An efficient Foxtail mosaic virus vector system with reduced environmental risk

PubMed Central

2010-01-01

Background Plant viral vectors offer high-yield expression of pharmaceutical and commercially important proteins with a minimum of cost and preparation time. The use of Agrobacterium tumefaciens has been introduced to deliver the viral vector as a transgene to each plant cell via a simple, nonsterile infiltration technique called "agroinoculation". With agroinoculation, a full length, systemically moving virus is no longer necessary for excellent protein yield, since the viral transgene is transcribed and replicates in every infiltrated cell. Viral genes may therefore be deleted to decrease the potential for accidental spread and persistence of the viral vector in the environment. Results In this study, both the coat protein (CP) and triple gene block (TGB) genetic segments were eliminated from Foxtail mosaic virus to create the "FECT" vector series, comprising a deletion of 29% of the genome. This viral vector is highly crippled and expresses little or no marker gene within the inoculated leaf. However, when co-agroinoculated with a silencing suppressor (p19 or HcPro), FECT expressed GFP at 40% total soluble protein in the tobacco host, Nicotiana benthamiana. The modified FoMV vector retained the full-length replicase ORF, the TGB1 subgenomic RNA leader sequence and either 0, 22 or 40 bases of TGB1 ORF (in vectors FECT0, FECT22 and FECT40, respectively). As well as N. benthamiana, infection of legumes was demonstrated. Despite many attempts, expression of GFP via syringe agroinoculation of various grass species was very low, reflecting the low Agrobacterium-mediated transformation rate of monocots. Conclusions The FECT/40 vector expresses foreign genes at a very high level, and yet has a greatly reduced biohazard potential. It can form no virions and can effectively replicate only in a plant with suppressed silencing. PMID:21162736

A Language-Independent Approach to Automatic Text Difficulty Assessment for Second-Language Learners

DTIC Science & Technology

2013-08-01

best-suited for regression. Our baseline uses z-normalized shallow length features and TF -LOG weighted vectors on bag-of-words for Arabic, Dari...length features and TF -LOG weighted vectors on bag-of-words for Arabic, Dari, English and Pashto. We compare Support Vector Machines and the Margin...football, whereas they are much less common in documents about opera). We used TF -LOG weighted word frequencies on bag-of-words for each document

Attenuated Human Parainfluenza Virus Type 1 Expressing the Respiratory Syncytial Virus (RSV) Fusion (F) Glycoprotein from an Added Gene: Effects of Prefusion Stabilization and Packaging of RSV F.

PubMed

Liu, Xiang; Liang, Bo; Ngwuta, Joan; Liu, Xueqiao; Surman, Sonja; Lingemann, Matthias; Kwong, Peter D; Graham, Barney S; Collins, Peter L; Munir, Shirin

2017-11-15

Human respiratory syncytial virus (RSV) is the most prevalent worldwide cause of severe respiratory tract infection in infants and young children. Human parainfluenza virus type 1 (HPIV1) also causes severe pediatric respiratory illness, especially croup. Both viruses lack vaccines. Here, we describe the preclinical development of a bivalent RSV/HPIV1 vaccine based on a recombinant HPIV1 vector, attenuated by a stabilized mutation, that expresses RSV F protein modified for increased stability in the prefusion (pre-F) conformation by previously described disulfide bond (DS) and hydrophobic cavity-filling (Cav1) mutations. RSV F was expressed from the first or second gene position as the full-length protein or as a chimeric protein with its transmembrane and cytoplasmic tail (TMCT) domains substituted with those of HPIV1 F in an effort to direct packaging in the vector particles. All constructs were recovered by reverse genetics. The TMCT versions of RSV F were packaged in the rHPIV1 particles much more efficiently than their full-length counterparts. In hamsters, the presence of the RSV F gene, and in particular the TMCT versions, was attenuating and resulted in reduced immunogenicity. However, the vector expressing full-length RSV F from the pre-N position was immunogenic for RSV and HPIV1. It conferred complement-independent high-quality RSV-neutralizing antibodies at titers similar to those of wild-type RSV and provided protection against RSV challenge. The vectors exhibited stable RSV F expression in vitro and in vivo In conclusion, an attenuated rHPIV1 vector expressing a pre-F-stabilized form of RSV F demonstrated promising immunogenicity and should be further developed as an intranasal pediatric vaccine. IMPORTANCE RSV and HPIV1 are major viral causes of acute pediatric respiratory illness for which no vaccines or suitable antiviral drugs are available. The RSV F glycoprotein is the major RSV neutralization antigen. We used a rHPIV1 vector, bearing a stabilized attenuating mutation, to express the RSV F glycoprotein bearing amino acid substitutions that increase its stability in the pre-F form, the most immunogenic form that elicits highly functional virus-neutralizing antibodies. RSV F was expressed from the pre-N or N-P gene position of the rHPIV1 vector as a full-length protein or as a chimeric form with its TMCT domain derived from HPIV1 F. TMCT modification greatly increased packaging of RSV F into the vector particles but also increased vector attenuation in vivo , resulting in reduced immunogenicity. In contrast, full-length RSV F expressed from the pre-N position was immunogenic, eliciting complement-independent RSV-neutralizing antibodies and providing protection against RSV challenge. Copyright © 2017 American Society for Microbiology.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Image coding using entropy-constrained residual vector quantization

NASA Technical Reports Server (NTRS)

Kossentini, Faouzi; Smith, Mark J. T.; Barnes, Christopher F.

1993-01-01

The residual vector quantization (RVQ) structure is exploited to produce a variable length codeword RVQ. Necessary conditions for the optimality of this RVQ are presented, and a new entropy-constrained RVQ (ECRVQ) design algorithm is shown to be very effective in designing RVQ codebooks over a wide range of bit rates and vector sizes. The new EC-RVQ has several important advantages. It can outperform entropy-constrained VQ (ECVQ) in terms of peak signal-to-noise ratio (PSNR), memory, and computation requirements. It can also be used to design high rate codebooks and codebooks with relatively large vector sizes. Experimental results indicate that when the new EC-RVQ is applied to image coding, very high quality is achieved at relatively low bit rates.

A new radar determination of the spin vector of Venus

NASA Technical Reports Server (NTRS)

Zohar, S.; Goldstein, R. M.; Rumsey, H. C.

1980-01-01

Two radar observations of a set of three relatively small features on the surface of Venus have facilitated a refined determination of the spin vector of Venus. The period is found to be 243.019 + or 0.014 days, while the obliquity is 177.22 + or - 0.18 deg. The effects of deviations from exact sphericity on the interpretation of the measurements are discussed at length and the question of resonance with earth is reexamined.

Modelling and simulation of particle-particle interaction in a magnetophoretic bio-separation chip

NASA Astrophysics Data System (ADS)

Alam, Manjurul; Golozar, Matin; Darabi, Jeff

2018-04-01

A Lagrangian particle trajectory model is developed to predict the interaction between cell-bead particle complexes and to track their trajectories in a magnetophoretic bio-separation chip. Magnetic flux gradients are simulated in the OpenFOAM CFD software and imported into MATLAB to obtain the trapping lengths and trajectories of the particles. A connector vector is introduced to calculate the interaction force between cell-bead complexes as they flow through a microfluidic device. The interaction force calculations are performed for cases where the connector vector is parallel, perpendicular, and at an angle of 45° with the applied magnetic field. The trajectories of the particles are simulated by solving a system of eight ordinary differential equations using a fourth order Runge-Kutta method. The model is then used to study the effects of geometric positions and angles of the connector vector between the particles as well as the cell size, number of beads per cell, and flow rate on the interaction force and trajectories of the particles. The results show that the interaction forces may be attractive or repulsive, depending on the orientation of the connector vector distance between the particle complexes and the applied magnetic field. When the interaction force is attractive, the particles are observed to merge and trap sooner than a single particle, whereas a repulsive interaction force has little or no effect on the trapping length.

Effects of internal yaw-vectoring devices on the static performance of a pitch-vectoring nonaxisymmetric convergent-divergent nozzle

NASA Technical Reports Server (NTRS)

Asbury, Scott C.

1993-01-01

An investigation was conducted in the static test facility of the Langley 16-Foot Transonic Tunnel to evaluate the internal performance of a nonaxisymmetric convergent divergent nozzle designed to have simultaneous pitch and yaw thrust vectoring capability. This concept utilized divergent flap deflection for thrust vectoring in the pitch plane and flow-turning deflectors installed within the divergent flaps for yaw thrust vectoring. Modifications consisting of reducing the sidewall length and deflecting the sidewall outboard were investigated as means to increase yaw-vectoring performance. This investigation studied the effects of multiaxis (pitch and yaw) thrust vectoring on nozzle internal performance characteristics. All tests were conducted with no external flow, and nozzle pressure ratio was varied from 2.0 to approximately 13.0. The results indicate that this nozzle concept can successfully generate multiaxis thrust vectoring. Deflection of the divergent flaps produced resultant pitch vector angles that, although dependent on nozzle pressure ratio, were nearly equal to the geometric pitch vector angle. Losses in resultant thrust due to pitch vectoring were small or negligible. The yaw deflectors produced resultant yaw vector angles up to 21 degrees that were controllable by varying yaw deflector rotation. However, yaw deflector rotation resulted in significant losses in thrust ratios and, in some cases, nozzle discharge coefficient. Either of the sidewall modifications generally reduced these losses and increased maximum resultant yaw vector angle. During multiaxis (simultaneous pitch and yaw) thrust vectoring, little or no cross coupling between the thrust vectoring processes was observed.

Vector species richness increases haemorrhagic disease prevalence through functional diversity modulating the duration of seasonal transmission.

PubMed

Park, Andrew W; Cleveland, Christopher A; Dallas, Tad A; Corn, Joseph L

2016-06-01

Although many parasites are transmitted between hosts by a suite of arthropod vectors, the impact of vector biodiversity on parasite transmission is poorly understood. Positive relationships between host infection prevalence and vector species richness (SR) may operate through multiple mechanisms, including (i) increased vector abundance, (ii) a sampling effect in which species of high vectorial capacity are more likely to occur in species-rich communities, and (iii) functional diversity whereby communities comprised species with distinct phenologies may extend the duration of seasonal transmission. Teasing such mechanisms apart is impeded by a lack of appropriate data, yet could highlight a neglected role for functional diversity in parasite transmission. We used statistical modelling of extensive host, vector and microparasite data to test the hypothesis that functional diversity leading to longer seasonal transmission explained variable levels of disease in a wildlife population. We additionally developed a simple transmission model to guide our expectation of how an increased transmission season translates to infection prevalence. Our study demonstrates that vector SR is associated with increased levels of disease reporting, but not via increases in vector abundance or via a sampling effect. Rather, the relationship operates by extending the length of seasonal transmission, in line with theoretical predictions.

Optimized Design of Spacer in Electrodialyzer Using CFD Simulation Method

NASA Astrophysics Data System (ADS)

Jia, Yuxiang; Yan, Chunsheng; Chen, Lijun; Hu, Yangdong

2018-06-01

In this study, the effects of length-width ratio and diversion trench of the spacer on the fluid flow behavior in an electrodialyzer have been investigated through CFD simulation method. The relevant information, including the pressure drop, velocity vector distribution and shear stress distribution, demonstrates the importance of optimized design of the spacer in an electrodialysis process. The results show width of the diversion trench has a great effect on the fluid flow compared with length. Increase of the diversion trench width could strength the fluid flow, but also increase the pressure drop. Secondly, the dead zone of the fluid flow decreases with increase of length-width ratio of the spacer, but the pressure drop increases with the increase of length-width ratio of the spacer. So the appropriate length-width ratio of the space should be moderate.

A mapping of an ensemble of mitochondrial sequences for various organisms into 3D space based on the word composition.

PubMed

Aita, Takuyo; Nishigaki, Koichi

2012-11-01

To visualize a bird's-eye view of an ensemble of mitochondrial genome sequences for various species, we recently developed a novel method of mapping a biological sequence ensemble into Three-Dimensional (3D) vector space. First, we represented a biological sequence of a species s by a word-composition vector x(s), where its length [absolute value]x(s)[absolute value] represents the sequence length, and its unit vector x(s)/[absolute value]x(s)[absolute value] represents the relative composition of the K-tuple words through the sequence and the size of the dimension, N=4(K), is the number of all possible words with the length of K. Second, we mapped the vector x(s) to the 3D position vector y(s), based on the two following simple principles: (1) [absolute value]y(s)[absolute value]=[absolute value]x(s)[absolute value] and (2) the angle between y(s) and y(t) maximally correlates with the angle between x(s) and x(t). The mitochondrial genome sequences for 311 species, including 177 Animalia, 85 Fungi and 49 Green plants, were mapped into 3D space by using K=7. The mapping was successful because the angles between vectors before and after the mapping highly correlated with each other (correlation coefficients were 0.92-0.97). Interestingly, the Animalia kingdom is distributed along a single arc belt (just like the Milky Way on a Celestial Globe), and the Fungi and Green plant kingdoms are distributed in a similar arc belt. These two arc belts intersect at their respective middle regions and form a cross structure just like a jet aircraft fuselage and its wings. This new mapping method will allow researchers to intuitively interpret the visual information presented in the maps in a highly effective manner. Copyright © 2012 Elsevier Inc. All rights reserved.

3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

PubMed

Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

2008-09-01

We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

Pilot study evaluating the effects of a cervical headgear on the C-axis: the growth axis of the dentomaxillary complex.

PubMed

Braun, Stanley; Bottrel, J Alexandre

2004-12-01

The C-axis, a growth vector for the dentomaxillary complex, is a means of quantifying complex maxillary growth in the sagittal plane through 3 key cephalometric measurements. This pilot study examined the effect of a cervical headgear, worn 8 to 10 hours per day, on the growth axis. The mean velocity of C-axis length increase in normally growing boys in the age range studied is 1.14 mm per year. In normally growing girls, the C-axis length increase is nonlinear, varying from a mean of 1.67 mm per year at age 9 and to 0.78 mm per year at 13.5 years of age. The cervical headgear reduced the C-axis length increases by 73.7% in boys and 61.1% in girls. The growth axis vector angle theta; was not clinically affected in either sex, but the palatal plane angle alpha became more acute in both sexes, rather than becoming more obtuse as it does in normally growing adolescents. Additional research should be undertaken to determine the effects on the C-axis by other cervical headgears having different lines of action relative to the center of resistance of the dentomaxillary complex, as well as occipital-pull and straight distal-pull headgear.

The effect of seat position on manual wheelchair propulsion biomechanics: a quasi-static model-based approach.

PubMed

Richter, W M

2001-12-01

The position of the seat relative to the rear wheels is generally adjusted to modify the rearward stability of the wheelchair. Recent studies have shown that seat position also has an effect on propulsion biomechanics and suggest that seat position can be optimized. A quasi-static wheelchair propulsion model was developed to investigate the mechanism by which seat position affects propulsion biomechanics. Inputs to the model include the length of the user's arm segments, the position of the user's shoulder, the size of handrim used and the force profile on the handrim. Outputs from the model include joint kinematics, joint torques, push angle, and push frequency. Handrim force profile was determined by averaging the force profile of five wheelchair users. Force profiles were measured using the SMARTWheel. The effect of seat position on push angle was found to be directly affected by the length of the position vector from the hub of the wheel to the shoulder and indirectly affected by the angular orientation of the vector. Decreasing hub to shoulder length was found to increase push angle, decrease push frequency, decrease shoulder torque and increase elbow extension torque. It is suggested that future research investigating the role of seat position on propulsion biomechanics include both the kinematics and kinetics of the upper extremity.

Reproductive and developmental costs of deltamethrin resistance in the Chagas disease vector Triatoma infestans.

PubMed

Germano, Mónica Daniela; Inés Picollo, María

2015-06-01

Effective chemical control relies on reducing vector population size. However, insecticide selection pressure is often associated with the development of resistant populations that reduce control success. In treated areas, these resistant individuals present an adaptive advantage due to enhanced survival. Resistance can also lead to negative effects when the insecticide pressure ceases. In this study, the biological effects of deltamethrin resistance were assessed in the Chagas disease vector Triatoma infestans. The length of each developmental stage and complete life cycle, mating rate, and fecundity were evaluated. Susceptible and resistant insects presented similar mating rates. A reproductive cost of resistance was expressed as a lower fecundity in the resistant colony. Developmental costs in the resistant colony were in the form of a shortening of the second and third nymph stage duration and an extension of the fifth stage. A maternal effect of deltamethrin resistance is suggested as these effects were identified in resistant females and their progeny independently of the mated male's deltamethrin response. Our results suggest the presence of pleiotropic effects of deltamethrin resistance. Possible associations of these characters to other traits such as developmental delays and behavioral resistance are discussed. © 2015 The Society for Vector Ecology.

Bioelectrical impedance vector distribution in the first year of life.

PubMed

Savino, Francesco; Grasso, Giulia; Cresi, Francesco; Oggero, Roberto; Silvestro, Leandra

2003-06-01

We assessed the bioelectrical impedance vector distribution in a sample of healthy infants in the first year of life, which is not available in literature. The study was conducted as a cross-sectional study in 153 healthy Caucasian infants (90 male and 63 female) younger than 1 y, born at full term, adequate for gestational age, free from chronic diseases or growth problems, and not feverish. Z scores for weight, length, cranial circumference, and body mass index for the study population were within the range of +/-1.5 standard deviations according to the Euro-Growth Study references. Concurrent anthropometrics (weight, length, and cranial circumference), body mass index, and bioelectrical impedance (resistance and reactance) measurements were made by the same operator. Whole-body (hand to foot) tetrapolar measurements were performed with a single-frequency (50 kHz), phase-sensitive impedance analyzer. The study population was subdivided into three classes of age for statistical analysis: 0 to 3.99 mo, 4 to 7.99 mo, and 8 to 11.99 mo. Using the bivariate normal distribution of resistance and reactance components standardized by the infant's length, the bivariate 95% confidence limits for the mean impedance vector separated by sex and age groups were calculated and plotted. Further, the bivariate 95%, 75%, and 50% tolerance intervals for individual vector measurements in the first year of life were plotted. Resistance and reactance values often fluctuated during the first year of life, particularly as raw measurements (without normalization by subject's length). However, 95% confidence ellipses of mean vectors from the three age groups overlapped each other, as did confidence ellipses by sex for each age class, indicating no significant vector migration during the first year of life. We obtained an estimate of mean impedance vector in a sample of healthy infants in the first year of life and calculated the bivariate values for an individual vector (95%, 75%, and 50% tolerance ellipses).

Optimal cue integration in ants.

PubMed

Wystrach, Antoine; Mangan, Michael; Webb, Barbara

2015-10-07

In situations with redundant or competing sensory information, humans have been shown to perform cue integration, weighting different cues according to their certainty in a quantifiably optimal manner. Ants have been shown to merge the directional information available from their path integration (PI) and visual memory, but as yet it is not clear that they do so in a way that reflects the relative certainty of the cues. In this study, we manipulate the variance of the PI home vector by allowing ants (Cataglyphis velox) to run different distances and testing their directional choice when the PI vector direction is put in competition with visual memory. Ants show progressively stronger weighting of their PI direction as PI length increases. The weighting is quantitatively predicted by modelling the expected directional variance of home vectors of different lengths and assuming optimal cue integration. However, a subsequent experiment suggests ants may not actually compute an internal estimate of the PI certainty, but are using the PI home vector length as a proxy. © 2015 The Author(s).

Expressing Transgenes That Exceed the Packaging Capacity of Adeno-Associated Virus Capsids

PubMed Central

Chamberlain, Kyle; Riyad, Jalish Mahmud; Weber, Thomas

2016-01-01

Recombinant adeno-associated virus vectors (rAAV) are being explored as gene delivery vehicles for the treatment of various inherited and acquired disorders. rAAVs are attractive vectors for several reasons: wild-type AAVs are nonpathogenic, and rAAVs can trigger long-term transgene expression even in the absence of genome integration—at least in postmitotic tissues. Moreover, rAAVs have a low immunogenic profile, and the various AAV serotypes and variants display broad but distinct tropisms. One limitation of rAAVs is that their genome-packaging capacity is only ∼5 kb. For most applications this is not of major concern because the median human protein size is 375 amino acids. Excluding the ITRs, for a protein of typical length, this allows the incorporation of ∼3.5 kb of DNA for the promoter, polyadenylation sequence, and other regulatory elements into a single AAV vector. Nonetheless, for certain diseases the packaging limit of AAV does not allow the delivery of a full-length therapeutic protein by a single AAV vector. Hence, approaches to overcome this limitation have become an important area of research for AAV gene therapy. Among the most promising approaches to overcome the limitation imposed by the packaging capacity of AAV is the use of dual-vector approaches, whereby a transgene is split across two separate AAV vectors. Coinfection of a cell with these two rAAVs will then—through a variety of mechanisms—result in the transcription of an assembled mRNA that could not be encoded by a single AAV vector because of the DNA packaging limits of AAV. The main purpose of this review is to assess the current literature with respect to dual-AAV-vector design, to highlight the effectiveness of the different methodologies and to briefly discuss future areas of research to improve the efficiency of dual-AAV-vector transduction. PMID:26757051

Static internal performance including thrust vectoring and reversing of two-dimensional convergent-divergent nozzles

NASA Technical Reports Server (NTRS)

Re, R. J.; Leavitt, L. D.

1984-01-01

The effects of geometric design parameters on two dimensional convergent-divergent nozzles were investigated at nozzle pressure ratios up to 12 in the static test facility. Forward flight (dry and afterburning power settings), vectored-thrust (afterburning power setting), and reverse-thrust (dry power setting) nozzles were investigated. The nozzles had thrust vector angles from 0 deg to 20.26 deg, throat aspect ratios of 3.696 to 7.612, throat radii from sharp to 2.738 cm, expansion ratios from 1.089 to 1.797, and various sidewall lengths. The results indicate that unvectored two dimensional convergent-divergent nozzles have static internal performance comparable to axisymmetric nozzles with similar expansion ratios.

Enhanced Central Nervous System Transduction with Lentiviral Vectors Pseudotyped with RVG/HIV-1gp41 Chimeric Envelope Glycoproteins

PubMed Central

Trabalza, Antonio; Eleftheriadou, Ioanna; Sgourou, Argyro; Liao, Ting-Yi; Patsali, Petros; Lee, Heyne

2014-01-01

ABSTRACT To investigate the potential benefits which may arise from pseudotyping the HIV-1 lentiviral vector with its homologous gp41 envelope glycoprotein (GP) cytoplasmic tail (CT), we created chimeric RVG/HIV-1gp41 GPs composed of the extracellular and transmembrane sequences of RVG and either the full-length gp41 CT or C terminus gp41 truncations sequentially removing existing conserved motifs. Lentiviruses (LVs) pseudotyped with the chimeric GPs were evaluated in terms of particle release (physical titer), biological titers, infectivity, and in vivo central nervous system (CNS) transduction. We report here that LVs carrying shorter CTs expressed higher levels of envelope GP and showed a higher average infectivity than those bearing full-length GPs. Interestingly, complete removal of GP CT led to vectors with the highest transduction efficiency. Removal of all C-terminal gp41 CT conserved motifs, leaving just 17 amino acids (aa), appeared to preserve infectivity and resulted in a significantly increased physical titer. Furthermore, incorporation of these 17 aa in the RVG CT notably enhanced the physical titer. In vivo stereotaxic delivery of LV vectors exhibiting the best in vitro titers into rodent striatum facilitated efficient transduction of the CNS at the site of injection. A particular observation was the improved retrograde transduction of neurons in connected distal sites that resulted from the chimeric envelope R5 which included the “Kennedy” sequence (Ken) and lentivirus lytic peptide 2 (LLP2) conserved motifs in the CT, and although it did not exhibit a comparable high titer upon pseudotyping, it led to a significant increase in distal retrograde transduction of neurons. IMPORTANCE In this study, we have produced novel chimeric envelopes bearing the extracellular domain of rabies fused to the cytoplasmic tail (CT) of gp41 and pseudotyped lentiviral vectors with them. Here we report novel effects on the transduction efficiency and physical titer of these vectors, depending on CT length and context. We also managed to achieve increased neuronal transduction in vivo in the rodent CNS, thus demonstrating that the efficiency of these vectors can be enhanced following merely CT manipulation. We believe that this paper is a novel contribution to the field and opens the way for further attempts to surface engineer lentiviral vectors and make them more amenable for applications in human disease. PMID:24371049

Extending the length and time scales of Gram-Schmidt Lyapunov vector computations

NASA Astrophysics Data System (ADS)

Costa, Anthony B.; Green, Jason R.

2013-08-01

Lyapunov vectors have found growing interest recently due to their ability to characterize systems out of thermodynamic equilibrium. The computation of orthogonal Gram-Schmidt vectors requires multiplication and QR decomposition of large matrices, which grow as N2 (with the particle count). This expense has limited such calculations to relatively small systems and short time scales. Here, we detail two implementations of an algorithm for computing Gram-Schmidt vectors. The first is a distributed-memory message-passing method using Scalapack. The second uses the newly-released MAGMA library for GPUs. We compare the performance of both codes for Lennard-Jones fluids from N=100 to 1300 between Intel Nahalem/Infiniband DDR and NVIDIA C2050 architectures. To our best knowledge, these are the largest systems for which the Gram-Schmidt Lyapunov vectors have been computed, and the first time their calculation has been GPU-accelerated. We conclude that Lyapunov vector calculations can be significantly extended in length and time by leveraging the power of GPU-accelerated linear algebra.

Induction of humoral responses to BHV-1 glycoprotein D expressed by HSV-1 amplicon vectors

PubMed Central

Blanc, Andrea Maria; Berois, Mabel Beatriz; Tomé, Lorena Magalí; Epstein, Alberto L.

2012-01-01

Herpes simplex virus type-1 (HSV-1) amplicon vectors are versatile and useful tools for transferring genes into cells that are capable of stimulating a specific immune response to their expressed antigens. In this work, two HSV-1-derived amplicon vectors were generated. One of these expressed the full-length glycoprotein D (gD) of bovine herpesvirus 1 while the second expressed the truncated form of gD (gDtr) which lacked the trans-membrane region. After evaluating gD expression in the infected cells, the ability of both vectors to induce a specific gD immune response was tested in BALB/c mice that were intramuscularly immunized. Specific serum antibody responses were detected in mice inoculated with both vectors, and the response against truncated gD was higher than the response against full-length gD. These results reinforce previous findings that HSV-1 amplicon vectors can potentially deliver antigens to animals and highlight the prospective use of these vectors for treating infectious bovine rhinotracheitis disease. PMID:22437537

Heart Electrical Actions as Biometric Indicia

NASA Technical Reports Server (NTRS)

Schipper, John F. (Inventor); Dusan, Sorin V. (Inventor); Jorgensen, Charles C. (Inventor); Belousof, Eugene (Inventor)

2013-01-01

A method and associated system for use of statistical parameters based on peak amplitudes and/or time interval lengths and/or depolarization-repolarization vector angles and/or depolarization-repolarization vector lengths for PQRST electrical signals associated with heart waves, to identify a person. The statistical parameters, estimated to be at least 192, serve as biometric indicia, to authenticate, or to decline to authenticate, an asserted identity of a candidate person.

Vehicle Based Vector Sensor

DTIC Science & Technology

2015-09-28

buoyant underwater vehicle with an interior space in which a length of said underwater vehicle is equal to one tenth of the acoustic wavelength...underwater vehicle with an interior space in which a length of said underwater vehicle is equal to one tenth of the acoustic wavelength; an...unmanned underwater vehicle that can function as an acoustic vector sensor. (2) Description of the Prior Art [0004] It is known that a propagating

Statistical Mechanical Analysis of Online Learning with Weight Normalization in Single Layer Perceptron

NASA Astrophysics Data System (ADS)

Yoshida, Yuki; Karakida, Ryo; Okada, Masato; Amari, Shun-ichi

2017-04-01

Weight normalization, a newly proposed optimization method for neural networks by Salimans and Kingma (2016), decomposes the weight vector of a neural network into a radial length and a direction vector, and the decomposed parameters follow their steepest descent update. They reported that learning with the weight normalization achieves better converging speed in several tasks including image recognition and reinforcement learning than learning with the conventional parameterization. However, it remains theoretically uncovered how the weight normalization improves the converging speed. In this study, we applied a statistical mechanical technique to analyze on-line learning in single layer linear and nonlinear perceptrons with weight normalization. By deriving order parameters of the learning dynamics, we confirmed quantitatively that weight normalization realizes fast converging speed by automatically tuning the effective learning rate, regardless of the nonlinearity of the neural network. This property is realized when the initial value of the radial length is near the global minimum; therefore, our theory suggests that it is important to choose the initial value of the radial length appropriately when using weight normalization.

Focus modulation of cylindrical vector beams by using 1D photonic crystal lens with negative refraction effect.

PubMed

Xu, Ji; Zhong, Yi; Wang, Shengming; Lu, Yunqing; Wan, Hongdan; Jiang, Jian; Wang, Jin

2015-10-19

Sub-wavelength focusing of cylindrical vector beams (CVBs) has attracted great attention due to the specific physical effects and the applications in many areas. More powerful, flexible and effective ways to modulate the focus transversally and also longitudinally are always being pursued. In this paper, cylindrically symmetric lens composed of negative-index one-dimensional photonic crystal is proposed to make a breakthrough. By revealing the relationship between focal length and the exit surface shape of the lens, a quite simple and effective principle of designing the lens structure is presented to realize specific focus modulation. Plano-concave lenses are parameterized to modulate the focal length and the number of focuses. An axicon constructed by one-dimensional photonic crystal is proposed for the first time to obtain a large depth of focus and an optical needle focal field with almost a theoretical minimum FWHM of 0.362λ is achieved under radially polarized incident light. Because of the almost identical negative refractive index for TE and TM polarization states, all the modulation methods can be applied for any arbitrary polarized CVBs. This work offers a promising methodology for designing negative-index lenses in related application areas.

Optimized Lentiviral Vector Design Improves Titer and Transgene Expression of Vectors Containing the Chicken β-Globin Locus HS4 Insulator Element

PubMed Central

Hanawa, Hideki; Yamamoto, Motoko; Zhao, Huifen; Shimada, Takashi; Persons, Derek A

2009-01-01

Hematopoietic cell gene therapy using retroviral vectors has achieved success in clinical trials. However, safety issues regarding vector insertional mutagenesis have emerged. In two different trials, vector insertion resulted in the transcriptional activation of proto-oncogenes. One strategy for potentially diminishing vector insertional mutagenesis is through the use of self-inactivating lentiviral vectors containing the 1.2-kb insulator element derived from the chicken β-globin locus. However, use of this element can dramatically decrease both vector titer and transgene expression, thereby compromising its practical use. Here, we studied lentiviral vectors containing either the full-length 1.2-kb insulator or the smaller 0.25-kb core element in both orientations in the partially deleted long-terminal repeat. We show that use of the 0.25-kb core insulator rescued vector titer by alleviating a postentry block to reverse transcription associated with the 1.2-kb element. In addition, in an orientation-dependent manner, the 0.25-kb core element significantly increased transgene expression from an internal promoter due to improved transcriptional termination. This element also demonstrated barrier activity, reducing variability of expression due to position effects. As it is known that the 0.25-kb core insulator has enhancer-blocking activity, this particular insulated lentiviral vector design may be useful for clinical application. PMID:19223867

Performance Improvements of the Phoneme Recognition Algorithm.

DTIC Science & Technology

1984-06-01

VECTOR NUNDIRt"tIVECTj Beginning vector ; of speech to be extracted INDEX * MOD(IVECT,4) ICheck for vector being ; last vector in block 63 ILE u ((JUICT...1fIER0) ; Read header block. CALL CHECK(IERO) IHEADER(57) : ICOfP ; Change a of freq. components ICHECK : (IHEADER(56) - ([LENGTH - 1)) * ILENGTH...ICONT .Al. ICHECK ) GO TO 55 ; Check to make sure correct ;amount of vectors have been created# INCR u INCR + 32 ;Jump over last set of components

The inference of vector magnetic fields from polarization measurements with limited spectral resolution

NASA Technical Reports Server (NTRS)

Lites, B. W.; Skumanich, A.

1985-01-01

A method is presented for recovery of the vector magnetic field and thermodynamic parameters from polarization measurement of photospheric line profiles measured with filtergraphs. The method includes magneto-optic effects and may be utilized on data sampled at arbitrary wavelengths within the line profile. The accuracy of this method is explored through inversion of synthetic Stokes profiles subjected to varying levels of random noise, instrumental wave-length resolution, and line profile sampling. The level of error introduced by the systematic effect of profile sampling over a finite fraction of the 5 minute oscillation cycle is also investigated. The results presented here are intended to guide instrumental design and observational procedure.

Spin wave filtering and guiding in Permalloy/iron nanowires

NASA Astrophysics Data System (ADS)

Silvani, R.; Kostylev, M.; Adeyeye, A. O.; Gubbiotti, G.

2018-03-01

We have investigated the spin wave filtering and guiding properties of periodic array of single (Permalloy and Fe) and bi-layer (Py/Fe) nanowires (NWs) by means of Brillouin light scattering measurements and micromagnetic simulations. For all the nanowire arrays, the thickness of the layers is 10 nm while all NWs have the same width of 340 nm and edge-to-edge separation of 100 nm. Spin wave dispersion has been measured in the Damon-Eshbach configuration for wave vector either parallel or perpendicular to the nanowire length. This study reveals the filtering property of the spin waves when the wave vector is perpendicular to the NW length, with frequency ranges where the spin wave propagation is permitted separated by frequency band gaps, and the guiding property of NW when the wave vector is oriented parallel to the NW, with spin wave modes propagating in parallel channels in the central and edge regions of the NW. The measured dispersions were well reproduced by micromagnetic simulations, which also deliver the spatial profiles for the modes at zero wave vector. To reproduce the dispersion of the modes localized close to the NW edges, uniaxial anisotropy has been introduced. In the case of Permalloy/iron NWs, the obtained results have been compared with those for a 20 nm thick effective NW having average magnetic properties of the two materials.

Extending the length and time scales of Gram–Schmidt Lyapunov vector computations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Costa, Anthony B., E-mail: acosta@northwestern.edu; Green, Jason R., E-mail: jason.green@umb.edu; Department of Chemistry, University of Massachusetts Boston, Boston, MA 02125

Lyapunov vectors have found growing interest recently due to their ability to characterize systems out of thermodynamic equilibrium. The computation of orthogonal Gram–Schmidt vectors requires multiplication and QR decomposition of large matrices, which grow as N{sup 2} (with the particle count). This expense has limited such calculations to relatively small systems and short time scales. Here, we detail two implementations of an algorithm for computing Gram–Schmidt vectors. The first is a distributed-memory message-passing method using Scalapack. The second uses the newly-released MAGMA library for GPUs. We compare the performance of both codes for Lennard–Jones fluids from N=100 to 1300 betweenmore » Intel Nahalem/Infiniband DDR and NVIDIA C2050 architectures. To our best knowledge, these are the largest systems for which the Gram–Schmidt Lyapunov vectors have been computed, and the first time their calculation has been GPU-accelerated. We conclude that Lyapunov vector calculations can be significantly extended in length and time by leveraging the power of GPU-accelerated linear algebra.« less

Static thrust-vectoring performance of nonaxisymmetric convergent-divergent nozzles with post-exit yaw vanes. M.S. Thesis - George Washington Univ., Aug. 1988

NASA Technical Reports Server (NTRS)

Foley, Robert J.; Pendergraft, Odis C., Jr.

1991-01-01

A static (wind-off) test was conducted in the Static Test Facility of the 16-ft transonic tunnel to determine the performance and turning effectiveness of post-exit yaw vanes installed on two-dimensional convergent-divergent nozzles. One nozzle design that was previously tested was used as a baseline, simulating dry power and afterburning power nozzles at both 0 and 20 degree pitch vectoring conditions. Vanes were installed on these four nozzle configurations to study the effects of vane deflection angle, longitudinal and lateral location, size, and camber. All vanes were hinged at the nozzle sidewall exit, and in addition, some were also hinged at the vane quarter chord (double-hinged). The vane concepts tested generally produced yaw thrust vectoring angles much less than the geometric vane angles, for (up to 8 percent) resultant thrust losses. When the nozzles were pitch vectored, yawing effectiveness decreased as the vanes were moved downstream. Thrust penalties and yawing effectiveness both decreased rapidly as the vanes were moved outboard (laterally). Vane length and height changes increased yawing effectiveness and thrust ratio losses, while using vane camber, and double-hinged vanes increased resultant yaw angles by 50 to 100 percent.

Testing resonating vector strength: Auditory system, electric fish, and noise

NASA Astrophysics Data System (ADS)

Leo van Hemmen, J.; Longtin, André; Vollmayr, Andreas N.

2011-12-01

Quite often a response to some input with a specific frequency ν○ can be described through a sequence of discrete events. Here, we study the synchrony vector, whose length stands for the vector strength, and in doing so focus on neuronal response in terms of spike times. The latter are supposed to be given by experiment. Instead of singling out the stimulus frequency ν○ we study the synchrony vector as a function of the real frequency variable ν. Its length turns out to be a resonating vector strength in that it shows clear maxima in the neighborhood of ν○ and multiples thereof, hence, allowing an easy way of determining response frequencies. We study this "resonating" vector strength for two concrete but rather different cases, viz., a specific midbrain neuron in the auditory system of cat and a primary detector neuron belonging to the electric sense of the wave-type electric fish Apteronotus leptorhynchus. We show that the resonating vector strength always performs a clear resonance correlated with the phase locking that it quantifies. We analyze the influence of noise and demonstrate how well the resonance associated with maximal vector strength indicates the dominant stimulus frequency. Furthermore, we exhibit how one can obtain a specific phase associated with, for instance, a delay in auditory analysis.

Generation of an infectious clone of a new Korean isolate of apple chlorotic leaf spot virus (ACLSV) driven by dual 35S and T7 promoters in a versatile binary vector

USDA-ARS?s Scientific Manuscript database

The full-length sequence of a new isolate of Apple chlorotic leaf spot virus (ACLSV) from Korea was divergent, but most closely related to the Japanese isolate A4, at 84% nucleotide identity. The full-length cDNA of the Korean isolate of ACLSV was cloned into a binary vector downstream of the bacter...

Static internal performance of a two-dimensional convergent-divergent nozzle with thrust vectoring

NASA Technical Reports Server (NTRS)

Bare, E. Ann; Reubush, David E.

1987-01-01

A parametric investigation of the static internal performance of multifunction two-dimensional convergent-divergent nozzles has been made in the static test facility of the Langley 16-Foot Transonic Tunnel. All nozzles had a constant throat area and aspect ratio. The effects of upper and lower flap angles, divergent flap length, throat approach angle, sidewall containment, and throat geometry were determined. All nozzles were tested at a thrust vector angle that varied from 5.60 tp 23.00 deg. The nozzle pressure ratio was varied up to 10 for all configurations.

Adding localization information in a fingerprint binary feature vector representation

NASA Astrophysics Data System (ADS)

Bringer, Julien; Despiegel, Vincent; Favre, Mélanie

2011-06-01

At BTAS'10, a new framework to transform a fingerprint minutiae template into a binary feature vector of fixed length is described. A fingerprint is characterized by its similarity with a fixed number set of representative local minutiae vicinities. This approach by representative leads to a fixed length binary representation, and, as the approach is local, it enables to deal with local distortions that may occur between two acquisitions. We extend this construction to incorporate additional information in the binary vector, in particular on localization of the vicinities. We explore the use of position and orientation information. The performance improvement is promising for utilization into fast identification algorithms or into privacy protection algorithms.

Modeling and parameterization of photoelectrons emitted in condensed matter by linearly polarized synchrotron radiation

NASA Astrophysics Data System (ADS)

Jablonski, A.

2018-01-01

Growing availability of synchrotron facilities stimulates an interest in quantitative applications of hard X-ray photoemission spectroscopy (HAXPES) using linearly polarized radiation. An advantage of this approach is the possibility of continuous variation of radiation energy that makes it possible to control the sampling depth for a measurement. Quantitative applications are based on accurate and reliable theory relating the measured spectral features to needed characteristics of the surface region of solids. A major complication in the case of polarized radiation is an involved structure of the photoemission cross-section for hard X-rays. In the present work, details of the relevant formalism are described and algorithms implementing this formalism for different experimental configurations are proposed. The photoelectron signal intensity may be considerably affected by variation in the positioning of the polarization vector with respect to the surface plane. This information is critical for any quantitative application of HAXPES by polarized X-rays. Different quantitative applications based on photoelectrons with energies up to 10 keV are considered here: (i) determination of surface composition, (ii) estimation of sampling depth, and (iii) measurements of an overlayer thickness. Parameters facilitating these applications (mean escape depths, information depths, effective attenuation lengths) were calculated for a number of photoelectron lines in four elemental solids (Si, Cu, Ag and Au) in different experimental configurations and locations of the polarization vector. One of the considered configurations, with polarization vector located in a plane perpendicular to the surface, was recommended for quantitative applications of HAXPES. In this configurations, it was found that the considered parameters vary weakly in the range of photoelectron emission angles from normal emission to about 50° with respect to the surface normal. The averaged values of the mean escape depth and effective attenuation length were approximated with accurate predictive formulas. The predicted effective attenuation lengths were compared with published values; major discrepancies observed can be ascribed to a possibility of discontinuous structure of the deposited overlayer.

Advances in Non-Viral DNA Vectors for Gene Therapy

PubMed Central

Hardee, Cinnamon L.; Arévalo-Soliz, Lirio Milenka; Hornstein, Benjamin D.; Zechiedrich, Lynn

2017-01-01

Uses of viral vectors have thus far eclipsed uses of non-viral vectors for gene therapy delivery in the clinic. Viral vectors, however, have certain issues involving genome integration, the inability to be delivered repeatedly, and possible host rejection. Fortunately, development of non-viral DNA vectors has progressed steadily, especially in plasmid vector length reduction, now allowing these tools to fill in specifically where viral or other non-viral vectors may not be the best options. In this review, we examine the improvements made to non-viral DNA gene therapy vectors, highlight opportunities for their further development, address therapeutic needs for which their use is the logical choice, and discuss their future expansion into the clinic. PMID:28208635

The Performance of the NAS HSPs in 1st Half of 1994

NASA Technical Reports Server (NTRS)

Bergeron, Robert J.; Walter, Howard (Technical Monitor)

1995-01-01

During the first six months of 1994, the NAS (National Airspace System) 16-CPU Y-MP C90 Von Neumann (VN) delivered an average throughput of 4.045 GFLOPS while the ACSF (Aeronautics Consolidated Supercomputer Facility) 8-CPU Y-MP C90 Eagle averaged 1.658 GFLOPS. The VN rate represents a machine efficiency of 26.3% whereas the Eagle rate corresponds to a machine efficiency of 21.6%. VN displayed a greater efficiency than Eagle primarily because the stronger workload demand for its CPU cycles allowed it to devote more time to user programs and less time to idle. An additional factor increasing VN efficiency was the ability of the UNICOS 8.0 Operating System to deliver a larger fraction of CPU time to user programs. Although measurements indicate increasing vector length for both workloads, insufficient vector lengths continue to hinder HSP (High Speed Processor) performance. To improve HSP performance, NAS should continue to encourage the HSP users to modify their codes to increase program vector length.

Global positioning system measurements for crustal deformation: Precision and accuracy

USGS Publications Warehouse

Prescott, W.H.; Davis, J.L.; Svarc, J.L.

1989-01-01

Analysis of 27 repeated observations of Global Positioning System (GPS) position-difference vectors, up to 11 kilometers in length, indicates that the standard deviation of the measurements is 4 millimeters for the north component, 6 millimeters for the east component, and 10 to 20 millimeters for the vertical component. The uncertainty grows slowly with increasing vector length. At 225 kilometers, the standard deviation of the measurement is 6, 11, and 40 millimeters for the north, east, and up components, respectively. Measurements with GPS and Geodolite, an electromagnetic distance-measuring system, over distances of 10 to 40 kilometers agree within 0.2 part per million. Measurements with GPS and very long baseline interferometry of the 225-kilometer vector agree within 0.05 part per million.

Characterization and expression analysis of gene encoding heme peroxidase HPX15 in major Indian malaria vector Anopheles stephensi (Diptera: Culicidae).

PubMed

Kajla, Mithilesh; Kakani, Parik; Choudhury, Tania Pal; Gupta, Kuldeep; Gupta, Lalita; Kumar, Sanjeev

2016-06-01

The interaction of mosquito immune system with Plasmodium is critical in determining the vector competence. Thus, blocking the crucial mosquito molecules that regulate parasite development might be effective in controlling the disease transmission. In this study, we characterized a full-length AsHPX15 gene from the major Indian malaria vector Anopheles stephensi. This gene is true ortholog of Anopheles gambiae heme peroxidase AgHPX15 (AGAP013327), which modulates midgut immunity and regulates Plasmodium falciparum development. We found that AsHPX15 is highly induced in mosquito developmental stages and blood fed midguts. In addition, this is a lineage-specific gene that has identical features and 65-99% amino acids identity with other HPX15 genes present in eighteen worldwide-distributed anophelines. We discuss that the conserved HPX15 gene might serve as a common target to manipulate mosquito immunity and arresting Plasmodium development inside the vector host. Copyright © 2016 Elsevier B.V. All rights reserved.

Vector rectangular-shape laser based on reduced graphene oxide interacting with a long fiber taper.

PubMed

Gao, Lei; Zhu, Tao; Huang, Wei; Zeng, Jing

2014-10-01

A vector dual-wavelength rectangular-shape laser (RSL) based on a long fiber taper deposited with reduced graphene oxide is proposed, where nonlinearity is enhanced due to a large evanescent-field-interacting length and strong field confinement of an 8 mm fiber taper with a waist diameter of 4 μm. Graphene flakes are deposited uniformly on the taper waist with light pressure effect, so this structure guarantees both excellent saturable absorption and high nonlinearity. The RSL with a repetition rate of 7.9 MHz shows fast polarization switching in two orthogonal polarization directions, and temporal and spectral characteristics are investigated.

Video data compression using artificial neural network differential vector quantization

NASA Technical Reports Server (NTRS)

Krishnamurthy, Ashok K.; Bibyk, Steven B.; Ahalt, Stanley C.

1991-01-01

An artificial neural network vector quantizer is developed for use in data compression applications such as Digital Video. Differential Vector Quantization is used to preserve edge features, and a new adaptive algorithm, known as Frequency-Sensitive Competitive Learning, is used to develop the vector quantizer codebook. To develop real time performance, a custom Very Large Scale Integration Application Specific Integrated Circuit (VLSI ASIC) is being developed to realize the associative memory functions needed in the vector quantization algorithm. By using vector quantization, the need for Huffman coding can be eliminated, resulting in superior performance against channel bit errors than methods that use variable length codes.

A method for generating double-ring-shaped vector beams

NASA Astrophysics Data System (ADS)

Huan, Chen; Xiao-Hui, Ling; Zhi-Hong, Chen; Qian-Guang, Li; Hao, Lv; Hua-Qing, Yu; Xu-Nong, Yi

2016-07-01

We propose a method for generating double-ring-shaped vector beams. A step phase introduced by a spatial light modulator (SLM) first makes the incident laser beam have a nodal cycle. This phase is dynamic in nature because it depends on the optical length. Then a Pancharatnam-Berry phase (PBP) optical element is used to manipulate the local polarization of the optical field by modulating the geometric phase. The experimental results show that this scheme can effectively create double-ring-shaped vector beams. It provides much greater flexibility to manipulate the phase and polarization by simultaneously modulating the dynamic and the geometric phases. Project supported by the National Natural Science Foundation of China (Grant No. 11547017), the Hubei Engineering University Research Foundation, China (Grant No. z2014001), and the Natural Science Foundation of Hubei Province, China (Grant No. 2014CFB578).

Estimation of Discontinuous Displacement Vector Fields with the Minimum Description Length Criterion.

DTIC Science & Technology

1990-10-01

type of approach for finding a dense displacement vector field has a time complexity that allows a real - time implementation when an appropriate control...hardly vector fields as they appear in Stereo or motion. The reason for this is the fact that local displacement vector field ( DVF ) esti- mates bave...2 objects’ motion, but that the quantitative optical flow is not a reliable measure of the real motion [VP87, SU87]. This applies even more to the

Digital Biological Converter

DTIC Science & Technology

2013-06-28

of cuts that each fragment should be cut into so the fragments are no greater than a specific length threshold. Additionally, vector sequences and...restriction sites are attached to each fragment while ensuring the restriction sites are unique to each sequence. The vector sequences serve as hooks...for assembly into vector for cloning purposes, and also as primer binding domains for PCR ampl ification. The restriction sites are added to

Gallid herpesvirus 3 SB-1 strain as a recombinant viral vector for poultry vaccination.

PubMed

Sadigh, Yashar; Powers, Claire; Spiro, Simon; Pedrera, Miriam; Broadbent, Andrew; Nair, Venugopal

2018-01-01

Live herpesvirus-vectored vaccines are widely used in veterinary medicine to protect against many infectious diseases. In poultry, three strains of herpesvirus vaccines are used against Marek's disease (MD). However, of these, only the herpesvirus of turkeys (HVT) has been successfully developed and used as a recombinant vaccine vector to induce protection against other avian viral diseases such as infectious bursal disease (IBD), Newcastle disease (ND) or avian influenza (AI). Although effective when administered individually, recombinant HVT vectors have limitations when combined in multivalent vaccines. Thus there is a need for developing additional viral vectors that could be combined with HVT in inducing protection against multiple avian diseases in multivalent vaccines. Gallid herpesvirus 3 (GaHV3) strain SB-1 is widely used by the poultry industry as bivalent vaccine in combination with HVT to exploit synergistic effects against MD. Here, we report the development and application of SB-1 as a vaccine vector to express the VP2 capsid antigen of IBD virus. A VP2 expression cassette was introduced into the SB-1 genome at three intergenic locations (UL3/UL4, UL10/UL11 and UL21/UL22) using recombineering methods on the full-length pSB-1 infectious clone of the virus. We show that the recombinant SB-1 vectors expressing VP2 induced neutralising antibody responses at levels comparable to that of commercial HVT-based VAXXITEK HVT+IBD vaccine. Birds vaccinated with the experimental recombinant SB-1 vaccine were protected against clinical disease after challenge with the very virulent UK661 IBDV isolate, demonstrating its value as an efficient viral vector for developing multivalent vaccines against avian diseases.

Optimal Cloning of PCR Fragments by Homologous Recombination in Escherichia coli

PubMed Central

Jacobus, Ana Paula; Gross, Jeferson

2015-01-01

PCR fragments and linear vectors containing overlapping ends are easily assembled into a propagative plasmid by homologous recombination in Escherichia coli. Although this gap-repair cloning approach is straightforward, its existence is virtually unknown to most molecular biologists. To popularize this method, we tested critical parameters influencing the efficiency of PCR fragments cloning into PCR-amplified vectors by homologous recombination in the widely used E. coli strain DH5α. We found that the number of positive colonies after transformation increases with the length of overlap between the PCR fragment and linear vector. For most practical purposes, a 20 bp identity already ensures high-cloning yields. With an insert to vector ratio of 2:1, higher colony forming numbers are obtained when the amount of vector is in the range of 100 to 250 ng. An undesirable cloning background of empty vectors can be minimized during vector PCR amplification by applying a reduced amount of plasmid template or by using primers in which the 5′ termini are separated by a large gap. DpnI digestion of the plasmid template after PCR is also effective to decrease the background of negative colonies. We tested these optimized cloning parameters during the assembly of five independent DNA constructs and obtained 94% positive clones out of 100 colonies probed. We further demonstrated the efficient and simultaneous cloning of two PCR fragments into a vector. These results support the idea that homologous recombination in E. coli might be one of the most effective methods for cloning one or two PCR fragments. For its simplicity and high efficiency, we believe that recombinational cloning in E. coli has a great potential to become a routine procedure in most molecular biology-oriented laboratories. PMID:25774528

GNSS Single Frequency, Single Epoch Reliable Attitude Determination Method with Baseline Vector Constraint.

PubMed

Gong, Ang; Zhao, Xiubin; Pang, Chunlei; Duan, Rong; Wang, Yong

2015-12-02

For Global Navigation Satellite System (GNSS) single frequency, single epoch attitude determination, this paper proposes a new reliable method with baseline vector constraint. First, prior knowledge of baseline length, heading, and pitch obtained from other navigation equipment or sensors are used to reconstruct objective function rigorously. Then, searching strategy is improved. It substitutes gradually Enlarged ellipsoidal search space for non-ellipsoidal search space to ensure correct ambiguity candidates are within it and make the searching process directly be carried out by least squares ambiguity decorrelation algorithm (LAMBDA) method. For all vector candidates, some ones are further eliminated by derived approximate inequality, which accelerates the searching process. Experimental results show that compared to traditional method with only baseline length constraint, this new method can utilize a priori baseline three-dimensional knowledge to fix ambiguity reliably and achieve a high success rate. Experimental tests also verify it is not very sensitive to baseline vector error and can perform robustly when angular error is not great.

[Construction of BAD Lentivirus Vector and Its Effect on Proliferation in A549 Cell Lines].

PubMed

Huang, Na; He, Yan-qi; Zhu, Jing; Li, Wei-min

2015-05-01

To construct the recombinant lentivirus expressing vector BAD (Bcl-2-associated death protein) gene and to study its effect on A549 cell proliferation. The BAD gene was amplified from plasmid pAV-MCMV-BAD-GFP by PCR. The purified BAD gene fragment was inserted into a lentivirus vector (pLVX-IRES-ZsGreen 1), and the insertion was identified by PCR, restriction endonuclease analysis and DNA sequencing. A549 cells were then transfected with the packaged recombinant lentivirus, and resistant cell clones were selected with flow cytometry. The expression of BAD in A549 cell lines stably transduction with a lentivirus was examined using Western blot. The effect of BAD overexpression on proliferation of A549 cells was evaluated by using CCK-8 kit. Restriction enzyme digestion and DNA sequencing showed that the full-length BAD gene (507 bp) had been successfully subcloned into the lentiviral vector to result in the recombinant vector pLVX-IRES-ZsGreen 1. Monoclonal cell lines BAD-A549 was produced after transfection with the recombinant lentivirus and selected with flow cytometry. Stable expression of BAD protein was verified by Western blot. In vitro, the OD value in BAD group was significantly lower than that of control groups from 120-144 h (P<0. 05). A549 cell lines stably transduced with a lentivirus expressing the BAD gene had been successfully generated. In vitro, BAD overexpression significantly inhibited A549 cells proliferation.

The Probability of Exceedance as a Nonparametric Person-Fit Statistic for Tests of Moderate Length

ERIC Educational Resources Information Center

Tendeiro, Jorge N.; Meijer, Rob R.

2013-01-01

To classify an item score pattern as not fitting a nonparametric item response theory (NIRT) model, the probability of exceedance (PE) of an observed response vector x can be determined as the sum of the probabilities of all response vectors that are, at most, as likely as x, conditional on the test's total score. Vector x is to be considered…

Genetic stability of gene targeted immunoglobulin loci. I. Heavy chain isotype exchange induced by a universal gene replacement vector.

PubMed Central

Kardinal, C; Selmayr, M; Mocikat, R

1996-01-01

Gene targeting at the immunoglobulin loci of B cells is an efficient tool for studying immunoglobulin expression or generating chimeric antibodies. We have shown that vector integration induced by human immunoglobulin G1 (IgG1) insertion vectors results in subsequent vector excision mediated by the duplicated target sequence, whereas replacement events which could be induced by the same constructs remain stable. We could demonstrate that the distribution of the vector homology strongly influences the genetic stability obtained. To this end we developed a novel type of a heavy chain replacement vector making use of the heavy chain class switch recombination sequence. Despite the presence of a two-sided homology this construct is universally applicable irrespective of the constant gene region utilized by the B cell. In comparison to an integration vector the frequency of stable incorporation was strongly increased, but we still observed vector excision, although at a markedly reduced rate. The latter events even occurred with circular constructs. Linearization of the construct at various sites and the comparison with an integration vector that carries the identical homology sequence, but differs in the distribution of homology, revealed the following features of homologous recombination of immunoglobulin genes: (i) the integration frequency is only determined by the length of the homology flank where the cross-over takes place; (ii) a 5' flank that does not meet the minimum requirement of homology length cannot be complemented by a sufficient 3' flank; (iii) free vector ends play a role for integration as well as for replacement targeting; (iv) truncating recombination events are suppressed in the presence of two flanks. Furthermore, we show that the switch region that was used as 3' flank is non-functional in an inverted orientation. Images Figure 2 PMID:8958041

Genetic stability of gene targeted immunoglobulin loci. I. Heavy chain isotype exchange induced by a universal gene replacement vector.

PubMed

Kardinal, C; Selmayr, M; Mocikat, R

1996-11-01

Gene targeting at the immunoglobulin loci of B cells is an efficient tool for studying immunoglobulin expression or generating chimeric antibodies. We have shown that vector integration induced by human immunoglobulin G1 (IgG1) insertion vectors results in subsequent vector excision mediated by the duplicated target sequence, whereas replacement events which could be induced by the same constructs remain stable. We could demonstrate that the distribution of the vector homology strongly influences the genetic stability obtained. To this end we developed a novel type of a heavy chain replacement vector making use of the heavy chain class switch recombination sequence. Despite the presence of a two-sided homology this construct is universally applicable irrespective of the constant gene region utilized by the B cell. In comparison to an integration vector the frequency of stable incorporation was strongly increased, but we still observed vector excision, although at a markedly reduced rate. The latter events even occurred with circular constructs. Linearization of the construct at various sites and the comparison with an integration vector that carries the identical homology sequence, but differs in the distribution of homology, revealed the following features of homologous recombination of immunoglobulin genes: (i) the integration frequency is only determined by the length of the homology flank where the cross-over takes place; (ii) a 5' flank that does not meet the minimum requirement of homology length cannot be complemented by a sufficient 3' flank; (iii) free vector ends play a role for integration as well as for replacement targeting; (iv) truncating recombination events are suppressed in the presence of two flanks. Furthermore, we show that the switch region that was used as 3' flank is non-functional in an inverted orientation.

Modeling node bandwidth limits and their effects on vector combining algorithms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Littlefield, R.J.

Each node in a message-passing multicomputer typically has several communication links. However, the maximum aggregate communication speed of a node is often less than the sum of its individual link speeds. Such computers are called node bandwidth limited (NBL). The NBL constraint is important when choosing algorithms because it can change the relative performance of different algorithms that accomplish the same task. This paper introduces a model of communication performance for NBL computers and uses the model to analyze the overall performance of three algorithms for vector combining (global sum) on the Intel Touchstone DELTA computer. Each of the threemore » algorithms is found to be at least 33% faster than the other two for some combinations of machine size and vector length. The NBL constraint is shown to significantly affect the conditions under which each algorithm is fastest.« less

Cre-lox Univector acceptor vectors for functional screening in protoplasts: analysis of Arabidopsis donor cDNAs encoding ABSCISIC ACID INSENSITIVE1-Like protein phosphatases

PubMed Central

Jia, Fan; Gampala, Srinivas S.L.; Mittal, Amandeep; Luo, Qingjun; Rock, Christopher D.

2009-01-01

The 14,200 available full length Arabidopsis thaliana cDNAs in the Universal Plasmid System (UPS) donor vector pUNI51 should be applied broadly and efficiently to leverage a “functional map-space” of homologous plant genes. We have engineered Cre-lox UPS host acceptor vectors (pCR701- 705) with N-terminal epitope tags in frame with the loxH site and downstream from the maize Ubiquitin promoter for use in transient protoplast expression assays and particle bombardment transformation of monocots. As an example of the utility of these vectors, we recombined them with several Arabidopsis cDNAs encoding Ser/Thr protein phosphatase type 2C (PP2Cs) known from genetic studies or predicted by hierarchical clustering meta-analysis to be involved in ABA and stress responses. Our functional results in Zea mays mesophyll protoplasts on ABA-inducible expression effects on the Late Embryogenesis Abundant promoter ProEm:GUS reporter were consistent with predictions and resulted in identification of novel activities of some PP2Cs. Deployment of these vectors can facilitate functional genomics and proteomics and identification of novel gene activities. PMID:19499346

Mucosal vaccination by adenoviruses displaying reovirus sigma 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weaver, Eric A.; Camacho, Zenaido T.; Hillestad, Matthew L.

We developed adenovirus serotype 5 (Ad5) vectors displaying the sigma 1 protein from reovirus as mucosal vaccines. Ad5-sigma retargets to JAM-1 and sialic acid, but has 40-fold reduced gene delivery when compared to Ad5. While weaker at transduction, Ad5-sigma generates stronger T cell responses than Ad5 when used for mucosal immunization. In this work, new Ad5-fiber-sigma vectors were generated by varying the number of fiber β-spiral shaft repeats (R) between the fiber tail and sigma. Increasing chimera length led to decreasing insertion of these proteinsAd5 virions. Ad-R3 and R14 vectors effectively targeted JAM-1 in vitro while R20 did not. Whenmore » wereused to immunize mice by the intranasal route, Ad5-R3-sigma produced higher serum and vaginal antibody responses than Ad5. These data suggest optimized Ad-sigma vectors may be useful vectors for mucosal vaccination. - Highlights: • Constructed adenoviruses (Ads) displaying different reovirus sigma 1 fusion proteins. • Progressively longer chimeras were more poorly encapsidated onto Ad virions. • Ad5-R3-sigma mediated better systemic and mucosal immune responses than Ad5.« less

Propagation of partially coherent vector anomalous vortex beam in turbulent atmosphere

NASA Astrophysics Data System (ADS)

Zhang, Xu; Wang, Haiyan; Tang, Lei

2018-01-01

A theoretical model is proposed to describe a partially coherent vector anomalous vortex(AV) beam. Based on the extended Huygens-Fresnel principle, analytical propagation formula for the proposed beams in turbulent atmosphere is derived. The spectral properties of the partially coherent vector AV beam are explored by using the unified theory of coherence and polarization in detail. It is interesting to find that the turbulence of atmosphere and the source parameter of the partially coherent vector AV beam( order, topological charge, coherence length, beam waist size etc) have significantly impacted the propagation properties of the partially coherent vector AV beam in turbulent atmosphere.

Light rays and the tidal gravitational pendulum

NASA Astrophysics Data System (ADS)

Farley, A. N. St J.

2018-05-01

Null geodesic deviation in classical general relativity is expressed in terms of a scalar function, defined as the invariant magnitude of the connecting vector between neighbouring light rays in a null geodesic congruence projected onto a two-dimensional screen space orthogonal to the rays, where λ is an affine parameter along the rays. We demonstrate that η satisfies a harmonic oscillator-like equation with a λ-dependent frequency, which comprises terms accounting for local matter affecting the congruence and tidal gravitational effects from distant matter or gravitational waves passing through the congruence, represented by the amplitude, of a complex Weyl driving term. Oscillating solutions for η imply the presence of conjugate or focal points along the rays. A polarisation angle, is introduced comprising the orientation of the connecting vector on the screen space and the phase, of the Weyl driving term. Interpreting β as the polarisation of a gravitational wave encountering the light rays, we consider linearly polarised waves in the first instance. A highly non-linear, second-order ordinary differential equation, (the tidal pendulum equation), is then derived, so-called due to its analogy with the equation describing a non-linear, variable-length pendulum oscillating under gravity. The variable pendulum length is represented by the connecting vector magnitude, whilst the acceleration due to gravity in the familiar pendulum formulation is effectively replaced by . A tidal torque interpretation is also developed, where the torque is expressed as a coupling between the moment of inertia of the pendulum and the tidal gravitational field. Precessional effects are briefly discussed. A solution to the tidal pendulum equation in terms of familiar gravitational lensing variables is presented. The potential emergence of chaos in general relativity is discussed in the context of circularly, elliptically or randomly polarised gravitational waves encountering the null congruence.

Elucidating the Potential of Plant Rhabdoviruses as Vector Expressions Systems

USDA-ARS?s Scientific Manuscript database

Maize fine streak virus (MFSV) is a member of the genus Nucleorhabdovirus that is transmitted by the leafhopper Graminella nigrifons. The virus replicates in both its maize host and its insect vector. To determine whether Drosophila S2 cells support the production of full-length MFSV proteins, we ...

Prediction of Broadband Shock-Associated Noise Including Propagation Effects Originating NASA

NASA Technical Reports Server (NTRS)

Miller, Steven; Morris, Philip J.

2012-01-01

An acoustic analogy is developed based on the Euler equations for broadband shock-associated noise (BBSAN) that directly incorporates the vector Green s function of the linearized Euler equations and a steady Reynolds-Averaged Navier-Stokes solution (SRANS) to describe the mean flow. The vector Green s function allows the BBSAN propagation through the jet shear layer to be determined. The large-scale coherent turbulence is modeled by two-point second order velocity cross-correlations. Turbulent length and time scales are related to the turbulent kinetic energy and dissipation rate. An adjoint vector Green s function solver is implemented to determine the vector Green s function based on a locally parallel mean flow at different streamwise locations. The newly developed acoustic analogy can be simplified to one that uses the Green s function associated with the Helmholtz equation, which is consistent with a previous formulation by the authors. A large number of predictions are generated using three different nozzles over a wide range of fully-expanded jet Mach numbers and jet stagnation temperatures. These predictions are compared with experimental data from multiple jet noise experimental facilities. In addition, two models for the so-called fine-scale mixing noise are included in the comparisons. Improved BBSAN predictions are obtained relative to other models that do not include propagation effects.

A Radiation Chemistry Code Based on the Greens Functions of the Diffusion Equation

NASA Technical Reports Server (NTRS)

Plante, Ianik; Wu, Honglu

2014-01-01

Ionizing radiation produces several radiolytic species such as.OH, e-aq, and H. when interacting with biological matter. Following their creation, radiolytic species diffuse and chemically react with biological molecules such as DNA. Despite years of research, many questions on the DNA damage by ionizing radiation remains, notably on the indirect effect, i.e. the damage resulting from the reactions of the radiolytic species with DNA. To simulate DNA damage by ionizing radiation, we are developing a step-by-step radiation chemistry code that is based on the Green's functions of the diffusion equation (GFDE), which is able to follow the trajectories of all particles and their reactions with time. In the recent years, simulations based on the GFDE have been used extensively in biochemistry, notably to simulate biochemical networks in time and space and are often used as the "gold standard" to validate diffusion-reaction theories. The exact GFDE for partially diffusion-controlled reactions is difficult to use because of its complex form. Therefore, the radial Green's function, which is much simpler, is often used. Hence, much effort has been devoted to the sampling of the radial Green's functions, for which we have developed a sampling algorithm This algorithm only yields the inter-particle distance vector length after a time step; the sampling of the deviation angle of the inter-particle vector is not taken into consideration. In this work, we show that the radial distribution is predicted by the exact radial Green's function. We also use a technique developed by Clifford et al. to generate the inter-particle vector deviation angles, knowing the inter-particle vector length before and after a time step. The results are compared with those predicted by the exact GFDE and by the analytical angular functions for free diffusion. This first step in the creation of the radiation chemistry code should help the understanding of the contribution of the indirect effect in the formation of DNA damage and double-strand breaks.

EVALUATION OF SUBLETHAL EFFECTS OF Ipomoea cairica LINN. EXTRACT ON LIFE HISTORY TRAITS OF DENGUE VECTORS

PubMed Central

ZUHARAH, Wan Fatma; AHBIRAMI, Rattanam; DIENG, Hamady; THIAGALETCHUMI, Maniam; FADZLY, Nik

2016-01-01

Plant derived insecticides have considerable potential for mosquito control because these products are safer than conventional insecticides. This study aimed to investigate sublethal activities of Ipomoea carica or railway creeper crude acethonilic extract against life history trait of dengue vectors, Aedes albopictus and Aedes aegypti. The late third instar larvae of Ae. albopictus and Ae. aegypti were exposed to a sublethal dose at LC50 and larvae that survived were further cultured. Overall, Ipomea cairica crude extracts affected the whole life history of both Aedes species. The study demonstrated significantly lower egg production (fecundity) and eggs hatchability (fertility) in Ae. albopictus. The sublethal dose of crude extracts reduced significantly the width of larval head capsule and the wing length of both sexes in both Aedes species. The significance of sublethal effects of I. cairica against Aedes mosquitoes was an additional hallmark to demonstrate further activity of this plant despite its direct toxicity to the larvae. The reduced reproductive capacity as well as morphological and physiological anomalies are some of the effects that make I. cairica a potential candidate to be used as a new plant-based insecticide to control dengue vectors. PMID:27253746

Multiscale vector fields for image pattern recognition

NASA Technical Reports Server (NTRS)

Low, Kah-Chan; Coggins, James M.

1990-01-01

A uniform processing framework for low-level vision computing in which a bank of spatial filters maps the image intensity structure at each pixel into an abstract feature space is proposed. Some properties of the filters and the feature space are described. Local orientation is measured by a vector sum in the feature space as follows: each filter's preferred orientation along with the strength of the filter's output determine the orientation and the length of a vector in the feature space; the vectors for all filters are summed to yield a resultant vector for a particular pixel and scale. The orientation of the resultant vector indicates the local orientation, and the magnitude of the vector indicates the strength of the local orientation preference. Limitations of the vector sum method are discussed. Investigations show that the processing framework provides a useful, redundant representation of image structure across orientation and scale.

Analysis of Links Positions in Landing Gear Mechanism

NASA Astrophysics Data System (ADS)

Brewczyński, D.; Tora, G.

2014-08-01

This article contains a kinematic analysis of an aircraft chassis mechanism in a range of positions. The mechanism of the chassis is made up of several smaller subsystems with different functions. The first mechanism is used to eject the chassis before landing (touchdown) and fold it to hatchway after the lift off. The second mechanism is designed to perform rotation of the crossover with the wheel, in order to adjust the position of the wheel to fit it in the limited space in the hold. The third mechanism allows movement of the chassis resulting from the change in length of the damper. To determine the position of the following links of the mechanism calculus of vectors was applied in which unit vectors were used to represent the angular position of the links. The aim of the analysis is to determine the angle of convergence and the angle of heel wheels as a function of the variable length of hydraulic cylinder, length of the shock absorber, length of the regulations rods

Nodal distances for rooted phylogenetic trees.

PubMed

Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente, Gabriel

2010-08-01

Dissimilarity measures for (possibly weighted) phylogenetic trees based on the comparison of their vectors of path lengths between pairs of taxa, have been present in the systematics literature since the early seventies. For rooted phylogenetic trees, however, these vectors can only separate non-weighted binary trees, and therefore these dissimilarity measures are metrics only on this class of rooted phylogenetic trees. In this paper we overcome this problem, by splitting in a suitable way each path length between two taxa into two lengths. We prove that the resulting splitted path lengths matrices single out arbitrary rooted phylogenetic trees with nested taxa and arcs weighted in the set of positive real numbers. This allows the definition of metrics on this general class of rooted phylogenetic trees by comparing these matrices through metrics in spaces M(n)(R) of real-valued n x n matrices. We conclude this paper by establishing some basic facts about the metrics for non-weighted phylogenetic trees defined in this way using L(p) metrics on M(n)(R), with p [epsilon] R(>0).

Effect of several geometric parameters on the static internal performance of three nonaxisymmetric nozzle concepts

NASA Technical Reports Server (NTRS)

Berrier, B. L.; Re, R. J.

1979-01-01

Effects of several geometric parameters on the internal performance of nonaxisymmetric convergent-divergent, single-ramp expansion, and wedge nozzles were investigated at nozzle pressure ratios up to approximately 10. In addition, two different thrust-vectoring schemes were investigated with the wedge nozzle. The results indicated that as with conventional round nozzles, peak nonaxisymmetric nozzle, internal performance occurred near the nozzle pressure ratio required for fully expanded exhaust flow. Nozzle sidewall length or area generally had little effect on the internal performance of the nozzles investigated.

Effects of vertical rotation on Arabidopsis development

NASA Technical Reports Server (NTRS)

Brown, A. H.; Chapman, D. K.; Dahl, A. O.

1975-01-01

Various gross morphological end points of Arabidopsis development are examined in an attempt to separate the effects of growth on the horizontal clinostat into a component caused by rotation alone and another component caused by the altered position with respect to the direction of the g-vector. In a series of tests which involved comparisons between vertical stationary plants, vertical rotated plants, and plants rotated on clinostats, certain characters were consistently influenced by vertical rotation alone. The characters for which this effect was statistically significant were petiole length and leaf blade width.

AZTEC. Parallel Iterative method Software for Solving Linear Systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hutchinson, S.; Shadid, J.; Tuminaro, R.

1995-07-01

AZTEC is an interactive library that greatly simplifies the parrallelization process when solving the linear systems of equations Ax=b where A is a user supplied n X n sparse matrix, b is a user supplied vector of length n and x is a vector of length n to be computed. AZTEC is intended as a software tool for users who want to avoid cumbersome parallel programming details but who have large sparse linear systems which require an efficiently utilized parallel processing system. A collection of data transformation tools are provided that allow for easy creation of distributed sparse unstructured matricesmore » for parallel solutions.« less

Demographic effects of deltamethrin resistance in the Chagas disease vector Triatoma infestans.

PubMed

Germano, M D; Picollo, M I

2016-12-01

Triatoma infestans (Heteroptera: Reduviidae) Klug is the main vector of Chagas disease in Latin America. Resistance to deltamethrin was reported in Argentina and recently associated with reproductive and longevity trade-offs. The objectives of the present study were to describe the demographic consequences of deltamethrin resistance in T. infestans and to establish possible target stages for chemical control in susceptible and resistant colonies. A stage-classified matrix model was constructed based on the average stage length for susceptible, resistant and reciprocal matings' progeny. The differences between colonies were analysed by prospective and retrospective analysis. The life table parameters indicated reduced fecundity, fertility and population growth in resistant insects. The retrospective analysis suggested the latter was associated with lower reproductive output and increased fifth-instar nymph stage length. The prospective analysis suggested that the adult stage should be the main target for insecticide control. Although, fifth-instar nymphs should also be targeted when resistance has been detected. The presented results show demographic effects of deltamethrin resistance in T. infestans. While the older stages could be the main targets for chemical control, this approach is impeded by their higher tolerance to insecticides. It is concluded that the different mode of action insecticides would be more effective than a dose increase for the control of deltamethrin-resistant T. infestans. © 2016 The Royal Entomological Society.

Differential cross sections in a thick brane world scenario

NASA Astrophysics Data System (ADS)

Pedraza, Omar; Arceo, R.; López, L. A.; Cerón, V. E.

2018-04-01

The elastic differential cross section is calculated at low energies for the elements He and Ne using an effective 4D electromagnetic potential coming from the contribution of the massive Kaluza-Klein modes of the 5D vector field in a thick brane scenario. The length scale is adjusted in the potential to compare with known experimental data and to set bounds for the parameter of the model.

The Prediction of Broadband Shock-Associated Noise Including Propagation Effects

NASA Technical Reports Server (NTRS)

Miller, Steven; Morris, Philip J.

2011-01-01

An acoustic analogy is developed based on the Euler equations for broadband shock- associated noise (BBSAN) that directly incorporates the vector Green's function of the linearized Euler equations and a steady Reynolds-Averaged Navier-Stokes solution (SRANS) as the mean flow. The vector Green's function allows the BBSAN propagation through the jet shear layer to be determined. The large-scale coherent turbulence is modeled by two-point second order velocity cross-correlations. Turbulent length and time scales are related to the turbulent kinetic energy and dissipation. An adjoint vector Green's function solver is implemented to determine the vector Green's function based on a locally parallel mean flow at streamwise locations of the SRANS solution. However, the developed acoustic analogy could easily be based on any adjoint vector Green's function solver, such as one that makes no assumptions about the mean flow. The newly developed acoustic analogy can be simplified to one that uses the Green's function associated with the Helmholtz equation, which is consistent with the formulation of Morris and Miller (AIAAJ 2010). A large number of predictions are generated using three different nozzles over a wide range of fully expanded Mach numbers and jet stagnation temperatures. These predictions are compared with experimental data from multiple jet noise labs. In addition, two models for the so-called 'fine-scale' mixing noise are included in the comparisons. Improved BBSAN predictions are obtained relative to other models that do not include the propagation effects, especially in the upstream direction of the jet.

Noninvasive evaluation of contractile behavior of cardiomyocyte monolayers based on motion vector analysis.

PubMed

Hayakawa, Tomohiro; Kunihiro, Takeshi; Dowaki, Suguru; Uno, Hatsume; Matsui, Eriko; Uchida, Masashi; Kobayashi, Seiji; Yasuda, Akio; Shimizu, Tatsuya; Okano, Teruo

2012-01-01

A noninvasive method for the characterization of cardiomyocyte contractile behavior is presented. Light microscopic video images of cardiomyocytes were captured with a high-speed camera, and motion vectors (which have a velocity dimension) were calculated with a high spatiotemporal resolution using a block-matching algorithm. This method could extract contraction and relaxation motions of cardiomyocytes separately and evaluate characteristics such as the beating rate, orientation of contraction, beating cooperativity/homogeneity in the monolayer, and wave propagation of impulses. Simultaneous phase-contrast imaging and calcium (Ca2+) fluorescence measurements confirmed that the timing of the maximum shortening velocity of cardiomyocytes correlated well with intracellular Ca2+ transients. Based on our analysis, gap junction inhibitors, 1-heptanol (2 mM) or 18-β-glycyrrhetinic acid (30 μM), resulted in clear changes in beating cooperativity and the propagation pattern of impulses in the cardiomyocyte monolayer. Additionally, the time dependence of the motion vector length indicated a prolonged relaxation process in the presence of potassium (K+) channel blockers, dl-sotalol (1 μM), E-4031 (100 nM), or terfenadine (100 nM), reflecting the prolonged QT (Q wave and T wave) interval of cardiomyocytes. Effects of autonomic agents (acetylcholine or epinephrine [EPI]) or EPI and propranolol on cardiomyocytes were clearly detected by the alterations of beating rate and the motion vector length in contraction and relaxation processes. This method was noninvasive and could sensitively evaluate the contractile behavior of cardiomyocytes; therefore, it may be used to study and/or monitor cardiomyocyte tissue during prolonged culture periods and in screens for drugs that may alter the contraction of cardiomyocytes.

On the Partitioning of Squared Euclidean Distance and Its Applications in Cluster Analysis.

ERIC Educational Resources Information Center

Carter, Randy L.; And Others

1989-01-01

The partitioning of squared Euclidean--E(sup 2)--distance between two vectors in M-dimensional space into the sum of squared lengths of vectors in mutually orthogonal subspaces is discussed. Applications to specific cluster analysis problems are provided (i.e., to design Monte Carlo studies for performance comparisons of several clustering methods…

Identification of Human Semiochemicals Attractive to the Major Vectors of Onchocerciasis

PubMed Central

Young, Ryan M.; Burkett-Cadena, Nathan D.; McGaha, Tommy W.; Rodriguez-Perez, Mario A.; Toé, Laurent D.; Adeleke, Monsuru A.; Sanfo, Moussa; Soungalo, Traore; Katholi, Charles R.; Noblet, Raymond; Fadamiro, Henry; Torres-Estrada, Jose L.; Salinas-Carmona, Mario C.; Baker, Bill; Unnasch, Thomas R.; Cupp, Eddie W.

2015-01-01

Background Entomological indicators are considered key metrics to document the interruption of transmission of Onchocerca volvulus, the etiological agent of human onchocerciasis. Human landing collection is the standard employed for collection of the vectors for this parasite. Recent studies reported the development of traps that have the potential for replacing humans for surveillance of O. volvulus in the vector population. However, the key chemical components of human odor that are attractive to vector black flies have not been identified. Methodology/Principal Findings Human sweat compounds were analyzed using GC-MS analysis and compounds common to three individuals identified. These common compounds, with others previously identified as attractive to other hematophagous arthropods were evaluated for their ability to stimulate and attract the major onchocerciasis vectors in Africa (Simulium damnosum sensu lato) and Latin America (Simulium ochraceum s. l.) using electroantennography and a Y tube binary choice assay. Medium chain length carboxylic acids and aldehydes were neurostimulatory for S. damnosum s.l. while S. ochraceum s.l. was stimulated by short chain aliphatic alcohols and aldehydes. Both species were attracted to ammonium bicarbonate and acetophenone. The compounds were shown to be attractive to the relevant vector species in field studies, when incorporated into a formulation that permitted a continuous release of the compound over time and used in concert with previously developed trap platforms. Conclusions/Significance The identification of compounds attractive to the major vectors of O. volvulus will permit the development of optimized traps. Such traps may replace the use of human vector collectors for monitoring the effectiveness of onchocerciasis elimination programs and could find use as a contributing component in an integrated vector control/drug program aimed at eliminating river blindness in Africa. PMID:25569240

Identification of human semiochemicals attractive to the major vectors of onchocerciasis.

PubMed

Young, Ryan M; Burkett-Cadena, Nathan D; McGaha, Tommy W; Rodriguez-Perez, Mario A; Toé, Laurent D; Adeleke, Monsuru A; Sanfo, Moussa; Soungalo, Traore; Katholi, Charles R; Noblet, Raymond; Fadamiro, Henry; Torres-Estrada, Jose L; Salinas-Carmona, Mario C; Baker, Bill; Unnasch, Thomas R; Cupp, Eddie W

2015-01-01

Entomological indicators are considered key metrics to document the interruption of transmission of Onchocerca volvulus, the etiological agent of human onchocerciasis. Human landing collection is the standard employed for collection of the vectors for this parasite. Recent studies reported the development of traps that have the potential for replacing humans for surveillance of O. volvulus in the vector population. However, the key chemical components of human odor that are attractive to vector black flies have not been identified. Human sweat compounds were analyzed using GC-MS analysis and compounds common to three individuals identified. These common compounds, with others previously identified as attractive to other hematophagous arthropods were evaluated for their ability to stimulate and attract the major onchocerciasis vectors in Africa (Simulium damnosum sensu lato) and Latin America (Simulium ochraceum s. l.) using electroantennography and a Y tube binary choice assay. Medium chain length carboxylic acids and aldehydes were neurostimulatory for S. damnosum s.l. while S. ochraceum s.l. was stimulated by short chain aliphatic alcohols and aldehydes. Both species were attracted to ammonium bicarbonate and acetophenone. The compounds were shown to be attractive to the relevant vector species in field studies, when incorporated into a formulation that permitted a continuous release of the compound over time and used in concert with previously developed trap platforms. The identification of compounds attractive to the major vectors of O. volvulus will permit the development of optimized traps. Such traps may replace the use of human vector collectors for monitoring the effectiveness of onchocerciasis elimination programs and could find use as a contributing component in an integrated vector control/drug program aimed at eliminating river blindness in Africa.

Investigation of two-dimensional wedge exhaust nozzles for advanced aircraft

NASA Technical Reports Server (NTRS)

Maiden, D. L.; Petit, J. E.

1975-01-01

Two-dimensional wedge nozzle performance characteristics were investigated in a series of wind-tunnel tests. An isolated single-engine/nozzle model was used to study the effects of internal expansion area ratio, aftbody cowl boattail angle, and wedge length. An integrated twin-engine/nozzle model, tested with and without empenage surfaces, included cruise, acceleration, thrust vectoring and thrust reversing nozzle operating modes. Results indicate that the thrust-minus-aftbody drag performance of the twin two-dimensional nozzle integration is significantly higher, for speeds greater than Mach 0.8, than the performance achieved with twin axisymmetric nozzle installations. Significant jet-induced lift was obtained on an aft-mounted lifting surface using a cambered wedge center body to vector thrust. The thrust reversing capabilities of reverser panels installed on the two-dimensional wedge center body were very effective for static or in-flight operation.

[Construction of a plant effective expression vector containing the gene of hepatitis B virus surface antigen].

PubMed

Lin, Bing-Ying; Jin, Zhi-Qiang; Li, Mei

2006-11-01

To construct a plant effective expression vector driven by a fruit specific promoter for the expression of hepatitis B virus surface antigen (HBsAg), to further improve the expression of exogenous gene in plant, and to prepare for the development of an effective anti-hepatitis vaccine. Tomato fruit-specific promoters' gene 2A12 and E8 were respectively introduced to pBPFOmega7 to form pB2A12 and pBE8. The DNA fragment containing HBsAg-s gene from plasmid YEP-HBs was inserted respectively into pB2A12 and pBE8 to form pB2A12-HBs and pBE8-HBs. The fragment containing "p35S+2A12+Omega+HBsAg-s+Tnos" of the pB2A12-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the reconstructed plant binary expression plasmid pCAM2A12-HBs, and the fragment containing "p35S+E8+Omega+HBsAg-s+Tnos" of the pBE8-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the plasmid pCAME8-HBs. The inserted gene HBsAg and fruit-specific promoters in the reconstructed plant binary expression vectors were confirmed by sequencing. Then, pCAM2A12-HBs and pCAME8-HBs were directly introduced into Agrobacterium tumefaciens strain EHA105. Digestion with restriction enzymes proved that all recombinant vectors had the inserts with expected length of the target fragments, and the sequencing results were confirmed correct. In this study, plant expression vector containing HBsAg gene driven by fruit specific promoter and CaMV35s promoter was successfully constructed.

Quantifying adsorption-induced deformation of nanoporous materials on different length scales

PubMed Central

Morak, Roland; Braxmeier, Stephan; Ludescher, Lukas; Hüsing, Nicola; Reichenauer, Gudrung

2017-01-01

A new in situ setup combining small-angle neutron scattering (SANS) and dilatometry was used to measure water-adsorption-induced deformation of a monolithic silica sample with hierarchical porosity. The sample exhibits a disordered framework consisting of macropores and struts containing two-dimensional hexagonally ordered cylindrical mesopores. The use of an H2O/D2O water mixture with zero scattering length density as an adsorptive allows a quantitative determination of the pore lattice strain from the shift of the corresponding diffraction peak. This radial strut deformation is compared with the simultaneously measured macroscopic length change of the sample with dilatometry, and differences between the two quantities are discussed on the basis of the deformation mechanisms effective at the different length scales. It is demonstrated that the SANS data also provide a facile way to quantitatively determine the adsorption isotherm of the material by evaluating the incoherent scattering contribution of H2O at large scattering vectors. PMID:29021735

Development and validation of novel AAV2 random libraries displaying peptides of diverse lengths and at diverse capsid positions.

PubMed

Naumer, Matthias; Ying, Ying; Michelfelder, Stefan; Reuter, Antje; Trepel, Martin; Müller, Oliver J; Kleinschmidt, Jürgen A

2012-05-01

Libraries based on the insertion of random peptide ligands into the capsid of adeno-associated virus type 2 (AAV2) have been widely used to improve the efficiency and selectivity of the AAV vector system. However, so far only libraries of 7-mer peptide ligands have been inserted at one well-characterized capsid position. Here, we expanded the combinatorial AAV2 display system to a panel of novel AAV libraries, displaying peptides of 5, 7, 12, 19, or 26 amino acids in length at capsid position 588 or displaying 7-mer peptides at position 453, the most prominently exposed region of the viral capsid. Library selections on two unrelated cell types-human coronary artery endothelial cells and rat cardiomyoblasts-revealed the isolation of cell type-characteristic peptides of different lengths mediating strongly improved target-cell transduction, except for the 26-mer peptide ligands. Characterization of vector selectivity by transduction of nontarget cells and comparative gene-transduction analysis using a panel of 44 human tumor cell lines revealed that insertion of different-length peptides allows targeting of distinct cellular receptors for cell entry with similar efficiency, but with different selectivity. The application of such novel AAV2 libraries broadens the spectrum of targetable receptors by capsid-modified AAV vectors and provides the opportunity to choose the best suited targeting ligand for a certain application from a number of different candidates.

Supercoiled Minivector DNA resists shear forces associated with gene therapy delivery

PubMed Central

Catanese, D J; Fogg, J M; Schrock, D E; Gilbert, B E; Zechiedrich, L

2012-01-01

Supercoiled DNAs varying from 281 to 5302 bp were subjected to shear forces generated by aerosolization or sonication. DNA shearing strongly correlated with length. Typical sized plasmids (⩾3000 bp) degraded rapidly. DNAs 2000–3000 bp persisted ∼10 min. Even in the absence of condensing agents, supercoiled DNA <1200 bp survived nebulization, and increased forces of sonication were necessary to shear it. Circular vectors were considerably more resistant to shearing than linear vectors of the same length. DNA supercoiling afforded additional protection. These results show the potential of shear-resistant Minivector DNAs to overcome one of the major challenges associated with gene therapy delivery. PMID:21633394

Final results of the Resonance spacecraft calibration effort

NASA Astrophysics Data System (ADS)

Sampl, Manfred; Macher, Wolfgang; Gruber, Christian; Oswald, Thomas; Rucker, Helmut O.

2010-05-01

We report our dedicated analyses of electrical field sensors onboard the Resonance spacecraft with a focus on the high-frequency electric antennas. The aim of the Resonance mission is to investigate wave-particle interactions and plasma dynamics in the inner magnetosphere of the Earth, with a focus on phenomena occurring along the same field line and within the same flux tube of the Earth's magnetic field. Four spacecraft will be launched, in the middle of the next decade, to perform these observations and measurements. Amongst a variety of instruments and probes several low- and high-frequency electric sensors will be carried which can be used for simultaneous remote sensing and in-situ measurements. The high-frequency electric sensors consist of cylindrical antennas mounted on four booms extruded from the central body of the spacecraft. In addition, the boom rods themselves are used together with the these sensors for mutual impedance measurements. Due to the parasitic effects of the conducting spacecraft body the electrical antenna representations (effective length vector, capacitances) do not coincide with their physical representations. The analysis of the reception properties of these antennas is presented, along with a contribution to the understanding of their impairment by other objects; in particular the influence of large magnetic loop sensors is studied. In order to analyse the antenna system, we applied experimental and numerical methods. The experimental method, called rheometry, is essentially an electrolytic tank measurement, where a scaled-down spacecraft model is immersed into an electrolytic medium (water) with corresponding measurements of voltages at the antennas. The numerical method consists of a numerical solution of the underlying field equations by means of computer programs, which are based on wire-grid and patch-grid models. The experimental and numerical results show that parasitic effects of the antenna-spacecraft assembly alter the antenna properties significantly. The antenna directions and lengths, represented by the "effective length vector" are altered by up to 4 degree in direction and 50% in length, for the quasi-static range. High frequency analyses (up to 40 MHz) illustrate massive antenna pattern changes beyond the quasi-static frequency limit of approximately 1.5 MHz. In addition we found that the magnetic loop sensors tremendously increase the effective lengths and capacitances, depending on their placement on the booms. The antenna calibration results and loop placement findings are of great benefit to the Resonance mission. In particular, goniopolarimetry techniques like polarization analysis and direction finding depend crucially on the effective axes.

Experimental Study of an Axisymmetric Dual Throat Fluidic Thrust Vectoring Nozzle for Supersonic Aircraft Application

NASA Technical Reports Server (NTRS)

Flamm, Jeffrey D.; Deere, Karen A.; Mason, Mary L.; Berrier, Bobby L.; Johnson, Stuart K.

2007-01-01

An axisymmetric version of the Dual Throat Nozzle concept with a variable expansion ratio has been studied to determine the impacts on thrust vectoring and nozzle performance. The nozzle design, applicable to a supersonic aircraft, was guided using the unsteady Reynolds-averaged Navier-Stokes computational fluid dynamics code, PAB3D. The axisymmetric Dual Throat Nozzle concept was tested statically in the Jet Exit Test Facility at the NASA Langley Research Center. The nozzle geometric design variables included circumferential span of injection, cavity length, cavity convergence angle, and nozzle expansion ratio for conditions corresponding to take-off and landing, mid climb and cruise. Internal nozzle performance and thrust vectoring performance was determined for nozzle pressure ratios up to 10 with secondary injection rates up to 10 percent of the primary flow rate. The 60 degree span of injection generally performed better than the 90 degree span of injection using an equivalent injection area and number of holes, in agreement with computational results. For injection rates less than 7 percent, thrust vector angle for the 60 degree span of injection was 1.5 to 2 degrees higher than the 90 degree span of injection. Decreasing cavity length improved thrust ratio and discharge coefficient, but decreased thrust vector angle and thrust vectoring efficiency. Increasing cavity convergence angle from 20 to 30 degrees increased thrust vector angle by 1 degree over the range of injection rates tested, but adversely affected system thrust ratio and discharge coefficient. The dual throat nozzle concept generated the best thrust vectoring performance with an expansion ratio of 1.0 (a cavity in between two equal minimum areas). The variable expansion ratio geometry did not provide the expected improvements in discharge coefficient and system thrust ratio throughout the flight envelope of typical a supersonic aircraft. At mid-climb and cruise conditions, the variable geometry design compromised thrust vector angle achieved, but some thrust vector control would be available, potentially for aircraft trim. The fixed area, expansion ratio of 1.0, Dual Throat Nozzle provided the best overall compromise for thrust vectoring and nozzle internal performance over the range of NPR tested compared to the variable geometry Dual Throat Nozzle.

Identification of DNA-binding proteins by combining auto-cross covariance transformation and ensemble learning.

PubMed

Liu, Bin; Wang, Shanyi; Dong, Qiwen; Li, Shumin; Liu, Xuan

2016-04-20

DNA-binding proteins play a pivotal role in various intra- and extra-cellular activities ranging from DNA replication to gene expression control. With the rapid development of next generation of sequencing technique, the number of protein sequences is unprecedentedly increasing. Thus it is necessary to develop computational methods to identify the DNA-binding proteins only based on the protein sequence information. In this study, a novel method called iDNA-KACC is presented, which combines the Support Vector Machine (SVM) and the auto-cross covariance transformation. The protein sequences are first converted into profile-based protein representation, and then converted into a series of fixed-length vectors by the auto-cross covariance transformation with Kmer composition. The sequence order effect can be effectively captured by this scheme. These vectors are then fed into Support Vector Machine (SVM) to discriminate the DNA-binding proteins from the non DNA-binding ones. iDNA-KACC achieves an overall accuracy of 75.16% and Matthew correlation coefficient of 0.5 by a rigorous jackknife test. Its performance is further improved by employing an ensemble learning approach, and the improved predictor is called iDNA-KACC-EL. Experimental results on an independent dataset shows that iDNA-KACC-EL outperforms all the other state-of-the-art predictors, indicating that it would be a useful computational tool for DNA binding protein identification. .

A new molecular evolution model for limited insertion independent of substitution.

PubMed

Lèbre, Sophie; Michel, Christian J

2013-10-01

We recently introduced a new molecular evolution model called the IDIS model for Insertion Deletion Independent of Substitution [13,14]. In the IDIS model, the three independent processes of substitution, insertion and deletion of residues have constant rates. In order to control the genome expansion during evolution, we generalize here the IDIS model by introducing an insertion rate which decreases when the sequence grows and tends to 0 for a maximum sequence length nmax. This new model, called LIIS for Limited Insertion Independent of Substitution, defines a matrix differential equation satisfied by a vector P(t) describing the sequence content in each residue at evolution time t. An analytical solution is obtained for any diagonalizable substitution matrix M. Thus, the LIIS model gives an expression of the sequence content vector P(t) in each residue under evolution time t as a function of the eigenvalues and the eigenvectors of matrix M, the residue insertion rate vector R, the total insertion rate r, the initial and maximum sequence lengths n0 and nmax, respectively, and the sequence content vector P(t0) at initial time t0. The derivation of the analytical solution is much more technical, compared to the IDIS model, as it involves Gauss hypergeometric functions. Several propositions of the LIIS model are derived: proof that the IDIS model is a particular case of the LIIS model when the maximum sequence length nmax tends to infinity, fixed point, time scale, time step and time inversion. Using a relation between the sequence length l and the evolution time t, an expression of the LIIS model as a function of the sequence length l=n(t) is obtained. Formulas for 'insertion only', i.e. when the substitution rates are all equal to 0, are derived at evolution time t and sequence length l. Analytical solutions of the LIIS model are explicitly derived, as a function of either evolution time t or sequence length l, for two classical substitution matrices: the 3-parameter symmetric substitution matrix [12] (LIIS-SYM3) and the HKY asymmetric substitution matrix[9] (LIIS-HKY). An evaluation of the LIIS model (precisely, LIIS-HKY) based on four statistical analyses of the GC content in complete genomes of four prokaryotic taxonomic groups, namely Chlamydiae, Crenarchaeota, Spirochaetes and Thermotogae, shows the expected improvement from the theory of the LIIS model compared to the IDIS model. Copyright © 2013 Elsevier Inc. All rights reserved.

Validation of a recombinant human bactericidal/permeability-increasing protein (hBPI) expression vector using murine mammary gland tumor cells and the early development of hBPI transgenic goat embryos.

PubMed

Gui, Tao; Liu, Xing; Tao, Jia; Chen, Jianwen; Li, Yunsheng; Zhang, Meiling; Wu, Ronghua; Zhang, Yuanliang; Peng, Kaisong; Liu, Ya; Zhang, Xiaorong; Zhang, Yunhai

2013-12-01

Human bactericidal/permeability-increasing protein (hBPI) is the only antibacterial peptide which acts against both gram-negative bacteria and neutralizes endotoxins in human polymorphonuclear neutrophils; therefore, hBPI is of great value in clinical applications. In the study, we constructed a hBPI expression vector (pBC1-Loxp-Neo-Loxp-hBPI) containing the full-length hBPI coding sequence which could be specifically expressed in the mammary gland. To validate the function of the vector, in vitro cultured C127 (mouse mammary Carcinoma Cells) were transfected with the vector, and the transgenic cell clones were selected to express hBPI by hormone induction. The mRNA and protein expression of hBPI showed that the constructed vector was effective and suitable for future application in producing mammary gland bioreactor. Then, female and male goat fibroblasts were transfected with the vector, and two male and two female transgenic clonal cell lines were obtained. Using the transgenic cell lines as nuclear donors for somatic cell nuclear transfer, the reconstructed goat embryos produced from all four clones could develop to blastocysts in vitro. In conclusion, we constructed and validated an efficient mammary gland-specific hBPI expression vector, pBC1-Loxp-Neo-Loxp-hBPI, and transgenic hBPI goat embryos were successfully produced, laying foundations for future production of recombinant hBPI in goat mammary gland. Copyright © 2013 Elsevier B.V. All rights reserved.

Coupling of Carbon Nanotubes to Metallic Contacts

NASA Technical Reports Server (NTRS)

Anantram, M. P.; Datta, S.; Xue, Yong-Xiang; Govindan, T. R. (Technical Monitor)

1999-01-01

The modeling of carbon nanotube-metal contacts is important from both basic and applied view points. For many applications, it is important to design contacts such that the transmission is dictated by intrinsic properties of the nanotube rather than by details of the contact. In this paper, we calculate the electron transmission probability from a nanotube to a free electron metal, which is side-contacted. If the metal-nanotube interface is sufficiently ordered, we find that k-vector conservation plays an important role in determining the coupling, with the physics depending on the area of contact, tube diameter, and chirality. The main results of this paper are: (1) conductance scales with contact length, a phenomena that has been observed in experiments and (2) in the case of uniform coupling between metal and nanotube, the threshold value of the metal Fermi wave vector (below which coupling is insignificant) depends on chirality. Disorder and small phase coherence length relax the need for k-vector conservation, thereby making the coupling stronger.

Sentence alignment using feed forward neural network.

PubMed

Fattah, Mohamed Abdel; Ren, Fuji; Kuroiwa, Shingo

2006-12-01

Parallel corpora have become an essential resource for work in multi lingual natural language processing. However, sentence aligned parallel corpora are more efficient than non-aligned parallel corpora for cross language information retrieval and machine translation applications. In this paper, we present a new approach to align sentences in bilingual parallel corpora based on feed forward neural network classifier. A feature parameter vector is extracted from the text pair under consideration. This vector contains text features such as length, punctuate score, and cognate score values. A set of manually prepared training data has been assigned to train the feed forward neural network. Another set of data was used for testing. Using this new approach, we could achieve an error reduction of 60% over length based approach when applied on English-Arabic parallel documents. Moreover this new approach is valid for any language pair and it is quite flexible approach since the feature parameter vector may contain more/less or different features than that we used in our system such as lexical match feature.

Construction of recombinant FGFR1 containing full-length gene and its potential application.

PubMed

Zhou, Yali; Luo, Wenjuan; Zheng, Lei; Li, Miao; Zhang, Yanmin

2010-07-01

FGFR1, one of the four fibroblast growth factor receptors, has been found to be over-expressed in many cancers. In this study, a full-length expression plasmid for FGFR1 was obtained by fragment amplification. The amplified PCR product was then digested and inserted into the pcDNA3.1(+) vector. A recombinant eukaryotic expression vector containing the complete CDS region of FGFR1 was successfully constructed. After it was transfected to Hek293 cell, the expression of the FGFR1 receptor in recombinant Hek293/FGFR1 was 18 times higher than that of Hek293 cell. The biological activities of high expression FGFR1 cell (Hek293/FGFR1) were verified by FCM, immunofluorescent, RT-PCR, western blot and cell cycle analysis. Then, Hek293/FGFR1 was used to screen taspine with cell membrane chromatography (CMC). Finally, we analyzed the effects of taspine on Hek293/FGFR1 cell and MCF-7 cell. In conclusion, Hek293/FGFR1 was successfully constructed. The results demonstrate that taspine can down-regulate phosphorylation of FGFR1 and ERK, and inhibit Hek293/FGFR1 and MCF-7 cell proliferation. Copyright 2010 Elsevier Inc. All rights reserved.

Influence of conversion on the location of points and lines: The change of location entropy and the probability of a vector point inside the converted grid point

NASA Astrophysics Data System (ADS)

Chen, Nan

2018-03-01

Conversion of points or lines from vector to grid format, or vice versa, is the first operation required for most spatial analysis. Conversion, however, usually causes the location of points or lines to change, which influences the reliability of the results of spatial analysis or even results in analysis errors. The purpose of this paper is to evaluate the change of the location of points and lines during conversion using the concepts of probability and entropy. This paper shows that when a vector point is converted to a grid point, the vector point may be outside or inside the grid point. This paper deduces a formula for computing the probability that the vector point is inside the grid point. It was found that the probability increased with the side length of the grid and with the variances of the coordinates of the vector point. In addition, the location entropy of points and lines are defined in this paper. Formulae for computing the change of the location entropy during conversion are deduced. The probability mentioned above and the change of location entropy may be used to evaluate the location reliability of points and lines in Geographic Information Systems and may be used to choose an appropriate range of the side length of grids before conversion. The results of this study may help scientists and users to avoid mistakes caused by the change of location during conversion as well as in spatial decision and analysis.

Compass cues used by a nocturnal bull ant, Myrmecia midas.

PubMed

Freas, Cody A; Narendra, Ajay; Cheng, Ken

2017-05-01

Ants use both terrestrial landmarks and celestial cues to navigate to and from their nest location. These cues persist even as light levels drop during the twilight/night. Here, we determined the compass cues used by a nocturnal bull ant, Myrmecia midas , in which the majority of individuals begin foraging during the evening twilight period. Myrmecia midas foragers with vectors of ≤5   m when displaced to unfamiliar locations did not follow the home vector, but instead showed random heading directions. Foragers with larger home vectors (≥10   m) oriented towards the fictive nest, indicating a possible increase in cue strength with vector length. When the ants were displaced locally to create a conflict between the home direction indicated by the path integrator and terrestrial landmarks, foragers oriented using landmark information exclusively and ignored any accumulated home vector regardless of vector length. When the visual landmarks at the local displacement site were blocked, foragers were unable to orient to the nest direction and their heading directions were randomly distributed. Myrmecia midas ants typically nest at the base of the tree and some individuals forage on the same tree. Foragers collected on the nest tree during evening twilight were unable to orient towards the nest after small lateral displacements away from the nest. This suggests the possibility of high tree fidelity and an inability to extrapolate landmark compass cues from information collected on the tree and at the nest site to close displacement sites. © 2017. Published by The Company of Biologists Ltd.

Application of Hyperspectal Techniques to Monitoring & Management of Invasive Plant Species Infestation

DTIC Science & Technology

2008-01-09

The image data as acquired from the sensor is a data cloud in multi- dimensional space with each band generating an axis of dimension. When the data... The color of a material is defined by the direction of its unit vector in n- dimensional spectral space . The length of the vector relates only to how...to n- dimensional space . SAM determines the similarity

Calibration of the Logarithmic-Periodic Dipole Antenna (LPDA) Radio Stations at the Pierre Auger Observatory using an Octocopter

DOE PAGES

Aab, Alexander

2017-10-16

An in-situ calibration of a logarithmic periodic dipole antenna with a frequency coverage of 30 MHz to 80 MHz is performed. Such antennas are part of a radio station system used for detection of cosmic ray induced air showers at the Engineering Radio Array of the Pierre Auger Observatory, the so-called Auger Engineering Radio Array (AERA). The directional and frequency characteristics of the broadband antenna are investigated using a remotely piloted aircraft (RPA) carrying a small transmitting antenna. The antenna sensitivity is described by the vector effective length relating the measured voltage with the electric-field components perpendicular to the incoming signal direction. The horizontal and meridional components are determined with an overall uncertainty ofmore » $$7.4^{+0.9}_{-0.3} %$$ and $$10.3^{+2.8}_{-1.7} %$$ respectively. The measurement is used to correct a simulated response of the frequency and directional response of the antenna. In addition, the influence of the ground conductivity and permitivity on the antenna response is simulated. Both have a negligible influence given the ground conditions measured at the detector site. The overall uncertainties of the vector effective length components result in an uncertainty of $$9.4^{+1.5}_{-1.6} %$$ in the square root of the energy fluence for incoming signal directions with zenith angles smaller than 60°.« less

Calibration of the Logarithmic-Periodic Dipole Antenna (LPDA) Radio Stations at the Pierre Auger Observatory using an Octocopter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aab, Alexander

An in-situ calibration of a logarithmic periodic dipole antenna with a frequency coverage of 30 MHz to 80 MHz is performed. Such antennas are part of a radio station system used for detection of cosmic ray induced air showers at the Engineering Radio Array of the Pierre Auger Observatory, the so-called Auger Engineering Radio Array (AERA). The directional and frequency characteristics of the broadband antenna are investigated using a remotely piloted aircraft (RPA) carrying a small transmitting antenna. The antenna sensitivity is described by the vector effective length relating the measured voltage with the electric-field components perpendicular to the incoming signal direction. The horizontal and meridional components are determined with an overall uncertainty ofmore » $$7.4^{+0.9}_{-0.3} %$$ and $$10.3^{+2.8}_{-1.7} %$$ respectively. The measurement is used to correct a simulated response of the frequency and directional response of the antenna. In addition, the influence of the ground conductivity and permitivity on the antenna response is simulated. Both have a negligible influence given the ground conditions measured at the detector site. The overall uncertainties of the vector effective length components result in an uncertainty of $$9.4^{+1.5}_{-1.6} %$$ in the square root of the energy fluence for incoming signal directions with zenith angles smaller than 60°.« less

Calibration of the logarithmic-periodic dipole antenna (LPDA) radio stations at the Pierre Auger Observatory using an octocopter

NASA Astrophysics Data System (ADS)

Aab, A.; Abreu, P.; Aglietta, M.; Samarai, I. Al; Albuquerque, I. F. M.; Allekotte, I.; Almela, A.; Alvarez Castillo, J.; Alvarez-Muñiz, J.; Anastasi, G. A.; Anchordoqui, L.; Andrada, B.; Andringa, S.; Aramo, C.; Arqueros, F.; Arsene, N.; Asorey, H.; Assis, P.; Aublin, J.; Avila, G.; Badescu, A. M.; Balaceanu, A.; Barbato, F.; Barreira Luz, R. J.; Beatty, J. J.; Becker, K. H.; Bellido, J. A.; Berat, C.; Bertaina, M. E.; Bertou, X.; Biermann, P. L.; Billoir, P.; Biteau, J.; Blaess, S. G.; Blanco, A.; Blazek, J.; Bleve, C.; Boháčová, M.; Boncioli, D.; Bonifazi, C.; Borodai, N.; Botti, A. M.; Brack, J.; Brancus, I.; Bretz, T.; Bridgeman, A.; Briechle, F. L.; Buchholz, P.; Bueno, A.; Buitink, S.; Buscemi, M.; Caballero-Mora, K. S.; Caccianiga, L.; Cancio, A.; Canfora, F.; Caramete, L.; Caruso, R.; Castellina, A.; Cataldi, G.; Cazon, L.; Chavez, A. G.; Chinellato, J. A.; Chudoba, J.; Clay, R. W.; Cobos, A.; Colalillo, R.; Coleman, A.; Collica, L.; Coluccia, M. R.; Conceição, R.; Consolati, G.; Contreras, F.; Cooper, M. J.; Coutu, S.; Covault, C. E.; Cronin, J.; D'Amico, S.; Daniel, B.; Dasso, S.; Daumiller, K.; Dawson, B. R.; de Almeida, R. M.; de Jong, S. J.; De Mauro, G.; de Mello Neto, J. R. T.; De Mitri, I.; de Oliveira, J.; de Souza, V.; Debatin, J.; Deligny, O.; Di Giulio, C.; Di Matteo, A.; Díaz Castro, M. L.; Diogo, F.; Dobrigkeit, C.; D'Olivo, J. C.; Dorosti, Q.; dos Anjos, R. C.; Dova, M. T.; Dundovic, A.; Ebr, J.; Engel, R.; Erdmann, M.; Erfani, M.; Escobar, C. O.; Espadanal, J.; Etchegoyen, A.; Falcke, H.; Farrar, G.; Fauth, A. C.; Fazzini, N.; Fenu, F.; Fick, B.; Figueira, J. M.; Filipčič, A.; Fratu, O.; Freire, M. M.; Fujii, T.; Fuster, A.; Gaior, R.; García, B.; Garcia-Pinto, D.; Gaté, F.; Gemmeke, H.; Gherghel-Lascu, A.; Ghia, P. L.; Giaccari, U.; Giammarchi, M.; Giller, M.; Głas, D.; Glaser, C.; Golup, G.; Gómez Berisso, M.; Gómez Vitale, P. F.; González, N.; Gorgi, A.; Gorham, P.; Grillo, A. F.; Grubb, T. D.; Guarino, F.; Guedes, G. P.; Hampel, M. R.; Hansen, P.; Harari, D.; Harrison, T. A.; Harton, J. L.; Haungs, A.; Hebbeker, T.; Heck, D.; Heimann, P.; Herve, A. E.; Hill, G. C.; Hojvat, C.; Holt, E.; Homola, P.; Hörandel, J. R.; Horvath, P.; Hrabovský, M.; Huege, T.; Hulsman, J.; Insolia, A.; Isar, P. G.; Jandt, I.; Jansen, S.; Johnsen, J. A.; Josebachuili, M.; Kääpä, A.; Kambeitz, O.; Kampert, K. H.; Katkov, I.; Keilhauer, B.; Kemmerich, N.; Kemp, E.; Kemp, J.; Kieckhafer, R. M.; Klages, H. O.; Kleifges, M.; Kleinfeller, J.; Krause, R.; Krohm, N.; Kuempel, D.; Kukec Mezek, G.; Kunka, N.; Kuotb Awad, A.; LaHurd, D.; Lauscher, M.; Legumina, R.; Leigui de Oliveira, M. A.; Letessier-Selvon, A.; Lhenry-Yvon, I.; Link, K.; Lo Presti, D.; Lopes, L.; López, R.; López Casado, A.; Luce, Q.; Lucero, A.; Malacari, M.; Mallamaci, M.; Mandat, D.; Mantsch, P.; Mariazzi, A. G.; Mariş, I. C.; Marsella, G.; Martello, D.; Martinez, H.; Martínez Bravo, O.; Masías Meza, J. J.; Mathes, H. J.; Mathys, S.; Matthews, J.; Matthews, J. A. J.; Matthiae, G.; Mayotte, E.; Mazur, P. O.; Medina, C.; Medina-Tanco, G.; Melo, D.; Menshikov, A.; Merenda, K.-D.; Micheletti, M. I.; Middendorf, L.; Minaya, I. A.; Miramonti, L.; Mitrica, B.; Mockler, D.; Mollerach, S.; Montanet, F.; Morello, C.; Mostafá, M.; Müller, A. L.; Müller, G.; Muller, M. A.; Müller, S.; Mussa, R.; Naranjo, I.; Nellen, L.; Nguyen, P. H.; Niculescu-Oglinzanu, M.; Niechciol, M.; Niemietz, L.; Niggemann, T.; Nitz, D.; Nosek, D.; Novotny, V.; Nožka, H.; Núñez, L. A.; Ochilo, L.; Oikonomou, F.; Olinto, A.; Palatka, M.; Pallotta, J.; Papenbreer, P.; Parente, G.; Parra, A.; Paul, T.; Pech, M.; Pedreira, F.; Pȩkala, J.; Pelayo, R.; Peña-Rodriguez, J.; Pereira, L. A. S.; Perlín, M.; Perrone, L.; Peters, C.; Petrera, S.; Phuntsok, J.; Piegaia, R.; Pierog, T.; Pieroni, P.; Pimenta, M.; Pirronello, V.; Platino, M.; Plum, M.; Porowski, C.; Prado, R. R.; Privitera, P.; Prouza, M.; Quel, E. J.; Querchfeld, S.; Quinn, S.; Ramos-Pollan, R.; Rautenberg, J.; Ravignani, D.; Revenu, B.; Ridky, J.; Risse, M.; Ristori, P.; Rizi, V.; Rodrigues de Carvalho, W.; Rodriguez Fernandez, G.; Rodriguez Rojo, J.; Rogozin, D.; Roncoroni, M. J.; Roth, M.; Roulet, E.; Rovero, A. C.; Ruehl, P.; Saffi, S. J.; Saftoiu, A.; Salamida, F.; Salazar, H.; Saleh, A.; Salesa Greus, F.; Salina, G.; Sánchez, F.; Sanchez-Lucas, P.; Santos, E. M.; Santos, E.; Sarazin, F.; Sarmento, R.; Sarmiento, C. A.; Sato, R.; Schauer, M.; Scherini, V.; Schieler, H.; Schimp, M.; Schmidt, D.; Scholten, O.; Schovánek, P.; Schröder, F. G.; Schulz, A.; Schumacher, J.; Sciutto, S. J.; Segreto, A.; Settimo, M.; Shadkam, A.; Shellard, R. C.; Sigl, G.; Silli, G.; Sima, O.; Śmiałkowski, A.; Šmída, R.; Snow, G. R.; Sommers, P.; Sonntag, S.; Sorokin, J.; Squartini, R.; Stanca, D.; Stanič, S.; Stasielak, J.; Stassi, P.; Strafella, F.; Suarez, F.; Suarez Durán, M.; Sudholz, T.; Suomijärvi, T.; Supanitsky, A. D.; Swain, J.; Szadkowski, Z.; Taboada, A.; Taborda, O. A.; Tapia, A.; Theodoro, V. M.; Timmermans, C.; Todero Peixoto, C. J.; Tomankova, L.; Tomé, B.; Torralba Elipe, G.; Travnicek, P.; Trini, M.; Ulrich, R.; Unger, M.; Urban, M.; Valdés Galicia, J. F.; Valiño, I.; Valore, L.; van Aar, G.; van Bodegom, P.; van den Berg, A. M.; van Vliet, A.; Varela, E.; Vargas Cárdenas, B.; Varner, G.; Vázquez, R. A.; Veberič, D.; Vergara Quispe, I. D.; Verzi, V.; Vicha, J.; Villaseñor, L.; Vorobiov, S.; Wahlberg, H.; Wainberg, O.; Walz, D.; Watson, A. A.; Weber, M.; Weindl, A.; Wiencke, L.; Wilczyński, H.; Winchen, T.; Wirtz, M.; Wittkowski, D.; Wundheiler, B.; Yang, L.; Yelos, D.; Yushkov, A.; Zas, E.; Zavrtanik, D.; Zavrtanik, M.; Zepeda, A.; Zimmermann, B.; Ziolkowski, M.; Zong, Z.; Zuccarello, F.

2017-10-01

An in-situ calibration of a logarithmic periodic dipole antenna with a frequency coverage of 30 MHz to 80 MHz is performed. Such antennas are part of a radio station system used for detection of cosmic ray induced air showers at the Engineering Radio Array of the Pierre Auger Observatory, the so-called Auger Engineering Radio Array (AERA) . The directional and frequency characteristics of the broadband antenna are investigated using a remotely piloted aircraft carrying a small transmitting antenna. The antenna sensitivity is described by the vector effective length relating the measured voltage with the electric-field components perpendicular to the incoming signal direction. The horizontal and meridional components are determined with an overall uncertainty of 7.4+0.9-0.3% and 10.3+2.8-1.7% respectively. The measurement is used to correct a simulated response of the frequency and directional response of the antenna. In addition, the influence of the ground conductivity and permittivity on the antenna response is simulated. Both have a negligible influence given the ground conditions measured at the detector site. The overall uncertainties of the vector effective length components result in an uncertainty of 8.8+2.1-1.3% in the square root of the energy fluence for incoming signal directions with zenith angles smaller than 60°.

[Construction and functional identification of eukaryotic expression vector carrying Sprague-Dawley rat MSX-2 gene].

PubMed

Yang, Xian-Xian; Zhang, Mei; Yan, Zhao-Wen; Zhang, Ru-Hong; Mu, Xiong-Zheng

2008-01-01

To construct a high effective eukaryotic expressing plasmid PcDNA 3.1-MSX-2 encoding Sprague-Dawley rat MSX-2 gene for the further study of MSX-2 gene function. The full length SD rat MSX-2 gene was amplified by PCR, and the full length DNA was inserted in the PMD1 8-T vector. It was isolated by restriction enzyme digest with BamHI and Xhol, then ligated into the cloning site of the PcDNA3.1 expression plasmid. The positive recombinant was identified by PCR analysis, restriction endonudease analysis and sequence analysis. Expression of RNA and protein was detected by RT-PCR and Western blot analysis in PcDNA3.1-MSX-2 transfected HEK293 cells. Sequence analysis and restriction endonudease analysis of PcDNA3.1-MSX-2 demonstrated that the position and size of MSX-2 cDNA insertion were consistent with the design. RT-PCR and Western blot analysis showed specific expression of mRNA and protein of MSX-2 in the transfected HEK293 cells. The high effective eukaryotic expression plasmid PcDNA3.1-MSX-2 encoding Sprague-Dawley Rat MSX-2 gene which is related to craniofacial development can be successfully reconstructed. It may serve as the basis for the further study of MSX-2 gene function.

The Interaction between Vector Life History and Short Vector Life in Vector-Borne Disease Transmission and Control.

PubMed

Brand, Samuel P C; Rock, Kat S; Keeling, Matt J

2016-04-01

Epidemiological modelling has a vital role to play in policy planning and prediction for the control of vectors, and hence the subsequent control of vector-borne diseases. To decide between competing policies requires models that can generate accurate predictions, which in turn requires accurate knowledge of vector natural histories. Here we highlight the importance of the distribution of times between life-history events, using short-lived midge species as an example. In particular we focus on the distribution of the extrinsic incubation period (EIP) which determines the time between infection and becoming infectious, and the distribution of the length of the gonotrophic cycle which determines the time between successful bites. We show how different assumptions for these periods can radically change the basic reproductive ratio (R0) of an infection and additionally the impact of vector control on the infection. These findings highlight the need for detailed entomological data, based on laboratory experiments and field data, to correctly construct the next-generation of policy-informing models.

Non-London electrodynamics in a multiband London model: Anisotropy-induced nonlocalities and multiple magnetic field penetration lengths

NASA Astrophysics Data System (ADS)

Silaev, Mihail; Winyard, Thomas; Babaev, Egor

2018-05-01

The London model describes strongly type-2 superconductors as massive vector field theories, where the magnetic field decays exponentially at the length scale of the London penetration length. This also holds for isotropic multiband extensions, where the presence of multiple bands merely renormalizes the London penetration length. We show that, by contrast, the magnetic properties of anisotropic multiband London models are not this simple, and the anisotropy leads to the interband phase differences becoming coupled to the magnetic field. This results in the magnetic field in such systems having N +1 penetration lengths, where N is the number of field components or bands. That is, in a given direction, the magnetic field decay is described by N +1 modes with different amplitudes and different decay length scales. For certain anisotropies we obtain magnetic modes with complex masses. That means that magnetic field decay is not described by a monotonic exponential increment set by a real penetration length but instead is oscillating. Some of the penetration lengths are shown to diverge away from the superconducting phase transition when the mass of the phase-difference mode vanishes. Finally the anisotropy-driven hybridization of the London mode with the Leggett modes can provide an effectively nonlocal magnetic response in the nominally local London model. Focusing on the two-component model, we discuss the magnetic field inversion that results from the effective nonlocality, both near the surface of the superconductor and around vortices. In the regime where the magnetic field decay becomes nonmonotonic, the multiband London superconductor is shown to form weakly-bound states of vortices.

On the use of finite difference matrix-vector products in Newton-Krylov solvers for implicit climate dynamics with spectral elements

DOE PAGES

Woodward, Carol S.; Gardner, David J.; Evans, Katherine J.

2015-01-01

Efficient solutions of global climate models require effectively handling disparate length and time scales. Implicit solution approaches allow time integration of the physical system with a step size governed by accuracy of the processes of interest rather than by stability of the fastest time scales present. Implicit approaches, however, require the solution of nonlinear systems within each time step. Usually, a Newton's method is applied to solve these systems. Each iteration of the Newton's method, in turn, requires the solution of a linear model of the nonlinear system. This model employs the Jacobian of the problem-defining nonlinear residual, but thismore » Jacobian can be costly to form. If a Krylov linear solver is used for the solution of the linear system, the action of the Jacobian matrix on a given vector is required. In the case of spectral element methods, the Jacobian is not calculated but only implemented through matrix-vector products. The matrix-vector multiply can also be approximated by a finite difference approximation which may introduce inaccuracy in the overall nonlinear solver. In this paper, we review the advantages and disadvantages of finite difference approximations of these matrix-vector products for climate dynamics within the spectral element shallow water dynamical core of the Community Atmosphere Model.« less

Effects of Ionic Dependence of DNA Persistence Length on the DNA Condensation at Room Temperature

NASA Astrophysics Data System (ADS)

Mao, Wei; Liu, Yan-Hui; Hu, Lin; Xu, Hou-Qiang

2016-05-01

DNA persistence length is a key parameter for quantitative interpretation of the conformational properties of DNA and related to the bending rigidity of DNA. A series of experiments pointed out that, in the DNA condensation process by multivalent cations, the condensed DNA takes elongated coil or compact globule states and the population of the compact globule states increases with an increase in ionic concentration. At the same time, single molecule experiments carried out in solution with multivalent cations (such as spermidine, spermine) indicated that DNA persistence length strongly depends on the ionic concentration. In order to revolve the effects of ionic concentration dependence of persistence length on DNA condensation, a model including the ionic concentration dependence of persistence length and strong correlation of multivalent cation on DNA is provided. The autocorrelation function of the tangent vectors is found as an effective way to detect the ionic concentration dependence of toroidal conformations. With an increase in ion concentration, the first periodic oscillation contained in the autocorrelation function shifts, the number of segment contained in the first periodic oscillation decreases gradually. According to the experiments, the average long-axis length is defined to estimate the ionic concentration dependence of condensation process further. The relation between long-axis length and ionic concentration matches the experimental results qualitatively. Supported by National Natural Science Foundation of China under Grant Nos. 11047022, 11204045, 11464004 and 31360215; The Research Foundation from Ministry of Education of China (212152), Guizhou Provincial Tracking Key Program of Social Development (SY20123089, SZ20113069); The General Financial Grant from the China Postdoctoral Science Foundation (2014M562341); The Research Foundation for Young University Teachers from Guizhou University (201311); The West Light Foundation (2015) and College Innovation Talent Team of Guizhou Province, (2014) 32

Anomalous Anderson localization

NASA Astrophysics Data System (ADS)

Deng, Wenji

2000-04-01

We propose a generalized Anderson model and study numerically the localization phenomena in one dimension. In our model, not all the sites take on-site random site energy. The on-site energy εn on the nth site is assigned as follows. If n+P-1=0 ( mod P) , where P is a positive integer, εn is assumed to be randomly distributed between - W/2 and W/2. On the other lattice sites, the site energy is fixed, say εn=0.The localization length ξ defined as | t| 2=e -2 L/ ξ, where t is the transmission coefficient, is calculated using the transfer matrix method. It is found that the single-electron states with wave vectors k= π/P, 2 π/P,…,(P-1) π/P are no longer localized as in the standard Anderson model. Compared with the smooth localization length spectrum of the Anderson model, there appear P-1 sharp peaks periodically located at P-1 values of wave vector on the localization length spectrum of the generalized Anderson model with parameter P.

Motorcyclists safety system to avoid rear end collisions based on acoustic signatures

NASA Astrophysics Data System (ADS)

Muzammel, M.; Yusoff, M. Zuki; Malik, A. Saeed; Mohamad Saad, M. Naufal; Meriaudeau, F.

2017-03-01

In many Asian countries, motorcyclists have a higher fatality rate as compared to other vehicles. Among many other factors, rear end collisions are also contributing for these fatalities. Collision detection systems can be useful to minimize these accidents. However, the designing of efficient and cost effective collision detection system for motorcyclist is still a major challenge. In this paper, an acoustic information based, cost effective and efficient collision detection system is proposed for motorcycle applications. The proposed technique uses the Short time Fourier Transform (STFT) to extract the features from the audio signal and Principal component analysis (PCA) has been used to reduce the feature vector length. The reduction of feature length, further increases the performance of this technique. The proposed technique has been tested on self recorded dataset and gives accuracy of 97.87%. We believe that this method can help to reduce a significant number of motorcycle accidents.

Mechanical properties and crack growth behavior of polycrystalline copper using molecular dynamics simulation

NASA Astrophysics Data System (ADS)

Qiu, Ren-Zheng; Li, Chi-Chen; Fang, Te-Hua

2017-08-01

This study investigated the mechanical properties and crack propagation behavior of polycrystalline copper using a molecular dynamics simulation. The effects of temperature, grain size, and crack length were evaluated in terms of atomic trajectories, slip vectors, common neighbor analysis, the material’s stress-strain diagram and Young’s modulus. The simulation results show that the grain boundary of the material is more easily damaged at high temperatures and that grain boundaries will combine at the crack tip. From the stress-strain diagram, it was observed that the maximum stress increased as the temperature decreased. In contrast, the maximum stress was reduced by increasing the temperature. With regard to the effect of the grain size, when the grain size was too small, the structure of the sample deformed due to the effect of atomic interactions, which caused the grain boundary structure to be disordered in general. However, when the grain size was larger, dislocations appeared and began to move from the tip of the crack, which led to a new dislocation phenomenon. With regards to the effect of the crack length, the tip of the crack did not affect the sample’s material when the crack length was less than 5 nm. However, when the crack length was above 7.5 nm, the grain boundary was damaged, and twinning structures and dislocations appeared on both sides of the crack tip. This is because the tip of the crack was blunt at first before sharpening due to the dislocation effect.

Further development of raccoon poxvirus-vectored vaccines against plague (Yersinia pestis)

USGS Publications Warehouse

Rocke, Tonie E.; Iams, Keith P.; Dawe, S.; Smith, Susan; Williamson, Judy L.; Heisey, Dennis M.; Osorio, Jorge E.

2009-01-01

In previous studies, we demonstrated protection against plague in mice and prairie dogs using a raccoon pox (RCN) virus-vectored vaccine that expressed the F1 capsular antigen of Yersinia pestis. In order to improve vaccine efficacy, we have now constructed additional RCN-plague vaccines containing two different forms of the lcrV (V) gene, including full-length (Vfull) and a truncated form (V307). Mouse challenge studies with Y. pestis strain CO92 showed that vaccination with a combination of RCN-F1 and the truncated V construct (RCN-V307) provided the greatest improvement (P = 0.01) in protection against plague over vaccination with RCN-F1 alone. This effect was mediated primarily by anti-F1 and anti-V antibodies and both contributed independently to increased survival of vaccinated mice.

Further development of raccoon poxvirus-vectored vaccines against plague (Yersinia pestis).

PubMed

Rocke, Tonie E; Iams, Keith P; Dawe, Sandra; Smith, Susan R; Williamson, Judy L; Heisey, Dennis M; Osorio, Jorge E

2009-12-11

In previous studies, we demonstrated protection against plague in mice and prairie dogs using a raccoon pox (RCN) virus-vectored vaccine that expressed the F1 capsular antigen of Yersinia pestis. In order to improve vaccine efficacy, we have now constructed additional RCN-plague vaccines containing two different forms of the lcrV (V) gene, including full-length (Vfull) and a truncated form (V307). Mouse challenge studies with Y. pestis strain CO92 showed that vaccination with a combination of RCN-F1 and the truncated V construct (RCN-V307) provided the greatest improvement (P=0.01) in protection against plague over vaccination with RCN-F1 alone. This effect was mediated primarily by anti-F1 and anti-V antibodies and both contributed independently to increased survival of vaccinated mice.

Sub-Pixel Extraction of Laser Stripe Center Using an Improved Gray-Gravity Method †

PubMed Central

Li, Yuehua; Zhou, Jingbo; Huang, Fengshan; Liu, Lijian

2017-01-01

Laser stripe center extraction is a key step for the profile measurement of line structured light sensors (LSLS). To accurately obtain the center coordinates at sub-pixel level, an improved gray-gravity method (IGGM) was proposed. Firstly, the center points of the stripe were computed using the gray-gravity method (GGM) for all columns of the image. By fitting these points using the moving least squares algorithm, the tangential vector, the normal vector and the radius of curvature can be robustly obtained. One rectangular region could be defined around each of the center points. Its two sides that are parallel to the tangential vector could alter their lengths according to the radius of the curvature. After that, the coordinate for each center point was recalculated within the rectangular region and in the direction of the normal vector. The center uncertainty was also analyzed based on the Monte Carlo method. The obtained experimental results indicate that the IGGM is suitable for both the smooth stripes and the ones with sharp corners. The high accuracy center points can be obtained at a relatively low computation cost. The measured results of the stairs and the screw surface further demonstrate the effectiveness of the method. PMID:28394288

Multiplex analysis of DNA

DOEpatents

Church, George M.; Kieffer-Higgins, Stephen

1992-01-01

This invention features vectors and a method for sequencing DNA. The method includes the steps of: a) ligating the DNA into a vector comprising a tag sequence, the tag sequence includes at least 15 bases, wherein the tag sequence will not hybridize to the DNA under stringent hybridization conditions and is unique in the vector, to form a hybrid vector, b) treating the hybrid vector in a plurality of vessels to produce fragments comprising the tag sequence, wherein the fragments differ in length and terminate at a fixed known base or bases, wherein the fixed known base or bases differs in each vessel, c) separating the fragments from each vessel according to their size, d) hybridizing the fragments with an oligonucleotide able to hybridize specifically with the tag sequence, and e) detecting the pattern of hybridization of the tag sequence, wherein the pattern reflects the nucleotide sequence of the DNA.

Support Vector Machines Model of Computed Tomography for Assessing Lymph Node Metastasis in Esophageal Cancer with Neoadjuvant Chemotherapy.

PubMed

Wang, Zhi-Long; Zhou, Zhi-Guo; Chen, Ying; Li, Xiao-Ting; Sun, Ying-Shi

The aim of this study was to diagnose lymph node metastasis of esophageal cancer by support vector machines model based on computed tomography. A total of 131 esophageal cancer patients with preoperative chemotherapy and radical surgery were included. Various indicators (tumor thickness, tumor length, tumor CT value, total number of lymph nodes, and long axis and short axis sizes of largest lymph node) on CT images before and after neoadjuvant chemotherapy were recorded. A support vector machines model based on these CT indicators was built to predict lymph node metastasis. Support vector machines model diagnosed lymph node metastasis better than preoperative short axis size of largest lymph node on CT. The area under the receiver operating characteristic curves were 0.887 and 0.705, respectively. The support vector machine model of CT images can help diagnose lymph node metastasis in esophageal cancer with preoperative chemotherapy.

Computational Study of Fluidic Thrust Vectoring using Separation Control in a Nozzle

NASA Technical Reports Server (NTRS)

Deere, Karen; Berrier, Bobby L.; Flamm, Jeffrey D.; Johnson, Stuart K.

2003-01-01

A computational investigation of a two- dimensional nozzle was completed to assess the use of fluidic injection to manipulate flow separation and cause thrust vectoring of the primary jet thrust. The nozzle was designed with a recessed cavity to enhance the throat shifting method of fluidic thrust vectoring. The structured-grid, computational fluid dynamics code PAB3D was used to guide the design and analyze over 60 configurations. Nozzle design variables included cavity convergence angle, cavity length, fluidic injection angle, upstream minimum height, aft deck angle, and aft deck shape. All simulations were computed with a static freestream Mach number of 0.05. a nozzle pressure ratio of 3.858, and a fluidic injection flow rate equal to 6 percent of the primary flow rate. Results indicate that the recessed cavity enhances the throat shifting method of fluidic thrust vectoring and allows for greater thrust-vector angles without compromising thrust efficiency.

Investigations on the hierarchy of reference frames in geodesy and geodynamics

NASA Technical Reports Server (NTRS)

Grafarend, E. W.; Mueller, I. I.; Papo, H. B.; Richter, B.

1979-01-01

Problems related to reference directions were investigated. Space and time variant angular parameters are illustrated in hierarchic structures or towers. Using least squares techniques, model towers of triads are presented which allow the formation of linear observation equations. Translational and rotational degrees of freedom (origin and orientation) are discussed along with and the notion of length and scale degrees of freedom. According to the notion of scale parallelism, scale factors with respect to a unit length are given. Three-dimensional geodesy was constructed from the set of three base vectors (gravity, earth-rotation and the ecliptic normal vector). Space and time variations are given with respect to a polar and singular value decomposition or in terms of changes in translation, rotation, deformation (shear, dilatation or angular and scale distortions).

Combined dispersive/interference spectroscopy for producing a vector spectrum

DOEpatents

Erskine, David J.

2002-01-01

A method of measuring the spectral properties of broadband waves that combines interferometry with a wavelength disperser having many spectral channels to produce a fringing spectrum. Spectral mapping, Doppler shifts, metrology of angles, distances and secondary effects such as temperature, pressure, and acceleration which change an interferometer cavity length can be measured accurately by a compact instrument using broadband illumination. Broadband illumination avoids the fringe skip ambiguities of monochromatic waves. The interferometer provides arbitrarily high spectral resolution, simple instrument response, compactness, low cost, high field of view and high efficiency. The inclusion of a disperser increases fringe visibility and signal to noise ratio over an interferometer used alone for broadband waves. The fringing spectrum is represented as a wavelength dependent 2-d vector, which describes the fringe amplitude and phase. Vector mathematics such as generalized dot products rapidly computes average broadband phase shifts to high accuracy. A Moire effect between the interferometer's sinusoidal transmission and the illumination heterodynes high resolution spectral detail to low spectral detail, allowing the use of a low resolution disperser. Multiple parallel interferometer cavities of fixed delay allow the instantaneous mapping of a spectrum, with an instrument more compact for the same spectral resolution than a conventional dispersive spectrometer, and not requiring a scanning delay.

Priming-boosting vaccination with recombinant Mycobacterium bovis bacillus Calmette-Guérin and a nonreplicating vaccinia virus recombinant leads to long-lasting and effective immunity.

PubMed

Ami, Yasushi; Izumi, Yasuyuki; Matsuo, Kazuhiro; Someya, Kenji; Kanekiyo, Masaru; Horibata, Shigeo; Yoshino, Naoto; Sakai, Koji; Shinohara, Katsuaki; Matsumoto, Sohkichi; Yamada, Takeshi; Yamazaki, Shudo; Yamamoto, Naoki; Honda, Mitsuo

2005-10-01

Virus-specific T-cell responses can limit immunodeficiency virus type 1 (HIV-1) transmission and prevent disease progression and so could serve as the basis for an affordable, safe, and effective vaccine in humans. To assess their potential for a vaccine, we used Mycobacterium bovis bacillus Calmette-Guérin (BCG)-Tokyo and a replication-deficient vaccinia virus strain (DIs) as vectors to express full-length gag from simian immunodeficiency viruses (SIVs) (rBCG-SIVgag and rDIsSIVgag). Cynomolgus macaques were vaccinated with either rBCG-SIVgag dermally as a single modality or in combination with rDIsSIVgag intravenously. When cynomologus macaques were primed with rBCG-SIVgag and then boosted with rDIsSIVgag, high levels of gamma interferon (IFN-gamma) spot-forming cells specific for SIV Gag were induced. This combination regimen elicited effective protective immunity against mucosal challenge with pathogenic simian-human immunodeficiency virus for the 1 year the macaques were under observation. Antigen-specific intracellular IFN-gamma activity was similarly induced in each of the macaques with the priming-boosting regimen. Other groups receiving the opposite combination or the single-modality vaccines were not effectively protected. These results suggest that a recombinant M. bovis BCG-based vector may have potential as an HIV/AIDS vaccine when administered in combination with a replication-deficient vaccinia virus DIs vector in a priming-boosting strategy.

A simplified model for predicting malaria entomologic inoculation rates based on entomologic and parasitologic parameters relevant to control.

PubMed

Killeen, G F; McKenzie, F E; Foy, B D; Schieffelin, C; Billingsley, P F; Beier, J C

2000-05-01

Malaria transmission intensity is modeled from the starting perspective of individual vector mosquitoes and is expressed directly as the entomologic inoculation rate (EIR). The potential of individual mosquitoes to transmit malaria during their lifetime is presented graphically as a function of their feeding cycle length and survival, human biting preferences, and the parasite sporogonic incubation period. The EIR is then calculated as the product of 1) the potential of individual vectors to transmit malaria during their lifetime, 2) vector emergence rate relative to human population size, and 3) the infectiousness of the human population to vectors. Thus, impacts on more than one of these parameters will amplify each other's effects. The EIRs transmitted by the dominant vector species at four malaria-endemic sites from Papua New Guinea, Tanzania, and Nigeria were predicted using field measurements of these characteristics together with human biting rate and human reservoir infectiousness. This model predicted EIRs (+/- SD) that are 1.13 +/- 0.37 (range = 0.84-1.59) times those measured in the field. For these four sites, mosquito emergence rate and lifetime transmission potential were more important determinants of the EIR than human reservoir infectiousness. This model and the input parameters from the four sites allow the potential impacts of various control measures on malaria transmission intensity to be tested under a range of endemic conditions. The model has potential applications for the development and implementation of transmission control measures and for public health education.

Molecular Identification of Two Vector Species, Cacopsylla melanoneura and Cacopsylla picta (Hemiptera: Psyllidae), of Apple Proliferation Disease and Further Common Psyllids of Northern Italy.

PubMed

Oettl, Sabine; Schlink, Katja

2015-10-01

The psyllid species Cacopsylla melanoneura (Förster) and Cacopsylla picta (Förster) are vectors of 'Candidatus Phytoplasma mali', the causal agent of apple proliferation, one of the economically most important apple diseases in Europe. Both vectors are present in apple orchards of South Tyrol and Trentino provinces in Northern Italy. As no direct treatment of the disease is possible, monitoring of the psyllids provides information about the vector presence in the orchards and enables targeted control. Thus, fast and reliable identification of the various psyllids occurring in the apple orchards is required. Morphological differentiation is problematic due to extensive resemblance of some psyllid species especially among females and is error-prone for nymphs. Here we present a rapid and cost-effective polymerase chain reaction-restriction fragment length polymorphism method based on the cytochrome c oxidase subunit I region for the molecular identification of the vector species as well as eight further Cacopsylla species present in the orchards. This method was verified through 98.9% consensus with morphologically identified males, through sequencing and subsequent phylogenetic analysis. In case of doubtful morphological identification of females, the method was able to provide a refined species assignment and could also remarkably facilitate the identification of nymphs. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Effects of Notch2 and Notch3 on Cell Proliferation and Apoptosis of Trophoblast Cell Lines.

PubMed

Zhao, Wei-Xiu; Zhuang, Xu; Huang, Tao-Tao; Feng, Ran; Lin, Jian-Hua

2015-01-01

To investigate the effect of Notch2 and Notch3 on cell proliferation and apoptosis of two trophoblast cell lines, BeWo and JAR. Notch2 and Notch3 expression in BeWo and JAR cells was upregulated or downregulated using lentivirus-mediated overexpression or RNA interference. The effect of Notch2 and Notch3 on cell proliferation was assessed by the CCK-8 assay. The effect of Notch2 and Notch3 on the apoptosis of BeWo and JAR cells was evaluated by flow cytometry using the Annexin V-PE Apoptosis kit. Lentivirus-based overexpression vectors were constructed by cloning the full-length coding sequences of human Notch2 and Notch3 C-terminally tagged with GFP or GFP alone (control) into a lentivirus-based expression vector. Lentivirus-based gene silencing vectors were prepared by cloning small interfering sequences targeting human Notch2 and Notch3 and scrambled control RNA sequence into a lentivirus-based gene knockdown vector. The effect of Notch2 and Notch3 on cell proliferation was assessed by the CCK-8 assay. And the effect of Notch2 and Notch3 on the apoptosis of BeWo and JAR cells was evaluated by flow cytometry using the Annexin V PE Apoptosis kit. We found that the downregulation of Notch2 and Notch3 gene expression in BeWo and JAR cells resulted in an increase in cell proliferation, while upregulation of Notch3 and Notch2 expression led to a decrease in cell proliferation. Moreover, the overexpression of Notch3 and Notch2 in BeWo and JAR cells reduced apoptosis in these trophoblast cell lines, whereas apoptosis was increased in the cells in which the expression of Notch3 and Notch2 was downregulated. Notch2 and Notch3 inhibited both cell proliferation and cell apoptosis in BeWo and JAR trophoblast cell lines.

Development of two bacterial artificial chromosome shuttle vectors for a recombination-based cloning and regulated expression of large genes in mammalian cells.

PubMed

Hong, Y K; Kim, D H; Beletskii, A; Lee, C; Memili, E; Strauss, W M

2001-04-01

Most conditional expression vectors designed for mammalian cells have been valuable systems for studying genes of interest by regulating their expressions. The available vectors, however, are reliable for the short-length cDNA clones and not optimal for relatively long fragments of genomic DNA or long cDNAs. Here, we report the construction of two bacterial artificial chromosome (BAC) vectors, capable of harboring large inserts and shuttling among Escherichia coli, yeast, and mammalian cells. These two vectors, pEYMT and pEYMI, contain conditional expression systems which are designed to be regulated by tetracycline and mouse interferons, respectively. To test the properties of the vectors, we cloned in both vectors the green fluorescence protein (GFP) through an in vitro ligation reaction and the 17.8-kb-long X-inactive-specific transcript (Xist) cDNA through homologous recombination in yeast. Subsequently, we characterized their regulated expression properties using real-time quantitative RT-PCR (TaqMan) and RNA-fluorescent in situ hybridization (FISH). We demonstrate that these two BAC vectors are good systems for recombination-based cloning and regulated expression of large genes in mammalian cells. Copyright 2001 Academic Press.

Giardia canis: ultrastructural analysis of G. canis trophozoites transfected with full length G. canis virus cDNA transcripts

USDA-ARS?s Scientific Manuscript database

Giardia canis virus (GCV) is a double-stranded RNA (dsRNA) virus of the family Totiviridae. In this study, the full-length cDNA of the G. canis virus was constructed in pPoly2/sfinot vector and RNA was transcribed in vitro. Virus-free G. canis trophozoites were transfected with in vitro transcribed ...

Metastable Bound States of Two-Dimensional Magnetoexcitons in the Lowest Landau Levels Approximation

NASA Astrophysics Data System (ADS)

Moskalenko, S. A.; Khadzhi, P. I.; Podlesny, I. V.; Dumanov, E. V.; Liberman, M. A.; Zubac, I. A.

2017-12-01

The possible existence of the two-dimensional bimagnetoexcitons and metastable bound states formed by two magnetoexcitons with opposite in-plane wave vectors k and -k has been studied. Magnetoexcitons taking part in the formation of molecules look as two electric dipoles with the arms oriented in-plane perpendicular to the respective wave vectors and with the length of the arms d=k(l_0)^2, where l_0 is the magnetic length. Two antiparallel dipoles moving with equal, yet antiparallel, wave vectors have the possibility of moving with equal probability in any direction of the plane, which is determined by the trial wave function of relative motion φ_n(|k|), depending on modulus k. The magnetoexcitons are composed of electrons and holes situated on the lowest Landau levels with the cyclotron energies greater than the binding energy of the 2D Wannier-Mott exciton. The description has been made in Landau gauge. The spin states of two electrons have been chosen in the form of antisymmetric or symmetric combinations with parameter η=+/-1. The effective spins of two heavy holes have been combined in the same resultant spinor states as the spin of the electrons. Because the projections of the both spinor states with η=+/-1 are equal to zero, the influence of the Zeeman splitting effect vanishes. In the case of trial wave function, the maximal density of the magnetoexcitons in the momentum space is concentrated on the in-plane ring. In the approximation of the lowest Landau levels, when the influence of the excited Landau levels is neglected, stable bound states of bimagnetoexcitons do not exist for both spin orientations. Instead, in the case of α=0.5 and η=1, a deep metastable bound state with the activation barrier comparable with two magnetoexciton ionization potentials 2I_l has been revealed. In the case of η=-1 and α=3.4, only a shallow metastable bound state can appear.

PlasmoGEM, a database supporting a community resource for large-scale experimental genetics in malaria parasites.

PubMed

Schwach, Frank; Bushell, Ellen; Gomes, Ana Rita; Anar, Burcu; Girling, Gareth; Herd, Colin; Rayner, Julian C; Billker, Oliver

2015-01-01

The Plasmodium Genetic Modification (PlasmoGEM) database (http://plasmogem.sanger.ac.uk) provides access to a resource of modular, versatile and adaptable vectors for genome modification of Plasmodium spp. parasites. PlasmoGEM currently consists of >2000 plasmids designed to modify the genome of Plasmodium berghei, a malaria parasite of rodents, which can be requested by non-profit research organisations free of charge. PlasmoGEM vectors are designed with long homology arms for efficient genome integration and carry gene specific barcodes to identify individual mutants. They can be used for a wide array of applications, including protein localisation, gene interaction studies and high-throughput genetic screens. The vector production pipeline is supported by a custom software suite that automates both the vector design process and quality control by full-length sequencing of the finished vectors. The PlasmoGEM web interface allows users to search a database of finished knock-out and gene tagging vectors, view details of their designs, download vector sequence in different formats and view available quality control data as well as suggested genotyping strategies. We also make gDNA library clones and intermediate vectors available for researchers to produce vectors for themselves. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Effects of the deletion of early region 4 (E4) open reading frame 1 (orf1), orf1-2, orf1-3 and orf1-4 on virus-host cell interaction, transgene expression, and immunogenicity of replicating adenovirus HIV vaccine vectors.

PubMed

Thomas, Michael A; Song, Rui; Demberg, Thorsten; Vargas-Inchaustegui, Diego A; Venzon, David; Robert-Guroff, Marjorie

2013-01-01

The global health burden engendered by human immunodeficiency virus (HIV)-induced acquired immunodeficiency syndrome (AIDS) is a sobering reminder of the pressing need for a preventative vaccine. In non-human primate models replicating adenovirus (Ad)-HIV/SIV recombinant vaccine vectors have been shown to stimulate potent immune responses culminating in protection against challenge exposures. Nonetheless, an increase in the transgene carrying capacity of these Ad vectors, currently limited to approximately 3000 base pairs, would greatly enhance their utility. Using a replicating, E3-deleted Ad type 5 host range mutant (Ad5 hr) encoding full-length single-chain HIVBaLgp120 linked to the D1 and D2 domains of rhesus macaque CD4 (rhFLSC) we systematically deleted the genes encoding early region 4 open reading frame 1 (E4orf1) through E4orf4. All the Ad-rhFLSC vectors produced similar levels of viral progeny. Cell cycle analysis of infected human and monkey cells revealed no differences in virus-host interaction. The parental and E4-deleted viruses expressed comparable levels of the transgene with kinetics similar to Ad late proteins. Similar levels of cellular immune responses and transgene-specific antibodies were elicited in vaccinated mice. However, differences in recognition of Ad proteins and induced antibody subtypes were observed, suggesting that the E4 gene products might modulate antibody responses by as yet unknown mechanisms. In short, we have improved the transgene carrying capacity by one thousand base pairs while preserving the replicability, levels of transgene expression, and immunogenicity critical to these vaccine vectors. This additional space allows for flexibility in vaccine design that could not be obtained with the current vector and as such should facilitate the goal of improving vaccine efficacy. To the best of our knowledge, this is the first report describing the effects of these E4 deletions on transgene expression and immunogenicity in a replicating Ad vector.

Effects of the Deletion of Early Region 4 (E4) Open Reading Frame 1 (orf1), orf1-2, orf1-3 and orf1-4 on Virus-Host Cell Interaction, Transgene Expression, and Immunogenicity of Replicating Adenovirus HIV Vaccine Vectors

PubMed Central

Thomas, Michael A.; Song, Rui; Demberg, Thorsten; Vargas-Inchaustegui, Diego A.; Venzon, David; Robert-Guroff, Marjorie

2013-01-01

The global health burden engendered by human immunodeficiency virus (HIV)-induced acquired immunodeficiency syndrome (AIDS) is a sobering reminder of the pressing need for a preventative vaccine. In non-human primate models replicating adenovirus (Ad)-HIV/SIV recombinant vaccine vectors have been shown to stimulate potent immune responses culminating in protection against challenge exposures. Nonetheless, an increase in the transgene carrying capacity of these Ad vectors, currently limited to approximately 3000 base pairs, would greatly enhance their utility. Using a replicating, E3-deleted Ad type 5 host range mutant (Ad5 hr) encoding full-length single-chain HIVBaLgp120 linked to the D1 and D2 domains of rhesus macaque CD4 (rhFLSC) we systematically deleted the genes encoding early region 4 open reading frame 1 (E4orf1) through E4orf4. All the Ad-rhFLSC vectors produced similar levels of viral progeny. Cell cycle analysis of infected human and monkey cells revealed no differences in virus-host interaction. The parental and E4-deleted viruses expressed comparable levels of the transgene with kinetics similar to Ad late proteins. Similar levels of cellular immune responses and transgene-specific antibodies were elicited in vaccinated mice. However, differences in recognition of Ad proteins and induced antibody subtypes were observed, suggesting that the E4 gene products might modulate antibody responses by as yet unknown mechanisms. In short, we have improved the transgene carrying capacity by one thousand base pairs while preserving the replicability, levels of transgene expression, and immunogenicity critical to these vaccine vectors. This additional space allows for flexibility in vaccine design that could not be obtained with the current vector and as such should facilitate the goal of improving vaccine efficacy. To the best of our knowledge, this is the first report describing the effects of these E4 deletions on transgene expression and immunogenicity in a replicating Ad vector. PMID:24143187

Investigation on partially coherent vector beams and their propagation and focusing properties.

PubMed

Hu, Kelei; Chen, Ziyang; Pu, Jixiong

2012-11-01

The propagation and focusing properties of partially coherent vector beams including radially polarized and azimuthally polarized (AP) beams are theoretically and experimentally investigated. The beam profile of a partially coherent radially or AP beam can be shaped by adjusting the initial spatial coherence length. The dark hollow, flat-topped, and Gaussian beam spots can be obtained, which will be useful in trapping particles. The experimental observations are consistent with the theoretical results.

Global-constrained hidden Markov model applied on wireless capsule endoscopy video segmentation

NASA Astrophysics Data System (ADS)

Wan, Yiwen; Duraisamy, Prakash; Alam, Mohammad S.; Buckles, Bill

2012-06-01

Accurate analysis of wireless capsule endoscopy (WCE) videos is vital but tedious. Automatic image analysis can expedite this task. Video segmentation of WCE into the four parts of the gastrointestinal tract is one way to assist a physician. The segmentation approach described in this paper integrates pattern recognition with statiscal analysis. Iniatially, a support vector machine is applied to classify video frames into four classes using a combination of multiple color and texture features as the feature vector. A Poisson cumulative distribution, for which the parameter depends on the length of segments, models a prior knowledge. A priori knowledge together with inter-frame difference serves as the global constraints driven by the underlying observation of each WCE video, which is fitted by Gaussian distribution to constrain the transition probability of hidden Markov model.Experimental results demonstrated effectiveness of the approach.

Comparative performance of modified full-length and truncated Bacillus thuringiensis-cry1Ac genes in transgenic tomato.

PubMed

Koul, Bhupendra; Yadav, Reena; Sanyal, Indraneel; Amla, Devindra Vijay

2015-01-01

Bt-cry1Ac gene has been reputedly effective against Helicoverpa armigera a notorious lepidopteran pest. Reports on the expression of full-length and truncated cry1Ac genes in plants for effective resistance against Helicoverpa sp. have been documented however, their performance is still ambiguous. Moreover, the question remains to be addressed that truncation of 3' end of the native gene was documented and suggested for active insecticidal toxin production while the most successful transgenic event(s) of commercialized-cotton are based on full-length of the cry gene. Therefore, we performed a comparative study on the efficacy of the two versions of cry1Ac genes (full-length: 3,510 bp and truncated: 1,845 bp) in T0 and T1 transgenic tomato plants and analyzed the extent of protection against H. armigera and also compared the results with our previous findings related to a successful transgenic tomato line Ab25E, expressing cry1Ab gene. The integration of cry1Ac gene(s) in T0 transgenic plants and its inheritance in T1 progeny was observed by PCR, RT-PCR and Southern blot hybridization analysis while, the toxin integrity, expression and toxicity was monitored by Western immunoassay, DAS-ELISA and insect bioassay respectively. An average transformation frequency and Bt-Cry protein content of 16.93 ± 2.10 and 0.0020-0.0128% of total soluble protein (TSP) was obtained with pRD400 vector (Trcry1Ac) while, a much lower value of 9.30 ± 2.041 and 0.0001 - 0.0026% of TSP was observed with pNBRI-1 vector (Flcry1Ac), respectively. The promising Trcry1Ac T0 transgenic plants and their T1 progeny gave full protection from H. armigera. Although Flcry1Ac gene showed lower transformation frequency and lower expression, it showed higher toxicity to H. armigera when compared with truncated Trcry1Ac gene. The full-length cry1Ac gene can be redesigned for higher expression and performance in dicots or a hybrid gene could be designed having a blend of strong receptor binding and stable expression characteristics for enhanced efficacy and toxicity to the susceptible insects.

Astigmatism reduction clinical trial: a multicenter prospective evaluation of the predictability of arcuate keratotomy. Evaluation of surgical nomogram predictability. ARC-T Study Group.

PubMed

Price, F W; Grene, R B; Marks, R G; Gonzales, J S

1995-03-01

To determine the accuracy of the Lindstrom surgical nomogram for astigmatism. A prospective multicenter study. One hundred sixty eyes of 95 patients underwent astigmatic keratotomy in eight centers by nine surgeons. Inclusion criteria for the study included age of at least 18 years with 1 to 6 diopters (D) of naturally occurring corneal astigmatism and less than 1 D of lenticular astigmatism. A standardized astigmatic keratotomy surgical technique was performed on each eye. Surgical measurements were determined using the Lindstrom surgical nomogram for astigmatism. The Holladay, Cravy, Koch vector analysis method was used to determine the change in refractive cylinder results. Refractive changes also are presented without vector analysis merely using the absolute change in refractive cylinder and axis. Multiple regression analysis was used to develop a mathematical model determining the factors predictive of the change in refractive cylinder. The significant predictors for the amount of astigmatic correction achieved were, in order of decreasing importance, the following: number of incisions (R2 = 30%), incision length (R2 = 16%), age (R2 = 8%), and gender (R2 = 2%). Astigmatism is a two-dimensional measurement of both quantity and direction that is most appropriately analyzed with vector analysis. The original Lindstrom surgical nomogram for arcuate keratotomy used in this study is still quite useful although it tended to underpredict results for many patients, especially those having two incisional surgeries. Some older subjects having minimal surgery achieved greater correction than predicted by the original nomogram. The most important factors predictive of greater astigmatic keratotomy surgical effect are incision number, incision length, older age, and male gender.

Evaluation of vector-primed cDNA library production from microgram quantities of total RNA.

PubMed

Kuo, Jonathan; Inman, Jason; Brownstein, Michael; Usdin, Ted B

2004-12-15

cDNA sequences are important for defining the coding region of genes, and full-length cDNA clones have proven to be useful for investigation of the function of gene products. We produced cDNA libraries containing 3.5-5 x 10(5) primary transformants, starting with 5 mug of total RNA prepared from mouse pituitary, adrenal, thymus, and pineal tissue, using a vector-primed cDNA synthesis method. Of approximately 1000 clones sequenced, approximately 20% contained the full open reading frames (ORFs) of known transcripts, based on the presence of the initiating methionine residue codon. The libraries were complex, with 94, 91, 83 and 55% of the clones from the thymus, adrenal, pineal and pituitary libraries, respectively, represented only once. Twenty-five full-length clones, not yet represented in the Mammalian Gene Collection, were identified. Thus, we have produced useful cDNA libraries for the isolation of full-length cDNA clones that are not yet available in the public domain, and demonstrated the utility of a simple method for making high-quality libraries from small amounts of starting material.

A Parallel Framework with Block Matrices of a Discrete Fourier Transform for Vector-Valued Discrete-Time Signals.

PubMed

Soto-Quiros, Pablo

2015-01-01

This paper presents a parallel implementation of a kind of discrete Fourier transform (DFT): the vector-valued DFT. The vector-valued DFT is a novel tool to analyze the spectra of vector-valued discrete-time signals. This parallel implementation is developed in terms of a mathematical framework with a set of block matrix operations. These block matrix operations contribute to analysis, design, and implementation of parallel algorithms in multicore processors. In this work, an implementation and experimental investigation of the mathematical framework are performed using MATLAB with the Parallel Computing Toolbox. We found that there is advantage to use multicore processors and a parallel computing environment to minimize the high execution time. Additionally, speedup increases when the number of logical processors and length of the signal increase.

Signal broadening in the laser Doppler velocimeter.

NASA Technical Reports Server (NTRS)

Angus, J. C.; Edwards, R. V.; Dunning, J. W., Jr.

1971-01-01

Critical review of a recent paper in which Denison, Stevenson, and Fox (1971) discussed the sources of spectral broadening in the laser Doppler velocimeter. It is pointed out that, in their discussion, the above-mentioned authors indicated that the spread in wave vectors of the incident and detected fields and the finite length of time a scattering center stayed in the sample volume each contributed separately and independently to the observed spectral width of the scattered radiation. This statement is termed incorrect, and it is shown that the two effects are one and the same.

Modified cantilevers to probe unambiguously out-of-plane piezoresponse

NASA Astrophysics Data System (ADS)

Alyabyeva, Natalia; Ouvrard, Aimeric; Lindfors-Vrejoiu, Ionela; Kolomiytsev, Alexey; Solodovnik, Maxim; Ageev, Oleg; McGrouther, Damien

2018-06-01

We demonstrate and investigate the coupling of contributions from both in-plane (IP) polarization and out-of-plane (OP) components in BiFeO3 (BFO) thin-film polarization probed by piezoresponse force microscopy (PFM). Such coupling leads to image artifacts which prevent the correct determination of OP polarization vector directions and the corresponding piezoelectric coefficient d33. Using material strength theory with a one-dimensional modeling of the cantilever oscillation amplitude under electrostatic and elastic forces as a function of the tip length, we have evidenced the impact of IP piezoresponse to the OP signal for tip length longer than 4 μm. The IP polarization vector induces a significant longitudinal bending of the cantilever, due to the small spring constant of long tips, which provokes a normal deviation superimposed to the OP piezoresponse. These artifacts can be reduced by increasing the longitudinal spring constant of the cantilever by shortening the tip length. Standard cantilevers with 15-μm-long tips were modified to reach the desired tip length, using focused ion-beam techniques and tested using PFM on the same BFO thin film. Tip length shortening has strongly reduced IP artifacts as expected, while the impact of nonlocal electrostatic forces, becoming predominant for tips shorter than 1 μm, has led to a non-negligible deflection offset. For shorter tips, a strong electric field from a cantilever beam can induce polarization switching as observed for a 0.5-μm-long tip. Tip length ranging from 1 to 4 μm allowed minimizing both artifacts to probe unambiguously OP piezoresponse and quantify the d33 piezoelectric coefficient.

[Construction and expression of fusion protein TRX-hJagged1 in E.coli BL21].

PubMed

Li, Guo-Hui; Fan, Yu-Zhen; Huang, Si-Yong; Liu, Qiang; Yin, Dan-Dan; Liu, Li; Chen, Ren-An; Hao, Miao-Wang; Liang, Ying-Min

2014-06-01

This study was purposed to construct prokaryotic expression vector and to investigate the expression of Notch ligand Jagged1 in E.coli. An expression vector pET-hJagged1 was constructed, which can be inserted in Jagged1 with different lengths, but the DSL domain of human Jagged1 should be contained. Then the recombinant plasmids were transformed into the competent cell of E.coli BL21, and the expression of the fusion protein was induced by IPTG. Fusion protein was purified from the supernatant of cell lysates via the Nickel affinity chromatography. The results showed that prokaryotic expression vectors pET-hJagged1 (Bgl II), pET-hJagged1 (Hind I) and pET-hJagged1 (Stu I) were successfully constructed, but only pET-hJagged1 (Stu I) could express the soluble TRX-hJagged1. The purified TRX-Jagged1 protein could be obtained via the Nickel affinity chromatography, and then confirmed by Western Blot. It is concluded that prokaryotic expression vector pET-hJagged1 is successfully constructed, but only pET-hJagged1 (Stu I) can express the soluble TRX-hJagged1 and the TRX-Jagged1 fusion protein is obtained through the prokaryotic expression system, which laid a solid foundation for further to explore the effects of Jagged1 in hematopoietic and lymphoid system.

[Construction of the superantigen SEA transfected laryngocarcinoma cells].

PubMed

Ji, Xiaobin; Jingli, J V; Liu, Qicai; Xie, Jinghua

2013-04-01

To construct an eukaryotic expression vectors containing superantigen staphylococcal enterotoxin A (SEA) gene, and to identify its expression in laryngeal squamous carcinoma cells. SEA full-length gene fragment was obtained from ATCC13565 genome of the staphylococcus, referencing standard strains producing SEA. Coding sequence of SEA was artificially synthetized. Than, SEA gene fragments was subcloned into eukaryotic expression vector pIRES-EGFP. The recombinant plasmid pSEA-IRES-EGFP was constructed and was transfected to laryngocarcinoma Hep-2 cells. Resistant clones were screened by G418. The expression of SEA in laryngocarcinoma cells was identified with ELISA and RT-PCR method. The subclone of artificially synthetized SEA gene was subclone to eukaryotic expression vector pires-EGFP. Flanking sequence confirmed that SEA sequence was fully identical to the coding sequence of standard staphylococcus strains ATCC13565 in Genbank. After recombinant plasmid transfected to laryngocarcinoma cells, the resistant clones was obtained after screening for two weeks. The clones were selected. The specific gene fragment was obtained by RT-PCR amplification. ELISA assay confirmed that the content of SEA protein in supernatant fluid of cell culture had reached about Pg level. The recombinant eukaryotic expression vector containing superantigen SEA gene is successfully constructed, and is capable of effective expression and continued secretion of SEA protein in laryngochrcinoma Hep-2 cells after recombinant plasmid transfected to laryngocarcinoma cells.

Measurements of Vorticity Vectors in Couette Flow with the Vorticity Optical Probe

DTIC Science & Technology

1991-05-01

Web 1981). The three components of the vorticity vector are measured, any two of them quite accurately. Multipoint measurement arrangements have been...the distribution of trajectory lengths is given by POrN ) rN O<rN<R. fwio-R R -rN where R is the angular measure of the detector radius. (The random...orticitv were performed deep within the viscous sublaver v 2.3). .At y < 10. the fluctuating vortici, ,tatistics show good agreement with the simulatins of

A Software Package for Neural Network Applications Development

NASA Technical Reports Server (NTRS)

Baran, Robert H.

1993-01-01

Original Backprop (Version 1.2) is an MS-DOS package of four stand-alone C-language programs that enable users to develop neural network solutions to a variety of practical problems. Original Backprop generates three-layer, feed-forward (series-coupled) networks which map fixed-length input vectors into fixed length output vectors through an intermediate (hidden) layer of binary threshold units. Version 1.2 can handle up to 200 input vectors at a time, each having up to 128 real-valued components. The first subprogram, TSET, appends a number (up to 16) of classification bits to each input, thus creating a training set of input output pairs. The second subprogram, BACKPROP, creates a trilayer network to do the prescribed mapping and modifies the weights of its connections incrementally until the training set is leaned. The learning algorithm is the 'back-propagating error correction procedures first described by F. Rosenblatt in 1961. The third subprogram, VIEWNET, lets the trained network be examined, tested, and 'pruned' (by the deletion of unnecessary hidden units). The fourth subprogram, DONET, makes a TSR routine by which the finished product of the neural net design-and-training exercise can be consulted under other MS-DOS applications.

On the Impact of Widening Vector Registers on Sequence Alignment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Daily, Jeffrey A.; Kalyanaraman, Anantharaman; Krishnamoorthy, Sriram

2016-09-22

Vector extensions, such as SSE, have been part of the x86 since the 1990s, with applications in graphics, signal processing, and scientific applications. Although many algorithms and applications can naturally benefit from automatic vectorization techniques, there are still many that are difficult to vectorize due to their dependence on irregular data structures, dense branch operations, or data dependencies. Sequence alignment, one of the most widely used operations in bioinformatics workflows, has a computational footprint that features complex data dependencies. In this paper, we demonstrate that the trend of widening vector registers adversely affects the state-of-the-art sequence alignment algorithm based onmore » striped data layouts. We present a practically efficient SIMD implementation of a parallel scan based sequence alignment algorithm that can better exploit wider SIMD units. We conduct comprehensive workload and use case analyses to characterize the relative behavior of the striped and scan approaches and identify the best choice of algorithm based on input length and SIMD width.« less

Performance characteristics of two multiaxis thrust-vectoring nozzles at Mach numbers up to 1.28

NASA Technical Reports Server (NTRS)

Wing, David J.; Capone, Francis J.

1993-01-01

The thrust-vectoring axisymmetric (VA) nozzle and a spherical convergent flap (SCF) thrust-vectoring nozzle were tested along with a baseline nonvectoring axisymmetric (NVA) nozzle in the Langley 16-Foot Transonic Tunnel at Mach numbers from 0 to 1.28 and nozzle pressure ratios from 1 to 8. Test parameters included geometric yaw vector angle and unvectored divergent flap length. No pitch vectoring was studied. Nozzle drag, thrust minus drag, yaw thrust vector angle, discharge coefficient, and static thrust performance were measured and analyzed, as well as external static pressure distributions. The NVA nozzle and the VA nozzle displayed higher static thrust performance than the SCF nozzle throughout the nozzle pressure ratio (NPR) range tested. The NVA nozzle had higher overall thrust minus drag than the other nozzles throughout the NPR and Mach number ranges tested. The SCF nozzle had the lowest jet-on nozzle drag of the three nozzles throughout the test conditions. The SCF nozzle provided yaw thrust angles that were equal to the geometric angle and constant with NPR. The VA nozzle achieved yaw thrust vector angles that were significantly higher than the geometric angle but not constant with NPR. Nozzle drag generally increased with increases in thrust vectoring for all the nozzles tested.

Absence of effects of an in-plane magnetic field in a quasi-two-dimensional electron system

NASA Astrophysics Data System (ADS)

Brandt, F. T.; Sánchez-Monroy, J. A.

2018-03-01

The dynamics of a quasi-two-dimensional electron system (q2DES) in the presence of a tilted magnetic field is reconsidered employing the thin-layer method. We derive the effective equations for relativistic and nonrelativistic q2DESs. Through a perturbative expansion, we show that while the magnetic length is much greater than the confinement width, the in-plane magnetic field only affects the particle dynamics through the spin. Therefore, effects due to an in-plane magnetic vector potential reported previously in the literature for 2D quantum rings, 2D quantum dots and graphene are fictitious. In particular, the so-called pseudo chiral magnetic effect recently proposed in graphene is not realistic.

Terahertz generation by beating two Langmuir waves in a warm and collisional plasma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Xiao-Bo; Qiao, Xin; Cheng, Li-Hong

2015-09-15

Terahertz (THz) radiation generated by beating of two Langmuir waves in a warm and collisional plasma is discussed theoretically. The critical angle between the two Langmuir waves and the critical wave-length (wave vector) of Langmuir waves for generating THz radiation are obtained analytically. Furthermore, the maximum radiation energy is obtained. We find that the critical angle, the critical wave-length, and the generated radiation energy strongly depend on plasma temperature and wave-length of the Langmuir waves. That is, the THz radiation generated by beating of two Langmuir waves in a warm and collisional plasma can be controlled by adjusting the plasmamore » temperature and the Langmuir wave-length.« less

A SIMPLIFIED MODEL FOR PREDICTING MALARIA ENTOMOLOGIC INOCULATION RATES BASED ON ENTOMOLOGIC AND PARASITOLOGIC PARAMETERS RELEVANT TO CONTROL

PubMed Central

KILLEEN, GERRY F.; McKENZIE, F. ELLIS; FOY, BRIAN D.; SCHIEFFELIN, CATHERINE; BILLINGSLEY, PETER F.; BEIER, JOHN C.

2008-01-01

Malaria transmission intensity is modeled from the starting perspective of individual vector mosquitoes and is expressed directly as the entomologic inoculation rate (EIR). The potential of individual mosquitoes to transmit malaria during their lifetime is presented graphically as a function of their feeding cycle length and survival, human biting preferences, and the parasite sporogonic incubation period. The EIR is then calculated as the product of 1) the potential of individual vectors to transmit malaria during their lifetime, 2) vector emergence rate relative to human population size, and 3) the infectiousness of the human population to vectors. Thus, impacts on more than one of these parameters will amplify each other’s effects. The EIRs transmitted by the dominant vector species at four malaria-endemic sites from Papua New Guinea, Tanzania, and Nigeria were predicted using field measurements of these characteristics together with human biting rate and human reservoir infectiousness. This model predicted EIRs (± SD) that are 1.13 ± 0.37 (range = 0.84–1.59) times those measured in the field. For these four sites, mosquito emergence rate and lifetime transmission potential were more important determinants of the EIR than human reservoir infectiousness. This model and the input parameters from the four sites allow the potential impacts of various control measures on malaria transmission intensity to be tested under a range of endemic conditions. The model has potential applications for the development and implementation of transmission control measures and for public health education. PMID:11289661

Influence of vectors' risk-spreading strategies and environmental stochasticity on the epidemiology and evolution of vector-borne diseases: the example of Chagas' disease.

PubMed

Pelosse, Perrine; Kribs-Zaleta, Christopher M; Ginoux, Marine; Rabinovich, Jorge E; Gourbière, Sébastien; Menu, Frédéric

2013-01-01

Insects are known to display strategies that spread the risk of encountering unfavorable conditions, thereby decreasing the extinction probability of genetic lineages in unpredictable environments. To what extent these strategies influence the epidemiology and evolution of vector-borne diseases in stochastic environments is largely unknown. In triatomines, the vectors of the parasite Trypanosoma cruzi, the etiological agent of Chagas' disease, juvenile development time varies between individuals and such variation most likely decreases the extinction risk of vector populations in stochastic environments. We developed a simplified multi-stage vector-borne SI epidemiological model to investigate how vector risk-spreading strategies and environmental stochasticity influence the prevalence and evolution of a parasite. This model is based on available knowledge on triatomine biodemography, but its conceptual outcomes apply, to a certain extent, to other vector-borne diseases. Model comparisons between deterministic and stochastic settings led to the conclusion that environmental stochasticity, vector risk-spreading strategies (in particular an increase in the length and variability of development time) and their interaction have drastic consequences on vector population dynamics, disease prevalence, and the relative short-term evolution of parasite virulence. Our work shows that stochastic environments and associated risk-spreading strategies can increase the prevalence of vector-borne diseases and favor the invasion of more virulent parasite strains on relatively short evolutionary timescales. This study raises new questions and challenges in a context of increasingly unpredictable environmental variations as a result of global climate change and human interventions such as habitat destruction or vector control.

An efficient and portable SIMD algorithm for charge/current deposition in Particle-In-Cell codes

DOE PAGES

Vincenti, H.; Lobet, M.; Lehe, R.; ...

2016-09-19

In current computer architectures, data movement (from die to network) is by far the most energy consuming part of an algorithm (≈20pJ/word on-die to ≈10,000 pJ/word on the network). To increase memory locality at the hardware level and reduce energy consumption related to data movement, future exascale computers tend to use many-core processors on each compute nodes that will have a reduced clock speed to allow for efficient cooling. To compensate for frequency decrease, machine vendors are making use of long SIMD instruction registers that are able to process multiple data with one arithmetic operator in one clock cycle. SIMD registermore » length is expected to double every four years. As a consequence, Particle-In-Cell (PIC) codes will have to achieve good vectorization to fully take advantage of these upcoming architectures. In this paper, we present a new algorithm that allows for efficient and portable SIMD vectorization of current/charge deposition routines that are, along with the field gathering routines, among the most time consuming parts of the PIC algorithm. Our new algorithm uses a particular data structure that takes into account memory alignment constraints and avoids gather/scat;ter instructions that can significantly affect vectorization performances on current CPUs. The new algorithm was successfully implemented in the 3D skeleton PIC code PICSAR and tested on Haswell Xeon processors (AVX2-256 bits wide data registers). Results show a factor of ×2 to ×2.5 speed-up in double precision for particle shape factor of orders 1–3. The new algorithm can be applied as is on future KNL (Knights Landing) architectures that will include AVX-512 instruction sets with 512 bits register lengths (8 doubles/16 singles). Program summary Program Title: vec_deposition Program Files doi:http://dx.doi.org/10.17632/nh77fv9k8c.1 Licensing provisions: BSD 3-Clause Programming language: Fortran 90 External routines/libraries:  OpenMP > 4.0 Nature of problem: Exascale architectures will have many-core processors per node with long vector data registers capable of performing one single instruction on multiple data during one clock cycle. Data register lengths are expected to double every four years and this pushes for new portable solutions for efficiently vectorizing Particle-In-Cell codes on these future many-core architectures. One of the main hotspot routines of the PIC algorithm is the current/charge deposition for which there is no efficient and portable vector algorithm. Solution method: Here we provide an efficient and portable vector algorithm of current/charge deposition routines that uses a new data structure, which significantly reduces gather/scatter operations. Vectorization is controlled using OpenMP 4.0 compiler directives for vectorization which ensures portability across different architectures. Restrictions: Here we do not provide the full PIC algorithm with an executable but only vector routines for current/charge deposition. These scalar/vector routines can be used as library routines in your 3D Particle-In-Cell code. However, to get the best performances out of vector routines you have to satisfy the two following requirements: (1) Your code should implement particle tiling (as explained in the manuscript) to allow for maximized cache reuse and reduce memory accesses that can hinder vector performances. The routines can be used directly on each particle tile. (2) You should compile your code with a Fortran 90 compiler (e.g Intel, gnu or cray) and provide proper alignment flags and compiler alignment directives (more details in README file).« less

An efficient and portable SIMD algorithm for charge/current deposition in Particle-In-Cell codes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vincenti, H.; Lobet, M.; Lehe, R.

In current computer architectures, data movement (from die to network) is by far the most energy consuming part of an algorithm (≈20pJ/word on-die to ≈10,000 pJ/word on the network). To increase memory locality at the hardware level and reduce energy consumption related to data movement, future exascale computers tend to use many-core processors on each compute nodes that will have a reduced clock speed to allow for efficient cooling. To compensate for frequency decrease, machine vendors are making use of long SIMD instruction registers that are able to process multiple data with one arithmetic operator in one clock cycle. SIMD registermore » length is expected to double every four years. As a consequence, Particle-In-Cell (PIC) codes will have to achieve good vectorization to fully take advantage of these upcoming architectures. In this paper, we present a new algorithm that allows for efficient and portable SIMD vectorization of current/charge deposition routines that are, along with the field gathering routines, among the most time consuming parts of the PIC algorithm. Our new algorithm uses a particular data structure that takes into account memory alignment constraints and avoids gather/scat;ter instructions that can significantly affect vectorization performances on current CPUs. The new algorithm was successfully implemented in the 3D skeleton PIC code PICSAR and tested on Haswell Xeon processors (AVX2-256 bits wide data registers). Results show a factor of ×2 to ×2.5 speed-up in double precision for particle shape factor of orders 1–3. The new algorithm can be applied as is on future KNL (Knights Landing) architectures that will include AVX-512 instruction sets with 512 bits register lengths (8 doubles/16 singles). Program summary Program Title: vec_deposition Program Files doi:http://dx.doi.org/10.17632/nh77fv9k8c.1 Licensing provisions: BSD 3-Clause Programming language: Fortran 90 External routines/libraries:  OpenMP > 4.0 Nature of problem: Exascale architectures will have many-core processors per node with long vector data registers capable of performing one single instruction on multiple data during one clock cycle. Data register lengths are expected to double every four years and this pushes for new portable solutions for efficiently vectorizing Particle-In-Cell codes on these future many-core architectures. One of the main hotspot routines of the PIC algorithm is the current/charge deposition for which there is no efficient and portable vector algorithm. Solution method: Here we provide an efficient and portable vector algorithm of current/charge deposition routines that uses a new data structure, which significantly reduces gather/scatter operations. Vectorization is controlled using OpenMP 4.0 compiler directives for vectorization which ensures portability across different architectures. Restrictions: Here we do not provide the full PIC algorithm with an executable but only vector routines for current/charge deposition. These scalar/vector routines can be used as library routines in your 3D Particle-In-Cell code. However, to get the best performances out of vector routines you have to satisfy the two following requirements: (1) Your code should implement particle tiling (as explained in the manuscript) to allow for maximized cache reuse and reduce memory accesses that can hinder vector performances. The routines can be used directly on each particle tile. (2) You should compile your code with a Fortran 90 compiler (e.g Intel, gnu or cray) and provide proper alignment flags and compiler alignment directives (more details in README file).« less

Management of postkeratoplasty astigmatism by paired arcuate incisions with compression sutures.

PubMed

Fares, Usama; Mokashi, Aashish A; Al-Aqaba, Mouhamed Ali; Otri, Ahmad Muneer; Miri, Ammar; Dua, Harminder Singh

2013-04-01

To analyse the efficacy of paired arcuate incisions and compression sutures technique in the management of post penetrating keratoplasty (PK) astigmatism. A paired arcuate incision with compression sutures procedure was used to treat 26 eyes with post-PK astigmatism ranging from 6.00 to 16.50 dioptres (D). The incisions were placed at the 7.0 mm optical zone inside the graft-host junction at a depth of 80% of corneal thickness. A 45° paired arc length was planned for eyes with preoperative astigmatism between 6D and 9D, and a 60° paired arc length was planned for eyes with preoperative astigmatism of >9D. At 3 months, corneal topography and refraction was performed and suture(s) removed if indicated. Net and vector astigmatism changes were calculated to determine the efficacy of the procedure. The indications for PK included keratoconus, Fuch's endothelial dystrophy, pseudophakic bullous keratopathy and corneal scar. There was a statistically significant reduction in the mean magnitude of astigmatism from 9.66 ± 2.90D preoperatively to 4.37 ± 2.53D postoperatively in the whole group. The mean decrease in the astigmatism was 4.37 ± 2.05D (58.4%) and 6.23 ± 3.63D (52.6%) in patients with 6-9D and >9D, respectively. Vector power calculations also showed a significant astigmatism reduction in all groups. The safety and efficacy indices were 1.40 and 0.28, respectively. Manual astigmatic keratotomy is a viable technique with relatively good safety and efficacy outcomes. Based on the results we propose that increasing the arc length to a minimum of 60° for astigmatism of 6-9D, and to 75° for astigmatism >9D, is likely to have a greater beneficial effect.

Communication networks, soap films and vectors

NASA Astrophysics Data System (ADS)

Clark, R. C.

1981-01-01

The problem of constructing the least-cost network of connections between arbitrarily placed points is one that is common and which can be very important financially. The network may consist of motorways between towns, a grid of electric power lines, buried gas or oil pipe lines or telephone cables. Soap films trapped between parallel planes with vertical pins between them provide a 'shortest path' network and Isenberg (1975) has suggested that soap films of this sort be used to model communication networks. However soap films are unable to simulate the different costs of laying, say, a three-lane motorway instead of a two-lane one or of using a larger pipeline to take the flow from two smaller ones. Soap films, however, have considerable intrinsic interest. In the article the emphasis is on the use of soap films and communication networks as a practical means of illustrating the importance of vector and matrix methods in geometry. The power of vector methods is illustrated by the fact that given any soap film network the total length of the film can be written down by inspection if the vector positions of the pins are known. It is also possible to predict the boundaries at which 'catastrophes' occur and to decide which network has the least total length. In the field of communication networks a method is given of designing the minimum cost network linking, say, a number of oilwells, which produce at different rates to an outlet terminal.

Derivation of the Lorentz force law, the magnetic field concept and the Faraday Lenz and magnetic Gauss laws using an invariant formulation of the Lorentz transformation

NASA Astrophysics Data System (ADS)

Field, J. H.

2006-06-01

It is demonstrated how the right-hand sides of the Lorentz transformation equations may be written, in a Lorentz-invariant manner, as 4-vector scalar products. This implies the existence of invariant length intervals analogous to invariant proper time intervals. An important distinction between the physical meanings of the space time and energy momentum 4-vectors is pointed out. The formalism is shown to provide a short derivation of the Lorentz force law of classical electrodynamics, and the conventional definition of the magnetic field, in terms of spatial derivatives of the 4-vector potential, as well as the Faraday Lenz law and the Gauss law for magnetic fields. The connection between the Gauss law for the electric field and the electrodynamic Ampère law, due to the 4-vector character of the electromagnetic potential, is also pointed out.

Comparison of SOM point densities based on different criteria.

PubMed

Kohonen, T

1999-11-15

Point densities of model (codebook) vectors in self-organizing maps (SOMs) are evaluated in this article. For a few one-dimensional SOMs with finite grid lengths and a given probability density function of the input, the numerically exact point densities have been computed. The point density derived from the SOM algorithm turned out to be different from that minimizing the SOM distortion measure, showing that the model vectors produced by the basic SOM algorithm in general do not exactly coincide with the optimum of the distortion measure. A new computing technique based on the calculus of variations has been introduced. It was applied to the computation of point densities derived from the distortion measure for both the classical vector quantization and the SOM with general but equal dimensionality of the input vectors and the grid, respectively. The power laws in the continuum limit obtained in these cases were found to be identical.

Identification of the CAD gene from Eucalyptus urophylla GLU4 and its functional analysis in transgenic tobacco.

PubMed

Chen, B W; Xiao, Y F; Li, J J; Liu, H L; Qin, Z H; Gai, Y; Jiang, X N

2016-12-02

Cinnamyl alcohol dehydrogenase (CAD) catalyzes the final step in lignin biosynthesis. The genus Eucalyptus belongs to the family Myrtaceae, which is the main cultivated species in China. Eucalyptus urophylla GLU4 (GLU4) is widely grown in Guangxi. It is preferred for pulping because of its excellent cellulose content and fiber length. Based on GLU4 and CAD gene expression, a Eucalyptus variety low in lignin content should be obtained using transgenic technology, which could reduce the cost of pulp and improve the pulping rate, and have favorable prospects for application. However, the role and function of CAD in GLU4 is still unclear. In the present study, EuCAD was cloned from GLU4 and identified using bioinformatic tools. Subsequently, in order to evaluate its impact on lignin synthesis, a full-length EuCAD RNAi vector was constructed, and transgenic tobacco was obtained via Agrobacterium-mediated transformation. A significant decrease in CAD expression and lignin content in transgenic tobacco demonstrated a key role for EuCAD in lignin biosynthesis and established a regulatory role for RNAi. In our study, the direct molecular basis of EuCAD expression was determined, and the potential regulatory effects of this RNAi vector on lignin biosynthesis in E. urophylla GLU4 were demonstrated. Our results provide a theoretical basis for the study of lignin biosynthesis in Eucalyptus.

Recovery of infectious virus from full-length cowpox virus (CPXV) DNA cloned as a bacterial artificial chromosome (BAC)

PubMed Central

2011-01-01

Transmission from pet rats and cats to humans as well as severe infection in felids and other animal species have recently drawn increasing attention to cowpox virus (CPXV). We report the cloning of the entire genome of cowpox virus strain Brighton Red (BR) as a bacterial artificial chromosome (BAC) in Escherichia coli and the recovery of infectious virus from cloned DNA. Generation of a full-length CPXV DNA clone was achieved by first introducing a mini-F vector, which allows maintenance of large circular DNA in E. coli, into the thymidine kinase locus of CPXV by homologous recombination. Circular replication intermediates were then electroporated into E. coli DH10B cells. Upon successful establishment of the infectious BR clone, we modified the full-length clone such that recombination-mediated excision of bacterial sequences can occur upon transfection in eukaryotic cells. This self-excision of the bacterial replicon is made possible by a sequence duplication within mini-F sequences and allows recovery of recombinant virus progeny without remaining marker or vector sequences. The in vitro growth properties of viruses derived from both BAC clones were determined and found to be virtually indistinguishable from those of parental, wild-type BR. Finally, the complete genomic sequence of the infectious clone was determined and the cloned viral genome was shown to be identical to that of the parental virus. In summary, the generated infectious clone will greatly facilitate studies on individual genes and pathogenesis of CPXV. Moreover, the vector potential of CPXV can now be more systematically explored using this newly generated tool. PMID:21314965

Minimal entropy probability paths between genome families.

PubMed

Ahlbrandt, Calvin; Benson, Gary; Casey, William

2004-05-01

We develop a metric for probability distributions with applications to biological sequence analysis. Our distance metric is obtained by minimizing a functional defined on the class of paths over probability measures on N categories. The underlying mathematical theory is connected to a constrained problem in the calculus of variations. The solution presented is a numerical solution, which approximates the true solution in a set of cases called rich paths where none of the components of the path is zero. The functional to be minimized is motivated by entropy considerations, reflecting the idea that nature might efficiently carry out mutations of genome sequences in such a way that the increase in entropy involved in transformation is as small as possible. We characterize sequences by frequency profiles or probability vectors, in the case of DNA where N is 4 and the components of the probability vector are the frequency of occurrence of each of the bases A, C, G and T. Given two probability vectors a and b, we define a distance function based as the infimum of path integrals of the entropy function H( p) over all admissible paths p(t), 0 < or = t< or =1, with p(t) a probability vector such that p(0)=a and p(1)=b. If the probability paths p(t) are parameterized as y(s) in terms of arc length s and the optimal path is smooth with arc length L, then smooth and "rich" optimal probability paths may be numerically estimated by a hybrid method of iterating Newton's method on solutions of a two point boundary value problem, with unknown distance L between the abscissas, for the Euler-Lagrange equations resulting from a multiplier rule for the constrained optimization problem together with linear regression to improve the arc length estimate L. Matlab code for these numerical methods is provided which works only for "rich" optimal probability vectors. These methods motivate a definition of an elementary distance function which is easier and faster to calculate, works on non-rich vectors, does not involve variational theory and does not involve differential equations, but is a better approximation of the minimal entropy path distance than the distance //b-a//(2). We compute minimal entropy distance matrices for examples of DNA myostatin genes and amino-acid sequences across several species. Output tree dendograms for our minimal entropy metric are compared with dendograms based on BLAST and BLAST identity scores.

Influence of Vectors’ Risk-Spreading Strategies and Environmental Stochasticity on the Epidemiology and Evolution of Vector-Borne Diseases: The Example of Chagas’ Disease

PubMed Central

Pelosse, Perrine; Kribs-Zaleta, Christopher M.; Ginoux, Marine; Rabinovich, Jorge E.; Gourbière, Sébastien; Menu, Frédéric

2013-01-01

Insects are known to display strategies that spread the risk of encountering unfavorable conditions, thereby decreasing the extinction probability of genetic lineages in unpredictable environments. To what extent these strategies influence the epidemiology and evolution of vector-borne diseases in stochastic environments is largely unknown. In triatomines, the vectors of the parasite Trypanosoma cruzi, the etiological agent of Chagas’ disease, juvenile development time varies between individuals and such variation most likely decreases the extinction risk of vector populations in stochastic environments. We developed a simplified multi-stage vector-borne SI epidemiological model to investigate how vector risk-spreading strategies and environmental stochasticity influence the prevalence and evolution of a parasite. This model is based on available knowledge on triatomine biodemography, but its conceptual outcomes apply, to a certain extent, to other vector-borne diseases. Model comparisons between deterministic and stochastic settings led to the conclusion that environmental stochasticity, vector risk-spreading strategies (in particular an increase in the length and variability of development time) and their interaction have drastic consequences on vector population dynamics, disease prevalence, and the relative short-term evolution of parasite virulence. Our work shows that stochastic environments and associated risk-spreading strategies can increase the prevalence of vector-borne diseases and favor the invasion of more virulent parasite strains on relatively short evolutionary timescales. This study raises new questions and challenges in a context of increasingly unpredictable environmental variations as a result of global climate change and human interventions such as habitat destruction or vector control. PMID:23951018

The diagnostic performance of recombinant Trypanosoma cruzi ribosomal P2beta protein is influenced by its expression system.

PubMed

Marcipar, Iván S; Olivares, María Laura; Robles, Lucía; Dekanty, Andrés; Marcipar, Alberto; Silber, Ariel M

2004-03-01

In the present work, we have determined the effect of expression vectors and their corresponding host bacteria on the antigenic performance of Trypanosoma cruzi P2beta (TcP2beta) full-length recombinant protein. The gene encoding the TcP2beta ribosomal protein was cloned in pMAL-c2 and pET-32a vectors that allow the expression of high levels of soluble fusion proteins. A panel of 32 positive and 32 negative sera was assayed with the purified proteins expressed using pMal-c2 (TcP2beta-MBP) and pET-32a (TcP2beta-TRX) vectors and with MBP and TRX purified from pMAL-c2 and pET-32a vectors, respectively. The antigenic behavior of each TcP2beta recombinant protein differed in the diagnostic performance in terms of DI(+) (93.7 for TcP2beta-MBP vs 100% for TcP2beta-TRX), in DI(-) (90.5 for TcP2beta-MBP vs 100% for TcP2beta-TRX) and in cross-reaction with negative sera. To determine if the higher reactivity of expressed pMAL-c2 protein was due to folding during protein expression or to a steric effect related to the protein adsorption at the titration plate, the reactivity of sera against soluble proteins was assessed by ELISA inhibition assays. As each soluble protein preserved its level of reactivity, we concluded that differences in reactivity were due to intrinsic characteristics of the proteins and not to differences in patterns of adsorption to the plates.

Vector Graph Assisted Pedestrian Dead Reckoning Using an Unconstrained Smartphone

PubMed Central

Qian, Jiuchao; Pei, Ling; Ma, Jiabin; Ying, Rendong; Liu, Peilin

2015-01-01

The paper presents a hybrid indoor positioning solution based on a pedestrian dead reckoning (PDR) approach using built-in sensors on a smartphone. To address the challenges of flexible and complex contexts of carrying a phone while walking, a robust step detection algorithm based on motion-awareness has been proposed. Given the fact that step length is influenced by different motion states, an adaptive step length estimation algorithm based on motion recognition is developed. Heading estimation is carried out by an attitude acquisition algorithm, which contains a two-phase filter to mitigate the distortion of magnetic anomalies. In order to estimate the heading for an unconstrained smartphone, principal component analysis (PCA) of acceleration is applied to determine the offset between the orientation of smartphone and the actual heading of a pedestrian. Moreover, a particle filter with vector graph assisted particle weighting is introduced to correct the deviation in step length and heading estimation. Extensive field tests, including four contexts of carrying a phone, have been conducted in an office building to verify the performance of the proposed algorithm. Test results show that the proposed algorithm can achieve sub-meter mean error in all contexts. PMID:25738763

Agroinoculation of Beet necrotic yellow vein virus cDNA clones results in plant systemic infection and efficient Polymyxa betae transmission.

PubMed

Delbianco, Alice; Lanzoni, Chiara; Klein, Elodie; Rubies Autonell, Concepcion; Gilmer, David; Ratti, Claudio

2013-05-01

Agroinoculation is a quick and easy method for the infection of plants with viruses. This method involves the infiltration of tissue with a suspension of Agrobacterium tumefaciens carrying binary plasmids harbouring full-length cDNA copies of viral genome components. When transferred into host cells, transcription of the cDNA produces RNA copies of the viral genome that initiate infection. We produced full-length cDNA corresponding to Beet necrotic yellow vein virus (BNYVV) RNAs and derived replicon vectors expressing viral and fluorescent proteins in pJL89 binary plasmid under the control of the Cauliflower mosaic virus 35S promoter. We infected Nicotiana benthamiana and Beta macrocarpa plants with BNYVV by leaf agroinfiltration of combinations of agrobacteria carrying full-length cDNA clones of BNYVV RNAs. We validated the ability of agroclones to reproduce a complete viral cycle, from replication to cell-to-cell and systemic movement and, finally, plant-to-plant transmission by its plasmodiophorid vector. We also showed successful root agroinfection of B. vulgaris, a new tool for the assay of resistance to rhizomania, the sugar beet disease caused by BNYVV. © 2013 BSPP AND BLACKWELL PUBLISHING LTD.

De novo assembly of the Aedes aegypti genome using Hi-C yields chromosome-length scaffolds.

PubMed

Dudchenko, Olga; Batra, Sanjit S; Omer, Arina D; Nyquist, Sarah K; Hoeger, Marie; Durand, Neva C; Shamim, Muhammad S; Machol, Ido; Lander, Eric S; Aiden, Aviva Presser; Aiden, Erez Lieberman

2017-04-07

The Zika outbreak, spread by the Aedes aegypti mosquito, highlights the need to create high-quality assemblies of large genomes in a rapid and cost-effective way. Here we combine Hi-C data with existing draft assemblies to generate chromosome-length scaffolds. We validate this method by assembling a human genome, de novo, from short reads alone (67× coverage). We then combine our method with draft sequences to create genome assemblies of the mosquito disease vectors Ae aegypti and Culex quinquefasciatus , each consisting of three scaffolds corresponding to the three chromosomes in each species. These assemblies indicate that almost all genomic rearrangements among these species occur within, rather than between, chromosome arms. The genome assembly procedure we describe is fast, inexpensive, and accurate, and can be applied to many species. Copyright © 2017, American Association for the Advancement of Science.

Burgers vector content of an interfacial ledge

NASA Astrophysics Data System (ADS)

Bonnet, R.; Loubradou, M.; Pénisson, J. M.

1992-07-01

A new way of investigating the elastic field around a ledge of a faceted interface is proposed for crystalline materials. The length and/or angular misfits along two adjacent facets are accommodated by slightly deforming the atomic structural units with an appropriate distribution of translation dislocations. The Burgers vector content of the ledge is not defined as usual from a circuit crossing the interface twice, a method which proves to be sometimes misleading. An example treats, at the atomic scale, an unusual ledge of the interface TiAl/Ti3Al.

An integrated vector system for cellular studies of phage display-derived peptides.

PubMed

Voss, Stephan D; DeGrand, Alec M; Romeo, Giulio R; Cantley, Lewis C; Frangioni, John V

2002-09-15

Peptide phage display is a method by which large numbers of diverse peptides can be screened for binding to a target of interest. Even when successful, the rate-limiting step is usually validation of peptide bioactivity using living cells. In this paper, we describe an integrated system of vectors that expedites both the screening and the characterization processes. Library construction and screening is performed using an optimized type 3 phage display vector, mJ(1), which is shown to accept peptide libraries of at least 23 amino acids in length. Peptide coding sequences are shuttled from mJ(1) into one of three families of mammalian expression vectors for cell physiological studies. The vector pAL(1) expresses phage display-derived peptides as Gal4 DNA binding domain fusion proteins for transcriptional activation studies. The vectors pG(1), pG(1)N, and pG(1)C express phage display-derived peptides as green fluorescent protein fusions targeted to the entire cell, nucleus, or cytoplasm, respectively. The vector pAP(1) expresses phage display-derived peptides as fusions to secreted placental alkaline phosphatase. Such enzyme fusions can be used as highly sensitive affinity reagents for high-throughput assays and for cloning of peptide-binding cell surface receptors. Taken together, this system of vectors should facilitate the development of phage display-derived peptides into useful biomolecules.

Rotating Apparatus for Isoelectric Focusing

NASA Technical Reports Server (NTRS)

Bier, M.

1986-01-01

Remixing of separated fractions prevented. Improved isoelectric focusing apparatus helps to prevent electro-osmosis and convection, both of which cause remixing of separated fractions. Fractionating column segmented and rotated about horizontal axis: Only combined effects of both features fully effective in making good separations. Improved apparatus slowly rotated continuously or rocked (at rotational amplitude of at least 180 degrees) about its horizontal axis so average gravitational vector experienced by fluid is zero and convection is therefore suppressed. Electro-osmosis suppressed and convection further suppressed by separating column into disklike compartments along its length with filters. Experiments have shown dimensions of apparatus not critical. Typical compartment and column volumes are 2 and 40 ml, respectively. Rotation speeds lie between 3 and 30 rpm.

A vector-based representation of the chemical bond for the substituted torsion of biphenyl

NASA Astrophysics Data System (ADS)

Li, Jiahui; Huang, Weijie; Xu, Tianlv; Kirk, Steven R.; Jenkins, Samantha

2018-06-01

We use a new interpretation of the chemical bond within QTAIM, the bond-path framework set B = {p, q, r} with associated linkages with lengths H∗, H and the familiar bond-path length is used to describe a torsion θ, 0.0° ≤ θ < 22.0° of para-substituted biphenyl, C12H9-x, x = N(CH3)2, NH2, CH3, CHO, CN, NO2. We include consideration of the H--H bonding interactions and find that the lengths H > H∗ that we explain in terms of the most and least preferred directions of charge density accumulation. We also consider the fractional eigenvector-following path with lengths Hf and Hfθmin.

LBSizeCleav: improved support vector machine (SVM)-based prediction of Dicer cleavage sites using loop/bulge length.

PubMed

Bao, Yu; Hayashida, Morihiro; Akutsu, Tatsuya

2016-11-25

Dicer is necessary for the process of mature microRNA (miRNA) formation because the Dicer enzyme cleaves pre-miRNA correctly to generate miRNA with correct seed regions. Nonetheless, the mechanism underlying the selection of a Dicer cleavage site is still not fully understood. To date, several studies have been conducted to solve this problem, for example, a recent discovery indicates that the loop/bulge structure plays a central role in the selection of Dicer cleavage sites. In accordance with this breakthrough, a support vector machine (SVM)-based method called PHDCleav was developed to predict Dicer cleavage sites which outperforms other methods based on random forest and naive Bayes. PHDCleav, however, tests only whether a position in the shift window belongs to a loop/bulge structure. In this paper, we used the length of loop/bulge structures (in addition to their presence or absence) to develop an improved method, LBSizeCleav, for predicting Dicer cleavage sites. To evaluate our method, we used 810 empirically validated sequences of human pre-miRNAs and performed fivefold cross-validation. In both 5p and 3p arms of pre-miRNAs, LBSizeCleav showed greater prediction accuracy than PHDCleav did. This result suggests that the length of loop/bulge structures is useful for prediction of Dicer cleavage sites. We developed a novel algorithm for feature space mapping based on the length of a loop/bulge for predicting Dicer cleavage sites. The better performance of our method indicates the usefulness of the length of loop/bulge structures for such predictions.

Definition of the persistence length in the coarse-grained models of DNA elasticity.

PubMed

Fathizadeh, A; Eslami-Mossallam, B; Ejtehadi, M R

2012-11-01

By considering the detailed structure of DNA in the base pair level, two possible definitions of the persistence length are compared. One definition is related to the orientation of the terminal base pairs, and the other is based on the vectors which connect two adjacent base pairs at each end of the molecule. It is shown that although these definitions approach each other for long DNA molecules, they are dramatically different on short length scales. We show analytically that the difference mostly comes from the shear flexibility of the molecule and can be used to measure the shear modulus of DNA.

Efficiency of VIGS and gene expression in a novel bipartite potexvirus vector delivery system as a function of strength of TGB1 silencing suppression.

PubMed

Lim, Hyoun-Sub; Vaira, Anna Maria; Domier, Leslie L; Lee, Sung Chul; Kim, Hong Gi; Hammond, John

2010-06-20

We have developed plant virus-based vectors for virus-induced gene silencing (VIGS) and protein expression, based on Alternanthera mosaic virus (AltMV), for infection of a wide range of host plants including Nicotiana benthamiana and Arabidopsis thaliana by either mechanical inoculation of in vitro transcripts or via agroinfiltration. In vivo transcripts produced by co-agroinfiltration of bacteriophage T7 RNA polymerase resulted in T7-driven AltMV infection from a binary vector in the absence of the Cauliflower mosaic virus 35S promoter. An artificial bipartite viral vector delivery system was created by separating the AltMV RNA-dependent RNA polymerase and Triple Gene Block (TGB)123-Coat protein (CP) coding regions into two constructs each bearing the AltMV 5' and 3' non-coding regions, which recombined in planta to generate a full-length AltMV genome. Substitution of TGB1 L(88)P, and equivalent changes in other potexvirus TGB1 proteins, affected RNA silencing suppression efficacy and suitability of the vectors from protein expression to VIGS. Published by Elsevier Inc.

Autorotation

NASA Astrophysics Data System (ADS)

Bohr, Jakob; Markvorsen, Steen

2016-02-01

A continuous autorotation vector field along a framed space curve is defined, which describes the rotational progression of the frame. We obtain an exact integral for the length of the autorotation vector. This invokes the infinitesimal rotation vector of the frame progression and the unit vector field for the corresponding autorotation vector field. For closed curves we define an autorotation number whose integer value depends on the starting point of the curve. Upon curve deformations, the autorotation number is either constant, or can make a jump of (multiples of) plus-minus two, which corresponds to a change in rotation of multiples of 4π. The autorotation number is therefore not topologically conserved under all transformations. We discuss this within the context of generalised inflection points and of frame revisit points. The results may be applicable to physical systems such as polymers, proteins, and DNA. Finally, turbulence is discussed in the light of autorotation, as is the Philippine wine dance, the Dirac belt trick, and the 4π cycle of the flying snake. This paper is dedicated to Ian K Robinson on the occasion of Ian receiving the Gregori Aminoff Prize 2015.

[Cloning and sequence analysis of tomato fruit-specific E8 promoter from Lycopersicon esculentum (Zhongshu No.5)].

PubMed

Zhou, Xiao-hong; Chen, Xiao-guang; Zhang, Xiao-dong; Wang, Ya-nan; Li, Lin; Xi, Jia-fei; Hu, Jian-jun

2003-01-01

To obtain the gene encoding tomato fruit-specific E8 promoter therefore to prepare for exogenous gene transcription and expression in transgenic tomato fruit. The cotyledons of tomato Lycopersicon esculentum (Zhongshu No.5) were collected for extracting the genomic DNA of this plant. The fruit-specific E81.1 and E82.2 promoter DNA were then amplified by PCR, the product of which was subcloned into pGEM-T vector. After identification by restriction enzymes, the recombinant T-vectors were subjected to sequence analysis. The fragments of the promoter as amplified by PCR were of predicted length. Digestion with Xba I and Hind III /BamH I proved correct insertion of the target fragments with expected length into the recombinant T vectors. As indicated by homology analysis, the resultant tomato fruit-specific E8 promoter was highly conservative, and E82.2 promoter of Zhongshu No.5, with GenBank submission number of AF515784, proved to share 99% homology with E82.2 promoter of Zhongshu No.5 Cherry as reported by Deikman J. Tomato fruit-specific E8 promoter of Zhongshu No.5 has been successfully cloned, thus making possible the subsequent research in oral vaccine of transgenic tomato.

[Construction and expression of recombinant lentiviral vectors of AKT2,PDK1 and BAD].

PubMed

Zhu, Jing; Chen, Bo-Jiang; Huang, Na; Li, Wei-Min

2014-03-01

To construct human protein kinase B (ATK2), phosphoinositide-dependent kinase 1 (PDK1) and bcl-2-associated death protein (BAD) lentiviral expression vector, and to determine their expressions in 293T cells. Total RNA was extracted from lung cancer tissues. The full-length coding regions of human ATK2, BAD and PDK1 cDNA were amplified via RT-PCR using specific primers, subcloned into PGEM-Teasy and then sequenced for confirmation. The full-length coding sequence was cut out with a specific restriction enzyme digest and subclone into pCDF1-MCS2-EF1-copGFP. The plasmids were transfected into 293T cells using the calcium phosphate method. The over expression of AKT2, BAD and PDK1 were detected by Western blot. AKT2, PDK1 and BAD were subcloned into pCDF1-MCS2-EF1-copGFP, with an efficiency of transfection of 100%, 95%, and 90% respectively. The virus titers were 6.7 x 10(6) PFU/mL in the supernatant. After infection, the proteins of AKT2, PDK1 and BAD were detected by Western blot. The lentivial vector pCDF1-MCS2-EF1-copGFP containing AKT2, BAD and PDK1 were successfully constructed and expressed in 293T cells.

Evaluating uncertainties in multi-layer soil moisture estimation with support vector machines and ensemble Kalman filtering

NASA Astrophysics Data System (ADS)

Liu, Di; Mishra, Ashok K.; Yu, Zhongbo

2016-07-01

This paper examines the combination of support vector machines (SVM) and the dual ensemble Kalman filter (EnKF) technique to estimate root zone soil moisture at different soil layers up to 100 cm depth. Multiple experiments are conducted in a data rich environment to construct and validate the SVM model and to explore the effectiveness and robustness of the EnKF technique. It was observed that the performance of SVM relies more on the initial length of training set than other factors (e.g., cost function, regularization parameter, and kernel parameters). The dual EnKF technique proved to be efficient to improve SVM with observed data either at each time step or at a flexible time steps. The EnKF technique can reach its maximum efficiency when the updating ensemble size approaches a certain threshold. It was observed that the SVM model performance for the multi-layer soil moisture estimation can be influenced by the rainfall magnitude (e.g., dry and wet spells).

Zn(II)-dipicolylamine-based metallo-lipids as novel non-viral gene vectors.

PubMed

Su, Rong-Chuan; Liu, Qiang; Yi, Wen-Jing; Zhao, Zhi-Gang

2017-08-01

In this study, a series of Zn(II)-dipicolylamine (Zn-DPA) based cationic lipids bearing different hydrophobic tails (long chains, α-tocopherol, cholesterol or diosgenin) were synthesized. Structure-activity relationship (SAR) of these lipids was studied in detail by investigating the effects of several structural aspects including the type of hydrophobic tails, the chain length and saturation degree. In addition, several assays were used to study their interactions with plasmid DNA, and results reveal that these lipids could condense DNA into nanosized particles with appropriate size and zeta-potentials. MTT-based cell viability assays showed that lipoplexes 5 had low cytotoxicity. The in vitro gene transfection studies showed the hydrophobic tails clearly affected the TE, and hexadecanol-containing lipid 5b gives the best TE, which was 2.2 times higher than bPEI 25k in the presence of 10% serum. The results not only demonstrate that these lipids might be promising non-viral gene vectors, but also afford us clues for further optimization of lipidic gene delivery materials.

Effects of climate change on the spread of zika virus: a public health threat.

PubMed

Asad, Hina; Carpenter, David O

2018-03-28

Zika is a vector-borne viral disease transmitted to humans primarily by Aedes aegypti mosquitoes. The increased climate instability has contributed to the emergence of infections carried by mosquitoes like dengue, chikungunya and zika. While infection with the zika virus is not new, the recent epidemic of microcephaly in Brazil and other countries in South America resulting from the infection of pregnant women with the zika virus raise a number of serious public health concerns. These include the question of how climate change affects the range of zika vectors, what can we do to shorten the length of mosquito season, how and why the symptoms of zika infection have changed and what can be done to reduce the burden of human disease from this infection? Another important question that needs to be answered is what are the factors that caused the zika virus to leave the non-human primates and/or other mammals and invade the human population?

Fluctuation dynamo and turbulent induction at small Prandtl number.

PubMed

Eyink, Gregory L

2010-10-01

We study the Lagrangian mechanism of the fluctuation dynamo at zero Prandtl number and infinite magnetic Reynolds number, in the Kazantsev-Kraichnan model of white-noise advection. With a rough velocity field corresponding to a turbulent inertial range, flux freezing holds only in a stochastic sense. We show that field lines arriving to the same point which were initially separated by many resistive lengths are important to the dynamo. Magnetic vectors of the seed field that point parallel to the initial separation vector arrive anticorrelated and produce an "antidynamo" effect. We also study the problem of "magnetic induction" of a spatially uniform seed field. We find no essential distinction between this process and fluctuation dynamo, both producing the same growth rates and small-scale magnetic correlations. In the regime of very rough velocity fields where fluctuation dynamo fails, we obtain the induced magnetic energy spectra. We use these results to evaluate theories proposed for magnetic spectra in laboratory experiments of turbulent induction.

RNAi-mediated endogene silencing in strawberry fruit: detection of primary and secondary siRNAs by deep sequencing.

PubMed

Härtl, Katja; Kalinowski, Gregor; Hoffmann, Thomas; Preuss, Anja; Schwab, Wilfried

2017-05-01

RNA interference (RNAi) has been exploited as a reverse genetic tool for functional genomics in the nonmodel species strawberry (Fragaria × ananassa) since 2006. Here, we analysed for the first time different but overlapping nucleotide sections (>200 nt) of two endogenous genes, FaCHS (chalcone synthase) and FaOMT (O-methyltransferase), as inducer sequences and a transitive vector system to compare their gene silencing efficiencies. In total, ten vectors were assembled each containing the nucleotide sequence of one fragment in sense and corresponding antisense orientation separated by an intron (inverted hairpin construct, ihp). All sequence fragments along the full lengths of both target genes resulted in a significant down-regulation of the respective gene expression and related metabolite levels. Quantitative PCR data and successful application of a transitive vector system coinciding with a phenotypic change suggested propagation of the silencing signal. The spreading of the signal in strawberry fruit in the 3' direction was shown for the first time by the detection of secondary small interfering RNAs (siRNAs) outside of the primary targets by deep sequencing. Down-regulation of endogenes by the transitive method was less effective than silencing by ihp constructs probably because the numbers of primary siRNAs exceeded the quantity of secondary siRNAs by three orders of magnitude. Besides, we observed consistent hotspots of primary and secondary siRNA formation along the target sequence which fall within a distance of less than 200 nt. Thus, ihp vectors seem to be superior over the transitive vector system for functional genomics in strawberry fruit. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

A Translational Pathway Toward a Clinical Trial Using the Second-Generation AAV Micro-Dystrophin Vector

DTIC Science & Technology

2016-09-01

minidystrophin gene (a gift from Dr Jeffrey Chamberlain at the University of Washington, Seattle, WA) and the bovine growth hormone polyadenylation...full-length micro-dystrophin protein. Dys-2 is a short peptide in the wild-type full-length dystrophin. It can be recognized by the Dys-2...muscle. In one approach, a muscle homing peptide is inserted on the surface of the capsid to facilitate the entry of AAV into muscle cells. In the

Different Effects of sgRNA Length on CRISPR-mediated Gene Knockout Efficiency.

PubMed

Zhang, Jian-Ping; Li, Xiao-Lan; Neises, Amanda; Chen, Wanqiu; Hu, Lin-Ping; Ji, Guang-Zhen; Yu, Jun-Yao; Xu, Jing; Yuan, Wei-Ping; Cheng, Tao; Zhang, Xiao-Bing

2016-06-24

CRISPR-Cas9 is a powerful genome editing technology, yet with off-target effects. Truncated sgRNAs (17nt) have been found to decrease off-target cleavage without affecting on-target disruption in 293T cells. However, the potency of 17nt sgRNAs relative to the full-length 20nt sgRNAs in stem cells, such as human mesenchymal stem cells (MSCs) and induced pluripotent stem cells (iPSCs), has not been assessed. Using a GFP reporter system, we found that both 17nt and 20nt sgRNAs expressed by lentiviral vectors induce ~95% knockout (KO) in 293T cells, whereas the KO efficiencies are significantly lower in iPSCs (60-70%) and MSCs (65-75%). Furthermore, we observed a decrease of 10-20 percentage points in KO efficiency with 17nt sgRNAs compared to full-length sgRNAs in both iPSCs and MSCs. Off-target cleavage was observed in 17nt sgRNAs with 1-2nt but not 3-4nt mismatches; whereas 20nt sgRNAs with up to 5nt mismatches can still induce off-target mutations. Of interest, we occasionally observed off-target effects induced by the 17nt but not the 20nt sgRNAs. These results indicate the importance of balancing on-target gene cleavage potency with off-target effects: when efficacy is a major concern such as genome editing in stem cells, the use of 20nt sgRNAs is preferable.

Microscopic diffusion and hydrodynamic interactions of hemoglobin in red blood cells.

PubMed

Doster, Wolfgang; Longeville, Stéphane

2007-08-15

The cytoplasm of red blood cells is congested with the oxygen storage protein hemoglobin occupying a quarter of the cell volume. The high protein concentration leads to a reduced mobility; the self-diffusion coefficient of hemoglobin in blood cells is six times lower than in dilute solution. This effect is generally assigned to excluded volume effects in crowded media. However, the collective or gradient diffusion coefficient of hemoglobin is only weakly dependent on concentration, suggesting the compensation of osmotic and friction forces. This would exclude hydrodynamic interactions, which are of dynamic origin and do not contribute to the osmotic pressure. Hydrodynamic coupling between protein molecules is dominant at short time- and length scales before direct interactions are fully established. Employing neutron spin-echo-spectroscopy, we study hemoglobin diffusion on a nanosecond timescale and protein displacements on the scale of a few nanometers. A time- and wave-vector dependent diffusion coefficient is found, suggesting the crossover of self- and collective diffusion. Moreover, a wave-vector dependent friction function is derived, which is a characteristic feature of hydrodynamic interactions. The wave-vector and concentration dependence of the long-time self-diffusion coefficient of hemoglobin agree qualitatively with theoretical results on hydrodynamics in hard spheres suspensions. Quantitative agreement requires us to adjust the volume fraction by including part of the hydration shell: Proteins exhibit a larger surface/volume ratio compared to standard colloids of much larger size. It is concluded that hydrodynamic and not direct interactions dominate long-range molecular transport at high concentration.

Flying with the wind: Scale dependency of speed and direction measurements in modelling wind support in avian flight

USGS Publications Warehouse

Safi, Kamran; Kranstauber, Bart; Weinzierl, Rolf P.; Griffin, Larry; Reese, Eileen C.; Cabot, David; Cruz, Sebastian; Proaño, Carolina; Takekawa, John Y.; Newman, Scott H.; Waldenström, Jonas; Bengtsson, Daniel; Kays, Roland; Wikelski, Martin; Bohrer, Gil

2013-01-01

Background: Understanding how environmental conditions, especially wind, influence birds' flight speeds is a prerequisite for understanding many important aspects of bird flight, including optimal migration strategies, navigation, and compensation for wind drift. Recent developments in tracking technology and the increased availability of data on large-scale weather patterns have made it possible to use path annotation to link the location of animals to environmental conditions such as wind speed and direction. However, there are various measures available for describing not only wind conditions but also the bird's flight direction and ground speed, and it is unclear which is best for determining the amount of wind support (the length of the wind vector in a bird’s flight direction) and the influence of cross-winds (the length of the wind vector perpendicular to a bird’s direction) throughout a bird's journey.Results: We compared relationships between cross-wind, wind support and bird movements, using path annotation derived from two different global weather reanalysis datasets and three different measures of direction and speed calculation for 288 individuals of nine bird species. Wind was a strong predictor of bird ground speed, explaining 10-66% of the variance, depending on species. Models using data from different weather sources gave qualitatively similar results; however, determining flight direction and speed from successive locations, even at short (15 min intervals), was inferior to using instantaneous GPS-based measures of speed and direction. Use of successive location data significantly underestimated the birds' ground and airspeed, and also resulted in mistaken associations between cross-winds, wind support, and their interactive effects, in relation to the birds' onward flight.Conclusions: Wind has strong effects on bird flight, and combining GPS technology with path annotation of weather variables allows us to quantify these effects for understanding flight behaviour. The potentially strong influence of scaling effects must be considered and implemented in developing sampling regimes and data analysis.

Flying with the wind: scale dependency of speed and direction measurements in modelling wind support in avian flight.

PubMed

Safi, Kamran; Kranstauber, Bart; Weinzierl, Rolf; Griffin, Larry; Rees, Eileen C; Cabot, David; Cruz, Sebastian; Proaño, Carolina; Takekawa, John Y; Newman, Scott H; Waldenström, Jonas; Bengtsson, Daniel; Kays, Roland; Wikelski, Martin; Bohrer, Gil

2013-01-01

Understanding how environmental conditions, especially wind, influence birds' flight speeds is a prerequisite for understanding many important aspects of bird flight, including optimal migration strategies, navigation, and compensation for wind drift. Recent developments in tracking technology and the increased availability of data on large-scale weather patterns have made it possible to use path annotation to link the location of animals to environmental conditions such as wind speed and direction. However, there are various measures available for describing not only wind conditions but also the bird's flight direction and ground speed, and it is unclear which is best for determining the amount of wind support (the length of the wind vector in a bird's flight direction) and the influence of cross-winds (the length of the wind vector perpendicular to a bird's direction) throughout a bird's journey. We compared relationships between cross-wind, wind support and bird movements, using path annotation derived from two different global weather reanalysis datasets and three different measures of direction and speed calculation for 288 individuals of nine bird species. Wind was a strong predictor of bird ground speed, explaining 10-66% of the variance, depending on species. Models using data from different weather sources gave qualitatively similar results; however, determining flight direction and speed from successive locations, even at short (15 min intervals), was inferior to using instantaneous GPS-based measures of speed and direction. Use of successive location data significantly underestimated the birds' ground and airspeed, and also resulted in mistaken associations between cross-winds, wind support, and their interactive effects, in relation to the birds' onward flight. Wind has strong effects on bird flight, and combining GPS technology with path annotation of weather variables allows us to quantify these effects for understanding flight behaviour. The potentially strong influence of scaling effects must be considered and implemented in developing sampling regimes and data analysis.

Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.

PubMed

Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

2014-01-01

The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.

Noise-induced hearing loss and associated factors among vector control workers in a Malaysian state.

PubMed

Masilamani, Retneswari; Rasib, Abdul; Darus, Azlan; Ting, Anselm Su

2014-11-01

This study aims to determine the prevalence and associated factors of noise-induced hearing loss (NIHL) among vector control workers in the state of Negeri Sembilan, Malaysia. This was an analytical cross-sectional study conducted on 181 vector control workers who were working in district health offices in a state in Malaysia. Data were collected using a self-administered questionnaire and audiometry. Prevalence of NIHL was 26% among this group of workers. NIHL was significantly associated with the age-group of 40 years and older, length of service of 10 or more years, current occupational noise exposure, listening to loud music, history of firearms use, and history of mumps/measles infection. Following logistic regression, age of more than 40 years and noise exposure in current occupation were associated with NIHL with an odds ratio of 3.45 (95% confidence interval = 1.68-7.07) and 6.87 (95% confidence interval = 1.54-30.69), respectively, among this group of vector control workers. © 2012 APJPH.

The nondeterministic divide

NASA Technical Reports Server (NTRS)

Charlesworth, Arthur

1990-01-01

The nondeterministic divide partitions a vector into two non-empty slices by allowing the point of division to be chosen nondeterministically. Support for high-level divide-and-conquer programming provided by the nondeterministic divide is investigated. A diva algorithm is a recursive divide-and-conquer sequential algorithm on one or more vectors of the same range, whose division point for a new pair of recursive calls is chosen nondeterministically before any computation is performed and whose recursive calls are made immediately after the choice of division point; also, access to vector components is only permitted during activations in which the vector parameters have unit length. The notion of diva algorithm is formulated precisely as a diva call, a restricted call on a sequential procedure. Diva calls are proven to be intimately related to associativity. Numerous applications of diva calls are given and strategies are described for translating a diva call into code for a variety of parallel computers. Thus diva algorithms separate logical correctness concerns from implementation concerns.

Protein Kinase Classification with 2866 Hidden Markov Models and One Support Vector Machine

NASA Technical Reports Server (NTRS)

Weber, Ryan; New, Michael H.; Fonda, Mark (Technical Monitor)

2002-01-01

The main application considered in this paper is predicting true kinases from randomly permuted kinases that share the same length and amino acid distributions as the true kinases. Numerous methods already exist for this classification task, such as HMMs, motif-matchers, and sequence comparison algorithms. We build on some of these efforts by creating a vector from the output of thousands of structurally based HMMs, created offline with Pfam-A seed alignments using SAM-T99, which then must be combined into an overall classification for the protein. Then we use a Support Vector Machine for classifying this large ensemble Pfam-Vector, with a polynomial and chisquared kernel. In particular, the chi-squared kernel SVM performs better than the HMMs and better than the BLAST pairwise comparisons, when predicting true from false kinases in some respects, but no one algorithm is best for all purposes or in all instances so we consider the particular strengths and weaknesses of each.

Shape Sensing Using a Multi-Core Optical Fiber Having an Arbitrary Initial Shape in the Presence of Extrinsic Forces

NASA Technical Reports Server (NTRS)

Rogge, Matthew D. (Inventor); Moore, Jason P. (Inventor)

2014-01-01

Shape of a multi-core optical fiber is determined by positioning the fiber in an arbitrary initial shape and measuring strain over the fiber's length using strain sensors. A three-coordinate p-vector is defined for each core as a function of the distance of the corresponding cores from a center point of the fiber and a bending angle of the cores. The method includes calculating, via a controller, an applied strain value of the fiber using the p-vector and the measured strain for each core, and calculating strain due to bending as a function of the measured and the applied strain values. Additionally, an apparent local curvature vector is defined for each core as a function of the calculated strain due to bending. Curvature and bend direction are calculated using the apparent local curvature vector, and fiber shape is determined via the controller using the calculated curvature and bend direction.

Magnetic resonance image compression using scalar-vector quantization

NASA Astrophysics Data System (ADS)

Mohsenian, Nader; Shahri, Homayoun

1995-12-01

A new coding scheme based on the scalar-vector quantizer (SVQ) is developed for compression of medical images. SVQ is a fixed-rate encoder and its rate-distortion performance is close to that of optimal entropy-constrained scalar quantizers (ECSQs) for memoryless sources. The use of a fixed-rate quantizer is expected to eliminate some of the complexity issues of using variable-length scalar quantizers. When transmission of images over noisy channels is considered, our coding scheme does not suffer from error propagation which is typical of coding schemes which use variable-length codes. For a set of magnetic resonance (MR) images, coding results obtained from SVQ and ECSQ at low bit-rates are indistinguishable. Furthermore, our encoded images are perceptually indistinguishable from the original, when displayed on a monitor. This makes our SVQ based coder an attractive compression scheme for picture archiving and communication systems (PACS), currently under consideration for an all digital radiology environment in hospitals, where reliable transmission, storage, and high fidelity reconstruction of images are desired.

Micro-Structured Two-Component 3D Metamaterials with Negative Thermal-Expansion Coefficient from Positive Constituents

PubMed Central

Qu, Jingyuan; Kadic, Muamer; Naber, Andreas; Wegener, Martin

2017-01-01

Controlling the thermal expansion of materials is of great technological importance. Uncontrolled thermal expansion can lead to failure or irreversible destruction of structures and devices. In ordinary crystals, thermal expansion is governed by the asymmetry of the microscopic binding potential, which cannot be adjusted easily. In artificial crystals called metamaterials, thermal expansion can be controlled by structure. Here, following previous theoretical work, we fabricate three-dimensional (3D) two-component polymer micro-lattices by using gray-tone laser lithography. We perform cross-correlation analysis of optical microscopy images taken at different sample temperatures. The derived displacement-vector field reveals that the thermal expansion and resulting bending of the bi-material beams leads to a rotation of the 3D chiral crosses arranged onto a 3D checkerboard pattern within one metamaterial unit cell. These rotations can compensate the expansion of the all positive constituents, leading to an effectively near-zero thermal length-expansion coefficient, or over-compensate the expansion, leading to an effectively negative thermal length-expansion coefficient. This evidences a striking level of thermal-expansion control. PMID:28079161

Predicting the host of influenza viruses based on the word vector.

PubMed

Xu, Beibei; Tan, Zhiying; Li, Kenli; Jiang, Taijiao; Peng, Yousong

2017-01-01

Newly emerging influenza viruses continue to threaten public health. A rapid determination of the host range of newly discovered influenza viruses would assist in early assessment of their risk. Here, we attempted to predict the host of influenza viruses using the Support Vector Machine (SVM) classifier based on the word vector, a new representation and feature extraction method for biological sequences. The results show that the length of the word within the word vector, the sequence type (DNA or protein) and the species from which the sequences were derived for generating the word vector all influence the performance of models in predicting the host of influenza viruses. In nearly all cases, the models built on the surface proteins hemagglutinin (HA) and neuraminidase (NA) (or their genes) produced better results than internal influenza proteins (or their genes). The best performance was achieved when the model was built on the HA gene based on word vectors (words of three-letters long) generated from DNA sequences of the influenza virus. This results in accuracies of 99.7% for avian, 96.9% for human and 90.6% for swine influenza viruses. Compared to the method of sequence homology best-hit searches using the Basic Local Alignment Search Tool (BLAST), the word vector-based models still need further improvements in predicting the host of influenza A viruses.

Parallel processors and nonlinear structural dynamics algorithms and software

NASA Technical Reports Server (NTRS)

Belytschko, Ted

1990-01-01

Techniques are discussed for the implementation and improvement of vectorization and concurrency in nonlinear explicit structural finite element codes. In explicit integration methods, the computation of the element internal force vector consumes the bulk of the computer time. The program can be efficiently vectorized by subdividing the elements into blocks and executing all computations in vector mode. The structuring of elements into blocks also provides a convenient way to implement concurrency by creating tasks which can be assigned to available processors for evaluation. The techniques were implemented in a 3-D nonlinear program with one-point quadrature shell elements. Concurrency and vectorization were first implemented in a single time step version of the program. Techniques were developed to minimize processor idle time and to select the optimal vector length. A comparison of run times between the program executed in scalar, serial mode and the fully vectorized code executed concurrently using eight processors shows speed-ups of over 25. Conjugate gradient methods for solving nonlinear algebraic equations are also readily adapted to a parallel environment. A new technique for improving convergence properties of conjugate gradients in nonlinear problems is developed in conjunction with other techniques such as diagonal scaling. A significant reduction in the number of iterations required for convergence is shown for a statically loaded rigid bar suspended by three equally spaced springs.

Professor Herman Burger (1893-1965), eminent teacher and scientist, who laid the theoretical foundations of vectorcardiography--and electrocardiography.

PubMed

van Herpen, Gerard

2014-01-01

Einthoven not only designed a high quality instrument, the string galvanometer, for recording the ECG, he also shaped the conceptual framework to understand it. He reduced the body to an equilateral triangle and the cardiac electric activity to a dipole, represented by an arrow (i.e. a vector) in the triangle's center. Up to the present day the interpretation of the ECG is based on the model of a dipole vector being projected on the various leads. The model is practical but intuitive, not physically founded. Burger analysed the relation between heart vector and leads according to the principles of physics. It then follows that an ECG lead must be treated as a vector (lead vector) and that the lead voltage is not simply proportional to the projection of the vector on the lead, but must be multiplied by the value (length) of the lead vector, the lead strength. Anatomical lead axis and electrical lead axis are different entities and the anatomical body space must be distinguished from electrical space. Appreciation of these underlying physical principles should contribute to a better understanding of the ECG. The development of these principles by Burger is described, together with some personal notes and a sketch of the personality of this pioneer of medical physics. Copyright © 2014. Published by Elsevier Inc.

Lentiviral Vector Induced Insertional Haploinsufficiency of Ebf1 Causes Murine Leukemia

PubMed Central

Heckl, Dirk; Schwarzer, Adrian; Haemmerle, Reinhard; Steinemann, Doris; Rudolph, Cornelia; Skawran, Britta; Knoess, Sabine; Krause, Johanna; Li, Zhixiong; Schlegelberger, Brigitte; Baum, Christopher; Modlich, Ute

2012-01-01

Integrating vectors developed on the basis of various retroviruses have demonstrated therapeutic potential following genetic modification of long-lived hematopoietic stem and progenitor cells. Lentiviral vectors (LV) are assumed to circumvent genotoxic events previously observed with γ-retroviral vectors, due to their integration bias to transcription units in comparison to the γ-retroviral preference for promoter regions and CpG islands. However, recently several studies have revealed the potential for gene activation by LV insertions. Here, we report a murine acute B-lymphoblastic leukemia (B-ALL) triggered by insertional gene inactivation. LV integration occurred into the 8th intron of Ebf1, a major regulator of B-lymphopoiesis. Various aberrant splice variants could be detected that involved splice donor and acceptor sites of the lentiviral construct, inducing downregulation of Ebf1 full-length message. The transcriptome signature was compatible with loss of this major determinant of B-cell differentiation, with partial acquisition of myeloid markers, including Csf1r (macrophage colony-stimulating factor (M-CSF) receptor). This was accompanied by receptor phosphorylation and STAT5 activation, both most likely contributing to leukemic progression. Our results highlight the risk of intragenic vector integration to initiate leukemia by inducing haploinsufficiency of a tumor suppressor gene. We propose to address this risk in future vector design. PMID:22472950

Adenoviral vectors elicit humoral immunity against variable loop 2 of clade C HIV-1 gp120 via "Antigen Capsid-Incorporation" strategy.

PubMed

Gu, Linlin; Krendelchtchikova, Valentina; Krendelchtchikov, Alexandre; Farrow, Anitra L; Derdeyn, Cynthia A; Matthews, Qiana L

2016-01-01

Adenoviral (Ad) vectors in combination with the "Antigen Capsid-Incorporation" strategy have been applied in developing HIV-1 vaccines, due to the vectors׳ abilities in incorporating and inducing immunity of capsid-incorporated antigens. Variable loop 2 (V2)-specific antibodies were suggested in the RV144 trial to correlate with reduced HIV-1 acquisition, which highlights the importance of developing novel HIV-1 vaccines by targeting the V2 loop. Therefore, the V2 loop of HIV-1 has been incorporated into the Ad capsid protein. We generated adenovirus serotype 5 (Ad5) vectors displaying variable loop 2 (V2) of HIV-1 gp120, with the "Antigen Capsid-Incorporation" strategy. To assess the incorporation capabilities on hexon hypervariable region1 (HVR1) and protein IX (pIX), 20aa or full length (43aa) of V2 and V1V2 (67aa) were incorporated, respectively. Immunizations with the recombinant vectors significantly generated antibodies against both linear and discontinuous V2 epitopes. The immunizations generated durable humoral immunity against V2. This study will lead to more stringent development of various serotypes of adenovirus-vectored V2 vaccine candidates, based on breakthroughs regarding the immunogenicity of V2. Copyright © 2015. Published by Elsevier Inc.

[Cloning of Chinese Banna minipig inbred-line alpha1,3-galactosyltransferase gene and construction of its recombinant eukaryotic expression vector].

PubMed

Zhu, Shengming; Wang, Yanping; Zheng, Hong; Cheng, Jingqiu; Lu, Yanrong; Zeng, Yangzhi; Wang, Yu; Wang, Zhu

2009-04-01

This study sought to clone Chinese Banna minipig inbred-line (BMI) alpha1,3-galactosyltransferase (alpha1,3-GT) gene and construct its recombinant eukaryotic expression vector. Total RNA was isolated from BMI liver. Full length cDNA of alpha1,3-GT gene was amplified by RT-PCR and cloned into pMD18-T vector to sequence. Subsequently, alpha1,3-GT gene was inserted into pEGFP-N1 to construct eukaryotic expression vector pEGFP-N1-GT. Then the reconstructed plasmid pEGFP-N1-GT was transiently transfected into human lung cancer cell line A549. The expression of alpha1,3-GT mRNA in transfected cells was detected by RT-PCR. FITC-BS-IB4 lectin was used in the direct immunofluorescence method, which was performed to observe the alpha-Gal synthesis function of BMI alpha1,3-GT in transfected cells. The results showed that full length of BMI alpha1,3-GT cDNA was 1116 bp. BMI alpha1,3-GT cDNA sequence was highly homogenous with those of mouse and bovine, and was exactly the same as the complete sequence of those of swine, pEGFP-N1-GT was confirmed by enzyme digestion and PCR. The expression of alpha1,3-GT mRNA was detected in A549 cells transfected by pEGFP-N1-GT. The expression of alpha-Gal was observed on the membrane of A549 cells transfected by pEGFP-N1-GT. Successful cloning of BMI alpha1,3-GT cDNA and construction of its eukaryotic expression vector have established a foundation for further research and application of BMI alpha1,3-GT in the fields of xenotransplantation and immunological therapy of cancer.

Anomalies in the equilibrium and nonequilibrium properties of correlated ions in complex molecular environments

NASA Astrophysics Data System (ADS)

Mahakrishnan, Sathiya; Chakraborty, Subrata; Vijay, Amrendra

2017-11-01

Emergent statistical attributes, and therefore the equations of state, of an assembly of interacting charge carriers embedded within a complex molecular environment frequently exhibit a variety of anomalies, particularly in the high-density (equivalently, the concentration) regime, which are not well understood, because they do not fall under the low-concentration phenomenologies of Debye-Hückel-Onsager and Poisson-Nernst-Planck, including their variants. To go beyond, we here use physical concepts and mathematical tools from quantum scattering theory, transport theory with the Stosszahlansatz of Boltzmann, and classical electrodynamics (Lorentz gauge) and obtain analytical expressions both for the average and the frequency-wave vector-dependent longitudinal and transverse current densities, diffusion coefficient, and the charge density, and therefore the analytical expressions for (a) the chemical potential, activity coefficient, and the equivalent conductivity for strong electrolytes and (b) the current-voltage characteristics for ion-transport processes in complex molecular environments. Using a method analogous to the notion of Debye length and thence the electrical double layer, we here identify a pair of characteristic length scales (longitudinal and the transverse), which, being wave vector and frequency dependent, manifestly exhibit nontrivial fluctuations in space-time. As a unifying theme, we advance a quantity (inverse length dimension), gscat(a ), which embodies all dynamical interactions, through various quantum scattering lengths, relevant to molecular species a, and the analytical behavior which helps us to rationalize the properties of strong electrolytes, including anomalies, in all concentration regimes. As an example, the behavior of gscat(a ) in the high-concentration regime explains the anomalous increase of the Debye length with concentration, as seen in a recent experiment on electrolyte solutions. We also put forth an extension of the standard diffusion equation, which manifestly incorporates the effects arising from the underlying microscopic collisions among constituent molecular species. Furthermore, we show a nontrivial connection between the current-voltage characteristics of electrolyte solutions and the Landauer's approach to electrical conduction in mesoscopic solids and thereby establish a definite conceptual bridge between the two disjoint subjects. For numerical insight, we present results on the aqueous solution of KCl as an example of strong electrolyte, and the transport (conduction as well as diffusion) of K+ ions in water, as an example of ion transport across the voltage-gated channels in biological cells.

Anomalies in the equilibrium and nonequilibrium properties of correlated ions in complex molecular environments.

PubMed

Mahakrishnan, Sathiya; Chakraborty, Subrata; Vijay, Amrendra

2017-11-01

Emergent statistical attributes, and therefore the equations of state, of an assembly of interacting charge carriers embedded within a complex molecular environment frequently exhibit a variety of anomalies, particularly in the high-density (equivalently, the concentration) regime, which are not well understood, because they do not fall under the low-concentration phenomenologies of Debye-Hückel-Onsager and Poisson-Nernst-Planck, including their variants. To go beyond, we here use physical concepts and mathematical tools from quantum scattering theory, transport theory with the Stosszahlansatz of Boltzmann, and classical electrodynamics (Lorentz gauge) and obtain analytical expressions both for the average and the frequency-wave vector-dependent longitudinal and transverse current densities, diffusion coefficient, and the charge density, and therefore the analytical expressions for (a) the chemical potential, activity coefficient, and the equivalent conductivity for strong electrolytes and (b) the current-voltage characteristics for ion-transport processes in complex molecular environments. Using a method analogous to the notion of Debye length and thence the electrical double layer, we here identify a pair of characteristic length scales (longitudinal and the transverse), which, being wave vector and frequency dependent, manifestly exhibit nontrivial fluctuations in space-time. As a unifying theme, we advance a quantity (inverse length dimension), g_{scat}^{(a)}, which embodies all dynamical interactions, through various quantum scattering lengths, relevant to molecular species a, and the analytical behavior which helps us to rationalize the properties of strong electrolytes, including anomalies, in all concentration regimes. As an example, the behavior of g_{scat}^{(a)} in the high-concentration regime explains the anomalous increase of the Debye length with concentration, as seen in a recent experiment on electrolyte solutions. We also put forth an extension of the standard diffusion equation, which manifestly incorporates the effects arising from the underlying microscopic collisions among constituent molecular species. Furthermore, we show a nontrivial connection between the current-voltage characteristics of electrolyte solutions and the Landauer's approach to electrical conduction in mesoscopic solids and thereby establish a definite conceptual bridge between the two disjoint subjects. For numerical insight, we present results on the aqueous solution of KCl as an example of strong electrolyte, and the transport (conduction as well as diffusion) of K^{+} ions in water, as an example of ion transport across the voltage-gated channels in biological cells.

UltraPse: A Universal and Extensible Software Platform for Representing Biological Sequences.

PubMed

Du, Pu-Feng; Zhao, Wei; Miao, Yang-Yang; Wei, Le-Yi; Wang, Likun

2017-11-14

With the avalanche of biological sequences in public databases, one of the most challenging problems in computational biology is to predict their biological functions and cellular attributes. Most of the existing prediction algorithms can only handle fixed-length numerical vectors. Therefore, it is important to be able to represent biological sequences with various lengths using fixed-length numerical vectors. Although several algorithms, as well as software implementations, have been developed to address this problem, these existing programs can only provide a fixed number of representation modes. Every time a new sequence representation mode is developed, a new program will be needed. In this paper, we propose the UltraPse as a universal software platform for this problem. The function of the UltraPse is not only to generate various existing sequence representation modes, but also to simplify all future programming works in developing novel representation modes. The extensibility of UltraPse is particularly enhanced. It allows the users to define their own representation mode, their own physicochemical properties, or even their own types of biological sequences. Moreover, UltraPse is also the fastest software of its kind. The source code package, as well as the executables for both Linux and Windows platforms, can be downloaded from the GitHub repository.

Correlation between solar flare productivity and photospheric vector magnetic fields

NASA Astrophysics Data System (ADS)

Cui, Yanmei; Wang, Huaning

2008-11-01

Studying the statistical correlation between the solar flare productivity and photospheric magnetic fields is very important and necessary. It is helpful to set up a practical flare forecast model based on magnetic properties and improve the physical understanding of solar flare eruptions. In the previous study ([Cui, Y.M., Li, R., Zhang, L.Y., He, Y.L., Wang, H.N. Correlation between solar flare productivity and photospheric magnetic field properties 1. Maximum horizontal gradient, length of neutral line, number of singular points. Sol. Phys. 237, 45 59, 2006]; from now on we refer to this paper as ‘Paper I’), three measures of the maximum horizontal gradient, the length of the neutral line, and the number of singular points are computed from 23990 SOHO/MDI longitudinal magnetograms. The statistical relationship between the solar flare productivity and these three measures is well fitted with sigmoid functions. In the current work, the three measures of the length of strong-shear neutral line, total unsigned current, and total unsigned current helicity are computed from 1353 vector magnetograms observed at Huairou Solar Observing Station. The relationship between the solar flare productivity and the current three measures can also be well fitted with sigmoid functions. These results are expected to be beneficial to future operational flare forecasting models.

Proximity effects in ferromagnet-superconductor structures

NASA Astrophysics Data System (ADS)

Halterman, Klaus Byron

I present an extensive theoretical investigation of the proximity effects that occur in ferromagnet/superconductor systems. I use a numerical method to solve self consistently the Bogoliubov-de Gennes equations in the continuum. I obtain the pair amplitude and the local density of states (DOS), and use these results to extract the relevant lengths characterizing both the leakage of superconductivity into the magnet and to study spin splitting induced in the superconductor. These phenomena are investigated as a function of parameters such as temperature, magnet polarization, interfacial scattering, sample size and Fermi wave vector mismatch, all of which turn out to have an important influence on the results. These comprehensive results should help characterize and analyze future data, and are shown to be in agreement with existing experiments.

Effect of engine shroud configuration on the static aerodynamic characteristics of a 0.00563 scale 142-inch diameter solid rocket booster (SA10F)

NASA Technical Reports Server (NTRS)

Johnson, J. D.; Braddock, W. F.

1974-01-01

A test of a 0.563 percent scale space shuttle Solid Rocket Booster (SRB) model, MSFC Model 449, was conducted in a trisonic wind tunnel. Test Mach numbers were 0.4, 0.6, 0.9, 1.2, 1.96, 3.48, 4.0, 4.45, and 4.96. Test angles-of-attack ranged from minus 10 degrees to 190 degrees. Test Reynolds numbers ranged from 3.0 million per foot to 8.6 million per foot. Test roll angles were 0, 11.25, 22.5, 45, and 90 degrees. In addition to the static stability evaluation of the primary SRB configuration, five parametric investigations were made: (1) effect of Reynolds number, (2) effect of engine shroud flare angle, (3) effect of engine shroud length, (4) effect of engine shroud strakes, and (5) effect of engine shroud strakes and trust vector control bottles.

Gene Transduction and Cell Entry Pathway of Fiber-Modified Adenovirus Type 5 Vectors Carrying Novel Endocytic Peptide Ligands Selected on Human Tracheal Glandular Cells

PubMed Central

Gaden, Florence; Franqueville, Laure; Magnusson, Maria K.; Hong, Saw See; Merten, Marc D.; Lindholm, Leif; Boulanger, Pierre

2004-01-01

Monolayers of cystic fibrosis transmembrane conductance regulator (CFTR)-deficient human tracheal glandular cells (CF-KM4) were subjected to phage biopanning, and cell-internalized phages were isolated and sequenced, in order to identify CF-KM4-specific peptide ligands that would confer upon adenovirus type 5 (Ad5) vector a novel cell target specificity and/or higher efficiency of gene delivery into airway cells of patients with cystic fibrosis (CF). Three different ligands, corresponding to prototypes of the most represented families of phagotopes recovered from intracellular phages, were designed and individually inserted into Ad5-green fluorescent protein (GFP) (AdGFP) vectors at the extremities of short fiber shafts (seven repeats [R7]) terminated by scissile knobs. Only one vector, carrying the decapeptide GHPRQMSHVY (abbreviated as QM10), showed an enhanced gene transduction of CF-KM4 cells compared to control nonliganded vector with fibers of the same length (AdGFP-R7-knob). The enhancement in gene transfer efficiency was not specific to CF-KM4 cells but was observed in other mammalian cell lines tested. The QM10-liganded vector was referred to as AdGFP-QM10-knob in its knobbed version and as AdGFP-QM10 in its proteolytically deknobbed version. AdGFP-QM10 was found to transduce cells with a higher efficiency than its knob-bearing version, AdGFP-QM10-knob. Consistent with this, competition experiments indicated that the presence of knob domains was not an absolute requirement for cell attachment of the QM10-liganded vector and that the knobless AdGFP-QM10 used alternative cell-binding domains on its capsid, including penton base capsomer, via a site(s) different from its RGD motifs. The QM10-mediated effect on gene transduction seemed to take place at the step of endocytosis in both quantitative and qualitative manners. Virions of AdGFP-QM10 were endocytosed in higher numbers than virions of the control vector and were directed to a compartment different from the early endosomes targeted by members of species C Ad. AdGFP-QM10 was found to accumulate in late endosomal and low-pH compartments, suggesting that QM10 acted as an endocytic ligand of the lysosomal pathway. These results validated the concept of detargeting and retargeting Ad vectors via our deknobbing system and redirecting Ad vectors to an alternative endocytic pathway via a peptide ligand inserted in the fiber shaft domain. PMID:15194799

Achievement of needle-like focus by engineering radial-variant vector fields.

PubMed

Gu, Bing; Wu, Jia-Lu; Pan, Yang; Cui, Yiping

2013-12-16

We present and demonstrate a novel method for engineering the radial-variant polarization on the incident field to achieve a needle of transversally polarized field without any pupil filters. We generate a new kind of localized linearly-polarized vector fields with distributions of states of polarization (SoPs) describing by the radius to the power p and explore its tight focusing, nonparaxial focusing, and paraxial focusing properties. By tuning the power p, we obtain the needle-like focal field with hybrid SoPs and give the formula for describing the length of the needle. Experimentally, we systematically investigate both the intensity distributions and the polarization evolution of the optical needle by paraxial focusing the generated vector field. Such an optical needle, which enhances the light-matter interaction, has intriguing applications in optical microma-chining and nonlinear optics.

The effect of larval nutritional deprivation on the life history and DDT resistance phenotype in laboratory strains of the malaria vector Anopheles arabiensis

PubMed Central

2013-01-01

Background Anopheles arabiensis is a major malaria vector in Africa. It thrives in agricultural areas and has been associated with increased malaria incidence in areas under rice and maize cultivation. This effect may be due to increased adult size and abundance as a consequence of optimal larval nutrition. The aim of this study was to examine the effect of larval nutrition on the life history and expression of insecticide resistance in adults of laboratory reared An. arabiensis. Methods Larvae drawn from an insecticide susceptible An. arabiensis strain (SENN) as well as a DDT-resistant strain (SENN-DDT) were subjected to three fasting regimes: 1 mg of food per larva offered once per day, once every second day and once every third day. Control cohorts included larvae offered 1 mg food thrice per day. The rate of larval development was compared between matched cohorts from each strain as well as between fasted larvae and their respective controls. The expression of DDT resistance/tolerance in adults was compared between the starved cohorts and their controls by strain. Factors potentially affecting variation in DDT resistance/tolerance were examined including: adult body size (wing length), knock-down resistance (kdr) status and levels of detoxification enzyme activity. Results and conclusion Anopheles arabiensis larval development is prolonged by nutrient deprivation and adults that eclose from starved larvae are smaller and less tolerant to DDT intoxication. This effect on DDT tolerance in adults is also associated with reduced detoxification enzyme activity. Conversely, well fed larvae develop comparatively quickly into large, more DDT tolerant (SENN) or resistant (SENN-DDT) adults. This is important in those instances where cereal farming is associated with increased An. arabiensis transmitted malaria incidence, because large adult females with high teneral reserves and decreased susceptibility to insecticide intoxication may also prove to be more efficient malaria vectors. In general, larval nutrient deprivation in An. arabiensis has important implications for subsequent adults in terms of their size and relative insecticide susceptibility, which may in turn impact on their malaria vector capacity in areas where insecticide based control measures are in place. PMID:23368928

Crossovers from excitons to plasmons in narrow-gap carbon nanotubes

NASA Astrophysics Data System (ADS)

Uryu, Seiji

2018-06-01

Plasmons and excitons, bound states of electrons and holes, are collective charge excitations in solids. In this study, we numerically show that in most metallic carbon nanotubes, which are called narrow-gap carbon nanotubes, excitons cross over to plasmons as the wave vector increases. This indicates that resonance with the excitons changes to that with the plasmons by changing the nanotube length, which can explain the origin of observed peaks in the terahertz or far-infrared region in the optical absorption spectra of metallic carbon nanotubes. In the crossovers from excitons to plasmons, a depolarization effect on the many-body wave functions of the plasmons and excitons is clarified.

Aztec user`s guide. Version 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hutchinson, S.A.; Shadid, J.N.; Tuminaro, R.S.

1995-10-01

Aztec is an iterative library that greatly simplifies the parallelization process when solving the linear systems of equations Ax = b where A is a user supplied n x n sparse matrix, b is a user supplied vector of length n and x is a vector of length n to be computed. Aztec is intended as a software tool for users who want to avoid cumbersome parallel programming details but who have large sparse linear systems which require an efficiently utilized parallel processing system. A collection of data transformation tools are provided that allow for easy creation of distributed sparsemore » unstructured matrices for parallel solution. Once the distributed matrix is created, computation can be performed on any of the parallel machines running Aztec: nCUBE 2, IBM SP2 and Intel Paragon, MPI platforms as well as standard serial and vector platforms. Aztec includes a number of Krylov iterative methods such as conjugate gradient (CG), generalized minimum residual (GMRES) and stabilized biconjugate gradient (BICGSTAB) to solve systems of equations. These Krylov methods are used in conjunction with various preconditioners such as polynomial or domain decomposition methods using LU or incomplete LU factorizations within subdomains. Although the matrix A can be general, the package has been designed for matrices arising from the approximation of partial differential equations (PDEs). In particular, the Aztec package is oriented toward systems arising from PDE applications.« less

Ceramic components manufacturing by selective laser sintering

NASA Astrophysics Data System (ADS)

Bertrand, Ph.; Bayle, F.; Combe, C.; Goeuriot, P.; Smurov, I.

2007-12-01

In the present paper, technology of selective laser sintering/melting is applied to manufacture net shaped objects from pure yttria-zirconia powders. Experiments are carried out on Phenix Systems PM100 machine with 50 W fibre laser. Powder is spread by a roller over the surface of 100 mm diameter alumina cylinder. Design of experiments is applied to identify influent process parameters (powder characteristics, powder layering and laser manufacturing strategy) to obtain high-quality ceramic components (density and micro-structure). The influence of the yttria-zirconia particle size and morphology onto powder layering process is analysed. The influence of the powder layer thickness on laser sintering/melting is studied for different laser beam velocity V ( V = 1250-2000 mm/s), defocalisation (-6 to 12 mm), distance between two neighbour melted lines (so-called "vectors") (20-40 μm), vector length and temperature in the furnace. The powder bed density before laser sintering/melting also has significant influence on the manufactured samples density. Different manufacturing strategies are applied and compared: (a) different laser beam scanning paths to fill the sliced surfaces of the manufactured object, (b) variation of vector length (c) different strategies of powder layering, (d) temperature in the furnace and (e) post heat treatment in conventional furnace. Performance and limitations of different strategies are analysed applying the following criteria: geometrical accuracy of the manufactured samples, porosity. The process stability is proved by fabrication of 1 cm 3 volume cube.

Improved Dual-Luciferase Reporter Assays for Nuclear Receptors

PubMed Central

Paguio, Aileen; Stecha, Pete; Wood, Keith V; Fan, Frank

2010-01-01

Nuclear receptors play important roles in many cellular functions through control of gene transcription. It is also a large target class for drug discovery. Luciferase reporter assays are frequently used to study nuclear receptor function because of their wide dynamic range, low endogenous activity, and ease of use. Recent improvements of luciferase genes and vectors have further enhanced their utilities. Here we applied these improvements to two reporter formats for studying nuclear receptors. The first assay contains a Murine Mammary Tumor Virus promoter upstream of a destabilized luciferase. The presence of response elements for nuclear hormone receptor in this promoter allows the studies of endogenous and/or exogenous full length receptors. The second assay contains a ligand binding domain (LBD) of a nuclear receptor fused to the GAL4 DNA binding domain (DBD) on one vector and multiple Gal4 Upstream Activator Sequences (UAS) upstream of luciferase reporter on another vector. We showed that codon optimization of luciferase reporter genes increased expression levels in conjunction with the incorporation of protein destabilizing sequences into luciferase led to a larger assay dynamic range in both formats. The optimum number of UAS to generate the best response was determined. The expression vector for nuclear receptor LBD/GAL4 DBD fusion also constitutively expresses a Renilla luciferase-neoR fusion protein, which provides selection capability (G418 resistance, neoR) as well as an internal control (Renilla luciferase). This dual-luciferase format allowed detecting compound cytotoxicity or off-target change in expression during drug screening, therefore improved data quality. These luciferase reporter assays provided better research and drug discovery tools for studying the functions of full length nuclear receptors and ligand binding domains. PMID:21687560

Mechanisms of inhibition of growth of human pancreatic carcinoma implanted in nude mice by somatostatin receptor subtype 2.

PubMed

Kumar, Manoj; Liu, Zheng-Ren; Thapa, Laxmi; Wang, Da-Yu; Tian, Rui; Qin, Ren-Yi

2004-08-01

Several studies reported that somatostatin receptor subtypes, especially subtype 2 (SSTR2), exerted their cytostatic and/or cytotoxic effects on various types of tumors. The aim of this study was to investigate the antitumor effect of SSTR2 gene transfer to the pancreatic cancer cell line PC-3 and the mechanisms involved in this effect. The full-length human SSTR2 cDNA was introduced into pancreatic cancer cell line PC-3 by lipofectamine-mediated transfection; positive clones were screened by G418, and stable expression of SSTR2 was detected by the immunohistochemical SABC method and RT-PCR. Athymic mice were separately xenografted with SSTR2-expressing cells (experimental group), vector control, and mock control cells. TUNEL assay was used to determine the apoptotic index (AI) in the tumors of these groups. The immunohistochemical SP method was used to determine expression of apoptosis-regulating genes Bcl-2 and Bax and re-expression of SSTR2 and to assess intratumoral microvessel density (MVD). Moreover, tumor volume and weight were compared among these 3 groups. Restoration of SSTR2 was observed in the experimental group both in vitro and in vivo. The AI was significantly higher in the experimental group (3.39 +/- 0.84%) compared with that in the vector control (0.69 +/- 0.08%) and mock control (0.68 +/- 0.09%) (P < 0.05). MVD was significantly lower in the experimental group (6.30 +/- 1.71) than that in the vector control (12.64 +/- 1.69) and mock control (13.50 +/- 1.86) (P < 0.05). Furthermore, a significant decrease in Bcl-2 and increase in Bax protein expression were detected in the experimental group compared with the vector control and mock control (P < 0.05). A significant negative correlation of protein expression between Bcl-2/Bax ratio and SSTR2 was observed in these tumors (P < 0.05). Tumor volume and weight were significantly decreased in the experimental group compared with the vector control and mock control (P < 0.05) groups. However, no significant differences were observed between the vector control and mock control (P > 0.05). Re-expression of the SSTR2 gene, the expression of which is frequently lost in human pancreatic adenocarcinoma, induces apoptosis, which may be mediated via down-regulation of Bcl-2 and up-regulation of Bax (alteration of Bcl-2/Bax ratio) and inhibits tumor angiogenesis in pancreatic carcinoma, resulting in inhibition of tumor growth.

Disease Vector Ecology Profile: Somalia. Fourth Edition

DTIC Science & Technology

1993-09-15

excrement, decaying plant material and other debris). Eggs hatch in 1-3 weeks. Larval stage 4-6 weeks. Often associated with termite mounds . Biting...lengths of up to 14 feet. It occurs primarily in the forest and open bush country of northern Somalia, where it is found in tree stumps, termite mounds

Predictive Features of a Cockpit Traffic Display: A Workload Assessment

NASA Technical Reports Server (NTRS)

Wickens, Christopher D.; Morphew, Ephimia

1997-01-01

Eighteen pilots flew a series of traffic avoidance maneuvers in an experiment designed to assess the support offered and workload imposed by different levels of traffic display information in a free flight simulation. Three display prototypes were compared which differed in traffic information provided. A BASELINE (BL) display provided current and (2nd order) predicted information regarding ownship and current information of an intruder aircraft, represented on lateral and vertical displays in a coplanar suite. An INTRUDER PREDICTOR (IP) display, augmented the baseline display by providing lateral and vertical prediction of the intruder aircraft. A THREAT VECTOR (TV) display added to the IP display a vector that indicates the direction from ownship to the intruder at the predicted point of closest contact (POCC). The length of the vector corresponds to the radius of the protected zone, and the distance of the intersection of the vector with ownship predictor, corresponds to the time available till POCC or loss of separation. Pilots time shared the traffic avoidance task with a secondary task requiring them to monitor the top of the display for faint targets. This task simulated the visual demands of out-of-cockpit scanning, and hence was used to estimate the head-down time required by the different display formats. The results revealed that both display augmentations improved performance (safety) as assessed by predicted and actual loss of separation (i.e., penetration of the protected zone). Both enhancements also reduced workload, as assessed by the NASA TLX scale. The intruder predictor display produced these benefits with no substantial impact on the qualitative nature of the avoidance maneuvers that were selected. The threat vector produced the safety benefits by inducing a greater degree of (effective) lateral maneuvering, thus partially offsetting the benefits of reduced workload. The three displays did not differ in terms of their effect on performance of the monitoring task, used to infer head-down time, nor in the extent of vertical or airspeed maneuvering. The results are discussed in terms of their implications for 19 cognitive engineering design features.

Static investigation of a two-dimensional convergent-divergent exhaust nozzle with multiaxis thrust-vectoring capability

NASA Technical Reports Server (NTRS)

Taylor, John G.

1990-01-01

An investigation was conducted in the Static Test Facility of the NASA Langley 16-Foot Transonic Tunnel to determine the internal performance of two-dimensional convergent-divergent nozzles designed to have simultaneous pitch and yaw thrust vectoring capability. This concept utilized divergent flap rotation of thrust vectoring in the pitch plane and deflection of flat yaw flaps hinged at the end of the sidewalls for yaw thrust vectoring. The hinge location of the yaw flaps was varied at four positions from the nozzle exit plane to the throat plane. The yaw flaps were designed to contain the flow laterally independent of power setting. In order to eliminate any physical interference between the yaw flap deflected into the exhaust stream and the divergent flaps, the downstream corners of both upper and lower divergent flaps were cut off to allow for up to 30 deg of yaw flap deflection. The impact of varying the nozzle pitch vector angle, throat area, yaw flap hinge location, yaw flap length, and yaw flap deflection angle on nozzle internal performance characteristics, was studied. High-pressure air was used to simulate jet exhaust at nozzle pressure ratios up to 7.0. Static results indicate that configurations with the yaw flap hinge located upstream of the exit plane provide relatively high levels of thrust vectoring efficiency without causing large losses in resultant thrust ratio. Therefore, these configurations represent a viable concept for providing simultaneous pitch and yaw thrust vectoring.

The Unified Floating Point Vector Coprocessor for Reconfigurable Hardware

NASA Astrophysics Data System (ADS)

Kathiara, Jainik

There has been an increased interest recently in using embedded cores on FPGAs. Many of the applications that make use of these cores have floating point operations. Due to the complexity and expense of floating point hardware, these algorithms are usually converted to fixed point operations or implemented using floating-point emulation in software. As the technology advances, more and more homogeneous computational resources and fixed function embedded blocks are added to FPGAs and hence implementation of floating point hardware becomes a feasible option. In this research we have implemented a high performance, autonomous floating point vector Coprocessor (FPVC) that works independently within an embedded processor system. We have presented a unified approach to vector and scalar computation, using a single register file for both scalar operands and vector elements. The Hybrid vector/SIMD computational model of FPVC results in greater overall performance for most applications along with improved peak performance compared to other approaches. By parameterizing vector length and the number of vector lanes, we can design an application specific FPVC and take optimal advantage of the FPGA fabric. For this research we have also initiated designing a software library for various computational kernels, each of which adapts FPVC's configuration and provide maximal performance. The kernels implemented are from the area of linear algebra and include matrix multiplication and QR and Cholesky decomposition. We have demonstrated the operation of FPVC on a Xilinx Virtex 5 using the embedded PowerPC.

Analyzing seasonal patterns of wildfire exposure factors in Sardinia, Italy.

PubMed

Salis, Michele; Ager, Alan A; Alcasena, Fermin J; Arca, Bachisio; Finney, Mark A; Pellizzaro, Grazia; Spano, Donatella

2015-01-01

In this paper, we applied landscape scale wildfire simulation modeling to explore the spatiotemporal patterns of wildfire likelihood and intensity in the island of Sardinia (Italy). We also performed wildfire exposure analysis for selected highly valued resources on the island to identify areas characterized by high risk. We observed substantial variation in burn probability, fire size, and flame length among time periods within the fire season, which starts in early June and ends in late September. Peak burn probability and flame length were observed in late July. We found that patterns of wildfire likelihood and intensity were mainly related to spatiotemporal variation in ignition locations, fuel moisture, and wind vectors. Our modeling approach allowed consideration of historical patterns of winds, ignition locations, and live and dead fuel moisture on fire exposure factors. The methodology proposed can be useful for analyzing potential wildfire risk and effects at landscape scale, evaluating historical changes and future trends in wildfire exposure, as well as for addressing and informing fuel management and risk mitigation issues.

PSI:Biology-Materials Repository: A Biologist’s Resource for Protein Expression Plasmids

PubMed Central

Cormier, Catherine Y.; Park, Jin G.; Fiacco, Michael; Steel, Jason; Hunter, Preston; Kramer, Jason; Singla, Rajeev; LaBaer, Joshua

2011-01-01

The Protein Structure Initiative:Biology-Materials Repository (PSI:Biology-MR; MR; http://psimr.asu.edu) sequence-verifies, annotates, stores, and distributes the protein expression plasmids and vectors created by the Protein Structure Initiative (PSI). The MR has developed an informatics and sample processing pipeline that manages this process for thousands of samples per month from nearly a dozen PSI centers. DNASU (http://dnasu.asu.edu), a freely searchable database, stores the plasmid annotations, which include the full-length sequence, vector information, and associated publications for over 130,000 plasmids created by our laboratory, by the PSI and other consortia, and by individual laboratories for distribution to researchers worldwide. Each plasmid links to external resources, including the PSI Structural Biology Knowledgebase (http://sbkb.org), which facilitates cross-referencing of a particular plasmid to additional protein annotations and experimental data. To expedite and simplify plasmid requests, the MR uses an expedited material transfer agreement (EP-MTA) network, where researchers from network institutions can order and receive PSI plasmids without institutional delays. Currently over 39,000 protein expression plasmids and 78 empty vectors from the PSI are available upon request from DNASU. Overall, the MR’s repository of expression-ready plasmids, its automated pipeline, and the rapid process for receiving and distributing these plasmids more effectively allows the research community to dissect the biological function of proteins whose structures have been studied by the PSI. PMID:21360289

[Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].

PubMed

Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing

2010-10-01

This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.

Scalar and vector Keldysh models in the time domain

NASA Astrophysics Data System (ADS)

Kiselev, M. N.; Kikoin, K. A.

2009-04-01

The exactly solvable Keldysh model of disordered electron system in a random scattering field with extremely long correlation length is converted to the time-dependent model with extremely long relaxation. The dynamical problem is solved for the ensemble of two-level systems (TLS) with fluctuating well depths having the discrete Z 2 symmetry. It is shown also that the symmetric TLS with fluctuating barrier transparency may be described in terms of the vector Keldysh model with dime-dependent random planar rotations in xy plane having continuous SO(2) symmetry. Application of this model to description of dynamic fluctuations in quantum dots and optical lattices is discussed.

Q-plates as higher order polarization controllers for orbital angular momentum modes of fiber.

PubMed

Gregg, P; Mirhosseini, M; Rubano, A; Marrucci, L; Karimi, E; Boyd, R W; Ramachandran, S

2015-04-15

We demonstrate that a |q|=1/2 plate, in conjunction with appropriate polarization optics, can selectively and switchably excite all linear combinations of the first radial mode order |l|=1 orbital angular momentum (OAM) fiber modes. This enables full mapping of free-space polarization states onto fiber vector modes, including the radially (TM) and azimuthally polarized (TE) modes. The setup requires few optical components and can yield mode purities as high as ∼30  dB. Additionally, just as a conventional fiber polarization controller creates arbitrary elliptical polarization states to counteract fiber birefringence and yield desired polarizations at the output of a single-mode fiber, q-plates disentangle degenerate state mixing effects between fiber OAM states to yield pure states, even after long-length fiber propagation. We thus demonstrate the ability to switch dynamically, potentially at ∼GHz rates, between OAM modes, or create desired linear combinations of them. We envision applications in fiber-based lasers employing vector or OAM mode outputs, as well as communications networking schemes exploiting spatial modes for higher dimensional encoding.

Monitoring Deformation in Graphene Through Hyperspectral Synchrotron Spectroscopy to Inform Fabrication

DOE Office of Scientific and Technical Information (OSTI.GOV)

Winter, Allen Douglas; Rojas, Wudmir Y.; Williams, Adrienne D.

The promise from graphene to produce devices with high mobilities and detectors with fast response times is truncated in practice by strain and deformation originating during growth and subsequent processing. This work describes effects from graphene growth, multiple layer transfer, and substrate termination on out of plane deformation, critical to device performance. Synchrotron spectroscopy data was acquired with a state-of-the-art hyperspectral large-area detector to describe growth and processing with molecular sensitivity at wafer length scales. A study of methodologies used in data analysis discouraged dichroic ratio approaches in favor of orbital vector approximations and data mining algorithms. Orbital vector methodsmore » provide a physical insight into mobility-detrimental rippling by identifying ripple frequency as main actor, rather than intensity; which was confirmed by data mining algorithms, and in good agreement with electron scattering theories of corrugation in graphene. This work paves the way to efficient information from mechanical properties in graphene in a high throughput mode throughout growth and processing in a materials by design approach.« less

A dual host vector for Fab phage display and expression of native IgG in mammalian cells.

PubMed

Tesar, Devin; Hötzel, Isidro

2013-10-01

A significant bottleneck in antibody discovery by phage display is the transfer of immunoglobulin variable regions from phage clones to vectors that express immunoglobulin G (IgG) in mammalian cells for screening. Here, we describe a novel phagemid vector for Fab phage display that allows expression of native IgG in mammalian cells without sub-cloning. The vector uses an optimized mammalian signal sequence that drives robust expression of Fab fragments fused to an M13 phage coat protein in Escherichia coli and IgG expression in mammalian cells. To allow the expression of Fab fragments fused to a phage coat protein in E.coli and full-length IgG in mammalian cells from the same vector without sub-cloning, the sequence encoding the phage coat protein was embedded in an optimized synthetic intron within the immunoglobulin heavy chain gene. This intron is removed from transcripts in mammalian cells by RNA splicing. Using this vector, we constructed a synthetic Fab phage display library with diversity in the heavy chain only and selected for clones binding different antigens. Co-transfection of mammalian cells with DNA from individual phage clones and a plasmid expressing the invariant light chain resulted in the expression of native IgG that was used to assay affinity, ligand blocking activity and specificity.

A novel representation for apoptosis protein subcellular localization prediction using support vector machine.

PubMed

Zhang, Li; Liao, Bo; Li, Dachao; Zhu, Wen

2009-07-21

Apoptosis, or programmed cell death, plays an important role in development of an organism. Obtaining information on subcellular location of apoptosis proteins is very helpful to understand the apoptosis mechanism. In this paper, based on the concept that the position distribution information of amino acids is closely related with the structure and function of proteins, we introduce the concept of distance frequency [Matsuda, S., Vert, J.P., Ueda, N., Toh, H., Akutsu, T., 2005. A novel representation of protein sequences for prediction of subcellular location using support vector machines. Protein Sci. 14, 2804-2813] and propose a novel way to calculate distance frequencies. In order to calculate the local features, each protein sequence is separated into p parts with the same length in our paper. Then we use the novel representation of protein sequences and adopt support vector machine to predict subcellular location. The overall prediction accuracy is significantly improved by jackknife test.

Meissner effect in normal-superconducting proximity-contact double layers

NASA Astrophysics Data System (ADS)

Higashitani, Seiji; Nagai, Katsuhiko

1995-02-01

The Meissner effect in normal-superconducting proximity-contact double layers is discussed in the clean limit. The diamagnetic current is calculated using the quasi-classical Green's function. We obtain the quasi-classical Green's function linear in the vector potential in the proximity-contact double layers with a finite reflection coefficient at the interface. It is found that the diamagnetic current in the clean normal layer is constant in space, therefore, the magnetic field linearly decreases in the clean normal layer. We give an explicit expression for the screening length in the clean normal layer and study its temperature dependence. We show that the temperature dependence in the clean normal layer is considerably different from that in the dirty normal layer and agrees with a recent experiment in Au-Nb system.

Transport properties of random media: A new effective medium theory

DOE Office of Scientific and Technical Information (OSTI.GOV)

Busch, K.; Soukoulis, C.M.

We present a new method for efficient, accurate calculations of transport properties of random media. It is based on the principle that the wave energy density should be uniform when averaged over length scales larger than the size of the scatterers. This scheme captures the effects of resonant scattering of the individual scatterer exactly, as well as the multiple scattering in a mean-field sense. It has been successfully applied to both ``scalar`` and ``vector`` classical wave calculations. Results for the energy transport velocity are in agreement with experiment. This approach is of general use and can be easily extended tomore » treat different types of wave propagation in random media. {copyright} {ital 1995} {ital The} {ital American} {ital Physical} {ital Society}.« less

Deriving Stopping Rules for Multidimensional Computerized Adaptive Testing

ERIC Educational Resources Information Center

Wang, Chun; Chang, Hua-Hua; Boughton, Keith A.

2013-01-01

Multidimensional computerized adaptive testing (MCAT) is able to provide a vector of ability estimates for each examinee, which could be used to provide a more informative profile of an examinee's performance. The current literature on MCAT focuses on the fixed-length tests, which can generate less accurate results for those examinees whose…

Climate change velocity underestimates climate change exposure in mountainous regions

Treesearch

Solomon Z. Dobrowski; Sean A. Parks

2016-01-01

Climate change velocity is a vector depiction of the rate of climate displacement used for assessing climate change impacts. Interpreting velocity requires an assumption that climate trajectory length is proportional to climate change exposure; longer paths suggest greater exposure. However, distance is an imperfect measure of exposure because it does not...

Study of the correlation parameters of the surface structure of disordered semiconductors by the two-dimensional DFA and average mutual information methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alpatov, A. V.; Vikhrov, S. P.; Rybina, N. V., E-mail: pgnv@mail.ru

The processes of self-organization of the surface structure of hydrogenated amorphous silicon are studied by the methods of fluctuation analysis and average mutual information on the basis of atomic-force-microscopy images of the surface. It is found that all of the structures can be characterized by a correlation vector and represented as a superposition of harmonic components and noise. It is shown that, under variations in the technological parameters of the production of a-Si:H films, the correlation properties of their structure vary as well. As the substrate temperature is increased, the formation of structural irregularities becomes less efficient; in this case,more » the length of the correlation vector and the degree of structural ordering increase. It is shown that the procedure based on the method of fluctuation analysis in combination with the method of average mutual information provides a means for studying the self-organization processes in any structures on different length scales.« less

Vectorial structures of linear-polarized Butterfly-Gauss vortex beams in the far zone

NASA Astrophysics Data System (ADS)

Cheng, Ke; Zhou, Yan; Lu, Gang; Yao, Na; Zhong, Xianqiong

2018-05-01

By introducing the Butterfly catastrophe to optics, the far-zone vectorial structures of Butterfly-Gauss beam with vortex and non-vortex are studied using the angular spectrum representation and stationary phase method. The influence of topological charge, linear-polarized angle, off-axis distance and scaling length on the far-zone vectorial structures, especially in the Poynting vector and angular momentum density of the corresponding beam is emphasized. The results show that the embedded optical vortex at source plane lead to special dark zones in the far zone, where the number of dark zone equals the absolute value of topological charge of optical vortex. Furthermore, the symmetry and direction of the special dark zones can be controlled by off-axis distance and scaling length, respectively. The linear-polarized angle adjusts only the Poynting vectors of TE and TM terms, but it does not affect those of whole beam. Finally, the vectorial expressions also indicate that the total angular momentum density is certainly zero owing to the far-zone stable structures rather than rotation behaviors.

Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

PubMed Central

Yoon, Ju-Yeon; Cho, In-Sook; Choi, Gug-Seoun; Choi, Seung-Kook

2014-01-01

Chrysanthemum stunt viroid (CSVd), a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1) were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants. PMID:25288987

Genotype and biotype of invasive Anopheles stephensi in Mannar Island of Sri Lanka.

PubMed

Surendran, Sinnathamby N; Sivabalakrishnan, Kokila; Gajapathy, Kanapathy; Arthiyan, Sivasingham; Jayadas, Tibutius T P; Karvannan, Kalingarajah; Raveendran, Selvarajah; Parakrama Karunaratne, S H P; Ramasamy, Ranjan

2018-01-03

Anopheles stephensi, the major vector of urban malaria in India, was recently detected for the first time in Sri Lanka in Mannar Island on the northwestern coast. Since there are different biotypes of An. stephensi with different vector capacities in India, a study was undertaken to further characterise the genotype and biotype of An. stephensi in Mannar Island. Mosquito larvae were collected in Pesalai village in Mannar and maintained in the insectary until adulthood. Adult An. stephensi were identified morphologically using published keys. Identified adult An. stephensi were molecularly characterized using two mitochondrial (cox1 and cytb) and one nuclear (ITS2) markers. Their PCR-amplified target fragments were sequenced and checked against available sequences in GenBank for phylogenetic analysis. The average spiracular and thoracic lengths and the spiracular index were determined to identify biotypes based on corresponding indices for Indian An. stephensi. All DNA sequences for the Mannar samples matched reported sequences for An. stephensi from the Middle East and India. However, a single nucleotide variation in the cox1 sequence suggested an amino acid change from valine to methionine in the cox1 protein in Sri Lankan An. stephensi. Morphological data was consistent with the presence of the Indian urban vector An. stephensi type-form in Sri Lanka. The present study provides a more detailed molecular characterization of An. stephensi and suggests the presence of the type-form of the vector for the first time in Sri Lanka. The single mutation in the cox1 gene may be indicative of a founder effect causing the initial diversification of An. stephensi in Sri Lanka from the Indian form. The distribution of the potent urban vector An. stephensi type-form needs to be established by studies throughout the island as its spread adds to the challenge of maintaining the country's malaria-free status.

Semiflexible polymer dynamics with a bead-spring model

NASA Astrophysics Data System (ADS)

Barkema, Gerard T.; Panja, Debabrata; van Leeuwen, J. M. J.

2014-11-01

We study the dynamical properties of semiflexible polymers with a recently introduced bead-spring model. We focus on double-stranded DNA (dsDNA). The two parameters of the model, T* and ν, are chosen to match its experimental force-extension curve. In comparison to its groundstate value, the bead-spring Hamiltonian is approximated in the first order by the Hessian that is quadratic in the bead positions. The eigenmodes of the Hessian provide the longitudinal (stretching) and transverse (bending) eigenmodes of the polymer, and the corresponding eigenvalues match well with the established phenomenology of semiflexible polymers. At the Hessian approximation of the Hamiltonian, the polymer dynamics is linear. Using the longitudinal and transverse eigenmodes, for the linearized problem, we obtain analytical expressions of (i) the autocorrelation function of the end-to-end vector, (ii) the autocorrelation function of a bond (i.e. a spring, or a tangent) vector at the middle of the chain, and (iii) the mean-square displacement of a tagged bead in the middle of the chain, as the sum over the contributions from the modes—the so-called ‘mode sums’. We also perform simulations with the full dynamics of the model. The simulations yield numerical values of the correlations functions (i-iii) that agree very well with the analytical expressions for the linearized dynamics. This does not however mean that the nonlinearities are not present. In fact, we also study the mean-square displacement of the longitudinal component of the end-to-end vector that showcases strong nonlinear effects in the polymer dynamics, and we identify at least an effective t7/8 power-law regime in its time-dependence. Nevertheless, in comparison to the full mean-square displacement of the end-to-end vector the nonlinear effects remain small at all times—it is in this sense we state that our results demonstrate that the linearized dynamics suffices for dsDNA fragments that are shorter than or comparable to the persistence length. Our results are consistent with those of the wormlike chain (WLC) model, the commonly used descriptive tool of semiflexible polymers.

Androgen receptor polyglutamine repeat length affects receptor activity and C2C12 cell development.

PubMed

Sheppard, Ryan L; Spangenburg, Espen E; Chin, Eva R; Roth, Stephen M

2011-10-20

Testosterone (T) has an anabolic effect on skeletal muscle and is believed to exert its local effects via the androgen receptor (AR). The AR harbors a polymorphic stretch of glutamine repeats demonstrated to inversely affect receptor transcriptional activity in prostate and kidney cells. The effects of AR glutamine repeat length on skeletal muscle are unknown. In this study we examined the effect of AR CAG repeat length on AR function in C2C12 cells. AR expression vectors harboring 14, 24, and 33 CAG repeats were used to assess AR transcriptional activity. C2C12 cell proliferation, differentiation, gene expression, myotube formation, and myonuclear fusion index were assessed. Transcriptional activity increased with increasing repeat length and in response to testosterone (AR14 = 3.91 ± 0.26, AR24 = 25.21 ± 1.72, AR33 = 36.08 ± 3.22 relative light units; P < 0.001). Ligand activation was increased for AR33 (2.10 ± 0.04) compared with AR14 (1.54 ± 0.09) and AR24 (1.57 ± 0.05, P < 0.001). AR mRNA expression was elevated in each stably transfected line. AR33 cell proliferation (20,512.3 ± 1,024.0) was decreased vs. AR14 (27,604.17 ± 1,425.3; P < 0.001) after 72 h. Decreased CK activity in AR14 cells (54.9 ± 2.9 units/μg protein) in comparison to AR33 (70.8 ± 8.1) (P < 0.05) was noted. The myonuclear fusion index was lower for AR14 (15.21 ± 3.24%) and AR33 (9.97 ± 3.14%) in comparison to WT (35.07 ± 5.60%, P < 0.001). AR14 and AR33 cells also displayed atypical myotube morphology. RT-PCR revealed genotype differences in myostatin and myogenin expression. We conclude that AR polyglutamine repeat length is directly associated with transcriptional activity and alters the growth and development of C2C12 cells. This polymorphism may contribute to the heritability of muscle mass in humans.

On the origin of Poincaré gauge gravity

NASA Astrophysics Data System (ADS)

Chkareuli, J. L.

2017-06-01

We argue that the origin of Poincaré gauge gravity (PGG) may be related to spontaneous violation of underlying spacetime symmetries involved and appearance of gauge fields as vector Goldstone bosons. In essence, we start with an arbitrary theory of some vector and fermion fields which possesses only global spacetime symmetries, such as Lorentz and translational invariance, in flat Minkowski space. The two vector field multiplets involved are assumed to belong, respectively, to the adjoint (Aμij) and vector (eμi) representations of the starting global Lorentz symmetry. We propose that these prototype vector fields are covariantly constrained, Aμij Aijμ = ±MA2 and eμi eiμ = ±Me2 , that causes a spontaneous violation of the accompanying global symmetries (MA,e are their presumed violation scales). It then follows that the only possible theory compatible with these length-preserving constraints is turned out to be the gauge invariant PGG, while the corresponding massless (pseudo)Goldstone modes are naturally collected in the emergent gauge fields of tetrads and spin-connections. In a minimal theory case being linear in a curvature we unavoidably come to the Einstein-Cartan theory. The extended theories with propagating spin-connection and tetrad modes are also considered and their possible unification with the Standard Model is briefly discussed.

Supercomputer implementation of finite element algorithms for high speed compressible flows

NASA Technical Reports Server (NTRS)

Thornton, E. A.; Ramakrishnan, R.

1986-01-01

Prediction of compressible flow phenomena using the finite element method is of recent origin and considerable interest. Two shock capturing finite element formulations for high speed compressible flows are described. A Taylor-Galerkin formulation uses a Taylor series expansion in time coupled with a Galerkin weighted residual statement. The Taylor-Galerkin algorithms use explicit artificial dissipation, and the performance of three dissipation models are compared. A Petrov-Galerkin algorithm has as its basis the concepts of streamline upwinding. Vectorization strategies are developed to implement the finite element formulations on the NASA Langley VPS-32. The vectorization scheme results in finite element programs that use vectors of length of the order of the number of nodes or elements. The use of the vectorization procedure speeds up processing rates by over two orders of magnitude. The Taylor-Galerkin and Petrov-Galerkin algorithms are evaluated for 2D inviscid flows on criteria such as solution accuracy, shock resolution, computational speed and storage requirements. The convergence rates for both algorithms are enhanced by local time-stepping schemes. Extension of the vectorization procedure for predicting 2D viscous and 3D inviscid flows are demonstrated. Conclusions are drawn regarding the applicability of the finite element procedures for realistic problems that require hundreds of thousands of nodes.

Vectorized and multitasked solution of the few-group neutron diffusion equations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zee, S.K.; Turinsky, P.J.; Shayer, Z.

1989-03-01

A numerical algorithm with parallelism was used to solve the two-group, multidimensional neutron diffusion equations on computers characterized by shared memory, vector pipeline, and multi-CPU architecture features. Specifically, solutions were obtained on the Cray X/MP-48, the IBM-3090 with vector facilities, and the FPS-164. The material-centered mesh finite difference method approximation and outer-inner iteration method were employed. Parallelism was introduced in the inner iterations using the cyclic line successive overrelaxation iterative method and solving in parallel across lines. The outer iterations were completed using the Chebyshev semi-iterative method that allows parallelism to be introduced in both space and energy groups. Formore » the three-dimensional model, power, soluble boron, and transient fission product feedbacks were included. Concentrating on the pressurized water reactor (PWR), the thermal-hydraulic calculation of moderator density assumed single-phase flow and a closed flow channel, allowing parallelism to be introduced in the solution across the radial plane. Using a pinwise detail, quarter-core model of a typical PWR in cycle 1, for the two-dimensional model without feedback the measured million floating point operations per second (MFLOPS)/vector speedups were 83/11.7. 18/2.2, and 2.4/5.6 on the Cray, IBM, and FPS without multitasking, respectively. Lower performance was observed with a coarser mesh, i.e., shorter vector length, due to vector pipeline start-up. For an 18 x 18 x 30 (x-y-z) three-dimensional model with feedback of the same core, MFLOPS/vector speedups of --61/6.7 and an execution time of 0.8 CPU seconds on the Cray without multitasking were measured. Finally, using two CPUs and the vector pipelines of the Cray, a multitasking efficiency of 81% was noted for the three-dimensional model.« less

“Stealth” Adenoviruses Blunt Cell-Mediated and Humoral Immune Responses against the Virus and Allow for Significant Gene Expression upon Readministration in the Lung

PubMed Central

Croyle, Maria A.; Chirmule, Narendra; Zhang, Yi; Wilson, James M.

2001-01-01

Most of the early gene therapy trials for cystic fibrosis have been with adenovirus vectors. First-generation viruses with E1a and E1b deleted are limited by transient expression of the transgene and substantial inflammatory responses. Gene transfer is also significantly curtailed following a second dose of virus. In an effort to reduce adenovirus-associated inflammation, capsids of first-generation vectors were modified with various activated monomethoxypolyethylene glycols. Cytotoxic T-lymphocyte production was significantly reduced in C57BL/6 mice after a single intratracheal administration of modified vectors, and length of gene expression was extended from 4 to 42 days. T-cell subsets from mice exposed to the conjugated vectors demonstrated a marked decrease in Th1 responses and slight enhancement of Th2 responses compared to animals dosed with native virus. Neutralizing antibodies (NAB) against adenovirus capsid proteins were reduced in serum and bronchoalveolar lavage fluid of animals after a single dose of modified virus, allowing significant levels of gene expression upon rechallenge with native adenovirus. Modification with polyethylene glycol (PEG) also allowed substantial gene expression from the new vectors in animals previously immunized with unmodified virus. However, gene expression was significantly reduced after two doses of the same PEG-conjugated vector. Alternating the activation group of PEG between doses did produce significant gene expression upon readministration. This technology in combination with second-generation or helper-dependent adenovirus could produce dosing strategies which promote successful readministration of vector in clinical trials and marked expression in patients with significant anti-adenovirus NAB levels and reduce the possibility of immune reactions against viral vectors for gene therapy. PMID:11312351

Baculovirus vectors expressing F proteins in combination with virus-induced signaling adaptor (VISA) molecules confer protection against respiratory syncytial virus infection.

PubMed

Zhang, Yuan; Qiao, Lei; Hu, Xiao; Zhao, Kang; Zhang, Yanwen; Chai, Feng; Pan, Zishu

2016-01-04

Baculovirus has been exploited for use as a novel vaccine vector. To investigate the feasibility and efficacy of recombinant baculoviruses (rBVs) expressing respiratory syncytial virus (RSV) fusion (F) proteins, four constructs (Bac-tF/64, Bac-CF, Bac-CF/tF64 and Bac-CF/tF64-VISA) were generated. Bac-tF64 displays the F ectodomain (tF) on the envelope of rBVs, whereas Bac-CF expresses full-length F protein in transduced mammalian cells. Bac-CF/tF64 not only displays tF on the envelope but also expresses F in cells. Bac-CF/tF64-VISA comprises Bac-CF/tF64 harboring the virus-induced signaling adaptor (VISA) gene. After administration to BALB/c mice, all four vectors elicited RSV neutralizing antibody (Ab), systemic Ab (IgG, IgG1, and IgG2a), and cytokine responses. Compared with Bac-tF64, mice inoculated with Bac-CF and Bac-CF/tF64 exhibited an increased mixed Th1/Th2 cytokine response, increased ratios of IgG2a/IgG1 antibody responses, and reduced immunopathology upon RSV challenge. Intriguingly, co-expression of VISA reduced Th2 cytokine (IL-4, IL-5, and IL-10) production induced by Bac-CF/tF64, thus relieving lung pathology upon a subsequent RSV challenge. Our results indicated that the Bac-CF/tF64 vector incorporated with the VISA molecule may provide an effective vaccine strategy for protection against RSV. Copyright © 2015 Elsevier Ltd. All rights reserved.

Attenuated Listeria monocytogenes vectors overcome suppressive plasma factors during HIV infection to stimulate myeloid dendritic cells to promote adaptive immunity and reactivation of latent virus.

PubMed

Miller, Elizabeth A; Spadaccia, Meredith R; Norton, Thomas; Demmler, Morgan; Gopal, Ramya; O'Brien, Meagan; Landau, Nathaniel; Dubensky, Thomas W; Lauer, Peter; Brockstedt, Dirk G; Bhardwaj, Nina

2015-01-01

HIV-1 infection is characterized by myeloid dendritic cell (DC) dysfunction, which blunts the responsiveness to vaccine adjuvants. We previously showed that nonviral factors in HIV-seropositive plasma are partially responsible for mediating this immune suppression. In this study we investigated recombinant Listeria monocytogenes (Lm) vectors, which naturally infect and potently activate DCs from seronegative donors, as a means to overcome DC dysfunction associated with HIV infection. Monocyte-derived DCs were cocultured with plasma from HIV-infected donors (HIV-moDCs) to induce a dysregulated state and infected with an attenuated, nonreplicative vaccine strain of Lm expressing full length clade B consensus gag (KBMA Lm-gag). Lm infection stimulated cytokine secretion [interleukin (IL)-12p70, tumor necrosis factor (TNF)-α, and IL-6] and Th-1 skewing of allogeneic naive CD4 T cells by HIV-moDCs, in contrast to the suppressive effects observed by HIV plasma on moDCs on toll-like receptor ligand stimulation. Upon coculture of "killed" but metabolically active (KBMA) Lm-gag-infected moDCs from HIV-infected donors with autologous cells, expansion of polyfunctional, gag-specific CD8(+) T cells was observed. Reactivation of latent proviruses by moDCs following Lm infection was also observed in models of HIV latency in a TNF-α-dependent manner. These findings reveal the unique ability of Lm vectors to contend with dysregulation of HIV-moDCs, while simultaneously possessing the capacity to activate latent virus. Concurrent stimulation of innate and adaptive immunity and disruption of latency may be an approach to reduce the pool of latently infected cells during HIV infection. Further study of Lm vectors as part of therapeutic vaccination and eradication strategies may advance this evolving field.

Morphometric discrimination of two sympatric sibling species in the Palaearctic region, Culicoides obsoletus Meigen and C. scoticus Downes & Kettle (Diptera: Ceratopogonidae), vectors of bluetongue and Schmallenberg viruses.

PubMed

Kluiters, G; Pagès, N; Carpenter, S; Gardès, L; Guis, H; Baylis, M; Garros, C

2016-05-04

Some Palaearctic biting midge species (subgenus Avaritia) have been implicated as vectors of bluetongue virus in northern Europe. Separation of two species (C. obsoletus and C. scoticus) is considered difficult morphologically and, often, these female specimens are grouped in entomological studies. However, species-specific identification is desirable to understand their life history characteristics, assess their roles in disease transmission or measure their abundance during arboviral outbreaks. This study aims to investigate whether morphometric identification techniques can be applied to female C. obsoletus and C. scoticus individuals trapped at different geographical regions and time periods during the vector season. C. obsoletus and C. scoticus were collected using light-suction traps from the UK, France and Spain, with two geographical locations sampled per country. A total of 759 C. obsoletus/C. scoticus individuals were identified using a molecular assay based on the cytochrome c oxidase subunit I gene. Fifteen morphometric measurements were taken from the head, wings and abdomen of slide-mounted specimens, and ratios calculated between these measurements. Multivariate analyses explored whether a combination of morphometric variables could lead to accurate species identification. Finally, Culicoides spp. collected in France at the start, middle and end of the adult vector season were compared, to determine whether seasonal variation exists in any of the morphometric measurements. The principal component analyses revealed that abdominal characteristics: length and width of the smaller and larger spermathecae, and the length of the chitinous plates and width between them, are the most reliable morphometric characteristics to differentiate between the species. Seasonal variation in the size of each species was observed for head and wing measurements, but not abdominal measurements. Geographical variation in the size of Culicoides spp. was also observed and is likely to be related to temperature at the trapping sites, with smaller individuals trapped at more southern latitudes. Our results suggest that female C. obsoletus and C. scoticus individuals can be separated under a stereomicroscope using abdominal measurements. Although we show the length and width of the spermathecae can be used to differentiate between the species, this can be time-consuming, so we recommend undertaking this using standardized subsampling of catches.

Short wavelength ion waves upstream of the earth's bow shock

NASA Technical Reports Server (NTRS)

Fuselier, S. A.; Gurnett, D. A.

1984-01-01

The identification and explanation of short wavelength antenna interference effects observed in spacecraft plasma wave data have provided an important new method of determining limits on the wavelength, direction of propagation, and Doppler shift of short wavelength electrostatic waves. Using the ISEE-1 wideband electric field data, antenna interference effects have been identified in the ion waves upstream of the earth's bow shock. This identification implies that wavelengths of the upstream ion waves are shorter than the antenna length. The interference effects also provide new measurements of the direction of propagation of the ion waves. The new measurements show that the wave vectors of the ion waves are not parallel to the interplanetary magnetic field (IMF) as previously reported. The direction of propagation does not appear to be controlled by the IMF. In addition, analysis of the Doppler shift of the short wavelength ion waves has provided a measurement of the dispersion relation. The upper limit of the rest frame frequency was found to be on the order of the ion plasma frequency. At this frequency, the wavelength is on the order of a few times the Debye length. The results of this study now provide strong evidence that the ion waves in the upstream region are Doppler-shifted ion acoustic waves. Previously announced in STAR as N83-36328

[Cloning and expressing of cyclophilin B gene from Schistosoma japonnicum and the analysis of immunoprotective effect].

PubMed

Peng, Jinbiao; Han, Hongxiao; Hong, Yang; Wang, Yan; Guo, Fanji; Shi, Yaojun; Fu, Zhiqiang; Liu, Jinming; Cheng, Guofeng; Lin, Jiaojiao

2010-03-01

The present study was intend to clone and express the cDNA encoding Cyclophilin B (CyPB) of Schistosoma japonicum, its preliminary biological function and further immunoprotective effect against schistosome infection in mice. RT-PCR technique was applied to amplify a full-length cDNA encoding protein Cyclophilin B (Sj CyPB) from schistosomula cDNA. The expression profiles of Sj CyPB were determined by Real-time PCR using the template cDNAs isolated from 7, 13, 18, 23, 32 and 42 days parasites. The cDNA containing the Open Reading Frame of CyPB was then subcloned into a pGEX-6P-1 vector and transformed into competent Escherichia coli BL21 for expressing. The recombinant protein was renaturated, purified and its antigenicity were detected by Western blotting, and the immunoprotective effect induced by recombinant Sj CyPB was evaluated in Balb/C mice. The cDNA containing the ORF of Sj CyPB was cloned with the length of 672 base pairs, encoding 223 amino acids. Real-time PCR analysis revealed that the gene had the highest expression in 18-day schistosomula, suggesting that Sj CyPB was schistosomula differentially expressed gene. The recombinant protein showed a good antigenicity detected by Western blotting. Animal experiment indicated that the vaccination of recombinant CyPB protein in mice led to 31.5% worm and 41.01% liver egg burden reduction, respectively, compared with those of the control. A full-length cDNA differentially expressed in schistosomula was obtained. The recombinant Sj CyPB protein could induce partial protection against schistosome infection.

Management of arthropod pathogen vectors in North America: Minimizing adverse effects on pollinators

USGS Publications Warehouse

Ginsberg, Howard; Bargar, Timothy A.; Hladik, Michelle L.; Lubelczyk, Charles

2017-01-01

Tick and mosquito management is important to public health protection. At the same time, growing concerns about declines of pollinator species raise the question of whether vector control practices might affect pollinator populations. We report the results of a task force of the North American Pollinator Protection Campaign (NAPPC) that examined potential effects of vector management practices on pollinators, and how these programs could be adjusted to minimize negative effects on pollinating species. The main types of vector control practices that might affect pollinators are landscape manipulation, biocontrol, and pesticide applications. Some current practices already minimize effects of vector control on pollinators (e.g., short-lived pesticides and application-targeting technologies). Nontarget effects can be further diminished by taking pollinator protection into account in the planning stages of vector management programs. Effects of vector control on pollinator species often depend on specific local conditions (e.g., proximity of locations with abundant vectors to concentrations of floral resources), so planning is most effective when it includes collaborations of local vector management professionals with local experts on pollinators. Interventions can then be designed to avoid pollinators (e.g., targeting applications to avoid blooming times and pollinator nesting habitats), while still optimizing public health protection. Research on efficient targeting of interventions, and on effects on pollinators of emerging technologies, will help mitigate potential deleterious effects on pollinators in future management programs. In particular, models that can predict effects of integrated pest management on vector-borne pathogen transmission, along with effects on pollinator populations, would be useful for collaborative decision-making.

Directional Asymmetry in the Limbs, Skull and Pelvis of the Silver Fox (V. vulpes)

PubMed Central

Kharlamova, Anastasia V.; Trut, Lyudmila N.; Chase, Kevin; Kukekova, Anna V.; Lark, Karl G.

2011-01-01

Directional asymmetry (DA) is a characteristic of most vertebrates, most strikingly exhibited by the placement of various organs (heart, lungs, liver, etc.) but also noted in small differences in the metrics of skeletal structures such as the pelvis of certain fish or sauropsids. We have analyzed DA in the skeleton of the fox (V. vulpes), using ~1,000 radiographs of foxes from populations used in the genetic analysis of behavior and morphology. Careful measurements from this robust data base demonstrate that: 1) DA occurs in the limb bones, the ileum, and ischium and in the mandible; 2) regardless of the direction of the length asymmetry vector of a particular skeletal unit, the vectorial direction of length is always opposite to that of width; 3) with the exception of the humerus and radius, there is no correlation or inverse correlation between vectorial amplitudes or magnitudes of bone asymmetries. 4) Postnatal measurements on foxes demonstrate that the asymmetry increases after birth and continues to change (increasing or decreasing) during postnatal growth. 5) A behavior test for preferential use of a specific forelimb exhibited fluctuating asymmetry but not DA. None of the skeletal asymmetries were significantly correlated with a preferential use of a specific forelimb. We suggest that for the majority of fox skeletal parameters, growth on the right and left side of the fox are differentially biased resulting in fixed differences between the two sides in either the rate of growth or the length of the period during which growth occurs. Random effects around these fixed differences perturb the magnitude of the effects such that the magnitudes of length and width asymmetries are not inversely correlated at the level of individual animals. PMID:20862692

Directional asymmetry in the limbs, skull and pelvis of the silver fox (V. vulpes).

PubMed

Kharlamova, Anastasia V; Trut, Lyudmila N; Chase, Kevin; Kukekova, Anna V; Lark, Karl G

2010-12-01

Directional asymmetry (DA) is a characteristic of most vertebrates, most strikingly exhibited by the placement of various organs (heart, lungs, liver, etc.) but also noted in small differences in the metrics of skeletal structures such as the pelvis of certain fish or sauropsids. We have analyzed DA in the skeleton of the fox (V. vulpes), using ∼1,000 radiographs of foxes from populations used in the genetic analysis of behavior and morphology. Careful measurements from this robust data base demonstrate that: 1) DA occurs in the limb bones, the ileum, and ischium and in the mandible; 2) regardless of the direction of the length asymmetry vector of a particular skeletal unit, the vectorial direction of length is always opposite to that of width; 3) with the exception of the humerus and radius, there is no correlation or inverse correlation between vectorial amplitudes or magnitudes of bone asymmetries. 4) Postnatal measurements on foxes demonstrate that the asymmetry increases after birth and continues to change (increasing or decreasing) during postnatal growth. 5) A behavior test for preferential use of a specific forelimb exhibited fluctuating asymmetry but not DA. None of the skeletal asymmetries were significantly correlated with a preferential use of a specific forelimb. We suggest that for the majority of fox skeletal parameters, growth on the right and left side of the fox are differentially biased resulting in fixed differences between the two sides in either the rate of growth or the length of the period during which growth occurs. Random effects around these fixed differences perturb the magnitude of the effects such that the magnitudes of length and width asymmetries are not inversely correlated at the level of individual animals. © 2010 Wiley-Liss, Inc.

Cancelable biometrics realization with multispace random projections.

PubMed

Teoh, Andrew Beng Jin; Yuang, Chong Tze

2007-10-01

Biometric characteristics cannot be changed; therefore, the loss of privacy is permanent if they are ever compromised. This paper presents a two-factor cancelable formulation, where the biometric data are distorted in a revocable but non-reversible manner by first transforming the raw biometric data into a fixed-length feature vector and then projecting the feature vector onto a sequence of random subspaces that were derived from a user-specific pseudorandom number (PRN). This process is revocable and makes replacing biometrics as easy as replacing PRNs. The formulation has been verified under a number of scenarios (normal, stolen PRN, and compromised biometrics scenarios) using 2400 Facial Recognition Technology face images. The diversity property is also examined.

Design of single-polarization wavelength splitter based on photonic crystal fiber.

PubMed

Zhang, Shanshan; Zhang, Weigang; Geng, Pengcheng; Li, Xiaolan; Ruan, Juan

2011-12-20

A new single-polarization wavelength splitter based on the photonic crystal fiber (PCF) has been proposed. The full-vector finite-element method (FEM) is applied to analyze the single-polarization single-mode guiding properties. Splitting of two different wavelengths is realized by adjusting the structural parameters. The semi-vector three-dimensional beam propagation method is employed to confirm the wavelength splitting characteristics of the PCF. Numerical simulations show that the wavelengths of 1.3 μm and 1.55 μm are split for a fiber length of 10.7 mm with single-polarization guiding in each core. The crosstalk between the two cores is low over appreciable optical bandwidths.

Integrating vector control across diseases.

PubMed

Golding, Nick; Wilson, Anne L; Moyes, Catherine L; Cano, Jorge; Pigott, David M; Velayudhan, Raman; Brooker, Simon J; Smith, David L; Hay, Simon I; Lindsay, Steve W

2015-10-01

Vector-borne diseases cause a significant proportion of the overall burden of disease across the globe, accounting for over 10 % of the burden of infectious diseases. Despite the availability of effective interventions for many of these diseases, a lack of resources prevents their effective control. Many existing vector control interventions are known to be effective against multiple diseases, so combining vector control programmes to simultaneously tackle several diseases could offer more cost-effective and therefore sustainable disease reductions. The highly successful cross-disease integration of vaccine and mass drug administration programmes in low-resource settings acts a precedent for cross-disease vector control. Whilst deliberate implementation of vector control programmes across multiple diseases has yet to be trialled on a large scale, a number of examples of 'accidental' cross-disease vector control suggest the potential of such an approach. Combining contemporary high-resolution global maps of the major vector-borne pathogens enables us to quantify overlap in their distributions and to estimate the populations jointly at risk of multiple diseases. Such an analysis shows that over 80 % of the global population live in regions of the world at risk from one vector-borne disease, and more than half the world's population live in areas where at least two different vector-borne diseases pose a threat to health. Combining information on co-endemicity with an assessment of the overlap of vector control methods effective against these diseases allows us to highlight opportunities for such integration. Malaria, leishmaniasis, lymphatic filariasis, and dengue are prime candidates for combined vector control. All four of these diseases overlap considerably in their distributions and there is a growing body of evidence for the effectiveness of insecticide-treated nets, screens, and curtains for controlling all of their vectors. The real-world effectiveness of cross-disease vector control programmes can only be evaluated by large-scale trials, but there is clear evidence of the potential of such an approach to enable greater overall health benefit using the limited funds available.

Cloning of a very virulent plus, 686 strain of Marek’s disease virus as a bacterial artificial chromosome

USDA-ARS?s Scientific Manuscript database

Bacterial artificial chromosome (BAC) vectors were first developed to facilitate propagation and manipulation of large DNA fragments. This technology was later used to clone full-length genomes of large DNA viruses to study viral gene function. Marek’s disease virus (MDV) is a highly oncogenic herpe...

Multi-color incomplete Cholesky conjugate gradient methods for vector computers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poole, E.L.

1986-01-01

This research is concerned with the solution on vector computers of linear systems of equations. Ax = b, where A is a large, sparse symmetric positive definite matrix with non-zero elements lying only along a few diagonals of the matrix. The system is solved using the incomplete Cholesky conjugate gradient method (ICCG). Multi-color orderings are used of the unknowns in the linear system to obtain p-color matrices for which a no-fill block ICCG method is implemented on the CYBER 205 with O(N/p) length vector operations in both the decomposition of A and, more importantly, in the forward and back solvesmore » necessary at each iteration of the method. (N is the number of unknowns and p is a small constant). A p-colored matrix is a matrix that can be partitioned into a p x p block matrix where the diagonal blocks are diagonal matrices. The matrix is stored by diagonals and matrix multiplication by diagonals is used to carry out the decomposition of A and the forward and back solves. Additionally, if the vectors across adjacent blocks line up, then some of the overhead associated with vector startups can be eliminated in the matrix vector multiplication necessary at each conjugate gradient iteration. Necessary and sufficient conditions are given to determine which multi-color orderings of the unknowns correspond to p-color matrices, and a process is indicated for choosing multi-color orderings.« less

Singular vector-based targeted observations of chemical constituents: description and first application of the EURAD-IM-SVA v1.0

NASA Astrophysics Data System (ADS)

Goris, N.; Elbern, H.

2015-12-01

Measurements of the large-dimensional chemical state of the atmosphere provide only sparse snapshots of the state of the system due to their typically insufficient temporal and spatial density. In order to optimize the measurement configurations despite those limitations, the present work describes the identification of sensitive states of the chemical system as optimal target areas for adaptive observations. For this purpose, the technique of singular vector analysis (SVA), which has proven effective for targeted observations in numerical weather prediction, is implemented in the EURAD-IM (EURopean Air pollution and Dispersion - Inverse Model) chemical transport model, yielding the EURAD-IM-SVA v1.0. Besides initial values, emissions are investigated as critical simulation controlling targeting variables. For both variants, singular vectors are applied to determine the optimal placement for observations and moreover to quantify which chemical compounds have to be observed with preference. Based on measurements of the airship based ZEPTER-2 campaign, the EURAD-IM-SVA v1.0 has been evaluated by conducting a comprehensive set of model runs involving different initial states and simulation lengths. For the sake of brevity, we concentrate our attention on the following chemical compounds, O3, NO, NO2, HCHO, CO, HONO, and OH, and focus on their influence on selected O3 profiles. Our analysis shows that the optimal placement for observations of chemical species is not entirely determined by mere transport and mixing processes. Rather, a combination of initial chemical concentrations, chemical conversions, and meteorological processes determines the influence of chemical compounds and regions. We furthermore demonstrate that the optimal placement of observations of emission strengths is highly dependent on the location of emission sources and that the benefit of including emissions as target variables outperforms the value of initial value optimization with growing simulation length. The obtained results confirm the benefit of considering both initial values and emission strengths as target variables and of applying the EURAD-IM-SVA v1.0 for measurement decision guidance with respect to chemical compounds.

Large Animal Models for Foamy Virus Vector Gene Therapy

PubMed Central

Trobridge, Grant D.; Horn, Peter A.; Beard, Brian C.; Kiem, Hans-Peter

2012-01-01

Foamy virus (FV) vectors have shown great promise for hematopoietic stem cell (HSC) gene therapy. Their ability to efficiently deliver transgenes to multi-lineage long-term repopulating cells in large animal models suggests they will be effective for several human hematopoietic diseases. Here, we review FV vector studies in large animal models, including the use of FV vectors with the mutant O6-methylguanine-DNA methyltransferase, MGMTP140K to increase the number of genetically modified cells after transplantation. In these studies, FV vectors have mediated efficient gene transfer to polyclonal repopulating cells using short ex vivo transduction protocols designed to minimize the negative effects of ex vivo culture on stem cell engraftment. In this regard, FV vectors appear superior to gammaretroviral vectors, which require longer ex vivo culture to effect efficient transduction. FV vectors have also compared favorably with lentiviral vectors when directly compared in the dog model. FV vectors have corrected leukocyte adhesion deficiency and pyruvate kinase deficiency in the dog large animal model. FV vectors also appear safer than gammaretroviral vectors based on a reduced frequency of integrants near promoters and also near proto-oncogenes in canine repopulating cells. Together, these studies suggest that FV vectors should be highly effective for several human hematopoietic diseases, including those that will require relatively high percentages of gene-modified cells to achieve clinical benefit. PMID:23223198

Universality of modulation length and time exponents.

PubMed

Chakrabarty, Saurish; Dobrosavljević, Vladimir; Seidel, Alexander; Nussinov, Zohar

2012-10-01

We study systems with a crossover parameter λ, such as the temperature T, which has a threshold value λ(*) across which the correlation function changes from exhibiting fixed wavelength (or time period) modulations to continuously varying modulation lengths (or times). We introduce a hitherto unknown exponent ν(L) characterizing the universal nature of this crossover and compute its value in general instances. This exponent, similar to standard correlation length exponents, is obtained from motion of the poles of the momentum (or frequency) space correlation functions in the complex k-plane (or ω-plane) as the parameter λ is varied. Near the crossover (i.e., for λ→λ(*)), the characteristic modulation wave vector K(R) in the variable modulation length "phase" is related to that in the fixed modulation length "phase" q via |K(R)-q|[proportionality]|T-T(*)|(νL). We find, in general, that ν(L)=1/2. In some special instances, ν(L) may attain other rational values. We extend this result to general problems in which the eigenvalue of an operator or a pole characterizing general response functions may attain a constant real (or imaginary) part beyond a particular threshold value λ(*). We discuss extensions of this result to multiple other arenas. These include the axial next-nearest-neighbor Ising (ANNNI) model. By extending our considerations, we comment on relations pertaining not only to the modulation lengths (or times), but also to the standard correlation lengths (or times). We introduce the notion of a Josephson time scale. We comment on the presence of aperiodic "chaotic" modulations in "soft-spin" and other systems. These relate to glass-type features. We discuss applications to Fermi systems, with particular application to metal to band insulator transitions, change of Fermi surface topology, divergent effective masses, Dirac systems, and topological insulators. Both regular periodic and glassy (and spatially chaotic behavior) may be found in strongly correlated electronic systems.

A Correlation Between Length of Strong-Shear Neutral Lines and Total X-Ray Brightness in Active Regions

NASA Technical Reports Server (NTRS)

Falconer, D. A.

1997-01-01

From a sample of 7 MSFC vector magnetograms,of active regions and 17 Yohkoh SXT soft X-ray images of these active regions, we have found that the total x-ray brightness of an entire active region is correlated with the total length of neutral lines on which the magnetic field is both strong (less than 250 G) and strongly sheared (shear angle greater than 75 deg) in the same active region. This correlation, if not fortuitous, is additional evidence of the importance of strong-shear strong-field neutral lines to strong heating in active regions.

Calculation of gravity and magnetic anomalies of finite-length right polygonal prisms.

USGS Publications Warehouse

Cady, J.W.

1980-01-01

An equation is derived for the vertical gravity field due to a homogeneous body with polygonal cross‐section and finite strike‐length. The equation can be separated into the two‐dimensional (2-D) terms of Talwani et al. (1959) and exact terms for the contributions of the ends of the prism. Equations for the magnetic field due to a similar body were derived by Shuey and Pasquale (1973), who coined the term “two‐and‐a‐half dimensional” (2 1/2-D) to describe the geometry. Magnetic intensities are expressed as a vector sum, from which the common dot product formulation can be obtained by binomial expansion.

Vector spherical quasi-Gaussian vortex beams

NASA Astrophysics Data System (ADS)

Mitri, F. G.

2014-02-01

Model equations for describing and efficiently computing the radiation profiles of tightly spherically focused higher-order electromagnetic beams of vortex nature are derived stemming from a vectorial analysis with the complex-source-point method. This solution, termed as a high-order quasi-Gaussian (qG) vortex beam, exactly satisfies the vector Helmholtz and Maxwell's equations. It is characterized by a nonzero integer degree and order (n,m), respectively, an arbitrary waist w0, a diffraction convergence length known as the Rayleigh range zR, and an azimuthal phase dependency in the form of a complex exponential corresponding to a vortex beam. An attractive feature of the high-order solution is the rigorous description of strongly focused (or strongly divergent) vortex wave fields without the need of either the higher-order corrections or the numerically intensive methods. Closed-form expressions and computational results illustrate the analysis and some properties of the high-order qG vortex beams based on the axial and transverse polarization schemes of the vector potentials with emphasis on the beam waist.

Perspective on Adeno-Associated Virus Capsid Modification for Duchenne Muscular Dystrophy Gene Therapy.

PubMed

Nance, Michael E; Duan, Dongsheng

2015-12-01

Duchenne muscular dystrophy (DMD) is a X-linked, progressive childhood myopathy caused by mutations in the dystrophin gene, one of the largest genes in the genome. It is characterized by skeletal and cardiac muscle degeneration and dysfunction leading to cardiac and/or respiratory failure. Adeno-associated virus (AAV) is a highly promising gene therapy vector. AAV gene therapy has resulted in unprecedented clinical success for treating several inherited diseases. However, AAV gene therapy for DMD remains a significant challenge. Hurdles for AAV-mediated DMD gene therapy include the difficulty to package the full-length dystrophin coding sequence in an AAV vector, the necessity for whole-body gene delivery, the immune response to dystrophin and AAV capsid, and the species-specific barriers to translate from animal models to human patients. Capsid engineering aims at improving viral vector properties by rational design and/or forced evolution. In this review, we discuss how to use the state-of-the-art AAV capsid engineering technologies to overcome hurdles in AAV-based DMD gene therapy.

Natural Infection of Phlebotomus sergenti by Leishmania tropica in Libya.

PubMed

Dokhan, Mostafa Ramadhan; Jaouadi, Kaouther; Salem, Sadok; Zenbil, Osama; Gonzalez, Jean Paul; Ben Salah, Afif; Annajar, Badreddin Bashir

2018-03-12

Cutaneous leishmaniasis (CL) is a public health concern caused by Leishmania ( L. ) major and ( L. ) tropica in Libya. Information on sandfly vectors, as well as their associated Leishmania species, is of paramount importance because vector dispersion is one of the major factors responsible for pathogen dissemination. A number of 515 sandflies (275 males and 240 females) were collected during June-November 2012 using the CDC miniature light traps from Al Rabta, northwest of Libya. Two hundred and forty unfed females were identified; Phlebotomus ( Ph. ) papatasi ( N = 97), Ph. sergenti ( N = 27), Ph. longicuspis ( N = 32), Sergentomyia ( Se. ) minuta ( N = 38), and Se. fallax ( N = 46). These flies were screened for Leishmania DNA using the polymerase chain reaction-restriction fragment length polymorphism analysis of the internal transcribed spacer 1 and sequencing. Two Ph. sergenti were found positive to L. tropica DNA. This finding should be considered for any further vector surveillance and epidemiological studies of CL in endemic areas across Libya.

[Construction of Plasmodium falciparum signal peptide peptidase-GFP mutant and its expression analysis in the malaria parasite].

PubMed

Li, Xue-rong; Wu, Yin-juan; Shang, Mei; Li, Ye; Xu, Jin; Yu, Xin-bing; Athar, Chishti

2014-08-01

To construct recombinant plasmid pSPPcGT which contains signal peptide peptidase gene of Plasmodium falciparum (PJSPP) and GFP, and transfect into P. falciparum (3D7 strain) to obtain mutant parasites which can express PJSPP-GFP. Plasmodium falciparum(3D7 strain) genomic DNA was extracted from cultured malaria parasites. The C-terminal region of PJSPP, an 883 bp gene fragment was amplified by PCR, and then cloned into pPM2GT vector to get recombinant vector pSPPcGT. The recombinant vectors were identified by PCR, double restriction enzyme digestion and DNA sequencing. pSPPcGT vector was transfected into malaria parasites. The positive clones were selected by adding inhibitor of Plasmodium falciparum dihydrofolate reductase WR99210 to the culture medium. The pSPP-GFP-transfected parasites were fixed with methanol, stained with DAPI, and observed under immunofluorescence microscope. The PJSPP-GFP expression in P. falciparum was identified by SDS-PAGE and Western blotting. The C-terminal region of PJSPP was amplified from P.falciparum (3D7 strain) genomic DNA by PCR with the length of 883 bp. The constructed recombinant vectors were identified by PCR screening, double restriction enzyme digestion and DNA sequencing. The pSPPcGT vector was transfected into P. falciparum and the positive clones were selected by WR99210. GFP fluorescence was observed in transfected parasites by immunofluorescence microscopy, and mainly located in the cytoplasm. The PJSPP-GFP expression in malaria parasites was confirmed by Western blotting with a relative molecular mass of Mr 64,000. Recombinant vector PJSPP-GFP is constructed and transfected into P. falciparum to obtain P. falciparum mutant clone which can express PfSPP-GFP.

An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene.

PubMed

Cui, Hongguang; Wang, Aiming

2017-03-01

RNA silencing is a powerful technology for molecular characterization of gene functions in plants. A commonly used approach to the induction of RNA silencing is through genetic transformation. A potent alternative is to use a modified viral vector for virus-induced gene silencing (VIGS) to degrade RNA molecules sharing similar nucleotide sequence. Unfortunately, genomic studies in many allogamous woody perennials such as peach are severely hindered because they have a long juvenile period and are recalcitrant to genetic transformation. Here, we report the development of a viral vector derived from Prunus necrotic ringspot virus (PNRSV), a widespread fruit tree virus that is endemic in all Prunus fruit production countries and regions in the world. We show that the modified PNRSV vector, harbouring the sense-orientated target gene sequence of 100-200 bp in length in genomic RNA3, could efficiently trigger the silencing of a transgene or an endogenous gene in the model plant Nicotiana benthamiana. We further demonstrate that the PNRSV-based vector could be manipulated to silence endogenous genes in peach such as eukaryotic translation initiation factor 4E isoform (eIF(iso)4E), a host factor of many potyviruses including Plum pox virus (PPV). Moreover, the eIF(iso)4E-knocked down peach plants were resistant to PPV. This work opens a potential avenue for the control of virus diseases in perennial trees via viral vector-mediated silencing of host factors, and the PNRSV vector may serve as a powerful molecular tool for functional genomic studies of Prunus fruit trees. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Optimal multiguidance integration in insect navigation.

PubMed

Hoinville, Thierry; Wehner, Rüdiger

2018-03-13

In the last decades, desert ants have become model organisms for the study of insect navigation. In finding their way, they use two major navigational routines: path integration using a celestial compass and landmark guidance based on sets of panoramic views of the terrestrial environment. It has been claimed that this information would enable the insect to acquire and use a centralized cognitive map of its foraging terrain. Here, we present a decentralized architecture, in which the concurrently operating path integration and landmark guidance routines contribute optimally to the directions to be steered, with "optimal" meaning maximizing the certainty (reliability) of the combined information. At any one time during its journey, the animal computes a path integration (global) vector and landmark guidance (local) vector, in which the length of each vector is proportional to the certainty of the individual estimates. Hence, these vectors represent the limited knowledge that the navigator has at any one place about the direction of the goal. The sum of the global and local vectors indicates the navigator's optimal directional estimate. Wherever applied, this decentralized model architecture is sufficient to simulate the results of quite a number of diverse cue-conflict experiments, which have recently been performed in various behavioral contexts by different authors in both desert ants and honeybees. They include even those experiments that have deliberately been designed by former authors to strengthen the evidence for a metric cognitive map in bees.

Phylogenetic tree construction using trinucleotide usage profile (TUP).

PubMed

Chen, Si; Deng, Lih-Yuan; Bowman, Dale; Shiau, Jyh-Jen Horng; Wong, Tit-Yee; Madahian, Behrouz; Lu, Henry Horng-Shing

2016-10-06

It has been a challenging task to build a genome-wide phylogenetic tree for a large group of species containing a large number of genes with long nucleotides sequences. The most popular method, called feature frequency profile (FFP-k), finds the frequency distribution for all words of certain length k over the whole genome sequence using (overlapping) windows of the same length. For a satisfactory result, the recommended word length (k) ranges from 6 to 15 and it may not be a multiple of 3 (codon length). The total number of possible words needed for FFP-k can range from 4 6 =4096 to 4 15 . We propose a simple improvement over the popular FFP method using only a typical word length of 3. A new method, called Trinucleotide Usage Profile (TUP), is proposed based only on the (relative) frequency distribution using non-overlapping windows of length 3. The total number of possible words needed for TUP is 4 3 =64, which is much less than the total count for the recommended optimal "resolution" for FFP. To build a phylogenetic tree, we propose first representing each of the species by a TUP vector and then using an appropriate distance measure between pairs of the TUP vectors for the tree construction. In particular, we propose summarizing a DNA sequence by a matrix of three rows corresponding to three reading frames, recording the frequency distribution of the non-overlapping words of length 3 in each of the reading frame. We also provide a numerical measure for comparing trees constructed with various methods. Compared to the FFP method, our empirical study showed that the proposed TUP method is more capable of building phylogenetic trees with a stronger biological support. We further provide some justifications on this from the information theory viewpoint. Unlike the FFP method, the TUP method takes the advantage that the starting of the first reading frame is (usually) known. Without this information, the FFP method could only rely on the frequency distribution of overlapping words, which is the average (or mixture) of the frequency distributions of three possible reading frames. Consequently, we show (from the entropy viewpoint) that the FFP procedure could dilute important gene information and therefore provides less accurate classification.

Coherent clusters of inertial particles in homogeneous turbulence

NASA Astrophysics Data System (ADS)

Baker, Lucia; Frankel, Ari; Mani, Ali; Coletti, Filippo

2016-11-01

Clustering of heavy particles in turbulent flows manifests itself in a broad spectrum of physical phenomena, including sediment transport, cloud formation, and spray combustion. However, a clear topological definition of particle cluster has been lacking, limiting our ability to describe their features and dynamics. Here we introduce a definition of coherent cluster based on self-similarity, and apply it to the distribution of heavy particles in direct numerical simulations of homogeneous isotropic turbulence. We consider a range of particle Stokes numbers, with and without the effect of gravity. Clusters show self-similarity at length scales larger than twice the Kolmogorov length, with a specific fractal dimension. In the absence of gravity, clusters demonstrate a tendency to sample regions of the flow where strain is dominant over vorticity, and to align themselves with the local vorticity vector; when gravity is present, the clusters tend to align themselves with gravity, and their fall speed is different from the average settling velocity. This approach yields observations which are consistent with findings obtained from previous studies while opening new avenues for analysis of the topology and evolution of particle clusters in a wealth of applications.

Evolution from BCS superconductivity to Bose condensation: Calculation of the zero-temperature phase coherence length

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pistolesi, F.; Strinati, G.C.

1996-06-01

We consider a fermionic system at zero temperature interacting through an effective nonretarded potential of the type introduced by Nozi{grave e}res and Schmitt-Rink, and calculate the {ital phase} coherence length {xi}{sub phase} (associated with the spatial fluctuations of the superconducting order parameter) by exploiting a functional-integral formulation for the correlation functions and the associated loop expansion. This formulation is especially suited to follow the evolution of the fermionic system from a BCS-type superconductor for weak coupling to a Bose-condensed system for strong coupling, since in the latter limit a {ital direct} mapping of the original fermionic system onto an effectivemore » system of bosons with a residual boson-boson interaction can be established. Explicit calculations are performed at the one-loop order. The phase coherence length {xi}{sub phase} is compared with the coherence length {xi}{sub pair} for two-electron correlation, which is relevant to distinguish the weak- ({ital k}{sub {ital F}}{xi}{sub pair}{gt}1) from the strong- ({ital k}{sub {ital F}}{xi}{sub pair}{lt}1) coupling limits ({ital k}{sub {ital F}} being the Fermi wave vector) {ital as} {ital well} {ital as} to follow the crossover in between. It is shown that {xi}{sub phase} coincides with {xi}{sub pair} down to {ital k}{sub {ital F}}{xi}{sub pair}{approx_equal}10, {xi}{sub pair} in turn coinciding with the Pippard coherence length. In the strong-coupling limit we find instead that {xi}{sub phase}{gt}{xi}{sub pair}, with {xi}{sub pair} coinciding with the radius of the bound-electron pair. From the mapping onto an effective system of bosons in the strong-coupling limit we further relate {xi}{sub pair} with the {open_quote}{open_quote}range{close_quote}{close_quote} of the residual boson-boson interaction, which is physically the only significant length associated with the dynamics of the bosonic system. {copyright} {ital 1996 The American Physical Society.}« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feyereisen-Koener, J.M.

Double-stranded cDNA was prepared from infectious hematopoietic necrosis virus mRNA and cloned into the plasmid vector pUC8. A coprotein (G-protein) of infectious hematopoietic necrosis virus was selected by hybridization to a /sup 32/P-labeled probe. The restriction map and nucleotide sequence of the mRNA encoding the glycoprotein of infectious hematopoietic necrosis virus was determined using this full-length cDNA clone.

In vitro characterization of felid herpesvirus 1 (FHV-1) mutants generated by recombineering in a recombinant BAC vector

USDA-ARS?s Scientific Manuscript database

Felid herpesvirus 1 (FHV-1) mutants were constructed using two-step Red-mediated recombination techniques based on a virulent full-length FHV-1 BAC clone. The individual mutant viruses generated were deficient in glycoprotein C (gC), glycoprotein E (gE),US3 serine/threonine protein kinase (PK), or b...

One-electron densities of freely rotating Wigner molecules

NASA Astrophysics Data System (ADS)

Cioslowski, Jerzy

2017-12-01

A formalism enabling computation of the one-particle density of a freely rotating assembly of identical particles that vibrate about their equilibrium positions with amplitudes much smaller than their average distances is presented. It produces densities as finite sums of products of angular and radial functions, the length of the expansion being determined by the interplay between the point-group and permutational symmetries of the system in question. Obtaining from a convolution of the rotational and bosonic components of the parent wavefunction, the angular functions are state-dependent. On the other hand, the radial functions are Gaussians with maxima located at the equilibrium lengths of the position vectors of individual particles and exponents depending on the scalar products of these vectors and the eigenvectors of the corresponding Hessian as well as the respective eigenvalues. Although the new formalism is particularly useful for studies of the Wigner molecules formed by electrons subject to weak confining potentials, it is readily adaptable to species (such as ´balliums’ and Coulomb crystals) composed of identical particles with arbitrary spin statistics and permutational symmetry. Several examples of applications of the present approach to the harmonium atoms within the strong-correlation regime are given.

Classifying Physical Morphology of Cocoa Beans Digital Images using Multiclass Ensemble Least-Squares Support Vector Machine

NASA Astrophysics Data System (ADS)

Lawi, Armin; Adhitya, Yudhi

2018-03-01

The objective of this research is to determine the quality of cocoa beans through morphology of their digital images. Samples of cocoa beans were scattered on a bright white paper under a controlled lighting condition. A compact digital camera was used to capture the images. The images were then processed to extract their morphological parameters. Classification process begins with an analysis of cocoa beans image based on morphological feature extraction. Parameters for extraction of morphological or physical feature parameters, i.e., Area, Perimeter, Major Axis Length, Minor Axis Length, Aspect Ratio, Circularity, Roundness, Ferret Diameter. The cocoa beans are classified into 4 groups, i.e.: Normal Beans, Broken Beans, Fractured Beans, and Skin Damaged Beans. The model of classification used in this paper is the Multiclass Ensemble Least-Squares Support Vector Machine (MELS-SVM), a proposed improvement model of SVM using ensemble method in which the separate hyperplanes are obtained by least square approach and the multiclass procedure uses One-Against- All method. The result of our proposed model showed that the classification with morphological feature input parameters were accurately as 99.705% for the four classes, respectively.

Helical waves in easy-plane antiferromagnets

NASA Astrophysics Data System (ADS)

Semenov, Yuriy G.; Li, Xi-Lai; Xu, Xinyi; Kim, Ki Wook

2017-12-01

Effective spin torques can generate the Néel vector oscillations in antiferromagnets (AFMs). Here, it is theoretically shown that these torques applied at one end of a normal AFM strip can excite a helical type of spin wave in the strip whose properties are drastically different from characteristic spin waves. An analysis based on both a Néel vector dynamical equation and the micromagnetic simulation identifies the direction of magnetic anisotropy and the damping factor as the two key parameters determining the dynamics. Helical wave propagation requires the hard axis of the easy-plane AFM to be aligned with the traveling direction, while the damping limits its spatial extent. If the damping is neglected, the calculation leads to a uniform periodic domain wall structure. On the other hand, finite damping decelerates the helical wave rotation around the hard axis, ultimately causing stoppage of its propagation along the strip. With the group velocity staying close to spin-wave velocity at the wave front, the wavelength becomes correspondingly longer away from the excitation point. In a sufficiently short strip, a steady-state oscillation can be established whose frequency is controlled by the waveguide length as well as the excitation energy or torque.

Expression and Stability of Foreign Epitopes Introduced into 3A Nonstructural Protein of Foot-and-Mouth Disease Virus

PubMed Central

Li, Pinghua; Bai, Xingwen; Cao, Yimei; Han, Chenghao; Lu, Zengjun; Sun, Pu; Yin, Hong; Liu, Zaixin

2012-01-01

Foot-and-mouth disease virus (FMDV) is an aphthovirus that belongs to the Picornaviridae family and causes one of the most important animal diseases worldwide. The capacity of other picornaviruses to express foreign antigens has been extensively reported, however, little is known about FMDV. To explore the potential of FMDV as a viral vector, an 11-amino-acid (aa) HSV epitope and an 8 aa FLAG epitope were introduced into the C-terminal different regions of 3A protein of FMDV full-length infectious cDNA clone. Recombinant viruses expressing the HSV or FLAG epitope were successfully rescued after transfection of both modified constructs. Immunofluorescence assay, Western blot and sequence analysis showed that the recombinant viruses stably maintained the foreign epitopes even after 11 serial passages in BHK-21 cells. The 3A-tagged viruses shared similar plaque phenotypes and replication kinetics to those of the parental virus. In addition, mice experimentally infected with the epitope-tagged viruses could induce tag-specific antibodies. Our results demonstrate that FMDV can be used effectively as a viral vector for the delivery of foreign tags. PMID:22848509

Improving near-infrared prediction model robustness with support vector machine regression: a pharmaceutical tablet assay example.

PubMed

Igne, Benoît; Drennen, James K; Anderson, Carl A

2014-01-01

Changes in raw materials and process wear and tear can have significant effects on the prediction error of near-infrared calibration models. When the variability that is present during routine manufacturing is not included in the calibration, test, and validation sets, the long-term performance and robustness of the model will be limited. Nonlinearity is a major source of interference. In near-infrared spectroscopy, nonlinearity can arise from light path-length differences that can come from differences in particle size or density. The usefulness of support vector machine (SVM) regression to handle nonlinearity and improve the robustness of calibration models in scenarios where the calibration set did not include all the variability present in test was evaluated. Compared to partial least squares (PLS) regression, SVM regression was less affected by physical (particle size) and chemical (moisture) differences. The linearity of the SVM predicted values was also improved. Nevertheless, although visualization and interpretation tools have been developed to enhance the usability of SVM-based methods, work is yet to be done to provide chemometricians in the pharmaceutical industry with a regression method that can supplement PLS-based methods.

Formation and characterization of perpendicular mode Si ripples by glancing angle O{sub 2}{sup +} sputtering at room temperature

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mollick, S. A.; Ghose, D.

Off-normal low energy ion beam sputtering of solid surfaces often leads to morphological instabilities resulting in the spontaneous formation of ripple structures in nanometer length scales. In the case of Si surfaces at ambient temperature, ripple formation is found to take place normally at lower incident angles with the wave vector parallel to the ion beam direction. The absence of ripple pattern on Si surface at larger angles is due to the dominance of ion beam polishing effect. We have shown that a gentle chemical roughening of the starting surface morphology can initiate ripple pattern under grazing incidence ion beammore » sputtering (theta>64 deg. with respect to the surface normal), where the ripple wave vector is perpendicular to the ion beam direction. The characteristics of the perpendicular mode ripples are studied as a function of pristine surface roughness (2-30 nm) and projectile fluence (5x10{sup 16}-1.5x10{sup 18} O atoms cm{sup -2}). The quality of the morphological structure is assessed from the analysis of ion induced topological defects.« less

In Vivo Fate of Carbon Nanotubes with Different Physicochemical Properties for Gene Delivery Applications.

PubMed

Cifuentes-Rius, Anna; Boase, Nathan R B; Font, Ines; Coronas, Nuria; Ramos-Perez, Victor; Thurecht, Kristofer J; Borrós, Salvador

2017-04-05

Gene therapy has arisen as a pioneering technique to treat diseases by direct employment of nucleic acids as medicine. The major historical problem is to develop efficient and safe systems for the delivery of therapeutic genes into the target cells. Carbon nanotubes (CNTs) have demonstrated considerable promise as delivery vectors due to their (i) high aspect ratio and (ii) capacity to translocate through plasma membranes, known as the nanoneedle effect. To leverage these advantages, close attention needs to be paid to the physicochemical characteristics of the CNTs used. CNTs with different diameters (thinner and thicker) were treated by chemical oxidation to produce shorter fragments. Rigid (thick) and flexible (thin) CNTs, and their shortened versions, were coated with polyallylamine (ppAA) by plasma-enhanced chemical vapor deposition. The ppAA coating leads to a positively charged CNT surface that is able to electrostatically bind the green fluorescent protein plasmid reporter. This study shows how rigidity and length can affect their (i) behavior in biological media, (ii) ability to transfect in vitro, and (iii) biodistribution in vivo. This study also generates a set of basic design rules for the development of more efficient CNT-based gene-delivery vectors.

Superposition of nonparaxial vectorial complex-source spherically focused beams: Axial Poynting singularity and reverse propagation

NASA Astrophysics Data System (ADS)

Mitri, F. G.

2016-08-01

In this work, counterintuitive effects such as the generation of an axial (i.e., long the direction of wave motion) zero-energy flux density (i.e., axial Poynting singularity) and reverse (i.e., negative) propagation of nonparaxial quasi-Gaussian electromagnetic (EM) beams are examined. Generalized analytical expressions for the EM field's components of a coherent superposition of two high-order quasi-Gaussian vortex beams of opposite handedness and different amplitudes are derived based on the complex-source-point method, stemming from Maxwell's vector equations and the Lorenz gauge condition. The general solutions exhibiting unusual effects satisfy the Helmholtz and Maxwell's equations. The EM beam components are characterized by nonzero integer degree and order (n ,m ) , respectively, an arbitrary waist w0, a diffraction convergence length known as the Rayleigh range zR, and a weighting (real) factor 0 ≤α ≤1 that describes the transition of the beam from a purely vortex (α =0 ) to a nonvortex (α =1 ) type. An attractive feature for this superposition is the description of strongly focused (or strongly divergent) wave fields. Computations of the EM power density as well as the linear and angular momentum density fluxes illustrate the analysis with particular emphasis on the polarization states of the vector potentials forming the beams and the weight of the coherent beam superposition causing the transition from the vortex to the nonvortex type. Should some conditions determined by the polarization state of the vector potentials and the beam parameters be met, an axial zero-energy flux density is predicted in addition to a negative retrograde propagation effect. Moreover, rotation reversal of the angular momentum flux density with respect to the beam handedness is anticipated, suggesting the possible generation of negative (left-handed) torques. The results are particularly useful in applications involving the design of strongly focused optical laser tweezers, tractor beams, optical spanners, arbitrary scattering, radiation force, angular momentum, and torque in particle manipulation, and other related topics.

Temporal Comparison Between NIRS and EEG Signals During a Mental Arithmetic Task Evaluated with Self-Organizing Maps.

PubMed

Oyama, Katsunori; Sakatani, Kaoru

2016-01-01

Simultaneous monitoring of brain activity with near-infrared spectroscopy and electroencephalography allows spatiotemporal reconstruction of the hemodynamic response regarding the concentration changes in oxyhemoglobin and deoxyhemoglobin that are associated with recorded brain activity such as cognitive functions. However, the accuracy of state estimation during mental arithmetic tasks is often different depending on the length of the segment for sampling of NIRS and EEG signals. This study compared the results of a self-organizing map and ANOVA, which were both used to assess the accuracy of state estimation. We conducted an experiment with a mental arithmetic task performed by 10 participants. The lengths of the segment in each time frame for observation of NIRS and EEG signals were compared with the 30-s, 1-min, and 2-min segment lengths. The optimal segment lengths were different for NIRS and EEG signals in the case of classification of feature vectors into the states of performing a mental arithmetic task and being at rest.

Vector wind profile gust model

NASA Technical Reports Server (NTRS)

Adelfang, S. I.

1981-01-01

To enable development of a vector wind gust model suitable for orbital flight test operations and trade studies, hypotheses concerning the distributions of gust component variables were verified. Methods for verification of hypotheses that observed gust variables, including gust component magnitude, gust length, u range, and L range, are gamma distributed and presented. Observed gust modulus has been drawn from a bivariate gamma distribution that can be approximated with a Weibull distribution. Zonal and meridional gust components are bivariate gamma distributed. An analytical method for testing for bivariate gamma distributed variables is presented. Two distributions for gust modulus are described and the results of extensive hypothesis testing of one of the distributions are presented. The validity of the gamma distribution for representation of gust component variables is established.

Vector wind profile gust model

NASA Technical Reports Server (NTRS)

Adelfang, S. I.

1979-01-01

Work towards establishing a vector wind profile gust model for the Space Transportation System flight operations and trade studies is reported. To date, all the statistical and computational techniques required were established and partially implemented. An analysis of wind profile gust at Cape Kennedy within the theoretical framework is presented. The variability of theoretical and observed gust magnitude with filter type, altitude, and season is described. Various examples are presented which illustrate agreement between theoretical and observed gust percentiles. The preliminary analysis of the gust data indicates a strong variability with altitude, season, and wavelength regime. An extension of the analyses to include conditional distributions of gust magnitude given gust length, distributions of gust modulus, and phase differences between gust components has begun.

Focusing properties of cylindrical vector vortex beams

NASA Astrophysics Data System (ADS)

Xiaoqiang, Zhang; Ruishan, Chen; Anting, Wang

2018-05-01

In this paper, following Richards and Wolf vectorial diffraction theory, the focusing properties of cylindrical vector vortex beams (CVVB) are investigated, and a diffractive optical element (DOE) is designed to spatially modulate the amplitude of the CVVB. Simulated results show that the CVVB focused by an objective also carry orbital angular momentum (OAM), and the optical fields near the focal region can be modulated by changing the topological charge of the CVVB. We numerically simulate the focus properties of radially and azimuthally polarized beams with topological charge equal to 0, 1, 2 and 10 respectively. As a result, a dark channel with a length about 20 λ can be obtained. These new properties have the potential applications such as particle acceleration, optical trapping and material processing.

Functional role of the N-terminal domain of ΔFosB in response to stress and drugs of abuse.

PubMed

Ohnishi, Y N; Ohnishi, Y H; Vialou, V; Mouzon, E; LaPlant, Q; Nishi, A; Nestler, E J

2015-01-22

Previous work has implicated the transcription factor, ΔFosB, acting in the nucleus accumbens, in mediating the pro-rewarding effects of drugs of abuse such as cocaine as well as in mediating resilience to chronic social stress. However, the transgenic and viral gene transfer models used to establish these ΔFosB phenotypes express, in addition to ΔFosB, an alternative translation product of ΔFosB mRNA, termed Δ2ΔFosB, which lacks the N-terminal 78 aa present in ΔFosB. To study the possible contribution of Δ2ΔFosB to these drug and stress phenotypes, we prepared a viral vector that overexpresses a point mutant form of ΔFosB mRNA which cannot undergo alternative translation as well as a vector that overexpresses Δ2ΔFosB alone. Our results show that the mutant form of ΔFosB, when overexpressed in the nucleus accumbens, reproduces the enhancement of reward and of resilience seen with our earlier models, with no effects seen for Δ2ΔFosB. Overexpression of full length FosB, the other major product of the FosB gene, also has no effect. These findings confirm the unique role of ΔFosB in the nucleus accumbens in controlling responses to drugs of abuse and stress. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

An Investigation of the Elements which Contribute to Statical and Dynamical Stability, and of the Effects of Variation in Those Elements

NASA Technical Reports Server (NTRS)

Klemin, Alexander; Warner, Edward P; Denkinger, George M

1918-01-01

Part 1 gives details of models tested and methods of testing of the Eiffel 36 wing alone and the JN2 aircraft. Characteristics and performance curves for standard JN are included. Part 2 presents a statistical analysis of the following: lift and drag contributed by body and chassis tested without wings; lift and drag contributed by tail, tested without wings; the effect on lift and drift of interference between the wings of a biplane combination; lift and drag contributed by the addition of body, chassis, and tail to a biplane combination; total parasite resistance; effect of varying size of tail, keeping angle of setting constant; effect of varying length of body and size of tail at the same time, keeping constant moment of tail surface about the center of gravity; forces on the tail and the effects of downwash; effect of size and setting of tail on statical longitudinal stability effects of length of body on stability; the effects of the various elements of an airplane on longitudinal stability and the placing of the force vectors. Part 3 presents the fundamental principals of dynamical stability; computations of resistance derivatives; solution of the stability equation; dynamical stability of the Curtiss JN2; tabulation of resistance derivatives; discussion of the resistance derivatives; formation and solution of stability equations; physical conceptions of the resistance derivatives; elements contributing to damping and an investigation of low speed conditions. Part 4 includes a summary of the results of the statistical investigation and a summary of the results for dynamic stability.

Using rabies virus vaccine strain SRV9 as viral vector to express exogenous gene.

PubMed

Wang, Hualei; Jin, Hongli; Feng, Na; Zheng, Xuexing; Li, Ling; Qi, Yinglin; Liang, Meng; Zhao, Yongkun; Wang, Tiecheng; Gao, Yuwei; Tu, Changchun; Jin, Ningyi; Yang, Songtao; Xia, Xianzhu

2015-04-01

Rabies virus (RABV) can cause a fatal neurological disease in human and animals, and vaccines were generally applied for the immunoprophylaxis of rabies. Here, a recombinant viral vector carrying the exogenous gene expression component between phosphoprotein (P) and matrix protein (M) genes of RABV was constructed based on the vaccine strain SRV9 used in China. To develop a reverse genetic system, the full-length cDNA plasmids of SRV9 were constructed using the eukaryotic expression vector pCI or pcDNA3.1(+). However, recovery efficiency based on the pcDNA3.1 vector was significantly higher than that of the pCI vector. The exogenous gene expression component PE-PS-BsiWI-PmeI or PS-BsiWI-PmeI-PE was introduced in different locations between the P and M genes of SRV9. When the enhanced green fluorescent protein (eGFP) was used as a reporter gene, both locations could rescue recombinant RABV (rRABV) expressing eGFP with high efficiency. Characterization of rRABV expressing eGFP in vitro revealed that its growth was similar to that of the parental virus. Animal experiments showed that rRABV expressing eGFP could replicate and express eGFP in the brains of suckling mice. Furthermore, rRABV of SRV9 was nonpathogenic for 3-week-old mice and could be cleared from the central nervous system at 5 days post-inoculation. Our results showed that the recombinant SRV9 virus could be used as a useful viral vector for exogenous gene expression.

Insecticidal Effects on the Spatial Progression of Tomato Yellow Leaf Curl Virus and Movement of Its Whitefly Vector in Tomato.

PubMed

Dempsey, M; Riley, D G; Srinivasan, R

2017-06-01

Commercial management of whitefly-transmitted Tomato yellow leaf curl virus (TYLCV) typically relies on insecticide control of whitefly vectors as a first line of defense. We quantified this effect in crop tunnel studies, with validation in a tomato field setting. Tomato yellow leaf curl virus-infected and Bemisia tabaci (Gennadius)-infested source plants were planted at the beginning of tunneled rows to serve as inoculum source, so that movement of whiteflies and TYLCV symptoms could be tracked down the length of the tunnel over time. Tunnel study results showed that proximity to the source plant was a more important factor than insecticide treatments. Insecticide-treated tomato transplants did tend to suppress whitefly incidence and slowed TYLCV movement in comparison with the untreated check; however, tomato plants planted closer to the source plant had higher incidence of whiteflies and TYLCV infection, regardless of treatment. In a large tomato plot study with a controlled inoculum source, insecticide treatments significantly reduced the spread of TYLCV. When uninhibited by insecticide treatment, 80% of the TYLCV spread was restricted to <15 m from the source plant (<11 m in the validation study), with insecticide treatment generally reducing the distance and magnitude of this spread. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Syngeneic AAV pseudo-vectors potentiates full vector transduction

USDA-ARS?s Scientific Manuscript database

An excessive amount of empty capsids are generated during regular AAV vector production process. These pseudo-vectors often remain in final vectors used for animal studies or clinical trials. The potential effects of these pseudo-vectors on AAV transduction have been a major concern. In the current ...

Vector Addition: Effect of the Context and Position of the Vectors

NASA Astrophysics Data System (ADS)

Barniol, Pablo; Zavala, Genaro

2010-10-01

In this article we investigate the effect of: 1) the context, and 2) the position of the vectors, on 2D vector addition tasks. We administered a test to 512 students completing introductory physics courses at a private Mexican university. In the first part, we analyze students' responses in three isomorphic problems: displacements, forces, and no physical context. Students were asked to draw two vectors and the vector sum. We analyzed students' procedures detecting the difficulties when drawing the vector addition and proved that the context matters, not only compared to the context-free case but also between the contexts. In the second part, we analyze students' responses with three different arrangements of the sum of two vectors: tail-to-tail, head-to-tail and separated vectors. We compared the frequencies of the errors in the three different positions to deduce students' conceptions in the addition of vectors.

Deep Recurrent Neural Networks for Human Activity Recognition

PubMed Central

Murad, Abdulmajid

2017-01-01

Adopting deep learning methods for human activity recognition has been effective in extracting discriminative features from raw input sequences acquired from body-worn sensors. Although human movements are encoded in a sequence of successive samples in time, typical machine learning methods perform recognition tasks without exploiting the temporal correlations between input data samples. Convolutional neural networks (CNNs) address this issue by using convolutions across a one-dimensional temporal sequence to capture dependencies among input data. However, the size of convolutional kernels restricts the captured range of dependencies between data samples. As a result, typical models are unadaptable to a wide range of activity-recognition configurations and require fixed-length input windows. In this paper, we propose the use of deep recurrent neural networks (DRNNs) for building recognition models that are capable of capturing long-range dependencies in variable-length input sequences. We present unidirectional, bidirectional, and cascaded architectures based on long short-term memory (LSTM) DRNNs and evaluate their effectiveness on miscellaneous benchmark datasets. Experimental results show that our proposed models outperform methods employing conventional machine learning, such as support vector machine (SVM) and k-nearest neighbors (KNN). Additionally, the proposed models yield better performance than other deep learning techniques, such as deep believe networks (DBNs) and CNNs. PMID:29113103

Deep Recurrent Neural Networks for Human Activity Recognition.

PubMed

Murad, Abdulmajid; Pyun, Jae-Young

2017-11-06

Adopting deep learning methods for human activity recognition has been effective in extracting discriminative features from raw input sequences acquired from body-worn sensors. Although human movements are encoded in a sequence of successive samples in time, typical machine learning methods perform recognition tasks without exploiting the temporal correlations between input data samples. Convolutional neural networks (CNNs) address this issue by using convolutions across a one-dimensional temporal sequence to capture dependencies among input data. However, the size of convolutional kernels restricts the captured range of dependencies between data samples. As a result, typical models are unadaptable to a wide range of activity-recognition configurations and require fixed-length input windows. In this paper, we propose the use of deep recurrent neural networks (DRNNs) for building recognition models that are capable of capturing long-range dependencies in variable-length input sequences. We present unidirectional, bidirectional, and cascaded architectures based on long short-term memory (LSTM) DRNNs and evaluate their effectiveness on miscellaneous benchmark datasets. Experimental results show that our proposed models outperform methods employing conventional machine learning, such as support vector machine (SVM) and k-nearest neighbors (KNN). Additionally, the proposed models yield better performance than other deep learning techniques, such as deep believe networks (DBNs) and CNNs.

Mach Number effects on turbulent superstructures in wall bounded flows

NASA Astrophysics Data System (ADS)

Kaehler, Christian J.; Bross, Matthew; Scharnowski, Sven

2017-11-01

Planer and three-dimensional flow field measurements along a flat plat boundary layer in the Trisonic Wind Tunnel Munich (TWM) are examined with the aim to characterize the scaling, spatial organization, and topology of large scale turbulent superstructures in compressible flow. This facility is ideal for this investigation as the ratio of boundary layer thickness to test section spanwise extent ratio is around 1/25, ensuring minimal sidewall and corner effects on turbulent structures in the center of the test section. A major difficulty in the experimental investigation of large scale features is the mutual size of the superstructures which can extend over many boundary layer thicknesses. Using multiple PIV systems, it was possible to capture the full spatial extent of large-scale structures over a range of Mach numbers from Ma = 0.3 - 3. To calculate the average large-scale structure length and spacing, the acquired vector fields were analyzed by statistical multi-point methods that show large scale structures with a correlation length of around 10 boundary layer thicknesses over the range of Mach numbers investigated. Furthermore, the average spacing between high and low momentum structures is on the order of a boundary layer thicknesses. This work is supported by the Priority Programme SPP 1881 Turbulent Superstructures of the Deutsche Forschungsgemeinschaft.

A galactose-functionalized dendritic siRNA-nanovector to potentiate hepatitis C inhibition in liver cells

NASA Astrophysics Data System (ADS)

Lakshminarayanan, Abirami; Reddy, B. Uma; Raghav, Nallani; Ravi, Vijay Kumar; Kumar, Anuj; Maiti, Prabal K.; Sood, A. K.; Jayaraman, N.; Das, Saumitra

2015-10-01

A RNAi based antiviral strategy holds the promise to impede hepatitis C viral (HCV) infection overcoming the problem of emergence of drug resistant variants, usually encountered in the interferon free direct-acting antiviral therapy. Targeted delivery of siRNA helps minimize adverse `off-target' effects and maximize the efficacy of therapeutic response. Herein, we report the delivery of siRNA against the conserved 5'-untranslated region (UTR) of HCV RNA using a liver-targeted dendritic nano-vector functionalized with a galactopyranoside ligand (DG). Physico-chemical characterization revealed finer details of complexation of DG with siRNA, whereas molecular dynamic simulations demonstrated sugar moieties projecting ``out'' in the complex. Preferential delivery of siRNA to the liver was achieved through a highly specific ligand-receptor interaction between dendritic galactose and the asialoglycoprotein receptor. The siRNA-DG complex exhibited perinuclear localization in liver cells and co-localization with viral proteins. The histopathological studies showed the systemic tolerance and biocompatibility of DG. Further, whole body imaging and immunohistochemistry studies confirmed the preferential delivery of the nucleic acid to mice liver. Significant decrease in HCV RNA levels (up to 75%) was achieved in HCV subgenomic replicon and full length HCV-JFH1 infectious cell culture systems. The multidisciplinary approach provides the `proof of concept' for restricted delivery of therapeutic siRNAs using a target oriented dendritic nano-vector.A RNAi based antiviral strategy holds the promise to impede hepatitis C viral (HCV) infection overcoming the problem of emergence of drug resistant variants, usually encountered in the interferon free direct-acting antiviral therapy. Targeted delivery of siRNA helps minimize adverse `off-target' effects and maximize the efficacy of therapeutic response. Herein, we report the delivery of siRNA against the conserved 5'-untranslated region (UTR) of HCV RNA using a liver-targeted dendritic nano-vector functionalized with a galactopyranoside ligand (DG). Physico-chemical characterization revealed finer details of complexation of DG with siRNA, whereas molecular dynamic simulations demonstrated sugar moieties projecting ``out'' in the complex. Preferential delivery of siRNA to the liver was achieved through a highly specific ligand-receptor interaction between dendritic galactose and the asialoglycoprotein receptor. The siRNA-DG complex exhibited perinuclear localization in liver cells and co-localization with viral proteins. The histopathological studies showed the systemic tolerance and biocompatibility of DG. Further, whole body imaging and immunohistochemistry studies confirmed the preferential delivery of the nucleic acid to mice liver. Significant decrease in HCV RNA levels (up to 75%) was achieved in HCV subgenomic replicon and full length HCV-JFH1 infectious cell culture systems. The multidisciplinary approach provides the `proof of concept' for restricted delivery of therapeutic siRNAs using a target oriented dendritic nano-vector. Electronic supplementary information (ESI) available: Spectral data and experimental details. See DOI: 10.1039/c5nr02898a

[Effects of plant viruses on vector and non-vector herbivorous arthropods and their natural enemies: a mini review].

PubMed

He, Xiao-Chan; Xu, Hong-Xing; Zhou, Xiao-Jun; Zheng, Xu-Song; Sun, Yu-Jian; Yang, Ya-Jun; Tian, Jun-Ce; Lü, Zhong-Xian

2014-05-01

Plant viruses transmitted by arthropods, as an important biotic factor, may not only directly affect the yield and quality of host plants, and development, physiological characteristics and ecological performances of their vector arthropods, but also directly or indirectly affect the non-vector herbivorous arthropods and their natural enemies in the same ecosystem, thereby causing influences to the whole agro-ecosystem. This paper reviewed the progress on the effects of plant viruses on herbivorous arthropods, including vector and non-vector, and their natural enemies, and on their ecological mechanisms to provide a reference for optimizing the management of vector and non-vector arthropod populations and sustainable control of plant viruses in agro-ecosystem.

Spin-bowling in cricket re-visited: model trajectories for various spin-vector angles

NASA Astrophysics Data System (ADS)

Robinson, Garry; Robinson, Ian

2016-08-01

In this paper we investigate, via the calculation of model trajectories appropriate to slow bowling in cricket, the effects on the flight path of the ball before pitching due to changes in the angle of the spin-vector. This was accomplished by allowing the spin-vector to vary in three ways. Firstly, from off-spin, where the spin-vector points horizontally and directly down the pitch, to top-spin where it points horizontally towards the off-side of the pitch. Secondly, from off-spin to side-spin where, for side-spin, the spin-vector points vertically upwards. Thirdly, where the spin-vector points horizontally and at 45° to the pitch (in the general direction of ‘point’, as viewed by the bowler), and is varied towards the vertical, while maintaining the 45° angle in the horizontal plane. It is found that, as is well known, top-spin causes the ball to dip in flight, side-spin causes the ball to move side-ways in flight and, perhaps most importantly, off-spin can cause the ball to drift to the off-side of the pitch late in its flight as it begins to fall. At a more subtle level it is found that, if the total spin is kept constant and a small amount of top-spin is added to the ball at the expense of some off-spin, there is little change in the side-ways drift. However, a considerable reduction in the length at which the ball pitches occurs, ˜25 cm, an amount that batsmen can ignore at their peril. On the other hand, a small amount of side-spin introduced to a top-spin delivery does not alter the point of pitching significantly, but produces a considerable amount of side-ways drift, ˜10 cm or more. For pure side-spin the side-ways drift is up to ˜30 cm. When a side-spin component is added to the spin of a ball bowled with a mixture of off-spin and top-spin in equal proportions, significant movement occurs in both the side-ways direction and in the point of pitching, of the order of a few tens of centimetres.

Alteration of plant species assemblages can decrease the transmission potential of malaria mosquitoes.

PubMed

Ebrahimi, Babak; Jackson, Bryan T; Guseman, Julie L; Przybylowicz, Colin M; Stone, Christopher M; Foster, Woodbridge A

2018-03-01

Knowledge of the link between a vector population's pathogen-transmission potential and its biotic environment can generate more realistic forecasts of disease risk due to environmental change. It also can promote more effective vector control by both conventional and novel means.This study assessed the effect of particular plant species assemblages differing in nectar production on components of the vectorial capacity of the mosquito Anopheles gambiae s.s. , an important vector of African malaria.We followed cohorts of mosquitoes for three weeks in greenhouse mesocosms holding nectar-poor and nectar-rich plant species by tracking daily mortalities and estimating daily biting rates and fecundities. At death, a mosquito's insemination status and wing length were determined. These life history traits allowed incorporation of larval dynamics into a vectorial capacity estimate. This new study provided both novel assemblages of putative host plants and a human blood host within a nocturnal period of maximum biting.Survivorship was significantly greater in nectar-rich environments than nectar-poor ones, resulting in greater total fecundity. Daily biting rate and fecundity per female between treatments was not detected. These results translated to greater estimated vectorial capacities in the nectar-rich environment in all four replicates of the experiment (means: 1,089.5 ± 125.2 vs. 518.3 ± 60.6). When mosquito density was made a function of survival and fecundity, rather than held constant, the difference between plant treatments was more pronounced, but so was the variance, so differences were not statistically significant. In the nectar-poor environment, females' survival suffered severely when a blood host was not provided. A sugar-accessibility experiment confirmed that Parthenium hysterophorus is a nectar-poor plant for these mosquitoes. Synthesis and applications. This study, assessing the effect of particular plant species assemblages on the vectorial capacity of malaria mosquitoes, highlights the likelihood that changes in plant communities (e.g. due to introduction of exotic or nectar-rich species) can increase malaria transmission and that a reduction of favourable nectar sources can reduce it. Also, plant communities' data can be used to identify potential high risk areas. Further studies are warranted to explore how and when management of plant species assemblages should be considered as an option in an integrated vector management strategy.

Integrating Transgenic Vector Manipulation with Clinical Interventions to Manage Vector-Borne Diseases.

PubMed

Okamoto, Kenichi W; Gould, Fred; Lloyd, Alun L

2016-03-01

Many vector-borne diseases lack effective vaccines and medications, and the limitations of traditional vector control have inspired novel approaches based on using genetic engineering to manipulate vector populations and thereby reduce transmission. Yet both the short- and long-term epidemiological effects of these transgenic strategies are highly uncertain. If neither vaccines, medications, nor transgenic strategies can by themselves suffice for managing vector-borne diseases, integrating these approaches becomes key. Here we develop a framework to evaluate how clinical interventions (i.e., vaccination and medication) can be integrated with transgenic vector manipulation strategies to prevent disease invasion and reduce disease incidence. We show that the ability of clinical interventions to accelerate disease suppression can depend on the nature of the transgenic manipulation deployed (e.g., whether vector population reduction or replacement is attempted). We find that making a specific, individual strategy highly effective may not be necessary for attaining public-health objectives, provided suitable combinations can be adopted. However, we show how combining only partially effective antimicrobial drugs or vaccination with transgenic vector manipulations that merely temporarily lower vector competence can amplify disease resurgence following transient suppression. Thus, transgenic vector manipulation that cannot be sustained can have adverse consequences-consequences which ineffective clinical interventions can at best only mitigate, and at worst temporarily exacerbate. This result, which arises from differences between the time scale on which the interventions affect disease dynamics and the time scale of host population dynamics, highlights the importance of accounting for the potential delay in the effects of deploying public health strategies on long-term disease incidence. We find that for systems at the disease-endemic equilibrium, even modest perturbations induced by weak interventions can exhibit strong, albeit transient, epidemiological effects. This, together with our finding that under some conditions combining strategies could have transient adverse epidemiological effects suggests that a relatively long time horizon may be necessary to discern the efficacy of alternative intervention strategies.

Integrating Transgenic Vector Manipulation with Clinical Interventions to Manage Vector-Borne Diseases

PubMed Central

Okamoto, Kenichi W.; Gould, Fred; Lloyd, Alun L.

2016-01-01

Many vector-borne diseases lack effective vaccines and medications, and the limitations of traditional vector control have inspired novel approaches based on using genetic engineering to manipulate vector populations and thereby reduce transmission. Yet both the short- and long-term epidemiological effects of these transgenic strategies are highly uncertain. If neither vaccines, medications, nor transgenic strategies can by themselves suffice for managing vector-borne diseases, integrating these approaches becomes key. Here we develop a framework to evaluate how clinical interventions (i.e., vaccination and medication) can be integrated with transgenic vector manipulation strategies to prevent disease invasion and reduce disease incidence. We show that the ability of clinical interventions to accelerate disease suppression can depend on the nature of the transgenic manipulation deployed (e.g., whether vector population reduction or replacement is attempted). We find that making a specific, individual strategy highly effective may not be necessary for attaining public-health objectives, provided suitable combinations can be adopted. However, we show how combining only partially effective antimicrobial drugs or vaccination with transgenic vector manipulations that merely temporarily lower vector competence can amplify disease resurgence following transient suppression. Thus, transgenic vector manipulation that cannot be sustained can have adverse consequences—consequences which ineffective clinical interventions can at best only mitigate, and at worst temporarily exacerbate. This result, which arises from differences between the time scale on which the interventions affect disease dynamics and the time scale of host population dynamics, highlights the importance of accounting for the potential delay in the effects of deploying public health strategies on long-term disease incidence. We find that for systems at the disease-endemic equilibrium, even modest perturbations induced by weak interventions can exhibit strong, albeit transient, epidemiological effects. This, together with our finding that under some conditions combining strategies could have transient adverse epidemiological effects suggests that a relatively long time horizon may be necessary to discern the efficacy of alternative intervention strategies. PMID:26962871

An improved CS-LSSVM algorithm-based fault pattern recognition of ship power equipments.

PubMed

Yang, Yifei; Tan, Minjia; Dai, Yuewei

2017-01-01

A ship power equipments' fault monitoring signal usually provides few samples and the data's feature is non-linear in practical situation. This paper adopts the method of the least squares support vector machine (LSSVM) to deal with the problem of fault pattern identification in the case of small sample data. Meanwhile, in order to avoid involving a local extremum and poor convergence precision which are induced by optimizing the kernel function parameter and penalty factor of LSSVM, an improved Cuckoo Search (CS) algorithm is proposed for the purpose of parameter optimization. Based on the dynamic adaptive strategy, the newly proposed algorithm improves the recognition probability and the searching step length, which can effectively solve the problems of slow searching speed and low calculation accuracy of the CS algorithm. A benchmark example demonstrates that the CS-LSSVM algorithm can accurately and effectively identify the fault pattern types of ship power equipments.

The continuous spin representations of the Poincare and super-Poincare groups and their construction by the Inonu-Wigner group contraction

NASA Astrophysics Data System (ADS)

Khan, Abu M. A. S.

We study the continuous spin representation (CSR) of the Poincare group in arbitrary dimensions. In d dimensions, the CSRs are characterized by the length of the light-cone vector and the Dynkin labels of the SO(d-3) short little group which leaves the light-cone vector invariant. In addition to these, a solid angle Od-3 which specifies the direction of the light-cone vector is also required to label the states. We also find supersymmetric generalizations of the CSRs. In four dimensions, the supermultiplet contains one bosonic and one fermionic CSRs which transform into each other under the action of the supercharges. In a five dimensional case, the supermultiplet contains two bosonic and two fermionic CSRs which is like N = 2 supersymmetry in four dimensions. When constructed using Grassmann parameters, the light-cone vector becomes nilpotent. This makes the representation finite dimensional, but at the expense of introducing central charges even though the representation is massless. This leads to zero or negative norm states. The nilpotent constructions are valid only for even dimensions. We also show how the CSRs in four dimensions can be obtained from five dimensions by the combinations of Kaluza-Klein (KK) dimensional reduction and the Inonu-Wigner group contraction. The group contraction is a singular transformation. We show that the group contraction is equivalent to imposing periodic boundary condition along one direction and taking a double singular limit. In this form the contraction parameter is interpreted as the inverse KK radius. We apply this technique to both five dimensional regular massless and massive representations. For the regular massless case, we find that the contraction gives the CSR in four dimensions under a double singular limit and the representation wavefunction is the Bessel function. For the massive case, we use Majorana's infinite component theory as a model for the SO(4) little group. In this case, a triple singular limit is required to yield any CSR in four dimensions. The representation wavefunction is the Bessel function, as expected, but the scale factor is not the length of the light-cone vector. The amplitude and the scale factor are implicit functions of the parameter y which is a ratio of the internal and external coordinates. We also state under what conditions our solutions become identical to Wigner's solution.

A Gas-Kinetic Scheme for Turbulent Flow

DTIC Science & Technology

2014-09-19

is dΞ = dv1dv2dv3 dξ and: ψ = [ 1 v1 v2 v3 1 2 ( ui 2 + ξ2 )]T . (2) The numerical fluxes F related to a unit interface length normal to direction n... Rockets , 44(6):1232–1240. [Mandal and Deshpande, 1994] Mandal, J. and Desh- pande, S. (1994). Kinetic flux vector splitting for Euler equations. Comput

Field Trial Data Analysis and Testing (FiTAT) Tool

DTIC Science & Technology

2011-10-01

amplitude/phase pour chaque antenne du réseau) contenu dans les données acquises pourrait être faite par FiTAT et utilisé dans PAASoM pour déterminer...identity matrix, k is the loop gain, φ is the correlation matrix of the incident signals and T = [1 0 . . . 0]T . The length of vector T is equal to the

Development of a new vector using Soybean yellow common mosaic virus for gene function study or heterologous protein expression in soybeans.

PubMed

Lim, Seungmo; Nam, Moon; Kim, Kil Hyun; Lee, Su-Heon; Moon, Jung-Kyung; Lim, Hyoun-Sub; Choung, Myoung-Gun; Kim, Sang-Mok; Moon, Jae Sun

2016-02-01

A new vector using Soybean yellow common mosaic virus (SYCMV) was constructed for gene function study or heterologous protein expression in soybeans. The in vitro transcript with a 5' cap analog m7GpppG from an SYCMV full-length infectious vector driven by a T7 promoter infected soybeans (pSYCMVT7-full). The symptoms observed in the soybeans infected with either the sap from SYCMV-infected leaves or pSYCMVT7-full were indistinguishable, suggesting that the vector exhibits equivalent biological activity as the virus itself. To utilize the vector further, a DNA-based vector driven by the Cauliflower mosaic virus (CaMV) 35S promoter was constructed. The complete sequence of the SYCMV genome was inserted into a binary vector flanked by a CaMV 35S promoter at the 5' terminus of the SYCMV genome and a cis-cleaving ribozyme sequence followed by a nopaline synthase terminator at the 3' terminus of the SYCMV genome (pSYCMV-full). The SYCMV-derived vector was tested for use as a virus-induced gene silencing (VIGS) vector for the functional analysis of soybean genes. VIGS constructs containing either a fragment of the Phytoene desaturase (PDS) gene (pSYCMV-PDS1) or a fragment of the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (RbcS) gene (pSYCMV-RbcS2) were constructed. Plants infiltrated with each vector using the Agrobacterium-mediated inoculation method exhibited distinct symptoms, such as photo-bleaching in plants infiltrated with pSYCMV-PDS1 and yellow or pale green coloring in plants infiltrated with pSYCMV-RbcS2. In addition, down-regulation of the transcripts of the two target genes was confirmed via northern blot analysis. Particle bombardment and direct plasmid DNA rubbing were also confirmed as alternative inoculation methods. To determine if the SYCMV vector can be used for the expression of heterologous proteins in soybean plants, the vector encoding amino acids 135-160 of VP1 of Foot-and-mouth disease virus (FMDV) serotype O1 Campos (O1C) was constructed (pSYCMV-FMDV). Plants infiltrated with pSYCMV-FMDV were only detected via western blotting using the O1C antibody. Based on these results, we propose that the SYCMV-derived vector can be used for gene function study or expression of useful heterologous proteins in soybeans. Copyright © 2015 Elsevier B.V. All rights reserved.

Life history correlates of adult size in the malaria vector Anopheles darlingi.

PubMed

Lounibos, L P; Nishimura, N; Conn, J; Lourenço-de-Oliveira, R

1995-01-01

Adult dry weights of laboratory-reared Anopheles darlingi were highly correlated with wing lengths, which were used to estimate size variation in natural populations of this species. Significant differences in mean wing lengths of females trapped at baits were detected among collections in the same week at one site, but not between three sites in Brazil and Bolivia. Relatively higher variability of wing lengths, compared to collections of other Anopheles (Nyssorhynchus), and platykurtic size distributions in large, single-night collections suggested that An. darlingi females caught at baits emerged from heterogenous larval habitats. No relationship was detected between parous state and the body size of wild-caught females. Adult males and females of laboratory-reared An. darlingi did not differ in body size. This absence of sexual size dimorphism is rare among mosquitoes and has not been noted previously in the genus Anopheles.

Small Angle Neutron Scattering Observation of Chain Retraction after a Large Step Deformation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blanchard, A.; Heinrich, M.; Pyckhout-Hintzen, W.

The process of retraction in entangled linear chains after a fast nonlinear stretch was detected from time-resolved but quenched small angle neutron scattering (SANS) experiments on long, well-entangled polyisoprene chains. The statically obtained SANS data cover the relevant time regime for retraction, and they provide a direct, microscopic verification of this nonlinear process as predicted by the tube model. Clear, quantitative agreement is found with recent theories of contour length fluctuations and convective constraint release, using parameters obtained mainly from linear rheology. The theory captures the full range of scattering vectors once the crossover to fluctuations on length scales belowmore » the tube diameter is accounted for.« less

A vector fetal magnetocardiogram system with high sensitivity

NASA Astrophysics Data System (ADS)

Kandori, Akihiko; Miyashita, Tsuyoshi; Tsukada, Keiji; Horigome, Hitoshi; Asaka, Mitsuhiro; Shigemitsu, Sadahiko; Takahashi, Miho; Terada, Yasushi; Mitsui, Toshio; Chiba, Yoshihide

1999-12-01

The vector fetal magnetocardiogram (V-FMCG) system that measures the three orthogonal components of the magnetic field from a fetal heart has been developed to clearly observe fetal cardiac activity during pregnancy by using the superconducting quantum interference device. To detect a clear V-FMCG signal, the bottom of the cryostat was made of thin glass-fiber-reinforced plastic and the total length between the pickup coil to the outer surface is 12 mm. Because the cryostat bottom was made thinner, the area of the cryostat's top and bottom could be made smaller, thus a low evaporation loss (<1.2 l per day) and a long refilling interval (>10 days) were obtained. The gantry was able to tilt the cryostat and the bed could move in three axis directions, which made it possible to easily locate the vector pickup coil at an optimum position to obtain the maximum magnetic field from a fetal heart. We obtained V-FMCGs from 21 normal fetuses with gestation periods of 27-38 weeks. Using these vector signals, the dipoles were estimated and the relationship between the strength of the dipole moments and the number of gestation weeks could be obtained. Thus, V-FMCG seems to represent a new noninvasive tool for clearly detecting the electrophysiological activity of a fetal heart.

Solar Flare Prediction Model with Three Machine-learning Algorithms using Ultraviolet Brightening and Vector Magnetograms

NASA Astrophysics Data System (ADS)

Nishizuka, N.; Sugiura, K.; Kubo, Y.; Den, M.; Watari, S.; Ishii, M.

2017-02-01

We developed a flare prediction model using machine learning, which is optimized to predict the maximum class of flares occurring in the following 24 hr. Machine learning is used to devise algorithms that can learn from and make decisions on a huge amount of data. We used solar observation data during the period 2010-2015, such as vector magnetograms, ultraviolet (UV) emission, and soft X-ray emission taken by the Solar Dynamics Observatory and the Geostationary Operational Environmental Satellite. We detected active regions (ARs) from the full-disk magnetogram, from which ˜60 features were extracted with their time differentials, including magnetic neutral lines, the current helicity, the UV brightening, and the flare history. After standardizing the feature database, we fully shuffled and randomly separated it into two for training and testing. To investigate which algorithm is best for flare prediction, we compared three machine-learning algorithms: the support vector machine, k-nearest neighbors (k-NN), and extremely randomized trees. The prediction score, the true skill statistic, was higher than 0.9 with a fully shuffled data set, which is higher than that for human forecasts. It was found that k-NN has the highest performance among the three algorithms. The ranking of the feature importance showed that previous flare activity is most effective, followed by the length of magnetic neutral lines, the unsigned magnetic flux, the area of UV brightening, and the time differentials of features over 24 hr, all of which are strongly correlated with the flux emergence dynamics in an AR.

Enhancement or inhibition of PLCγ2 expression in rat hepatocytes by recombinant adenoviral vectors that contain full-length gene or siRNA.

PubMed

Chen, X G; Liu, Y M; Lv, Q X; Ma, J

2017-01-01

We investigated the effects of recombinant adenovirus vectors that overexpress or silence PLCγ2 on the expression of this gene during hepatocyte proliferation. Hepatocytes were isolated, identified by immunofluorescent cytochemical staining and infected by previously constructed Ad-PLCγ2 and Ad-PLCγ2 siRNA1, siRNA2 and siRNA3. Green fluorescent protein (GFP) expression was observed by fluorescence microscopy. Infection percentage was calculated by flow cytometry. mRNA and protein levels of PLCγ2 were detected by quantitative reverse transcription-PCR (qRT-PCR) and western blotting, respectively. The viability of the infected hepatocytes was measured by 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. We found that nearly 97% of cells were positive for the hepatocyte marker, CK18. After infection of Ad-PLCγ2 and Ad-PLCγ2 siRNA, more than 99% of hepatocytes expressed GFP significantly, and mRNA and protein expression of PLCγ2 was up-regulated significantly in Ad-PLCγ2 infected hepatocytes, but down-regulated in Ad-PLCγ2 siRNA2 infected cells. The cell proliferation rate decreased in PLCγ2-overexpressing cells, while the rate increased in PLCγ2-silencing cells. We verified that recombinant Ad-PLCγ2 and Ad-PLCγ2 siRNA2 were constructed successfully. These two recombinant vectors promoted or decreased the expression of PLCγ2 in rat hepatocytes and affected the cell proliferation rate, which provides a useful tool for further investigation of the role of PLCγ2 in hepatocyte apoptosis.

Solar Flare Prediction Model with Three Machine-learning Algorithms using Ultraviolet Brightening and Vector Magnetograms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishizuka, N.; Kubo, Y.; Den, M.

We developed a flare prediction model using machine learning, which is optimized to predict the maximum class of flares occurring in the following 24 hr. Machine learning is used to devise algorithms that can learn from and make decisions on a huge amount of data. We used solar observation data during the period 2010–2015, such as vector magnetograms, ultraviolet (UV) emission, and soft X-ray emission taken by the Solar Dynamics Observatory and the Geostationary Operational Environmental Satellite . We detected active regions (ARs) from the full-disk magnetogram, from which ∼60 features were extracted with their time differentials, including magnetic neutralmore » lines, the current helicity, the UV brightening, and the flare history. After standardizing the feature database, we fully shuffled and randomly separated it into two for training and testing. To investigate which algorithm is best for flare prediction, we compared three machine-learning algorithms: the support vector machine, k-nearest neighbors (k-NN), and extremely randomized trees. The prediction score, the true skill statistic, was higher than 0.9 with a fully shuffled data set, which is higher than that for human forecasts. It was found that k-NN has the highest performance among the three algorithms. The ranking of the feature importance showed that previous flare activity is most effective, followed by the length of magnetic neutral lines, the unsigned magnetic flux, the area of UV brightening, and the time differentials of features over 24 hr, all of which are strongly correlated with the flux emergence dynamics in an AR.« less

AllergenFP: allergenicity prediction by descriptor fingerprints.

PubMed

Dimitrov, Ivan; Naneva, Lyudmila; Doytchinova, Irini; Bangov, Ivan

2014-03-15

Allergenicity, like antigenicity and immunogenicity, is a property encoded linearly and non-linearly, and therefore the alignment-based approaches are not able to identify this property unambiguously. A novel alignment-free descriptor-based fingerprint approach is presented here and applied to identify allergens and non-allergens. The approach was implemented into a four step algorithm. Initially, the protein sequences are described by amino acid principal properties as hydrophobicity, size, relative abundance, helix and β-strand forming propensities. Then, the generated strings of different length are converted into vectors with equal length by auto- and cross-covariance (ACC). The vectors were transformed into binary fingerprints and compared in terms of Tanimoto coefficient. The approach was applied to a set of 2427 known allergens and 2427 non-allergens and identified correctly 88% of them with Matthews correlation coefficient of 0.759. The descriptor fingerprint approach presented here is universal. It could be applied for any classification problem in computational biology. The set of E-descriptors is able to capture the main structural and physicochemical properties of amino acids building the proteins. The ACC transformation overcomes the main problem in the alignment-based comparative studies arising from the different length of the aligned protein sequences. The conversion of protein ACC values into binary descriptor fingerprints allows similarity search and classification. The algorithm described in the present study was implemented in a specially designed Web site, named AllergenFP (FP stands for FingerPrint). AllergenFP is written in Python, with GIU in HTML. It is freely accessible at http://ddg-pharmfac.net/Allergen FP. idoytchinova@pharmfac.net or ivanbangov@shu-bg.net.

A heterologous prime-boosting strategy with replicating Vaccinia virus vectors and plant-produced HIV-1 Gag/dgp41 virus-like particles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meador, Lydia R.

Showing modest efficacy, the RV144 HIV-1 vaccine clinical trial utilized a non-replicating canarypox viral vector and a soluble gp120 protein boost. Here we built upon the RV144 strategy by developing a novel combination of a replicating, but highly-attenuated Vaccinia virus vector, NYVAC-KC, and plant-produced HIV-1 virus-like particles (VLPs). Both components contained the full-length Gag and a membrane anchored truncated gp41 presenting the membrane proximal external region with its conserved broadly neutralizing epitopes in the pre-fusion conformation. We tested different prime/boost combinations of these components in mice and showed that the group primed with NYVAC-KC and boosted with both the viralmore » vectors and plant-produced VLPs have the most robust Gag-specific CD8 T cell responses, at 12.7% of CD8 T cells expressing IFN-γ in response to stimulation with five Gag epitopes. The same immunization group elicited the best systemic and mucosal antibody responses to Gag and dgp41 with a bias towards IgG1. - Highlights: • We devised a prime/boost anti HIV-1 vaccination strategy modeled after RV144. • We used plant-derived virus-like particles (VLPs) consisting of Gag and dgp41. • We used attenuated, replicating vaccinia virus vectors expressing the same antigens. • The immunogens elicited strong cellular and humoral immune responses.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gokumakulapalle, Madhuri; Mei, Ya-Fang, E-mail: ya-fang.mei@umu.se

The use of continuous cell lines derived from the African green monkey kidney (AGMK) has led to major advances in virus vaccine development. However, to date, these cells have not been used to facilitate the creation of human adenoviruses because most human adenoviruses undergo abortive infections in them. Here, we report the susceptibility of AGMK-derived cells to adenovirus 11p (Ad11p) infection. First, we showed that CD46 molecules, which act as receptors for Ad11p, are expressed in AGMK cells. We then monitored Ad11p replication by measuring GFP expression as an indicator of viral transcription. We found that AGMK-derived cells were asmore » capable as carcinoma cells at propagating full-length replication-competent Ad11p (RCAd11p) DNA. Of the AGMK cell lines tested, Vero cells had the greatest capacity for adenovirus production. Thus, AGMK cells can be used to evaluate RCAd11p-mediated gene delivery, and Vero cells can be used for the production of RCAd11pGFP vectors at relatively high yields. - Highlights: • Africa green monkey cell lines were monitored for human adenovirus 11p GFP vector infection. • Human CD46 molecules were detectable in these monkey cell lines. • Adenovirus 11p GFP vector can be propagated in Vero cells increases the safety of Ad11p-based vectors for clinical trials. • To use Vero cells for preparation of Ad11p vector avoids the potential inclusion of oncogenes from tumor cells.« less

Visualization and Analysis of Geology Word Vectors for Efficient Information Extraction

NASA Astrophysics Data System (ADS)

Floyd, J. S.

2016-12-01

When a scientist begins studying a new geographic region of the Earth, they frequently begin by gathering relevant scientific literature in order to understand what is known, for example, about the region's geologic setting, structure, stratigraphy, and tectonic and environmental history. Experienced scientists typically know what keywords to seek and understand that if a document contains one important keyword, then other words in the document may be important as well. Word relationships in a document give rise to what is known in linguistics as the context-dependent nature of meaning. For example, the meaning of the word `strike' in geology, as in the strike of a fault, is quite different from its popular meaning in baseball. In addition, word order, such as in the phrase `Cretaceous-Tertiary boundary,' often corresponds to the order of sequences in time or space. The context of words and the relevance of words to each other can be derived quantitatively by machine learning vector representations of words. Here we show the results of training a neural network to create word vectors from scientific research papers from selected rift basins and mid-ocean ridges: the Woodlark Basin of Papua New Guinea, the Hess Deep rift, and the Gulf of Mexico basin. The word vectors are statistically defined by surrounding words within a given window, limited by the length of each sentence. The word vectors are analyzed by their cosine distance to related words (e.g., `axial' and `magma'), classified by high dimensional clustering, and visualized by reducing the vector dimensions and plotting the vectors on a two- or three-dimensional graph. Similarity analysis of `Triassic' and `Cretaceous' returns `Jurassic' as the nearest word vector, suggesting that the model is capable of learning the geologic time scale. Similarity analysis of `basalt' and `minerals' automatically returns mineral names such as `chlorite', `plagioclase,' and `olivine.' Word vector analysis and visualization allow one to extract information from hundreds of papers or more and find relationships in less time than it would take to read all of the papers. As machine learning tools become more commonly available, more and more scientists will be able to use and refine these tools for their individual needs.

Climate change and vector-borne diseases of public health significance.

PubMed

Ogden, Nicholas H

2017-10-16

There has been much debate as to whether or not climate change will have, or has had, any significant effect on risk from vector-borne diseases. The debate on the former has focused on the degree to which occurrence and levels of risk of vector-borne diseases are determined by climate-dependent or independent factors, while the debate on the latter has focused on whether changes in disease incidence are due to climate at all, and/or are attributable to recent climate change. Here I review possible effects of climate change on vector-borne diseases, methods used to predict these effects and the evidence to date of changes in vector-borne disease risks that can be attributed to recent climate change. Predictions have both over- and underestimated the effects of climate change. Mostly under-estimations of effects are due to a focus only on direct effects of climate on disease ecology while more distal effects on society's capacity to control and prevent vector-borne disease are ignored. There is increasing evidence for possible impacts of recent climate change on some vector-borne diseases but for the most part, observed data series are too short (or non-existent), and impacts of climate-independent factors too great, to confidently attribute changing risk to climate change. © Crown copyright 2017.

Vectorization efforts to increase Gram-negative intracellular drug concentration: a case study on HldE-K inhibitors.

PubMed

Atamanyuk, Dmytro; Faivre, Fabien; Oxoby, Mayalen; Ledoussal, Benoit; Drocourt, Elodie; Moreau, François; Gerusz, Vincent

2013-03-14

In this paper, we present different strategies to vectorize HldE kinase inhibitors with the goal to improve their gram-negative intracellular concentration. Syntheses and biological effects of siderophoric, aminoglycosidic, amphoteric, and polycationic vectors are discussed. While siderophoric and amphoteric vectorization efforts proved to be disappointing in this series, aminoglycosidic and polycationic vectors were able for the first time to achieve synergistic effects of our inhibitors with erythromycin. Although these effects proved to be nonspecific, this study provides information about the required stereoelectronic arrangement of the polycationic amines and their basicity requirements to fulfill outer membrane destabilization resulting in better erythromycin synergies.

Packaging of HCV-RNA into lentiviral vector

DOE Office of Scientific and Technical Information (OSTI.GOV)

Caval, Vincent; Piver, Eric; Service de Biochimie et Biologie Moleculaire, CHRU de Tours

2011-11-04

Highlights: Black-Right-Pointing-Pointer Description of HCV-RNA Core-D1 interactions. Black-Right-Pointing-Pointer In vivo evaluation of the packaging of HCV genome. Black-Right-Pointing-Pointer Determination of the role of the three basic sub-domains of D1. Black-Right-Pointing-Pointer Heterologous system involving HIV-1 vector particles to mobilise HCV genome. Black-Right-Pointing-Pointer Full length mobilisation of HCV genome and HCV-receptor-independent entry. -- Abstract: The advent of infectious molecular clones of Hepatitis C virus (HCV) has unlocked the understanding of HCV life cycle. However, packaging of the genomic RNA, which is crucial to generate infectious viral particles, remains poorly understood. Molecular interactions of the domain 1 (D1) of HCV Core protein andmore » HCV RNA have been described in vitro. Since compaction of genetic information within HCV genome has hampered conventional mutational approach to study packaging in vivo, we developed a novel heterologous system to evaluate the interactions between HCV RNA and Core D1. For this, we took advantage of the recruitment of Vpr fusion-proteins into HIV-1 particles. By fusing HCV Core D1 to Vpr we were able to package and transfer a HCV subgenomic replicon into a HIV-1 based lentiviral vector. We next examined how deletion mutants of basic sub-domains of Core D1 influenced HCV RNA recruitment. The results emphasized the crucial role of the first and third basic regions of D1 in packaging. Interestingly, the system described here allowed us to mobilise full-length JFH1 genome in CD81 defective cells, which are normally refractory to HCV infection. This finding paves the way to an evaluation of the replication capability of HCV in various cell types.« less

An efficient and portable SIMD algorithm for charge/current deposition in Particle-In-Cell codes

NASA Astrophysics Data System (ADS)

Vincenti, H.; Lobet, M.; Lehe, R.; Sasanka, R.; Vay, J.-L.

2017-01-01

In current computer architectures, data movement (from die to network) is by far the most energy consuming part of an algorithm (≈ 20 pJ/word on-die to ≈10,000 pJ/word on the network). To increase memory locality at the hardware level and reduce energy consumption related to data movement, future exascale computers tend to use many-core processors on each compute nodes that will have a reduced clock speed to allow for efficient cooling. To compensate for frequency decrease, machine vendors are making use of long SIMD instruction registers that are able to process multiple data with one arithmetic operator in one clock cycle. SIMD register length is expected to double every four years. As a consequence, Particle-In-Cell (PIC) codes will have to achieve good vectorization to fully take advantage of these upcoming architectures. In this paper, we present a new algorithm that allows for efficient and portable SIMD vectorization of current/charge deposition routines that are, along with the field gathering routines, among the most time consuming parts of the PIC algorithm. Our new algorithm uses a particular data structure that takes into account memory alignment constraints and avoids gather/scatter instructions that can significantly affect vectorization performances on current CPUs. The new algorithm was successfully implemented in the 3D skeleton PIC code PICSAR and tested on Haswell Xeon processors (AVX2-256 bits wide data registers). Results show a factor of × 2 to × 2.5 speed-up in double precision for particle shape factor of orders 1- 3. The new algorithm can be applied as is on future KNL (Knights Landing) architectures that will include AVX-512 instruction sets with 512 bits register lengths (8 doubles/16 singles).

Anti-hIgE gene therapy of peanut-induced anaphylaxis in a humanized murine model of peanut allergy.

PubMed

Pagovich, Odelya E; Wang, Bo; Chiuchiolo, Maria J; Kaminsky, Stephen M; Sondhi, Dolan; Jose, Clarisse L; Price, Christina C; Brooks, Sarah F; Mezey, Jason G; Crystal, Ronald G

2016-12-01

Peanuts are the most common food to provoke fatal or near-fatal anaphylactic reactions. Treatment with an anti-hIgE mAb is efficacious but requires frequent parenteral administration. Based on the knowledge that peanut allergy is mediated by peanut-specific IgE, we hypothesized that a single administration of an adeno-associated virus (AAV) gene transfer vector encoding for anti-hIgE would protect against repeated peanut exposure in the host with peanut allergy. We developed a novel humanized murine model of peanut allergy that recapitulates the human anaphylactic response to peanuts in NOD-scid IL2Rgamma null mice transferred with blood mononuclear cells from donors with peanut allergy and then sensitized with peanut extract. As therapy, we constructed an adeno-associated rh.10 serotype vector coding for a full-length, high-affinity, anti-hIgE antibody derived from the Fab fragment of the anti-hIgE mAb omalizumab (AAVrh.10anti-hIgE). In the reconstituted mice peanut-specific IgE was induced by peanut sensitization and hypersensitivity, and reactions were provoked by feeding peanuts to mice with symptoms similar to those of human subjects with peanut allergy. A single administration of AAVrh.10anti-hIgE vector expressed persistent levels of anti-hIgE. The anti-hIgE vector, administered either before sensitization or after peanut sensitization and manifestation of the peanut-induced phenotype, blocked IgE-mediated alterations in peanut-induced histamine release, anaphylaxis scores, locomotor activity, and free IgE levels and protected animals from death caused by anaphylaxis. If this degree of persistent efficacy translates to human subjects, AAVrh.10anti-hIgE could be an effective 1-time preventative therapy for peanut allergy and possibly other severe, IgE-mediated allergies. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

[Construction and function identification of luciferase reporter gene vectors containing SNPs in NFKBIA gene 3'UTR].

PubMed

Yang, Shuo; Li, Jia-li; Bi, Hui-chang; Zhou, Shou-ning; Liu, Xiao-man; Zeng, Hang; Hu, Bing-fang; Huang, Min

2016-01-01

This study aims to investigate the function of two SNPs (rs8904C > T and rs696G >A) in 3' untranslated region (3'UTR) of NFKBIA gene by constructing luciferase reporter gene. A patient's genomic DNA with rs8904 CC and rs696 GA genotype was used as the PCR template. Full-length 3'UTR of NFKBIA gene was amplified by different primers. After sequencing validation, these fragments were inserted to the luciferase reporter vector, pGL3-promoter to construct recombinant plasmids containing four kinds of haplotypes, pGL3-rs8904C/rs696G, pGL3-rs8904C/rs696A, pGL3-rs8904T/rs696G and pGL3-rs8904T/rs696A. Then these plasmids were transfected into LS174T cells and the luciferase activity was detected. Compared with pGL3-vector transfected cells (negative control), the luciferase activity of the four kinds of recombinant plasmids was significantly decreased (P < 0.001). For rs696G > A, the luciferase activity of the recombinant plasmids containing A allele (pGL3-rs8904C/rs696A and pGL3-rs8904T/rs696A) was about 45.1% (P < 0.05) and 56.1% (P < 0.001) lower than those containing G allele (pGL3-rs8904C/rs696G and pGL3-rs8904T/rs696G), respectively. For rs8904C > T, there were no significant differences in the luciferase activity between the recombinant plasmids containing T allele and those with C allele. Together, the luciferase reporter gene vectors containing SNPs in NFKBIA gene 3'UTR were constructed successfully and rs696G > A could decrease the luciferase activity while rs8904C >T didn't have much effect on the luciferase activity.

Complete mitochondrial genome of Lutzomyia (Nyssomyia) umbratilis (Diptera: Psychodidae), the main vector of Leishmania guyanensis.

PubMed

Kocher, Arthur; Gantier, Jean-Charles; Holota, Hélène; Jeziorski, Céline; Coissac, Eric; Bañuls, Anne-Laure; Girod, Romain; Gaborit, Pascal; Murienne, Jérôme

2016-11-01

The nearly complete mitochondrial genome of Lutzomyia umbratilis Ward & Fraiha, 1977 (Psychodidae: Phlebotominae), considered as the main vector of Leishmania guyanensis, is presented. The sequencing has been performed on an Illumina Hiseq 2500 platform, with a genome skimming strategy. The full nuclear ribosomal RNA segment was also assembled. The mitogenome of L. umbratilis was determined to be at least 15,717 bp-long and presents an architecture found in many mitogenomes of insect (13 protein-coding genes, 22 transfer RNAs, two ribosomal RNAs, and one non-coding region also referred as the control region). The control region contains a large repeated element of c. 370 bp and a poly-AT region of unknown length. This is the first mitogenome of Psychodidae to be described.

[Stethoscope or staphyloscope?: Potential vector in nosocomial infections].

PubMed

Zúniga, Andrés; Mañalich, Jaime; Cortés, Rosario

2016-02-01

Healthcare-associated infections (HCAI) are a problem worldwide. In our country, the estimated incidence of HCAI is 70,000 per year. This results in an increase in the average length of hospital stay by 10 days per patient, an estimated annual cost of US $ 70 million and an overstay of 700 thousand bed days a year. For over 30 years stethoscopes have been considered as potential HCAI vectors, since pathogens like methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus strains adhere and colonize them. These organisms can be transmitted between patients if the instruments are not sanitized. Several studies conclude that disinfecting the stethoscope with isopropyl alcohol eliminates up to 99% of bacteria. Simple, economic measures such as implementation of guidelines for stethoscope disinfection are a clear opportunity for preventing infections.

Fractal and twin SVM-based handgrip recognition for healthy subjects and trans-radial amputees using myoelectric signal.

PubMed

Arjunan, Sridhar Poosapadi; Kumar, Dinesh Kant; Jayadeva J

2016-02-01

Identifying functional handgrip patterns using surface electromygram (sEMG) signal recorded from amputee residual muscle is required for controlling the myoelectric prosthetic hand. In this study, we have computed the signal fractal dimension (FD) and maximum fractal length (MFL) during different grip patterns performed by healthy and transradial amputee subjects. The FD and MFL of the sEMG, referred to as the fractal features, were classified using twin support vector machines (TSVM) to recognize the handgrips. TSVM requires fewer support vectors, is suitable for data sets with unbalanced distributions, and can simultaneously be trained for improving both sensitivity and specificity. When compared with other methods, this technique resulted in improved grip recognition accuracy, sensitivity, and specificity, and this improvement was significant (κ=0.91).

Many-body delocalization with random vector potentials

NASA Astrophysics Data System (ADS)

Cheng, Chen; Mondaini, Rubem

2016-11-01

We study the ergodic properties of excited states in a model of interacting fermions in quasi-one-dimensional chains subjected to a random vector potential. In the noninteracting limit, we show that arbitrarily small values of this complex off-diagonal disorder trigger localization for the whole spectrum; the divergence of the localization length in the single-particle basis is characterized by a critical exponent ν which depends on the energy density being investigated. When short-range interactions are included, the localization is lost, and the system is ergodic regardless of the magnitude of disorder in finite chains. Our numerical results suggest a delocalization scheme for arbitrary small values of interactions. This finding indicates that the standard scenario of the many-body localization cannot be obtained in a model with random gauge fields.

Controlling Malaria Using Livestock-Based Interventions: A One Health Approach

PubMed Central

Franco, Ana O.; Gomes, M. Gabriela M.; Rowland, Mark; Coleman, Paul G.

2014-01-01

Where malaria is transmitted by zoophilic vectors, two types of malaria control strategies have been proposed based on animals: using livestock to divert vector biting from people (zooprophylaxis) or as baits to attract vectors to insecticide sources (insecticide-treated livestock). Opposing findings have been obtained on malaria zooprophylaxis, and despite the success of an insecticide-treated livestock trial in Pakistan, where malaria vectors are highly zoophilic, its effectiveness is yet to be formally tested in Africa where vectors are more anthropophilic. This study aims to clarify the different effects of livestock on malaria and to understand under what circumstances livestock-based interventions could play a role in malaria control programmes. This was explored by developing a mathematical model and combining it with data from Pakistan and Ethiopia. Consistent with previous work, a zooprophylactic effect of untreated livestock is predicted in two situations: if vector population density does not increase with livestock introduction, or if livestock numbers and availability to vectors are sufficiently high such that the increase in vector density is counteracted by the diversion of bites from humans to animals. Although, as expected, insecticide-treatment of livestock is predicted to be more beneficial in settings with highly zoophilic vectors, like South Asia, we find that the intervention could also considerably decrease malaria transmission in regions with more anthropophilic vectors, like Anopheles arabiensis in Africa, under specific circumstances: high treatment coverage of the livestock population, using a product with stronger or longer lasting insecticidal effect than in the Pakistan trial, and with small (ideally null) repellency effect, or if increasing the attractiveness of treated livestock to malaria vectors. The results suggest these are the most appropriate conditions for field testing insecticide-treated livestock in an Africa region with moderately zoophilic vectors, where this intervention could contribute to the integrated control of malaria and livestock diseases. PMID:25050703

Comparison of Surgically Induced Astigmatism and Morphologic Features Resulting From Femtosecond Laser and Manual Clear Corneal Incisions for Cataract Surgery.

PubMed

Ferreira, Tiago B; Ribeiro, Filomena J; Pinheiro, João; Ribeiro, Paulo; O'Neill, João G

2018-05-01

To compare the surgically induced astigmatism (SIA) vector, flattening effect, torque, and wound architecture following femtosecond laser and manual clear corneal incisions (CCIs). In a double-armed, randomized, prospective case series, cataract surgery was performed for 600 eyes using femtosecond laser (300 eyes) or manual (300 eyes) 2.4-mm CCIs in temporal or superior oblique locations. SIA, flattening effect, torque, and the summated vector mean for SIA were calculated. Correlation with individual features was established and incision morphology was investigated by anterior segment optical coherence tomography at 3 months of follow-up. The SIA, flattening effect, and torque were lower in the femtosecond laser group for both incision locations, although the differences were not significant (all P > .05). The femtosecond laser group showed less dispersion of SIA magnitude and flattening effect. Temporal and superior oblique incisions resulted in flattening effect values of -0.11 and -0.21 diopters (D), respectively, in the femtosecond laser group and -0.13 and -0.34 D, respectively, in the manual group. Significant correlations with individual features were only found in the femtosecond laser group, with preoperative astigmatism being the only significant SIA predictor by multiple regression analysis (P = .003). Femtosecond laser CCIs showed less deviation from the intended length, wound enlargement, endothelial misalignment, and Descemet membrane detachments (all P < .037). Femtosecond laser CCIs were more reproducible. Although SIAs were smaller in femtosecond laser CCIs than in manual CCIs for both temporal and superior oblique incisions, the difference was not statistically significant. Association with individual features is highly variable. [J Refract Surg. 2018;34(5):322-329.]. Copyright 2018, SLACK Incorporated.

Cycles of Transient High-Dose Cyclophosphamide Administration and Oncolytic Adenovirus Vector Intratumoral Injection for Long Term Tumor Suppression in Syrian Hamsters

PubMed Central

Dhar, Debanjan; Toth, Karoly; Wold, William S.M.

2014-01-01

Immune responses against oncolytic adenovirus (Ad) vectors are thought to limit vector anti-tumor efficacy. In Syrian hamsters, which are immunocompetent and whose tumors and normal tissues are permissive for replication of Ad5-based oncolytic Ad vectors, treating with high-dose cyclophosphamide to suppress the immune system and exert chemotherapeutic effects enhances Ad vector anti-tumor efficacy. However, long term cyclophosphamide treatment and immunosuppression can lead to anemia and vector spread to normal tissues. Here we employed three cycles of transient high-dose cyclophosphamide administration plus intratumoral injection of the oncolytic Ad vector VRX-007 followed by withdrawal from cyclophosphamide. Each cycle lasted 4-6 weeks. This protocol allowed the hamsters to remain healthy so the study could be continued for ~100 days. The tumors were very well suppressed throughout the study. With immunocompetent hamsters, the vector retarded tumor growth initially, but after 3-4 weeks the tumors resumed rapid growth and further injections of vector were ineffective. Preimmunization of the hamsters with Ad5 prevented vector spillover from the tumor to the liver yet still allowed for effective long term anti-tumor efficacy. Our results suggest that a clinical protocol might be developed with cycles of transient chemotherapy plus intratumoral vector injection to achieve significant anti-tumor efficacy while minimizing the side effects of cytostatic treatment. PMID:24722357

Cycles of transient high-dose cyclophosphamide administration and intratumoral oncolytic adenovirus vector injection for long-term tumor suppression in Syrian hamsters.

PubMed

Dhar, D; Toth, K; Wold, W S M

2014-04-01

Immune responses against oncolytic adenovirus (Ad) vectors are thought to limit vector anti-tumor efficacy. With Syrian hamsters, which are immunocompetent and whose tumors and normal tissues are permissive for replication of Ad5-based oncolytic Ad vectors, treating with high-dose cyclophosphamide (CP) to suppress the immune system and exert chemotherapeutic effects enhances Ad vector anti-tumor efficacy. However, long-term CP treatment and immunosuppression can lead to anemia and vector spread to normal tissues. Here, we employed three cycles of transient high-dose CP administration plus intratumoral injection of the oncolytic Ad vector VRX-007 followed by withdrawal of CP. Each cycle lasted 4-6 weeks. This protocol allowed the hamsters to remain healthy so the study could be continued for ~100 days. The tumors were very well suppressed throughout the study. With immunocompetent hamsters, the vector retarded tumor growth initially, but after 3-4 weeks the tumors resumed rapid growth and further injections of vector were ineffective. Preimmunization of the hamsters with Ad5 prevented vector spillover from the tumor to the liver yet still allowed for effective long-term anti-tumor efficacy. Our results suggest that a clinical protocol might be developed with cycles of transient chemotherapy plus intratumoral vector injection to achieve significant anti-tumor efficacy while minimizing the side effects of cytostatic treatment.

Integrated pest management and allocation of control efforts for vector-borne diseases

USGS Publications Warehouse

Ginsberg, H.S.

2001-01-01

Applications of various control methods were evaluated to determine how to integrate methods so as to minimize the number of human cases of vector-borne diseases. These diseases can be controlled by lowering the number of vector-human contacts (e.g., by pesticide applications or use of repellents), or by lowering the proportion of vectors infected with pathogens (e.g., by lowering or vaccinating reservoir host populations). Control methods should be combined in such a way as to most efficiently lower the probability of human encounter with an infected vector. Simulations using a simple probabilistic model of pathogen transmission suggest that the most efficient way to integrate different control methods is to combine methods that have the same effect (e.g., combine treatments that lower the vector population; or combine treatments that lower pathogen prevalence in vectors). Combining techniques that have different effects (e.g., a technique that lowers vector populations with a technique that lowers pathogen prevalence in vectors) will be less efficient than combining two techniques that both lower vector populations or combining two techniques that both lower pathogen prevalence, costs being the same. Costs of alternative control methods generally differ, so the efficiency of various combinations at lowering human contact with infected vectors should be estimated at available funding levels. Data should be collected from initial trials to improve the effects of subsequent interventions on the number of human cases.

Mathematical modeling of Chikungunya fever control

NASA Astrophysics Data System (ADS)

Hincapié-Palacio, Doracelly; Ospina, Juan

2015-05-01

Chikungunya fever is a global concern due to the occurrence of large outbreaks, the presence of persistent arthropathy and its rapid expansion throughout various continents. Globalization and climate change have contributed to the expansion of the geographical areas where mosquitoes Aedes aegypti and Aedes albopictus (Stegomyia) remain. It is necessary to improve the techniques of vector control in the presence of large outbreaks in The American Region. We derive measures of disease control, using a mathematical model of mosquito-human interaction, by means of three scenarios: a) a single vector b) two vectors, c) two vectors and human and non-human reservoirs. The basic reproductive number and critical control measures were deduced by using computer algebra with Maple (Maplesoft Inc, Ontario Canada). Control measures were simulated with parameter values obtained from published data. According to the number of households in high risk areas, the goals of effective vector control to reduce the likelihood of mosquito-human transmission would be established. Besides the two vectors, if presence of other non-human reservoirs were reported, the monthly target of effective elimination of the vector would be approximately double compared to the presence of a single vector. The model shows the need to periodically evaluate the effectiveness of vector control measures.

Age- and bite-structured models for vector-borne diseases.

PubMed

Rock, K S; Wood, D A; Keeling, M J

2015-09-01

The biology and behaviour of biting insects is a vitally important aspect in the spread of vector-borne diseases. This paper aims to determine, through the use of mathematical models, what effect incorporating vector senescence and realistic feeding patterns has on disease. A novel model is developed to enable the effects of age- and bite-structure to be examined in detail. This original PDE framework extends previous age-structured models into a further dimension to give a new insight into the role of vector biting and its interaction with vector mortality and spread of disease. Through the PDE model, the roles of the vector death and bite rates are examined in a way which is impossible under the traditional ODE formulation. It is demonstrated that incorporating more realistic functions for vector biting and mortality in a model may give rise to different dynamics than those seen under a more simple ODE formulation. The numerical results indicate that the efficacy of control methods that increase vector mortality may not be as great as predicted under a standard host-vector model, whereas other controls including treatment of humans may be more effective than previously thought. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Error Analysis for High Resolution Topography with Bi-Static Single-Pass SAR Interferometry

NASA Technical Reports Server (NTRS)

Muellerschoen, Ronald J.; Chen, Curtis W.; Hensley, Scott; Rodriguez, Ernesto

2006-01-01

We present a flow down error analysis from the radar system to topographic height errors for bi-static single pass SAR interferometry for a satellite tandem pair. Because of orbital dynamics the baseline length and baseline orientation evolve spatially and temporally, the height accuracy of the system is modeled as a function of the spacecraft position and ground location. Vector sensitivity equations of height and the planar error components due to metrology, media effects, and radar system errors are derived and evaluated globally for a baseline mission. Included in the model are terrain effects that contribute to layover and shadow and slope effects on height errors. The analysis also accounts for nonoverlapping spectra and the non-overlapping bandwidth due to differences between the two platforms' viewing geometries. The model is applied to a 514 km altitude 97.4 degree inclination tandem satellite mission with a 300 m baseline separation and X-band SAR. Results from our model indicate that global DTED level 3 can be achieved.

Malaria vector control: from past to future.

PubMed

Raghavendra, Kamaraju; Barik, Tapan K; Reddy, B P Niranjan; Sharma, Poonam; Dash, Aditya P

2011-04-01

Malaria is one of the most common vector-borne diseases widespread in the tropical and subtropical regions. Despite considerable success of malaria control programs in the past, malaria still continues as a major public health problem in several countries. Vector control is an essential part for reducing malaria transmission and became less effective in recent years, due to many technical and administrative reasons, including poor or no adoption of alternative tools. Of the different strategies available for vector control, the most successful are indoor residual spraying and insecticide-treated nets (ITNs), including long-lasting ITNs and materials. Earlier DDT spray has shown spectacular success in decimating disease vectors but resulted in development of insecticide resistance, and to control the resistant mosquitoes, organophosphates, carbamates, and synthetic pyrethroids were introduced in indoor residual spraying with needed success but subsequently resulted in the development of widespread multiple insecticide resistance in vectors. Vector control in many countries still use insecticides in the absence of viable alternatives. Few developments for vector control, using ovitraps, space spray, biological control agents, etc., were encouraging when used in limited scale. Likewise, recent introduction of safer vector control agents, such as insect growth regulators, biocontrol agents, and natural plant products have yet to gain the needed scale of utility for vector control. Bacterial pesticides are promising and are effective in many countries. Environmental management has shown sufficient promise for vector control and disease management but still needs advocacy for inter-sectoral coordination and sometimes are very work-intensive. The more recent genetic manipulation and sterile insect techniques are under development and consideration for use in routine vector control and for these, standardized procedures and methods are available but need thorough understanding of biology, ethical considerations, and sufficiently trained manpower for implementation being technically intensive methods. All the methods mentioned in the review that are being implemented or proposed for implementation needs effective inter-sectoral coordination and community participation. The latest strategy is evolution-proof insecticides that include fungal biopesticides, Wolbachia, and Denso virus that essentially manipulate the life cycle of the mosquitoes were found effective but needs more research. However, for effective vector control, integrated vector management methods, involving use of combination of effective tools, is needed and is also suggested by Global Malaria Control Strategy. This review article raises issues associated with the present-day vector control strategies and state opportunities with a focus on ongoing research and recent advances to enable to sustain the gains achieved so far.

Conductance dips and spin precession in a nonuniform waveguide with spin–orbit coupling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Malyshev, A. I., E-mail: malyshev@phys.unn.ru; Kozulin, A. S.

An infinite waveguide with a nonuniformity, a segment of finite length with spin–orbit coupling, is considered in the case when the Rashba and Dresselhaus parameters are identical. Analytical expressions have been derived in the single-mode approximation for the conductance of the system for an arbitrary initial spin state. Based on numerical calculations with several size quantization modes, we have detected and described the conductance dips arising when the waves are localized in the nonuniformity due to the formation of an effective potential well in it. We show that allowance for the evanescent modes under carrier spin precession in an effectivemore » magnetic field does not lead to a change in the direction of the average spin vector at the output of the system.« less

Magnetic particles guided by ellipsoidal AC magnetic fields in a shallow viscous fluid: Controlling trajectories and chain lengths

NASA Astrophysics Data System (ADS)

Jorge, Guillermo A.; Llera, María; Bekeris, Victoria

2017-12-01

We study the propulsion of superparamagnetic particles dispersed in a viscous fluid upon the application of an elliptically polarized rotating magnetic field. Reducing the fluid surface tension the particles sediment due to density mismatch and rotate close to the low recipient confining plate. We study the net translational motion arising from the hydrodynamic coupling with the plate and find that, above a cross over magnetic field, magnetically assembled doublets move faster than single particles. In turn, particles are driven in complex highly controlled trajectories by rotating the plane containing the magnetic field vector. The effect of the field rotation on long self assembled chains is discussed and the alternating breakup and reformation of the particle chains is described.

Minimizing distortion and internal forces in truss structures by simulated annealing

NASA Technical Reports Server (NTRS)

Kincaid, Rex K.

1989-01-01

Inaccuracies in the length of members and the diameters of joints of large truss reflector backup structures may produce unacceptable levels of surface distortion and member forces. However, if the member lengths and joint diameters can be measured accurately it is possible to configure the members and joints so that root-mean-square (rms) surface error and/or rms member forces is minimized. Following Greene and Haftka (1989) it is assumed that the force vector f is linearly proportional to the member length errors e(sub M) of dimension NMEMB (the number of members) and joint errors e(sub J) of dimension NJOINT (the number of joints), and that the best-fit displacement vector d is a linear function of f. Let NNODES denote the number of positions on the surface of the truss where error influences are measured. The solution of the problem is discussed. To classify, this problem was compared to a similar combinatorial optimization problem. In particular, when only the member length errors are considered, minimizing d(sup 2)(sub rms) is equivalent to the quadratic assignment problem. The quadratic assignment problem is a well known NP-complete problem in operations research literature. Hence minimizing d(sup 2)(sub rms) is is also an NP-complete problem. The focus of the research is the development of a simulated annealing algorithm to reduce d(sup 2)(sub rms). The plausibility of this technique is its recent success on a variety of NP-complete combinatorial optimization problems including the quadratic assignment problem. A physical analogy for simulated annealing is the way liquids freeze and crystallize. All computational experiments were done on a MicroVAX. The two interchange heuristic is very fast but produces widely varying results. The two and three interchange heuristic provides less variability in the final objective function values but runs much more slowly. Simulated annealing produced the best objective function values for every starting configuration and was faster than the two and three interchange heuristic.

A Demonstration of Optimal Apodization Determination for Proper Lateral Modulation

NASA Astrophysics Data System (ADS)

Sumi, Chikayoshi; Komiya, Yuichi; Uga, Shinya

2009-07-01

We have realized effective ultrasound (US) beamformings by the steering of plural beams and apodizations for B-mode imaging with a high lateral resolution and accurate measurement of tissue or blood displacement vector and/or strain tensor using the multidimensional cross-spectrum phase gradient method (MCSPGM), or multidimensional autocorrelation or Doppler methods (MAM and MDM) using multidimensional analytic signals. For instance, the coherent superposition of the steered beams performed in the lateral cosine modulation method (LCM) has a higher potential for realizing a more accurate measurement of a displacement vector than the synthesis of the displacement vector using the accurately measured axial displacements obtained by the multidimensional synthetic aperture method (MDSAM), multidirectional transmission method (MTM) or the use of plural US transducers. Originally, the apodization function to be used for realizing a designed point spread function (PSF) was obtained by the Fraunhofer approximation (FA). However, to obtain the best approximated, designed PSF in the least-squares sense, we proposed a linear optimization (LO) method. Furthermore, on the basis of the knowledge about the losts of US energy during the propagation, we have recently developed a nonlinear optimization (NLO) method, in which the feet of the main lobes in apodization function are properly truncated. Thus, NLO also allows the decrease in the number of channels or the confinement of the effective aperture. In this study, to gain insight into the ideal shape of the PSF, the accuracies of the two-dimensional (2D) displacement vector measurements were compared for typical PSFs with distinct lateral envelope shapes, particularly, in terms of full width at half maximum (FWHM) and the length of the feet, i.e., the Gaussian function, Hanning window and parabolic function. It was confirmed that a PSF having a wide FWHM and short feet was ideal. Such a PSF yielded an echo with a high signal-to-noise ratio (SNR), a large bandwidth and a large maximum spectrum of the center frequency. Moreover, for the three PSFs used, by calculating the PSFs using a typical transducer model and the apodization functions obtained by the respective LO and NLO methods and FA, we compare the approximation accuracies of the realized PSFs. NLO was effective for realizing such an ideal PSF. In addition, NLO allowed the significant decrease in the number of channels or the confinement of the effective aperture. Thus, in the comparisons of the three distinct PSFs, we obtain an appropriate apodization function. This study will assist the realization of the best lateral modulation.

Exact Descriptions of General Relativity Derived from Newtonian Mechanics within Curved Geometries

NASA Astrophysics Data System (ADS)

Savickas, David

2015-04-01

General relativity and Newtonian mechanics are shown to be exactly related when Newton's second law is written in a curved geometry by using the physical components of a vector as is defined in tensor calculus. By replacing length within the momentum's velocity by the vector metric in a curved geometry the second law can then be shown to be exactly identical to the geodesic equation of motion occurring in general relativity. When time's vector direction is constant, as similarly occurs in Newtonian mechanics, this equation can be reduced to a curved three-dimensional equation of motion that yields the the Schwarzschild equations of motion for an isolated particle. They can be used to describe gravitational behavior for any array of masses for which the Newtonian gravitational potential is known, and is shown to describe a mass particle's behavior in the gravitational field of a thin mass-rod. This use of Newton's laws allows relativistic behavior to be described in a physically comprehensible manner. D. Savickas, Int. J. Mod. Phys. D 23 1430018, (2014).

Preliminary calibration plan for the Advanced Particles and Field Observatory (APAFO) magnetometer experiment

NASA Technical Reports Server (NTRS)

Voorhies, C. V.; Langel, R. A.; Slavin, J.; Lancaster, E. R.; Jones, S.

1991-01-01

Prelaunch and postlaunch calibration plans for the APAFO magnetometer experiment are presented. A study of tradeoffs between boom length and spacecraft field is described; the results are summarized. The prelaunch plan includes: calibration of the Vector Fluxgate Magnetometer (VFM), Star Sensors, and Scalar Helium Magnetometer (SHM); optical bench integration; and acquisition of basic spacecraft field data. Postlaunch calibration has two phases. In phase one, SHM data are used to calibrate the VFM, total vector magnetic field data are used to calibrate a physical model of the spacecraft field, and both calibrations are refined by iteration. In phase two, corrected vector data are transformed into geocentric coordinates, previously undetected spacecraft fields are isolated, and initial geomagnetic field models are computed. Provided the SHM is accurate to the required 1.0 nT and can be used to calibrate the VFM to the required 3.0- nT accuracy, the tradeoff study indicates that a 12 m boom and a spacecraft field model uncertainty of 5 percent together allow the 1.0 nT spacecraft field error requirement to be met.

Sentiments Analysis of Reviews Based on ARCNN Model

NASA Astrophysics Data System (ADS)

Xu, Xiaoyu; Xu, Ming; Xu, Jian; Zheng, Ning; Yang, Tao

2017-10-01

The sentiments analysis of product reviews is designed to help customers understand the status of the product. The traditional method of sentiments analysis relies on the input of a fixed feature vector which is performance bottleneck of the basic codec architecture. In this paper, we propose an attention mechanism with BRNN-CNN model, referring to as ARCNN model. In order to have a good analysis of the semantic relations between words and solves the problem of dimension disaster, we use the GloVe algorithm to train the vector representations for words. Then, ARCNN model is proposed to deal with the problem of deep features training. Specifically, BRNN model is proposed to investigate non-fixed-length vectors and keep time series information perfectly and CNN can study more connection of deep semantic links. Moreover, the attention mechanism can automatically learn from the data and optimize the allocation of weights. Finally, a softmax classifier is designed to complete the sentiment classification of reviews. Experiments show that the proposed method can improve the accuracy of sentiment classification compared with benchmark methods.

Mutually orthogonal Latin squares from the inner products of vectors in mutually unbiased bases

NASA Astrophysics Data System (ADS)

Hall, Joanne L.; Rao, Asha

2010-04-01

Mutually unbiased bases (MUBs) are important in quantum information theory. While constructions of complete sets of d + 1 MUBs in {\\bb C}^d are known when d is a prime power, it is unknown if such complete sets exist in non-prime power dimensions. It has been conjectured that complete sets of MUBs only exist in {\\bb C}^d if a maximal set of mutually orthogonal Latin squares (MOLS) of side length d also exists. There are several constructions (Roy and Scott 2007 J. Math. Phys. 48 072110; Paterek, Dakić and Brukner 2009 Phys. Rev. A 79 012109) of complete sets of MUBs from specific types of MOLS, which use Galois fields to construct the vectors of the MUBs. In this paper, two known constructions of MUBs (Alltop 1980 IEEE Trans. Inf. Theory 26 350-354 Wootters and Fields 1989 Ann. Phys. 191 363-381), both of which use polynomials over a Galois field, are used to construct complete sets of MOLS in the odd prime case. The MOLS come from the inner products of pairs of vectors in the MUBs.

Probing Low-Mass Vector Bosons with Parity Nonconservation and Nuclear Anapole Moment Measurements in Atoms and Molecules

NASA Astrophysics Data System (ADS)

Dzuba, V. A.; Flambaum, V. V.; Stadnik, Y. V.

2017-12-01

In the presence of P -violating interactions, the exchange of vector bosons between electrons and nucleons induces parity-nonconserving (PNC) effects in atoms and molecules, while the exchange of vector bosons between nucleons induces anapole moments of nuclei. We perform calculations of such vector-mediated PNC effects in Cs, Ba+ , Yb, Tl, Fr, and Ra+ using the same relativistic many-body approaches as in earlier calculations of standard-model PNC effects, but with the long-range operator of the weak interaction. We calculate nuclear anapole moments due to vector-boson exchange using a simple nuclear model. From measured and predicted (within the standard model) values for the PNC amplitudes in Cs, Yb, and Tl, as well as the nuclear anapole moment of 133Cs, we constrain the P -violating vector-pseudovector nucleon-electron and nucleon-proton interactions mediated by a generic vector boson of arbitrary mass. Our limits improve on existing bounds from other experiments by many orders of magnitude over a very large range of vector-boson masses.

Complete nucleotide sequences and construction of full-length infectious cDNA clones of Cucumber green mottle virus (CGMMV) in a versatile newly developed binary vector including both 35S and T7 promoters

USDA-ARS?s Scientific Manuscript database

Seed-transmitted viruses have caused significant damage to watermelon crops in Korea in recent years, with Cucumber green mottle mosaic virus (CGMMV) infection widespread as a result of infected seed lots. To determine the likely origin of CGMMV infection, we collected CGMMV isolates from watermelon...

DOMAIN MISMATCH COMPENSATION FOR SPEAKER RECOGNITION USING A LIBRARY OF WHITENERS

DTIC Science & Technology

2015-05-29

DOMAIN MISMATCH COMPENSATION FOR SPEAKER RECOGNITION USING A LIBRARY OF WHITENERS Elliot Singer and Douglas Reynolds Massachusetts Institute of...development data is assumed to be unavailable. The method is based on a generalization of data whitening used in association with i-vector length...normalization and utilizes a library of whitening transforms trained at system development time using strictly out-of-domain data. The approach is

Generation of magnetic fields by chaotic fluid convection - The fast dynamo problem

NASA Technical Reports Server (NTRS)

Finn, John M.

1992-01-01

In the kinematic fast dynamo problem, the underlying nonlinear dynamics of the flow play a critical role in the behavior of a dynamo field. It is presently noted that the two important facets of the problem are the approximately lognormal distribution of vector lengths, and the presence of partial cancellation. It is suggested that these features may be reflected in the magnetic fields observed on the sun.

ML 3.0 smoothed aggregation user's guide.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sala, Marzio; Hu, Jonathan Joseph; Tuminaro, Raymond Stephen

2004-05-01

ML is a multigrid preconditioning package intended to solve linear systems of equations Az = b where A is a user supplied n x n sparse matrix, b is a user supplied vector of length n and x is a vector of length n to be computed. ML should be used on large sparse linear systems arising from partial differential equation (PDE) discretizations. While technically any linear system can be considered, ML should be used on linear systems that correspond to things that work well with multigrid methods (e.g. elliptic PDEs). ML can be used as a stand-alone package ormore » to generate preconditioners for a traditional iterative solver package (e.g. Krylov methods). We have supplied support for working with the AZTEC 2.1 and AZTECOO iterative package [15]. However, other solvers can be used by supplying a few functions. This document describes one specific algebraic multigrid approach: smoothed aggregation. This approach is used within several specialized multigrid methods: one for the eddy current formulation for Maxwell's equations, and a multilevel and domain decomposition method for symmetric and non-symmetric systems of equations (like elliptic equations, or compressible and incompressible fluid dynamics problems). Other methods exist within ML but are not described in this document. Examples are given illustrating the problem definition and exercising multigrid options.« less

ML 3.1 smoothed aggregation user's guide.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sala, Marzio; Hu, Jonathan Joseph; Tuminaro, Raymond Stephen

2004-10-01

ML is a multigrid preconditioning package intended to solve linear systems of equations Ax = b where A is a user supplied n x n sparse matrix, b is a user supplied vector of length n and x is a vector of length n to be computed. ML should be used on large sparse linear systems arising from partial differential equation (PDE) discretizations. While technically any linear system can be considered, ML should be used on linear systems that correspond to things that work well with multigrid methods (e.g. elliptic PDEs). ML can be used as a stand-alone package ormore » to generate preconditioners for a traditional iterative solver package (e.g. Krylov methods). We have supplied support for working with the Aztec 2.1 and AztecOO iterative package [16]. However, other solvers can be used by supplying a few functions. This document describes one specific algebraic multigrid approach: smoothed aggregation. This approach is used within several specialized multigrid methods: one for the eddy current formulation for Maxwell's equations, and a multilevel and domain decomposition method for symmetric and nonsymmetric systems of equations (like elliptic equations, or compressible and incompressible fluid dynamics problems). Other methods exist within ML but are not described in this document. Examples are given illustrating the problem definition and exercising multigrid options.« less

Vector-based model of elastic bonds for simulation of granular solids.

PubMed

Kuzkin, Vitaly A; Asonov, Igor E

2012-11-01

A model (further referred to as the V model) for the simulation of granular solids, such as rocks, ceramics, concrete, nanocomposites, and agglomerates, composed of bonded particles (rigid bodies), is proposed. It is assumed that the bonds, usually representing some additional gluelike material connecting particles, cause both forces and torques acting on the particles. Vectors rigidly connected with the particles are used to describe the deformation of a single bond. The expression for potential energy of the bond and corresponding expressions for forces and torques are derived. Formulas connecting parameters of the model with longitudinal, shear, bending, and torsional stiffnesses of the bond are obtained. It is shown that the model makes it possible to describe any values of the bond stiffnesses exactly; that is, the model is applicable for the bonds with arbitrary length/thickness ratio. Two different calibration procedures depending on bond length/thickness ratio are proposed. It is shown that parameters of the model can be chosen so that under small deformations the bond is equivalent to either a Bernoulli-Euler beam or a Timoshenko beam or short cylinder connecting particles. Simple analytical expressions, relating parameters of the V model with geometrical and mechanical characteristics of the bond, are derived. Two simple examples of computer simulation of thin granular structures using the V model are given.

Evolutionary potential of the extrinsic incubation period of dengue virus in Aedes aegypti.

PubMed

Ye, Yixin H; Chenoweth, Stephen F; Carrasco, Alison M; Allen, Scott L; Frentiu, Francesca D; van den Hurk, Andrew F; Beebe, Nigel W; McGraw, Elizabeth A

2016-11-01

Dengue fever is the most common arboviral disease worldwide. It is caused by dengue viruses (DENV) and the mosquito Aedes aegypti is its primary vector. One of the most powerful determinants of a mosquito's ability to transmit DENV is the length of the extrinsic incubation period (EIP), the time it takes for a virus to be transmitted by a mosquito after consuming an infected blood meal. Here, we repeatedly measured DENV load in the saliva of individual mosquitoes over their lifetime and used this in combination with a breeding design to determine the extent to which EIP might respond to the evolutionary forces of drift and selection. We demonstrated that genetic variation among mosquitoes contributes significantly to transmission potential and length of EIP. We reveal that shorter EIP is genetically correlated with reduced mosquito lifespan, highlighting negative life-history consequences for virus-infected mosquitoes. This work highlights the capacity for local genetic variation in mosquito populations to evolve and to dramatically affect the nature of human outbreaks. It also provides the impetus for isolating mosquito genes that determine EIP. More broadly, our dual experimental approach offers new opportunities for studying the evolutionary potential of transmission traits in other vector/pathogen systems. © 2016 The Author(s). Evolution © 2016 The Society for the Study of Evolution.

Classification of CT examinations for COPD visual severity analysis

NASA Astrophysics Data System (ADS)

Tan, Jun; Zheng, Bin; Wang, Xingwei; Pu, Jiantao; Gur, David; Sciurba, Frank C.; Leader, J. Ken

2012-03-01

In this study we present a computational method of CT examination classification into visual assessed emphysema severity. The visual severity categories ranged from 0 to 5 and were rated by an experienced radiologist. The six categories were none, trace, mild, moderate, severe and very severe. Lung segmentation was performed for every input image and all image features are extracted from the segmented lung only. We adopted a two-level feature representation method for the classification. Five gray level distribution statistics, six gray level co-occurrence matrix (GLCM), and eleven gray level run-length (GLRL) features were computed for each CT image depicted segment lung. Then we used wavelets decomposition to obtain the low- and high-frequency components of the input image, and again extract from the lung region six GLCM features and eleven GLRL features. Therefore our feature vector length is 56. The CT examinations were classified using the support vector machine (SVM) and k-nearest neighbors (KNN) and the traditional threshold (density mask) approach. The SVM classifier had the highest classification performance of all the methods with an overall sensitivity of 54.4% and a 69.6% sensitivity to discriminate "no" and "trace visually assessed emphysema. We believe this work may lead to an automated, objective method to categorically classify emphysema severity on CT exam.

A retrotransposable element from the mosquito Anopheles gambiae .

PubMed Central

Besansky, N J

1990-01-01

A family of middle repetitive elements from the African malaria vector Anopheles gambiae is described. Approximately 100 copies of the element, designated T1Ag, are dispersed in the genome. Full-length elements are 4.6 kilobase pairs in length, but truncation of the 5' end is common. Nucleotide sequences of one full-length, two 5'-truncated, and two 5' ends of T1Ag elements were determined and aligned to define a consensus sequence. Sequence analysis revealed two long, overlapping open reading frames followed by a polyadenylation signal, AATAAA, and a tail consisting of tandem repetitions of the motif TGAAA. No direct or inverted long terminal repeats (LTRs) were detected. The first open reading frame, 442 amino acids in length, includes a domain resembling that of nucleic acid-binding proteins. The second open reading frame, 975 amino acids long, resembles the reverse transcriptases of a category of retrotransposable elements without LTRs, variously termed class II retrotransposons, class III elements or non-LTR retrotransposons. Similarity at the sequence and structural levels places T1Ag in this category. Images PMID:1689457

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rottmann, Joerg; Berbeco, Ross

Purpose: Precise prediction of respiratory motion is a prerequisite for real-time motion compensation techniques such as beam, dynamic couch, or dynamic multileaf collimator tracking. Collection of tumor motion data to train the prediction model is required for most algorithms. To avoid exposure of patients to additional dose from imaging during this procedure, the feasibility of training a linear respiratory motion prediction model with an external surrogate signal is investigated and its performance benchmarked against training the model with tumor positions directly. Methods: The authors implement a lung tumor motion prediction algorithm based on linear ridge regression that is suitable tomore » overcome system latencies up to about 300 ms. Its performance is investigated on a data set of 91 patient breathing trajectories recorded from fiducial marker tracking during radiotherapy delivery to the lung of ten patients. The expected 3D geometric error is quantified as a function of predictor lookahead time, signal sampling frequency and history vector length. Additionally, adaptive model retraining is evaluated, i.e., repeatedly updating the prediction model after initial training. Training length for this is gradually increased with incoming (internal) data availability. To assess practical feasibility model calculation times as well as various minimum data lengths for retraining are evaluated. Relative performance of model training with external surrogate motion data versus tumor motion data is evaluated. However, an internal–external motion correlation model is not utilized, i.e., prediction is solely driven by internal motion in both cases. Results: Similar prediction performance was achieved for training the model with external surrogate data versus internal (tumor motion) data. Adaptive model retraining can substantially boost performance in the case of external surrogate training while it has little impact for training with internal motion data. A minimum adaptive retraining data length of 8 s and history vector length of 3 s achieve maximal performance. Sampling frequency appears to have little impact on performance confirming previously published work. By using the linear predictor, a relative geometric 3D error reduction of about 50% was achieved (using adaptive retraining, a history vector length of 3 s and with results averaged over all investigated lookahead times and signal sampling frequencies). The absolute mean error could be reduced from (2.0 ± 1.6) mm when using no prediction at all to (0.9 ± 0.8) mm and (1.0 ± 0.9) mm when using the predictor trained with internal tumor motion training data and external surrogate motion training data, respectively (for a typical lookahead time of 250 ms and sampling frequency of 15 Hz). Conclusions: A linear prediction model can reduce latency induced tracking errors by an average of about 50% in real-time image guided radiotherapy systems with system latencies of up to 300 ms. Training a linear model for lung tumor motion prediction with an external surrogate signal alone is feasible and results in similar performance as training with (internal) tumor motion. Particularly for scenarios where motion data are extracted from fluoroscopic imaging with ionizing radiation, this may alleviate the need for additional imaging dose during the collection of model training data.« less

Using an external surrogate for predictor model training in real-time motion management of lung tumors.

PubMed

Rottmann, Joerg; Berbeco, Ross

2014-12-01

Precise prediction of respiratory motion is a prerequisite for real-time motion compensation techniques such as beam, dynamic couch, or dynamic multileaf collimator tracking. Collection of tumor motion data to train the prediction model is required for most algorithms. To avoid exposure of patients to additional dose from imaging during this procedure, the feasibility of training a linear respiratory motion prediction model with an external surrogate signal is investigated and its performance benchmarked against training the model with tumor positions directly. The authors implement a lung tumor motion prediction algorithm based on linear ridge regression that is suitable to overcome system latencies up to about 300 ms. Its performance is investigated on a data set of 91 patient breathing trajectories recorded from fiducial marker tracking during radiotherapy delivery to the lung of ten patients. The expected 3D geometric error is quantified as a function of predictor lookahead time, signal sampling frequency and history vector length. Additionally, adaptive model retraining is evaluated, i.e., repeatedly updating the prediction model after initial training. Training length for this is gradually increased with incoming (internal) data availability. To assess practical feasibility model calculation times as well as various minimum data lengths for retraining are evaluated. Relative performance of model training with external surrogate motion data versus tumor motion data is evaluated. However, an internal-external motion correlation model is not utilized, i.e., prediction is solely driven by internal motion in both cases. Similar prediction performance was achieved for training the model with external surrogate data versus internal (tumor motion) data. Adaptive model retraining can substantially boost performance in the case of external surrogate training while it has little impact for training with internal motion data. A minimum adaptive retraining data length of 8 s and history vector length of 3 s achieve maximal performance. Sampling frequency appears to have little impact on performance confirming previously published work. By using the linear predictor, a relative geometric 3D error reduction of about 50% was achieved (using adaptive retraining, a history vector length of 3 s and with results averaged over all investigated lookahead times and signal sampling frequencies). The absolute mean error could be reduced from (2.0 ± 1.6) mm when using no prediction at all to (0.9 ± 0.8) mm and (1.0 ± 0.9) mm when using the predictor trained with internal tumor motion training data and external surrogate motion training data, respectively (for a typical lookahead time of 250 ms and sampling frequency of 15 Hz). A linear prediction model can reduce latency induced tracking errors by an average of about 50% in real-time image guided radiotherapy systems with system latencies of up to 300 ms. Training a linear model for lung tumor motion prediction with an external surrogate signal alone is feasible and results in similar performance as training with (internal) tumor motion. Particularly for scenarios where motion data are extracted from fluoroscopic imaging with ionizing radiation, this may alleviate the need for additional imaging dose during the collection of model training data.

An economic evaluation of vector control in the age of a dengue vaccine.

PubMed

Fitzpatrick, Christopher; Haines, Alexander; Bangert, Mathieu; Farlow, Andrew; Hemingway, Janet; Velayudhan, Raman

2017-08-01

Dengue is a rapidly emerging vector-borne Neglected Tropical Disease, with a 30-fold increase in the number of cases reported since 1960. The economic cost of the illness is measured in the billions of dollars annually. Environmental change and unplanned urbanization are conspiring to raise the health and economic cost even further beyond the reach of health systems and households. The health-sector response has depended in large part on control of the Aedes aegypti and Ae. albopictus (mosquito) vectors. The cost-effectiveness of the first-ever dengue vaccine remains to be evaluated in the field. In this paper, we examine how it might affect the cost-effectiveness of sustained vector control. We employ a dynamic Markov model of the effects of vector control on dengue in both vectors and humans over a 15-year period, in six countries: Brazil, Columbia, Malaysia, Mexico, the Philippines, and Thailand. We evaluate the cost (direct medical costs and control programme costs) and cost-effectiveness of sustained vector control, outbreak response and/or medical case management, in the presence of a (hypothetical) highly targeted and low cost immunization strategy using a (non-hypothetical) medium-efficacy vaccine. Sustained vector control using existing technologies would cost little more than outbreak response, given the associated costs of medical case management. If sustained use of existing or upcoming technologies (of similar price) reduce vector populations by 70-90%, the cost per disability-adjusted life year averted is 2013 US$ 679-1331 (best estimates) relative to no intervention. Sustained vector control could be highly cost-effective even with less effective technologies (50-70% reduction in vector populations) and in the presence of a highly targeted and low cost immunization strategy using a medium-efficacy vaccine. Economic evaluation of the first-ever dengue vaccine is ongoing. However, even under very optimistic assumptions about a highly targeted and low cost immunization strategy, our results suggest that sustained vector control will continue to play an important role in mitigating the impact of environmental change and urbanization on human health. If additional benefits for the control of other Aedes borne diseases, such as Chikungunya, yellow fever and Zika fever are taken into account, the investment case is even stronger. High-burden endemic countries should proceed to map populations to be covered by sustained vector control.

An economic evaluation of vector control in the age of a dengue vaccine

PubMed Central

Haines, Alexander; Bangert, Mathieu; Farlow, Andrew; Hemingway, Janet; Velayudhan, Raman

2017-01-01

Introduction Dengue is a rapidly emerging vector-borne Neglected Tropical Disease, with a 30-fold increase in the number of cases reported since 1960. The economic cost of the illness is measured in the billions of dollars annually. Environmental change and unplanned urbanization are conspiring to raise the health and economic cost even further beyond the reach of health systems and households. The health-sector response has depended in large part on control of the Aedes aegypti and Ae. albopictus (mosquito) vectors. The cost-effectiveness of the first-ever dengue vaccine remains to be evaluated in the field. In this paper, we examine how it might affect the cost-effectiveness of sustained vector control. Methods We employ a dynamic Markov model of the effects of vector control on dengue in both vectors and humans over a 15-year period, in six countries: Brazil, Columbia, Malaysia, Mexico, the Philippines, and Thailand. We evaluate the cost (direct medical costs and control programme costs) and cost-effectiveness of sustained vector control, outbreak response and/or medical case management, in the presence of a (hypothetical) highly targeted and low cost immunization strategy using a (non-hypothetical) medium-efficacy vaccine. Results Sustained vector control using existing technologies would cost little more than outbreak response, given the associated costs of medical case management. If sustained use of existing or upcoming technologies (of similar price) reduce vector populations by 70–90%, the cost per disability-adjusted life year averted is 2013 US$ 679–1331 (best estimates) relative to no intervention. Sustained vector control could be highly cost-effective even with less effective technologies (50–70% reduction in vector populations) and in the presence of a highly targeted and low cost immunization strategy using a medium-efficacy vaccine. Discussion Economic evaluation of the first-ever dengue vaccine is ongoing. However, even under very optimistic assumptions about a highly targeted and low cost immunization strategy, our results suggest that sustained vector control will continue to play an important role in mitigating the impact of environmental change and urbanization on human health. If additional benefits for the control of other Aedes borne diseases, such as Chikungunya, yellow fever and Zika fever are taken into account, the investment case is even stronger. High-burden endemic countries should proceed to map populations to be covered by sustained vector control. PMID:28806786

Environmental and biological factors influencing Culex pipiens quinquefasciatus (Diptera: Culicidae) vector competence for West Nile Virus.

PubMed

Richards, Stephanie L; Lord, Cynthia C; Pesko, Kendra N; Tabachnick, Walter J

2010-07-01

Interactions between environmental and biological factors affect the vector competence of Culex pipiens quinquefasciatus for West Nile virus. Three age cohorts from two Cx. p. quinquefasciatus colonies were fed blood containing a low- or high-virus dose, and each group was held at two different extrinsic incubation temperatures (EIT) for 13 days. The colonies differed in the way that they responded to the effects of the environment on vector competence. The effects of mosquito age on aspects of vector competence were dependent on the EIT and dose, and they changed depending on the colony. Complex interactions must be considered in laboratory studies of vector competence, because the extent of the genetic and environmental variation controlling vector competence in nature is largely unknown. Differences in the environmental (EIT and dose) and biological (mosquito age and colony) effects from previous studies of Cx. p. quinquefasciatus vector competence for St. Louis encephalitis virus are discussed.

The combined geodetic network adjusted on the reference ellipsoid - a comparison of three functional models for GNSS observations

NASA Astrophysics Data System (ADS)

Kadaj, Roman

2016-12-01

The adjustment problem of the so-called combined (hybrid, integrated) network created with GNSS vectors and terrestrial observations has been the subject of many theoretical and applied works. The network adjustment in various mathematical spaces was considered: in the Cartesian geocentric system on a reference ellipsoid and on a mapping plane. For practical reasons, it often takes a geodetic coordinate system associated with the reference ellipsoid. In this case, the Cartesian GNSS vectors are converted, for example, into geodesic parameters (azimuth and length) on the ellipsoid, but the simple form of converted pseudo-observations are the direct differences of the geodetic coordinates. Unfortunately, such an approach may be essentially distorted by a systematic error resulting from the position error of the GNSS vector, before its projection on the ellipsoid surface. In this paper, an analysis of the impact of this error on the determined measures of geometric ellipsoid elements, including the differences of geodetic coordinates or geodesic parameters is presented. Assuming that the adjustment of a combined network on the ellipsoid shows that the optimal functional approach in relation to the satellite observation, is to create the observational equations directly for the original GNSS Cartesian vector components, writing them directly as a function of the geodetic coordinates (in numerical applications, we use the linearized forms of observational equations with explicitly specified coefficients). While retaining the original character of the Cartesian vector, one avoids any systematic errors that may occur in the conversion of the original GNSS vectors to ellipsoid elements, for example the vector of the geodesic parameters. The problem is theoretically developed and numerically tested. An example of the adjustment of a subnet loaded from the database of reference stations of the ASG-EUPOS system was considered for the preferred functional model of the GNSS observations.

Development of a Novel Escherichia coli-Kocuria Shuttle Vector Using the Cryptic pKPAL3 Plasmid from K. palustris IPUFS-1 and Its Utilization in Producing Enantiopure (S)-Styrene Oxide.

PubMed

Toda, Hiroshi; Itoh, Nobuya

2017-01-01

The novel cryptic pKPAL3 plasmid was isolated from the Gram-positive microorganism Kocuria palustris IPUFS-1 and characterized in detail. pKPAL3 is a circular plasmid that is 4,443 bp in length. Open reading frame (ORF) and homology search analyses indicated that pKPAL3 possesses four ORFs; however, there were no replication protein coding genes predicted in the plasmid. Instead, there were two nucleotide sequence regions that showed significant identities with untranslated regions of K. rhizophila DC2201 (NBRC 103217) genomic sequences, and these sequences were essential for autonomous replication of pKPAL3 in Kocuria cells. Based on these findings, we constructed the novel Escherichia coli - Kocuria shuttle vectors pKITE301 (kanamycin resistant) and pKITE303 (thiostrepton resistant) from pKPAL3. The copy numbers of the constructed shuttle vectors were estimated to be 20 per cell, and they exhibited low segregation stability in Kocuria transformant cells in the absence of antibiotics. Moreover, constructed vectors showed compatibility with the other K. rhizophila shuttle vector pKITE103. We successfully expressed multiple heterologous genes, including the styrene monooxygenase gene from Rhodococcus sp. ST-10 ( rhsmo ) and alcohol dehydrogenase gene from Leifsonia sp. S749 ( lsadh ), in K . rhizophila DC2201 using the pKITE301P and pKITE103P vectors under the control of the glyceraldehyde 3-phosphate dehydrogenase ( gapdh ) promotor. The RhSMO-LSADH co-expressing K. rhizophila was used as a biocatalyst in an organic solvent-water biphasic reaction system to efficiently convert styrene into ( S )-styrene oxide with 99% ee in the presence of 2-propanol as a hydrogen donor. The product concentration of the reaction in the organic solvent reached 235 mM after 30 h under optimum conditions. Thus, we demonstrated that this novel shuttle vector is useful for developing biocatalysts based on organic solvent-tolerant Kocuria cells.

Performance characteristics of a variable-area vane nozzle for vectoring an ASTOVL exhaust jet up to 45 deg

NASA Technical Reports Server (NTRS)

Mcardle, Jack G.; Esker, Barbara S.

1993-01-01

Many conceptual designs for advanced short-takeoff, vertical landing (ASTOVL) aircraft need exhaust nozzles that can vector the jet to provide forces and moments for controlling the aircraft's movement or attitude in flight near the ground. A type of nozzle that can both vector the jet and vary the jet flow area is called a vane nozzle. Basically, the nozzle consists of parallel, spaced-apart flow passages formed by pairs of vanes (vanesets) that can be rotated on axes perpendicular to the flow. Two important features of this type of nozzle are the abilities to vector the jet rearward up to 45 degrees and to produce less harsh pressure and velocity footprints during vertical landing than does an equivalent single jet. A one-third-scale model of a generic vane nozzle was tested with unheated air at the NASA Lewis Research Center's Powered Lift Facility. The model had three parallel flow passages. Each passage was formed by a vaneset consisting of a long and a short vane. The longer vanes controlled the jet vector angle, and the shorter controlled the flow area. Nozzle performance for three nominal flow areas (basic and plus or minus 21 percent of basic area), each at nominal jet vector angles from -20 deg (forward of vertical) to +45 deg (rearward of vertical) are presented. The tests were made with the nozzle mounted on a model tailpipe with a blind flange on the end to simulate a closed cruise nozzle, at tailpipe-to-ambient pressure ratios from 1.8 to 4.0. Also included are jet wake data, single-vaneset vector performance for long/short and equal-length vane designs, and pumping capability. The pumping capability arises from the subambient pressure developed in the cavities between the vanesets, which could be used to aspirate flow from a source such as the engine compartment. Some of the performance characteristics are compared with characteristics of a single-jet nozzle previously reported.

Increasing the Efficacy of Oncolytic Adenovirus Vectors

PubMed Central

Toth, Karoly; Wold, William S. M.

2010-01-01

Oncolytic adenovirus (Ad) vectors present a new modality to treat cancer. These vectors attack tumors via replicating in and killing cancer cells. Upon completion of the vector replication cycle, the infected tumor cell lyses and releases progeny virions that are capable of infecting neighboring tumor cells. Repeated cycles of vector replication and cell lysis can destroy the tumor. Numerous Ad vectors have been generated and tested, some of them reaching human clinical trials. In 2005, the first oncolytic Ad was approved for the treatment of head-and-neck cancer by the Chinese FDA. Oncolytic Ads have been proven to be safe, with no serious adverse effects reported even when high doses of the vector were injected intravenously. The vectors demonstrated modest anti-tumor effect when applied as a single agent; their efficacy improved when they were combined with another modality. The efficacy of oncolytic Ads can be improved using various approaches, including vector design, delivery techniques, and ancillary treatment, which will be discussed in this review. PMID:21994711

Microsphere-liposome complexes protect adenoviral vectors from neutralising antibody without losses in transfection efficiency, in-vitro.

PubMed

Steel, Jason C; Cavanagh, Heather M A; Burton, Mark A; Kalle, Wouter H J

2004-11-01

Adenoviral vectors have been commonly used in gene therapy protocols but the success of their use is often limited by the induction of host immunity to the vector. Following exposure to the adenoviral vector, adenoviral-specific neutralising antibodies are produced, which limits further administration. This study examines the effectiveness of a novel combination of microspheres and liposomes for the shielding of adenovirus from neutralising antibodies in an in-vitro setting. We show that liposomes are effective in the protection of adenovirus from neutralising antibody and that the conjugation of these complexes to microspheres augments the level of protection. This study further reveals that previously neutralised adenovirus may still be transported into the cell via liposome-cell interactions and is still capable of expressing its genes, making this vector an effective tool for circumvention of the humoral immune response. We also looked at possible side effects of using the complexes, namely increases in cytotoxicity and reductions in transfection efficiency. Our results showed that varying the liposome:adenovirus ratio can reduce the cytotoxicity of the vector as well as increase the transfection efficiency. In addition, in cell lines that are adenoviral competent, transfection efficiencies on par with uncomplexed adenoviral vectors were achievable with the combination vector.

Analytic calculation of finite-population reproductive numbers for direct- and vector-transmitted diseases with homogeneous mixing.

PubMed

Keegan, Lindsay; Dushoff, Jonathan

2014-05-01

The basic reproductive number, R0, provides a foundation for evaluating how various factors affect the incidence of infectious diseases. Recently, it has been suggested that, particularly for vector-transmitted diseases, R0 should be modified to account for the effects of finite host population within a single disease transmission generation. Here, we use a transmission factor approach to calculate such "finite-population reproductive numbers," under the assumption of homogeneous mixing, for both vector-borne and directly transmitted diseases. In the case of vector-borne diseases, we estimate finite-population reproductive numbers for both host-to-host and vector-to-vector generations, assuming that the vector population is effectively infinite. We find simple, interpretable formulas for all three of these quantities. In the direct case, we find that finite-population reproductive numbers diverge from R0 before R0 reaches half of the population size. In the vector-transmitted case, we find that the host-to-host number diverges at even lower values of R0, while the vector-to-vector number diverges very little over realistic parameter ranges.

Energy-exchange collisions of dark-bright-bright vector solitons.

PubMed

Radhakrishnan, R; Manikandan, N; Aravinthan, K

2015-12-01

We find a dark component guiding the practically interesting bright-bright vector one-soliton to two different parametric domains giving rise to different physical situations by constructing a more general form of three-component dark-bright-bright mixed vector one-soliton solution of the generalized Manakov model with nine free real parameters. Moreover our main investigation of the collision dynamics of such mixed vector solitons by constructing the multisoliton solution of the generalized Manakov model with the help of Hirota technique reveals that the dark-bright-bright vector two-soliton supports energy-exchange collision dynamics. In particular the dark component preserves its initial form and the energy-exchange collision property of the bright-bright vector two-soliton solution of the Manakov model during collision. In addition the interactions between bound state dark-bright-bright vector solitons reveal oscillations in their amplitudes. A similar kind of breathing effect was also experimentally observed in the Bose-Einstein condensates. Some possible ways are theoretically suggested not only to control this breathing effect but also to manage the beating, bouncing, jumping, and attraction effects in the collision dynamics of dark-bright-bright vector solitons. The role of multiple free parameters in our solution is examined to define polarization vector, envelope speed, envelope width, envelope amplitude, grayness, and complex modulation of our solution. It is interesting to note that the polarization vector of our mixed vector one-soliton evolves in sphere or hyperboloid depending upon the initial parametric choices.

Klein tunneling in Weyl semimetals under the influence of magnetic field.

PubMed

Yesilyurt, Can; Tan, Seng Ghee; Liang, Gengchiau; Jalil, Mansoor B A

2016-12-12

Klein tunneling refers to the absence of normal backscattering of electrons even under the case of high potential barriers. At the barrier interface, the perfect matching of electron and hole wavefunctions enables a unit transmission probability for normally incident electrons. It is theoretically and experimentally well understood in two-dimensional relativistic materials such as graphene. Here we investigate the Klein tunneling effect in Weyl semimetals under the influence of magnetic field induced by ferromagnetic stripes placed at barrier boundaries. Our results show that the resonance of Fermi wave vector at specific barrier lengths gives rise to perfect transmission rings, i.e., three-dimensional analogue of the so-called magic transmission angles in two-dimensional Dirac semimetals. Besides, the transmission profile can be shifted by application of magnetic field in the central region, a property which may be utilized in electro-optic applications. When the applied potential is close to the Fermi level, a particular incident vector can be selected by tuning the magnetic field, thus enabling highly selective transmission of electrons in the bulk of Weyl semimetals. Our analytical and numerical calculations obtained by considering Dirac electrons in three regions and using experimentally feasible parameters can pave the way for relativistic tunneling applications in Weyl semimetals.

Enzyme-synthesized Poly(amine-co-esters) as Non-viral Vectors for Gene Delivery

PubMed Central

Liu, Jie; Jiang, Zhaozhong; Zhou, Jiangbing; Zhang, Shengmin; Saltzman, W. Mark

2010-01-01

A family of biodegradable poly(amine-co-esters) was synthesized in one step via enzymatic copolymerization of diesters with amino-substituted diols. Diesters of length C4–C12 (i.e., from succinate to dodecanedioate) were successfully copolymerized with diethanolamines with either an alkyl (methyl, ethyl, n-butyl, t-butyl) or an aryl (phenyl) substituent on the nitrogen. Upon protonation at slightly acidic conditions, these poly(amine-co-esters) readily turned to cationic polyelectrolytes, which were capable of condensing with polyanionic DNA to form nanometer-sized polyplexes. In vitro screening with pLucDNA revealed that two of the copolymers, poly(N-methyldiethyleneamine sebacate) (PMSC) and poly(N-ethyldiethyleneamine sebacate) (PESC), possessed comparable or higher transfection efficiencies compared to Lipofectamine 2000. PMSC/pLucDNA and PESC/pLucDNA nanoparticles had desirable particle sizes (40–70 nm) for cellular uptake and were capable of functioning as proton sponges to facilitate endosomal escape after cellular uptake. These polyplex nanoparticles exhibited extremely low cytotoxicity. Furthermore, in vivo gene transfection experiments revealed that PMSC is a substantially more effective gene carrier than PEI in delivering pLucDNAto cells in tumors in mice. All these properties suggest that poly(amine-co-esters) are promising non-viral vectors for safe and efficient DNA delivery in gene therapy. PMID:21171165

Effectively infinite optical path-length created using a simple cubic photonic crystal for extreme light trapping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frey, Brian J.; Kuang, Ping; Hsieh, Mei-Li

A 900 nm thick TiO 2 simple cubic photonic crystal with lattice constant 450 nm was fabricated and used to experimentally validate a newly-discovered mechanism for extreme light-bending. Absorption enhancement was observed extending 1–2 orders of magnitude over that of a reference TiO 2 film. Several enhancement peaks in the region from 600–950 nm were identified, which far exceed both the ergodic fundamental limit and the limit based on surface-gratings, with some peaks exceeding 100 times enhancement. These results are attributed to radically sharp refraction where the optical path length approaches infinity due to the Poynting vector lying nearly parallelmore » to the photonic crystal interface. The observed phenomena follow directly from the simple cubic symmetry of the photonic crystal, and can be achieved by integrating the light-trapping architecture into the absorbing volume. These results are not dependent on the material used, and can be applied to any future light trapping applications such as phosphor-converted white light generation, water-splitting, or thin-film solar cells, where increased response in areas of weak absorption is desired.« less

Effectively infinite optical path-length created using a simple cubic photonic crystal for extreme light trapping

DOE PAGES

Frey, Brian J.; Kuang, Ping; Hsieh, Mei-Li; ...

2017-06-23

A 900 nm thick TiO 2 simple cubic photonic crystal with lattice constant 450 nm was fabricated and used to experimentally validate a newly-discovered mechanism for extreme light-bending. Absorption enhancement was observed extending 1–2 orders of magnitude over that of a reference TiO 2 film. Several enhancement peaks in the region from 600–950 nm were identified, which far exceed both the ergodic fundamental limit and the limit based on surface-gratings, with some peaks exceeding 100 times enhancement. These results are attributed to radically sharp refraction where the optical path length approaches infinity due to the Poynting vector lying nearly parallelmore » to the photonic crystal interface. The observed phenomena follow directly from the simple cubic symmetry of the photonic crystal, and can be achieved by integrating the light-trapping architecture into the absorbing volume. These results are not dependent on the material used, and can be applied to any future light trapping applications such as phosphor-converted white light generation, water-splitting, or thin-film solar cells, where increased response in areas of weak absorption is desired.« less

Epicuticular lipids induce aggregation in Chagas disease vectors

PubMed Central

Figueiras, Alicia N Lorenzo; Girotti, Juan R; Mijailovsky, Sergio J; Juárez, M Patricia

2009-01-01

Background The triatomine bugs are vectors of the protozoan parasite Trypanosoma cruzi, the causative agent of Chagas disease. Aggregation behavior plays an important role in their survival by facilitating the location of refuges and cohesion of aggregates, helping to keep them safely assembled into shelters during daylight time, when they are vulnerable to predators. There are evidences that aggregation is mediated by thigmotaxis, by volatile cues from their faeces, and by hexane-extractable contact chemoreceptive signals from their cuticle surface. The epicuticular lipids of Triatoma infestans include a complex mixture of hydrocarbons, free and esterified fatty acids, alcohols, and sterols. Results We analyzed the response of T. infestans fifth instar nymphs after exposure to different amounts either of total epicuticular lipid extracts or individual lipid fractions. Assays were performed in a circular arena, employing a binary choice test with filter papers acting as aggregation attractive sites; papers were either impregnated with a hexane-extract of the total lipids, or lipid fraction; or with the solvent. Insects were significantly aggregated around papers impregnated with the epicuticular lipid extracts. Among the lipid fractions separately tested, only the free fatty acid fraction promoted significant bug aggregation. We also investigated the response to different amounts of selected fatty acid components of this fraction; receptiveness varied with the fatty acid chain length. No response was elicited by hexadecanoic acid (C16:0), the major fatty acid component. Octadecanoic acid (C18:0) showed a significant assembling effect in the concentration range tested (0.1 to 2 insect equivalents). The very long chain hexacosanoic acid (C26:0) was significantly attractant at low doses (≤ 1 equivalent), although a repellent effect was observed at higher doses. Conclusion The detection of contact aggregation pheromones has practical application in Chagas disease vector control. These data may be used to help design new tools against triatomine bugs. PMID:19173716

Epicuticular lipids induce aggregation in Chagas disease vectors.

PubMed

Figueiras, Alicia N Lorenzo; Girotti, Juan R; Mijailovsky, Sergio J; Juárez, M Patricia

2009-01-27

The triatomine bugs are vectors of the protozoan parasite Trypanosoma cruzi, the causative agent of Chagas disease. Aggregation behavior plays an important role in their survival by facilitating the location of refuges and cohesion of aggregates, helping to keep them safely assembled into shelters during daylight time, when they are vulnerable to predators. There are evidences that aggregation is mediated by thigmotaxis, by volatile cues from their faeces, and by hexane-extractable contact chemoreceptive signals from their cuticle surface. The epicuticular lipids of Triatoma infestans include a complex mixture of hydrocarbons, free and esterified fatty acids, alcohols, and sterols. We analyzed the response of T. infestans fifth instar nymphs after exposure to different amounts either of total epicuticular lipid extracts or individual lipid fractions. Assays were performed in a circular arena, employing a binary choice test with filter papers acting as aggregation attractive sites; papers were either impregnated with a hexane-extract of the total lipids, or lipid fraction; or with the solvent. Insects were significantly aggregated around papers impregnated with the epicuticular lipid extracts. Among the lipid fractions separately tested, only the free fatty acid fraction promoted significant bug aggregation. We also investigated the response to different amounts of selected fatty acid components of this fraction; receptiveness varied with the fatty acid chain length. No response was elicited by hexadecanoic acid (C16:0), the major fatty acid component. Octadecanoic acid (C18:0) showed a significant assembling effect in the concentration range tested (0.1 to 2 insect equivalents). The very long chain hexacosanoic acid (C26:0) was significantly attractant at low doses (

Determination of magnetic helicity in the solar wind and implications for cosmic ray propagation

NASA Technical Reports Server (NTRS)

Matthaeus, W. M.; Goldstein, M. L.

1981-01-01

Magnetic helicity (Hm) is the mean value of the correlation between a turbulent magnetic field and the magnetic vector potential. A technique is described for determining Hm and its 'reduced' spectrum from the two point magnetic correlation matrix. The application of the derived formalism to solar wind magnetic fluctuations is discussed, taking into account cases for which only single point measurements are available. The application procedure employs the usual 'frozen in approximation' approach. The considered method is applied to an analysis of several periods of Voyager 2 interplanetary magnetometer data near 2.8 AU. During these periods the correlation length, or energy containing length, was found to be approximately 3 x 10 to the 11th cm

Design and implementation of a hot-wire probe for simultaneous velocity and vorticity vector measurements in boundary layers

NASA Astrophysics Data System (ADS)

Zimmerman, S.; Morrill-Winter, C.; Klewicki, J.

2017-10-01

A multi-sensor hot-wire probe for simultaneously measuring all three components of velocity and vorticity in boundary layers has been designed, fabricated and implemented in experiments up to large Reynolds numbers. The probe consists of eight hot-wires, compactly arranged in two pairs of orthogonal ×-wire arrays. The ×-wire sub-arrays are symmetrically configured such that the full velocity and vorticity vectors are resolved about a single central location. During its design phase, the capacity of this sensor to accurately measure each component of velocity and vorticity was first evaluated via a synthetic experiment in a set of well-resolved DNS fields. The synthetic experiments clarified probe geometry effects, allowed assessment of various processing schemes, and predicted the effects of finite wire length and wire separation on turbulence statistics. The probe was subsequently fabricated and employed in large Reynolds number experiments in the Flow Physics Facility wind tunnel at the University of New Hampshire. Comparisons of statistics from the actual probe with those from the simulated sensor exhibit very good agreement in trend, but with some differences in magnitude. These comparisons also reveal that the use of gradient information in processing the probe data can significantly improve the accuracy of the spanwise velocity measurement near the wall. To the authors' knowledge, the present are the largest Reynolds number laboratory-based measurements of all three vorticity components in boundary layers.

Quantum corrections for spinning particles in de Sitter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fröb, Markus B.; Verdaguer, Enric, E-mail: mbf503@york.ac.uk, E-mail: enric.verdaguer@ub.edu

We compute the one-loop quantum corrections to the gravitational potentials of a spinning point particle in a de Sitter background, due to the vacuum polarisation induced by conformal fields in an effective field theory approach. We consider arbitrary conformal field theories, assuming only that the theory contains a large number N of fields in order to separate their contribution from the one induced by virtual gravitons. The corrections are described in a gauge-invariant way, classifying the induced metric perturbations around the de Sitter background according to their behaviour under transformations on equal-time hypersurfaces. There are six gauge-invariant modes: two scalarmore » Bardeen potentials, one transverse vector and one transverse traceless tensor, of which one scalar and the vector couple to the spinning particle. The quantum corrections consist of three different parts: a generalisation of the flat-space correction, which is only significant at distances of the order of the Planck length; a constant correction depending on the undetermined parameters of the renormalised effective action; and a term which grows logarithmically with the distance from the particle. This last term is the most interesting, and when resummed gives a modified power law, enhancing the gravitational force at large distances. As a check on the accuracy of our calculation, we recover the linearised Kerr-de Sitter metric in the classical limit and the flat-space quantum correction in the limit of vanishing Hubble constant.« less

Application of kinetic flux vector splitting scheme for solving multi-dimensional hydrodynamical models of semiconductor devices

NASA Astrophysics Data System (ADS)

Nisar, Ubaid Ahmed; Ashraf, Waqas; Qamar, Shamsul

In this article, one and two-dimensional hydrodynamical models of semiconductor devices are numerically investigated. The models treat the propagation of electrons in a semiconductor device as the flow of a charged compressible fluid. It plays an important role in predicting the behavior of electron flow in semiconductor devices. Mathematically, the governing equations form a convection-diffusion type system with a right hand side describing the relaxation effects and interaction with a self consistent electric field. The proposed numerical scheme is a splitting scheme based on the kinetic flux-vector splitting (KFVS) method for the hyperbolic step, and a semi-implicit Runge-Kutta method for the relaxation step. The KFVS method is based on the direct splitting of macroscopic flux functions of the system on the cell interfaces. The second order accuracy of the scheme is achieved by using MUSCL-type initial reconstruction and Runge-Kutta time stepping method. Several case studies are considered. For validation, the results of current scheme are compared with those obtained from the splitting scheme based on the NT central scheme. The effects of various parameters such as low field mobility, device length, lattice temperature and voltage are analyzed. The accuracy, efficiency and simplicity of the proposed KFVS scheme validates its generic applicability to the given model equations. A two dimensional simulation is also performed by KFVS method for a MESFET device, producing results in good agreement with those obtained by NT-central scheme.

Spatial distribution of an infectious disease in a small mammal community

NASA Astrophysics Data System (ADS)

Correa, Juana P.; Bacigalupo, Antonella; Fontúrbel, Francisco E.; Oda, Esteban; Cattan, Pedro E.; Solari, Aldo; Botto-Mahan, Carezza

2015-10-01

Chagas disease is a zoonosis caused by the parasite Trypanosoma cruzi and transmitted by insect vectors to several mammals, but little is known about its spatial epidemiology. We assessed the spatial distribution of T. cruzi infection in vectors and small mammals to test if mammal infection status is related to the proximity to vector colonies. During four consecutive years we captured and georeferenced the locations of mammal species and colonies of Mepraia spinolai, a restricted-movement vector. Infection status on mammals and vectors was evaluated by molecular techniques. To examine the effect of vector colonies on mammal infection status, we constructed an infection distance index using the distance between the location of each captured mammal to each vector colony and the average T. cruzi prevalence of each vector colony, weighted by the number of colonies assessed. We collected and evaluated T. cruzi infection in 944 mammals and 1976 M. spinolai. We found a significant effect of the infection distance index in explaining their infection status, when considering all mammal species together. By examining the most abundant species separately, we found this effect only for the diurnal and gregarious rodent Octodon degus. Spatially explicit models involving the prevalence and location of infected vectors and hosts had not been reported previously for a wild disease.

Effects of Cucumber mosaic virus infection on vector and non-vector herbivores of squash.

PubMed

Mauck, Kerry E; De Moraes, Consuelo M; Mescher, Mark C

2010-11-01

Plant chemicals mediating interactions with insect herbivores seem a likely target for manipulation by insectvectored plant pathogens. Yet, little is currently known about the chemical ecology of insect-vectored diseases or their effects on the ecology of vector and nonvector insects. We recently reported that a widespread plant pathogen, Cucumber mosaic virus (CMV), greatly reduces the quality of host-plants (squash) for aphid vectors, but that aphids are nevertheless attracted to the odors of infected plants-which exhibit elevated emissions of a volatile blend otherwise similar to the odor of healthy plants. This finding suggests that exaggerating existing host-location cues can be a viable vector attraction strategy for pathogens that otherwise reduce host quality for vectors. Here we report additional data regarding the effects of CMV infection on plant interactions with a common nonvector herbivore, the squash bug, Anasa tristis, which is a pest in this system. We found that adult A. tristis females preferred to oviposit on healthy plants in the field, and that healthy plants supported higher populations of nymphs. Collectively, our recent findings suggest that CMV-induced changes in host plant chemistry influence the behavior of both vector and non-vector herbivores, with significant implications both for disease spread and for broader community-level interactions.

Lentivirus-mediated klotho up-regulation improves aging-related memory deficits and oxidative stress in senescence-accelerated mouse prone-8 mice.

PubMed

Zhou, Hong-Jing; Zeng, Chen-Ye; Yang, Ting-Ting; Long, Fang-Yi; Kuang, Xi; Du, Jun-Rong

2018-05-01

Oxidative stress caused by aging aggravates neuropathological changes and cognitive deficits. Klotho, an anti-aging protein, shows an anti-oxidative effect. The aims of the present study were to determine the potential therapeutic effect of klotho in aging-related neuropathological changes and memory impairments in senescence-accelerated mouse prone-8 (SAMP8) mice, and identify the potential mechanism of these neuroprotective effects. A lentivirus was used to deliver and sustain the expression of klotho. The lentiviral vectors were injected into the bilateral lateral ventricles of 7-month-old SAMP8 mice or age-matched SAMR1 mice. Three months later, the Y-maze alternation task and passive avoidance task were used to assess the memory deficits of the mice. In situ hybridization, immunohistochemistry, immunofluorescence, Nissl staining, quantitative real-time PCR and Western blot assays were applied in the following research. Our results showed that 3 months after injection of the lentiviral vectors encoding the full-length klotho gene, the expression of klotho in the brain was significantly increased in 10-month-old SAMP8 mice. This treatment reduced memory deficits, neuronal loss, synaptic damage and 4-HNE levels but increased mitochondrial manganese-superoxide dismutase (Mn-SOD) and catalase (CAT) expression. Moreover, the up-regulation of klotho expression decreased Akt and Forkhead box class O1 (FoxO1) phosphorylation. The present study provides a novel approach for klotho gene therapy and demonstrates that direct up-regulation of klotho in the brain might improve aging-related memory impairments and decrease oxidative stress. The underlying mechanism of this effect likely involves the inhibition of the Akt/FoxO1 pathway. Copyright © 2018 Elsevier Inc. All rights reserved.

Comparative field trial of alternative vector control strategies for non-domiciliated Triatoma dimidiata.

PubMed

Ferral, Jhibran; Chavez-Nuñez, Leysi; Euan-Garcia, Maria; Ramirez-Sierra, Maria Jesus; Najera-Vazquez, M Rosario; Dumonteil, Eric

2010-01-01

Chagas disease is a major vector-borne disease, and regional initiatives based on insecticide spraying have successfully controlled domiciliated vectors in many regions. Non-domiciliated vectors remain responsible for a significant transmission risk, and their control is a challenge. We performed a proof-of-concept field trial to test alternative strategies in rural Yucatan, Mexico. Follow-up of house infestation for two seasons following the interventions confirmed that insecticide spraying should be performed annually for the effective control of Triatoma dimidiata; however, it also confirmed that insect screens or long-lasting impregnated curtains may represent good alternative strategies for the sustained control of these vectors. Ecosystemic peridomicile management would be an excellent complementary strategy to improve the cost-effectiveness of interventions. Because these strategies would also be effective against other vector-borne diseases, such as malaria or dengue, they could be integrated within a multi-disease control program.

Spatial Resolution Effect on Forest Road Gradient Calculation and Erosion Modelling

NASA Astrophysics Data System (ADS)

Cao, L.; Elliot, W.

2017-12-01

Road erosion is one of the main sediment sources in a forest watershed and should be properly evaluated. With the help of GIS technology, road topography can be determined and soil loss can be predicted at a watershed scale. As a vector geographical feature, the road gradient should be calculated following road direction rather than hillslope direction. This calculation might be difficult with a coarse (30-m) DEM which only provides the underlying topography information. This study was designed to explore the effect of road segmentation and DEM resolution on the road gradient calculation and erosion prediction at a watershed scale. The Water Erosion Prediction Project (WEPP) model was run on road segments of 9 lengths ranging from 40m to 200m. Road gradient was calculated from three DEM data sets: 1m LiDAR, and 10m and 30m USGS DEMs. The 1m LiDAR DEM calculated gradients were very close to the field observed road gradients, so we assumed the 1m LiDAR DEM predicted the true road gradient. The results revealed that longer road segments skipped detail topographical undulations and resulted in lower road gradients. Coarser DEMs computed steeper road gradients as larger grid cells covered more adjacent areas outside road resulting in larger elevation differences. Field surveyed results also revealed that coarser DEM might result in more gradient deviation in a curved road segment when it passes through a convex or concave slope. As road segment length increased, the gradient difference between three DEMs was reduced. There were no significant differences between road gradients of different segment lengths and DEM resolution when segments were longer than 100m. For long segments, the 10m DEM calculated road gradient was similar to the 1m LiDAR gradient. When evaluating the effects of road segment length, the predicted erosion rate decreased with increasing length when road gradient was less than 3%. In cases where the road gradients exceed 3% and rill erosion dominates, predicted erosion rates exponentially increased with segment length. At the watershed scale, most of the predicted soil loss occurred on segments with gradients ranging from 3% to 9%. Based on the road gradient calculated with the 10-m and 30-m DEMs, soil loss was overestimated when compared to the 1m LiDAR DEM. Both the 10m and 30m DEM result in similar total road soil loss.

Effects of temperature and photoperiod on daily activity rhythms of Lutzomyia longipalpis (Diptera: Psychodidae).

PubMed

Rivas, Gustavo B S; de Souza, Nataly Araujo; Peixoto, Alexandre A; Bruno, Rafaela V

2014-06-19

Insect vectors have been established as models in Chronobiology for many decades, and recent studies have demonstrated a close relationship between the circadian clock machinery, daily rhythms of activity and vectorial capacity. Lutzomyia longipalpis, the primary vector of Leishmania (Leishmania) infantum in the New World, is reported to have crepuscular/nocturnal activity in the wild. However, most of these studies applied hourly CDC trap captures, which is a good indicative of L. longipalpis behaviour, but has limited accuracy due to the inability to record the daily activity of a single insect during consecutive days. In addition, very little is known about the activity pattern of L. longipalpis under seasonal variations of average temperature and day length in controlled laboratory conditions. We recorded the locomotor activity of L. longipalpis males under different artificial regimes of temperature and photoperiod. First, in order to test the effects of temperature on the activity, sandflies were submitted to regimes of light/dark cycles similar to the equinox photoperiod (LD 12:12) combined with different constant temperatures (20°C, 25°C and 30°C). In addition, we recorded sandfly locomotor activity under a mild constant temperature (25°C with different day length regimes: 8 hours, 12 hours and 16 hours). L. longipalpis exhibited more activity at night, initiating dusk-related activity (onset time) at higher rather than lower temperatures. In parallel, changes of photoperiod affected anticipation as well as all the patterns of activity (onset, peak and offset time). However, under LD 16:08, sandflies presented the earliest values of maximum peak and offset times, contrary to other regimes. Herein, we showed that light and temperature modulate L. longipalpis behaviour under controlled laboratory conditions, suggesting that sandflies might use environmental information to sustain their crepuscular/nocturnal activity, as well as other important aspects as mating and host-seeking at appropriate times in different seasons. Our results depict previously unappreciated aspects of the L. longipalpis daily rhythms of activity that might have important epidemiological implications.

Effects of temperature and photoperiod on daily activity rhythms of Lutzomyia longipalpis (Diptera: Psychodidae)

PubMed Central

2014-01-01

Background Insect vectors have been established as models in Chronobiology for many decades, and recent studies have demonstrated a close relationship between the circadian clock machinery, daily rhythms of activity and vectorial capacity. Lutzomyia longipalpis, the primary vector of Leishmania (Leishmania) infantum in the New World, is reported to have crepuscular/nocturnal activity in the wild. However, most of these studies applied hourly CDC trap captures, which is a good indicative of L. longipalpis behaviour, but has limited accuracy due to the inability to record the daily activity of a single insect during consecutive days. In addition, very little is known about the activity pattern of L. longipalpis under seasonal variations of average temperature and day length in controlled laboratory conditions. Methods We recorded the locomotor activity of L. longipalpis males under different artificial regimes of temperature and photoperiod. First, in order to test the effects of temperature on the activity, sandflies were submitted to regimes of light/dark cycles similar to the equinox photoperiod (LD 12:12) combined with different constant temperatures (20°C, 25°C and 30°C). In addition, we recorded sandfly locomotor activity under a mild constant temperature (25°C with different day length regimes: 8 hours, 12 hours and 16 hours). Results L. longipalpis exhibited more activity at night, initiating dusk-related activity (onset time) at higher rather than lower temperatures. In parallel, changes of photoperiod affected anticipation as well as all the patterns of activity (onset, peak and offset time). However, under LD 16:08, sandflies presented the earliest values of maximum peak and offset times, contrary to other regimes. Conclusions Herein, we showed that light and temperature modulate L. longipalpis behaviour under controlled laboratory conditions, suggesting that sandflies might use environmental information to sustain their crepuscular/nocturnal activity, as well as other important aspects as mating and host-seeking at appropriate times in different seasons. Our results depict previously unappreciated aspects of the L. longipalpis daily rhythms of activity that might have important epidemiological implications. PMID:24947114

Effect of high-pitch dual-source CT to compensate motion artifacts: a phantom study.

PubMed

Farshad-Amacker, Nadja A; Alkadhi, Hatem; Leschka, Sebastian; Frauenfelder, Thomas

2013-10-01

To evaluate the potential of high-pitch, dual-source computed tomography (DSCT) for compensation of motion artifacts. Motion artifacts were created using a moving chest/cardiac phantom with integrated stents at different velocities (from 0 to 4-6 cm/s) parallel (z direction), transverse (x direction), and diagonal (x and z direction combined) to the scanning direction using standard-pitch (SP) (pitch = 1) and high-pitch (HP) (pitch = 3.2) 128-detector DSCT (Siemens, Healthcare, Forchheim, Germany). The scanning parameters were (SP/HP): tube voltage, 120 kV/120 kV; effective tube current time product, 300 mAs/500 mAs; and a pitch of 1/3.2. Motion artifacts were analyzed in terms of subjective image quality and object distortion. Image quality was rated by two blinded, independent observers using a 4-point scoring system (1, excellent; 2, good with minor object distortion or blurring; 3, diagnostically partially not acceptable; and 4, diagnostically not acceptable image quality). Object distortion was assessed by the measured changes of the object's outer diameter (x) and length (z) and a corresponding calculated distortion vector (d) (d = √(x(2) + z(2))). The interobserver agreement was excellent (k = 0.91). Image quality using SP was diagnostically not acceptable with any motion in x direction (scores 3 and 4), in contrast to HP DSCT where it remained diagnostic up to 2 cm/s (scores 1 and 2). For motion in the z direction only, image quality remained diagnostic for SP and HP DSCT (scores 1 and 2). Changes of the object's diameter (x), length (z), and distortion vectors (d) were significantly greater with SP (overall: x = 1.9 cm ± 1.7 cm, z = 0.6 cm ± 0.8 cm, and d = 1.4 cm ± 1.5 cm) compared to HP DSCT (overall: x = 0.1 cm ± 0.1 cm, z = 0.0 cm ± 0.1 cm, and d = 0.1 cm ± 0.1 cm; each P < .05). High-pitch DSCT significantly decreases motion artifacts in various directions and improves image quality. Copyright © 2013 AUR. Published by Elsevier Inc. All rights reserved.

Optimal control of malaria: combining vector interventions and drug therapies.

PubMed

Khamis, Doran; El Mouden, Claire; Kura, Klodeta; Bonsall, Michael B

2018-04-24

The sterile insect technique and transgenic equivalents are considered promising tools for controlling vector-borne disease in an age of increasing insecticide and drug-resistance. Combining vector interventions with artemisinin-based therapies may achieve the twin goals of suppressing malaria endemicity while managing artemisinin resistance. While the cost-effectiveness of these controls has been investigated independently, their combined usage has not been dynamically optimized in response to ecological and epidemiological processes. An optimal control framework based on coupled models of mosquito population dynamics and malaria epidemiology is used to investigate the cost-effectiveness of combining vector control with drug therapies in homogeneous environments with and without vector migration. The costs of endemic malaria are weighed against the costs of administering artemisinin therapies and releasing modified mosquitoes using various cost structures. Larval density dependence is shown to reduce the cost-effectiveness of conventional sterile insect releases compared with transgenic mosquitoes with a late-acting lethal gene. Using drug treatments can reduce the critical vector control release ratio necessary to cause disease fadeout. Combining vector control and drug therapies is the most effective and efficient use of resources, and using optimized implementation strategies can substantially reduce costs.

Structure of flexible and semiflexible polyelectrolyte chains in confined spaces of slit micro/nanochannels.

PubMed

Jeon, Jonggu; Chun, Myung-Suk

2007-04-21

Understanding the behavior of a polyelectrolyte in confined spaces has direct relevance in design and manipulation of microfluidic devices, as well as transport in living organisms. In this paper, a coarse-grained model of anionic semiflexible polyelectrolyte is applied, and its structure and dynamics are fully examined with Brownian dynamics (BD) simulations both in bulk solution and under confinement between two negatively charged parallel plates. The modeling is based on the nonlinear bead-spring discretization of a continuous chain with additional long-range electrostatic, Lennard-Jones, and hydrodynamic interactions between pairs of beads. The authors also consider the steric and electrostatic interactions between the bead and the confining wall. Relevant model parameters are determined from experimental rheology data on the anionic polysaccharide xanthan reported previously. For comparison, both flexible and semiflexible models are developed accompanying zero and finite intrinsic persistence lengths, respectively. The conformational changes of the polyelectrolyte chain induced by confinements and their dependence on the screening effect of the electrolyte solution are faithfully characterized with BD simulations. Depending on the intrinsic rigidity and the medium ionic strength, the polyelectrolyte can be classified as flexible, semiflexible, or rigid. Confined flexible and semiflexible chains exhibit a nonmonotonic variation in size, as measured by the radius of gyration and end-to-end distance, with changing slit width. For the semiflexible chain, this is coupled to the variations in long-range bond vector correlation. The rigid chain, realized at low ionic strength, does not have minima in size but exhibits a sigmoidal transition. The size of confined semiflexible and rigid polyelectrolytes can be well described by the wormlike chain model once the electrostatic effects are taken into account by the persistence length measured at long length scale.

PROMISE: a tool to identify genomic features with a specific biologically interesting pattern of associations with multiple endpoint variables.

PubMed

Pounds, Stan; Cheng, Cheng; Cao, Xueyuan; Crews, Kristine R; Plunkett, William; Gandhi, Varsha; Rubnitz, Jeffrey; Ribeiro, Raul C; Downing, James R; Lamba, Jatinder

2009-08-15

In some applications, prior biological knowledge can be used to define a specific pattern of association of multiple endpoint variables with a genomic variable that is biologically most interesting. However, to our knowledge, there is no statistical procedure designed to detect specific patterns of association with multiple endpoint variables. Projection onto the most interesting statistical evidence (PROMISE) is proposed as a general procedure to identify genomic variables that exhibit a specific biologically interesting pattern of association with multiple endpoint variables. Biological knowledge of the endpoint variables is used to define a vector that represents the biologically most interesting values for statistics that characterize the associations of the endpoint variables with a genomic variable. A test statistic is defined as the dot-product of the vector of the observed association statistics and the vector of the most interesting values of the association statistics. By definition, this test statistic is proportional to the length of the projection of the observed vector of correlations onto the vector of most interesting associations. Statistical significance is determined via permutation. In simulation studies and an example application, PROMISE shows greater statistical power to identify genes with the interesting pattern of associations than classical multivariate procedures, individual endpoint analyses or listing genes that have the pattern of interest and are significant in more than one individual endpoint analysis. Documented R routines are freely available from www.stjuderesearch.org/depts/biostats and will soon be available as a Bioconductor package from www.bioconductor.org.

A Cartesian parametrization for the numerical analysis of material instability

DOE PAGES

Mota, Alejandro; Chen, Qiushi; Foulk, III, James W.; ...

2016-02-25

We examine four parametrizations of the unit sphere in the context of material stability analysis by means of the singularity of the acoustic tensor. We then propose a Cartesian parametrization for vectors that lie a cube of side length two and use these vectors in lieu of unit normals to test for the loss of the ellipticity condition. This parametrization is then used to construct a tensor akin to the acoustic tensor. It is shown that both of these tensors become singular at the same time and in the same planes in the presence of a material instability. Furthermore, themore » performance of the Cartesian parametrization is compared against the other parametrizations, with the results of these comparisons showing that in general, the Cartesian parametrization is more robust and more numerically efficient than the others.« less

A Cartesian parametrization for the numerical analysis of material instability

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mota, Alejandro; Chen, Qiushi; Foulk, III, James W.

We examine four parametrizations of the unit sphere in the context of material stability analysis by means of the singularity of the acoustic tensor. We then propose a Cartesian parametrization for vectors that lie a cube of side length two and use these vectors in lieu of unit normals to test for the loss of the ellipticity condition. This parametrization is then used to construct a tensor akin to the acoustic tensor. It is shown that both of these tensors become singular at the same time and in the same planes in the presence of a material instability. Furthermore, themore » performance of the Cartesian parametrization is compared against the other parametrizations, with the results of these comparisons showing that in general, the Cartesian parametrization is more robust and more numerically efficient than the others.« less

The effect of photoperiod on life history and blood-feeding activity in Aedes albopictus and Aedes aegypti (Diptera: Culicidae).

PubMed

Costanzo, K S; Schelble, S; Jerz, K; Keenan, M

2015-06-01

Several studies have examined how climatic variables such as temperature and precipitation may affect life history traits in mosquitoes that are important to disease transmission. Despite its importance as a seasonal cue in nature, studies investigating the influence of photoperiod on such traits are relatively few. This study aims to investigate how photoperiod alters life history traits, survival, and blood-feeding activity in Aedes albopictus (Skuse) and Aedes aegypti (Linnaeus). We performed three experiments that tested the effects of day length on female survival, development time, adult size, fecundity, adult life span, and propensity to blood feed in Ae. albopictus and Ae. aegypti. Each experiment had three photoperiod treatments: 1) short-day (10L:14D), 2) control (12L:12D), and 3) long-day (14L:10D). Aedes albopictus adult females were consistently larger in size when reared in short-day conditions. Aedes aegypti adult females from short-day treatments lived longer and were more likely to take a blood meal compared to other treatments. We discuss how species-specific responses may reflect alternative strategies evolved to increase survival during unfavorable conditions. We review the potential impacts of these responses on seasonal transmission patterns, such as potentially increasing vectorial capacity of Ae. aegypti during periods of shorter day lengths. © 2015 The Society for Vector Ecology.

The assisted prediction modelling frame with hybridisation and ensemble for business risk forecasting and an implementation

NASA Astrophysics Data System (ADS)

Li, Hui; Hong, Lu-Yao; Zhou, Qing; Yu, Hai-Jie

2015-08-01

The business failure of numerous companies results in financial crises. The high social costs associated with such crises have made people to search for effective tools for business risk prediction, among which, support vector machine is very effective. Several modelling means, including single-technique modelling, hybrid modelling, and ensemble modelling, have been suggested in forecasting business risk with support vector machine. However, existing literature seldom focuses on the general modelling frame for business risk prediction, and seldom investigates performance differences among different modelling means. We reviewed researches on forecasting business risk with support vector machine, proposed the general assisted prediction modelling frame with hybridisation and ensemble (APMF-WHAE), and finally, investigated the use of principal components analysis, support vector machine, random sampling, and group decision, under the general frame in forecasting business risk. Under the APMF-WHAE frame with support vector machine as the base predictive model, four specific predictive models were produced, namely, pure support vector machine, a hybrid support vector machine involved with principal components analysis, a support vector machine ensemble involved with random sampling and group decision, and an ensemble of hybrid support vector machine using group decision to integrate various hybrid support vector machines on variables produced from principle components analysis and samples from random sampling. The experimental results indicate that hybrid support vector machine and ensemble of hybrid support vector machines were able to produce dominating performance than pure support vector machine and support vector machine ensemble.

Reconstruction of muscle fascicle architecture from iodine-enhanced microCT images: A combined texture mapping and streamline approach.

PubMed

Kupczik, Kornelius; Stark, Heiko; Mundry, Roger; Neininger, Fabian T; Heidlauf, Thomas; Röhrle, Oliver

2015-10-07

Skeletal muscle models are used to investigate motion and force generation in both biological and bioengineering research. Yet, they often lack a realistic representation of the muscle's internal architecture which is primarily composed of muscle fibre bundles, known as fascicles. Recently, it has been shown that fascicles can be resolved with micro-computed tomography (µCT) following staining of the muscle tissue with iodine potassium iodide (I2KI). Here, we present the reconstruction of the fascicular spatial arrangement and geometry of the superficial masseter muscle of a dog based on a combination of pattern recognition and streamline computation. A cadaveric head of a dog was incubated in I2KI and µCT-scanned. Following segmentation of the masseter muscle a statistical pattern recognition algorithm was applied to create a vector field of fascicle directions. Streamlines were then used to transform the vector field into a realistic muscle fascicle representation. The lengths of the reconstructed fascicles and the pennation angles in two planes (frontal and sagittal) were extracted and compared against a tracked fascicle field obtained through cadaver dissection. Both fascicle lengths and angles were found to vary substantially within the muscle confirming the complex and heterogeneous nature of skeletal muscle described by previous studies. While there were significant differences in the pennation angle between the experimentally derived and µCT-reconstructed data, there was congruence in the fascicle lengths. We conclude that the presented approach allows for embedding realistic fascicle information into finite element models of skeletal muscles to better understand the functioning of the musculoskeletal system. Copyright © 2015 Elsevier Ltd. All rights reserved.

Subtle but ubiquitous selection on body size in a natural population of collared flycatchers over 33 years.

PubMed

Björklund, M; Gustafsson, L

2017-07-01

Understanding the magnitude and long-term patterns of selection in natural populations is of importance, for example, when analysing the evolutionary impact of climate change. We estimated univariate and multivariate directional, quadratic and correlational selection on four morphological traits (adult wing, tarsus and tail length, body mass) over a time period of 33 years (≈ 19 000 observations) in a nest-box breeding population of collared flycatchers (Ficedula albicollis). In general, selection was weak in both males and females over the years regardless of fitness measure (fledged young, recruits and survival) with only few cases with statistically significant selection. When data were analysed in a multivariate context and as time series, a number of patterns emerged; there was a consistent, but weak, selection for longer wings in both sexes, selection was stronger on females when the number of fledged young was used as a fitness measure, there were no indications of sexually antagonistic selection, and we found a negative correlation between selection on tarsus and wing length in both sexes but using different fitness measures. Uni- and multivariate selection gradients were correlated only for wing length and mass. Multivariate selection gradient vectors were longer than corresponding vector of univariate gradients and had more constrained direction. Correlational selection had little importance. Overall, the fitness surface was more or less flat with few cases of significant curvature, indicating that the adaptive peak with regard to body size in this species is broader than the phenotypic distribution, which has resulted in weak estimates of selection. © 2017 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2017 European Society For Evolutionary Biology.

Coronal Heating and the Magnetic Field in Solar Active Regions

NASA Astrophysics Data System (ADS)

Falconer, D. A.; Tiwari, S. K.; Winebarger, A. R.; Moore, R. L.

2017-12-01

A strong dependence of active-region (AR) coronal heating on the magnetic field is demonstrated by the strong correlation of AR X-ray luminosity with AR total magnetic flux (Fisher et al 1998 ApJ). AR X-ray luminosity is also correlated with AR length of strong-shear neutral line in the photospheric magnetic field (Falconer 1997). These two whole-AR magnetic parameters are also correlated with each other. From 150 ARs observed within 30 heliocentric degrees from disk center by AIA and HMI on SDO, using AR luminosity measured from the hot component of the AIA 94 Å band (Warren et al 2012, ApJ) near the time of each of 3600 measured HMI vector magnetograms of these ARs and a wide selection of whole-AR magnetic parameters from each vector magnetogram after it was deprojected to disk center, we find: (1) The single magnetic parameter having the strongest correlation with AR 94-hot luminosity is the length of strong-field neutral line. (2) The two-parameter combination having the strongest still-stronger correlation with AR 94-hot luminosity is a combination of AR total magnetic flux and AR neutral-line length weighted by the vertical-field gradient across the neutral line. We interpret these results to be consistent with the results of both Fisher et al (1998) and Falconer (1997), and with the correlation of AR coronal loop heating with loop field strength recently found by Tiwari et al (2017, ApJ Letters). Our interpretation is that, in addition to depending strongly on coronal loop field strength, AR coronal heating has a strong secondary positive dependence on the rate of flux cancelation at neutral lines at coronal loop feet. This work was funded by the Living With a Star Science and Heliophysics Guest Investigators programs of NASA's Heliophysics Division.

Can carbon nanotube fibers achieve the ultimate conductivity?—Coupled-mode analysis for electron transport through the carbon nanotube contact

NASA Astrophysics Data System (ADS)

Xu, Fangbo; Sadrzadeh, Arta; Xu, Zhiping; Yakobson, Boris I.

2013-08-01

Recent measurements of carbon nanotube (CNT) fibers electrical conductivity still show the values lower than that of individual CNTs, by about one magnitude order. The imperfections of manufacturing process and constituent components are described as culprits. What if every segment is made perfect? In this work, we study the quantum conductance through the parallel junction of flawless armchair CNTs using tight-binding method in conjunction with non-equilibrium Green's function approach. Short-range oscillations within the long-range oscillations as well as decaying envelopes are all observed in the computed Fermi-level (low bias) conductance as a function of contact length, L. The propagation of CNTs' Bloch waves is cast in the coupled-mode formalism and helps to reveal the quantum interference nature of various behaviors of conductance. Our analysis shows that the Bloch waves at the Fermi-level propagate through a parallel junction without reflection only at an optimal value of contact length. For quite a long junction, however, the conductance at the Fermi level diminishes due to the perturbation of periodic potential field of close-packed CNTs. Thus, a macroscopic fiber, containing an infinite number of junctions, forms a filter that permits passage of electrons with specific wave vectors, and these wave vectors are determined by the collection of all the junction lengths. We also argue that the energy gap introduced by long junctions can be overcome by small voltage (˜0.04 V) across the whole fiber. Overall, developing long individual all-armchair metallic CNTs serves as a promising way to the manufacture of high-conductivity fibers.

General Rotorcraft Aeromechanical Stability Program (GRASP) - Theory Manual

DTIC Science & Technology

1990-10-01

the A basis. Two symbols frequently encountered in vector operations that use index notation are the Kronecker delta eij and the Levi - Civita epsilon...Blade root cutout fijk Levi - Civita epsilon permutation symbol 0 pretwist angle 0’ pretwist per unit length (d;) Oi Tait-Bryan angles K~i moment strains...the components of the identity tensor in a Cartesian coordinate system, while the Levi Civita epsilon consists of components of the permutation

Designing a Soluble Near Full-Length HIV-1 GP41 Trimer

DTIC Science & Technology

2012-11-26

envelope; gp41 trimer; bacteriophage T4 display; prehairpin fusion intermediate. Background: The envelope glycoprotein gp41 is a key component of...protein into trimers and defined oligomers. These gp41 trimers were displayed on bacteriophage T4 capsid nanoparticles by attaching to the small...Construction of the Expression Vectors —All the gp41 constructs were generated by splicing-by- overlap extension PCR using wild-type HXB2 gp41 DNA

Hairpin plum pox virus coat protein (hpPPV-CP) structure in 'HoneySweet' C5 plum provides PPV resistance when genetically engineered into plum (Prunus domestica) seedlings

USDA-ARS?s Scientific Manuscript database

The genetically engineered plum 'HoneySweet' (aka C5) has proven to be highly resistant to Plum pox virus (PPV) for over 10 years in field trials. The original vector used for transformation to develop 'HoneySweet' carried a single sense sequence of the full length PPV coat protein (ppv-cp) gene, y...

Cell culture compositions

DOEpatents

Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yiao, Jian

2014-03-18

The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6 (SEQ ID NO:1 encodes the full length endoglucanase; SEQ ID NO:4 encodes the mature form), and the corresponding endoglucanase VI amino acid sequence ("EGVI"; SEQ ID NO:3 is the signal sequence; SEQ ID NO:2 is the mature sequence). The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

Using single buffers and data reorganization to implement a multi-megasample fast Fourier transform

NASA Technical Reports Server (NTRS)

Brown, R. D.

1992-01-01

Data ordering in large fast Fourier transforms (FFT's) is both conceptually and implementationally difficult. Discribed here is a method of visualizing data orderings as vectors of address bits, which enables the engineer to use more efficient data orderings and reduce double-buffer memory designs. Also detailed are the difficulties and algorithmic solutions involved in FFT lengths up to 4 megasamples (Msamples) and sample rates up to 80 MHz.

Is Vector Control Sufficient to Limit Pathogen Spread in Vineyards?

PubMed

Daugherty, M P; O'Neill, S; Byrne, F; Zeilinger, A

2015-06-01

Vector control is widely viewed as an integral part of disease management. Yet epidemiological theory suggests that the effectiveness of control programs at limiting pathogen spread depends on a variety of intrinsic and extrinsic aspects of a pathosystem. Moreover, control programs rarely evaluate whether reductions in vector density or activity translate into reduced disease prevalence. In areas of California invaded by the glassy-winged sharpshooter (Homalodisca vitripennis Germar), Pierce's disease management relies heavily on chemical control of this vector, primarily via systemic conventional insecticides (i.e., imidacloprid). But, data are lacking that attribute reduced vector pressure and pathogen spread to sharpshooter control. We surveyed 34 vineyards over successive years to assess the epidemiological value of within-vineyard chemical control. The results showed that imidacloprid reduced vector pressure without clear nontarget effects or secondary pest outbreaks. Effects on disease prevalence were more nuanced. Treatment history over the preceding 5 yr affected disease prevalence, with significantly more diseased vines in untreated compared with regularly or intermittently treated vineyards. Yet, the change in disease prevalence between years was low, with no significant effects of insecticide treatment or vector abundance. Collectively, the results suggest that within-vineyard applications of imidacloprid can reduce pathogen spread, but with benefits that may take multiple seasons to become apparent. The relatively modest effect of vector control on disease prevalence in this system may be attributable in part to the currently low regional sharpshooter population densities stemming from area-wide control, without which the need for within-vineyard vector control would be more pronounced. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

The Effects of Climate Change and Globalization on Mosquito Vectors: Evidence from Jeju Island, South Korea on the Potential for Asian Tiger Mosquito (Aedes albopictus) Influxes and Survival from Vietnam Rather Than Japan

PubMed Central

Jeong, Ji Yeon; Yoo, Seung Jin; Koh, Young-Sang; Lee, Seogjae; Heo, Sang Taek; Seong, Seung-Yong; Lee, Keun Hwa

2013-01-01

Background Climate change affects the survival and transmission of arthropod vectors as well as the development rates of vector-borne pathogens. Increased international travel is also an important factor in the spread of vector-borne diseases (VBDs) such as dengue, West Nile, yellow fever, chikungunya, and malaria. Dengue is the most important vector-borne viral disease. An estimated 2.5 billion people are at risk of infection in the world and there are approximately 50 million dengue infections and an estimated 500,000 individuals are hospitalized with dengue haemorrhagic fever annually. The Asian tiger mosquito (Aedes albopictus) is one of the vectors of dengue virus, and populations already exist on Jeju Island, South Korea. Currently, colder winter temperatures kill off Asian tiger mosquito populations and there is no evidence of the mosquitos being vectors for the dengue virus in this location. However, dengue virus-bearing mosquito vectors can inflow to Jeju Island from endemic area such as Vietnam by increased international travel, and this mosquito vector's survival during colder winter months will likely occur due to the effects of climate change. Methods and Results In this section, we show the geographical distribution of medically important mosquito vectors such as Ae. albopictus, a vector of both dengue and chikungunya viruses; Culex pipiens, a vector of West Nile virus; and Anopheles sinensis, a vector of Plasmodium vivax, within Jeju Island, South Korea. We found a significant association between the mean temperature, amount of precipitation, and density of mosquitoes. The phylogenetic analyses show that an Ae. albopictus, collected in southern area of Jeju Island, was identical to specimens found in Ho Chi Minh, Vietnam, and not Nagasaki, Japan. Conclusion Our results suggest that mosquito vectors or virus-bearing vectors can transmit from epidemic regions of Southeast Asia to Jeju Island and can survive during colder winter months. Therefore, Jeju Island is no longer safe from vector borne diseases (VBDs) due to the effects of globalization and climate change, and we should immediately monitor regional climate change to identify newly emerging VBDs. PMID:23894312

The effects of climate change and globalization on mosquito vectors: evidence from Jeju Island, South Korea on the potential for Asian tiger mosquito (Aedes albopictus) influxes and survival from Vietnam rather than Japan.

PubMed

Lee, Su Hyun; Nam, Kwang Woo; Jeong, Ji Yeon; Yoo, Seung Jin; Koh, Young-Sang; Lee, Seogjae; Heo, Sang Taek; Seong, Seung-Yong; Lee, Keun Hwa

2013-01-01

Climate change affects the survival and transmission of arthropod vectors as well as the development rates of vector-borne pathogens. Increased international travel is also an important factor in the spread of vector-borne diseases (VBDs) such as dengue, West Nile, yellow fever, chikungunya, and malaria. Dengue is the most important vector-borne viral disease. An estimated 2.5 billion people are at risk of infection in the world and there are approximately 50 million dengue infections and an estimated 500,000 individuals are hospitalized with dengue haemorrhagic fever annually. The Asian tiger mosquito (Aedes albopictus) is one of the vectors of dengue virus, and populations already exist on Jeju Island, South Korea. Currently, colder winter temperatures kill off Asian tiger mosquito populations and there is no evidence of the mosquitos being vectors for the dengue virus in this location. However, dengue virus-bearing mosquito vectors can inflow to Jeju Island from endemic area such as Vietnam by increased international travel, and this mosquito vector's survival during colder winter months will likely occur due to the effects of climate change. In this section, we show the geographical distribution of medically important mosquito vectors such as Ae. albopictus, a vector of both dengue and chikungunya viruses; Culex pipiens, a vector of West Nile virus; and Anopheles sinensis, a vector of Plasmodium vivax, within Jeju Island, South Korea. We found a significant association between the mean temperature, amount of precipitation, and density of mosquitoes. The phylogenetic analyses show that an Ae. albopictus, collected in southern area of Jeju Island, was identical to specimens found in Ho Chi Minh, Vietnam, and not Nagasaki, Japan. Our results suggest that mosquito vectors or virus-bearing vectors can transmit from epidemic regions of Southeast Asia to Jeju Island and can survive during colder winter months. Therefore, Jeju Island is no longer safe from vector borne diseases (VBDs) due to the effects of globalization and climate change, and we should immediately monitor regional climate change to identify newly emerging VBDs.

Inhalation of Nebulized Perfluorochemical Enhances Recombinant Adenovirus and Adeno-Associated Virus-Mediated Gene Expression in Lung Epithelium

PubMed Central

Beckett, Travis; Bonneau, Laura; Howard, Alan; Blanchard, James; Borda, Juan; Weiner, Daniel J.; Wang, Lili; Gao, Guang Ping; Kolls, Jay K.; Bohm, Rudolf; Liggitt, Denny

2012-01-01

Abstract Use of perfluorochemical liquids during intratracheal vector administration enhances recombinant adenovirus and adeno-associated virus (AAV)-mediated lung epithelial gene expression. We hypothesized that inhalation of nebulized perfluorochemical vapor would also enhance epithelial gene expression after subsequent intratracheal vector administration. Freely breathing adult C57BL/6 mice were exposed for selected times to nebulized perflubron or sterile saline in a sealed Plexiglas chamber. Recombinant adenoviral vector was administered by transtracheal puncture at selected times afterward and mice were killed 3 days after vector administration to assess transgene expression. Mice tolerated the nebulized perflubron without obvious ill effects. Vector administration 6 hr after nebulized perflubron exposure resulted in an average 540% increase in gene expression in airway and alveolar epithelium, compared with that with vector alone or saline plus vector control (p<0.05). However, vector administration 1 hr, 1 day, or 3 days after perflubron exposure was not different from either nebulized saline with vector or vector alone and a 60-min exposure to nebulized perflubron is required. In parallel pilot studies in macaques, inhalation of nebulized perflubron enhanced recombinant AAV2/5 vector expression throughout the lung. Serial chest radiographs, bronchoalveolar lavages, and results of complete blood counts and serum biochemistries demonstrated no obvious adverse effects of nebulized perflubron. Further, one macaque receiving nebulized perflubron only was monitored for 1 year with no obvious adverse effects of exposure. These results demonstrate that inhalation of nebulized perflubron, a simple, clinically more feasible technique than intratracheal administration of liquid perflubron, safely enhances lung gene expression. PMID:22568624

Birefringent Fiber Devices and Lasers

NASA Astrophysics Data System (ADS)

Theimer, James Prentice

1995-01-01

This thesis presents the results of numerical simulations of mode-locked figure eight lasers and their components: fiber amplifiers and nonlinear optical loop mirrors (NOLMs). The computations were designed to study pulse evolution in optical amplifiers and NOLMs with periodic repetition of these elements. Since fiber laser systems also include birefringent fiber, the effects of fiber birefringence was incorporated into the simulations. My studies of pulse amplification in non-birefringent amplifiers show pulse breakup when their energies exceed 4.5 fundamental soliton energies. In birefringent fibers pulse breakup is also found, but the two orthogonally polarized pulses propagate together. I find that their behavior is related to the properties of a vector soliton. I found that vector waves have close to unity transmission through a birefringent NOLM, but the pulse shape is distorted. This shape distortion reduces subsequent transmissions through the NOLM. The energy required for peak transmission of the pulse is predicted by the theory based on vector solitons. The same theory also predicted the low intensity transmission. The performance of the NOLM with birefringent fiber could not be improved by altering the polarization state of the pulse from linear polarization; the polarization controller introduced pulse distortion that resulted in excessive loss. I found an instability in the steady-state operation of the figure eight laser, which is due to pulse reshaping during propagation in the amplifier section. To remove this instability I introduced the concept of dispersion balancing; by increasing the dispersion in the amplifier section, the pulse can propagate nearly as a fundamental soliton in both the amplifier and the NOLM sections of the laser. This eliminated a major source of dispersive wave shedding and allowed the laser operation to become independent of the amplifier length. Sidebands were found on the pulse spectrum and their maxima corresponded well with the periodic resonance model.

Lorentzian Goldstone modes shared among photons and gravitons

NASA Astrophysics Data System (ADS)

Chkareuli, J. L.; Jejelava, J.; Kepuladze, Z.

2018-02-01

It has long been known that photons and gravitons may appear as vector and tensor Goldstone modes caused by spontaneous Lorentz invariance violation (SLIV). Usually this approach is considered for photons and gravitons separately. We develop the emergent electrogravity theory consisting of the ordinary QED and the tensor-field gravity model which mimics the linearized general relativity in Minkowski spacetime. In this theory, Lorentz symmetry appears incorporated into higher global symmetries of the length-fixing constraints put on the vector and tensor fields involved, A_{μ }2=± MA2 and H_{μ ν }2=± MH2 (MA and MH are the proposed symmetry breaking scales). We show that such a SLIV pattern being related to breaking of global symmetries underlying these constraints induces the massless Goldstone and pseudo-Goldstone modes shared by photon and graviton. While for a vector field case the symmetry of the constraint coincides with Lorentz symmetry SO(1, 3) of the electrogravity Lagrangian, the tensor-field constraint itself possesses much higher global symmetry SO(7, 3), whose spontaneous violation provides a sufficient number of zero modes collected in a graviton. Accordingly, while the photon may only contain true Goldstone modes, the graviton appears at least partially to be composed of pseudo-Goldstone modes rather than of pure Goldstone ones. When expressed in terms of these modes, the theory looks essentially nonlinear and contains a variety of Lorentz and CPT violating couplings. However, all SLIV effects turn out to be strictly cancelled in the lowest order processes considered in some detail. How this emergent electrogravity theory could be observationally different from conventional QED and GR theories is also briefly discussed.

What is the 'true' effect of Trypanosoma rangeli on its triatomine bug vector?

PubMed

Peterson, Jennifer K; Graham, Andrea L

2016-06-01

The phrase, "T. rangeli is pathogenic to its insect vector," is commonly found in peer-reviewed publications on the matter, such that it has become the orthodox view of this interaction. In a literature survey, we identified over 20 papers with almost the exact phrase and several others alluding to it. The idea is of particular importance in triatomine population dynamics and the study of vector-borne T. cruzi transmission, as it could mean that triatomines infected with T. rangeli have lower fitness than uninfected insects. Trypanosoma rangeli pathogenicity was first observed in a series of studies carried out over fifty years ago using the triatomine species Rhodnius prolixus. However, there are few studies of the effect of T. rangeli on its other vector species, and several of the studies were carried out with R. prolixus under non-physiological conditions. Here, we re-evaluate the published studies that led to the conclusion that T. rangeli is pathogenic to its vector, to determine whether or not this indeed is the "true" effect of T. rangeli on its triatomine vector. © 2016 The Society for Vector Ecology.

Effects of OCR Errors on Ranking and Feedback Using the Vector Space Model.

ERIC Educational Resources Information Center

Taghva, Kazem; And Others

1996-01-01

Reports on the performance of the vector space model in the presence of OCR (optical character recognition) errors in information retrieval. Highlights include precision and recall, a full-text test collection, smart vector representation, impact of weighting parameters, ranking variability, and the effect of relevance feedback. (Author/LRW)

Vector-borne Infections

PubMed Central

Ben Beard, C.

2011-01-01

Infections with vector-borne pathogens are a major source of emerging diseases. The ability of vectors to bridge spatial and ecologic gaps between animals and humans increases opportunities for emergence. Small adaptations of a pathogen to a vector can have profound effects on the rate of transmission to humans. PMID:21529382

Production of a full-length infectious GFP-tagged cDNA clone of Beet mild yellowing virus for the study of plant-polerovirus interactions.

PubMed

Stevens, Mark; Viganó, Felicita

2007-04-01

The full-length cDNA of Beet mild yellowing virus (Broom's Barn isolate) was sequenced and cloned into the vector pLitmus 29 (pBMYV-BBfl). The sequence of BMYV-BBfl (5721 bases) shared 96% and 98% nucleotide identity with the other complete sequences of BMYV (BMYV-2ITB, France and BMYV-IPP, Germany respectively). Full-length capped RNA transcripts of pBMYV-BBfl were synthesised and found to be biologically active in Arabidopsis thaliana protoplasts following electroporation or PEG inoculation when the protoplasts were subsequently analysed using serological and molecular methods. The BMYV sequence was modified by inserting DNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene close to its 3' end. A. thaliana protoplasts electroporated with these RNA transcripts were biologically active and up to 2% of transfected protoplasts showed GFP-specific fluorescence. The exploitation of these cDNA clones for the study of the biology of beet poleroviruses is discussed.

Effects of Cavity on the Performance of Dual Throat Nozzle During the Thrust-Vectoring Starting Transient Process.

PubMed

Gu, Rui; Xu, Jinglei

2014-01-01

The dual throat nozzle (DTN) technique is capable to achieve higher thrust-vectoring efficiencies than other fluidic techniques, without compromising thrust efficiency significantly during vectoring operation. The excellent performance of the DTN is mainly due to the concaved cavity. In this paper, two DTNs of different scales have been investigated by unsteady numerical simulations to compare the parameter variations and study the effects of cavity during the vector starting process. The results remind us that during the vector starting process, dynamic loads may be generated, which is a potentially challenging problem for the aircraft trim and control.

An Adaptive S-Method to Analyze Micro-Doppler Signals for Human Activity Classification

PubMed Central

Yang, Chao; Xia, Yuqing; Ma, Xiaolin; Zhang, Tao; Zhou, Zhou

2017-01-01

In this paper, we propose the multiwindow Adaptive S-method (AS-method) distribution approach used in the time-frequency analysis for radar signals. Based on the results of orthogonal Hermite functions that have good time-frequency resolution, we vary the length of window to suppress the oscillating component caused by cross-terms. This method can bring a better compromise in the auto-terms concentration and cross-terms suppressing, which contributes to the multi-component signal separation. Finally, the effective micro signal is extracted by threshold segmentation and envelope extraction. To verify the proposed method, six states of motion are separated by a classifier of a support vector machine (SVM) trained to the extracted features. The trained SVM can detect a human subject with an accuracy of 95.4% for two cases without interference. PMID:29186075

An Adaptive S-Method to Analyze Micro-Doppler Signals for Human Activity Classification.

PubMed

Li, Fangmin; Yang, Chao; Xia, Yuqing; Ma, Xiaolin; Zhang, Tao; Zhou, Zhou

2017-11-29

In this paper, we propose the multiwindow Adaptive S-method (AS-method) distribution approach used in the time-frequency analysis for radar signals. Based on the results of orthogonal Hermite functions that have good time-frequency resolution, we vary the length of window to suppress the oscillating component caused by cross-terms. This method can bring a better compromise in the auto-terms concentration and cross-terms suppressing, which contributes to the multi-component signal separation. Finally, the effective micro signal is extracted by threshold segmentation and envelope extraction. To verify the proposed method, six states of motion are separated by a classifier of a support vector machine (SVM) trained to the extracted features. The trained SVM can detect a human subject with an accuracy of 95.4% for two cases without interference.

Generation of Infectious Poliovirus with Altered Genetic Information from Cloned cDNA.

PubMed

Bujaki, Erika

2016-01-01

The effect of specific genetic alterations on virus biology and phenotype can be studied by a great number of available assays. The following method describes the basic protocol to generate infectious poliovirus with altered genetic information from cloned cDNA in cultured cells.The example explained here involves generation of a recombinant poliovirus genome by simply replacing a portion of the 5' noncoding region with a synthetic gene by restriction cloning. The vector containing the full length poliovirus genome and the insert DNA with the known mutation(s) are cleaved for directional cloning, then ligated and transformed into competent bacteria. The recombinant plasmid DNA is then propagated in bacteria and transcribed to RNA in vitro before RNA transfection of cultured cells is performed. Finally, viral particles are recovered from the cell culture.

Dip-pen patterning of poly(9,9-dioctylfluorene) chain-conformation-based nano-photonic elements.

PubMed

Perevedentsev, Aleksandr; Sonnefraud, Yannick; Belton, Colin R; Sharma, Sanjiv; Cass, Anthony E G; Maier, Stefan A; Kim, Ji-Seon; Stavrinou, Paul N; Bradley, Donal D C

2015-01-19

Metamaterials are a promising new class of materials, in which sub-wavelength physical structures, rather than variations in chemical composition, can be used to modify the nature of their interaction with electromagnetic radiation. Here we show that a metamaterials approach, using a discrete physical geometry (conformation) of the segments of a polymer chain as the vector for a substantial refractive index change, can be used to enable visible wavelength, conjugated polymer photonic elements. In particular, we demonstrate that a novel form of dip-pen nanolithography provides an effective means to pattern the so-called β-phase conformation in poly(9,9-dioctylfluorene) thin films. This can be done on length scales ≤500 nm, as required to fabricate a variety of such elements, two of which are theoretically modelled using complex photonic dispersion calculations.

Mosquitocidal Effect of Glycosmis pentaphylla Leaf Extracts against Three Mosquito Species (Diptera: Culicidae)

PubMed Central

Ramkumar, Govindaraju; Karthi, Sengodan; Muthusamy, Ranganathan; Suganya, Ponnusamy; Natarajan, Devarajan; Kweka, Eliningaya J.; Shivakumar, Muthugounder S.

2016-01-01

Background The resistance status of malaria vectors to different classes of insecticides used for public health has raised concern for vector control programmes. Alternative compounds to supplement the existing tools are important to be searched to overcome the existing resistance and persistence of pesticides in vectors and the environment respectively. The mosquitocidal effects of Glycosmis pentaphylla using different solvents of acetone, methanol, chloroform and ethyl acetate extracts against three medically important mosquito vectors was conducted. Methods Glycosmis pentaphylla plant leaves were collected from Kolli Hills, India. The WHO test procedures for larval and adult bioassays were used to evaluate extracts against mosquito vectors, and the chemical composition of extracts identified using GC-MS analysis. Results The larvicidal and adulticidal activity of G. pentaphylla plant extracts clearly impacted the three species of major mosquitoes vectors. Acetone extracts had the highest larvicidal effect against An. stephensi, Cx. quinquefasciatus and Ae. aegypti with the LC50 and LC90 values of 0.0004, 138.54; 0.2669, 73.7413 and 0.0585, 303.746 mg/ml, respectively. The LC50 and LC90 adulticide values of G. pentaphylla leaf extracts in acetone, methanol, chloroform and ethyl acetate, solvents were as follows for Cx. quinquefasciatus, An. stephensi and Ae. Aegypti: 2.957, 5.458, 2.708, and 4.777, 3.449, 6.676 mg/ml respectively. The chemical composition of G. pentaphylla leaf extract has been found in 20 active compounds. Conclusions The plant leaf extracts of G. pentaphylla bioactive molecules which are effective and can be developed as an eco-friendly approach for larvicides and adulticidal mosquitoes vector control. Detailed identification and characterization of mosquitocidal effect of individual bioactive molecules ingredient may result into biodegradable effective tools for the control of mosquito vectors. PMID:27391146

Mosquitocidal Effect of Glycosmis pentaphylla Leaf Extracts against Three Mosquito Species (Diptera: Culicidae).

PubMed

Ramkumar, Govindaraju; Karthi, Sengodan; Muthusamy, Ranganathan; Suganya, Ponnusamy; Natarajan, Devarajan; Kweka, Eliningaya J; Shivakumar, Muthugounder S

2016-01-01

The resistance status of malaria vectors to different classes of insecticides used for public health has raised concern for vector control programmes. Alternative compounds to supplement the existing tools are important to be searched to overcome the existing resistance and persistence of pesticides in vectors and the environment respectively. The mosquitocidal effects of Glycosmis pentaphylla using different solvents of acetone, methanol, chloroform and ethyl acetate extracts against three medically important mosquito vectors was conducted. Glycosmis pentaphylla plant leaves were collected from Kolli Hills, India. The WHO test procedures for larval and adult bioassays were used to evaluate extracts against mosquito vectors, and the chemical composition of extracts identified using GC-MS analysis. The larvicidal and adulticidal activity of G. pentaphylla plant extracts clearly impacted the three species of major mosquitoes vectors. Acetone extracts had the highest larvicidal effect against An. stephensi, Cx. quinquefasciatus and Ae. aegypti with the LC50 and LC90 values of 0.0004, 138.54; 0.2669, 73.7413 and 0.0585, 303.746 mg/ml, respectively. The LC50 and LC90 adulticide values of G. pentaphylla leaf extracts in acetone, methanol, chloroform and ethyl acetate, solvents were as follows for Cx. quinquefasciatus, An. stephensi and Ae. Aegypti: 2.957, 5.458, 2.708, and 4.777, 3.449, 6.676 mg/ml respectively. The chemical composition of G. pentaphylla leaf extract has been found in 20 active compounds. The plant leaf extracts of G. pentaphylla bioactive molecules which are effective and can be developed as an eco-friendly approach for larvicides and adulticidal mosquitoes vector control. Detailed identification and characterization of mosquitocidal effect of individual bioactive molecules ingredient may result into biodegradable effective tools for the control of mosquito vectors.

[Effects of canine IL-2 and IL-7 genes on enhancing immunogenicity of canine parvovirus VP2 gene vaccine in mice].

PubMed

Chen, Huihui; Zhong, Fei; Li, Xiujin; Wang, Lu; Sun, Yan; Neng, Changai; Zhang, Kao; Li, Wenyan; Wen, Jiexia

2012-11-04

To investigate the effects of canine interleukin-2 (cIL-2) and cIL-7 genes on enhancing the immunogenicity of canine parvovirus (CPV) VP2 DNA vaccine. The bicistronic vectors of cIL-2 and cIL-7 genes were constructed using the eukaryotic expression vector containing internal ribosome entry site (IRES). The cIL-2/ cIL-7 dicistronic vector plus previously constructed vectors, including CPV VP2 DNA vaccine vector, cIL-2 vector and cIL-7 vector, were used to co-immunize mice with different combinations, consisting of VP2 alone, VP2 + cIL-2, VP2 + cIL-7 and VP2 + cIL-2/cIL-7. The VP2-specific antibody levels in immunized mice were measured by ELISA at different time post-immunization. The proliferation indices and interferon-gamma expression were measured by lymphocyte proliferation assay and ELISA, respectively. The cIL-2/cIL-7 bicistronic vector was correct and could mediate cIL-2 and cIL-7 gene expression in eukaryotic cells. Immunization results revealed that the antibody titers and the neutralizing antibody levels of the mice co-immunized with VP2 + cIL-7/cIL-2 vectors were significantly higher than that with either VP2 + cIL-2 vectors or VP2 + cIL-7 vectors (P < 0.05). The lymphocyte proliferation indices of VP2 + cIL-7/cIL-2 vector-immunized mice were also higher than that of other two groups although not statistically significant. However, the IFN-gamma expression levels of VP2 + cIL-7/cIL-2 vector-immunized mice were significantly higher than other immunized mice (P < 0.05). The cIL-2 and cIL-7 genes showed the significant synergic effects on enhancing the immunogenecity of CPV VP2 DNA vaccine.

Meta-analysis of the effects of insect vector saliva on host immune responses and infection of vector-transmitted pathogens: a focus on leishmaniasis.

PubMed

Ockenfels, Brittany; Michael, Edwin; McDowell, Mary Ann

2014-10-01

A meta-analysis of the effects of vector saliva on the immune response and progression of vector-transmitted disease, specifically with regard to pathology, infection level, and host cytokine levels was conducted. Infection in the absence or presence of saliva in naïve mice was compared. In addition, infection in mice pre-exposed to uninfected vector saliva was compared to infection in unexposed mice. To control for differences in vector and pathogen species, mouse strain, and experimental design, a random effects model was used to compare the ratio of the natural log of the experimental to the control means of the studies. Saliva was demonstrated to enhance pathology, infection level, and the production of Th2 cytokines (IL-4 and IL-10) in naïve mice. This effect was observed across vector/pathogen pairings, whether natural or unnatural, and with single salivary proteins used as a proxy for whole saliva. Saliva pre-exposure was determined to result in less severe leishmaniasis pathology when compared with unexposed mice infected either in the presence or absence of sand fly saliva. The results of further analyses were not significant, but demonstrated trends toward protection and IFN-γ elevation for pre-exposed mice.

Mammalian cDNA Library from the NIH Mammalian Gene Collection (MGC) | Office of Cancer Genomics

Cancer.gov

The MGC provides the research community full-length clones for most of the defined (as of 2006) human and mouse genes, along with selected clones of cow and rat genes. Clones were designed to allow easy transfer of the ORF sequences into nearly any type of expression vector. MGC provides protein ‘expression-ready’ clones for each of the included human genes. MGC is part of the ORFeome Collaboration (OC).

Basic Studies of the Unsteady Flow Past High Angle of Attack Airfoils

DTIC Science & Technology

1989-05-15

wing was about 3. The airfoil travels from right to left. The data is presented in the body fixed reference frame. The length of the velocity vector...generated and is carried away from the is presented. This experiment illustrated body . concomitant with this is the the technique’s capabilities to record...minie:ivil operations is propotional to the squar of the number of %ortice, Here a relateey smiple procedutrc is otilitncd Mich sigtificartdlv reduces

System and method for generating a relationship network

DOEpatents

Franks, Kasian; Myers, Cornelia A; Podowski, Raf M

2015-05-05

A computer-implemented system and process for generating a relationship network is disclosed. The system provides a set of data items to be related and generates variable length data vectors to represent the relationships between the terms within each data item. The system can be used to generate a relationship network for documents, images, or any other type of file. This relationship network can then be queried to discover the relationships between terms within the set of data items.

System and method for generating a relationship network

DOEpatents

Franks, Kasian [Kensington, CA; Myers, Cornelia A [St. Louis, MO; Podowski, Raf M [Pleasant Hill, CA

2011-07-26

A computer-implemented system and process for generating a relationship network is disclosed. The system provides a set of data items to be related and generates variable length data vectors to represent the relationships between the terms within each data item. The system can be used to generate a relationship network for documents, images, or any other type of file. This relationship network can then be queried to discover the relationships between terms within the set of data items.

Longitudinal Beam Diagnostics for the ILC Injectors and Bunch Compressors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Piot, Philippe; Bracke, Adam; Demir, Veysel

2010-12-01

We present a diagnostics suite and analyze techniques for setting up the longitudinal beam dynamics in ILC e⁻ injectors and e⁺ and e⁻ bunch compressors. Techniques to measure the first order moments and recover the first order longitudinal transfer map of the injector's intricate bunching scheme are presented. Coherent transition radiation diagnostics needed to measure and monitor the bunch length downstream of the ~5 GeV bunch compressor are investigated using a vector diffraction model.

Discrete analysis of spatial-sensitivity models

NASA Technical Reports Server (NTRS)

Nielsen, Kenneth R. K.; Wandell, Brian A.

1988-01-01

Procedures for reducing the computational burden of current models of spatial vision are described, the simplifications being consistent with the prediction of the complete model. A method for using pattern-sensitivity measurements to estimate the initial linear transformation is also proposed which is based on the assumption that detection performance is monotonic with the vector length of the sensor responses. It is shown how contrast-threshold data can be used to estimate the linear transformation needed to characterize threshold performance.

The organization of conspecific face space in nonhuman primates

PubMed Central

Parr, Lisa A.; Taubert, Jessica; Little, Anthony C.; Hancock, Peter J. B.

2013-01-01

Humans and chimpanzees demonstrate numerous cognitive specializations for processing faces, but comparative studies with monkeys suggest that these may be the result of recent evolutionary adaptations. The present study utilized the novel approach of face space, a powerful theoretical framework used to understand the representation of face identity in humans, to further explore species differences in face processing. According to the theory, faces are represented by vectors in a multidimensional space, the centre of which is defined by an average face. Each dimension codes features important for describing a face’s identity, and vector length codes the feature’s distinctiveness. Chimpanzees and rhesus monkeys discriminated male and female conspecifics’ faces, rated by humans for their distinctiveness, using a computerized task. Multidimensional scaling analyses showed that the organization of face space was similar between humans and chimpanzees. Distinctive faces had the longest vectors and were the easiest for chimpanzees to discriminate. In contrast, distinctiveness did not correlate with the performance of rhesus monkeys. The feature dimensions for each species’ face space were visualized and described using morphing techniques. These results confirm species differences in the perceptual representation of conspecific faces, which are discussed within an evolutionary framework. PMID:22670823

Efficient Optimization of Low-Thrust Spacecraft Trajectories

NASA Technical Reports Server (NTRS)

Lee, Seungwon; Fink, Wolfgang; Russell, Ryan; Terrile, Richard; Petropoulos, Anastassios; vonAllmen, Paul

2007-01-01

A paper describes a computationally efficient method of optimizing trajectories of spacecraft driven by propulsion systems that generate low thrusts and, hence, must be operated for long times. A common goal in trajectory-optimization problems is to find minimum-time, minimum-fuel, or Pareto-optimal trajectories (here, Pareto-optimality signifies that no other solutions are superior with respect to both flight time and fuel consumption). The present method utilizes genetic and simulated-annealing algorithms to search for globally Pareto-optimal solutions. These algorithms are implemented in parallel form to reduce computation time. These algorithms are coupled with either of two traditional trajectory- design approaches called "direct" and "indirect." In the direct approach, thrust control is discretized in either arc time or arc length, and the resulting discrete thrust vectors are optimized. The indirect approach involves the primer-vector theory (introduced in 1963), in which the thrust control problem is transformed into a co-state control problem and the initial values of the co-state vector are optimized. In application to two example orbit-transfer problems, this method was found to generate solutions comparable to those of other state-of-the-art trajectory-optimization methods while requiring much less computation time.

A novel salt-inducible gene SbSI-1 from Salicornia brachiata confers salt and desiccation tolerance in E. coli.

PubMed

Yadav, Narendra Singh; Rashmi, Deo; Singh, Dinkar; Agarwal, Pradeep K; Jha, Bhavanath

2012-02-01

Salicornia brachiata is one of the extreme salt tolerant plants and grows luxuriantly in coastal areas. Previously we have reported isolation and characterization of ESTs from S. brachiata with large number of unknown gene sequences. Reverse Northern analysis showed upregulation and downregulation of few unknown genes in response to salinity. Some of these unknown genes were made full length and their functional analysis is being tested. In this study, we have selected a novel unknown salt inducible gene SbSI-1 (Salicornia brachiata salt inducible-1) for the functional validation. The SbSI-1 (Gen-Bank accession number JF 965339) was made full length and characterized in detail for its functional validation under desiccation and salinity. The SbSI-1 gene is 917 bp long, and contained 437 bp 3' UTR, and 480 bp ORF region encoding 159 amino acids protein with estimated molecular mass of 18.39 kDa and pI 8.58. The real time PCR analysis revealed high transcript expression in salt, desiccation, cold and heat stresses. However, the maximum expression was obtained by desiccation. The ORF region of SbSI-1 was cloned in pET28a vector and transformed in BL21 (DE3) E. coli cells. The SbSI-1 recombinant E. coli cells showed tolerance to desiccation and salinity stress compared to only vector in the presence of stress.

Multi-kilobase homozygous targeted gene replacement in human induced pluripotent stem cells.

PubMed

Byrne, Susan M; Ortiz, Luis; Mali, Prashant; Aach, John; Church, George M

2015-02-18

Sequence-specific nucleases such as TALEN and the CRISPR/Cas9 system have so far been used to disrupt, correct or insert transgenes at precise locations in mammalian genomes. We demonstrate efficient 'knock-in' targeted replacement of multi-kilobase genes in human induced pluripotent stem cells (iPSC). Using a model system replacing endogenous human genes with their mouse counterpart, we performed a comprehensive study of targeting vector design parameters for homologous recombination. A 2.7 kilobase (kb) homozygous gene replacement was achieved in up to 11% of iPSC without selection. The optimal homology arm length was around 2 kb, with homology length being especially critical on the arm not adjacent to the cut site. Homologous sequence inside the cut sites was detrimental to targeting efficiency, consistent with a synthesis-dependent strand annealing (SDSA) mechanism. Using two nuclease sites, we observed a high degree of gene excisions and inversions, which sometimes occurred more frequently than indel mutations. While homozygous deletions of 86 kb were achieved with up to 8% frequency, deletion frequencies were not solely a function of nuclease activity and deletion size. Our results analyzing the optimal parameters for targeting vector design will inform future gene targeting efforts involving multi-kilobase gene segments, particularly in human iPSC. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Telomerase gene therapy rescues telomere length, bone marrow aplasia, and survival in mice with aplastic anemia.

PubMed

Bär, Christian; Povedano, Juan Manuel; Serrano, Rosa; Benitez-Buelga, Carlos; Popkes, Miriam; Formentini, Ivan; Bobadilla, Maria; Bosch, Fatima; Blasco, Maria A

2016-04-07

Aplastic anemia is a fatal bone marrow disorder characterized by peripheral pancytopenia and marrow hypoplasia. The disease can be hereditary or acquired and develops at any stage of life. A subgroup of the inherited form is caused by replicative impairment of hematopoietic stem and progenitor cells due to very short telomeres as a result of mutations in telomerase and other telomere components. Abnormal telomere shortening is also described in cases of acquired aplastic anemia, most likely secondary to increased turnover of bone marrow stem and progenitor cells. Here, we test the therapeutic efficacy of telomerase activation by using adeno-associated virus (AAV)9 gene therapy vectors carrying the telomerase Tert gene in 2 independent mouse models of aplastic anemia due to short telomeres (Trf1- and Tert-deficient mice). We find that a high dose of AAV9-Tert targets the bone marrow compartment, including hematopoietic stem cells. AAV9-Tert treatment after telomere attrition in bone marrow cells rescues aplastic anemia and mouse survival compared with mice treated with the empty vector. Improved survival is associated with a significant increase in telomere length in peripheral blood and bone marrow cells, as well as improved blood counts. These findings indicate that telomerase gene therapy represents a novel therapeutic strategy to treat aplastic anemia provoked or associated with short telomeres. © 2016 by The American Society of Hematology.

A novel RET rearrangement (ACBD5/RET) by pericentric inversion, inv(10)(p12.1;q11.2), in papillary thyroid cancer from an atomic bomb survivor exposed to high-dose radiation.

PubMed

Hamatani, Kiyohiro; Eguchi, Hidetaka; Koyama, Kazuaki; Mukai, Mayumi; Nakachi, Kei; Kusunoki, Yoichiro

2014-11-01

During analysis of RET/PTC rearrangements in papillary thyroid cancer (PTC) among atomic bomb survivors, a cDNA fragment of a novel type of RET rearrangement was identified in a PTC patient exposed to a high radiation dose using the improved 5' RACE method. This gene resulted from the fusion of the 3' portion of RET containing tyrosine kinase domain to the 5' portion of the acyl-coenzyme A binding domain containing 5 (ACBD5) gene, by pericentric inversion inv(10)(p12.1;q11.2); expression of the fusion gene was confirmed by RT-PCR. ACBD5 gene is ubiquitously expressed in various human normal tissues including thyroid. Full-length cDNA of the ACBD5-RET gene was constructed and then examined for tumorigenicity. Enhanced phosphorylation of ERK proteins in the MAPK pathway was observed in NIH3T3 cells transfected with expression vector encoding the full-length ACBD5/RET cDNA, while this was not observed in the cells transfected with empty expression vector. Stable NIH3T3 transfectants with ACBD5-RET cDNA induced tumor formation after their injection into nude mice. These findings suggest that the ACBD5-RET rearrangement is causatively involved in the development of PTC.

Adiabatic and nonadiabatic perturbation theory for coherence vector description of neutrino oscillations

NASA Astrophysics Data System (ADS)

Hollenberg, Sebastian; Päs, Heinrich

2012-01-01

The standard wave function approach for the treatment of neutrino oscillations fails in situations where quantum ensembles at a finite temperature with or without an interacting background plasma are encountered. As a first step to treat such phenomena in a novel way, we propose a unified approach to both adiabatic and nonadiabatic two-flavor oscillations in neutrino ensembles with finite temperature and generic (e.g., matter) potentials. Neglecting effects of ensemble decoherence for now, we study the evolution of a neutrino ensemble governed by the associated quantum kinetic equations, which apply to systems with finite temperature. The quantum kinetic equations are solved formally using the Magnus expansion and it is shown that a convenient choice of the quantum mechanical picture (e.g., the interaction picture) reveals suitable parameters to characterize the physics of the underlying system (e.g., an effective oscillation length). It is understood that this method also provides a promising starting point for the treatment of the more general case in which decoherence is taken into account.

Determination of the spin Hall angle in single-crystalline Pt films from spin pumping experiments

NASA Astrophysics Data System (ADS)

Keller, Sascha; Mihalceanu, Laura; Schweizer, Matthias R.; Lang, Philipp; Heinz, Björn; Geilen, Moritz; Brächer, Thomas; Pirro, Philipp; Meyer, Thomas; Conca, Andres; Karfaridis, Dimitrios; Vourlias, George; Kehagias, Thomas; Hillebrands, Burkard; Papaioannou, Evangelos Th

2018-05-01

We report on the determination of the spin Hall angle in ultra-clean, defect-reduced epitaxial Pt films. By applying vector network analyzer ferromagnetic resonance spectroscopy to a series of single crystalline Fe (12 nm) /Pt (t Pt) bilayers we determine the real part of the spin mixing conductance (4.4 ± 0.2) × 1019 m‑2 and reveal a very small spin diffusion length in the epitaxial Pt (1.1 ± 0.1) nm film. We investigate the spin pumping and ISHE in a stripe microstucture excited by a microwave coplanar waveguide antenna. By using their different angular dependencies, we distinguish between spin rectification effects and the inverse spin Hall effect. The relatively large value of the spin Hall angle (5.7 ± 1.4)% shows that ultra-clean e-beam evaporated non-magnetic materials can also have a comparable spin-to-charge current conversion efficiency as sputtered high resistivity layers.

Complete mitochondrial genome of the giant ramshorn snail Marisa cornuarietis (Gastropoda: Ampullariidae).

PubMed

Wang, Mingling; Qiu, Jian-Wen

2016-05-01

We report the complete mitochondrial genome (mitogenome) of the giant ramshorn snail Marisa cornuarietis, a biocontrol agent of freshwater weeds and snail vectors of schistosomes. The mitogenome is 15,923 bp in length, encoding 13 protein-coding genes, 22 transfer RNAs and 2 ribosomal RNAs. The mitogenome is A+T biased (70.0%), with 28.9% A, 41.1% T, 16.7% G, and 13.3% C. A comparison with Pomacea canaliculata, the other member in the same family (Ampullariidae) with a sequenced mitogenome, shows that the two species have an identical gene order, but their intergenic regions vary substantially in sequence length. The mitogenome data can be used to understand the population genetics of M. cornuarietis, and resolve the phylogenetic relationship of various genera in Ampullariidae.

Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

NASA Technical Reports Server (NTRS)

Vercoutere, Wenonah; DeGuzman, Veronica

2003-01-01

The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

Thermally driven mass flows in the convection zone of the sun

NASA Technical Reports Server (NTRS)

Dijkhuis, G. C.

1973-01-01

A formulation of the fluid dynamics of convective regions is developed which leads to an analytical description of the solar rotation, the Evershed flow, and the supergranulation. The starting point of the present formulation is the mixing length picture of convective equilibrium, but the earlier point mass model for convective molecules is replaced here by a model with both inertia and intrinsic moment of inertia. This extension introduces three rotational degrees of freedom into the dynamics of individual convective molecules, which enter into the dynamical equations for a mixing length fluid in the form of a separate vector field which we term the spin field. It is shown that for convective molecules having a spherically symmetric mass distribution, the spin field is proportional to the local vorticity.

Viruses vector control proposal: genus Aedes emphasis.

PubMed

Reis, Nelson Nogueira; Silva, Alcino Lázaro da; Reis, Elma Pereira Guedes; Silva, Flávia Chaves E; Reis, Igor Guedes Nogueira

The dengue fever is a major public health problem in the world. In Brazil, in 2015, there were 1,534,932 cases, being 20,320 cases of severe form, and 811 deaths related to this disease. The distribution of Aedes aegypti, the vector, is extensive. Recently, Zika and Chikungunya viruses had arisen, sharing the same vector as dengue and became a huge public health issue. Without specific treatment, it is urgently required as an effective vector control. This article is focused on reviewing vector control strategies, their effectiveness, viability and economical impact. Among all, the Sterile Insect Technique is highlighted as the best option to be adopted in Brazil, once it is largely effectively used in the USA and Mexico for plagues related to agribusiness. Copyright © 2017 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.

Multiaxis control power from thrust vectoring for a supersonic fighter aircraft model at Mach 0.20 to 2.47

NASA Technical Reports Server (NTRS)

Capone, Francis J.; Bare, E. Ann

1987-01-01

The aeropropulsive characteristics of an advanced twin-engine fighter aircraft designed for supersonic cruise have been studied in the Langley 16-Foot Tansonic Tunnel and the Lewis 10- by 10-Foot Supersonic Tunnel. The objective was to determine multiaxis control-power characteristics from thrust vectoring. A two-dimensional convergent-divergent nozzle was designed to provide yaw vector angles of 0, -10, and -20 deg combined with geometric pitch vector angles of 0 and 15 deg. Yaw thrust vectoring was provided by yaw flaps located in the nozzle sidewalls. Roll control was obtained from differential pitch vectoring. This investigation was conducted at Mach numbers from 0.20 to 2.47. Angle of attack was varied from 0 to about 19 deg, and nozzle pressure ratio was varied from about 1 (jet off) to 28, depending on Mach number. Increments in force or moment coefficient that result from pitch or yaw thrust vectoring remain essentially constant over the entire angle-of-attack range of all Mach numbers tested. There was no effect of pitch vectoring on the lateral aerodynamic forces and moments and only very small effects of yaw vectoring on the longitudinal aerodynamic forces and moments. This result indicates little cross-coupling of control forces and moments for combined pitch-yaw vectoring.

Viral Vectors for Gene Delivery to the Central Nervous System

PubMed Central

Lentz, Thomas B.; Gray, Steven J.; Samulski, R. Jude

2011-01-01

The potential benefits of gene therapy for neurological diseases such as Parkinson’s, Amyotrophic Lateral Sclerosis (ALS), Epilepsy, and Alzheimer’s are enormous. Even a delay in the onset of severe symptoms would be invaluable to patients suffering from these and other diseases. Significant effort has been placed in developing vectors capable of delivering therapeutic genes to the CNS in order to treat neurological disorders. At the forefront of potential vectors, viral systems have evolved to efficiently deliver their genetic material to a cell. The biology of different viruses offers unique solutions to the challenges of gene therapy, such as cell targeting, transgene expression and vector production. It is important to consider the natural biology of a vector when deciding whether it will be the most effective for a specific therapeutic function. In this review, we outline desired features of the ideal vector for gene delivery to the CNS and discuss how well available viral vectors compare to this model. Adeno-associated virus, retrovirus, adenovirus and herpesvirus vectors are covered. Focus is placed on features of the natural biology that have made these viruses effective tools for gene delivery with emphasis on their application in the CNS. Our goal is to provide insight into features of the optimal vector and which viral vectors can provide these features. PMID:22001604

A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

PubMed Central

Marques, M Carmen; Alonso-Cantabrana, Hugo; Forment, Javier; Arribas, Raquel; Alamar, Santiago; Conejero, Vicente; Perez-Amador, Miguel A

2009-01-01

Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new EST collection denotes an important step towards the identification of all genes in the citrus genome. Furthermore, public availability of the cDNA clones generated in this study, and not only their sequence, enables testing of the biological function of the genes represented in the collection. Expression of the citrus SEP3 homologue, CitrSEP, in Arabidopsis results in early flowering, along with other phenotypes resembling the over-expression of the Arabidopsis SEPALLATA genes. Our findings suggest that the members of the SEP gene family play similar roles in these quite distant plant species. PMID:19747386

Reversible vector ratchets for skyrmion systems

NASA Astrophysics Data System (ADS)

Ma, X.; Reichhardt, C. J. Olson; Reichhardt, C.

2017-03-01

We show that ac driven skyrmions interacting with an asymmetric substrate provide a realization of a class of ratchet system which we call a vector ratchet that arises due to the effect of the Magnus term on the skyrmion dynamics. In a vector ratchet, the dc motion induced by the ac drive can be described as a vector that can be rotated clockwise or counterclockwise relative to the substrate asymmetry direction. Up to a full 360∘ rotation is possible for varied ac amplitudes or skyrmion densities. In contrast to overdamped systems, in which ratchet motion is always parallel to the substrate asymmetry direction, vector ratchets allow the ratchet motion to be in any direction relative to the substrate asymmetry. It is also possible to obtain a reversal in the direction of rotation of the vector ratchet, permitting the creation of a reversible vector ratchet. We examine vector ratchets for ac drives applied parallel or perpendicular to the substrate asymmetry direction, and show that reverse ratchet motion can be produced by collective effects. No reversals occur for an isolated skyrmion on an asymmetric substrate. Since a vector ratchet can produce motion in any direction, it could represent a method for controlling skyrmion motion for spintronic applications.

Multiaxis Thrust-Vectoring Characteristics of a Model Representative of the F-18 High-Alpha Research Vehicle at Angles of Attack From 0 deg to 70 deg

NASA Technical Reports Server (NTRS)

Asbury, Scott C.; Capone, Francis J.

1995-01-01

An investigation was conducted in the Langley 16-Foot Transonic Tunnel to determine the multiaxis thrust-vectoring characteristics of the F-18 High-Alpha Research Vehicle (HARV). A wingtip supported, partially metric, 0.10-scale jet-effects model of an F-18 prototype aircraft was modified with hardware to simulate the thrust-vectoring control system of the HARV. Testing was conducted at free-stream Mach numbers ranging from 0.30 to 0.70, at angles of attack from O' to 70', and at nozzle pressure ratios from 1.0 to approximately 5.0. Results indicate that the thrust-vectoring control system of the HARV can successfully generate multiaxis thrust-vectoring forces and moments. During vectoring, resultant thrust vector angles were always less than the corresponding geometric vane deflection angle and were accompanied by large thrust losses. Significant external flow effects that were dependent on Mach number and angle of attack were noted during vectoring operation. Comparisons of the aerodynamic and propulsive control capabilities of the HARV configuration indicate that substantial gains in controllability are provided by the multiaxis thrust-vectoring control system.

A new strategy for full-length Ebola virus glycoprotein expression in E.coli.

PubMed

Zai, Junjie; Yi, Yinhua; Xia, Han; Zhang, Bo; Yuan, Zhiming

2016-12-01

Ebola virus (EBOV) causes severe hemorrhagic fever in humans and non-human primates with high rates of fatality. Glycoprotein (GP) is the only envelope protein of EBOV, which may play a critical role in virus attachment and entry as well as stimulating host protective immune responses. However, the lack of expression of full-length GP in Escherichia coli hinders the further study of its function in viral pathogenesis. In this study, the vp40 gene was fused to the full-length gp gene and cloned into a prokaryotic expression vector. We showed that the VP40-GP and GP-VP40 fusion proteins could be expressed in E.coli at 16 °C. In addition, it was shown that the position of vp40 in the fusion proteins affected the yields of the fusion proteins, with a higher level of production of the fusion protein when vp40 was upstream of gp compared to when it was downstream. The results provide a strategy for the expression of a large quantity of EBOV full-length GP, which is of importance for further analyzing the relationship between the structure and function of GP and developing an antibody for the treatment of EBOV infection.

Current vector control challenges in the fight against malaria.

PubMed

Benelli, Giovanni; Beier, John C

2017-10-01

The effective and eco-friendly control of Anopheles vectors plays a key role in any malaria management program. Integrated Vector Management (IVM) suggests making use of the full range of vector control tools available. The strategies for IVM require novel technologies to control outdoor transmission of malaria. Despite the wide number of promising control tools tested against mosquitoes, current strategies for malaria vector control used in most African countries are not sufficient to achieve successful malaria control. The majority of National Malaria Control Programs in Africa still rely on indoor residual spraying (IRS) and long-lasting insecticidal nets (LLINs). These methods reduce malaria incidence but generally have little impact on malaria prevalence. In addition to outdoor transmission, growing levels of insecticide resistance in targeted vectors threaten the efficacy of LLINs and IRS. Larvicidal treatments can be useful, but are not recommended for rural areas. The research needed to improve the quality and delivery of mosquito vector control should focus on (i) optimization of processes and methods for vector control delivery; (ii) monitoring of vector populations and biting activity with reliable techniques; (iii) the development of effective and eco-friendly tools to reduce the burden or locally eliminate malaria and other mosquito-borne diseases; (iv) the careful evaluation of field suitability and efficacy of new mosquito control tools to prove their epidemiological impact; (v) the continuous monitoring of environmental changes which potentially affect malaria vector populations; (vi) the cooperation among different disciplines, with main emphasis on parasitology, tropical medicine, ecology, entomology, and ecotoxicology. A better understanding of behavioral ecology of malaria vectors is required. Key ecological obstacles that limit the effectiveness of vector control include the variation in mosquito behavior, development of insecticide resistance, presence of behavioral avoidance, high vector biodiversity, competitive and food web interactions, lack of insights on mosquito dispersal and mating behavior, and the impact of environmental changes on mosquito ecological traits. Overall, the trans-disciplinary cooperation among parasitologists and entomologists is crucial to ensure proper evaluation of the epidemiological impact triggered by novel mosquito vector control strategies. Copyright © 2017 Elsevier B.V. All rights reserved.

Quartz crystal resonator g sensitivity measurement methods and recent results

NASA Astrophysics Data System (ADS)

Driscoll, M. M.

1990-09-01

A technique for accurate measurements of quartz crystal resonator vibration sensitivity is described. The technique utilizes a crystal oscillator circuit in which a prescribed length of coaxial cable is used to connect the resonator to the oscillator sustaining stage. A method is provided for determination and removal of measurement errors normally introduced as a result of cable vibration. In addition to oscillator-type measurements, it is also possible to perform similar vibration sensitivity measurements using a synthesized signal generator with the resonator installed in a passive phase bridge. Test results are reported for 40 and 50 MHz, fifth overtone AT-cut, and third overtone SC-cut crystals. Acceleration sensitivity (gamma vector) values for the SC-cut resonators were typically four times smaller (5 x 10 to the -10th/g) than for the AT-cut units. However, smaller unit-to-unit gamma vector magnitude variation was exhibited by the AT-cut resonators.

On the large-scale dynamics of rapidly rotating convection zones. [in solar and stellar interiors

NASA Technical Reports Server (NTRS)

Durney, B. R.

1983-01-01

The fact that the values of the eight basic waves present in turbulent flows in the presence of rotation prohibit a tilt of eddy towards the axis of rotation is incorporated into a formalism for rapidly rotating convection zones. Equations for turbulent velocities are defined in a rotating coordinate system, assuming that gravity and grad delta T act in a radial direction. An expression is derived for the lifetime of a basic wave and then for the average velocity vector. A real convective eddy is formulated and the wave vectors are calculated. The velocity amplitude and the stress tensor amplitude are integrated over the eddy domain. Applied to the solar convective zone, it is found that the convective cells are aligned along the axis of rotation at the poles and at the equator, a model that conflicts with nonrotating mixng length theory predictions.

First report of naturally infected Sergentomyia minuta with Leishmania major in Tunisia.

PubMed

Jaouadi, Kaouther; Ghawar, Wissem; Salem, Sadok; Gharbi, Mohamed; Bettaieb, Jihene; Yazidi, Rihab; Harrabi, Mariem; Hamarsheh, Omar; Ben Salah, Afif

2015-12-21

Many sand fly species are implicated in the transmission cycle of Leishmania parasites around the world. Incriminating new sand flies species, as vectors of Leishmania is crucial to understanding the parasite-vector transmission cycle in different areas in Tunisia and surrounding countries. Seventy-four unfed females belonging to the genera Sergentomyia and Phlebotomus were collected in South Tunisia between June and November 2014, using sticky papers. PCR-RFLP (Restriction Fragment Length Polymorphism) analysis of the internal transcribed spacer 1 (ITS1) was used for Leishmania parasites detection and identification. Leishmania (L.) major (Yakimoff & Shokkor, 1914) was identified within two Sergentomyia (S.) minuta (Rondani, 1843) and one Phlebotomus papatasi (Scopoli, 1786). This is the first report of L. major identified from S. minuta in Tunisia. This novel finding enhances the understanding of the transmission cycle of L. major parasites of cutaneous leishmaniasis in an endemic area in South Tunisia.

Position of the station Borowiec in the Doppler observation campaign WEDOC 80

NASA Astrophysics Data System (ADS)

Pachelski, W.

The position of the Doppler antenna located at the Borowiec Observatory, Poland, is analyzed based on data gathered during the WEDOC 80 study and an earlier study in 1977. Among other findings, it is determined that biases of the reference system origin can be partially eliminated by transforming absolute coordinates of two or more stations into station-to-station vector components, and by determining the vector length while the system scale remains affected by broadcast ephemerides. The standard deviations of absolute coordinates are shown to represent only the internal accuracy of the solution, and are found to depend on the geometrical configuration between the station position and the satellite passes. It is shown that significant correlations between station coordinates in translocation or multilocation are due to the poor conditioning of design matrices with respect to the origin and orientation of the reference system.

Doping effect on charge ordering in the spinel compound AlV_2-xCr_xO_4

NASA Astrophysics Data System (ADS)

Horibe, Yoichi; Kurushima, Kosuke; Mori, Shigeo; Shingu, Masao; Katsufuji, Takuro

2004-03-01

It is reported that AlV_2O4 with the spinel-type structure shows the charge-ordering (CO) behavior below 700K.[1] Because the average valence of V is V^2.5+ in this compound, the CO structure is characterized by the unique CO pattern with V^2+:V^4+=3:1. In this talk, we will report doping effect on the CO structure in AlV_2O_4. In particular, we will focus on changes of microstructure related to the CO structure by Cr doping by transmission electron microscopy. Firstly we confirmed that AlV_2O4 has a long-ranged CO structure characterized by a single wave vector q=(1/2)[111]. On the other hand, we found the presence of diffuse scatterings at the (1/2)[111] and (1/2)[1-11]-type positions in AlV_1.875Cr_0.125O4 at room temperature. This means that the CO structure in AlV_1.875Cr_0.125O4 has two wave vectors of q=(1/2)[111] and q=the (1/2)[1-11]. Furthermore, the long-ranged CO structure in AlV_2O4 changes into the short-ranged one by substituting Cr ions into the V ones. The correlation length of CO in x=0.125 can be estimated to be about 5 nm. Our results suggest that the Cr doping destroyed the CO correlation effectively. It is revealed that by substituting Cr ions to V ones, the CO state is suppressed drastically and disappeared with x > 0.125. [1] K. Matsuno et al., J. Phys. Soc. Jpn 70, 1456 (2001)

Effect of normalization methods on the performance of supervised learning algorithms applied to HTSeq-FPKM-UQ data sets: 7SK RNA expression as a predictor of survival in patients with colon adenocarcinoma.

PubMed

Shahriyari, Leili

2017-11-03

One of the main challenges in machine learning (ML) is choosing an appropriate normalization method. Here, we examine the effect of various normalization methods on analyzing FPKM upper quartile (FPKM-UQ) RNA sequencing data sets. We collect the HTSeq-FPKM-UQ files of patients with colon adenocarcinoma from TCGA-COAD project. We compare three most common normalization methods: scaling, standardizing using z-score and vector normalization by visualizing the normalized data set and evaluating the performance of 12 supervised learning algorithms on the normalized data set. Additionally, for each of these normalization methods, we use two different normalization strategies: normalizing samples (files) or normalizing features (genes). Regardless of normalization methods, a support vector machine (SVM) model with the radial basis function kernel had the maximum accuracy (78%) in predicting the vital status of the patients. However, the fitting time of SVM depended on the normalization methods, and it reached its minimum fitting time when files were normalized to the unit length. Furthermore, among all 12 learning algorithms and 6 different normalization techniques, the Bernoulli naive Bayes model after standardizing files had the best performance in terms of maximizing the accuracy as well as minimizing the fitting time. We also investigated the effect of dimensionality reduction methods on the performance of the supervised ML algorithms. Reducing the dimension of the data set did not increase the maximum accuracy of 78%. However, it leaded to discovery of the 7SK RNA gene expression as a predictor of survival in patients with colon adenocarcinoma with accuracy of 78%. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Effects of vest loading on sprint kinetics and kinematics.

PubMed

Cross, Matt R; Brughelli, Matt E; Cronin, John B

2014-07-01

The effects of vest loading on sprint kinetics and kinematics during the acceleration and maximum velocity phases of sprinting are relatively unknown. A repeated measures analysis of variance with post hoc contrasts was used to determine whether performing 6-second maximal exertion sprints on a nonmotorized force treadmill, under 2 weighted vest loading conditions (9 and 18 kg) and an unloaded baseline condition, affected the sprint mechanics of 13 males from varying sporting backgrounds. Neither vest load promoted significant change in peak vertical ground reaction force (GRF-z) outputs compared with baseline during acceleration, and only 18-kg loading increased GRF-z at the maximum velocity (8.8%; effect size [ES] = 0.70). The mean GRF-z significantly increased with 18-kg loading during acceleration and maximum velocity (11.8-12.4%; ES = 1.17-1.33). Horizontal force output was unaffected, although horizontal power was decreased with the 18-kg vest during maximum velocity (-14.3%; ES = -0.48). Kinematic analysis revealed decreasing velocity (-3.6 to -5.6%; ES = -0.38 to -0.61), decreasing step length (-4.2%; ES = -0.33 to -0.34), increasing contact time (5.9-10.0%; ES = 1.01-1.71), and decreasing flight time (-17.4 to -26.7%; ES = -0.89 to -1.50) with increased loading. As a vertical vector-training stimulus, it seems that vest loading decreases flight time, which in turn reduces GRF-z. Furthermore, it seems that heavier loads than that are traditionally recommended are needed to promote increases in the GRF-z output during maximum velocity sprinting. Finally, vest loading offers little as a horizontal vector-training stimulus and actually compromises horizontal power output.

Current Advances and Future Challenges in Adenoviral Vector Biology and Targeting

PubMed Central

Campos, Samuel K.; Barry, Michael A.

2008-01-01

Gene delivery vectors based on Adenoviral (Ad) vectors have enormous potential for the treatment of both hereditary and acquired disease. Detailed structural analysis of the Ad virion, combined with functional studies has broadened our knowledge of the structure/function relationships between Ad vectors and host cells/tissues and substantial achievement has been made towards a thorough understanding of the biology of Ad vectors. The widespread use of Ad vectors for clinical gene therapy is compromised by their inherent immunogenicity. The generation of safer and more effective Ad vectors, targeted to the site of disease, has therefore become a great ambition in the field of Ad vector development. This review provides a synopsis of the structure/function relationships between Ad vectors and host systems and summarizes the many innovative approaches towards achieving Ad vector targeting. PMID:17584037

Poincaré gauge gravity: An emergent scenario

NASA Astrophysics Data System (ADS)

Chkareuli, J. L.

2017-04-01

The Poincaré gauge gravity (PGG) with the underlying vector fields of tetrads and spin-connections is perhaps the best theory candidate for gravitation to be unified with the other three elementary forces of nature. There is a clear analogy between the local frame in PGG and the local internal symmetry space in the Standard Model. As a result, the spin-connection fields, gauging the local frame Lorentz symmetry group S O (1 ,3 )LF , appear in PGG much as photons and gluons appear in SM. We propose that such an analogy may follow from their common emergent nature allowing us to derive PGG in the same way as conventional gauge theories. In essence, we start with an arbitrary theory of some vector and fermion fields which possesses only global spacetime symmetries, such as Lorentz and translational invariance, in flat Minkowski space. The two vector field multiplets involved are proposed to belong, respectively, to the adjoint (Aμi j) and vector (eμi) representations of the starting global Lorentz symmetry. We show that if these prototype vector fields are covariantly constrained, Aμi jAij μ=±MA2 and eμieiμ=±Me2 , thus causing a spontaneous violation of the accompanying global symmetries (MA ,e are their proposed violation scales), then the only possible theory compatible with these length-preserving constraints is turned out to be the gauge invariant PGG, while the corresponding massless (pseudo)Goldstone modes are naturally collected in the emergent gauge fields of tetrads and spin-connections. In a minimal theory case being linear in a curvature we unavoidably come to the Einstein-Cartan theory. The extended theories with propagating spin-connection and tetrad modes are also considered and their possible unification with the Standard Model is briefly discussed.

Modelling control of epidemics spreading by long-range interactions.

PubMed

Dybiec, Bartłomiej; Kleczkowski, Adam; Gilligan, Christopher A

2009-10-06

We have studied the spread of epidemics characterized by a mixture of local and non-local interactions. The infection spreads on a two-dimensional lattice with the fixed nearest neighbour connections. In addition, long-range dynamical links are formed by moving agents (vectors). Vectors perform random walks, with step length distributed according to a thick-tail distribution. Two distributions are considered in this paper, an alpha-stable distribution describing self-similar vector movement, yet characterized by an infinite variance and an exponential power characterized by a large but finite variance. Such long-range interactions are hard to track and make control of epidemics very difficult. We also allowed for cryptic infection, whereby an infected individual on the lattice can be infectious prior to showing any symptoms of infection or disease. To account for such cryptic spread, we considered a control strategy in which not only detected, i.e. symptomatic, individuals but also all individuals within a certain control neighbourhood are treated upon the detection of disease. We show that it is possible to eradicate the disease by using such purely local control measures, even in the presence of long-range jumps. In particular, we show that the success of local control and the choice of the optimal strategy depend in a non-trivial way on the dispersal patterns of the vectors. By characterizing these patterns using the stability index of the alpha-stable distribution to change the power-law behaviour or the exponent characterizing the decay of an exponential power distribution, we show that infection can be successfully contained using relatively small control neighbourhoods for two limiting cases for long-distance dispersal and for vectors that are much more limited in their dispersal range.

Bioinspired Star-Shaped Poly(l-lysine) Polypeptides: Efficient Polymeric Nanocarriers for the Delivery of DNA to Mesenchymal Stem Cells.

PubMed

Walsh, David P; Murphy, Robert D; Panarella, Angela; Raftery, Rosanne M; Cavanagh, Brenton; Simpson, Jeremy C; O'Brien, Fergal J; Heise, Andreas; Cryan, Sally-Ann

2018-05-07

The field of tissue engineering is increasingly recognizing that gene therapy can be employed for modulating in vivo cellular response thereby guiding tissue regeneration. However, the field lacks a versatile and biocompatible gene delivery platform capable of efficiently delivering transgenes to mesenchymal stem cells (MSCs), a cell type often refractory to transfection. Herein, we describe the extensive and systematic exploration of three architectural variations of star-shaped poly(l-lysine) polypeptide (star-PLL) with varying number and length of poly(l-lysine) arms as potential nonviral gene delivery vectors for MSCs. We demonstrate that star-PLL vectors are capable of self-assembling with pDNA to form stable, cationic nanomedicines. Utilizing high content screening, live cell imaging, and mechanistic uptake studies we confirm the intracellular delivery of pDNA by star-PLLs to MSCs is a rapid process, which likely proceeds via a clathrin-independent mechanism. We identify a star-PLL composition with 64 poly(l-lysine) arms and five l-lysine subunits per arm as a particularly efficient vector that is capable of delivering both reporter genes and the therapeutic transgenes bone morphogenetic protein-2 and vascular endothelial growth factor to MSCs. This composition facilitated a 1000-fold increase in transgene expression in MSCs compared to its linear analogue, linear poly(l-lysine). Furthermore, it demonstrated comparable transgene expression to the widely used vector polyethylenimine using a lower pDNA dose with significantly less cytotoxicity. Overall, this study illustrates the ability of the star-PLL vectors to facilitate efficient, nontoxic nucleic acid delivery to MSCs thereby functioning as an innovative nanomedicine platform for tissue engineering applications.

Feature selection using a one dimensional naïve Bayes' classifier increases the accuracy of support vector machine classification of CDR3 repertoires.

PubMed

Cinelli, Mattia; Sun, Yuxin; Best, Katharine; Heather, James M; Reich-Zeliger, Shlomit; Shifrut, Eric; Friedman, Nir; Shawe-Taylor, John; Chain, Benny

2017-04-01

Somatic DNA recombination, the hallmark of vertebrate adaptive immunity, has the potential to generate a vast diversity of antigen receptor sequences. How this diversity captures antigen specificity remains incompletely understood. In this study we use high throughput sequencing to compare the global changes in T cell receptor β chain complementarity determining region 3 (CDR3β) sequences following immunization with ovalbumin administered with complete Freund's adjuvant (CFA) or CFA alone. The CDR3β sequences were deconstructed into short stretches of overlapping contiguous amino acids. The motifs were ranked according to a one-dimensional Bayesian classifier score comparing their frequency in the repertoires of the two immunization classes. The top ranking motifs were selected and used to create feature vectors which were used to train a support vector machine. The support vector machine achieved high classification scores in a leave-one-out validation test reaching >90% in some cases. The study describes a novel two-stage classification strategy combining a one-dimensional Bayesian classifier with a support vector machine. Using this approach we demonstrate that the frequency of a small number of linear motifs three amino acids in length can accurately identify a CD4 T cell response to ovalbumin against a background response to the complex mixture of antigens which characterize Complete Freund's Adjuvant. The sequence data is available at www.ncbi.nlm.nih.gov/sra/?term¼SRP075893 . The Decombinator package is available at github.com/innate2adaptive/Decombinator . The R package e1071 is available at the CRAN repository https://cran.r-project.org/web/packages/e1071/index.html . b.chain@ucl.ac.uk. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.

PROMISE: a tool to identify genomic features with a specific biologically interesting pattern of associations with multiple endpoint variables

PubMed Central

Pounds, Stan; Cheng, Cheng; Cao, Xueyuan; Crews, Kristine R.; Plunkett, William; Gandhi, Varsha; Rubnitz, Jeffrey; Ribeiro, Raul C.; Downing, James R.; Lamba, Jatinder

2009-01-01

Motivation: In some applications, prior biological knowledge can be used to define a specific pattern of association of multiple endpoint variables with a genomic variable that is biologically most interesting. However, to our knowledge, there is no statistical procedure designed to detect specific patterns of association with multiple endpoint variables. Results: Projection onto the most interesting statistical evidence (PROMISE) is proposed as a general procedure to identify genomic variables that exhibit a specific biologically interesting pattern of association with multiple endpoint variables. Biological knowledge of the endpoint variables is used to define a vector that represents the biologically most interesting values for statistics that characterize the associations of the endpoint variables with a genomic variable. A test statistic is defined as the dot-product of the vector of the observed association statistics and the vector of the most interesting values of the association statistics. By definition, this test statistic is proportional to the length of the projection of the observed vector of correlations onto the vector of most interesting associations. Statistical significance is determined via permutation. In simulation studies and an example application, PROMISE shows greater statistical power to identify genes with the interesting pattern of associations than classical multivariate procedures, individual endpoint analyses or listing genes that have the pattern of interest and are significant in more than one individual endpoint analysis. Availability: Documented R routines are freely available from www.stjuderesearch.org/depts/biostats and will soon be available as a Bioconductor package from www.bioconductor.org. Contact: stanley.pounds@stjude.org Supplementary information: Supplementary data are available at Bioinformatics online. PMID:19528086

The effects of noise due to random undetected tilts and paleosecular variation on regional paleomagnetic directions

USGS Publications Warehouse

Calderone, G.J.; Butler, R.F.

1991-01-01

Random tilting of a single paleomagnetic vector produces a distribution of vectors which is not rotationally symmetric about the original vector and therefore not Fisherian. Monte Carlo simulations were performed on two types of vector distributions: 1) distributions of vectors formed by perturbing a single original vector with a Fisher distribution of bedding poles (each defining a tilt correction) and 2) standard Fisher distributions. These simulations demonstrate that inclinations of vectors drawn from both distributions are biased toward shallow inclinations. The Fisher mean direction of the distribution of vectors formed by perturbing a single vector with random undetected tilts is biased toward shallow inclinations, but this bias is insignificant for angular dispersions of bedding poles less than 20??. -from Authors

Development of a Novel Escherichia coli–Kocuria Shuttle Vector Using the Cryptic pKPAL3 Plasmid from K. palustris IPUFS-1 and Its Utilization in Producing Enantiopure (S)-Styrene Oxide

PubMed Central

Toda, Hiroshi; Itoh, Nobuya

2017-01-01

The novel cryptic pKPAL3 plasmid was isolated from the Gram-positive microorganism Kocuria palustris IPUFS-1 and characterized in detail. pKPAL3 is a circular plasmid that is 4,443 bp in length. Open reading frame (ORF) and homology search analyses indicated that pKPAL3 possesses four ORFs; however, there were no replication protein coding genes predicted in the plasmid. Instead, there were two nucleotide sequence regions that showed significant identities with untranslated regions of K. rhizophila DC2201 (NBRC 103217) genomic sequences, and these sequences were essential for autonomous replication of pKPAL3 in Kocuria cells. Based on these findings, we constructed the novel Escherichia coli–Kocuria shuttle vectors pKITE301 (kanamycin resistant) and pKITE303 (thiostrepton resistant) from pKPAL3. The copy numbers of the constructed shuttle vectors were estimated to be 20 per cell, and they exhibited low segregation stability in Kocuria transformant cells in the absence of antibiotics. Moreover, constructed vectors showed compatibility with the other K. rhizophila shuttle vector pKITE103. We successfully expressed multiple heterologous genes, including the styrene monooxygenase gene from Rhodococcus sp. ST-10 (rhsmo) and alcohol dehydrogenase gene from Leifsonia sp. S749 (lsadh), in K. rhizophila DC2201 using the pKITE301P and pKITE103P vectors under the control of the glyceraldehyde 3-phosphate dehydrogenase (gapdh) promotor. The RhSMO–LSADH co-expressing K. rhizophila was used as a biocatalyst in an organic solvent–water biphasic reaction system to efficiently convert styrene into (S)-styrene oxide with 99% ee in the presence of 2-propanol as a hydrogen donor. The product concentration of the reaction in the organic solvent reached 235 mM after 30 h under optimum conditions. Thus, we demonstrated that this novel shuttle vector is useful for developing biocatalysts based on organic solvent-tolerant Kocuria cells. PMID:29230202

Spin Vector Distribution in the Koronis Family for a Sample Complete to IAU H=10.88

NASA Astrophysics Data System (ADS)

Slivan, Stephen M.; Hosek, Matt; Sokol, Alyssa; Maynard, Sarah; Payne, Anna; Radford, Arden; Springmann, Alessondra; Mailhot, Emily; Midkiff, Alan; Russell, April; Stephens, Robert D.

2016-10-01

Because they share the same formation age, asteroid family members have experienced similar evolution for similar lengths of time, offering valuable information to help understand spin evolution processes. Clustered distributions of spin vectors determined from observations of ten of the largest Koronis family members (Slivan 2002) revealed evidence of spin modification by YORP thermal radiation torques (Vokrouhlický et al. 2003). The currently known spin vector sample in the Koronis family (Slivan et al., 2003; Slivan et al., 2009, Hanuš et al., 2011; Hanuš et al., 2013; Durech et al., 2016) clearly shows the two spin groupings observed among the large members: (1) the larger group with low-obliquity retrograde spin and periods between about 3 h and 30 h, and (2) a smaller group with prograde spin obliquity near 45° and periods near 8 h, characteristic of trapping in the s6 spin-orbit resonance (Vokrouhlický et al. 2003). There's also one "stray" longer-period prograde object with smaller obliquity, perhaps trapped in some other resonance.A limitation of the existing spin vector sample, which (using IAU H as a proxy for size) includes 16 of the brightest 27 members of the family, is that selection biases render it complete only to the brightest 12 members. Slivan et al. (2008) began a lightcurve observing program to increase the sample of Koronis family spin vectors down to about 20 km diameter.We report pole solutions that were determined for fourteen survey objects using lightcurves recorded from 2005-2016, which complete the Koronis spin vector sample to the brightest 22 members, now including 24 of the brightest 27 members. The larger sample adds several objects to the existing group of low-obliquity retrograde rotators, increasing the period range upward to almost 60 h, and also identifies two companions for the stray longer-period prograde spin object, strengthening the case for the presence of a second cluster of objects trapped in a spin-orbit resonance. The more complete distribution also reveals two new "strays" of its own - one lone fast prograde rotator, and one spin vector of atypical high obliquity, close to the ecliptic plane.

Is outdoor vector control needed for malaria elimination? An individual-based modelling study.

PubMed

Zhu, Lin; Müller, Günter C; Marshall, John M; Arheart, Kristopher L; Qualls, Whitney A; Hlaing, WayWay M; Schlein, Yosef; Traore, Sekou F; Doumbia, Seydou; Beier, John C

2017-07-03

Residual malaria transmission has been reported in many areas even with adequate indoor vector control coverage, such as long-lasting insecticidal nets (LLINs). The increased insecticide resistance in Anopheles mosquitoes has resulted in reduced efficacy of the widely used indoor tools and has been linked with an increase in outdoor malaria transmission. There are considerations of incorporating outdoor interventions into integrated vector management (IVM) to achieve malaria elimination; however, more information on the combination of tools for effective control is needed to determine their utilization. A spatial individual-based model was modified to simulate the environment and malaria transmission activities in a hypothetical, isolated African village setting. LLINs and outdoor attractive toxic sugar bait (ATSB) stations were used as examples of indoor and outdoor interventions, respectively. Different interventions and lengths of efficacy periods were tested. Simulations continued for 420 days, and each simulation scenario was repeated 50 times. Mosquito populations, entomologic inoculation rates (EIRs), probabilities of local mosquito extinction, and proportion of time when the annual EIR was reduced below one were compared between different intervention types and efficacy periods. In the village setting with clustered houses, the combinational intervention of 50% LLINs plus outdoor ATSBs significantly reduced mosquito population and EIR in short term, increased the probability of local mosquito extinction, and increased the time when annual EIR is less than one per person compared to 50% LLINs alone; outdoor ATSBs alone significantly reduced mosquito population in short term, increased the probability of mosquito extinction, and increased the time when annual EIR is less than one compared to 50% LLINs alone, but there was no significant difference in EIR in short term between 50% LLINs and outdoor ATSBs. In the village setting with dispersed houses, the combinational intervention of 50% LLINs plus outdoor ATSBs significantly reduced mosquito population in short term, increased the probability of mosquito extinction, and increased the time when annual EIR is less than one per person compared to 50% LLINs alone; outdoor ATSBs alone significantly reduced mosquito population in short term, but there were no significant difference in the probability of mosquito extinction and the time when annual EIR is less than one between 50% LLIN and outdoor ATSBs; and there was no significant difference in EIR between all three interventions. A minimum of 2 months of efficacy period is needed to bring out the best possible effect of the vector control tools, and to achieve long-term mosquito reduction, a minimum of 3 months of efficacy period is needed. The results highlight the value of incorporating outdoor vector control into IVM as a supplement to traditional indoor practices for malaria elimination in Africa, especially in village settings of clustered houses where LLINs alone is far from sufficient.

Viral Vectors for Use in the Development of Biodefense Vaccines

DTIC Science & Technology

2005-06-17

vaccinia virus, and Venezuelan equine encephalitis virus, as vaccine vectors has enabled researchers to develop effective means for countering the...biowarfare. The use of viruses, for example adenovirus, vaccinia virus, and Venezuelan equine encephalitis virus, as vaccine -vectors has enabled researchers to... vaccines . . . . . . . . . . . . . . . . . . . 1298 2.1.3. Vaccinia virus-vectored Venezuelan equine encephalitis vaccines

Thrust Vectoring on the NASA F-18 High Alpha Research Vehicle

NASA Technical Reports Server (NTRS)

Bowers, Albion H.; Pahle, Joseph W.

1996-01-01

Investigations into a multiaxis thrust-vectoring system have been conducted on an F-18 configuration. These investigations include ground-based scale-model tests, ground-based full-scale testing, and flight testing. This thrust-vectoring system has been tested on the NASA F-18 High Alpha Research Vehicle (HARV). The system provides thrust vectoring in pitch and yaw axes. Ground-based subscale test data have been gathered as background to the flight phase of the program. Tests investigated aerodynamic interaction and vane control effectiveness. The ground-based full-scale data were gathered from static engine runs with image analysis to determine relative thrust-vectoring effectiveness. Flight tests have been conducted at the NASA Dryden Flight Research Center. Parameter identification input techniques have been developed. Individual vanes were not directly controlled because of a mixer-predictor function built into the flight control laws. Combined effects of the vanes have been measured in flight and compared to combined effects of the vanes as predicted by the cold-jet test data. Very good agreement has been found in the linearized effectiveness derivatives.

Early warning of West Nile virus mosquito vector: climate and land use models successfully explain phenology and abundance of Culex pipiens mosquitoes in north-western Italy.

PubMed

Rosà, Roberto; Marini, Giovanni; Bolzoni, Luca; Neteler, Markus; Metz, Markus; Delucchi, Luca; Chadwick, Elizabeth A; Balbo, Luca; Mosca, Andrea; Giacobini, Mario; Bertolotti, Luigi; Rizzoli, Annapaola

2014-06-12

West Nile Virus (WNV) is an emerging global health threat. Transmission risk is strongly related to the abundance of mosquito vectors, typically Culex pipiens in Europe. Early-warning predictors of mosquito population dynamics would therefore help guide entomological surveillance and thereby facilitate early warnings of transmission risk. We analysed an 11-year time series (2001 to 2011) of Cx. pipiens mosquito captures from the Piedmont region of north-western Italy to determine the principal drivers of mosquito population dynamics. Linear mixed models were implemented to examine the relationship between Cx. pipiens population dynamics and environmental predictors including temperature, precipitation, Normalized Difference Water Index (NDWI) and the proximity of mosquito traps to urban areas and rice fields. Warm temperatures early in the year were associated with an earlier start to the mosquito season and increased season length, and later in the year, with decreased abundance. Early precipitation delayed the start and shortened the length of the mosquito season, but increased total abundance. Conversely, precipitation later in the year was associated with a longer season. Finally, higher NDWI early in the year was associated with an earlier start to the season and increased season length, but was not associated with abundance. Proximity to rice fields predicted higher total abundance when included in some models, but was not a significant predictor of phenology. Proximity to urban areas was not a significant predictor in any of our models. Predicted variations in start of the season and season length ranged from one to three weeks, across the measured range of variables. Predicted mosquito abundance was highly variable, with numbers in excess of 1000 per trap per year when late season temperatures were low (average 21°C) to only 150 when late season temperatures were high (average 30°C). Climate data collected early in the year, in conjunction with local land use, can be used to provide early warning of both the timing and magnitude of mosquito outbreaks. This potentially allows targeted mosquito control measures to be implemented, with implications for prevention and control of West Nile Virus and other mosquito borne diseases.

Transmission risk of two chikungunya lineages by invasive mosquito vectors from Florida and the Dominican Republic

PubMed Central

Wiggins, Keenan; Eastmond, Bradley; Velez, Daniel; Lounibos, L. Philip; Lord, Cynthia C.

2017-01-01

Between 2014 and 2016 more than 3,800 imported human cases of chikungunya fever in Florida highlight the high risk for local transmission. To examine the potential for sustained local transmission of chikungunya virus (CHIKV) in Florida we tested whether local populations of Aedes aegypti and Aedes albopictus show differences in susceptibility to infection and transmission to two emergent lineages of CHIKV, Indian Ocean (IOC) and Asian genotypes (AC) in laboratory experiments. All examined populations of Ae. aegypti and Ae. albopictus mosquitoes displayed susceptibility to infection, rapid viral dissemination into the hemocoel, and transmission for both emergent lineages of CHIKV. Aedes albopictus had higher disseminated infection and transmission of IOC sooner after ingesting CHIKV infected blood than Ae. aegypti. Aedes aegypti had higher disseminated infection and transmission later during infection with AC than Ae. albopictus. Viral dissemination and transmission of AC declined during the extrinsic incubation period, suggesting that transmission risk declines with length of infection. Interestingly, the reduction in transmission of AC was less in Ae. aegypti than Ae. albopictus, suggesting that older Ae. aegypti females are relatively more competent vectors than similar aged Ae. albopictus females. Aedes aegypti originating from the Dominican Republic had viral dissemination and transmission rates for IOC and AC strains that were lower than for Florida vectors. We identified small-scale geographic variation in vector competence among Ae. aegypti and Ae. albopictus that may contribute to regional differences in risk of CHIKV transmission in Florida. PMID:28749964

Optimization of Retinal Gene Therapy for X-Linked Retinitis Pigmentosa Due to RPGR Mutations.

PubMed

Beltran, William A; Cideciyan, Artur V; Boye, Shannon E; Ye, Guo-Jie; Iwabe, Simone; Dufour, Valerie L; Marinho, Luis Felipe; Swider, Malgorzata; Kosyk, Mychajlo S; Sha, Jin; Boye, Sanford L; Peterson, James J; Witherspoon, C Douglas; Alexander, John J; Ying, Gui-Shuang; Shearman, Mark S; Chulay, Jeffrey D; Hauswirth, William W; Gamlin, Paul D; Jacobson, Samuel G; Aguirre, Gustavo D

2017-08-02

X-linked retinitis pigmentosa (XLRP) caused by mutations in the RPGR gene is an early onset and severe cause of blindness. Successful proof-of-concept studies in a canine model have recently shown that development of a corrective gene therapy for RPGR-XLRP may now be an attainable goal. In preparation for a future clinical trial, we have here optimized the therapeutic AAV vector construct by showing that GRK1 (rather than IRBP) is a more efficient promoter for targeting gene expression to both rods and cones in non-human primates. Two transgenes were used in RPGR mutant (XLPRA2) dogs under the control of the GRK1 promoter. First was the previously developed stabilized human RPGR (hRPGRstb). Second was a new full-length stabilized and codon-optimized human RPGR (hRPGRco). Long-term (>2 years) studies with an AAV2/5 vector carrying hRPGRstb under control of the GRK1 promoter showed rescue of rods and cones from degeneration and retention of vision. Shorter term (3 months) studies demonstrated comparable preservation of photoreceptors in canine eyes treated with an AAV2/5 vector carrying either transgene under the control of the GRK1 promoter. These results provide the critical molecular components (GRK1 promoter, hRPGRco transgene) to now construct a therapeutic viral vector optimized for RPGR-XLRP patients. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

Visualization of flow by vector analysis of multidirectional cine MR velocity mapping.

PubMed

Mohiaddin, R H; Yang, G Z; Kilner, P J

1994-01-01

We describe a noninvasive method for visualization of flow and demonstrate its application in a flow phantom and in the great vessels of healthy volunteers and patients with aortic and pulmonary arterial disease. The technique uses multidirectional MR velocity mapping acquired in selected planes. Maps of orthogonal velocity components were then processed into a graphic form immediately recognizable as flow. Cine MR velocity maps of orthogonal velocity components in selected planes were acquired in a flow phantom, 10 healthy volunteers, and 13 patients with dilated great vessels. Velocities were presented by multiple computer-generated streaks whose orientation, length, and movement corresponded to velocity vectors in the chosen plane. The velocity vector maps allowed visualization of complex patterns of primary and secondary flow in the thoracic aorta and pulmonary arteries. The technique revealed coherent, helical forward blood movements in the normal thoracic aorta during midsystole and a reverse flow during early diastole. Abnormal flow patterns with secondary vortices were seen in patients with dilated arteries. The potential of MR velocity vector mapping for in vitro and in vivo visualization of flow patterns is demonstrated. Although this study was limited to two-directional flow in a single anatomical plane, the method provides information that might advance our understanding of the human vascular system in health and disease. Further developments to reduce the acquisition time and the handling and presenting of three-directional velocity data are required to enhance the capability of this method.

Consolidating strategic planning and operational frameworks for integrated vector management in Eritrea.

PubMed

Chanda, Emmanuel; Ameneshewa, Birkinesh; Mihreteab, Selam; Berhane, Araia; Zehaie, Assefash; Ghebrat, Yohannes; Usman, Abdulmumini

2015-12-02

Contemporary malaria vector control relies on the use of insecticide-based, indoor residual spraying (IRS) and long-lasting insecticidal nets (LLINs). However, malaria-endemic countries, including Eritrea, have struggled to effectively deploy these tools due technical and operational challenges, including the selection of insecticide resistance in malaria vectors. This manuscript outlines the processes undertaken in consolidating strategic planning and operational frameworks for vector control to expedite malaria elimination in Eritrea. The effort to strengthen strategic frameworks for vector control in Eritrea was the 'case' for this study. The integrated vector management (IVM) strategy was developed in 2010 but was not well executed, resulting in a rise in malaria transmission, prompting a process to redefine and relaunch the IVM strategy with integration of other vector borne diseases (VBDs) as the focus. The information sources for this study included all available data and accessible archived documentary records on malaria vector control in Eritrea. Structured literature searches of published, peer-reviewed sources using online, scientific, bibliographic databases, Google Scholar, PubMed and WHO, and a combination of search terms were utilized to gather data. The literature was reviewed and adapted to the local context and translated into the consolidated strategic framework. In Eritrea, communities are grappling with the challenge of VBDs posing public health concerns, including malaria. The global fund financed the scale-up of IRS and LLIN programmes in 2014. Eritrea is transitioning towards malaria elimination and strategic frameworks for vector control have been consolidated by: developing an integrated vector management (IVM) strategy (2015-2019); updating IRS and larval source management (LSM) guidelines; developing training manuals for IRS and LSM; training of national staff in malaria entomology and vector control, including insecticide resistance monitoring techniques; initiating the global plan for insecticide resistance management; conducting needs' assessments and developing standard operating procedure for insectaries; developing a guidance document on malaria vector control based on eco-epidemiological strata, a vector surveillance plan and harmonized mapping, data collection and reporting tools. Eritrea has successfully consolidated strategic frameworks for vector control. Rational decision-making remains critical to ensure that the interventions are effective and their choice is evidence-based, and to optimize the use of resources for vector control. Implementation of effective IVM requires proper collaboration and coordination, consistent technical and financial capacity and support to offer greater benefits.

Investigation on chlorosomal antenna geometries: tube, lamella and spiral-type self-aggregates.

PubMed

Linnanto, Juha M; Korppi-Tommola, Jouko E I

2008-06-01

Molecular mechanics calculations and exciton theory have been used to study pigment organization in chlorosomes of green bacteria. Single and double rod, multiple concentric rod, lamella, and Archimedean spiral macrostructures of bacteriochlorophyll c molecules were created and their spectral properties evaluated. The effects of length, width, diameter, and curvature of the macrostructures as well as orientations of monomeric transition dipole moment vectors on the spectral properties of the aggregates were studied. Calculated absorption, linear dichroism, and polarization dependent fluorescence-excitation spectra of the studied long macrostructures were practically identical, but circular dichroism spectra turned out to be very sensitive to geometry and monomeric transition dipole moment orientations of the aggregates. The simulations for long multiple rod and spiral-type macrostructures, observed in recent high-resolution electron microscopy images (Oostergetel et al., FEBS Lett 581:5435-5439, 2007) gave shapes of circular dichroism spectra observed experimentally for chlorosomes. It was shown that the ratio of total circular dichroism intensity to integrated absorption of the Q(y) transition is a good measure of degree of tubular structures in the chlorosomes. Calculations suggest that the broad Q(y) line width of chlorosomes of sulfur bacteria could be due to (1) different orientations of the transition moment vectors in multi-walled rod structures or (2) a variety of Bchl-aggregate structures in the chlorosomes.

Detection of abnormal living patterns for elderly living alone using support vector data description.

PubMed

Shin, Jae Hyuk; Lee, Boreom; Park, Kwang Suk

2011-05-01

In this study, we developed an automated behavior analysis system using infrared (IR) motion sensors to assist the independent living of the elderly who live alone and to improve the efficiency of their healthcare. An IR motion-sensor-based activity-monitoring system was installed in the houses of the elderly subjects to collect motion signals and three different feature values, activity level, mobility level, and nonresponse interval (NRI). These factors were calculated from the measured motion signals. The support vector data description (SVDD) method was used to classify normal behavior patterns and to detect abnormal behavioral patterns based on the aforementioned three feature values. The simulation data and real data were used to verify the proposed method in the individual analysis. A robust scheme is presented in this paper for optimally selecting the values of different parameters especially that of the scale parameter of the Gaussian kernel function involving in the training of the SVDD window length, T of the circadian rhythmic approach with the aim of applying the SVDD to the daily behavior patterns calculated over 24 h. Accuracies by positive predictive value (PPV) were 95.8% and 90.5% for the simulation and real data, respectively. The results suggest that the monitoring system utilizing the IR motion sensors and abnormal-behavior-pattern detection with SVDD are effective methods for home healthcare of elderly people living alone.

Characterization of fructose-bisphosphate aldolase regulated by gibberellin in roots of rice seedling.

PubMed

Konishi, Hirosato; Yamane, Hisakazu; Maeshima, Masayoshi; Komatsu, Setsuko

2004-12-01

Fructose-bisphosphate aldolase is a glycolytic enzyme whose activity increases in rice roots treated with gibberellin (GA). To investigate the relationship between aldolase and root growth, GA-induced root aldolase was characterized. GA3 promoted an increase in aldolase accumulation when 0.1 microM GA3 was added exogenously to rice roots. Aldolase accumulated abundantly in roots, especially in the apical region. To examine the effect of aldolase function on root growth, transgenic rice plants expressing antisense aldolase were constructed. Root growth of aldolase-antisense transgenic rice was repressed compared with that of the vector control transgenic rice. Although aldolase activity increased by 25% in vector control rice roots treated with 0.1 microM GA3, FBPA activity increased very little by 0.1 microM GA3 treatment in the root of aldolase-antisense transgenic rice. Furthermore, aldolase co-immunoprecipitated with antibodies against vacuolar H+ -ATPase in rice roots. In the root of OsCDPK13-antisense transgenic rice, aldolase did not accumulate even after treatment with GA3. These results suggest that the activation of glycolytic pathway function accelerates root growth and that GA3-induced root aldolase may be modulated through OsCDPK13. Aldolase physically associates with vacuolar H-ATPase in roots and may regulate the vacuolar H-ATPase mediated control of cell elongation that determines root length.

A Discriminant Distance Based Composite Vector Selection Method for Odor Classification

PubMed Central

Choi, Sang-Il; Jeong, Gu-Min

2014-01-01

We present a composite vector selection method for an effective electronic nose system that performs well even in noisy environments. Each composite vector generated from a electronic nose data sample is evaluated by computing the discriminant distance. By quantitatively measuring the amount of discriminative information in each composite vector, composite vectors containing informative variables can be distinguished and the final composite features for odor classification are extracted using the selected composite vectors. Using the only informative composite vectors can be also helpful to extract better composite features instead of using all the generated composite vectors. Experimental results with different volatile organic compound data show that the proposed system has good classification performance even in a noisy environment compared to other methods. PMID:24747735

INTERIM ANALYSIS OF THE CONTRIBUTION OF HIGH-LEVEL EVIDENCE FOR DENGUE VECTOR CONTROL.

PubMed

Horstick, Olaf; Ranzinger, Silvia Runge

2015-01-01

This interim analysis reviews the available systematic literature for dengue vector control on three levels: 1) single and combined vector control methods, with existing work on peridomestic space spraying and on Bacillus thuringiensis israelensis; further work is available soon on the use of Temephos, Copepods and larvivorous fish; 2) or for a specific purpose, like outbreak control, and 3) on a strategic level, as for example decentralization vs centralization, with a systematic review on vector control organization. Clear best practice guidelines for methodology of entomological studies are needed. There is a need to include measuring dengue transmission data. The following recommendations emerge: Although vector control can be effective, implementation remains an issue; Single interventions are probably not useful; Combinations of interventions have mixed results; Careful implementation of vector control measures may be most important; Outbreak interventions are often applied with questionable effectiveness.

Thrust shock vector control of an axisymmetric conical supersonic nozzle via secondary transverse gas injection

NASA Astrophysics Data System (ADS)

Zmijanovic, V.; Lago, V.; Sellam, M.; Chpoun, A.

2014-01-01

Transverse secondary gas injection into the supersonic flow of an axisymmetric convergent-divergent nozzle is investigated to describe the effects of the fluidic thrust vectoring within the framework of a small satellite launcher. Cold-flow dry-air experiments are performed in a supersonic wind tunnel using two identical supersonic conical nozzles with the different transverse injection port positions. The complex three-dimensional flow field generated by the supersonic cross-flows in these test nozzles was examined. Valuable experimental data were confronted and compared with the results obtained from the numerical simulations. Different nozzle models are numerically simulated under experimental conditions and then further investigated to determine which parameters significantly affect thrust vectoring. Effects which characterize the nozzle and thrust vectoring performances are established. The results indicate that with moderate secondary to primary mass flow rate ratios, ranging around 5 %, it is possible to achieve pertinent vector side forces. It is also revealed that injector positioning and geometry have a strong effect on the shock vector control system and nozzle performances.

Resting and feeding preferences of Anopheles stephensi in an urban setting, perennial for malaria.

PubMed

Thomas, Shalu; Ravishankaran, Sangamithra; Justin, N A Johnson Amala; Asokan, Aswin; Mathai, Manu Thomas; Valecha, Neena; Montgomery, Jacqui; Thomas, Matthew B; Eapen, Alex

2017-03-10

The Indian city of Chennai is endemic for malaria and the known local malaria vector is Anopheles stephensi. Plasmodium vivax is the predominant malaria parasite species, though Plasmodium falciparum is present at low levels. The urban ecotype of malaria prevails in Chennai with perennial transmission despite vector surveillance by the Urban Malaria Scheme (UMS) of the National Vector Borne Disease Control Programme (NVBDCP). Understanding the feeding and resting preferences, together with the transmission potential of adult vectors in the area is essential in effective planning and execution of improved vector control measures. A yearlong survey was carried out in cattle sheds and human dwellings to check the resting, feeding preferences and transmission potential of An. stephensi. The gonotrophic status, age structure, resting and host seeking preferences were studied. The infection rate in An. stephensi and Anopheles subpictus were analysed by circumsporozoite ELISA (CS-ELISA). Adult vectors were found more frequently and at higher densities in cattle sheds than human dwellings. The overall Human Blood Index (HBI) was 0.009 indicating the vectors to be strongly zoophilic. Among the vectors collected from human dwellings, 94.2% were from thatched structures and the remaining 5.8% from tiled and asbestos structures. 57.75% of the dissected vectors were nulliparous whereas, 35.83% were monoparous and the rest 6.42% biparous. Sporozoite positivity rate was 0.55% (4/720) and 1.92% (1/52) for An. stephensi collected from cattle sheds and human dwellings, respectively. One adult An. subpictus (1/155) was also found to be infected with P. falciparum. Control of the adult vector populations can be successful only by understanding the resting and feeding preferences. The present study indicates that adult vectors predominantly feed on cattle and cattle sheds are the preferred resting place, possibly due to easy availability of blood meal source and lack of any insecticide or repellent pressure. Hence targeting these resting sites with cost effective, socially acceptable intervention tools, together with effective larval source management to reduce vector breeding, could provide an improved integrated vector management strategy to help drive down malaria transmission and assist in India's plan to eliminate malaria by 2030.

Minimizing inner product data dependencies in conjugate gradient iteration

NASA Technical Reports Server (NTRS)

Vanrosendale, J.

1983-01-01

The amount of concurrency available in conjugate gradient iteration is limited by the summations required in the inner product computations. The inner product of two vectors of length N requires time c log(N), if N or more processors are available. This paper describes an algebraic restructuring of the conjugate gradient algorithm which minimizes data dependencies due to inner product calculations. After an initial start up, the new algorithm can perform a conjugate gradient iteration in time c*log(log(N)).

Mapping the Conjugate Gradient Algorithm onto High Performance Heterogeneous Computers

DTIC Science & Technology

2014-05-01

Matrix Storage Formats According to J . Dongarra (Dongerra 2000), the efficiency of most iterative methods, such as CG, can be attributed to the...valh = aij) ⇒ (colh = j ). The ptr integer vector is of length n + 1 and contains the index in val where each matrix row starts. For example, the...first nonzero element of matrix rowm is found at index ptrm of val. By convention, ptrn+1 ≡ nz + 1. Notice that (aij) ⇒ (ptri ≤ j < ptri+1) for all i. An

Observations on Polar Coding with CRC-Aided List Decoding

DTIC Science & Technology

2016-09-01

9 v 1. INTRODUCTION Polar codes are a new type of forward error correction (FEC) codes, introduced by Arikan in [1], in which he...error correction (FEC) currently used and planned for use in Navy wireless communication systems. The project’s results from FY14 and FY15 are...good error- correction per- formance. We used the Tal/Vardy method of [5]. The polar encoder uses a row vector u of length N . Let uA be the subvector

Observed and Simulated Temporal and Spatial Variations of Gap Outflow Region

DTIC Science & Technology

2006-09-01

5 Figure 3. (a) Cross section plot of potential temperature (every 2oK) and horizontal wind along line AB. The orientation of cross section AB is...c)18Z, and (d) 21Z. The length of the wind vector is proportional to its magnitude. The yellow lines indicate the leading edge identified from...a) 12Z February 26 2004 and (b) 00Z February 27 2004. The black transverse lines indicate the position of the low level flight passes by the

Conserved Elements Vaccine for HIV | NCI Technology Transfer Center | TTC

Cancer.gov

Researchers at the National Cancer Institute (NCI) developed a DNA vaccine using conserved elements of HIV-1 Gag, administered in a prime-boost vaccination protocol. Two of the HIV Gag CE DNA vectors have been tested in a rhesus macaque model. Priming with the Gag CE vaccine and boosting with full length Gag DNA showed increased immune responses when compared to vaccination with Gag alone. Researchers seek licensing and/or co-development research collaborations for development this DNA vaccine.

Evaluation and Improvement of Spectral Features for the Detection of Buried Explosive Hazards Using Forward-Looking Ground-Penetrating Radar

DTIC Science & Technology

2012-07-01

cross track direction is calculated. This is accomplished by taking a 101 point horizontal slice of pixels centered on the alarm. Then, a 101 point...Hamming window, is the 101 -length row vector of FLGPR image pixels surrounding alarm A. We then store the first 50 frequency values (excluding the...Figure 3. Illustration of spectral features in the cross track direction and the difference between actual targets and FAs. Eleven rows of 101

Star tracker error analysis: Roll-to-pitch nonorthogonality

NASA Technical Reports Server (NTRS)

Corson, R. W.

1979-01-01

An error analysis is described on an anomaly isolated in the star tracker software line of sight (LOS) rate test. The LOS rate cosine was found to be greater than one in certain cases which implied that either one or both of the star tracker measured end point unit vectors used to compute the LOS rate cosine had lengths greater than unity. The roll/pitch nonorthogonality matrix in the TNB CL module of the IMU software is examined as the source of error.

Analysis and Simulation of Narrowband GPS Jamming Using Digital Excision Temporal Filtering.

DTIC Science & Technology

1994-12-01

the sequence of stored values from the P- code sampled at a 20 MHz rate. When correlated with a reference vector of the same length to simulate a GPS ...rate required for the GPS signals, (20 MHz sampling rate for the P- code signal), the personal computer (PC) used run the simulation could not perform...This subroutine is used to perform a fast FFT based 168 biased cross correlation . Written by Capt Gerry Falen, USAF, 16 AUG 94 % start of code

Cross-dialectal variation in formant dynamics of American English vowels

PubMed Central

Fox, Robert Allen; Jacewicz, Ewa

2009-01-01

This study aims to characterize the nature of the dynamic spectral change in vowels in three distinct regional varieties of American English spoken in the Western North Carolina, in Central Ohio, and in Southern Wisconsin. The vowels ∕ɪ, ε, e, æ, aɪ∕ were produced by 48 women for a total of 1920 utterances and were contained in words of the structure ∕bVts∕ and ∕bVdz∕ in sentences which elicited nonemphatic and emphatic vowels. Measurements made at the vowel target (i.e., the central 60% of the vowel) produced a set of acoustic parameters which included position and movement in the F1 by F2 space, vowel duration, amount of spectral change [measured as vector length (VL) and trajectory length (TL)], and spectral rate of change. Results revealed expected variation in formant dynamics as a function of phonetic factors (vowel emphasis and consonantal context). However, for each vowel and for each measure employed, dialect was a strong source of variation in vowel-inherent spectral change. In general, the dialect-specific nature and amount of spectral change can be characterized quite effectively by position and movement in the F1 by F2 space, vowel duration, TL (but not VL which underestimates formant movement), and spectral rate of change. PMID:19894839

Confirmation of general relativity on large scales from weak lensing and galaxy velocities.

PubMed

Reyes, Reinabelle; Mandelbaum, Rachel; Seljak, Uros; Baldauf, Tobias; Gunn, James E; Lombriser, Lucas; Smith, Robert E

2010-03-11

Although general relativity underlies modern cosmology, its applicability on cosmological length scales has yet to be stringently tested. Such a test has recently been proposed, using a quantity, E(G), that combines measures of large-scale gravitational lensing, galaxy clustering and structure growth rate. The combination is insensitive to 'galaxy bias' (the difference between the clustering of visible galaxies and invisible dark matter) and is thus robust to the uncertainty in this parameter. Modified theories of gravity generally predict values of E(G) different from the general relativistic prediction because, in these theories, the 'gravitational slip' (the difference between the two potentials that describe perturbations in the gravitational metric) is non-zero, which leads to changes in the growth of structure and the strength of the gravitational lensing effect. Here we report that E(G) = 0.39 +/- 0.06 on length scales of tens of megaparsecs, in agreement with the general relativistic prediction of E(G) approximately 0.4. The measured value excludes a model within the tensor-vector-scalar gravity theory, which modifies both Newtonian and Einstein gravity. However, the relatively large uncertainty still permits models within f(R) theory, which is an extension of general relativity. A fivefold decrease in uncertainty is needed to rule out these models.

Confirmation of general relativity on large scales from weak lensing and galaxy velocities

NASA Astrophysics Data System (ADS)

Reyes, Reinabelle; Mandelbaum, Rachel; Seljak, Uros; Baldauf, Tobias; Gunn, James E.; Lombriser, Lucas; Smith, Robert E.

2010-03-01

Although general relativity underlies modern cosmology, its applicability on cosmological length scales has yet to be stringently tested. Such a test has recently been proposed, using a quantity, EG, that combines measures of large-scale gravitational lensing, galaxy clustering and structure growth rate. The combination is insensitive to `galaxy bias' (the difference between the clustering of visible galaxies and invisible dark matter) and is thus robust to the uncertainty in this parameter. Modified theories of gravity generally predict values of EG different from the general relativistic prediction because, in these theories, the `gravitational slip' (the difference between the two potentials that describe perturbations in the gravitational metric) is non-zero, which leads to changes in the growth of structure and the strength of the gravitational lensing effect. Here we report that EG = 0.39+/-0.06 on length scales of tens of megaparsecs, in agreement with the general relativistic prediction of EG~0.4. The measured value excludes a model within the tensor-vector-scalar gravity theory, which modifies both Newtonian and Einstein gravity. However, the relatively large uncertainty still permits models within f() theory, which is an extension of general relativity. A fivefold decrease in uncertainty is needed to rule out these models.

Characterization of fine motor development: dynamic analysis of children's drawing movements.

PubMed

Lin, Qiushi; Luo, Jianfei; Wu, Zhongcheng; Shen, Fei; Sun, Zengwu

2015-04-01

In this study, we investigated children's fine motor development by analyzing drawing trajectories, kinematics and kinetics. Straight lines drawing task and circles drawing task were performed by using a force sensitive tablet. Forty right-handed and Chinese mother-tongue students aged 6-12, attending classes from grade 1 to 5, were engaged in the experiment. Three spatial parameters, namely cumulative trace length, vector length of straight line and vertical diameter of circle were determined. Drawing duration, mean drawing velocity, and number of peaks in stroke velocity profile (NPV) were derived as kinematic parameters. Besides mean normal force, two kinetic indices were proposed: normalized force angle regulation (NFR) and variation of fine motor control (VFC) for circles drawing task. The maturation and automation of fine motor ability were reflected by increased drawing velocity, reduced drawing duration, NPV and NFR, with decreased VFC in circles drawing task. Grade and task main effects as well as significant correlations between age and parameters suggest that factors such as schooling, age and task should be considered in the assessment of fine motor skills. Compared with kinematic parameters, findings of NFR and VFC revealed that kinetics is another important perspective in the analysis of fine motor movement. Copyright © 2014 Elsevier B.V. All rights reserved.

Solid-state NMR reveals differential carbohydrate utilization in diapausing Culex pipiens

NASA Astrophysics Data System (ADS)

Chang, James; Singh, Jugeshwar; Kim, Sungshil; Hockaday, William C.; Sim, Cheolho; Kim, Sung Joon

2016-11-01

Culex pipiens is the mosquito that vectors West Nile Virus and other human-pathogenic flavivruses in North America. In response to shortened day length and lower temperatures, female Cx. pipiense prepares for the diapause by actively feeding on carbohydrates to increase the biosynthesis of glycogen and lipid to store energy for overwintering. The effect of feeding different carbohydrates on glycogen and lipid biosynthesis in diapausing mosquitoes was investigated in vivo using 13C solid-state NMR. Diapause-destined adult females and nondiapausing counterparts after adult eclosion were fed with three different carbohydrate sources for 7 days: 1) 10% sucrose, 2) 10% D-[13C6]glucose, and 3) 1% D-[13C6]glucose co-provisioned with 10% sucrose. NMR measurements show that sucrose and glucose are metabolized differently in diapausing mosquitoes. Mosquitoes fed on sucrose primarily accumulate glycogen with increased branching structures, but less of lipids. In contrast, mosquitoes fed exclusively on glucose show accumulation of both glycogen and lipid with increased aliphatic chain length. Glucose is exclusively metabolized for the biosynthesis of triacylglyceride when mosquitoes were co-fed with sucrose. Our findings provide novel insights into the insect carbohydrate metabolism that governs glycogen and lipid biosynthesis during diapause, which is fundamental for the insect survival during inimical environments.

Reversible vector ratchets for skyrmion systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ma, Xiu; Reichhardt, Cynthia Jane Olson; Reichhardt, Charles

In this paper, we show that ac driven skyrmions interacting with an asymmetric substrate provide a realization of a class of ratchet system which we call a vector ratchet that arises due to the effect of the Magnus term on the skyrmion dynamics. In a vector ratchet, the dc motion induced by the ac drive can be described as a vector that can be rotated clockwise or counterclockwise relative to the substrate asymmetry direction. Up to a full 360° rotation is possible for varied ac amplitudes or skyrmion densities. In contrast to overdamped systems, in which ratchet motion is alwaysmore » parallel to the substrate asymmetry direction, vector ratchets allow the ratchet motion to be in any direction relative to the substrate asymmetry. It is also possible to obtain a reversal in the direction of rotation of the vector ratchet, permitting the creation of a reversible vector ratchet. We examine vector ratchets for ac drives applied parallel or perpendicular to the substrate asymmetry direction, and show that reverse ratchet motion can be produced by collective effects. No reversals occur for an isolated skyrmion on an asymmetric substrate. Finally, since a vector ratchet can produce motion in any direction, it could represent a method for controlling skyrmion motion for spintronic applications.« less

Exploiting the potential of vector control for disease prevention.

PubMed

Townson, H; Nathan, M B; Zaim, M; Guillet, P; Manga, L; Bos, R; Kindhauser, M

2005-12-01

Although vector control has proven highly effective in preventing disease transmission, it is not being used to its full potential, thereby depriving disadvantaged populations of the benefits of well tried and tested methods. Following the discovery of synthetic residual insecticides in the 1940s, large-scale programmes succeeded in bringing many of the important vector-borne diseases under control. By the late 1960s, most vector-borne diseases--with the exception of malaria in Africa--were no longer considered to be of primary public health importance. The result was that control programmes lapsed, resources dwindled, and specialists in vector control disappeared from public health units. Within two decades, many important vector-borne diseases had re-emerged or spread to new areas. The time has come to restore vector control to its key role in the prevention of disease transmission, albeit with an increased emphasis on multiple measures, whether pesticide-based or involving environmental modification, and with a strengthened managerial and operational capacity. Integrated vector management provides a sound conceptual framework for deployment of cost-effective and sustainable methods of vector control. This approach allows for full consideration of the complex determinants of disease transmission, including local disease ecology, the role of human activity in increasing risks of disease transmission, and the socioeconomic conditions of affected communities.

Exploiting the potential of vector control for disease prevention.

PubMed Central

Townson, H.; Nathan, M. B.; Zaim, M.; Guillet, P.; Manga, L.; Bos, R.; Kindhauser, M.

2005-01-01

Although vector control has proven highly effective in preventing disease transmission, it is not being used to its full potential, thereby depriving disadvantaged populations of the benefits of well tried and tested methods. Following the discovery of synthetic residual insecticides in the 1940s, large-scale programmes succeeded in bringing many of the important vector-borne diseases under control. By the late 1960s, most vector-borne diseases--with the exception of malaria in Africa--were no longer considered to be of primary public health importance. The result was that control programmes lapsed, resources dwindled, and specialists in vector control disappeared from public health units. Within two decades, many important vector-borne diseases had re-emerged or spread to new areas. The time has come to restore vector control to its key role in the prevention of disease transmission, albeit with an increased emphasis on multiple measures, whether pesticide-based or involving environmental modification, and with a strengthened managerial and operational capacity. Integrated vector management provides a sound conceptual framework for deployment of cost-effective and sustainable methods of vector control. This approach allows for full consideration of the complex determinants of disease transmission, including local disease ecology, the role of human activity in increasing risks of disease transmission, and the socioeconomic conditions of affected communities. PMID:16462987

Reversible vector ratchets for skyrmion systems

DOE PAGES

Ma, Xiu; Reichhardt, Cynthia Jane Olson; Reichhardt, Charles

2017-03-03

In this paper, we show that ac driven skyrmions interacting with an asymmetric substrate provide a realization of a class of ratchet system which we call a vector ratchet that arises due to the effect of the Magnus term on the skyrmion dynamics. In a vector ratchet, the dc motion induced by the ac drive can be described as a vector that can be rotated clockwise or counterclockwise relative to the substrate asymmetry direction. Up to a full 360° rotation is possible for varied ac amplitudes or skyrmion densities. In contrast to overdamped systems, in which ratchet motion is alwaysmore » parallel to the substrate asymmetry direction, vector ratchets allow the ratchet motion to be in any direction relative to the substrate asymmetry. It is also possible to obtain a reversal in the direction of rotation of the vector ratchet, permitting the creation of a reversible vector ratchet. We examine vector ratchets for ac drives applied parallel or perpendicular to the substrate asymmetry direction, and show that reverse ratchet motion can be produced by collective effects. No reversals occur for an isolated skyrmion on an asymmetric substrate. Finally, since a vector ratchet can produce motion in any direction, it could represent a method for controlling skyrmion motion for spintronic applications.« less

Global climate change and vector-borne diseases

USGS Publications Warehouse

Ginsberg, H.S.

2002-01-01

Global warming will have different effects on different diseases because of the complex and idiosynchratic interactions between vectors, hosts, and pathogens that influence transmission dynamics of each pathogen. Human activities, including urbanization, rapid global travel, and vector management, have profound effects on disease transmission that can operate on more rapid time scales than does global climate change. The general concern about global warming encouraging the spread of tropical diseases is legitimate, but the effects vary among diseases, and the ecological implications are difficult to predict.

A Subdivision-Based Representation for Vector Image Editing.

PubMed

Liao, Zicheng; Hoppe, Hugues; Forsyth, David; Yu, Yizhou

2012-11-01

Vector graphics has been employed in a wide variety of applications due to its scalability and editability. Editability is a high priority for artists and designers who wish to produce vector-based graphical content with user interaction. In this paper, we introduce a new vector image representation based on piecewise smooth subdivision surfaces, which is a simple, unified and flexible framework that supports a variety of operations, including shape editing, color editing, image stylization, and vector image processing. These operations effectively create novel vector graphics by reusing and altering existing image vectorization results. Because image vectorization yields an abstraction of the original raster image, controlling the level of detail of this abstraction is highly desirable. To this end, we design a feature-oriented vector image pyramid that offers multiple levels of abstraction simultaneously. Our new vector image representation can be rasterized efficiently using GPU-accelerated subdivision. Experiments indicate that our vector image representation achieves high visual quality and better supports editing operations than existing representations.

Challenges in predicting climate and environmental effects on vector-borne disease episystems in a changing world.

PubMed

Tabachnick, W J

2010-03-15

Vector-borne pathogens cause enormous suffering to humans and animals. Many are expanding their range into new areas. Dengue, West Nile and Chikungunya have recently caused substantial human epidemics. Arthropod-borne animal diseases like Bluetongue, Rift Valley fever and African horse sickness pose substantial threats to livestock economies around the world. Climate change can impact the vector-borne disease epidemiology. Changes in climate will influence arthropod vectors, their life cycles and life histories, resulting in changes in both vector and pathogen distribution and changes in the ability of arthropods to transmit pathogens. Climate can affect the way pathogens interact with both the arthropod vector and the human or animal host. Predicting and mitigating the effects of future changes in the environment like climate change on the complex arthropod-pathogen-host epidemiological cycle requires understanding of a variety of complex mechanisms from the molecular to the population level. Although there has been substantial progress on many fronts the challenges to effectively understand and mitigate the impact of potential changes in the environment on vector-borne pathogens are formidable and at an early stage of development. The challenges will be explored using several arthropod-borne pathogen systems as illustration, and potential avenues to meet the challenges will be presented.

Evaluation of Spatially Targeted Strategies to Control Non-Domiciliated Triatoma dimidiata Vector of Chagas Disease

PubMed Central

Barbu, Corentin; Dumonteil, Eric; Gourbière, Sébastien

2011-01-01

Background Chagas disease is a major neglected tropical disease with deep socio-economical effects throughout Central and South America. Vector control programs have consistently reduced domestic populations of triatomine vectors, but non-domiciliated vectors still have to be controlled efficiently. Designing control strategies targeting these vectors is challenging, as it requires a quantitative description of the spatio-temporal dynamics of village infestation, which can only be gained from combinations of extensive field studies and spatial population dynamic modelling. Methodology/Principal Findings A spatially explicit population dynamic model was combined with a two-year field study of T. dimidiata infestation dynamics in the village of Teya, Mexico. The parameterized model fitted and predicted accurately both intra-annual variation and the spatial gradient in vector abundance. Five different control strategies were then applied in concentric rings to mimic spatial design targeting the periphery of the village, where vectors were most abundant. Indoor insecticide spraying and insect screens reduced vector abundance by up to 80% (when applied to the whole village), and half of this effect was obtained when control was applied only to the 33% of households closest to the village periphery. Peri-domicile cleaning was able to eliminate up to 60% of the vectors, but at the periphery of the village it has a low effect, as it is ineffective against sylvatic insects. The use of lethal traps and the management of house attractiveness provided similar levels of control. However this required either house attractiveness to be null, or ≥5 lethal traps, at least as attractive as houses, to be installed in each household. Conclusion/Significance Insecticide and insect screens used in houses at the periphery of the village can contribute to reduce house infestation in more central untreated zones. However, this beneficial effect remains insufficient to allow for a unique spatially targeted strategy to offer protection to all households. Most efficiently, control should combine the use of insect screens in outer zones to reduce infestation by both sylvatic and peri-domiciliated vectors, and cleaning of peri-domicile in the centre of the village where sylvatic vectors are absent. The design of such spatially mixed strategies of control offers a promising avenue to reduce the economic cost associated with the control of non-domiciliated vectors. PMID:21610862

Bursaphelenchus xylophilus is killed by homologues of 2-(1-undecyloxy)-1-ethanol

NASA Astrophysics Data System (ADS)

Kim, Junheon; Lee, Sang-Myeong; Park, Chung Gyoo

2016-07-01

2-(1-Undecyloxy)-1-ethanol, monochamol, is a male-produced aggregation pheromone of the Monochamus species, which are efficient vectors of the pine wood nematode (PWN), Bursaphelenchus xylophilus, which cause devastating damage to pines worldwide. The nematicidal activity of synthetic monochamol and its homologues (ROEtOH: R = C7-C13) were investigated to find potential alternatives to the currently used PWN control agents abamectin and emamectin. Compounds with C7-C13 chain length alkyl groups exhibited 100% nematicidal activity at a concentration of 1000 mg/L. At a concentration of 100 mg/L, 2-(1-nonyloxy)-1-ethanol (C9OEtOH), 2-(1-decyloxy)-1-ethanol (C10OEtOH), 2-(1-undecyloxy)-1-ethanol (C11OEtOH), and 2-(1-dodecyloxy)-1-ethanol (C12OEtOH) showed 100% nematicidal activity, but the others showed weaker activities. C11OEtOH showed similar nematicidal activity to abamectin in terms of LD90 values, which were 13.30 and 12.53 mg/L, respectively. However, C9OEtOH, C10OEtOH, and C12OEtOH (LC90 values: 53.63, 38.18, and 46.68 mg/L, respectively) were less effective than C11OEtOH and abamectin. These results indicate that monochamol could be an effective alternative agent against PWN. The relationship of insecticidal and nematicidal activity to different carbon chain lengths in compounds is discussed.

Static investigation of two fluidic thrust-vectoring concepts on a two-dimensional convergent-divergent nozzle

NASA Technical Reports Server (NTRS)

Wing, David J.

1994-01-01

A static investigation was conducted in the static test facility of the Langley 16-Foot Transonic Tunnel of two thrust-vectoring concepts which utilize fluidic mechanisms for deflecting the jet of a two-dimensional convergent-divergent nozzle. One concept involved using the Coanda effect to turn a sheet of injected secondary air along a curved sidewall flap and, through entrainment, draw the primary jet in the same direction to produce yaw thrust vectoring. The other concept involved deflecting the primary jet to produce pitch thrust vectoring by injecting secondary air through a transverse slot in the divergent flap, creating an oblique shock in the divergent channel. Utilizing the Coanda effect to produce yaw thrust vectoring was largely unsuccessful. Small vector angles were produced at low primary nozzle pressure ratios, probably because the momentum of the primary jet was low. Significant pitch thrust vector angles were produced by injecting secondary flow through a slot in the divergent flap. Thrust vector angle decreased with increasing nozzle pressure ratio but moderate levels were maintained at the highest nozzle pressure ratio tested. Thrust performance generally increased at low nozzle pressure ratios and decreased near the design pressure ratio with the addition of secondary flow.

Anatomical and physiological evidence for polarisation vision in the nocturnal bee Megalopta genalis.

PubMed

Greiner, Birgit; Cronin, Thomas W; Ribi, Willi A; Wcislo, William T; Warrant, Eric J

2007-06-01

The presence of a specialised dorsal rim area with an ability to detect the e-vector orientation of polarised light is shown for the first time in a nocturnal hymenopteran. The dorsal rim area of the halictid bee Megalopta genalis features a number of characteristic anatomical specialisations including an increased rhabdom diameter and a lack of primary screening pigments. Optically, these specialisations result in wide spatial receptive fields (Deltarho = 14 degrees ), a common adaptation found in the dorsal rim areas of insects used to filter out interfering effects (i.e. clouds) from the sky. In this specialised eye region all nine photoreceptors contribute their microvilli to the entire length of the ommatidia. These orthogonally directed microvilli are anatomically arranged in an almost linear, anterior-posterior orientation. Intracellular recordings within the dorsal rim area show very high polarisation sensitivity and a sensitivity peak within the ultraviolet part of the spectrum.

Temperature stability of transit time delay for a single-mode fibre in a loose tube cable

NASA Technical Reports Server (NTRS)

Bergman, L. A.; Eng, S. T.; Johnston, A. R.

1983-01-01

The effect of temperature on the transit-time delay of a loose-tube-type single-mode optical-fiber cable is investigated experimentally. A 1058-m length of cable was placed loosely coiled in an oven and used to connect a 820-nm single-mode laser diode to a high-speed avalanche-photodiode detector feeding a vector voltmeter; the signal was provided by a high-stability frequency-synthesized generator. Measurements were made every 2 C from -50 to 60 C and compared to those obtained with a 200-m lacquered bare fiber. The phase change of both fibers varied with temperature at a positive slope of 6-7 ppm/C. This value is significantly better than those reported for other cable types, suggesting the application of loose-fiber cables to long-haul gigabit digital transmissions or precision time-base distribution for VLBI.

Site-percolation threshold of carbon nanotube fibers-Fast inspection of percolation with Markov stochastic theory

NASA Astrophysics Data System (ADS)

Xu, Fangbo; Xu, Zhiping; Yakobson, Boris I.

2014-08-01

We present a site-percolation model based on a modified FCC lattice, as well as an efficient algorithm of inspecting percolation which takes advantage of the Markov stochastic theory, in order to study the percolation threshold of carbon nanotube (CNT) fibers. Our Markov-chain based algorithm carries out the inspection of percolation by performing repeated sparse matrix-vector multiplications, which allows parallelized computation to accelerate the inspection for a given configuration. With this approach, we determine that the site-percolation transition of CNT fibers occurs at pc=0.1533±0.0013, and analyze the dependence of the effective percolation threshold (corresponding to 0.5 percolation probability) on the length and the aspect ratio of a CNT fiber on a finite-size-scaling basis. We also discuss the aspect ratio dependence of percolation probability with various values of p (not restricted to pc).