a high degree of inappropriate pragmatic abilities compared with controls in all domains. Furthermore, RHD patients showed a trend of increasing difficulty in understanding and producing different pragmatic phenomena, including standard communication acts. Conclusion: Present results indicated that the right hemisphere lesions significantly affected pragmatic abilities in verbal, paralinguistic and nonverbal aspects. Such a pattern of performance, which is in line with deficits previously reported for RHD, proved the unquestioned role of the right hemisphere in processing nonliteral language. PMID:25295151

The role of RhD agglutination for the detection of weak D red cells by anti-D flow cytometry.

PubMed

Grey, D E; Davies, J I; Connolly, M; Fong, E A; Erber, W N

2005-04-01

Anti-D flow cytometry is an accurate method for quantifying feto-maternal haemorrhage (FMH). However, weak D red cells with <1000 RhD sites are not detectable using this methodology but are immunogenic. As quantitation of RhD sites is not practical, an alternative approach is required to identify those weak D fetal red cells where anti-D flow cytometry is inappropriate. We describe a simple algorithm based on RhD agglutination and flow cytometry peak separation. All weak D (n = 34) gave weak agglutination with RUM-1 on immediate spin (grading

The assessment of pragmatics in Iranian patients with right brain damage.

PubMed

Sobhani-Rad, Davood; Ghorbani, Askar; Ashayeri, Hassan; Jalaei, Shohereh; Mahmoodi-Bakhtiari, Behrooz

2014-04-03

Pragmatics is appropriate use of language across a variety of social contexts that provides accurate interpretation of intentions. The occurrence of the right hemisphere lesions can interfere with pragmatic abilities, and particularly with the processing of nonliteral speech acts. Since the objective of this study was to assess different aspects of pragmatic competence in the right hemisphere damage (RHD) patients, 20 Iranian patients with right hemisphere lesions were examined by adult pragmatic profile (APP) and a novel checklist was introduced for Persian language speaking individuals. Meanwhile, 40 healthy adult individuals, who were age and gender matched with RHD patients, were considered as the control group. After obtaining video records, all subjects were evaluated for 35 pragmatic skills, including 24 verbal, 5 paralinguistic, and 6 nonverbal aspects, by a two-point scale system. Studying RHD patients and their healthy counterparts revealed that the performance by participants with right hemisphere lesions exhibited a high degree of inappropriate pragmatic abilities compared with controls in all domains. Furthermore, RHD patients showed a trend of increasing difficulty in understanding and producing different pragmatic phenomena, including standard communication acts. Present results indicated that the right hemisphere lesions significantly affected pragmatic abilities in verbal, paralinguistic and nonverbal aspects. Such a pattern of performance, which is in line with deficits previously reported for RHD, proved the unquestioned role of the right hemisphere in processing nonliteral language.

Application of a Multivariant, Caucasian-Specific, Genotyped Donor Panel for Performance Validation of MDmulticard®, ID-System®, and Scangel® RhD/ABO Serotyping

PubMed Central

Gassner, Christoph; Rainer, Esther; Pircher, Elfriede; Markut, Lydia; Körmöczi, Günther F.; Jungbauer, Christof; Wessin, Dietmar; Klinghofer, Roswitha; Schennach, Harald; Schwind, Peter; Schönitzer, Diether

2009-01-01

Summary Background Validations of routinely used serological typing methods require intense performance evaluations typically including large numbers of samples before routine application. However, such evaluations could be improved considering information about the frequency of standard blood groups and their variants. Methods Using RHD and ABO population genetic data, a Caucasian-specific donor panel was compiled for a performance comparison of the three RhD and ABO serological typing methods MDmulticard (Medion Diagnostics), ID-System (DiaMed) and ScanGel (Bio-Rad). The final test panel included standard and variant RHD and ABO genotypes, e.g. RhD categories, partial and weak RhDs, RhD DELs, and ABO samples, mainly to interpret weak serological reactivity for blood group A specificity. All samples were from individuals recorded in our local DNA blood group typing database. Results For ‘standard’ blood groups, results of performance were clearly interpretable for all three serological methods compared. However, when focusing on specific variant phenotypes, pronounced differences in reaction strengths and specificities were observed between them. Conclusions A genetically and ethnically predefined donor test panel consisting of 93 individual samples only, delivered highly significant results for serological performance comparisons. Such small panels offer impressive representative powers, higher as such based on statistical chances and large numbers only. PMID:21113264

Partnership for sustainability in cardiac surgery to address critical rheumatic heart disease in sub-Saharan Africa: the experience from Rwanda.

PubMed

Swain, JaBaris D; Pugliese, Daniel N; Mucumbitsi, Joseph; Rusingiza, Emmanuel K; Ruhamya, Nathan; Kagame, Abel; Ganza, Gapira; Come, Patricia C; Breakey, Suellen; Greenwood, Bonnie; Muehlschlegel, Jochen D; Patton-Bolman, Cecilia; Binagwaho, Agnes; Morton Bolman, R

2014-09-01

Rheumatic heart disease (RHD) in the developing world results in critical disability among children, adolescents, and young adults-marginalizing a key population at its peak age of productivity. Few regions in sub-Saharan Africa have independently created an effective strategy to detect and treat streptococcal infection and mitigate its progression to RHD. We describe a unique collaboration, where the Rwanda Ministry of Health, the Rwanda Heart Foundation, and an expatriate humanitarian cardiac surgery program have together leveraged an innovative partnership as a means to expand Rwanda's current capacity to address screening and primary prevention, as well as provide life-saving cardiac surgery for patients with critical RHD. Interviews with key personnel and review of administrative records were conducted to obtain qualitative and quantitative data on the recruitment of clinical personnel, procurement of equipment, and program finances. The number of surgical cases completed and the resultant clinical outcomes are reviewed. From 2008 to 2013, six annual visits were completed. A total of 128 prosthetic valves have been implanted in 86 complex patients in New York Heart Association (NYHA) class III or IV heart failure, with excellent clinical outcomes (5 % 30-day mortality). Postoperative complications included a cerebrovascular accident (n = 1) and hemorrhage, requiring reoperation (n = 2). All procedures were performed with participation of local personnel. This strategy provides a reliable and consistent model of sophisticated specialty care delivery; inclusive of patient-centered cardiac surgery, mentorship, didactics, skill transfer, and investment in a sustainable cardiac program to address critical RHD in sub-Saharan Africa.

Spontaneous Humor among Right Hemisphere Stroke Survivors

ERIC Educational Resources Information Center

Heath, R.L.; Blonder, L.X.

2005-01-01

We analyzed spontaneous conversational humor production and response among 11 right hemisphere-damaged (RHD) patients, 10 left hemisphere-damaged (LHD) patients, 7 normal controls (NC), and their spouses. RHD patients and their spouses reported a statistically significant decline in the patients' orientation to humor post-stroke. Also, we found a…

A novel, implicit treatment for language comprehension processes in right hemisphere brain damage: Phase I data

PubMed Central

Tompkins, Connie A.; Blake, Margaret T.; Wambaugh, Julie; Meigh, Kimberly

2012-01-01

Background This manuscript reports the initial phase of testing for a novel, “Contextual constraint” treatment, designed to stimulate inefficient language comprehension processes in adults with right hemisphere brain damage (RHD). Two versions of treatment were developed to target two normal comprehension processes that have broad relevance for discourse comprehension and that are often disrupted by RHD: coarse semantic coding and suppression. The development of the treatment was informed by two well-documented strengths of the RHD population. The first is consistently better performance on assessments that are implicit, or nearly so, than on explicit, metalinguistic measures of language and cognitive processing. The second is improved performance when given linguistic context that moderately-to-strongly biases an intended meaning. Treatment consisted of providing brief context sentences to prestimulate, or constrain, intended interpretations. Participants made no explicit associations or judgments about the constraint sentences; rather, these contexts served only as implicit primes. Aims This Phase I treatment study aimed to determine the effects of a novel, implicit, Contextual Constraint treatment in adults with RHD whose coarse coding or suppression processes were inefficient. Treatment was hypothesized to speed coarse coding or suppression function in these individuals. Methods & Procedures Three adults with RHD participated in this study, one (P1) with a coarse coding deficit and two (P2, P3) with suppression deficits. Probe tasks were adapted from prior studies of coarse coding and suppression in RHD. The dependent measure was the percentage of responses that met predetermined response time criteria. When pre-treatment baseline performance was stable, treatment was initiated. There were two levels of contextual constraint, Strong and Moderate, and treatment for each item began with the provision of the Strong constraint context. Outcomes & Results Treatment-contingent gains were evident after brief periods of treatment, for P1 on two treatment lists, and for P2. P3 made slower but still substantial gains. Maintenance of gains was evident for P1, the only participant for whom it was measured. Conclusions This Phase I treatment study documents the potential for considerable gains from an implicit, Contextual constraint treatment. If replicated, this approach to treatment may hold promise for individuals who do poorly with effortful, metalinguistic treatment tasks, or for whom it is desirable to minimize errors during treatment. The real test of this treatment’s benefit will come from later phase studies of study, which will test broad-based generalization to various aspects of discourse comprehension. PMID:22368317

Weak D Type 4.2.2 (DAR1.2) in an African child: Serology and molecular characterization.

PubMed

Orlando, Nicoletta; Putzulu, Rossana; Massini, Giuseppina; Scavone, Fernando; Piccirillo, Nicola; Maresca, Maddalena; Zini, Gina; Teofili, Luciana

2015-04-01

The weak D phenotype is represented by a group of RHD genotypes that code for alterated RhD proteins associated with a reduced RhD expression on red blood cell. By routine serology, some partial D variants are likely to be missed. In this report we describe the case of a three-year-old Black African child with a "unclear" reaction with monoclonal anti-D. We analyzed the blood sample of the child with different methods to conclude that it is a case of DAR 1.2 (weak D 4.2.2) and that it must be transfused with D negative erithrocytes. Copyright © 2014 Elsevier Ltd. All rights reserved.

Theoretical Considerations for Understanding “Understanding” by Adults With Right Hemisphere Brain Damage

PubMed Central

Tompkins, Connie A.

2009-01-01

This article reviews and evaluates leading accounts of narrative comprehension deficits in adults with focal damage to the right cerebral hemisphere (RHD). It begins with a discussion of models of comprehension, which explain how comprehension proceeds through increasingly complex levels of representation. These models include two phases of comprehension processes, broad activation of information as well as pruning and focusing interpretation of meaning based on context. The potential effects of RHD on each processing phase are reviewed, focusing on factors that range from relatively specific (e.g., how the right versus the left hemisphere activate word meanings; how the right hemisphere is involved in inferencing) to more general (the influence of cognitive resource factors; the role of suppression of contextually-irrelevant information). Next, two specific accounts of RHD comprehension difficulties, coarse coding and suppression deficit, are described. These have been construed as opposing processes, but a possible reconciliation is proposed related to the different phases of comprehension and the extent of meaning activation. Finally, the article addresses the influences of contextual constraint on language processing and the continuity of literal and nonliteral language processing, two areas in which future developments may assist our clinical planning PMID:20011667

PHYSICAL-CONSTRAINT-PRESERVING CENTRAL DISCONTINUOUS GALERKIN METHODS FOR SPECIAL RELATIVISTIC HYDRODYNAMICS WITH A GENERAL EQUATION OF STATE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Kailiang; Tang, Huazhong, E-mail: wukl@pku.edu.cn, E-mail: hztang@math.pku.edu.cn

The ideal gas equation of state (EOS) with a constant adiabatic index is a poor approximation for most relativistic astrophysical flows, although it is commonly used in relativistic hydrodynamics (RHD). This paper develops high-order accurate, physical-constraints-preserving (PCP), central, discontinuous Galerkin (DG) methods for the one- and two-dimensional special RHD equations with a general EOS. It is built on our theoretical analysis of the admissible states for RHD and the PCP limiting procedure that enforce the admissibility of central DG solutions. The convexity, scaling invariance, orthogonal invariance, and Lax–Friedrichs splitting property of the admissible state set are first proved with themore » aid of its equivalent form. Then, the high-order central DG methods with the PCP limiting procedure and strong stability-preserving time discretization are proved, to preserve the positivity of the density, pressure, specific internal energy, and the bound of the fluid velocity, maintain high-order accuracy, and be L {sup 1}-stable. The accuracy, robustness, and effectiveness of the proposed methods are demonstrated by several 1D and 2D numerical examples involving large Lorentz factor, strong discontinuities, or low density/pressure, etc.« less

Standard echocardiography versus handheld echocardiography for the detection of subclinical rheumatic heart disease: protocol for a systematic review

PubMed Central

Telford, Lisa H; Abdullahi, Leila H; Ochodo, Eleanor A; Engel, Mark E

2018-01-01

Introduction Rheumatic heart disease (RHD) is a preventable and treatable chronic condition which persists in many developing countries largely affecting impoverished populations. Handheld echocardiography presents an opportunity to address the need for more cost-effective methods of diagnosing RHD in developing countries, where the disease continues to carry high rates of morbidity and mortality. Preliminary studies have demonstrated moderate sensitivity as well as high specificity and diagnostic odds for detecting RHD in asymptomatic patients. We describe a protocol for a systematic review on the diagnostic performance of handheld echocardiography compared to standard echocardiography using the 2012 World Heart Federation criteria for diagnosing subclinical RHD. Methods and analysis Electronic databases including PubMed, Scopus, Web of Science and EBSCOhost as well as reference lists and citations of relevant articles will be searched from 2012 to date using a predefined strategy incorporating a combination of Medical Subject Heading terms and keywords. The methodological validity and quality of studies deemed eligible for inclusion will be assessed against review specific Quality Assessment of Diagnostic Accuracy Studies 2 criteria and information on metrics of diagnostic accuracy and demographics extracted. Forest plots of sensitivity and specificity as well as scatter plots in receiver operating characteristic (ROC) space will be used to investigate heterogeneity. If possible, a meta-analysis will be conducted to produce summary results of sensitivity and specificity using the Hierarchical Summary ROC method. In addition, a sensitivity analysis will be conducted to investigate the effect of studies with a high risk of bias. Ethics and dissemination Ethics approval is not required for this systematic review of previously published literature. The planned review will provide a summary of the diagnostic accuracy of handheld echocardiography. Results may feed into evidence-based guidelines and should the findings of this review warrant a change in clinical practice, a summary report will be disseminated among leading clinicians and healthcare professionals in the field. PROSPERO registration number CRD42016051261. PMID:29440164

RhD isoimmunization and current management modalities.

PubMed

Neal, J L

2001-01-01

To review the literature on current perspectives and treatment of RhD isoimmunization. A search was conducted on MEDLINE and CINAHL, and supplemental articles/ bulletins were obtained from cited references and the Web site of the American College of Obstetricians and Gynecologists. Recent texts also were reviewed. Key search words: isoimmunization, Rho (d) immune globulin, fetal erythroblastosis, intrauterine blood transfusions, alloimmunization. Articles and comprehensive works from indexed journals in the English language relevant to key words and published after 1995 were evaluated. Historically relevant periodicals and texts were also reviewed and selected. Data were extracted and organized under the following headings: testing of the antepartum patient, antepartum treatment of isoimmunization, testing of the postpartum patient, anti-D immune globulin, antepartum anti-D immune globulin prophylaxis, other antepartum and obstetric indications for anti-D immune globulin administration, postpartum anti-D immune globulin prophylaxis, nursing implications, and future possibilities. RhD isoimmunized pregnancies continue to contribute to worldwide perinatal and neonatal morbidity and mortality. This review describes the basic knowledge necessary to care for these pregnancies and the current management modalities. The management options for RhD compromised gestations continue to evolve almost as quickly as technological advances are made. Multiple areas of research in this field have surfaced, and nurses can become valuable members of these research teams. The literature also indicates that with the available knowledge and resources, the current rate of RhD isoimmunization can be further decreased with closer adherence to proposed management guidelines by all health care professionals.

Rheumatic heart disease in indigenous populations--New Zealand experience.

PubMed

Wilson, Nigel

2010-01-01

Rheumatic fever continues unabated among the indigenous Māori and Pacific Island New Zealanders. Ethnic disparities have increased in the past decade. The major success story for disease control has been secondary penicillin prophylaxis with 28-day intramuscular benzathine penicillin with high penicillin delivery rates and low recurrence rates. A landmark study for primary prevention of acute rheumatic fever for group A streptococcal pharyngitis was published in 2009. New Zealand has helped establish the role of echocardiography in acute rheumatic fever, with subclinical carditis incorporated into guidelines as a major criterion of rheumatic fever in high prevalence regions. The rates of mitral valve repair for rheumatic heart disease (RHD) are currently greater than 90% in the children's cardiac unit but remain low in adult cardiac units in New Zealand. This is particularly relevant to women of child bearing age where New Zealand data has shown that pregnancy outcomes for mothers with prosthetic valves on warfarin are poor. There are new initiatives to prevent severe RHD using portable echocardiography by screening school aged children. The prevalence of definite RHD was 2.4% in a large cohort of socially disadvantaged children in South Auckland studied in 2007-2008. Cost benefit models of screening need to be developed. Ongoing research involves international consensus standardisation of RHD patterns, and the need to define the natural history of subclinical RHD. Copyright 2010 Australasian Society of Cardiac and Thoracic Surgeons and the Cardiac Society of Australia and New Zealand. Published by Elsevier B.V. All rights reserved.

Newly diagnosed rheumatic heart disease among indigenous populations in the Pacific.

PubMed

Mirabel, Mariana; Tafflet, Muriel; Noël, Baptiste; Parks, Tom; Axler, Olivier; Robert, Jacques; Nadra, Marie; Phelippeau, Gwendolyne; Descloux, Elodie; Cazorla, Cécile; Missotte, Isabelle; Gervolino, Shirley; Barguil, Yann; Rouchon, Bernard; Laumond, Sylvie; Jubeau, Thierry; Braunstein, Corinne; Empana, Jean-Philippe; Marijon, Eloi; Jouven, Xavier

2015-12-01

Rheumatic heart disease (RHD) remains the leading acquired heart disease in the young worldwide. We aimed at assessing outcomes and influencing factors in the contemporary era. Hospital-based cohort in a high-income island nation where RHD remains endemic and the population is captive. All patients admitted with newly diagnosed RHD according to World Heart Federation echocardiographic criteria were enrolled (2005-2013). The incidence of major cardiovascular events (MACEs) including heart failure, peripheral embolism, stroke, heart valve intervention and cardiovascular death was calculated, and their determinants identified. Of the 396 patients, 43.9% were male with median age 18 years (IQR 10-40)). 127 (32.1%) patients presented with mild, 131 (33.1%) with moderate and 138 (34.8%) with severe heart valve disease. 205 (51.8%) had features of acute rheumatic fever. 106 (26.8%) presented with at least one MACE. Among the remaining 290 patients, after a median follow-up period of 4.08 (95% CI 1.84 to 6.84) years, 7 patients (2.4%) died and 62 (21.4%) had a first MACE. The annual incidence of first MACE and of heart failure were 59.05‰ (95% CI 44.35 to 73.75) and 29.06‰ (95% CI 19.29 to 38.82), respectively. The severity of RHD at diagnosis (moderate vs mild HR 3.39 (0.95 to 12.12); severe vs mild RHD HR 10.81 (3.11 to 37.62), p<0.001) and ongoing secondary prophylaxis at follow-up (HR 0.27 (0.12 to 0.63), p=0.01) were the two most influential factors associated with MACE. Newly diagnosed RHD is associated with poor outcomes, mainly in patients with moderate or severe valve disease and no secondary prophylaxis. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Epidemiology, health systems and stakeholders in rheumatic heart disease in Africa: a systematic review protocol

PubMed Central

Moloi, Annesinah Hlengiwe; Watkins, David; Engel, Mark E; Mall, Sumaya; Zühlke, Liesl

2016-01-01

Introduction Rheumatic heart disease (RHD) is a chronic disease affecting the heart valves, secondary to group A streptococcal infection (GAS) and subsequent acute rheumatic fever (ARF). However, RHD cure and preventative measures are inextricably linked with socioeconomic development, as the disease mainly affects children and young adults living in poverty. In order to address RHD, public health officials and health policymakers require up-to-date knowledge on the epidemiology of GAS, ARF and RHD, as well as the existing enablers and gaps in delivery of evidence-based care for these conditions. We propose to conduct a systematic review to assess the literature comprehensively, synthesising all existing quantitative and qualitative data relating to RHD in Africa. Methods and analysis We plan to conduct a comprehensive literature search using a number of databases and reference lists of relevant articles published from January 1995 to December 2015. Two evaluators will independently review and extract data from each article. Additionally, we will assess overall study quality and risk of bias, using the Newcastle-Ottawa Scale and the Critical Appraisal Skills Programme criteria for quantitative and qualitative studies, respectively. We will meta-analyse estimates of prevalence, incidence, case fatality and mortality for each of the conditions separately for each country. Qualitative meta-analysis will be conducted for facilitators and barriers in RHD health access. Lastly, we will create a list of key stakeholders. This protocol is registered in the PROSPERO International Prospective Register of systematic reviews, registration number CRD42016032852. Ethics and dissemination The information provided by this review will inform and assist relevant stakeholders in identifying key areas of intervention, and designing and implementing evidence-based programmes and policies at the local and regional level. With slight modifications (ie, to the country terms in the search strategy), this protocol can be used as part of a needs assessment in any endemic country. PMID:27207627

Inference Generation during Text Comprehension by Adults with Right Hemisphere Brain Damage: Activation Failure Versus Multiple Activation.

ERIC Educational Resources Information Center

Tompkins, Connie A.; Fassbinder, Wiltrud; Blake, Margaret Lehman; Baumgaertner, Annette; Jayaram, Nandini

2004-01-01

ourse comprehensionEvidence conflicts as to whether adults with right hemisphere brain damage (RHD) generate inferences during text comprehension. M. Beeman (1993) reported that adults with RHD fail to activate the lexical-semantic bases of routine bridging inferences, which are necessary for comprehension. But other evidence indicates that adults…

A cost-effectiveness analysis of a program to control rheumatic fever and rheumatic heart disease in Pinar del Rio, Cuba.

PubMed

Watkins, David A; Mvundura, Mercy; Nordet, Porfirio; Mayosi, Bongani M

2015-01-01

Acute rheumatic fever (ARF) and rheumatic heart disease (RHD) persist in many low- and middle-income countries. To date, the cost-effectiveness of population-based, combined primary and secondary prevention strategies has not been assessed. In the Pinar del Rio province of Cuba, a comprehensive ARF/RHD control program was undertaken over 1986-1996. The present study analyzes the cost-effectiveness of this Cuban program. We developed a decision tree model based on the natural history of ARF/RHD, comparing the costs and effectiveness of the 10-year Cuban program to a "do nothing" approach. Our population of interest was the cohort of children aged 5-24 years resident in Pinar del Rio in 1986. We assessed costs and health outcomes over a lifetime horizon, and we took the healthcare system perspective on costs but did not apply a discount rate. We used epidemiologic, clinical, and direct medical cost inputs that were previously collected for publications on the Cuban program. We estimated health gains as disability-adjusted life years (DALYs) averted using standard approaches developed for the Global Burden of Disease studies. Cost-effectiveness acceptability thresholds were defined by one and three times per capita gross domestic product per DALY averted. We also conducted an uncertainty analysis using Monte Carlo simulations and several scenario analyses exploring the impact of alternative assumptions about the program's effects and costs. We found that, compared to doing nothing, the Cuban program averted 5051 DALYs (1844 per 100,000 school-aged children) and saved $7,848,590 (2010 USD) despite a total program cost of $202,890 over 10 years. In the scenario analyses, the program remained cost saving when a lower level of effectiveness and a reduction in averted years of life lost were assumed. In a worst-case scenario including 20-fold higher costs, the program still had a 100% of being cost-effective and an 85% chance of being cost saving. A 10-year program to control ARF/RHD in Pinar del Rio, Cuba dramatically reduced morbidity and premature mortality in children and young adults and was cost saving. The results of our analysis were robust to higher program costs and more conservative assumptions about the program's effectiveness. It is possible that the program's effectiveness resulted from synergies between primary and secondary prevention strategies. The findings of this study have implications for non-communicable disease policymaking in other resource-limited settings.

Systematic RH genotyping and variant identification in French donors of African origin

PubMed Central

Kappler-Gratias, Sandrine; Auxerre, Carine; Dubeaux, Isabelle; Beolet, Marylise; Ripaux, Maryline; Le Pennec, Pierre-Yves; Pham, Bach-Nga

2014-01-01

Background RH molecular analysis has enabled the documentation of numerous variants of RHD and RHCE alleles, especially in individuals of African origin. The aim of the present study was to determine the type and frequency of D and/or RhCE variants among blood donors of African origin in France, by performing a systematic RH molecular analysis, in order to evaluate the implications for blood transfusion of patients of African origin. Materials and methods Samples from 316 African blood donors, whose origin was established by their Fy(a−b−) phenotype, were first analysed using the RHD and RHCE BeadChips Kit (BioArray Solutions, Immucor, Warren, NJ, USA). Sequencing was performed when necessary. Results RHD molecular analysis showed that 26.2% of donors had a variant RHD allele. It allowed the prediction of a partial D in 11% of cases. RHCE molecular analysis showed that 14.2% of donors had a variant RHCE allele or RH [RN or (C)ces] haplotype. A rare Rh phenotype associated with the loss of a high-prevalence antigen or partial RhCE antigens were predicted from RHCE molecular analysis in 1 (0.3%) and 17 (5%) cases, respectively. Discussion Systematic RHD and RHCE molecular analysis performed in blood donors of African origin provides transfusion-relevant information for individuals of African origin because of the frequency of variant RH alleles. RH molecular analysis may improve transfusion therapy of patients by allowing better donor and recipient matching, based not only on phenotypically matched red blood cell units, but also on units that are genetically matched with regards to RhCE variants. PMID:23867180

Routine testing of fetal Rhesus D status in Rhesus D negative women using cell-free fetal DNA: an investigation into the preferences and information needs of women

PubMed Central

Oxenford, Kerry; Silcock, Caroline; Hill, Melissa; Chitty, Lyn

2013-01-01

Objective The goal of this study is to investigate women's preferences and information needs for routine implementation of fetal Rhesus D (RhD) typing using cell-free fetal DNA. Methods A questionnaire was developed following focus groups and interviews with both health professionals and RhD negative (RhD−) women offered fetal RhD genotyping within a research study and distributed to RhD− women attending routine antenatal appointments in four National Health Service hospitals. Current knowledge of blood types, anti-D administration, fetal RhD genotyping and future practices were explored. Results A total of 19 respondents participated in interviews and focus groups, and 270 respondents completed the questionnaires. Questionnaire respondents overwhelmingly felt that the test should be offered to all RhD− women (92.1%), and 75.9% said that they would accept this test. Most were happy to have the test even if it involved extra blood tests (89.3%) or appointments (79%). The knowledge of blood groups was poor. Although 90.7% knew that the baby could have a different blood group from themselves, only 34% knew that blood groups are inherited from both parents. More than 40% were not aware that anti-D would not be required if their baby was RhD−. Conclusions Women would welcome the introduction of routine fetal RhD genotyping. Information leaflets and training of midwives will be essential for implementation to ensure good understanding regarding testing. © 2013 The Authors. Prenatal Diagnosis published by John Wiley & Sons Ltd. PMID:23625761

Angiotensin converting enzyme DD genotype is associated with development of rheumatic heart disease in Egyptian children.

PubMed

Morsy, Mohamed-Mofeed Fawaz; Abdelaziz, Nada Abdelmohsen Mohamed; Boghdady, Ahmed Mohamed; Ahmed, Hydi; Abu Elfadl, Essam Mohamed; Ismail, Mohamed Ali

2011-01-01

Angiotensin converting enzyme (ACE) gene polymorphism was previously studied in some cardiovascular diseases. There are only few studies which investigated this polymorphism in patients with rheumatic heart disease (RHD). The results of these investigations are inconsistent. Furthermore, gene polymorphism distribution is different in various ethnic populations. We conducted this study to demonstrate this gene polymorphism in Egyptian children with RHD. Leukocytes DNA was extracted from 139 patients with RHD and 79 healthy control children. After amplification by the PCR, the products were separated by electrophoresis in 6% polyacrylamide gel and visualized after ethidium bromide staining with UV light. The PCR product is a 190-bp fragment in the absence of the insertion (D allele) and a 490-bp fragment in the presence of the insertion (I allele). Gene polymorphism was as follows: DD gene when lane contains only 190-bp fragment, II gene when lane contains only 490-bp fragment and ID gene when lane contains both fragments. We found that gene polymorphism in both control and patients groups followed the following order of distribution from highest to lowest: ID, II, DD gene. The frequency in control group was 49.4, 36.7, and 13.9%, respectively. In patients groups, the gene frequency was 42.5, 30.9, and 26.6%, respectively. DD gene frequency differs significantly between the two groups. We concluded that patients with RHD have a higher ACE-DD genotype than normal control. ACE-DD genotype may be a risk factor for RHD in Egyptian children.

Screening and identification of RhD antigen mimic epitopes from a phage display random peptide library for the serodiagnosis of haemolytic disease of the foetus and newborn.

PubMed

Wang, Jiao; Song, Jingjing; Zhou, Shuimei; Fu, Yourong; Bailey, Jeffrey A; Shen, Changxin

2018-01-16

Identification of RhD antigen epitopes is a key component in understanding the pathogenesis of haemolytic disease of the foetus and newborn. Research has indicated that phage display libraries are useful tools for identifying novel mimic epitopes (mimotopes) which may help to determine antigen specificity. We selected the mimotopes of blood group RhD antigen by affinity panning a phage display library using monoclonal anti-D. After three rounds of biopanning, positive phage clones were identified by enzyme-linked immunosorbent assay (ELISA) and then sent for sequencing and peptides synthesis. Next, competitive ELISA and erythrocyte haemagglutination inhibition tests were carried out to confirm the inhibitory activity of the synthetic peptide. To evaluate the diagnostic performance of the synthetic peptide, a diagnostic ELISA was examined. Fourteen of 35 phage clones that were chosen randomly from the titering plate were considered to be positive. Following DNA sequencing and translation, 11 phage clones were found to represent the same peptide - RMKMLMMLMRRK (P4) - whereas each of the other three clones represented a unique peptide. Through the competitive ELISA and erythrocyte haemagglutination inhibition tests, the peptide (P4) was verified to have the ability to mimic the RhD antigen. The diagnostic ELISA for P4 proved to be sensitive (82.61%) and specific (88.57%). This study reveals that the P4 peptide can mimic RhD antigen and paves the way for the development of promising targeted diagnostic and therapeutic platforms for haemolytic disease of the foetus and newborn.

You may now kiss the bride: Interpretation of social situations by individuals with right or left hemisphere injury.

PubMed

Baldo, Juliana V; Kacinik, Natalie A; Moncrief, Amber; Beghin, Francesca; Dronkers, Nina F

2016-01-08

While left hemisphere damage (LHD) has been clearly shown to cause a range of language impairments, patients with right hemisphere damage (RHD) also exhibit communication deficits, such as difficulties processing prosody, discourse, and social contexts. In the current study, individuals with RHD and LHD were directly compared on their ability to interpret what a character in a cartoon might be saying or thinking, in order to better understand the relative role of the right and left hemisphere in social communication. The cartoon stimuli were manipulated so as to elicit more or less formulaic responses (e.g., a scene of a couple being married by a priest vs. a scene of two people talking, respectively). Participants' responses were scored by blind raters on how appropriately they captured the gist of the social situation, as well as how formulaic and typical their responses were. Results showed that RHD individuals' responses were rated as significantly less appropriate than controls and were also significantly less typical than controls and individuals with LHD. Individuals with RHD produced a numerically lower proportion of formulaic expressions than controls, but this difference was only a trend. Counter to prediction, the pattern of performance across participant groups was not affected by how constrained/formulaic the social situation was. The current findings expand our understanding of the roles that the right and left hemispheres play in social processing and communication and have implications for the potential treatment of social communication deficits in individuals with RHD. Published by Elsevier Ltd.

The worldwide epidemiology of acute rheumatic fever and rheumatic heart disease

PubMed Central

Seckeler, Michael D; Hoke, Tracey R

2011-01-01

Acute rheumatic fever (ARF) and rheumatic heart disease (RHD) are significant public health concerns around the world. Despite decreasing incidence, there is still a significant disease burden, especially in developing nations. This review provides background on the history of ARF, its pathology and treatment, and the current reported worldwide incidence of ARF and prevalence of RHD. PMID:21386976

Renal hypodysplasia associates with a WNT4 variant that causes aberrant canonical WNT signaling.

PubMed

Vivante, Asaf; Mark-Danieli, Michal; Davidovits, Miriam; Harari-Steinberg, Orit; Omer, Dorit; Gnatek, Yehudit; Cleper, Roxana; Landau, Daniel; Kovalski, Yael; Weissman, Irit; Eisenstein, Israel; Soudack, Michalle; Wolf, Haike Reznik; Issler, Naomi; Lotan, Danny; Anikster, Yair; Dekel, Benjamin

2013-03-01

Abnormal differentiation of the renal stem/progenitor pool into kidney tissue can lead to renal hypodysplasia (RHD), but the underlying causes of RHD are not well understood. In this multicenter study, we identified 20 Israeli pedigrees with isolated familial, nonsyndromic RHD and screened for mutations in candidate genes involved in kidney development, including PAX2, HNF1B, EYA1, SIX1, SIX2, SALL1, GDNF, WNT4, and WT1. In addition to previously reported RHD-causing genes, we found that two affected brothers were heterozygous for a missense variant in the WNT4 gene. Functional analysis of this variant revealed both antagonistic and agonistic canonical WNT stimuli, dependent on cell type. In HEK293 cells, WNT4 inhibited WNT3A induced canonical activation, and the WNT4 variant significantly enhanced this inhibition of the canonical WNT pathway. In contrast, in primary cultures of human fetal kidney cells, which maintain WNT activation and more closely represent WNT signaling in renal progenitors during nephrogenesis, this mutation caused significant loss of function, resulting in diminished canonical WNT/β-catenin signaling. In conclusion, heterozygous WNT4 variants are likely to play a causative role in renal hypodysplasia.

Renal Hypodysplasia Associates with a Wnt4 Variant that Causes Aberrant Canonical Wnt Signaling

PubMed Central

Vivante, Asaf; Mark-Danieli, Michal; Davidovits, Miriam; Harari-Steinberg, Orit; Omer, Dorit; Gnatek, Yehudit; Cleper, Roxana; Landau, Daniel; Kovalski, Yael; Weissman, Irit; Eisenstein, Israel; Soudack, Michalle; Wolf, Haike Reznik; Issler, Naomi; Lotan, Danny; Anikster, Yair

2013-01-01

Abnormal differentiation of the renal stem/progenitor pool into kidney tissue can lead to renal hypodysplasia (RHD), but the underlying causes of RHD are not well understood. In this multicenter study, we identified 20 Israeli pedigrees with isolated familial, nonsyndromic RHD and screened for mutations in candidate genes involved in kidney development, including PAX2, HNF1B, EYA1, SIX1, SIX2, SALL1, GDNF, WNT4, and WT1. In addition to previously reported RHD-causing genes, we found that two affected brothers were heterozygous for a missense variant in the WNT4 gene. Functional analysis of this variant revealed both antagonistic and agonistic canonical WNT stimuli, dependent on cell type. In HEK293 cells, WNT4 inhibited WNT3A induced canonical activation, and the WNT4 variant significantly enhanced this inhibition of the canonical WNT pathway. In contrast, in primary cultures of human fetal kidney cells, which maintain WNT activation and more closely represent WNT signaling in renal progenitors during nephrogenesis, this mutation caused significant loss of function, resulting in diminished canonical WNT/β-catenin signaling. In conclusion, heterozygous WNT4 variants are likely to play a causative role in renal hypodysplasia. PMID:23520208

Productive Use of the English Past Tense in Children with Focal Brain Injury and Specific Language Impairment

ERIC Educational Resources Information Center

Marchman, Virginia A.; Saccuman, Cristina; Wulfeck, Beverly

2004-01-01

In this study, 22 children with early left hemisphere (LHD) or right hemisphere (RHD) focal brain lesions (FL, n=14 LHD, n=8 RHD) were administered an English past tense elicitation test (M=6.5 years). Proportion correct and frequency of overregularization and zero-marking errors were compared to age-matched samples of children with specific…

Rapid RHD Zygosity Determination Using Digital PCR.

PubMed

Sillence, Kelly A; Halawani, Amr J; Tounsi, Wajnat A; Clarke, Kirsty A; Kiernan, Michele; Madgett, Tracey E; Avent, Neil D

2017-08-01

Paternal zygosity testing is used for determining homo- or hemizygosity of RHD in pregnancies that are at a risk of hemolytic disease of the fetus and newborn. At present, this is achieved by using real-time PCR or the Rhesus box PCR, which can be difficult to interpret and unreliable, particularly for black African populations. DNA samples extracted from 53 blood donors were analyzed using 2 multiplex reactions for RHD -specific targets against a reference ( AGO1 ) 2 to determine gene dosage by digital PCR. Results were compared with serological data, and the correct genotype for 2 discordant results was determined by long-range PCR (LR-PCR), next-generation sequencing, and conventional Sanger sequencing. The results showed clear and reliable determination of RHD zygosity using digital PCR and revealed that 4 samples did not match the serologically predicted genotype. Sanger sequencing and long-range PCR followed by next-generation sequencing revealed that the correct genotypes for samples 729M and 351D, which were serologically typed as R 1 R 2 (DCe/DcE), were R 2 r' (DcE/dCe) for 729M and R 1 r″ (DCe/dcE), R 0 r y (Dce/dCE), or R Z r (DCE/dce) for 351D, in concordance with the digital PCR data. Digital PCR provides a highly accurate method to rapidly define blood group zygosity and has clinical application in the analysis of Rh phenotyped or genotyped samples. The vast majority of current blood group genotyping platforms are not designed to define zygosity, and thus, this technique may be used to define paternal RH zygosity in pregnancies that are at a risk of hemolytic disease of the fetus and newborn and can distinguish between homo- and hemizygous RHD -positive individuals. © 2017 American Association for Clinical Chemistry.

Anti-D in a mother, hemizygous for the variant RHD*DNB gene, associated with hemolytic disease of the fetus and newborn.

PubMed

Quantock, Kelli M; Lopez, Genghis H; Hyland, Catherine A; Liew, Yew-Wah; Flower, Robert L; Niemann, Frans J; Joyce, Arthur

2017-08-01

Individuals with the partial D phenotype when exposed to D+ red blood cells (RBCs) carrying the epitopes they lack may develop anti-D specific for the missing epitopes. DNB is the most common partial D in Caucasians and the clinical significance for anti-D in these individuals is unknown. This article describes the serologic genotyping results and clinical manifestations in two group D+ babies of a mother presenting as group O, D+ with alloanti-D. The mother was hemizygous for RHD*DNB gene and sequencing confirmed a single-nucleotide change at c.1063G>A. One baby (group A, D+) displayed bilirubinemia at birth with a normal hemoglobin level. Anti-A and anti-D were eluted from the RBCs. For the next ongoing pregnancy, the anti-D titer increased from 32 to 256. On delivery the baby typed group O and anti-D was eluted from the RBCs. This baby at birth exhibited anemia, reticulocytosis, and hyperbilirubinemia requiring intensive phototherapy treatment from Day 0 to Day 9 after birth and was discharged on Day 13. Intravenous immunoglobulin was also administered. Both babies were heterozygous for RHD and RHD*DNB. The anti-D produced by this woman with partial D DNB resulted in a case of hemolytic disease of the fetus and newborn (HDFN) requiring intensive treatment in the perinatal period. Anti-D formed by women with the partial D DNB phenotype has the potential to cause HDFN where the fetus is D+. Women carrying RHD*DNB should be offered appropriate prophylactic anti-D and be transfused with D- RBCs if not already alloimmunized. © 2017 AABB.

Correlation of CBD/CHD angulation with recurrent cholangitis in patients treated with ERCP.

PubMed

Chong, Charing Cn; Chiu, Philip Wy; Tan, Teresa; Teoh, Anthony Yb; Lee, Kit Fai; Ng, Enders Kwok Wai; Lai, Paul Bs; Lau, James Yw

2016-01-01

Endoscopic retrograde cholangiopancreatography (ERCP) with endoscopic sphincterotomy (EST) for bile duct stone extraction has a major role in the treatment of cholangitis. It is well known that certain risk factors predispose to recurrence of such stones. The aims of this study were to evaluate the correlation between angulation of the common bile duct (CBD), right hepatic duct (RHD), and left hepatic duct (LHD) with recurrent cholangitic attacks and to elucidate other risk factors that may be associated with these attacks. This is retrospective study included 62 patients who had undergone therapeutic endoscopic retrograde cholangiopancreatography (ERCP) for bile duct stones. Their medical records were followed until May 1, 2009. The RHD, LHD, and CBD angulation and CBD diameter were measured on cholangiography prior to any endoscopic procedures. Among these 62 patients, 6 (9.7 %) had recurrence of cholangitis. Both angles of the RHD and the CBD were significantly smaller in the group with recurrence (P = 0.001, P = 0.004). A CBD angle ≤ 130(o) and RHD angle ≤ 125(o) were found to be significantly associated with an increased risk of recurrence (RR = 10.526, P = 0.033; RR = 24.97, P = 0.008) in multivariate analysis. Cholecystectomy was not a protective factor against recurrence of cholangitis (P = 0.615). Angulation of the CBD (≤ 130°) and RHD (≤ 125°) on ERCP are independent risk factors for recurrent cholangitis. Further prospective studies using these data may be warranted for a more accurate estimation and verification of the risk factors predisposing to recurrent cholangitis.

Study on ABO and RhD blood grouping: Comparison between conventional tile method and a new solid phase method (InTec Blood Grouping Test Kit).

PubMed

Yousuf, R; Abdul Ghani, S A; Abdul Khalid, N; Leong, C F

2018-04-01

'InTec Blood Grouping Test kit' using solid-phase technology is a new method which may be used at outdoor blood donation site or at bed side as an alternative to the conventional tile method in view of its stability at room temperature and fulfilled the criteria as point of care test. This study aimed to compare the efficiency of this solid phase method (InTec Blood Grouping Test Kit) with the conventional tile method in determining the ABO and RhD blood group of healthy donors. A total of 760 voluntary donors who attended the Blood Bank, Penang Hospital or offsite blood donation campaigns from April to May 2014 were recruited. The ABO and RhD blood groups were determined by the conventional tile method and the solid phase method, in which the tube method was used as the gold standard. For ABO blood grouping, the tile method has shown 100% concordance results with the gold standard tube method, whereas the solid-phase method only showed concordance result for 754/760 samples (99.2%). Therefore, for ABO grouping, tile method has 100% sensitivity and specificity while the solid phase method has slightly lower sensitivity of 97.7% but both with good specificity of 100%. For RhD grouping, both the tile and solid phase methods have grouped one RhD positive specimen as negative each, thus giving the sensitivity and specificity of 99.9% and 100% for both methods respectively. The 'InTec Blood Grouping Test Kit' is suitable for offsite usage because of its simplicity and user friendliness. However, further improvement in adding the internal quality control may increase the test sensitivity and validity of the test results.

Acute rheumatic fever and rheumatic heart disease

PubMed Central

Carapetis, Jonathan R.; Beaton, Andrea; Cunningham, Madeleine W.; Guilherme, Luiza; Karthikeyan, Ganesan; Mayosi, Bongani M.; Sable, Craig; Steer, Andrew; Wilson, Nigel; Wyber, Rosemary; Zühlke, Liesl

2018-01-01

Acute rheumatic fever (ARF) is the result of an autoimmune response to pharyngitis caused by infection with group A Streptococcus. The long-term damage to cardiac valves caused by ARF, which can result from a single severe episode or from multiple recurrent episodes of the illness, is known as rheumatic heart disease (RHD) and is a notable cause of morbidity and mortality in resource-poor settings around the world. Although our understanding of disease pathogenesis has advanced in recent years, this has not led to dramatic improvements in diagnostic approaches, which are still reliant on clinical features using the Jones Criteria, or treatment practices. Indeed, penicillin has been the mainstay of treatment for decades and there is no other treatment that has been proven to alter the likelihood or the severity of RHD after an episode of ARF. Recent advances — including the use of echocardiographic diagnosis in those with ARF and in screening for early detection of RHD, progress in developing group A streptococcal vaccines and an increased focus on the lived experience of those with RHD and the need to improve quality of life — give cause for optimism that progress will be made in coming years against this neglected disease that affects populations around the world, but is a particular issue for those living in poverty. PMID:27188830

A new fetal RHD genotyping test: Costs and benefits of mass testing to target antenatal anti-D prophylaxis in England and Wales

PubMed Central

2011-01-01

Background Postnatal and antenatal anti-D prophylaxis have dramatically reduced maternal sensitisations and cases of rhesus disease in babies born to women with RhD negative blood group. Recent scientific advances mean that non-invasive prenatal diagnosis (NIPD), based on the presence of cell-free fetal DNA in maternal plasma, could be used to target prophylaxis on "at risk" pregnancies where the fetus is RhD positive. This paper provides the first assessment of cost-effectiveness of NIPD-targeted prophylaxis compared to current policies. Methods We conducted an economic analysis of NIPD implementation in England and Wales. Two scenarios were considered. Scenario 1 assumed that NIPD will be only used to target antenatal prophylaxis with serology tests continuing to direct post-delivery prophylaxis. In Scenario 2, NIPD would also displace postnatal serology testing if an RhD negative fetus was identified. Costs were estimated from the provider's perspective for both scenarios together with a threshold royalty fee per test. Incremental costs were compared with clinical implications. Results The basic cost of an NIPD in-house test is £16.25 per sample (excluding royalty fee). The two-dose antenatal prophylaxis policy recommended by NICE is estimated to cost the NHS £3.37 million each year. The estimated threshold royalty fee is £2.18 and £8.83 for Scenarios 1 and 2 respectively. At a £2.00 royalty fee, mass NIPD testing would produce no saving for Scenario 1 and £507,154 per annum for Scenario 2. Incremental cost-effectiveness analysis indicates that, at a test sensitivity of 99.7% and this royalty fee, NIPD testing in Scenario 2 will generate one additional sensitisation for every £9,190 saved. If a single-dose prophylaxis policy were implemented nationally, as recently recommended by NICE, Scenario 2 savings would fall. Conclusions Currently, NIPD testing to target anti-D prophylaxis is unlikely to be sufficiently cost-effective to warrant its large scale introduction in England and Wales. Only minor savings are calculated and, balanced against this, the predicted increase in maternal sensitisations may be unacceptably high. Reliability of NIPD assays still needs to be demonstrated rigorously in different ethnic minority populations. First trimester testing is unlikely to alter this picture significantly although other emerging technologies may. PMID:21244652

A new fetal RHD genotyping test: costs and benefits of mass testing to target antenatal anti-D prophylaxis in England and Wales.

PubMed

Szczepura, Ala; Osipenko, Leeza; Freeman, Karoline

2011-01-18

Postnatal and antenatal anti-D prophylaxis have dramatically reduced maternal sensitisations and cases of rhesus disease in babies born to women with RhD negative blood group. Recent scientific advances mean that non-invasive prenatal diagnosis (NIPD), based on the presence of cell-free fetal DNA in maternal plasma, could be used to target prophylaxis on "at risk" pregnancies where the fetus is RhD positive. This paper provides the first assessment of cost-effectiveness of NIPD-targeted prophylaxis compared to current policies. We conducted an economic analysis of NIPD implementation in England and Wales. Two scenarios were considered. Scenario 1 assumed that NIPD will be only used to target antenatal prophylaxis with serology tests continuing to direct post-delivery prophylaxis. In Scenario 2, NIPD would also displace postnatal serology testing if an RhD negative fetus was identified. Costs were estimated from the provider's perspective for both scenarios together with a threshold royalty fee per test. Incremental costs were compared with clinical implications. The basic cost of an NIPD in-house test is £16.25 per sample (excluding royalty fee). The two-dose antenatal prophylaxis policy recommended by NICE is estimated to cost the NHS £3.37 million each year. The estimated threshold royalty fee is £2.18 and £8.83 for Scenarios 1 and 2 respectively. At a £2.00 royalty fee, mass NIPD testing would produce no saving for Scenario 1 and £507,154 per annum for Scenario 2. Incremental cost-effectiveness analysis indicates that, at a test sensitivity of 99.7% and this royalty fee, NIPD testing in Scenario 2 will generate one additional sensitisation for every £9,190 saved. If a single-dose prophylaxis policy were implemented nationally, as recently recommended by NICE, Scenario 2 savings would fall. Currently, NIPD testing to target anti-D prophylaxis is unlikely to be sufficiently cost-effective to warrant its large scale introduction in England and Wales. Only minor savings are calculated and, balanced against this, the predicted increase in maternal sensitisations may be unacceptably high. Reliability of NIPD assays still needs to be demonstrated rigorously in different ethnic minority populations. First trimester testing is unlikely to alter this picture significantly although other emerging technologies may.

Discourse Impairments Following Right Hemisphere Brain Damage: A Critical Review

PubMed Central

Johns, Clinton L.; Tooley, Kristen M.; Traxler, Matthew J.

2015-01-01

Right hemisphere brain damage (RHD) rarely causes aphasias marked by clear and widespread failures of comprehension or extreme difficulty producing fluent speech. Nonetheless, subtle language comprehension deficits can occur following unilateral RHD. In this article, we review the empirical record on discourse function following right hemisphere damage, as well as relevant work on non-brain damaged individuals that focuses on right hemisphere function. The review is divided into four sections that focus on discourse processing, inferencing, humor, and non-literal language. While the exact role that the right hemisphere plays in language processing, and the exact way that the two cerebral hemispheres coordinate their linguistic processes are still open to debate, our review suggests that the right hemisphere plays a critical role in managing inferred or implied information by maintaining relevant information and/or suppressing irrelevant information. Deficits in one or both of these mechanisms may account for discourse deficits following RHD. PMID:26085839

Rheumatic fever and rheumatic heart disease in Bangladesh: A review

PubMed Central

Islam, A.K.M. Monwarul; Majumder, A.A.S.

2016-01-01

Rheumatic fever (RF) and rheumatic heart disease (RHD) are the most-common cardiovascular disease in young people aged <25 years, globally. They are important contributors to cardiovascular morbidity and mortality in Bangladesh. Classical risk factors, i.e. poverty, overcrowding, ignorance, and insufficient health care services were responsible for the high incidence and prevalence of these diseases over the last century. In concert with the progresses in socioeconomic indicators, advances in health sectors, improved public awareness, and antibiotic prophylaxis, acute RF came into control. However, chronic RHD continues to be prevalent, and the actual disease burden may be much higher. RHD predominantly affects the young adults, seriously incapacitates them, follows a protracted course, gets complicated because of delayed diagnosis and is sometimes maltreated. The treatment is often palliative and expensive. Large-scale epidemiological and clinical researches are needed to formulate evidence-based national policy to tackle this important public health issue in future. PMID:26896274

Better compliance and better tolerance in relation to a well-conducted introduction to rub-in hand disinfection.

PubMed

Girard, R; Amazian, K; Fabry, J

2001-02-01

The aim of the study was to demonstrate that the introduction of rub-in hand disinfection (RHD) in hospital units, with the implementation of suitable equipment, drafting of specific protocols, and training users, improved compliance of hand disinfection and tolerance of user's hands. In four hospital units not previously using RHD an external investigator conducted two identical studies in order to measure the rate of compliance with, and the quality of, disinfection practices, [rate of adapted (i.e., appropriate) procedures, rate of correct (i.e., properly performed) procedures, rate of adapted and correct procedures carried out] and to assess the state of hands (clinical scores of dryness and irritation, measuring hydration with a corneometer). Between the two studies, the units were equipped with dispensers for RHD products and staff were trained. Compliance improved from 62.2 to 66.5%, quality was improved (rate of adapted procedures from 66.8% to 84.3%, P > or = 10(-6), rate of correct procedures from 11.1% to 28.9%, P > or = 10(-8), rate of adapted and correct procedures from 6.0 to 17.8%, P > or = 10(-8)). The tolerance was improved significantly (P > or = 10(-2)) for clinical dryness and irritation scores, although not significantly for measurements using a corneometer. This study shows the benefit of introducing RHD with a technical and educational accompaniment. Copyright 2001 The Hospital Infection Society.

Changes in intrapopulation resource use patterns of an endangered raptor in response to a disease-mediated crash in prey abundance.

PubMed

Moleón, Marcos; Sebastián-González, Esther; Sánchez-Zapata, José A; Real, Joan; Pires, Mathias M; Gil-Sánchez, José M; Bautista, Jesús; Palma, Luís; Bayle, Patrick; Guimarães, Paulo R; Beja, Pedro

2012-11-01

1. A long-standing question in ecology is how natural populations respond to a changing environment. Emergent optimal foraging theory-based models for individual variation go beyond the population level and predict how its individuals would respond to disturbances that produce changes in resource availability. 2. Evaluating variations in resource use patterns at the intrapopulation level in wild populations under changing environmental conditions would allow to further advance in the research on foraging ecology and evolution by gaining a better idea of the underlying mechanisms explaining trophic diversity. 3. In this study, we use a large spatio-temporal scale data set (western continental Europe, 1968-2006) on the diet of Bonelli's Eagle Aquila fasciata breeding pairs to analyse the predator trophic responses at the intrapopulation level to a prey population crash. In particular, we borrow metrics from studies on network structure and intrapopulation variation to understand how an emerging infectious disease [the rabbit haemorrhagic disease (RHD)] that caused the density of the eagle's primary prey (rabbit Oryctolagus cuniculus) to dramatically drop across Europe impacted on resource use patterns of this endangered raptor. 4. Following the major RHD outbreak, substantial changes in Bonelli's Eagle's diet diversity and organisation patterns at the intrapopulation level took place. Dietary variation among breeding pairs was larger after than before the outbreak. Before RHD, there were no clusters of pairs with similar diets, but significant clustering emerged after RHD. Moreover, diets at the pair level presented a nested pattern before RHD, but not after. 5. Here, we reveal how intrapopulation patterns of resource use can quantitatively and qualitatively vary, given drastic changes in resource availability. 6. For the first time, we show that a pathogen of a prey species can indirectly impact the intrapopulation patterns of resource use of an endangered predator. © 2012 The Authors. Journal of Animal Ecology © 2012 British Ecological Society.

Multidimensional simulations of core-collapse supernovae with CHIMERA

NASA Astrophysics Data System (ADS)

Lentz, Eric J.; Bruenn, S. W.; Yakunin, K.; Endeve, E.; Blondin, J. M.; Harris, J. A.; Hix, W. R.; Marronetti, P.; Messer, O. B.; Mezzacappa, A.

2014-01-01

Core-collapse supernovae are driven by a multidimensional neutrino radiation hydrodynamic (RHD) engine, and full simulation requires at least axisymmetric (2D) and ultimately symmetry-free 3D RHD simulation. We present recent and ongoing work with our multidimensional RHD supernova code CHIMERA to understand the nature of the core-collapse explosion mechanism and its consequences. Recently completed simulations of 12-25 solar mass progenitors(Woosley & Heger 2007) in well resolved (0.7 degrees in latitude) 2D simulations exhibit robust explosions meeting the observationally expected explosion energy. We examine the role of hydrodynamic instabilities (standing accretion shock instability, neutrino driven convection, etc.) on the explosion dynamics and the development of the explosion energy. Ongoing 3D and 2D simulations examine the role that simulation resolution and the removal of the imposed axisymmetry have in the triggering and development of an explosion from stellar core collapse. Companion posters will explore the gravitational wave signals (Yakunin et al.) and nucleosynthesis (Harris et al.) of our simulations.

Emergence of a new lagovirus related to Rabbit Haemorrhagic Disease Virus

PubMed Central

2013-01-01

Since summer 2010, numerous cases of Rabbit Haemorrhagic Disease (RHD) have been reported in north-western France both in rabbitries, affecting RHD-vaccinated rabbits, and in wild populations. We demonstrate that the aetiological agent was a lagovirus phylogenetically distinct from other lagoviruses and which presents a unique antigenic profile. Experimental results show that the disease differs from RHD in terms of disease duration, mortality rates, higher occurrence of subacute/chronic forms and that partial cross-protection occurs between RHDV and the new RHDV variant, designated RHDV2. These data support the hypothesis that RHDV2 is a new member of the Lagovirus genus. A molecular epidemiology study detected RHDV2 in France a few months before the first recorded cases and revealed that one year after its discovery it had spread throughout the country and had almost replaced RHDV strains. RHDV2 was detected in continental Italy in June 2011, then four months later in Sardinia. PMID:24011218

Acquired RhD mosaicism identifies fibrotic transformation of thrombopoietin receptor-mutated essential thrombocythemia.

PubMed

Montemayor-Garcia, Celina; Coward, Rebecca; Albitar, Maher; Udani, Rupa; Jain, Prachi; Koklanaris, Eleftheria; Battiwalla, Minoo; Keel, Siobán; Klein, Harvey G; Barrett, A John; Ito, Sawa

2017-09-01

Acquired copy-neutral loss of heterozygosity has been described in myeloid malignant progression with an otherwise normal karyotype. A 65-year-old woman with MPL-mutated essential thrombocythemia and progression to myelofibrosis was noted upon routine pretransplant testing to have mixed field reactivity with anti-D and an historic discrepancy in RhD type. The patient had never received transfusions or transplantation. Gel immunoagglutination revealed group A red blood cells and a mixed-field reaction for the D phenotype, with a predominant D-negative population and a small subset of circulating red blood cells carrying the D antigen. Subsequent genomic microarray single nucleotide polymorphism profiling revealed copy-neutral loss of heterozygosity of chromosome 1 p36.33-p34.2, a known molecular mechanism underlying fibrotic progression of MPL-mutated essential thrombocythemia. The chromosomal region affected by this copy-neutral loss of heterozygosity encompassed the RHD, RHCE, and MPL genes. We propose a model of chronological molecular events that is supported by RHD zygosity assays in peripheral lymphoid and myeloid-derived cells. Copy-neutral loss of heterozygosity events that lead to clonal selection and myeloid malignant progression may also affect the expression of adjacent unrelated genes, including those encoding for blood group antigens. Detection of mixed-field reactions and investigation of discrepant blood typing results are important for proper transfusion support of these patients and can provide useful surrogate markers of myeloproliferative disease progression. © 2017 AABB.

Emergence of new virulent rabbit hemorrhagic disease virus strains in Saudi Arabia.

PubMed

Ismail, Mahmoud M; Mohamed, Mahmoud H A; El-Sabagh, Ibrahim M; Al-Hammadi, Mohamed A

2017-02-01

Rabbit hemorrhagic disease is an acute fatal highly contagious viral infectious disease that causes high losses among rabbitries. The disease was first reported in China in 1984 and later on in Saudi Arabia in 1996. The aim of this study was to investigate the emergence and pathogenicity of new rabbit hemorrhagic disease virus (RHDV) strains in Saudi Arabia. The pathogenicity was confirmed by inoculation in susceptible rabbits. Three RHDV strains were detected by reverse transcriptase polymerase chain reaction (RT-PCR) using primers targeting VP60 capsid protein gene in infected rabbitries during 2012 and 2013. These strains clustered into two genetically distinct genogroups related to year of isolation (G2 and G3). All new Saudi Arabia viruses clustered with the European strains, while the old strains clustered with strains from China and America. Based on amino acids and nucleotide sequences, the Saudi Arabia strains (RHD/1/SA/2012, RHD/2/SA/2012, and RHD/3/SA /2013) had high identity with Mexico89, Ca11-ITA, and 00-13,FRA virus; on the other hand, there was a relatively high identity with Bahrain strain. The evolutionary relationship of Saudi RHDVs strains revealed significant nucleotides and amino acid substitutions in hypervariable region E, suggesting the emergence of new RHDVs circulating in Saudi Arabia rabbitries. These antigenic changes represented by the antigenic index might be a potential cause of vaccination failure and raises the need to review the vaccination strategies against RHD.

Survey on the prevention and incidence of haemolytic disease of the newborn in Italy

PubMed Central

Bennardello, Francesco; Curciarello, Giuseppe

2013-01-01

Background In 2010, the Italian Society of Immunohaematology and Transfusion Medicine (SIMTI) carried out a survey of the incidence of haemolytic disease of the newborn (HDN) and the prevention of HDN caused by anti-Rh(D) in Italian Transfusion Structures (TS). Materials and methods A questionnaire divided into the following five sections was administered: (i) types of services provided and maintenance of legally required registers, (ii) immunoprophylaxis (IP), (iii) red cell typing and searches for irregular antibodies, (iv) evaluation of foetal-maternal haemorrhage (FMH), and (v) incidence of HDN in 2010. Of the 280 TS sent the questionnaire, 176 (63%) replied. Results A HDN register was available in 55.5% of the TS (n =91). Immunoprophylaxis with a dose of anti-D IgG was given to all Rh(D) negative and Rh(D) variant puerpera with Rh(D) positive newborns: in more than 93% of cases the dose was between 1,500 IU (300 μg) and 1,250 IU (250 μg). Antenatal IP between the 25th and 28th week was proposed by 42 TS (26%). Seventy percent of the TS (n =115) did not make any evaluation of FMH. The number of births surveyed in 2010 was 203,384, the number of Rh(D) negative pregnancies was 13,569, while anti-D antibodies were present in 245 pregnancies. There were 111 cases of HDN due to anti Rh(D) incompatibility and in 40 of these, intrauterine transfusion (n =8) or exchange transfusion (n =32) was necessary. In 94 cases HDN was due to other irregular antibodies: in 4 of these cases intrauterine transfusion was needed and in 11 other recourse was made of exchange transfusion. Finally, there were 1,456 newborns with ABO HDN of whom 13 underwent exchange transfusion. Discussion The data collected give a picture of the incidence of HDN in Italy and of the methods of managing IP and could form the basis for an update of the SIMTI recommendations on the management and prevention of this disease. PMID:23867179

Taiwan experience suggests that RhD typing for blood transfusion is unnecessary in southeast Asian populations.

PubMed

Lin, Marie

2006-01-01

The high frequency of RhD (D) antigen among Taiwanese persons (99.67%) often imposes unnecessary risks of under-transfusion on D- patients awaiting D- blood. Also because of the rare occurrence of anti-D among Taiwanese persons, routine pretransfusion D typing has been discontinued in the Mackay Memorial Hospital since 1988. This report is the retrospective evaluation of the outcome of abolishing RhD typing for Taiwanese. More than 10 years of alloantibody data at Mackay Memorial Hospital Blood Bank were reviewed. The cases with anti-D were further used to analyze the potency of D antigen and to observe whether there were differences in the incidence of anti-D before and after discontinuation of routine D typing among Taiwanese individuals. The incidence of anti-D before and after discontinuation of routine pretransfusion D typing has remained unchanged. The immunogenicity of D and "Mi(a)" in Taiwanese persons is found to be similar. In terms of opportunity for immunization, however, the "Mi(a)" antigen (phenotype frequency 7.3% in Taiwanese persons) has become the most important blood group antigen in Taiwan. The results strongly support the exclusion of D typing from routine compatibility testing for individuals of Taiwanese origin. Because the low incidence of D- and relatively high incidence of "Mi(a)"+ phenotypes are common findings throughout southeast Asia, and because a population genetic study revealed that the Taiwanese people are genetically related to southern Asian populations, it is suggested that RhD typing for blood transfusion is unnecessary among southeast Asian populations.

Evaluation of single-nucleotide polymorphisms as internal controls in prenatal diagnosis of fetal blood groups.

PubMed

Doescher, Andrea; Petershofen, Eduard K; Wagner, Franz F; Schunter, Markus; Müller, Thomas H

2013-02-01

Determination of fetal blood groups in maternal plasma samples critically depends on adequate amplification of fetal DNA. We evaluated the routine inclusion of 52 single-nucleotide polymorphisms (SNPs) as internal reference in our polymerase chain reaction (PCR) settings to obtain a positive internal control for fetal DNA. DNA from 223 plasma samples of pregnant women was screened for RHD Exons 3, 4, 5, and 7 in a multiplex PCR including 52 SNPs divided into four primer pools. Amplicons were analyzed by single-base extension and the GeneScan method in a genetic analyzer. Results of D screening were compared to standard RHD genotyping of amniotic fluid or real-time PCR of fetal DNA from maternal plasma. The vast majority of all samples (97.8%) demonstrated differences in maternal and fetal SNP patterns when tested with four primer pools. These differences were not observed in less than 2.2% of the samples most probably due to an extraction failure for adequate amounts of fetal DNA. Comparison of the fetal genotypes with independent results did not reveal a single false-negative case among samples (n = 42) with positive internal control and negative fetal RHD typing. Coamplification of 52 SNPs with RHD-specific sequences for fetal blood group determination introduces a valid positive control for the amplification of fetal DNA to avoid false-negative results. This new approach does not require a paternal blood sample. It may also be applicable to other assays for fetal genotyping in maternal blood samples. © 2012 American Association of Blood Banks.

Rheumatic Heart Disease and Myxomatous Degeneration: Differences and Similarities of Valve Damage Resulting from Autoimmune Reactions and Matrix Disorganization.

PubMed

Martins, Carlo de Oliveira; Demarchi, Lea; Ferreira, Frederico Moraes; Pomerantzeff, Pablo Maria Alberto; Brandao, Carlos; Sampaio, Roney Orismar; Spina, Guilherme Sobreira; Kalil, Jorge; Cunha-Neto, Edecio; Guilherme, Luiza

2017-01-01

Autoimmune inflammatory reactions leading to rheumatic fever (RF) and rheumatic heart disease (RHD) result from untreated Streptococcus pyogenes throat infections in individuals who exhibit genetic susceptibility. Immune effector mechanisms have been described that lead to heart tissue damage culminating in mitral and aortic valve dysfunctions. In myxomatous valve degeneration (MXD), the mitral valve is also damaged due to non-inflammatory mechanisms. Both diseases are characterized by structural valve disarray and a previous proteomic analysis of them has disclosed a distinct profile of matrix/structural proteins differentially expressed. Given their relevance in organizing valve tissue, we quantitatively evaluated the expression of vimentin, collagen VI, lumican, and vitronectin as well as performed immunohistochemical analysis of their distribution in valve tissue lesions of patients in both diseases. We identified abundant expression of two isoforms of vimentin (45 kDa, 42 kDa) with reduced expression of the full-size protein (54 kDa) in RHD valves. We also found increased vitronectin expression, reduced collagen VI expression and similar lumican expression between RHD and MXD valves. Immunohistochemical analysis indicated disrupted patterns of these proteins in myxomatous degeneration valves and disorganized distribution in rheumatic heart disease valves that correlated with clinical manifestations such as valve regurgitation or stenosis. Confocal microscopy analysis revealed a diverse pattern of distribution of collagen VI and lumican into RHD and MXD valves. Altogether, these results demonstrated distinct patterns of altered valve expression and tissue distribution/organization of structural/matrix proteins that play important pathophysiological roles in both valve diseases.

Measurement of RBC agglutination with microscopic cell image analysis in a microchannel chip.

PubMed

Cho, Chi Hyun; Kim, Ju Yeon; Nyeck, Agnes E; Lim, Chae Seung; Hur, Dae Sung; Chung, Chanil; Chang, Jun Keun; An, Seong Soo A; Shin, Sehyun

2014-01-01

Since Landsteiner's discovery of ABO blood groups, RBC agglutination has been one of the most important immunohematologic techniques for ABO and RhD blood groupings. The conventional RBC agglutination grading system for RhD blood typings relies on macroscopic reading, followed by the assignment of a grade ranging from (-) to (4+) to the degree of red blood cells clumping. However, with the new scoring method introduced in this report, microscopically captured cell images of agglutinated RBCs, placed in a microchannel chip, are used for analysis. Indeed, the cell images' pixel number first allows the differentiation of agglutinated and non-agglutinated red blood cells. Finally, the ratio of agglutinated RBCs per total RBC counts (CRAT) from 90 captured images is then calculated. During the trial, it was observed that the agglutinated group's CRAT was significantly higher (3.77-0.003) than that of the normal control (0). Based on these facts, it was established that the microchannel method was more suitable for the discrimination between agglutinated RBCs and non-agglutinated RhD negative, and thus more reliable for the grading of RBCs agglutination than the conventional method.

Association between a common immunoglobulin heavy chain allele and rheumatic heart disease risk in Oceania

PubMed Central

Parks, Tom; Mirabel, Mariana M.; Kado, Joseph; Auckland, Kathryn; Nowak, Jaroslaw; Rautanen, Anna; Mentzer, Alexander J.; Marijon, Eloi; Jouven, Xavier; Perman, Mai Ling; Cua, Tuliana; Kauwe, John K.; Allen, John B.; Taylor, Henry; Robson, Kathryn J.; Deane, Charlotte M.; Steer, Andrew C.; Hill, Adrian V. S.; Allen, Lori; Allen, Marvin; Braunstein, Corinne; Colquhoun, Samantha M.; Jewine, Aurélia; Ah Kee, Maureen; Kumar, Rina; John Martin, William; Mataika, Reapi; Nadra, Marie; Nadu, Shahin; Naseri, Take; Noël, Baptiste; Simon, Nathalie; Ward, Brenton

2017-01-01

The indigenous populations of the South Pacific experience a high burden of rheumatic heart disease (RHD). Here we report a genome-wide association study (GWAS) of RHD susceptibility in 2,852 individuals recruited in eight Oceanian countries. Stratifying by ancestry, we analysed genotyped and imputed variants in Melanesians (607 cases and 1,229 controls) before follow-up of suggestive loci in three further ancestral groups: Polynesians, South Asians and Mixed or other populations (totalling 399 cases and 617 controls). We identify a novel susceptibility signal in the immunoglobulin heavy chain (IGH) locus centring on a haplotype of nonsynonymous variants in the IGHV4-61 gene segment corresponding to the IGHV4-61*02 allele. We show each copy of IGHV4-61*02 is associated with a 1.4-fold increase in the risk of RHD (odds ratio 1.43, 95% confidence intervals 1.27–1.61, P=4.1 × 10−9). These findings provide new insight into the role of germline variation in the IGH locus in disease susceptibility. PMID:28492228

Integrin Alpha 8 Recessive Mutations Are Responsible for Bilateral Renal Agenesis in Humans

PubMed Central

Humbert, Camille; Silbermann, Flora; Morar, Bharti; Parisot, Mélanie; Zarhrate, Mohammed; Masson, Cécile; Tores, Frédéric; Blanchet, Patricia; Perez, Marie-José; Petrov, Yuliya; Khau Van Kien, Philippe; Roume, Joelle; Leroy, Brigitte; Gribouval, Olivier; Kalaydjieva, Luba; Heidet, Laurence; Salomon, Rémi; Antignac, Corinne; Benmerah, Alexandre; Saunier, Sophie; Jeanpierre, Cécile

2014-01-01

Renal hypodysplasia (RHD) is a heterogeneous condition encompassing a spectrum of kidney development defects including renal agenesis, hypoplasia, and (cystic) dysplasia. Heterozygous mutations of several genes have been identified as genetic causes of RHD with various severity. However, these genes and mutations are not associated with bilateral renal agenesis, except for RET mutations, which could be involved in a few cases. The pathophysiological mechanisms leading to total absence of kidney development thus remain largely elusive. By using a whole-exome sequencing approach in families with several fetuses with bilateral renal agenesis, we identified recessive mutations in the integrin α8-encoding gene ITGA8 in two families. Itga8 homozygous knockout in mice is known to result in absence of kidney development. We provide evidence of a damaging effect of the human ITGA8 mutations. These results demonstrate that mutations of ITGA8 are a genetic cause of bilateral renal agenesis and that, at least in some cases, bilateral renal agenesis is an autosomal-recessive disease. PMID:24439109

Penicillin Dried Blood Spot Assay for Use in Patients Receiving Intramuscular Benzathine Penicillin G and Other Penicillin Preparations To Prevent Rheumatic Fever.

PubMed

Page-Sharp, Madhu; Coward, Jonathan; Moore, Brioni R; Salman, Sam; Marshall, Lewis; Davis, Timothy M E; Batty, Kevin T; Manning, Laurens

2017-08-01

Rheumatic heart disease (RHD) remains an important global health challenge. Administration of benzathine penicillin (BPG) every 3 to 4 weeks is recommended as a secondary prophylaxis to prevent recurrent episodes of acute rheumatic fever and subsequent RHD. Following intramuscular injection, BPG is hydrolyzed to penicillin G (benzylpenicillin). However, little is known of the pharmacokinetics (PK) of BPG in pediatric populations at high risk of RHD or of the pharmacokinetic-pharmacodynamic relationship between penicillin exposure and clinically relevant outcomes. Dried blood spot (DBS) assays can facilitate PK studies in situations where frequent venous blood sampling is logistically difficult. A liquid chromatography-mass spectroscopy assay for penicillin G in plasma and DBS was developed and validated. Application of the DBS assay for PK studies was confirmed using samples from adult patients receiving penicillin as part of an infection management plan. The limit of quantification for penicillin G in DBS was 0.005 mg/liter. Penicillin G is stable in DBS for approximately 12 h at room temperature (22°C), 6 days at 4°C, and >1 month at -20°C. Plasma and DBS penicillin G concentrations for patients receiving BPG and penicillin G given via bolus doses correlated well and had comparable time-concentration profiles. There was poor correlation for patients receiving penicillin via continuous infusions, perhaps as a result of the presence of residual penicillin in the peripherally inserted central catheter, from which the plasma samples were collected. The present DBS penicillin G assay can be used as a surrogate for plasma concentrations to provide valid PK data for studies of BPG and other penicillin preparations developed to prevent rheumatic fever and RHD. Copyright © 2017 American Society for Microbiology.

Ethical precepts for medical volunteerism: including local voices and values to guide RHD surgery in Rwanda.

PubMed

Coors, Marilyn E; Matthew, Thomas L; Matthew, Dayna B

2015-10-01

At the invitation of the Rwandan Government, Team Heart, a team of American healthcare professionals, performs volunteer rheumatic heart disease (RHD) surgery in Rwanda every year, and confronts ethical concerns that call for cultural sensitivity. This article describes how five standard bioethical precepts are applied in practice in medical volunteerism related to RHD surgery in Rwanda. The content for the applied precepts stems from semiscripted, transcribed conversations with the authors, two Rwandan cardiologists, a Rwandan nurse and a Rwandan premedical student. The conversations revealed that the criteria for RHD surgical selection in Rwanda are analogous to the patient-selection process involving material scarcity in the USA. Rwandan notions of benefit and harm focus more attention on structural issues, such as shared benefit, national reputation and expansion of expertise, than traditional Western notions. Harm caused by inadequate patient follow-up remains a critical concern. Gender disparities regarding biological and social implications of surgical valve choices impact considerations of justice. Individual agency remains important, but not central to Rwandan concepts of justice, transparency and respect, particularly regarding women. The Rwandan understanding of standard bioethical precepts is substantively similar to the traditionally recognised interpretation with important contextual differences. The communal importance of improving the health of a small number of individuals may be underestimated in previous literature. Moreover, openness and the incorporation of Rwandan stakeholders in difficult ethical choices and long-term contributions to indigenous medical capacity appear to be valued by Rwandans. These descriptions of applied precepts are applicable to different medical missions in other emerging nations following a similar process of inclusion. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

New Proteins Involved in Sulfur Trafficking in the Cytoplasm of Allochromatium vinosum*

PubMed Central

Stockdreher, Yvonne; Sturm, Marga; Josten, Michaele; Sahl, Hans-Georg; Dobler, Nadine; Zigann, Renate; Dahl, Christiane

2014-01-01

The formation of periplasmic sulfur globules is an intermediate step during the oxidation of reduced sulfur compounds in various sulfur-oxidizing microorganisms. The mechanism of how this sulfur is activated and crosses the cytoplasmic membrane for further oxidation to sulfite by the dissimilatory reductase DsrAB is incompletely understood, but it has been well documented that the pathway involves sulfur trafficking mediated by sulfur-carrying proteins. So far sulfur transfer from DsrEFH to DsrC has been established. Persulfurated DsrC very probably serves as a direct substrate for DsrAB. Here, we introduce further important players in oxidative sulfur metabolism; the proteins Rhd_2599, TusA, and DsrE2 are strictly conserved in the Chromatiaceae, Chlorobiaceae, and Acidithiobacillaceae families of sulfur-oxidizing bacteria and are linked to genes encoding complexes involved in sulfur oxidation (Dsr or Hdr) in the latter two. Here we show via relative quantitative real-time PCR and microarray analysis an increase of mRNA levels under sulfur-oxidizing conditions for rhd_2599, tusA, and dsrE2 in Allochromatium vinosum. Transcriptomic patterns for the three genes match those of major genes for the sulfur-oxidizing machinery rather than those involved in biosynthesis of sulfur-containing biomolecules. TusA appears to be one of the major proteins in A. vinosum. A rhd_2599-tusA-dsrE2-deficient mutant strain, although not viable in liquid culture, was clearly sulfur oxidation negative upon growth on solid media containing sulfide. Rhd_2599, TusA, and DsrE2 bind sulfur atoms via conserved cysteine residues, and experimental evidence is provided for the transfer of sulfur between these proteins as well as to DsrEFH and DsrC. PMID:24648525

The predictive value of FDG-PET with 3D-SSP for surgical outcomes in patients with temporal lobe epilepsy.

PubMed

Higo, Takuma; Sugano, Hidenori; Nakajima, Madoka; Karagiozov, Kostadin; Iimura, Yasushi; Suzuki, Masaru; Sato, Kiyoshi; Arai, Hajime

2016-10-01

We retrospectively evaluated the diagnostic value of (18)F-2-fluorodeoxy-d-glucose positron emission tomography (FDG-PET) with statistical analysis for the foci detection and predictive utility for postsurgical seizure outcome of patients with mesial temporal lobe epilepsy (mTLE). We evaluated 40 patients who were diagnosed mTLE and underwent selective amygdalohippocampectomy (SAH) or anterior temporal lobectomy (ATL) in our institute. Preoperative interictal FDG-PET with statistical analysis using three-dimensional stereotactic surface projection (3D-SSP) was detected with several clinical data including seizure semiology, MRI, scalp electroencephalography, surgical procedure with SAH or ATL and postsurgical outcome. The region of interest (ROI) was defined on 'Hippocampus & Amygdala', 'Parahippocampal gyrus & Uncus', 'T1 & T2', and 'T3 & Fusiform gyrus'. We obtained the ratio of hypometabolism difference (RHD) by 3D-SSP, and evaluated the relation among hypometabolic extent, surgical outcome and surgical procedure. The RHD in each ROIs ipsilateral to operative side was significantly higher than that of contralateral side in good outcome group. Hypometabolism of 'Hippocampus & Amygdala' was most reliable prognostic factor. Patients of discordant with presurgical examinations hardly showed obvious lateralized hypometabolism. Nevertheless, when they have significantly high RHD in mesial temporal lobe, good surgical outcome was expected. There was not significant difference of RHD distribution between SAH and ATL in good outcome group. Significant hypometabolism in mesial temporal lobe on FDG-PET with 3D-SSP is useful to predict good surgical outcome for patients with mTLE, particularly in discordant patients with hypometabolism in mesial temporal structure. However, FDG-PET is not indicative of surgical procedure. Copyright © 2016 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

Rabbit haemorrhagic disease: advantages of cELISA in assessing immunity in wild rabbits (Oryctolagus cuniculus).

PubMed

Zheng, Tao; Parkes, John P

2011-12-15

Rabbit haemorrhagic disease (RHD) is an acute fatal disease of domestic and wild European rabbits (Oryctolagus cuniculus) caused by RHD virus (RHDV). Accurate assessment of immunity is of great importance for the conservation and control of wild rabbits. We evaluated a competitive ELISA (cELISA) against isotype ELISAs for assessing the protective immunity against the disease by challenging 50 wild-caught rabbits with a lethal dose of RHDV. Death or survival to the challenge was used as a criterion to determine the performance characteristics of the assay for the assessment of immunity in rabbits. At 1:10 dilution, a serum exhibiting ≥ 25% inhibition (1:10(25)) was regarded as the presence of RHDV-specific antibodies. Eleven of 16 (68.8%) rabbits with antibodies at 1:10(25) (<1:40) died of RHD. When the cut-off was moved from 25% to 50% inhibition (1:10(50)) at 1:10 serum dilution, the assay sensitivity, specificity and accuracy for the protective immunity were improved from 84%, 54.2% and 69.4% to 84%, 100% and 91.8%, respectively. We also demonstrated at the epitope amino acid sequence level why the presence of the RHDV-cross reactive benign rabbit calicivirus, which interfered with isotype ELISAs, had little impact on the specificity of the cELISA for the diagnosis of RHDV infection. The presence of RHDV-specific antibody at 1:10(50) by the cELISA is a reliable indicator for the protective immunity. In contrast to isotype ELISAs, the cELISA is a valuable specific tool for monitoring the herd immunity to RHD for the conservation and management of wild rabbits in the field. Copyright © 2011 Elsevier B.V. All rights reserved.

Relationship between obstetric history and Rh(D) alloimmunization severity.

PubMed

Lobato, Gustavo; Soncini, Cristina Silveira

2008-03-01

To evaluate the relationship between obstetric history and Rh(D) alloimmunization severity, employing the gestational age at the first intrauterine fetal transfusion (IUT) as an indicator of this severity. From 1996 to 2006, Rh(D) alloimmunized pregnancies submitted to IUT had their data assessed. Gestational age at the first IUT was modeled as a linear outcome. The associations between obstetric history variables, anti-Rh(D) antibodies titer and gestational age at the first IUT were analyzed. Statistics are presented with 95% confidence intervals (P < 0.05). A total of 82 non-hydropic anemic fetuses, ensuing in 92.7% (n = 76) of perinatal survival, were submitted to IUT. Nineteen (23,2%) pregnant women did not present with any previous stillbirth, neonatal death, IUT, hydrops or neonatal exchange transfusion (group 1); and 63 (76.8%) reported at least one of these events (group 2). Gestational age at the first IUT differed significantly between the groups (P = 0.0001). For group 1, it ranged from 24 to 35 weeks (median 32.5 weeks), whereas for group 2 it ranged from 19 to 34 weeks (median 27 weeks). In the multivariated analysis, previous neonatal death (P = 0.040), previous IUT (P = 0.000) and previous neonatal exchange transfusion (P = 0.036) were independently associated with the gestational age at the first IUT. The evaluation of the obstetrical history is an important diagnostic tool for predicting Rh(D) alloimmunization severity. Alloimmunized pregnant women who reported previous neonatal death(s), neonatal exchange transfusion(s) or IUT(s) should receive a closer fetal surveillance due to the risk of a higher rate of fetal hemolysis and the need of an earlier IUT.

Diagnostic value of color flow mapping and Doppler echocardiography in the quantification of mitral regurgitation in patients with mitral valve prolapse or rheumatic heart disease.

PubMed

Pinheiro, Aurélio Carvalho; Mancuso, Frederico José Neves; Hemerly, Daniela Fernanda Alli; Kiyose, Alberto Takeshi; Campos, Orlando; de Andrade, José Lázaro; de Paola, Angelo Amato Vicenzo; de Camargo Carvalho, Antonio Carlos; Moises, Valdir Ambrosio

2007-10-01

The objective was to analyze the diagnostic value of the echocardiographic methods used for quantification of mitral regurgitation (MR) in patients with mitral valve prolapse (MVP) or rheumatic heart disease (RHD). The study included 50 patients with MR (mean age of 46.1 years; 35 women), 27 (54%) with RHD and 23 (46%) with MVP. Quantification of the mitral valve regurgitation was obtained by regurgitant orifice area (ROA) and regurgitant volume (RV) by the flow convergence region (FCR) and two-dimensional Doppler echocardiographic methods, regurgitant fraction, jet area (JA), jet area/left atrial area ratio (JA/LAA), and vena contracta (VC). Patients were clinically followed to identify cardiovascular events. Data were analyzed by Pearson, kappa, and receiver operator characteristic curve tests; significance was defined as a P value less than .05. The correlation between the two methods for ROA and RV were r = 0.79 and r = 0.80, respectively, and between these parameters and regurgitant fraction, VC, JA, and JA/LAA varied from r = 0.54 to r = 0.94 (P lt; .05); the agreement varied from kappa = 0.19 to kappa = 0.83. The highest accuracy to identify patients with clinically significant MR (events at follow-up) was 96% for ROA by FCR, 94% for VC, 86% for RV by FCR, and 86% for JA. No method showed a significant difference between MVP and RHD. The methods analyzed had significant correlation and good agreement. ROA by FCR and VC had the best performance to identify severe MR; no significant difference between MVP and RHD was observed.

Exploring auditory neglect: Anatomo-clinical correlations of auditory extinction.

PubMed

Tissieres, Isabel; Crottaz-Herbette, Sonia; Clarke, Stephanie

2018-05-23

The key symptoms of auditory neglect include left extinction on tasks of dichotic and/or diotic listening and rightward shift in locating sounds. The anatomical correlates of the latter are relatively well understood, but no systematic studies have examined auditory extinction. Here, we performed a systematic study of anatomo-clinical correlates of extinction by using dichotic and/or diotic listening tasks. In total, 20 patients with right hemispheric damage (RHD) and 19 with left hemispheric damage (LHD) performed dichotic and diotic listening tasks. Either task consists of the simultaneous presentation of word pairs; in the dichotic task, 1 word is presented to each ear, and in the diotic task, each word is lateralized by means of interaural time differences and presented to one side. RHD was associated with exclusively contralesional extinction in dichotic or diotic listening, whereas in selected cases, LHD led to contra- or ipsilesional extinction. Bilateral symmetrical extinction occurred in RHD or LHD, with dichotic or diotic listening. The anatomical correlates of these extinction profiles offer an insight into the organisation of the auditory and attentional systems. First, left extinction in dichotic versus diotic listening involves different parts of the right hemisphere, which explains the double dissociation between these 2 neglect symptoms. Second, contralesional extinction in the dichotic task relies on homologous regions in either hemisphere. Third, ipsilesional extinction in dichotic listening after LHD was associated with lesions of the intrahemispheric white matter, interrupting callosal fibres outside their midsagittal or periventricular trajectory. Fourth, bilateral symmetrical extinction was associated with large parieto-fronto-temporal LHD or smaller parieto-temporal RHD, which suggests that divided attention, supported by the right hemisphere, and auditory streaming, supported by the left, likely play a critical role. Copyright © 2018. Published by Elsevier Masson SAS.

Penicillin Dried Blood Spot Assay for Use in Patients Receiving Intramuscular Benzathine Penicillin G and Other Penicillin Preparations To Prevent Rheumatic Fever

PubMed Central

Page-Sharp, Madhu; Coward, Jonathan; Moore, Brioni R.; Marshall, Lewis; Batty, Kevin T.

2017-01-01

ABSTRACT Rheumatic heart disease (RHD) remains an important global health challenge. Administration of benzathine penicillin (BPG) every 3 to 4 weeks is recommended as a secondary prophylaxis to prevent recurrent episodes of acute rheumatic fever and subsequent RHD. Following intramuscular injection, BPG is hydrolyzed to penicillin G (benzylpenicillin). However, little is known of the pharmacokinetics (PK) of BPG in pediatric populations at high risk of RHD or of the pharmacokinetic-pharmacodynamic relationship between penicillin exposure and clinically relevant outcomes. Dried blood spot (DBS) assays can facilitate PK studies in situations where frequent venous blood sampling is logistically difficult. A liquid chromatography-mass spectroscopy assay for penicillin G in plasma and DBS was developed and validated. Application of the DBS assay for PK studies was confirmed using samples from adult patients receiving penicillin as part of an infection management plan. The limit of quantification for penicillin G in DBS was 0.005 mg/liter. Penicillin G is stable in DBS for approximately 12 h at room temperature (22°C), 6 days at 4°C, and >1 month at −20°C. Plasma and DBS penicillin G concentrations for patients receiving BPG and penicillin G given via bolus doses correlated well and had comparable time-concentration profiles. There was poor correlation for patients receiving penicillin via continuous infusions, perhaps as a result of the presence of residual penicillin in the peripherally inserted central catheter, from which the plasma samples were collected. The present DBS penicillin G assay can be used as a surrogate for plasma concentrations to provide valid PK data for studies of BPG and other penicillin preparations developed to prevent rheumatic fever and RHD. PMID:28559267

The MNS glycophorin variant GP.Mur affects differential erythroid expression of Rh/RhAG transcripts.

PubMed

Hsu, K; Kuo, M-S; Yao, C-C; Cheng, H-C; Lin, H-J; Chan, Y-S; Lin, M

2017-10-01

The band 3 macrocomplex (also known as the ankyrin-associated complex) on the red cell membrane comprises two interacting subcomplexes: a band 3/glycophorin A subcomplex, and a Rh/RhAG subcomplex. Glycophorin B (GPB) is a component of the Rh/RhAG subcomplex that is also structurally associated with glycophorin A (GPA). Expression of glycophorin B-A-B hybrid GP.Mur enhances band 3 expression and is associated with lower levels of Rh-associated glycoprotein (RhAG) and Rh polypeptides. The goal of this study was to determine whether GP.Mur influenced erythroid Rh/RhAG expression at the transcript level. GP.Mur was serologically determined in healthy participants from Taitung County, Taiwan. RNA was extracted from the reticulocyte-enriched fraction of peripheral blood, followed by reverse transcription and quantitative PCR for RhAG, RhD and RhCcEe. Quantification by real-time PCR revealed significantly fewer RhAG and RhCcEe transcripts in the reticulocytes from subjects with homozygous GYP*Mur. Independent from GYP.Mur, both RhAG and RhD transcript levels were threefold or higher than that of RhCcEe. Also, in GYP.Mur and the control samples alike, direct quantitative associations were observed between the transcript levels of RhAG and RhD, but not between that of RhAG and RhCcEe. Erythroid RhD and RhCcEe were differentially expressed at the transcript levels, which could be related to their different degrees of interaction or sensitivity to RhAG. Further, the reduction or absence of glycophorin B in GYP.Mur erythroid cells affected transcript expressions of RhAG and RhCcEe. Thus, GPB and GP.Mur differentially influenced Rh/RhAG expressions prior to protein translation. © 2017 International Society of Blood Transfusion.

Rheumatic fever & rheumatic heart disease: The last 50 years

PubMed Central

Kumar, R. Krishna; Tandon, R.

2013-01-01

Rheumatic fever (RF) and rheumatic heart disease (RHD) continue to be a major health hazard in most developing countries as well as sporadically in developed economies. Despite reservations about the utility, echocardiographic and Doppler (E&D) studies have identified a massive burden of RHD suggesting the inadequacy of the Jones’ criteria updated by the American Heart Association in 1992. Subclinical carditis has been recognized by E&D in patients with acute RF without clinical carditis as well as by follow up of RHD patients presenting as isolated chorea or those without clinical evidence of carditis. Over the years, the medical management of RF has not changed. Paediatric and juvenile mitral stenosis (MS), upto the age of 12 and 20 yr respectively, severe enough to require operative treatement was documented. These negate the belief that patients of RHD become symptomatic ≥20 years after RF as well as the fact that congestive cardiac failure in childhood indicates active carditis and RF. Non-surgical balloon mitral valvotomy for MS has been initiated. Mitral and/or aortic valve replacement during active RF in patients not responding to medical treatment has been found to be life saving as well as confirming that congestive heart failure in acute RF is due to an acute haemodynamic overload. Pathogenesis as well as susceptibility to RF continue to be elusive. Prevention of RF morbidity depends on secondary prophylaxis which cannot reduce the burden of diseases. Primary prophylaxis is not feasible in the absence of a suitable vaccine. Attempts to design an antistreptococcal vaccine utilizing the M-protein has not succeeded in the last 40 years. Besides pathogenesis many other questions remain unanswered. PMID:23703332

Repeat exposure to group A streptococcal M protein exacerbates cardiac damage in a rat model of rheumatic heart disease.

PubMed

Gorton, Davina; Sikder, Suchandan; Williams, Natasha L; Chilton, Lisa; Rush, Catherine M; Govan, Brenda L; Cunningham, Madeleine W; Ketheesan, Natkunam

2016-12-01

Rheumatic fever and rheumatic heart disease (RF/RHD) develop following repeated infection with group A streptococci (GAS). We used the Rat Autoimmune Valvulitis (RAV) model of RF/RHD to demonstrate that repetitive booster immunization with GAS-derived recombinant M protein (rM5) resulted in an enhanced anti-cardiac myosin antibody response that may contribute to the breaking of immune tolerance leading to RF/RHD and increased infiltration of heart valves by mononuclear cells. With each boost, more inflammatory cells were observed infiltrating heart tissue which could lead to severe cardiac damage. We also found evidence that both complement and anti-M protein antibodies in serum from rM5-immunized rats have the potential to contribute to inflammation in heart valves by activating cardiac endothelium. More importantly, we have demonstrated by electrocardiography for the first time in the RAV model that elongation of P-R interval follows repetitive boost with rM5. Our observations provide experimental evidence for cardiac alterations following repeated exposure to GAS M protein with immunological and electrophysiological features resembling that seen in humans following recurrent GAS infection.

Selective DNA demethylation by fusion of TDG with a sequence-specific DNA-binding domain

PubMed Central

Gregory, David J.; Mikhaylova, Lyudmila; Fedulov, Alexey V.

2012-01-01

Our ability to selectively manipulate gene expression by epigenetic means is limited, as there is no approach for targeted reactivation of epigenetically silenced genes, in contrast to what is available for selective gene silencing. We aimed to develop a tool for selective transcriptional activation by DNA demethylation. Here we present evidence that direct targeting of thymine-DNA-glycosylase (TDG) to specific sequences in the DNA can result in local DNA demethylation at potential regulatory sequences and lead to enhanced gene induction. When TDG was fused to a well-characterized DNA-binding domain [the Rel-homology domain (RHD) of NFκB], we observed decreased DNA methylation and increased transcriptional response to unrelated stimulus of inducible nitric oxide synthase (NOS2). The effect was not seen for control genes lacking either RHD-binding sites or high levels of methylation, nor in control mock-transduced cells. Specific reactivation of epigenetically silenced genes may thus be achievable by this approach, which provides a broadly useful strategy to further our exploration of biological mechanisms and to improve control over the epigenome. PMID:22419066

Deliquescence and efflorescence of small particles.

PubMed

McGraw, Robert; Lewis, Ernie R

2009-11-21

We examine size-dependent deliquescence/efflorescence phase transformation for particles down to several nanometers in size. Thermodynamic properties of inorganic salt particles, coated with aqueous solution layers of varying thickness and surrounded by vapor, are analyzed. A thin layer criterion (TLC) is introduced to define a limiting deliquescence relative humidity (RH(D)) for small particles. This requires: (1) equality of chemical potentials between salt in an undissolved core, and thin adsorbed solution layer, and (2) equality of chemical potentials between water in the thin layer and vapor phase. The usual bulk deliquescence conditions are recovered in the limit of large dry particle size. Nanosize particles are found to deliquesce at relative humidity just below the RH(D) on crossing a nucleation barrier, located at a critical solution layer thickness. This barrier vanishes precisely at the RH(D) defined by the TLC. Concepts and methods from nucleation theory including the kinetic potential, self-consistent nucleation theory, nucleation theorems, and the Gibbs dividing surface provide theoretical foundation and point to unifying features of small particle deliquescence/efflorescence processes. These include common thermodynamic area constructions, useful for interpretation of small particle water uptake measurements, and a common free-energy surface, with constant RH cross sections describing deliquescence and efflorescence related through the nucleation theorem.

ß-Cyanoalanine Synthase Action in Root Hair Elongation is Exerted at Early Steps of the Root Hair Elongation Pathway and is Independent of Direct Cyanide Inactivation of NADPH Oxidase.

PubMed

Arenas-Alfonseca, Lucía; Gotor, Cecilia; Romero, Luis C; García, Irene

2018-05-01

In Arabidopsis thaliana, cyanide is produced concomitantly with ethylene biosynthesis and is mainly detoxified by the ß-cyanoalanine synthase CAS-C1. In roots, CAS-C1 activity is essential to maintain a low level of cyanide for proper root hair development. Root hair elongation relies on polarized cell expansion at the growing tip, and we have observed that CAS-C1 locates in mitochondria and accumulates in root hair tips during root hair elongation, as shown by observing the fluorescence in plants transformed with the translational construct ProC1:CASC1-GFP, containing the complete CAS-C1 gene fused to green fluorescent protein (GFP). Mutants in the SUPERCENTIPEDE (SCN1) gene, that regulate the NADPH oxidase gene ROOT HAIR DEFECTIVE 2 (RHD2)/AtrbohC, are affected at the very early steps of the development of root hair that do not elongate and do not show a preferential localization of the GFP accumulation in the tips of the root hair primordia. Root hairs of mutants in CAS-C1 or RHD2/AtrbohC, whose protein product catalyzes the generation of ROS and the Ca2+ gradient, start to grow out correctly, but they do not elongate. Genetic crosses between the cas-c1 mutant and scn1 or rhd2 mutants were performed, and the detailed phenotypic and molecular characterization of the double mutants demonstrates that scn1 mutation is epistatic to cas-c1 and cas-c1 is epistatic to rhd2 mutation, indicating that CAS-C1 acts in early steps of the root hair development process. Moreover, our results show that the role of CAS-C1 in root hair elongation is independent of H2O2 production and of a direct NADPH oxidase inhibition by cyanide.

Genome-Wide Analysis of Genetic Risk Factors for Rheumatic Heart Disease in Aboriginal Australians Provides Support for Pathogenic Molecular Mimicry.

PubMed

Gray, Lesley-Ann; D'Antoine, Heather A; Tong, Steven Y C; McKinnon, Melita; Bessarab, Dawn; Brown, Ngiare; Reményi, Bo; Steer, Andrew; Syn, Genevieve; Blackwell, Jenefer M; Inouye, Michael; Carapetis, Jonathan R

2017-12-12

Rheumatic heart disease (RHD) after group A streptococcus (GAS) infections is heritable and prevalent in Indigenous populations. Molecular mimicry between human and GAS proteins triggers proinflammatory cardiac valve-reactive T cells. Genome-wide genetic analysis was undertaken in 1263 Aboriginal Australians (398 RHD cases; 865 controls). Single-nucleotide polymorphisms were genotyped using Illumina HumanCoreExome BeadChips. Direct typing and imputation was used to fine-map the human leukocyte antigen (HLA) region. Epitope binding affinities were mapped for human cross-reactive GAS proteins, including M5 and M6. The strongest genetic association was intronic to HLA-DQA1 (rs9272622; P = 1.86 × 10-7). Conditional analyses showed rs9272622 and/or DQA1*AA16 account for the HLA signal. HLA-DQA1*0101_DQB1*0503 (odds ratio [OR], 1.44; 95% confidence interval [CI], 1.09-1.90; P = 9.56 × 10-3) and HLA-DQA1*0103_DQB1*0601 (OR, 1.27; 95% CI, 1.07-1.52; P = 7.15 × 10-3) were risk haplotypes; HLA_DQA1*0301-DQB1*0402 (OR 0.30, 95%CI 0.14-0.65, P = 2.36 × 10-3) was protective. Human myosin cross-reactive N-terminal and B repeat epitopes of GAS M5/M6 bind with higher affinity to DQA1/DQB1 alpha/beta dimers for the 2-risk haplotypes than the protective haplotype. Variation at HLA_DQA1-DQB1 is the major genetic risk factor for RHD in Aboriginal Australians studied here. Cross-reactive epitopes bind with higher affinity to alpha/beta dimers formed by risk haplotypes, supporting molecular mimicry as the key mechanism of RHD pathogenesis. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

[Natural forming causes of China population distribution].

PubMed

Fang, Yu; Ouyang, Zhi-Yun; Zheng, Hua; Xiao, Yi; Niu, Jun-Feng; Chen, Sheng-Bin; Lu, Fei

2012-12-01

The diverse natural environment in China causes the spatial heterogeneity of China population distribution. It is essential to understand the interrelations between the population distribution pattern and natural environment to enhance the understanding of the man-land relationship and the realization of the sustainable management for the population, resources, and environment. This paper analyzed the China population distribution by adopting the index of population density (PD) in combining with spatial statistic method and Lorenz curve, and discussed the effects of the natural factors on the population distribution and the interrelations between the population distribution and 16 indices including average annual precipitation (AAP), average annual temperature (AAT), average annual sunshine duration (AASD), precipitation variation (PV), temperature variation (TV), sunshine duration variation (SDV), relative humidity (RH), aridity index (AI), warmth index ( WI), > or = 5 degrees C annual accumulated temperature (AACT), average elevation (AE), relative height difference (RHD), surface roughness (SR), water system density (WSD), net primary productivity (NPP), and shortest distance to seashore (SDTS). There existed an obvious aggregation phenomenon in the population distribution in China. The PD was high in east China, medium in central China, and low in west China, presenting an obvious positive spatial association. The PD was significantly positively correlated with WSD, AAT, AAP, NPP, AACT, PV, RH, and WI, and significantly negatively correlated with RHD, AE, SDV, SR, and SDTS. The climate factors (AAT, WI, PV, and NPP), topography factors (SR and RHD), and water system factor (WSD) together determined the basic pattern of the population distribution in China. It was suggested that the monitoring of the eco-environment in the east China of high population density should be strengthened to avoid the eco-environmental degradation due to the expanding population, and the conservation of the eco-environment in the central and west China with vulnerable eco-environment should also be strengthened to enhance the population carrying ability of these regions and to mitigate the eco-environmental pressure in the east China of high population density.

Surface decoration of red blood cells with maleimidophenyl-polyethylene glycol facilitated by thiolation with iminothiolane: an approach to mask A, B, and D antigens to generate universal red blood cells.

PubMed

Nacharaju, Parimala; Boctor, Fouad N; Manjula, Belur N; Acharya, Seetharama A

2005-03-01

The surface decoration of red blood cells (RBCs) by polyethylene glycol (PEG) chains has been an approach developed to camouflage the blood group antigens from their antibodies. A PEGylation protocol, however, that can mask the antigens appropriately to inhibit the agglutination of RBCs with the respective antibodies is not available so far. A new approach for PEGylation of RBC membrane proteins has been designed with thiolation-mediated maleimide chemistry. The accessibility of the surface lysine residues of membrane proteins to bulky PEG reagents was increased by linking an extension arm carrying a thiol group. RBCs have been PEGylated by thiolation-mediated chemistry with maleimidophenyl-PEG (Mal-Phe-PEG) reagents of different chain lengths. Mal-Phe-PEG-5000 chains alone masked the most important antigens of the Rh system (C, c, E, e, and D) from their antibodies. The masking of the A and B antigens needed a combination of Mal-Phe-PEG-5000 and Mal-Phe-PEG-20000 chains to inhibit the agglutination of RBCs completely with anti-A or anti-B. Thiolation-mediated PEGylation of RBCs with Mal-Phe-PEG-5000 and Mal-Phe-PEG-20000 converts Group A Rh(D)+ and B Rh(D)+ RBCs into RBCs with serologic behavior comparable to Group O Rh(D)- RBCs that are considered as universal RBCs for transfusion.

High prevalence of rheumatic heart disease detected by echocardiography in school children.

PubMed

Bhaya, Maneesha; Panwar, Sadik; Beniwal, Rajesh; Panwar, Raja Babu

2010-04-01

It is fairly easy to detect advanced valve lesions of established rheumatic heart disease by echocardiography in the clinically identified cases of rheumatic heart disease. However, to diagnose a subclinical case of rheumatic heart disease, no uniform set of echocardiographic criteria exist. Moderate thickening of valve leaflets is considered an indicator of established rheumatic heart disease. World Health Organization criteria for diagnosing probable rheumatic heart disease are more sensitive and are based on the detection of significant regurgitation of mitral and/or aortic valves by color Doppler. We attempted diagnosing RHD in school children in Bikaner city by cardiac ultrasound. The stratified cluster sampling technique was employed to identify 31 random clusters in the coeducational schools of Bikaner city. We selected 1059 school children aged 6-15 years from these schools. An experienced operator did careful cardiac auscultation and echocardiographic study. A second expert confirmed the echocardiographic findings. The prevalence of lesions suggestive of rheumatic heart disease by echocardiography was 51 per 1,000 (denominator = 1059; 95% CI: 38-64 per 1,000). We were able to clinically diagnose RHD in one child. None of these children or their parents having echocardiographic evidence of RHD could provide a positive history of acute rheumatic fever. By echocardiographic screening, we found a high prevalence of rheumatic heart disease in the surveyed population. Clinical auscultation had much lower diagnostic efficacy.

Finite upper bound for the Hawking decay time of an arbitrarily large black hole in anti-de Sitter spacetime

NASA Astrophysics Data System (ADS)

Page, Don N.

2018-01-01

In an asymptotically flat spacetime of dimension d >3 and with the Newtonian gravitational constant G , a spherical black hole of initial horizon radius rh and mass M ˜rhd -3/G has a total decay time to Hawking emission of td˜rhd -1/G ˜G2 /(d -3 )M(d -1 )/(d -3 ) which grows without bound as the radius rh and mass M are taken to infinity. However, in asymptotically anti-de Sitter spacetime with a length scale ℓ and with absorbing boundary conditions at infinity, the total Hawking decay time does not diverge as the mass and radius go to infinity but instead remains bounded by a time of the order of ℓd-1/G .

A max-to-min technique for making projections of NDVI change in semi-arid Africa for food security early warning

NASA Astrophysics Data System (ADS)

Brown, M. E.; Funk, C. C.

2005-12-01

Climatic hazards such as droughts and floods often result in a decline in food production in economically vulnerable pre-industrial economies such as those in Africa. Early warning systems (EWS) have been developed to identify slow onset disasters such famine and epidemic disease that may result from hazardous environmental conditions. These conditions often precede food crises by many months, thus effective monitoring via satellite and in situ observations can allow for successful mitigation activities. Accurate forecasts of NDVI could increase monitoring lead times and allow for effective institutional planning of intervention, making early warning earlier. This paper presents a simple empirical max-to-min model for making 1 to 4 month NDVI projections. These statistical projections are based on parameterized satellite rainfall estimates (RFE) and relative humidity demand (RHD). A heuristic example in central Zimbabwe introduces the RFE growth and RHD loss terms. A quasi-global, one month ahead, 1 degree study then demonstrates reasonable accuracies in many semi-arid regions. In Africa, a 0.1 degree cross-validated skill assessment quantifies the technique's applicability at 1 to 4 month forecast intervals. These results suggest that useful projections can be made over many semi-arid, food insecure regions of Africa, with plausible extensions to drought prone areas of Asia, Australia and South America.

Clinical Significance of Markers of Collagen Metabolism in Rheumatic Mitral Valve Disease

PubMed Central

Banerjee, Tanima; Mukherjee, Somaditya; Ghosh, Sudip; Biswas, Monodeep; Dutta, Santanu; Pattari, Sanjib; Chatterjee, Shelly; Bandyopadhyay, Arun

2014-01-01

Background Rheumatic Heart Disease (RHD), a chronic acquired heart disorder results from Acute Rheumatic Fever. It is a major public health concern in developing countries. In RHD, mostly the valves get affected. The present study investigated whether extracellular matrix remodelling in rheumatic valve leads to altered levels of collagen metabolism markers and if such markers can be clinically used to diagnose or monitor disease progression. Methodology This is a case control study comprising 118 subjects. It included 77 cases and 41 healthy controls. Cases were classified into two groups- Mitral Stenosis (MS) and Mitral Regurgitation (MR). Carboxy-terminal propeptide of type I procollagen (PICP), amino-terminal propeptide of type III procollagen (PIIINP), total Matrix Metalloproteinase-1(MMP-1) and Tissue Inhibitor of Metalloproteinase-1 (TIMP-1) were assessed. Histopathology studies were performed on excised mitral valve leaflets. A p value <0.05 was considered statistically significant. Results Plasma PICP and PIIINP concentrations increased significantly (p<0.01) in MS and MR subjects compared to controls but decreased gradually over a one year period post mitral valve replacement (p<0.05). In MS, PICP level and MMP-1/TIMP-1 ratio strongly correlated with mitral valve area (r = −0.40; r = 0.49 respectively) and pulmonary artery systolic pressure (r = 0.49; r = −0.49 respectively); while in MR they correlated with left ventricular internal diastolic (r = 0.68; r = −0.48 respectively) and systolic diameters (r = 0.65; r = −0.55 respectively). Receiver operating characteristic curve analysis established PICP as a better marker (AUC = 0.95; 95% CI = 0.91−0.99; p<0.0001). A cut-off >459 ng/mL for PICP provided 91% sensitivity, 90% specificity and a likelihood ratio of 9 in diagnosing RHD. Histopathology analysis revealed inflammation, scarring, neovascularisation and extensive leaflet fibrosis in diseased mitral valve. Conclusions Levels of collagen metabolism markers correlated with echocardiographic parameters for RHD diagnosis. PMID:24603967

Techniques for virtual lung nodule insertion: volumetric and morphometric comparison of projection-based and image-based methods for quantitative CT

NASA Astrophysics Data System (ADS)

Robins, Marthony; Solomon, Justin; Sahbaee, Pooyan; Sedlmair, Martin; Choudhury, Kingshuk Roy; Pezeshk, Aria; Sahiner, Berkman; Samei, Ehsan

2017-09-01

Virtual nodule insertion paves the way towards the development of standardized databases of hybrid CT images with known lesions. The purpose of this study was to assess three methods (an established and two newly developed techniques) for inserting virtual lung nodules into CT images. Assessment was done by comparing virtual nodule volume and shape to the CT-derived volume and shape of synthetic nodules. 24 synthetic nodules (three sizes, four morphologies, two repeats) were physically inserted into the lung cavity of an anthropomorphic chest phantom (KYOTO KAGAKU). The phantom was imaged with and without nodules on a commercial CT scanner (SOMATOM Definition Flash, Siemens) using a standard thoracic CT protocol at two dose levels (1.4 and 22 mGy CTDIvol). Raw projection data were saved and reconstructed with filtered back-projection and sinogram affirmed iterative reconstruction (SAFIRE, strength 5) at 0.6 mm slice thickness. Corresponding 3D idealized, virtual nodule models were co-registered with the CT images to determine each nodule’s location and orientation. Virtual nodules were voxelized, partial volume corrected, and inserted into nodule-free CT data (accounting for system imaging physics) using two methods: projection-based Technique A, and image-based Technique B. Also a third Technique C based on cropping a region of interest from the acquired image of the real nodule and blending it into the nodule-free image was tested. Nodule volumes were measured using a commercial segmentation tool (iNtuition, TeraRecon, Inc.) and deformation was assessed using the Hausdorff distance. Nodule volumes and deformations were compared between the idealized, CT-derived and virtual nodules using a linear mixed effects regression model which utilized the mean, standard deviation, and coefficient of variation (Mea{{n}RHD} , ST{{D}RHD} and C{{V}RHD}{) }~ of the regional Hausdorff distance. Overall, there was a close concordance between the volumes of the CT-derived and virtual nodules. Percent differences between them were less than 3% for all insertion techniques and were not statistically significant in most cases. Correlation coefficient values were greater than 0.97. The deformation according to the Hausdorff distance was also similar between the CT-derived and virtual nodules with minimal statistical significance in the (C{{V}RHD} ) for Techniques A, B, and C. This study shows that both projection-based and image-based nodule insertion techniques yield realistic nodule renderings with statistical similarity to the synthetic nodules with respect to nodule volume and deformation. These techniques could be used to create a database of hybrid CT images containing nodules of known size, location and morphology.

Anatomic Variation in Intrahepatic Bile Ducts: an Analysis of Intraoperative Cholangiograms in 300 Consecutive Donors for Living Donor Liver Transplantation

PubMed Central

Choi, Jin Woo; Kim, Kyoung Won; Kim, Ah Young; Kim, Pyo Nyun; Ha, Hyun Kwon; Lee, Moon-Gyu

2003-01-01

Objective To describe the anatomical variation occurring in intrahepatic bile ducts (IHDs) in terms of their branching patterns, and to determine the frequency of each variation. Materials and Methods The study group consisted of 300 consecutive donors for liver transplantation who underwent intraoperative cholangiography. Anatomical variation in IHDs was classified according to the branching pattern of the right anterior and right posterior segmental duct (RASD and RPSD, respectively), and the presence or absence of the first-order branch of the left hepatic duct (LHD), and of an accessory hepatic duct. Results The anatomy of the intrahepatic bile ducts was typical in 63% of cases (n=188), showed triple confluence in 10% (n=29), anomalous drainage of the RPSD into the LHD in 11% (n=34), anomalous drainage of the RPSD into the common hepatic duct (CHD) in 6% (n=19), anomalous drainage of the RPSD into the cystic duct in 2% (n=6), drainage of the right hepatic duct (RHD) into the cystic duct (n=1), the presence of an accessory duct leading to the CHD or RHD in 5% (n=16), individual drainage of the LHD into the RHD or CHD in 1% (n=4), and unclassified or complex variation in 1% (n=3). Conclusion The branching pattern of IHDs was atypical in 37% of cases. The two most common variations were drainage of the RPSD into the LHD (11%) and triple confluence of the RASD, RPSD and LHD (10%). PMID:12845303

Anatomic variations in intrahepatic bile ducts in a north Indian population.

PubMed

Sharma, Vijay; Saraswat, Vivek Anand; Baijal, Sanjay Saran; Choudhuri, Gourdas

2008-07-01

In the present study, we described the anatomical variations in the branching patterns of intrahepatic bile ducts (IHD) and determined the frequency of each variation in north Indian patients. There are no data from India. The study group consisted of 253 consecutive patients (131 women) undergoing endoscopic retrograde cholangiograms for different indications. Anatomical variations in IHD were classified according to the branching pattern of the right anterior segmental duct (RASD) and the right posterior segmental duct (RPSD), presence or absence of first-order branch of left hepatic duct (LHD) and of an accessory hepatic duct. Anatomy of the IHD was typical in 52.9% of cases (n = 134), showing triple confluence in 11.46% (n = 29), anomalous drainage of the RPSD into the LHD in 18.2% (n = 46), anomalous drainage of the RPSD into the common hepatic duct (CHD) in 7.1% (n = 18), drainage of the right hepatic duct (RHD) into the cystic duct 0.4% (n = 1), presence of an accessory duct leading to the CHD or RHD in 4.7% (n = 12), individual drainage of the LHD into the RHD or CHD in 2.4% (n = 6), and unclassified or complex variations in 2.7% (n = 7). None had anomalous drainage of RPSD into the cystic duct. The branching pattern of IHD was atypical in 47% patients. The two most common variations were drainage of the RPSD into the LHD (18.2%) and triple confluence of the RASD, RPSD, and LHD (11.5%).

Narratives of Focal Brain Injured Individuals: A Macro-Level Analysis

PubMed Central

Karaduman, Ayşenur; Göksun, Tilbe; Chatterjee, Anjan

2017-01-01

Focal brain injury can have detrimental effects on the pragmatics of communication. This study examined narrative production by unilateral brain damaged people (n= 36) and healthy controls and focused on the complexity (content and coherence) and the evaluative aspect of their narratives to test the general hypothesis that the left hemisphere is biased to process microlinguistic information and the right hemisphere is biased to process macrolinguistic information. We found that people with left hemisphere damage’s (LHD) narratives were less likely to maintain the overall theme of the story and produced fewer evaluative comments in their narratives. These deficits correlated with their performances on microlinguistic linguistic tasks. People with the right hemisphere damage (RHD) seemed to be preserved in expressing narrative complexity and evaluations as a group. Yet, single case analyses revealed that particular regions in the right hemisphere such as damage to the dorsolateral prefrontal cortex (DLPFC), the anterior and superior temporal gyrus, the middle temporal gyrus, and the supramarginal gyrus lead to problems in creating narratives. Our findings demonstrate that both hemispheres are necessary to produce competent narrative production. LHD people’s poor production is related to their microlinguistic language problems whereas RHD people’s impaired abilities can be associated with planning and working memory abilities required to relate events in a narrative. PMID:28347806

An FDA oncology analysis of CD3 bispecific constructs and first-in-human dose selection.

PubMed

Saber, Haleh; Del Valle, Pedro; Ricks, Tiffany K; Leighton, John K

2017-11-01

We retrospectively examined the nonclinical studies conducted with 17 CD3 bispecific constructs in support of first-in-human (FIH) trials in oncology. We also collected information on the design of dose-finding clinical trials. Sponsors have used different MABEL approaches for FIH dose selection. To better assess acceptable approaches, FIH doses were computed from nonclinical studies and compared to the maximum tolerated doses (MTDs) in patients, to the highest human doses (HHDs) when an MTD was not identified, or to the recommended human dose (RHD) for blinatumomab. We concluded that approaches based on receptor occupancy, highest non-severely toxic dose, or no-observed adverse effect level are not acceptable for selecting the FIH dose as they resulted in doses close to or above the MTDs, HHDs, or the RHD. A FIH dose corresponding to 10%-30% pharmacologic activity (PA) was an acceptable approach. A FIH dose corresponding to 50% PA was acceptable for all except one construct, potentially due to its biological or structural properties. The most common toxicities in animals and patients were those related to cytokine release. Doses were better tolerated when intra-animal or intra-patient dose escalation was used. Exposing naïve patients to an MTD achieved with intra-patient dose escalation design may be unsafe. Published by Elsevier Inc.

Complicated rheumatic mitral stenosis presenting in an elderly patient and the challenges in its management.

PubMed

Ganeshpure, Swapnil; Vaidya, Gaurang Nandkishor; Gattani, Vipul

2012-12-05

A 76 -year-old lady with a recent diagnosis of rheumatic heart disease (RHD), and a history of repeated lower respiratory tract infections, came with symptoms of gastritis unrelated to the primary disease but further diagnostic study in the hospital revealed poorly controlled atrial fibrillation, grossly dilated left atrium with two large left atrial thrombi and mitral valve area<1 cm(2). It was decided that the best approach in our patient would be mitral valve replacement with mechanical prosthesis. Despite the usual trend of using bioprosthesis in the elderly, our decision was influenced by the fact that the patient would need chronic anticoagulation for atrial fibrillation in any case. The purpose of our case presentation is to illustrate a late-presenting case of RHD with unusual associations and the challenges to choose the best possible management.

mga genosensor for early detection of human rheumatic heart disease.

PubMed

Singh, Swati; Kaushal, Ankur; Khare, Shashi; Kumar, Ashok

2014-05-01

The 5' amino-labeled DNA probe complementary to mga gene of Streptococcus pyogenes was immobilized on carboxylated multiwall carbon nanotubes electrode and hybridized with 0.1-100 ng/6 μl single-stranded genomic DNA (ssG-DNA) of S. pyogenes from throat swab of suspected rheumatic heart disease (RHD) patients. Electrochemical response was measured by cyclic voltammetry (CV), differential pulse voltammetry (DPV), and electrochemical impedance (EI). The sensitivity of the sensor was 106.03 (μA/cm(2))/ng and limit of detection (LOD) was found 0.014 ng/6 μl with regression coefficient (R(2)) of 0.921 using DPV. The genosensor was characterized by FTIR and SEM, and electrode was found stable for 6 months on storage at 4 °C with 5-6 % loss in initial DPV current. mga genosensor is the first report on RHD sensor which can save life of several suspected patients by early diagnosis in 30 min.

Right cerebral hemisphere specialization for quiet and perturbed body balance control: Evidence from unilateral stroke.

PubMed

Fernandes, Corina Aparecida; Coelho, Daniel Boari; Martinelli, Alessandra Rezende; Teixeira, Luis Augusto

2018-02-01

Our aim in this investigation was to assess the relative importance of each cerebral hemisphere in quiet and perturbed balance, based on uni-hemispheric lesions by stroke. We tested the hypothesis of right cerebral hemisphere specialization for balance control. Groups of damage either to the right (RHD, n=9) or the left (LHD, n=7) cerebral hemisphere were compared across tasks requiring quiet balance or body balance recovery following a mechanical perturbation, comparing them to age-matched nondisabled individuals (controls, n=24). They were evaluated in conditions of full and occluded vision. In Experiment 1, the groups were compared in the task of quiet standing on (A) rigid and (B) malleable surfaces, having as outcome measures center of pressure (CoP) amplitude and velocity sway. In Experiment 2, we evaluated the recovery of body balance following a perturbation inducing forward body oscillation, having as outcome measures CoP displacement, peak hip and ankle rotations and muscular activation of both legs. Results from Experiment 1 showed higher values of CoP sway velocity for RHD in comparison to LHD and controls in the anteroposterior (rigid surface) and mediolateral (malleable surface) directions, while LHD had lower balance stability than the controls only in the mediolateral direction when supported on the rigid surface. In Experiment 2 results showed that RHD led to increased values in comparison to LHD and controls for anteroposterior CoP displacement and velocity, time to CoP direction reversion, hip rotation, and magnitude of muscular activation in the paretic leg, while LHD was found to differ in comparison to controls in magnitude of muscular activation of the paretic leg and amplitude of mediolateral sway only. These results suggest that damage to the right as compared to the left cerebral hemisphere by stroke leads to poorer postural responses both in quiet and perturbed balance. That effect was not altered by manipulation of sensory information. Our findings suggest that the right cerebral hemisphere plays a more prominent role in efferent processes responsible for balance control. Copyright © 2017 Elsevier B.V. All rights reserved.

Heart failure in sub-Saharan Africa: A contemporaneous systematic review and meta-analysis.

PubMed

Agbor, Valirie N; Essouma, Mickael; Ntusi, Ntobeko A B; Nyaga, Ulrich Flore; Bigna, Jean Joel; Noubiap, Jean Jacques

2018-04-15

To summarise available data on the prevalence, aetiology, treatment and prognosis of heart failure (HF) in sub-Saharan Africa (SSA). This systematic review and meta-analysis included data from individuals recruited in primary to tertiary health facilities in SSA. All published and unpublished literatures between January 1, 1996 and June 23, 2017, of individuals aged 12years and older and residing in sub-Saharan Africa. They must be of African descent. Number of heart failure admissions into general wards or HF clinics; number of cases of the different aetiologies of HF; number of participants on the different medications for HF; number of cases of all-cause mortality in participants with HF, and the predictors of all-cause mortality. Due to a limited word count, only results on the aetiologies of HF will be presented in the abstract. Thirty five full text articles were selected after screening of an initial 3785 titles and abstract. Hypertensive heart disease (HHD) (39.2% [95% CI=32.6-45.9]) was the commonest cause of HF in SSA, followed by cardiomyopathies (CMO) (21.4% [95% CI=16.0-27.2]) and rheumatic heart disease (RHD) (14.1% [95% CI=10.0-18.8]). Ischaemic heart disease (7.2% [95% CI=4.1-11.0]) was rare. HHD, CMO and RHD are the most common causes of HF in SSA, with HHD and CMO responsible for over 50% of the cases. Also, the last two decades have witnessed a relative reduction in the prevalence of RHD below 15.0%. Copyright © 2017 Elsevier B.V. All rights reserved.

Rheumatic Fever and Rheumatic Heart Disease: Collaboration Patterns and Research Core Topics.

PubMed

Salinas, Alejandro; González, Gregorio; Manuel Ramos, Jose

2016-09-01

Rheumatic fever and rheumatic heart disease (RHD) are important health problems in developing countries. The study aim was to provide a review and content analysis of the scientific literature on rheumatic fever and RHD over a 70-year period. Medline was employed via the online PubMed service of the US National Library of Medicine, to search for all documents containing the MeSH terms 'rheumatic fever' or 'rheumatic heart disease' between January 1945 and December 2013. A total of 18,552 references was retrieved. Between 1945 and 1970 the number of annual publications containing the search terms increased, but decreased between 1971 and 2013. Between 1990 and 2013, national collaboration (co-authorship) was greatly increased, from 8.7% to 41.7% of the total reports. International collaboration also increased, from 2.5% to 14.8% (p = 0.001). The United States was the main collaborating country, sharing ties mainly with India, South Africa and Brazil. A content analysis led to the identification of three prominent core research topics, chief among which were heart diseases (rheumatic fever diseases, mitral valve diseases and endocarditis). Other areas of note included streptococcal infections and rheumatic diseases (which, in addition to rheumatic fever, also highlighted arthritis and juvenile arthritis). Publications on rheumatic fever and RHD had a major impact during the 1960s, but research groups interest has since declined overall, in line with a decreasing interest in these diseases in developed countries. In contrast, national and international collaboration has increased, a phenomenon that should be encouraged for research into these and other diseases that affect developing countries.

In silico and experimental methods revealed highly diverse bacteria with quorum sensing and aromatics biodegradation systems--a potential broad application on bioremediation.

PubMed

Huang, Yili; Zeng, Yanhua; Yu, Zhiliang; Zhang, Jing; Feng, Hao; Lin, Xiuchun

2013-11-01

Phylogenetic overlaps between aromatics-degrading bacteria and acyl-homoserine-lactone (AHL) or autoinducer (AI) based quorum-sensing (QS) bacteria were evident in literatures; however, the diversity of bacteria with both activities had never been finely described. In-silico searching in NCBI genome database revealed that more than 11% of investigated population harbored both aromatic ring-hydroxylating-dioxygenase (RHD) gene and AHL/AI-synthetase gene. These bacteria were distributed in 10 orders, 15 families, 42 genus and 78 species. Horizontal transfers of both genes were common among them. Using enrichment and culture dependent method, 6 Sphingomonadales and 4 Rhizobiales with phenanthrene- or pyrene-degrading ability and AHL-production were isolated from marine, wetland and soil samples. Thin-layer-chromatography and gas-chromatography-mass-spectrum revealed that these Sphingomonads produced various AHL molecules. This is the first report of highly diverse bacteria that harbored both aromatics-degrading and QS systems. QS regulation may have broad impacts on aromatics biodegradation, and would be a new angle for developing bioremediation technology. Copyright © 2013 Elsevier Ltd. All rights reserved.

Secondary prevention for screening detected rheumatic heart disease: opportunities to improve adherence.

PubMed

Engelman, Daniel; Ah Kee, Maureen; Mataika, Reapi L; Kado, Joseph H; Colquhoun, Samantha M; Tulloch, Jim; Steer, Andrew C

2017-04-01

Secondary prevention is an effective treatment for rheumatic heart disease (RHD), but ensuring high adherence to prophylaxis over many years is challenging and requires understanding of local factors. Participants were young people diagnosed with RHD through echocardiographic screening in Fiji. We used a structured interview to evaluate the following: health seeking behaviours; attitudes, practice, barriers and potential improvement strategies for adherence to antibiotic prophylaxis; and adolescent-friendly qualities of the health service. One hundred and one participants were interviewed (median age, 17.2 years). Adherence was very low overall (adequate in 6%). Sore throat and fever with sore joints were experienced in the preceding year by 42% and 28%, respectively. Barriers to receiving treatment included taking alternate treatments and the perception that symptoms were benign and self-limiting. Reasons for missing prophylaxis injections included lack of awareness, feeling well, transport cost and access, and medication unavailability (>40% of participants each). The injection health service had many perceived strengths, but inclusion of adolescents in decision making, and quality of educational materials were deficiencies. Reminder strategies, particularly phone-based reminders, were considered helpful by 94%. We identified several factors influencing secondary prevention that may be used to develop interventions to improve adherence. © The Author 2017. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Substrate characteristics and ablation outcome of left atrial tachycardia in rheumatic mitral valve disease.

PubMed

Chen, Hongwu; Yang, Bing; Ju, Weizhu; Zhang, Fengxiang; Yang, Gang; Gu, Kai; Li, Mingfang; Liu, Hailei; Wang, Zidun; Cao, Kejiang; Chen, Minglong

2017-08-01

Right atrial tachycardia (AT) is a common arrhythmia postsurgical valve replacement in patients with rheumatic heart disease (RHD). However, the substrate and the mechanism of left AT in such patients and the ablation efficacy is less known. Twenty-seven RHD patients with AT were enrolled in this study; nine of them (33%) had left AT. Five and four patients had left AT during the first and second procedure, respectively. A spontaneous scar in the left posterior wall was identified in all patients, and obvious anterior scar in three patients. Dual-roof-dependent AT was found in three patients and macroreentry AT surrounding right pulmonary vein was identified in one patient, two of whom had left anterior scar. Three patients had AT circuit going around the mitral annulus, one of whom had left anterior scar. Entrainment pacing at different sites confirmed the mechanism of these macroreentries. Two patients had a focal origin, one was localized in posterior wall at the edge of the scar and the other one was originated from the left septum with normal voltage. After a mean follow-up of 27.4 ± 7.9 months, the left AT group had a similar recurrence rate compared with the right AT group alone (67% vs 56%, P = 0.58). In the left AT group, 11% of patients had AT recurrence and 56% of patients developed atrial fibrillation. Left atrial AT can occur in RHD patients postmitral valve replacement. Catheter ablation is feasible with high acute success rate. The incidence of late development atrial fibrillation is considerable after successful ablation. © 2017 Wiley Periodicals, Inc.

Adherence to secondary antibiotic prophylaxis for patients with rheumatic heart disease diagnosed through screening in Fiji.

PubMed

Engelman, Daniel; Mataika, Reapi L; Kado, Joseph H; Ah Kee, Maureen; Donath, Susan; Parks, Tom; Steer, Andrew C

2016-12-01

Echocardiographic screening for rheumatic heart disease (RHD) can detect subclinical cases; however, adequate adherence to secondary antibiotic prophylaxis (SAP) is required to alter disease outcomes. We aimed to investigate the adherence to SAP among young people with RHD diagnosed through echocardiographic screening in Fiji and to investigate factors associated with adherence. Patients diagnosed with RHD through echocardiographic screening in Fiji from 2006 to 2014 were included. Dates of benzathine penicillin G injections were collected from 76 health clinics nationally from December 2011 to December 2014. Adherence was measured using the proportion of days covered (PDC). Multivariate logistic regression analysis was used to identify characteristics associated with any adherence (≥1 injection received) and adequate adherence (PDC ≥0.80). Of 494 patients, 268 (54%) were female and the median age was 14 years. Overall, 203 (41%) had no injections recorded and just 33 (7%) had adequate adherence. Multivariate logistic regression showed increasing age (OR 0.93 per year, 95% CI 0.87-0.99) and time since diagnosis ≥1.5 years (OR 0.53, 95% CI 0.37-0.79) to be inversely associated with any adherence. Non-iTaukei ethnicity (OR 2.58, 95%CI 1.04-6.33) and urban residence (OR 3.36, 95% CI 1.54-7.36) were associated with adequate adherence, whereas time since diagnosis ≥1.5 years (OR 0.38, 95%CI 0.17-0.83) was inversely associated with adequate adherence. Adherence to SAP after screening in Fiji is currently inadequate for individual patient protection or population disease control. Secondary prevention should be strengthened before further screening can be justified. © 2016 John Wiley & Sons Ltd.

Response of PAH-degrading genes to PAH bioavailability in the overlying water, suspended sediment, and deposited sediment of the Yangtze River.

PubMed

Xia, Xinghui; Xia, Na; Lai, Yunjia; Dong, Jianwei; Zhao, Pujun; Zhu, Baotong; Li, Zhihuang; Ye, Wan; Yuan, Yue; Huang, Junxiong

2015-06-01

The degrading genes of hydrophobic organic compounds (HOCs) serve as indicators of in situ HOC degradation potential, and the existing forms and bioavailability of HOCs might influence the distribution of HOC-degrading genes in natural waters. However, little research has been conducted to study the relationship between them. In the present study, nahAc and nidA genes, which act as biomarkers for naphthalene- and pyrene-degrading bacteria, were selected as model genotypes to investigate the response of polycyclic aromatic hydrocarbon (PAH)-degrading genes to PAH bioavailability in the overlying water, suspended sediment (SPS), and deposited sediment of the Yangtze River. The freely dissolved concentration, typically used to reflect HOC bioavailability, and total dissolved, as well as sorbed concentrations of PAHs were determined. Phylogenetic analysis showed that all the PAH-ring hydroxylating dioxygenase gene sequences of Gram-negative bacteria (PAH-RHD[GN]) were closely related to nahAc, nagAc, nidA, and uncultured PAH-RHD genes. The PAH-RHD[GN] gene diversity as well as nahAc and nidA gene copy numbers decreased in the following order: deposited sediment>SPS>overlying water. The nahAc and nidA gene abundance was not significantly correlated with environmental parameters but was significantly correlated with the bioavailable existing forms of naphthalene and pyrene in the three phases. The nahAc gene copy numbers in the overlying water and deposited sediment were positively correlated with freely dissolved naphthalene concentrations in the overlying and pore water phases, respectively, and so were nidA gene copy numbers. This study suggests that the distribution and abundance of HOC-degrading bacterial population depend on the HOC bioavailability in aquatic environments. Copyright © 2015 Elsevier Ltd. All rights reserved.

High-throughput, non-invasive prenatal testing for fetal Rhesus D genotype to guide antenatal prophylaxis with anti-D immunoglobulin: a cost-effectiveness analysis.

PubMed

Saramago, P; Yang, H; Llewellyn, A; Palmer, S; Simmonds, M; Griffin, S

2018-02-07

To evaluate the cost-effectiveness of high-throughput, non-invasive prenatal testing (HT-NIPT) for fetal Rhesus D (RhD) genotype to guide antenatal prophylaxis with anti-D immunoglobulin compared with routine antenatal anti-D immunoglobulin prophylaxis (RAADP). Cost-effectiveness decision-analytic modelling. Primary care. A simulated population of 100 000 RhD-negative women not known to be sensitised to the RhD antigen. A decision tree model was used to characterise the antenatal care pathway in England and the long-term consequences of sensitisation events. The diagnostic accuracy of HT-NIPT was derived from a systematic review and bivariate meta-analysis; estimates of other inputs were derived from relevant literature sources and databases. Women in whom the HT-NIPT was positive or inconclusive continued to receive RAADP, whereas women with a negative result received none. Five alternative strategies in which the use of HT-NIPT may affect the existing postpartum care pathway were considered. Costs expressed in 2015GBP and impact on health outcomes expressed in terms of quality-adjusted life-years over a lifetime. The results suggested that HT-NIPT appears cost saving but also less effective than current practice, irrespective of the postpartum strategy evaluated. A postpartum strategy in which inconclusive test results are distinguished from positive results performed best. HT-NIPT is only cost-effective when the overall test cost is £26.60 or less. HT-NIPT would reduce unnecessary treatment with routine anti-D immunoglobulin and is cost saving when compared with current practice. The extent of any savings and cost-effectiveness is sensitive to the overall test cost. HT-NIPT is cost saving compared with providing anti-D to all RhD-negative pregnant women. © 2018 Royal College of Obstetricians and Gynaecologists.

Measuring stellar granulation during planet transits

NASA Astrophysics Data System (ADS)

Chiavassa, A.; Caldas, A.; Selsis, F.; Leconte, J.; Von Paris, P.; Bordé, P.; Magic, Z.; Collet, R.; Asplund, M.

2017-01-01

Context. Stellar activity and convection-related surface structures might cause bias in planet detection and characterization that use these transits. Surface convection simulations help to quantify the granulation signal. Aims: We used realistic three-dimensional (3D) radiative hydrodynamical (RHD) simulations from the Stagger grid and synthetic images computed with the radiative transfer code Optim3D to model the transits of three prototype planets: a hot Jupiter, a hot Neptune, and a terrestrial planet. Methods: We computed intensity maps from RHD simulations of the Sun and a K-dwarf star at different wavelength bands from optical to far-infrared that cover the range of several ground- and space-based telescopes which observe exoplanet transits. We modeled the transit using synthetic stellar-disk images obtained with a spherical-tile imaging method and emulated the temporal variation of the granulation intensity generating random images covering a granulation time-series of 13.3 h. We measured the contribution of the stellar granulation on the light curves during the planet transit. Results: We identified two types of granulation noise that act simultaneously during the planet transit: (I) the intrinsic change in the granulation pattern with timescale (e.g., 10 min for solar-type stars assumed in this work) is smaller than the usual planet transit ( hours as in our prototype cases); and (II) the fact that the transiting planet occults isolated regions of the photosphere that differ in local surface brightness as a result of convective-related surface structures. First, we showed that our modeling approach returns granulation timescale fluctuations that are comparable with what has been observed for the Sun. Then, our statistical approach shows that the granulation pattern of solar and K-dwarf-type stars have a non-negligible effect of the light curve depth during the transit, and, consequentially on the determination of the planet transit parameters such as the planet radius (up to 0.90% and 0.47% for terrestrial and gaseous planets, respectively). We also showed that larger (or smaller) orbital inclination angles with respect to values corresponding to transit at the stellar center display a shallower transit depth and longer ingress and egress times, but also granulation fluctuations that are correlated to the center-to-limb variation: they increase (or decrease) the value of the inclination, which amplifies the fluctuations. The granulation noise appears to be correlated among the different wavelength ranges either in the visible or in the infrared regions. Conclusions: The prospects for planet detection and characterization with transiting methods are excellent with access to large amounts of data for stars. The granulation has to be considered as an intrinsic uncertainty (as a result of stellar variability) on the precise measurements of exoplanet transits of planets. The full characterization of the granulation is essential for determining the degree of uncertainty on the planet parameters. In this context, the use of 3D RHD simulations is important to measure the convection-related fluctuations. This can be achieved by performing precise and continuous observations of stellar photometry and radial velocity, as we explained with RHD simulations, before, after, and during the transit periods.

The clustering of galaxies in the SDSS-III Baryon Oscillation Spectroscopic Survey: BAO measurement from the LOS-dependent power spectrum of DR12 BOSS galaxies

DOE PAGES

Gil-Marin, Hector; Percival, Will J.; Cuesta, Antonio J.; ...

2016-05-30

Here, we present an anisotropic analysis of the baryon acoustic oscillation (BAO) scale in the twelfth and final data release of the Baryon Oscillation Spectroscopic Survey (BOSS). We independently analyse the LOWZ and CMASS galaxy samples: the LOWZ sample contains 361 762 galaxies with an effective redshift of zLOWZ = 0.32; the CMASS sample consists of 777 202 galaxies with an effective redshift of zCMASS = 0.57. We extract the BAO peak position from the monopole power-spectrum moment, α0, and from the μ 2 moment, α2, where μ is the cosine of the angle to the line of sight. Themore » μ 2-moment provides equivalent information to that available in the quadrupole but is simpler to analyse. After applying a reconstruction algorithm to reduce the BAO suppression by bulk motions, we measure the BAO peak position in the monopole and μ 2-moment, which are related to radial and angular shifts in scale. We report H(zLOWZ)r s(zd) = (11.60 ± 0.60) × 10 3 km s -1 and D A(zLOWZ)/r s(zd) = 6.66 ± 0.16 with a cross-correlation coefficient of rHD A = 0.41, for the LOWZ sample; and H(zCMASS)r s(zd) = (14.56 ± 0.37) × 10 3 km s -1 and D A(zCMASS)/r s(z d) = 9.42 ± 0.13 with a cross-correlation coefficient of rHD A = 0.47, for the CMASS sample.« less

Does the prevalence of latent toxoplasmosis and frequency of Rhesus-negative subjects correlate with the nationwide rate of traffic accidents?

PubMed

Flegr, Jaroslav; Dama, Madhukar

2014-12-01

Latent toxoplasmosis is probably the most common protistan parasitic disease with many indirect negative impacts on human health. One of the important impacts is impaired psychomotor function leading to reduced driving efficiency in Toxoplasma-seropositive subjects. Numerous case-control studies have established a positive relation between the seroprevalence of Toxoplasma gondii (Nicolle et Manceaux, 1908) and probability of traffic accidents in study populations. The prevalence of toxoplasmosis varies between populations according to local geographical conditions, hygienic practices and kitchen habits. Similarly, we see a striking variation in the incidence of traffic accidents across countries. Hence, we compiled the largest ever data set on the seroprevalence of toxoplasmosis and tried to understand its role in traffic accident-related deaths and disabilities across 87 countries. Simple non-parametric analysis showed a positive and strong relation of T. gondii seroprevalence and traffic accident related disabilities. Further, we conducted multivariate analysis to control for confounding factors. After controlling for wealth, geographical latitude, health of population, length of roads and number of vehicles, the correlation disappeared. When the frequency of RhD negativity and its interaction with toxoplasmosis were included into the model, the effects of toxoplasmosis seemingly returned. However, the analysed data suffered from the problem of multicollinearity. When a proper method of analysis, ridge regression, was applied, the effects of toxoplasmosis prevalence and RhD negativity frequency disappeared again. The existence of a strong correlation between the prevalence of toxoplasmosis and health of population in particular countries, which was the probable cause of multicollinearity and possible reason for the negative result of the present study, suggests that 'asymptomatic' latent toxoplasmosis could have a large impact on public health.

Suppression and Narrative Time Shifts in Adults with Right-Hemisphere Brain Damage

ERIC Educational Resources Information Center

Scharp, Victoria L.; Tompkins, Connie A.

2013-01-01

Purpose: This study examined the functioning of a central comprehension mechanism, suppression, in adults with right-hemisphere damage (RHD) while they processed narratives that cued a shift in time frame. In normal language comprehension, mental activation of concepts from a prior time frame is suppressed. The (re)activation of information…

Association of Elevated High Sensitivity Cardiac Troponin T(hs-cTnT) Levels with Hemorrhagic Transformation and 3-Month Mortality in Acute Ischemic Stroke Patients with Rheumatic Heart Disease in China

PubMed Central

Xiong, Yao; Liu, Bian; Hao, Zilong; Tao, Wendan; Liu, Ming

2016-01-01

Background and Objective Elevated levels of high sensitivity cardiac troponin T (hs-cTnT) occur in a substantial proportion of patients with acute ischemic stroke (AIS) and can predict poor outcome and mortality after stroke. Whether elevated hs-cTnT levels can also predict hemorrhagic transformation (HT) or prognosis in AIS patients with rheumatic heart disease (RHD) remains unclear. Methods Data from the Chengdu Stroke Registry on consecutive AIS patients with RHD admitted to West China Hospital within1 month of stroke onset from October 2011 to February 2014 were examined. Clinico-demographic characteristics, HT, functional outcomes and stroke recurrence were compared between patients with elevated hs-cTnT levels(≥14ng/L) and patients with normal hs-cTnT levels (<14ng/L). Results The final analysis involved 84 patients (31 males; mean age, 61.6±12.2years), of whom serum hs-cTnT levels were elevated in 58.3%. Renal impairment was independently associated with elevated hs-cTnT levels (OR 4.184, 95%CI 1.17 to 15.01, P = 0.028), and patients with elevated hs-cTnT levels were at significantly higher risk of HT, 3-month mortality and 3-month disability/mortality (all P≤0.029). After controlling for age, sex, hypertension, renal impairment and National Institutes of Health Stroke Scale score on admission, the risk of HT and 3-month mortality was, respectively, 4.0- and 5.5-fold higher in patients with elevated hs-cTnT levels than in patients with normal hs-cTnT levels. Conclusion Elevated hs-cTnT levels are independently associated with HT and 3-month mortality in AIS patients with RHD. These results with a small cohort should be verified and extended in large studies. PMID:26849554

Association of Elevated High Sensitivity Cardiac Troponin T(hs-cTnT) Levels with Hemorrhagic Transformation and 3-Month Mortality in Acute Ischemic Stroke Patients with Rheumatic Heart Disease in China.

PubMed

Liu, Junfeng; Wang, Deren; Xiong, Yao; Liu, Bian; Hao, Zilong; Tao, Wendan; Liu, Ming

2016-01-01

Elevated levels of high sensitivity cardiac troponin T (hs-cTnT) occur in a substantial proportion of patients with acute ischemic stroke (AIS) and can predict poor outcome and mortality after stroke. Whether elevated hs-cTnT levels can also predict hemorrhagic transformation (HT) or prognosis in AIS patients with rheumatic heart disease (RHD) remains unclear. Data from the Chengdu Stroke Registry on consecutive AIS patients with RHD admitted to West China Hospital within 1 month of stroke onset from October 2011 to February 2014 were examined. Clinico-demographic characteristics, HT, functional outcomes and stroke recurrence were compared between patients with elevated hs-cTnT levels (≥14 ng/L) and patients with normal hs-cTnT levels (<14 ng/L). The final analysis involved 84 patients (31 males; mean age, 61.6±12.2 years), of whom serum hs-cTnT levels were elevated in 58.3%. Renal impairment was independently associated with elevated hs-cTnT levels (OR 4.184, 95%CI 1.17 to 15.01, P = 0.028), and patients with elevated hs-cTnT levels were at significantly higher risk of HT, 3-month mortality and 3-month disability/mortality (all P≤0.029). After controlling for age, sex, hypertension, renal impairment and National Institutes of Health Stroke Scale score on admission, the risk of HT and 3-month mortality was, respectively, 4.0- and 5.5-fold higher in patients with elevated hs-cTnT levels than in patients with normal hs-cTnT levels. Elevated hs-cTnT levels are independently associated with HT and 3-month mortality in AIS patients with RHD. These results with a small cohort should be verified and extended in large studies.

RSL genes are sufficient for rhizoid system development in early diverging land plants.

PubMed

Jang, Geupil; Yi, Keke; Pires, Nuno D; Menand, Benoît; Dolan, Liam

2011-06-01

Land plants are anchored to their substratum from which essential inorganic nutrients are taken up. These functions are carried out by a system of rhizoids in early diverging groups of land plants, such as mosses, liverworts and hornworts. Physcomitrella patens RHD SIX-LIKE1 (PpRSL1) and PpRSL2 transcription factors are necessary for rhizoid development in mosses. Similar proteins, AtRHD6 and AtRSL1, control the development of root hairs in Arabidopsis thaliana. Auxin positively regulates root hair development independently of AtRHD6 and AtRSL1 in A. thaliana but the regulatory interactions between auxin and PpRSL1 and PpRSL2 are unknown. We show here that co-expression of PpRSL1 and PpRSL2 is sufficient for the development of the rhizoid system in the moss P. patens; constitutive expression of PpRSL1 and PpRSL2 converts developing leafy shoot axes (gametophores) into rhizoids. During wild-type development, PpRSL1 and PpRSL2 are expressed in the specialized cells that develop rhizoids, indicating that cell-specific expression of PpRSL1 and PpRSL2 is sufficient to promote rhizoid differentiation during wild-type P. patens development. In contrast to A. thaliana, auxin promotes rhizoid development by positively regulating PpRSL1 and PpRSL2 activity in P. patens. This indicates that even though the same genes control the development of root hairs and rhizoids, the regulation of this transcriptional network by auxin is different in these two species. This suggests that auxin might have controlled the development of the first land plant soil anchoring systems that evolved 465 million years ago by regulating the expression of RSL genes and that this regulatory network has changed since mosses and angiosperms last shared a common ancestor.

Gene polymorphisms of TNF-alpha(-308), IL-10(-1082), IL-6(-174), and IL-1Ra(VNTR) related to susceptibility and severity of rheumatic heart disease.

PubMed

Settin, A; Abdel-Hady, H; El-Baz, R; Saber, I

2007-01-01

Rheumatic heart disease (RHD) is an inflammatory disease of the heart tissues caused by interactive immune, genetic, and environmental factors. The objective of this study is to test for the association of polymorphisms related to cytokine genes with susceptibility and severity of RHD among affected children from the Nile Delta region of Egypt. The study included 50 children with chronic RHD (29 males and 21 females), with a mean age of 12.2 years, in addition to 98 healthy unrelated controls. Cases were further classified on the basis of echocardiographic findings into those with only mitral valve disease (MVD) or multivalvular lesions (MVLs) and also as mild, moderate, or severe valve lesions. For all cases and controls, DNA was extracted and amplified using polymerase chain reaction with sequence-specific primers for detection of single nucleotide polymorphisms (SNPs) in the promoter regions of cytokine genes tumor necrosis factor (TNF)-alpha(-308 )G/A, interleukin (IL)-10(-1082 )G/A, and IL-6(-174 )G/C as well as a variable number of tandem repeats (VNTRs) in intron 2 of the IL-1Ra gene. All cases showed a significantly higher frequency of homozygous genotypes of TNF-alpha(-308 )A/A [odds ratio (OR) = 5.7, p < 0.001], IL-10(-1082) A/A (OR = 3.1, p < 0.05), IL-10(-1082) G/G (OR = 5.2, p < 0.05), and IL-1Ra A1/A1 (OR = 2.2, p < 0.05). Cases with MVD showed higher frequencies of genotypes TNF-alpha(-308 )A/A, G/G; IL-10(-1082) G/G; and IL-1Ra(VNTR) A1/A1 (p < 0.05). Cases with MVL showed a significantly higher frequency of homozygous A/A genotype of both TNF-alpha(-308 )(OR = 10.6, p < 0.05) and IL-10(-1082) (OR = 5.2, p < 0.05). The same was observed for cases with severe valve lesions. On the other hand, all studied groups showed significantly lower frequency of heterozygous genotypes of TNF-alpha(-308 )G/A, IL-10(-1082) G/A, and IL-1Ra(VNTR) A1/A2. No significant difference was found regarding the frequency of IL-6(-174 )G/C polymorphisms in total cases or subgroups compared to controls (p > 0.05). Predisposition to RHD is influenced by genetic factors including cytokine gene polymorphisms, with possible susceptibility to severe disease with multivalvular affection among cases with composite polymorphism (TNF-alpha(-308 )A/A and IL-10(-1082) A/A) and (TNF-alpha(-308 )A/A and IL-10(-1082) G/G).

An Update on the Conceptual-Production Systems Model of Apraxia: Evidence from Stroke

ERIC Educational Resources Information Center

Stamenova, Vessela; Black, Sandra E.; Roy, Eric A.

2012-01-01

Limb apraxia is a neurological disorder characterized by an inability to pantomime and/or imitate gestures. It is more commonly observed after left hemisphere damage (LHD), but has also been reported after right hemisphere damage (RHD). The Conceptual-Production Systems model (Roy, 1996) suggests that three systems are involved in the control of…

Associations and Dissociations of Transitive and Intransitive Gestures in Left and Right Hemisphere Stroke Patients

ERIC Educational Resources Information Center

Stamenova, Vessela; Roy, Eric A.; Black, Sandra E.

2010-01-01

The study investigated performance on pantomime and imitation of transitive and intransitive gestures in 80 stroke patients, 42 with left (LHD) and 38 with right (RHD) hemisphere damage. Patients were also categorized in two groups based on the time that has elapsed between their stroke and the apraxia assessment: acute-subacute (n = 42) and…

Rhnull syndrome: identification of a novel mutation in RHce.

PubMed

Rosa, K A; Reid, M E; Lomas-Francis, C; Powell, V I; Costa, F F; Stinghen, S T; Watanabe, A M; Carboni, E K; Baldon, J P; Jucksch, M M F; Castilho, L

2005-11-01

The deficiency of Rh proteins on red blood cells (RBCs) from individuals of the Rh(null) amorph type are the result of homozygosity for a silent RHCE in cis with a deleted RHD. A novel mutation in RHce was identified in two Caucasian Brazilian girls with the amorph type of Rh(null) who were born to parents who were first cousins. RBCs from the Rh(null) sisters and from family members were analyzed by serology and flow cytometry with specific antibodies. Genomic DNA and transcripts were tested by polymerase chain reaction and sequence analysis. Rh(null) RBCs were nonreactive with anti-Rh and anti-LW. Molecular analyses showed a deletion of RHD and of one nucleotide (960/963; GGGG-->GGG) in exon 7 of the RHce. This deletion introduced a frameshift after Gly321, a new C-terminal sequence, and a premature stop codon, resulting in a shorter predicted protein with 357 amino acids. The detection of a unique RHce transcript indicated that the two sisters were homozygous, whereas the other family members were heterozygous for the mutation. A novel mutation resulting in the amorph Rh(null) with loss of Rh antigen expression is described.

Blood groups and acute aortic dissection type III.

PubMed

Fatic, Nikola; Nikolic, Aleksandar; Vukmirovic, Mihailo; Radojevic, Nemanja; Zornic, Nenad; Banzic, Igor; Ilic, Nikola; Kostic, Dusan; Pajovic, Bogdan

2017-04-01

Acute aortic type III dissection is one of the most catastrophic events, with in-hospital mortality ranging between 10% and 12%. The majority of patients are treated medically, but complicated dissections, which represent 15% to 20% of cases, require surgical or thoracic endovascular aortic repair (TEVAR). For the best outcomes adequate blood transfusion support is required. Interest in the relationship between blood type and vascular disease has been established. The aim of our study is to evaluate distribution of blood groups among patients with acute aortic type III dissection and to identify any kind of relationship between blood type and patient's survival. From January 2005 to December 2014, 115 patients with acute aortic type III dissection were enrolled at the Clinic of Vascular and Endovascular Surgery in Belgrade, Serbia and retrospectively analyzed. Patients were separated into two groups. The examination group consisted of patients with a lethal outcome, and the control group consisted of patients who survived. The analysis of the blood groups and RhD typing between groups did not reveal a statistically significant difference ( p = 0.220). Our results indicated no difference between different blood groups and RhD typing with respect to in-hospital mortality of patients with acute aortic dissection type III.

Aerosol hygroscopic growth parameterization based on a solute specific coefficient

NASA Astrophysics Data System (ADS)

Metzger, S.; Steil, B.; Xu, L.; Penner, J. E.; Lelieveld, J.

2011-09-01

Water is a main component of atmospheric aerosols and its amount depends on the particle chemical composition. We introduce a new parameterization for the aerosol hygroscopic growth factor (HGF), based on an empirical relation between water activity (aw) and solute molality (μs) through a single solute specific coefficient νi. Three main advantages are: (1) wide applicability, (2) simplicity and (3) analytical nature. (1) Our approach considers the Kelvin effect and covers ideal solutions at large relative humidity (RH), including CCN activation, as well as concentrated solutions with high ionic strength at low RH such as the relative humidity of deliquescence (RHD). (2) A single νi coefficient suffices to parameterize the HGF for a wide range of particle sizes, from nanometer nucleation mode to micrometer coarse mode particles. (3) In contrast to previous methods, our analytical aw parameterization depends not only on a linear correction factor for the solute molality, instead νi also appears in the exponent in form x · ax. According to our findings, νi can be assumed constant for the entire aw range (0-1). Thus, the νi based method is computationally efficient. In this work we focus on single solute solutions, where νi is pre-determined with the bisection method from our analytical equations using RHD measurements and the saturation molality μssat. The computed aerosol HGF and supersaturation (Köhler-theory) compare well with the results of the thermodynamic reference model E-AIM for the key compounds NaCl and (NH4)2SO4 relevant for CCN modeling and calibration studies. The equations introduced here provide the basis of our revised gas-liquid-solid partitioning model, i.e. version 4 of the EQuilibrium Simplified Aerosol Model (EQSAM4), described in a companion paper.

Radiation-hydrodynamical simulations of massive star formation using Monte Carlo radiative transfer - II. The formation of a 25 solar-mass star

NASA Astrophysics Data System (ADS)

Harries, Tim J.; Douglas, Tom A.; Ali, Ahmad

2017-11-01

We present a numerical simulation of the formation of a massive star using Monte Carlo-based radiation hydrodynamics (RHD). The star forms via stochastic disc accretion and produces fast, radiation-driven bipolar cavities. We find that the evolution of the infall rate (considered to be the mass flux across a 1500 au spherical boundary) and the accretion rate on to the protostar, are broadly consistent with observational constraints. After 35 kyr the star has a mass of 25 M⊙ and is surrounded by a disc of mass 7 M⊙ and 1500 au radius, and we find that the velocity field of the disc is close to Keplerian. Once again these results are consistent with those from recent high-resolution studies of discs around forming massive stars. Synthetic imaging of the RHD model shows good agreement with observations in the near- and far-IR, but may be in conflict with observations that suggest that massive young stellar objects are typically circularly symmetric in the sky at 24.5 μm. Molecular line simulations of a CH3CN transition compare well with observations in terms of surface brightness and line width, and indicate that it should be possible to reliably extract the protostellar mass from such observations.

[The Hospital Information System of the Brazilian National Unified Health System: a preliminary evaluation of performance in monitoring RhD hemolytic disease of the newborn].

PubMed

Lobato, Gustavo; Reichenheim, Michael Eduardo; Coeli, Claudia Medina

2008-03-01

This study aimed to evaluate the adequacy of the Hospital Information System of the National Unified Health System (SIH-SUS) in identifying cases of RhD hemolytic disease of the newborn (HDN) at the Fernandes Figueira Institute (IFF/FIOCRUZ) from 1998 to 2003. Neonatal records, data from the Medical Archives, and AIH (Hospital Admissions Authorization Form) data consolidated in the SIH-SUS were analyzed. Cases were identified according to the following fields: principal diagnosis, secondary diagnosis, and procedure performed. During the period studied, 194 cases of HDN were diagnosed. The Medical Archives registered 148 newborns with HDN, however only 147 AIHs were issued and 145 consolidated in the SIH-SUS. Among these 145 cases, 84 cited HDN as the principal diagnosis, while secondary diagnosis identified 38 additional cases and the procedures performed failed to identify any further cases. Thus, the SIH-SUS identified only 122 (62.9%) of the 194 cases of HDN treated at the IFF/FIOCRUZ. Although it is necessary to evaluate other units, the SIH-SUS does not appear to be reliable for monitoring HDN. Additional studies are essential for employing secondary administrative data in the context of epidemiological surveillance.

Electric Vehicle Modeling and Simulation.

DTIC Science & Technology

1983-08-01

RD-RI39 709 ELECTRIC VEHICLE MODELING RHD SIMULRTION(U) AIR FORCE lit INST OF TECH NRIGHT-PRTTERSON RFD OH SCHOOL OF ENGINEERING A R DEMISPELARE RUG...for Public Release Distribution Unlimited Fl School of Engineering Air Force Institute of Technology Wright-Patterson Air Force Base, Ohio Table of... Engineering , 49: 49-51 (27 August 1979). 36. Renner -Smith, S. "Battery-Saving Flywheel Gives Electric Car Freeway Zip," Popular Science, 215(10): 82-84

Lessons learnt from many years of experience using anti-D in humans for prevention of RhD immunization and haemolytic disease of the fetus and newborn

PubMed Central

Kumpel, B M

2008-01-01

For 40 years prophylactic anti-D has been given to D-negative women after parturition to prevent haemolytic disease of the fetus and newborn. Monoclonal or recombinant anti-D may provide alternatives to the current plasma-derived polyclonal IgG anti-D, although none of them have yet proved as effective in phase 1 clinical trials. The variation in efficacy of the antibodies may have been influenced by heterogeneity in glycosylation of anti-D produced from different cell lines. Some aspects of the conduct of the human studies, most notably the use of low doses of anti-D and target D positive red cells in vivo, may aid the design of the clinical development of other immunomodulatory drugs in order to minimize adverse effects. PMID:18727626

The importance of cardiovascular pathology contributing to maternal death: Confidential Enquiry into Maternal Deaths in South Africa, 2011–2013

PubMed Central

Soma-Pillay, Priya; Seabe, Joseph; Soma-Pillay, Priya; Seabe, Joseph; Sliwa, Karen

2016-01-01

Summary Aims Cardiac disease is emerging as an important contributor to maternal deaths in both lower-to-middle and higher-income countries. There has been a steady increase in the overall institutional maternal mortality rate in South Africa over the last decade. The objectives of this study were to determine the cardiovascular causes and contributing factors of maternal death in South Africa, and identify avoidable factors, and thus improve the quality of care provided. Methods Data collected via the South African National Confidential Enquiry into Maternal Deaths (NCCEMD) for the period 2011–2013 for cardiovascular disease (CVD) reported as the primary pathology was analysed. Only data for maternal deaths within 42 days post-delivery were recorded, as per statutory requirement. One hundred and sixty-nine cases were reported for this period, with 118 complete hospital case files available for assessment and data analysis. Results Peripartum cardiomyopathy (PPCM) (34%) and complications of rheumatic heart disease (RHD) (25.3%) were the most important causes of maternal death. Hypertensive disorders of pregnancy, HIV disease infection and anaemia were important contributing factors identified in women who died of peripartum cardiomyopathy. Mitral stenosis was the most important contributor to death in RHD cases. Of children born alive, 71.8% were born preterm and 64.5% had low birth weight. Seventy-eight per cent of patients received antenatal care, however only 33.7% had a specialist as an antenatal care provider. Avoidable factors contributing to death included delay in patients seeking help (41.5%), lack of expertise of medical staff managing the case (29.7%), delay in referral to the appropriate level of care (26.3%), and delay in appropriate action (36.4%). Conclusion The pattern of CVD contributing to maternal death in South Africa was dominated by PPCM and complications of RHD, which could, to a large extent, have been avoided. It is likely that there were many CVD deaths that were not reported, such as late maternal mortality (up to one year postpartum). Infrastructural changes, use of appropriate referral algorithm and training of primary, secondary and tertiary staff in CVD complicating pregnancy is likely to improve the outcome. The use of simple screening equipment and point-of-care testing for early-onset heart failure should be explored via research projects. PMID:26895406

[Diagnostic and therapeutic use of human anti-D (Rho) monoclonal antibodies. Evaluation and perspectives].

PubMed

Rouger, P; Goossens, D; Champomier, F; Tsikas, G; Liberge, G; Leblanc, J; Richard, C; Bailleul, C; Salmon, C

1985-12-01

Human monoclonal antibodies will be essential in medicine. They are valuable tools for biological diagnosis and therapeutics. Our model, human monoclonal antibodies directed against the Rhesus D antigen can be used for the determination of the Rhesus D phenotype and for the suppression of Rh(D) immunisation in women. These new products require new procedures of preparation, new regulations for the quality controls, which will be discussed in this paper.

Whole-exome sequencing for RH genotyping and alloimmunization risk in children with sickle cell anemia

PubMed Central

Flanagan, Jonathan M.; Vege, Sunitha; Luban, Naomi L. C.; Brown, R. Clark; Ware, Russell E.; Westhoff, Connie M.

2017-01-01

RH genes are highly polymorphic and encode the most complex of the 35 human blood group systems. This genetic diversity contributes to Rh alloimmunization in patients with sickle cell anemia (SCA) and is not avoided by serologic Rh-matched red cell transfusions. Standard serologic testing does not distinguish variant Rh antigens. Single nucleotide polymorphism (SNP)–based DNA arrays detect many RHD and RHCE variants, but the number of alleles tested is limited. We explored a next-generation sequencing (NGS) approach using whole-exome sequencing (WES) in 27 Rh alloimmunized and 27 matched non-alloimmunized patients with SCA who received chronic red cell transfusions and were enrolled in a multicenter study. We demonstrate that WES provides a comprehensive RH genotype, identifies SNPs not interrogated by DNA array, and accurately determines RHD zygosity. Among this multicenter cohort, we demonstrate an association between an altered RH genotype and Rh alloimmunization: 52% of Rh immunized vs 19% of non-immunized patients expressed variant Rh without co-expression of the conventional protein. Our findings suggest that RH allele variation in patients with SCA is clinically relevant, and NGS technology can offer a comprehensive alternative to targeted SNP-based testing. This is particularly relevant as NGS data becomes more widely available and could provide the means for reducing Rh alloimmunization in children with SCA. PMID:29296782

Contextual Constraint Treatment for coarse coding deficit in adults with right hemisphere brain damage: Generalization to narrative discourse comprehension

PubMed Central

Blake, Margaret Lehman; Tompkins, Connie A.; Scharp, Victoria L.; Meigh, Kimberly M.; Wambaugh, Julie

2014-01-01

Coarse coding is the activation of broad semantic fields that can include multiple word meanings and a variety of features, including those peripheral to a word’s core meaning. It is a partially domain-general process related to general discourse comprehension and contributes to both literal and non-literal language processing. Adults with damage to the right cerebral hemisphere (RHD) and a coarse coding deficit are particularly slow to activate features of words that are relatively distant or peripheral. This manuscript reports a pre-efficacy study of Contextual Constraint Treatment (CCT), a novel, implicit treatment designed to increase the efficiency of coarse coding with the goal of improving narrative comprehension and other language performance that relies on coarse coding. Participants were four adults with RHD. The study used a single-subject controlled experimental design across subjects and behaviors. The treatment involves pre-stimulation, using a hierarchy of strong- and moderately-biased contexts, to prime the intended distantly-related features of critical stimulus words. Three of the four participants exhibited gains in auditory narrative discourse comprehension, the primary outcome measure. All participants exhibited generalization to untreated items. No strong generalization to processing nonliteral language was evident. The results indicate that CCT yields both improved efficiency of the coarse coding process and generalization to narrative comprehension. PMID:24983133

Acquired dysgraphia in adults following right or left-hemisphere stroke

PubMed Central

Rodrigues, Jaqueline de Carvalho; da Fontoura, Denise Ren; de Salles, Jerusa Fumagalli

2014-01-01

Objective This study aimed to assess the strengths and difficulties in word and pseudoword writing in adults with left- and right-hemisphere strokes, and discuss the profiles of acquired dysgraphia in these individuals. Methods The profiles of six adults with acquired dysgraphia in left- or right-hemisphere strokes were investigated by comparing their performance on word and pseudoword writing tasks against that of neurologically healthy adults. A case series analysis was performed on the patients whose impairments on the task were indicative of acquired dysgraphia. Results Two patients were diagnosed with lexical dysgraphia (one with left hemisphere damage, and the other with right hemisphere damage), one with phonological dysgraphia, another patient with peripheral dysgraphia, one patient with mixed dysgraphia and the last with dysgraphia due to damage to the graphemic buffer. The latter patients all had left-hemisphere damage (LHD). The patterns of impairment observed in each patient were discussed based on the dual-route model of writing. Conclusion The fact that most patients had LHD rather than right-hemisphere damage (RHD) highlights the importance of the former structure for word processing. However, the fact that lexical dysgraphia was also diagnosed in a patient with RHD suggests that these individuals may develop writing impairments due to damage to the lexical route, leading to heavier reliance on phonological processing. Our results are of significant importance to the planning of writing interventions in neuropsychology. PMID:29213909

Heterologous Expression of Polycyclic Aromatic Hydrocarbon Ring-Hydroxylating Dioxygenase Genes from a Novel Pyrene-Degrading Betaproteobacterium

PubMed Central

Hu, Jing; Aitken, Michael D.

2012-01-01

A betaproteobacterium within the family Rhodocyclaceae previously identified as a pyrene degrader via stable-isotope probing (SIP) of contaminated soil (designated pyrene group 1 or PG1) was cultivated as the dominant member of a mixed bacterial culture. A metagenomic library was constructed, and the largest contigs were analyzed for genes associated with polycyclic aromatic hydrocarbon (PAH) metabolism. Eight pairs of genes with similarity to the α- and β-subunits of ring-hydroxylating dioxygenases (RHDs) associated with aerobic bacterial PAH degradation were identified and linked to PG1 through PCR analyses of a simplified enrichment culture. In tandem with a ferredoxin and reductase found in close proximity to one pair of RHD genes, six of the RHDs were cloned and expressed in Escherichia coli. Each cloned RHD was tested for activity against nine PAHs ranging in size from two to five rings. Despite differences in their predicted protein sequences, each of the six RHDs was capable of transforming phenanthrene and pyrene. Three RHDs could additionally transform naphthalene and fluorene, and these genotypes were also associated with the ability of the E. coli constructs to convert indole to indigo. Only one of the six cloned RHDs was capable of transforming anthracene and benz[a]anthracene. None of the tested RHDs were capable of significantly transforming fluoranthene, chrysene, or benzo[a]pyrene. PMID:22427500

Blood group A and Rh(D)-negativity are associated with symptomatic West Nile virus infection

PubMed Central

Kaidarova, Zhanna; Bravo, Marjorie D.; Kamel, Hany T.; Custer, Brian S; Busch, Michael P.; Lanteri, Marion C.

2016-01-01

Background West Nile virus (WNV) infection is mostly asymptomatic but 20% of subjects report WNV fever and 1% of patients experience neurological diseases with higher rates in elderly and immunosuppressed persons. With no treatment and no vaccine to prevent the development of symptomatic infections, it is essential to understand prognostic factors influencing symptomatic disease outcome. Host genetic background has been linked to the development of WNV neuroinvasive disease. The present study investigates the association between the ABO and Rh(D) blood group status and WNV disease outcome. Study Design and Methods The distribution of blood groups was investigated within a cohort of 374 WNV+ blood donors including 244 asymptomatic (AS) and 130 symptomatic (S) WNV+ blood donors. Logistic regression analyses were used to examine associations between A, B, O and Rh(D) blood groups and WNV clinical disease outcome. Results Symptomatic WNV+ donors exhibited increased frequencies of blood group A (S 47.6% AS 36.8%, P=0.04, OR [95%CI] 1.56 [1.01–2.40]) and Rh(D)-negative individuals (S 21.5% AS 13.1%, P=0.03, OR [95%CI] 1.82 [1.04–3.18]). Conclusion The findings suggest a genetic susceptibility placing blood group A and Rh(D)-negative individuals at risk for the development of symptomatic disease outcome after WNV infection. PMID:27189860

Navigating the conformational landscape of G protein-coupled receptor kinases during allosteric activation.

PubMed

Yao, Xin-Qiu; Cato, M Claire; Labudde, Emily; Beyett, Tyler S; Tesmer, John J G; Grant, Barry J

2017-09-29

G protein-coupled receptors (GPCRs) are essential for transferring extracellular signals into carefully choreographed intracellular responses controlling diverse aspects of cell physiology. The duration of GPCR-mediated signaling is primarily regulated via GPCR kinase (GRK)-mediated phosphorylation of activated receptors. Although many GRK structures have been reported, the mechanisms underlying GRK activation are not well-understood, in part because it is unknown how these structures map to the conformational landscape available to this enzyme family. Unlike most other AGC kinases, GRKs rely on their interaction with GPCRs for activation and not phosphorylation. Here, we used principal component analysis of available GRK and protein kinase A crystal structures to identify their dominant domain motions and to provide a framework that helps evaluate how close each GRK structure is to being a catalytically competent state. Our results indicated that disruption of an interface formed between the large lobe of the kinase domain and the regulator of G protein signaling homology domain (RHD) is highly correlated with establishment of the active conformation. By introducing point mutations in the GRK5 RHD-kinase domain interface, we show with both in silico and in vitro experiments that perturbation of this interface leads to higher phosphorylation activity. Navigation of the conformational landscape defined by this bioinformatics-based study is likely common to all GPCR-activated GRKs. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Treating Metaphor Interpretation Deficits Subsequent to Right Hemisphere Brain Damage: Preliminary Results

PubMed Central

Lundgren, Kristine; Brownell, Hiram; Cayer-Meade, Carol; Milione, Janet; Kearns, Kevin

2012-01-01

Purpose This investigation sought to determine whether a structured intervention focused on improving use of semantic associations could improve patients’ ability to provide oral interpretations of metaphors following Right Hemisphere Damage (RHD). Methods Principles of single subject experimental design provided the basis for the study. Five patients received either 10 or 20 baseline assessments of oral metaphor interpretation and, as a control, assessments of line orientation skill. They then received approximately 10 one-hour sessions of structured intervention to improve oral metaphor interpretation followed by post-training assessments and a 3 month follow up. Results Patients’ performances revealed evidence of good response to training as shown by patients' ability to reach criterion on all intervention tasks and by their significant improvement on oral metaphor interpretation. There was relatively little improvement on the line orientation task. Discussion The results of this study support the clinical usefulness of this new approach to treating communication deficits associated with RHD due to stroke, even years post-onset. There are, however, questions that remain unanswered. For example, additional data will be needed to gauge how a patient’s severity of impairment relates to the potential for improvement, to chart the durability and scope of improvement associated with the training, and to determine the type of visuospatial ability needed for using this type of pictorial material. PMID:22837588

Hydrogen Balmer Line Broadening in Solar and Stellar Flares

NASA Technical Reports Server (NTRS)

Kowalski, Adam F.; Allred, Joel C.; Uitenbroek, Han; Tremblay, Pier-Emmanuel; Brown, Stephen; Carlsson, Mats; Osten, Rachel A.; Wisniewski, John P.; Hawley, Suzanne L.

2017-01-01

The broadening of the hydrogen lines during flares is thought to result from increased charge (electron, proton) density in the flare chromosphere. However, disagreements between theory and modeling prescriptions have precluded an accurate diagnostic of the degree of ionization and compression resulting from flare heating in the chromosphere. To resolve this issue, we have incorporated the unified theory of electric pressure broadening of the hydrogen lines into the non-LTE radiative-transfer code RH. This broadening prescription produces a much more realistic spectrum of the quiescent, A0 star Vega compared to the analytic approximations used as a damping parameter in the Voigt profiles. We test recent radiative-hydrodynamic (RHD) simulations of the atmospheric response to high nonthermal electron beam fluxes with the new broadening prescription and find that the Balmer lines are overbroadened at the densest times in the simulations. Adding many simultaneously heated and cooling model loops as a 'multithread' model improves the agreement with the observations. We revisit the three component phenomenological flare model of the YZ CMi Megaflare using recent and new RHD models. The evolution of the broadening, line flux ratios, and continuum flux ratios are well-reproduced by a multithread model with high-flux nonthermal electron beam heating, an extended decay phase model, and a 'hot spot' atmosphere heated by an ultra relativistic electron beam with reasonable filling factors: approximately 0.1%, 1%, and 0.1% of the visible stellar hemisphere, respectively. The new modeling motivates future work to understand the origin of the extended gradual phase emission.

Assessment of Cpa, Scl1 and Scl2 in clinical group A streptococcus isolates and patients from north India: an evaluation of the host pathogen interaction.

PubMed

Chaudhary, Priyanka; Kumar, Rajesh; Sagar, Vivek; Sarkar, Subendu; Singh, Rupneet; Ghosh, Sujata; Singh, Surjit; Chakraborti, Anuradha

2018-01-01

Group A streptococcus (GAS) infection remains a major concern due to multiple diseases including pharyngitis, impetigo, acute rheumatic fever (ARF) and rheumatic heart disease (RHD). It uses different adhesins and virulence factors like Cpa (collagen binding protein) and Scl (collagen-like protein) in its pathogenicity. Scl having similarities with human collagen may contribute to inducing autoimmunity in the host. Here we assessed gene expression, antibody titer of Cpa, Scl1 and Scl2 in both clinical GAS isolates (n = 45) and blood (n = 45) obtained from pharyngitis, ARF (acute rheumatic fever) and RHD respectively. Skin isolates (n = 30) were obtained from impetigo patients. The study revealed a total of 27 GAS emm types. Frequency of cpa, scl1, scl2 was high in ARF isolates. The antibody titer of these proteins was high in all isolates, and also in patients with pharyngitis and ARF. All isolates showed high binding affinity toward collagen I and IV, which further indicates a potential host pathogen interaction. Our study reflects a strong association of Cpa and Scls in early and post-GAS pathogenicity. However, the increased antibody titer of Scl1 and Scl2 during ARF may be attributed to a cogent immune response in the host. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

COMPARISON OF IMPLICIT SCHEMES TO SOLVE EQUATIONS OF RADIATION HYDRODYNAMICS WITH A FLUX-LIMITED DIFFUSION APPROXIMATION: NEWTON–RAPHSON, OPERATOR SPLITTING, AND LINEARIZATION

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tetsu, Hiroyuki; Nakamoto, Taishi, E-mail: h.tetsu@geo.titech.ac.jp

Radiation is an important process of energy transport, a force, and a basis for synthetic observations, so radiation hydrodynamics (RHD) calculations have occupied an important place in astrophysics. However, although the progress in computational technology is remarkable, their high numerical cost is still a persistent problem. In this work, we compare the following schemes used to solve the nonlinear simultaneous equations of an RHD algorithm with the flux-limited diffusion approximation: the Newton–Raphson (NR) method, operator splitting, and linearization (LIN), from the perspective of the computational cost involved. For operator splitting, in addition to the traditional simple operator splitting (SOS) scheme,more » we examined the scheme developed by Douglas and Rachford (DROS). We solve three test problems (the thermal relaxation mode, the relaxation and the propagation of linear waves, and radiating shock) using these schemes and then compare their dependence on the time step size. As a result, we find the conditions of the time step size necessary for adopting each scheme. The LIN scheme is superior to other schemes if the ratio of radiation pressure to gas pressure is sufficiently low. On the other hand, DROS can be the most efficient scheme if the ratio is high. Although the NR scheme can be adopted independently of the regime, especially in a problem that involves optically thin regions, the convergence tends to be worse. In all cases, SOS is not practical.« less

Discrete diffusion Lyman α radiative transfer

NASA Astrophysics Data System (ADS)

Smith, Aaron; Tsang, Benny T.-H.; Bromm, Volker; Milosavljević, Miloš

2018-06-01

Due to its accuracy and generality, Monte Carlo radiative transfer (MCRT) has emerged as the prevalent method for Lyα radiative transfer in arbitrary geometries. The standard MCRT encounters a significant efficiency barrier in the high optical depth, diffusion regime. Multiple acceleration schemes have been developed to improve the efficiency of MCRT but the noise from photon packet discretization remains a challenge. The discrete diffusion Monte Carlo (DDMC) scheme has been successfully applied in state-of-the-art radiation hydrodynamics (RHD) simulations. Still, the established framework is not optimal for resonant line transfer. Inspired by the DDMC paradigm, we present a novel extension to resonant DDMC (rDDMC) in which diffusion in space and frequency are treated on equal footing. We explore the robustness of our new method and demonstrate a level of performance that justifies incorporating the method into existing Lyα codes. We present computational speedups of ˜102-106 relative to contemporary MCRT implementations with schemes that skip scattering in the core of the line profile. This is because the rDDMC runtime scales with the spatial and frequency resolution rather than the number of scatterings—the latter is typically ∝τ0 for static media, or ∝(aτ0)2/3 with core-skipping. We anticipate new frontiers in which on-the-fly Lyα radiative transfer calculations are feasible in 3D RHD. More generally, rDDMC is transferable to any computationally demanding problem amenable to a Fokker-Planck approximation of frequency redistribution.

Germline transmission in transgenic Huntington's disease monkeys.

PubMed

Moran, Sean; Chi, Tim; Prucha, Melinda S; Ahn, Kwang Sung; Connor-Stroud, Fawn; Jean, Sherrie; Gould, Kenneth; Chan, Anthony W S

2015-07-15

Transgenic nonhuman primate models are an increasingly popular model for neurologic and neurodegenerative disease because their brain functions and neural anatomies closely resemble those of humans. Transgenic Huntington's disease monkeys (HD monkeys) developed clinical features similar to those seen in HD patients, making the monkeys suitable for a preclinical study of HD. However, until HD monkey colonies can be readily expanded, their use in preclinical studies will be limited. In the present study, we confirmed germline transmission of the mutant huntingtin (mHTT) transgene in both embryonic stem cells generated from three male HD monkey founders (F0) and in second-generation offspring (F1) produced via artificial insemination by using intrauterine insemination technique. A total of five offspring were produced from 15 females that were inseminated by intrauterine insemination using semen collected from the three HD founders (5 of 15, 33%). Thus far, sperm collected from the HD founder (rHD8) has led to two F1 transgenic HD monkeys with germline transmission rate at 100% (2 of 2). mHTT expression was confirmed by quantitative real-time polymerase chain reaction using skin fibroblasts from the F1 HD monkeys and induced pluripotent stem cells established from one of the F1 HD monkeys (rHD8-2). Here, we report the stable germline transmission and expression of the mHTT transgene in HD monkeys, which suggest possible expansion of HD monkey colonies for preclinical and biomedical research studies. Copyright © 2015 Elsevier Inc. All rights reserved.

Distribution of ABO/Rh blood groups and their association with hepatitis B virus infection in 3.8 million Chinese adults: A population-based cross-sectional study.

PubMed

Liu, J; Zhang, S; Liu, M; Wang, Q; Shen, H; Zhang, Y

2018-04-01

ABO and Rh blood groups play a vital role in blood transfusion safety and clinical practice and are thought to be linked with disease susceptibility. The results from previous studies that focused on the association between blood groups and HBV infection remain controversial. China has the world's largest burden of HBV infection. We assessed the distribution of ABO/Rh blood groups in Chinese adults and examined the association between these groups and HBV infection. We did a nationwide cross-sectional study using data from a physical check-up programme from 31 provinces examined between 2010 and 2012. ELISA was used to test for HBsAg in serologic samples. Multivariable logistic regression was used to estimate aOR of the association between ABO and Rh blood groups and HBV infection. Among 3 827 125 participants, the proportion of participants with blood group A was highest (30.54%), followed by O (30.37%), B (29.42%) and AB (9.66%). A total of 38 907 (1.02%) were Rh-D negative. The prevalence of HBsAg in blood groups O, A, B and AB were 6.34%, 5.55%, 5.18% and 5.06%, respectively. HBsAg prevalence was 5.65% in Rh-D-positive and 3.96% in Rh-D-negative participants. After controlling for other potential risk factors, multivariate models showed that participants with blood group O (adjusted OR = 1.22, 95% CI: 1.20-1.25) were at higher risk of HBV infection compared with group AB. Rh-D-positive participants (adjusted OR = 1.44, 95% CI: 1.37-1.52) were at higher risk of HBV infection than Rh-D-negative participants. The associations between ABO/Rh blood groups and HBV infection were similar in subgroup analysis. The proportions of O, A, B and AB blood groups were approximately 3:3:3:1, and nearly 1 in 100 people was Rh-D negative among Chinese adults. Blood group O and Rh-D positivity were both associated with increased HBV infection. The risk of HBV infection and blood safety should be taken into consideration in clinical practice, especially when transfusing those with blood group O. Awareness and prevention of HBV infection is of particular importance for individuals with blood group O. © 2017 John Wiley & Sons Ltd.

A Two-moment Radiation Hydrodynamics Module in ATHENA Using a Godunov Method

NASA Astrophysics Data System (ADS)

Skinner, M. A.; Ostriker, E. C.

2013-04-01

We describe a module for the Athena code that solves the grey equations of radiation hydrodynamics (RHD) using a local variable Eddington tensor (VET) based on the M1 closure of the two-moment hierarchy of the transfer equation. The variables are updated via a combination of explicit Godunov methods to advance the gas and radiation variables including the non-stiff source terms, and a local implicit method to integrate the stiff source terms. We employ the reduced speed of light approximation (RSLA) with subcycling of the radiation variables in order to reduce computational costs. The streaming and diffusion limits are well-described by the M1 closure model, and our implementation shows excellent behavior for problems containing both regimes simultaneously. Our operator-split method is ideally suited for problems with a slowly-varying radiation field and dynamical gas flows, in which the effect of the RSLA is minimal.

First field trial of a transmissible recombinant vaccine against myxomatosis and rabbit hemorrhagic disease.

PubMed

Torres, J M; Sánchez, C; Ramírez, M A; Morales, M; Bárcena, J; Ferrer, J; Espuña, E; Pagès-Manté, A; Sánchez-Vizcaíno, J M

2001-08-14

As a novel approach for immunisation of wild rabbits, we have recently developed a transmissible vaccine against myxomatosis and rabbit hemorrhagic disease (RHD) based on a recombinant myxoma virus (MV) expressing the RHDV capsid protein [J. Virol. 74 (2000) 1114]. The efficacy and safety of the vaccine have been extensively evaluated under laboratory conditions. In this study, we report the first limited field trial of the candidate vaccine that was undertaken in an island of 34 Has containing a population of around 300 rabbits. Following administration by the subcutaneous route to 76 rabbits, the vaccine induced specific antibody responses against both myxomatosis and RHDV in all the inoculated rabbits. Furthermore, the recombinant virus exhibited a limited horizontal transmission capacity, promoting seroconversion of around 50% of the uninoculated rabbit population. No evidence of undesirable effects due to the recombinant virus field release was detected.

Intra-seasonal NDVI change projections in semi-arid Africa

USGS Publications Warehouse

Funk, Christopher C.; Brown, Molly E.

2006-01-01

Early warning systems (EWS) tend to focus on the identification of slow onset disasters such famine and epidemic disease. Since hazardous environmental conditions often precede disastrous outcomes by many months, effective monitoring via satellite and in situ observations can successfully guide mitigation activities. Accurate short term forecasts of NDVI could increase lead times, making early warning earlier. This paper presents a simple empirical model for making 1 to 4 month NDVI projections. These statistical projections are based on parameterized satellite rainfall estimates (RFE) and relative humidity demand (RHD). A quasi-global, 1 month ahead, 1° study demonstrates reasonable accuracies in many semi-arid regions. In Africa, a 0.1° cross-validated skill assessment quantifies the technique's applicability at 1 to 4 month forecast intervals. These results suggest that useful projections can be made over many semi-arid, food insecure regions of Africa, with plausible extensions to drought prone areas of Asia, Australia and South America.

Hydrogen Balmer Line Broadening in Solar and Stellar Flares

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kowalski, Adam F.; Allred, Joel C.; Uitenbroek, Han

2017-03-10

The broadening of the hydrogen lines during flares is thought to result from increased charge (electron, proton) density in the flare chromosphere. However, disagreements between theory and modeling prescriptions have precluded an accurate diagnostic of the degree of ionization and compression resulting from flare heating in the chromosphere. To resolve this issue, we have incorporated the unified theory of electric pressure broadening of the hydrogen lines into the non-LTE radiative-transfer code RH. This broadening prescription produces a much more realistic spectrum of the quiescent, A0 star Vega compared to the analytic approximations used as a damping parameter in the Voigtmore » profiles. We test recent radiative-hydrodynamic (RHD) simulations of the atmospheric response to high nonthermal electron beam fluxes with the new broadening prescription and find that the Balmer lines are overbroadened at the densest times in the simulations. Adding many simultaneously heated and cooling model loops as a “multithread” model improves the agreement with the observations. We revisit the three-component phenomenological flare model of the YZ CMi Megaflare using recent and new RHD models. The evolution of the broadening, line flux ratios, and continuum flux ratios are well-reproduced by a multithread model with high-flux nonthermal electron beam heating, an extended decay phase model, and a “hot spot” atmosphere heated by an ultrarelativistic electron beam with reasonable filling factors: ∼0.1%, 1%, and 0.1% of the visible stellar hemisphere, respectively. The new modeling motivates future work to understand the origin of the extended gradual phase emission.« less

Heart surgery for immigrants in Italy: burden of cardiovascular disease, adherence to treatment and outcomes.

PubMed

Grimaldi, Antonio; Vermi, Anna Chiara; Cammalleri, Valeria; Castiglioni, Alessandro; Pappalardo, Federico; Taramasso, Maurizio; Baratto, Francesca; Alfieri, Ottavio

2016-02-01

Italy is a country with high rates of immigration and the knowledge of immigrant health is very fragmentary. We provide a current picture of cardiovascular disease causes and clinical outcomes following heart surgery. A clinical and echocardiographic survey was conducted on 154 consecutive immigrants referred for heart surgery to San Raffaele Hospital in Milan between 2003 and 2011. Major causes of heart disease were rheumatic heart disease (RHD) (n = 64, 41%), nonrheumatic valvulopathies (n = 41, 27%), ischemic heart disease (IHD) (n = 25, 16%), congenital heart disease (n = 13, 9%) and miscellaneous (n = 11, 7%). Median age was 49 years [interquartile range (IQR) 7-81]; 55% of patients were male. Among valvulopathies, rheumatic mitral disease was predominant (n = 56, 53%) as both single and multivalvular disease (n = 46, 73%); myxomatous prolapse emerged as the second main pattern of mitral disease (n = 30, 33%). Among patients with IHD, 72% had a high cardiovascular risk. Surgery was scheduled in 138 patients (90%). Clinical follow-up was available in 96 patients (62%) [median time 62 months (IQR 15-123)], among whom 92 (96%) were alive, four patients (4%) had died and 58 (38%) were lost. Cardiovascular diseases represent a major health topic among immigrants in developed countries. RHD still is the predominant cause of hospitalization for heart surgery, nonrheumatic valvulopathies and IHD emerging as second and third causes, respectively. Data underline the need of reinforcement of prevention and care strategies in the matter of immigrant health and warrant the urgent attention of the international public health and research communities.

Clinical presentation, management, and outcomes in the Indian Heart Rhythm Society-Atrial Fibrillation (IHRS-AF) registry.

PubMed

Vora, A; Kapoor, A; Nair, M; Lokhandwala, Y; Narsimhan, C; Ravikishore, A G; Dwivedi, S K; Namboodiri, N; Hygriv, R; Saxena, A; Nabar, A; Garg, S; Bardoloi, N; Yadav, R; Nambiar, A; Pandurangi, U; Jhala, D; Naik, A; Nagmallesh; Rajagopal, S; Selvaraj, R; Arora, V; Thachil, A; Thomas, J; Panicker, G

A national atrial fibrillation (AF) registry was conducted under the aegis of the Indian Heart Rhythm Society (IHRS), to capture epidemiological data-type of AF, clinical presentation and comorbidities, current treatment practices, and 1-year follow-up outcomes. A total of 1537 patients were enrolled from 24 sites in India in the IHRS-AF registry from July 2011 to August 2012. Their baseline characteristics and follow-up data were recorded in case report forms and subsequently analyzed. The average age of Indian AF patients was 54.7 years. There was a marginal female preponderance - 51.5% females and 48.5% males. At baseline, 20.4% had paroxysmal AF; 33% had persistent AF; 35.1% had permanent AF and 11% had first AF episode. At one-year follow-up, 45.6% patients had permanent AF. Rheumatic valvular heart disease (RHD) was present in 47.6% of patients. Hypertension, heart failure, coronary artery disease, and diabetes were seen in 31.4%, 18.7%, 16.2%, and 16.1%, respectively. Rate control was the strategy used in 75.2% patients, digoxin and beta-blockers being the most frequently prescribed rate-control drugs. Oral anticoagulation (OAC) drugs were used in 70% of patients. The annual mortality was 6.5%, hospitalization 8%, and incidence of stroke 1%. In India, AF patients are younger and RHD is still the most frequent etiology. Almost two-third of the patients have persistent/permanent AF. At one-year follow-up, there is a significant mortality and morbidity in AF patients in India. Copyright © 2016. Published by Elsevier B.V.

Validation of paper-based assay for rapid blood typing.

PubMed

Al-Tamimi, Mohammad; Shen, Wei; Zeineddine, Rania; Tran, Huy; Garnier, Gil

2012-02-07

We developed and validated a new paper-based assay for the detection of human blood type. Our method involves spotting a 3 μL blood sample on a paper surface where grouping antibodies have already been introduced. A thin film chromatograph tank was used to chromatographically elute the blood spot with 0.9% NaCl buffer for 10 min by capillary absorption. Agglutinated red blood cells (RBCs) were fixed on the paper substrate, resulting in a high optical density of the spot, with no visual trace in the buffer wicking path. Conversely, nonagglutinated RBCs could easily be eluted by the buffer and had low optical density of the spot and clearly visible trace of RBCs in the buffer wicking path. Different paper substrates had comparable ability to fix agglutinated blood, while a more porous substrate like Kleenex paper had enhanced ability to elute nonagglutinated blood. Using optimized conditions, a rapid assay for detection of blood groups was developed by spotting blood to antibodies absorbed to paper and eluted with 200 μL of 0.9% NaCl buffer directly by pipetting. RBCs fixation on paper accurately detected blood groups (ABO and RhD) using ascending buffer for 10 min or using a rapid elution step in 100/100 blood samples including 4 weak AB and 4 weak RhD samples. The assay has excellent reproducibility where the same blood group was obtained in 26 samples assessed in 2 different days. Agglutinated blood fixation on porous paper substrate provides a new, simple, and sensitive assay for rapid detection of blood group for point-of-care applications. © 2011 American Chemical Society

Social stratification in the Sikh population of Punjab (India) has a genetic basis: evidence from serological and biochemical markers.

PubMed

Chahal, Sukh Mohinder Singh; Virk, Rupinder Kaur; Kaur, Sukhvir; Bansal, Rupinder

2011-01-01

The present study was planned to assess whether social stratification in the Sikh population inhabiting the northwest border Indian state of Punjab has any genetic basis. Blood samples were collected randomly from a total of 2851 unrelated subjects belonging to 21 groups of two low-ranking Sikh scheduled caste populations, viz. Mazhabi and Ramdasi, and a high-ranking Jat Sikh caste population of Punjab. The genetic profile of Sikh groups was investigated using a total of nine serobiochemical genetic markers, comprising two blood groups (ABO, RH(D)) and a battery of seven red cell enzyme polymorphisms (ADA, AK1, ESD, PGM1, GLO1, ACP1, GPI), following standard serological and biochemical laboratory protocols. Genetic structure was studied using original allele frequency data and statistical measures of heterozygosity, genic differentiation, genetic distance, and genetic admixture. Great heterogeneity was observed between Sikh scheduled caste and Jat Sikh populations, especially in the RH(D) blood group system, and distribution of ESD, ACP1, and PGM1 enzyme markers was also found to be significantly different between many of their groups. Genetic distance trees demonstrated little or no genetic affinities between Sikh scheduled caste and Jat Sikh populations; the Mazhabi and Ramdasi also showed little genetic relationship. Genetic admixture analysis suggested a higher element of autochthonous tribal extraction in the Ramdasi. The present study revealed much genetic heterogeneity in differently ranking Sikh caste populations of Punjab, mainly attributable to their different ethnic backgrounds, and provided a genetic basis to social stratification present in this religious community of Punjab, India.

Wide range scaling laws for radiation driven shock speed, wall albedo and ablation parameters for high-Z materials

NASA Astrophysics Data System (ADS)

Mishra, Gaurav; Ghosh, Karabi; Ray, Aditi; Gupta, N. K.

2018-06-01

Radiation hydrodynamic (RHD) simulations for four different potential high-Z hohlraum materials, namely Tungsten (W), Gold (Au), Lead (Pb), and Uranium (U) are performed in order to investigate their performance with respect to x-ray absorption, re-emission and ablation properties, when irradiated by constant temperature drives. A universal functional form is derived for estimating time dependent wall albedo for high-Z materials. Among the high-Z materials studied, it is observed that for a fixed simulation time the albedo is maximum for Au below 250 eV, whereas it is maximum for U above 250 eV. New scaling laws for shock speed vs drive temperature, applicable over a wide temperature range of 100 eV to 500 eV, are proposed based on the physics of x-ray driven stationary ablation. The resulting scaling relation for a reference material Aluminium (Al), shows good agreement with that of Kauffman's power law for temperatures ranging from 100 eV to 275 eV. New scaling relations are also obtained for temperature dependent mass ablation rate and ablation pressure, through RHD simulation. Finally, our study reveals that for temperatures above 250 eV, U serves as a better hohlraum material since it offers maximum re-emission for x-rays along with comparable mass ablation rate. Nevertheless, traditional choice, Au works well for temperatures below 250 eV. Besides inertial confinement fusion (ICF), the new scaling relations may find its application in view-factor codes, which generally ignore atomic physics calculations of opacities and emissivities, details of laser-plasma interaction and hydrodynamic motions.

Streptococcal Pharyngitis in Schoolchildren in Bamako, Mali

PubMed Central

Tapia, Milagritos D.; Sow, Samba O.; Tamboura, Boubou; Keita, Mahamadou M.; Berthe, Abdoulaye; Samake, Mariam; Nataro, James P.; Onwuchekwa, Uma O.; Penfound, Thomas A.; Blackwelder, William; Dale, James B.; Kotloff, Karen L.

2014-01-01

Background Group A streptococcus (GAS) pharyngitis is associated with high rates of rheumatic heart disease (RHD) in developing countries. We sought to identify guidelines for empiric treatment of pharyngitis in low resource settings. To inform the design of GAS vaccines, we determined the emm types associated with pharyngitis among African schoolchildren. Methods Surveillance for pharyngitis was conducted among children 5 to 16 years of age attending schools in Bamako, Mali. Students were encouraged to visit a study clinician when they had a sore throat. Enrollees underwent evaluation and throat swab for isolation of GAS. Strains were emm typed by standard methods. Results GAS was isolated from 449 (25.5%) of the 1,759 sore throat episodes. Painful cervical adenopathy identified 403 children (89.8%) with GAS infection and was absent in 369 uninfected children (28.2%). Emm type was determined in 396 (88.2%) of the 449 culture-positive children; 70 types were represented and 14 types accounted for 49% of isolates. Based on the proportion of the 449 isolates bearing emm types included in the 30-valent vaccine (31.0%) plus non-vaccine types previously shown to react to vaccine-induced bactericidal antibodies (44.1%), the vaccine could protect against almost 75% of GAS infections among Bamako schoolchildren. Conclusions Two promising strategies could reduce RHD in low resource settings. Administering antibiotics to children with sore throat and tender cervical adenopathy could treat most GAS-positive children while reducing use of unnecessary antibiotics for uninfected children. Broad coverage against M types associated with pharyngitis in Bamako schoolchildren might be achieved with the 30-valent GAS vaccine under development. PMID:25356953

WHO programme for the prevention of rheumatic fever/rheumatic heart disease in 16 developing countries: report from Phase I (1986-90). WHO Cardiovascular Diseases Unit and principal investigators.

PubMed

1992-01-01

The programme was initiated in 1984 by WHO in close collaboration with the International Society and Federation of Cardiology (ISFC). Sixteen countries in five WHO Regions participated: Mali, Zambia and Zimbabwe (in Africa); Bolivia, El Salvador and Jamaica (in the Americas); Egypt, Iraq, Pakistan and Sudan (in the Eastern Mediterranean); India, Sri Lanka and Thailand (in South-East Asia); and China, the Philippines and Tonga (in the Western Pacific). The programme was planned for implementation in three phases: pilot study and control programme in a selected area, control programmes in all the selected communities, and their extension to the whole country. In Phase I, a total of 1,433,710 schoolchildren were screened and 3135 cases of rheumatic fever/rheumatic heart disease (RF/RHD) were found, giving a prevalence of 2.2 per 1000 (higher in the African and Eastern Mediterranean regions); 33,651 recently identified or already known cases were registered; completion of secondary prophylaxis was irregular but averaged 63.2% coverage; percentages of adverse reactions (0.3%) and recurrence of acute RF (0.4%) were very small; 24,398 health personnel and teachers were trained. Health education activities were organized for patients, their relatives, and the general public in hundreds of health education sessions. Thousands of pamphlets, brochures and posters were distributed, and health education programmes were broadcast on radio and television. The quality of care for RF/RHD patients improved under the programme, which has been expanded to other areas.

Hydrogen Balmer Line Broadening in Solar and Stellar Flares

NASA Astrophysics Data System (ADS)

Kowalski, Adam F.; Allred, Joel C.; Uitenbroek, Han; Tremblay, Pier-Emmanuel; Brown, Stephen; Carlsson, Mats; Osten, Rachel A.; Wisniewski, John P.; Hawley, Suzanne L.

2017-03-01

The broadening of the hydrogen lines during flares is thought to result from increased charge (electron, proton) density in the flare chromosphere. However, disagreements between theory and modeling prescriptions have precluded an accurate diagnostic of the degree of ionization and compression resulting from flare heating in the chromosphere. To resolve this issue, we have incorporated the unified theory of electric pressure broadening of the hydrogen lines into the non-LTE radiative-transfer code RH. This broadening prescription produces a much more realistic spectrum of the quiescent, A0 star Vega compared to the analytic approximations used as a damping parameter in the Voigt profiles. We test recent radiative-hydrodynamic (RHD) simulations of the atmospheric response to high nonthermal electron beam fluxes with the new broadening prescription and find that the Balmer lines are overbroadened at the densest times in the simulations. Adding many simultaneously heated and cooling model loops as a “multithread” model improves the agreement with the observations. We revisit the three-component phenomenological flare model of the YZ CMi Megaflare using recent and new RHD models. The evolution of the broadening, line flux ratios, and continuum flux ratios are well-reproduced by a multithread model with high-flux nonthermal electron beam heating, an extended decay phase model, and a “hot spot” atmosphere heated by an ultrarelativistic electron beam with reasonable filling factors: ˜0.1%, 1%, and 0.1% of the visible stellar hemisphere, respectively. The new modeling motivates future work to understand the origin of the extended gradual phase emission.

Time-Resolved Properties and Global Trends in dMe Flares from Simultaneous Photometry and Spectra

NASA Astrophysics Data System (ADS)

Kowalski, Adam F.

We present a homogeneous survey of near-ultraviolet (NUV) /optical line and continuum emission during twenty M dwarf flares with simultaneous, high cadence photometry and spectra. These data were obtained to study the white-light continuum components to the blue and red of the Balmer jump to break the degeneracy with fitting emission mechanisms to broadband colors and to provide constraints for radiative-hydrodynamic flare models that seek to reproduce the white-light flare emission. The main results from the continuum analysis are the following: 1) the detection of Balmer continuum (in emission) that is present during all flares, with a wide range of relative contribution to the continuum flux in the NUV; 2) a blue continuum at the peak of the photometry that is linear with wavelength from λ = 4000 - 4800Å, matched by the spectral shape of hot, blackbody emission with typical temperatures of 10 000 - 12 000 K; 3) a redder continuum apparent at wavelengths longer than Hβ; this continuum becomes relatively more important to the energy budget during the late gradual phase. The hot blackbody component and redder continuum component (which we call "the conundruum") have been detected in previous UBVR colorimetry studies of flares. With spectra, one can compare the properties and detailed timings of all three components. Using time-resolved spectra during the rise phase of three flares, we calculate the speed of an expanding flare region assuming a simple geometry; the speeds are found to be ~5- 10 km s-1 and 50 - 120 km s -1, which are strikingly consistent with the speeds at which two-ribbon flares develop on the Sun. The main results from the emission line analysis are 1) the presentation of the "time-decrement", a relation between the timescales of the Balmer series; 2) a Neupert-like relation between Ca \\pcy K and the blackbody continuum, and 3) the detection of absorption wings in the Hydrogen Balmer lines during times of peak continuum emission, indicative of hot-star spectra forming during the flare. A byproduct of this study is a new method for deriving absolute fluxes during M dwarf flare observations obtained from narrow-slit spectra or during variable weather conditions. This technique allows us to analyze the spectra and photometry independently of one another, in order to connect the spectral properties to the rise, peak, and decay phases of broadband light curve morphology. We classify the light curve morphology according to an "impulsiveness index" and find that the fast (impulsive) flares have less Balmer continuum at peak emission than the slow (gradual) flares. In the gradual phase, the energy budget of the flare spectrum during almost all flares has a larger contribution from the Hydrogen Balmer component than in the impulsive phase, suggesting that the heating and cooling processes evolve over the course of a flare. We find that, in general, the evolution of the hot blackbody is rapid, and that the blackbody temperature decreases to ~8000 K in the gradual phase. The Balmer continuum evolves more slowly than the blackbody ¨C similar to the higher order Balmer lines but faster than the lower order Balmer lines. The height of the Balmer jump increases during the gradual decay phase. We model the Balmer continuum emission using the RHD F11 model spectrum from Allred et al. (2006), but we discuss several important systematic uncertainties in relating the apparent amount of Balmer continuum to a given RHD beam model. Good fits to the shape of the RHD F11 model spectrum are not obtained at peak times, in contrast to the gradual phase. We model the blackbody component using model hot star atmospheres from Castelli & Kurucz (2004) in order to account for the effects of flux redistribution in the flare atmosphere. This modeling is motivated by observations during a secondary flare in the decay phase of a megaflare, when the newly formed flare spectrum resembled that of Vega with the Balmer continuum and lines in absorption. We model this continuum phenomenologically with the RH code using hot spots placed at high column mass in the M dwarf quiescent atmosphere; a superposition of hot spot models and the RHD model are used to explain the anti-correlation in the apparent amount of Balmer continuum in emission and the U-band light curve. We attempt to reproduce the blackbody component in self-consistent 1D radiative hydrodynamic flare models using the RADYN code. We simulate the flare using a solar-type nonthermal electron beam heating function with a total energy flux of 1012 ergs cm-2 s-1 (F12) for a duration of 5 seconds and a subsequent gradual phase. Although there is a larger amount of NUV backwarming at log mc/(1g cm-2)~0 than in the F11 model, the resulting flare continuum shape is similar to the F11 model spectrum with a larger Balmer jump and a much redder spectral shape than is seen in the observations. We do not find evidence of white-light emitting chromospheric condensations, in contrast to the previous F12 model of Livshits et al. (1981). We discuss future avenues for RHD modeling in order to produce a hot blackbody component, including the treatment of nonthermal protons in M dwarf flares.

Influence of latent Toxoplasma infection on human personality, physiology and morphology: pros and cons of the Toxoplasma-human model in studying the manipulation hypothesis.

PubMed

Flegr, Jaroslav

2013-01-01

The parasitic protozoan Toxoplasma gondii infects about one-third of the population of developed countries. The life-long presence of dormant stages of this parasite in the brain and muscular tissues of infected humans is usually considered asymptomatic from the clinical point of view. In the past 20 years, research performed mostly on military personnel, university students, pregnant women and blood donors has shown that this 'asymptomatic' disease has a large influence on various aspects of human life. Toxoplasma-infected subjects differ from uninfected controls in the personality profile estimated with two versions of Cattell's 16PF, Cloninger's TCI and Big Five questionnaires. Most of these differences increase with the length of time since the onset of infection, suggesting that Toxoplasma influences human personality rather than human personality influencing the probability of infection. Toxoplasmosis increases the reaction time of infected subjects, which can explain the increased probability of traffic accidents in infected subjects reported in three retrospective and one very large prospective case-control study. Latent toxoplasmosis is associated with immunosuppression, which might explain the increased probability of giving birth to a boy in Toxoplasma-infected women and also the extremely high prevalence of toxoplasmosis in mothers of children with Down syndrome. Toxoplasma-infected male students are about 3 cm taller than Toxoplasma-free subjects and their faces are rated by women as more masculine and dominant. These differences may be caused by an increased concentration of testosterone. Toxoplasma also appears to be involved in the initiation of more severe forms of schizophrenia. At least 40 studies confirmed an increased prevalence of toxoplasmosis among schizophrenic patients. Toxoplasma-infected schizophrenic patients differ from Toxoplasma-free schizophrenic patients by brain anatomy and by a higher intensity of the positive symptoms of the disease. Finally, five independent studies performed in blood donors, pregnant women and military personnel showed that RhD blood group positivity, especially in RhD heterozygotes, protects infected subjects against various effects of latent toxoplasmosis, such as the prolongation of reaction times, an increased risk of traffic accidents and excessive pregnancy weight gain. The modern human is not a natural host of Toxoplasma. Therefore, it can only be speculated which of the observed effects of latent toxoplasmosis are the result of the manipulation activity of the Toxoplasma aimed to increase the probability of its transmission from a natural intermediate to the definitive host by predation, and which are just side effects of chronic infection.

Benzene Degradation by a Variovorax Species within a Coal Tar-Contaminated Groundwater Microbial Community.

PubMed

Posman, Kevin M; DeRito, Christopher M; Madsen, Eugene L

2017-02-15

Investigations of environmental microbial communities are crucial for the discovery of populations capable of degrading hazardous compounds and may lead to improved bioremediation strategies. The goal of this study was to identify microorganisms responsible for aerobic benzene degradation in coal tar-contaminated groundwater. Benzene degradation was monitored in laboratory incubations of well waters using gas chromatography mass spectrometry (GC-MS). Stable isotope probing (SIP) experiments using [ 13 C]benzene enabled us to obtain 13 C-labled community DNA. From this, 16S rRNA clone libraries identified Gammaproteobacteria and Betaproteobacteria as the active benzene-metabolizing microbial populations. Subsequent cultivation experiments yielded nine bacterial isolates that grew in the presence of benzene; five were confirmed in laboratory cultures to grow on benzene. The isolated benzene-degrading organisms were genotypically similar (>97% 16S rRNA gene nucleotide identities) to the organisms identified in SIP experiments. One isolate, Variovorax MAK3, was further investigated for the expression of a putative aromatic ring-hydroxylating dioxygenase (RHD) hypothesized to be involved in benzene degradation. Microcosm experiments using Variovorax MAK3 revealed a 10-fold increase in RHD (Vapar_5383) expression, establishing a link between this gene and benzene degradation. Furthermore, the addition of Variovorax MAK3 to microcosms prepared from site waters accelerated community benzene degradation and correspondingly increased RHD gene expression. In microcosms using uninoculated groundwater, quantitative (q)PCR assays (with 16S rRNA and RDH genes) showed that Variovorax was present and responsive to added benzene. These data demonstrate how the convergence of cultivation-dependent and -independent techniques can boost understandings of active populations and functional genes in complex benzene-degrading microbial communities. Benzene is a human carcinogen whose presence in contaminated groundwater drives environmental cleanup efforts. Although the aerobic biodegradation of benzene has long been established, knowledge of the identity of the microorganisms in complex naturally occurring microbial communities responsible for benzene biodegradation has evaded scientific inquiry for many decades. Here, we applied a molecular biology technique known as stable isotope probing (SIP) to the microbial communities residing in contaminated groundwater samples to identify the community members active in benzene biodegradation. We complemented this approach by isolating and growing in the laboratory a bacterium representative of the bacteria found using SIP. Further characterization of the isolated bacterium enabled us to track the expression of a key gene that attacks benzene both in pure cultures of the bacterium and in the naturally occurring groundwater microbial community. This work advances information regarding the documentation of microbial processes, especially the populations and genes that contribute to bioremediation. Copyright © 2017 American Society for Microbiology.

Benzene Degradation by a Variovorax Species within a Coal Tar-Contaminated Groundwater Microbial Community

PubMed Central

Posman, Kevin M.; DeRito, Christopher M.

2016-01-01

ABSTRACT Investigations of environmental microbial communities are crucial for the discovery of populations capable of degrading hazardous compounds and may lead to improved bioremediation strategies. The goal of this study was to identify microorganisms responsible for aerobic benzene degradation in coal tar-contaminated groundwater. Benzene degradation was monitored in laboratory incubations of well waters using gas chromatography mass spectrometry (GC-MS). Stable isotope probing (SIP) experiments using [13C]benzene enabled us to obtain 13C-labled community DNA. From this, 16S rRNA clone libraries identified Gammaproteobacteria and Betaproteobacteria as the active benzene-metabolizing microbial populations. Subsequent cultivation experiments yielded nine bacterial isolates that grew in the presence of benzene; five were confirmed in laboratory cultures to grow on benzene. The isolated benzene-degrading organisms were genotypically similar (>97% 16S rRNA gene nucleotide identities) to the organisms identified in SIP experiments. One isolate, Variovorax MAK3, was further investigated for the expression of a putative aromatic ring-hydroxylating dioxygenase (RHD) hypothesized to be involved in benzene degradation. Microcosm experiments using Variovorax MAK3 revealed a 10-fold increase in RHD (Vapar_5383) expression, establishing a link between this gene and benzene degradation. Furthermore, the addition of Variovorax MAK3 to microcosms prepared from site waters accelerated community benzene degradation and correspondingly increased RHD gene expression. In microcosms using uninoculated groundwater, quantitative (q)PCR assays (with 16S rRNA and RDH genes) showed that Variovorax was present and responsive to added benzene. These data demonstrate how the convergence of cultivation-dependent and -independent techniques can boost understandings of active populations and functional genes in complex benzene-degrading microbial communities. IMPORTANCE Benzene is a human carcinogen whose presence in contaminated groundwater drives environmental cleanup efforts. Although the aerobic biodegradation of benzene has long been established, knowledge of the identity of the microorganisms in complex naturally occurring microbial communities responsible for benzene biodegradation has evaded scientific inquiry for many decades. Here, we applied a molecular biology technique known as stable isotope probing (SIP) to the microbial communities residing in contaminated groundwater samples to identify the community members active in benzene biodegradation. We complemented this approach by isolating and growing in the laboratory a bacterium representative of the bacteria found using SIP. Further characterization of the isolated bacterium enabled us to track the expression of a key gene that attacks benzene both in pure cultures of the bacterium and in the naturally occurring groundwater microbial community. This work advances information regarding the documentation of microbial processes, especially the populations and genes that contribute to bioremediation. PMID:27913419

Toxoplasmosis-associated difference in intelligence and personality in men depends on their Rhesus blood group but not ABO blood group.

PubMed

Flegr, Jaroslav; Preiss, Marek; Klose, Jiří

2013-01-01

The parasite Toxoplasma gondii influences the behaviour of infected animals and probably also personality of infected humans. Subjects with a Rhesus-positive blood group are protected against certain behavioural effects associated with Toxoplasma infection, including the deterioration of reaction times and personality factor shift. Here, we searched for differences in the toxoplasmosis-associated effects between RhD-positive and RhD-negative subjects by testing 502 soldiers with two personality tests and two intelligence tests. The infected subjects expressed lower levels of all potentially pathognomic factors measured with the N-70 questionnaire and in neurasthenia measured with NEO-PI-R. The RhD-positive, Toxoplasma-infected subjects expressed lower while RhD-negative, Toxoplasma-infected subjects expressed higher intelligence than their Toxoplasma-free peers. The observed Toxoplasma-associated differences were always larger in RhD-negative than in RhD-positive subjects. RhD phenotype plays an important role in the strength and direction of association between latent toxoplasmosis and not only psychomotor performance, but also personality and intelligence.

Toxoplasmosis-Associated Difference in Intelligence and Personality in Men Depends on Their Rhesus Blood Group but Not ABO Blood Group

PubMed Central

Flegr, Jaroslav; Preiss, Marek; Klose, Jiří

2013-01-01

Background The parasite Toxoplasma gondii influences the behaviour of infected animals and probably also personality of infected humans. Subjects with a Rhesus-positive blood group are protected against certain behavioural effects associated with Toxoplasma infection, including the deterioration of reaction times and personality factor shift. Methodology/Principal Findings Here, we searched for differences in the toxoplasmosis-associated effects between RhD-positive and RhD-negative subjects by testing 502 soldiers with two personality tests and two intelligence tests. The infected subjects expressed lower levels of all potentially pathognomic factors measured with the N-70 questionnaire and in neurasthenia measured with NEO-PI-R. The RhD-positive, Toxoplasma-infected subjects expressed lower while RhD-negative, Toxoplasma-infected subjects expressed higher intelligence than their Toxoplasma-free peers. The observed Toxoplasma-associated differences were always larger in RhD-negative than in RhD-positive subjects. Conclusions RhD phenotype plays an important role in the strength and direction of association between latent toxoplasmosis and not only psychomotor performance, but also personality and intelligence. PMID:23593448

Parameterizations of Chromospheric Condensations in dG and dMe Model Flare Atmospheres

NASA Astrophysics Data System (ADS)

Kowalski, Adam F.; Allred, Joel C.

2018-01-01

The origin of the near-ultraviolet and optical continuum radiation in flares is critical for understanding particle acceleration and impulsive heating in stellar atmospheres. Radiative-hydrodynamic (RHD) simulations in 1D have shown that high energy deposition rates from electron beams produce two flaring layers at T ∼ 104 K that develop in the chromosphere: a cooling condensation (downflowing compression) and heated non-moving (stationary) flare layers just below the condensation. These atmospheres reproduce several observed phenomena in flare spectra, such as the red-wing asymmetry of the emission lines in solar flares and a small Balmer jump ratio in M dwarf flares. The high beam flux simulations are computationally expensive in 1D, and the (human) timescales for completing NLTE models with adaptive grids in 3D will likely be unwieldy for some time to come. We have developed a prescription for predicting the approximate evolved states, continuum optical depth, and emergent continuum flux spectra of RHD model flare atmospheres. These approximate prescriptions are based on an important atmospheric parameter: the column mass ({m}{ref}) at which hydrogen becomes nearly completely ionized at the depths that are approximately in steady state with the electron beam heating. Using this new modeling approach, we find that high energy flux density (>F11) electron beams are needed to reproduce the brightest observed continuum intensity in IRIS data of the 2014 March 29 X1 solar flare, and that variation in {m}{ref} from 0.001 to 0.02 g cm‑2 reproduces most of the observed range of the optical continuum flux ratios at the peak of M dwarf flares.

Hydrogen Sulfide Sensing through Reactive Sulfur Species (RSS) and Nitroxyl (HNO) in Enterococcus faecalis.

PubMed

Shen, Jiangchuan; Walsh, Brenna J C; Flores-Mireles, Ana Lidia; Peng, Hui; Zhang, Yifan; Zhang, Yixiang; Trinidad, Jonathan C; Hultgren, Scott J; Giedroc, David P

2018-05-17

Recent studies of hydrogen sulfide (H 2 S) signaling implicate low molecular weight (LMW) thiol persulfides and other reactive sulfur species (RSS) as signaling effectors. Here, we show that a CstR protein from the human pathogen Enterococcus faecalis ( E. faecalis), previously identified in Staphylococcus aureus ( S. aureus), is an RSS-sensing repressor that transcriptionally regulates a cst-like operon in response to both exogenous sulfide stress and Angeli's salt, a precursor of nitroxyl (HNO). E. faecalis CstR reacts with coenzyme A persulfide (CoASSH) to form interprotomer disulfide and trisulfide bridges between C32 and C61', which negatively regulate DNA binding to a consensus CstR DNA operator. A Δ cstR strain exhibits deficiency in catheter colonization in a catheter-associated urinary tract infection (CAUTI) mouse model, suggesting sulfide regulation and homeostasis is critical for pathogenicity. Cellular polysulfide metabolite profiling of sodium sulfide-stressed E. faecalis confirms an increase in both inorganic polysulfides and LMW thiols and persulfides sensed by CstR. The cst-like operon encodes two authentic thiosulfate sulfurtransferases and an enzyme we characterize here as an NADH and FAD-dependent coenzyme A (CoA) persulfide reductase (CoAPR) that harbors an N-terminal CoA disulfide reductase (CDR) domain and a C-terminal rhodanese homology domain (RHD). Both cysteines in the CDR (C42) and RHD (C508) domains are required for CoAPR activity and complementation of a sulfide-induced growth phenotype of a S. aureus strain lacking cstB, encoding a nonheme Fe II persulfide dioxygenase. We propose that S. aureus CstB and E. faecalis CoAPR employ orthogonal chemistries to lower CoASSH that accumulates under conditions of cellular sulfide toxicity and signaling.

Maternal red blood cell alloimmunisation in south western Uganda.

PubMed

Natukunda, B; Mugyenyi, G; Brand, A; Schonewille, H

2011-08-01

To identify the frequency and nature of maternal red blood cell (RBC) alloimmunisation in Uganda and to determine the prevalence of RhD negativity and the rate of RBC alloimmunisation in Ugandan pregnant women. Haemolytic disease of the foetus and newborn (HDFN) results from maternal alloimmunisation following exposure to allogeneic RBCs during pregnancy or blood transfusion. The prevalence of maternal RBC alloimmunisation in Ugandans is not known. Pregnant women at Mbarara Hospital, South Western Uganda, were investigated in a cross-sectional study. Demographics, transfusion and obstetric histories were recorded. Maternal RBC alloimmunisation was demonstrated using immunohaematological techniques. A total of 2001 pregnant women were recruited; 3.6% of them being RhD negative. Forty-five women (2.2%; 95% CI: 1.6-2.9) were found to be alloimmunised to RBC antigens. There were 38 RBC alloantibodies of known specificity including anti-S, 12; anti-M, 11; anti-Le(a) , 6; anti-D, 4 and 1 each of anti-K, anti-Fy(b) , anti-Jk(a) , anti-Lu(a) and anti-Kp(a) . In two women (4.4%), there were antibody combinations (anti-M+S and anti-K+Kp(a) ). Obstetric history, gestational age and previous immunising events were not significantly associated with the rate of alloimmunisation. This study revealed a maternal RBC alloimmunisation rate of 2.2% which was comparable with findings from a Zimbabwean study where the prevalence was 1.7%. Given the 6·0% prevalence of anti-D among RhD-negative women in our study and the high immunogenicity of the D antigen, programmes for preventing anti-D alloimmunisation and HDFN in Uganda should be considered seriously. © 2011 The Authors. Transfusion Medicine © 2011 British Blood Transfusion Society.

Three-dimensional structure of clumpy outflow from supercritical accretion flow onto black holes

NASA Astrophysics Data System (ADS)

Kobayashi, Hiroshi; Ohsuga, Ken; Takahashi, Hiroyuki R.; Kawashima, Tomohisa; Asahina, Yuta; Takeuchi, Shun; Mineshige, Shin

2018-03-01

We perform global three-dimensional (3D) radiation-hydrodynamic (RHD) simulations of outflow from supercritical accretion flow around a 10 M⊙ black hole. We only solve the outflow part, starting from the axisymmetric 2D simulation data in a nearly steady state but with small perturbations in a sinusoidal form being added in the azimuthal direction. The mass accretion rate onto the black hole is ˜102LE/c2 in the underlying 2D simulation data, and the outflow rate is ˜10 LE/c2 (with LE and c being the Eddington luminosity and speed of light, respectively). We first confirm the emergence of clumpy outflow, which was discovered by the 2D RHD simulations, above the photosphere located at a few hundreds of Schwarzschild radii (rS) from the central black hole. As prominent 3D features we find that the clumps have the shape of a torn sheet, rather than a cut string, and that they are rotating around the central black hole with a sub-Keplerian velocity at a distance of ˜103 rS from the center. The typical clump size is ˜30 rS or less in the radial direction, and is more elongated in the angular directions, ˜ hundreds of rS at most. The sheet separation ranges from 50 to 150 rS. We expect stochastic time variations when clumps pass across the line of the sight of a distant observer. Variation timescales are estimated to be several seconds for a black hole with mass of ten to several tens of M⊙, in rough agreement with the observations of some ultra-luminous X-ray sources.

Identifying mild and severe preeclampsia in asymptomatic pregnant women by levels of cell-free fetal DNA.

PubMed

Jakobsen, Tanja Roien; Clausen, Frederik Banch; Rode, Line; Dziegiel, Morten Hanefeld; Tabor, Ann

2013-09-01

The objective was to investigate whether women who develop preeclampsia can be identified in a routine analysis when determining fetal RHD status at 25 weeks' gestation in combination with PAPP-A levels at the first-trimester combined risk assessment for Trisomy 21. D- women participating in the routine antenatal RHD screening program in the capital region of Denmark were retrospectively studied. We used a standard dilution curve to quantify the amounts of cell-free fetal DNA (cffDNA) and divided women into groups according to cffDNA levels. PAPP-A was measured at 11 to 14 weeks. Information about pregnancy outcome and complications was obtained from the National Fetal Medicine Database, medical charts, and discharge letters. The odds ratio (OR) of developing severe preeclampsia given a cffDNA level above the 90th percentile compared to cffDNA below the 90th percentile was 8.1 (95% confidence interval [CI], 2.6-25.5). The OR of developing mild preeclampsia given a cffDNA level below the 5th percentile compared to cffDNA levels above the 5th percentile was 3.6 (95% CI, 1.1-11.7). PAPP-A levels below the 5th percentile were associated with mild preeclampsia, but adding it to the analysis did not increase the detection rate (DR). Women with cffDNA levels below the 5th percentile and above the 90th percentile quantified at 25 weeks' gestation are at increased risk of developing preeclampsia. Adding PAPP-A levels to the analysis did not increase the DR of preeclampsia. © 2013 American Association of Blood Banks.

On the Nature of Off-limb Flare Continuum Sources Detected by SDO /HMI

DOE Office of Scientific and Technical Information (OSTI.GOV)

Heinzel, P.; Kašparová, J.; Kleint, L.

The Helioseismic and Magnetic Imager on board the Solar Dynamics Observatory has provided unique observations of off-limb flare emission. White-light continuum enhancements were detected in the “continuum” channel of the Fe 6173 Å line during the impulsive phase of the observed flares. In this paper we aim to determine which radiation mechanism is responsible for such enhancement being seen above the limb, at chromospheric heights around or below 1000 km. Using a simple analytical approach, we compare two candidate mechanisms, the hydrogen recombination continuum (Paschen) and the Thomson continuum due to scattering of disk radiation on flare electrons. Both mechanismsmore » depend on the electron density, which is typically enhanced during the impulsive phase of a flare as the result of collisional ionization (both thermal and also non-thermal due to electron beams). We conclude that for electron densities higher than 10{sup 12} cm{sup −3}, the Paschen recombination continuum significantly dominates the Thomson scattering continuum and there is some contribution from the hydrogen free–free emission. This is further supported by detailed radiation-hydrodynamical (RHD) simulations of the flare chromosphere heated by the electron beams. We use the RHD code FLARIX to compute the temporal evolution of the flare-heating in a semi-circular loop. The synthesized continuum structure above the limb resembles the off-limb flare structures detected by HMI, namely their height above the limb, as well as the radiation intensity. These results are consistent with recent findings related to hydrogen Balmer continuum enhancements, which were clearly detected in disk flares by the IRIS near-ultraviolet spectrometer.« less

DEL phenotype.

PubMed

Kwon, Dong H; Sandler, S G; Flegel, Willy A

2017-09-01

DEL red blood cells (RBCs) type as D- by routine serologic methods and are transfused routinely, without being identified as expressing a very weak D antigen, to D- recipients. DEL RBCs are detected only by adsorption and elution of anti-D or by molecular methods. Most DEL phenotypes have been reported in population studies conducted in East Asia, although DEL phenotypes have been detected also among Caucasian individuals. Approximately 98 percent of DEL phenotypes in East Asians are associated with the RHD*DEL1 or RHD*01EL.01 allele. The prevalence of DEL phenotypes has been reported among D- Han Chinese (30%), Japanese (28%), and Korean (17%) populations. The prevalence of DEL phenotypes is significantly lower among D- Caucasian populations (0.1%). Among the 3-5 percent of African individuals who are D-, there are no reports of the DEL phenotype. Case reports from East Asia indicate that transfusion of DEL RBCs to D- recipients has been associated with D alloimmunization. East Asian immigrants constitute 2.1 percent of the 318.9 million persons residing in the United States, and an estimated 2.8 percent are blood donors. Using these statistics, we estimate that 68-683 units of DEL RBCs from donors of East Asian ancestry are transfused as D- annually in the United States. Given the reports from East Asia of D alloimmunization attributed to transfusion of DEL RBCs, one would expect an occasional report of D alloimmunization in the United States following transfusion of DEL RBCs to a D- recipient. If such cases do occur, the most likely reason that they are not detected is the absence of active post-transfusion monitoring for formation of anti-D.

Early Results of Rheumatic Mitral Valve Repair.

PubMed

Petrone, Giuseppe; Theodoropoulos, Panagiotis; Punjabi, Prakash P

2016-11-01

Mitral valve repair (MVr) in rheumatic heart disease (RHD) remains challenging. The present authors' surgical experience of MVr in 56 patients with RHD operated in between January 2011 and September 2014 is reported. Among the patients (mean age 32 ± 11 years), 11 were in NYHA functional class II, 32 in class III, and seven in class IV. An adequate or oversized autologous pericardial patch was sutured to extend the coaptating edge of both the anterior leaflet (in 18 patients) and the posterior leaflet (in 30 patients). Neochordae were implanted as needed (n = 43), and leaflet thinning (n = 13), commissurotomy (n = 15) and chordal splitting (n = 9) were also performed. A rigid annuloplasty ring was implanted in 32 patients, and in 24 patients a complete flexible annuloplasty ring made from pericardium, 4 mm Gore-Tex tube graft or a Dacron patch was constructed. Repair was not attempted in 16 patients, with replacement using a mechanical bileaflet prosthesis being considered the only option. Intraoperative post-repair transesophageal echocardiography demonstrated competency, with trivial mitral regurgitation (MR) up to grade I in all patients and a minimum coaptation depth ≥5 mm. There were no intraoperative or in-hospital deaths. Clinical and echocardiographic evaluations were performed up to six weeks after surgery, at which time 51 patients were in NYHA classes I-II and five were in class III. Residual mild MR up to grade I was identified in six patients. No recurrence of MR was observed in any of the patients, and no patients were reoperated on. The lack of adequate access to anticoagulation medication and monitoring, in addition to religious/cultural bias to the type of prosthetic valve used in low-income countries, necessitates an increase in the numbers of rheumatic MVr.

Transport characteristics of mammalian Rh and Rh glycoproteins expressed in heterologous systems.

PubMed

Westhoff, C M; Wylie, D E

2006-01-01

The development and use of heterologous expression systems is critical for deciphering the function of mammalian Rh and Rh-glycoproteins. The studies here use Xenopus oocytes, well known for their ability to readily traffic and express difficult membrane proteins, and S. cerevisiae wild-type strains and mutants that are defective in ammonium transport. Data obtained in both of these expression systems revealed that mammalian Rh-glycoprotein-mediated transport (RhAG, RhBG, and RhCG) is an electroneutral process that is driven by the NH4+ concentration and the transmembrane H+ gradient, effectively exchanging NH4+ for H+ in a process that results in transport of net NH3. Homology modeling and functional studies suggest that the more recently evolved erythrocyte blood group proteins, RhCE and RhD, may not function directly in ammonia transport and may be evolving a new function in the RBC membrane. The relationship of Rh and Rh-glycoproteins to the Amt/Mep ammonium transporters is substantiated with functional transport data and structural modeling.

Blood Group Antigens on HeLa Cells shown by Mixed Agglutination

PubMed Central

Kelus, A.; Gurner, B. W.; Coombs, R. R. A.

1959-01-01

The mixed agglutination reaction has been used for investigating the presence of blood group antigens on the surface of human cervical carcinoma cells (HeLa) cultured for eight years in vitro. The H antigen was demonstrated in the absence of A and B. The MN-type antigen has been found as well as Tja. Treatment of HeLa cells with ficin greatly enhanced the reaction of anti-H and anti-Tja with the corresponding antigens on HeLa cells. The authors failed to show the following antigens: Rh(D) and Rh(c), S, P, Lea, Leb, Lua and Lub. ImagesFIG. 1FIG. 2 PMID:14405338

Genetic structure of Rajaka caste and affinities with other caste populations of Andhra Pradesh, India.

PubMed

Parvatheesam, C; Babu, B V; Babu, M C

1997-01-01

The present study gives an account of the genetic structure in terms of distribution of a few genetic markers, viz., A1A2B0, Rh(D), G6PD deficiency and haemoglobin among the Rajaka caste population of Andhra Pradesh, India. The genetic relationships of the Rajaka caste with other Andhra caste populations were investigated in terms of genetic distance, i.e., Sq B (mn) of Balakrishnan and Sanghvi. Relatively lesser distance was established between the Rajaka and two Panchama castes. Also, the pattern of genetic distance corroborates the hierarchical order of the Hindu varna system.

Successful management of neonatal alloimmune thrombocytopenia in the second pregnancy: a case report

PubMed Central

Conti, Fabiana Mendes; Hibner, Sergio; Costa, Thiago Henrique; Dezan, Marcia Regina; Aravechia, Maria Giselda; Pereira, Ricardo Antonio D'Almeida; Kondo, Andrea Tiemi; D'Amico, Élbio Antônio; Mota, Mariza; Kutner, José Mauro

2014-01-01

ABSTRACT Neonatal alloimmune thrombocytopenia is a serious disease, in which the mother produces antibodies against fetal platelet antigens inherited from the father; it is still an underdiagnosed disease. This disease is considered the platelet counterpart of the RhD hemolytic disease of the fetus and newborn, yet in neonatal alloimmune thrombocytopenia the first child is affected with fetal and/or neonatal thrombocytopenia. There is a significant risk of intracranial hemorrhage and severe neurological impairment, with a tendency for earlier and more severe thrombocytopenia in subsequent pregnancies. This article reports a case of neonatal alloimmune thrombocytopenia in the second pregnancy affected and discusses diagnosis, management and the clinical importance of this disease. PMID:24728253

Evaluation of targeted exome sequencing for 28 protein-based blood group systems, including the homologous gene systems, for blood group genotyping.

PubMed

Schoeman, Elizna M; Lopez, Genghis H; McGowan, Eunike C; Millard, Glenda M; O'Brien, Helen; Roulis, Eileen V; Liew, Yew-Wah; Martin, Jacqueline R; McGrath, Kelli A; Powley, Tanya; Flower, Robert L; Hyland, Catherine A

2017-04-01

Blood group single nucleotide polymorphism genotyping probes for a limited range of polymorphisms. This study investigated whether massively parallel sequencing (also known as next-generation sequencing), with a targeted exome strategy, provides an extended blood group genotype and the extent to which massively parallel sequencing correctly genotypes in homologous gene systems, such as RH and MNS. Donor samples (n = 28) that were extensively phenotyped and genotyped using single nucleotide polymorphism typing, were analyzed using the TruSight One Sequencing Panel and MiSeq platform. Genes for 28 protein-based blood group systems, GATA1, and KLF1 were analyzed. Copy number variation analysis was used to characterize complex structural variants in the GYPC and RH systems. The average sequencing depth per target region was 66.2 ± 39.8. Each sample harbored on average 43 ± 9 variants, of which 10 ± 3 were used for genotyping. For the 28 samples, massively parallel sequencing variant sequences correctly matched expected sequences based on single nucleotide polymorphism genotyping data. Copy number variation analysis defined the Rh C/c alleles and complex RHD hybrids. Hybrid RHD*D-CE-D variants were correctly identified, but copy number variation analysis did not confidently distinguish between D and CE exon deletion versus rearrangement. The targeted exome sequencing strategy employed extended the range of blood group genotypes detected compared with single nucleotide polymorphism typing. This single-test format included detection of complex MNS hybrid cases and, with copy number variation analysis, defined RH hybrid genes along with the RHCE*C allele hitherto difficult to resolve by variant detection. The approach is economical compared with whole-genome sequencing and is suitable for a red blood cell reference laboratory setting. © 2017 AABB.

Positive evolutionary selection of an HD motif on Alzheimer precursor protein orthologues suggests a functional role.

PubMed

Miklós, István; Zádori, Zoltán

2012-02-01

HD amino acid duplex has been found in the active center of many different enzymes. The dyad plays remarkably different roles in their catalytic processes that usually involve metal coordination. An HD motif is positioned directly on the amyloid beta fragment (Aβ) and on the carboxy-terminal region of the extracellular domain (CAED) of the human amyloid precursor protein (APP) and a taxonomically well defined group of APP orthologues (APPOs). In human Aβ HD is part of a presumed, RGD-like integrin-binding motif RHD; however, neither RHD nor RXD demonstrates reasonable conservation in APPOs. The sequences of CAEDs and the position of the HD are not particularly conserved either, yet we show with a novel statistical method using evolutionary modeling that the presence of HD on CAEDs cannot be the result of neutral evolutionary forces (p<0.0001). The motif is positively selected along the evolutionary process in the majority of APPOs, despite the fact that HD motif is underrepresented in the proteomes of all species of the animal kingdom. Position migration can be explained by high probability occurrence of multiple copies of HD on intermediate sequences, from which only one is kept by selective evolutionary forces, in a similar way as in the case of the "transcription binding site turnover." CAED of all APP orthologues and homologues are predicted to bind metal ions including Amyloid-like protein 1 (APLP1) and Amyloid-like protein 2 (APLP2). Our results suggest that HDs on the CAEDs are most probably key components of metal-binding domains, which facilitate and/or regulate inter- or intra-molecular interactions in a metal ion-dependent or metal ion concentration-dependent manner. The involvement of naturally occurring mutations of HD (Tottori (D7N) and English (H6R) mutations) in early onset Alzheimer's disease gives additional support to our finding that HD has an evolutionary preserved function on APPOs.

Positive Evolutionary Selection of an HD Motif on Alzheimer Precursor Protein Orthologues Suggests a Functional Role

PubMed Central

Miklós, István; Zádori, Zoltán

2012-01-01

HD amino acid duplex has been found in the active center of many different enzymes. The dyad plays remarkably different roles in their catalytic processes that usually involve metal coordination. An HD motif is positioned directly on the amyloid beta fragment (Aβ) and on the carboxy-terminal region of the extracellular domain (CAED) of the human amyloid precursor protein (APP) and a taxonomically well defined group of APP orthologues (APPOs). In human Aβ HD is part of a presumed, RGD-like integrin-binding motif RHD; however, neither RHD nor RXD demonstrates reasonable conservation in APPOs. The sequences of CAEDs and the position of the HD are not particularly conserved either, yet we show with a novel statistical method using evolutionary modeling that the presence of HD on CAEDs cannot be the result of neutral evolutionary forces (p<0.0001). The motif is positively selected along the evolutionary process in the majority of APPOs, despite the fact that HD motif is underrepresented in the proteomes of all species of the animal kingdom. Position migration can be explained by high probability occurrence of multiple copies of HD on intermediate sequences, from which only one is kept by selective evolutionary forces, in a similar way as in the case of the “transcription binding site turnover.” CAED of all APP orthologues and homologues are predicted to bind metal ions including Amyloid-like protein 1 (APLP1) and Amyloid-like protein 2 (APLP2). Our results suggest that HDs on the CAEDs are most probably key components of metal-binding domains, which facilitate and/or regulate inter- or intra-molecular interactions in a metal ion-dependent or metal ion concentration-dependent manner. The involvement of naturally occurring mutations of HD (Tottori (D7N) and English (H6R) mutations) in early onset Alzheimer's disease gives additional support to our finding that HD has an evolutionary preserved function on APPOs. PMID:22319430

Horizontal transmissible protection against myxomatosis and rabbit hemorrhagic disease by using a recombinant myxoma virus.

PubMed

Bárcena, J; Morales, M; Vázquez, B; Boga, J A; Parra, F; Lucientes, J; Pagès-Manté, A; Sánchez-Vizcaíno, J M; Blasco, R; Torres, J M

2000-02-01

We have developed a new strategy for immunization of wild rabbit populations against myxomatosis and rabbit hemorrhagic disease (RHD) that uses recombinant viruses based on a naturally attenuated field strain of myxoma virus (MV). The recombinant viruses expressed the RHDV major capsid protein (VP60) including a linear epitope tag from the transmissible gastroenteritis virus (TGEV) nucleoprotein. Following inoculation, the recombinant viruses induced specific antibody responses against MV, RHDV, and the TGEV tag. Immunization of wild rabbits by the subcutaneous and oral routes conferred protection against virulent RHDV and MV challenges. The recombinant viruses showed a limited horizontal transmission capacity, either by direct contact or in a flea-mediated process, promoting immunization of contact uninoculated animals.

Horizontal Transmissible Protection against Myxomatosis and Rabbit Hemorrhagic Disease by Using a Recombinant Myxoma Virus

PubMed Central

Bárcena, Juan; Morales, Mónica; Vázquez, Belén; Boga, José A.; Parra, Francisco; Lucientes, Javier; Pagès-Manté, Albert; Sánchez-Vizcaíno, José M.; Blasco, Rafael; Torres, Juan M.

2000-01-01

We have developed a new strategy for immunization of wild rabbit populations against myxomatosis and rabbit hemorrhagic disease (RHD) that uses recombinant viruses based on a naturally attenuated field strain of myxoma virus (MV). The recombinant viruses expressed the RHDV major capsid protein (VP60) including a linear epitope tag from the transmissible gastroenteritis virus (TGEV) nucleoprotein. Following inoculation, the recombinant viruses induced specific antibody responses against MV, RHDV, and the TGEV tag. Immunization of wild rabbits by the subcutaneous and oral routes conferred protection against virulent RHDV and MV challenges. The recombinant viruses showed a limited horizontal transmission capacity, either by direct contact or in a flea-mediated process, promoting immunization of contact uninoculated animals. PMID:10627521

Molecular Diagnostics in Transfusion Medicine: In Capillary, on a Chip, in Silico, or in Flight?

PubMed Central

Garritsen, Henk S.P.; Xiu-Cheng Fan, Alex; Lenz, Daniela; Hannig, Horst; Yan Zhong, Xiao; Geffers, Robert; Lindenmaier, Werner; Dittmar, Kurt E.J.; Wörmann, Bernhard

2009-01-01

Summary Serology, defined as antibody-based diagnostics, has been regarded as the diagnostic gold standard in transfusion medicine. Nowadays however the impact of molecular diagnostics in transfusion medicine is rapidly growing. Molecular diagnostics can improve tissue typing (HLA typing), increase safety of blood products (NAT testing of infectious diseases), and enable blood group typing in difficult situations (after transfusion of blood products or prenatal non-invasive RhD typing). Most of the molecular testing involves the determination of the presence of single nucleotide polymorphisms (SNPs). Antigens (e.g. blood group antigens) mostly result from single nucleotide differences in critical positions. However, most blood group systems cannot be determined by looking at a single SNP. To identify members of a blood group system a number of critical SNPs have to be taken into account. The platforms which are currently used to perform molecular diagnostics are mostly gel-based, requiring time-consuming multiple manual steps. To implement molecular methods in transfusion medicine in the future the development of higher-throughput SNP genotyping non-gel-based platforms which allow a rapid, cost-effective screening are essential. Because of its potential for automation, high throughput and cost effectiveness the special focus of this paper is a relative new technique: SNP genotyping by MALDI-TOF MS analysis. PMID:21113259

Contrast-enhanced MR Angiography of the Abdomen with Highly Accelerated Acquisition Techniques

PubMed Central

Mostardi, Petrice M.; Glockner, James F.; Young, Phillip M.

2011-01-01

Purpose: To demonstrate that highly accelerated (net acceleration factor [Rnet] ≥ 10) acquisition techniques can be used to generate three-dimensional (3D) subsecond timing images, as well as diagnostic-quality high-spatial-resolution contrast material–enhanced (CE) renal magnetic resonance (MR) angiograms with a single split dose of contrast material. Materials and Methods: All studies were approved by the institutional review board and were HIPAA compliant; written consent was obtained from all participants. Twenty-two studies were performed in 10 female volunteers (average age, 47 years; range, 27–62 years) and six patients with renovascular disease (three women; average age, 48 years; range, 37–68 years; three men; average age, 60 years; range, 50–67 years; composite average age, 54 years; range, 38–68 years). The two-part protocol consisted of a low-dose (2 mL contrast material) 3D timing image with approximate 1-second frame time, followed by a high-spatial-resolution (1.0–1.6-mm isotropic voxels) breath-hold 3D renal MR angiogram (18 mL) over the full abdominal field of view. Both acquisitions used two-dimensional (2D) sensitivity encoding acceleration factor (R) of eight and 2D homodyne (HD) acceleration (RHD) of 1.4–1.8 for Rnet = R · RHD of 10 or higher. Statistical analysis included determination of mean values and standard deviations of image quality scores performed by two experienced reviewers with use of eight evaluation criteria. Results: The 2-mL 3D time-resolved image successfully portrayed progressive arterial filling in all 22 studies and provided an anatomic overview of the vasculature. Successful timing was also demonstrated in that the renal MR angiogram showed adequate or excellent portrayal of the main renal arteries in 21 of 22 studies. Conclusion: Two-dimensional acceleration techniques with Rnet of 10 or higher can be used in CE MR angiography to acquire (a) a 3D image series with 1-second frame time, allowing accurate bolus timing, and (b) a high-spatial-resolution renal angiogram. © RSNA, 2011 Supplemental material: http://radiology.rsna.org/lookup/suppl/doi:10.1148/radiol.11110242/-/DC1 PMID:21900616

Cardiac surgery in Africa: a thirty-five year experience on open heart surgery in Cote d'Ivoire.

PubMed

Yangni-Angate, Koffi Herve; Meneas, Christophe; Diby, Florent; Diomande, Manga; Adoubi, Anicet; Tanauh, Yves

2016-10-01

Few centers for open heart surgery (OHS) are in Sub-Saharan Africa. Lack of OHS results is also noted. By reporting our African experience on OHS, the aim of this study was to fill the gap. It is a retrospective study on 2,612 patients who were subject to an OHS between 1978 and 2013. Data were collected from demographical, clinical, investigative studies, surgical and outcomes parameters. There were 1,475 cases of rheumatic heart diseases (RHD), 126 endomyocardial fibrosis (EMF), 741 congenital heart diseases (CHDs) and 270 various affections. Related to rheumatic valvular surgery we enumerated 1,175 monovalvular (mitral n=778, aortic n=336, tricuspid n=61); 280 bivalvular (mitral + aortic n=150, mitral + tricuspid n=130) and 20 trivalvular. For RHD, average age was 26±10.1 years (4-69 years) and 60% of our patients presented a functional class III or IV according to New York Heart Association (NYHA) classification. A total of 1,481 valvular replacements (bioprostheses n=489, mechanical prostheses n=992) and 445 valvular repair were carried out with a global and late mortality surgery respectively at 7% and 8%. One hundred and twenty-six [126] cases of EMF with right sided form 39, left sided form 40, and bilateral form 47 were colligated. Average age was 12±0.6 years (2-15 years). All patients with EMF underwent surgery; an endocardectomy in all patients combined with valvular reconstruction (n=36) or valvular replacement (n=90) was carried out with a hospital mortality at 16% (n=20). Concerning CHD, the most frequent were ventricular septal defect (VSD) (n=240), atrial septal defect (ASD) (n=200), partial atrio-ventricular sepal defect (n=30) and tetralogy of Fallot (T4F) (n=220), a total correction was performed for those CHD with an early mortality at 6.4% (n=44). OHS in Cote d'Ivoire was successfully performed in most of our patients, the spectrum of acquired valvular heart diseases and CHDs in our country is similar to others in Sub-Saharan Africa.

Cardiac surgery in Africa: a thirty-five year experience on open heart surgery in Cote d’Ivoire

PubMed Central

Meneas, Christophe; Diby, Florent; Diomande, Manga; Adoubi, Anicet; Tanauh, Yves

2016-01-01

Background Few centers for open heart surgery (OHS) are in Sub-Saharan Africa. Lack of OHS results is also noted. By reporting our African experience on OHS, the aim of this study was to fill the gap. Methods It is a retrospective study on 2,612 patients who were subject to an OHS between 1978 and 2013. Data were collected from demographical, clinical, investigative studies, surgical and outcomes parameters. Results There were 1,475 cases of rheumatic heart diseases (RHD), 126 endomyocardial fibrosis (EMF), 741 congenital heart diseases (CHDs) and 270 various affections. Related to rheumatic valvular surgery we enumerated 1,175 monovalvular (mitral n=778, aortic n=336, tricuspid n=61); 280 bivalvular (mitral + aortic n=150, mitral + tricuspid n=130) and 20 trivalvular. For RHD, average age was 26±10.1 years (4–69 years) and 60% of our patients presented a functional class III or IV according to New York Heart Association (NYHA) classification. A total of 1,481 valvular replacements (bioprostheses n=489, mechanical prostheses n=992) and 445 valvular repair were carried out with a global and late mortality surgery respectively at 7% and 8%. One hundred and twenty-six [126] cases of EMF with right sided form 39, left sided form 40, and bilateral form 47 were colligated. Average age was 12±0.6 years (2–15 years). All patients with EMF underwent surgery; an endocardectomy in all patients combined with valvular reconstruction (n=36) or valvular replacement (n=90) was carried out with a hospital mortality at 16% (n=20). Concerning CHD, the most frequent were ventricular septal defect (VSD) (n=240), atrial septal defect (ASD) (n=200), partial atrio-ventricular sepal defect (n=30) and tetralogy of Fallot (T4F) (n=220), a total correction was performed for those CHD with an early mortality at 6.4% (n=44). Conclusions OHS in Cote d’Ivoire was successfully performed in most of our patients, the spectrum of acquired valvular heart diseases and CHDs in our country is similar to others in Sub-Saharan Africa. PMID:27904843

Hemolytic disease of the fetus and newborn: managing the mother, fetus, and newborn.

PubMed

Delaney, Meghan; Matthews, Dana C

2015-01-01

Hemolytic disease of the fetus and newborn (HDFN) affects 3/100 000 to 80/100 000 patients per year. It is due to maternal blood group antibodies that cause fetal red cell destruction and in some cases, marrow suppression. This process leads to fetal anemia, and in severe cases can progress to edema, ascites, heart failure, and death. Infants affected with HDFN can have hyperbilirubinemia in the acute phase and hyporegenerative anemia for weeks to months after birth. The diagnosis and management of pregnant women with HDFN is based on laboratory and radiographic monitoring. Fetuses with marked anemia may require intervention with intrauterine transfusion. HDFN due to RhD can be prevented by RhIg administration. Prevention for other causal blood group specificities is less studied. © 2015 by The American Society of Hematology. All rights reserved.

Root Hairs

PubMed Central

Grierson, Claire; Nielsen, Erik; Ketelaarc, Tijs; Schiefelbein, John

2014-01-01

Roots hairs are cylindrical extensions of root epidermal cells that are important for acquisition of nutrients, microbe interactions, and plant anchorage. The molecular mechanisms involved in the specification, differentiation, and physiology of root hairs in Arabidopsis are reviewed here. Root hair specification in Arabidopsis is determined by position-dependent signaling and molecular feedback loops causing differential accumulation of a WD-bHLH-Myb transcriptional complex. The initiation of root hairs is dependent on the RHD6 bHLH gene family and auxin to define the site of outgrowth. Root hair elongation relies on polarized cell expansion at the growing tip, which involves multiple integrated processes including cell secretion, endomembrane trafficking, cytoskeletal organization, and cell wall modifications. The study of root hair biology in Arabidopsis has provided a model cell type for insights into many aspects of plant development and cell biology. PMID:24982600

Carcinine has 4-hydroxynonenal scavenging property and neuroprotective effect in mouse retina.

PubMed

Marchette, Lea D; Wang, Huaiwen; Li, Feng; Babizhayev, Mark A; Kasus-Jacobi, Anne

2012-06-20

Oxidative stress induces retinal damage and contributes to vision loss in progressive retinopathies. Carcinine (β-alanyl-histamine) is a natural imidazole-containing peptide derivative with antioxidant activity. It is predicted to scavenge 4-hydroxynonenal (4-HNE), a toxic product of lipid oxidation. The aim of this study was to confirm the 4-HNE scavenging effect and evaluate the neuroprotective effect of carcinine in mouse retina subjected to oxidative stress. HPLC coupled with mass spectrometry was used to analyze carcinine and 4-HNE-carcinine adduct. Protection of retinal proteins from modification by 4-HNE was tested by incubating carcinine with retinal protein extract and 4-HNE. Modified retinal proteins were quantified by dot-blot analysis. Mice were treated with carcinine (intravitreal injection and gavage) and exposed to bright light to induce oxidative damage in the retina. Photoreceptor degeneration was measured by histology and electroretinography. Retinal levels of retinol dehydrogenase 12 (RDH12) were measured by immunoblot analysis, after exposure to bright light and in retinal explants after exposure to 4-HNE. The ability of carcinine to form an adduct with 4-HNE, as well as to prevent and even reverse the adduction of retinal proteins by the toxic aldehyde was demonstrated in vitro. Carcinine, administered by intravitreal injection or gavage, strongly protected mouse retina against light-induced photoreceptor degeneration and had a protective effect on RHD12, a protein found specifically in photoreceptor cells. This study suggests that carcinine can be administered noninvasively to efficiently protect photoreceptor cells from oxidative damage. Carcinine could be administered daily to prevent vision loss in progressive retinopathies.

Is the New Variant RHDV Replacing Genogroup 1 in Portuguese Wild Rabbit Populations?

PubMed Central

Lopes, Ana M.; Correia, Jorge; Abrantes, Joana; Melo, Pedro; Ramada, Margarida; Magalhães, Maria J.; Alves, Paulo C.; Esteves, Pedro J.

2014-01-01

The Lagovirus rabbit hemorrhagic disease virus (RHDV), a member of the family Caliciviridae, severely affects European rabbit (Oryctolagus cuniculus) populations by causing rabbit hemorrhagic disease (RHD). RHDV is subdivided in six genogroups but, more recently, a new RHDV variant with a unique genetic and antigenic profile emerged. We performed a study in rabbits found dead in the field during 2013 and 2014 in Portugal to determine the prevalence of this new variant versus the classical RHDV. Fifty-seven liver samples were screened for the presence of RHDV and positive samples were genotyped. All cases of RHDV infection were caused by the new variant. The only former genogroup circulating in Portugal, G1, was not detected. We hence conclude that the new RHDV variant is replacing G1 in Portugal, probably due to a selective advantage. This sudden and rapid replacement emphasizes the necessity of continued monitoring of wild rabbit populations. PMID:25559218

Paper-based device for rapid typing of secondary human blood groups.

PubMed

Li, Miaosi; Then, Whui Lyn; Li, Lizi; Shen, Wei

2014-01-01

We report the use of bioactive paper for typing of secondary human blood groups. Our recent work on using bioactive paper for human blood typing has led to the discovery of a new method for identifying haemagglutination of red blood cells. The primary human blood groups, i.e., ABO and RhD groups, have been successfully typed with this method. Clinically, however, many secondary blood groups can also cause fatal blood transfusion accidents, despite the fact that the haemagglutination reactions of secondary blood groups are generally weaker than those of the primary blood groups. We describe the design of a user-friendly sensor for rapid typing of secondary blood groups using bioactive paper. We also present mechanistic insights into interactions between secondary blood group antibodies and red blood cells obtained using confocal microscopy. Haemagglutination patterns under different conditions are revealed for optimization of the assay conditions.

What will it take? Pathways, time and funding: Australian medical students' perspective on clinician-scientist training.

PubMed

Eley, Diann S; Jensen, Charmaine; Thomas, Ranjeny; Benham, Helen

2017-12-08

Clinician-scientists are in decline worldwide. They represent a unique niche in medicine by bridging the gap between scientific discovery and patient care. A national, integrated approach to training clinician-scientists, typically programs that comprise a comprehensive MD-PhD pathway, are customary. Such a pathway is lacking in Australia. The objective was to gather perceptions from Australian medical students on factors they perceive would influence their decision to pursue clinician-scientist training. A cross-sectional mixed methods design used quantitative and qualitative questions in an online self-report survey with medical students from a four-year MD program. Quantitative measures comprised scaled response questions regarding prior experience and current involvement in research, and short- and long-term opinions about factors that influence their decisions to undertake a research higher degree (RHD) during medical school. Qualitative questions gathered broader perceptions of what a career pathway as a clinician-scientist would include and what factors are most conducive to a medical student's commitment to MD-PhD training. Respondents (N = 418; 51% female) indicated Time, Funding and Pathway as the major themes arising from the qualitative data, highlighting negative perceptions rather than possible benefits to RHD training. The lack of an evident Pathway was inter-related to Time and Funding. Themes were supported by the quantitative data. Sixty percent of students have previous research experience of varying forms, and 90% report a current interest, mainly to improve their career prospects. The data emphasise the need for an MD-PhD pathway in Australia. A model that provides an early, integrated, and exclusive approach to research training pathways across all stages of medical education is suggested as the best way to rejuvenate the clinician-scientist. A national pathway that addresses factors influencing career decision making throughout the medical education continuum should include an appropriate funding structure, and provide early and continuing advice and mentoring. It should be flexible, gender equitable, and include post-graduate training. The implications of implementing MD-PhD programs represent a substantial investment. However this should not be a deterrent to Australia's commitment to an MD-PhD pathway, but rather a challenge to help ensure our future healthcare is guided by highly trained and competent clinician-scientists.

Conductivity Modifications of Graphene by Electron Donative Organic Molecules

NASA Astrophysics Data System (ADS)

Masujima, Hiroaki; Mori, Takehiko; Hayamizu, Yuhei

2017-07-01

Graphene has been studied for the application of transparent electrodes in flexible electrical devices with semiconductor organics. Control of the charge carrier density in graphene is crucial to reduce the contact resistance between graphene and the active layer of organic semiconductor. Chemical doping of graphene is an approach to change the carrier density, where the adsorbed organic molecules donate or accept electrons form graphene. While various acceptor organic molecules have been demonstrated so far, investigation about donor molecules is still poor. In this work, we have investigated doping effect in graphene field-effect transistors functionalized by organic donor molecules such as dibenzotetrathiafulvalene (DBTTF), hexamethyltetrathiafulvalene (HMTTF), 1,5-diaminonaphthalene (DAN), and N, N, N', N'-tetramethyl- p-phenylenediamine (TMPD). Based on conductivity measurements of graphene transistors, the former three molecules do not have any significant effect to graphene transistors. However, TMPD shows effective n-type doping. The doping effect has a correlation with the level of highest occupied molecular orbital (HOMO) of each molecule, where TMPD has the highest HOMO level.

Different effects of water molecules on CO oxidation with different reaction mechanisms.

PubMed

Liu, Shan Ping; Zhao, Ming; Sun, Guo En; Gao, Wang; Jiang, Qing

2018-03-28

The effects of water molecules (promotion/prohibition) on CO oxidation remain debated. Herein, using density functional theory calculations, we demonstrate that water molecules can facilitate the CO + O/O 2 oxidation process, but prohibit the CO + OH oxidation process, which is consistent with the experimental finding that water molecules have two distinct effects on CO oxidation. For the CO + O/O 2 oxidation mechanisms, we find that the reactants were pushed towards each other due to the steric effect of the water molecules, which decreases the reaction barriers and promotes the CO + O/O 2 oxidation process. For the CO + OH oxidation mechanisms, water molecules increase the stability of the COOH* intermeditae by H-bonds and van der Waals forces, which increase the barriers of the COOH* transformation process and the COOH*-tra dissociation process, and prohibit the CO + OH oxidation process. These results clarify the different effects of water molecules on CO oxidation and shed light on catalyst usage in the CO oxidation industry.

The Indian consensus guidance on stroke prevention in atrial fibrillation: An emphasis on practical use of nonvitamin K oral anticoagulants.

PubMed

Dalal, Jamshed; Bhave, Abhay; Oomman, Abraham; Vora, Amit; Saxena, Anil; Kahali, Dhiman; Poncha, Fali; Gambhir, D S; Chaudhuri, Jaydip Ray; Sinha, Nakul; Ray, Saumitra; Iyengar, S S; Banerjee, Suvro; Kaul, Upendra

2015-12-01

The last ten years have seen rapid strides in the evolution of nonvitamin K oral anticoagulants (NOACs) for stroke prevention in patients with atrial fibrillation (AF). For the preparation of this consensus, a comprehensive literature search was performed and data on available trials, subpopulation analyses, and case reports were analyzed. This Indian consensus document intends to provide guidance on selecting the right NOAC for the right patients by formulating expert opinions based on the available trials and Asian/Indian subpopulation analyses of these trials. A section has been dedicated to the current evidence of NOACs in the Asian population. Practical suggestions have been formulated in the following clinical situations: (i) Dose recommendations of the NOACs in different clinical scenarios; (ii) NOACs in patients with rheumatic heart disease (RHD); (iii) Monitoring anticoagulant effect of the NOACs; (iv) Overdose of NOACs; (v) Antidotes to NOACs; (vi) Treatment of hypertrophic cardiomyopathy (HCM) with AF using NOACs; (vii) NOACs dose in elderly, (viii) Switching between NOACs and vitamin K antagonists (VKA); (ix) Cardioversion or ablation in NOAC-treated patients; (x) Planned/emergency surgical interventions in patients currently on NOACs; (xi) Management of bleeding complications of NOACs; (xii) Management of acute coronary syndrome (ACS) in AF with NOACs; (xiii) Management of acute ischemic stroke while on NOACs. Copyright © 2015. Published by Elsevier B.V.

Negative ions of polyatomic molecules.

PubMed Central

Christophorou, L G

1980-01-01

In this paper general concepts relating to, and recent advances in, the study of negative ions of polyatomic molecules area discussed with emphasis on halocarbons. The topics dealt with in the paper are as follows: basic electron attachment processes, modes of electron capture by molecules, short-lived transient negative ions, dissociative electron attachment to ground-state molecules and to "hot" molecules (effects of temperature on electron attachment), parent negative ions, effect of density, nature, and state of the medium on electron attachment, electron attachment to electronically excited molecules, the binding of attached electrons to molecules ("electron affinity"), and the basic and the applied significance of negative-ion studies. PMID:7428744

Searching for plant root traits to improve soil cohesion and resist soil erosion

NASA Astrophysics Data System (ADS)

De Baets, Sarah; Smyth, Kevin; Denbigh, Tom; Weldon, Laura; Higgins, Ben; Matyjaszkiewicz, Antoni; Meersmans, Jeroen; Chenchiah, Isaac; Liverpool, Tannie; Quine, Tim; Grierson, Claire

2017-04-01

Soil erosion poses a serious threat to future food and environmental security. Soil erosion protection measures are therefore of great importance for soil conservation and food security. Plant roots have proven to be very effective in stabilizing the soil and protecting the soil against erosion. However, no clear insights are yet obtained into the root traits that are responsible for root-soil cohesion. This is important in order to better select the best species for soil protection. Research using Arabidopsis mutants has made great progress towards explaining how root systems are generated by growth, branching, and responses to gravity, producing mutants that affect root traits. In this study, the performance of selected Arabidopsis mutants is analyzed in three root-soil cohesion assays. Measurements of detachment, uprooting force and soil detachment are here combined with the microscopic analysis of root properties, such as the presence, length and density of root hairs in this case. We found that Arabidopsis seedlings with root hairs (wild type, wer myb23, rsl4) were more difficult to detach from gel media than hairless (cpc try) or short haired (rsl4, rhd2) roots. Hairy roots (wild type, wer myb23) on mature, non-reproductive rosettes were more difficult to uproot from compost or clay soil than hairless roots (cpc try). At high root densities, erosion rates from soils with hairless roots (cpc try) were as much as 10 times those seen from soils occupied by roots with hairs (wer myb23, wild type). We find therefore root hairs play a significant role in root-soil cohesion and in minimizing erosion. This framework and associated suite of experimental assays demonstrates its ability to measure the effect of any root phenotype on the effectiveness of plant roots in binding substrates and reducing erosion.

Understanding the Halogenation Effects in Diketopyrrolopyrrole-Based Small Molecule Photovoltaics.

PubMed

Sun, Shi-Xin; Huo, Yong; Li, Miao-Miao; Hu, Xiaowen; Zhang, Hai-Jun; Zhang, You-Wen; Zhang, You-Dan; Chen, Xiao-Long; Shi, Zi-Fa; Gong, Xiong; Chen, Yongsheng; Zhang, Hao-Li

2015-09-16

Two molecules containing a central diketopyrrolopyrrole and two oligothiophene units have been designed and synthesized. Comparisons between the molecules containing terminal F (FDPP) and Cl (CDPP) atoms allowed us to evaluate the effects of halogenation on the photovoltaic properties of the small molecule organic solar cells (OSCs). The OSCs devices employing FDPP:PC71BM films showed power conversion efficiencies up to 4.32%, suggesting that fluorination is an efficient method for constructing small molecules for OSCs.

Tracking fetal development through molecular analysis of maternal biofluids☆

PubMed Central

Edlow, Andrea G.; Bianchi, Diana W.

2015-01-01

Current monitoring of fetal development includes fetal ultrasonography, chorionic villus sampling or amniocentesis for chromosome analysis, and maternal serum biochemical screening for analytes associated with aneuploidy and open neural tube defects. Over the last 15 years, significant advances in noninvasive prenatal diagnosis (NIPD) via cell-free fetal (cff) nucleic acids in maternal plasma have resulted in the ability to determine fetal sex, RhD genotype, and aneuploidy. Cff nucleic acids in the maternal circulation originate primarily from the placenta. This contrasts with cff nucleic acids in amniotic fluid, which derive from the fetus, and are present in significantly higher concentrations than in maternal blood. The fetal origin of cff nucleic acids in the amniotic fluid permits the acquisition of real-time information about fetal development and gene expression. This review seeks to provide a comprehensive summary of the molecular analysis of cff nucleic acids in maternal biofluids to elucidate mechanisms of fetal development, physiology, and pathology. This article is part of a Special Issue entitled: Molecular Genetics of Human Reproductive Failure. PMID:22542507

Non-invasive prenatal testing using cell-free fetal DNA in maternal circulation.

PubMed

Liao, Gary J W; Gronowski, Ann M; Zhao, Zhen

2014-01-20

The identification of cell-free fetal DNA (cffDNA) in maternal circulation has made non-invasive prenatal testing (NIPT) possible. Maternal plasma cell free DNA is a mixture of maternal and fetal DNA, of which, fetal DNA represents a minor population in maternal plasma. Therefore, methods with high sensitivity and precision are required to detect and differentiate fetal DNA from the large background of maternal DNA. In recent years, technical advances in the molecular analysis of fetal DNA (e.g., digital PCR and massively parallel sequencing (MPS)) has enabled the successful implementation of noninvasive testing into clinical practice, such as fetal sex assessment, RhD genotyping, and fetal chromosomal aneuploidy detection.With the ability to decipher the entire fetal genome from maternal plasma DNA, we foresee that an increased number of non-invasive prenatal tests will be available for detecting many single-gene disorders in the near future. This review briefly summarizes the technical aspects of the NIPT and application of NIPT in clinical practice.

Single Molecule Raman Spectroscopy Under High Pressure

NASA Astrophysics Data System (ADS)

Fu, Yuanxi; Dlott, Dana

2014-06-01

Pressure effects on surface-enhanced Raman scattering spectra of Rhdoamine 6G adsorbed on silver nanoparticle surfaces was studied using a confocal Raman microscope. Colloidal silver nanoparticles were treated with Rhodamine 6G (R6G) and its isotopically substituted partner, R6G-d4. Mixed isotopomers let us identify single-molecule spectra, since multiple-molecule spectra would show vibrational transitions from both species. The nanoparticles were embedded into a poly vinyl alcohol film, and loaded into a diamond anvil cell for the high-pressure Raman scattering measurement. Argon was the pressure medium. Ambient pressure Raman scattering spectra showed few single-molecule spectra. At moderately high pressure ( 1GPa), a surprising effect was observed. The number of sites with observable spectra decreased dramatically, and most of the spectra that could be observed were due to single molecules. The effects of high pressure suppressed the multiple-molecule Raman sites, leaving only the single-molecule sites to be observed.

Reduction of diffusional defocusing in hydrodynamically focused flows

DOEpatents

Affleck, Rhett L.; Demas, James N.; Goodwin, Peter M.; Keller, Richard; Wu, Ming

1998-01-01

An analyte fluid stream with first molecules having relatively low molecular weight and a corresponding high coefficient of diffusion has reduced diffusional defocusing out of an analyte fluid stream. The analyte fluid stream of first molecules is associated with second molecules of relatively high molecular weight having a relatively low coefficient of diffusion and a binding constant effective to associate with the first molecules. A focused analyte fluid stream is maintained since the combined molecular weight of the associated first and second molecules is effective to minimize diffusion of the first molecules out of the analyte fluid stream.

Reduction of diffusional defocusing in hydrodynamically focused flows

DOEpatents

Affleck, R.L.; Demas, J.N.; Goodwin, P.M.; Keller, R.; Wu, M.

1998-09-01

An analyte fluid stream with first molecules having relatively low molecular weight and a corresponding high coefficient of diffusion has reduced diffusional defocusing out of an analyte fluid stream. The analyte fluid stream of first molecules is associated with second molecules of relatively high molecular weight having a relatively low coefficient of diffusion and a binding constant effective to associate with the first molecules. A focused analyte fluid stream is maintained since the combined molecular weight of the associated first and second molecules is effective to minimize diffusion of the first molecules out of the analyte fluid stream. 6 figs.

Prominent dominant negative effect of a mutant Fas molecule lacking death domain on cell-mediated induction of apoptosis.

PubMed

Yokota, Aya; Takeuchi, Emiko; Iizuka, Misao; Ikegami, Yuko; Takayama, Hajime; Shinohara, Nobukata

2005-01-01

Using a panel of transfectant B lymphoma cells expressing varying amounts of the mutant Fas together with the endogenous wild type Fas, semi-quantitative studies on the dominant negative effect of a murine mutant Fas molecule lacking death domain were carried out. In anti-Fas antibody-mediated induction of apoptosis, the mutant molecules exerted significant dominant-negative effect only when their expression level was comparable to or higher than that of wild type molecules, or when exposed to low amounts of the antibody. The inhibitory effect was accompanied by the failure in DISC formation in spite of Fas aggregation. When they were subjected to T cell-mediated Fas-based induction of apoptosis, however, the dominant negative effect was prominent such that the expression of even a small amount of the mutant molecules resulted in significant inhibition. Such a strong inhibitory effect explains the dominant phenotype of this type of mutant Fas molecules in ALPS heterozygous patients and also implies that the physiological effectors for Fas in vivo are cells, i.e., FasL-expressing activated T cells.

Heavy element effects in the diagonal Born–Oppenheimer correction within a relativistic spin-free Hamiltonian

DOE PAGES

Imafuku, Yuji; Abe, Minori; Schmidt, Michael W.; ...

2016-03-22

Methodologies beyond the Born–Oppenheimer (BO) approximation are nowadays important to explain high precision spectroscopic measurements. Most previous evaluations of the BO correction are, however, focused on light-element molecules and based on a nonrelativistic Hamiltonian, so no information about the BO approximation (BOA) breakdown in heavy-element molecules is available. The present work is the first to investigate the BOA breakdown for the entire periodic table, by considering scalar relativistic effects in the Diagonal BO correction (DBOC). In closed shell atoms, the relativistic EDBOC scales as Z 1.25 and the nonrelativistic EDBOC scales as Z 1.17, where Z is the atomic number.more » Hence, we found that EDBOC becomes larger in heavy element atoms and molecules, and the relativistic EDBOC increases faster than nonrelativistic EDBOC. We have further investigated the DBOC effects on properties such as potential energy curves, spectroscopic parameters, and various energetic properties. The DBOC effects for these properties are mostly affected by the lightest atom in the molecule. Furthermore, in X 2 or XAt molecule (X = H, Li, Na, K, Rb, and Cs) the effect of DBOC systematically decreases when X becomes heavier but in HX molecules, the effect of DBOC seems relatively similar among all the molecules.« less

Effective diffusion coefficient including the Marangoni effect

NASA Astrophysics Data System (ADS)

Kitahata, Hiroyuki; Yoshinaga, Natsuhiko

2018-04-01

Surface-active molecules supplied from a particle fixed at the water surface create a spatial gradient of the molecule concentration, resulting in Marangoni convection. Convective flow transports the molecules far from the particle, enhancing diffusion. We analytically derive the effective diffusion coefficient associated with the Marangoni convection rolls. The resulting estimated effective diffusion coefficient is consistent with our numerical results and the apparent diffusion coefficient measured in experiments.

Efficient conservative ADER schemes based on WENO reconstruction and space-time predictor in primitive variables

NASA Astrophysics Data System (ADS)

Zanotti, Olindo; Dumbser, Michael

2016-01-01

We present a new version of conservative ADER-WENO finite volume schemes, in which both the high order spatial reconstruction as well as the time evolution of the reconstruction polynomials in the local space-time predictor stage are performed in primitive variables, rather than in conserved ones. To obtain a conservative method, the underlying finite volume scheme is still written in terms of the cell averages of the conserved quantities. Therefore, our new approach performs the spatial WENO reconstruction twice: the first WENO reconstruction is carried out on the known cell averages of the conservative variables. The WENO polynomials are then used at the cell centers to compute point values of the conserved variables, which are subsequently converted into point values of the primitive variables. This is the only place where the conversion from conservative to primitive variables is needed in the new scheme. Then, a second WENO reconstruction is performed on the point values of the primitive variables to obtain piecewise high order reconstruction polynomials of the primitive variables. The reconstruction polynomials are subsequently evolved in time with a novel space-time finite element predictor that is directly applied to the governing PDE written in primitive form. The resulting space-time polynomials of the primitive variables can then be directly used as input for the numerical fluxes at the cell boundaries in the underlying conservative finite volume scheme. Hence, the number of necessary conversions from the conserved to the primitive variables is reduced to just one single conversion at each cell center. We have verified the validity of the new approach over a wide range of hyperbolic systems, including the classical Euler equations of gas dynamics, the special relativistic hydrodynamics (RHD) and ideal magnetohydrodynamics (RMHD) equations, as well as the Baer-Nunziato model for compressible two-phase flows. In all cases we have noticed that the new ADER schemes provide less oscillatory solutions when compared to ADER finite volume schemes based on the reconstruction in conserved variables, especially for the RMHD and the Baer-Nunziato equations. For the RHD and RMHD equations, the overall accuracy is improved and the CPU time is reduced by about 25 %. Because of its increased accuracy and due to the reduced computational cost, we recommend to use this version of ADER as the standard one in the relativistic framework. At the end of the paper, the new approach has also been extended to ADER-DG schemes on space-time adaptive grids (AMR).

Persistence length of collagen molecules based on nonlocal viscoelastic model.

PubMed

Ghavanloo, Esmaeal

2017-12-01

Persistence length is one of the most interesting properties of a molecular chain, which is used to describe the stiffness of a molecule. The experimentally measured values of the persistence length of the collagen molecule are widely scattered from 14 to 180 nm. Therefore, an alternative approach is highly desirable to predict the persistence length of a molecule and also to explain the experimental results. In this paper, a nonlocal viscoelastic model is developed to obtain the persistence length of the collagen molecules in solvent. A new explicit formula is proposed for the persistence length of the molecule with the consideration of the small-scale effect, viscoelastic properties of the molecule, loading frequency, and viscosity of the solvent. The presented model indicates that there exists a range of molecule lengths in which the persistence length strongly depends on the frequency and spatial mode of applied loads, small-scale effect, and viscoelastic properties of the collagen.

Review of Antibiotic and Non-Antibiotic Properties of Beta-lactam Molecules.

PubMed

Ochoa-Aguilar, Abraham; Ventura-Martinez, Rosa; Sotomayor-Sobrino, Marco Antonio; Gómez, Claudia; Morales-Espinoza, María del Rosario

2016-01-01

Beta-lactam molecules are a family of drugs commonly used for their antibiotic properties; however, recent research has shown that several members of this group present a large number of other effects such as neuroprotective, antioxidant, analgesic or immunomodulatory capabilities. These properties have been used in both preclinical and clinical studies in different diseases such as hypoxic neuronal damage or acute and chronic pain. The present work briefly reviews the antibiotic effect of these molecules, and will then focus specially on the non-antibiotic effects of three beta-lactam subfamilies: penicillins, cephalosporins and beta lactamase inhibitors, each of which have different molecular structure and pharmacokinetics and therefore have several potential clinical applications. A thorough search of bibliographic databases for peer-reviewed research was performed including only classic experiments or high quality reviews for the antibiotic mechanisms of beta-lactam molecules and only experimental research papers where included when the non-antibiotic properties of these molecules were searched. Only published articles from indexed journals were included. Quality of retrieved papers was assessed using standard tools. The characteristics of screened papers were described and findings of included studies were contextualized to either a mechanistic or a clinical framework. Seventy-eight papers were included in the review; the majority (56) were relative to the non-antibiotic properties of beta-lactam molecules. The non-antibiotic effects reviewed were divided accordingly to the amount of information available for each one. Twelve papers outlined the epileptogenic effects induced by beta-lactam molecules administration; these included both clinical and basic research as well as probable mechanistic explanations. Eighteen papers described a potential neuroprotective effect, mostly in basic in vitro and in vivo experiments. Analgesic properties where identified in twelve papers and basic research was described alongside with both experimental and serendipic clinical findings. Seven papers described a down-regulation effect exerted by beta-lactam molecules administration in different addiction animal models. Finally other effects such as penile erection, dopamine release facilitation and anti-neoplasic effects where described from seven papers. The findings of this review show that beta-lactam molecules may induce several effects, which may be clinically relevant in a lot of different diseases. This paper is, to our knowledge, the first comprehensive review of the non-antibiotic effects shown by beta-lactam molecules and may help increase the interest in this field, which may result in a direct translation of this effects to a clinical context.

Ultracold Molecules in Optical Lattices: Efficient Production and Application to Molecular Clocks

DTIC Science & Technology

2015-05-03

near the intercombination- line threshold were measured for a variety of states, and explained by considering nonadiabatic effects ( Coriolis coupling) in...Moszynski, T. Zelevinsky. Nonadiabatic Effects in Ultracold Molecules via Anomalous Linear and Quadratic Zeeman Shifts, Physical Review Letters, (12...M. McDonald, G. Reinaudi, W. Skomorowski, R. Moszynski, T. Zelevinsky. Measurement of Nonadiabatic Effects in Ultracold Molecules via Anomalous

Molecular induced skyhook effect for magnetic interlayer softening

NASA Astrophysics Data System (ADS)

Friedrich, Rico; Caciuc, Vasile; Atodiresei, Nicolae; Blügel, Stefan

2015-11-01

Our first-principles study demonstrates for the first time that by increasing the molecule-surface binding strength, the interlayer magnetic coupling of a ferromagnetic metal can be drastically reduced with respect to that of a clean substrate. Importantly, for a weakly chemisorbed molecule the rehybridization of metal atomic d states within the molecule-induced surface geometry (geometrical effect) plays a crucial role in obtaining interlayer magnetic softening. On the contrary, for a strongly chemisorbed molecule the interlayer magnetic coupling is further reduced due to an interplay between the geometrical effect and the hybridization of atomic d states with molecular ones.

Controlling single-molecule junction conductance by molecular interactions

NASA Astrophysics Data System (ADS)

Kitaguchi, Y.; Habuka, S.; Okuyama, H.; Hatta, S.; Aruga, T.; Frederiksen, T.; Paulsson, M.; Ueba, H.

2015-07-01

For the rational design of single-molecular electronic devices, it is essential to understand environmental effects on the electronic properties of a working molecule. Here we investigate the impact of molecular interactions on the single-molecule conductance by accurately positioning individual molecules on the electrode. To achieve reproducible and precise conductivity measurements, we utilize relatively weak π-bonding between a phenoxy molecule and a STM-tip to form and cleave one contact to the molecule. The anchoring to the other electrode is kept stable using a chalcogen atom with strong bonding to a Cu(110) substrate. These non-destructive measurements permit us to investigate the variation in single-molecule conductance under different but controlled environmental conditions. Combined with density functional theory calculations, we clarify the role of the electrostatic field in the environmental effect that influences the molecular level alignment.

Correlated electron-nuclear dynamics in above-threshold multiphoton ionization of asymmetric molecule.

PubMed

Wang, Zhuo; Li, Min; Zhou, Yueming; Lan, Pengfei; Lu, Peixiang

2017-02-20

The partition of the photon energy into the subsystems of molecules determines many photon-induced chemical and physical dynamics in laser-molecule interactions. The electron-nuclear energy sharing from multiphoton ionization of molecules has been used to uncover the correlated dynamics of the electron and fragments. However, most previous studies focus on symmetric molecules. Here we study the electron-nuclear energy sharing in strong-field photoionization of HeH 2+ by solving the one-dimensional time-dependent Schrödinger equation (TDSE). Compared with symmetric molecules, the joint electron-nuclear energy spectrum (JES) of HeH 2+ reveals an anomalous energy shift at certain nuclear energies, while it disappears at higher and lower nuclear energies. Through tracing the time evolution of the wavepacket of bound states, we identify that this energy shift originates from the joint effect of the Stark shift, associated with the permanent dipole, and the Autler-Townes effect due to the coupling of the 2pσ and 2sσ states in strong fields. The energy shift in the JES appears at certain nuclear distances only when both Stark effect and Autler-Townes effect play important roles. We further demonstrate that the electron-nuclei energy sharing can be controlled by varying laser intensity for asymmetric molecules, providing alternative approaches to manipulate photochemical reactions for more complex molecules.

Computational Study of Nonadiabatic Effects in Atom-Molecule Reactive Scattering.

DTIC Science & Technology

1982-11-15

a similar interpretation to those in Fig. 4-a, with the rotational effects most evident in the reactant tube (due to the mixing of the two open rotor ...AD-A125 135 COMPUTATIONAL STUDY OF NONRDIABATIC EFFECTS IN 1/2 ATOM-MOLECULE REACTIVE SCATTERING(U) CHEMICAL DYNAMICS CORP COLUMBUS OH B C GARRETT...COMPUTATIONAL STUDY OF NONADIABATIC EFFECTS [ Z IN ATOM-MOLECULE REACTIVE SCATTERING C:) TO AIR FORCE OFFICE OF SCIENTIFIC RESEARCHk CONTRACT NO. F49620-81

Counterion accumulation effects on a suspension of DNA molecules: Equation of state and pressure-driven denaturation

NASA Astrophysics Data System (ADS)

Nicasio-Collazo, Luz Adriana; Delgado-González, Alexandra; Hernández-Lemus, Enrique; Castañeda-Priego, Ramón

2017-04-01

The study of the effects associated with the electrostatic properties of DNA is of fundamental importance to understand both its molecular properties at the single molecule level, like the rigidity of the chain, and its interaction with other charged bio-molecules, including other DNA molecules; such interactions are crucial to maintain the thermodynamic stability of the intra-cellular medium. In the present work, we combine the Poisson-Boltzmann mean-field theory with an irreversible thermodynamic approximation to analyze the effects of counterion accumulation inside DNA on both the denaturation profile of the chain and the equation of state of the suspension. To this end, we model the DNA molecule as a porous charged cylinder immersed in an aqueous solution. These thermo-electrostatic effects are explicitly studied in the particular case of some genes for which damage in their sequence is associated with diffuse large B-cell lymphoma.

Effects of myxoma virus and rabbit hemorrhagic disease virus on the physiological condition of wild European rabbits: Is blood biochemistry a useful monitoring tool?

PubMed

Pacios-Palma, Isabel; Santoro, Simone; Bertó-Moran, Alejandro; Moreno, Sacramento; Rouco, Carlos

2016-12-01

Myxomatosis and rabbit hemorrhagic disease (RHD) are the major viral diseases that affect the wild European rabbit (Oryctolagus cuniculus). These diseases arrived in Europe within the last decades and have caused wild rabbit populations to decline dramatically. Both viruses are currently considered to be endemic in the Iberian Peninsula; periodic outbreaks that strongly impact wild populations regularly occur. Myxoma virus (MV) and rabbit hemorrhagic disease virus (RHDV) alter the physiology of infected rabbits, resulting in physical deterioration. Consequently, the persistence and viability of natural populations are affected. The main goal of our study was to determine if blood biochemistry is correlated with serostatus in wild European rabbits. We carried out seven live-trapping sessions in three wild rabbit populations over a two-year period. Blood samples were collected to measure anti-MV and anti-RHDV antibody concentrations and to measure biochemical parameters related to organ function, protein metabolism, and nutritional status. Overall, we found no significant relationships between rabbit serostatus and biochemistry. Our main result was that rabbits that were seropositive for both MV and RHDV had low gamma glutamyltransferase concentrations. Given the robustness of our analyses, the lack of significant relationships may indicate that the biochemical parameters measured are poor proxies for serostatus. Another explanation is that wild rabbits might be producing attenuated physiological responses to these viruses because the latter are now enzootic in the study area. Copyright © 2016 Elsevier Ltd. All rights reserved.

Effect of secondary penicillin prophylaxis on valvular changes in patients with rheumatic heart disease in Far North Queensland.

PubMed

Haran, Shankar; Crane, Natalie; Kazi, Saniya; Axford-Haines, Louise; White, Andrew

2018-04-01

To determine the effect of secondary penicillin prophylaxis on echocardiographic diagnosed valvular changes in patients with rheumatic heart disease or history of acute rheumatic fever in the Townsville Health district. Patients with known were identified from the North Queensland register, serial echocardiogram results and number of secondary penicillin prophylaxis doses received in 2014 were collated. Descriptive statistics were utilised. Townsville Hospital and outreach clinics within the Townsville Health catchment zone. All patients diagnosed with acute rheumatic fever or rheumatic heart disease between 2010 and October 2013 who had serial echocardiograms prior to and post commencement of secondary penicillin prophylaxis were included. All patients were of Aboriginal or Torres Strait Islander descent. Progression of echocardiographic valvular changes and association with secondary penicillin prophylaxis compliance. Compliance with secondary penicillin prophylaxis among the study population was a secondary outcome measure. Twenty-three patients were recruited. Only those patients who were compliant with secondary penicillin prophylaxis had any improvement in valvular changes on echocardiogram. Four of six patients without any baseline valvular involvement developed new valvular changes. Seventy percent of patients received >75% of secondary penicillin prophylaxis doses. This small study of patients in Townsville suggests that with good secondary penicillin prophylaxis compliance there is regression of some cardiac lesions over time in people with rheumatic heart disease. Furthermore the natural history of acute rheumatic fever in the Indigenous population is progressive requiring strict adherence to secondary penicillin prophylaxis. Prospective studies or use of data from the nationwide RHD register and standardised reporting of cardiac echocardiograms will provide more robust evidence. © 2017 National Rural Health Alliance Inc.

Reshaping and linking of molecules in ion-pair traps

NASA Astrophysics Data System (ADS)

Cochrane, Bryce; Naumkin, Fedor Y.

2016-01-01

A series of insertion complexes of small molecules trapped between alkali-halide counter-ions are investigated ab initio. The molecular shape is altered inside the complexes and varies in corresponding anions. Stabilities and charge distributions are investigated. Strong charge-transfer in the alkali-halide component effectively through the almost neutral molecule results in very large dipole moments. The most stable species is used to construct a dimer significantly bound via dipole-dipole interaction. Another complex with two alkali-halide diatoms trapping the molecule represents a unit of corresponding longer oligomer. This completes the array of systems with the molecule effectively in ion-pair, ion-dipole, dipole-pair electric fields.

Influence of thermocleavable functionality on organic field-effect transistor performance of small molecules

NASA Astrophysics Data System (ADS)

Mahale, Rajashree Y.; Dharmapurikar, Satej S.; Chini, Mrinmoy Kumar; Venugopalan, Vijay

2017-06-01

Diketopyrrolopyrrole based donor-acceptor-donor conjugated small molecules using ethylene dioxythiophene as a donor was synthesized. Electron deficient diketopyrrolopyrrole unit was substituted with thermocleavable (tert-butyl acetate) side chains. The thermal treatment of the molecules at 160 °C eliminated the tert-butyl ester group results in the formation of corresponding acid. Optical and theoretical studies revealed that the molecules adopted a change in molecular arrangement after thermolysis. The conjugated small molecules possessed p-channel charge transport characteristics in organic field effect transistors. The charge carrier mobility was increased after thermolysis of tert-butyl ester group to 5.07 × 10-5 cm2/V s.

Atomistic investigation on the detachment of oil molecules from defective alumina surface

NASA Astrophysics Data System (ADS)

Xie, W. K.; Sun, Y. Z.; Liu, H. T.

2017-12-01

The mechanism of oil detachment from defective alumina surface in aqueous solution was investigated via atomistic molecular dynamics (MD) simulations. Special attention was focused on the effect of surface defect on the oil detachment. Our simulation results suggest that compared with perfect Al2O3 surface, defective substrate surface provides much more sites for the adsorption of oil molecules, thus it has higher oil adsorption energy. However, higher oil-solid adsorption energy does not mean that oil contaminants are much more difficult to be detached. It is found that surface defect could induce the spontaneous imbibition of water molecules, effectively promoting the detachment of oil molecules. Thus, compared with perfect alumina surface, the detachment of oil molecules from defective alumina surface tends to be much easier. Moreover, surface defect could lead to the oil residues inside surface defect. In water solution, the entire detachment process of oil molecules on defective surface consists of following stages, including the early detachment of oil molecules inside surface defect induced by capillary-driven spontaneous imbibition of water molecules, the following conformational change of oil molecules on topmost surface and the final migration of detached oil molecules from solid surface. These findings may help to sufficiently enrich the removal mechanism of oil molecules adhered onto defective solid surface.

Adsorbed molecules in external fields: Effect of confining potential

NASA Astrophysics Data System (ADS)

Tyagi, Ashish; Silotia, Poonam; Maan, Anjali; Prasad, Vinod

2016-12-01

We study the rotational excitation of a molecule adsorbed on a surface. As is well known the interaction potential between the surface and the molecule can be modeled in number of ways, depending on the molecular structure and the geometry under which the molecule is being adsorbed by the surface. We explore the effect of change of confining potential on the excitation, which is largely controlled by the static electric fields and continuous wave laser fields. We focus on dipolar molecules and hence we restrict ourselves to the first order interaction in field-molecule interaction potential either through permanent dipole moment or/and the molecular polarizability parameter. It is shown that confining potential shapes, strength of the confinement, strongly affect the excitation. We compare our results for different confining potentials.

In vitro investigation of the effect of matrix molecules on the behavior of colon cancer cells under the effect of geldanamycin derivative.

PubMed

Vural, Kamil; Kosova, Funda; Kurt, Feyzan Özdal; Tuğlu, İbrahim

2017-10-01

The chaperone-binding drug, 17-allylamino-17-demethoxygeldanamycin, has recently come into clinical use. It is a derivative of geldanamycin, an ansamycin benzoquinone antibiotic with anti-carcinogenic effect. Understanding the effect of this drug on the cancer cells and their niche is important for treatment. We applied 17-allylamino-17-demethoxygeldanamycin to colon cancer cell line (Colo 205) on matrix molecules to investigate the relationship of apoptosis with terminal deoxynucleotidyl transferase dUTP nick end labeling immunocytochemistry and related gene expression. We used laminin and collagen I for matrix molecules and vascular endothelial growth factor for angiogenic structure. We also examined apoptosis-related signaling pathway including mitochondrial proteins, cytochrome c, Bcl-2, caspase-9, Apaf-1 expression using real-time polymerase chain reaction. There was clear effect of 17-allylamino-17-demethoxygeldanamycin that killed more cells on tissue culture plastic compared to matrix molecules. The IC 50 value was 0.58 µg/mL for tissue culture plastic compared with 0.64 µg/mL for laminin and 0.75 µg/mL for collagen I. The analyses showed that more cells on matrix molecules underwent apoptosis compared to that on tissue culture plastic. Apoptosis-related gene expression was similar in which Bcl-2 expression decreased and proapoptotic gene expression of the cells on matrix molecules increased compared to that on tissue culture plastic. However, the application of 17-allylamino-17-demethoxygeldanamycin was more effective for the cells on collagen I compared to the cells on laminin. There was also a decrease in angiogenesis as shown by the vascular endothelial growth factor staining. This was more pronounced by coating of the tissue culture plastic with matrix molecules. Our results supported the anti-cancer effect of 17-allylamino-17-demethoxygeldanamycin, and this effect depended on matrix molecules. This effect occurs through apoptosis, and related genes were also altered. All these genes may serve for novel target under the effect of matrix substrate. However, correct interpretation of the results requires further studies.

The Therapeutic Effect of the Antitumor Drug 11beta and Related Molecules on Polycystic Kidney Disease

DTIC Science & Technology

2016-10-01

AWARD NUMBER: W81XWH-15-1-0364 TITLE: The Therapeutic Effect of the Antitumor Drug 11beta and Related Molecules on Polycystic Kidney Disease...SUBTITLE The Therapeutic Effect of the Antitumor Drug 11beta and Related Molecules on Polycystic Kidney Disease 5a. CONTRACT NUMBER 5b. GRANT NUMBER...synthetic multifunctional compounds as therapeutics for polycystic kidney disease (PKD). In collaboration with the Essigmann lab at MIT, we have

Blinking effect and the use of quantum dots in single molecule spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rombach-Riegraf, Verena; Oswald, Peter; Bienert, Roland

2013-01-04

Highlights: Black-Right-Pointing-Pointer It is possible to eliminate the blinking effect of a water-soluble QD. Black-Right-Pointing-Pointer We provide a direct method to study protein function and dynamics at the single level. Black-Right-Pointing-Pointer QD, potent tool for single molecule studies of biochemical and biological processes. -- Abstract: Luminescent semiconductor nanocrystals (quantum dots, QD) have unique photo-physical properties: high photostability, brightness and narrow size-tunable fluorescence spectra. Due to their unique properties, QD-based single molecule studies have become increasingly more popular during the last years. However QDs show a strong blinking effect (random and intermittent light emission), which may limit their use in singlemore » molecule fluorescence studies. QD blinking has been widely studied and some hypotheses have been done to explain this effect. Here we summarise what is known about the blinking effect in QDs, how this phenomenon may affect single molecule studies and, on the other hand, how the 'on'/'off' states can be exploited in diverse experimental settings. In addition, we present results showing that site-directed binding of QD to cysteine residues of proteins reduces the blinking effect. This option opens a new possibility of using QDs to study protein-protein interactions and dynamics by single molecule fluorescence without modifying the chemical composition of the solution or the QD surface.« less

Myxomatosis in wild rabbit: design of control programs in Mediterranean ecosystems.

PubMed

García-Bocanegra, Ignacio; Astorga, Rafael Jesús; Napp, Sebastián; Casal, Jordi; Huerta, Belén; Borge, Carmen; Arenas, Antonio

2010-01-01

A cross-sectional study was carried out in natural wild rabbit (Oryctolagus cuniculus) populations from southern Spain to identify risk factors associated to myxoma virus infection. Blood samples from 619 wild rabbits were collected, and questionnaires which included variables related to host, disease, game management and environment were completed. A logistic regression analysis was conducted to investigate the associations between myxomatosis seropositivity (dependent variable) across 7 hunting estates and an extensive set of explanatory variables obtained from the questionnaires. The prevalence of antibodies against myxomatosis virus was 56.4% (95% CI: 52.5-60.3) and ranged between 21.4% (95% CI: 9.0-33.8) and 70.2% (95% CI: 58.3-82.1) among the different sampling areas. The logistic regression analysis showed that autumn (OR 9.0), high abundance of mosquitoes (OR 8.2), reproductive activity (OR 4.1), warren's insecticide treatment (OR 3.7), rabbit haemorrhagic disease (RHD) seropositivity (OR 2.6), high hunting pressure (OR 6.3) and sheep presence (OR 6.4) were associated with seropositivity to myxomatosis. Based on the results, diverse management measures for myxomatosis control are proposed.

Adsorbed molecules in external fields: Effect of confining potential.

PubMed

Tyagi, Ashish; Silotia, Poonam; Maan, Anjali; Prasad, Vinod

2016-12-05

We study the rotational excitation of a molecule adsorbed on a surface. As is well known the interaction potential between the surface and the molecule can be modeled in number of ways, depending on the molecular structure and the geometry under which the molecule is being adsorbed by the surface. We explore the effect of change of confining potential on the excitation, which is largely controlled by the static electric fields and continuous wave laser fields. We focus on dipolar molecules and hence we restrict ourselves to the first order interaction in field-molecule interaction potential either through permanent dipole moment or/and the molecular polarizability parameter. It is shown that confining potential shapes, strength of the confinement, strongly affect the excitation. We compare our results for different confining potentials. Copyright © 2016 Elsevier B.V. All rights reserved.

Non-Markovian full counting statistics in quantum dot molecules

PubMed Central

Xue, Hai-Bin; Jiao, Hu-Jun; Liang, Jiu-Qing; Liu, Wu-Ming

2015-01-01

Full counting statistics of electron transport is a powerful diagnostic tool for probing the nature of quantum transport beyond what is obtainable from the average current or conductance measurement alone. In particular, the non-Markovian dynamics of quantum dot molecule plays an important role in the nonequilibrium electron tunneling processes. It is thus necessary to understand the non-Markovian full counting statistics in a quantum dot molecule. Here we study the non-Markovian full counting statistics in two typical quantum dot molecules, namely, serially coupled and side-coupled double quantum dots with high quantum coherence in a certain parameter regime. We demonstrate that the non-Markovian effect manifests itself through the quantum coherence of the quantum dot molecule system, and has a significant impact on the full counting statistics in the high quantum-coherent quantum dot molecule system, which depends on the coupling of the quantum dot molecule system with the source and drain electrodes. The results indicated that the influence of the non-Markovian effect on the full counting statistics of electron transport, which should be considered in a high quantum-coherent quantum dot molecule system, can provide a better understanding of electron transport through quantum dot molecules. PMID:25752245

Tuning charge and correlation effects for a single molecule on a graphene device

DOE PAGES

Wickenburg, Sebastian; Lu, Jiong; Lischner, Johannes; ...

2016-11-25

The ability to understand and control the electronic properties of individual molecules in a device environment is crucial for developing future technologies at the nanometre scale and below. Achieving this, however, requires the creation of three-terminal devices that allow single molecules to be both gated and imaged at the atomic scale. We have accomplished this by integrating a graphene field effect transistor with a scanning tunnelling microscope, thus allowing gate-controlled charging and spectroscopic interrogation of individual tetrafluoro-tetracyanoquinodimethane molecules. We observe a non-rigid shift in the molecule’s lowest unoccupied molecular orbital energy (relative to the Dirac point) as a function ofmore » gate voltage due to graphene polarization effects. Our results show that electron–electron interactions play an important role in how molecular energy levels align to the graphene Dirac point, and may significantly influence charge transport through individual molecules incorporated in graphene-based nanodevices.« less

Entanglement of polar symmetric top molecules as candidate qubits.

PubMed

Wei, Qi; Kais, Sabre; Friedrich, Bretislav; Herschbach, Dudley

2011-10-21

Proposals for quantum computing using rotational states of polar molecules as qubits have previously considered only diatomic molecules. For these the Stark effect is second-order, so a sizable external electric field is required to produce the requisite dipole moments in the laboratory frame. Here we consider use of polar symmetric top molecules. These offer advantages resulting from a first-order Stark effect, which renders the effective dipole moments nearly independent of the field strength. That permits use of much lower external field strengths for addressing sites. Moreover, for a particular choice of qubits, the electric dipole interactions become isomorphous with NMR systems for which many techniques enhancing logic gate operations have been developed. Also inviting is the wider chemical scope, since many symmetric top organic molecules provide options for auxiliary storage qubits in spin and hyperfine structure or in internal rotation states. © 2011 American Institute of Physics

Systems Based Study of the Therapeutic Potential of Small Charged Molecules for the Inhibition of IL-1 Mediated Cartilage Degradation

PubMed Central

Kar, Saptarshi; Smith, David W.; Gardiner, Bruce S.; Grodzinsky, Alan J.

2016-01-01

Inflammatory cytokines are key drivers of cartilage degradation in post-traumatic osteoarthritis. Cartilage degradation mediated by these inflammatory cytokines has been extensively investigated using in vitro experimental systems. Based on one such study, we have developed a computational model to quantitatively assess the impact of charged small molecules intended to inhibit IL-1 mediated cartilage degradation. We primarily focus on the simplest possible computational model of small molecular interaction with the IL-1 system—direct binding of the small molecule to the active site on the IL-1 molecule itself. We first use the model to explore the uptake and release kinetics of the small molecule inhibitor by cartilage tissue. Our results show that negatively charged small molecules are excluded from the negatively charged cartilage tissue and have uptake kinetics in the order of hours. In contrast, the positively charged small molecules are drawn into the cartilage with uptake and release timescales ranging from hours to days. Using our calibrated computational model, we subsequently explore the effect of small molecule charge and binding constant on the rate of cartilage degradation. The results from this analysis indicate that the small molecules are most effective in inhibiting cartilage degradation if they are either positively charged and/or bind strongly to IL-1α, or both. Furthermore, our results showed that the cartilage structural homeostasis can be restored by the small molecule if administered within six days following initial tissue exposure to IL-1α. We finally extended the scope of the computational model by simulating the competitive inhibition of cartilage degradation by the small molecule. Results from this model show that small molecules are more efficient in inhibiting cartilage degradation by binding directly to IL-1α rather than binding to IL-1α receptors. The results from this study can be used as a template for the design and development of more pharmacologically effective osteoarthritis drugs, and to investigate possible therapeutic options. PMID:27977731

Superradiance Effects in the Linear and Nonlinear Optical Response of Quantum Dot Molecules

NASA Astrophysics Data System (ADS)

Sitek, A.; Machnikowski, P.

2008-11-01

We calculate the linear optical response from a single quantum dot molecule and the nonlinear, four-wave-mixing response from an inhomogeneously broadened ensemble of such molecules. We show that both optical signals are affected by the coupling-dependent superradiance effect and by optical interference between the two polarizations. As a result, the linear and nonlinear responses are not identical.

Torsional mechanics of DNA are regulated by small-molecule intercalation.

PubMed

Celedon, Alfredo; Wirtz, Denis; Sun, Sean

2010-12-23

Whether the bend and twist mechanics of DNA molecules are coupled is unclear. Here, we report the direct measurement of the resistive torque of single DNA molecules to study the effect of ethidium bromide (EtBr) intercalation and pulling force on DNA twist mechanics. DNA molecules were overwound and unwound using recently developed magnetic tweezers where the molecular resistive torque was obtained from Brownian angular fluctuations. The effect of EtBr intercalation on the twist stiffness was found to be significantly different from the effect on the bend persistence length. The twist stiffness of DNA was dramatically reduced at low intercalator concentration (<10 nM); however, it did not decrease further when the intercalator concentration was increased by 3 orders of magnitude. We also determined the dependence of EtBr intercalation on the torque applied to DNA. We propose a model for the elasticity of DNA base pairs with intercalated EtBr molecules to explain the abrupt decrease of twist stiffness at low EtBr concentration. These results indicate that the bend and twist stiffnesses of DNA are independent and can be differently affected by small-molecule binding.

Adsorption of methanol molecule on graphene: Experimental results and first-principles calculations

NASA Astrophysics Data System (ADS)

Zhao, X. W.; Tian, Y. L.; Yue, W. W.; Chen, M. N.; Hu, G. C.; Ren, J. F.; Yuan, X. B.

2018-04-01

Adsorption properties of methanol molecule on graphene surface are studied both theoretically and experimentally. The adsorption geometrical structures, adsorption energies, band structures, density of states and the effective masses are obtained by means of first-principles calculations. It is found that the electronic characteristics and conductivity of graphene are sensitive to the methanol molecule adsorption. After adsorption of methanol molecule, bandgap appears. With the increasing of the adsorption distance, the bandgap, adsorption energy and effective mass of the adsorption system decreased, hence the resistivity of the system decreases gradually, these results are consistent with the experimental results. All these calculations and experiments indicate that the graphene-based sensors have a wide range of applications in detecting particular molecules.

Effect of Solvent and Substrate on the Surface Binding Mode of Carboxylate-Functionalized Aromatic Molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Domenico, Janna; Foster, Michael E.; Spoerke, Erik D.

Here, the efficiency of dye-sensitized solar cells (DSSCs) is strongly influenced by dye molecule orientation and interactions with the substrate. Understanding the factors controlling the surface orientation of sensitizing organic molecules will aid in the improvement of both traditional DSSCs and other devices that integrate molecular linkers at interfaces. Here, we describe a general approach to understand relative dye–substrate orientation and provide analytical expressions predicting orientation. We consider the effects of substrate, solvent, and protonation state on dye molecule orientation. In the absence of solvent, our model predicts that most carboxylic acid-functionalized molecules prefer to lie flat (parallel) on themore » surface, due to van der Waals interactions, as opposed to a tilted orientation with respect to the surface that is favored by covalent bonding of the carboxylic acid group to the substrate. When solvation effects are considered, however, the molecules are predicted to orient perpendicular to the surface. We extend this approach to help understand and guide the orientation of metal–organic framework (MOF) thin-film growth on various metal–oxide substrates. A two-part analytical model is developed on the basis of the results of DFT calculations and ab initio MD simulations that predicts the binding energy of a molecule by chemical and dispersion forces on rutile and anatase TiO 2 surfaces, and quantifies the dye solvation energy for two solvents. The model is in good agreement with the DFT calculations and enables rapid prediction of dye molecule and MOF linker binding preference on the basis of the size of the adsorbing molecule, identity of the surface, and the solvent environment. We establish the threshold molecular size, governing dye molecule orientation, for each condition.« less

Statistical effects related to low numbers of reacting molecules analyzed for a reversible association reaction A + B = C in ideally dispersed systems: An apparent violation of the law of mass action

DOE Office of Scientific and Technical Information (OSTI.GOV)

Szymanski, R., E-mail: rszymans@cbmm.lodz.pl; Sosnowski, S.; Maślanka, Ł.

2016-03-28

Theoretical analysis and computer simulations (Monte Carlo and numerical integration of differential equations) show that the statistical effect of a small number of reacting molecules depends on a way the molecules are distributed among the small volume nano-reactors (droplets in this study). A simple reversible association A + B = C was chosen as a model reaction, enabling to observe both thermodynamic (apparent equilibrium constant) and kinetic effects of a small number of reactant molecules. When substrates are distributed uniformly among droplets, all containing the same equal number of substrate molecules, the apparent equilibrium constant of the association is highermore » than the chemical one (observed in a macroscopic—large volume system). The average rate of the association, being initially independent of the numbers of molecules, becomes (at higher conversions) higher than that in a macroscopic system: the lower the number of substrate molecules in a droplet, the higher is the rate. This results in the correspondingly higher apparent equilibrium constant. A quite opposite behavior is observed when reactant molecules are distributed randomly among droplets: the apparent association rate and equilibrium constants are lower than those observed in large volume systems, being the lower, the lower is the average number of reacting molecules in a droplet. The random distribution of reactant molecules corresponds to ideal (equal sizes of droplets) dispersing of a reaction mixture. Our simulations have shown that when the equilibrated large volume system is dispersed, the resulting droplet system is already at equilibrium and no changes of proportions of droplets differing in reactant compositions can be observed upon prolongation of the reaction time.« less

Effect of Solvent and Substrate on the Surface Binding Mode of Carboxylate-Functionalized Aromatic Molecules

DOE PAGES

Domenico, Janna; Foster, Michael E.; Spoerke, Erik D.; ...

2018-04-25

Here, the efficiency of dye-sensitized solar cells (DSSCs) is strongly influenced by dye molecule orientation and interactions with the substrate. Understanding the factors controlling the surface orientation of sensitizing organic molecules will aid in the improvement of both traditional DSSCs and other devices that integrate molecular linkers at interfaces. Here, we describe a general approach to understand relative dye–substrate orientation and provide analytical expressions predicting orientation. We consider the effects of substrate, solvent, and protonation state on dye molecule orientation. In the absence of solvent, our model predicts that most carboxylic acid-functionalized molecules prefer to lie flat (parallel) on themore » surface, due to van der Waals interactions, as opposed to a tilted orientation with respect to the surface that is favored by covalent bonding of the carboxylic acid group to the substrate. When solvation effects are considered, however, the molecules are predicted to orient perpendicular to the surface. We extend this approach to help understand and guide the orientation of metal–organic framework (MOF) thin-film growth on various metal–oxide substrates. A two-part analytical model is developed on the basis of the results of DFT calculations and ab initio MD simulations that predicts the binding energy of a molecule by chemical and dispersion forces on rutile and anatase TiO 2 surfaces, and quantifies the dye solvation energy for two solvents. The model is in good agreement with the DFT calculations and enables rapid prediction of dye molecule and MOF linker binding preference on the basis of the size of the adsorbing molecule, identity of the surface, and the solvent environment. We establish the threshold molecular size, governing dye molecule orientation, for each condition.« less

Theoretical DFT study on spectroscopic signature and molecular dynamics of neurotransmitter and effect of hydrogen removal

NASA Astrophysics Data System (ADS)

Mukherjee, V.; Singh, N. P.; Yadav, R. A.

2013-04-01

Vibrational spectroscopic study has been made for the serotonin molecule and its deprotonated form. The Infrared and Raman spectra in optimum geometry of these two molecules are calculated using density functional theorem and the normal modes are assigned using potential energy distributions (PEDs) which are calculated using normal coordinate analysis method. The vibrational frequencies of these two molecules are reported and a comparison has been made. The effect of removal of the hydrogen atom from the serotonin molecule upon its geometry and vibrational frequencies are studied. Electronic structures of these two molecules are also studied using natural bond orbital (NBO) analysis. Theoretical Raman spectrum of serotonin at different exciting laser frequencies and at different temperatures are obtained and the results are discussed. Present study reveals that some wrong assignments had been made for serotonin molecule in earlier study.

Roles of vacuum tunnelling and contact mechanics in single-molecule thermopower

NASA Astrophysics Data System (ADS)

Tsutsui, Makusu; Yokota, Kazumichi; Morikawa, Takanori; Taniguchi, Masateru

2017-03-01

Molecular junction is a chemically-defined nanostructure whose discrete electronic states are expected to render enhanced thermoelectric figure of merit suitable for energy-harvesting applications. Here, we report on geometrical dependence of thermoelectricity in metal-molecule-metal structures. We performed simultaneous measurements of the electrical conductance and thermovoltage of aromatic molecules having different anchoring groups at room temperature in vacuum. We elucidated the mutual contributions of vacuum tunnelling on thermoelectricity in the short molecular bridges. We also found stretching-induced thermoelectric voltage enhancement in thiol-linked single-molecule bridges along with absence of the pulling effects in diamine counterparts, thereby suggested that the electromechanical effect would be a rather universal phenomenon in Au-S anchored molecular junctions that undergo substantial metal-molecule contact elongation upon stretching. The present results provide a novel concept for molecular design to achieve high thermopower with single-molecule junctions.

Hydrogen molecule defect in proton-conductive SrTiO3 Perovskite

NASA Astrophysics Data System (ADS)

Onishi, Taku

2017-11-01

In proton-conductive SrTiO3 perovskite, no hydrogen molecule defect ideally exists. However, the unforeseen chemical reaction is often observed after the use of fuel cell. From the viewpoint of battery safety, we have investigated the effect of hydrogen molecule defect by molecular orbital analysis. When counter cation vacancy exists, the activation energy for hydrogen molecule migration was 1.39 - 1.50 eV, which is much smaller than the dissociation energy of hydrogen molecule. It implies that hydrogen molecule may migrate without its dissociation.

Single-molecule conductance studies of photo-active and photochromic molecules

NASA Astrophysics Data System (ADS)

Tam, E. S.; Parks, J. J.; Santiago-Berrios, M. B.; Zhong, Y.-W.; Abruna, H. D.; Ralph, D. C.

2010-03-01

We perform statistical measurements of single molecule conductance in repeatedly-formed metal-molecule-metal junctions at room temperature. Our results on diaminoalkanes are consistent with those reported by the Venkataraman group. We focus on photo-active and photochromic molecules, including a series of transition-metal complexes with different metal centers and endgroups. We compare the trend in conductance across the family of complexes with that expected from electrochemical measurements. We will also report initial results on the voltage dependence of single-molecule conductances and the effects of optical excitations.

Effects of electrostatic screening on the conformation of single DNA molecules confined in a nanochannel

NASA Astrophysics Data System (ADS)

Zhang, Ce; Zhang, Fang; van Kan, Jeroen A.; van der Maarel, Johan R. C.

2008-06-01

Single T4-DNA molecules were confined in rectangular-shaped channels with a depth of 300 nm and a width in the range of 150-300 nm casted in a poly(dimethylsiloxane) nanofluidic chip. The extensions of the DNA molecules were measured with fluorescence microscopy as a function of the ionic strength and composition of the buffer as well as the DNA intercalation level by the YOYO-1 dye. The data were interpreted with the scaling theory for a wormlike polymer in good solvent, including the effects of confinement, charge, and self-avoidance. It was found that the elongation of the DNA molecules with decreasing ionic strength can be interpreted in terms of an increase of the persistence length. Self-avoidance effects on the extension are moderate, due to the small correlation length imposed by the channel cross-sectional diameter. Intercalation of the dye results in an increase of the DNA contour length and a partial neutralization of the DNA charge, but besides effects of electrostatic origin it has no significant effect on the bare bending rigidity. In the presence of divalent cations, the DNA molecules were observed to contract, but they do not collapse into a condensed structure. It is proposed that this contraction results from a divalent counterion mediated attractive force between the segments of the DNA molecule.

Gating capacitive field-effect sensors by the charge of nanoparticle/molecule hybrids.

PubMed

Poghossian, Arshak; Bäcker, Matthias; Mayer, Dirk; Schöning, Michael J

2015-01-21

The semiconductor field-effect platform is a powerful tool for chemical and biological sensing with direct electrical readout. In this work, the field-effect capacitive electrolyte-insulator-semiconductor (EIS) structure - the simplest field-effect (bio-)chemical sensor - modified with citrate-capped gold nanoparticles (AuNPs) has been applied for a label-free electrostatic detection of charged molecules by their intrinsic molecular charge. The EIS sensor detects the charge changes in AuNP/molecule inorganic/organic hybrids induced by the molecular adsorption or binding events. The feasibility of the proposed detection scheme has been exemplarily demonstrated by realizing capacitive EIS sensors consisting of an Al-p-Si-SiO2-silane-AuNP structure for the label-free detection of positively charged cytochrome c and poly-d-lysine molecules as well as for monitoring the layer-by-layer formation of polyelectrolyte multilayers of poly(allylamine hydrochloride)/poly(sodium 4-styrene sulfonate), representing typical model examples of detecting small proteins and macromolecules and the consecutive adsorption of positively/negatively charged polyelectrolytes, respectively. For comparison, EIS sensors without AuNPs have been investigated, too. The adsorption of molecules on the surface of AuNPs has been verified via the X-ray photoelectron spectroscopy method. In addition, a theoretical model of the functioning of the capacitive field-effect EIS sensor functionalized with AuNP/charged-molecule hybrids has been discussed.

Salting Constants of Small Organic Molecules in Aerosol-Relevant Salts and Application to Aerosol Formation in the Southeastern United States

NASA Astrophysics Data System (ADS)

Waxman, E.; Carlton, A. M. G.; Ziemann, P. J.; Volkamer, R. M.

2014-12-01

Secondary organic aerosol (SOA) formation from small water-soluble molecules such as glyoxal and methyl glyoxal is a topic of emerging interest. Results from recent field campaigns, e.g. Waxman et al. (2013, GRL) and Knote et al. (2014, ACP), show that these molecules can form significant SOA mass as a result of 'salting-in'. Salting-in happens when a molecule's solubility increases with salt concentration and salting-out is the reverse. Salting effects modify the solubility exponentially with increasing salt concentration, and thus the effective Henry's law constant can strongly modify partitioning, and multiphase chemical reaction rates in aerosol water. Moreover, the solubility in aerosol water cannot easily inferred based on the solubility in cloud water, as the salting effects could change the solubility by a factor of 104 or more. In this work, we have devised and applied a novel experimental setup to measure salting constants using an ion trap mass spectrometer. We focus on small, water soluble molecules like methyl glyoxal and similar compounds and measure salting constants for aerosol-relevant salts including ammonium sulfate, ammonium nitrate, and sodium chloride. The Setschenow salting-constant values are then used to parameterize the effects of salting in CMAQ. We present a series of sensitivity studies of the effects that inorganic aerosols have on the SOA formation from small soluble molecules in the southeastern United States.

Calixarene-Mediated Liquid-Membrane Transport of Choline Conjugates.

PubMed

Adhikari, Birendra Babu; Fujii, Ayu; Schramm, Michael P

2014-05-01

A series of supramolecular calixarenes efficiently transport distinct molecular species through a liquid membrane when attached to a receptor-complementary choline handle. Calix-[6]arene hexacarboxylic acid was highly effective at transporting different target molecules against a pH gradient. Both carboxylic- and phosphonic-acid-functionalized calix[4]arenes effect transport without requiring a pH or ion gradient. NMR binding studies, two-phase solvent extraction, and three-phase transport experiments reveal the necessary and subtle parameters to effect the transport of molecules attached to a choline "handle". On the other hand, rescorin[4]arene cavitands, which have similar guest recognition profiles, did not transport guest molecules. These developments reveal new approaches towards attempting synthetic-receptor-mediated selective small-molecule transport in vesicular and cellular systems.

Mercury monohalides: suitability for electron electric dipole moment searches.

PubMed

Prasannaa, V S; Vutha, A C; Abe, M; Das, B P

2015-05-08

Heavy polar diatomic molecules are the primary tools for searching for the T-violating permanent electric dipole moment of the electron (eEDM). Valence electrons in some molecules experience extremely large effective electric fields due to relativistic interactions. These large effective electric fields are crucial to the success of polar-molecule-based eEDM search experiments. Here we report on the results of relativistic ab initio calculations of the effective electric fields in a series of molecules that are highly sensitive to an eEDM, the mercury monohalides (HgF, HgCl, HgBr, and HgI). We study the influence of the halide anions on E_{eff}, and identify HgBr and HgI as attractive candidates for future electric dipole moment search experiments.

A critical overview on the biological and molecular features of red and processed meat in colorectal carcinogenesis.

PubMed

Jeyakumar, Arunan; Dissabandara, Lakal; Gopalan, Vinod

2017-04-01

A recent investigation by the World Health Organisation (WHO) has found that the consumption of processed meat and potentially red meat promotes carcinogenesis and can increase the risk of colorectal cancer. This literature review aims to summarise both the red and processed meat molecules associated with colorectal carcinogenesis and investigate their relationship with the pathogenic process of colorectal cancer. Literature relating to the carcinogenic effect of red and processed meat molecules was critically reviewed. There are multiple molecules present in red and processed meat with a potential carcinogenic effect on colorectal tissues. Processed meat is more carcinogenic compared to red meat because of the abundance of potent nitrosyl-heme molecules that form N-nitroso compounds. Studies have also noted that other molecules such as polycyclic aromatic hydrocarbons and heterocyclic amines have potential mechanisms for the initiation of colorectal cancer pathogenesis. The non-human sugar molecule N-glycolylneuraminic acid may account for the carcinogenic effects of pork despite its heme content being comparable to that of chicken. Red meat products, especially those that have been processed, have a wide variety of carcinogenic molecules known to increase the risk of colorectal cancer. Thus, the outcome of this review is consistent with the recent findings of WHO.

Design, synthesis, and characterization of 2,2-bis(2,4-dinitrophenyl)-2-(phosphonatomethylamino)acetate as a herbicidal and biological active agent.

PubMed

Kumar, Vijay; Singh, Simranjeet; Singh, Rohit; Upadhyay, Niraj; Singh, Joginder

2017-10-01

The present study was designed to synthesize the bioactive molecule 2,2-bis(2,4-dinitrophenyl)-2-(phosphonatomethylamino)acetate ( 1 ), having excellent applications in the field of plant protection as a herbicide. Structure of newly synthesized molecule 1 was confirmed by using the elemental analysis, mass spectrometric, NMR, UV-visible, and FTIR spectroscopic techniques. To obtain better structural insights of molecule 1 , 3D molecular modeling was performed using the GAMESS programme. Microbial activities of 1 were checked against the pathogenic strains Aspergillus fumigatus (NCIM 902) and Salmonella typhimurium (NCIM 2501). Molecule 1 has shown excellent activities against fungal strain A. fumigates (35 μg/l) and bacterial strain S. typhimurium (25 μg/l). To check the medicinal significance of molecule 1 , interactions with bovine serum albumin (BSA) protein were checked. The calculated value of binding constant of molecule 1 -BSA complex was 1.4 × 10 6  M -1 , which were similar to most effective drugs like salicylic acid. More significantly, as compared to herbicide glyphosate, molecule 1 has exhibited excellent herbicidal activities, in pre- and post-experiments on three weeds; barnyard grass ( Echinochloa Crus ), red spranglitop ( Leptochloa filiformis ), and yellow nuts ( Cyperus Esculenfus ). Further, effects of molecule 1 on plant growth-promoting rhizobacterial (PGPR) strains were checked. More interestingly, as compared to glyphosate, molecule 1 has shown least adverse effects on soil PGPR strains including the Rhizobium leguminosarum (NCIM 2749), Pseudomonas fluorescens (NCIM 5096), and Pseudomonas putida (NCIM 2847).

In situ superexchange electron transfer through a single molecule: a rectifying effect.

PubMed

Kornyshev, Alexei A; Kuznetsov, Alexander M; Ulstrup, Jens

2006-05-02

An increasingly comprehensive body of literature is being devoted to single-molecule bridge-mediated electronic nanojunctions, prompted by their prospective applications in molecular electronics and single-molecule analysis. These junctions may operate in gas phase or electrolyte solution (in situ). For biomolecules, the latter is much closer to their native environment. Convenient target molecules are aromatic molecules, peptides, oligonucleotides, transition metal complexes, and, broadly, molecules with repetitive units, for which the conducting orbitals are energetically well below electronic levels of the solvent. A key feature for these junctions is rectification in the current-voltage relation. A common view is that asymmetric molecules or asymmetric links to the electrodes are needed to acquire rectification. However, as we show here, this requirement could be different in situ, where a structurally symmetric system can provide rectification because of the Debye screening of the electric field in the nanogap if the screening length is smaller than the bridge length. The Galvani potentials of each electrode can be varied independently and lead to a transistor effect. We explore this behavior for the superexchange mechanism of electron transport, appropriate for a wide class of molecules. We also include the effect of conformational fluctuations on the lowest unoccupied molecular orbital (LUMO) energy levels; that gives rise to non-Arrhenius temperature dependence of the conductance, affected by the molecule length. Our study offers an analytical formula for the current-voltage characteristics that demonstrates all these features. A detailed physical interpretation of the results is given with a discussion of reported experimental data.

Influence of irrigation during the growth stage on yield and quality in mango (Mangifera indica L)

PubMed Central

Wei, Junya; Liu, Guoyin; Liu, Debing; Chen, Yeyuan

2017-01-01

Although being one of the few drought-tolerant plants, mango trees are irrigated to ensure optimum and consistent productivity in China. In order to better understand the effects of soil water content on mango yield and fruit quality at fruit growth stage, irrigation experiments were investigated and the object was to determine the soil water content criteria at which growth and quality of mango would be optimal based on soil water measured by RHD-JS water-saving irrigation system through micro-sprinkling irrigation. Five soil water content treatments (relative to the percentage of field water capacity) for irrigation (T1:79%-82%, T2:75%-78%, T3:71%-74%, T4: 65%-70%, T5:63%-66%) were compared in 2013. Amount of applied irrigation water for different treatments varied from 2.93m3 to 1.08 m3. The results showed that mango fruit production and quality at fruit growth stage were significantly affected under different irrigation water amounts. Variation in soil water content not only had effects on fruit size, but also on fruit yield. The highest fruit yield and irrigation water use efficiency were obtained from the T4 treatment. Irrigation water amount also affected fruit quality parameters like fruit total soluble solids, soluble sugar, starch, titratable acid and vitamin C content. Comprehensive evaluation of the effect of indexs of correlation on irrigation treatment by subordinate function showed that when the soil moisture content were controlled at about 65–70% of the field water moisture capacity, water demand in the growth and development of mango could be ensured, and maximum production efficiency of irrigation and the best quality of fruit could be achieved. In conclusion, treatment T4 was the optimum irrigation schedule for growing mango, thus achieving efficient production of mango in consideration of the compromise among mango yield, fruit quality and water use efficiency. PMID:28384647

Influence of irrigation during the growth stage on yield and quality in mango (Mangifera indica L).

PubMed

Wei, Junya; Liu, Guoyin; Liu, Debing; Chen, Yeyuan

2017-01-01

Although being one of the few drought-tolerant plants, mango trees are irrigated to ensure optimum and consistent productivity in China. In order to better understand the effects of soil water content on mango yield and fruit quality at fruit growth stage, irrigation experiments were investigated and the object was to determine the soil water content criteria at which growth and quality of mango would be optimal based on soil water measured by RHD-JS water-saving irrigation system through micro-sprinkling irrigation. Five soil water content treatments (relative to the percentage of field water capacity) for irrigation (T1:79%-82%, T2:75%-78%, T3:71%-74%, T4: 65%-70%, T5:63%-66%) were compared in 2013. Amount of applied irrigation water for different treatments varied from 2.93m3 to 1.08 m3. The results showed that mango fruit production and quality at fruit growth stage were significantly affected under different irrigation water amounts. Variation in soil water content not only had effects on fruit size, but also on fruit yield. The highest fruit yield and irrigation water use efficiency were obtained from the T4 treatment. Irrigation water amount also affected fruit quality parameters like fruit total soluble solids, soluble sugar, starch, titratable acid and vitamin C content. Comprehensive evaluation of the effect of indexs of correlation on irrigation treatment by subordinate function showed that when the soil moisture content were controlled at about 65-70% of the field water moisture capacity, water demand in the growth and development of mango could be ensured, and maximum production efficiency of irrigation and the best quality of fruit could be achieved. In conclusion, treatment T4 was the optimum irrigation schedule for growing mango, thus achieving efficient production of mango in consideration of the compromise among mango yield, fruit quality and water use efficiency.

Optical Fluorescent Imaging to Monitor Temporal Effects of Microbubble-Mediated Ultrasound Therapy

PubMed Central

Sorace, Anna G.; Saini, Reshu; Rosenthal, Eben; Warram, Jason M.; Zinn, Kurt R.; Hoyt, Kenneth

2013-01-01

Microbubble-mediated ultrasound therapy can noninvasively enhance drug delivery to localized regions in the body. This technique can be beneficial in cancer therapy, but currently there are limitations to tracking the therapeutic effects. The purpose of this experiment was to investigate the potential of fluorescent imaging for monitoring the temporal effects of microbubble-mediated ultrasound therapy. Mice were implanted with 2LMP breast cancer cells. The animals underwent microbubble-mediated ultrasound therapy in the presence of Cy5.5 fluorescent-labeled IgG antibody (large molecule) or Cy5.5 dye (small molecule) and microbubble contrast agents. Control animals were administered fluorescent molecules only. Animals were transiently imaged in vivo at 1, 10, 30, and 60 min post therapy using a small animal optical imaging system. Tumors were excised and analyzed ex vivo. Tumors were homogenized and emulsion imaged for Cy5.5 fluorescence. Monitoring in vivo results showed significant influx of dye into the tumor (p < 0.05) using the small molecule, but not in the large molecule group (p > 0.05). However, after tumor emulsion, significantly higher dye concentration was detected in therapy group tumors for both small and large molecule groups in comparison to their control counterparts (p < 0.01). This paper explores a noninvasive optical imaging method for monitoring the effects of microbubble-mediated ultrasound therapy in a cancer model. It provides temporal information following the process of increasing extravasation of molecules into target tumors. PMID:23357902

Optical fluorescent imaging to monitor temporal effects of microbubble-mediated ultrasound therapy.

PubMed

Sorace, Anna G; Saini, Reshu; Rosenthal, Eben; Warram, Jason M; Zinn, Kurt R; Hoyt, Kenneth

2013-02-01

Microbubble-mediated ultrasound therapy can noninvasively enhance drug delivery to localized regions in the body. This technique can be beneficial in cancer therapy, but currently there are limitations to tracking the therapeutic effects. The purpose of this experiment was to investigate the potential of fluorescent imaging for monitoring the temporal effects of microbubble-mediated ultrasound therapy. Mice were implanted with 2LMP breast cancer cells. The animals underwent microbubble-mediated ultrasound therapy in the presence of Cy5.5 fluorescent-labeled IgG antibody (large molecule) or Cy5.5 dye (small molecule) and microbubble contrast agents. Control animals were administered fluorescent molecules only. Animals were transiently imaged in vivo at 1, 10, 30, and 60 min post therapy using a small animal optical imaging system. Tumors were excised and analyzed ex vivo. Tumors were homogenized and emulsion imaged for Cy5.5 fluorescence. Monitoring in vivo results showed significant influx of dye into the tumor (p < 0.05) using the small molecule, but not in the large molecule group (p > 0.05). However, after tumor emulsion, significantly higher dye concentration was detected in therapy group tumors for both small and large molecule groups in comparison to their control counterparts (p <0.01). This paper explores a noninvasive optical imaging method for monitoring the effects of microbubble-mediated ultrasound therapy in a cancer model. It provides temporal information following the process of increasing extravasation of molecules into target tumors.

Effect of PGE2 on the cell surface molecule expression in PMA treated thymocytes.

PubMed

Daculsi, R; Vaillier, D; Carron, J C; Gualde, N

1998-02-01

PGE2 is produced by cells of the thymic microenvironment. The effects of PGE2 are mediated by cAMP through binding to its intracellular receptor protein kinase A (PKA). Phorbol 12-myristate 13-acetate (PMA) is known to modulate CD molecule expression on thymocytes, probably through activation of protein kinase C (PKC). We have hypothesized that cross-talk between these two signalling pathways may affect modulation of the CD molecules on the cell surface of thymocytes. For this purpose, we compare the effects of PMA alone or combined with PGE2 on CD3, CD4 and CD8 expression on mouse thymocytes by flow-cytometric analysis. PMA treatment almost completely abolished CD4 expression and slightly decreased CD3 and CD8 expression. PGE2 alone did not change the CD3, CD4 and CD8 molecule expression. Combined with PMA, PGE2 can overcome the decrease induced by PMA of the CD3 expression and partially reduced the disappearance of the CD4 molecule. On the other hand PGE2 accelerated the loss of CD8 molecule expression. These events occurred only in CD4+ CD8+ immature thymocytes. An analogue of cAMP (dibutyryl cAMP) mimics the effect of PGE2, but not Br-cGMP. This differential regulation by PGE2 of the CD molecule expression on immature thymocytes may provide additional evidence on the role of PGE2 during the process of thymic differentiation.

Therapeutic Targeting of Eosinophil Adhesion and Accumulation in Allergic Conjunctivitis

PubMed Central

Baiula, Monica; Bedini, Andrea; Carbonari, Gioia; Dattoli, Samantha Deianira; Spampinato, Santi

2012-01-01

Considerable evidence indicates that eosinophils are important effectors of ocular allergy. Increased worldwide prevalence of allergic eye pathologies has stimulated the identification of novel drug targets, including eosinophils and adhesion molecules. Accumulation of eosinophils in the eye is a key event in the onset and maintenance of allergic inflammation and is mediated by different adhesion molecules. Antihistamines with multiple mechanisms of action can be effective during the early and late phases of allergic conjunctivitis by blocking the interaction between β1 integrins and vascular cell adhesion molecule (VCAM)-1. Small molecule antagonists that target key elements in the process of eosinophil recruitment have been identified and reinforce the validity of α4β1 integrin as a therapeutic target. Glucocorticoids are among the most effective drugs for ocular allergy, but their use is limited by adverse effects. Novel dissociated glucocorticoids can prevent eosinophil accumulation and induce apoptosis of eosinophils, making them promising candidates for ophthalmic drugs. This article reviews recent understanding of the role of adhesion molecules in eosinophil recruitment in the inflamed conjunctiva along with effective treatments for allergic conjunctivitis. PMID:23271999

Enhancement of the thermoelectric figure of merit in DNA-like systems induced by Fano and Dicke effects.

PubMed

Fu, Hua-Hua; Gu, Lei; Wu, Dan-Dan; Zhang, Zu-Quan

2015-04-28

We report a theoretical study highlighting the thermoelectric properties of biological and synthetic DNA molecules. Based on an effective tight-binding model of duplex DNA and by using the nonequilibrium Green's function technique, the thermal conductance, electrical conductance, Seebeck coefficient and thermoelectric figure of merit in the system are numerically calculated by varying the asymmetries of energies and electronic hoppings in the backbone sites to simulate the environmental complications and fluctuations. We find that due to the multiple transport paths in the DNA molecule, the Fano antiresonance occurs, and enhances the Seebeck coefficient and the figure of merit. When the energy difference is produced in every opposite backbone site, the Dicke effect appears. This effect gives rise to a semiconducting-metallic transition, and enhances the thermoelectric efficiency of the DNA molecule remarkably. Moreover, as the Fano antiresonance point is close to the Dicke resonance one, a giant enhancement in the thermoelectric figure of merit in the DNA molecule has been found. These results provide a scenario to obtain effective routes to enhance the thermoelectric efficiency in the DNA molecules, and suggest perspectives for future experiments intending to control the thermoelectric transport in DNA-like nanodevices.

Characteristic effects onto C13H12N2O3 molecule dissolved in solvents of argon plasma at atmospheric pressure

NASA Astrophysics Data System (ADS)

Tanışlı, Murat; Taşal, Erol

2017-07-01

We could easily argue that the decomposition of the chemical chain molecules is a compelling application when it comes to the atmospheric pressure plasma. In this paper, we have investigated the effect of the atmospheric pressure argon plasma on 4-((2-methoxyphenyl)diazenyl)benzene-1,3,-diol molecule (abbreviated as 4MBD) at room temperature. 4MBD molecule is one of the industrial dye molecules used widely. When considering the ecological life, this molecule is very harmful and dangerous. As such, we suggest a new decomposing method for such molecules. Atmospheric pressure plasma jet is principally treated for the breakdown of the molecule in question. Fourier transform infrared spectrometry and UV-Vis spectrophotometry tools are used to characterization of the molecules subsequent to the plasma applications to 4MBD molecule in ethanol and methanol solvents. The atmospheric-pressure plasma jet of argon (Ar) as non-equilibrium has been formed by ac-power generator with frequency—24 kHz and voltage—12 kV. Characterizations for solutions prepared with ethanol and methanol solvents of 4MBD molecule have been examined after applying ( duration 3 min) the atmospheric pressure plasma jet. The molecule is broken at 6C-7N-8N=9C stretching peak in consequence of the plasma treatment. The new plasma photo-products for ethanol and methanol solutions are produced as 6C-7N-8N=9C (strong, varying) and 12C=17O (strong, wide) stretching peaks. Also, the bathochromic drifts are discerned.

Molecular Dynamics Simulations of the Oil-Detachment from the Hydroxylated Silica Surface: Effects of Surfactants, Electrostatic Interactions, and Water Flows on the Water Molecular Channel Formation.

PubMed

Tang, Jian; Qu, Zhou; Luo, Jianhui; He, Lanyan; Wang, Pingmei; Zhang, Ping; Tang, Xianqiong; Pei, Yong; Ding, Bin; Peng, Baoliang; Huang, Yunqing

2018-02-15

The detachment process of an oil molecular layer situated above a horizontal substrate was often described by a three-stage process. In this mechanism, the penetration and diffusion of water molecules between the oil phase and the substrate was proposed to be a crucial step to aid in removal of oil layer/drops from substrate. In this work, the detachment process of a two-dimensional alkane molecule layer from a silica surface in aqueous surfactant solutions is studied by means of molecular dynamics (MD) simulations. By tuning the polarity of model silica surfaces, as well as considering the different types of surfactant molecules and the water flow effects, more details about the formation of water molecular channel and the expansion processes are elucidated. It is found that for both ionic and nonionic type surfactant solutions, the perturbation of surfactant molecules on the two-dimensional oil molecule layer facilitates the injection and diffusion of water molecules between the oil layer and silica substrate. However, the water channel formation and expansion speed is strongly affected by the substrate polarity and properties of surfactant molecules. First, only for the silica surface with relative stronger polarity, the formation of water molecular channel is observed. Second, the expansion speed of the water molecular channel upon the ionic surfactant (dodecyl trimethylammonium bromide, DTAB and sodium dodecyl benzenesulfonate, SDBS) flooding is more rapidly than the nonionic surfactant system (octylphenol polyoxyethylene(10) ether, OP-10). Third, the water flow speed may also affect the injection and diffusion of water molecules. These simulation results indicate that the water molecular channel formation process is affected by multiple factors. The synergistic effects of perturbation of surfactant molecules and the electrostatic interactions between silica substrate and water molecules are two key factors aiding in the injection and diffusion of water molecules and helpful for the oil detachment from silica substrate.

Conductance manipulation at the molecular level

NASA Astrophysics Data System (ADS)

Paulsson, Magnus; Stafström, Sven

1999-05-01

Using a tight-binding model we have studied the electronic transmission through a C60 molecule sandwiched between a metal surface and a metal (scanning tunnelling microscope) tip. By simulating compression of C60 we have interpreted an experimental study of the variation of the conductance through a C60 molecule with an applied external pressure. We found that the observed increase in conductance cannot be explained in terms of the changes in the electronic structure of the C60 molecule alone. Effects related to the metal/molecule contact, i.e. the strength of the metal/C60 interaction and the shape of the molecular orbitals in the tip, are in fact more important for the conductance. In view of this we discuss the importance of interference effects in the tip/molecule coupling.

Activation of cannabinoid CB2 receptor ameliorates atherosclerosis associated with suppression of adhesion molecules.

PubMed

Zhao, Yan; Yuan, Zuyi; Liu, Yan; Xue, Jiahong; Tian, Yuling; Liu, Weimin; Zhang, Weiping; Shen, Yan; Xu, Wei; Liang, Xiao; Chen, Tao

2010-03-01

Adhesion molecules have been implicated in the development and progression of atherosclerosis. Cannabinoids have been reported to modulate the migration and adhesion molecules expression of various cell types. Here we examined the effects of WIN55212-2, a cannabinoid receptor 1 (CB1-R)/cannabinoid receptor 2 (CB2-R) agonist on the development of atherosclerotic lesions in apolipoprotein E-deficient (ApoE-/-) mice, which are vulnerable because of their high plasma cholesterol and triacylglycerol levels, focusing on the expression of endothelial adhesion molecules. In the aorta of ApoE-/- mice, WIN55212-2 significantly reduced aortic root plaque area. The mechanism for this seemed to be reduced infiltration of macrophages into the atherosclerotic plaque which was also associated with reduced expression of vascular cellular adhesion molecule-1 (VCAM-1), intercellular adhesion molecule-1 (ICAM-1), and P-selectin in the aorta. In vitro studies revealed reduced cell adhesion of a monocytic cell line (U937) to human umbilical vein endothelial cells after incubation with WIN55212-2. The reduction in macrophage adhesion also correlated with significant reductions in the expression of VCAM-1, ICAM-1, and P-selectin, indicating that reduced infiltration of macrophages in atherosclerotic plaques may occur as a result of the direct effect of WIN55212-2 on adhesion molecules in macrophages and endothelial cells. In conclusion, WIN55212-2 seems to have direct anti-atherosclerotic effects in an animal model of atherosclerosis. These effects were at least partly due to effects on the expression of VCAM-1, ICAM-1, and P-selectin, which led to reduced macrophage adhesion and infiltration. Furthermore, the protective effects completely blocked by the highly selective CB2 receptor antagonist AM630 suggest that these beneficial effects of WIN55212-2 may be mediated through the CB2 receptor.

Study on Synergistic Mechanism of Inhibitor Mixture Based on Electron Transfer Behavior

PubMed Central

Han, Peng; He, Yang; Chen, Changfeng; Yu, Haobo; Liu, Feng; Yang, Hong; Ma, Yue; Zheng, Yanjun

2016-01-01

Mixing is an important method to improve the performance of surfactants due to their synergistic effect. The changes in bonding interaction and adsorption structure of IM and OP molecules before and after co-adsorbed on Fe(001) surface is calculated by DFTB+ method. It is found that mixture enable the inhibitor molecules with higher EHOMO donate more electrons while the inhibitor molecules with lower ELUMO accept more electrons, which strengthens the bonding interaction of both inhibitor agent and inhibitor additive with metal surface. Meanwhile, water molecules in the compact layer of double electric layer are repulsed and the charge transfer resistance during the corrosion process increases. Accordingly, the correlation between the frontier orbital (EHOMO and ELUMO of inhibitor molecules and the Fermi level of metal) and inhibition efficiency is determined. Finally, we propose a frontier orbital matching principle for the synergistic effect of inhibitors, which is verified by electrochemical experiments. This frontier orbital matching principle provides an effective quantum chemistry calculation method for the optimal selection of inhibitor mixture. PMID:27671332

A Computational Study of the Rheology and Structure of Surfactant Covered Droplets

NASA Astrophysics Data System (ADS)

Maia, Joao; Boromand, Arman; Jamali, Safa

2015-11-01

The use of different types of surface-active agents is ubiquitous practice in different industrial applications ranging from cosmetic and food industries to polymeric nano-composite and blends. This allows stable multiphasic systems like foams and emulsions to be produced. Stability and shelf-life of those products are directly determined by the efficiency of the surfactant molecules. Although the effect of molecular configuration of the surface-active molecules on the planar interfaces has been studied both experimentally and computationally, it remains challenging to track the efficiency and effectiveness of different surfactant molecules on curved interfaces. In this study we address this gap by using Dissipative Particle Dynamics, to study the effectiveness and efficiency of different surfactant molecules (linear vs. branched) on a curved interface in equilibrium and far from equilibrium. In particular, we are interested to relate interfacial properties of the surface covered droplets and its dynamics to the molecular configuration of the surface active molecules under equilibrium and far from equilibrium condition.

Electrostatic melting in a single-molecule field-effect transistor with applications in genomic identification

PubMed Central

Vernick, Sefi; Trocchia, Scott M.; Warren, Steven B.; Young, Erik F.; Bouilly, Delphine; Gonzalez, Ruben L.; Nuckolls, Colin; Shepard, Kenneth L.

2017-01-01

The study of biomolecular interactions at the single-molecule level holds great potential for both basic science and biotechnology applications. Single-molecule studies often rely on fluorescence-based reporting, with signal levels limited by photon emission from single optical reporters. The point-functionalized carbon nanotube transistor, known as the single-molecule field-effect transistor, is a bioelectronics alternative based on intrinsic molecular charge that offers significantly higher signal levels for detection. Such devices are effective for characterizing DNA hybridization kinetics and thermodynamics and enabling emerging applications in genomic identification. In this work, we show that hybridization kinetics can be directly controlled by electrostatic bias applied between the device and the surrounding electrolyte. We perform the first single-molecule experiments demonstrating the use of electrostatics to control molecular binding. Using bias as a proxy for temperature, we demonstrate the feasibility of detecting various concentrations of 20-nt target sequences from the Ebolavirus nucleoprotein gene in a constant-temperature environment. PMID:28516911

Controlled release of molecular components of dendrimer/bioactive complexes

DOEpatents

Segalman, Daniel J.; Wallace, J. Shield

1998-01-01

A method for releasing molecules (guest molecules) from the matrix formed by the structure of another molecule (host molecule) in a controllable manner has been invented. This method has many applications in science and industry. In addition, applications based on such molecular systems may revolutionize significant areas of medicine, in particular the treatment of cancer and of viral infection. Similar effects can also be obtained by controlled fragmentation of a source molecule, where the molecular fragments form the active principle.

DNA molecule stretching through thermo-electrophoresis and thermal convection in a heated converging-diverging microchannel.

PubMed

Hsieh, Shou-Shing; Chen, Jyun-Hong; Tsai, Cheng-Fung

2013-02-18

A novel DNA molecule stretching technique is developed and tested herein. Through a heated converging-diverging microchannel, thermal convection and thermophoresis induced by regional heating are shown to significantly elongate single DNA molecules; they are visualized via a confocal laser scanning microscopy. In addition, electrophoretic stretching is also implemented to examine the hybrid effect on the conformation and dynamics of single DNA molecules. The physical properties of the DNA molecules are secured via experimental measurements.

Controlled release of molecular components of dendrimer/bioactive complexes

DOEpatents

Segalman, D.J.; Wallace, J.S.

1998-08-18

A method for releasing molecules (guest molecules) from the matrix formed by the structure of another molecule (host molecule) in a controllable manner has been invented. This method has many applications in science and industry. In addition, applications based on such molecular systems may revolutionize significant areas of medicine, in particular the treatment of cancer and of viral infection. Similar effects can also be obtained by controlled fragmentation of a source molecule, where the molecular fragments form the active principle. 13 figs.

A Computational Investigation of Small-Molecule Engagement of Hot Spots at Protein-Protein Interaction Interfaces.

PubMed

Xu, David; Si, Yubing; Meroueh, Samy O

2017-09-25

The binding affinity of a protein-protein interaction is concentrated at amino acids known as hot spots. It has been suggested that small molecules disrupt protein-protein interactions by either (i) engaging receptor protein hot spots or (ii) mimicking hot spots of the protein ligand. Yet, no systematic studies have been done to explore how effectively existing small-molecule protein-protein interaction inhibitors mimic or engage hot spots at protein interfaces. Here, we employ explicit-solvent molecular dynamics simulations and end-point MM-GBSA free energy calculations to explore this question. We select 36 compounds for which high-quality binding affinity and cocrystal structures are available. Five complexes that belong to three classes of protein-protein interactions (primary, secondary, and tertiary) were considered, namely, BRD4•H4, XIAP•Smac, MDM2•p53, Bcl-xL•Bak, and IL-2•IL-2Rα. Computational alanine scanning using MM-GBSA identified hot-spot residues at the interface of these protein interactions. Decomposition energies compared the interaction of small molecules with individual receptor hot spots to those of the native protein ligand. Pharmacophore analysis was used to investigate how effectively small molecules mimic the position of hot spots of the protein ligand. Finally, we study whether small molecules mimic the effects of the native protein ligand on the receptor dynamics. Our results show that, in general, existing small-molecule inhibitors of protein-protein interactions do not optimally mimic protein-ligand hot spots, nor do they effectively engage protein receptor hot spots. The more effective use of hot spots in future drug design efforts may result in smaller compounds with higher ligand efficiencies that may lead to greater success in clinical trials.

Calixarene-Mediated Liquid-Membrane Transport of Choline Conjugates

PubMed Central

Adhikari, Birendra Babu; Fujii, Ayu

2015-01-01

A series of supramolecular calixarenes efficiently transport distinct molecular species through a liquid membrane when attached to a receptor-complementary choline handle. Calix-[6]arene hexacarboxylic acid was highly effective at transporting different target molecules against a pH gradient. Both carboxylic- and phosphonic-acid-functionalized calix[4]arenes effect transport without requiring a pH or ion gradient. NMR binding studies, two-phase solvent extraction, and three-phase transport experiments reveal the necessary and subtle parameters to effect the transport of molecules attached to a choline “handle”. On the other hand, rescorin[4]arene cavitands, which have similar guest recognition profiles, did not transport guest molecules. These developments reveal new approaches towards attempting synthetic-receptor-mediated selective small-molecule transport in vesicular and cellular systems. PMID:26161034

Bioluminescent Reaction by Immobilized Luciferase

NASA Astrophysics Data System (ADS)

Tanaka, Ryuta; Takahama, Eriko; Iinuma, Masataka; Ikeda, Takeshi; Kadoya, Yutaka; Kuroda, Akio

We have investigated an effect of immobilization of luciferase molecules at the optical fiber end on a bioluminescent reaction. The time dependence of measured count rates of emitted photons has been analyzed by fitting with numerical solution of differential equations including the effect of the product-inhibitor and the deactivation of the luciferase. Through the analysis, we have successfully extracted kinetic constants such as, reaction rate, number of active luciferase molecules, etc. Ratio of active molecules to total luciferase molecules in immobilization was one order of magnitude lower than that in solution. The reaction rate of the bioluminescent process was also different from the one of free luciferase in solution.

Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules.

PubMed

Li, Yueqi; Xiang, Limin; Palma, Julio L; Asai, Yoshihiro; Tao, Nongjian

2016-04-15

Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models.

Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules

PubMed Central

Li, Yueqi; Xiang, Limin; Palma, Julio L.; Asai, Yoshihiro; Tao, Nongjian

2016-01-01

Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models. PMID:27079152

Effect of different substitution position on the switching behavior in single-molecule device with carbon nanotube electrodes

NASA Astrophysics Data System (ADS)

Yang, Jingjuan; Han, Xiaoxiao; Yuan, Peipei; Bian, Baoan; Wang, Yixiang

2018-01-01

We investigate the electronic transport properties of dihydroazulene (DHA) and vinylheptafulvene (VHF) molecule sandwiched between two carbon nanotubes using density functional theory and non-equilibrium Green's function. The device displays significantly switching behavior between DHA and VHF isomerizations. It is found the different substitution position of F in the molecule influences the switching ratio of device, which is analyzed by transmission spectra and molecular projected self-consistent Hamiltonian. The observed negative differential resistance effect is explained by transmission spectra and transmission eigenstates of transmission peak in the bias window. The observed reverse of current in VHF form in which two H atoms on the right side of the benzene ring of the molecule are replaced by F is explained by transmission spectra and molecule-electrode coupling with the varied bias. The results suggest that the reasonable substitution position of molecule may improve the switching ratio, displaying a potential application in future molecular circuit.

The effect of pressure on the hydration structure around hydrophobic solute: A molecular dynamics simulation study

NASA Astrophysics Data System (ADS)

Sarma, Rahul; Paul, Sandip

2012-03-01

Molecular dynamics simulations are performed to study the effects of pressure on the hydrophobic interactions between neopentane molecules immersed in water. Simulations are carried out for five different pressure values ranging from 1 atm to 8000 atm. From potential of mean force calculations, we find that with enhancement of pressure, there is decrease in the well depth of contact minimum (CM) and the relative stability of solvent separated minimum over CM increases. Lower clustering of neopentane at high pressure is also observed in association constant and cluster-structure analysis. Selected site-site radial distribution functions suggest efficient packing of water molecules around neopentane molecules at elevated pressure. The orientational profile calculations of water molecules show that the orientation of water molecules in the vicinity of solute molecule is anisotropic and this distribution becomes flatter as we move away from the solute. Increasing pressure slightly changes the water distribution. Our hydrogen bond properties and dynamics calculations reveal pressure-induced formation of more and more number of water molecules with five and four hydrogen bond at the expense of breaking of two and three hydrogen bonded water molecules. We also find lowering of water-water continuous hydrogen bond lifetime on application of pressure. Implication of these results for relative dispersion of hydrophobic molecules at high pressure are discussed.

Effect of particle size on the glass transition.

PubMed

Larsen, Ryan J; Zukoski, Charles F

2011-05-01

The glass transition temperature of a broad class of molecules is shown to depend on molecular size. This dependency results from the size dependence of the pair potential. A generalized equation of state is used to estimate how the volume fraction at the glass transition depends on the size of the molecule, for rigid molecule glass-formers. The model shows that at a given pressure and temperature there is a size-induced glass transition: For molecules larger than a critical size, the volume fraction required to support the effective pressure due to particle attractions is above that which characterizes the glassy state. This observation establishes the boundary between nanoparticles, which exist in liquid form only as dispersions in low molecular weight solvents and large molecules which form liquids that have viscosities below those characterized by the glassy state.

Theoretical Investigation of Single-Molecule Sensing Using Nanotube-Enhanced Circular Dichroism.

PubMed

Silva, Jaime; Milne, Bruce F; Nogueira, Fernando

2018-06-19

First-principles calculations have been used to investigate the potential use of circular dichroism (CD) spectroscopy in single-molecule sensing. Using a real-space implementation of time-dependent density functional theory (TDDFT), several systems involving single-walled carbon nanotubes (SWCNT) and small molecules have been studied to evaluate their CD response. Large induced CD (ICD) effects, differing for each test molecule, were observed in all SWCNT-molecule complexes. As the SWCNT used in this study shows no intrinsic CD response, the ICD spectra are the result of interaction with the small molecules. This finding is general and independent of the (a)chiral nature of the adsorbed molecule. Our results indicate that it is possible to design a system that uses SWCNT for detection of molecules using the change in CD spectrum of the system induced by adsorption of the molecule onto the SWCNT surface.

Ultrasensitive molecular sensor using N-doped graphene through enhanced Raman scattering

PubMed Central

Feng, Simin; dos Santos, Maria Cristina; Carvalho, Bruno R.; Lv, Ruitao; Li, Qing; Fujisawa, Kazunori; Elías, Ana Laura; Lei, Yu; Perea-López, Nestor; Endo, Morinobu; Pan, Minghu; Pimenta, Marcos A.; Terrones, Mauricio

2016-01-01

As a novel and efficient surface analysis technique, graphene-enhanced Raman scattering (GERS) has attracted increasing research attention in recent years. In particular, chemically doped graphene exhibits improved GERS effects when compared with pristine graphene for certain dyes, and it can be used to efficiently detect trace amounts of molecules. However, the GERS mechanism remains an open question. We present a comprehensive study on the GERS effect of pristine graphene and nitrogen-doped graphene. By controlling nitrogen doping, the Fermi level (EF) of graphene shifts, and if this shift aligns with the lowest unoccupied molecular orbital (LUMO) of a molecule, charge transfer is enhanced, thus significantly amplifying the molecule’s vibrational Raman modes. We confirmed these findings using different organic fluorescent molecules: rhodamine B, crystal violet, and methylene blue. The Raman signals from these dye molecules can be detected even for concentrations as low as 10−11 M, thus providing outstanding molecular sensing capabilities. To explain our results, these nitrogen-doped graphene-molecule systems were modeled using dispersion-corrected density functional theory. Furthermore, we demonstrated that it is possible to determine the gaps between the highest occupied and the lowest unoccupied molecular orbitals (HOMO-LUMO) of different molecules when different laser excitations are used. Our simulated Raman spectra of the molecules also suggest that the measured Raman shifts come from the dyes that have an extra electron. This work demonstrates that nitrogen-doped graphene has enormous potential as a substrate when detecting low concentrations of molecules and could also allow for an effective identification of their HOMO-LUMO gaps. PMID:27532043

Tailoring the Adsorption and Reaction Chemistry of the Metal-Organic Frameworks UiO-66, UiO-66-NH2, and HKUST-1 via the Incorporation of Molecular Guests.

PubMed

Ploskonka, Ann M; DeCoste, Jared B

2017-06-28

Metal-organic frameworks (MOFs) are versatile materials highly regarded for their porous nature. Depending on the synthetic method, various guest molecules may remain in the pores or can be systematically loaded for various reasons. Herein, we present a study that explores the effect of guest molecules on the adsorption and reactivity of the MOF in both the gas phase and solution. The differences between guest molecule interactions and the subsequent effects on their activity are described for each system. Interestingly, different effects are observed and described in detail for each class of guest molecules studied. We determine that there is a strong effect of alcohols with the secondary building unit of UiO MOFs, while Lewis bases have an effect on the reactivity of the -NH 2 group in UiO-66-NH 2 and adsorption by the coordinatively unsaturated copper sites in HKUST-1. These effects must be considered when determining synthesis and activation methods of MOFs toward various applications.

Ultrasensitive Laser Spectroscopy in Solids: Statistical Fine Structure and Single-Molecule Detection

DTIC Science & Technology

1990-03-28

observation, detection of the optical absorption of a single pentacene molecule in a p-terphenyl crystal, opens the door to new studies of single local ...produce appreciable quadratic Stark shifting. Such effects would greatly perturb the local field around the pentacene molecule, making detection of the...of the local surroundings of pentacene molecules with single injected charge carriers nearby may become an interesting field; however, for the

Photon Antibunching in the Fluorescence of a Single Dye Molecule Trapped in a Solid

DTIC Science & Technology

1992-06-08

number) FIELD GROUP SUB-GROUP single-molecule spectroscopy in solids, photon antibunching, quantum-optics, nonclassical effects pentacene in p-terphenyl...emitted by an optically pumped single molecule of pentacene In a p-terphenyl host has been Investigated at short times. The correlation function...excitation tcclnique, certain individual pentacene impurity molecules in a p-terphenyl crystal 11 were observed to spectrally diffuse, i.e. their absorption

Effects of Functional Groups in Redox-Active Organic Molecules: A High-Throughput Screening Approach

DOE PAGES

Pelzer, Kenley M.; Cheng, Lei; Curtiss, Larry A.

2016-12-08

Nonaqueous redox flow batteries have attracted recent attention with their potential for high electrochemical storage capacity, with organic electrolytes serving as solvents with a wide electrochemical stability window. Organic molecules can also serve as electroactive species, where molecules with low reduction potentials or high oxidation potentials can provide substantial chemical energy. To identify promising electrolytes in a vast chemical space, high-throughput screening (HTS) of candidate molecules plays an important role, where HTS is used to calculate properties of thousands of molecules and identify a few organic molecules worthy of further attention in battery research. Here, in this work, we presentmore » reduction and oxidation potentials obtained from HTS of 4178 molecules. The molecules are composed of base groups of five- or six-membered rings with one or two functional groups attached, with the set of possible functional groups including both electron-withdrawing and electron-donating groups. In addition to observing the trends in potentials that result from differences in organic base groups and functional groups, we analyze the effects of molecular characteristics such as multiple bonds, Hammett parameters, and functional group position. In conclusion, this work provides useful guidance in determining how the identities of the base groups and functional groups are correlated with desirable reduction and oxidation potentials.« less

Effects of Functional Groups in Redox-Active Organic Molecules: A High-Throughput Screening Approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pelzer, Kenley M.; Cheng, Lei; Curtiss, Larry A.

Nonaqueous redox flow batteries have attracted recent attention with their potential for high electrochemical storage capacity, with organic electrolytes serving as solvents with a wide electrochemical stability window. Organic molecules can also serve as electroactive species, where molecules with low reduction potentials or high oxidation potentials can provide substantial chemical energy. To identify promising electrolytes in a vast chemical space, high-throughput screening (HTS) of candidate molecules plays an important role, where HTS is used to calculate properties of thousands of molecules and identify a few organic molecules worthy of further attention in battery research. Here, in this work, we presentmore » reduction and oxidation potentials obtained from HTS of 4178 molecules. The molecules are composed of base groups of five- or six-membered rings with one or two functional groups attached, with the set of possible functional groups including both electron-withdrawing and electron-donating groups. In addition to observing the trends in potentials that result from differences in organic base groups and functional groups, we analyze the effects of molecular characteristics such as multiple bonds, Hammett parameters, and functional group position. In conclusion, this work provides useful guidance in determining how the identities of the base groups and functional groups are correlated with desirable reduction and oxidation potentials.« less

Effect of the collective motions of molecules inside a condensed phase on fluctuations in the density of small bodies

NASA Astrophysics Data System (ADS)

Tovbin, Yu. K.

2017-11-01

An approach to calculating the effects of fluctuations in density that considers the collective motions of molecules in small condensed phases (e.g., droplets, microcrystals, adsorption at microcrystal faces) is proposed. Statistical sums of the vibrational, rotational, and translational motions of molecules are of a collective character expressed in the dependences of these statistical sums on the local configurations of neighboring molecules. This changes their individual contributions to the free energy and modifies fluctuations in density in the inner homogeneous regions of small bodies. Interactions between nearest neighbors are considered in a quasi-chemical approximation that reflects the effects of short-range direct correlations. Expressions for isotherms relating the densities of mixture components to the chemical potentials in a thermostat are obtained, along with equations for pair distribution functions.

Kondo effect in single cobalt phthalocyanine molecules adsorbed on Au(111) monoatomic steps

NASA Astrophysics Data System (ADS)

Zhao, Aidi; Hu, Zhenpeng; Wang, Bing; Xiao, Xudong; Yang, Jinlong; Hou, J. G.

2008-06-01

The Kondo effect in single dehydrogenated cobalt phthalocyanine (CoPc) molecules adsorbed on Au(111) monoatomic steps was studied with a low temperature scanning tunneling microscope. The CoPc molecules adsorbed on Au(111) monoatomic steps show two typical configurations, which can be dehydrogenated to reveal Kondo effect. Moreover, the Kondo temperatures (TK) measured for different molecules vary in a large range from ~150 to ~550 K, increasing monotonically with decreasing Co-Au distance. A simple model consisting of a single Co 3dz2 orbital and a Au 6s orbital is considered and gives a qualitative explanation to the dependence. The large variation of TK is attributed to the variation of the interaction between the magnetic-active cobalt ion and the Au substrate resulted from different Co-Au distances.

Method and system for measurement of mechanical properties of molecules and cells

NASA Technical Reports Server (NTRS)

Fredberg, Jeffrey J. (Inventor); Butler, James P. (Inventor); Ingber, Donald E. (Inventor); Wang, Ning (Inventor)

1996-01-01

Mechanical stresses and deformations are applied directly to cell surface receptors or molecules and measured using a system including a magnetic twisting device in combination with ferromagnetic microbeads coated with ligands for integrins or any other surface receptors. The system can be used diagnostically to characterize cells and molecules and to determine the effect of transformation and compounds, including drugs, on the cells and molecules. The system can also be used to induce cells to grow or alter production of molecules by the cells.

Role of Naphthenic Acids in Controlling Self-Aggregation of a Polyaromatic Compound in Toluene.

PubMed

Teklebrhan, Robel B; Jian, Cuiying; Choi, Phillip; Xu, Zhenghe; Sjöblom, Johan

2016-04-14

In this work, a series of molecular dynamics simulations were performed to investigate the effect of naphthenic acids (NAs) in early stage self-assembly of polyaromatic (PA) molecules in toluene. By exploiting NA molecules of the same polar functional group but different aliphatic/cycloaliphatic nonpolar tails, it was found that irrespective of the presence of the NA molecules in the system, the dominant mode of π-π stacking is a twisted, offset parallel stacking of a slightly larger overlapping area. Unlike large NA molecules, the presence of small NA molecules enhanced the number of π-π stacked PA molecules by suppressing the hydrogen bonding interactions among the PA molecules. Smaller NA molecules were found to have a higher tendency to associate with PA molecules than larger NA molecules. Moreover, the size and distribution of π-π stacking structures were affected to different degrees by changing the size and structural features of the NA molecules in the system. It was further revealed that the association between NA and PA molecules, mainly through hydrogen bonding, creates a favorable local environment for the overlap of PA cores (i.e., π-π stacking growth) by depressing the hydrogen bonding between PA molecules, which results in the removal of some toluene molecules from the vicinity of the PA molecules.

Effect of multi-dimensional ultraviolet light exposure on the growth of pentacene film and application to organic field-effect transistors.

PubMed

Bae, Jin-Hyuk; Lee, Sin-Doo; Choi, Jong Sun; Park, Jaehoon

2012-05-01

We report on the multi-dimensional alignment of pentacene molecules on a poly(methyl methacrylate)-based photosensitive polymer (PMMA-polymer) and its effect on the electrical performance of the pentacene-based field-effect transistor (FET). Pentacene molecules are shown to be preferentially aligned on the linearly polarized ultraviolet (LPUV)-exposed PMMA-polymer layer, which is contrast to an isotropic alignment on the bare PMMA-polymer layer. Multi-dimensional alignment of pentacene molecules in the film could be achieved by adjusting the direction of LPUV exposed to the PMMA-polymer. The control of pentacene molecular alignment is found to be promising for the field-effect mobility enhancement in the pentacene FET.

The Therapeutic Effect of the Antitumor Drug 11beta and Related Molecules on Polycystic Kidney Disease

DTIC Science & Technology

2017-09-01

AWARD NUMBER: W81XWH-15-1-0365 TITLE: The Therapeutic Effect of the Antitumor Drug 11beta and Related Molecules on Polycystic Kidney Disease...Molecules on Polycystic Kidney Disease 5b. GRANT NUMBER W81XWH-15-1-0365 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) John Essigmann, Robert Croy, Bogdan...polycystic kidney disease (PKD). In collaboration with Somlo group at Yale University, we have already shown that two parent compounds, 11β-dichloro and 11β

Detection and Spectroscopy of Single Pentacene Molecules in a p- Terphenyl Crystal by Means of Fluorescence Excitation

DTIC Science & Technology

1991-07-22

suggesting that the effect may be ite td’ phonon-assisted transitions of local degrees of freedom around the pentacene defect whose source remains to...the effect may be due to phonon-assisted transitions of local degrees of freedom around the pentacene defect whose source remains to be identified...single molecule of pentacene in p-terphenyl is an exquisitely sensitive probe of the detailed local environment around the impurity molecule. It appears

Contact dependence of the conductance through C60

NASA Astrophysics Data System (ADS)

Paulsson, Magnus; Stafström, Sven

1998-08-01

The electronic transmission through a C60 molecule is studied with emphasis on the contact geometry. The transmission can not be understood simply by the electronic structure of the C60 molecule itself, interference effects related to the metal/molecule contact are in fact very important for the conductance.

An in vitro screening cascade to identify neuroprotective antioxidants in ALS

PubMed Central

Barber, Siân C.; Higginbottom, Adrian; Mead, Richard J.; Barber, Stuart; Shaw, Pamela J.

2009-01-01

Amyotrophic lateral sclerosis (ALS) is an adult-onset neurodegenerative disease, characterized by progressive dysfunction and death of motor neurons. Although evidence for oxidative stress in ALS pathogenesis is well described, antioxidants have generally shown poor efficacy in animal models and human clinical trials. We have developed an in vitro screening cascade to identify antioxidant molecules capable of rescuing NSC34 motor neuron cells expressing an ALS-associated mutation of superoxide dismutase 1. We have tested known antioxidants and screened a library of 2000 small molecules. The library screen identified 164 antioxidant molecules, which were refined to the 9 most promising molecules in subsequent experiments. Analysis of the in silico properties of hit compounds and a review of published literature on their in vivo effectiveness have enabled us to systematically identify molecules with antioxidant activity combined with chemical properties necessary to penetrate the central nervous system. The top-performing molecules identified include caffeic acid phenethyl ester, esculetin, and resveratrol. These compounds were tested for their ability to rescue primary motor neuron cultures after trophic factor withdrawal, and the mechanisms of action of their antioxidant effects were investigated. Subsequent in vivo studies can be targeted using molecules with the greatest probability of success. PMID:19439221

Atomic force microscopy and tribology study of the adsorption of alcohols on diamond-like carbon coatings and steel

NASA Astrophysics Data System (ADS)

Kalin, M.; Simič, R.

2013-04-01

Polar molecules are known to affect the friction and wear of steel contacts via adsorption onto the surface, which represents one of the fundamental boundary-lubrication mechanisms. Since the basic chemical and physical effects of polar molecules on diamond-like carbon (DLC) coatings have been investigated only very rarely, it is important to find out whether such molecules have a similar effect on DLC coatings as they do on steel. In our study the adsorption of hexadecanol in various concentrations (2-20 mmol/l) on DLC was studied under static conditions using an atomic force microscope (AFM). The amount of surface coverage, the size and the density of the adsorbed islands of alcohol molecules were analyzed. Tribological tests were also performed to correlate the wear and friction behaviours with the adsorption of molecules on the surface. In this case, steel surfaces served as a reference. The AFM was successfully used to analyze the adsorption ability of polar molecules onto the DLC surfaces and a good correlation between the AFM results and the tribological behaviour of the DLC and the steel was found. We confirmed that alcohols can adsorb physically and chemically onto the DLC surfaces and are, therefore, potential boundary-lubrication agents for the DLC coatings. The adsorption of alcohol onto the DLC surfaces reduces the wear of the coatings, but it is less effective in reducing the friction because of the already inherently low-friction properties of DLC. Tentative adsorption mechanisms that include the environmental species effect, the temperature effect and the tribological rubbing effect are proposed for DLC and steel surfaces.

An enhanced Petri-net model to predict synergistic effects of pairwise drug combinations from gene microarray data.

PubMed

Jin, Guangxu; Zhao, Hong; Zhou, Xiaobo; Wong, Stephen T C

2011-07-01

Prediction of synergistic effects of drug combinations has traditionally been relied on phenotypic response data. However, such methods cannot be used to identify molecular signaling mechanisms of synergistic drug combinations. In this article, we propose an enhanced Petri-Net (EPN) model to recognize the synergistic effects of drug combinations from the molecular response profiles, i.e. drug-treated microarray data. We addressed the downstream signaling network of the targets for the two individual drugs used in the pairwise combinations and applied EPN to the identified targeted signaling network. In EPN, drugs and signaling molecules are assigned to different types of places, while drug doses and molecular expressions are denoted by color tokens. The changes of molecular expressions caused by treatments of drugs are simulated by two actions of EPN: firing and blasting. Firing is to transit the drug and molecule tokens from one node or place to another, and blasting is to reduce the number of molecule tokens by drug tokens in a molecule node. The goal of EPN is to mediate the state characterized by control condition without any treatment to that of treatment and to depict the drug effects on molecules by the drug tokens. We applied EPN to our generated pairwise drug combination microarray data. The synergistic predictions using EPN are consistent with those predicted using phenotypic response data. The molecules responsible for the synergistic effects with their associated feedback loops display the mechanisms of synergism. The software implemented in Python 2.7 programming language is available from request. stwong@tmhs.org.

Laboratory simulation to support the search for organic molecules at the surface of Mars

NASA Astrophysics Data System (ADS)

Poch, Olivier; Szopa, Cyril; Coll, Patrice; Jaber, Maguy; Georgelin, Thomas; Lambert, Jean-Francois; Stalport, Fabien

The search for organic carbon at the surface of Mars, as clues of past habitability or remnants of life, is a major science goal of Mars’ exploration. Understanding the chemical evolution of organic molecules under current Martian environmental conditions is essential to support the analyses performed in situ. What molecule can be preserved? What is the timescale of organic evolution at the surface? Here we present results of laboratory investigations dedicated to monitor qualitative and quantitative evolutions of several organic molecules under simulated Martian surface ultraviolet incident light, mean ground temperature and pressure, using the Mars Organic Molecules Irradiation and Evolution setup (1) . For each organic molecule studied, the nature of the evolution products (solid or gaseous) and the kinetic parameters (extrapolated half-life at Mars, quantum yields) were experimentally determined. The results show that when exposed to UV radiation, specific organic molecules lead to the formation of solid residues, probably of macromolecular nature, which could reach long term stability. On the other hand, the study of the evolution of molecules in presence of nontronite, a clay mineral detected at the surface of Mars, highlights a strong protective effect of the clay reducing dissociation rates for some molecules, whereas a possible catalytic effect is tentatively observed for one studied molecule. These results are essential to support the analyses performed in situ during the past, current and future exploration missions. Moreover, the experimentally determined kinetic parameters provide new inputs for numerical modeling of current reservoirs of organic molecules on Mars. (1) O. Poch et al., Planetary and Space Science 85, 188-197, http://dx.doi.org/10.1016/j.pss.2013.06.013

Effect of molecular shape on rotation under severe confinement

DOE PAGES

Dhiman, Indu; Bhowmik, Debsindhu; Shrestha, Utsab R.; ...

2018-01-31

Orientational structure and dynamics of molecules is known to be affected by confinement in space comparable in size to the molecule itself. ZSM-5 with porous channels of ≈0.55 nm is such a porous medium, which offers a strict spatial confinement on low molecular weight hydrocarbons. An important factor that determines these properties is the shape of the confined molecules. In this work, we employed molecular dynamics simulation to study the orientational structure and dynamics of four molecules that differ in shape but have similar kinetic diameters and moments of inertia, confined in ZSM-5. The effect of molecular shape on themore » orientational structure and dynamics of propane, acetonitrile, acetaldehyde and acetone in ZSM-5 is studied by means of probing the differences in the orientational distribution of molecules in the ZSM-5 channels, and extracting time scales of the decay of correlation functions related to rotational motion. Orientational correlation functions of all the four molecules exhibit two regimes of rotational motion. While the short time regime represents free rotation of the molecules before they collide with the pore walls, the long time orientational jumps driven by inter-channel migrations give rise to a very slow varying second regime. Of the molecules studied, orientational structure and dynamics of propane is found to be least affected by confinement under ZSM-5, whereas charge and shape asymmetry of other molecules makes their interchannel migration-driven rotation slow. The time scales involved in the rotational motion for the molecules studied are compared with similar studies reported in literature. Lastly, this study reveals the important role that molecular shape plays in the behavior of confined molecules.« less

Effect of molecular shape on rotation under severe confinement

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dhiman, Indu; Bhowmik, Debsindhu; Shrestha, Utsab R.

Orientational structure and dynamics of molecules is known to be affected by confinement in space comparable in size to the molecule itself. ZSM-5 with porous channels of ≈0.55 nm is such a porous medium, which offers a strict spatial confinement on low molecular weight hydrocarbons. An important factor that determines these properties is the shape of the confined molecules. In this work, we employed molecular dynamics simulation to study the orientational structure and dynamics of four molecules that differ in shape but have similar kinetic diameters and moments of inertia, confined in ZSM-5. The effect of molecular shape on themore » orientational structure and dynamics of propane, acetonitrile, acetaldehyde and acetone in ZSM-5 is studied by means of probing the differences in the orientational distribution of molecules in the ZSM-5 channels, and extracting time scales of the decay of correlation functions related to rotational motion. Orientational correlation functions of all the four molecules exhibit two regimes of rotational motion. While the short time regime represents free rotation of the molecules before they collide with the pore walls, the long time orientational jumps driven by inter-channel migrations give rise to a very slow varying second regime. Of the molecules studied, orientational structure and dynamics of propane is found to be least affected by confinement under ZSM-5, whereas charge and shape asymmetry of other molecules makes their interchannel migration-driven rotation slow. The time scales involved in the rotational motion for the molecules studied are compared with similar studies reported in literature. Lastly, this study reveals the important role that molecular shape plays in the behavior of confined molecules.« less

Small Molecules Affect Human Dental Pulp Stem Cell Properties Via Multiple Signaling Pathways

PubMed Central

Al-Habib, Mey; Yu, Zongdong

2013-01-01

One fundamental issue regarding stem cells for regenerative medicine is the maintenance of stem cell stemness. The purpose of the study was to test whether small molecules can enhance stem cell properties of mesenchymal stem cells (MSCs) derived from human dental pulp (hDPSCs), which have potential for multiple clinical applications. We identified the effects of small molecules (Pluripotin (SC1), 6-bromoindirubin-3-oxime and rapamycin) on the maintenance of hDPSC properties in vitro and the mechanisms involved in exerting the effects. Primary cultures of hDPSCs were exposed to optimal concentrations of these small molecules. Treated hDPSCs were analyzed for their proliferation, the expression levels of pluripotent and MSC markers, differentiation capacities, and intracellular signaling activations. We found that small molecule treatments decreased cell proliferation and increased the expression of STRO-1, NANOG, OCT4, and SOX2, while diminishing cell differentiation into odonto/osteogenic, adipogenic, and neurogenic lineages in vitro. These effects involved Ras-GAP-, ERK1/2-, and mTOR-signaling pathways, which may preserve the cell self-renewal capacity, while suppressing differentiation. We conclude that small molecules appear to enhance the immature state of hDPSCs in culture, which may be used as a strategy for adult stem cell maintenance and extend their capacity for regenerative applications. PMID:23573877

Explaining rISC and 100% efficient TADF (Conference Presentation)

NASA Astrophysics Data System (ADS)

Monkman, Andrew P.; Etherington, Marc; Graves, David; Data, Przemyslaw; Dos Santos, Paloma Lays; Nobuyasu, Roberto; Baiao Dias, Fernando M.

2016-09-01

Detailed photophysical measurements of intramolecular charge transfer (ICT) states have been made both in solution and solid state. Temperature dependent time resolved emission, delayed emission and photoinduced absorption are used to map the energy levels involved in molecule decay, and through detailed kinetic modelling of the thermally activated processes observed, true electron exchange energies and other energy barriers of the systems determined with the real states involved in the reversed intersystem crossing mechanism elucidated. For specific donor acceptor molecules, the CT singlet and local triplet states (of donor or acceptor) are found to be the lowest lying excited states of the molecule with very small energy barrier between them ? kT. In these cases the decay kinetics of the molecules become significantly different to normal molecules, and the effect of rapid recycling between CT singlet and local triplet states is observed which gives rise to the true triplet harvesting mechanism in TADF. Using a series of different TADF emitters we will show how the energy level ordering effects or does not effect TADF and how ultimate OLED performance is dictated by energy level ordering, from 5% to 22% external quantum efficiency. From this understanding, we are able to define three criterion for TADF in different molecules and these will be discussed.

Methodologies for Studying B. subtilis Biofilms as a Model for Characterizing Small Molecule Biofilm Inhibitors.

PubMed

Bucher, Tabitha; Kartvelishvily, Elena; Kolodkin-Gal, Ilana

2016-10-09

This work assesses different methodologies to study the impact of small molecule biofilm inhibitors, such as D-amino acids, on the development and resilience of Bacillus subtilis biofilms. First, methods are presented that select for small molecule inhibitors with biofilm-specific targets in order to separate the effect of the small molecule inhibitors on planktonic growth from their effect on biofilm formation. Next, we focus on how inoculation conditions affect the sensitivity of multicellular, floating B. subtilis cultures to small molecule inhibitors. The results suggest that discrepancies in the reported effects of such inhibitors such as D-amino acids are due to inconsistent pre-culture conditions. Furthermore, a recently developed protocol is described for evaluating the contribution of small molecule treatments towards biofilm resistance to antibacterial substances. Lastly, scanning electron microscopy (SEM) techniques are presented to analyze the three-dimensional spatial arrangement of cells and their surrounding extracellular matrix in a B. subtilis biofilm. SEM facilitates insight into the three-dimensional biofilm architecture and the matrix texture. A combination of the methods described here can greatly assist the study of biofilm development in the presence and absence of biofilm inhibitors, and shed light on the mechanism of action of these inhibitors.

Surface Effect on Oil Transportation in Nanochannel: a Molecular Dynamics Study.

PubMed

Zheng, Haixia; Du, Yonggang; Xue, Qingzhong; Zhu, Lei; Li, Xiaofang; Lu, Shuangfang; Jin, Yakang

2017-12-01

In this work, we investigate the dynamics mechanism of oil transportation in nanochannel using molecular dynamics simulations. It is demonstrated that the interaction between oil molecules and nanochannel has a great effect on the transportation properties of oil in nanochannel. Because of different interactions between oil molecules and channel, the center of mass (COM) displacement of oil in a 6-nm channel is over 30 times larger than that in a 2-nm channel, and the diffusion coefficient of oil molecules at the center of a 6-nm channel is almost two times more than that near the channel surface. Besides, it is found that polarity of oil molecules has the effect on impeding oil transportation, because the electrostatic interaction between polar oil molecules and channel is far larger than that between nonpolar oil molecules and channel. In addition, channel component is found to play an important role in oil transportation in nanochannel, for example, the COM displacement of oil in gold channel is very few due to great interaction between oil and gold substrate. It is also found that nano-sized roughness of channel surface greatly influences the speed and flow pattern of oil. Our findings would contribute to revealing the mechanism of oil transportation in nanochannels and therefore are very important for design of oil extraction in nanochannels.

Effect of PEGylation on drug entry into lipid bilayer.

PubMed

Rissanen, Sami; Kumorek, Marta; Martinez-Seara, Hector; Li, Yen-Chin; Jamróz, Dorota; Bunker, Alex; Nowakowska, Maria; Vattulainen, Ilpo; Kepczynski, Mariusz; Róg, Tomasz

2014-01-09

Poly(ethylene glycol) (PEG) is a polymer commonly used for functionalization of drug molecules to increase their bloodstream lifetime, hence efficacy. However, the interactions between the PEGylated drugs and biomembranes are not clearly understood. In this study, we employed atomic-scale molecular dynamics (MD) simulations to consider the behavior of two drug molecules functionalized with PEG (tetraphenylporphyrin used in cancer phototherapy and biochanin A belonging to the isoflavone family) in the presence of a lipid bilayer. The commonly held view is that functionalization of a drug molecule with a polymer acts as an entropic barrier, inhibiting the penetration of the drug molecule through a cell membrane. Our results indicate that in the bloodstream there is an additional source of electrostatic repulsive interactions between the PEGylated drugs and the lipid bilayer. Both the PEG chain and lipids can bind Na(+) ions, thus effectively becoming positively charged molecules. This leads to an extra repulsive effect resulting from the presence of salt in the bloodstream. Thus, our study sheds further light on the role of PEG in drug delivery.

Solvation structures of water in trihexyltetradecylphosphonium-orthoborate ionic liquids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Yong-Lei, E-mail: wangyonl@gmail.com; System and Component Design, Department of Machine Design, KTH Royal Institute of Technology, SE-100 44 Stockholm; Sarman, Sten

2016-08-14

Atomistic molecular dynamics simulations have been performed to investigate effective interactions of isolated water molecules dispersed in trihexyltetradecylphosphonium-orthoborate ionic liquids (ILs). The intrinsic free energy changes in solvating one water molecule from gas phase into bulk IL matrices were estimated as a function of temperature, and thereafter, the calculations of potential of mean force between two dispersed water molecules within different IL matrices were performed using umbrella sampling simulations. The systematic analyses of local ionic microstructures, orientational preferences, probability and spatial distributions of dispersed water molecules around neighboring ionic species indicate their preferential coordinations to central polar segments in orthoboratemore » anions. The effective interactions between two dispersed water molecules are partially or totally screened as their separation distance increases due to interference of ionic species in between. These computational results connect microscopic anionic structures with macroscopically and experimentally observed difficulty in completely removing water from synthesized IL samples and suggest that the introduction of hydrophobic groups to central polar segments and the formation of conjugated ionic structures in orthoborate anions can effectively reduce residual water content in the corresponding IL samples.« less

Single-Molecule Sensing with Nanopore Confinement: From Chemical Reactions to Biological Interactions.

PubMed

Lin, Yao; Ying, Yi-Lun; Gao, Rui; Long, Yi-Tao

2018-03-25

The nanopore can generate an electrochemical confinement for single-molecule sensing that help understand the fundamental chemical principle in nanoscale dimensions. By observing the generated ionic current, individual bond-making and bond-breaking steps, single biomolecule dynamic conformational changes and electron transfer processes that occur within pore can be monitored with high temporal and current resolution. These single-molecule studies in nanopore confinement are revealing information about the fundamental chemical and biological processes that cannot be extracted from ensemble measurements. In this Concept article, we introduce and discuss the electrochemical confinement effects on single-molecule covalent reactions, conformational dynamics of individual molecules and host-guest interactions in protein nanopores. Then, we extend the concept of nanopore confinement effects to confine electrochemical redox reactions in solid-state nanopores for developing new sensing mechanisms. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Treatment of Gram-negative bacterial infections by potentiation of antibiotics.

PubMed

Zabawa, Thomas P; Pucci, Michael J; Parr, Thomas R; Lister, Troy

2016-10-01

Infections caused by antibiotic-resistant pathogens, particularly Gram-negative bacteria, represent significant treatment challenges for physicians resulting in high rates of morbidity and mortality. The outer membrane of Gram-negative bacteria acts as a permeability barrier to many compounds that would otherwise be effective antibacterial agents, including those effective against Gram-positive pathogens. Potentiator molecules disrupt this barrier allowing entry of otherwise impermeant molecules, thus providing a strategy to render multi-drug resistant pathogens susceptible to a broader range of antibiotics. Potentiator molecules are cationic and the mechanism of disruption involves interaction with the negatively charged outer membrane. This physical attribute, along with an often high degree of lipophilicity typically endears these molecules with unacceptable toxicity. Presented herein are examples of advanced potentiator molecules being evaluated for use in combination therapy for the treatment of resistant Gram-negative infections. Copyright © 2016 Elsevier Ltd. All rights reserved.

Effect of substrate thickness on ejection of phenylalanine molecules adsorbed on free-standing graphene bombarded by 10 keV C60

NASA Astrophysics Data System (ADS)

Golunski, M.; Verkhoturov, S. V.; Verkhoturov, D. S.; Schweikert, E. A.; Postawa, Z.

2017-02-01

Molecular dynamics computer simulations have been employed to investigate the effect of substrate thickness on the ejection mechanism of phenylalanine molecules deposited on free-standing graphene. The system is bombarded from the graphene side by 10 keV C60 projectiles at normal incidence and the ejected particles are collected both in transmission and reflection directions. It has been found that the ejection mechanism depends on the substrate thickness. At thin substrates mostly organic fragments are ejected by direct collisions between projectile atoms and adsorbed molecules. At thicker substrates interaction between deforming topmost graphene sheet and adsorbed molecules becomes more important. As this process is gentle and directionally correlated, it leads predominantly to ejection of intact molecules. The implications of the results to a novel analytical approach in Secondary Ion Mass Spectrometry based on ultrathin free-standing graphene substrates and a transmission geometry are discussed.

Non-perturbative calculation of orbital and spin effects in molecules subject to non-uniform magnetic fields

NASA Astrophysics Data System (ADS)

Sen, Sangita; Tellgren, Erik I.

2018-05-01

External non-uniform magnetic fields acting on molecules induce non-collinear spin densities and spin-symmetry breaking. This necessitates a general two-component Pauli spinor representation. In this paper, we report the implementation of a general Hartree-Fock method, without any spin constraints, for non-perturbative calculations with finite non-uniform fields. London atomic orbitals are used to ensure faster basis convergence as well as invariance under constant gauge shifts of the magnetic vector potential. The implementation has been applied to investigate the joint orbital and spin response to a field gradient—quantified through the anapole moments—of a set of small molecules. The relative contributions of orbital and spin-Zeeman interaction terms have been studied both theoretically and computationally. Spin effects are stronger and show a general paramagnetic behavior for closed shell molecules while orbital effects can have either direction. Basis set convergence and size effects of anapole susceptibility tensors have been reported. The relation of the mixed anapole susceptibility tensor to chirality is also demonstrated.

Orientation of surfactant self-assembled aggregates on graphite

NASA Astrophysics Data System (ADS)

Sammalkorpi, Maria; Hynninen, Antti-Pekka; Panagiotopoulos, Athanassios Z.; Haataja, Mikko

2007-03-01

Micellar aggregates on surfaces can provide a self-healing corrosion protection or lubrication layer. It has been observed experimentally that on a single crystal surface this layer often consists of oriented hemi-cylindrical micelles which are aligned with the underlying crystal lattice (``orientation effect''). A key feature of this self-assembly process is the interplay between detergent--detergent and detergent--surface interactions. Since the dimensions of the detergent molecules and the unit cell of the surface are typically quite different, the origins of this orientation effect remain unclear. Here we address the question and present the results of Molecular Dynamics simulations of sodium dodecyl sulfate (SDS) self-aggregation on graphite. We employ both single-molecule and multi-molecule simulations of SDS to unravel the origins of the orientation effect. We report that the underlying graphite surface is sufficient to impose orientational bias on individual SDS molecules diffusing on the surface. This produces collective effects that give rise to the oriented hemi-micelles.

Sonocatalytic degradation of malachite green oxalate by a semiconductor metal oxide nanocatalyst.

PubMed

Bhavani, R; Sivasamy, A

2016-12-01

Advanced Oxidation Process (AOP) technologies are considered to be better technique for the degradation or mineralization of many recalcitrant compounds and pollutants. In the present study heterogeneous sonocatalytic degradation of a model organic compound such as Malachite green oxalate (MGO) was carried out in the aqueous phase. Zinc oxide nanorods were prepared by precipitation method employing zinc acetates as precursors and were characterized by FT-IR, XRD, FE-SEM and EDAX analysis. Degradation of MGO in the aqueous phase was studied in detail under the sonocatalytic process. Effects of pH, dye concentration, oxidant concentration, kinetics and effect of electrolytes on dye degradation were carried out to check the efficiency of the sonocatalyst. Effect of energy input on the degradation processes was also investigated. The degradation of dye molecules were monitored by UV-visible spectrophotometer and Chemical Oxygen demand (COD). The dye molecules were readily degraded at above 90% in the pH range 5.0-7.0 under ultrasound with zinc oxide nanorods. The interference of electrolytes like NaCl, KCl, Na 2 CO 3 , NaHCO 3 and MgSO 4 on the degradation of dye molecules were also studied on the sonocatalytic degradation of MGO. From the kinetic studies it was observed that at lower initial concentration of dye molecules the degradation efficiency was above 90%. The rate of the reaction decreased on increasing the initial dye concentrations of the dye molecules. It was observed that the complete mineralization of dye molecules was achieved without the formation of toxic by-products. The reusability of the catalyst also showed the effective degradation of the dye molecules up to five cycles without loss of the catalytic activities. Copyright © 2015 Elsevier Inc. All rights reserved.

Physics and chemistry of the influence of excited molecules on combustion enhancement

PubMed Central

Starik, A. M.; Loukhovitski, B. I.; Sharipov, A. S.; Titova, N. S

2015-01-01

The paper addresses detailed analysis of kinetic processes in the H2−O2, CO−O2 and CH4−O2-reactive systems upon the presence of singlet oxygen molecules O2(a1Δg) and and the influence of the activation of oxygen molecules in electric discharge on the acceleration of ignition in the H2−O2 and CH4−O2 mixtures. The possibility of the intensification of CO oxidation due to excitation of O2 and N2 molecule vibrations and generation of singlet oxygen molecules is also considered. It is shown that the effect of accelerating the ignition strongly depends on the reduced electric field and, as a consequence, on the composition of discharge plasma as well as on the features of chain mechanism development in oxy-fuel systems. It is revealed that the most effective approach for the intensification of CO oxidation both in the moist air and in the products of hydrocarbon combustion in air is the generation of O2(a1Δg) molecules by electric discharge. Computations showed that the presence of 1% O2(a1Δg) in the total oxygen allowed one to convert CO to CO2 even at the temperature T=850–900 K in the time of 10−2 s. The excitation of O2 and N2 molecule vibrations is less effective for such a conversion. PMID:26170425

Non-equilibrium kinetics of plasma-assisted combustion: the role of electronically excited atoms and molecules

NASA Astrophysics Data System (ADS)

Popov, Nikolay

2016-09-01

A review of experimental and theoretical investigations of the effect of electronically excited atoms and molecules on the induction delay time and on the shift of the ignition temperature threshold of combustible mixtures is presented. At relatively low initial gas temperature, the effect of excited O(1D) atoms on the oxidation and reforming of combustible mixtures is quite significant due to the high rates of reactions of O(1D) atoms with hydrogen and hydrocarbon molecules. The singlet oxygen molecules, O2(a1Δg) , participate both in chain initiation and chain branching reactions, but the effect of O2(a1Δg) in the ignition processes is generally less important compared to the oxygen atoms. To reduce the ignition delay time and decrease the temperature threshold of fuel-air mixtures, the use of gas discharges with relatively high E/N values is recommended. In this case the reactions of electronically excited N2(A3Σu+ , B3πg , C3πu , a'1Σu-) molecules, and atomic particles in ground and electronically excited states are extremely important. The energy stored in electronic excitation of atoms and molecules is spent on the additional dissociation of oxygen and fuel molecules, on the fast gas heating, and finally to the triggering of chain branching reactions. This work was partially supported by AOARD AFOSR, FA2386-13-1-4064 grant and Linked International Laboratory LIA KaPPA (France-Russia).

Properties of inhibitors of methane hydrate formation via molecular dynamics simulations.

PubMed

Anderson, Brian J; Tester, Jefferson W; Borghi, Gian Paolo; Trout, Bernhardt L

2005-12-21

Within the framework of a proposed two-step mechanism for hydrate inhibition, the energy of binding of four inhibitor molecules (PEO, PVP, PVCap, and VIMA) to a hydrate surface is estimated with molecular dynamic simulations. One key feature of this proposed mechanism is that the binding of an inhibitor molecule to the surface of an ensuing hydrate crystal disrupts growth and therein crystallization. It is found through the molecular dynamic simulations that inhibitor molecules that experimentally exhibit better inhibition strength also have higher free energies of binding, an indirect confirmation of our proposed mechanism. Inhibitors increasing in effectiveness, PEO < PVP < PVCap < VIMA, have increasingly negative (exothermic) binding energies of -0.2 < -20.6 < -37.5 < -45.8 kcal/mol and binding free energies of increasing favorability (+0.4 approximately = +0.5 < -9.4 < -15.1 kcal/mol). Furthermore, the effect of an inhibitor molecule on the local liquid water structure under hydrate-forming conditions was examined and correlated to the experimental effectiveness of the inhibitors. Two molecular characteristics that lead to strongly binding inhibitors were found: (1) a charge distribution on the edge of the inhibitor that mimics the charge separation in the water molecules on the surface of the hydrate and (2) the congruence of the size of the inhibitor with respect to the available space at the hydrate-surface binding site. Equipped with this molecular-level understanding of the process of hydrate inhibition via low-dosage kinetic hydrate inhibitors we can design new, more effective inhibitor molecules.

Adiabatic Field-Free Alignment of Asymmetric Top Molecules with an Optical Centrifuge.

PubMed

Korobenko, A; Milner, V

2016-05-06

We use an optical centrifuge to align asymmetric top SO_{2} molecules by adiabatically spinning their most polarizable O-O axis. The effective centrifugal potential in the rotating frame confines the sulfur atoms to the plane of the laser-induced rotation, leading to the planar molecular alignment that persists after the molecules are released from the centrifuge. The periodic appearance of the full three-dimensional alignment, typically observed only with linear and symmetric top molecules, is also detected. Together with strong in-plane centrifugal forces, which bend the molecules by up to 10 deg, permanent field-free alignment offers new ways of controlling molecules with laser light.

Delocalization of frontier orbitals induced red emission for heptazine based thermally activated delayed fluorescence molecule: First-principles study

NASA Astrophysics Data System (ADS)

Kang, Yongxiang; Zhao, Liyun; Leng, Jiancai

2018-04-01

Design of red organic emitting molecules with characteristic of thermally activated delayed fluorescence (TADF) remains a great challenge. Here, electronic and optical properties of a series of multi-branched TADF molecules have been investigated based on the newly-proposed optimal Hartree-Fock percentage method. Results show that, though enlarging the delocalization of HOMO and LUMO, the emission wavelength is redshift. The designed red TADF molecule possesses smaller reorganization energy than these for reported molecules. This indicates the non-radiative energy consumption of excited state is small and effective luminescence can be expected. Thus, a promising red thermally activated delayed fluorescence molecule is proposed.

Montreal-Toulouse Language Assessment Battery: evidence of criterion validity from patients with aphasia.

PubMed

Pagliarin, Karina Carlesso; Ortiz, Karin Zazo; Barreto, Simone dos Santos; Pimenta Parente, Maria Alice de Mattos; Nespoulous, Jean-Luc; Joanette, Yves; Fonseca, Rochele Paz

2015-10-15

The Montreal-Toulouse Language Assessment Battery - Brazilian version (MTL-BR) provides a general description of language processing and related components in adults with brain injury. The present study aimed at verifying the criterion-related validity of the Montreal-Toulouse Language Assessment Battery - Brazilian version (MTL-BR) by assessing its ability to discriminate between individuals with unilateral brain damage with and without aphasia. The investigation was carried out in a Brazilian community-based sample of 104 adults, divided into four groups: 26 participants with left hemisphere damage (LHD) with aphasia, 25 participants with right hemisphere damage (RHD), 28 with LHD non-aphasic, and 25 healthy adults. There were significant differences between patients with aphasia and the other groups on most total and subtotal scores on MTL-BR tasks. The results showed strong criterion-related validity evidence for the MTL-BR Battery, and provided important information regarding hemispheric specialization and interhemispheric cooperation. Future research is required to search for additional evidence of sensitivity, specificity and validity of the MTL-BR in samples with different types of aphasia and degrees of language impairment. Copyright © 2015 Elsevier B.V. All rights reserved.

Gold-mercaptopropionic acid-polyethylenimine composite based DNA sensor for early detection of rheumatic heart disease.

PubMed

Singh, Swati; Kaushal, Ankur; Khare, Shashi; Kumar, Pradeep; Kumar, Ashok

2014-07-21

The first gold-mercaptopropionic acid-polyethylenimine composite based electrochemical DNA biosensor was fabricated for the early detection of Streptococcus pyogenes infection in humans causing rheumatic heart disease (heart valve damage). No biosensor is available for the detection of rheumatic heart disease (RHD). Therefore, the mga gene based sensor was developed by the covalent immobilization of a 5'-carboxyl modified single stranded DNA probe onto the gold composite electrode. The immobilized probe was hybridized with the genomic DNA (G-DNA) of S. pyogenes from throat swabs and the electrochemical response was measured by cyclic voltammetry (CV), differential pulse voltammetry (DPV) and electrochemical impedance (EI). Covalent immobilization of the probe onto the gold composite and its hybridization with G-DNA was characterized by FTIR and SEM. The sensitivity of the sensor was 110.25 μA cm(-2) ng(-1) with DPV and the lower limit of detection was 10 pg per 6 μL. The sensor was validated with patient throat swab samples and results were compared with available methods. The sensor is highly specific to S. pyogenes and can prevent damage to heart valves by the early detection of the infection in only 30 min.

Charge Transfer Effect on Raman and Surface Enhanced Raman Spectroscopy of Furfural Molecules.

PubMed

Wan, Fu; Shi, Haiyang; Chen, Weigen; Gu, Zhaoliang; Du, Lingling; Wang, Pinyi; Wang, Jianxin; Huang, Yingzhou

2017-08-02

The detection of furfural in transformer oil through surface enhanced Raman spectroscopy (SERS) is one of the most promising online monitoring techniques in the process of transformer aging. In this work, the Raman of individual furfural molecules and SERS of furfural-M x (M = Ag, Au, Cu) complexes are investigated through density functional theory (DFT). In the Raman spectrum of individual furfural molecules, the vibration mode of each Raman peak is figured out, and the deviation from experimental data is analyzed by surface charge distribution. In the SERS of furfural-M x complexes, the influence of atom number and species on SERS chemical enhancement factors (EFs) are studied, and are further analyzed by charge transfer effect. Our studies strengthen the understanding of charge transfer effect in the SERS of furfural molecules, which is important in the online monitoring of the transformer aging process through SERS.

Charge Transfer Effect on Raman and Surface Enhanced Raman Spectroscopy of Furfural Molecules

PubMed Central

Wan, Fu; Shi, Haiyang; Chen, Weigen; Gu, Zhaoliang; Du, Lingling; Wang, Pinyi; Wang, Jianxin

2017-01-01

The detection of furfural in transformer oil through surface enhanced Raman spectroscopy (SERS) is one of the most promising online monitoring techniques in the process of transformer aging. In this work, the Raman of individual furfural molecules and SERS of furfural-Mx (M = Ag, Au, Cu) complexes are investigated through density functional theory (DFT). In the Raman spectrum of individual furfural molecules, the vibration mode of each Raman peak is figured out, and the deviation from experimental data is analyzed by surface charge distribution. In the SERS of furfural-Mx complexes, the influence of atom number and species on SERS chemical enhancement factors (EFs) are studied, and are further analyzed by charge transfer effect. Our studies strengthen the understanding of charge transfer effect in the SERS of furfural molecules, which is important in the online monitoring of the transformer aging process through SERS. PMID:28767053

A theoretical study of potentially observable chirality-sensitive NMR effects in molecules.

PubMed

Garbacz, Piotr; Cukras, Janusz; Jaszuński, Michał

2015-09-21

Two recently predicted nuclear magnetic resonance effects, the chirality-induced rotating electric polarization and the oscillating magnetization, are examined for several experimentally available chiral molecules. We discuss in detail the requirements for experimental detection of chirality-sensitive NMR effects of the studied molecules. These requirements are related to two parameters: the shielding polarizability and the antisymmetric part of the nuclear magnetic shielding tensor. The dominant second contribution has been computed for small molecules at the coupled cluster and density functional theory levels. It was found that DFT calculations using the KT2 functional and the aug-cc-pCVTZ basis set adequately reproduce the CCSD(T) values obtained with the same basis set. The largest values of parameters, thus most promising from the experimental point of view, were obtained for the fluorine nuclei in 1,3-difluorocyclopropene and 1,3-diphenyl-2-fluoro-3-trifluoromethylcyclopropene.

A whole organism screen identifies novel regulators of fat storage

PubMed Central

Lemieux, George A.; Liu, Jason; Mayer, Nasima; Bainton, Roland J.; Ashrafi, Kaveh; Werb, Zena

2011-01-01

The regulation of energy homeostasis integrates diverse biological processes ranging from behavior to metabolism and is linked fundamentally to numerous disease states. To identify new molecules that can bypass homeostatic compensatory mechanisms of energy balance in intact animals, we screened for small molecule modulators of C. elegans fat content. We report on several molecules that modulate fat storage without obvious deleterious effects on feeding, growth, and reproduction. A subset of these compounds also altered fat storage in mammalian and insect cell culture. We found that one of the newly identified compounds exerts its effects in C. elegans through a pathway that requires novel functions of an AMP-activated kinase catalytic subunit and a transcription factor previously unassociated with fat regulation. Thus, our strategy identifies small molecules that are effective within the context of intact animals and reveals relationships between new pathways that operate across phyla to influence energy homeostasis. PMID:21390037

Amino Acid-Assisted Incorporation of Dye Molecules within Calcite Crystals.

PubMed

Marzec, Bartosz; Green, David C; Holden, Mark A; Coté, Alexander S; Ihli, Johannes; Khalid, Saba; Kulak, Alexander; Walker, Daniel; Tang, Chiu; Duffy, Dorothy M; Kim, Yi-Yeoun; Meldrum, Fiona C

2018-05-23

Biomineralisation processes invariably occur in the presence of multiple organic additives, which act in combination to give exceptional control over structures and properties. However, few synthetic studies have investigated the cooperative effects of soluble additives. This work addresses this challenge and focuses on the combined effects of amino acids and coloured dye molecules. The experiments demonstrate that strongly coloured calcite crystals only form in the presence of Brilliant Blue R (BBR) and four of the seventeen soluble amino acids, as compared with almost colourless crystals using the dye alone. The active amino acids are identified as those which themselves effectively occlude in calcite, suggesting a mechanism where they can act as chaperones for individual molecules or even aggregates of dyes molecules. These results provide new insight into crystal-additive interactions and suggest a novel strategy for generating materials with target properties. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Stiffness, working stroke, and force of single-myosin molecules in skeletal muscle: elucidation of these mechanical properties via nonlinear elasticity evaluation.

PubMed

Kaya, Motoshi; Higuchi, Hideo

2013-11-01

In muscles, the arrays of skeletal myosin molecules interact with actin filaments and continuously generate force at various contraction speeds. Therefore, it is crucial for myosin molecules to generate force collectively and minimize the interference between individual myosin molecules. Knowledge of the elasticity of myosin molecules is crucial for understanding the molecular mechanisms of muscle contractions because elasticity directly affects the working and drag (resistance) force generation when myosin molecules are positively or negatively strained. The working stroke distance is also an important mechanical property necessary for elucidation of the thermodynamic efficiency of muscle contractions at the molecular level. In this review, we focus on these mechanical properties obtained from single-fiber and single-molecule studies and discuss recent findings associated with these mechanical properties. We also discuss the potential molecular mechanisms associated with reduction of the drag effect caused by negatively strained myosin molecules.

Effect of treatment with the antioxidant alpha-lipoic (thioctic) acid on heart and kidney microvasculature in spontaneously hypertensive rats.

PubMed

Tayebati, Seyed Khosrow; Tomassoni, Daniele; Di Cesare Mannelli, Lorenzo; Amenta, Francesco

2016-01-01

Endothelial cells represent an important vascular site of signaling and development of damage during ischemia, inflammation and other pathological conditions. Excessive reactive oxygen species production causes pathological activation of endothelium including exposure of cell to adhesion molecules. Intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1) and platelet-endothelial cell adhesion molecule-1 (PECAM-1) are members of the immunoglobulin super-family which are present on the surface of endothelial cells. These molecules represent important markers of endothelial inflammation. The present study was designed to investigate, with immunochemical and immunohistochemical techniques, the effect of treatment with (+/-)-alpha lipoic (thioctic) acid and its enantiomers on heart and kidney endothelium in spontaneously hypertensive rats (SHR). Arterial hypertension is accompanied by an increased oxidative stress status in the heart characterized by thiobarbituric acid reactive substances (TBARS) and nucleic acid oxidation increase. The higher oxidative stress also modifies adhesion molecules expression. In the heart VCAM-1, which was higher than ICAM-1 and PECAM-1, was increased in SHR. ICAM-1, VCAM-1 and PECAM-1 expression was significantly greater in the renal endothelium of SHR. (+/-)-Alpha lipoic acid and (+)-alpha lipoic acid treatment significantly decreased TBARS levels, the nucleic acid oxidation and prevented adhesion molecules expression in cardiac and renal vascular endothelium. These data suggest that endothelial molecules may be used for studying the mechanisms of vascular injury on target organs of hypertension. The effects observed after treatment with (+)-alpha lipoic acid could open new perspectives for countering heart and kidney microvascular injury which represent a common feature in hypertensive end-organs damage.

Cytotoxicity, oxidative stress and expression of adhesion molecules in human umbilical vein endothelial cells exposed to dust from paints with or without nanoparticles.

PubMed

Mikkelsen, Lone; Jensen, Keld A; Koponen, Ismo K; Saber, Anne T; Wallin, Håkan; Loft, Steffen; Vogel, Ulla; Møller, Peter

2013-03-01

Nanoparticles in primary form and nanoproducts might elicit different toxicological responses. We compared paint-related nanoparticles with respect to effects on endothelial oxidative stress, cytotoxicity and cell adhesion molecule expression. Primary human umbilical vein endothelial cells were exposed to primary nanoparticles (fine, photocatalytic or nanosized TiO(2), aluminium silicate, carbon black, nano-silicasol or axilate) and dust from sanding reference- or nanoparticle-containing paints. Most of the samples increased cell surface expressions of vascular cell adhesion molecule-1 (VCAM-1) and intracellular adhesion molecule-1 (ICAM-1), but paint sanding dust samples generally generated less response than primary particles of TiO(2) and carbon black. We found no relationship between the expression of adhesion molecules, cytotoxicity and production of reactive oxygen species. In conclusion, sanding dust from nanoparticle-containing paint did not generate more oxidative stress or expression of cell adhesion molecules than sanding dust from paint without nanoparticles, whereas the primary particles had the largest effect on mass basis.

Role of translational entropy in spatially inhomogeneous, coarse-grained models

NASA Astrophysics Data System (ADS)

Langenberg, Marcel; Jackson, Nicholas E.; de Pablo, Juan J.; Müller, Marcus

2018-03-01

Coarse-grained models of polymer and biomolecular systems have enabled the computational study of cooperative phenomena, e.g., self-assembly, by lumping multiple atomistic degrees of freedom along the backbone of a polymer, lipid, or DNA molecule into one effective coarse-grained interaction center. Such a coarse-graining strategy leaves the number of molecules unaltered. In order to treat the surrounding solvent or counterions on the same coarse-grained level of description, one can also stochastically group several of those small molecules into an effective, coarse-grained solvent bead or "fluid element." Such a procedure reduces the number of molecules, and we discuss how to compensate the concomitant loss of translational entropy by density-dependent interactions in spatially inhomogeneous systems.

Conformational, spectroscopic and nonlinear optical properties of biologically active N,N-dimethyltryptamine molecule: A theoretical study

NASA Astrophysics Data System (ADS)

Öner, Nazmiye; Tamer, Ömer; Avcı, Davut; Atalay, Yusuf

2014-12-01

The effective psychoactive properties of N,N-dimethyltryptamine (DMT) known as the near-death molecule have encouraged the imagination of many research disciplines for several decades. Although there is no theoretical study, a number of paper composed by experimental techniques have been reported for DMT molecule. In this study, the molecular modeling of DMT was carried out using B3LYP and HSEh1PBE levels of density functional theory (DFT). Our calculations showed that the energy gap between HOMO and LUMO is low, demonstrating that DMT is a biologically active molecule. Large hyperconjugation interaction energies imply that molecular charge transfer occurs in DMT. Moreover, NLO analysis indicates that DMT can be used an effective NLO material.

Symmetry of Carrier-Envelope Phase Difference Effects in Strong-Field, Few-Cycle Ionization of Atoms and Molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martiny, Christian Per Juul; Madsen, Lars Bojer

2006-09-01

In few-cycle pulses, the exact value of the carrier-envelope phase difference (CEPD) has a pronounced influence on the ionization dynamics of atoms and molecules. We show that, for atoms in circularly polarized light, a change in the CEPD is mapped uniquely to an overall rotation of the system, and results for arbitrary CEPD are obtained by rotation of the results from a single calculation with fixed CEPD. For molecules, this is true only for linear molecules aligned parallel with the propagation direction of the field. The effects of CEPD are classified as geometric or nongeometric. The observations are exemplified bymore » strong-field calculations on hydrogen.« less

Magnetoconductivity and magnetoluminescence studies in bipolar and almost hole-only sandwich devices made from films of a π-conjugated molecule

PubMed Central

Duc Nguyen, Tho; Sheng, Yugang; Rybicki, James E; Wohlgenannt, Markus

2008-01-01

We present magnetoconductivity and magnetoluminescence measurements in sandwich devices made from films of a π-conjugated molecule and demonstrate effects of more than 30 and 50% magnitude, respectively, in fields of 100 mT at room-temperature. It has previously been recognized that the effect is caused by hyperfine coupling, and that it is phenomenologically similar to other magnetic field effects that act on electron–hole pairs, which are well-known in spin-chemistry. However, we show that the very large magnitude of the effect contradicts present knowledge of the electron–hole pair recombination processes in electroluminescent π-conjugated molecules, and that the effect persists even in almost hole-only devices. Therefore, this effect is likely caused by the interaction of radical pairs of equal charge. PMID:27877957

Photobleaching effect in azo-dye containing epoxy resin films: the potentiality of carbon nanotubes as azo-dye dispensers

NASA Astrophysics Data System (ADS)

Díaz Costanzo, Guadalupe; Goyanes, Silvia; Ledesma, Silvia

2015-04-01

Azo-dye molecules may suffer from bleaching under certain illumination conditions. When this photoinduced process occurs, it generates an irreversible effect that is characterized by the loss of absorption of the dye molecule. Moreover, the well-known isomerization of azodye molecules does not occur anymore. In this work it is shown how the addition of a small amount of multi-walled carbon nanotubes (MWCNTs) helps to decrease the bleaching effect in a photosensitive guest-host azo-polymer film. Two different systems were fabricated using an epoxy resin as polymer matrix. An azo-dye, Disperse Orange 3, was used as photosensitive material in both systems and MWCNTs were added into one of them. The optical response of the polymeric systems was studied considering the degree of photoinduced birefringence. Photobleaching of the azo-dye was observed in all cases however, the effect is lower for the composite material containing 0.2 wt % MWCNTs. The weak interaction between MWCNTs and dye molecules is less favorable when the material is heated. The optical behavior of the heated composite material suggests that carbon nanotubes can be potentially used as azo dye dispensers. The results are interpreted in terms of the non-covalent interaction between azo-dye molecules and MWCNTs.

Spectroscopy and Chemistry of Cold Molecules

NASA Astrophysics Data System (ADS)

Momose, Takamasa

2012-06-01

Molecules at low temperatures are expected to behave quite differently from those at high temperatures because pronounced quantum effects emerge from thermal averages. Even at 10 K, a significant enhancement of reaction cross section is expected due to tunneling and resonance effects. Chemistry at this temperature is very important in order to understand chemical reactions in interstellar molecular clouds. At temperatures lower than 1 K, collisions and intermolecular interactions become qualitatively different from those at high temperatures because of the large thermal de Broglie wavelength of molecules. Collisions at these temperatures must be treated as the interference of molecular matter waves, but not as hard sphere collisions. A Bose-Einstein condensate is a significant state of matter as a result of coherent matter wave interaction. Especially, dense para-H_2 molecules are predicted to become a condensate even around 1 K. A convenient method to investigate molecules around 1 K is to dope molecules in cold matrices. Among various matrices, quantum hosts such as solid para-H_2 and superfluid He nano-droplets have been proven to be an excellent host for high-resolution spectroscopy. Rovibrational motion of molecules in these quantum hosts is well quantized on account of the weak interactions and the softness of quantum environment. The linewidths of infrared spectra of molecules in the quantum hosts are extremely narrow compared with those in other matrices. The sharp linewidths allow us to resolve fine spectral structures originated in subtle interactions between guest and host molecules. In this talk, I will describe how the splitting and lineshape of high-resolution spectra of molecules in quantum hosts give us new information on the static and dynamical interactions of molecules in quantum medium. The topics include dynamical response of superfluid environment upon rotational excitation, and possible superfluid phase of para-H_2 clusters. I will also describe our current efforts to make free cold molecules for the study of cold chemistry.

The Synthesis and Photophysical Characterization of Porphyrin Photoactive Materials for Use as Sensitizers in Organic Photovoltaics and Photodynamic Therapy

NASA Astrophysics Data System (ADS)

Marin, Dawn Marie

Solar energy conversion and photodynamic therapy (PDT) are very different applications. However, both utilize very similar photoactive molecules called porphyrins. Porphyrins are structural analogs of chlorophyll and also function as prosthetic groups in some biological enzymes. Understanding the structure/function relationship of these molecules is crucial for enhancing the energy generation efficiency of molecular solar cells and improving chemotherapeutic activity in PDT. In this dissertation, two approaches were applied with the goal of increasing the efficiency of molecular semiconductors for these applications: the heavy atom effect and donor-acceptor molecules. We enhanced the efficiency of triplet excited state formation and singlet oxygen generation for porphyrin sensitizers using the heavy atom effect. The heavy atom effect induces spin-orbit coupling to promote intersystem crossing into the triplet state. In this study, a carbomethoxyphenyl substituent was replaced with either a bromophenyl or an iodophenyl substituent on 5,10,15,20-tetrakis(4-carbomethoxyphenyl)porphyrin. The longer lifetimes obtained from the increase in the triplet excited state allow for longer exciton diffusion lengths and lower recombination rates in photovoltaics. Also, the enhanced intersystem crossing is beneficial for photodynamic therapy because it increases singlet oxygen generation, which destroys tumor cells. Optimizing photovoltaic performance and PDT efficacy can also be accomplished with donor-acceptor molecules because they have extended electronic pi bond delocalization across the molecule, which causes the molecule to absorb longer wavelengths of light. Donor-acceptor molecules should produce photovoltaic devices that absorb more of the solar spectrum and produce sensitizers that absorb wavelengths of light that can penetrate through tissues. Donor-acceptor molecules were synthesized using 5,15-bis(4-carbomethoxyphenyl)porphyrin as the acceptor and thiazolo[5,4-d]thiazole derivatives as the donor. The excited state dynamics of the heavy atom derivatives and donor-acceptor molecules were studied using UV-vis spectroscopy, steady-state emission, time-resolved and delayed photoluminescence.

Effect of chain length on binding of fatty acids to Pluronics in microemulsions.

PubMed

James-Smith, Monica A; Shekhawat, Dushyant; Cheung, Sally; Moudgil, Brij M; Shah, Dinesh O

2008-03-15

We investigated the effect of fatty acid chain length on the binding capacity of drug and fatty acid to Pluronic F127-based microemulsions. This was accomplished by using turbidity experiments. Pluronic-based oil-in-water microemulsions of various compositions were synthesized and titrated to turbidity with concentrated Amitriptyline, an antidepressant drug. Sodium salts of C(8), C(10), or C(12) fatty acid were used in preparation of the microemulsion and the corresponding binding capacities were observed. It has been previously determined that, for microemulsions prepared with sodium caprylate (C(8) fatty acid soap), a maximum of 11 fatty acid molecules bind to the microemulsion per 1 molecule of Pluronic F127 and a maximum of 12 molecules of Amitriptyline bind per molecule of F127. We have found that with increasing the chain length of the fatty acid salt component of the microemulsion, the binding capacity of both the fatty acid and the Amitriptyline to the microemulsion decreases. For sodium salts of C(8), C(10) and C(12) fatty acids, respectively, a maximum of approximately 11, 8.4 and 8.3 molecules of fatty acid molecules bind to 1 Pluronic F127 molecule. We propose that this is due to the decreasing number of free monomers with increasing chain length. As chain length increases, the critical micelle concentration (cmc) decreases, thus leading to fewer monomers. Pluronics are symmetric tri-block copolymers consisting of propylene oxide (PO) and ethylene oxide (EO). The polypropylene oxide block, PPO is sandwiched between two polyethylene oxide (PEO) blocks. The PEO blocks are hydrophilic while PPO is hydrophobic portion in the Pluronic molecule. Due to this structure, we propose that the fatty acid molecules that are in monomeric form most effectively diffuse between the PEO "tails" and bind to the hydrophobic PPO groups.

Self-consistent field calculations of conductance through conjugated molecules at finite bias

NASA Astrophysics Data System (ADS)

Paulsson, Magnus; Stafström, Sven

2001-03-01

Conductance through conjugated molecules have previously been calculated for a large number of systems using the Landauer formula but only a few calculations have included charging effects. In this study we present calculations in the mean field approximation of the conductance of metal-molecule-metal systems using two different kinds of molecules for a large number of configurations and applied biases. The molecules are described in the Pariser-Parr Pople model. Current-voltage (I-V) characteristics and charge distribution of the molecule connected by one dimensional leads to reservoirs is solved within the Hartree-Fock approximation. Charging of the molecule occurs when the chemical potential of the reservoirs approach the resonant tunneling levels. The ensuing potential difference, due to the charging, shifts the tunneling peaks which affects the I-V curves considerably. Asymmetrical interaction with the metal leads, e.g. molecule on a metal surface contacted with an STM-tip, also give asymmetrical I-V curves where the potential of the molecule is shown to more closely follow the potential of the surface. Negative differential conductance is discussed in systems consisting of two weakly coupled molecules.

Nonadiabatic effects in ultracold molecules via anomalous linear and quadratic Zeeman shifts.

PubMed

McGuyer, B H; Osborn, C B; McDonald, M; Reinaudi, G; Skomorowski, W; Moszynski, R; Zelevinsky, T

2013-12-13

Anomalously large linear and quadratic Zeeman shifts are measured for weakly bound ultracold 88Sr2 molecules near the intercombination-line asymptote. Nonadiabatic Coriolis coupling and the nature of long-range molecular potentials explain how this effect arises and scales roughly cubically with the size of the molecule. The linear shifts yield nonadiabatic mixing angles of the molecular states. The quadratic shifts are sensitive to nearby opposite f-parity states and exhibit fourth-order corrections, providing a stringent test of a state-of-the-art ab initio model.

Tailoring the interface using thiophene small molecules in TiO2/P3HT hybrid solar cells.

PubMed

Freitas, Flavio S; Clifford, John N; Palomares, Emilio; Nogueira, Ana F

2012-09-14

In this paper we focus on the effect of carboxylated thiophene small molecules as interface modifiers in TiO(2)/P3HT hybrid solar cells. Our results show that small differences in the chemical structure of these molecules, for example, the presence of the -CH(2)- group in the 2-thiopheneacetic acid (TAA), can greatly increase the TiO(2) surface wettability, improving the TiO(2)/polymer contact. This effect is important to enhance exciton splitting and charge separation.

Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).

PubMed

Schneider, Uffe Vest

2012-01-01

This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA molecules and other nucleic acid stabilizing molecules can increase analytical sensitivity whilst maintaining nucleobase mismatch discrimination in triplex helix based diagnostic assays.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Xuan; Deeb, Claire; Kostcheev, Sergei

We report a self-developing anisotropic gold/polymer hybrid nanosystem that precisely places dye molecules at the plasmonic hotspot of metal nanostructures for sensing and photonics applications. Unlike conventional molecule-particle configurations, the anisotropic hybrid nanosystem (AHN) introduces an anisotropic spatial distribution of dye-containing active medium. This allows us to precisely overlap the near-field spatial distribution with the active medium and rule out the contribution from the background molecules. This overlap effect selectively highlights the optical response of the molecules of interest, i.e., molecules located at the hotspots. Our AHN consists of gold nanodimers whose gaps have been filled with methylene blue molecules.more » They have been studied by plasmon-enhanced Raman spectroscopy as a probing tool. The AHN opens new doors not only for fundamental studies and photonics applications of molecule-particle interactions, but also for molecular trapping methods at the nanoscale.« less

Absorption of CO2 on Carbon-based Sensors: First-Principle Analysis

NASA Astrophysics Data System (ADS)

Tit, Nacir; Elezzi, Mohammed; Abdullah, Hasan; Bahlouli, Hocine; Yamani, Zain

We present first-principle investigation of the adsorption properties of CO and CO2 molecules on both graphene and carbon nano-tubes (CNTs) in presence of metal catalysis, mainly iron (Fe). The relaxations were carried out using the self-consistent-charge density-functional tight-binding (SCC-DFTB) code in neglect of heat effects. The results show the following: (1) Defected graphene is found to have high sensitivity and high selectivity towards chemisorption of CO molecules and weak physisorption with CO2 molecules. (2) In case of CNTs, the iron ``Fe'' catalyst plays an essential role in capturing CO2 molecules. The Fe ad-atoms on the surface of CNT introduce huge density of states at Fermi level, but the capture of CO2 molecules would reduce that density and consequently reduce conductivity and increase sensitivity. Concerning the selectivity, we have studied the sensitivity versus various gas molecules (such as: O2, N2, H2, H2O, and CO). Furthermore, to assess the effect of catalysis on sensitivity, we have studied the sensitivity of other metal catalysts (such as: Ni, Co, Ti, and Sc). We found that CNT-Fe is highly sensitive and selective towards detection of CO and CO2 molecules. CNT being conductive or semiconducting does not matter much on the adsorption properties.

Antibody-enabled small-molecule drug discovery.

PubMed

Lawson, Alastair D G

2012-06-29

Although antibody-based therapeutics have become firmly established as medicines for serious diseases, the value of antibodies as tools in the early stages of small-molecule drug discovery is only beginning to be realized. In particular, antibodies may provide information to reduce risk in small-molecule drug discovery by enabling the validation of targets and by providing insights into the design of small-molecule screening assays. Moreover, antibodies can act as guides in the quest for small molecules that have the ability to modulate protein-protein interactions, which have traditionally only been considered to be tractable targets for biological drugs. The development of small molecules that have similar therapeutic effects to current biologics has the potential to benefit a broader range of patients at earlier stages of disease.

Effect of hydration on the stability of fullerene-like silica molecules

NASA Astrophysics Data System (ADS)

Filonenko, O. V.; Lobanov, V. V.

2011-05-01

The hydration of fullerene-like silica molecules was studied by the density functional method (exchange-correlation functional B3LYP, basis set 6-31G**). It was demonstrated that completely coordinated structures transform to more stable hydroxylated ones during hydrolysis. These in turn react with H2O molecules with the formation of hydrogen bonds.

Effects of the surroundings and conformerisation of n-dodecane molecules on evaporation/condensation processes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gun’ko, Vladimir M.; Sir Harry Ricardo Laboratories, School of Computing, Engineering and Mathematics, University of Brighton, Cockcroft Building, Lewes Road, Brighton BN2 4GJ; Nasiri, Rasoul

2015-01-21

The evaporation/condensation coefficient (β) and the evaporation rate (γ) for n-dodecane vs. temperature, gas pressure, gas and liquid density, and solvation effects at a droplet surface are analysed using quantum chemical density functional theory calculations of several ensembles of conformers of n-dodecane molecules in the gas phase (hybrid functional ωB97X-D with the cc-pVTZ and cc-pVDZ basis sets) and in liquid phase (solvation method: SMD/ωB97X-D). It is shown that β depends more strongly on a number of neighbouring molecules interacting with an evaporating molecule at a droplet surface (this number is estimated through changes in the surface Gibbs free energy ofmore » solvation) than on pressure in the gas phase or conformerisation and cross-conformerisation of molecules in both phases. Thus, temperature and the surrounding effects at droplet surfaces are the dominant factors affecting the values of β for n-dodecane molecules. These values are shown to be similar (at reduced temperatures T/T{sub c} < 0.8) or slightly larger (at T/T{sub c} > 0.8) than the values of β calculated by the molecular dynamics force fields (MD FF) methods. This endorses the reliability of the previously developed classical approach to estimation of β by the MD FF methods, except at temperatures close to the critical temperature.« less

A mathematical model for DNA

NASA Astrophysics Data System (ADS)

Sepehri, Alireza

Recently, some authors have shown that a DNA molecule produces electromagnetic signals and communicates with other DNA molecules or other molecules. In fact, a DNA acts like a receiver or transmitter of radio waves. In this paper, we suggest a mathematical model for the DNA molecule and use of its communication to cure some diseases like cancer. In this model, first, by using concepts from string theory and M-theory, we calculate the energy of a DNA in terms of interactions between free electrons and bound electrons. We show that when a DNA is damaged, its energy changes and an extra current is produced. This extra current causes the electromagnetic signals of a damaged DNA molecule to be different when compared to the electromagnetic signals of a normal DNA molecule. The electromagnetic signals of a damaged DNA molecule induce an extra current in a normal DNA molecule and lead to its destruction. By sending crafted electromagnetic signals to normal DNA molecules and inducing an opposite current with respect to this extra current, we can prevent the destruction of normal DNA. Finally, we argue that the type of packing of DNA in chromosomes of men and women is different. This causes radiated waves from DNAs of men and women to have opposite signs and cancel the effect of each other in a pair. Using this property, we suggest another mechanism to cancel the effect of extra waves, which are produced by DNAs in cancer cells of a male or a female, by extra waves which are produced by DNAs in similar cells of a female or a male and prevent the progression of the disease.

Distribution of pericellular matrix molecules in the temporomandibular joint and their chondroprotective effects against inflammation

PubMed Central

Chu, Wern Cui; Zhang, Shipin; Sng, Timothy J; Ong, Yu Jie; Tan, Wen-Li; Ang, Vivien Y; Foldager, Casper B; Toh, Wei Seong

2017-01-01

The objectives of this study were to (1) determine the distribution and synthesis of pericellular matrix (PCM) molecules (collagen VI, collagen IV and laminin) in rat temporomandibular joint (TMJ) and (2) investigate the effects of PCM molecules on chondrocytes against inflammation in osteoarthritis. Four zones (fibrous, proliferating, mature and hypertrophic) of condylar cartilage and three bands (anterior, intermediate and posterior) of disc were analysed by immunohistochemistry for the presence of PCM molecules in rat TMJs. Isolated chondrocytes were pre-treated with PCM molecules before being subjected to interleukin (IL)-1β treatment to stimulate inflammation. The responses of the chondrocytes were analysed using gene expression, nitric oxide release and matrix metalloproteinase (MMP)-13 production measures. Histomorphometric analyses revealed that the highest areal deposition of collagen VI (67.4%), collagen IV (45.7%) and laminin (52.4%) was in the proliferating zone of TMJ condylar cartilage. No significant difference in the distribution of PCM molecules was noted among the three bands of the TMJ disc. All three PCM molecules were expressed intracellularly by chondrocytes cultured in the monolayer. Among the PCM molecules, pre-treatment with collagen VI enhanced cellular proliferation, ameliorated IL-1β-induced MMP-3, MMP-9, MMP-13 and inducible nitric oxide synthase gene expression, and attenuated the downregulation of cartilage matrix genes, including collagen I, aggrecan and cartilage oligomeric matrix protein (COMP). Concurrently, collagen VI pretreatment inhibited nitric oxide and MMP-13 production. Our study demonstrates for the first time the distribution and role of PCM molecules, particularly collagen VI, in the protection of chondrocytes against inflammation. PMID:28282029

Salting effects on protein components in aqueous NaCl and urea solutions: toward understanding of urea-induced protein denaturation.

PubMed

Li, Weifeng; Zhou, Ruhong; Mu, Yuguang

2012-02-02

The mechanism of urea-induced protein denaturation is explored through studying the salting effect of urea on 14 amino acid side chain analogues, and N-methylacetamide (NMA) which mimics the protein backbone. The solvation free energies of the 15 molecules were calculated in pure water, aqueous urea, and NaCl solutions. Our results show that NaCl displays strong capability to salt out all 15 molecules, while urea facilitates the solvation (salting-in) of all the 15 molecules on the other hand. The salting effect is found to be largely enthalpy-driven for both NaCl and urea. Our observations can explain the higher stability of protein's secondary and tertiary structures in typical salt solutions than that in pure water. Meanwhile, urea's capability to better solvate protein backbone and side-chain components can be extrapolated to explain protein's denaturation in aqueous urea solution. Urea salts in molecules through direct binding to solute surface, and the strength is linearly dependent on the number of heavy atoms of solute molecules. The van der Waals interactions are found to be the dominant force, which challenges a hydrogen-bonding-driven mechanism proposed previously.

Effect of laser irradiation on the functional activity of enzymes with different structural complexity

NASA Astrophysics Data System (ADS)

Ostrovtsova, Svetlana A.; Volodenkov, Alexander P.; Maskevich, Alexander A.; Artsukevich, Irina M.; Anufrik, Slavomir S.; Makarchikov, Alexander F.; Chernikevich, Ivan P.; Stepuro, Vitali I.

1998-05-01

Three enzymes differing in their structural composition were irradiated by UV lasers to study the effect of temperature, protein concentration and addition of small molecules on their sensitivity to radiation exposure. The laser-induced effects were due to the structural complexity of the protein molecules and depended on the dose applied, the wavelength and the density of irradiation. The multi-enzyme 2- oxoglutarate dehydrogenase complex was subjected to pronounced irradiation-induced changes whereas the response of the two other enzymes was less significant. Reduction of the protein levels in irradiated samples was important under the XeCl laser coercion and the effects depended on the doses applied. The laser irradiation effects are suggested to be realized by means of conformational changes in the protein molecules and intermolecular association- dissociation processes.

Inhibitory effects of clotrimazole on TNF-alpha-induced adhesion molecule expression and angiogenesis.

PubMed

Thapa, Dinesh; Lee, Jong Suk; Park, Min-A; Cho, Mi-Yeon; Park, Young-Joon; Choi, Han Gon; Jeong, Tae Cheon; Kim, Jung-Ae

2009-04-01

Cell adhesion molecules play a pivotal role in chronic inflammation and pathological angiogenesis. In the present study, we investigated the inhibitory effects of clotrimazole (CLT) on tumor necrosis factor (TNF)-alpha-induced changes in adhesion molecule expression. CLT dose-dependently inhibited monocyte chemoattractant protein-1 (MCP-1), intercellular cell adhesion molecule-1 (ICAM-1), and vascular cell adhesion molecule-1 (VCAM-1) expressions in TNF-alpha-stimulated HT29 colonic epithelial cells. This inhibitory action of CLT correlated with a significant reduction in TNF-alpha-induced adhesion of monocytes to HT29 cells, which was comparable to the inhibitory effects of anti-ICAM-1 and VCAM-1 monoclonal antibodies on monocyte-epithelial adhesion. These inhibitory actions of CLT were, at least in part, attributable to the inhibition of redox sensitive NF-kappaB activation, as CLT inhibited TNF-alpha-induced ROS generation as well as NF-kappaB nuclear translocation and activation in HT29 cells. Furthermore, the inhibition of TNF-alpha-induced monocyte adhesion was also mimicked by the specific NF-kappaB inhibitor, pyrrolidine dithiocarbamate (PDTC). Inflammatory mediators including TNF-alpha have known to promote angiogenesis, which in turn further contributes to inflammatory pathology. Therefore, we additionally evaluated whether CLT modulates TNF-alpha-induced angiogenesis using in vivo chick chorioallantoic membrane (CAM) assay. The CAM assay showed that CLT dose-dependently attenuated TNF-alpha-induced angiogenesis, and the effect was correlated with decreased inflammation of the CAM tissue. In conclusion, our results suggest that CLT can inhibit TNF-alpha-triggered expression of adhesion molecules, ICAM-1 and VCAM-1, and angiogenesis during inflammation.

DNA-psoralen interaction: a single molecule experiment.

PubMed

Rocha, M S; Viana, N B; Mesquita, O N

2004-11-15

By attaching one end of a single lambda-DNA molecule to a microscope coverslip and the other end to a polystyrene microsphere trapped by an optical tweezers, we can study the entropic elasticity of the lambda-DNA by measuring force versus extension as we stretch the molecule. This powerful method permits single molecule studies. We are particularly interested in the effects of the photosensitive drug psoralen on the elasticity of the DNA molecule. We have illuminated the sample with different light sources, studying how the different wavelengths affect the psoralen-DNA linkage. To do this, we measure the persistence length of individual DNA-psoralen complexes.

Tunneling electron induced chemisorption of copper phthalocyanine molecules on the Cu(111) surface

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stock, T.; Nogami, J.

2014-02-17

The adsorption of up to one monolayer (ML) of copper phthalocyanine (CuPc) molecules on a room temperature Cu(111) surface has been studied using scanning tunneling microscopy (STM). Below 1 ML the molecules are in a fluid state and are highly mobile on the surface. At 1 ML coverage the molecules coalesce into a highly ordered 2D crystal phase. At sub-ML coverages, chemisorption of individual CuPc molecules can be induced through exposure to tunneling electrons at a tunneling bias voltage exceeding a threshold value. This tunneling electron induced effect has been exploited to perform molecular STM lithography.

Understanding the influence of external perturbation on aziridinium ion formation

NASA Astrophysics Data System (ADS)

Sinha, Sourab; Bhattacharyya, Pradip Kr

2018-01-01

A density functional theory study is performed to understand the effect of discrete water molecules during Az+ ion formation in nitrogen mustards. A comparative study in gas phase, and implicit and explicit solvation models of three drug molecules (mustine, chlorambucil and melphalan) is reported. Noteworthy changes in the structure and C-N stretching frequencies of the transition states have been observed in the presence of explicit water molecules. Presence of explicit water molecules reduces the positive charge around the tricyclic Az+ ring, and hence stabilising it. Both activation energy and rate constants are seen to be significantly affected in the presence of discrete water molecules.

Conformational, spectroscopic and nonlinear optical properties of biologically active N,N-dimethyltryptamine molecule: a theoretical study.

PubMed

Öner, Nazmiye; Tamer, Ömer; Avcı, Davut; Atalay, Yusuf

2014-12-10

The effective psychoactive properties of N,N-dimethyltryptamine (DMT) known as the near-death molecule have encouraged the imagination of many research disciplines for several decades. Although there is no theoretical study, a number of paper composed by experimental techniques have been reported for DMT molecule. In this study, the molecular modeling of DMT was carried out using B3LYP and HSEh1PBE levels of density functional theory (DFT). Our calculations showed that the energy gap between HOMO and LUMO is low, demonstrating that DMT is a biologically active molecule. Large hyperconjugation interaction energies imply that molecular charge transfer occurs in DMT. Moreover, NLO analysis indicates that DMT can be used an effective NLO material. Copyright © 2014 Elsevier B.V. All rights reserved.

Acenes, Heteroacenes and Analogous Molecules for Organic Photovoltaic and Field Effect Transistor Applications

NASA Astrophysics Data System (ADS)

Granger, Devin Benjamin

Polycyclic aromatic hydrocarbons composed of benzenoid rings fused in a linear fashion comprise the class of compounds known as acenes. The structures containing three to six ring fusions are brightly colored and possess band gaps and charge transport efficiencies sufficient for semiconductor applications. These molecules have been investigated throughout the past several decades to assess their optoelectronic properties. The absorption, emission and charge transport properties of this series of molecules has been studied extensively to elucidate structure-property relationships. A wide variety of analogous molecules, incorporating heterocycles in place of benzenoid rings, demonstrate similar properties to the parent compounds and have likewise been investigated. Functionalization of acene compounds by placement of groups around the molecule affects the way in which molecules interact in the solid state, in addition to the energetics of the molecule. The use of electron donating or electron withdrawing groups affects the frontier molecular orbitals and thus affects the optical and electronic gaps of the molecules. The use of bulky side groups such as alkylsilylethynyl groups allows for crystal engineering of molecular aggregates, and changing the volume and dimensions of the alkylsilyl groups affects the intermolecular interactions and thus changes the packing motif. In chapter 2, a series of tetracene and pentacene molecules with strongly electron withdrawing groups is described. The investigation focuses on the change in energetics of the frontier molecular orbitals between the base acene and the nitrile and dicyanovinyl derivatives as well as the differences between the pentacene and tetracene molecules. The differences in close packing motifs through use of bulky alkylsilylethynyl groups is also discussed in relation to electron acceptor material design and bulk heterojunction organic photovoltaic characteristics. Chapter 3 focuses on molecular acceptor and donor molecules for bulk heterojunction organic photovoltaics based on anthrathiophene and benzo[1,2-b:4,5-b']dithiophene central units like literature molecules containing fluorene and dithieno[2,3-b:2',3'-d]silole cores. The synthetic strategies of developing reduced symmetry benzo[1,2-b:4,5-b']dithiophene to study the effect of substitution around the central unit is also described. The optical and electronic properties of the donors and acceptors are described along with the performance and characteristics of devices employing these molecules. The final two data chapters focus on new nitrogen containing polycyclic hydrocarbons containing indolizine and (2.2.2) cyclazine units. The optical, electronic and other physical properties of these molecules are explored, in addition to the synthetic strategies for incorporating the indolizine and cyclazine units. By use of alkylsilylethynyl groups, crystal engineering was investigated for the benzo[2,3-b:5,6-b']diindolizine chromophore described in chapter 4 to target the 2-D "brick-work" packing motif for application in field effect transistor devices. Optical and electronic properties of the cyclazine end-capped acene molecules described in chapter 5 were investigated and described in relation to the base acene molecules. In both cases, density functional theory calculations were conducted to better understand unexpected optical properties of these molecules, which are like the linear acene series despite the non-linear attachment.

The coffee diterpene kahweol inhibits tumor necrosis factor-{alpha}-induced expression of cell adhesion molecules in human endothelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Hyung Gyun; Kim, Ji Young; Hwang, Yong Pil

2006-12-15

Endothelial cells produce adhesion molecules after being stimulated with various inflammatory cytokines. These adhesion molecules play an important role in the development of atherogenesis. Recent studies have highlighted the chemoprotective and anti-inflammatory effects of kahweol, a coffee-specific diterpene. This study examined the effects of kahweol on the cytokine-induced monocyte/human endothelial cell interaction, which is a crucial early event in atherogenesis. Kahweol inhibited the adhesion of TNF{alpha}-induced monocytes to endothelial cells and suppressed the TNF{alpha}-induced protein and mRNA expression of the cell adhesion molecules, VCAM-1 and ICAM-1. Furthermore, kahweol inhibited the TNF{alpha}-induced JAK2-PI3K/Akt-NF-{kappa}B activation pathway in these cells. Overall, kahweol hasmore » anti-inflammatory and anti-atherosclerotic activities, which occurs partly by down-regulating the pathway that affects the expression and interaction of the cell adhesion molecules on endothelial cells.« less

Study the Formation of H2, HD and D2 under Various Interstellar Conditions

NASA Astrophysics Data System (ADS)

Sahu, Dipen; Chakrabarti, Sandip Kumar; Das, Ankan

2016-07-01

Hydrogen is the most abundant molecule in the Interstellar medium (ISM). Formation of gas phase hydrogen molecule is inefficient; perhaps grain surface acts as a necessary ingredients for the formation of H_2 molecule. H atoms accrete on the grain surface, recombine there and desorb in the gas phase. Similarly, deuterium accretion on grain surfaces can produce simple dueterated molecules (HD and D_2) on the ISM. Unlike gas phase reactions, rate equations can not yield accurate result for grain surface reactions due to inherent randomness of surface species. We use Monte-Carlo method to follow this surface chemistry which effectively take care of this randomness. We use square grids and impose periodic boundary condition on them to mimic the spherical nature of grains. Various types of rough surfaces are considered to study the impact on effective production rates. We found that these simple but most important molecules are produced in low temperature (physisorption sites) as well as in high temperature (chemisorption sites) regions.

A solution-based single-molecule study of surface-bound PBIs: solvent-mediated environmental effects on molecular flexibility.

PubMed

Lee, Ji-Eun; Han, Ye Ri; Ham, Sujin; Jun, Chul-Ho; Kim, Dongho

2017-11-08

We have investigated the fundamental photophysical properties of surface-bound perylene bisimide (PBI) molecules in a solution-phase at the single-molecule level. By efficient immobilization of single PBIs on glass, we were able to simultaneously monitor fluorescence intensity trajectories, fluorescence lifetimes, and emission spectra of individual PBIs in organic and aqueous media using confocal microscopy. We showed that the fluorescence dynamics of single PBIs in the solution phase is highly dependent on their local and chemical environments. Furthermore, we visualized different spatial-fluctuations of surface-bound PBIs using defocused wide-field imaging. While PBIs show more steric flexibility in organic media, the flexible motion of PBI molecules in aqueous solution is relatively prohibited due to a cage effect by a hydrogen bonding network, which is previously unobserved. Our method opens up a new possibility to investigate the photophysical properties of multi-chromophoric systems in various solvents at the single-molecule level for developing optimal molecular devices such as water-proof devices.

Observation of Resonant Effects in Ultracold Collisions between Heteronuclear Feshbach Molecules

NASA Astrophysics Data System (ADS)

Ye, Xin; Wang, Fudong; Zhu, Bing; Guo, Mingyang; Lu, Bo; Wang, Dajun

2016-05-01

Magnetic field dependent dimer-dimer collisional losses are studied with ultracold 23 Na87 Rb Feshbach molecules. By ramping the magnetic field across the 347.8 G inter-species Feshbach resonance and removing residual atoms with a magnetic field gradient, ~ 8000 pure NaRb Feshbach molecules with a temperature below 1 μK are produced. By holding the pure molecule sample in a crossed optical dipole trap and measuring the time-dependent loss curves under different magnetic fields near the Feshbach resonance, the dimer-dimer loss rates with respect to the atomic scattering length a are mapped out. We observe a resonant feature at around a = 600a0 and a rising tail at above a = 1600a0 . This behavior resembles previous theoretical works on homonuclear Feshbach molecule, where resonant effects between dimer-dimer collisions tied to tetramer bound states were predicted. Our work shows the possibility of exploring four-body physics within a heteronuclear system. We are supported by Hong Kong RGC General Research Fund no. CUHK403813.

Single molecule tools for enzymology, structural biology, systems biology and nanotechnology: an update

PubMed Central

Widom, Julia R.; Dhakal, Soma; Heinicke, Laurie A.; Walter, Nils G.

2015-01-01

Toxicology is the highly interdisciplinary field studying the adverse effects of chemicals on living organisms. It requires sensitive tools to detect such effects. After their initial implementation during the 1990s, single-molecule fluorescence detection tools were quickly recognized for their potential to contribute greatly to many different areas of scientific inquiry. In the intervening time, technical advances in the field have generated ever-improving spatial and temporal resolution, and have enabled the application of single-molecule fluorescence to increasingly complex systems, such as live cells. In this review, we give an overview of the optical components necessary to implement the most common versions of single-molecule fluorescence detection. We then discuss current applications to enzymology and structural studies, systems biology, and nanotechnology, presenting the technical considerations that are unique to each area of study, along with noteworthy recent results. We also highlight future directions that have the potential to revolutionize these areas of study by further exploiting the capabilities of single-molecule fluorescence microscopy. PMID:25212907

Adsorption of squaraine molecules to Au(111) and Ag(001) surfaces

NASA Astrophysics Data System (ADS)

Luft, Maike; Groß, Boris; Schulz, Matthias; Lützen, Arne; Schiek, Manuela; Nilius, Niklas

2018-02-01

The adsorption of anilino squaraines, an important chromophore for the use in organic solar cells, to Ag(001) and Au(111) has been studied with scanning tunneling microscopy. Self-assembly into square building blocks with eight molecules per unit cell is revealed on the Ag surface, while no ordering effects occur on gold. The squaraine-silver interaction is mediated by the carbonyl and hydroxyl oxygens located in the center of the molecule. The intermolecular coupling, on the other hand, is governed by hydrogen bonds formed between the terminal isobutyl groups and oxygen species of adjacent molecules. The latter gets maximized by rotating the molecules by a few degrees against a perfect square alignment. A similar molecular pattern does not form on Au(111) due to symmetry mismatch. Moreover, the high electronegativity of gold reduces the directing effect of oxygen-metal bonds that trigger the ordering process on silver. As a consequence, only frustrated three-fold symmetric units that do not expand into an ordered molecular network are present on the gold surface.

Small molecules enhance CRISPR genome editing in pluripotent stem cells.

PubMed

Yu, Chen; Liu, Yanxia; Ma, Tianhua; Liu, Kai; Xu, Shaohua; Zhang, Yu; Liu, Honglei; La Russa, Marie; Xie, Min; Ding, Sheng; Qi, Lei S

2015-02-05

The bacterial CRISPR-Cas9 system has emerged as an effective tool for sequence-specific gene knockout through non-homologous end joining (NHEJ), but it remains inefficient for precise editing of genome sequences. Here we develop a reporter-based screening approach for high-throughput identification of chemical compounds that can modulate precise genome editing through homology-directed repair (HDR). Using our screening method, we have identified small molecules that can enhance CRISPR-mediated HDR efficiency, 3-fold for large fragment insertions and 9-fold for point mutations. Interestingly, we have also observed that a small molecule that inhibits HDR can enhance frame shift insertion and deletion (indel) mutations mediated by NHEJ. The identified small molecules function robustly in diverse cell types with minimal toxicity. The use of small molecules provides a simple and effective strategy to enhance precise genome engineering applications and facilitates the study of DNA repair mechanisms in mammalian cells. Copyright © 2015 Elsevier Inc. All rights reserved.

[Innovative application of small molecules to influence -pathogenicity of dental plaque].

PubMed

Janus, M M; Volgenant, C M C; Krom, B P

2018-05-01

Current preventive measures against infectious oral diseases are mainly focussed on plaque removal and promoting a healthy lifestyle. This in vitro study investigated a third preventive method: maintaining healthy dental plaque with the use of small molecules. As a model of dental plaque, in vitro biofilms were cultivated under conditions that induce pathogenic characteristics. The effect of erythritol and other small molecules on the pathogenic characteristics and bacterial composition of the biofilm was evaluated. The artificial sweetener erythritol and the molecule 3-Oxo-N-(2-oxycyclohexyl)dodecanamide (3-Oxo-N) had no clinically relevant effect on total biofilm formation. Erythritol did, however, lower the gingivitis related protease activity of the biofilm, while 3-Oxo-N blocked the caries related lactic acid accumulation. Furthermore, both substances ensured the biofilm maintained a young, non-pathogenic microbial composition. This shows it is possible to influence the dental plaque in a positive manner in vitro with the help of small molecules. Further research is necessary before this manipulation of dental plaque can be applied.

Effects of Acids, Bases, and Heteroatoms on Proximal Radial Distribution Functions for Proteins.

PubMed

Nguyen, Bao Linh; Pettitt, B Montgomery

2015-04-14

The proximal distribution of water around proteins is a convenient method of quantifying solvation. We consider the effect of charged and sulfur-containing amino acid side-chain atoms on the proximal radial distribution function (pRDF) of water molecules around proteins using side-chain analogs. The pRDF represents the relative probability of finding any solvent molecule at a distance from the closest or surface perpendicular protein atom. We consider the near-neighbor distribution. Previously, pRDFs were shown to be universal descriptors of the water molecules around C, N, and O atom types across hundreds of globular proteins. Using averaged pRDFs, a solvent density around any globular protein can be reconstructed with controllable relative error. Solvent reconstruction using the additional information from charged amino acid side-chain atom types from both small models and protein averages reveals the effects of surface charge distribution on solvent density and improves the reconstruction errors relative to simulation. Solvent density reconstructions from the small-molecule models are as effective and less computationally demanding than reconstructions from full macromolecular models in reproducing preferred hydration sites and solvent density fluctuations.

Low-temperature matrix effects on orientational motion of Methyl radical trapped in gas solids: Angular tunneling vs. libration

NASA Astrophysics Data System (ADS)

Dmitriev, Yurij A.; Zelenetckii, Ilia A.; Benetis, Nikolas P.

2018-05-01

EPR investigation of the lineshape of matrix -isolated methyl radical, CH3, spectra recorded in solid N2O and CO2 was carried out. Reversible temperature-dependent line width anisotropy was observed in both matrices. This effect is a fingerprint of the extra-slow radical rotation about the in-plane C2 axes. The rotation was found to be anisotropic and closely correlated to the orientational dynamics of the matrix molecules. It was suggested that a recently discovered "hoping precession" effect of matrix molecules in solid CO2 is a common feature of matrices of the linear molecules CO, N2O, and CO2. A new low-temperature matrix effect, referred to as "libration trap", was proposed which accounts for the changing CH3 reorientational motion about the radical C3-axis from rotation to libration. Temperature dependence of the intensity of the EPR satellites produced by these nonrotating-but librating methyls was presented. This allowed for a rough estimation of the rotation hindering potential due to correlation mismatch between the radical and the nearest matrix molecules' librations.

Liquid crystal-on-organic field-effect transistor sensory devices for perceptive sensing of ultralow intensity gas flow touch.

PubMed

Seo, Jooyeok; Park, Soohyeong; Nam, Sungho; Kim, Hwajeong; Kim, Youngkyoo

2013-01-01

We demonstrate liquid crystal-on-organic field-effect transistor (LC-on-OFET) sensory devices that can perceptively sense ultralow level gas flows. The LC-on-OFET devices were fabricated by mounting LC molecules (4-cyano-4'-pentylbiphenyl - 5CB) on the polymer channel layer of OFET. Results showed that the presence of LC molecules on the channel layer resulted in enhanced drain currents due to a strong dipole effect of LC molecules. Upon applying low intensity nitrogen gas flows, the drain current was sensitively increased depending on the intensity and time of nitrogen flows. The present LC-on-OFET devices could detect extremely low level nitrogen flows (0.7 sccm-11 μl/s), which could not be felt by human skins, thanks to a synergy effect between collective behavior of LC molecules and charge-sensitive channel layer of OFET. The similar sensation was also achieved using the LC-on-OFET devices with a polymer film skin, suggesting viable practical applications of the present LC-on-OFET sensory devices.

Spin dynamics in helical molecules with nonlinear interactions

NASA Astrophysics Data System (ADS)

Díaz, E.; Albares, P.; Estévez, P. G.; Cerveró, J. M.; Gaul, C.; Diez, E.; Domínguez-Adame, F.

2018-04-01

It is widely admitted that the helical conformation of certain chiral molecules may induce a sizable spin selectivity observed in experiments. Spin selectivity arises as a result of the interplay between a helicity-induced spin–orbit coupling (SOC) and electric dipole fields in the molecule. From the theoretical point of view, different phenomena might affect the spin dynamics in helical molecules, such as quantum dephasing, dissipation and the role of metallic contacts. With a few exceptions, previous studies usually neglect the local deformation of the molecule about the carrier, but this assumption seems unrealistic to describe charge transport in molecular systems. We introduce an effective model describing the electron spin dynamics in a deformable helical molecule with weak SOC. We find that the electron–lattice interaction allows the formation of stable solitons such as bright solitons with well defined spin projection onto the molecule axis. We present a thorough study of these bright solitons and analyze their possible impact on the spin dynamics in deformable helical molecules.

Intensity enhancement and selective detection of proximate solvent molecules by molecular near-field effect in resonance hyper-Raman scattering

NASA Astrophysics Data System (ADS)

Shimada, Rintaro; Kano, Hideaki; Hamaguchi, Hiro-o.

2008-07-01

A new molecular phenomenon associated with resonance hyper-Raman (HR) scattering in solution has been discovered. Resonance HR spectra of all-trans-β-carotene and all-trans-lycopene in various solvents exhibited several extra bands that were not assignable to the solute but were unequivocally assigned to the solvents. Neat solvents did not show detectable HR signals under the same experimental conditions. Similar experiments with all-trans-retinal did not exhibit such enhancement either. All-trans-β-carotene and all-trans-lycopene have thus been shown to induce enhanced HR scattering of solvent molecules through a novel molecular effect that is not associated with all-trans-retinal. We call this new effect the "molecular near-field effect." In order to explain this newly found effect, an extended vibronic theory of resonance HR scattering is developed where the vibronic interaction including the proximate solvent molecule (intermolecular vibronic coupling) is explicitly introduced in the solute hyperpolarizability tensor. The potential of "molecular near-field HR spectroscopy," which selectively detects molecules existing in the close vicinity of a HR probe in complex chemical or biological systems, is discussed.

DNA Molecules Adsorbed on Rippled Supported Cationic Lipid Membranes -- A new way to stretch DNAs

NASA Astrophysics Data System (ADS)

Golubovic, Leonardo

2005-03-01

We discuss a novel approach to control to shapes of DNA molecules. We elucidate the recent experimental work of M. Hochrein, L. Golubovic and J. Raedler, on the conformational behavior of DNA molecules adsorbed on lipid membranes that are supported on grooved micro-structured surfaces. We explain the striking ability of the edges formed on these supported membranes to adsorb and completely orient (stretch) very long DNA molecules. Here we explain the experimentally observed DNA stretching effect in terms of the surface curvature dependent electrostatic potential seen by the adsorbed DNA molecules. On the curved, rippled membrane, we show that the DNA molecules undergo localization transitions causing them to stretch by binding to the ripple edges of the supported membrane. In the future, this stretching will allow to directly image, by the common fluorescence microscopy, fundamental biological processes of the interactions between DNA and single protein molecules.

Experimental evidence of pharmacological management of anchorage in Orthodontics: A systematic review

PubMed Central

Fernández-González, Felipe José; Cañigral, Aránzazu; Balbontín-Ayala, Felipe; Gonzalo-Orden, José Manuel; de Carlos, Felix; Cobo, Teresa; Fernández-Vázquez, Jose Pedro; Sánchez-Lasheras, Fernando; Vega, José Antonio

2015-01-01

Introduction: Orthodontic anchorage is one of the most challenging aspects of Orthodontics. Preventing undesired movement of teeth could result in safer and less complicated orthodontic treatment. Recently, several reviews have been published about the effects of different molecules on bone physiology and the clinical side effects in Orthodontics. However, the effects of local application of these substances on the rate of orthodontic tooth movement have not been assessed. Objectives: The aim of this research was to analyze the scientific evidence published in the literature about the effects of different molecules on orthodontic anchorage. Methods: The literature was systematically reviewed using PubMed/Medline, Scopus and Cochrane databases from 2000 up to July 31st, 2014. Articles were independently selected by two different researchers based on previously established inclusion and exclusion criteria, with a concordance Kappa index of 0.86. The methodological quality of the reviewed papers was performed. Results: Search strategy identified 270 articles. Twenty-five of them were selected after application of inclusion/exclusion criteria, and only 11 qualified for final analysis. Molecules involved in orthodontic anchorage were divided into three main groups: osteoprotegerin (OPG), bisphosphonates (BPs) and other molecules (OMs). Conclusions: Different drugs are able to alter the bone remodeling cycle, influencing osteoclast function and, therefore, tooth movement. Thus, they could be used in order to provide maximal anchorage while preventing undesired movements. OPG was found the most effective molecule in blocking the action of osteoclasts, thereby reducing undesired movements. PMID:26560822

Experimental evidence of pharmacological management of anchorage in Orthodontics: A systematic review.

PubMed

Fernández-González, Felipe José; Cañigral, Aránzazu; Balbontín-Ayala, Felipe; Gonzalo-Orden, José Manuel; Carlos, Felix de; Cobo, Teresa; Fernández-Vázquez, Jose Pedro; Sánchez-Lasheras, Fernando; Vega, José Antonio

2015-10-01

Orthodontic anchorage is one of the most challenging aspects of Orthodontics. Preventing undesired movement of teeth could result in safer and less complicated orthodontic treatment. Recently, several reviews have been published about the effects of different molecules on bone physiology and the clinical side effects in Orthodontics. However, the effects of local application of these substances on the rate of orthodontic tooth movement have not been assessed. The aim of this research was to analyze the scientific evidence published in the literature about the effects of different molecules on orthodontic anchorage. The literature was systematically reviewed using PubMed/Medline, Scopus and Cochrane databases from 2000 up to July 31st, 2014. Articles were independently selected by two different researchers based on previously established inclusion and exclusion criteria, with a concordance Kappa index of 0.86. The methodological quality of the reviewed papers was performed. Search strategy identified 270 articles. Twenty-five of them were selected after application of inclusion/exclusion criteria, and only 11 qualified for final analysis. Molecules involved in orthodontic anchorage were divided into three main groups: osteoprotegerin (OPG), bisphosphonates (BPs) and other molecules (OMs). Different drugs are able to alter the bone remodeling cycle, influencing osteoclast function and, therefore, tooth movement. Thus, they could be used in order to provide maximal anchorage while preventing undesired movements. OPG was found the most effective molecule in blocking the action of osteoclasts, thereby reducing undesired movements.

A study of the small-molecule system used to investigate the effect of arginine on antibody elution in hydrophobic charge-induction chromatography.

PubMed

Hirano, Atsushi; Maruyama, Takuya; Shiraki, Kentaro; Arakawa, Tsutomu; Kameda, Tomoshi

2017-01-01

Hydrophobic charge-induction chromatography (HCIC) using 4-mercaptoethylpyridine (4-MEP) as the ligand is used to purify antibodies. The 4-MEP resin ligand has high affinity for antibodies, which makes it difficult to optimize the elution conditions. Recent studies showed that arginine is effective at eluting and purifying antibodies using the HCIC with 4-MEP. In the present study, we investigated the mechanism of the action of arginine on the interaction between butyl gallate (BG) and the 4-MEP resin as a model system for protein-4-MEP interactions. Equilibrium adsorption experiments showed that arginine has a significant effect on the desorption of BG from the 4-MEP resin and, in fact, is found to exhibit a greater effectiveness than guanidine and urea, which are known denaturants. The calculated binding free energy between a BG molecule and a 4-MEP resin ligand molecule using molecular dynamics simulations was qualitatively consistent with the experimental results. A principal component analysis of the simulations showed that arginine molecules intervene in the interaction between the BG and 4-MEP molecules at a distance of 8.5 Å by entering the space between the phenol and pyridine planes. The present results suggest that arginine has a unique mechanism of interaction with the phenol-pyridine system, which should be associated with the effects of arginine on the protein-4-MEP systems. Copyright © 2016 Elsevier Inc. All rights reserved.

Cafestol Inhibits Cyclic-Strain-Induced Interleukin-8, Intercellular Adhesion Molecule-1, and Monocyte Chemoattractant Protein-1 Production in Vascular Endothelial Cells

PubMed Central

Hao, Wen-Rui; Sung, Li-Chin; Chen, Chun-Chao; Chen, Jin-Jer

2018-01-01

Moderate coffee consumption is inversely associated with cardiovascular disease mortality; however, mechanisms underlying this causal effect remain unclear. Cafestol, a diterpene found in coffee, has various properties, including an anti-inflammatory property. This study investigated the effect of cafestol on cyclic-strain-induced inflammatory molecule secretion in vascular endothelial cells. Cells were cultured under static or cyclic strain conditions, and the secretion of inflammatory molecules was determined using enzyme-linked immunosorbent assay. The effects of cafestol on mitogen-activated protein kinases (MAPK), heme oxygenase-1 (HO-1), and sirtuin 1 (Sirt1) signaling pathways were examined using Western blotting and specific inhibitors. Cafestol attenuated cyclic-strain-stimulated intercellular adhesion molecule-1 (ICAM-1), monocyte chemoattractant protein- (MCP-) 1, and interleukin- (IL-) 8 secretion. Cafestol inhibited the cyclic-strain-induced phosphorylation of extracellular signal-regulated kinase and p38 MAPK. By contrast, cafestol upregulated cyclic-strain-induced HO-1 and Sirt1 expression. The addition of zinc protoporphyrin IX, sirtinol, or Sirt1 silencing (transfected with Sirt1 siRNA) significantly attenuated cafestol-mediated modulatory effects on cyclic-strain-stimulated ICAM-1, MCP-1, and IL-8 secretion. This is the first study to report that cafestol inhibited cyclic-strain-induced inflammatory molecule secretion, possibly through the activation of HO-1 and Sirt1 in endothelial cells. The results provide valuable insights into molecular pathways that may contribute to the effects of cafestol. PMID:29854096

Percutaneous transvenous mitral commissurotomy in juvenile mitral stenosis.

PubMed

Adhikari, Chandra Mani; Malla, Rabi; Rajbhandari, Rajib; Shakya, Urmila; Sharma, Poonam; Shrestha, Nagma; Kc, Bishal; Limbu, Deepak; Kc, Man Bahadur

2016-02-01

Percutaneous transvenous mitral commissurotomy (PTMC) is a valid alternative to surgical therapy in selected patients with mitral stenosis. Juvenile mitral stenosis (JMS) varies uniquely from adult rheumatic heart disease (RHD). We aimed to evaluate the efficacy of PTMC in JMS patients. It was a single centre, retrospective study conducted between July 2013 to June 2015 in Shahid Gangalal National Heart Centre, Kathmandu, Nepal. Medical records of all consecutive patients aged less than 21 years who underwent PTMC were included. Mitral valve area (MVA), left atrial pressure and mitral regurgitation (MR) were compared pre and post procedure. During the study period 131 JMS patients underwent PTMC. Seventy (53.4%) were female and 61 (46.6%) were male. Among the 131 patients, 40 (30.5%) patients were below the age of 15 years. Patient age ranged between 9 to 20 years with the mean of 16.3±2.9 years. Electrocardiography (ECG) findings were normal sinus rhythm in 115 (87.7%) patients and atrial fibrillation in 16 (12.3%) patients. Left atrial size ranged from 2.9 to 6.1 cm with the mean of 4.5±0.6 cm. The mean MVA increased from 0.8±0.1 cm(2) to 1.6±0.2 following PTMC. Mean left atrial pressure decreased from their pre-PTMC state of 27.5±8.6 to 14.1±5.8 mmHg. Successful results were observed in 115 (87.7%) patients. Suboptimal MVA <1.5 cm(2) in 11 (8.4%) patients and post-procedure MR of more than moderate MR in 5 (3.8%) patients was the reason for unsuccessful PTMC. PTMC in JMS is safe and effective.

Evaluation of Computer-Based Training for Health Workers in Echocardiography for RHD.

PubMed

Engelman, Daniel; Okello, Emmy; Beaton, Andrea; Selnow, Gary; Remenyi, Bo; Watson, Caroline; Longenecker, Chris T; Sable, Craig; Steer, Andrew C

2017-03-01

The implementation of screening for rheumatic heart disease at a population-scale would require a considerable increase in human resources. Training nonexpert staff in echocardiography requires appropriate methods and materials. This pre/post study aims to measure the change in the knowledge and confidence of a group of health workers after a computer-assisted training intervention in basic echocardiography for rheumatic heart disease. A syllabus of self-guided, computer-based modules to train nonexpert health workers in basic echocardiography for rheumatic heart disease was developed. Thirty-eight health workers from Uganda participated in the training. Using a pre/post design, identical test instruments were administered before and after the training intervention, assessing the knowledge (using multiple-choice questions) and confidence (using Likert scale questions) in clinical science and echocardiography. The mean total score on knowledge tests rose from 44.8% to 85.4% (mean difference: 40.6%, 95% confidence interval [CI]: 35.4% to 45.8%), with strong evidence for an increase in scores across all knowledge theme areas (p < 0.001). Increased confidence with each key aspect was reported, and there was strong evidence for an increase in the mean score for confidence scales in clinical science (difference: 7.1, 95% CI: 6.2 to 8.0; p < 0.001) and echocardiography (difference: 18.3, 95% CI: 16.6 to 20.0; p < 0.001). The training program was effective at increasing knowledge and confidence for basic echocardiography in nonexpert health workers. Use of computer-assisted learning may reduce the human resource requirements for training staff in echocardiography. Copyright © 2016 World Heart Federation (Geneva). Published by Elsevier B.V. All rights reserved.

Ultrasensitive detection and characterization of molecules with infrared plasmonic metamaterials

PubMed Central

Cheng, Fei; Yang, Xiaodong; Gao, Jie

2015-01-01

Infrared vibrational spectroscopy is an effective technique which enables the direct probe of molecular fingerprints, and such detection can be further enhanced by the emerging engineered plasmonic metamaterials. Here we experimentally demonstrate ultrasensitive detection and characterization of polymer molecules based on an asymmetric infrared plasmonic metamaterial, and quantitatively analyze the molecule detection sensitivity and molecule-structure interactions. A sharp, non-radiative Fano resonance supported by the plasmonic metamaterial exhibits strongly enhanced near-field, and the resonance frequency is tailored to match the vibrational fingerprint of the target molecule. By utilizing the near-field nature of the plasmonic excitation, significantly enhanced absorption signal of molecules in the infrared spectroscopy are obtained, enabling ultrasensitive detection of only minute quantities of organic molecules. The enhancement of molecular absorption up to 105 fold is obtained, and sensitive detection of molecules at zeptomole levels (corresponding to a few tens of molecules within a unit cell) is achieved with high signal-to-noise ratio in our experiment. The demonstrated infrared plasmonic metamaterial sensing platform offers great potential for improving the specificity and sensitivity of label-free, biochemical detection. PMID:26388404

Analysis of the Fourier Spectrum of the ν2 Inversion Band of the 15NHD2 Molecule

NASA Astrophysics Data System (ADS)

Fomchenko, A. L.; Belova, A. S.; Bekhtereva, E. S.; Kwabia Tchana, F.

2018-06-01

To determine high-resolution rovibrational levels of the inversion vibrational (v2 = 1) state of the 15NHD2 molecule, the Fourier spectrum in the range from 650 to 1150 cm-1 is studied. The data obtained are used to determine the parameters of the effective Hamiltonian of the examined molecule.

Monitoring Single-Molecule Protein Dynamics with a Carbon Nanotube Transistor

NASA Astrophysics Data System (ADS)

Collins, Philip G.

2014-03-01

Nanoscale electronic devices like field-effect transistors have long promised to provide sensitive, label-free detection of biomolecules. Single-walled carbon nanotubes press this concept further by not just detecting molecules but also monitoring their dynamics in real time. Recent measurements have demonstrated this premise by monitoring the single-molecule processivity of three different enzymes: lysozyme, protein Kinase A, and the Klenow fragment of DNA polymerase I. With all three enzymes, single molecules tethered to nanotube transistors were electronically monitored for 10 or more minutes, allowing us to directly observe a range of activity including rare transitions to chemically inactive and hyperactive conformations. The high bandwidth of the nanotube transistors further allow every individual chemical event to be clearly resolved, providing excellent statistics from tens of thousands of turnovers by a single enzyme. Initial success with three different enzymes indicates the generality and attractiveness of the nanotube devices as a new tool to complement other single-molecule techniques. Research on transduction mechanisms provides the design rules necessary to further generalize this architecture and apply it to other proteins. The purposeful incorporation of just one amino acid is sufficient to fabricate effective, single molecule sensors from a wide range of enzymes or proteins.

Effects of nanorod structure and conformation of fatty acid self-assembled layers on superhydrophobicity of zinc oxide surface.

PubMed

Badre, Chantal; Dubot, P; Lincot, Daniel; Pauporte, Thierry; Turmine, Mireille

2007-12-15

Superhydrophobic surfaces have been prepared from nanostructured zinc oxide layers by a treatment with fatty acid molecules. The layers are electrochemically deposited from an oxygenated aqueous zinc chloride solution. The effects of the layer's structure, from a dense film to that of a nanorod array, as well as that of the properties of the fatty acid molecules based on C18 chains are described. A contact angle (CA) as high as 167 degrees is obtained with the nanorod structure and the linear saturated molecule (stearic acid). Lower values are found with molecules having an unsaturated bond on C9, in particular with a cis conformation (140 degrees ). These results, supplemented by infrared spectroscopy, indicate an enhancement of the sensitivity to the properties of the fatty acid molecules (conformation, flexibility, saturated or not) when moving from the flat surface to the nanostructured surface. This is attributed to a specific influence of the structure of the tops of the rods and lateral wall properties on the adsorption and organization of the molecules. CA measurements show a very good stability of the surface in time if stored in an environment protected from UV radiations.

Conformation-based signal transfer and processing at the single-molecule level

NASA Astrophysics Data System (ADS)

Li, Chao; Wang, Zhongping; Lu, Yan; Liu, Xiaoqing; Wang, Li

2017-11-01

Building electronic components made of individual molecules is a promising strategy for the miniaturization and integration of electronic devices. However, the practical realization of molecular devices and circuits for signal transmission and processing at room temperature has proven challenging. Here, we present room-temperature intermolecular signal transfer and processing using SnCl2Pc molecules on a Cu(100) surface. The in-plane orientations of the molecules are effectively coupled via intermolecular interaction and serve as the information carrier. In the coupled molecular arrays, the signal can be transferred from one molecule to another in the in-plane direction along predesigned routes and processed to realize logical operations. These phenomena enable the use of molecules displaying intrinsic bistable states as complex molecular devices and circuits with novel functions.

Quantum transport of the single metallocene molecule

NASA Astrophysics Data System (ADS)

Yu, Jing-Xin; Chang, Jing; Wei, Rong-Kai; Liu, Xiu-Ying; Li, Xiao-Dong

2016-10-01

The Quantum transport of three single metallocene molecule is investigated by performing theoretical calculations using the non-equilibrium Green's function method combined with density functional theory. We find that the three metallocen molecules structure become stretched along the transport direction, the distance between two Cp rings longer than the other theory and experiment results. The lager conductance is found in nickelocene molecule, the main transmission channel is the electron coupling between molecule and the electrodes is through the Ni dxz and dyz orbitals and the s, dxz, dyz of gold. This is also confirmed by the highest occupied molecular orbital resonance at Fermi level. In addition, negative differential resistance effect is found in the ferrocene, cobaltocene molecules, this is also closely related with the evolution of the transmission spectrum under applied bias.

A model for competition for ribosomes in the cell

PubMed Central

Raveh, Alon; Margaliot, Michael; Sontag, Eduardo D.; Tuller, Tamir

2016-01-01

A single mammalian cell includes an order of 104–105 mRNA molecules and as many as 105–106 ribosomes. Large-scale simultaneous mRNA translation induces correlations between the mRNA molecules, as they all compete for the finite pool of available ribosomes. This has important implications for the cell's functioning and evolution. Developing a better understanding of the intricate correlations between these simultaneous processes, rather than focusing on the translation of a single isolated transcript, should help in gaining a better understanding of mRNA translation regulation and the way elongation rates affect organismal fitness. A model of simultaneous translation is specifically important when dealing with highly expressed genes, as these consume more resources. In addition, such a model can lead to more accurate predictions that are needed in the interconnection of translational modules in synthetic biology. We develop and analyse a general dynamical model for large-scale simultaneous mRNA translation and competition for ribosomes. This is based on combining several ribosome flow models (RFMs) interconnected via a pool of free ribosomes. We use this model to explore the interactions between the various mRNA molecules and ribosomes at steady state. We show that the compound system always converges to a steady state and that it always entrains or phase locks to periodically time-varying transition rates in any of the mRNA molecules. We then study the effect of changing the transition rates in one mRNA molecule on the steady-state translation rates of the other mRNAs that results from the competition for ribosomes. We show that increasing any of the codon translation rates in a specific mRNA molecule yields a local effect, an increase in the translation rate of this mRNA, and also a global effect, the translation rates in the other mRNA molecules all increase or all decrease. These results suggest that the effect of codon decoding rates of endogenous and heterologous mRNAs on protein production is more complicated than previously thought. In addition, we show that increasing the length of an mRNA molecule decreases the production rate of all the mRNAs. PMID:26962028

Spontaneous encapsulation behavior of ionic liquid into carbon nanotube

NASA Astrophysics Data System (ADS)

Jiang, Yanyan; Zhang, Kun; Li, Hui; He, Yezeng; Song, Xigui

2012-10-01

Molecular dynamics simulations and density functional theory have been performed to investigate the spontaneous encapsulation of 1-butyl-3-methylimidazolium chloride ([Bmim][Cl]) into single-walled carbon nanotubes (SWCNTs). This phenomenon can be attributed to the van der Waals attractive force, hydrogen bonds and especially the π-π stacking effect. The [Bmim][Cl] molecules enter SWCNTs with larger diameters more rapidly, showing an interesting dependence on tube size. A high temperature is not beneficial to, and may even disrupt, the encapsulation of the [Bmim][Cl] molecules. It is also worth noting that the graphene nanoribbon entering the SWCNT would have an extremely different effect on this encapsulation process from when they wrap around the outer surface. Furthermore, the [Bmim][Cl] molecules can assist water transport in the SWCNT by expelling water molecules from the SWCNT. The proposed discoveries eventually provide a powerful way to fabricate nanoscale materials and devices and tune their properties.Molecular dynamics simulations and density functional theory have been performed to investigate the spontaneous encapsulation of 1-butyl-3-methylimidazolium chloride ([Bmim][Cl]) into single-walled carbon nanotubes (SWCNTs). This phenomenon can be attributed to the van der Waals attractive force, hydrogen bonds and especially the π-π stacking effect. The [Bmim][Cl] molecules enter SWCNTs with larger diameters more rapidly, showing an interesting dependence on tube size. A high temperature is not beneficial to, and may even disrupt, the encapsulation of the [Bmim][Cl] molecules. It is also worth noting that the graphene nanoribbon entering the SWCNT would have an extremely different effect on this encapsulation process from when they wrap around the outer surface. Furthermore, the [Bmim][Cl] molecules can assist water transport in the SWCNT by expelling water molecules from the SWCNT. The proposed discoveries eventually provide a powerful way to fabricate nanoscale materials and devices and tune their properties. Electronic supplementary information (ESI) available: (1) Movie: the encapsulation process of the ILs into the SWCNT (16,16). (2) More calculation details, including the data of the morphology vs. the encapsulation process from both ends and different tube diameters. See DOI: 10.1039/c2nr31432k

Designing and testing regenerative pulp treatment strategies: modeling the transdentinal transport mechanisms

PubMed Central

Passos, Agathoklis D.; Mouza, Aikaterini A.; Paras, Spiros V.; Gogos, Christos; Tziafas, Dimitrios

2015-01-01

The need for simulation models to thoroughly test the inflammatory effects of dental materials and dentinogenic effects of specific signaling molecules has been well recognized in current dental research. The development of a model that simulates the transdentinal flow and the mass transfer mechanisms is of prime importance in terms of achieving the objectives of developing more effective treatment modalities in restorative dentistry. The present protocol study is part of an ongoing investigation on the development of a methodology that can calculate the transport rate of selected molecules inside a typical dentinal tubule. The transport rate of biological molecules has been investigated using a validated CFD code. In that framework we propose a simple algorithm that, given the type of molecules of the therapeutic agent and the maximum acceptable time for the drug concentration to attain a required value at the pulpal side of the tubules, can estimate the initial concentration to be imposed. PMID:26441676

Unconventional Current Scaling and Edge Effects for Charge Transport through Molecular Clusters

PubMed Central

2017-01-01

Metal–molecule–metal junctions are the key components of molecular electronics circuits. Gaining a microscopic understanding of their conducting properties is central to advancing the field. In the present contribution, we highlight the fundamental differences between single-molecule and ensemble junctions focusing on the fundamentals of transport through molecular clusters. In this way, we elucidate the collective behavior of parallel molecular wires, bridging the gap between single molecule and large-area monolayer electronics, where even in the latter case transport is usually dominated by finite-size islands. On the basis of first-principles charge-transport simulations, we explain why the scaling of the conductivity of a junction has to be distinctly nonlinear in the number of molecules it contains. Moreover, transport through molecular clusters is found to be highly inhomogeneous with pronounced edge effects determined by molecules in locally different electrostatic environments. These effects are most pronounced for comparably small clusters, but electrostatic considerations show that they prevail also for more extended systems. PMID:29043825

In silico design of novel proton-pump inhibitors with reduced adverse effects.

PubMed

Li, Xiaoyi; Kang, Hong; Liu, Wensheng; Singhal, Sarita; Jiao, Na; Wang, Yong; Zhu, Lixin; Zhu, Ruixin

2018-05-30

The development of new proton-pump inhibitors (PPIs) with less adverse effects by lowering the pKa values of nitrogen atoms in pyrimidine rings has been previously suggested by our group. In this work, we proposed that new PPIs should have the following features: (1) number of ring II = number of ring I + 1; (2) preferably five, six, or seven-membered heteroatomic ring for stability; and (3) 1 < pKa1 < 4. Six molecular scaffolds based on the aforementioned criteria were constructed, and R groups were extracted from compounds in extensive data sources. A virtual molecule dataset was established, and the pKa values of specific atoms on the molecules in the dataset were calculated to select the molecules with required pKa values. Drug-likeness screening was further conducted to obtain the candidates that significantly reduced the adverse effects of long-term PPI use. This study provided insights and tools for designing targeted molecules in silico that are suitable for practical applications.

Relativistic (SR-ZORA) quantum theory of atoms in molecules properties.

PubMed

Anderson, James S M; Rodríguez, Juan I; Ayers, Paul W; Götz, Andreas W

2017-01-15

The Quantum Theory of Atoms in Molecules (QTAIM) is used to elucidate the effects of relativity on chemical systems. To do this, molecules are studied using density-functional theory at both the nonrelativistic level and using the scalar relativistic zeroth-order regular approximation. Relativistic effects on the QTAIM properties and topology of the electron density can be significant for chemical systems with heavy atoms. It is important, therefore, to use the appropriate relativistic treatment of QTAIM (Anderson and Ayers, J. Phys. Chem. 2009, 115, 13001) when treating systems with heavy atoms. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Chemical models of interstellar gas-grain processes. II - The effect of grain-catalysed methane on gas phase evolution

NASA Technical Reports Server (NTRS)

Brown, Paul D.; Charnley, S. B.

1991-01-01

The effects on gas phase chemistry which result from the continuous desorption of methane molecules from grain surfaces are studied. Significant and sustained enhancements in the abundances of several complex hydrocarbon molecules are found, in good agreement with their observed values in TMC-1. The overall agreement is, however, just as good for the case of zero CH4 desorption efficiency. It is thus impossible to determine from the models whether or not the grain-surface production of methane is responsible for the observed abundances of some hydrocarbon molecules.

[Medicamental treatment of schizophrenia].

PubMed

Lotstra, F; Lestienne, S; De Nayer, A

2010-09-01

Antipsychotics play a key role in biologic therapy of schizophrenia. Following the first-generation neuroleptics, associated with many extrapyramidal side effects (severe dystonias, parkinsonian syndrome, akatisia and late dyskinesia) altering patients' compliance to the treatment, one can now find a new generation of molecules considered as atypical antipsychotics because they rarely cause neurological complications. This propriety provides a better compliance, along with a clear decrease of late dyskinesia risk but the effectiveness compared to ordinary molecules is still questioned. However, some of them can cause an increased risk of metabolic syndrome. Some molecules such as benzodiazepines and some antidepressants can also be prescribed to cure schizophrenic patients.

Polarization properties of below-threshold harmonics from aligned molecules H2+ in linearly polarized laser fields.

PubMed

Dong, Fulong; Tian, Yiqun; Yu, Shujuan; Wang, Shang; Yang, Shiping; Chen, Yanjun

2015-07-13

We investigate the polarization properties of below-threshold harmonics from aligned molecules in linearly polarized laser fields numerically and analytically. We focus on lower-order harmonics (LOHs). Our simulations show that the ellipticity of below-threshold LOHs depends strongly on the orientation angle and differs significantly for different harmonic orders. Our analysis reveals that this LOH ellipticity is closely associated with resonance effects and the axis symmetry of the molecule. These results shed light on the complex generation mechanism of below-threshold harmonics from aligned molecules.

Tunnel magnetoresistance of ferrocene molecules

NASA Astrophysics Data System (ADS)

Matsuura, Yukihito

2018-01-01

The spin transport in ferrocene molecules has been examined by using the nonequilibrium Green's function formalism with density functional theory. The ferrocene molecules were sandwiched between the two nickel electrodes in a parallel magnetic configuration, which enhanced the current in comparison with that in an antiparallel spin state and resulting in tunnel magnetoresistance (TMR). The current, having an opposite spin state to that of the ferromagnetic electrode, was the main channel for electron transport. In addition, it became clear that ferrocenylene molecules, having a fulvalene structure with an extended π-conjugation, enhanced the TMR effect.

A molecular dynamics study of model SI clathrate hydrates: the effect of guest size and guest-water interaction on decomposition kinetics.

PubMed

Das, Subhadip; Baghel, Vikesh Singh; Roy, Sudip; Kumar, Rajnish

2015-04-14

One of the options suggested for methane recovery from natural gas hydrates is molecular replacement of methane by suitable guests like CO2 and N2. This approach has been found to be feasible through many experimental and molecular dynamics simulation studies. However, the long term stability of the resultant hydrate needs to be evaluated; the decomposition rate of these hydrates is expected to depend on the interaction between these guest and water molecules. In this work, molecular dynamics simulation has been performed to illustrate the effect of guest molecules with different sizes and interaction strengths with water on structure I (SI) hydrate decomposition and hence the stability. The van der Waals interaction between water of hydrate cages and guest molecules is defined by Lennard Jones potential parameters. A wide range of parameter spaces has been scanned by changing the guest molecules in the SI hydrate, which acts as a model gas for occupying the small and large cages of the SI hydrate. All atomistic simulation results show that the stability of the hydrate is sensitive to the size and interaction of the guest molecules with hydrate water. The increase in the interaction of guest molecules with water stabilizes the hydrate, which in turn shows a slower rate of hydrate decomposition. Similarly guest molecules with a reasonably small (similar to Helium) or large size increase the decomposition rate. The results were also analyzed by calculating the structural order parameter to understand the dynamics of crystal structure and correlated with the release rate of guest molecules from the solid hydrate phase. The results have been explained based on the calculation of potential energies felt by guest molecules in amorphous water, hydrate bulk and hydrate-water interface regions.

Quantum theory of atoms in molecules charge-charge flux-dipole flux models for the infrared intensities of X(2)CY (X = H, F, Cl; Y = O, S) molecules.

PubMed

Faria, Sergio H D M; da Silva, João Viçozo; Haiduke, Roberto L A; Vidal, Luciano N; Vazquez, Pedro A M; Bruns, Roy E

2007-08-16

The molecular dipole moments, their derivatives, and the fundamental IR intensities of the X2CY (X = H, F, Cl; Y = O, S) molecules are determined from QTAIM atomic charges and dipoles and their fluxes at the MP2/6-311++G(3d,3p) level. Root-mean-square errors of +/-0.03 D and +/-1.4 km mol(-1) are found for the molecular dipole moments and fundamental IR intensities calculated using quantum theory of atoms in molecules (QTAIM) parameters when compared with those obtained directly from the MP2/6-311++G(3d,3p) calculations and +/-0.05 D and 51.2 km mol(-1) when compared with the experimental values. Charge (C), charge flux (CF), and dipole flux (DF) contributions are reported for all the normal vibrations of these molecules. A large negative correlation coefficient of -0.83 is calculated between the charge flux and dipole flux contributions and indicates that electronic charge transfer from one side of the molecule to the other during vibrations is accompanied by a relaxation effect with electron density polarization in the opposite direction. The characteristic substituent effect that has been observed for experimental infrared intensity parameters and core electron ionization energies has been applied to the CCFDF/QTAIM parameters of F2CO, Cl2CO, F2CS, and Cl2CS. The individual atomic charge, atomic charge flux, and atomic dipole flux contributions are seen to obey the characteristic substituent effect equation just as accurately as the total dipole moment derivative. The CH, CF, and CCl stretching normal modes of these molecules are shown to have characteristic sets of charge, charge flux, and dipole flux contributions.

Dye-binding assays for evaluation of the effects of small molecule inhibitors on amyloid (aβ) self-assembly.

PubMed

Jameson, Laramie P; Smith, Nicholas W; Dzyuba, Sergei V

2012-11-21

Dye-binding assays, such as those utilizing Congo red and thioflavin T, are among the most widely used tools to probe the aggregation of amyloidogenic biomolecules and for the evaluation of small molecule inhibitors of amyloid aggregation and fibrillization. A number of recent reports have indicated that these dye-binding assays could be prone to false positive effects when assessing inhibitors' potential toward Aβ peptides, species involved in Alzheimer's disease. Specifically, this review focuses on the application of thioflavin T for determining the efficiency of small molecule inhibitors of Aβ aggregation and addresses potential reasons that might be associated with the false positive effects in an effort to increase reliability of dye-binding assays.

Dye-Binding Assays for Evaluation of the Effects of Small Molecule Inhibitors on Amyloid (Aβ) Self-Assembly

PubMed Central

2012-01-01

Dye-binding assays, such as those utilizing Congo red and thioflavin T, are among the most widely used tools to probe the aggregation of amyloidogenic biomolecules and for the evaluation of small molecule inhibitors of amyloid aggregation and fibrillization. A number of recent reports have indicated that these dye-binding assays could be prone to false positive effects when assessing inhibitors’ potential toward Aβ peptides, species involved in Alzheimer’s disease. Specifically, this review focuses on the application of thioflavin T for determining the efficiency of small molecule inhibitors of Aβ aggregation and addresses potential reasons that might be associated with the false positive effects in an effort to increase reliability of dye-binding assays. PMID:23173064

Langevin and Fokker-Planck analyses of inhibited molecular passing processes controlling transport and reactivity in nanoporous materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Chi-Jen; Ackerman, David M.; Slowing, Igor I.

2014-07-14

Inhibited passing of reactant and product molecules within the linear pores of nanoporous catalytic materials strongly reduces reactivity. The dependence of the passing propensity P on pore radius R is analyzed utilizing Langevin dynamics to account for solvent effects. We find that P~(R-R c) σ, where passing is sterically blocked for R≤R c, with σ below the transition state theory value. Deeper insight comes from analysis of the corresponding high-dimensional Fokker-Planck equation, which facilitates an effective small-P approximation, and dimensional reduction enabling utilization of conformal mapping ideas. We analyze passing for spherical molecules and also assess the effect of rotationalmore » degrees of freedom for elongated molecules.« less

Expression of Inflammation-related Intercellular Adhesion Molecules in Cardiomyocytes In Vitro and Modulation by Pro-inflammatory Agents.

PubMed

El-Battrawy, Ibrahim; Tülümen, Erol; Lang, Siegfried; Akin, Ibrahim; Behnes, Michael; Zhou, Xiabo; Mavany, Martin; Bugert, Peter; Bieback, Karen; Borggrefe, Martin; Elmas, Elif

2016-01-01

Cell-surface adhesion molecules regulate multiple intercellular and intracellular processes and play important roles in inflammation by facilitating leukocyte endothelial transmigration. Whether cardiomyocytes express surface-adhesion molecules related to inflammation and the effect of pro-inflammatory mediators remain unknown. In the present study, the expression of different cell-adhesion molecules (CD11a, CD11b, CD31, CD62P, CD162, F11 receptor and mucosal vascular addressin cell adhesion molecule 1 (MADCAM1)) and the effect of pro-inflammatory mediators were investigated in an in vitro model of human cardiomyocytes. Cells were supplied as a primary culture of cardiac alpha actin-positive cells from human heart tissue. The cells were incubated for 24 h with 1 U/ml thrombin or 700 ng/ml lipopolysaccharide (LPS) or with a combination of both. The expression of the cell adhesion molecules was measured by flow cytometry. In cultured human cardiomyocytes, 22.8% of cells expressed CD31, 7.1% MADCAM1 and 2.6% F11R. CD11a, CD11b, CD62P and CD162 were expressed by fewer than 2% of the cells at baseline. CD31 expression increased on incubation of cardiomyocytes with thrombin by 26% (p<0.05) and with LPS by 26% (p=0.06). The combination of thrombin and LPS did not result in increased levels of CD31 (p>0.10). The pro-inflammatory agents LPS and thrombin had no effect on the expression of MADCAM1 and F11R. Inflammation-related cell-adhesion molecules CD31, MADCAM1 and F11R were shown to be expressed on the surface of human cardiomyocytes in an in vitro model. Incubation with LPS or thrombin resulted in increased expression of CD31, however, it did not modify the expression of the cell adhesion molecules MADCAM1 and F11R. Copyright © 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Effects of concentration on the microwave dielectric spectra of aqueous urea solutions

NASA Astrophysics Data System (ADS)

Lyashchenko, A. K.; Dunyashev, V. S.; Zasetsky, A. Yu.

2017-05-01

Several models of relaxation for the dielectric spectra of aqueous urea solutions in the microwave region are compared. The spectra are shown to contain two main Debye components arising from the rotational motions of urea and water molecules. Two essentially different concentration regions in urea solutions are identified. The first is characterized by a small increase in the mobility of water molecules (τ1 = 7.8 ps) and the existence of hydrated urea molecules (τ2 = 19 ps). Due to the aggregation of urea molecules, the relaxation times for the latter process grow considerably in highly concentrated solutions. At the same time, faster molecular motions (τ3 = 6 ps) are observed for water molecules.

Electron scattering effects at physisorbed hydrogen molecules on break-junction electrodes and nanowires formation in hydrogen environment

NASA Astrophysics Data System (ADS)

van der Maas, M.; Vasnyov, S.; Hendriksen, B. L. M.; Shklyarevskii, O. I.; Speller, S.

2012-06-01

Physisorption of hydrogen molecules on the surface of gold and other coinage metals has been studied using distance tunneling spectroscopy. We have observed that the distance dependence of the tunnel current (resistance) displays a strong N-shaped deviation from exponential behavior. Such deviations are difficult to explain within the Tersoff-Hamann approximation. We suggest the scattering of tunneling electrons by H2 molecules as an origin for the observed effect. We have found that this phenomenon is also common for strongly adsorbed organic molecules with a single anchoring group. Pulling Au, Cu and Pt nanowires at 22 K in hydrogen environment shows that the break-junction electrodes are still connected through hydrogen-metal monoatomic chains down to very low conductance values of 10-4-10-6 G0.

Electron-induced hydrogen loss in uracil in a water cluster environment

NASA Astrophysics Data System (ADS)

Smyth, M.; Kohanoff, J.; Fabrikant, I. I.

2014-05-01

Low-energy electron-impact hydrogen loss due to dissociative electron attachment (DEA) to the uracil and thymine molecules in a water cluster environment is investigated theoretically. Only the A'-resonance contribution, describing the near-threshold behavior of DEA, is incorporated. Calculations are based on the nonlocal complex potential theory and the multiple scattering theory, and are performed for a model target with basic properties of uracil and thymine, surrounded by five water molecules. The DEA cross section is strongly enhanced when the attaching molecule is embedded in a water cluster. This growth is due to two effects: the increase of the resonance lifetime and the negative shift in the resonance position due to interaction of the intermediate negative ion with the surrounding water molecules. A similar effect was earlier found in DEA to chlorofluorocarbons.

Co-administration of liposomal l-OHP and PEGylated TS shRNA-lipoplex: A novel approach to enhance anti-tumor efficacy and reduce the immunogenic response to RNAi molecules.

PubMed

Alaaeldin, Eman; Abu Lila, Amr S; Ando, Hidenori; Fukushima, Masakazu; Huang, Cheng-Long; Wada, Hiromi; Sarhan, Hatem A; Khaled, Khaled A; Ishida, Tatsuhiro

2017-06-10

Many therapeutic strategies have been applied in efforts to conquer the development and/or progression of cancer. The combination of chemotherapy and an RNAi-based approach has proven to be an efficient anticancer therapy. However, the feasibility of such a therapeutic strategy has been substantially restricted either by the failure to achieve the efficient delivery of RNAi molecules to tumor tissue or by the immunostimulatory response triggered by RNAi molecules. In this study, therefore, we intended to investigate the efficacy of using liposomal oxaliplatin (liposomal l-OHP) to guarantee the efficient delivery of RNAi molecules, namely shRNA against thymidylate synthase (TS shRNA) complexed with cationic liposome (TS shRNA-lipoplex), to solid tumors, and to suppress the immunostimulatory effect of RNAi molecules, TS shRNA, following intravenous administration. Herein, we describe how liposomal l-OHP enhanced the intra-tumor accumulation of TS shRNA-lipoplex and significantly reduced the immunostimulatory response triggered by TS shRNA. Consequently, such enhanced accumulation of TS shRNA-lipoplex along with the cytotoxic effect of liposomal l-OHP led to a remarkable tumor growth suppression (compared to mono-therapy) following systemic administration. Our results, therefore, may have important implications for the provision of a safer and more applicable combination therapy of RNAi molecules and anti-cancer agents that can produce a more reliable anti-tumor effect. Copyright © 2017 Elsevier B.V. All rights reserved.

The influence of polarity of additive molecules on micelle structures of polystyrene-block-poly(4-vinylpyridine) in the fabrication of nano-porous templates.

PubMed

Chua, Kee Sze; Koh, Ai Peng; Lam, Yeng Ming

2010-11-01

Block copolymers are useful for in situ synthesis of nanoparticles as well as producing nanoporous templates. As such, the effects of precursors on the block copolymer micelle structure is important. In this study, we investigate the effects of polarity of molecules introduced into block copolymer micelle cores on the micelle structure. The molecular dipole moment of the additive molecules has been evaluated and their effects on the block copolymer micelles investigated using light scattering spectroscopy, small-angle X-ray scattering, transmission electron microscopy and atomic force microscopy. The molecule with the largest dipole moment resulted in spherical structures with a polydispersity of less than 0.06 in a fully translational diffusion system. Surprisingly, the less polar additive molecules produced elongated micelles and the aspect ratio increases with decreasing polarity. The change in structure from spherical to elongated structure was attributed to P4VP chain extension, where compounds with polarity most similar to P4VP induce the most chain extension. The second virial coefficients of the solutions with elongated micelles are lower than that for spherical micelle systems by up to one order in magnitude, indicating a strong tendency for micelles to coalesce. On rinsing the spin-cast films, pores were obtained from spherical micelles and ridges from elongated micelles, suggesting a viable alternative for morphology modification using mild conditions where external annealing treatments to the film are not preferred. The knowledge of polarity effects of additive molecules on micelle structure has wider implications for supramolecular block copolymer systems where, depending on the application requirements, changes to the shape of the micelle structure can be induced or avoided. Copyright 2010 Elsevier Inc. All rights reserved.

QM/MM investigation of the concentration effects on the second-order nonlinear optical responses of solutions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hidalgo Cardenuto, Marcelo, E-mail: marcelo.hidalgo@unamur.be, E-mail: benoit.champagne@unamur.be; Instituto de Física, Universidade de São Paulo, CP 66318, 05314-970 São Paulo, SP; Champagne, Benoît, E-mail: marcelo.hidalgo@unamur.be, E-mail: benoit.champagne@unamur.be

2014-12-21

A multiscale approach combining quantum mechanics (QM) and molecular mechanics methods has been employed to investigate the effects of solute-solute interactions and therefore of concentration on the first hyperpolarizability of solutions of nitrobenzene in benzene. First, spatial distributions of solute and solvent molecules are generated using Monte Carlo simulations where the intermolecular interactions are described using the Lennard-Jones potentials and Coulomb terms. Then, a reduced number of statistically-uncorrelated configurations are sampled and submitted to time-dependent Hartree-Fock calculations of the first hyperpolarizability. When only one molecule is described quantum-mechanically and is embedded in the electrostatic polarization field of the solution describedmore » by point charges, β{sub HRS} and β{sub //} as well as the depolarization ratio increase in parallel with the concentration in nitrobenzene. This effect is attributed to the increase of the polarization field associated with the presence of polar nitrobenzene molecules in the surrounding. Then, the first solvation shell is considered explicitly in the QM calculation to address solute-solute interactions effects. When the number of nitrobenzenes in the first solvation shell increases, β{sub HRS} and β{sub //} normalized to the number of nitrobenzene molecules decrease and this decrease attains roughly 50% when there are 3 nitrobenzene molecules in the first solvation shell. These drastic reductions of the first hyperpolarizability result from (partial) centro-symmetric arrangements between the nitrobenzene molecules, as supported by the relationship between β and the angle between the nitrobenzene charge transfer axes. Moreover, these β decreases originate mostly from the reduction of the dipolar β component, whereas the octupolar one is rather constant as a function of the nitrobenzene concentration.« less

Differences in single and aggregated nanoparticle plasmon spectroscopy.

PubMed

Singh, Pushkar; Deckert-Gaudig, Tanja; Schneidewind, Henrik; Kirsch, Konstantin; van Schrojenstein Lantman, Evelien M; Weckhuysen, Bert M; Deckert, Volker

2015-02-07

Vibrational spectroscopy usually provides structural information averaged over many molecules. We report a larger peak position variation and reproducibly smaller FWHM of TERS spectra compared to SERS spectra indicating that the number of molecules excited in a TERS experiment is extremely low. Thus, orientational averaging effects are suppressed and micro ensembles are investigated. This is shown for a thiophenol molecule adsorbed on Au nanoplates and nanoparticles.

Laser Cooled YbF Molecules for Measuring the Electron's Electric Dipole Moment

NASA Astrophysics Data System (ADS)

Lim, J.; Almond, J. R.; Trigatzis, M. A.; Devlin, J. A.; Fitch, N. J.; Sauer, B. E.; Tarbutt, M. R.; Hinds, E. A.

2018-03-01

We demonstrate one-dimensional sub-Doppler laser cooling of a beam of YbF molecules to 100 μ K . This is a key step towards a measurement of the electron's electric dipole moment using ultracold molecules. We compare the effectiveness of magnetically assisted and polarization-gradient sub-Doppler cooling mechanisms. We model the experiment and find good agreement with our data.

Laser Cooled YbF Molecules for Measuring the Electron's Electric Dipole Moment.

PubMed

Lim, J; Almond, J R; Trigatzis, M A; Devlin, J A; Fitch, N J; Sauer, B E; Tarbutt, M R; Hinds, E A

2018-03-23

We demonstrate one-dimensional sub-Doppler laser cooling of a beam of YbF molecules to 100  μK. This is a key step towards a measurement of the electron's electric dipole moment using ultracold molecules. We compare the effectiveness of magnetically assisted and polarization-gradient sub-Doppler cooling mechanisms. We model the experiment and find good agreement with our data.

Field Effect Transistor in Nanoscale

DTIC Science & Technology

2017-04-26

analogues) and BxCyNz (Napathalene analogues with x+y+z=10) molecules using quantum many body approach coupled with kinetic (master) equations...analogues with x +y+z=10) molecules using quantum many body approach coupled with kinetic (master) equations. Interestingly, various types of non-linear...Small molecules (such as benzene), double quantum dots (like GaAs-based QDs) which are coupled weakly to metallic electrodes have shown their

Beneficial effects of bacteria-plant communication based on quorum sensing molecules of the N-acyl homoserine lactone group.

PubMed

Schikora, Adam; Schenk, Sebastian T; Hartmann, Anton

2016-04-01

Bacterial quorum sensing (QS) mechanisms play a crucial role in the proper performance and ecological fitness of bacterial populations. Many key physiological processes are regulated in a QS-dependent manner by auto-inducers, like the N-acyl homoserine lactones (AHLs) in numerous Gram-negative bacteria. In addition, also the interaction between bacteria and eukaryotic hosts can be regulated by AHLs. Those mechanisms gained much attention, because of the positive effects of different AHL molecules on plants. This positive impact ranges from growth promotion to induced resistance and is quite contrasting to the rather negative effects observed in the interactions between bacterial AHL molecules and animals. Only very recently, we began to understand the molecular mechanisms underpinning plant responses to AHL molecules. In this review, we gathered the latest information in this research field. The first part gives an overview of the bacterial aspects of quorum sensing. Later we focus on the impact of AHLs on plant growth and AHL-priming, as one of the most understood phenomena in respect to the inter-kingdom interactions based on AHL-quorum sensing molecules. Finally, we discuss the potential benefits of the understanding of bacteria-plant interaction for the future agricultural applications.

The Effect of Water Molecules on Mechanical Properties of Cell Walls

NASA Astrophysics Data System (ADS)

Rahbar, Nima; Youssefian, Sina

The unique properties of bamboo fibers come from their natural composite structures that comprise mainly cellulose nanofibrils in a matrix of intertwined hemicellulose and lignin called lignin-carbohydrate complex (LCC). Here, we have utilized atomistic simulations to investigate the mechanical properties and mechanisms of interactions between these materials, in the presence of water molecules. The role of hemicellulose found to be enhancing the mechanical properties and lignin found to be providing the strength of bamboo fibers. The abundance of Hbonds in hemicellulose chains is responsible for improving the mechanical behavior of LCC. The strong van der Waals forces between lignin molecules and cellulose nanofibrils are responsible for higher adhesion energy between LCC/cellulose nanofibrils. We also found out that the amorphous regions of cellulose nanofibrils is the weakest interface in bamboo Microfibrils. In presence of water, the elastic modulus of lignin increases at low water content and decreases in higher water content, whereas the hemicellulose elastic modulus constantly decreases. The variations of Radial Distribution Function and Free Fractional Volume of these materials with water suggest that water molecules enhance the mechanical properties of lignin by filling voids in the system and creating Hbond bridges between polymer chains. For hemicellulose, however, the effect is always regressive due to the destructive effect of water molecules on the Hbond of its dense structure.

A Computational Study of the Rheology and Structure of Surfactant Covered Droplets

NASA Astrophysics Data System (ADS)

Maia, Joao; Boromand, Arman

Using different types of surface-active agents are ubiquitous in different industrial applications ranging from cosmetic and food industries to polymeric nano-composite and blends. This allows to produce stable multiphasic systems like foams and emulsions whose stability and shelf-life are directly determined by the efficiency and the type of the surfactant molecules. Moreover, presence and self-assembly of these species on an interface will display complex dynamics and structural evolution under different processing conditions. Analogous to bulk rheology of complex systems, surfactant covered interfaces will response to an external mechanical forces or deformation differently depends on the molecular configuration and topology of the system constituents. Although the effect of molecular configuration of the surface-active molecules on the planar interfaces has been studied both experimentally and computationally, it remains challenging from both experimental and computational aspects to track efficiency and effectiveness of different surfactant molecules with different molecular geometries on curved interfaces. Using Dissipative Particle Dynamics, we have studies effectiveness and efficiency of different surfactant molecules on a curved interface in equilibrium and far from equilibrium. Interfacial tension is calculated for linear and branched surfactant with different hydrophobic and hydrophilic tail and head groups with different branching densities. Deformation parameter and Taylor plots are obtained for individual surfactant molecules under shear flow.

Thermodynamic and kinetic considerations of nucleation and stabilization of acoustic cavitation bubbles in water.

PubMed

Bapat, Pratap S; Pandit, Aniruddha B

2008-01-01

Qualitative explanation for a homogeneous nucleation of acoustic cavitation bubbles in the incompressible liquid water with simple phenomenological approach has been provided via the concept of the desorbtion of the dissolved gas and the vaporization of local liquid molecules. The liquid medium has been viewed as an ensemble of lattice structures. Validity of the lattice structure approach against the Brownian motion of molecules in the liquid state has been discussed. Criterion based on probability for nucleus formation has been defined for the vaporization of local liquid molecules. Energy need for the enthalpy of vaporization has been considered as an energy criterion for the formation of a vaporous nucleus. Sound energy, thermal energy of the liquid bulk (Joule-Thomson effect) and free energy of activation, which is associated with water molecules in the liquid state (Brownian motion) as per the modified Eyring's kinetic theory of liquid are considered as possible sources for the enthalpy of vaporization of water molecules forming a single unit lattice. The classical nucleation theory has then been considered for expressing further growth of the vaporous nucleus against the surface energy barrier. Effect of liquid property (temperature), and effect of an acoustic parameter (frequency) on an acoustic cavitation threshold pressure have been discussed. Kinetics of nucleation has been considered.

Developing an Efficient and General Strategy for Immobilization of Small Molecules onto Microarrays Using Isocyanate Chemistry.

PubMed

Zhu, Chenggang; Zhu, Xiangdong; Landry, James P; Cui, Zhaomeng; Li, Quanfu; Dang, Yongjun; Mi, Lan; Zheng, Fengyun; Fei, Yiyan

2016-03-16

Small-molecule microarray (SMM) is an effective platform for identifying lead compounds from large collections of small molecules in drug discovery, and efficient immobilization of molecular compounds is a pre-requisite for the success of such a platform. On an isocyanate functionalized surface, we studied the dependence of immobilization efficiency on chemical residues on molecular compounds, terminal residues on isocyanate functionalized surface, lengths of spacer molecules, and post-printing treatment conditions, and we identified a set of optimized conditions that enable us to immobilize small molecules with significantly improved efficiencies, particularly for those molecules with carboxylic acid residues that are known to have low isocyanate reactivity. We fabricated microarrays of 3375 bioactive compounds on isocyanate functionalized glass slides under these optimized conditions and confirmed that immobilization percentage is over 73%.

Quenching methods for background reduction in luminescence-based probe-target binding assays

DOEpatents

Cai, Hong [Los Alamos, NM; Goodwin, Peter M [Los Alamos, NM; Keller, Richard A [Los Alamos, NM; Nolan, Rhiannon L [Santa Fe, NM

2007-04-10

Background luminescence is reduced from a solution containing unbound luminescent probes, each having a first molecule that attaches to a target molecule and having an attached luminescent moiety, and luminescent probe/target adducts. Quenching capture reagent molecules are formed that are capable of forming an adduct with the unbound luminescent probes and having an attached quencher material effective to quench luminescence of the luminescent moiety. The quencher material of the capture reagent molecules is added to a solution of the luminescent probe/target adducts and binds in a proximity to the luminescent moiety of the unbound luminescent probes to quench luminescence from the luminescent moiety when the luminescent moiety is exposed to exciting illumination. The quencher capture reagent does not bind to probe molecules that are bound to target molecules and the probe/target adduct emission is not quenched.

Effect of molecule-particle binding on the reduction in the mixed-frequency alternating current magnetic susceptibility of magnetic bio-reagents

NASA Astrophysics Data System (ADS)

Yang, C. C.; Yang, S. Y.; Chen, H. H.; Weng, W. L.; Horng, H. E.; Chieh, J. J.; Hong, C. Y.; Yang, H. C.

2012-07-01

By specifically bio-functionalizing magnetic nanoparticles, magnetic nanoparticles are able to label target bio-molecules. This property can be applied to quantitatively detect molecules invitro by measuring the related magnetic signals of nanoparticles bound with target molecules. One of the magnetic signals is the reduction in the mixed-frequency ac magnetic susceptibility of suspended magnetic nanoparticles due to the molecule-particle association. Many experimental results show empirically that the molecular-concentration dependent reduction in ac magnetic susceptibility follows the logistic function. In this study, it has been demonstrated that the logistic behavior is originated from the growth of particle sizes due to the molecule-particle association. The analytic relationship between the growth of particle sizes and the reduction in ac magnetic susceptibility is developed.

Probing the effect of charge transfer enhancement in off resonance mode SERS via conjugation of the probe dye between silver nanoparticles and metal substrates.

PubMed

Selvakannan, Pr; Ramanathan, Rajesh; Plowman, Blake J; Sabri, Ylias M; Daima, Hemant K; O'Mullane, Anthony P; Bansal, Vipul; Bhargava, Suresh K

2013-08-21

The charge transfer-mediated surface enhanced Raman scattering (SERS) of crystal violet (CV) molecules that were chemically conjugated between partially polarized silver nanoparticles and optically smooth gold and silver substrates has been studied under off-resonant conditions. Tyrosine molecules were used as a reducing agent to convert silver ions into silver nanoparticles where oxidised tyrosine caps the silver nanoparticle surface with its semiquinone group. This binding through the quinone group facilitates charge transfer and results in partially oxidised silver. This establishes a chemical link between the silver nanoparticles and the CV molecules, where the positively charged central carbon of CV molecules can bind to the terminal carboxylate anion of the oxidised tyrosine molecules. After drop casting Ag nanoparticles bound with CV molecules it was found that the free terminal amine groups tend to bind with the underlying substrates. Significantly, only those CV molecules that were chemically conjugated between the partially polarised silver nanoparticles and the underlying gold or silver substrates were found to show SERS under off-resonant conditions. The importance of partial charge transfer at the nanoparticle/capping agent interface and the resultant conjugation of CV molecules to off resonant SERS effects was confirmed by using gold nanoparticles prepared in a similar manner. In this case the capping agent binds to the nanoparticle through the amine group which does not facilitate charge transfer from the gold nanoparticle and under these conditions SERS enhancement in the sandwich configuration was not observed.

Chirality-induced spin polarization places symmetry constraints on biomolecular interactions.

PubMed

Kumar, Anup; Capua, Eyal; Kesharwani, Manoj K; Martin, Jan M L; Sitbon, Einat; Waldeck, David H; Naaman, Ron

2017-03-07

Noncovalent interactions between molecules are key for many biological processes. Necessarily, when molecules interact, the electronic charge in each of them is redistributed. Here, we show experimentally that, in chiral molecules, charge redistribution is accompanied by spin polarization. We describe how this spin polarization adds an enantioselective term to the forces, so that homochiral interaction energies differ from heterochiral ones. The spin polarization was measured by using a modified Hall effect device. An electric field that is applied along the molecules causes charge redistribution, and for chiral molecules, a Hall voltage is measured that indicates the spin polarization. Based on this observation, we conjecture that the spin polarization enforces symmetry constraints on the biorecognition process between two chiral molecules, and we describe how these constraints can lead to selectivity in the interaction between enantiomers based on their handedness. Model quantum chemistry calculations that rigorously enforce these constraints show that the interaction energy for methyl groups on homochiral molecules differs significantly from that found for heterochiral molecules at van der Waals contact and shorter (i.e., ∼0.5 kcal/mol at 0.26 nm).

NMR shielding and spin–rotation constants of {sup 175}LuX (X = {sup 19}F, {sup 35}Cl, {sup 79}Br, {sup 127}I) molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Demissie, Taye B.

2015-12-31

This presentation demonstrates the relativistic effects on the spin-rotation constants, absolute nuclear magnetic resonance (NMR) shielding constants and shielding spans of {sup 175}LuX (X = {sup 19}F, {sup 35}Cl, {sup 79}Br, {sup 127}I) molecules. The results are obtained from calculations performed using density functional theory (non-relativistic and four-component relativistic) and coupled-cluster calculations. The spin-rotation constants are compared with available experimental values. In most of the molecules studied, relativistic effects make an order of magnitude difference on the NMR absolute shielding constants.

Towards a minimal stochastic model for a large class of diffusion-reactions on biological membranes.

PubMed

Chevalier, Michael W; El-Samad, Hana

2012-08-28

Diffusion of biological molecules on 2D biological membranes can play an important role in the behavior of stochastic biochemical reaction systems. Yet, we still lack a fundamental understanding of circumstances where explicit accounting of the diffusion and spatial coordinates of molecules is necessary. In this work, we illustrate how time-dependent, non-exponential reaction probabilities naturally arise when explicitly accounting for the diffusion of molecules. We use the analytical expression of these probabilities to derive a novel algorithm which, while ignoring the exact position of the molecules, can still accurately capture diffusion effects. We investigate the regions of validity of the algorithm and show that for most parameter regimes, it constitutes an accurate framework for studying these systems. We also document scenarios where large spatial fluctuation effects mandate explicit consideration of all the molecules and their positions. Taken together, our results derive a fundamental understanding of the role of diffusion and spatial fluctuations in these systems. Simultaneously, they provide a general computational methodology for analyzing a broad class of biological networks whose behavior is influenced by diffusion on membranes.

Creation of a strongly dipolar gas of ultracold ground-state 23 Na87 Rb molecules

NASA Astrophysics Data System (ADS)

Guo, Mingyang; Zhu, Bing; Lu, Bo; Ye, Xin; Wang, Fudong; Wang, Dajun; Vexiau, Romain; Bouloufa-Maafa, Nadia; Quéméner, Goulven; Dulieu, Olivier

2016-05-01

We report on successful creation of an ultracold sample of ground-state 23 Na87 Rb molecules with a large effective electric dipole moment. Through a carefully designed two-photon Raman process, we have successfully transferred the magneto-associated Feshbach molecules to the singlet ground state with high efficiency, obtaining up to 8000 23 Na87 Rb molecules with peak number density over 1011 cm-3 in their absolute ground-state level. With an external electric field, we have induced an effective dipole moment over 1 Debye, making 23 Na87 Rb the most dipolar ultracold particle ever achieved. Contrary to the expectation, we observed a rather fast population loss even for 23 Na87 Rb in the absolute ground state with the bi-molecular exchange reaction energetically forbidden. The origin for the short lifetime and possible ways of mitigating it are currently under investigation. Our achievements pave the way toward investigation of ultracold bosonic molecules with strong dipolar interactions. This work is supported by the Hong Kong RGC CUHK404712 and the ANR/RGC Joint Research Scheme ACUHK403/13.

Studies on transcription termination and splicing of the rRNA precursor in vivo in the presence of proflavine.

PubMed Central

Nielsen, O F; Carin, M; Westergaard, O

1984-01-01

In isolated nucleoli from Tetrahymena thermophila, low concentrations of the intercalating agent proflavine inhibit both transcription termination and splicing of the rRNA precursor. Proflavine also exerts an in vivo effect on the process of transcription termination under conditions, where the growth rate is only slightly reduced. Thus, approximately 40% of the rRNA precursor molecules, accumulated in nucleoli during 60 min of treatment with the drug, are longer than the normal 35S rRNA precursor. R-Loop mapping of these longer precursor molecules isolated after 30 and 60 min of incubation demonstrates that the RNA polymerases have a 50 fold lower elongation rate in the spacer region than in the coding region. Proflavine in the given concentration is found to have no significant effect on the splicing of properly terminated precursor molecules. In contrast, none of the longer non-terminated molecules are found to be spliced. These results indicate that proflavine primarily affects the process of transcription termination and that the splicing event is inhibited due to the improper termination of the precursor molecule. Images PMID:6694912

Tuning Charge and Correlation Effects for a Single Molecule on a Graphene Device

NASA Astrophysics Data System (ADS)

Tsai, Hsin-Zon; Wickenburg, Sebastian; Lu, Jiong; Lischner, Johannes; Omrani, Arash A.; Riss, Alexander; Karrasch, Christoph; Jung, Han Sae; Khajeh, Ramin; Wong, Dillon; Watanabe, Kenji; Taniguchi, Takashi; Zettl, Alex; Louie, Steven G.; Crommie, Michael F.

Controlling electronic devices down to the single molecule level is a grand challenge of nanotechnology. Single-molecules have been integrated into devices capable of tuning electronic response, but a drawback for these systems is that their microscopic structure remains unknown due to inability to image molecules in the junction region. Here we present a combined STM and nc-AFM study demonstrating gate-tunable control of the charge state of individual F4TCNQ molecules at the surface of a graphene field effect transistor. This is different from previous studies in that the Fermi level of the substrate was continuously tuned across the molecular orbital energy level. Using STS we have determined the resulting energy level evolution of the LUMO, its associated vibronic modes, and the graphene Dirac point (ED). We show that the energy difference between ED and the LUMO increases as EF is moved away from ED due to electron-electron interactions that renormalize the molecular quasiparticle energy. This is attributed to gate-tunable image-charge screening in graphene and corroborated by ab initio calculations.

Cell adhesion molecules in context

PubMed Central

2011-01-01

Cell adhesion molecules (CAMs) are now known to mediate much more than adhesion between cells and between cells and the extracellular matrix. Work by many researchers has illuminated their roles in modulating activation of molecules such as receptor tyrosine kinases, with subsequent effects on cell survival, migration and process extension. CAMs are also known to serve as substrates for proteases that can create diffusible fragments capable of signaling independently from the CAM. The diversity of interactions is further modulated by membrane rafts, which can co-localize or separate potential signaling partners to affect the likelihood of a given signaling pathway being activated. Given the ever-growing number of known CAMs and the fact that their heterophilic binding in cis or in trans can affect their interactions with other molecules, including membrane-bound receptors, one would predict a wide range of effects attributable to a particular CAM in a particular cell at a particular stage of development. The function(s) of a given CAM must therefore be considered in the context of the history of the cell expressing it and the repertoire of molecules expressed both by that cell and its neighbors. PMID:20948304

Effect of impurity molecules on the low-temperature vibrational dynamics of polyisobutylene: Investigation by single-molecule spectroscopy

NASA Astrophysics Data System (ADS)

Eremchev, I. Yu.; Naumov, A. V.; Vainer, Yu. G.; Kador, L.

2009-05-01

The influence of impurity chromophore molecules—tetra-tert-butylterrylene (TBT) and dibenzo-anthanthrene (DBATT)—on the vibrational dynamics of the amorphous polymer polyisobutylene (PIB) has been studied via single-molecule spectroscopy. The measurements were performed in the temperature region of 7-30 K, where the interaction of the chromophores with quasilocalized low-frequency vibrational modes (LFMs) determines the observed spectral line broadening. The analysis of the individual temperature dependences of the linewidths for a large number of single probe molecules yielded effective frequency values of those LFMs which are located near the respective chromophores. In this way the distributions of the LFM frequencies were measured for the two systems, and they were found to be similar. Moreover, they are in good agreement with the vibrational density of states as measured in pure PIB by inelastic neutron scattering. This allows us to conclude that, at least in the case of PIB, doping with low concentrations of the nonpolar and neutral molecules TBT and DBATT does not affect the vibrational dynamics of the matrix markedly.

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

Effects of Shapes of Solute Molecules on Diffusion: A Study of Dependences on Solute Size, Solvent, and Temperature.

PubMed

Chan, T C; Li, H T; Li, K Y

2015-12-24

Diffusivities of basically linear, planar, and spherical solutes at infinite dilution in various solvents are studied to unravel the effects of solute shapes on diffusion. On the basis of the relationship between the reciprocal of diffusivity and the molecular volume of solute molecules with similar shape in a given solvent at constant temperature, the diffusivities of solutes of equal molecular volume but different shapes are evaluated and the effects due to different shapes of two equal-sized solute molecules on diffusion are determined. It is found that the effects are dependent on the size of the solute pairs studied. Evidence of the dependence of the solute-shape effects on solvent properties is also demonstrated and discussed. Here, some new diffusion data of aromatic compounds in methanol at different temperatures are reported. The result for methanol in this study indicates that the effects of solute shape on diffusivity are only weakly dependent on temperature.

Single Molecule Effects of Osteogenesis Imperfecta Mutations in Tropocollagen Protein Domains

DTIC Science & Technology

2008-12-02

Single molecule effects of osteogenesis imperfecta mutations in tropocollagen protein domains Alfonso Gautieri,1,2 Simone Vesentini,2 Alberto...2008 proteinscience.org Abstract: Osteogenesis imperfecta (OI) is a genetic disease characterized by fragile bones, skeletal deformities and, in severe...diagnosis and treatment, an effort referred to as materiomics. Keywords: steered molecular dynamics; osteogenesis imperfecta ; Young’s modulus; collagen

Nanopore extended field-effect transistor for selective single-molecule biosensing.

PubMed

Ren, Ren; Zhang, Yanjun; Nadappuram, Binoy Paulose; Akpinar, Bernice; Klenerman, David; Ivanov, Aleksandar P; Edel, Joshua B; Korchev, Yuri

2017-09-19

There has been a significant drive to deliver nanotechnological solutions to biosensing, yet there remains an unmet need in the development of biosensors that are affordable, integrated, fast, capable of multiplexed detection, and offer high selectivity for trace analyte detection in biological fluids. Herein, some of these challenges are addressed by designing a new class of nanoscale sensors dubbed nanopore extended field-effect transistor (nexFET) that combine the advantages of nanopore single-molecule sensing, field-effect transistors, and recognition chemistry. We report on a polypyrrole functionalized nexFET, with controllable gate voltage that can be used to switch on/off, and slow down single-molecule DNA transport through a nanopore. This strategy enables higher molecular throughput, enhanced signal-to-noise, and even heightened selectivity via functionalization with an embedded receptor. This is shown for selective sensing of an anti-insulin antibody in the presence of its IgG isotype.Efficient detection of single molecules is vital to many biosensing technologies, which require analytical platforms with high selectivity and sensitivity. Ren et al. combine a nanopore sensor and a field-effect transistor, whereby gate voltage mediates DNA and protein transport through the nanopore.

Effects of Acids, Bases, and Heteroatoms on Proximal Radial Distribution Functions for Proteins

PubMed Central

Nguyen, Bao Linh; Pettitt, B. Montgomery

2015-01-01

The proximal distribution of water around proteins is a convenient method of quantifying solvation. We consider the effect of charged and sulfur-containing amino acid side-chain atoms on the proximal radial distribution function (pRDF) of water molecules around proteins using side-chain analogs. The pRDF represents the relative probability of finding any solvent molecule at a distance from the closest or surface perpendicular protein atom. We consider the near-neighbor distribution. Previously, pRDFs were shown to be universal descriptors of the water molecules around C, N, and O atom types across hundreds of globular proteins. Using averaged pRDFs, a solvent density around any globular protein can be reconstructed with controllable relative error. Solvent reconstruction using the additional information from charged amino acid side-chain atom types from both small models and protein averages reveals the effects of surface charge distribution on solvent density and improves the reconstruction errors relative to simulation. Solvent density reconstructions from the small-molecule models are as effective and less computationally demanding than reconstructions from full macromolecular models in reproducing preferred hydration sites and solvent density fluctuations. PMID:26388706

Background of the Hammett equation as observed for isolated molecules: meta- and para-substituted benzoic acids.

PubMed

Exner, Otto; Böhm, Stanislav

2002-09-06

Fundamental model compounds for the Hammett equation, meta- and para-substituted benzoic acids, were investigated by the density functional theory at the B3LYP/6-311+G(d,p) level. Energies of 25 acids and of their anions were calculated in all possible conformations and from them the energies of the assumed mixture of conformers. Relative acidities correlated with the experimental gas-phase acidities almost within the experimental uncertainty, much more precisely than in the case of previous calculations at lower levels. Dissection of the substituent effects into those operating in the acid molecule and in the anion was carried out by means of isodesmic reactions starting from monosubstituted benzenes. Both effects are cooperating in the resulting effect on the acidity; those in the acid molecule are smaller but not negligible. They are also responsible for some deviations from the Hammett equation (through-resonance of para donor substituents) and for the weaker resonance in the acid molecule in meta derivatives; in the anions the inductive and resonance effects are almost equal. On the other hand, the cooperation of effects in the acid and in the anion makes the relative acidity more sensitive to electron withdrawing and is probably one of the reasons why the Hammett equation is so generally valid.

Microtubule-Targeting Therapy for Prostate Cancer

DTIC Science & Technology

2007-02-01

that were done to achieve the above specific goals. 1. Biological effects of ribozyme -carrying adenoviruses that target stathmin mRNA in human...prostate cancer cells: A ribozyme is a small RNA molecule that acts stoichiometrically to cleave multiple target RNA molecules [1]. This unique ability...of a ribozyme to degrade multiple target RNA molecules is a more efficient approach for down regulating genes that are expressed at very high levels

Nonstationary behavior of a high-spin molecule in a bifrequency alternating current magnetic field

NASA Astrophysics Data System (ADS)

Tokman, I. D.; Vugalter, G. A.

2002-07-01

An interaction of a high-spin molecule with a bifrequency ac magnetic field, occurring at times much shorter than the molecule relaxation times, has been considered. The molecule is subjected to a dc magnetic field perpendicular to the easy anisotropy axis of the molecule. The bifrequency ac field is a superposition of two ac fields, one of which is perpendicular to the easy anisotropy axis and causes resonant transitions between the lower states of the fundamental and first excited doublets. The other ac field is parallel to the easy anisotropy axis and has a frequency much smaller than the frequency of the first ac field. It has been shown that, first, the molecule can absorb or emit energy, depending on the frequency of the low-frequency ac field, second, the bifrequency ac magnetic field induces tunneling of the molecule magnetization with the Rabi frequency. The conditions of observation of the effects predicted are discussed.

Vibrational spectroscopic, molecular docking and quantum chemical studies on 6-aminonicotinamide

NASA Astrophysics Data System (ADS)

Mohamed Asath, R.; Premkumar, S.; Mathavan, T.; Milton Franklin Benial, A.

2017-04-01

The most stable molecular structure of 6-aminonicotinamide (ANA) molecule was predicted by conformational analysis and vibrational spectral analysis was carried out by experimental and theoretical methods. The calculated and experimentally observed vibrational frequencies were assigned and compared. The π→π* electronic transition of the molecule was predicted by theoretically calculated ultraviolet-visible spectra in gas and liquid phase and further validated experimentally using ethanol as a solvent. Frontier molecular orbitals analysis was carried out to probe the reactive nature of the ANA molecule and further the site selectivity to specific chemical reactions were effectively analyzed by Fukui function calculation. The molecular electrostatic potential surface was simulated to confirm the reactive sites of the molecule. The natural bond orbital analysis was also performed to understand the intra molecular interactions, which confirms the bioactivity of the ANA molecule. Neuroprotective nature of the ANA molecule was analyzed by molecular docking analysis and the ANA molecule was identified as a good inhibitor against Alzheimer's disease.

Adsorption of gas molecules on Cu impurities embedded monolayer MoS2: A first- principles study

NASA Astrophysics Data System (ADS)

Zhao, B.; Li, C. Y.; Liu, L. L.; Zhou, B.; Zhang, Q. K.; Chen, Z. Q.; Tang, Z.

2016-09-01

Adsorption of small gas molecules (O2, NO, NO2 and NH3) on transition-metal Cu atom embedded monolayer MoS2 was investigated by first-principles calculations based on the density-functional theory (DFT). The embedded Cu atom is strongly constrained on the sulfur vacancy of monolayer MoS2 with a high diffusion barrier. The stable adsorption geometry, charge transfer and electronic structures of these gas molecules on monolayer MoS2 embedded with transition-metal Cu atom are discussed in detail. It is found that the monolayer MoS2 with embedded Cu atom can effectively capture these gas molecules with high adsorption energy. The NH3 molecule acts as electron donor after adsorption, which is different from the other gas molecules (O2, NO, and NO2). The results suggest that MoS2-Cu system may be promising for future applications in gas molecules sensing and catalysis, which is similar to those of the transition-metal embedded graphene.