Detection of hepatitis "C" virus in formalin-fixed liver tissue by nested polymerase chain reaction.

PubMed

Sallie, R; Rayner, A; Portmann, B; Eddleston, A L; Williams, R

1992-08-01

Interpretation of antibody to hepatitis C virus (HCV) in patients with liver disease is difficult due to false-positive reactivity in some conditions. To evaluate the feasibility of HCV in archival material, HCV was sought in formalin-fixed, paraffin-embedded liver biopsy specimens. Nested polymerase chain reaction was used to detect hepatitis C virus in formalin-fixed, paraffin-embedded liver biopsy specimens after total RNA was extracted from tissue by proteinase K digestion and phenol/chloroform purification. The relative efficiency of amplification of HCV RNA from formalin-fixed material was estimated semiquantitatively by serial dilution of cDNA synthesised from RNA extracted from fresh and formalin-fixed sections from the same liver. Although HCV RNA could be detected in formalin-fixed liver tissue by nested PCR in 5/5 cases in which HCV was detected in serum, amplification was approximately 5-fold less efficient than when HCV was amplified from fresh tissue. Nevertheless, nested PCR of HCV from formalin-fixed liver tissue represents a useful technique in addressing some important questions related to the pathogenesis of liver disease.

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2010 CFR

2010-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2011 CFR

2011-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

An A-T linker adapter polymerase chain reaction method for chromosome walking without restriction site cloning bias.

PubMed

Trinh, Quoclinh; Xu, Wentao; Shi, Hui; Luo, Yunbo; Huang, Kunlun

2012-06-01

A-T linker adapter polymerase chain reaction (PCR) was modified and employed for the isolation of genomic fragments adjacent to a known DNA sequence. The improvements in the method focus on two points. The first is the modification of the PO(4) and NH(2) groups in the adapter to inhibit the self-ligation of the adapter or the generation of nonspecific products. The second improvement is the use of the capacity of rTaq DNA polymerase to add an adenosine overhang at the 3' ends of digested DNA to suppress self-ligation in the digested DNA and simultaneously resolve restriction site clone bias. The combination of modifications in the adapter and in the digested DNA leads to T/A-specific ligation, which enhances the flexibility of this method and makes it feasible to use many different restriction enzymes with a single adapter. This novel A-T linker adapter PCR overcomes the inherent limitations of the original ligation-mediated PCR method such as low specificity and a lack of restriction enzyme choice. Moreover, this method also offers higher amplification efficiency, greater flexibility, and easier manipulation compared with other PCR methods for chromosome walking. Experimental results from 143 Arabidopsis mutants illustrate that this method is reliable and efficient in high-throughput experiments. Copyright © 2012 Elsevier Inc. All rights reserved.

Modified pseudomonas oleovorans phaC1 nucleic acids encoding bispecific polyhydroxyalkanoate polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Srienc, Friedrich; Jackson, John K.; Somers, David A.

A genetically engineered Pseudomonas oleovorans phaC1 polyhydroxyalkanoate (PHA) polymerase having tailored substrate specificity is provided. The modified PHA polymerase is preferably a "bispecific" PHA polymerase capable of copolymerizing a short chain length monomer and a medium chain length monomer is provided. Methods for making the modified PHA polymerase and for making nucleic acids encoding the modified PHA polymerase are also disclosed, as are methods of producing PHA using the modified PHA polymerase. The invention further includes methods to assay for altered substrate specificity.

Recombinase Polymerase Amplification Compared to Real-Time Polymerase Chain Reaction Test for the Detection of Fasciola hepatica in Human Stool

PubMed Central

Cabada, Miguel M.; Malaga, Jose L.; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A.; Naeger, Patrick A.; Rogers, Hayley K.; Maharsi, Safa; Mbaka, Maryann; White, A. Clinton

2017-01-01

Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)–based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization. PMID:27821691

Modulating the DNA polymerase β reaction equilibrium to dissect the reverse reaction

PubMed Central

Shock, David D.; Freudenthal, Bret D.; Beard, William A.; Wilson, Samuel H.

2017-01-01

DNA polymerases catalyze efficient and high fidelity DNA synthesis. While this reaction favors nucleotide incorporation, polymerases also catalyze a reverse reaction, pyrophosphorolysis, removing the DNA primer terminus and generating deoxynucleoside triphosphates. Since pyrophosphorolysis can influence polymerase fidelity and sensitivity to chain-terminating nucleosides, we analyzed pyrophosphorolysis with human DNA polymerase β and found the reaction to be inefficient. The lack of a thio-elemental effect indicated that it was limited by a non-chemical step. Utilizing a pyrophosphate analog, where the bridging oxygen is replaced with an imido-group (PNP), increased the rate of the reverse reaction and displayed a large thio-elemental effect indicating that chemistry was now rate determining. Time-lapse crystallography with PNP captured structures consistent with a chemical equilibrium that favored the reverse reaction. These results highlight the importance of the bridging atom between the β- and γ-phosphates of the incoming nucleotide in reaction chemistry, enzyme conformational changes, and overall reaction equilibrium. PMID:28759020

Massively parallel single-molecule and single-cell emulsion reverse transcription polymerase chain reaction using agarose droplet microfluidics.

PubMed

Zhang, Huifa; Jenkins, Gareth; Zou, Yuan; Zhu, Zhi; Yang, Chaoyong James

2012-04-17

A microfluidic device for performing single copy, emulsion Reverse Transcription Polymerase Chain Reaction (RT-PCR) within agarose droplets is presented. A two-aqueous-inlet emulsion droplet generator was designed and fabricated to produce highly uniform monodisperse picoliter agarose emulsion droplets with RT-PCR reagents in carrier oil. Template RNA or cells were delivered from one inlet with RT-PCR reagents/cell lysis buffer delivered separately from the other. Efficient RNA/cell encapsulation and RT-PCR at the single copy level was achieved in agarose-in-oil droplets, which, after amplification, can be solidified into agarose beads for further analysis. A simple and efficient method to graft primer to the polymer matrix using 5'-acrydite primer was developed to ensure highly efficient trapping of RT-PCR products in agarose. High-throughput single RNA molecule/cell RT-PCR was demonstrated in stochastically diluted solutions. Our results indicate that single-molecule RT-PCR can be efficiently carried out in agarose matrix. Single-cell RT-PCR was successfully performed which showed a clear difference in gene expression level of EpCAM, a cancer biomarker gene, at the single-cell level between different types of cancer cells. This work clearly demonstrates for the first time, single-copy RT-PCR in agarose droplets. We believe this will open up new possibilities for viral RNA detection and single-cell transcription analysis.

Pre-Steady State Kinetic Investigation of the Incorporation of Anti-Hepatitis B Nucleotide Analogs Catalyzed by Non-Canonical Human DNA Polymerases

PubMed Central

Brown, Jessica A.; Pack, Lindsey R.; Fowler, Jason D.; Suo, Zucai

2011-01-01

Antiviral nucleoside analogs have been developed to inhibit the enzymatic activities of the hepatitis B virus (HBV) polymerase, thereby preventing the replication and production of HBV. However, the usage of these analogs can be limited by drug toxicity because the 5′-triphosphates of these nucleoside analogs (nucleotide analogs) are potential substrates for human DNA polymerases to incorporate into host DNA. Although they are poor substrates for human replicative DNA polymerases, it remains to be established whether these nucleotide analogs are substrates for the recently discovered human X- and Y-family DNA polymerases. Using pre-steady state kinetic techniques, we have measured the substrate specificity values for human DNA polymerases β, λ, η, ι, κ, and Rev1 incorporating the active forms of the following anti-HBV nucleoside analogs approved for clinical use: adefovir, tenofovir, lamivudine, telbivudine, and entecavir. Compared to the incorporation of a natural nucleotide, most of the nucleotide analogs were incorporated less efficiently (2 to >122,000) by the six human DNA polymerases. In addition, the potential for entecavir and telbivudine, two drugs which possess a 3′-hydroxyl, to become embedded into human DNA was examined by primer extension and DNA ligation assays. These results suggested that telbivudine functions as a chain terminator while entecavir was efficiently extended by the six enzymes and was a substrate for human DNA ligase I. Our findings suggested that incorporation of anti-HBV nucleotide analogs catalyzed by human X- and Y-family polymerases may contribute to clinical toxicity. PMID:22132702

A method for quantitative analysis of standard and high-throughput qPCR expression data based on input sample quantity.

PubMed

Adamski, Mateusz G; Gumann, Patryk; Baird, Alison E

2014-01-01

Over the past decade rapid advances have occurred in the understanding of RNA expression and its regulation. Quantitative polymerase chain reactions (qPCR) have become the gold standard for quantifying gene expression. Microfluidic next generation, high throughput qPCR now permits the detection of transcript copy number in thousands of reactions simultaneously, dramatically increasing the sensitivity over standard qPCR. Here we present a gene expression analysis method applicable to both standard polymerase chain reactions (qPCR) and high throughput qPCR. This technique is adjusted to the input sample quantity (e.g., the number of cells) and is independent of control gene expression. It is efficiency-corrected and with the use of a universal reference sample (commercial complementary DNA (cDNA)) permits the normalization of results between different batches and between different instruments--regardless of potential differences in transcript amplification efficiency. Modifications of the input quantity method include (1) the achievement of absolute quantification and (2) a non-efficiency corrected analysis. When compared to other commonly used algorithms the input quantity method proved to be valid. This method is of particular value for clinical studies of whole blood and circulating leukocytes where cell counts are readily available.

Polymerase chain reaction: A molecular diagnostic tool in periodontology

PubMed Central

Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

2016-01-01

This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

Polymerase chain reaction: A molecular diagnostic tool in periodontology.

PubMed

Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

2016-01-01

This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

Sensitive and specific identification by polymerase chain reaction of Eimeria tenella and Eimeria maxima, important protozoan pathogens in laboratory avian facilities.

PubMed

Lee, Hyun-A; Hong, Sunhwa; Chung, Yungho; Kim, Okjin

2011-09-01

Eimeria tenella and Eimeria maxima are important pathogens causing intracellular protozoa infections in laboratory avian animals and are known to affect experimental results obtained from contaminated animals. This study aimed to find a fast, sensitive, and efficient protocol for the molecular identification of E. tenella and E. maxima in experimental samples using chickens as laboratory avian animals. DNA was extracted from fecal samples collected from chickens and polymerase chain reaction (PCR) analysis was employed to detect E. tenella and E. maxima from the extracted DNA. The target nucleic acid fragments were specifically amplified by PCR. Feces secreting E. tenella and E. maxima were detected by a positive PCR reaction. In this study, we were able to successfully detect E. tenella and E. maxima using the molecular diagnostic method of PCR. As such, we recommended PCR for monitoring E. tenella and E. maxima in laboratory avian facilities.

International ring trial for the validation of an event-specific Golden Rice 2 quantitative real-time polymerase chain reaction method.

PubMed

Jacchia, Sara; Nardini, Elena; Bassani, Niccolò; Savini, Christian; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco

2015-05-27

This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3' junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in haploid genome equivalents. We assessed trueness, precision, efficiency, and linearity of the two assays, and the results demonstrate that both the assays independently assessed and the entire method fulfill European and international requirements for methods for genetically modified organism (GMO) testing, within the dynamic range tested. The homogeneity of the results of the collaborative trial between Europe and Asia is a good indicator of the robustness of the method.

Cellular RNA-dependent RNA polymerase involved in posttranscriptional gene silencing has two distinct activity modes.

PubMed

Makeyev, Eugene V; Bamford, Dennis H

2002-12-01

Recent genetic data suggest that proteins homologous to a plant RNA-dependent RNA polymerase (RdRP) play a central role in posttranscriptional gene silencing (PTGS) in many organisms. We show here that purified recombinant protein QDE-1, a genetic component of PTGS ("quelling") in the fungus Neurospora crassa, possesses RNA polymerase activity in vitro. The full-length enzyme and its enzymatically active C-terminal fragment perform two different reactions on single-stranded RNA templates, synthesizing either extensive RNA chains that form template-length duplexes or approximately 9-21-mer complementary RNA oligonucleotides scattered along the entire template. QDE-1 supports both de novo and primer-dependent initiation mechanisms. These results suggest that several distinct activities of cell-encoded RdRPs can be employed for efficient PTGS in vivo.

Problem-Solving Test: Real-Time Polymerase Chain Reaction

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2009-01-01

Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

Micro-droplet Digital Polymerase Chain Reaction and Real-Time Quantitative Polymerase Chain Reaction Technologies Provide Highly Sensitive and Accurate Detection of Zika Virus.

PubMed

Hui, Yuan; Wu, Zhiming; Qin, Zhiran; Zhu, Li; Liang, Junhe; Li, Xujuan; Fu, Hanmin; Feng, Shiyu; Yu, Jianhai; He, Xiaoen; Lu, Weizhi; Xiao, Weiwei; Wu, Qinghua; Zhang, Bao; Zhao, Wei

2018-06-01

The establishment of highly sensitive diagnostic methods is critical in the early diagnosis and control of Zika virus (ZIKV) and in preventing serious neurological complications of ZIKV infection. In this study, we established micro-droplet digital polymerase chain reaction (ddPCR) and real-time quantitative PCR (RT-qPCR) protocols for the detection of ZIKV based on the amplification of the NS5 gene. For the ZIKV standard plasmid, the RT-qPCR results showed that the cycle threshold (Ct) value was linear from 10 1 to 10 8  copy/μL, with a standard curve R 2 of 0.999 and amplification efficiency of 92.203%; however, a concentration as low as 1 copy/μL could not be detected. In comparison with RT-qPCR, the ddPCR method resulted in a linear range of 10 1 -10 4  copy/μL and was able to detect concentrations as low as 1 copy/μL. Thus, for detecting ZIKV from clinical samples, RT-qPCR is a better choice for high-concentration samples (above 10 1  copy/μL), while ddPCR has excellent accuracy and sensitivity for low-concentration samples. These results indicate that the ddPCR method should be of considerable use in the early diagnosis, laboratory study, and monitoring of ZIKV.

Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

PubMed

Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

2018-06-01

Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

Gene 1.7 of bacteriophage T7 confers sensitivity of phage growth to dideoxythymidine.

PubMed

Tran, Ngoc Q; Rezende, Lisa F; Qimron, Udi; Richardson, Charles C; Tabor, Stanley

2008-07-08

Bacteriophage T7 DNA polymerase efficiently incorporates dideoxynucleotides into DNA, resulting in chain termination. Dideoxythymidine (ddT) present in the medium at levels not toxic to Escherichia coli inhibits phage T7. We isolated 95 T7 phage mutants that were resistant to ddT. All contained a mutation in T7 gene 1.7, a nonessential gene of unknown function. When gene 1.7 was expressed from a plasmid, T7 phage resistant to ddT still arose; analysis of 36 of these mutants revealed that all had a single mutation in gene 5, which encodes T7 DNA polymerase. This mutation changes tyrosine-526 to phenylalanine, which is known to increase dramatically the ability of T7 DNA polymerase to discriminate against dideoxynucleotides. DNA synthesis in cells infected with wild-type T7 phage was inhibited by ddT, suggesting that it resulted in chain termination of DNA synthesis in the presence of gene 1.7 protein. Overexpression of gene 1.7 from a plasmid rendered E. coli cells sensitive to ddT, indicating that no other T7 proteins are required to confer sensitivity to ddT.

Tracking of Indels by DEcomposition is a Simple and Effective Method to Assess Efficiency of Guide RNAs in Zebrafish.

PubMed

Etard, Christelle; Joshi, Swarnima; Stegmaier, Johannes; Mikut, Ralf; Strähle, Uwe

2017-12-01

A bottleneck in CRISPR/Cas9 genome editing is variable efficiencies of in silico-designed gRNAs. We evaluated the sensitivity of the TIDE method (Tracking of Indels by DEcomposition) introduced by Brinkman et al. in 2014 for assessing the cutting efficiencies of gRNAs in zebrafish. We show that this simple method, which involves bulk polymerase chain reaction amplification and Sanger sequencing, is highly effective in tracking well-performing gRNAs in pools of genomic DNA derived from injected embryos. The method is equally effective for tracing INDELs in heterozygotes.

Primer-independent RNA sequencing with bacteriophage phi6 RNA polymerase and chain terminators.

PubMed

Makeyev, E V; Bamford, D H

2001-05-01

Here we propose a new general method for directly determining RNA sequence based on the use of the RNA-dependent RNA polymerase from bacteriophage phi6 and the chain terminators (RdRP sequencing). The following properties of the polymerase render it appropriate for this application: (1) the phi6 polymerase can replicate a number of single-stranded RNA templates in vitro. (2) In contrast to the primer-dependent DNA polymerases utilized in the sequencing procedure by Sanger et al. (Proc Natl Acad Sci USA, 1977, 74:5463-5467), it initiates nascent strand synthesis without a primer, starting the polymerization on the very 3'-terminus of the template. (3) The polymerase can incorporate chain-terminating nucleotide analogs into the nascent RNA chain to produce a set of base-specific termination products. Consequently, 3' proximal or even complete sequence of many target RNA molecules can be rapidly deduced without prior sequence information. The new technique proved useful for sequencing several synthetic ssRNA templates. Furthermore, using genomic segments of the bluetongue virus we show that RdRP sequencing can also be applied to naturally occurring dsRNA templates. This suggests possible uses of the method in the RNA virus research and diagnostics.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

PubMed

Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

2006-07-01

We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

Development of a recombinase polymerase amplification assay for the diagnosis of banana bunchy top virus in different banana cultivars.

PubMed

Kapoor, Reetika; Srivastava, Nishant; Kumar, Shailender; Saritha, R K; Sharma, Susheel Kumar; Jain, Rakesh Kumar; Baranwal, Virendra Kumar

2017-09-01

Recombinase polymerase amplification (RPA) is a rapid, isothermal amplification method with high specificity and sensitivity. In this study, an assay was developed and evaluated for the detection of banana bunchy top virus (BBTV) in infected banana plants. Three oligonucleotide primer pairs were designed from the replicase initiator protein gene sequences of BBTV to function both in RPA as well as in polymerase chain reaction (PCR). A total of 133 symptomatic as well as asymptomatic banana leaf samples from various cultivars were collected from the different regions of India and evaluated for BBTV infection using the RPA assay. BBTV was efficiently detected using crude leaf sap in RPA and the results obtained were consistent with PCR-based detection using purified DNA as template. To our knowledge, this is the first report of reliable diagnosis of BBTV infection by RPA using crude leaf sap as a template.

Polymerase chain reaction system

DOEpatents

Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

2004-03-02

A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

Pooled nucleic acid testing to identify antiretroviral treatment failure during HIV infection.

PubMed

May, Susanne; Gamst, Anthony; Haubrich, Richard; Benson, Constance; Smith, Davey M

2010-02-01

Pooling strategies have been used to reduce the costs of polymerase chain reaction-based screening for acute HIV infection in populations in which the prevalence of acute infection is low (less than 1%). Only limited research has been done for conditions in which the prevalence of screening positivity is higher (greater than 1%). We present data on a variety of pooling strategies that incorporate the use of polymerase chain reaction-based quantitative measures to monitor for virologic failure among HIV-infected patients receiving antiretroviral therapy. For a prevalence of virologic failure between 1% and 25%, we demonstrate relative efficiency and accuracy of various strategies. These results could be used to choose the best strategy based on the requirements of individual laboratory and clinical settings such as required turnaround time of results and availability of resources. Virologic monitoring during antiretroviral therapy is not currently being performed in many resource-constrained settings largely because of costs. The presented pooling strategies may be used to significantly reduce the cost compared with individual testing, make such monitoring feasible, and limit the development and transmission of HIV drug resistance in resource-constrained settings. They may also be used to design efficient pooling strategies for other settings with quantitative screening measures.

Enhancing the specificity of polymerase chain reaction by graphene oxide through surface modification: zwitterionic polymer is superior to other polymers with different charges.

PubMed

Zhong, Yong; Huang, Lihong; Zhang, Zhisen; Xiong, Yunjing; Sun, Liping; Weng, Jian

Graphene oxides (GOs) with different surface characteristics, such as size, reduction degree and charge, are prepared, and their effects on the specificity of polymerase chain reaction (PCR) are investigated. In this study, we demonstrate that GO with a large size and high reduction degree is superior to small and nonreduced GO in enhancing the specificity of PCR. Negatively charged polyacrylic acid (PAA), positively charged polyacrylamide (PAM), neutral polyethylene glycol (PEG) and zwitterionic polymer poly(sulfobetaine) (pSB) are used to modify GO. The PCR specificity-enhancing ability increases in the following order: GO-PAA < GO-PAM < GO-PEG < GO-pSB. Thus, zwitterionic polymer-modified GO is superior to other GO derivatives with different charges in enhancing the specificity of PCR. GO derivatives are also successfully used to enhance the specificity of PCR for the amplification of human mitochondrial DNA using blood genomic DNA as template. Molecular dynamics simulations and molecular docking are performed to elucidate the interaction between the polymers and Pfu DNA polymerase. Our data demonstrate that the size, reduction degree and surface charge of GO affect the specificity of PCR. Based on our results, zwitterionic polymer-modified GO may be used as an efficient additive for enhancing the specificity of PCR.

Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions

PubMed Central

Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

2011-01-01

To clarify the biochemical behavior of 2′-deoxyribonucleoside 5′-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (Co) and adenine N-oxide (Ao), we examined their base recognition ability in DNA duplex formation using melting temperature (Tm) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the Tm values of modified DNA–DNA duplexes incorporating 2′-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo−) and Vent (exo−) suggested that Co and Ao selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo−) toward Ao on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator. PMID:21300642

Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions.

PubMed

Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

2011-04-01

To clarify the biochemical behavior of 2'-deoxyribonucleoside 5'-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (C(o)) and adenine N-oxide (A(o)), we examined their base recognition ability in DNA duplex formation using melting temperature (T(m)) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the T(m) values of modified DNA-DNA duplexes incorporating 2'-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo(-)) and Vent (exo(-)) suggested that C(o) and A(o) selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo(-)) toward A(o) on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator.

DNA Polymerase III Star Requires ATP to Start Synthesis on a Primed DNA†

PubMed Central

Wickner, William; Kornberg, Arthur

1973-01-01

DNA polymerase III star replicates a ϕX174 single-stranded, circular DNA primed with a fragment of RNA. This reaction proceeds in two stages. In stage I, a complex is formed requiring DNA polymerase III star, ATP, spermidine, copolymerase III*, and RNA-primed ϕX174 single-stranded, circular DNA. The complex, isolated by gel filtration, contains ADP and inorganic phosphate (the products of a specific ATP cleavage) as well as spermidine, polymerase III star, and copolymerase III star. In stage II, the chain grows upon addition of deoxynucleoside triphosphates; ADP and inorganic phosphate are discharged and chain elongation is resistant to antibody to copolymerase III star. Thus ATP and copolymerase III star are required to initiate chain growth but not to sustain it. Images PMID:4519657

Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

PubMed

Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

2012-12-01

Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

PubMed

Chen, Y T; Mercer, G O; Chen, Y

1993-11-01

Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

PubMed

Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

2002-07-01

Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.

Enhanced analysis of real-time PCR data by using a variable efficiency model: FPK-PCR

PubMed Central

Lievens, Antoon; Van Aelst, S.; Van den Bulcke, M.; Goetghebeur, E.

2012-01-01

Current methodology in real-time Polymerase chain reaction (PCR) analysis performs well provided PCR efficiency remains constant over reactions. Yet, small changes in efficiency can lead to large quantification errors. Particularly in biological samples, the possible presence of inhibitors forms a challenge. We present a new approach to single reaction efficiency calculation, called Full Process Kinetics-PCR (FPK-PCR). It combines a kinetically more realistic model with flexible adaptation to the full range of data. By reconstructing the entire chain of cycle efficiencies, rather than restricting the focus on a ‘window of application’, one extracts additional information and loses a level of arbitrariness. The maximal efficiency estimates returned by the model are comparable in accuracy and precision to both the golden standard of serial dilution and other single reaction efficiency methods. The cycle-to-cycle changes in efficiency, as described by the FPK-PCR procedure, stay considerably closer to the data than those from other S-shaped models. The assessment of individual cycle efficiencies returns more information than other single efficiency methods. It allows in-depth interpretation of real-time PCR data and reconstruction of the fluorescence data, providing quality control. Finally, by implementing a global efficiency model, reproducibility is improved as the selection of a window of application is avoided. PMID:22102586

DNA polymerase θ (POLQ) can extend from mismatches and from bases opposite a (6–4) photoproduct

PubMed Central

Seki, Mineaki; Wood, Richard D.

2007-01-01

DNA polymerase θ (pol θ) is a nuclear A-family DNA polymerase encoded by the POLQ gene in vertebrate cells. The biochemical properties of pol θ and of Polq-defective mice have suggested that pol θ participates in DNA damage tolerance. For example, pol θ was previously found to be proficient not only in incorporation of a nucleotide opposite a thymine glycol or an abasic site, but also extends a polynucleotide chain efficiently from the base opposite the lesion. We carried out experiments to determine whether this ability to extend from non-standard termini is a more general property of the enzyme. Pol θ extended relatively efficiently from matched termini as well as termini with A:G, A:T, and A:C mismatches, with less descrimination than a well-studied A family DNA polymerase, exonuclease-free pol I from E. coli. Although pol θ was unable to, by itself, bypass a cyclobutane pyrimidine dimer or a (6–4) photoproduct, it could perform some extension from primers with bases placed across from these lesions. When pol θ was combined with DNA polymerase ι , an enzyme that can insert a base opposite a UV-induced (6–4) photoproduct, complete bypass of a (6–4) photoproduct was possible. These data show that in addition to its ability to insert nucleotides opposite some DNA lesions, pol θ is proficient at extension of unpaired termini. These results show the potential of pol θ to act as an extender after incorporation of nucleotides by other DNA polymerases, and aid in understanding the role of pol θ in somatic mutagenesis and genome instability. PMID:17920341

DNA polymerase theta (POLQ) can extend from mismatches and from bases opposite a (6-4) photoproduct.

PubMed

Seki, Mineaki; Wood, Richard D

2008-01-01

DNA polymerase theta (pol theta) is a nuclear A-family DNA polymerase encoded by the POLQ gene in vertebrate cells. The biochemical properties of pol theta and of Polq-defective mice have suggested that pol theta participates in DNA damage tolerance. For example, pol theta was previously found to be proficient not only in incorporation of a nucleotide opposite a thymine glycol or an abasic site, but also extends a polynucleotide chain efficiently from the base opposite the lesion. We carried out experiments to determine whether this ability to extend from non-standard termini is a more general property of the enzyme. Pol theta extended relatively efficiently from matched termini as well as termini with A:G, A:T and A:C mismatches, with less descrimination than a well-studied A-family DNA polymerase, exonuclease-free pol I from E. coli. Although pol theta was unable to, by itself, bypass a cyclobutane pyrimidine dimer or a (6-4) photoproduct, it could perform some extension from primers with bases placed across from these lesions. When pol theta was combined with DNA polymerase iota, an enzyme that can insert a base opposite a UV-induced (6-4) photoproduct, complete bypass of a (6-4) photoproduct was possible. These data show that in addition to its ability to insert nucleotides opposite some DNA lesions, pol theta is proficient at extension of unpaired termini. These results show the potential of pol theta to act as an extender after incorporation of nucleotides by other DNA polymerases, and aid in understanding the role of pol theta in somatic mutagenesis and genome instability.

Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

USDA-ARS?s Scientific Manuscript database

This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

PubMed

Igarashi, T; Yamamoto, A; Goto, N

1996-10-01

Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

EPA Science Inventory

Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

ERIC Educational Resources Information Center

Elkins, Kelly M.

2011-01-01

The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

USDA-ARS?s Scientific Manuscript database

Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

Polymerase chain reaction amplification as a diagnostic tool in culture-negative multiple-valve endocarditis.

PubMed

Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten

2005-03-01

We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.

A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

EPA Science Inventory

A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

EPA Science Inventory

Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

Collaborative ring trial of the papaya endogenous reference gene and its polymerase chain reaction assays for genetically modified organism analysis.

PubMed

Wei, Jiaojun; Li, Feiwu; Guo, Jinchao; Li, Xiang; Xu, Junfeng; Wu, Gang; Zhang, Dabing; Yang, Litao

2013-11-27

The papaya (Carica papaya L.) Chymopapain (CHY) gene has been reported as a suitable endogenous reference gene for genetically modified (GM) papaya detection in previous studies. Herein, we further validated the use of the CHY gene and its qualitative and quantitative polymerase chain reaction (PCR) assays through an interlaboratory collaborative ring trial. A total of 12 laboratories working on detection of genetically modified organisms participated in the ring trial and returned test results. Statistical analysis of the returned results confirmed the species specificity, low heterogeneity, and single-copy number of the CHY gene among different papaya varieties. The limit of detection of the CHY qualitative PCR assay was 0.1%, while the limit of quantification of the quantitative PCR assay was ∼25 copies of haploid papaya genome with acceptable PCR efficiency and linearity. The differences between the tested and true values of papaya content in 10 blind samples ranged from 0.84 to 6.58%. These results indicated that the CHY gene was suitable as an endogenous reference gene for the identification and quantification of GM papaya.

Use of Rapid Diagnostic Tests in Malaria School Surveys in Kenya: Does their Under-performance Matter for Planning Malaria Control?

PubMed Central

Gitonga, Caroline W.; Kihara, Jimmy H.; Njenga, Sammy M.; Awuondo, Ken; Noor, Abdisalan M.; Snow, Robert W.; Brooker, Simon J.

2012-01-01

Malaria rapid diagnostic tests (RDTs) are known to yield false-positive results, and their use in epidemiologic surveys will overestimate infection prevalence and potentially hinder efficient targeting of interventions. To examine the consequences of using RDTs in school surveys, we compared three RDT brands used during a nationwide school survey in Kenya with expert microscopy and investigated the cost implications of using alternative diagnostic approaches in identifying localities with differing levels of infection. Overall, RDT sensitivity was 96.1% and specificity was 70.8%. In terms of classifying districts and schools according to prevalence categories, RDTs were most reliable for the < 1% and > 40% categories and least reliable in the 1–4.9% category. In low-prevalence settings, microscopy was the most expensive approach, and RDT results corrected by either microscopy or polymerase chain reaction were the cheapest. Use of polymerase chain reaction–corrected RDT results is recommended in school malaria surveys, especially in settings with low-to-moderate malaria transmission. PMID:23091194

Quantification of Wilms' tumor 1 mRNA by digital polymerase chain reaction.

PubMed

Koizumi, Yuki; Furuya, Daisuke; Endo, Teruo; Asanuma, Kouichi; Yanagihara, Nozomi; Takahashi, Satoshi

2018-02-01

Wilms' tumor 1 (WT1) is overexpressed in various hematopoietic tumors and widely used as a marker of minimal residual disease. WT1 mRNA has been analyzed using quantitative real-time polymerase chain reaction (real-time PCR). In the present study, we analyzed 40 peripheral blood and bone marrow samples obtained from cases of acute myeloid leukemia, acute lymphoblastic leukemia, and myelodysplastic syndrome at Sapporo Medical University Hospital from April 2012 to January 2015. We performed quantification of WT1 was performed using QuantStudio 3D Digital PCR System (Thermo Fisher Scientific‎) and compared the results between digital PCR and real-time PCR technology. The correlation between digital PCR and real-time PCR was very strong (R = 0.99), and the detection limits of the two methods were equivalent. Digital PCR was able to accurately detect lower WT levels compared with real-time PCR. Digital PCR technology can thus be utilized to predict WT1/ABL1 expression level accurately and should thus be useful for diagnosis or the evaluation of drug efficiency in patients with leukemia.

Simplified transient isotachophoresis/capillary gel electrophoresis method for highly sensitive analysis of polymerase chain reaction samples on a microchip with laser-induced fluorescence detection.

PubMed

Liu, Dayu; Ou, Ziyou; Xu, Mingfei; Wang, Lihui

2008-12-19

We present a sensitive, simple and robust on-chip transient isotachophoresis/capillary gel electrophoresis (tITP/CGE) method for the analysis of polymerase chain reaction (PCR) samples. Using chloride ions in the PCR buffer and N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES) in the background electrolyte, respectively, as the leading and terminating electrolytes, the tITP preconcentration was coupled with CGE separation with double-T shaped channel network. The tITP/CGE separation was carried out with a single running buffer. The separation process involved only two steps that were performed continuously with the sequential switching of four voltage outputs. The tITP/CGE method showed an analysis time and a separation efficiency comparable to those of standard CGE, while the signal intensity was enhanced by factors of over 20. The limit of detection of the chip-based tITP/CGE method was estimated to be 1.1 ng/mL of DNA in 1x PCR buffer using confocal fluorescence detection following 473 nm laser excitation.

Highly parallel single-molecule amplification approach based on agarose droplet polymerase chain reaction for efficient and cost-effective aptamer selection.

PubMed

Zhang, Wei Yun; Zhang, Wenhua; Liu, Zhiyuan; Li, Cong; Zhu, Zhi; Yang, Chaoyong James

2012-01-03

We have developed a novel method for efficiently screening affinity ligands (aptamers) from a complex single-stranded DNA (ssDNA) library by employing single-molecule emulsion polymerase chain reaction (PCR) based on the agarose droplet microfluidic technology. In a typical systematic evolution of ligands by exponential enrichment (SELEX) process, the enriched library is sequenced first, and tens to hundreds of aptamer candidates are analyzed via a bioinformatic approach. Possible candidates are then chemically synthesized, and their binding affinities are measured individually. Such a process is time-consuming, labor-intensive, inefficient, and expensive. To address these problems, we have developed a highly efficient single-molecule approach for aptamer screening using our agarose droplet microfluidic technology. Statistically diluted ssDNA of the pre-enriched library evolved through conventional SELEX against cancer biomarker Shp2 protein was encapsulated into individual uniform agarose droplets for droplet PCR to generate clonal agarose beads. The binding capacity of amplified ssDNA from each clonal bead was then screened via high-throughput fluorescence cytometry. DNA clones with high binding capacity and low K(d) were chosen as the aptamer and can be directly used for downstream biomedical applications. We have identified an ssDNA aptamer that selectively recognizes Shp2 with a K(d) of 24.9 nM. Compared to a conventional sequencing-chemical synthesis-screening work flow, our approach avoids large-scale DNA sequencing and expensive, time-consuming DNA synthesis of large populations of DNA candidates. The agarose droplet microfluidic approach is thus highly efficient and cost-effective for molecular evolution approaches and will find wide application in molecular evolution technologies, including mRNA display, phage display, and so on. © 2011 American Chemical Society

DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

EPA Science Inventory

The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

ERIC Educational Resources Information Center

Phelps, Tara L.; And Others

1996-01-01

Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

Determining Annealing Temperatures for Polymerase Chain Reaction

ERIC Educational Resources Information Center

Porta, Angela R.; Enners, Edward

2012-01-01

The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

USDA-ARS?s Scientific Manuscript database

A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

European guideline for the management of chancroid, 2011.

PubMed

Kemp, M; Christensen, J J; Lautenschlager, S; Vall-Mayans, M; Moi, H

2011-05-01

Chancroid is a sexually acquired disease caused by Haemophilus ducreyi. The infection is characterized by one or more genital ulcers, which are soft and painful, and regional lymphadenitis which may develop into buboes. The infection may easily be misidentified due to its rare occurrence in Europe and difficulties in detecting the causative pathogen. H. ducreyi is difficult to culture. Polymerase chain reaction (PCR) can demonstrate the bacterium in suspected cases. Antibiotics will usually be efficient for curing chancroid.

Variation in Bluetongue virus real-time reverse transcription polymerase chain reaction assay results in blood samples of sheep, cattle, and alpaca.

PubMed

Brito, Barbara P; Gardner, Ian A; Hietala, Sharon K; Crossley, Beate M

2011-07-01

Bluetongue is a vector-borne viral disease that affects domestic and wild ruminants. The epidemiology of this disease has recently changed, with occurrence in new geographic areas. Various real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) assays are used to detect Bluetongue virus (BTV); however, the impact of biologic differences between New World camelids and domestic ruminant samples on PCR efficiency, for which the BTV real-time qRT-PCR was initially validated are unknown. New world camelids are known to have important biologic differences in whole blood composition, including hemoglobin concentration, which can alter PCR performance. In the present study, sheep, cattle, and alpaca blood were spiked with BTV serotypes 10, 11, 13, and 17 and analyzed in 10-fold dilutions by real-time qRT-PCR to determine if species affected nucleic acid recovery and assay performance. A separate experiment was performed using spiked alpaca blood subsequently diluted in 10-fold series in sheep blood to assess the influence of alpaca blood on performance efficiency of the BTV real-time qRT-PCR assay. Results showed that BTV-specific nucleic acid detection from alpaca blood was consistently 1-2 logs lower than from sheep and cattle blood, and results were similar for each of the 4 BTV serotypes analyzed.

Calcium: A novel and efficient inducer of differentiation of adipose-derived stem cells into neuron-like cells.

PubMed

Goudarzi, Farjam; Tayebinia, Heidar; Karimi, Jamshid; Habibitabar, Elahe; Khodadadi, Iraj

2018-06-05

This study comparatively investigated the effectiveness of calcium and other well-known inducers such as isobutylmethylxanthine (IBMX) and insulin in differentiating human adipose-derived stem cells (ADSCs) into neuronal-like cells. ADSCs were immunophenotyped and differentiated into neuron-like cells with different combinations of calcium, IBMX, and insulin. Calcium mobilization across the membrane was determined. Differentiated cells were characterized by cell cycle profiling, staining of Nissl bodies, detecting the gene expression level of markers such as neuronal nuclear antigen (NeuN), microtubule associated protein 2 (MAP2), neuron-specific enolase (NSE), doublecortin, synapsin I, glial fibrillary acidic protein (GFAP), and myelin basic protein (MBP) by quantitative real-time polymerase chain reaction (quantitative real-time polymerase chain reaction (qRT-PCR) and protein level by the immunofluorescence technique. Treatment with Ca + IBMX + Ins induced neuronal appearance and projection of neurite-like processes in the cells, accompanied with inhibition of proliferation and halt in the cell cycle. A significantly higher expression of MBP, GFAP, NeuN, NSE, synapsin 1, doublecortin, and MAP2 was detected in differentiated cells, confirming the advantages of Ca + IBMX + Ins to the other combinations of inducers. Here, we showed an efficient protocol for neuronal differentiation of ADSCs, and calcium fostered differentiation by augmenting the number of neuron-like cells and instantaneous increase in the expression of neuronal markers. © 2018 Wiley Periodicals, Inc.

Development of sandwich-form biosensor to detect Mycobacterium tuberculosis complex in clinical sputum specimens.

PubMed

Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh

2014-01-01

Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

A polymerase chain reaction strategy for the diagnosis of camelpox.

PubMed

Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar

2009-03-01

Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.

Rapid Diagnosis of Infection in the Critically Ill, a Multicenter Study of Molecular Detection in Bloodstream Infections, Pneumonia, and Sterile Site Infections*

PubMed Central

Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn

2015-01-01

Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198

Template-switching during DNA synthesis by Thermus aquaticus DNA polymerase I.

PubMed Central

Odelberg, S J; Weiss, R B; Hata, A; White, R

1995-01-01

Recombinant DNA molecules are often generated during the polymerase chain reaction (PCR) when partially homologous templates are available [e.g., see Pääbo et al. (1990) J. Biol. Chem. 265, 4718-4721]. It has been suggested that these recombinant molecules are a consequence of truncated extension products annealing to partially homologous templates on subsequent PCR cycles. However, we demonstrate here that recombinants can be generated during a single round of primer extension in the absence of subsequent heat denaturation, indicating that template-switching produces some of these recombinant molecules. Two types of template-switches were observed: (i) switches to pre-existing templates and (ii) switches to the complementary nascent strand. Recombination is reduced several fold when the complementary template strands are physically separated by attachment to streptavidin magnetic beads. This result supports the hypothesis that either the polymerase or at least one of the two extending strands switches templates during DNA synthesis and that interaction between the complementary template strands is necessary for efficient template-switching. Images PMID:7596836

Application of Reverse Transcriptase -PCR (RT-PCR) for rapid detection of viable Escherichia coli in drinking water samples.

PubMed

Molaee, Neda; Abtahi, Hamid; Ghannadzadeh, Mohammad Javad; Karimi, Masoude; Ghaznavi-Rad, Ehsanollah

2015-01-01

Polymerase chain reaction (PCR) is preferred to other methods for detecting Escherichia coli (E. coli) in water in terms of speed, accuracy and efficiency. False positive result is considered as the major disadvantages of PCR. For this reason, reverse transcriptase-polymerase chain reaction (RT-PCR) can be used to solve this problem. The aim of present study was to determine the efficiency of RT-PCR for rapid detection of viable Escherichia coli in drinking water samples and enhance its sensitivity through application of different filter membranes. Specific primers were designed for 16S rRNA and elongation Factor II genes. Different concentrations of bacteria were passed through FHLP and HAWP filters. Then, RT-PCR was performed using 16srRNA and EF -Tu primers. Contamination of 10 wells was determined by RT-PCR in Arak city. To evaluate RT-PCR efficiency, the results were compared with most probable number (MPN) method. RT-PCR is able to detect bacteria in different concentrations. Application of EF II primers reduced false positive results compared to 16S rRNA primers. The FHLP hydrophobic filters have higher ability to absorb bacteria compared with HAWB hydrophilic filters. So the use of hydrophobic filters will increase the sensitivity of RT-PCR. RT-PCR shows a higher sensitivity compared to conventional water contamination detection method. Unlike PCR, RT-PCR does not lead to false positive results. The use of EF-Tu primers can reduce the incidence of false positive results. Furthermore, hydrophobic filters have a higher ability to absorb bacteria compared to hydrophilic filters.

Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

PubMed

Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

2017-09-01

The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species. Nevertheless, to accurately differentiate among the taxonomically related species, PCR-RFLP should be implemented.

Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

Identification of Brucella spp. by using the polymerase chain reaction.

PubMed Central

Herman, L; De Ridder, H

1992-01-01

The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

Detection of Listeria monocytogenes by using the polymerase chain reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bessesen, M.T.; Luo, Q.; Blaser, M.J.

1990-09-01

A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

PubMed

Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

2012-07-09

Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

9 CFR 145.33 - Terminology and classification; flocks and products.

Code of Federal Regulations, 2010 CFR

2010-01-01

.... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...

Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

PubMed

Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

2016-08-01

On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

PubMed

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

DATA COLLECTION CONSTRAINTS FOR THE USE OF LENGTH HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION

EPA Science Inventory

This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...

Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

ERIC Educational Resources Information Center

Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

2006-01-01

We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

PubMed

Adewale, B; Mafe, M A; Oyerinde, J P O

2005-01-01

Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

PubMed

Ragheb, Suzan Mohammed; Jimenez, Luis

Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

[The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

PubMed

Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

2014-04-01

The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears

PubMed Central

Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

2016-01-01

This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834

Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

Treesearch

David E. Schreiber; Karen J. Garner; James M. Slavicek

1997-01-01

Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

Diagnostic application of polymerase chain reaction for detection of Ehrlichia risticii in equine monocytic ehrlichiosis (Potomac horse fever).

PubMed

Biswas, B; Mukherjee, D; Mattingly-Napier, B L; Dutta, S K

1991-10-01

Genomic amplification by the polymerase chain reaction (PCR) was used to identify a unique genomic sequence of Ehrlichia risticii directly in DNA isolated from peripheral-blood buffy coat cells of E. risticii-infected horses (Potomac horse fever) and from infected cell cultures. A specific primer pair, selected from a cloned, species-specific, 1-kb DNA fragment of the E. risticii genome as a template, was used for the amplification of the target DNA of 247 bp. The optimal number of 40 PCR cycles, determined by analyzing an amplification profile obtained with a constant Taq polymerase concentration, was used to achieve maximum amplification of the E. risticii DNA segment. Efficient amplification of target DNA was achieved with specimens processed by either the phenol extraction or rapid lysis method. The specificity of the amplified DNA product was confirmed by the proper size (247 bp) and appropriate restriction enzyme cleavage pattern of the amplified target DNA, as well as by the specific hybridization signal obtained by using a PCR-amplified 185-bp internal DNA probe. A 10(5)- to 10(6)-fold amplification of target DNA, which allowed detection of E. risticii from as few as two to three infected cells in culture and from a very small volume of buffy coat cells from infected horses, was achieved. This PCR amplification procedure was found to be highly specific and sensitive for the detection of E. risticii for the study of Potomac horse fever.

Quercetin improves postpartum hypogalactia in milk-deficient mice via stimulating prolactin production in pituitary gland.

PubMed

Lin, Man; Wang, Na; Yao, Bei; Zhong, Yao; Lin, Yan; You, Tianhui

2018-04-19

Postpartum dysgalactia is a common clinical problem for lactating women. Seeking out the safe and efficient phytoestrogens will be a promising strategy for postpartum dysgalactia therapy. In this study, the postpartum mice within four groups, including control group, the model group, and the treatment groups intragastrically administrated with normal saline, bromocriptine, bromocriptine plus 17α-ethinyl estradiol, and bromocriptine plus quercetin, respectively, were used. The results showed that quercetin, a kind of natural phytoestrogen, could efficiently promote lactation yield and mammary gland development in the agalactosis mice produced by bromocriptine administration. Mechanically, quercetin, such as 17α-ethinyl estradiol, significantly stimulated prolactin (PRL) production and deposition in the mammary gland in the agalactosis mice determined by western blotting, quantitative polymerase chain reaction, and enzyme-linked immunosorbent assay, respectively. Furthermore, quercetin could increase the expression of β-casein, stearoyl-CoA desaturase, fatty acid synthase, and α-lactalbumin in the breast tissues that are responsible for the production of fatty acid, lactose, and galactose in the milk at the transcriptional level determined by quantitative polymerase chain reaction. Specifically, quercetin promoted primary mammary epithelial cell proliferation and stimulated prolactin receptor (PRLR) expression probably via AKT activation in vitro. In conclusion, this study indicates that estrogen-like quercetin promotes mammary gland development and lactation yield in milk-deficient mice, probably via stimulating PRL expression and release from the pituitary gland, as well as induces PRLR expression in primary mammary epithelial cells. Copyright © 2018 John Wiley & Sons, Ltd.

Carbon nanotube-based substrates promote cardiogenesis in brown adipose-derived stem cells via β1-integrin-dependent TGF-β1 signaling pathway

PubMed Central

Sun, Hongyu; Mou, Yongchao; Li, Yi; Li, Xia; Chen, Zi; Duval, Kayla; Huang, Zhu; Dai, Ruiwu; Tang, Lijun; Tian, Fuzhou

2016-01-01

Stem cell-based therapy remains one of the promising approaches for cardiac repair and regeneration. However, its applications are restricted by the limited efficacy of cardiac differentiation. To address this issue, we examined whether carbon nanotubes (CNTs) would provide an instructive extracellular microenvironment to facilitate cardiogenesis in brown adipose-derived stem cells (BASCs) and to elucidate the underlying signaling pathways. In this study, we systematically investigated a series of cellular responses of BASCs due to the incorporation of CNTs into collagen (CNT-Col) substrates that promoted cell adhesion, spreading, and growth. Moreover, we found that CNT-Col substrates remarkably improved the efficiency of BASCs cardiogenesis by using fluorescence staining and quantitative real-time reverse transcription-polymerase chain reaction. Critically, CNTs in the substrates accelerated the maturation of BASCs-derived cardiomyocytes. Furthermore, the underlying mechanism for promotion of BASCs cardiac differentiation by CNTs was determined by immunostaining, quantitative real-time reverse transcription-polymerase chain reaction, and Western blotting assay. It is notable that β1-integrin-dependent TGF-β1 signaling pathway modulates the facilitative effect of CNTs in cardiac differentiation of BASCs. Therefore, it is an efficient approach to regulate cardiac differentiation of BASCs by the incorporation of CNTs into the native matrix. Importantly, our findings can not only facilitate the mechanistic understanding of molecular events initiating cardiac differentiation in stem cells, but also offer a potentially safer source for cardiac regenerative medicine. PMID:27660434

Development of a peptide nucleic acid polymerase chain reaction clamping assay for semiquantitative evaluation of genetically modified organism content in food.

PubMed

Peano, C; Lesignoli, F; Gulli, M; Corradini, R; Samson, M C; Marchelli, R; Marmiroli, N

2005-09-15

In the present study a peptide nucleic acid (PNA)-mediated polymerase chain reaction (PCR) clamping method was developed and applied to the detection of genetically modified organisms (GMO), to test PCR products for band identity and to obtain a semiquantitative evaluation of GMO content. The minimal concentration of PNA necessary to block the PCR was determined by comparing PCRs containing a constant amount of DNA in the presence of increasing concentration of target-specific PNA. The lowest PNA concentration at which specific inhibition took place, by the inhibition of primer extension and/or steric hindrance, was the most efficient condition. Optimization of PCR clamping by PNA was observed by testing five different PNAs with a minimum of 13 bp to a maximum of 15 bp, designed on the target sequence of Roundup Ready soybean. The results obtained on the DNA extracted from Roundup Ready soybean standard flour were verified also on DNA extracted from standard flours of maize GA21, Bt176, Bt11, and MON810. A correlation between the PNA concentration necessary for inducing PCR clamping and the percentage of the GMO target sequence in the sample was found.

Detection of Mycobacterium avium subsp. paratuberculosis in bovine manure using Whatman FTA card technology and Lightcycler real-time PCR.

PubMed

Jaravata, Carmela V; Smith, Wayne L; Rensen, Gabriel J; Ruzante, Juliana M; Cullor, James S

2006-01-01

A modified forensic DNA extraction and real-time fluorescent polymerase chain reaction assay has been evaluated for the detection of Mycobacterium avium subsp. paratuberculosis (MAP) in bovine fecal samples using primers and fluorescent resonance energy transfer (FRET) probes targeting the IS900 gene sequence of MAP. DNA was successfully extracted from manure samples by utilizing the Whatman FTA card technology, which allows for simple processing and storage of samples at room temperature. The FTA cards were washed and subjected to a Chelex-100 incubation to remove any remaining polymerase chain reaction (PCR) inhibitors and to elute the DNA from the FTA card. This isolated DNA was then subjected to direct real time fluorescent PCR analysis. Detection of MAP DNA from bovine fecal samples spiked with known concentrations of viable MAP cells was obtained. The detection limits of the assay was consistently found to be between 10(2) and 10(4) colony forming units [CFU]/g, with some samples containing as low as 10 CFU/g, yielding positive assay results. This cost-efficient assay allows reporting of results as early as 4 h after fecal collection, which can be particularly useful in highthroughput herd screening.

A primer on on-demand polymerase chain reaction technology.

PubMed

Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

2015-10-01

Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

Quantitative analysis of pork and chicken products by droplet digital PCR.

PubMed

Cai, Yicun; Li, Xiang; Lv, Rong; Yang, Jielin; Li, Jian; He, Yuping; Pan, Liangwen

2014-01-01

In this project, a highly precise quantitative method based on the digital polymerase chain reaction (dPCR) technique was developed to determine the weight of pork and chicken in meat products. Real-time quantitative polymerase chain reaction (qPCR) is currently used for quantitative molecular analysis of the presence of species-specific DNAs in meat products. However, it is limited in amplification efficiency and relies on standard curves based Ct values, detecting and quantifying low copy number target DNA, as in some complex mixture meat products. By using the dPCR method, we find the relationships between the raw meat weight and DNA weight and between the DNA weight and DNA copy number were both close to linear. This enabled us to establish formulae to calculate the raw meat weight based on the DNA copy number. The accuracy and applicability of this method were tested and verified using samples of pork and chicken powder mixed in known proportions. Quantitative analysis indicated that dPCR is highly precise in quantifying pork and chicken in meat products and therefore has the potential to be used in routine analysis by government regulators and quality control departments of commercial food and feed enterprises.

Agrobacterium-mediated genetic transformation of yam (Dioscorea rotundata): an important tool for functional study of genes and crop improvement

PubMed Central

Nyaboga, Evans; Tripathi, Jaindra N.; Manoharan, Rajesh; Tripathi, Leena

2014-01-01

Although genetic transformation of clonally propagated crops has been widely studied as a tool for crop improvement and as a vital part of the development of functional genomics resources, there has been no report of any existing Agrobacterium-mediated transformation of yam (Dioscorea spp.) with evidence of stable integration of T-DNA. Yam is an important crop in the tropics and subtropics providing food security and income to over 300 million people. However, yam production remains constrained by increasing levels of field and storage pests and diseases. A major constraint to the development of biotechnological approaches for yam improvement has been the lack of an efficient and robust transformation and regeneration system. In this study, we developed an Agrobacterium-mediated transformation of Dioscorea rotundata using axillary buds as explants. Two cultivars of D. rotundata were transformed using Agrobacterium tumefaciens harboring the binary vectors containing selectable marker and reporter genes. After selection with appropriate concentrations of antibiotic, shoots were developed on shoot induction and elongation medium. The elongated antibiotic-resistant shoots were subsequently rooted on medium supplemented with selection agent. Successful transformation was confirmed by polymerase chain reaction, Southern blot analysis, and reporter genes assay. Expression of gusA gene in transgenic plants was also verified by reverse transcription polymerase chain reaction analysis. Transformation efficiency varied from 9.4 to 18.2% depending on the cultivars, selectable marker genes, and the Agrobacterium strain used for transformation. It took 3–4 months from Agro-infection to regeneration of complete transgenic plant. Here we report an efficient, fast and reproducible protocol for Agrobacterium-mediated transformation of D. rotundata using axillary buds as explants, which provides a useful platform for future genetic engineering studies in this economically important crop. PMID:25309562

Evaluation of the LTQ-Orbitrap mass spectrometer for the analysis of polymerase chain reaction products.

PubMed

Manduzio, Hélène; Ezan, Eric; Fenaille, François

2010-12-30

We have investigated the potential and robustness of the off-line coupling of polymerase chain reaction (PCR) with electrospray ionization mass spectrometry (ESI-MS), for further applications in the screening of single-nucleotide polymorphisms (SNPs). This was based on recently reported data demonstrating that anion-exchange solid-phase extraction was the most efficient technique for efficiently desalting PCR products, with a recovery of ∼70%. Results showed that this purification approach efficiently removes almost all the chemicals commonly added to PCR buffers. ESI-MS analysis of a model 114-bp PCR product performed on the LTQ-Orbitrap instrument demonstrated that detection limits in the nM range along with an average mass measurement uncertainty of 9.15 ± 7.11 ppm can be routinely obtained using an external calibration. The PCR/ESI-MS platform was able to detect just a few copies of a targeted oligonucleotide. However, it was shown that if two PCR products are present in a mixture in a ratio higher than 10 to 1, the lower abundance one might not be reproducibly detected. Applications to SNPs demonstrated that an LTQ-Orbitrap with a resolution of 30 000 (at m/z 400) easily identified a single (A ↔ G) switch, i.e. a 16 Da difference, in binary mixtures of ∼ 35 kDa PCR products. Complementary experiments also showed that the combination of endonucleases and ESI-MS could be used to confirm base composition and sequence, and thus to screen for unknown polymorphisms in specific sequences. For example, a single (T ↔ A) switch (9 Da mass difference) was successfully identified in a 114-bp PCR product. Copyright © 2010 John Wiley & Sons, Ltd.

Determination of real-time polymerase chain reaction uncertainty of measurement using replicate analysis and a graphical user interface with Fieller’s theorem

PubMed Central

Stuart, James Ian; Delport, Johan; Lannigan, Robert; Zahariadis, George

2014-01-01

BACKGROUND: Disease monitoring of viruses using real-time polymerase chain reaction (PCR) requires knowledge of the precision of the test to determine what constitutes a significant change. Calculation of quantitative PCR confidence limits requires bivariate statistical methods. OBJECTIVE: To develop a simple-to-use graphical user interface to determine the uncertainty of measurement (UOM) of BK virus, cytomegalovirus (CMV) and Epstein-Barr virus (EBV) real-time PCR assays. METHODS: Thirty positive clinical samples for each of the three viral assays were repeated once. A graphical user interface was developed using a spreadsheet (Excel, Microsoft Corporation, USA) to enable data entry and calculation of the UOM (according to Fieller’s theorem) and PCR efficiency. RESULTS: The confidence limits for the BK virus, CMV and EBV tests were ∼0.5 log, 0.5 log to 1.0 log, and 0.5 log to 1.0 log, respectively. The efficiencies of these assays, in the same order were 105%, 119% and 90%. The confidence limits remained stable over the linear range of all three tests. DISCUSSION: A >5 fold (0.7 log) and a >3-fold (0.5 log) change in viral load were significant for CMV and EBV when the results were ≤1000 copies/mL and >1000 copies/mL, respectively. A >3-fold (0.5 log) change in viral load was significant for BK virus over its entire linear range. PCR efficiency was ideal for BK virus and EBV but not CMV. Standardized international reference materials and shared reporting of UOM among laboratories are required for the development of treatment guidelines for BK virus, CMV and EBV in the context of changes in viral load. PMID:25285125

Determination of real-time polymerase chain reaction uncertainty of measurement using replicate analysis and a graphical user interface with Fieller's theorem.

PubMed

Stuart, James Ian; Delport, Johan; Lannigan, Robert; Zahariadis, George

2014-07-01

Disease monitoring of viruses using real-time polymerase chain reaction (PCR) requires knowledge of the precision of the test to determine what constitutes a significant change. Calculation of quantitative PCR confidence limits requires bivariate statistical methods. To develop a simple-to-use graphical user interface to determine the uncertainty of measurement (UOM) of BK virus, cytomegalovirus (CMV) and Epstein-Barr virus (EBV) real-time PCR assays. Thirty positive clinical samples for each of the three viral assays were repeated once. A graphical user interface was developed using a spreadsheet (Excel, Microsoft Corporation, USA) to enable data entry and calculation of the UOM (according to Fieller's theorem) and PCR efficiency. The confidence limits for the BK virus, CMV and EBV tests were ∼0.5 log, 0.5 log to 1.0 log, and 0.5 log to 1.0 log, respectively. The efficiencies of these assays, in the same order were 105%, 119% and 90%. The confidence limits remained stable over the linear range of all three tests. A >5 fold (0.7 log) and a >3-fold (0.5 log) change in viral load were significant for CMV and EBV when the results were ≤1000 copies/mL and >1000 copies/mL, respectively. A >3-fold (0.5 log) change in viral load was significant for BK virus over its entire linear range. PCR efficiency was ideal for BK virus and EBV but not CMV. Standardized international reference materials and shared reporting of UOM among laboratories are required for the development of treatment guidelines for BK virus, CMV and EBV in the context of changes in viral load.

Molecular Basis for the Selective Inhibition of Respiratory Syncytial Virus RNA Polymerase by 2'-Fluoro-4'-Chloromethyl-Cytidine Triphosphate

PubMed Central

Deval, Jerome; Hong, Jin; Wang, Guangyi; Taylor, Josh; Smith, Lucas K.; Fung, Amy; Stevens, Sarah K.; Liu, Hong; Jin, Zhinan; Dyatkina, Natalia; Prhavc, Marija; Stoycheva, Antitsa D.; Serebryany, Vladimir; Liu, Jyanwei; Smith, David B.; Tam, Yuen; Zhang, Qingling; Moore, Martin L.; Fearns, Rachel; Chanda, Sushmita M.; Blatt, Lawrence M.; Symons, Julian A.; Beigelman, Leo

2015-01-01

Respiratory syncytial virus (RSV) causes severe lower respiratory tract infections, yet no vaccines or effective therapeutics are available. ALS-8176 is a first-in-class nucleoside analog prodrug effective in RSV-infected adult volunteers, and currently under evaluation in hospitalized infants. Here, we report the mechanism of inhibition and selectivity of ALS-8176 and its parent ALS-8112. ALS-8176 inhibited RSV replication in non-human primates, while ALS-8112 inhibited all strains of RSV in vitro and was specific for paramyxoviruses and rhabdoviruses. The antiviral effect of ALS-8112 was mediated by the intracellular formation of its 5'-triphosphate metabolite (ALS-8112-TP) inhibiting the viral RNA polymerase. ALS-8112 selected for resistance-associated mutations within the region of the L gene of RSV encoding the RNA polymerase. In biochemical assays, ALS-8112-TP was efficiently recognized by the recombinant RSV polymerase complex, causing chain termination of RNA synthesis. ALS-8112-TP did not inhibit polymerases from host or viruses unrelated to RSV such as hepatitis C virus (HCV), whereas structurally related molecules displayed dual RSV/HCV inhibition. The combination of molecular modeling and enzymatic analysis showed that both the 2'F and the 4'ClCH2 groups contributed to the selectivity of ALS-8112-TP. The lack of antiviral effect of ALS-8112-TP against HCV polymerase was caused by Asn291 that is well-conserved within positive-strand RNA viruses. This represents the first comparative study employing recombinant RSV and HCV polymerases to define the selectivity of clinically relevant nucleotide analogs. Understanding nucleotide selectivity towards distant viral RNA polymerases could not only be used to repurpose existing drugs against new viral infections, but also to design novel molecules. PMID:26098424

Ribonucleotide incorporation by human DNA polymerase η impacts translesion synthesis and RNase H2 activity

PubMed Central

Mentegari, Elisa; Crespan, Emmanuele; Bavagnoli, Laura; Kissova, Miroslava; Bertoletti, Federica; Sabbioneda, Simone; Imhof, Ralph; Sturla, Shana J.; Nilforoushan, Arman; Hübscher, Ulrich; van Loon, Barbara

2017-01-01

Abstract Ribonucleotides (rNs) incorporated in the genome by DNA polymerases (Pols) are removed by RNase H2. Cytidine and guanosine preferentially accumulate over the other rNs. Here we show that human Pol η can incorporate cytidine monophosphate (rCMP) opposite guanine, 8-oxo-7,8-dihydroguanine, 8-methyl-2΄-deoxyguanosine and a cisplatin intrastrand guanine crosslink (cis-PtGG), while it cannot bypass a 3-methylcytidine or an abasic site with rNs as substrates. Pol η is also capable of synthesizing polyribonucleotide chains, and its activity is enhanced by its auxiliary factor DNA Pol δ interacting protein 2 (PolDIP2). Human RNase H2 removes cytidine and guanosine less efficiently than the other rNs and incorporation of rCMP opposite DNA lesions further reduces the efficiency of RNase H2. Experiments with XP-V cell extracts indicate Pol η as the major basis of rCMP incorporation opposite cis-PtGG. These results suggest that translesion synthesis by Pol η can contribute to the accumulation of rCMP in the genome, particularly opposite modified guanines. PMID:27994034

An Enhanced Polymerase Chain Reaction Assay to Detect Pre- and Full Mutation Alleles of the Fragile X Mental Retardation 1 Gene

PubMed Central

Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo

2005-01-01

Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159

Blood grouping based on PCR methods and agarose gel electrophoresis.

PubMed

Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

2015-01-01

The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

PubMed

Kalendar, Ruslan; Lee, David; Schulman, Alan H

2011-08-01

The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

Exploring the limits of ultrafast polymerase chain reaction using liquid for thermal heat exchange: A proof of principle

NASA Astrophysics Data System (ADS)

Maltezos, George; Johnston, Matthew; Taganov, Konstantin; Srichantaratsamee, Chutatip; Gorman, John; Baltimore, David; Chantratita, Wasun; Scherer, Axel

2010-12-01

Thermal ramp rate is a major limiting factor in using real-time polymerase chain reaction (PCR) for routine diagnostics. We explored the limits of speed by using liquid for thermal exchange rather than metal as in traditional devices, and by testing different polymerases. In a clinical setting, our system equaled or surpassed state-of-the-art devices for accuracy in amplifying DNA/RNA of avian influenza, cytomegalovirus, and human immunodeficiency virus. Using Thermococcus kodakaraensis polymerase and optimizing both electrical and chemical systems, we obtained an accurate, 35 cycle amplification of an 85-base pair fragment of E. coli O157:H7 Shiga toxin gene in as little as 94.1 s, a significant improvement over a typical 1 h PCR amplification.

[Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

PubMed

Wang, F; Zhang, Y Q; Ding, J; Yu, L X

2017-10-18

To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

EPA Science Inventory

The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

USDA-ARS?s Scientific Manuscript database

This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

A novel gammaherpesvirus in a large flying fox (Pteropus vampyrus) with blepharitis.

PubMed

Paige Brock, A; Cortés-Hinojosa, Galaxia; Plummer, Caryn E; Conway, Julia A; Roff, Shannon R; Childress, April L; Wellehan, James F X

2013-05-01

A novel gammaherpesvirus was identified in a large flying fox (Pteropus vampyrus) with conjunctivitis, blepharitis, and meibomianitis by nested polymerase chain reaction and sequencing. Polymerase chain reaction amplification and sequencing of 472 base pairs of the DNA-dependent DNA polymerase gene were used to identify a novel herpesvirus. Bayesian and maximum likelihood phylogenetic analyses indicated that the virus is a member of the genus Percavirus in the subfamily Gammaherpesvirinae. Additional research is needed regarding the association of this virus with conjunctivitis and other ocular pathology. This virus may be useful as a biomarker of stress and may be a useful model of virus recrudescence in Pteropus spp.

Impact of toxigenic Clostridium difficile polymerase chain reaction testing on the clinical microbiology laboratory and inpatient epidemiology.

PubMed

Napierala, Maureen; Munson, Erik; Skonieczny, Patrice; Rodriguez, Sonia; Riederer, Nancy; Land, Gayle; Luzinski, Mary; Block, Denise; Hryciuk, Jeanne E

2013-08-01

Conversion from Clostridium difficile toxin A/B EIA to tcdB polymerase chain reaction for diagnosis of C. difficile infection (CDI) resulted in significant decreases in laboratory testing volume and largely unchanged C. difficile toxin detection rates. Decreases in healthcare-associated CDI rates (P ≤ 0.05) reflected a clinical practice benefit of this conversion. Copyright © 2013 Elsevier Inc. All rights reserved.

Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

PubMed

Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

2014-03-01

The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

Preemptive Isolation Precautions of Patients at High Risk for Methicillin-Resistant Staphylococcus aureus in Combination With Ultrarapid Polymerase Chain Reaction Screening as an Effective Tool for Infection Control.

PubMed

Hallak, Ghias; Neuner, Bruno; Schefold, Joerg C; Gorzelniak, Kerstin; Rapsch, Brigitte; Pfüller, Roland; Stengel, Dirk; Wellmann, Jürgen; Ekkernkamp, Axel; Walter, Michael

2016-12-01

This sequential nonrandomized intervention study investigated the role of preemptive isolation precautions plus ultrarapid polymerase chain reaction screening for methicillin-resistant Staphylococcus aureus (MRSA). Compared with no prophylactic isolation plus conventional microbiology MRSA screening, nosocomial MRSA colonization and total MRSA incidence per 10,000 patient days significantly decreased. Infect Control Hosp Epidemiol 2016;1489-1491.

Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

PubMed Central

Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

2006-01-01

Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978

Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

PubMed

Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

2016-01-01

This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. © The American Society of Tropical Medicine and Hygiene.

Clinical Characteristics and Outcomes of Hematologic Malignancy Patients With Positive Clostridium difficile Toxin Immunoassay Versus Polymerase Chain Reaction Test Results.

PubMed

Ziegler, Matthew; Landsburg, Daniel; Pegues, David; Alby, Kevin; Gilmar, Cheryl; Bink, Kristen; Gorman, Theresa; Moore, Amy; Bonhomme, Brittaney; Omorogbe, Jacqueline; Tango, Dana; Tolomeo, Pam; Han, Jennifer H

2018-04-25

In a cohort of inpatients with hematologic malignancy and positive enzyme immunoassay (EIA) or polymerase chain reaction (PCR) Clostridium difficile tests, we found that clinical characteristics and outcomes were similar between these groups. The method of testing is unlikely to predict infection in this population, and PCR-positive results should be treated with concern.Infect Control Hosp Epidemiol 2018;1-4.

Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

PubMed

Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

1997-09-01

In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

Detection of putative oral pathogens in acute periradicular abscesses by 16S rDNA-directed polymerase chain reaction.

PubMed

Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R

2001-03-01

A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.

Highly specific and efficient primers for in-house multiplex PCR detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum

PubMed Central

2014-01-01

Background Although sophisticated methodologies are available, the use of endpoint polymerase chain reaction (PCR) to detect 16S rDNA genes remains a good approach for estimating the incidence and prevalence of specific infections and for monitoring infections. Considering the importance of the early diagnosis of sexually transmitted infections (STIs), the development of a sensitive and affordable method for identifying pathogens in clinical samples is needed. Highly specific and efficient primers for a multiplex polymerase chain reaction (m-PCR) system were designed in silico to detect the 16S rDNA genes of four bacteria that cause genital infections, and the PCR method was developed. Methods The Genosensor Probe Designer (GPD) (version 1.0a) software was initially used to design highly specific and efficient primers for in-house m-PCR. Single-locus PCR reactions were performed and standardised, and then primers for each locus in turn were added individually in subsequent amplifications until m-PCR was achieved. Amplicons of the expected size were obtained from each of the four bacterial gene fragments. Finally, the analytical specificity and limits of detection were tested. Results Because they did not amplify any product from non-STI tested species, the primers were specific. The detection limits for the Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum primer sets were 5.12 × 105, 3.9 × 103, 61.19 × 106 and 6.37 × 105 copies of a DNA template, respectively. Conclusions The methodology designed and standardised here could be applied satisfactorily for the simultaneous or individual detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum. This method is at least as efficient as other previously described methods; however, this method is more affordable for low-income countries. PMID:24997675

Efficient enzymatic synthesis and dual-colour fluorescent labelling of DNA probes using long chain azido-dUTP and BCN dyes

PubMed Central

Ren, Xiaomei; El-Sagheer, Afaf H.; Brown, Tom

2016-01-01

A sterically undemanding azide analogue of dTTP (AHP dUTP) with an alkyl chain and ethynyl attachment to the nucleobase was designed and incorporated into DNA by primer extension, reverse transcription and polymerase chain reaction (PCR). An azide-modified 523 bp PCR amplicon with all 335 thymidines replaced by AHP dU was shown to be a perfect copy of the template from which it was amplified. Replacement of thymidine with AHP dU increases duplex stability, accounting in part for the high incorporation efficiency of the azide-modified triphosphate. Single-stranded azide-labelled DNA was conveniently prepared from PCR products by λ-exonuclease digestion and streptavidin magnetic bead isolation. Efficient fluorescent labelling of single and double-stranded DNA was carried out using dyes functionalized with bicyclo[6.1.0]non-4-yne (BCN) via the strain-promoted alkyne-azide cycloaddition (SPAAC) reaction. This revealed that the degree of labelling must be carefully controlled to achieve optimum fluorescence and avoid fluorescence quenching. Dual-coloured probes were obtained in a single tube fluorescent labelling reaction; and varying the ratios of the two dyes provides a simple method to prepare DNA probes with unique fluorescent signatures. AHP dUTP is a versatile clickable nucleotide with potentially wide applications in biology and nanotechnology including single molecule studies and synthesis of modified aptamer libraries via SELEX. PMID:26819406

Inhibition of herpes simplex virus DNA polymerase by purine ribonucleoside monophosphates.

PubMed

Frank, K B; Cheng, Y C

1986-02-05

Purine ribonucleoside monophosphates were found to inhibit chain elongation catalyzed by herpes simplex virus (HSV) DNA polymerase when DNA template-primer concentrations were rate-limiting. Inhibition was fully competitive with DNA template-primer during chain elongation; however, DNA polymerase-associated exonuclease activity was inhibited noncompetitively with respect to DNA. Combinations of 5'-GMP and phosphonoformate were kinetically mutually exclusive in dual inhibitor studies. Pyrimidine nucleoside monophosphates and deoxynucleoside monophosphates were less inhibitory than purine riboside monophosphates. The monophosphates of 9-beta-D-arabinofuranosyladenine, Virazole (1-beta-D-ribofuranosyl-1,2,4-triazole-3-carboxamide), 9-(2-hydroxyethoxymethyl)guanine, and 9-(1,3-dihydroxy-2-propoxymethyl)guanine exerted little or no inhibition. In contrast to HSV DNA polymerase, human DNA polymerase alpha was not inhibited by purine ribonucleoside monophosphates. These studies suggest the possibility of a physiological role of purine ribonucleoside monophosphates as regulators of herpesvirus DNA synthesis and a new approach to developing selective anti-herpesvirus compounds.

A novel mechanism of sugar selection utilized by a human X-family DNA polymerase.

PubMed

Brown, Jessica A; Fiala, Kevin A; Fowler, Jason D; Sherrer, Shanen M; Newmister, Sean A; Duym, Wade W; Suo, Zucai

2010-01-15

During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2'-hydroxyl group and the bulky side chain of an active-site residue. In this study, we demonstrated that human DNA polymerase lambda used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2'-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such steric clash was further demonstrated to be dependent on the size and orientation of the substituent covalently attached at the ribonucleotide C2'-position. Copyright 2009 Elsevier Ltd. All rights reserved.

Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples.

PubMed

McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y

2014-04-01

A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.

Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples

PubMed Central

McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.

2014-01-01

A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178

Lymphogranuloma venereum variant L2b-specific polymerase chain reaction: insertion used to close an epidemiological gap.

PubMed

Verweij, S P; Catsburg, A; Ouburg, S; Lombardi, A; Heijmans, R; Dutly, F; Frei, R; Morré, S A; Goldenberger, D

2011-11-01

The management of the ongoing lymphogranuloma venereum epidemic in industrialized Western countries caused by Chlamydia trachomatis variant L2b still needs improvements in diagnosis, therapy and prevention. We therefore developed the first rapid C. trachomatis variant L2b-specific polymerase chain reaction to circumvent laborious ompA gene sequencing. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time, reverse transcription polymerase chain reaction (rRT-PCR) and virus isolation

USDA-ARS?s Scientific Manuscript database

The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...

Development of a multiplex polymerase chain reaction-sequence-specific primer method for NKG2D and NKG2F single-nucleotide polymorphism typing using isothermal multiple displacement amplification products.

PubMed

Kaewmanee, M; Phoksawat, W; Romphruk, A; Romphruk, A V; Jumnainsong, A; Leelayuwat, C

2013-06-01

Natural killer group 2 member D (NKG2D) on immune effector cells recognizes multiple stress-inducible ligands. NKG2D single-nucleotide polymorphism (SNP) haplotypes were related to the levels of cytotoxic activity of peripheral blood mononuclear cells. Indeed, these polymorphisms were also located in NKG2F. Isothermal multiple displacement amplification (IMDA) is used for whole genome amplification (WGA) that can amplify very small genomic DNA templates into microgram with whole genome coverage. This is particularly useful in the cases of limited amount of valuable DNA samples requiring multi-locus genotyping. In this study, we evaluated the quality and applicability of IMDA to genetic studies in terms of sensitivity, efficiency of IMDA re-amplification and stability of IMDA products. The smallest amount of DNA to be effectively amplified by IMDA was 200 pg yielding final DNA of approximately 16 µg within 1.5 h. IMDA could be re-amplified only once (second round of amplification), and could be kept for 5 months at 4°C and more than a year at -20°C without loosing genome coverage. The amplified products were used successfully to setup a multiplex polymerase chain reaction-sequence-specific primer for SNP typing of the NKG2D/F genes. The NKG2D/F multiplex polymerase chain reaction (PCR) contained six PCR mixtures for detecting 10 selected SNPs, including 8 NKG2D/F SNP haplotypes and 2 additional NKG2D coding SNPs. This typing procedure will be applicable in both clinical and research laboratories. Thus, our data provide useful information and limitations for utilization of genome-wide amplification using IMDA and its application for multiplex NKG2D/F typing. © 2013 John Wiley & Sons Ltd.

Automated Extraction of Formalin-Fixed, Paraffin-Embedded Tissue for High-Risk Human Papillomavirus Testing of Head and Neck Squamous Cell Carcinomas Using the Roche Cobas 4800 System.

PubMed

Kerr, Darcy A; Sweeney, Brenda; Arpin, Ronald N; Ring, Melissa; Pitman, Martha B; Wilbur, David C; Faquin, William C

2016-08-01

-Testing for high-risk human papillomavirus (HR-HPV) in head and neck squamous cell carcinomas (HNSCCs) is important for both prognostication and clinical management. Several testing platforms are available for HR-HPV; however, effective alternative automated approaches are needed. -To assess the performance of the automated Roche cobas 4800 HPV real-time polymerase chain reaction-based system on formalin-fixed, paraffin-embedded HNSCC specimens and compare results with standard methods of in situ hybridization (ISH) and p16 immunohistochemistry. -Formalin-fixed, paraffin-embedded samples of HNSCC were collected from archival specimens in the Department of Pathology, Massachusetts General Hospital (Boston), and prepared using the automated system by deparaffinization and dehydration followed by tissue lysis. Samples were integrated into routine cervical cytology testing runs by cobas. Corresponding formalin-fixed, paraffin-embedded samples were evaluated for HR-HPV by ISH and p16 by immunohistochemistry. Discrepant cases were adjudicated by polymerase chain reaction. -Sixty-two HNSCC samples were analyzed using the automated cobas system, ISH, and immunohistochemistry. Fifty-two percent (n = 32 of 62) of formalin-fixed, paraffin-embedded tumors were positive for HR-HPV by cobas. Eighty-eight percent (n = 28 of 32) of cases were the HPV 16 subtype and 12% (n = 4 of 32) were other HR-HPV subtypes. Corresponding testing with ISH was concordant in 92% (n = 57 of 62) of cases. Compared with the adjudication polymerase chain reaction standard, there were 3 false-positive cases by cobas. -Concordance in HNSCC HR-HPV status between cobas and ISH was more than 90%. The cobas demonstrated a sensitivity of 100% and a specificity of 91% for detection of HR-HPV. Advantages favoring cobas include its automation, cost efficiency, objective results, and ease of performance.

Roles of Residues Arg-61 and Gln-38 of Human DNA Polymerase η in Bypass of Deoxyguanosine and 7,8-Dihydro-8-oxo-2'-deoxyguanosine.

PubMed

Su, Yan; Patra, Amritraj; Harp, Joel M; Egli, Martin; Guengerich, F Peter

2015-06-26

Like the other Y-family DNA polymerases, human DNA polymerase η (hpol η) has relatively low fidelity and is able to tolerate damage during DNA synthesis, including 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxoG), one of the most abundant DNA lesions in the genome. Crystal structures show that Arg-61 and Gln-38 are located near the active site and may play important roles in the fidelity and efficiency of hpol η. Site-directed mutagenesis was used to replace these side chains either alone or together, and the wild type or mutant proteins were purified and tested by replicating DNA past deoxyguanosine (G) or 8-oxoG. The catalytic activity of hpol η was dramatically disrupted by the R61M and Q38A/R61A mutations, as opposed to the R61A and Q38A single mutants. Crystal structures of hpol η mutant ternary complexes reveal that polarized water molecules can mimic and partially compensate for the missing side chains of Arg-61 and Gln-38 in the Q38A/R61A mutant. The combined data indicate that the positioning and positive charge of Arg-61 synergistically contribute to the nucleotidyl transfer reaction, with additional influence exerted by Gln-38. In addition, gel filtration chromatography separated multimeric and monomeric forms of wild type and mutant hpol η, indicating the possibility that hpol η forms multimers in vivo. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Roles of Residues Arg-61 and Gln-38 of Human DNA Polymerase η in Bypass of Deoxyguanosine and 7,8-Dihydro-8-oxo-2′-deoxyguanosine*

PubMed Central

Su, Yan; Patra, Amritraj; Harp, Joel M.; Egli, Martin; Guengerich, F. Peter

2015-01-01

Like the other Y-family DNA polymerases, human DNA polymerase η (hpol η) has relatively low fidelity and is able to tolerate damage during DNA synthesis, including 7,8-dihydro-8-oxo-2′-deoxyguanosine (8-oxoG), one of the most abundant DNA lesions in the genome. Crystal structures show that Arg-61 and Gln-38 are located near the active site and may play important roles in the fidelity and efficiency of hpol η. Site-directed mutagenesis was used to replace these side chains either alone or together, and the wild type or mutant proteins were purified and tested by replicating DNA past deoxyguanosine (G) or 8-oxoG. The catalytic activity of hpol η was dramatically disrupted by the R61M and Q38A/R61A mutations, as opposed to the R61A and Q38A single mutants. Crystal structures of hpol η mutant ternary complexes reveal that polarized water molecules can mimic and partially compensate for the missing side chains of Arg-61 and Gln-38 in the Q38A/R61A mutant. The combined data indicate that the positioning and positive charge of Arg-61 synergistically contribute to the nucleotidyl transfer reaction, with additional influence exerted by Gln-38. In addition, gel filtration chromatography separated multimeric and monomeric forms of wild type and mutant hpol η, indicating the possibility that hpol η forms multimers in vivo. PMID:25947374

Papaya (Carica papaya L.).

PubMed

Zhu, Yun J; Fitch, Maureen M M; Moore, Paul H

2006-01-01

Transgenic papaya plants were initially obtained using particle bombardment, a method having poor efficiency in producing intact, single-copy insertion of transgenes. Single-copy gene insertion was improved using Agrobacterium tumefaciens. With progress being made in genome sequencing and gene discovery, there is a need for more efficient methods of transformation in order to study the function of these genes. We describe a protocol for Agrobacterium-mediated transformation using carborundum-wounded papaya embryogenic calli. This method should lead to high-throughput transformation, which on average produced at least one plant that was positive in polymerase chain reaction (PCR), histochemical staining, or by Southern blot hybridization from 10 to 20% of the callus clusters that had been co-cultivated with Agrobacterium. Plants regenerated from the callus clusters in 9 to 13 mo.

Problem-Solving Test: Pyrosequencing

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2013-01-01

Terms to be familiar with before you start to solve the test: Maxam-Gilbert sequencing, Sanger sequencing, gel electrophoresis, DNA synthesis reaction, polymerase chain reaction, template, primer, DNA polymerase, deoxyribonucleoside triphosphates, orthophosphate, pyrophosphate, nucleoside monophosphates, luminescence, acid anhydride bond,…

Recombinase polymerase amplification: Emergence as a critical molecular technology for rapid, low-resource diagnostics.

PubMed

James, Ameh; Macdonald, Joanne

2015-01-01

Isothermal molecular diagnostics are bridging the technology gap between traditional diagnostics and polymerase chain reaction-based methods. These new techniques enable timely and accurate testing, especially in settings where there is a lack of infrastructure to support polymerase chain reaction facilities. Despite this, there is a significant lack of uptake of these technologies in developing countries where they are highly needed. Among these novel isothermal technologies, recombinase polymerase amplification (RPA) holds particular potential for use in developing countries. This rapid nucleic acid amplification approach is fast, highly sensitive and specific, and amenable to countries with a high burden of infectious diseases. Implementation of RPA technology in developing countries is critically required to assess limitations and potentials of the diagnosis of infectious disease, and may help identify impediments that prevent adoption of new molecular technologies in low resource- and low skill settings. This review focuses on approaching diagnosis of infectious disease with RPA.

Recombinase polymerase amplification-based assay to diagnose Giardia in stool samples.

PubMed

Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

2015-03-01

Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. © The American Society of Tropical Medicine and Hygiene.

Recombinase Polymerase Amplification-Based Assay to Diagnose Giardia in Stool Samples

PubMed Central

Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

2015-01-01

Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. PMID:25510713

Development of an event-specific hydrolysis probe quantitative real-time polymerase chain reaction assay for Embrapa 5.1 genetically modified common bean (Phaseolus vulgaris).

PubMed

Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M

2014-12-10

A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1.

A novel duplex real time quantitative reverse transcription polymerase chain reaction for rubella virus with armored RNA as a noncompetitive internal positive control.

PubMed

Zhao, Lihong; Li, Ruiying; Liu, Aihua; Zhao, Shuping

2015-07-01

The objective of this study was to build and apply a duplex real time quantitative reverse transcription-polymerase chain reaction (RT-PCR) for rubella virus. Firstly, a 60-bp-long armored RV RNA was constructed in the laboratory. Secondly, a duplex real time RT-PCR assay was established. Thirdly, the 60-bp-long armored RV RNA was used as an internal positive control (IPC) for the duplex real time RT-PCR. And finally the duplex real time RT-PCR assay was applied to detect RV RNA in clinical specimens. The in-house assay has a high amplification efficiency (0.99), a high analytical sensitivity (200 copies/mL), and a good reproducibility. The diagnostic specificity and sensitivity of the in-house assay were both 100%, due to the monitoring of the armored RV RNA IPC. Therefore, the in-house duplex real time quantitative RT-PCR assay is a specific, sensitive, reproducible and accurate assay for quantitation of RV RNA in clinical specimens. And noncompetitive armored RV RNA IPC can monitor RT-PCR inhibition and prevent false-negative and inaccurate results in the real time detection system. Copyright © 2015 Elsevier B.V. All rights reserved.

Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

PubMed Central

2011-01-01

In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV), a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR) and restriction fragment length polymorphism (RFLP). We selected an 829 bp fragment of the nucleoprotein (N) gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively. PMID:21352564

Distinguishing Heterodera filipjevi and H. avenae using polymerase chain reaction-restriction fragment length polymorphism and cyst morphology.

PubMed

Yan, Guiping; Smiley, Richard W

2010-03-01

The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.

Thermally multiplexed polymerase chain reaction.

PubMed

Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

2015-07-01

Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

The use of heteroduplex analysis of polymerase chain reaction products to support the possible transmission of Legionella pneumophila from a malfunctioning automobile air conditioner.

PubMed

Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T

2002-03-01

Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.

Identification of co-infection by rotavirus and parvovirus in dogs with gastroenteritis in Mexico.

PubMed

Ortega, Ariadna Flores; Martínez-Castañeda, José Simón; Bautista-Gómez, Linda G; Muñoz, Raúl Fajardo; Hernández, Israel Quijano

This is the first report on circulating canine rotavirus in Mexico. Fifty samples from dogs with gastroenteritis were analyzed used polymerase chain reaction and reverse transcription polymerase chain reaction in order to identify parvovirus and rotavirus, respectively; 7% of dogs were infected with rotavirus exclusively, while 14% were co-infected with both rotavirus and parvovirus; clinical signs in co-infected dogs were more severe. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

PubMed

Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

2016-01-01

American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.

Real-time polymerase chain reaction for detection of encapsulated Haemophilus influenzae using degenerate primers to target the capsule transport gene bexA.

PubMed

Law, Dennis K S; Tsang, Raymond S W

2013-05-01

A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.

Geographic variation in marine turtle fibropapillomatosis

USGS Publications Warehouse

Greenblatt, R.J.; Work, Thierry M.; Dutton, P.; Sutton, C.A.; Spraker, T.R.; Casey, R.N.; Diez, C.E.; Parker, Dana C.; St. Ledger, J.; Balazs, G.H.; Casey, J.W.

2005-01-01

We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.

Geographic variation in marine turtle fibropapillomatosis.

PubMed

Greenblatt, Rebecca J; Work, Thierry M; Dutton, Peter; Sutton, Claudia A; Spraker, Terry R; Casey, Rufina N; Diez, Carlos E; Parker, Denise; St Leger, Judy; Balazs, George H; Casey, James W

2005-09-01

We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.

Brief ultrasonication improves detection of biofilm-formative bacteria around a metal implant.

PubMed

Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Fujishiro, Takaaki; Procop, Gary W

2007-04-01

Biofilms are complex microenvironments produced by microorganisms on surfaces. Ultrasonication disrupts biofilms and may make the microorganism or its DNA available for detection. We determined whether ultrasonication could affect our ability to detect bacteria adherent to a metal substrate. A biofilm-formative Staphylococcus aureus strain was used for an in vitro implant infection model (biofilm-formative condition). We used quantitative culture and real time-polymerase chain reaction to determine the influence of different durations of ultrasound on bacterial adherence and viability. Sonication for 1 minute increased the yield of bacteria. Sonication longer than 5 minutes led to fewer bacterial colonies by conventional culture but not by polymerase chain reaction. This suggests short periods of sonication help release bacteria from the metal substrate by disrupting the biofilm, but longer periods of sonication lyse bacteria prohibiting their detection in microbiologic cultures. A relatively short duration of sonication may be desirable for maximizing detection of biofilm-formative bacteria around implants by culture or polymerase chain reaction.

Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

PubMed

Bridge, Julia A

2017-01-01

The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

[Application of isothermal amplification technology for pathogen detection in parasitic and other diseases].

PubMed

Ting, Li; Kun, Yang

2018-04-16

The in vitro nucleic acid amplification technique based on polymerase chain reaction (PCR) has been successfully applied to scientific researches. In recent years, the emergence of isothermal amplification technology is increasingly applied in the molecular diagnosis and disease detection because of its advantages of constant temperature, high efficiency, short time-consuming, and less reliance on equipment and instruments. The principle, characteristics and application of the partial isothermal amplification technique in the pathogen detection in parasitic and other diseases are reviewed in this paper, and the prospects of the wide development of the technique are also discussed.

PCR thermocycler

DOEpatents

Benett, William J.; Richards, James B.

2003-01-01

A sleeve-type silicon polymerase chain reaction (PCR) chamber or thermocycler having improved thermal performance. The silicon sleeve reaction chamber is improved in thermal performance by etched features therein that reduce thermal mass and increase the surface area of the sleeve for cooling. This improved thermal performance of the thermocycler enables an increase in speed and efficiency of the reaction chamber. The improvement is accomplished by providing grooves in the faces of the sleeve and a series of grooves on the interior surfaces that connect with grooves on the faces of the sleeve. The grooves can be anisotropically etched in the silicon sleeve simultaneously with formation of the chamber.

PCR thermocycler

DOEpatents

Benett, William J.; Richards, James B.

2005-05-17

A sleeve-type silicon polymerase chain reaction (PCR) chamber or thermocycler having improved thermal performance. The silicon sleeve reaction chamber is improved in thermal performance by etched features therein that reduce thermal mass and increase the surface area of the sleeve for cooling. This improved thermal performance of the thermocycler enables an increase in speed and efficiency of the reaction chamber. The improvement is accomplished by providing grooves in the faces of the sleeve and a series of grooves on the interior surfaces that connect with grooves on the faces of the sleeve. The grooves can be anisotropically etched in the silicon sleeve simultaneously with formation of the chamber.

Nondestructive DNA extraction from blackflies (Diptera: Simuliidae): retaining voucher specimens for DNA barcoding projects.

PubMed

Hunter, Stephanie J; Goodall, Tim I; Walsh, Kerry A; Owen, Richard; Day, John C

2008-01-01

A nondestructive, chemical-free method is presented for the extraction of DNA from small insects. Blackflies were submerged in sterile, distilled water and sonicated for varying lengths of time to provide DNA which was assessed in terms of quantity, purity and amplification efficiency. A verified DNA barcode was produced from DNA extracted from blackfly larvae, pupae and adult specimens. A 60-second sonication period was found to release the highest quality and quantity of DNA although the amplification efficiency was found to be similar regardless of sonication time. Overall, a 66% amplification efficiency was observed. Examination of post-sonicated material confirmed retention of morphological characters. Sonication was found to be a reliable DNA extraction approach for barcoding, providing sufficient quality template for polymerase chain reaction amplification as well as retaining the voucher specimen for post-barcoding morphological evaluation. © 2007 The Authors.

Optimized knock-in of point mutations in zebrafish using CRISPR/Cas9.

PubMed

Prykhozhij, Sergey V; Fuller, Charlotte; Steele, Shelby L; Veinotte, Chansey J; Razaghi, Babak; Robitaille, Johane M; McMaster, Christopher R; Shlien, Adam; Malkin, David; Berman, Jason N

2018-06-14

We have optimized point mutation knock-ins into zebrafish genomic sites using clustered regularly interspaced palindromic repeats (CRISPR)/Cas9 reagents and single-stranded oligodeoxynucleotides. The efficiency of knock-ins was assessed by a novel application of allele-specific polymerase chain reaction and confirmed by high-throughput sequencing. Anti-sense asymmetric oligo design was found to be the most successful optimization strategy. However, cut site proximity to the mutation and phosphorothioate oligo modifications also greatly improved knock-in efficiency. A previously unrecognized risk of off-target trans knock-ins was identified that we obviated through the development of a workflow for correct knock-in detection. Together these strategies greatly facilitate the study of human genetic diseases in zebrafish, with additional applicability to enhance CRISPR-based approaches in other animal model systems.

Detecting the Presence of Bacterial DNA and RNA by Polymerase Chain Reaction to Diagnose Suspected Periprosthetic Joint Infection after Antibiotic Therapy.

PubMed

Fang, Xin-Yu; Li, Wen-Bo; Zhang, Chao-Fan; Huang, Zi-da; Zeng, Hui-Yi; Dong, Zheng; Zhang, Wen-Ming

2018-02-01

To explore the diagnostic efficiency of DNA-based and RNA-based quantitative polymerase chain reaction (qPCR) analyses for periprosthetic joint infection (PJI). To determine the detection limit of DNA-based and RNA-based qPCR in vitro, Staphylococcus aureus and Escherichia coli strains were added to sterile synovial fluid obtained from a patient with knee osteoarthritis. Serial dilutions of samples were analyzed by DNA-based and RNA-based qPCR. Clinically, patients who were suspected of having PJI and eventually underwent revision arthroplasty in our hospital from July 2014 to December 2016 were screened. Preoperative puncture or intraoperative collection was performed on patients who met the inclusion and exclusion criteria to obtain synovial fluid. DNA-based and RNA-based PCR analyses and culture were performed on each synovial fluid sample. The patients' demographic characteristics, medical history, and laboratory test results were recorded. The diagnostic efficiency of both PCR assays was compared with culture methods. The in vitro analysis demonstrated that DNA-based qPCR assay was highly sensitive, with the detection limit being 1200 colony forming units (CFU)/mL of S. aureus and 3200 CFU/mL of E. coli. Meanwhile, The RNA-based qPCR assay could detect 2300 CFU/mL of S. aureus and 11 000 CFU/mL of E. coli. Clinically, the sensitivity, specificity, and accuracy were 65.7%, 100%, and 81.6%, respectively, for the culture method; 81.5%, 84.8%, and 83.1%, respectively, for DNA-based qPCR; and 73.6%, 100%, and 85.9%, respectively, for RNA-based qPCR. DNA-based qPCR could detect suspected PJI with high sensitivity after antibiotic therapy. RNA-based qPCR could reduce the false positive rates of DNA-based assays. qPCR-based methods could improve the efficiency of PJI diagnosis. © 2018 Chinese Orthopaedic Association and John Wiley & Sons Australia, Ltd.

Adenovirus-mediated in utero gene transfer in mice and guinea pigs: tissue distribution of recombinant adenovirus determined by quantitative TaqMan-polymerase chain reaction assay.

PubMed

Senoo, M; Matsubara, Y; Fujii, K; Nagasaki, Y; Hiratsuka, M; Kure, S; Uehara, S; Okamura, K; Yajima, A; Narisawa, K

2000-04-01

Fetal somatic cell gene therapy could become an attractive solution for some congenital genetic diseases or the disorders which manifest themselves during the fetal period. We performed adenovirus-mediated gene transfer to mice and guinea pig fetuses in utero and evaluated the efficiency of gene transfer by histochemical analysis and a quantitative TaqMan-polymerase chain reaction (TaqMan-PCR) assay. We first injected a replication-deficient recombinant adenovirus containing the Escherichia coli LacZ gene driven by a CAG promoter (AxCALacZ) into pregnant mice through the amniotic space, placenta, or intraperitoneal space of the fetus. Histochemical analysis showed limited transgene expression in fetal tissues. We then administered AxCALacZ to guinea pig fetuses in the late stage of pregnancy through the umbilical vein. The highest beta-galactosidase expression was observed in liver followed by moderate expression in heart, spleen, and adrenal gland. The transgene expression was also present in kidney, intestine, and placenta to a lesser degree. No positively stained cells were observed in lung, muscle, or pancreas except in the vascular endothelium of these organs. Quantitative measurement of recombinant adenoviral DNA by the TaqMan-PCR assay showed that the vast majority of the injected viruses was present in liver. The current study indicated that adenovirus-mediated gene transfer into guinea pig fetus through the umbilical vein is feasible and results in efficient transgene expression in fetal tissues. The experimental procedures using pregnant guinea pigs might serve as a good experimental model for in utero gene transfer. Since our TaqMan-PCR assay detects the LacZ gene, one of the most widely used reporter genes, it may be generally applicable to adenovirus quantification in various gene transfer experiments.

An easy and efficient strategy for KEL genotyping in a multiethnic population.

PubMed

Arnoni, Carine Prisco; Muniz, Janaína Guinhem; de Paula, Tatiane Aparecida; Person, Rosangela Duarte de Medeiros; Gazito, Diana; Baleotti, Wilson; Barreto, José Augusto; Castilho, Lilian; Latini, Flavia Roche Moreira

2013-01-01

The Kell blood group system expresses high and low frequency antigens with the most important in relation to transfusion including the antithetic KEL1 and KEL2; KEL3 and KEL4; KEL6 and KEL7 antigens. Kell is a clinically relevant system, as it is highly immunogenic and anti-KEL antibodies are associated with hemolytic transfusion reactions and hemolytic disease of the fetus and newborn. Although required in some situations, Kell antigen phenotyping is restricted due to technical limitations. In these cases, molecular approaches maybe a solution. This study proposes three polymerase chain reaction genotyping protocols to analyze the single nucleotide polymorphisms responsible for six Kell antithetic antigens expressed in a Brazilian population. DNA was extracted from 800 blood donor samples and three polymerase chain reaction-restriction fragment length polymorphism protocols were used to genotype the KEL*1/KEL*2, KEL*3/KEL*4 and KEL*6/KEL*7 alleles. KEL*3/KEL*4 and KEL*6/KEL*7 genotyping was standardized using the NlaIII and MnlI restriction enzymes and validated using sequencing. KEL*1/KEL*2 genotyping was performed using a previously reported assay. KEL genotyping was successfully implemented in the service; the following distribution of KEL alleles was obtained for a population from southeastern Brazil: KEL*1 (2.2%), KEL*2 (97.8%), KEL*3 (0.69%), KEL*4 (99.31%), KEL*6 (2.69%) and KEL*7 (97.31%). Additionally, two individuals with rare genotypes, KEL*1/KEL*1 and KEL*3/KEL*3, were identified. KEL allele genotyping using these methods proved to be reliable and applicable to predict Kell antigen expressions in a Brazilian cohort. This easy and efficient strategy can be employed to provide safer transfusions and to help in rare donor screening.

A sensitive and high throughput TaqMan-based reverse transcription quantitative polymerase chain reaction assay efficiently discriminates ALK rearrangement from overexpression for lung cancer FFPE specimens.

PubMed

Lung, Jrhau; Lin, Yu-Ching; Hung, Ming-Szu; Jiang, Yuan Yuan; Lee, Kuan-Der; Lin, Paul Yann; Tsai, Ying Huang

2016-04-01

ALK fusion gene is an oncogenic driver in lung cancer with low prevalence, which can be ameliorated by crizotinib. Currently, ALK fusion gene can be diagnosed by fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC), but inconstistnt results between the two methods are encountered regularly. To make the ALK fusion gene screening more efficient and to provide a simple solution to clarify the discrepancy between FISH and IHC results, a sensitive TaqMan-based reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay was established. The 3-plex TaqMan-based RT-qPCR assay was established and performed on 102 archived formalin-fixed, paraffin-embedded (FFPE) NSCLC samples to detect ALK rearrangement and overexpression. Break-apart FISH and automatic immunohistochemistry based ALK assays were performed side by side using tissue microarray. The RT-qPCR was performed successfully for 80 samples and 10 of them showed positive signals. Three out of the 10 qPCR positive cases were further confirmed by FISH and IHC test. Two others were IHC positive and FISH negative, and expressed full-length ALK transcript. The rest were neither FISH nor IHC positive and their ALK expression level was significantly lower than those FISH or IHC positive cases. Our RT-qPCR assay demonstrates that the capability and reliability of ALK detection is comparable to FISH and IHC, but it is more effective at discriminating ALK rearrangement from overexpression. The RT-qPCR assay easily clarifies the discrepancy between FISH and IHC, and can be incorporated into routine ALK screening for lung cancer. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

PubMed

Harano, K; Harano, T; Kushida, Y; Ueda, S

1991-08-01

Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

Screening for diverse PDGFRA or PDGFRB fusion genes is facilitated by generic quantitative reverse transcriptase polymerase chain reaction analysis

PubMed Central

Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas

2010-01-01

Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158

A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

PubMed

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

2008-09-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.

Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

PubMed

Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

2015-07-01

Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Slow Joining of Newly Replicated DNA Chains in DNA Polymerase I-Deficient Escherichia coli Mutants*

PubMed Central

Okazaki, Reiji; Arisawa, Mikio; Sugino, Akio

1971-01-01

In Escherichia coli mutants deficient in DNA polymerase I, newly replicated short DNA is joined at about 10% of the rate in the wild-type strains. It is postulated that DNA polymerase I normally functions in filling gaps between the nascent short segments synthesized by the replication complex. Possible implications of the finding are discussed in relation to other abnormal properties of these mutants. PMID:4943548

Molecular diagnostics of periodontitis.

PubMed

Korona-Głowniak, Izabela; Siwiec, Radosław; Berger, Marcin; Malm, Anna; Szymańska, Jolanta

2017-01-28

The microorganisms that form dental plaque are the main cause of periodontitis. Their identification and the understanding of the complex relationships and interactions that involve these microorganisms, environmental factors and the host's health status enable improvement in diagnostics and targeted therapy in patients with periodontitis. To this end, molecular diagnostics techniques (both techniques based on the polymerase chain reaction and those involving nucleic acid analysis via hybridization) come increasingly into use. On the basis of a literature review, the following methods are presented: polymerase chain reaction (PCR), real-time polymerase chain reaction (real-time PCR), 16S rRNA-encoding gene sequencing, checkerboard and reverse-capture checkerboard hybridization, microarrays, denaturing gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE), as well as terminal restriction fragment length polymorphism (TRFLP) and next generation sequencing (NGS). The advantages and drawbacks of each method in the examination of periopathogens are indicated. The techniques listed above allow fast detection of even small quantities of pathogen present in diagnostic material and prove particularly useful to detect microorganisms that are difficult or impossible to grow in a laboratory.

T85C polymorphisms of the dihydropyrimidine dehydrogenase gene detected in gastric cancer tissues by high-resolution melting curve analysis.

PubMed

Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen

2012-01-01

Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.

Expression and mutational analysis of Cip/Kip family in early glottic cancer.

PubMed

Kim, D-K; Lee, J H; Lee, O J; Park, C H

2015-02-01

Genetic alteration of cyclin-dependent kinase inhibitors has been associated with carcinogenesis mechanisms in various organs. This study aimed to evaluate the expression and mutational analysis of Cip/Kip family cyclin-dependent kinase inhibitors (p21CIP1/WAF1, p27KIP1 and p57KIP2) in early glottic cancer. Expressions of Cip/Kip family and p53 were determined by quantitative reverse transcription polymerase chain reaction and densitometry. For the analysis of p21 inactivation, sequence alteration was assessed using single-strand conformational polymorphism polymerase chain reaction. Additionally, the inactivation mechanism of p27 and p57 were investigated using DNA methylation analysis. Reduced expression of p27 and p57 were detected in all samples, whereas the expression of p21 was incompletely down-regulated in 6 of 11 samples. Additionally, single-strand conformational polymorphism polymerase chain reaction analysis showed the p53 mutation at exon 6. Methylation of p27 and p57 was detected by DNA methylation assay. Our results suggest that the Cip/Kip family may have a role as a molecular mechanism of carcinogenesis in early glottic cancer.

Direct and quantitative detection of HIV-1 RNA in human plasma with a branched DNA signal amplification assay.

PubMed

Urdea, M S; Wilber, J C; Yeghiazarian, T; Todd, J A; Kern, D G; Fong, S J; Besemer, D; Hoo, B; Sheridan, P J; Kokka, R

1993-11-01

To determine the relative effect of sample matrix on the quantitation of HIV RNA in plasma. Two HIV-positive specimens were diluted into five and 10 different HIV-negative plasma samples, respectively. Branched DNA signal amplification technology and reverse-transcriptase polymerase chain reaction were used to measure the viral load. In one sample the viral load by polymerase chain reaction ranged from undetectable to 1.9 x 10(5) copies/ml, and the branched DNA results ranged from 2.6 x 10(4) to 4.2 x 10(4) HIV RNA equivalent/ml. In the other sample the corresponding figures were 6.3 x 10(4) to 5.5 x 10(5) copies/ml and 5.7 x 10(4) to 7.5 x 10(4) HIV RNA equivalents/ml. In contrast to reverse-transcriptase polymerase chain reaction the branched DNA signal amplification assay does not require a separate extraction step or enzymatic amplification of the target. Therefore this measurement is less affected by the sample matrix and the signal generated is directly proportional to the viral load.

Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR

PubMed Central

Pinto, Fernando Lopes; Svensson, Håkan; Lindblad, Peter

2006-01-01

Background In order to overcome genomic DNA contamination in transcriptional studies, reverse template-specific polymerase chain reaction, a modification of reverse transcriptase polymerase chain reaction, is used. The possibility of using tags whose sequences are not found in the genome further improves reverse specific polymerase chain reaction experiments. Given the absence of software available to produce genome suitable tags, a simple tool to fulfill such need was developed. Results The program was developed in Perl, with separate use of the basic local alignment search tool, making the tool platform independent (known to run on Windows XP and Linux). In order to test the performance of the generated tags, several molecular experiments were performed. The results show that Tagenerator is capable of generating tags with good priming properties, which will deliberately not result in PCR amplification of genomic DNA. Conclusion The program Tagenerator is capable of generating tag sequences that combine genome absence with good priming properties for RT-PCR based experiments, circumventing the effects of genomic DNA contamination in an RNA sample. PMID:16820068

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, Marcelo Bento; Bonaldo, Maria de Fatima

1998-01-01

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, M.B.; Fatima Bonaldo, M. de

1998-12-08

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

Multicentre study of Y chromosome microdeletions in 1,808 Chinese infertile males using multiplex and real-time polymerase chain reaction.

PubMed

Zhu, X-B; Gong, Y-H; He, J; Guo, A-L; Zhi, E-L; Yao, J-E; Zhu, B-S; Zhang, A-J; Li, Z

2017-06-01

Azoospermia factor (AZF) genes on the long arm of the human Y chromosome are involved in spermatogenesis, and microdeletions in the AZF region have been recognised to be the second major genetic cause of spermatogenetic failure resulting in male infertility. While screening for these microdeletions can avoid unnecessary medical and surgical treatments, current methods are generally time-consuming. Therefore, we established a new method to detect and analyse microdeletions in the AZF region quickly, safely and efficiently. In total, 1,808 patients with spermatogenetic failure were recruited from three hospitals in southern China, of which 600 patients were randomly selected for screening for Y chromosome microdeletions in AZF regions employing real-time polymerase chain reaction with a TaqMan probe. In our study, of 1,808 infertile patients, 150 (8.3%) were found to bear microdeletions in the Y chromosome using multiplex PCR, while no deletions were found in the controls. Among the AZF deletions detected, two were in AZFa, three in AZFb, 35 in AZFc, three in AZFb+c and two in AZFa+b+c. Our method is fast-it permits the scanning of DNA from a patient in one and a half hours-and reliable, minimising the risk of cross-contamination and false-positive and false-negative results. © 2016 Blackwell Verlag GmbH.

Gemi: PCR Primers Prediction from Multiple Alignments

PubMed Central

Sobhy, Haitham; Colson, Philippe

2012-01-01

Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117

Bi-parentally inherited species-specific markers identify hybridization between rainbow trout and cutthroat trout subspecies

USGS Publications Warehouse

Ostberg, C.O.; Rodriguez, R.J.

2004-01-01

Eight polymerase chain reaction primer sets amplifying bi-parentally inherited species-specific markers were developed that differentiate between rainbow trout (Oncorhynchus mykiss) and various cutthroat trout (O. clarki) subspecies. The primers were tested within known F1 and first generation hybrid backcrosses and were shown to amplify codominantly within hybrids. Heterozygous individuals also amplified a slower migrating band that was a heteroduplex, caused by the annealing of polymerase chain reaction products from both species. These primer sets have numerous advantages for native cutthroat trout conservation including statistical genetic analyses of known crosses and simple hybrid identification.

Flow-through polymerase chain reaction inside a seamless 3D helical microreactor fabricated utilizing a silicone tube and a paraffin mold.

PubMed

Wu, Wenming; Trinh, Kieu The Loan; Lee, Nae Yoon

2015-03-07

We introduce a new strategy for fabricating a seamless three-dimensional (3D) helical microreactor utilizing a silicone tube and a paraffin mold. With this method, various shapes and sizes of 3D helical microreactors were fabricated, and a complicated and laborious photolithographic process, or 3D printing, was eliminated. With dramatically enhanced portability at a significantly reduced fabrication cost, such a device can be considered to be the simplest microreactor, developed to date, for performing the flow-through polymerase chain reaction (PCR).

Polymer-based microfluidic chips for isothermal amplification of nucleic acids

NASA Astrophysics Data System (ADS)

Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.

2017-11-01

Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.

[Identification of human pathogenic variola and monkeypox viruses by real-time polymerase chain reaction].

PubMed

Kostina, E V; Gavrilova, E V; Riabinin, V A; Shchelkunov, S N; Siniakov, A N

2009-01-01

A kit of specific oligonucleotide primers and hybridization probes has been proposed to detect orthopoxviruses (OPV) and to discriminate human pathogenic viruses, such as variola virus and monkey virus by real-time polymerase chain reaction (PCR). For real-time PCR, the following pairs of fluorophore and a fluorescence quencher were used: TAMRA-BHQ2 for genus-specific probes and FAM-BHQ1 for species-specific ones (variola virus, monkeypox virus, ectomelia virus). The specificity of this assay was tested on 38 strains of 6 OPV species and it was 100%.

Identification of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) by using polymerase chain reaction amplification and restriction analysis of the mitochondrial cytochrome b gene.

PubMed

Carrera, E; García, T; Céspedes, A; González, I; Sanz, B; Hernández, P E; Martín, R

1998-04-01

Restriction site analysis of polymerase chain reaction (PCR) products from a conserved region of the cytochrome b gene has been used for the identification of fresh and smoked samples of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Digestion of the 359-bp PCR product with the endonucleases EcoRV and TaqI yielded specific banding patterns for salmon and trout. This genetic marker can be very useful for detecting fraudulent substitution of the cheaper smoked trout for the more expensive smoked salmon.

Polymerase chain reaction with phase change as intrinsic thermal control

NASA Astrophysics Data System (ADS)

Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

2013-04-01

This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

Building block synthesis using the polymerase chain assembly method.

PubMed

Marchand, Julie A; Peccoud, Jean

2012-01-01

De novo gene synthesis allows the creation of custom DNA molecules without the typical constraints of traditional cloning assembly: scars, restriction site incompatibility, and the quest to find all the desired parts to name a few. Moreover, with the help of computer-assisted design, the perfect DNA molecule can be created along with its matching sequence ready to download. The challenge is to build the physical DNA molecules that have been designed with the software. Although there are several DNA assembly methods, this section presents and describes a method using the polymerase chain assembly (PCA).

Astrocyte- and endothelial-targeted CCL2 conditional knockout mice: critical tools for studying the pathogenesis of neuroinflammation.

PubMed

Ge, Shujun; Murugesan, Nivetha; Pachter, Joel S

2009-09-01

While the expression of the C-C chemokine ligand 2 (CCL2) in the central nervous system (CNS) is associated with numerous neuroinflammatory conditions, the critical cellular sources of this chemokine, which is responsible for disease processes-as well as associated pathogenic mechanisms, remain unresolved. As the potential for anti-CCL2 therapeutics in treating neuroinflammatory disease is likely to be contingent upon effective drug delivery to the source(s) and/or target(s) of CCL2 action in the CNS, tools to highlight the course of CCL2 action during neuroinflammation are imperative. In response to this need, we used the Cre/loxP and FLP-FRT recombination system to develop the first two, cell-conditional CCL2 knockout mice-separately targeting CCL2 gene elimination to astrocytes and endothelial cells, both of which have been considered to play crucial though undefined roles in neuroinflammatory disease. Specifically, mice containing a floxed CCL2 allele were intercrossed with GFAP-Cre or Tie2-Cre transgenic mice to generate mice with CCL2-deficient astrocytes (astrocyte KO) or endothelial cells (endothelial KO), respectively. Polymerase chain reaction, reverse transcription polymerase chain reaction/quantitative reverse transcriptase polymerase chain reaction, and enzyme-linked immunosorbent assay of CCL2 gene, RNA, and protein, respectively, from cultured astrocytes and brain microvascular endothelial cells (BMEC) established the efficiency and specificity of the CCL2 gene deletions and a CCL2 null phenotype in these CNS cells. Effective cell-conditional knockout of CCL2 was also confirmed in an in vivo setting, wherein astrocytes and BMEC were retrieved by immune-guided laser capture microdissection from their in situ positions in the brains of mice experiencing acute, lipopolysaccharide-mediated endotoxemia to induce CCL2 gene expression. In vivo analysis further revealed apparent cross-talk between BMEC and astrocytes regarding the regulation of astrocyte CCL2 expression. Use of astrocyte KO and endothelial KO mice should prove critical in elaborating the pathogenic mechanisms of and optimizing the treatments for neuroinflammatory disease.

Translesion synthesis across the (6-4) photoproduct and its Dewar valence isomer by the Y-family and engineered DNA polymerases.

PubMed

Yamamoto, Junpei; Loakes, David; Masutani, Chikahide; Simmyo, Shizu; Urabe, Kumiko; Hanaoka, Fumio; Holliger, Philipp; Iwai, Shigenori

2008-01-01

We analyzed the translesion synthesis across the UV-induced lesions, the (6-4) photoproduct and its Dewar valence isomer, by using human DNA polymerases eta and iota in vitro. The primer extension experiments revealed that pol eta tended to incorporate dG opposite the 3' component of both lesions, but the incorporation efficiency for the Dewar isomer was higher than that for the (6-4) photoproduct. On the other hand, pol iota was likely to incorporate dA opposite the 3' components of the (6-4) photoproduct and its Dewar isomer with a similar efficiency. Elongation after the incorporation opposite the UV lesions was not observed for these Y-family polymerases. We further analyzed the bypass ability of an engineered polymerase developed from Thermus DNA polymerase for the amplification of ancient DNA. This polymerase could bypass the Dewar isomer more efficiently than the (6-4) photoproduct.

Paper-based archiving of biological samples from fish for detecting betanodavirus.

PubMed

Navaneeth Krishnan, A; Bhuvaneswari, T; Ezhil Praveena, P; Jithendran, K P

2016-07-01

This study was carried out to evaluate the efficiency of the Flinders Technology Associates (FTA(®)) card (Whatman(®)) as a sampling device and storage platform for RNA from betanodavirus-infected biological samples (viz., larvae, broodstock, cell culture supernatants and rearing seawater spiked with infected materials). The study showed that FTA cards can be used to detect betanodaviruses by reverse transcription-polymerase chain reaction (RT-PCR). The diagnostic efficiency of RT-PCR from all sample types on FTA cards decreased after 21 days of storage at 4 °C, although the virus could be detected up to 28 days by nested RT-PCR. The FTA card protocol thus provides a supplementary method for quick and easy collection of samples, preservation of RNA on a dry storage basis, and detection of betanodavirus-infected fish.

Experimental Design for a Macrofoam Swab Study Relating the Recovery Efficiency and False Negative Rate to Low Concentrations of Two Bacillus anthracis Surrogates on Four Surface Materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Piepel, Gregory F.; Hutchison, Janine R.

2014-04-16

This report describes the experimental design for a laboratory study to quantify the recovery efficiencies and false negative rates of a validated, macrofoam swab sampling method for low concentrations of Bacillus anthracis Sterne (BAS) and Bacillus atrophaeus (BG) spores on four surface materials (stainless steel, glass, vinyl tile, plastic light cover panel). Two analytical methods (plating/counting and polymerase chain reaction) will be used. Only one previous study has investigated false negative as a function of affecting test factors. The surrogates BAS and BG have not been tested together in the same study previously. Hence, this study will provide for completingmore » gaps in the available information on the performance of macrofoam swab sampling at low concentrations.« less

Experimental Design for a Macrofoam-Swab Study Relating the Recovery Efficiency and False Negative Rate to Low Concentrations of Two Bacillus anthracis Surrogates on Four Surface Materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Piepel, Gregory F.; Hutchison, Janine R.

This report describes the experimental design for a laboratory study to quantify the recovery efficiencies and false negative rates of a validated, macrofoam-swab sampling method for low concentrations of Bacillus anthracis Sterne (BAS) and Bacillus atrophaeus (BG) spores on four surface materials (stainless steel, glass, vinyl tile, plastic light cover panel). Two analytical methods (culture and polymerase chain reaction) will be used. Only one previous study has investigated how the false negative rate depends on test factors. The surrogates BAS and BG have not been tested together in the same study previously. Hence, this study will provide for completing gapsmore » in the available information on the performance of macrofoam-swab sampling at low concentrations.« less

Identification of fragile X pre-mutation carriers in the Chinese obstetric population using a robust FMR1 polymerase chain reaction assay: implications for screening and prenatal diagnosis.

PubMed

Cheng, Y Ky; Lin, C Sw; Kwok, Y Ky; Chan, Y M; Lau, T K; Leung, T Y; Choy, K W

2017-04-01

There is significant morbidity associated with fragile X syndrome. Unfortunately, most maternal carriers are clinically silent during their reproductive years. Because of this, many experts have put forward the notion of preconception or prenatal fragile X carrier screening for females. This study aimed to determine the prevalence of fragile X syndrome pre-mutation and asymptomatic full-mutation carriers in a Chinese pregnant population, and the distribution of cytosine-guanine-guanine (CGG) repeat numbers using a robust fragile X mental retardation 1 (FMR1) polymerase chain reaction assay. This was a cross-sectional survey in prospectively recruited pregnant women from a university hospital in Hong Kong. Chinese pregnant women without a family history of fragile X syndrome were recruited between April 2013 and May 2015. A specific FMR1 polymerase chain reaction assay was performed on peripheral blood to determine the CGG repeat number of the FMR1 gene. Prenatal counselling was offered to full-mutation and pre-mutation carriers. In 2650 Chinese pregnant women, two individuals with pre-mutation alleles (0.08%, one in 1325) and one asymptomatic woman with full-mutation (0.04%, one in 2650) alleles were identified. The overall prevalence of pre-mutation and full-mutation alleles was 0.11% (1 in 883). Furthermore, 30 (1.1%) individuals with intermediate alleles were detected. In the 2617 women with normal CGG repeats, the most common CGG repeat allele was 30. The overall prevalence of pre-mutation and asymptomatic full-mutation carriers in the Chinese pregnant population was one in 883, detected by a new FMR1 polymerase chain reaction assay.

A Sensitive Detection Method for MPLW515L or MPLW515K Mutation in Chronic Myeloproliferative Disorders with Locked Nucleic Acid-Modified Probes and Real-Time Polymerase Chain Reaction

PubMed Central

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M.

2008-01-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy. PMID:18669880

No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

PubMed

D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

2006-10-01

Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

Polymerase chain displacement reaction.

PubMed

Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang

2013-02-01

Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics.

[The detection and sequence analysis of the simian T-lymphotrophic retrovirus (STLV-1 Papio) by using the polymerase chain reaction].

PubMed

D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I

1993-01-01

The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.

Utilizing a polymerase chain reaction method for the detection of Toxocara canis and T. cati eggs in soil.

PubMed

Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H

2007-03-01

A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.

Diagnosis of feline leukaemia virus infection by semi-quantitative real-time polymerase chain reaction.

PubMed

Pinches, Mark D G; Helps, Christopher R; Gruffydd-Jones, Tim J; Egan, Kathy; Jarrett, Oswald; Tasker, Séverine

2007-02-01

In this paper the design and use of a semi-quantitative real-time polymerase chain reaction assay (RT-PCR) for feline leukaemia virus (FeLV) provirus is described. Its performance is evaluated against established methods of FeLV diagnosis, including virus isolation and enzyme-linked immunoassay (ELISA) in a population of naturally infected cats. The RT-PCR assay is found to have both a high sensitivity (0.92) and specificity (0.99) when examined by expectation maximisation methods and is also able to detect a large number of cats with low FeLV proviral loads that were negative by other conventional test methods.

Polymerase chain reaction-based detection of myc transduction in feline leukemia virus-infected cats.

PubMed

Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo

2018-04-01

Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.

Molecular Evidence of Bartonella Infection in Domestic Dogs from Algeria, North Africa, by Polymerase Chain Reaction (PCR)

PubMed Central

Kernif, Tahar; Aissi, Meriem; Doumandji, Salah-Eddine; Chomel, Bruno B.; Raoult, Didier; Bitam, Idir

2010-01-01

Bartonella species are being recognized as important bacterial human and canine pathogens, and are associated with multiple arthropod vectors. Bartonella DNA extracted from blood samples was obtained from domestic dogs in Algiers, Algeria. Polymerase chain reaction (PCR) and DNA sequence analyses of the ftsZ gene and the 16S-23S intergenic spacer region (ITS) were performed. Three Bartonella species: Bartonella vinsonii subsp. berkhoffii, Bartonella clarridgeiae, and Bartonells elizabethae were detected infecting Algerian dogs. To our knowledge, this study is the first report of detection by PCR amplification of Bartonella in dogs in North Africa. PMID:20682871

Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction.

PubMed

Corman, V M; Eckerle, I; Bleicker, T; Zaki, A; Landt, O; Eschbach-Bludau, M; van Boheemen, S; Gopal, R; Ballhause, M; Bestebroer, T M; Muth, D; Müller, M A; Drexler, J F; Zambon, M; Osterhaus, A D; Fouchier, R M; Drosten, C

2012-09-27

We present two real-time reverse-transcription polymerase chain reaction assays for a novel human coronavirus (CoV), targeting regions upstream of the E gene (upE) or within open reading frame (ORF)1b, respectively. Sensitivity for upE is 3.4 copies per reaction (95% confidence interval (CI): 2.5–6.9 copies) or 291 copies/mL of sample. No cross-reactivity was observed with coronaviruses OC43, NL63, 229E, SARS-CoV, nor with 92 clinical specimens containing common human respiratory viruses. We recommend using upE for screening and ORF1b for confirmation.

Illegitimate transcription: transcription of any gene in any cell type.

PubMed Central

Chelly, J; Concordet, J P; Kaplan, J C; Kahn, A

1989-01-01

Using in vitro amplification of cDNA by the polymerase chain reaction, we have detected spliced transcripts of various tissue-specific genes (genes for anti-Müllerian hormone, beta-globin, aldolase A, and factor VIIIc) in human nonspecific cells, such as fibroblasts, hepatoma cells, and lymphoblasts. In rats, erythroid- and liver-type pyruvate kinase transcripts were also detected in brain, lung, and muscle. The abundance of these "illegitimate" transcripts is very low; yet, their existence and the possibility of amplifying them by the cDNA polymerase chain reaction provide a powerful tool to analyze pathological transcripts of any tissue-specific gene by using any accessible cell. Images PMID:2495532

A Novel Mechanism of Sugar Selection Utilized by a Human X-family DNA Polymerase†

PubMed Central

Brown, Jessica A.; Fiala, Kevin A.; Fowler, Jason D.; Sherrer, Shanen M.; Newmister, Sean A.; Dyum, Wade W.; Suo, Zucai

2009-01-01

During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2′-hydroxyl group and the bulky side chain of an active site residue. Here, we demonstrated that human DNA polymerase λ used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2′-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such a steric clash was further demonstrated to be dependent on the size and orientation of the substituent covalently attached at the ribonucleotide C2′ position. PMID:19900463

DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

PubMed

Guthrie, J N; Moriarty, D J; Blackall, L L

2000-12-15

A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

Use of polymerase chain reaction (PCR) in the diagnosis of congenital toxoplasmosis.

PubMed

Loveridge-Easther, Cam; Yardley, Anne-Marie; Breidenstein, Brenda

2018-06-01

Congenital toxoplasmosis (CT) is a parasitic disease that causes serious fetal and neonatal harm or death. In countries that do not have antenatal screening programs, the initiation of CT treatment relies on a postnatal diagnosis. Until recently, diagnosis was based on clinical signs and immunoglobulin seropositivity, which is fraught with difficulty. In these cases, diagnosis was often delayed or treatment, which carries risk, started empirically. We highlight the use of polymerase chain reaction to diagnose a case of congenital toxoplasmosis, allowing early treatment and justifying the treatment burden. Copyright © 2018 American Association for Pediatric Ophthalmology and Strabismus. Published by Elsevier Inc. All rights reserved.

Polymerase chain reaction detection of Bartonella spp. in dogs from Spain with blood culture-negative infectious endocarditis.

PubMed

Roura, X; Santamarina, G; Tabar, M-D; Francino, O; Altet, L

2018-05-25

The presence of Bartonella spp. was detected by polymerase chain reaction (PCR) in dogs from Spain with blood culture-negative endocarditis. The aim of this study is to add information about canine infectious endocarditis in Europe. Thirty dogs with naturally occurring blood culture-negative endocarditis were examined from 2010 to 2017 at three veterinary referral hospitals, located in northwest, northeast, and southeast of Spain. It is a retrospective study. Medical records were reviewed to extract relevant data. Frozen or paraffin-embedded cardiac valve tissue and/or ethylenediamine tetraacetic acid blood samples were evaluated by PCR for the presence of Bartonella DNA. Positive results were sequenced to confirm the species. Polymerase chain reaction was positive for eight out of 30 dogs included (26.6%). Bartonella rochalimae, Bartonella vinsonii subsp. berkhoffii, and Bartonella koehlerae were detected in valve tissue or blood. Bartonella could be an important cause of blood culture-negative infectious endocarditis in dogs from Spain. The outcome for those dogs affected with Bartonella spp. was grave. Prompt empirical treatment with amoxicillin-clavulanate plus fluoroquinolones could be of value in cases of blood culture-negative endocarditis. Copyright © 2018 Elsevier B.V. All rights reserved.

[Roles of histologic examination and polymerase chain reaction in diagnosis of toxoplasmic lymphadenitis].

PubMed

Dai, Lin; Huang, Juan; Tang, Yuan; Liao, Dian-ying; Dong, Dan-dan; Xu, Gang; Li, Gan-di

2010-06-01

To study the roles of histologic examination and polymerase chain reaction in diagnosis of toxoplasmic lymphadenitis (TL). Forty-six archival cases of histologically diagnosed TL, encountered during the period from April, 1999 to September, 2009 and with the paraffin-embedded lymph node tissue blocks available, were enrolled into the study. The presence of genome fragments of Toxoplasma gondii (T. gondii) was analyzed using semi-nested polymerase chain reaction (PCR). Thirty cases of one or two histopathologic triad of TL as the controls. The positive rate of PCR in TL group was 76.1% (35/46), as compared to 10.0% (3/30) in the control group. The difference was of statistical significance. The sensitivity and specificity of the histologic triad in diagnosing TL was 92.1% (35/38) and 71.1% (27/38), respectively. The predictive value of positive and negative PCR results was 76.1% (35/46) and 90.0% (27/30). respectively. The high specificity but low sensitivity of applying the histologic triad in diagnosing TL cases may be due to the occurrence of atypical histologic pattern. The sensitivity is improved with the use of semi-nested PCR in detecting T. gondii DNA.

Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

PubMed Central

Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

2013-01-01

Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

Real-Time Polymerase Chain Reaction for Detection of Schistosoma DNA in Small-Volume Urine Samples Reflects Focal Distribution of Urogenital Schistosomiasis in Primary School Girls in KwaZulu Natal, South Africa

PubMed Central

Pillay, Pavitra; Taylor, Myra; Zulu, Siphosenkosi G.; Gundersen, Svein G.; Verweij, Jaco J.; Hoekstra, Pytsje; Brienen, Eric A. T.; Kleppa, Elisabeth; Kjetland, Eyrun F.; van Lieshout, Lisette

2014-01-01

Schistosoma haematobium eggs and Schistosoma DNA levels were measured in urine samples from 708 girls recruited from 18 randomly sampled primary schools in South Africa. Microscopic analysis of two 10-mL urine subsamples collected on three consecutive days confirmed high day-to-day variation; 103 (14.5%) girls had positive results at all six examinations, and at least one positive sample was seen in 225 (31.8%) girls. Schistosoma-specific DNA, which was measured in a 200-μL urine subsample by using real-time polymerase chain reaction, was detected in 180 (25.4%) cases, and levels of DNA corresponded significantly with average urine egg excretion. In concordance with microscopic results, polymerase chain reaction results were significantly associated with history of gynecologic symptoms and confirmed highly focal distribution of urogenital schistosomiasis. Parasite-specific DNA detection has a sensitivity comparable to single urine microscopy and could be used as a standardized high-throughput procedure to assess distribution of urogenital schistosomiasis in relatively large study populations by using small sample volumes. PMID:24470560

Diagnosis of ocular toxoplasmosis by two polymerase chain reaction (PCR) examinations: qualitative multiplex and quantitative real-time.

PubMed

Sugita, Sunao; Ogawa, Manabu; Inoue, Shizu; Shimizu, Norio; Mochizuki, Manabu

2011-09-01

To establish a two-step polymerase chain reaction (PCR) diagnostic system for ocular toxoplasmosis. A total of 13 ocular fluid samples (11 aqueous humor and 2 vitreous fluid) were collected from 13 patients with clinically suspected ocular toxoplasmosis. Ten ocular samples from other uveitis patients and 20 samples from subjects without ocular inflammation were used as controls. Two polymerase chain reaction (PCR) methods, i.e., qualitative multiplex PCR and quantitative real-time PCR, were used to measure the toxoplasma genome (T. gondii B1 gene). Qualitative multiplex PCR detected T. gondii B1 gene in the ocular fluids of 11 out of 13 patients with clinically suspected ocular toxoplasmosis. In real-time PCR, we detected high copy numbers of T. gondii DNA (5.1 × 10(2)-2.1 × 10(6) copies/mL) in a total of 10 patients (10/13, 77%). Only ocular toxoplasmosis scar lesions were observed in the three real-time PCR-negative patients. PCR assay results for the samples from the two control groups were all negative. The two-step PCR examination to detect toxoplasma DNA is a useful tool for diagnosing ocular toxoplasmosis.

Cerebrospinal fluid PCR analysis and biochemistry in bodies with severe decomposition.

PubMed

Palmiere, Cristian; Vanhaebost, Jessica; Ventura, Francesco; Bonsignore, Alessandro; Bonetti, Luca Reggiani

2015-02-01

The aim of this study was to assess whether Neisseria meningitidis, Listeria monocytogenes, Streptococcus pneumoniae and Haemophilus influenzae can be identified using the polymerase chain reaction technique in the cerebrospinal fluid of severely decomposed bodies with known, noninfectious causes of death or whether postmortem changes can lead to false positive results and thus erroneous diagnostic information. Biochemical investigations, postmortem bacteriology and real-time polymerase chain reaction analysis in cerebrospinal fluid were performed in a series of medico-legal autopsies that included noninfectious causes of death with decomposition, bacterial meningitis without decomposition, bacterial meningitis with decomposition, low respiratory tract infections with decomposition and abdominal infections with decomposition. In noninfectious causes of death with decomposition, postmortem investigations failed to reveal results consistent with generalized inflammation or bacterial infections at the time of death. Real-time polymerase chain reaction analysis in cerebrospinal fluid did not identify the studied bacteria in any of these cases. The results of this study highlight the usefulness of molecular approaches in bacteriology as well as the use of alternative biological samples in postmortem biochemistry in order to obtain suitable information even in corpses with severe decompositional changes. Copyright © 2014 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Elimination of endogenous aberrant kappa chain transcripts from sp2/0-derived hybridoma cells by specific ribozyme cleavage: utility in genetic therapy of HIV-1 infections.

PubMed Central

Duan, L; Pomerantz, R J

1994-01-01

The pooled degenerate-primer polymerase chain reaction (PCR) technology is now widely used in the amplification and cloning of murine hybridoma-specific immunoglobulin gene cDNAs. The design of primers is mainly based on the highly conserved 5' terminus of immunoglobulin gene variable regions and the constant region in the 3' terminus. Of note, most murine hybridoma cell lines are derived from the Sp2/0 cell line, which is demonstrated to express endogenous aberrant kappa chains (abV kappa). This high-level endogenous abV kappa mixes with specific kappa chains in the hybridomas and interferes with the efficiency of the reverse transcriptase (RT)-PCR cloning strategy. In this report, during the cloning of murine anti-human immunodeficiency virus type I (HIV-1) hybridoma immunoglobulin cDNAs, a specific primer-PCR screening system was developed, based on the abV kappa complementarity-defining region (CDR), to eliminate abV kappa-carrying plasmids. Furthermore, an abV kappa sequence-specific derived ribozyme was developed and packaged in a retroviral expression vector system. This abV kappa ribozyme can be transduced into different murine hybridomas, and expressed intracellularly to potently eliminate endogenous abV kappa RNA. Images PMID:7816635

A Model of Risk Analysis in Analytical Methodology for Biopharmaceutical Quality Control.

PubMed

Andrade, Cleyton Lage; Herrera, Miguel Angel De La O; Lemes, Elezer Monte Blanco

2018-01-01

One key quality control parameter for biopharmaceutical products is the analysis of residual cellular DNA. To determine small amounts of DNA (around 100 pg) that may be in a biologically derived drug substance, an analytical method should be sensitive, robust, reliable, and accurate. In principle, three techniques have the ability to measure residual cellular DNA: radioactive dot-blot, a type of hybridization; threshold analysis; and quantitative polymerase chain reaction. Quality risk management is a systematic process for evaluating, controlling, and reporting of risks that may affects method capabilities and supports a scientific and practical approach to decision making. This paper evaluates, by quality risk management, an alternative approach to assessing the performance risks associated with quality control methods used with biopharmaceuticals, using the tool hazard analysis and critical control points. This tool provides the possibility to find the steps in an analytical procedure with higher impact on method performance. By applying these principles to DNA analysis methods, we conclude that the radioactive dot-blot assay has the largest number of critical control points, followed by quantitative polymerase chain reaction, and threshold analysis. From the analysis of hazards (i.e., points of method failure) and the associated method procedure critical control points, we conclude that the analytical methodology with the lowest risk for performance failure for residual cellular DNA testing is quantitative polymerase chain reaction. LAY ABSTRACT: In order to mitigate the risk of adverse events by residual cellular DNA that is not completely cleared from downstream production processes, regulatory agencies have required the industry to guarantee a very low level of DNA in biologically derived pharmaceutical products. The technique historically used was radioactive blot hybridization. However, the technique is a challenging method to implement in a quality control laboratory: It is laborious, time consuming, semi-quantitative, and requires a radioisotope. Along with dot-blot hybridization, two alternatives techniques were evaluated: threshold analysis and quantitative polymerase chain reaction. Quality risk management tools were applied to compare the techniques, taking into account the uncertainties, the possibility of circumstances or future events, and their effects upon method performance. By illustrating the application of these tools with DNA methods, we provide an example of how they can be used to support a scientific and practical approach to decision making and can assess and manage method performance risk using such tools. This paper discusses, considering the principles of quality risk management, an additional approach to the development and selection of analytical quality control methods using the risk analysis tool hazard analysis and critical control points. This tool provides the possibility to find the method procedural steps with higher impact on method reliability (called critical control points). Our model concluded that the radioactive dot-blot assay has the larger number of critical control points, followed by quantitative polymerase chain reaction and threshold analysis. Quantitative polymerase chain reaction is shown to be the better alternative analytical methodology in residual cellular DNA analysis. © PDA, Inc. 2018.

Design and integration of an all-in-one biomicrofluidic chip

PubMed Central

Liu, Liyu; Cao, Wenbin; Wu, Jingbo; Wen, Weijia; Chang, Donald Choy; Sheng, Ping

2008-01-01

We demonstrate a highly integrated microfluidic chip with the function of DNA amplification. The integrated chip combines giant electrorheological-fluid actuated micromixer and micropump with a microheater array, all formed using soft lithography. Internal functional components are based on polydimethylsiloxane (PDMS) and silver∕carbon black-PDMS composites. The system has the advantages of small size with a high degree of integration, high polymerase chain reaction efficiency, digital control and simple fabrication at low cost. This integration approach shows promise for a broad range of applications in chemical synthesis and biological sensing∕analysis, as different components can be combined to target desired functionalities, with flexible designs of different microchips easily realizable through soft lithography. PMID:19693370

Genome shuffling of Saccharomyces cerevisiae for enhanced glutathione yield and relative gene expression analysis using fluorescent quantitation reverse transcription polymerase chain reaction.

PubMed

Yin, Hua; Ma, Yanlin; Deng, Yang; Xu, Zhenbo; Liu, Junyan; Zhao, Junfeng; Dong, Jianjun; Yu, Junhong; Chang, Zongming

2016-08-01

Genome shuffling is an efficient and promising approach for the rapid improvement of microbial phenotypes. In this study, genome shuffling was applied to enhance the yield of glutathione produced by Saccharomyces cerevisiae YS86. Six isolates with subtle improvements in glutathione yield were obtained from populations generated by ultraviolet (UV) irradiation and nitrosoguanidine (NTG) mutagenesis. These yeast strains were then subjected to recursive pool-wise protoplast fusion. A strain library that was likely to yield positive colonies was created by fusing the lethal protoplasts obtained from both UV irradiation and heat treatments. After two rounds of genome shuffling, a high-yield recombinant YSF2-19 strain that exhibited 3.2- and 3.3-fold increases in glutathione production in shake flask and fermenter respectively was obtained. Comparative analysis of synthetase gene expression was conducted between the initial and shuffled strains using FQ (fluorescent quantitation) RT-PCR (reverse transcription polymerase chain reaction). Delta CT (threshold cycle) relative quantitation analysis revealed that glutathione synthetase gene (GSH-I) expression at the transcriptional level in the YSF2-19 strain was 9.9-fold greater than in the initial YS86. The shuffled yeast strain has a potential application in brewing, other food, and pharmaceutical industries. Simultaneously, the analysis of improved phenotypes will provide more valuable data for inverse metabolic engineering. Copyright © 2016 Elsevier B.V. All rights reserved.

Analysis of cytomegalovirus (CMV) viremia using the pp65 antigenemia assay, the amplicor CMV test, and a semi-quantitative polymerase chain reaction test after allogeneic marrow transplantation.

PubMed

Ksouri, H; Eljed, H; Greco, A; Lakhal, A; Torjman, L; Abdelkefi, A; Ben Othmen, T; Ladeb, S; Slim, A; Zouari, B; Abdeladhim, A; Ben Hassen, A

2007-03-01

A pp65 antigenemia assay for polymorphonuclear leukocytes (PMNLs) (CINAkit Rapid Antigenemia), and a qualitative polymerase chain reaction (PCR) test for plasma 'PCR-P qual' (Amplicor cytomegalovirus [CMV] test) were performed for 126 samples (blood and plasma) obtained from 18 bone marrow transplant patients, over a 9-month surveillance period. Among those samples, 92 were assayed with a semi-quantitative PCR test for PMNLs 'PCR-L quant.' The number of samples with a positive CMV test for antigenemia and PCR-P qual assays was 20.63% and 12.7%, respectively, whereas the PCR-L quant assay was positive in 48 of the 92 samples assayed (52.17%). The rates of concordance of the results of PCR-P qual and antigenemia, PCR-P qual and PCR-L quant, antigenemia and PCR-L quant were 92%, 65.2% and 66.8%, respectively. The analysis of the results for the 92 specimens tested by all 3 methods showed a rate of concordance of 63% among all methods. Good agreement (kappa=0.72) was found only between pp65 Ag and PCR-P qual assays. Clinical disease correlates with an antigenemia high viral load. Three patients had CMV disease despite preemptive therapy, and all of them had graft-versus-host-disease (GVHD). PMNLs-based assays are more efficient in monitoring CMV reactivation, but for high-risk patients with GVHD, more sensitive assays (real-time PCR) must be done.

Development and characterization of a synthetic DNA, NUversa, to be used as a standard in quantitative polymerase chain reactions for molecular pneumococcal serotyping.

PubMed

Sakai, Fuminori; Sonaty, Griffin; Watson, David; Klugman, Keith P; Vidal, Jorge E

2017-09-15

Identification of Streptococcus pneumoniae and its more than 90 serotypes is routinely conducted by culture and Quellung reactions. Quantitative polymerase chain reactions (qPCRs) have been developed for molecular detection, including a pan-pneumococcus lytA assay, and assays targeting 79 serotypes. Reactions require genomic DNA from every target to prepare standards, which can be time consuming. In this study, we have developed a synthetic DNA molecule as a surrogate for genomic DNA and present new single-plex qPCR reactions to increase molecular detection to 94 pneumococcal serotypes. Specificity of these new reactions was confirmed with a limit of detection between 2 and 20 genome equivalents/reaction. A synthetic DNA (NUversa, ∼8.2 kb) was then engineered to contain all available qPCR targets for serotyping and lytA. NUversa was cloned into pUC57-Amp-modified to generate pNUversa (∼10.2 kb). Standards prepared from pNUversa and NUversa were compared against standards made out of genomic DNA. Linearity [NUversa (R2 > 0.982); pNUversa (R2 > 0.991)] and efficiency of qPCR reactions were similar to those utilizing chromosomal DNA (R2 > 0.981). Quantification with plasmid pNUversa was affected, however, whereas quantification with synthetic NUversa was comparable to that of genomic DNA. Therefore, NUversa may be utilized as DNA standard in single-plex assays of the currently known 94 pneumococcal serotypes. © FEMS 2017.

A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

PubMed Central

2010-01-01

Background The hepatitis C virus (HCV) genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR) assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM), at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP)/COBAS TaqMan (CTM) assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection. PMID:20529244

Polymerase chain reaction assay for the detection of Helicobacter pylori in gastric biopsy specimens: comparison with culture, rapid urease test, and histopathological tests.

PubMed Central

Fabre, R; Sobhani, I; Laurent-Puig, P; Hedef, N; Yazigi, N; Vissuzaine, C; Rodde, I; Potet, F; Mignon, M; Etienne, J P

1994-01-01

Ulcer recurrence is probably related to residual Helicobacter pylori (H pylori). Histological examination and culture are considered to be the most specific tests. CLO test is a rapid but less specific test, which is usually used as an alternative test to culture. The aim of this study was to investigate the efficiency of a simplified polymerase chain reaction (PCR) assay as a procedure for the diagnosis of gastric H pylori infection of patients. Biopsy specimens were obtained from antral mucosa of 58 patients at endoscopy and submitted to four tests for detection of H pylori. The bacteria were found in 53%, 43%, 48%, and 50% of patients according to the results of PCR, CLO test, culture, and histological examination. Twenty three patients had both negative histology and negative culture and PCR was negative in all of these. Thirteen patients were not classified because only histology or culture was positive and 10 of these had a positive PCR test. When the diagnosis of H pylori was established by agreement with both histology and culture or three positive tests out of four, 29 patients were H pylori positive (28 having had three positive tests and one displaying positive histology and culture), and 26 were negative, and three undetermined. PCR proved the most sensitive and specific test. These results suggest the simplified PCR assay may be a valuable test for the detection of H pylori. Images p906-a PMID:8063217

Basic quantitative polymerase chain reaction using real-time fluorescence measurements.

PubMed

Ares, Manuel

2014-10-01

This protocol uses quantitative polymerase chain reaction (qPCR) to measure the number of DNA molecules containing a specific contiguous sequence in a sample of interest (e.g., genomic DNA or cDNA generated by reverse transcription). The sample is subjected to fluorescence-based PCR amplification and, theoretically, during each cycle, two new duplex DNA molecules are produced for each duplex DNA molecule present in the sample. The progress of the reaction during PCR is evaluated by measuring the fluorescence of dsDNA-dye complexes in real time. In the early cycles, DNA duplication is not detected because inadequate amounts of DNA are made. At a certain threshold cycle, DNA-dye complexes double each cycle for 8-10 cycles, until the DNA concentration becomes so high and the primer concentration so low that the reassociation of the product strands blocks efficient synthesis of new DNA and the reaction plateaus. There are two types of measurements: (1) the relative change of the target sequence compared to a reference sequence and (2) the determination of molecule number in the starting sample. The first requires a reference sequence, and the second requires a sample of the target sequence with known numbers of the molecules of sequence to generate a standard curve. By identifying the threshold cycle at which a sample first begins to accumulate DNA-dye complexes exponentially, an estimation of the numbers of starting molecules in the sample can be extrapolated. © 2014 Cold Spring Harbor Laboratory Press.

Polymerase chain reaction and DNA probe hybridization to assess the efficacy of diminazene treatment in Trypanosoma brucei-infected cattle.

PubMed

Clausen, P H; Waiswa, C; Katunguka-Rwakishaya, E; Schares, G; Steuber, S; Mehlitz, D

1999-03-01

Four of eight Ankole longhorn cattle experimentally infected with Trypanosoma brucei were treated with 7 mg/kg diminazene aceturate (Berenil, Hoechst AG, Germany) at day 71 postinfection. The trypanocidal activity was monitored using polymerase chain reaction (PCR) and DNA probe hybridization. When extracted parasite DNA (without host DNA) was used, as little as 1 fg per reaction, which is equivalent to about 1-10% of the DNA in a single trypanosome, produced a specific product that was visible as a 177-bp band in an agarose gel. In infected cattle, specific PCR products could be amplified at as early as 1 day postinfection. PCR signals remained positive during infection, except in one sample, although aparasitemic phases occurred. In cases where treatment resulted in a significant clinical improvement, PCR signals disappeared at 3-4 days after the administration of the drug. By contrast, in cattle that showed clinical signs of CNS involvement after treatment, although aparasitemic, and died before the termination of the experiment, specific products could be amplified on several occasions following treatment. The PCR signals generated after treatment could be further enhanced by subsequent slot-blot hybridization with a T. brucei-specific DNA probe. We conclude that PCR coupled with DNA probe hybridization provides a highly sensitive tool for the assessment of therapeutic efficiency and disease progression in trypanosome infections, especially in chronic infections when the level of parasitemia is low or when trypanosomes are sequestered at cryptic sites.

High-throughput real-time quantitative reverse transcription PCR.

PubMed

Bookout, Angie L; Cummins, Carolyn L; Mangelsdorf, David J; Pesola, Jean M; Kramer, Martha F

2006-02-01

Extensive detail on the application of the real-time quantitative polymerase chain reaction (QPCR) for the analysis of gene expression is provided in this unit. The protocols are designed for high-throughput, 384-well-format instruments, such as the Applied Biosystems 7900HT, but may be modified to suit any real-time PCR instrument. QPCR primer and probe design and validation are discussed, and three relative quantitation methods are described: the standard curve method, the efficiency-corrected DeltaCt method, and the comparative cycle time, or DeltaDeltaCt method. In addition, a method is provided for absolute quantification of RNA in unknown samples. RNA standards are subjected to RT-PCR in the same manner as the experimental samples, thus accounting for the reaction efficiencies of both procedures. This protocol describes the production and quantitation of synthetic RNA molecules for real-time and non-real-time RT-PCR applications.

Advanced DNA-Based Point-of-Care Diagnostic Methods for Plant Diseases Detection.

PubMed

Lau, Han Yih; Botella, Jose R

2017-01-01

Diagnostic technologies for the detection of plant pathogens with point-of-care capability and high multiplexing ability are an essential tool in the fight to reduce the large agricultural production losses caused by plant diseases. The main desirable characteristics for such diagnostic assays are high specificity, sensitivity, reproducibility, quickness, cost efficiency and high-throughput multiplex detection capability. This article describes and discusses various DNA-based point-of care diagnostic methods for applications in plant disease detection. Polymerase chain reaction (PCR) is the most common DNA amplification technology used for detecting various plant and animal pathogens. However, subsequent to PCR based assays, several types of nucleic acid amplification technologies have been developed to achieve higher sensitivity, rapid detection as well as suitable for field applications such as loop-mediated isothermal amplification, helicase-dependent amplification, rolling circle amplification, recombinase polymerase amplification, and molecular inversion probe. The principle behind these technologies has been thoroughly discussed in several review papers; herein we emphasize the application of these technologies to detect plant pathogens by outlining the advantages and disadvantages of each technology in detail.

Advanced DNA-Based Point-of-Care Diagnostic Methods for Plant Diseases Detection

PubMed Central

Lau, Han Yih; Botella, Jose R.

2017-01-01

Diagnostic technologies for the detection of plant pathogens with point-of-care capability and high multiplexing ability are an essential tool in the fight to reduce the large agricultural production losses caused by plant diseases. The main desirable characteristics for such diagnostic assays are high specificity, sensitivity, reproducibility, quickness, cost efficiency and high-throughput multiplex detection capability. This article describes and discusses various DNA-based point-of care diagnostic methods for applications in plant disease detection. Polymerase chain reaction (PCR) is the most common DNA amplification technology used for detecting various plant and animal pathogens. However, subsequent to PCR based assays, several types of nucleic acid amplification technologies have been developed to achieve higher sensitivity, rapid detection as well as suitable for field applications such as loop-mediated isothermal amplification, helicase-dependent amplification, rolling circle amplification, recombinase polymerase amplification, and molecular inversion probe. The principle behind these technologies has been thoroughly discussed in several review papers; herein we emphasize the application of these technologies to detect plant pathogens by outlining the advantages and disadvantages of each technology in detail. PMID:29375588

Hybridization chain reaction: a versatile molecular tool for biosensing, bioimaging, and biomedicine.

PubMed

Bi, Sai; Yue, Shuzhen; Zhang, Shusheng

2017-07-17

Developing powerful, simple and low-cost DNA amplification techniques is of great significance to bioanalysis and biomedical research. Thus far, many signal amplification strategies have been developed, such as polymerase chain reaction (PCR), rolling circle amplification (RCA), and DNA strand displacement amplification (SDA). In particular, hybridization chain reaction (HCR), a type of toehold-mediated strand displacement (TMSD) reaction, has attracted great interest because of its enzyme-free nature, isothermal conditions, simple protocols, and excellent amplification efficiency. In a typical HCR, an analyte initiates the cross-opening of two DNA hairpins, yielding nicked double helices that are analogous to alternating copolymers. As an efficient amplification platform, HCR has been utilized for the sensitive detection of a wide variety of analytes, including nucleic acids, proteins, small molecules, and cells. In recent years, more complicated sets of monomers have been designed to develop nonlinear HCR, such as branched HCR and even dendritic systems, achieving quadratic and exponential growth mechanisms. In addition, HCR has attracted enormous attention in the fields of bioimaging and biomedicine, including applications in fluorescence in situ hybridization (FISH) imaging, live cell imaging, and targeted drug delivery. In this review, we introduce the fundamentals of HCR and examine the visualization and analysis techniques for HCR products in detail. The most recent HCR developments in biosensing, bioimaging, and biomedicine are subsequently discussed with selected examples. Finally, the review provides insight into the challenges and future perspectives of HCR.

RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

EPA Science Inventory

Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

Designing primers and evaluation of the efficiency of propidium monoazide - Quantitative polymerase chain reaction for counting the viable cells of Lactobacillus gasseri and Lactobacillus salivarius.

PubMed

Lai, Chieh-Hsien; Wu, Sih-Rong; Pang, Jen-Chieh; Ramireddy, Latha; Chiang, Yu-Cheng; Lin, Chien-Ku; Tsen, Hau-Yang

2017-07-01

The purpose of this study is to evaluate the efficiency of using propidium monoazide (PMA) real-time quantitative polymerase chain reaction (qPCR) to count the viable cells of Lactobacillus gasseri and Lactobacillus salivarius in probiotic products. Based on the internal transcription spacer and 23S rRNA genes, two primer sets specific for these two Lactobacillus species were designed. For a probiotic product, the total deMan Rogosa Sharpe plate count was 8.65±0.69 log CFU/g, while for qPCR, the cell counts of L. gasseri and L. salivarius were 8.39±0.14 log CFU/g and 8.57±0.24 log CFU/g, respectively. Under the same conditions, for its heat-killed product, qPCR counts for L. gasseri and L. salivarius were 6.70±0.16 log cells/g and 7.67±0.20 log cells/g, while PMA-qPCR counts were 5.33±0.18 log cells/g and 5.05±0.23 log cells/g, respectively. For cell dilutions with a viable cell count of 8.5 log CFU/mL for L. gasseri and L. salivarius, after heat killing, the PMA-qPCR count for both Lactobacillus species was near 5.5 log cells/mL. When the PMA-qPCR counts of these cell dilutions were compared before and after heat killing, although some DNA might be lost during the heat killing, significant qPCR signals from dead cells, i.e., about 4-5 log cells/mL, could not be reduced by PMA treatment. Increasing PMA concentrations from 100 μM to 200 μM or light exposure time from 5 minutes to 15 minutes had no or, if any, only minor effect on the reduction of qPCR signals from their dead cells. Thus, to differentiate viable lactic acid bacterial cells from dead cells using the PMA-qPCR method, the efficiency of PMA to reduce the qPCR signals from dead cells should be notable. Copyright © 2016. Published by Elsevier B.V.

Palm Mutants in DNA Polymerases α and η Alter DNA Replication Fidelity and Translesion Activity

PubMed Central

Niimi, Atsuko; Limsirichaikul, Siripan; Yoshida, Shonen; Iwai, Shigenori; Masutani, Chikahide; Hanaoka, Fumio; Kool, Eric T.; Nishiyama, Yukihiro; Suzuki, Motoshi

2004-01-01

We isolated active mutants in Saccharomyces cerevisiae DNA polymerase α that were associated with a defect in error discrimination. Among them, L868F DNA polymerase α has a spontaneous error frequency of 3 in 100 nucleotides and 570-fold lower replication fidelity than wild-type (WT) polymerase α. In vivo, mutant DNA polymerases confer a mutator phenotype and are synergistic with msh2 or msh6, suggesting that DNA polymerase α-dependent replication errors are recognized and repaired by mismatch repair. In vitro, L868F DNA polymerase α catalyzes efficient bypass of a cis-syn cyclobutane pyrimidine dimer, extending the 3′ T 26,000-fold more efficiently than the WT. Phe34 is equivalent to residue Leu868 in translesion DNA polymerase η, and the F34L mutant of S. cerevisiae DNA polymerase η has reduced translesion DNA synthesis activity in vitro. These data suggest that high-fidelity DNA synthesis by DNA polymerase α is required for genomic stability in yeast. The data also suggest that the phenylalanine and leucine residues in translesion and replicative DNA polymerases, respectively, might have played a role in the functional evolution of these enzyme classes. PMID:15024063

relA-dependent RNA polymerase activity in Escherichia coli.

PubMed Central

Ryals, J; Bremer, H

1982-01-01

Parameters relating to RNA synthesis were measured after a temperature shift from 30 to 42 degrees C, in a relA+ and relA- isogenic pair of Escherichia coli strains containing a temperature-sensitive valyl tRNA synthetase. The following results were obtained: (i) the rRNA chain growth rate increased 2-fold in both strains; (ii) newly synthesized rRNA became unstable in both strains; (iii) the stable RNA gene activity (rRNA and tRNA, measured as stable RNA synthesis rate relative to the total instantaneous rate of RNA synthesis) decreased 1.7-fold in the relA+ strain and increased 1.9-fold in the relA mutant; and (iv) the RNA polymerase activity (measured by the percentage of total RNA polymerase enzyme active in transcription an any instant) decreased from 20 to 3.6% in the relA+ strain and remained unchanged (or increased at most to 22%) in the relA mutant. It is suggested that both rRNA gene activity and the RNA polymerase activity depend on the intracellular concentration of guanosine tetraphosphate, whereas the altered chain elongation rate and stability of rRNA are temperature or amino acid starvation effects, respectively, without involvement of relA function. PMID:6174501

Kinetic and Structural Impact of Metal Ions and Genetic Variations on Human DNA Polymerase ι.

PubMed

Choi, Jeong-Yun; Patra, Amritaj; Yeom, Mina; Lee, Young-Sam; Zhang, Qianqian; Egli, Martin; Guengerich, F Peter

2016-09-30

DNA polymerase (pol) ι is a Y-family polymerase involved in translesion synthesis, exhibiting higher catalytic activity with Mn 2+ than Mg 2+ The human germline R96G variant impairs both Mn 2+ -dependent and Mg 2+ -dependent activities of pol ι, whereas the Δ1-25 variant selectively enhances its Mg 2+ -dependent activity. We analyzed pre-steady-state kinetic and structural effects of these two metal ions and genetic variations on pol ι using pol ι core (residues 1-445) proteins. The presence of Mn 2+ (0.15 mm) instead of Mg 2+ (2 mm) caused a 770-fold increase in efficiency (k pol /K d ,dCTP ) of pol ι for dCTP insertion opposite G, mainly due to a 450-fold decrease in K d ,dCTP The R96G and Δ1-25 variants displayed a 53-fold decrease and a 3-fold increase, respectively, in k pol /K d ,dCTP for dCTP insertion opposite G with Mg 2+ when compared with wild type, substantially attenuated by substitution with Mn 2+ Crystal structures of pol ι ternary complexes, including the primer terminus 3'-OH and a non-hydrolyzable dCTP analogue opposite G with the active-site Mg 2+ or Mn 2+ , revealed that Mn 2+ achieves more optimal octahedral coordination geometry than Mg 2+ , with lower values in average coordination distance geometry in the catalytic metal A-site. Crystal structures of R96G revealed the loss of three H-bonds of residues Gly-96 and Tyr-93 with an incoming dNTP, due to the lack of an arginine, as well as a destabilized Tyr-93 side chain secondary to the loss of a cation-π interaction between both side chains. These results provide a mechanistic basis for alteration in pol ι catalytic function with coordinating metals and genetic variation. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Kinetic and Structural Impact of Metal Ions and Genetic Variations on Human DNA Polymerase ι*

PubMed Central

Choi, Jeong-Yun; Patra, Amritaj; Yeom, Mina; Lee, Young-Sam; Zhang, Qianqian; Egli, Martin; Guengerich, F. Peter

2016-01-01

DNA polymerase (pol) ι is a Y-family polymerase involved in translesion synthesis, exhibiting higher catalytic activity with Mn2+ than Mg2+. The human germline R96G variant impairs both Mn2+-dependent and Mg2+-dependent activities of pol ι, whereas the Δ1–25 variant selectively enhances its Mg2+-dependent activity. We analyzed pre-steady-state kinetic and structural effects of these two metal ions and genetic variations on pol ι using pol ι core (residues 1–445) proteins. The presence of Mn2+ (0.15 mm) instead of Mg2+ (2 mm) caused a 770-fold increase in efficiency (kpol/Kd,dCTP) of pol ι for dCTP insertion opposite G, mainly due to a 450-fold decrease in Kd,dCTP. The R96G and Δ1–25 variants displayed a 53-fold decrease and a 3-fold increase, respectively, in kpol/Kd,dCTP for dCTP insertion opposite G with Mg2+ when compared with wild type, substantially attenuated by substitution with Mn2+. Crystal structures of pol ι ternary complexes, including the primer terminus 3′-OH and a non-hydrolyzable dCTP analogue opposite G with the active-site Mg2+ or Mn2+, revealed that Mn2+ achieves more optimal octahedral coordination geometry than Mg2+, with lower values in average coordination distance geometry in the catalytic metal A-site. Crystal structures of R96G revealed the loss of three H-bonds of residues Gly-96 and Tyr-93 with an incoming dNTP, due to the lack of an arginine, as well as a destabilized Tyr-93 side chain secondary to the loss of a cation-π interaction between both side chains. These results provide a mechanistic basis for alteration in pol ι catalytic function with coordinating metals and genetic variation. PMID:27555320

Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

PubMed

Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

2009-01-01

A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

USGS Publications Warehouse

Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

2011-01-01

Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

Gonorrhoea of the sigmoid neovagina in a male-to-female transgender.

PubMed

van der Sluis, Wouter B; Bouman, Mark-Bram; Gijs, Luk; van Bodegraven, Adriaan A

2015-07-01

A 33-year-old male-to-female transgender consulted our outpatient clinic with perneovaginal bleeding during and following coitus. Four years before, she underwent a total laparoscopic sigmoid neovaginoplasty. Physical, histological and endoscopic examination revealed neither focus of active bleeding nor signs of active inflammation. A polymerase chain reaction test performed on a neovaginal swab showed gonococcal infection. Treatment consisted of 500 mg intramuscular ceftriaxone. Three weeks later, our patient reported resolution of symptoms, consistent with eradication of the infection demonstrated by a follow-up neovaginal swab polymerase chain reaction. To our knowledge, this is the first case report of gonococcal infection of the sigmoid neovagina. © The Author(s) 2014.

Multiple papillomas in a diamond python, Morelia spilota spilota.

PubMed

Gull, Jessica M; Lange, Christian E; Favrot, Claude; Dorrestein, Gerry M; Hatt, Jean-Michel

2012-12-01

A 4-yr-old male diamond python (Morelia spilota spilota) was evaluated for multiple black papillated exophytic skin proliferations and signs of pneumonia. The histopathologic structure of the skin biopsy specimens led to the diagnosis of a benign papilloma-like neoplasia. In this case, papillomavirus DNA could be amplified from a biopsy sample with a broad range polymerase chain reaction. Nested pan-herpes polymerase chain reaction was negative, and herpesvirus inclusion bodies were not found. Because of the histologically benign nature of the papilloma, the skin proliferations were left untreated. Ten mo after the first presentation, the skin lesions had regressed almost completely; 34 mo later, only scars from the biopsies were left.

Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest

Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required formore » PCR.« less

Detection of trypanosomatid Phytomonas parasitic in plants by polymerase chain reaction amplification of small subunit ribosomal DNA.

PubMed

Teixeira, M M; Campaner, M; Camargo, E P

1994-01-01

To improve the diagnosis of Phytomonas infections in plants, we developed a polymerase chain reaction (PCR) assay using synthetic oligonucleotides complementary to conserved sequences of the 18S small subunit ribosomal (SSU) gene. From 10 ng upward of DNA of cultures of Phytomonas isolated from plants, fruits, and insects, PCR amplified an 800-bp DNA band that, after restriction analysis and probe hybridization, proved to be of 18S rDNA Phytomonas origin. PCR was also done with sap samples of tomatoes experimentally infected with Phytomonas, yielding amplified 800-bp ribosomal DNA bands before any flagellate could be detected by microscopic examination of the fruit sap.

Diagnostic exercise: chronic vomiting in a dog.

PubMed

Ellis, A E; Brown, C A; Miller, D L

2010-09-01

An approximately one-and-a-half-year-old, neutered male, mixed-breed dog was presented for a chronic history of vomiting. Profuse diarrhea was also noted during examination. An exploratory laparotomy was performed, bone chips were removed from the stomach, and a raised, circular area of gastric mucosa was biopsied. Histologically, there was severe gastric cryptosporidiosis as well as numerous spiral bacteria, consistent with Helicobacter spp. Polymerase chain reaction revealed visible bands for the 18S ribosomal RNA gene for Cryptosporidium spp. The polymerase chain reaction product was sequenced and was found to be most similar to Cryptosporidium muris. Both the gastric location and the species of Cryptosporidium are unusual in a dog.

Vertebral Osteomyelitis Caused by Helicobacter cinaedi Identified Using Broad-range Polymerase Chain Reaction with Sequencing of the Biopsied Specimen.

PubMed

Hase, Ryota; Hirooka, Takuya; Itabashi, Takashi; Endo, Yasunobu; Otsuka, Yoshihito

2018-05-15

A 65-year-old man presented with gradually exacerbating low back pain. Magnetic resonance imaging revealed vertebral osteomyelitis in the Th11-L2 vertebral bodies and discs. The patient showed negative findings on conventional cultures. Direct broad-range polymerase chain reaction (PCR) with sequencing of the biopsied specimen had the highest similarity to the 16S rRNA gene of Helicobacter cinaedi. This case suggests that direct broad-range PCR with sequencing should be considered when conventional cultures cannot identify the causative organism of vertebral osteomyelitis, and that this method may be particularly useful when the pathogen is a fastidious organism, such as H. cinaedi.

Transformation of soybean Gy3 gene into Artemisaarenaria mediated by corona discharge

NASA Astrophysics Data System (ADS)

Chao, Lu-meng; Na, Ri; Xue, Dan; Xu, Yongze; Liu, Teng

2013-03-01

In order to improve the protein content of desert plant, a method of genetic transformation mediated by corona discharge was established. Artemisia seeds were processed in corona electric field for 120 min at 12 kV, and then soaked in 0.1 SSC media that contained Soybean Gy3 gene DNA to incubate for 12 h at 26 °C. Finally the seeds were inoculated on the differentiation medium. Polymerase Chain Reaction (PCR) and Reverse Transcription Polymerase Chain Reaction (RT-PCR) detection showed that the Soybean Gy3 gene had been successfully introduced into genomic DNA of the regenerated plants of Artemisaarenaria. The study provided a new way for corona discharge in plant genetic modification.

Cerebral Toxoplasmosis Diagnosed by Nested-polymerase Chain Reaction in a Patient with Rheumatoid Arthritis.

PubMed

Matsuura, Jun; Fujii, Akihiro; Mizuta, Ikuko; Norose, Kazumi; Mizuno, Toshiki

2018-05-15

A 65-year-old woman with rheumatoid arthritis (RA) visited our hospital because of right facial sensory hypoesthesia. Cerebral toxoplasmosis was suspected on brain magnetic resonance imaging. We discontinued methotrexate for RA and started a sulfamethoxazole/trimethoprim (ST) mixture. Although ST treatment was interrupted because of adverse reactions, her prognosis was favorable. The Toxoplasma 18S rDNA gene was detected by nested-polymerase chain reaction (PCR) from blood and cerebrospinal fluid. Detecting the Toxoplasma 18S rDNA gene by nested-PCR is useful for the diagnosis and safer than a brain biopsy. In addition, the discontinuation of immunosuppressants may be recommended in patients compromised by those immunosuppressants.

Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus

PubMed Central

Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.

2004-01-01

A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703

Detection of coliform bacteria and Escherichia coli by multiplex polymerase chain reaction: comparison with defined substrate and plating methods for water quality monitoring.

PubMed Central

Bej, A K; McCarty, S C; Atlas, R M

1991-01-01

Multiplex polymerase chain reaction (PCR) and gene probe detection of target lacZ and uidA genes were used to detect total coliform bacteria and Escherichia coli, respectively, for determining water quality. In tests of environmental water samples, the lacZ PCR method gave results statistically equivalent to those of the plate count and defined substrate methods accepted by the U.S. Environmental Protection Agency for water quality monitoring and the uidA PCR method was more sensitive than 4-methylumbelliferyl-beta-D-glucuronide-based defined substrate tests for specific detection of E. coli. Images PMID:1768116

Nested methylation-specific polymerase chain reaction cancer detection method

DOEpatents

Belinsky, Steven A [Albuquerque, NM; Palmisano, William A [Edgewood, NM

2007-05-08

A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

Vascular endothelial growth factor and platelet-derived growth factor are potential angiogenic and metastatic factors in human breast cancer.

PubMed

Anan, K; Morisaki, T; Katano, M; Ikubo, A; Kitsuki, H; Uchiyama, A; Kuroki, S; Tanaka, M; Torisu, M

1996-03-01

Angiogenesis is a prerequisite for tumor growth and metastasis. Tumor angiogenesis may be mediated by several angiogenic factors such as vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF), transforming growth factor-alpha, and basic fibroblast growth factor. Differential mRNA expressions of VEGF, PDGF (A chain), transforming growth factor-alpha and basic fibroblast growth factor in 32 primary invasive breast tumors were examined by reverse transcriptase-polymerase chain reaction. We analyzed relationships between mRNA expressions of these angiogenic factors and the degree of angiogenesis, tumor size, and metastasis. Quantification of angiogenesis was achieved by the immunohistochemical staining of endothelial cells with antibody to CD31. VEGF and PDGF-A mRNAs were expressed more frequently in breast tumors than in nontumor breast tissues, whereas no difference was found in expression frequency of either transforming growth factor-alpha or basic fibroblast growth factor mRNA. Vascular counts in tumors correlated with each expression frequency of VEGF and PDGF-A mRNA. PDGF-A mRNA was expressed more frequently in tumors with lymph node metastasis than in those without metastasis. Expression of VEGF and PDGF mRNAs detected by reverse transcriptase-polymerase chain reaction in breast tumors correlates with tumor-related characteristics of angiogenesis and metastatic potential. Analysis of these mRNAs by reverse transcriptase-polymerase chain reaction may be useful for assessing the biologic behavior of a breast tumor before surgical treatment.

Lesion bypass by S. cerevisiae Pol ζ alone

PubMed Central

Stone, Jana E.; Kumar, Dinesh; Binz, Sara K.; Inase, Aki; Iwai, Shigenori; Chabes, Andrei; Burgers, Peter M.; Kunkel, Thomas A.

2011-01-01

DNA polymerase zeta (Pol ζ) participates in translesion synthesis (TLS) of DNA adducts that stall replication fork progression. Previous studies have led to the suggestion that the primary role of Pol ζ in TLS is to extend primers created when another DNA polymerase inserts nucleotides opposite lesions. Here we test the non-exclusive possibility that Pol ζ can sometimes perform TLS in the absence of any other polymerase. To do so, we quantified the efficiency with which S. cerevisiae Pol ζ bypasses abasic sites, cis-syn cyclobutane pyrimidine dimers and (6-4) photoproducts. In reactions containing dNTP concentrations that mimic those induced by DNA damage, a Pol ζ derivative with phenylalanine substituted for leucine 979 at the polymerase active site bypasses all three lesions at efficiencies between 27–73%. Wild-type Pol ζ also bypasses these lesions, with efficiencies that are lower and depend on the sequence context in which the lesion resides. The results are consistent with the hypothesis that, in addition to extending aberrant termini created by other DNA polymerases, Pol ζ has the potential to be the sole DNA polymerase involved in TLS. PMID:21622032

A New Method to Develop Human Dental Pulp Cells and Platelet-rich Fibrin Complex.

PubMed

He, Xuan; Chen, Wen-Xia; Ban, Guifei; Wei, Wei; Zhou, Jun; Chen, Wen-Jin; Li, Xian-Yu

2016-11-01

Platelet-rich fibrin (PRF) has been used as a scaffold material in various tissue regeneration studies. In the previous methods to combine seed cells with PRF, the structure of PRF was damaged, and the manipulation time in vitro was also increased. The objective of this in vitro study was to explore an appropriate method to develop a PRF-human dental pulp cell (hDPC) complex to maintain PRF structure integrity and to find out the most efficient part of PRF. The PRF-hDPC complex was developed at 3 different time points during PRF preparation: (1) the before centrifugation (BC) group, the hDPC suspension was added to the venous blood before blood centrifugation; (2) the immediately after centrifugation (IAC) group, the hDPC suspension was added immediately after blood centrifugation; (3) the after centrifugation (AC) group, the hDPC suspension was added 10 minutes after blood centrifugation; and (4) the control group, PRF without hDPC suspension. The prepared PRF-hDPC complexes were cultured for 7 days. The samples were fixed for histologic, immunohistochemistry, and scanning electron microscopic evaluation. Real-time polymerase chain reaction was performed to evaluate messenger RNA expression of alkaline phosphatase and dentin sialophosphoprotein. Enzyme-linked immunosorbent assay quantification for growth factors was performed within the different parts of the PRF. Histologic, immunohistochemistry, and scanning electron microscopic results revealed that hDPCs were only found in the BC group and exhibited favorable proliferation. Real-time polymerase chain reaction revealed that alkaline phosphatase and dentin sialophosphoprotein expression increased in the cultured PRF-hDPC complex. The lower part of the PRF released the maximum quantity of growth factors. Our new method to develop a PRF-hDPCs complex maintained PRF structure integrity. The hDPCs were distributed in the buffy coat, which might be the most efficient part of PRF. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Detection of feline coronavirus in cheetah (Acinonyx jubatus) feces by reverse transcription-nested polymerase chain reaction in cheetahs with variable frequency of viral shedding.

PubMed

Gaffney, Patricia M; Kennedy, Melissa; Terio, Karen; Gardner, Ian; Lothamer, Chad; Coleman, Kathleen; Munson, Linda

2012-12-01

Cheetahs (Acinonyx jubatus) are a highly threatened species because of habitat loss, human conflict, and high prevalence of disease in captivity. An epidemic of feline infectious peritonitis and concern for spread of infectious disease resulted in decreased movement of cheetahs between U.S. zoological facilities for managed captive breeding. Identifying the true feline coronavirus (FCoV) infection status of cheetahs is challenging because of inconsistent correlation between seropositivity and fecal viral shedding. Because the pattern of fecal shedding of FCoV is unknown in cheetahs, this study aimed to assess the frequency of detectable fecal viral shedding in a 30-day period and to determine the most efficient fecal sampling strategy to identify cheetahs shedding FCoV. Fecal samples were collected from 16 cheetahs housed at seven zoological facilities for 30 to 46 consecutive days; the samples were evaluated for the presence of FCoV by reverse transcription-nested polymerase chain reaction (RT-nPCR). Forty-four percent (7/16) of cheetahs had detectable FCoV in feces, and the proportion of positive samples for individual animals ranged from 13 to 93%. Cheetahs shed virus persistently, intermittently, or rarely over 30-46 days. Fecal RT-nPCR results were used to calculate the probability of correctly identifying a cheetah known to shed virus given multiple hypothetical fecal collection schedules. The most efficient hypothetical fecal sample collection schedule was evaluation of five individual consecutive fecal samples, resulting in a 90% probability of identifying a known shedder. Demographic and management risk factors were not significantly associated (P < or = 0.05) with fecal viral shedding. Because some cheetahs shed virus intermittently to rarely, fecal sampling schedules meant to identify all known shedders would be impractical with current tests and eradication of virus from the population unreasonable. Managing the captive population as endemically infected with FCoV may be a more feasible approach.

A molecular tool for detection and tracking of a potential indigenous Beauveria bassiana strain for managing emerald ash borer populations in Canada.

PubMed

Johny, Shajahan; Kyei-Poku, George

2014-10-01

Emerald ash borer is an invasive species from Asia. Beauveria bassiana strain L49-1AA is being tested for the control of emerald ash borer in Canada, using an autocontamination trapping system. We have developed a simplified allele discrimination polymerase chain reaction (PCR) assay to screen B. bassiana strain, L49-1AA from other Beauveria species by targeting the inter-strain genetic differences in 5' end of EF1-α gene of the genus Beauveria. A single nucleotide polymorphism (SNP) site, T→C was identified only in L49-1AA and was used to develop a simplified allele discrimination polymerase chain reaction (PCR) assay based on a modified allelic inhibition of displacement activity (AIDA) approach for distinguishing B. bassiana L49-1AA from all background Beauveria isolates. The SNP site was employed to design inner primers but with a deliberate mismatch introduced at the 3' antepenultimate from the mutation site in order to maximize specificity and detection efficiency. Amplification was specific to L49-1AA without cross-reaction with DNA from other Beauveria strains. In addition, the designed primers were also tested against environmental samples in L49-1AA released plots and observed to be highly efficient in detecting and discriminating the target strain, L49-1AA from both pure and crude DNA samples. This new method can potentially allow for more discriminatory tracking and monitoring of released L49-1AA in our autocontamination and dissemination projects for managing EAB populations. Additionally, the modified-AIDA format has potential as a tool for simultaneously identifying and differentiating closely related Beauveria species, strains/isolates as well as general classification of other pathogens or organisms. Crown Copyright © 2014. Published by Elsevier Inc. All rights reserved.

Real Time Polymerase Chain Reaction (rt-PCR): A New Patent to Diagnostic Purposes for Paracoccidioidomycosis.

PubMed

Rocha-Silva, Fabiana; Gomes, Luciana I; Gracielle-Melo, Cidiane; Goes, Alfredo M; Caligiorne, Rachel B

2017-01-01

Paracoccidioidomycosis (PCM) is a systemic mycosis caused by dimorphic fungi Paracoccidioides brasiliensis and Paracoccidioides lutzii. It is prevalent in Latin American, mainly in Brazil. Therefore, PCM has fundamental impact on the Brazilian global economy, especially in public health system, since it is affecting economical active population in different country regions. The present study aimed to standardize the Real Time-Polymerase Chain Reaction (rt-PCR) for an efficient and safe PCM diagnosis amplifying the recombinant protein PB27 gene, only expressed by specimens of Paracoccidioides genus. To standardize a methodology of rt-PCR using species-specific primers and probe designed for annealing in this specific region of the fungi´s genome, amplifying the recombinant protein PB27 gene, only expressed by specimens of Paracoccidioides genus. Followed by design in silico, experiments were performed in vitro to determine rt-PCR specificity, efficiency and genome detection limit. The primers and probe sequences were deposited in Brazilian Coordination of Technological Innovation and Transfer (CTIT), under patent reference number BR1020160078830. The present study demonstrated the rt-PCR applicability for support on diagnosis of paracoccidioidomycosis, presenting low cost, which makes it affordable for public health services in developing countries as Brazil. It is noteworthy that it is necessary to validate this methodology using clinical samples before to use as a safe method of diagnosis. A review of all patents related to this topic was performed and it was shown that, to date, there are no records of patent on kits for paracoccidioidomycosis´s diagnostic. Indeed, there is still a lot to go to reach this goal. The reaction developed was standardized and patented, opening perspectives to molecular diagnosis development for paracoccidioidomycosis, since rt-PCR can be applied to a broad spectrum of infectious diseases. It would need to be tested in biological samples in order to validate this method and then generate a diagnostic kit for Paracoccidioidomycosis. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Aneuploidy screening of embryonic stem cell clones by metaphase karyotyping and droplet digital polymerase chain reaction.

PubMed

Codner, Gemma F; Lindner, Loic; Caulder, Adam; Wattenhofer-Donzé, Marie; Radage, Adam; Mertz, Annelyse; Eisenmann, Benjamin; Mianné, Joffrey; Evans, Edward P; Beechey, Colin V; Fray, Martin D; Birling, Marie-Christine; Hérault, Yann; Pavlovic, Guillaume; Teboul, Lydia

2016-08-05

Karyotypic integrity is essential for the successful germline transmission of alleles mutated in embryonic stem (ES) cells. Classical methods for the identification of aneuploidy involve cytological analyses that are both time consuming and require rare expertise to identify mouse chromosomes. As part of the International Mouse Phenotyping Consortium, we gathered data from over 1,500 ES cell clones and found that the germline transmission (GLT) efficiency of clones is compromised when over 50 % of cells harbour chromosome number abnormalities. In JM8 cells, chromosomes 1, 8, 11 or Y displayed copy number variation most frequently, whilst the remainder generally remain unchanged. We developed protocols employing droplet digital polymerase chain reaction (ddPCR) to accurately quantify the copy number of these four chromosomes, allowing efficient triage of ES clones prior to microinjection. We verified that assessments of aneuploidy, and thus decisions regarding the suitability of clones for microinjection, were concordant between classical cytological and ddPCR-based methods. Finally, we improved the method to include assay multiplexing so that two unstable chromosomes are counted simultaneously (and independently) in one reaction, to enhance throughput and further reduce the cost. We validated a PCR-based method as an alternative to classical karyotype analysis. This technique enables laboratories that are non-specialist, or work with large numbers of clones, to precisely screen ES cells for the most common aneuploidies prior to microinjection to ensure the highest level of germline transmission potential. The application of this method allows early exclusion of aneuploid ES cell clones in the ES cell to mouse conversion process, thus improving the chances of obtaining germline transmission and reducing the number of animals used in failed microinjection attempts. This method can be applied to any other experiments that require accurate analysis of the genome for copy number variation (CNV).

Development of a CMOS-compatible PCR chip: comparison of design and system strategies

NASA Astrophysics Data System (ADS)

Erill, Ivan; Campoy, Susana; Rus, José; Fonseca, Luis; Ivorra, Antoni; Navarro, Zenón; Plaza, José A.; Aguiló, Jordi; Barbé, Jordi

2004-11-01

In the last decade research in chips for DNA amplification through the polymerase chain reaction (PCR) has been relatively abundant, but has taken very diverse approaches, leaving little common ground for a straightforward comparison of results. Here we report the development of a line of PCR chips that is fully compatible with complementary-metal-oxide-semiconductor (CMOS) technology and its revealing use as a general platform to test and compare a wide range of experimental parameters involved in PCR-chip design and operation. Peltier-heated and polysilicon thin-film driven PCR chips have been produced and directly compared in terms of efficiency, speed and power consumption, showing that thin-film systems run faster and more efficiently than Peltier-based ones, but yield inferior PCR products. Serpentine-like chamber designs have also been compared with standard rectangular designs and with the here reported rhomboidal chamber shape, showing that serpentine-like chambers do not have detrimental effects in PCR efficiency when using non-flow-through schemes, and that chamber design has a strong impact on sample insertion/extraction yields. With an accurate temperature control (±0.2 °C) we have optimized reaction kinetics to yield sound PCR amplifications of 25 µl mixtures in 20 min and with 24.4 s cycle times, confirming that a titrated amount of bovine albumin serum (BSA, 2.5 µg µl-1) is essential to counteract polymerase adsorption at chip walls. The reported use of a CMOS-compatible technological process paves the way for an easy adaption to foundry requirements and for a scalable integration of electro-optic detection and control circuitry.

Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis.

PubMed

Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui

2016-05-01

In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.

Infectious agent screening in canine blood donors in the United Kingdom.

PubMed

Crawford, K; Walton, J; Lewis, D; Tasker, S; Warman, S M

2013-08-01

Transfusion of blood products is an important component of veterinary emergency medicine. Donors must be carefully selected to minimise risk of transmission of blood-borne infectious agents. This study was devised to assess the prevalence of such agents in healthy, non-travelled UK dogs screened as prospective donors. Ethylenediaminetetraacetic acid blood samples from dogs donating blood between August 2007 and January 2012 were screened by polymerase chain reaction for haemotropic mycoplasmas, Bartonella, Babesia, Leishmania, Ehrlichia and Anaplasma spp. Dogs with positive or inconclusive results underwent repeat polymerase chain reaction testing. Four of 262 dogs had positive or inconclusive results at initial screening. Repeat polymerase chain reaction testing in each dog was negative, and none of the dogs developed clinical signs of disease. The positive results on initial screening may have represented false positives from sample contamination or amplification of non-target DNA. It is also possible that dogs were infected at initial sampling but successfully cleared infection before repeat testing. The low number of positive results obtained suggests that prevalence of these agents in a population of healthy UK dogs is low and that use of blood products is unlikely to represent a significant risk of transmission of these diseases. © 2013 British Small Animal Veterinary Association.

Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

PubMed

Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

2015-04-01

Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Digital PCR Quantitation of Muscle Mitochondrial DNA: Age, Fiber Type, and Mutation-Induced Changes.

PubMed

Herbst, Allen; Widjaja, Kevin; Nguy, Beatrice; Lushaj, Entela B; Moore, Timothy M; Hevener, Andrea L; McKenzie, Debbie; Aiken, Judd M; Wanagat, Jonathan

2017-10-01

Definitive quantitation of mitochondrial DNA (mtDNA) and mtDNA deletion mutation abundances would help clarify the role of mtDNA instability in aging. To more accurately quantify mtDNA, we applied the emerging technique of digital polymerase chain reaction to individual muscle fibers and muscle homogenates from aged rodents. Individual fiber mtDNA content correlated with fiber type and decreased with age. We adapted a digital polymerase chain reaction deletion assay that was accurate in mixing experiments to a mutation frequency of 0.03% and quantitated an age-induced increase in deletion frequency from rat muscle homogenates. Importantly, the deletion frequency measured in muscle homogenates strongly correlated with electron transport chain-deficient fiber abundance determined by histochemical analyses. These data clarify the temporal accumulation of mtDNA deletions that lead to electron chain-deficient fibers, a process culminating in muscle fiber loss. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Pyrosequencing-based validation of a simple cell-suspension polymerase chain reaction assay for Campylobacter... of high-processivity polymerase with novel internal amplification controls for rapid and specific detection.

USDA-ARS?s Scientific Manuscript database

Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowl...

RNA Polymerase Structure, Function, Regulation, Dynamics, Fidelity, and Roles in GENE EXPRESSION | Center for Cancer Research

Cancer.gov

Multi-subunit RNA polymerases (RNAP) are ornate molecular machines that translocate on a DNA template as they generate a complementary RNA chain. RNAPs are highly conserved in evolution among eukarya, eubacteria, archaea, and some viruses. As such, multi-subunit RNAPs appear to be an irreplaceable advance in the evolution of complex life on earth. Because of their stepwise

Quantitation of Human Papillomavirus DNA in Plasma of Oropharyngeal Carcinoma Patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cao Hongbin; Banh, Alice; Kwok, Shirley

Purpose: To determine whether human papillomavirus (HPV) DNA can be detected in the plasma of patients with HPV-positive oropharyngeal carcinoma (OPC) and to monitor its temporal change during radiotherapy. Methods and Materials: We used polymerase chain reaction to detect HPV DNA in the culture media of HPV-positive SCC90 and VU147T cells and the plasma of SCC90 and HeLa tumor-bearing mice, non-tumor-bearing controls, and those with HPV-negative tumors. We used real-time quantitative polymerase chain reaction to quantify the plasma HPV DNA in 40 HPV-positive OPC, 24 HPV-negative head-and-neck cancer patients and 10 non-cancer volunteers. The tumor HPV status was confirmed bymore » p16{sup INK4a} staining and HPV16/18 polymerase chain reaction or HPV in situ hybridization. A total of 14 patients had serial plasma samples for HPV DNA quantification during radiotherapy. Results: HPV DNA was detectable in the plasma samples of SCC90- and HeLa-bearing mice but not in the controls. It was detected in 65% of the pretreatment plasma samples from HPV-positive OPC patients using E6/7 quantitative polymerase chain reaction. None of the HPV-negative head-and-neck cancer patients or non-cancer controls had detectable HPV DNA. The pretreatment plasma HPV DNA copy number correlated significantly with the nodal metabolic tumor volume (assessed using {sup 18}F-deoxyglucose positron emission tomography). The serial measurements in 14 patients showed a rapid decline in HPV DNA that had become undetectable at radiotherapy completion. In 3 patients, the HPV DNA level had increased to a discernable level at metastasis. Conclusions: Xenograft studies indicated that plasma HPV DNA is released from HPV-positive tumors. Circulating HPV DNA was detectable in most HPV-positive OPC patients. Thus, plasma HPV DNA might be a valuable tool for identifying relapse.« less

Temporal relationships between colds, upper respiratory viruses detected by polymerase chain reaction, and otitis media in young children followed through a typical cold season.

PubMed

Winther, Birgit; Alper, Cuneyt M; Mandel, Ellen M; Doyle, William J; Hendley, J Owen

2007-06-01

Otitis media is a frequent complication of a viral upper respiratory tract infection, and the reported co-incidence of those diseases increases with assay sensitivity and sampling density. We determined the incidence of otitis-media complications in young children when referenced to cold-like illnesses and to concurrent virus recovery from the nasopharynx. A total of 60 children from 24 families were followed from October 2003 through April 30, 2004, by daily parental recording of illness signs, weekly pneumatic otoscopic examinations, and periodic polymerase chain reaction assay of collected nasal fluids for common viruses. One hundred ninety-nine cold-like illnesses were observed, but a sample for virus assay was not collected concurrent with 71 episodes. Of the remainder, 73% of cold-like illnesses were temporally related to recovery of 1 or a combination of the assayed viruses, with rhinovirus predominating. For non-cold-like illness periods, 54 (18%) of 297 assays were positive for virus, and the virus frequency distribution was similar to that for cold-like illnesses. There were 93 diagnosed otitis-media episodes; 65 (70%) of these occurred during a cold-like illness. For the 79 otitis-media episodes with available nasal samples, 61 (77%) were associated with a positive virus result. In this population, the otitis-media complication rate for a cold-like illness was 33%. A cold-like illness was not a prerequisite for polymerase chain reaction detection of viruses in the nose and nasopharynx of young children. Viral detection by polymerase chain reaction in the absence of a cold-like illness is associated with complications in some subjects. Otitis media is a complication of viral infection both with and without concurrent cold-like illnesses, thus downwardly biasing coincidence estimates that use cold-based illnesses as the denominator.

No implication of Simian virus 40 in pathogenesis of malignant pleural mesothelioma in Slovenia.

PubMed

Hmeljak, Julija; Kern, Izidor; Cör, Andrej

2010-01-01

Malignant mesothelioma is predominantly caused by asbestos exposure, although the association of Simian virus 40 in its pathogenesis is currently still under debate. Simian virus 40, a DNA rhesus monkey virus with oncogenic properties, accidentally contaminated early batches of polio vaccine in the 1960s. In the 1990s, viral sequences and proteins were discovered in several human tumors, which triggered research to find a link between Simian virus 40 and human cancers, especially malignant mesothelioma. The aim of our study was to establish an effective laboratory procedure for Simian virus 40 detection and to investigate the presence of Simian virus 40 DNA and small t antigen in mesothelioma samples from Slovenian patients. Paraffin-embedded malignant pleural mesothelioma specimens from 103 Slovenian patients were collected and used for total DNA isolation and real-time polymerase chain reaction for Simian virus 40 small t and large T DNA analysis. Special attention was devoted to primer design, good laboratory practice and polymerase chain reaction contamination prevention. Polymerase chain reaction products were sequenced and BLAST aligned. One 5 microm thick paraffin section from each patient's tissue block was stained with hematoxylin and eosin for histological typing and one for immunohistochemical detection of Simian virus 40 small t antigen using a monoclonal antibody against Simian virus 40 (Pab280). SV40-expressing Wi-38 cells were used as positive control in both PCR and immunohistochemistry. In real-time polymerase chain reaction analyses, only 4 samples gave products with primer pairs amplifying small t antigen and were inconsistent and poorly reproducible. BLAST alignment showed no homology with any deposited SV40 sequences. No immunopositive staining for SV40 small t antigen was found in any of the samples. We found no evidence of SV40 presence in tissue samples from 103 Slovenian patients with malignant pleural mesothelioma. Asbestos exposure remains the main risk factor for malignant pleural mesothelioma in Slovenia.

DNA and RNA polymerase activity in a Moniliophthora perniciosa mitochondrial plasmid and self-defense against oxidative stress.

PubMed

Andrade, B S; Villela-Dias, C; Gomes, D S; Micheli, F; Góes-Neto, A

2013-06-13

Moniliophthora perniciosa (Stahel) Aime and Phillips-Mora is a hemibiotrophic basidiomycete (Agaricales, Tricholomataceae) that causes witches' broom disease in cocoa (Theobroma cacao L.). This pathogen carries a stable integrated invertron-type linear plasmid in its mitochondrial genome that encodes viral-like DNA and RNA polymerases related to fungal senescence and longevity. After culturing the fungus and obtaining its various stages of development in triplicate, we carried out total RNA extraction and subsequent complementary DNA synthesis. To analyze DNA and RNA polymerase expression levels, we performed real-time reverse transcriptase polymerase chain reaction for various fungal phases of development. Our results showed that DNA and RNA polymerase gene expression in the primordium phase of M. perniciosa is related to a potential defense mechanism against T. cacao oxidative attack.

Extension of base mispairs by Taq DNA polymerase: implications for single nucleotide discrimination in PCR.

PubMed Central

Huang, M M; Arnheim, N; Goodman, M F

1992-01-01

Thermus aquaticus (Taq) DNA polymerase was used to measure the extension efficiency for all configurations of matched and mismatched base pairs at template-primer 3'-termini. The transition mispairs, A(primer).C, C.A, G.T, and T.G were extended 10(-3) to 10(-4)-fold less efficiently than their correctly paired counterparts. Relative efficiencies for extending transversion mispairs were 10(-4) to 10(-5) for T.C and T.T, about 10(-6) for A.A, and less than 10(-6) for G.A, A.G, G.G and C.C. The transversion mispair C(primer).T was extended with high efficiency, about 10(-2) compared to a correct A.T basepair. The unexpected ease of extending the C.T mismatch was not likely to have been caused by primer-template misalignment. Taq polymerase was observed to bind with similar affinities to each of the correctly paired and mispaired primer-template 3'-ends. Thus, the failure of Taq polymerase to extend mismatches efficiently appears to be an intrinsic property of the enzyme and not due to an inability to bind to 3'-terminal mispairs. For almost all of the mispairs, C.T being the exception, Taq polymerase exhibits about 100 to 1000-fold greater discrimination against mismatch extension compared to avian myeloblastosis reverse transcriptase and HIV-1 reverse transcriptase which extend most mismatched basepairs permissively. Relative mismatch extension efficiencies for Taq polymerase were measured at 45 degrees C, 55 degrees C and 70 degrees C and found to be independent of temperature. The mispair extension data should be important in designing experiments using PCR to distinguish between sequences that vary by a single nucleotide. Images PMID:1408758

Detection of a putative novel adenovirus by PCR amplification, sequencing and phylogenetic characterisation of two gene fragments from formalin-fixed paraffin-embedded tissues of a cat diagnosed with disseminated adenovirus disease.

PubMed

Lakatos, Béla; Hornyák, Ákos; Demeter, Zoltán; Forgách, Petra; Kennedy, Frances; Rusvai, Miklós

2017-12-01

Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in formalin-fixed paraffin-embedded tissue samples of a cat that had suffered from disseminated adenovirus infection. The identity of the amplified products from the hexon and DNA-dependent DNA polymerase genes was confirmed by DNA sequencing. The sequences were clearly distinguishable from corresponding hexon and polymerase sequences of other mastadenoviruses, including human adenoviruses. These results suggest the possible existence of a distinct feline adenovirus.

Technologies for Investigating the Physiological Barriers to Efficient Lipid Nanoparticle–siRNA Delivery

PubMed Central

Abrams, Marc

2013-01-01

Small interfering RNA (siRNA) therapeutics have advanced from bench to clinical trials in recent years, along with new tools developed to enable detection of siRNA delivered at the organ, cell, and subcellular levels. Preclinical models of siRNA delivery have benefitted from methodologies such as stem-loop quantitative polymerase chain reaction, histological in situ immunofluorescent staining, endosomal escape assay, and RNA-induced silencing complex loading assay. These technologies have accelerated the detection and optimization of siRNA platforms to overcome the challenges associated with delivering therapeutic oligonucleotides to the cytosol of specific target cells. This review focuses on the methodologies and their application in the biodistribution of siRNA delivered by lipid nanoparticles. PMID:23504369

Multiplex Detection of Aspergillus Species.

PubMed

Martínez-Culebras, Pedro; Selma, María Victoria; Aznar, Rosa

2017-01-01

Multiplex real-time polymerase chain reaction (PCR) provides a fast and accurate DNA-based tool for the simultaneous amplification of more than one target sequence in a single reaction. Here a duplex real-time PCR assay is described for the simultaneous detection of Aspergillus carbonarius and members of the Aspergillus niger aggregate, which are the main responsible species for ochratoxin A (OTA) contamination in grapes. This single tube reaction targets the beta-ketosynthase and the acyl transferase domains of the polyketide synthase of A. carbonarius and the A. niger aggregate, respectively.Besides, a rapid and efficient fungi DNA extraction procedure is described suitable to be applied in wine grapes. It includes a pulsifier equipment to remove conidia from grapes which prevents releasing of PCR inhibitors.

Functional characterization of an invertase inhibitor gene involved in sucrose metabolism in tomato fruit.

PubMed

Zhang, Ning; Jiang, Jing; Yang, Yan-li; Wang, Zhi-he

2015-10-01

In this study, we produced tomato plants overexpressing an invertase inhibitor gene (Sly-INH) from tomato, using a simple and efficient transient transformation system. Compared with control plants, the expression of Sly-INH was highly upregulated in Sly-INH overexpressing plants, as indicated by real-time polymerase chain reaction (PCR). Physiological analysis revealed that Sly-INH inhibited the activity of cell wall invertase (CWIN), which increased sugar accumulation in tomato fruit. Furthermore, Sly-INH mediated sucrose metabolism by regulating CWIN activity. Our results suggest that invertase activity is potentially regulated by the Sly-INH inhibitor at the post-translational level, and they demonstrate that the transient transformation system is an effective method for determining the functions of genes in tomato.

[Applying competitive polymerase chain reaction to the detection of hepatitis B virus DNA].

PubMed

Wang, Ling; Yang, Peng; Li, Shuang-qing; Xu, Shu-hui; Cao, Gui-qun; Zhang, Fa-qiang; Zhang, Mei-xia; Chen, Qing-ying; Xia, Qing-jie; Liu, Kai; Tang, Fang; Zhang, Yuan-zheng

2004-11-01

To reduce the rate of accidental false negative result in the HBV DNA PCR test on clinical serum samples. A competitive polymerase chain reaction (C-PCR) was used to decrease the false negative ratio. In the C-PCR, a constructed inner control DNA was added for co-amplification with the HBV target DNA. In a 20 microl C-PCR system, about 60 to 200 copies of inner control DNA could give apparent co-amplification signal band after electrophoresis on a 2% agarose gel. Five of 120 samples of clinical serum (4.2%) could not be amplified. C-PCR has the advantage of yielding information on false negative in the HBV DNA PCR assay of clinical serum samples.

Cytomegalovirus retinitis after intravitreal bevacizumab injection in an immunocompetent patient.

PubMed

Bae, So Hyun; Kim, Tae Wan; Chung, Hum; Heo, Jang Won

2013-02-01

We report a case of cytomegalovirus (CMV) retinitis after intravitreal bevacizumab injection. A 61-year-old woman with diabetic macular edema developed dense vitritis and necrotizing retinitis 3 weeks after intravitreal bevacizumab injection. A diagnostic vitrectomy was performed. The undiluted vitreous sample acquired by vitrectomy was analyzed by polymerase chain reaction and culture. Polymerase chain reaction of the vitreous was positive for CMV DNA. Other laboratory results did not show evidence of other infectious retinitis and systemic immune dysfunction. Human immunodeficiency virus antibodies were also negative. After systemic administration of ganciclovir, retinitis has resolved and there has been no recurrence of retinitis during the follow-up period of 12 months. Ophthalmologists should be aware of potential risk for CMV retinitis after intravitreal bevacizumab injection.

Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction.

PubMed

Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal

2012-01-01

The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.

Sexing chick mRNA: A protocol based on quantitative real-time polymerase chain reaction.

PubMed

Wan, Z; Lu, Y; Rui, L; Yu, X; Li, Z

2017-03-01

The accurate identification of sex in birds is important for research on avian sex determination and differentiation. Polymerase chain reaction (PCR)-based methods have been widely applied for the molecular sexing of birds. However, these methods have used genomic DNA. Here, we present the first sexing protocol for chick mRNA based on real-time quantitative PCR. We demonstrate that this method can accurately determine sex using mRNA from chick gonads and other tissues, such as heart, liver, spleen, lung, and muscle. The strategy of this protocol also may be suitable for other species in which sex is determined by the inheritance of sex chromosomes (ZZ male and ZW female). © 2016 Poultry Science Association Inc.

Plague in a Pediatric Patient: Case Report and Use of Polymerase Chain Reaction as a Diagnostic Aid.

PubMed

Drummond, Wendi K; Nelson, Christina A; Fowler, Joe; Epson, Erin E; Mead, Paul S; Lawaczeck, Elisabeth W

2014-12-01

We report a case of bubonic plaque in a 7-year-old patient who presented with a core temperature of 107°F, seizures, vomiting, altered mental status, and septic shock. This case highlights the utility of polymerase chain reaction (PCR) as a diagnostic aid for rapid presumptive identification of Yersinia pestis as well as the importance of correlating PCR results with clinical data. We discuss the various manifestations of plague as they relate to infection control, postexposure prophylaxis, antimicrobial therapy, and treatment duration. © The Author 2014. Published by Oxford University Press on behalf of the Pediatric Infectious Diseases Society. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Reverse Transcription Quantitative Polymerase Chain Reaction for Detection of and Differentiation Between RNA and DNA of HIV-1-Based Lentiviral Vectors.

PubMed

Pavlovic, Melanie; Koehler, Nina; Anton, Martina; Dinkelmeier, Anna; Haase, Maren; Stellberger, Thorsten; Busch, Ulrich; Baiker, Armin E

2017-08-01

The purpose of the described method is the detection of and differentiation between RNA and DNA of human immunodeficiency virus (HIV)-derived lentiviral vectors (LV) in cell culture supernatants and swab samples. For the analytical surveillance of genetic engineering, operations methods for the detection of the HIV-1-based LV generations are required. Furthermore, for research issues, it is important to prove the absence of LV particles for downgrading experimental settings in terms of the biosafety level. Here, a quantitative polymerase chain reaction method targeting the long terminal repeat U5 subunit and the start sequence of the packaging signal ψ is described. Numerous controls are included in order to monitor the technical procedure.

[DIAGNOSTIC VALUE OF COMBINED USE OF COMBINED METHOD OF ENZYME IMMUNOASSAY AND POLYMERASE CHAIN REACTION TO DETECT OF INTRAUTERINE FETAL INFECTION BY PARVOVIRUS B19].

PubMed

Bondarenko, N P; Lakatosh, V P; Lakatosh, P V; Malanchuk, O B; Poladich, I V

2015-01-01

The combined method of diagnosis parvovirus infection during pregnancy by maternal serum enzyme immunoassay and deoxyribonucleic acid isolation parvovirus B19 polymerase chain reaction in amnniotic fluid and fetal cord blood newborns, can diagnose vertical transmission and anticipate a negative effect on the fetus parvovirus. Lack of maternal IgM antibodies in serum due to parvovirus seroconversion during pregnancy does not exclude the persistence of the virus in the fetus. To analyze the diagnostic value of the method for determining the LHP parvovirus B19 DNA in the amniotic fluid, umbilical cord blood of newborns to determine vertical transmission of parvovirus infection when infected mothers B19 during pregnancy.

Oligonucleotide microarray analysis of gene expression profiles followed by real-time reverse-transcriptase polymerase chain reaction assay in chronic active Epstein-Barr virus infection.

PubMed

Ito, Yoshinori; Shibata-Watanabe, Yukiko; Ushijima, Yoko; Kawada, Jun-Ichi; Nishiyama, Yukihiro; Kojima, Seiji; Kimura, Hiroshi

2008-03-01

Chronic active Epstein-Barr virus infection (CAEBV) is characterized by recurrent infectious mononucleosis-like symptoms and has high mortality and morbidity. To clarify the mechanisms of CAEBV, the gene-expression profiles of peripheral blood obtained from patients with CAEBV were investigated. Twenty genes were differentially expressed in 4 patients with CAEBV. This microarray result was verified using a real-time reverse-transcriptase polymerase chain reaction assay in a larger group of patients with CAEBV. Eventually, 3 genes were found to be significantly upregulated: guanylate binding protein 1, tumor necrosis factor-induced protein 6, and guanylate binding protein 5. These genes may be associated with the inflammatory reaction or with cell proliferation.

A case of Pitt-Hopkins syndrome with absence of hyperventilation.

PubMed

Inati, Adlette; Abbas, Hussein A; Korjian, Serge; Daaboul, Yazan; Harajeily, Mohamad; Saab, Raya

2013-12-01

Pitt-Hopkins syndrome is characterized by mental retardation, hyperventilation, and dysmorphic features due to TCF4 mutations. We report a case of Pitt-Hopkins syndrome in a 2½-year-old boy presenting with psychomotor retardation, recurrent respiratory tract infections, and dysmorphic features with absence of hyperventilation or other breathing abnormalities. Comparative genomic hybridization and quantitative real-time polymerase chain reaction were used to confirm TCF4 haploinsufficiency. Pitt-Hopkins syndrome is a rare debilitating disease that should be in the differential diagnosis of other neurodevelopmental disorders characterized by mental retardation and hypotonicity despite the absence of hyperapnea and seizures. Quantitative real-time polymerase chain reaction is another method to identify TCF4 and to confirm Pitt-Hopkins syndrome diagnosis.

The diagnostic value of polymerase chain reaction for Mycobacterium tuberculosis to distinguish intestinal tuberculosis from crohn's disease: A meta-analysis.

PubMed

Jin, Ting; Fei, Baoying; Zhang, Yu; He, Xujun

2017-01-01

Intestinal tuberculosis (ITB) and Crohn's disease (CD) are important differential diagnoses that can be difficult to distinguish. Polymerase chain reaction (PCR) for Mycobacterium tuberculosis (MTB) is an efficient and promising tool. This meta-analysis was performed to systematically and objectively assess the potential diagnostic accuracy and clinical value of PCR for MTB in distinguishing ITB from CD. We searched PubMed, Embase, Web of Science, Science Direct, and the Cochrane Library for eligible studies, and nine articles with 12 groups of data were identified. The included studies were subjected to quality assessment using the revised Quality Assessment of Diagnostic Accuracy Studies (QUADAS-2) tool. The summary estimates were as follows: sensitivity 0.47 (95% CI: 0.42-0.51); specificity 0.95 (95% CI: 0.93-0.97); the positive likelihood ratio (PLR) 10.68 (95% CI: 6.98-16.35); the negative likelihood ratio (NLR) 0.49 (95% CI: 0.33-0.71); and diagnostic odds ratio (DOR) 21.92 (95% CI: 13.17-36.48). The area under the curve (AUC) was 0.9311, with a Q* value of 0.8664. Heterogeneity was found in the NLR. The heterogeneity of the studies was evaluated by meta-regression analysis and subgroup analysis. The current evidence suggests that PCR for MTB is a promising and highly specific diagnostic method to distinguish ITB from CD. However, physicians should also keep in mind that negative results cannot exclude ITB for its low sensitivity. Additional prospective studies are needed to further evaluate the diagnostic accuracy of PCR.

Real-Time Reverse-Transcription Quantitative Polymerase Chain Reaction Assay Is a Feasible Method for the Relative Quantification of Heregulin Expression in Non-Small Cell Lung Cancer Tissue.

PubMed

Kristof, Jessica; Sakrison, Kellen; Jin, Xiaoping; Nakamaru, Kenji; Schneider, Matthias; Beckman, Robert A; Freeman, Daniel; Spittle, Cindy; Feng, Wenqin

2017-01-01

In preclinical studies, heregulin ( HRG ) expression was shown to be the most relevant predictive biomarker for response to patritumab, a fully human anti-epidermal growth factor receptor 3 monoclonal antibody. In support of a phase 2 study of erlotinib ± patritumab in non-small cell lung cancer (NSCLC), a reverse-transcription quantitative polymerase chain reaction (RT-qPCR) assay for relative quantification of HRG expression from formalin-fixed paraffin-embedded (FFPE) NSCLC tissue samples was developed and validated and described herein. Test specimens included matched FFPE normal lung and NSCLC and frozen NSCLC tissue, and HRG -positive and HRG -negative cell lines. Formalin-fixed paraffin-embedded tissue was examined for functional performance. Heregulin distribution was also analyzed across 200 NSCLC commercial samples. Applied Biosystems TaqMan Gene Expression Assays were run on the Bio-Rad CFX96 real-time PCR platform. Heregulin RT-qPCR assay specificity, PCR efficiency, PCR linearity, and reproducibility were demonstrated. The final assay parameters included the Qiagen FFPE RNA Extraction Kit for RNA extraction from FFPE NSCLC tissue, 50 ng of RNA input, and 3 reference (housekeeping) genes ( HMBS, IPO8 , and EIF2B1 ), which had expression levels similar to HRG expression levels and were stable among FFPE NSCLC samples. Using the validated assay, unimodal HRG distribution was confirmed across 185 evaluable FFPE NSCLC commercial samples. Feasibility of an RT-qPCR assay for the quantification of HRG expression in FFPE NSCLC specimens was demonstrated.

Three-dimensional printing surgical instruments: are we there yet?

PubMed

Rankin, Timothy M; Giovinco, Nicholas A; Cucher, Daniel J; Watts, George; Hurwitz, Bonnie; Armstrong, David G

2014-06-15

The applications for rapid prototyping have expanded dramatically over the last 20 y. In recent years, additive manufacturing has been intensely investigated for surgical implants, tissue scaffolds, and organs. There is, however, scant literature to date that has investigated the viability of three-dimensional (3D) printing of surgical instruments. Using a fused deposition modeling printer, an Army/Navy surgical retractor was replicated from polylactic acid (PLA) filament. The retractor was sterilized using standard Food and Drug Administration approved glutaraldehyde protocols, tested for bacteria by polymerase chain reaction, and stressed until fracture to determine if the printed instrument could tolerate force beyond the demands of an operating room (OR). Printing required roughly 90 min. The instrument tolerated 13.6 kg of tangential force before failure, both before and after exposure to the sterilant. Freshly extruded PLA from the printer was sterile and produced no polymerase chain reaction product. Each instrument weighed 16 g and required only $0.46 of PLA. Our estimates place the cost per unit of a 3D-printed retractor to be roughly 1/10th the cost of a stainless steel instrument. The PLA Army/Navy retractor is strong enough for the demands of the OR. Freshly extruded PLA in a clean environment, such as an OR, would produce a sterile ready-to-use instrument. Because of the unprecedented accessibility of 3D printing technology world wide and the cost efficiency of these instruments, there are far reaching implications for surgery in some underserved and less developed parts of the world. Copyright © 2014 Elsevier Inc. All rights reserved.

Droplet digital polymerase chain reaction (PCR) outperforms real-time PCR in the detection of environmental DNA from an invasive fish species.

PubMed

Doi, Hideyuki; Takahara, Teruhiko; Minamoto, Toshifumi; Matsuhashi, Saeko; Uchii, Kimiko; Yamanaka, Hiroki

2015-05-05

Environmental DNA (eDNA) has been used to investigate species distributions in aquatic ecosystems. Most of these studies use real-time polymerase chain reaction (PCR) to detect eDNA in water; however, PCR amplification is often inhibited by the presence of organic and inorganic matter. In droplet digital PCR (ddPCR), the sample is partitioned into thousands of nanoliter droplets, and PCR inhibition may be reduced by the detection of the end-point of PCR amplification in each droplet, independent of the amplification efficiency. In addition, real-time PCR reagents can affect PCR amplification and consequently alter detection rates. We compared the effectiveness of ddPCR and real-time PCR using two different PCR reagents for the detection of the eDNA from invasive bluegill sunfish, Lepomis macrochirus, in ponds. We found that ddPCR had higher detection rates of bluegill eDNA in pond water than real-time PCR with either of the PCR reagents, especially at low DNA concentrations. Limits of DNA detection, which were tested by spiking the bluegill DNA to DNA extracts from the ponds containing natural inhibitors, found that ddPCR had higher detection rate than real-time PCR. Our results suggest that ddPCR is more resistant to the presence of PCR inhibitors in field samples than real-time PCR. Thus, ddPCR outperforms real-time PCR methods for detecting eDNA to document species distributions in natural habitats, especially in habitats with high concentrations of PCR inhibitors.

Real-time quantification of antibody-short interfering RNA conjugate in serum by antigen capture reverse transcription-polymerase chain reaction.

PubMed

Tan, Martha; Vernes, Jean-Michel; Chan, Joyce; Cuellar, Trinna L; Asundi, Aarati; Nelson, Christopher; Yip, Victor; Shen, Ben; Vandlen, Richard; Siebel, Christian; Meng, Y Gloria

2012-11-15

Short interfering RNA (siRNA) has therapeutic potential. However, efficient delivery is a formidable task. To facilitate delivery of siRNA into cells, we covalently conjugated siRNA to antibodies that bind to cell surface proteins and internalize. Understanding how these antibody-siRNA conjugates function in vivo requires pharmacokinetic analysis. Thus, we developed a simple real-time antigen capture reverse transcription-polymerase chain reaction (RT-PCR) assay to detect intact antibody-siRNA conjugates. Biotinylated antigen bound to streptavidin-coated PCR tubes was used to capture antibody-siRNA conjugate. The captured antibody-siRNA conjugate was then reverse-transcribed in the same tube, avoiding a sample transfer step. This reproducible assay had a wide standard curve range of 0.029 to 480ng/ml and could detect as low as 0.58ng/ml antibody-siRNA conjugates in mouse serum. The presence of unconjugated antibody that could be generated from siRNA degradation in vivo did not affect the assay as long as the total antibody concentration in the antigen capture step did not exceed 480ng/ml. Using this assay, we observed a more rapid decrease in serum antibody-siRNA conjugate concentrations than the total antibody concentrations in mice dosed with antibody-siRNA conjugates, suggesting loss of siRNA from the antibody. This assay is useful for optimizing antibody-siRNA and likely aptamer-siRNA conjugates to improve pharmacokinetics and aid siRNA delivery. Copyright © 2012 Elsevier Inc. All rights reserved.

Polymerase chain reaction (PCR) amplification of a nucleoprotein gene sequence of infectious hematopoietic necrosis virus

USGS Publications Warehouse

Arakawa, C.K.; Deering, R.E.; Higman, K.H.; Oshima, K.H.; O'Hara, P.J.; Winton, J.R.

1990-01-01

The polymerase chain reaction [PCR) was used to amplify a portion of the nucleoprotein [NI gene of infectious hematopoietic necrosis virus (IHNV). Using a published sequence for the Round Butte isolate of IHNV, a pair of PCR pnmers was synthesized that spanned a 252 nucleotide region of the N gene from residue 319 to residue 570 of the open reading frame. This region included a 30 nucleotide target sequence for a synthetic oligonucleotide probe developed for detection of IHNV N gene messenger RNA. After 25 cycles of amplification of either messenger or genomic RNA, the PCR product (DNA) of the expected size was easily visible on agarose gels stained with ethidium bromide. The specificity of the amplified DNA was confirmed by Southern and dot-blot analysis using the biotinylated oligonucleotide probe. The PCR was able to amplify the N gene sequence of purified genomic RNA from isolates of IHNV representing 5 different electropherotypes. Using the IHNV primer set, no PCR product was obtained from viral hemorrhagic septicemia virus RNA, but 2 higher molecular weight products were synthesized from hirame rhabdovirus RNA that did not hybridize with the biotinylated probe. The PCR could be efficiently performed with all IHNV genomic RNA template concentrations tested (1 ng to 1 pg). The lowest level of sensitivity was not determined. The PCR was used to amplify RNA extracted from infected cell cultures and selected tissues of Infected rainbow trout. The combination of PCR and nucleic acid probe promises to provide a detection method for IHNV that is rapid, h~ghly specific, and sensitive.

Selection of internal reference genes for normalization of reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis in the rumen epithelium

USDA-ARS?s Scientific Manuscript database

The rumen is lined on the luminal side by a stratified squamous epithelium that is responsible for not only absorption, but also transport, extensive short-chain fatty acid (SCFA) metabolism and protection. Butyrate has been demonstrated to initiate the differentiation of the tissue following intro...

[THE COMPARATIVE ANALYSIS OF EFFECTIVENESS OF QUICK TESTS IN DIAGNOSTIC OF INFLUENZA AND RESPIRATORY SYNCYTIAL VIRAL INFECTION IN CHILDREN].

PubMed

Petrova, E R; Sukhovetskaia, V P; Pisareva, M M; Maiorova, V G; Sverlova, M V; Danilenko, D M; Petrova, P A; Krivitskaia, V Z; Sominina, A A

2015-11-01

The analysis was implemented concerning diagnostic parameters of commercial quick tests (immune chromatographic tests BinaxNOW Influenza A&B and BinaxNow RSV Alere, Scarborough Inc., USA) under detection of antigens of influenza virus A and respiratory syncytial virus in clinical materials. The polymerase chain reaction in real-time and isolation ofviruses in cell cultures. The analysis of naso-pharyngeal smears from 116 children demonstrated that sensitivity and specifcity of detection of influenza virus A using device mariPOC in comparison with polymerase chain reaction made up to 93.8% and 99.0% correspondingly at total concordance of results of both techniques as 98.3%. At diagnosing of respiratory syncytial virus using device mariPOC parameters made up to 77.3%, 98.9% and 862% as compared with polymerase chain reaction. The sensitivity, specificity and total concordance of results of immune chromatographic tests BinaxNOW in comparison ofpolymerase chain reaction made up to 86.7%, 100% and 96.2% correspondingly at detection of influenza virus A and 80.9%, 97.4% and 91.6% correspondingly at detection of respiratory syncytial virus. In comparison with isolation technique in cell cultures sensitivity of system mariPOC and immune chromatographic tests proved to be in 1.3-1.4 times higher at detection of influenza virus A and in 1.7-2 times higher in case of isolation of respiratory syncytial virus. There is no statistically significant differences between diagnostic parameters received for mariPOC and immune chromatographic tests at diagnosing influenza virus A and respiratory syncytial viral infection.

The uncoupling of catalysis and translocation in the viral RNA-dependent RNA polymerase

PubMed Central

Shu, Bo; Gong, Peng

2017-01-01

ABSTRACT The nucleotide addition cycle of nucleic acid polymerases includes 2 major events: the pre-chemistry active site closure leading to the addition of one nucleotide to the product chain; the post-chemistry translocation step moving the polymerase active site one position downstream on its template. In viral RNA-dependent RNA polymerases (RdRPs), structural and biochemical evidences suggest that these 2 events are not tightly coupled, unlike the situation observed in A-family polymerases such as the bacteriophage T7 RNA polymerase. Recently, an RdRP translocation intermediate crystal structure of enterovirus 71 shed light on how translocation may be controlled by elements within RdRP catalytic motifs, and a series of poliovirus apo RdRP crystal structures explicitly suggest that a motif B loop may assist the movement of the template strand in late stages of transcription. Implications of RdRP catalysis-translocation uncoupling and the remaining challenges to further elucidate RdRP translocation mechanism are also discussed. PMID:28277928

[Efficiency and specificity of the KAT-test for rapid diagnosis of falciparum malaria].

PubMed

Cong, Le Dinh; Sergiev, V P; Rabinovich, S A; Nhah, Doan Hanh; Huong, Nguyen Van; Morozov, E N; Kukina, I V; Thinh, Ta Thi; Maksakovskaia, E V; Dao, Le Minh; Chalyĭ, V F; To, Dang Thi; Fandeev, V A; Hoa, Ngo Viet; Due, Nguyen Thi

2002-01-01

A new rapid KAT Quick Malaria test for the diagnosis of falciparum malaria, which is based on the detection of a monoclonal antibody-antigen complex of malaria parasites, has been worked out by the KAT Medical CC in South Africa. The efficiency and specificity of the KAT test were compared with those of the microscopic method and with the ICT test for rapid diagnosis of P. falciparum and P. vivax. The polymerase chain reaction was used as a control test. Testing for malaria was performed on 98 blood samples from feverish patients in Vietnam and Tadjikistan and among the persons who had returned to Moscow from endemic regions. The efficiency of the KAT test for falciparum-malaria was found to be 100% versus 90.5% with ICT. The absence of cross-reactions with P. vivax and the presence of pseudopositive results of the KAT test for fever cases of non-malaria origin indicate its high specificity. There was no correlation between the rate of test line colouring and the level of parasitemia. The KAT test yielded positive results only when gametocytes were found in blood specimens.

Detection of Shigella in Milk and Clinical Samples by Magnetic Immunocaptured-Loop-Mediated Isothermal Amplification Assay

PubMed Central

Zhang, Liding; Wei, Qiujiang; Han, Qinqin; Chen, Qiang; Tai, Wenlin; Zhang, Jinyang; Song, Yuzhu; Xia, Xueshan

2018-01-01

Shigella is an important human food-borne zoonosis bacterial pathogen, and can cause clinically severe diarrhea. There is an urgent need to develop a specific, sensitive, and rapid methodology for detection of this pathogen. In this study, loop-mediated isothermal amplification (LAMP) combined with magnetic immunocapture assay (IC-LAMP) was first developed for the detection of Shigella in pure culture, artificial milk, and clinical stool samples. This method exhibited a detection limit of 8.7 CFU/mL. Compared with polymerase chain reaction, IC-LAMP is sensitive, specific, and reliable for monitoring Shigella. Additionally, IC-LAMP is more convenient, efficient, and rapid than ordinary LAMP, as it is more efficiently enriches pathogen cells without extraction of genomic DNA. Under isothermal conditions, the amplification curves and the green fluorescence were detected within 30 min in the presence of genomic DNA template. The overall analysis time was approximately 1 h, including the enrichment and lysis of the bacterial cells, a significantly short detection time. Therefore, the IC-LAMP methodology described here is potentially useful for the efficient detection of Shigella in various samples. PMID:29467730

Development of polymerase chain reaction-based diagnostic tests for detection of Malsoor virus & adenovirus isolated from Rousettus species of bats in Maharashtra, India.

PubMed

Shete, Anita M; Yadav, Pragya; Kumar, Vimal; Nikam, Tushar; Mehershahi, Kurosh; Kokate, Prasad; Patil, Deepak; Mourya, Devendra T

2017-01-01

Bats are recognized as important reservoirs for emerging infectious disease and some unknown viral diseases. Two novel viruses, Malsoor virus (family Bunyaviridae, genus, Phlebovirus) and a novel adenovirus (AdV) (family, Adenoviridae genus, Mastadenovirus), were identified from Rousettus bats in the Maharashtra State of India. This study was done to develop and optimize real time reverse transcription - polymerase chain reaction (RT-PCR) assays for Malsoor virus and real time and nested PCR for adenovirus from Rousettus bats. For rapid and accurate screening of Malsoor virus and adenovirus a nested polymerase chain reaction and TaqMan-based real-time PCR were developed. Highly conserved region of nucleoprotein gene of phleboviruses and polymerase gene sequence from the Indian bat AdV isolate polyprotein gene were selected respectively for diagnostic assay development of Malsoor virus and AdV. Sensitivity and specificity of assays were calculated and optimized assays were used to screen bat samples. Molecular diagnostic assays were developed for screening of Malsoor virus and AdV and those were found to be specific. Based on the experiments performed with different parameters, nested PCR was found to be more sensitive than real-time PCR; however, for rapid screening, real-time PCR can be used and further nested PCR can be used for final confirmation or in those laboratories where real-time facility/expertise is not existing. This study reports the development and optimization of nested RT-PCR and a TaqMan-based real-time PCR for Malsoor virus and AdV. The diagnostic assays can be used for rapid detection of these novel viruses to understand their prevalence among bat population.

Stochastic model of template-directed elongation processes in biology.

PubMed

Schilstra, Maria J; Nehaniv, Chrystopher L

2010-10-01

We present a novel modular, stochastic model for biological template-based linear chain elongation processes. In this model, elongation complexes (ECs; DNA polymerase, RNA polymerase, or ribosomes associated with nascent chains) that span a finite number of template units step along the template, one after another, with semaphore constructs preventing overtaking. The central elongation module is readily extended with modules that represent initiation and termination processes. The model was used to explore the effect of EC span on motor velocity and dispersion, and the effect of initiation activator and repressor binding kinetics on the overall elongation dynamics. The results demonstrate that (1) motors that move smoothly are able to travel at a greater velocity and closer together than motors that move more erratically, and (2) the rate at which completed chains are released is proportional to the occupancy or vacancy of activator or repressor binding sites only when initiation or activator/repressor dissociation is slow in comparison with elongation. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay with TaqMan Probes Discriminates Cattle, Buffalo, and Porcine Materials in Food Chain.

PubMed

Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur

2017-05-17

Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.

Amplification of ST50 gene using dry-reagent-based polymerase chain reaction for the detection of Salmonella typhi.

PubMed

Aziah, Ismail; Ravichandran, Manickam; Ismail, Asma

2007-12-01

Conventional polymerase chain reaction (PCR) testing requires many pipetting steps and has to be transported and stored in cold chain. To overcome these limitations, we designed a ready-to-use PCR test for Salmonella typhi using PCR reagents, primers against the ST50 gene of S. typhi, a built-in internal amplification control (IAC), and gel loading dye mixed and freeze-dried in a single tube. The 2-step dry-reagent-based assay was used to amplify a 1238-bp target gene and an 810-bp IAC gene from 73 BACTEC blood culture broths (33 true positives for S. typhi and 40 true negatives for non-S. typhi). The sensitivity, specificity, positive predictive value, and negative predictive value of the PCR assay were 87.9%, 100%, 100%, and 90.9%, respectively. We suggest that this rapid 2-step PCR test could be used for the rapid diagnosis of typhoid fever.

Detection of epsilon class switching and IgE synthesis in human B cells.

PubMed

Pène, Jérôme; Guilhot, Florence; Cognet, Isabelle; Guglielmi, Paul; Guay-Giroux, Angélique; Bonnefoy, Jean-Yves; Elson, Greg C; Yssel, Hans; Gauchat, Jean-François

2006-01-01

We observed that mast cells, as other cells expressing the CD40 ligand CD154, can trigger IgE synthesis in B cells in the presence of interleukin (IL)-4. Numerous complementary techniques can be used to follow the succession of molecular events leading to IgE synthesis. This chapter will illustrate how human B cells (naïve or memory) can be purified, stored, and cultivated in medium that is permissive for IgE synthesis and stimulated with IL-4 or IL-13 and CD40 activation, the latter being induced by soluble CD154, anti-CD40 antibodies, or CD154-expressing cells. All these molecules are expressed by mast cells. The quantification of the epsilon-sterile transcript synthesis by polymerase chain reaction or Northern blot, the epsilon excision circles produced during immunoglobulin heavy chain locus rearrangement by polymerase chain reaction, and the IgE production by enzyme-linked immunosorbent assay will be described.

Efficient transformation and expression of gfp gene in Valsa mali var. mali.

PubMed

Chen, Liang; Sun, Gengwu; Wu, Shujing; Liu, Huixiang; Wang, Hongkai

2015-01-01

Valsa mali var. mali, the causal agent of valsa canker of apple, causes great loss of apple production in apple producing regions. The pathogenic mechanism of the pathogen has not been studied extensively, thus a suitable gene marker for pathogenic invasion analysis and a random insertion of T-DNA for mutants are desirable. In this paper, we reported the construction of a binary vector pKO1-HPH containing a positive selective gene hygromycin phosphotransferase (hph), a reporter gene gfp conferring green fluorescent protein, and an efficient protocol for V. mali var. mali transformation mediated by Agrobacterium tumefaciens. A transformation efficiency up to about 75 transformants per 10(5) conidia was achieved when co-cultivation of V. mali var. mali and A. tumefaciens for 48 h in A. tumefaciens inductive medium agar plates. The insertions of hph gene and gfp gene into V. mali var. mali genome verified by polymerase chain reaction and southern blot analysis showed that 10 randomly-selected transformants exhibited a single, unique hybridization pattern. This is the first report of A. tumefaciens-mediated transformation of V. mali var mali carrying a 'reporter' gfp gene that stably and efficiently expressed in the transformed V. mali var. mali species.

Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

DOE PAGES

McInerney, Peter; Adams, Paul; Hadi, Masood Z.

2014-01-01

As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error ratemore » measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less

Development of a rapid and sensitive one-step reverse transcription-nested polymerase chain reaction in a single tube using the droplet-polymerase chain reaction machine.

PubMed

Yamaguchi, Akemi; Matsuda, Kazuyuki; Sueki, Akane; Taira, Chiaki; Uehara, Masayuki; Saito, Yasunori; Honda, Takayuki

2015-08-25

Reverse transcription (RT)-nested polymerase chain reaction (PCR) is a time-consuming procedure because it has several handling steps and is associated with the risk of cross-contamination during each step. Therefore, a rapid and sensitive one-step RT-nested PCR was developed that could be performed in a single tube using a droplet-PCR machine. The K562 BCR-ABL mRNA-positive cell line as well as bone marrow aspirates from 5 patients with chronic myelogenous leukemia (CML) and 5 controls without CML were used. We evaluated one-step RT-nested PCR using the droplet-PCR machine. One-step RT-nested PCR performed in a single tube using the droplet-PCR machine enabled the detection of BCR-ABL mRNA within 40min, which was 10(3)-fold superior to conventional RT nested PCR using three steps in separate tubes. The sensitivity of the one-step RT-nested PCR was 0.001%, with sample reactivity comparable to that of the conventional assay. One-step RT-nested PCR was developed using the droplet-PCR machine, which enabled all reactions to be performed in a single tube accurately and rapidly and with high sensitivity. This one-step RT-nested PCR may be applicable to a wide spectrum of genetic tests in clinical laboratories. Copyright © 2015 Elsevier B.V. All rights reserved.

A screening method for the detection of the 35S promoter and the nopaline synthase terminator in genetically modified organisms in a real-time multiplex polymerase chain reaction using high-resolution melting-curve analysis.

PubMed

Akiyama, Hiroshi; Nakamura, Fumi; Yamada, Chihiro; Nakamura, Kosuke; Nakajima, Osamu; Kawakami, Hiroshi; Harikai, Naoki; Furui, Satoshi; Kitta, Kazumi; Teshima, Reiko

2009-11-01

To screen for unauthorized genetically modified organisms (GMO) in the various crops, we developed a multiplex real-time polymerase chain reaction high-resolution melting-curve analysis method for the simultaneous qualitative detection of 35S promoter sequence of cauliflower mosaic virus (35SP) and the nopaline synthase terminator (NOST) in several crops. We selected suitable primer sets for the simultaneous detection of 35SP and NOST and designed the primer set for the detection of spiked ColE1 plasmid to evaluate the validity of the polymerase chain reaction (PCR) analyses. In addition, we optimized the multiplex PCR conditions using the designed primer sets and EvaGreen as an intercalating dye. The contamination of unauthorized GMO with single copy similar to NK603 maize can be detected as low as 0.1% in a maize sample. Furthermore, we showed that the present method would be applicable in identifying GMO in various crops and foods like authorized GM soybean, authorized GM potato, the biscuit which is contaminated with GM soybeans and the rice which is contaminated with unauthorized GM rice. We consider this method to be a simple and reliable assay for screening for unauthorized GMO in crops and the processing food products.

Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

PubMed

Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

2014-09-01

The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

Epstein-Barr viral load before a liver transplant in children with chronic liver disease.

PubMed

Shakibazad, Nader; Honar, Naser; Dehghani, Seyed Mohsen; Alborzi, Abdolvahab

2014-12-01

Many children with chronic liver disease require a liver transplant. These patients are prone to various infections, including Epstein-Barr virus infection. This study sought to measure the Epstein-Barr viral load by polymerase chain reaction before a liver transplant. This cross-sectional study was done at the Shiraz University of Medical Sciences, Shiraz, Iran, in 2011. All patients were aged younger than 18 years with chronic liver disease and were candidates for a liver transplant at the Shiraz Nemazee Hospital Organ Transplant Center. They had been investigated regarding their demographic characteristics, underlying disease, laboratory findings, and Epstein-Barr viral load by real-time TaqMan polymerase chain reaction. Ninety-eight patients were studied and the mean age was 6.5 ± 5.9 years. Cryptogenic cirrhosis was the most-prevalent reason for liver transplant, and the death rate before a transplant was 15%. Among the study subjects, 6 had measurable Epstein-Barr viral load by polymerase chain reaction before the transplant, and 4 of them had considerably higher Epstein-Barr viral loads (more than 1000 copies/mL). With respect to the close prevalence of posttransplant lymphoproliferative disease (6%) and the high Epstein-Barr viral load in the patients before a transplant (4%), high pretransplant Epstein-Barr viral load can be considered a risk factor for posttransplant lymphoproliferative disorder.

Parvovirus B19 Infection in Children With Arterial Ischemic Stroke.

PubMed

Fullerton, Heather J; Luna, Jorge M; Wintermark, Max; Hills, Nancy K; Tokarz, Rafal; Li, Ying; Glaser, Carol; DeVeber, Gabrielle A; Lipkin, W Ian; Elkind, Mitchell S V

2017-10-01

Case-control studies suggest that acute infection transiently increases the risk of childhood arterial ischemic stroke. We hypothesized that an unbiased pathogen discovery approach utilizing MassTag-polymerase chain reaction would identify pathogens in the blood of childhood arterial ischemic stroke cases. The multicenter international VIPS study (Vascular Effects of Infection in Pediatric Stroke) enrolled arterial ischemic stroke cases, and stroke-free controls, aged 29 days through 18 years. Parental interview included questions on recent infections. In this pilot study, we used MassTag-polymerase chain reaction to test the plasma of the first 161 cases and 34 controls enrolled for a panel of 28 common bacterial and viral pathogens. Pathogen DNA was detected in no controls and 14 cases (8.7%): parvovirus B19 (n=10), herpesvirus 6 (n=2), adenovirus (n=1), and rhinovirus 6C (n=1). Parvovirus B19 infection was confirmed by serologies in all 10; infection was subclinical in 8. Four cases with parvovirus B19 had underlying congenital heart disease, whereas another 5 had a distinct arteriopathy involving a long-segment stenosis of the distal internal carotid and proximal middle cerebral arteries. Using MassTag-polymerase chain reaction, we detected parvovirus B19-a virus known to infect erythrocytes and endothelial cells-in some cases of childhood arterial ischemic stroke. This approach can generate new, testable hypotheses about childhood stroke pathogenesis. © 2017 American Heart Association, Inc.

Single cell digital polymerase chain reaction on self-priming compartmentalization chip

PubMed Central

Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

2017-01-01

Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%–4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease. PMID:28191267

Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

PubMed Central

Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

2015-01-01

This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

Combined subtraction hybridization and polymerase chain reaction amplification procedure for isolation of strain-specific Rhizobium DNA sequences.

PubMed Central

Bjourson, A J; Stone, C E; Cooper, J E

1992-01-01

A novel subtraction hybridization procedure, incorporating a combination of four separation strategies, was developed to isolate unique DNA sequences from a strain of Rhizobium leguminosarum bv. trifolii. Sau3A-digested DNA from this strain, i.e., the probe strain, was ligated to a linker and hybridized in solution with an excess of pooled subtracter DNA from seven other strains of the same biovar which had been restricted, ligated to a different, biotinylated, subtracter-specific linker, and amplified by polymerase chain reaction to incorporate dUTP. Subtracter DNA and subtracter-probe hybrids were removed by phenol-chloroform extraction of a streptavidin-biotin-DNA complex. NENSORB chromatography of the sequences remaining in the aqueous layer captured biotinylated subtracter DNA which may have escaped removal by phenol-chloroform treatment. Any traces of contaminating subtracter DNA were removed by digestion with uracil DNA glycosylase. Finally, remaining sequences were amplified by polymerase chain reaction with a probe strain-specific primer, labelled with 32P, and tested for specificity in dot blot hybridizations against total genomic target DNA from each strain in the subtracter pool. Two rounds of subtraction-amplification were sufficient to remove cross-hybridizing sequences and to give a probe which hybridized only with homologous target DNA. The method is applicable to the isolation of DNA and RNA sequences from both procaryotic and eucaryotic cells. Images PMID:1637166

Performance of transport and selective media for swine Bordetella bronchiseptica recovery and it comparison to polymerase chain reaction detection

PubMed Central

Coutinho, Tania Alen; Bernardi, Mari Lourdes; de Itapema Cardoso, Marisa Ribeiro; Borowski, Sandra Maria; Moreno, Andrea Micke; de Barcellos, David Emilio Santos Neves

2009-01-01

Three comparative assays were performed seeking to improve the sensitivity of the diagnosis of Bordetella bronchiseptica infection analyzing swine nasal swabs. An initial assay compared the recovery of B. bronchiseptica from swabs simultaneously inoculated with B. bronchiseptica and some interfering bacteria, immersed into three transport formulations (Amies with charcoal, trypticase soy broth and phosphate buffer according to Soerensen supplemented with 5% of bovine fetal serum) and submitted to different temperatures (10°C and 27°C) and periods of incubation (24, 72 and 120 hours). A subsequent assay compared three selective media (MacConkey agar, modified selective medium G20G and a ceftiofur medium) for their recovery capabilities from clinical specimens. One last assay compared the polymerase chain reaction to the three selective media. In the first assay, the recovery of B. bronchiseptica from transport systems was better at 27°C and the three formulations had good performances at this temperature, but the collection of qualitative and quantitative analysis indicated the advantage of Amies medium for nasal swabs transportation. The second assay indicated that MacConkey agar and modified G20G had similar results and were superior to the ceftiofur medium. In the final assay, polymerase chain reaction presented superior capability of B. bronchiseptica detection to culture procedures. PMID:24031390

Single cell digital polymerase chain reaction on self-priming compartmentalization chip.

PubMed

Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

2017-01-01

Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%-4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease.

Large scale analysis of the mutational landscape in HT-SELEX improves aptamer discovery

PubMed Central

Hoinka, Jan; Berezhnoy, Alexey; Dao, Phuong; Sauna, Zuben E.; Gilboa, Eli; Przytycka, Teresa M.

2015-01-01

High-Throughput (HT) SELEX combines SELEX (Systematic Evolution of Ligands by EXponential Enrichment), a method for aptamer discovery, with massively parallel sequencing technologies. This emerging technology provides data for a global analysis of the selection process and for simultaneous discovery of a large number of candidates but currently lacks dedicated computational approaches for their analysis. To close this gap, we developed novel in-silico methods to analyze HT-SELEX data and utilized them to study the emergence of polymerase errors during HT-SELEX. Rather than considering these errors as a nuisance, we demonstrated their utility for guiding aptamer discovery. Our approach builds on two main advancements in aptamer analysis: AptaMut—a novel technique allowing for the identification of polymerase errors conferring an improved binding affinity relative to the ‘parent’ sequence and AptaCluster—an aptamer clustering algorithm which is to our best knowledge, the only currently available tool capable of efficiently clustering entire aptamer pools. We applied these methods to an HT-SELEX experiment developing aptamers against Interleukin 10 receptor alpha chain (IL-10RA) and experimentally confirmed our predictions thus validating our computational methods. PMID:25870409

Nuclear TRIM25 Specifically Targets Influenza Virus Ribonucleoproteins to Block the Onset of RNA Chain Elongation.

PubMed

Meyerson, Nicholas R; Zhou, Ligang; Guo, Yusong R; Zhao, Chen; Tao, Yizhi J; Krug, Robert M; Sawyer, Sara L

2017-11-08

TRIM25 is an E3 ubiquitin ligase that activates RIG-I to promote the antiviral interferon response. The NS1 protein from all strains of influenza A virus binds TRIM25, although not all virus strains block the interferon response, suggesting alternative mechanisms for TRIM25 action. Here we present a nuclear role for TRIM25 in specifically restricting influenza A virus replication. TRIM25 inhibits viral RNA synthesis through a direct mechanism that is independent of its ubiquitin ligase activity and the interferon pathway. This activity can be inhibited by the viral NS1 protein. TRIM25 inhibition of viral RNA synthesis results from its binding to viral ribonucleoproteins (vRNPs), the structures containing individual viral RNA segments, the viral polymerase, and multiple viral nucleoproteins. TRIM25 binding does not inhibit initiation of capped-RNA-primed viral mRNA synthesis by the viral polymerase. Rather, the onset of RNA chain elongation is inhibited because TRIM25 prohibits the movement of RNA into the polymerase complex. Copyright © 2017 Elsevier Inc. All rights reserved.

Dispersion quality of amine functionalized multiwall carbon nanotubes plays critical roles in polymerase chain reaction enhancement

NASA Astrophysics Data System (ADS)

Yuce, Meral; Budak, Hikmet

2014-12-01

Impact of dispersion quality of NH2-MWCNTs (13-18 nm in diameter with a length between 1 and 12 µm, >99 % purity) in the amplification efficiency of a random DNA oligonucleotide library (96 bp) was investigated. Amplification yield in the presence of non-filtered NH2-MWCNT dispersion, filtered NH2-MWCNT dispersion and surface-attached NH2-MWCNTs was explored, and physical interactions between NH2-MWCNTs and major PCR reagents including DNA template, wild type Taq DNA polymerase enzyme and primers were determined using high resolution polyacrylamide gel electrophoresis, dynamic light scattering, UV-Vis-NIR spectroscopy and scanning electron microscopy techniques. The results revealed that presence of NH2-MWCNT dispersion which was sonicated, centrifuged and filtered, enhanced the total PCR efficiency up to 70 % while the presence of NH2-MWCNT only centrifuged after sonication, inhibited the reaction significantly at similar concentrations. Furthermore, the NH2-MWCNTs coupled covalently onto magnetic microspheres, contributed for the specificity enhancement whilst decreasing the amplification efficiency by 30 % at the maximum concentration, which suggests a removable enhancement system for sensitive applications. On the other hand, the relative hydrodynamic size distribution measurements displayed a clear difference between the filtered NH2 and non-filtered NH2-MWCNT water dispersions, which justifies the inhibition of the amplification by the non-filtered NH2-MWCNTs containing big agglomerates and bundles. Finally, we demonstrated that major PCR components adsorb onto the NH2-MWCNTs with diverse affinities, and maintain their functions after adsorption, which provides a good framework to further develop tunable NH2-MWCNT-carriers to be utilized in various nanobiotechnology and material science applications.

Sequences of heavy and light chain variable regions from four bovine immunoglobulins.

PubMed

Armour, K L; Tempest, P R; Fawcett, P H; Fernie, M L; King, S I; White, P; Taylor, G; Harris, W J

1994-12-01

Oligodeoxyribonucleotide primers based on the 5' ends of bovine IgG1/2 and lambda constant (C) region genes, together with primers encoding conserved amino acids at the N-terminus of mature variable (V) regions from other species, have been used in cDNA and polymerase chain reactions (PCRs) to amplify heavy and light chain V region cDNA from bovine heterohybridomas. The amino acid sequences of VH and V lambda from four bovine immunoglobulins of different specificities are presented.

Selective Modification of Adenovirus Replication Can Be Achieved through Rational Mutagenesis of the Adenovirus Type 5 DNA Polymerase

PubMed Central

Capella, Cristina; Beltejar, Michael-John; Brown, Caitlin; Fong, Vincent; Daddacha, Waaqo; Kim, Baek

2012-01-01

Mutations that reduce the efficiency of deoxynucleoside (dN) triphosphate (dNTP) substrate utilization by the HIV-1 DNA polymerase prevent viral replication in resting cells, which contain low dNTP concentrations, but not in rapidly dividing cells such as cancer cells, which contain high levels of dNTPs. We therefore tested whether mutations in regions of the adenovirus type 5 (Ad5) DNA polymerase that interact with the dNTP substrate or DNA template could alter virus replication. The majority of the mutations created, including conservative substitutions, were incompatible with virus replication. Five replication-competent mutants were recovered from 293 cells, but four of these mutants failed to replicate in A549 lung carcinoma cells and Wi38 normal lung cells. Purified polymerase proteins from these viruses exhibited only a 2- to 4-fold reduction in their dNTP utilization efficiency but nonetheless could not be rescued, even when intracellular dNTP concentrations were artificially raised by the addition of exogenous dNs to virus-infected A549 cells. The fifth mutation (I664V) reduced biochemical dNTP utilization by the viral polymerase by 2.5-fold. The corresponding virus replicated to wild-type levels in three different cancer cell lines but was significantly impaired in all normal cell lines in which it was tested. Efficient replication and virus-mediated cell killing were rescued by the addition of exogenous dNs to normal lung fibroblasts (MRC5 cells), confirming the dNTP-dependent nature of the polymerase defect. Collectively, these data provide proof-of-concept support for the notion that conditionally replicating, tumor-selective adenovirus vectors can be created by modifying the efficiency with which the viral DNA polymerase utilizes dNTP substrates. PMID:22811532

Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method.

PubMed

Brzezinski, Jennifer L

2006-01-01

The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.

Case Report of Focal Epithelial Hyperplasia (Heck's Disease) with Polymerase Chain Reaction Detection of Human Papillomavirus 13.

PubMed

Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna

2016-05-01

Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment. © 2016 Wiley Periodicals, Inc.

Polymerase chain reaction identification of three members of the Anopheles sundaicus (Diptera: Culicidae) complex, malaria vectors in Southeast Asia.

PubMed

Dusfour, Isabelle; Blondeau, Johanna; Harbach, Ralph E; Vythilingham, Indra; Baimai, Visut; Trung, Ho D; Sochanta, Tho; Bangs, Michael J; Manguin, Sylvie

2007-09-01

Anopheles sundaicus s.l., a major malaria vector taxon, occurs primarily along coastal areas and on islands in Southeast Asia. Our previous studies using cytochrome oxidase I, cytochrome-b, and internal transcribed spacer 2 markers discriminated three allopatric species: An. sundaicus s.s. in northern Borneo, An. epiroticus in Southeast Asia, and An. sundaicus E on Sumatra and Java, Indonesia. Morphological comparisons of three developmental stages did not reveal unique diagnostic characters that could reliably distinguish the three species. Therefore, we developed a multiplex polymerase chain reaction (PCR) assay based on two mitochondrial DNA markers to unambiguously identify them. This PCR was tested on 374 specimens from 24 different geographical populations, expanding our knowledge of the distribution of these species.

Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

DOE Office of Scientific and Technical Information (OSTI.GOV)

Flores, J.; Sears, J.; Schael, I.P.

1990-08-01

We have synthesized {sup 32}P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated frommore » field studies.« less

Susceptibility of Culicoides variipennis sonorensis to infection by polymerase chain reaction-detectable bluetongue virus in cattle blood.

PubMed

Tabachnick, W J; MacLachlan, N J; Thompson, L H; Hunt, G J; Patton, J F

1996-05-01

Cattle bloods containing only polymerase chain reaction (PCR)--detectable bluetongue-10 viral nucleic acid, but as determined by virus isolation techniques, not bluetongue-10 virus, were incapable of infecting intrathoracically inoculated Culicoides variipennis sonorensis. These insects also failed to transmit bluetongue-10 virus when fed on sheep. Cattle whose blood contain only PCR-detectable bluetongue viral nucleic acid, but no infectious virus, are unlikely to play a role in the epidemiology of bluetongue. The biological significance of PCR-based detection assays and their effect on animal health regulations on the international trade of livestock and livestock germplasm is discussed. Bluetongue virus infection provides a very useful model with which to study arthropod-transmitted RNA virus infections of humans and other animals.

Detection of egg drop syndrome 1976 virus by polymerase chain reaction and study of its persistence in experimentally infected layer birds.

PubMed

Kumar, N S; Kataria, J M; Koti, M; Dhama, K; Toroghi, R

2003-01-01

Polymerase chain reaction (PCR) assay was developed for the detection of Egg drop syndrome 1976 (EDS-76) virus in tissues, namely in the uterus, spleen and buffy coat. It was also used to study the persistence of the virus in tissues of experimentally infected layer birds. The PCR assay could detect as little as 10 fg of purified EDS-76 viral DNA. It also amplified the DNA of Fowl adenovirus serotypes 4 (FAV-4) and 8 (FAV-8). The virus persisted in the uterus up to day 21 post infection (p.i.). Detection of EDS-76 viral DNA in the buffy coat could be useful for studying the occurrence of the respective disease in layer bird flocks.

Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique tilapia (Oreochromis mossambicus) by polymerase chain reaction

USGS Publications Warehouse

Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.

2004-01-01

We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5×104 cells per 0.25 g material or 1.9×103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.

[Pea (Pisum sativum) genes, participating in symbiosis with nitrogen-fixing bacteria. III. Study of the structure of the ENOD12 early nodulin gene for various types of peas using the polymerase chain reaction (PCR)].

PubMed

Kozik, A V; Matvienko, M A; Men', A E; Zalenskiĭ, A O; Tikhonovich, I A

1992-01-01

We have determined the length of early noduline gene ENOD12 in various varieties and lines of pea (Pisum sativum) using the polymerase chain reaction (PCR). It was demonstrated that promoter regions of ENOD12A and ENOD12B genes in line 2150 (Afghanistan) are longer than these in variety "Feltham first". The disparity is 14 bp. When studying these genes in 7 different lines and varieties of pea it was found that ENOD12A gene is more variable in size than the ENOD12B gene. We showed the possibility to analyze the heritage of ENOD12 gene's alleles by using the PCR method.

Leishmania chagasi in Opossums (Didelphis albiventris) in an Urban Area Endemic for Visceral Leishmaniasis, Campo Grande, Mato Grosso do Sul, Brazil

PubMed Central

Humberg, Roberta M. P.; Oshiro, Elisa T.; Cruz, Maria do Socorro Pires e; Ribolla, Paulo E. M.; Alonso, Diego P.; Ferreira, Alda M. T.; Bonamigo, Raquel A.; Tasso, Norton; de Oliveira, Alessandra Gutierrez

2012-01-01

We investigated the occurrence of Leishmania infantum chagasi in Didelphis albiventris opossums at a wild animal rehabilitation center in the city of Campo Grande, Brazil. A total of 54 opossums were tested for L. i. chagasi infection in peripheral blood and bone marrow samples. The samples were analyzed by direct examination, culturing in a specific medium, and polymerase chain reaction–restriction fragment length polymorphism. Leishmania i. chagasi DNA was detected by polymerase chain reaction–restriction fragment length polymorphism in 11 (20.37%) animals. A total of 81.81% of positive opossums were captured in areas of known visceral leishmaniasis transmission. These results suggest a role for D. albiventris in the urban transmission of visceral leishmaniasis. PMID:22802435

Subacute Sclerosing Panencephalitis in an Infant: Diagnostic Role of Viral Genome Analysis

PubMed Central

Baram, Tallie Z.; Gonzalez-Gomez, Ignacio; Xie, Zong-De; Yao, Dapeng; Gilles, Floyd H.; Nelson, Marvin D.; Nguyen, Hahn T.; Peters, Julius

2013-01-01

Subacute sclerosing panencephalitis (SSPE) is related to “defective” measles virus or vaccination, though an association with parainfluenza viruses has been reported. SSPE is characterized by a slow, erratic course and elevated cerebrospinal fluid measles titers. An immunocompetent, vaccinated infant, with onset of symptoms in parainfiuenza virus season and a catastrophic course is described. Cerebrospinal fluid titers were negative, but postmortem brain had typical SSPE lesions. Patient brain-derived RNA, subjected to reverse transcription followed by polymerase chain reaction yielded polymerase chain reaction products with measles virus but not parainfluenza virus genes. The sequenced fragment revealed multiple mutations, typical for SSPE. SSPE can thus present in infants, with short latency and no cerebrospinal fluid antibodies. Viral genomic analysis may be diagnostic, permitting early therapy. PMID:8024248

Efficient Structure Resonance Energy Transfer from Microwaves to Confined Acoustic Vibrations in Viruses

PubMed Central

Yang, Szu-Chi; Lin, Huan-Chun; Liu, Tzu-Ming; Lu, Jen-Tang; Hung, Wan-Ting; Huang, Yu-Ru; Tsai, Yi-Chun; Kao, Chuan-Liang; Chen, Shih-Yuan; Sun, Chi-Kuang

2015-01-01

Virus is known to resonate in the confined-acoustic dipolar mode with microwave of the same frequency. However this effect was not considered in previous virus-microwave interaction studies and microwave-based virus epidemic prevention. Here we show that this structure-resonant energy transfer effect from microwaves to virus can be efficient enough so that airborne virus was inactivated with reasonable microwave power density safe for the open public. We demonstrate this effect by measuring the residual viral infectivity of influenza A virus after illuminating microwaves with different frequencies and powers. We also established a theoretical model to estimate the microwaves power threshold for virus inactivation and good agreement with experiments was obtained. Such structure-resonant energy transfer induced inactivation is mainly through physically fracturing the virus structure, which was confirmed by real-time reverse transcription polymerase chain reaction. These results provide a pathway toward establishing a new epidemic prevention strategy in open public for airborne virus. PMID:26647655

Agrobacterium tumefaciens-mediated transformation of Phellodendron amurense Rupr. using mature-seed explants.

PubMed

Yang, Jingli; Zhao, Bo; Kim, Yeon Bok; Zhou, Chenguang; Li, Chunyan; Chen, Yunlin; Zhang, Haizhen; Li, Cheng Hao

2013-01-01

An efficient transformation protocol was developed for Agrobacterium-mediated transformation of Phellodendron amurense Rupr. for using explants from mature seeds. The binary vector pCAMBIA1303, which contained hygromycin phosphotransferase (hptII) as a selectable marker gene and β-glucuronidase (GUS) as a reporter gene, was used for transformation studies. Different factors that affect survival of transformed buds, namely Agrobacterium infection method, bacterial strain, pre-culture duration, acetosyringone concentration, co-culture duration, and co-culture temperature were examined and optimized for transformation efficiency on the basis of GUS staining of hygromycin-resistant buds. Polymerase chain reaction (PCR), Southern blot and reverse transcription PCR confirmed the presence of the GUS gene. A transformation frequency of 13.1 % was achieved under optimized conditions for transformation (A. tumefaciens strain EHA105, 4 days co-cultivation at 4 °C, and infection of the pre-cultured mature-seed explants for 2 days). This is the first report of a successful genetic transformation protocol for P. amurense.

Efficient Structure Resonance Energy Transfer from Microwaves to Confined Acoustic Vibrations in Viruses.

PubMed

Yang, Szu-Chi; Lin, Huan-Chun; Liu, Tzu-Ming; Lu, Jen-Tang; Hung, Wan-Ting; Huang, Yu-Ru; Tsai, Yi-Chun; Kao, Chuan-Liang; Chen, Shih-Yuan; Sun, Chi-Kuang

2015-12-09

Virus is known to resonate in the confined-acoustic dipolar mode with microwave of the same frequency. However this effect was not considered in previous virus-microwave interaction studies and microwave-based virus epidemic prevention. Here we show that this structure-resonant energy transfer effect from microwaves to virus can be efficient enough so that airborne virus was inactivated with reasonable microwave power density safe for the open public. We demonstrate this effect by measuring the residual viral infectivity of influenza A virus after illuminating microwaves with different frequencies and powers. We also established a theoretical model to estimate the microwaves power threshold for virus inactivation and good agreement with experiments was obtained. Such structure-resonant energy transfer induced inactivation is mainly through physically fracturing the virus structure, which was confirmed by real-time reverse transcription polymerase chain reaction. These results provide a pathway toward establishing a new epidemic prevention strategy in open public for airborne virus.

Poly(ADP-ribose) binding to Chk1 at stalled replication forks is required for S-phase checkpoint activation

NASA Astrophysics Data System (ADS)

Min, Wookee; Bruhn, Christopher; Grigaravicius, Paulius; Zhou, Zhong-Wei; Li, Fu; Krüger, Anja; Siddeek, Bénazir; Greulich, Karl-Otto; Popp, Oliver; Meisezahl, Chris; Calkhoven, Cornelis F.; Bürkle, Alexander; Xu, Xingzhi; Wang, Zhao-Qi

2013-12-01

Damaged replication forks activate poly(ADP-ribose) polymerase 1 (PARP1), which catalyses poly(ADP-ribose) (PAR) formation; however, how PARP1 or poly(ADP-ribosyl)ation is involved in the S-phase checkpoint is unknown. Here we show that PAR, supplied by PARP1, interacts with Chk1 via a novel PAR-binding regulatory (PbR) motif in Chk1, independent of ATR and its activity. iPOND studies reveal that Chk1 associates readily with the unperturbed replication fork and that PAR is required for efficient retention of Chk1 and phosphorylated Chk1 at the fork. A PbR mutation, which disrupts PAR binding, but not the interaction with its partners Claspin or BRCA1, impairs Chk1 and the S-phase checkpoint activation, and mirrors Chk1 knockdown-induced hypersensitivity to fork poisoning. We find that long chains, but not short chains, of PAR stimulate Chk1 kinase activity. Collectively, we disclose a previously unrecognized mechanism of the S-phase checkpoint by PAR metabolism that modulates Chk1 activity at the replication fork.

The Host E3-Ubiquitin Ligase TRIM6 Ubiquitinates the Ebola Virus VP35 Protein and Promotes Virus Replication.

PubMed

Bharaj, Preeti; Atkins, Colm; Luthra, Priya; Giraldo, Maria Isabel; Dawes, Brian E; Miorin, Lisa; Johnson, Jeffrey R; Krogan, Nevan J; Basler, Christopher F; Freiberg, Alexander N; Rajsbaum, Ricardo

2017-09-15

Ebola virus (EBOV), a member of the Filoviridae family, is a highly pathogenic virus that causes severe hemorrhagic fever in humans and is responsible for epidemics throughout sub-Saharan, central, and West Africa. The EBOV genome encodes VP35, an important viral protein involved in virus replication by acting as an essential cofactor of the viral polymerase as well as a potent antagonist of the host antiviral type I interferon (IFN-I) system. By using mass spectrometry analysis and coimmunoprecipitation assays, we show here that VP35 is ubiquitinated on lysine 309 (K309), a residue located on its IFN antagonist domain. We also found that VP35 interacts with TRIM6, a member of the E3-ubiquitin ligase tripartite motif (TRIM) family. We recently reported that TRIM6 promotes the synthesis of unanchored K48-linked polyubiquitin chains, which are not covalently attached to any protein, to induce efficient antiviral IFN-I-mediated responses. Consistent with this notion, VP35 also associated noncovalently with polyubiquitin chains and inhibited TRIM6-mediated IFN-I induction. Intriguingly, we also found that TRIM6 enhances EBOV polymerase activity in a minigenome assay and TRIM6 knockout cells have reduced replication of infectious EBOV, suggesting that VP35 hijacks TRIM6 to promote EBOV replication through ubiquitination. Our work provides evidence that TRIM6 is an important host cellular factor that promotes EBOV replication, and future studies will focus on whether TRIM6 could be targeted for therapeutic intervention against EBOV infection. IMPORTANCE EBOV belongs to a family of highly pathogenic viruses that cause severe hemorrhagic fever in humans and other mammals with high mortality rates (40 to 90%). Because of its high pathogenicity and lack of licensed antivirals and vaccines, EBOV is listed as a tier 1 select-agent risk group 4 pathogen. An important mechanism for the severity of EBOV infection is its suppression of innate immune responses. The EBOV VP35 protein contributes to pathogenesis, because it serves as an essential cofactor of the viral polymerase as well as a potent antagonist of innate immunity. However, how VP35 function is regulated by host cellular factors is poorly understood. Here, we report that the host E3-ubiquitin ligase TRIM6 promotes VP35 ubiquitination and is important for efficient virus replication. Therefore, our study identifies a new host factor, TRIM6, as a potential target in the development of antiviral drugs against EBOV. Copyright © 2017 American Society for Microbiology.

The Host E3-Ubiquitin Ligase TRIM6 Ubiquitinates the Ebola Virus VP35 Protein and Promotes Virus Replication

PubMed Central

Bharaj, Preeti; Atkins, Colm; Luthra, Priya; Giraldo, Maria Isabel; Dawes, Brian E.; Miorin, Lisa; Johnson, Jeffrey R.; Krogan, Nevan J.; Basler, Christopher F.; Freiberg, Alexander N.

2017-01-01

ABSTRACT Ebola virus (EBOV), a member of the Filoviridae family, is a highly pathogenic virus that causes severe hemorrhagic fever in humans and is responsible for epidemics throughout sub-Saharan, central, and West Africa. The EBOV genome encodes VP35, an important viral protein involved in virus replication by acting as an essential cofactor of the viral polymerase as well as a potent antagonist of the host antiviral type I interferon (IFN-I) system. By using mass spectrometry analysis and coimmunoprecipitation assays, we show here that VP35 is ubiquitinated on lysine 309 (K309), a residue located on its IFN antagonist domain. We also found that VP35 interacts with TRIM6, a member of the E3-ubiquitin ligase tripartite motif (TRIM) family. We recently reported that TRIM6 promotes the synthesis of unanchored K48-linked polyubiquitin chains, which are not covalently attached to any protein, to induce efficient antiviral IFN-I-mediated responses. Consistent with this notion, VP35 also associated noncovalently with polyubiquitin chains and inhibited TRIM6-mediated IFN-I induction. Intriguingly, we also found that TRIM6 enhances EBOV polymerase activity in a minigenome assay and TRIM6 knockout cells have reduced replication of infectious EBOV, suggesting that VP35 hijacks TRIM6 to promote EBOV replication through ubiquitination. Our work provides evidence that TRIM6 is an important host cellular factor that promotes EBOV replication, and future studies will focus on whether TRIM6 could be targeted for therapeutic intervention against EBOV infection. IMPORTANCE EBOV belongs to a family of highly pathogenic viruses that cause severe hemorrhagic fever in humans and other mammals with high mortality rates (40 to 90%). Because of its high pathogenicity and lack of licensed antivirals and vaccines, EBOV is listed as a tier 1 select-agent risk group 4 pathogen. An important mechanism for the severity of EBOV infection is its suppression of innate immune responses. The EBOV VP35 protein contributes to pathogenesis, because it serves as an essential cofactor of the viral polymerase as well as a potent antagonist of innate immunity. However, how VP35 function is regulated by host cellular factors is poorly understood. Here, we report that the host E3-ubiquitin ligase TRIM6 promotes VP35 ubiquitination and is important for efficient virus replication. Therefore, our study identifies a new host factor, TRIM6, as a potential target in the development of antiviral drugs against EBOV. PMID:28679761

An efficient in planta transformation of Jatropha curcas (L.) and multiplication of transformed plants through in vivo grafting.

PubMed

Jaganath, Balusamy; Subramanyam, Kondeti; Mayavan, Subramanian; Karthik, Sivabalan; Elayaraja, Dhandapani; Udayakumar, Rajangam; Manickavasagam, Markandan; Ganapathi, Andy

2014-05-01

An efficient and reproducible Agrobacterium-mediated in planta transformation was developed in Jatropha curcas. The various factors affecting J. curcas in planta transformation were optimized, including decapitation, Agrobacterium strain, pin-pricking, vacuum infiltration duration and vacuum pressure. Simple vegetative in vivo cleft grafting method was adopted in the multiplication of transformants without the aid of tissue culture. Among the various parameters evaluated, decapitated plants on pin-pricking and vacuum infiltrated at 250 mmHg for 3 min with the Agrobacterium strain EHA 105 harbouring the binary vector pGA 492 was proved to be efficient in all terms with a transformation efficiency of 62.66%. Transgene integration was evinced by the GUS histochemical analysis, and the GUS positive plants were subjected to grafting. Putatively transformed J. curcas served as "Scion" and the wild type J. curcas plant severed as "Stock". There was no occurrence of graft rejection and the plants were then confirmed by GUS histochemical analysis, polymerase chain reaction (PCR) and Southern hybridization. Genetic stability of the grafted plants was evaluated by using randomly amplified polymorphic DNA (RAPD), marker which showed 100% genetic stability between mother and grafted plants. Thus, an efficient in planta transformation and grafting based multiplication of J. curcas was established.

A newly developed silymarin nanoformulation as a potential antidiabetic agent in experimental diabetes.

PubMed

El-Far, Yousra M; Zakaria, Mahmoud M; Gabr, Mahmoud M; El Gayar, Amal M; El-Sherbiny, Ibrahim M; Eissa, Laila A

2016-10-01

This study aimed to develop a new stable nanoformulation of silymarin (SM) with optimum enhanced oral bioavailability and to evaluate its effect as well as mechanism of action as a superior antidiabetic agent over native SM using streptozotocin-induced diabetic rats. SM-loaded pluronic nanomicelles (SMnp) were prepared and fully characterized. Biochemical parameters were performed as well as histological, confocal and reverse-transcription polymerase chain reaction studies on pancreatic target tissues. SMnp were found to improve significantly the antihyperglycemic, antioxidant and antihyperlipidemic properties as compared with native SM. In addition, SMnp was found to be a more efficient agent over SM in the management of diabetes and its associated complications due to its superior bioavailability in vivo, and the controlled release profile of SM. [Formula: see text].

Using the rate of bacterial clearance determined by real-time polymerase chain reaction as a timely surrogate marker to evaluate the appropriateness of antibiotic usage in critical patients with Acinetobacter baumannii bacteremia.

PubMed

Chuang, Yu-Chung; Chang, Shan-Chwen; Wang, Wei-Kung

2012-08-01

Bacteremia caused by Acinetobacter baumannii is becoming more frequent among critically ill patients, and has been associated with high mortality and prolonged hospital stay. Multidrug resistance and delay in blood culture have been shown to be significant barriers to appropriate antibiotic treatment. Quantitative polymerase chain reaction assays were recently used to monitor bacterial loads; we hypothesized that the rate of bacterial clearance determined by quantitative polymerase chain reaction can be used as a timely surrogate marker to evaluate the appropriateness of antibiotic usage. Prospective observational study. University hospital and research laboratory. Patients with culture-proven A. baumannii bacteremia in the intensive care units were prospectively enrolled from April 2008 to February 2009. Plasmid Oxa-51/pCRII-TOPO, which contained a 431-bp fragment of the A. baumannii-specific Oxa-51 gene in a pCRII-TOPO vector, was used as the standard. Sequential bacterial DNA loads in the blood were measured by a quantitative polymerase chain reaction assay. We enrolled 51 patients with A. baumannii bacteremia, and examined 318 sequential whole blood samples. The initial mean bacterial load was 2.15 log copies/mL, and the rate of bacterial clearance was 0.088 log copies/mL/day. Multivariate linear regression using the generalized estimation equation approach revealed that the use of immunosuppressants was an independent predictor for slower bacterial clearance (coefficient, 1.116; p<.001), and appropriate antibiotic usage was an independent predictor for more rapid bacterial clearance (coefficient, -0.995; p<.001). Patients with a slower rate of bacterial clearance experienced higher in-hospital mortality (odds ratio, 2.323; p=.04) Immunosuppression and appropriate antibiotic usage were independent factors affecting the rate of clearance of A. baumannii bacteremia in critical patients. These findings highlight the importance of appropriate antibiotic usage and development of effective antibiotics against A. baumannii in an era of emerging antibiotic resistance. The rate of bacterial clearance could serve as a timely surrogate marker for evaluating the appropriateness of antibiotics.

Expression of TGF-beta1, osteonectin, and BMP-4 in mandibular distraction osteogenesis with compression stimulation: reverse transcriptase-polymerase chain reaction study and biomechanical test.

PubMed

Kim, Uk-Kyu; Park, Seong-Jin; Seong, Wook-Jin; Heo, Jun; Hwang, Dae-Seok; Kim, Yong-Deok; Shin, Sang-Hun; Kim, Gyoo-Cheon

2010-09-01

This study compared the levels of transforming growth factor-beta1 (TGF-beta1), osteonectin, and bone morphogenetic protein-4 (BMP-4) expression in regenerated bone in a rabbit mandible that had undergone conventional distraction osteogenesis (DO) with those in regenerated bone from a modified DO technique with compression stimulation. A total of 42 rabbits were used in this reverse transcriptase-polymerase chain reaction study. In the control group, distraction was performed at 1 mm/day for 8 days. In the experimental group, overdistraction was performed for 10 days, followed by a 3-day latency period and 2 days of compression to achieve the same amount of DO. Three rabbits per subgroup were killed at 0, 5, 13, 20, 27, 34, and 41 days after the initial osteotomy. The levels of TGF-beta1, osteonectin, and BMP-4 in the bone regenerates were measured by reverse transcriptase-polymerase chain reaction. A biomechanical microhardness test was also performed in 8 rabbits as a separate experiment. Reverse transcriptase-polymerase chain reaction revealed a greater level of TGF-beta1 in the experimental group immediately after applying the compression force that continued for 2 weeks. The level then decreased to that of the control group at 3 weeks. The greater level of osteonectin in the experimental group after compression than that in the control group continued for 3 weeks. In the experimental group, the level of BMP-4 increased immediately after compression. However, the level in the control group decreased. The microhardness ratio of distracted bone to normal bone on the cortex was statistically different at 0.47 in the control group and 0.80 in the experimental group (P = .049) at 55 days after osteotomy. The effectiveness of the new DO technique with compression stimulation was confirmed by the gene expression study and the biomechanical test findings. Copyright 2010 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

Polymerase chain reaction detection of Propionibacterium propionicus and Actinomyces radicidentis in primary and persistent endodontic infections.

PubMed

Siqueira, José F; Rôças, Isabela N

2003-08-01

Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and persistent endodontic infections. This strengthens the assumption that this bacterial species is an endodontic pathogen associated with different forms of periradicular diseases. In contrast, A radicidentis was only occasionally detected in the patients examined. The role played by this species in endodontic infections remains to be clarified.

Pyrosequencing-based validation of a simple cell-suspension polymerase chain reaction assay for Campylobacter with application of high-processivity polymerase and novel internal amplification controls for rapid and specific detection.

PubMed

Oakley, Brian B; Line, J Eric; Berrang, Mark E; Johnson, Jessica M; Buhr, R Jeff; Cox, Nelson A; Hiett, Kelli L; Seal, Bruce S

2012-02-01

Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowledge none has been empirically tested for specificity using high-throughput sequencing. Here we demonstrate the power of next-generation sequencing to determine the specificity of a widely cited Campylobacter-specific polymerase chain reaction (PCR) assay and describe a rapid method for direct cell suspension PCR to quickly and easily screen samples for Campylobacter. We present a specific protocol which eliminates the need for time-consuming and expensive genomic DNA extractions and, using a high-processivity polymerase, demonstrate conclusive screening of samples in <1 h. Pyrosequencing results show the assay to be extremely (>99%) sensitive, and spike-back experiments demonstrated a detection threshold of <10(2) CFU mL(-1). Additionally, we present 2 newly designed broad-range bacterial primer sets targeting the 23S rRNA gene that have wide applicability as internal amplification controls. Empirical testing of putative taxon-specific assays using high-throughput sequencing is an important validation step that is now financially feasible for research, regulatory, or clinical applications. Published by Elsevier Inc.

Measurement of messenger RNA encoding the alpha-chain, polymeric immunoglobulin receptor, and J-chain in duodenal mucosa from dogs with and without chronic diarrhea by use of quantitative real-time reverse transcription-polymerase chain reaction assays.

PubMed

Peters, Iain R; Helps, Chris R; Calvert, Emma L; Hall, Edward J; Day, Michael J

2005-01-01

To examine the difference in expression of messenger RNA (mRNA) transcripts for polymeric immunoglobulin receptor (plgR), alpha-chain, and J-chain determined by use of quantitative real-time reverse transcription-polymerase chain reaction (QRT-PCR) assays in duodenal biopsy specimens obtained from dogs with and without chronic diarrhea. Biopsy specimens of the proximal portion of the duodenum were obtained endoscopically from 39 dogs evaluated because of chronic diarrhea (12 German Shepherd Dogs and 27 non-German Shepherd Dog breeds); specimens were also obtained from a control group of 7 dogs evaluated because of other gastrointestinal tract diseases and 2 dogs that were euthanatized as a result of nongastrointestinal tract disease. Dogs were anesthetized, and multiple mucosal biopsy specimens were obtained endoscopically at the level of the caudal duodenal flexure by use of biopsy forceps; in 2 control dogs, samples were obtained from the descending duodenum within 5 minutes of euthanasia. One-step QRT-PCR was used to quantify the level of expression of transcripts for the housekeeper gene glyceraldehyde-3-phosphate dehydrogenase, plgR, alpha-chain, and J-chain in duodenal mucosal tissue. There was no significant difference in the level of expression of any transcript among non-German Shepherd Dog breeds without diarrhea (control group), non-German Shepherd Dog breeds with chronic diarrhea, and German Shepherd Dogs with chronic diarrhea. Conclusions and Clinical Relevance-Results indicated that the susceptibility of German Shepherd Dogs to chronic diarrhea is not a result of simple failure of transcription of the key genes that encode molecules involved in mucosal IgA secretion.

Roles of exonucleases and translesion synthesis DNA polymerases during mitotic gap repair in yeast

PubMed Central

Guo, Xiaoge; Jinks-Robertson, Sue

2013-01-01

Transformation-based gap-repair assays have long been used to model the repair of mitotic double-strand breaks (DSBs) by homologous recombination in yeast. In the current study, we examine genetic requirements of two key processes involved in DSB repair: (1) the processive 5′-end resection that is required to efficiently engage a repair template and (2) the filling of resected ends by DNA polymerases. The specific gap-repair assay used allows repair events resolved as crossover versus noncrossover products to be distinguished, as well as the extent of heteroduplex DNA formed during recombination to be measured. To examine end resection, the efficiency and outcome of gap repair were monitored in the absence of the Exo1 exonuclease and the Sgs1 helicase. We found that either Exo1 or Sgs1 presence is sufficient to inhibit gap-repair efficiency over 10-fold, consistent with resection-mediated destruction of the introduced plasmid. In terms of DNA polymerase requirements for gap repair, we focused specifically on potential roles of the Pol ζ and Pol η translesion synthesis DNA polymerases. We found that both Pol ζ and Pol η are necessary for efficient gap repair and that each functions independently of the other. These polymerases may be either in the initiation of DNA synthesis from the an invading end, or in a gap-filling process that is required to complete recombination. PMID:24210827

Ultrasensitive Single Fluorescence-Labeled Probe-Mediated Single Universal Primer-Multiplex-Droplet Digital Polymerase Chain Reaction for High-Throughput Genetically Modified Organism Screening.

PubMed

Niu, Chenqi; Xu, Yuancong; Zhang, Chao; Zhu, Pengyu; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

2018-05-01

As genetically modified (GM) technology develops and genetically modified organisms (GMOs) become more available, GMOs face increasing regulations and pressure to adhere to strict labeling guidelines. A singleplex detection method cannot perform the high-throughput analysis necessary for optimal GMO detection. Combining the advantages of multiplex detection and droplet digital polymerase chain reaction (ddPCR), a single universal primer-multiplex-ddPCR (SUP-M-ddPCR) strategy was proposed for accurate broad-spectrum screening and quantification. The SUP increases efficiency of the primers in PCR and plays an important role in establishing a high-throughput, multiplex detection method. Emerging ddPCR technology has been used for accurate quantification of nucleic acid molecules without a standard curve. Using maize as a reference point, four heterologous sequences ( 35S, NOS, NPTII, and PAT) were selected to evaluate the feasibility and applicability of this strategy. Surprisingly, these four genes cover more than 93% of the transgenic maize lines and serve as preliminary screening sequences. All screening probes were labeled with FAM fluorescence, which allows the signals from the samples with GMO content and those without to be easily differentiated. This fiveplex screening method is a new development in GMO screening. Utilizing an optimal amplification assay, the specificity, limit of detection (LOD), and limit of quantitation (LOQ) were validated. The LOD and LOQ of this GMO screening method were 0.1% and 0.01%, respectively, with a relative standard deviation (RSD) < 25%. This method could serve as an important tool for the detection of GM maize from different processed, commercially available products. Further, this screening method could be applied to other fields that require reliable and sensitive detection of DNA targets.

Development of a duplex droplet digital PCR assay for absolute quantitative detection of "Candidatus Liberibacter asiaticus".

PubMed

Selvaraj, Vijayanandraj; Maheshwari, Yogita; Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg; Yokomi, Raymond

2018-01-01

Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium "Candidatus Liberibacter asiaticus" (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer.

Development of a duplex droplet digital PCR assay for absolute quantitative detection of "Candidatus Liberibacter asiaticus"

PubMed Central

Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg

2018-01-01

Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium “Candidatus Liberibacter asiaticus” (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer. PMID:29772016

Tools to minimize interlaboratory variability in vitellogenin gene expression monitoring programs

USGS Publications Warehouse

Jastrow, Aaron; Gordon, Denise A.; Auger, Kasie M.; Punska, Elizabeth C.; Arcaro, Kathleen F.; Keteles, Kristen; Winkelman, Dana L.; Lattier, David; Biales, Adam; Lazorchak, James M.

2017-01-01

The egg yolk precursor protein vitellogenin is widely used as a biomarker of estrogen exposure in male fish. However, standardized methodology is lacking and little is known regarding the reproducibility of results among laboratories using different equipment, reagents, protocols, and data analysis programs. To address this data gap we tested the reproducibility across laboratories to evaluate vitellogenin gene (vtg) expression and assessed the value of using a freely available software data analysis program. Samples collected from studies of male fathead minnows (Pimephales promelas) exposed to 17α-ethinylestradiol (EE2) and minnows exposed to processed wastewater effluent were evaluated for vtg expression in 4 laboratories. Our results indicate reasonable consistency among laboratories if the free software for expression analysis LinRegPCR is used, with 3 of 4 laboratories detecting vtg in fish exposed to 5 ng/L EE2 (n = 5). All 4 laboratories detected significantly increased vtg levels in 15 male fish exposed to wastewater effluent compared with 15 male fish held in a control stream. Finally, we were able to determine that the source of high interlaboratory variability from complementary deoxyribonucleic acid (cDNA) to quantitative polymerase chain reaction (qPCR) analyses was the expression analysis software unique to each real-time qPCR machine. We successfully eliminated the interlaboratory variability by reanalyzing raw fluorescence data with independent freeware, which yielded cycle thresholds and polymerase chain reaction (PCR) efficiencies that calculated results independently of proprietary software. Our results suggest that laboratories engaged in monitoring programs should validate their PCR protocols and analyze their gene expression data following the guidelines established in the present study for all gene expression biomarkers. 

Specific detection of Echinococcus spp. from the Tibetan fox (Vulpes ferrilata) and the red fox (V. vulpes) using copro-DNA PCR analysis.

PubMed

Jiang, Weibin; Liu, Nan; Zhang, Gaotian; Renqing, Pengcuo; Xie, Fei; Li, Tiaoying; Wang, Zhenghuan; Wang, Xiaoming

2012-10-01

There are three Echinococcus species, Echinococcus granulosus, E. multilocularis, and E. shiquicus, which are distributed on the vast area of pastureland on the eastern Tibetan plateau in China. Tibetan foxes (Vulpes ferrilata) have been determined to be the main wild definitive host of E. multilocularis and E. shiquicus, but little information is available on the prevalence of these two parasites in Tibetan foxes. Consequently, the copro-prevalence of these parasites in foxes from the eastern Tibetan plateau was evaluated in this study. For each copro-DNA sample extracted from fox feces, a 133-bp segment of EgG1 Hae III was used to screen for infection with E. granulosus. Multiplex nested polymerase chain reaction (PCR) analysis was used to target an 874-bp segment of the mitochondrial COI gene to distinguish E. multilocularis and E. shiquicus. Among 184 fecal samples, 120 were from Tibetan foxes and six from red foxes (Vulpes vulpes). Of the fecal samples from Tibetan foxes, 74 (giving a copro-prevalence of 62%) showed the presence of Echinococcus spp.: 23 (19%) were found to contain E. multilocularis, 32 (27%) E. shiquicus, and 19 (16%) showed mixed infection with both E. multilocularis and E. shiquicus. Two fecal samples from red foxes were found to be infected with E. multilocularis. No fox feces were found to be infected with E. granulosus. Tests on zinc finger protein genes and a 105-bp fragment of the Sry gene found no significant difference in the prevalence of the two parasites between sexes. The efficiency of our multiplex nested PCR methods were compared with previous polymerase chain reaction-based restriction fragment length polymorphism (PCR-RFLP) methods and some problems associated with the copro-PCR were discussed.

Development of a propidium monoazide-polymerase chain reaction assay for detection of viable Lactobacillus brevis in beer.

PubMed

Ma, Yanlin; Deng, Yang; Xu, Zhenbo; Liu, Junyan; Dong, Jianjun; Yin, Hua; Yu, Junhong; Chang, Zongming; Wang, Dongfeng

The spoilage of beer by bacteria is of great concern to the brewer as this can lead to turbidity and abnormal flavors. The polymerase chain reaction (PCR) method for detection of beer-spoilage bacteria is highly specific and provides results much faster than traditional microbiology techniques. However, one of the drawbacks is the inability to differentiate between live and dead cells. In this paper, the combination of propidium monoazide (PMA) pretreatment and conventional PCR had been described. The established PMA-PCR identified beer spoilage Lactobacillus brevis based not on their identity, but on the presence of horA gene which we show to be highly correlated with the ability of beer spoilage LAB to grow in beer. The results suggested that the use of 30μg/mL or less of PMA did not inhibit the PCR amplification of DNA derived from viable L. brevis cells. The minimum amount of PMA to completely inhibit the PCR amplification of DNA derived from dead L. brevis cells was 2.0μg/mL. The detection limit of PMA-PCR assay described here was found to be 10 colony forming units (CFU)/reaction for the horA gene. Moreover, the horA-specific PMA-PCR assays were subjected to 18 reference isolates, representing 100% specificity with no false positive amplification observed. Overall the use of horA-specific PMA-PCR allows for a substantial reduction in the time required for detection of potential beer spoilage L. brevis and efficiently differentiates between viable and nonviable cells. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Genetic variability and molecular identification of Brazilian Biomphalaria species (Mollusca: Planorbidae).

PubMed

Carvalho, S; Caldeira, R L; Simpson, A J; Vidigal, T H

2001-01-01

Freshwater snails belonging to the genus Biomphalaria are intermediate hosts of the trematode Schistosoma mansoni in the Neotropical region and Africa. In Brazil, one subspecies and ten species of Biomphalaria have been identified: B. glabrata, B. tenagophila, B. straminea, B. occidentalis, B. peregrina, B. kuhniana, B. schrammi, B. amazonica, B. oligoza, B. intermedia and B.t. guaibensis. However, only the first three species are found naturally infected with S. mansoni. The classical identification of these planorbids is based on comparison of morphological characteristics of the shell and male and female reproductive organs, which is greatly complicated by the extensive intra-specific variation. Several molecular techniques have been used in studies on the identification, genetic structure as well as phylogenetic relationships between these groups of organisms. Using the randomly amplified polymorphic DNAs (RAPD) analysis we demonstrated that B. glabrata exhibits a remarkable degree of intra-specific polymorphism. Thus, the genetics of the snail host may be more important to the epidemiology of schistosomiasis than those of the parasite itself. Using the simple sequence repeat anchored polymerase chain reaction (SSR-PCR) in intra-populational and intra-specific studies we have demonstrated that snails belonging to the B. straminea complex (B. straminea, B. kuhniana and B. intermedia) clearly presented higher heterogeneity. Using the low stringency polymerase chain reaction (LS-PCR) technique we were able to separate B. glabrata from B. tenagophila and B. tenagophila from B. occidentalis. To separate all Brazilian Biomphalaria species we used the restriction fragment length polymorphism (PCR-RFLP) of the internal transcribed spacer region (ITS) of the DNA gene. The method also proved to be efficient for the specific identification of DNA extracted from snail eggs. Recently we have sequenced the ITS2 region for phylogenetic studies of all Biomphalaria snails from Brazil.

Real-time polymerase chain reaction detection of cauliflower mosaic virus to complement the 35S screening assay for genetically modified organisms.

PubMed

Cankar, Katarina; Ravnikar, Maja; Zel, Jana; Gruden, Kristina; Toplak, Natasa

2005-01-01

Labeling of genetically modified organisms (GMOs) is now in place in many countries, including the European Union, in order to guarantee the consumer's choice between GM and non-GM products. Screening of samples is performed by polymerase chain reaction (PCR) amplification of regulatory sequences frequently introduced into genetically modified plants. Primers for the 35S promoter from Cauliflower mosaic virus (CaMV) are those most frequently used. In virus-infected plants or in samples contaminated with plant material carrying the virus, false-positive results can consequently occur. A system for real-time PCR using a TaqMan minor groove binder probe was designed that allows recognition of virus coat protein in the sample, thus allowing differentiation between transgenic and virus-infected samples. We measured the efficiency of PCR amplification, limits of detection and quantification, range of linearity, and repeatability of the assay in order to assess the applicability of the assay for routine analysis. The specificity of the detection system was tested on various virus isolates and plant species. All 8 CaMV isolates were successfully amplified using the designed system. No cross-reactivity was detected with DNA from 3 isolates of the closely related Carnation etched ring virus. Primers do not amplify plant DNA from available genetically modified maize and soybean lines or from different species of Brassicaceae or Solanaceae that are natural hosts for CaMV. We evaluated the assay for different food matrixes by spiking CaMV DNA into DNA from food samples and have successfully amplified CaMV from all samples. The assay was tested on rapeseed samples from routine GMO testing that were positive in the 35S screening assay, and the presence of the virus was confirmed.

Simultaneous detection of the three ilarviruses affecting stone fruit trees by nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction.

PubMed

Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V

2000-12-01

ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.

A movie of the RNA polymerase nucleotide addition cycle.

PubMed

Brueckner, Florian; Ortiz, Julio; Cramer, Patrick

2009-06-01

During gene transcription, RNA polymerase (Pol) passes through repetitive cycles of adding a nucleotide to the growing mRNA chain. Here we obtained a movie of the nucleotide addition cycle by combining structural information on different functional states of the Pol II elongation complex (EC). The movie illustrates the two-step loading of the nucleoside triphosphate (NTP) substrate, closure of the active site for catalytic nucleotide incorporation, and the presumed two-step translocation of DNA and RNA, which is accompanied by coordinated conformational changes in the polymerase bridge helix and trigger loop. The movie facilitates teaching and a mechanistic analysis of transcription and can be downloaded from http://www.lmb.uni-muenchen.de/cramer/pr-materials.

Space-to-Ground: Genes in Space: 04/13/2018

NASA Image and Video Library

2018-04-12

Can the Polymerase Chain Reaction be used to study DNA alterations on the International Space Station? NASA's Space to Ground is your weekly update on what's happening aboard the International Space Station.

EPA Scientists Develop Research Methods for Studying Mold Fact Sheet

EPA Pesticide Factsheets

In 2002, U.S. Environmental Protection Agency researchers developed a DNA-based Mold Specific Quantitative Polymerase Chain Reaction method (MSQPCR) for identifying and quantifying over 100 common molds and fungi.

Polymerase chain reaction-based identification of clinically relevant Pasteurellaceae isolated from cats and dogs in Poland.

PubMed

Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw

2011-05-01

A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)

Biotechnical use of polymerase chain reaction for microbiological analysis of biological samples.

PubMed

Lantz, P G; Abu al-Soud, W; Knutsson, R; Hahn-Hägerdal, B; Rådström, P

2000-01-01

Since its introduction in the mid-80s, polymerase chain reaction (PCR) technology has been recognised as a rapid, sensitive and specific molecular diagnostic tool for the analysis of micro-organisms in clinical, environmental and food samples. Although this technique can be extremely effective with pure solutions of nucleic acids, it's sensitivity may be reduced dramatically when applied directly to biological samples. This review describes PCR technology as a microbial detection method, PCR inhibitors in biological samples and various sample preparation techniques that can be used to facilitate PCR detection, by either separating the micro-organisms from PCR inhibitors and/or by concentrating the micro-organisms to detectable concentrations. Parts of this review are updated and based on a doctoral thesis by Lantz [1] and on a review discussing methods to overcome PCR inhibition in foods [2].

Vanadium accelerates polymerase chain reaction and expands the applicability of forensic DNA testing.

PubMed

Kaminiwa, Junko; Honda, Katsuya; Sugano, Yukiko; Yano, Shizue; Nishi, Takeki; Sekine, Yuko

2013-05-01

Polymerase chain reaction (PCR) has been rapidly established as one of the most widely used techniques in molecular biology. Because most DNA analysis is PCR-based, the analysis of unamplifiable DNA of poor quality or low quantity is nearly impossible. However, we observed that if an appropriate concentration of vanadium chloride is added to the standard reaction mixture, the enzymatic amplification of DNA could be enhanced. Using multiplex PCR with the addition of vanadium, DNA typing was possible from even trace amounts of DNA that we were unable to amplify using normal reaction conditions. This method might be an effective tool for not only criminal investigations and ancient DNA analysis, but also for nearly all fields using DNA technology. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Large pathogenic expansions in the SCA2 and SCA7 genes can be detected by fluorescent repeat-primed polymerase chain reaction assay.

PubMed

Cagnoli, Claudia; Stevanin, Giovanni; Michielotto, Chiara; Gerbino Promis, Giovanni; Brussino, Alessandro; Pappi, Patrizia; Durr, Alexandra; Dragone, Elisa; Viemont, Michelle; Gellera, Cinzia; Brice, Alexis; Migone, Nicola; Brusco, Alfredo

2006-02-01

Large expansions in the SCA2 and SCA7 genes (>100 CAG repeats) have been associated with juvenile and infantile forms of cerebellar ataxias that cannot be detected using standard polymerase chain reaction (PCR). Here, we describe a successful application of the fluorescent short tandem repeat-primed PCR method for accurate identification of these expanded repeats. The test is robust, reliable, and inexpensive and can be used to screen large series of patients, although it cannot give a precise evaluation of the size of the expansion. This test may be of practical value in prenatal diagnoses offered to affected or pre-symptomatic at-risk parents, in which a very large expansion inherited from one of the parents can be missed in the fetus by standard PCR.

Large Pathogenic Expansions in the SCA2 and SCA7 Genes Can Be Detected by Fluorescent Repeat-Primed Polymerase Chain Reaction Assay

PubMed Central

Cagnoli, Claudia; Stevanin, Giovanni; Michielotto, Chiara; Gerbino Promis, Giovanni; Brussino, Alessandro; Pappi, Patrizia; Durr, Alexandra; Dragone, Elisa; Viemont, Michelle; Gellera, Cinzia; Brice, Alexis; Migone, Nicola; Brusco, Alfredo

2006-01-01

Large expansions in the SCA2 and SCA7 genes (>100 CAG repeats) have been associated with juvenile and infantile forms of cerebellar ataxias that cannot be detected using standard polymerase chain reaction (PCR). Here, we describe a successful application of the fluorescent short tandem repeat-primed PCR method for accurate identification of these expanded repeats. The test is robust, reliable, and inexpensive and can be used to screen large series of patients, although it cannot give a precise evaluation of the size of the expansion. This test may be of practical value in prenatal diagnoses offered to affected or pre-symptomatic at-risk parents, in which a very large expansion inherited from one of the parents can be missed in the fetus by standard PCR. PMID:16436644

Tuberculous otitis media: a resurgence?

PubMed

Kameswaran, M; Natarajan, K; Parthiban, M; Krishnan, P V; Raghunandhan, S

2017-09-01

Tuberculosis is a global health problem that is especially prevalent in developing countries such as India. Recently, atypical presentation has become more common and a high index of suspicion is essential. This study analysed the various presenting symptoms and signs of tuberculous otitis media and the role of diagnostic tests, with the aim of formulating criteria for the diagnosis. A total of 502 patients underwent tympanomastoidectomy over a two-year period. Microbiological and histopathological examinations and polymerase chain reaction analysis of tissue taken during tympanomastoidectomy were performed. A total of 25 patients (5 per cent) were diagnosed with tuberculous otitis media. Severe mixed hearing loss, facial palsy, labyrinthine fistula, post-aural fistula, perichondritis and extradural abscess were noted. There seems to be a resurgence in tuberculous otitis media in India. Microbiological, histopathological and polymerase chain reaction tests for tuberculosis are helpful for its diagnosis.

Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

PubMed

Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

2008-12-01

One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

[Polymerase chain reaction applied for detection of Toxoplasma gondii in lymph nodes].

PubMed

Liu, C; Ouyang, K; Tan, D

1998-01-01

In order to investigate the morbidity of toxoplasmic lymphadenitis, polymerase chain reaction (PCR) was used to detect DNA of Toxoplasma gondii within lymph nodes in 3 groups of 120 patients with different diseases. After extracting the DNA of each sample, PCR was employed to amplify toxoplasma DNA. The results showed that the amplification product of 210 bp was confirmed in 7 patients: 3 cases of Hodgkin's disease (HD), 2 cases of non-Hodgkin's lymphoma (NHL) and 2 cases of chronic lymphadenitis (CL). Each PCR product was then subjected to Southern blot hybridization. Besides the 7 cases proved by PCR, 1 case of CL was found positive. The positive percentages of HD, NHL and CL were 9.38% (3/32), 4.88% (2/41), and 6.38% (3/47), respectively. The total positive rate was 6.67% (8/120).

Advances in digital polymerase chain reaction (dPCR) and its emerging biomedical applications.

PubMed

Cao, Lei; Cui, Xingye; Hu, Jie; Li, Zedong; Choi, Jane Ru; Yang, Qingzhen; Lin, Min; Ying Hui, Li; Xu, Feng

2017-04-15

Since the invention of polymerase chain reaction (PCR) in 1985, PCR has played a significant role in molecular diagnostics for genetic diseases, pathogens, oncogenes and forensic identification. In the past three decades, PCR has evolved from end-point PCR, through real-time PCR, to its current version, which is the absolute quantitive digital PCR (dPCR). In this review, we first discuss the principles of all key steps of dPCR, i.e., sample dispersion, amplification, and quantification, covering commercialized apparatuses and other devices still under lab development. We highlight the advantages and disadvantages of different technologies based on these steps, and discuss the emerging biomedical applications of dPCR. Finally, we provide a glimpse of the existing challenges and future perspectives for dPCR. Copyright © 2016 Elsevier B.V. All rights reserved.

Norrie disease in a family with a manifesting female carrier.

PubMed

Sims, K B; Irvine, A R; Good, W V

1997-04-01

To show that Norrie disease can occur in a girl and to describe her ophthalmologic and genetic features. Amplification of DNA polymerase chain reaction and sequencing of asymmetric polymerase chain reaction for exon 3 were performed on the blood specimen obtained from a girl born with bilateral retinal detachments. A female child with bilateral retinal detachment who had 2 uncles in whom Norrie disease had already been diagnosed. The child had a mutation in the third exon (T776-->A; Ile 123-->Asn) identical to the mutation found in her uncles. Norrie disease can occur in girls. The most likely explanation is nonrandom or unfavorable X inactivation, although timing of development of the peripheral retina and its blood supply could render it vulnerable to effects of the mutant allele at a critical developmental phase.

Development of the polymerase chain reaction for diagnosis of chancroid.

PubMed Central

Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

1993-01-01

The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

NASA Astrophysics Data System (ADS)

Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen S.; Skov, Julia; Sun, Yi; Duong Bang, Dang; Pedersen, Michael E.; Hansen, Mikkel F.; Wolff, Anders

2013-07-01

We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence signal from Rhodamine B. The method was validated with the PCR amplification of mecA gene (162 bp) from methicillin-resistant Staphylococcus aureus bacterium (MRSA), where the time for 30 cycles was reduced from 50 min (without over- and undershooting) to 20 min.

Absence of giant blood Marseille-like virus DNA detection by polymerase chain reaction in plasma from healthy US blood donors and serum from multiply transfused patients from Cameroon.

PubMed

Phan, Tung Gia; Desnues, Christelle; Switzer, William M; Djoko, Cyrille F; Schneider, Bradley S; Deng, Xutao; Delwart, Eric

2015-06-01

A new Marseilleviridae virus family member, giant blood Marseille-like (GBM) virus, was recently reported in persons from France in the serum of an infant with adenitis, in the blood of 4% of healthy blood donors, and in 9% of multiply transfused thalassemia patients. These results suggested the presence of a nucleocytoplasmic large DNA virus potentially transmissible by blood product transfusion. To investigate this possibility we tested the plasma from 113 US blood donors and 74 multiply transfused Cameroon patients for GBM viral DNA using highly sensitive polymerase chain reaction (PCR) assays. GBM DNA was not detected by nested PCR in any of these 187 human specimens. Further testing is required to confirm the occurrence of human GBM virus infections. © 2015 AABB.

Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds.

PubMed

Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario

2010-06-01

Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons <150 base pairs) of the mitochondrial 12S rRNA gene, and an endogenous control primer pair that amplifies a 141-bp fragment of the nuclear 18S rRNA gene from eukaryotic DNA. Analysis of experimental raw and heat-treated binary mixtures as well as of commercial meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.

Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

DOEpatents

Chen, Xian; Gupta, Goutam; Bradbury, E. Morton

2001-01-01

Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

A novel polymerase chain reaction (PCR) - denaturing gradient gel electrophoresis (DGGE) for the identification of Micrococcaceae strains involved in meat fermentations. Its application to naturally fermented Italian sausages.

PubMed

Cocolin, L; Manzano, M; Aggio, D; Cantoni, C; Comi, G

2001-05-01

A new molecular method consisting of polymerase chain reaction (PCR) amplification and denaturing gradient gel electrophoresis (DGGE) of a small fragment from the 16S rRNA gene identified the Micrococcaceae strains isolated from natural fermented Italian sausages. Lactic acid bacteria, total aerobic mesophilic flora, Enterobacteriaceae and faecal enterococci were also monitored. Micrococcaceaea control strains from international collections were used to optimise the method and 90 strains, isolated from fermented sausages, were identified by biochemical tests and PCR-DGGE. No differences were observed between the methods used. The results reported in this paper prove that Staphylococcus xylosus is the main bacterium involved in fermented sausage production, representing, from the tenth day of ripening, the only Micrococcaceaea species isolated.

High-throughput amplification of mature microRNAs in uncharacterized animal models using polyadenylated RNA and stem-loop reverse transcription polymerase chain reaction.

PubMed

Biggar, Kyle K; Wu, Cheng-Wei; Storey, Kenneth B

2014-10-01

This study makes a significant advancement on a microRNA amplification technique previously used for expression analysis and sequencing in animal models without annotated mature microRNA sequences. As research progresses into the post-genomic era of microRNA prediction and analysis, the need for a rapid and cost-effective method for microRNA amplification is critical to facilitate wide-scale analysis of microRNA expression. To facilitate this requirement, we have reoptimized the design of amplification primers and introduced a polyadenylation step to allow amplification of all mature microRNAs from a single RNA sample. Importantly, this method retains the ability to sequence reverse transcription polymerase chain reaction (RT-PCR) products, validating microRNA-specific amplification. Copyright © 2014 Elsevier Inc. All rights reserved.

Real-time quantitative polymerase chain reaction methods for four genetically modified maize varieties and maize DNA content in food.

PubMed

Brodmann, Peter D; Ilg, Evelyn C; Berthoud, Hélène; Herrmann, Andre

2002-01-01

Quantitative detection methods are needed for enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients. This labeling threshold, which is set to 1% in the European Union and Switzerland, must be applied to all approved GMOs. Four different varieties of maize are approved in the European Union: the insect-resistant Bt176 maize (Maximizer), Btl 1 maize, Mon810 (YieldGard) maize, and the herbicide-tolerant T25 (Liberty Link) maize. Because the labeling must be considered individually for each ingredient, a quantitation system for the endogenous maize content is needed in addition to the GMO-specific detection systems. Quantitative real-time polymerase chain reaction detection methods were developed for the 4 approved genetically modified maize varieties and for an endogenous maize (invertase) gene system.

[Development of molecular detection of food-borne pathogenic bacteria using miniaturized microfluidic devices].

PubMed

Iván, Kristóf; Maráz, Anna

2015-12-20

Detection and identification of food-borne pathogenic bacteria are key points for the assurance of microbiological food safety. Traditional culture-based methods are more and more replaced by or supplemented with nucleic acid based molecular techniques, targeting specific (preferably virulence) genes in the genomes. Internationally validated DNA amplification - most frequently real-time polymerase chain reaction - methods are applied by the food microbiological testing laboratories for routine analysis, which will result not only in shortening the time for results but they also improve the performance characteristics (e.g. sensitivity, specificity) of the methods. Beside numerous advantages of the polymerase chain reaction based techniques for routine microbiological analysis certain drawbacks have to be mentioned, such as the high cost of the equipment and reagents, as well as the risk of contamination of the laboratory environment by the polymerase chain reaction amplicons, which require construction of an isolated laboratory system. Lab-on-a-chip systems can integrate most of these laboratory processes within a miniaturized device that delivers the same specificity and reliability as the standard protocols. The benefits of miniaturized devices are: simple - often automated - use, small overall size, portability, sterility due to single use possibility. These miniaturized rapid diagnostic tests are being researched and developed at the best research centers around the globe implementing various sample preparation and molecular DNA amplification methods on-chip. In parallel, the aim of the authors' research is to develop microfluidic Lab-on-a-chip devices for the detection and identification of food-borne pathogenic bacteria.

Clinical characteristics of children with viral single- and co-infections and a petechial rash.

PubMed

Schneider, Henriette; Adams, Ortwin; Weiss, Christel; Merz, Ulrich; Schroten, Horst; Tenenbaum, Tobias

2013-05-01

Children with petechial rash are more likely to undergo invasive diagnostics, to be treated with antibiotics for potential bacterial infection and to be hospitalized. However, viruses have also been associated with petechial rash. Nonetheless, a systematic analysis of viral infections with modern available techniques as quantitative real-time polymerase chain reaction in the context of petechial rash is lacking. The purpose of this pediatric study was to prospectively uncover viral pathogens that may promote the emergence of petechiae and to analyze the correlation with the clinical characteristics and course. We conducted a prospective study in children (0 to 18 years) presenting with petechiae and signs or symptoms of infection at the emergency department between November 2009 and March 2012. In nasopharyngeal aspirates the following viruses were analyzed by quantitative real-time polymerase chain reaction: cytomegalovirus, Epstein-Barr virus, parvovirus B19, influenza A and B, parainfluenza viruses, human respiratory syncytial virus A and B, human metapneumovirus, rhinovirus, enterovirus, adenovirus, human coronavirus OC43, 229E, NL63 and human bocavirus. A viral pathogen was identified in 67% of the analyzed 58 cases with petechial rash. Virus positive patients showed a significantly higher incidence of lower respiratory tract infections. Forty-one percent were viral coinfections, which were significantly younger than virus negative patients, had a higher leukocyte count and were hospitalized for a longer time. A petechial rash is frequently associated viral single- and coinfections and can rapidly be identified via quantitative real-time polymerase chain reaction.

Prevalence of Sexually Transmitted Diseases in Asymptomatic Renal Transplant Recipients.

PubMed

Sarier, Mehmet; Sepin Ozen, Nevgun; Guler, Hicran; Duman, Ibrahim; Yüksel, Yücel; Tekin, Sabri; Yavuz, Asuman Havva; Yucetin, Levent; Erdogan Yilmaz, Mine

2018-04-04

Sexually transmitted diseases, which may be asymptomatic, have the potential to cause serious health problems in renal transplant recipients. The aim of this study was to determine the prevalence of sexually transmitted diseases in sexually active asymptomatic renal transplant patients by using real-time multiplex polymerase chain reaction assays. This prospective controlled study was conducted between November 2016 and January 2017 in our hospital. Our study group included 80 consecutive, sexually active asymptomatic patients (40 men and 40 women) who had undergone renal transplant in our hospital and who presented to our outpatient clinic for routine follow-up. We also included a control group of 80 consecutive, sexually active nontransplant patients (40 men and 40 women). All patient samples were tested for Gardnerella vaginalis and obligate anaerobes (Prevotella bivia, Porphyromonas species), Candida species, Mycoplasma hominis, Mycoplasma genitalium, Ureaplasma species, Trichomonas vaginalis, Neisseria gonorrhoeae, Chlamydia trachomatis, herpes simplex virus 1 and 2, and Cytomegalovirus by real-time multiplex polymerase chain reaction. The prevalences of infection with Gardnerella vaginalis and obligate anaerobes (P = .043), Ureaplasma species (P = .02), and Cytomegalovirus (P = .016) were found to be significantly higher in the study group versus the control group. However, there was no difference between the 2 groups regarding the prevalence of Mycoplasma infection (P = .70). Sexually transmitted diseases may occur more frequently in sexually active asymptomatic renal transplant recipients than in nontransplanted individuals. Real-time multiplex polymerase chain reaction analysis may be a suitable method for determining these pathogens.

Granulomatous herpes simplex encephalitis in an infant with multicystic encephalopathy: a distinct clinicopathologic entity?

PubMed

Schutz, Peter W; Fauth, Clarissa T; Al-Rawahi, Ghada N; Pugash, Denise; White, Valerie A; Stockler, Sylvia; Dunham, Christopher P

2014-04-01

Herpes simplex virus encephalitis can manifest as a range of clinical presentations including classic adult, neonatal, and biphasic chronic-granulomatous herpes encephalitis. We report an infant with granulomatous herpes simplex virus type 2 encephalitis with a subacute course and multicystic encephalopathy. A 2-month-old girl presented with lethargy and hypothermia. Computed tomography scan of the head showed multicystic encephalopathy and calcifications. Cerebrospinal fluid analysis by polymerase chain reaction testing for herpes simplex virus 1 and 2, enterovirus, and cytomegalovirus was negative. Normal cerebrospinal fluid interferon-α levels argued against Aicardi-Goutières syndrome. The patient died 2 weeks after presentation. At autopsy, multicystic encephalopathy was confirmed with bilateral gliosis, granulomatous inflammation with multinucleated giant cells, and calcifications. Bilateral healing necrotizing retinitis suggested a viral etiology, but retina and brain were free of viral inclusions and immunohistochemically negative for herpes simplex virus-2 and cytomegalovirus. However, polymerase chain reaction analysis showed herpes simplex virus-2 DNA in four cerebral paraffin blocks. Subsequent repeat testing of the initial cerebrospinal fluid sample using a different polymerase chain reaction assay was weakly positive for herpes simplex virus-2 DNA. Granulomatous herpes simplex virus encephalitis in infants can present with subacute course and result in multicystic encephalopathy with mineralization and minimal cerebrospinal fluid herpes simplex virus DNA load. Infectious etiologies should be carefully investigated in the differential diagnosis of multicystic encephalopathy with mineralization, in particular if multinucleated giant cells are present. Copyright © 2014 Elsevier Inc. All rights reserved.

Molecular testing for familial hypercholesterolaemia-associated mutations in a UK-based cohort: development of an NGS-based method and comparison with multiplex polymerase chain reaction and oligonucleotide arrays.

PubMed

Reiman, Anne; Pandey, Sarojini; Lloyd, Kate L; Dyer, Nigel; Khan, Mike; Crockard, Martin; Latten, Mark J; Watson, Tracey L; Cree, Ian A; Grammatopoulos, Dimitris K

2016-11-01

Background Detection of disease-associated mutations in patients with familial hypercholesterolaemia is crucial for early interventions to reduce risk of cardiovascular disease. Screening for these mutations represents a methodological challenge since more than 1200 different causal mutations in the low-density lipoprotein receptor has been identified. A number of methodological approaches have been developed for screening by clinical diagnostic laboratories. Methods Using primers targeting, the low-density lipoprotein receptor, apolipoprotein B, and proprotein convertase subtilisin/kexin type 9, we developed a novel Ion Torrent-based targeted re-sequencing method. We validated this in a West Midlands-UK small cohort of 58 patients screened in parallel with other mutation-targeting methods, such as multiplex polymerase chain reaction (Elucigene FH20), oligonucleotide arrays (Randox familial hypercholesterolaemia array) or the Illumina next-generation sequencing platform. Results In this small cohort, the next-generation sequencing method achieved excellent analytical performance characteristics and showed 100% and 89% concordance with the Randox array and the Elucigene FH20 assay. Investigation of the discrepant results identified two cases of mutation misclassification of the Elucigene FH20 multiplex polymerase chain reaction assay. A number of novel mutations not previously reported were also identified by the next-generation sequencing method. Conclusions Ion Torrent-based next-generation sequencing can deliver a suitable alternative for the molecular investigation of familial hypercholesterolaemia patients, especially when comprehensive mutation screening for rare or unknown mutations is required.

Single polysaccharide assembly protein that integrates polymerization, termination, and chain-length quality control

PubMed Central

Williams, Danielle M.; Ovchinnikova, Olga G.; Koizumi, Akihiko; Mainprize, Iain L.; Kimber, Matthew S.; Lowary, Todd L.

2017-01-01

Lipopolysaccharides (LPS) are essential outer membrane glycolipids in most gram-negative bacteria. Biosynthesis of the O-antigenic polysaccharide (OPS) component of LPS follows one of three widely distributed strategies, and similar processes are used to assemble other bacterial surface glycoconjugates. This study focuses on the ATP-binding cassette (ABC) transporter-dependent pathway, where glycans are completed on undecaprenyl diphosphate carriers at the cytosol:membrane interface, before export by the ABC transporter. We describe Raoultella terrigena WbbB, a prototype for a family of proteins that, remarkably, integrates several key activities in polysaccharide biosynthesis into a single polypeptide. WbbB contains three glycosyltransferase (GT) modules. Each of the GT102 and GT103 modules characterized here represents a previously unrecognized GT family. They form a polymerase, generating a polysaccharide of [4)-α-Rhap-(1→3)-β-GlcpNAc-(1→] repeat units. The polymer chain is terminated by a β-linked Kdo (3-deoxy-d-manno-oct-2-ulosonic acid) residue added by a third GT module belonging to the recently discovered GT99 family. The polymerase GT modules are separated from the GT99 chain terminator by a coiled-coil structure that forms a molecular ruler to determine product length. Different GT modules in the polymerase domains of other family members produce diversified OPS structures. These findings offer insight into glycan assembly mechanisms and the generation of antigenic diversity as well as potential tools for glycoengineering. PMID:28137848

The polymerase subunit of a dsRNA virus plays a central role in the regulation of viral RNA metabolism.

PubMed

Makeyev, E V; Bamford, D H

2000-11-15

Bacteriophage φ6 has a three-segmented double-stranded (ds) RNA genome, which resides inside a polymerase complex particle throughout the entire life cycle of the virus. The polymerase subunit P2, a minor constituent of the polymerase complex, has previously been reported to replicate both φ6-specific and heterologous single-stranded (ss) RNAs, giving rise to dsRNA products. In this study, we show that the enzyme is also able to use dsRNA templates to perform semi-conservative RNA transcription in vitro without the assistance of other proteins. The polymerase synthesizes predominantly plus-sense copies of φ6 dsRNA, medium and small segments being more efficient templates than the large one. This distribution of the test-tube reaction products faithfully mimics viral transcription in vivo. Experiments with chimeric ssRNAs and dsRNAs show that short terminal nucleotide sequences can account for the difference in efficiency of RNA synthesis. Taken together, these results suggest a model explaining important aspects of viral RNA metabolism regulation in terms of enzymatic properties of the polymerase subunit.

Differentiation of human foreskin fibroblast-derived induced pluripotent stem cells into hepatocyte-like cells.

PubMed

Wang, Jianjun; Zhao, Ping; Wan, Zhihong; Jin, Xueyuan; Cheng, Yongqian; Yan, Tao; Qing, Song; Ding, Ning; Xin, Shaojie

2016-10-01

The aim of this study was to investigate the differentiation potential of induced pluripotent stem cells (iPSCs) derived from human foreskin fibroblasts (HFFs) into hepatocyte-like cells (HLCs). The iPSCs were firstly induced by transduction of OCT4, SOX2, KLF4, and c-MYC into HFFs using retrovirus. Afterwards, expressions of pluripotency factors were identified by semiquantitative reverse transcription-polymerase chain reaction and immunofluorescence staining, and karyotype, embryoid, and teratoma were observed by microscope. Then, iPSCs were gradually differentiated into endoderm cells, hepatic progenitor cells, and mature HLCs by special culture medium. During this process, differentiation efficiency into each kind of cells was evaluated by detecting SOX17, HNF4a, and ALB using flow cytometry, respectively. Besides, enzyme-linked immunosorbent assay was conducted to detect the secretion of ALB in iPSC-induced HLCs and quantitative reverse transcription-polymerase chain reaction was performed to detect the expression levels of hepatocyte-specific genes. The iPSCs were successfully induced by HFFs, which exhibited typical embryonic stem cells morphology, positive alkaline phosphatase staining, normal diploid karyotype, and positive expression of various pluripotency factors. Meanwhile, spherical embryoid and teratoma with 3 germ layers were formed by iPSCs. The iPSCs were consecutively induced into endoderm cells, hepatic progenitor cells and mature HLCs, and the differentiation efficiency was 55.7 ± 2.9%, 45.7 ± 4.8%, and 35.0 ± 3.9%, respectively. Besides, the secretion of ALB and expression of various hepatocyte-specific genes was highly detected in iPSC-induced HLCs. The iPSCs were successfully derived from HFFs and then differentiated into HLCs, which proved a new source for hepatocyte transplantation. HFFs were successfully induced into iPSCs by transduction of OCT4, SOX2, KLF4, and c-MYC. Positive expressions of various pluripotency factors were exhibited in HFFs-induced iPSCs. The iPSCs were consecutively induced into endoderm cells, hepatic progenitor cells, and mature HLCs. Various hepatocyte-specific genes were highly expressed in iPSC-induced HLCs. Copyright © 2016 John Wiley & Sons, Ltd.

Optimization and evaluation of single-cell whole-genome multiple displacement amplification.

PubMed

Spits, C; Le Caignec, C; De Rycke, M; Van Haute, L; Van Steirteghem, A; Liebaers, I; Sermon, K

2006-05-01

The scarcity of genomic DNA can be a limiting factor in some fields of genetic research. One of the methods developed to overcome this difficulty is whole genome amplification (WGA). Recently, multiple displacement amplification (MDA) has proved very efficient in the WGA of small DNA samples and pools of cells, the reaction being catalyzed by the phi29 or the Bst DNA polymerases. The aim of the present study was to develop a reliable, efficient, and fast protocol for MDA at the single-cell level. We first compared the efficiency of phi29 and Bst polymerases on DNA samples and single cells. The phi29 polymerase generated accurately, in a short time and from a single cell, sufficient DNA for a large set of tests, whereas the Bst enzyme showed a low efficiency and a high error rate. A single-cell protocol was optimized using the phi29 polymerase and was evaluated on 60 single cells; the DNA obtained DNA was assessed by 22 locus-specific PCRs. This new protocol can be useful for many applications involving minute quantities of starting material, such as forensic DNA analysis, prenatal and preimplantation genetic diagnosis, or cancer research. (c) 2006 Wiley-Liss, Inc.

Studies on sex-organ development. Changes in chromatin structure during spermatogenesis in maturing rooster testis as demonstrated by the initiation pattern of ribonucleic acid synthesis in vitro.

PubMed Central

Mezquita, C; Teng, C S

1978-01-01

To probe the structural change in the genome of the differentiating germ cell of the maturing rooster testis, the chromatin from nuclei at various stages of differentiation were transcribed with prokaryotic RNA polymerase from Escherichia coli or with eukaryotic RNA polymerase II from wheat germ. The transcription was performed under conditions of blockage of RNA chain reinitiation in vitro with rifampicin or rifampicin AF/013. With the E. coli enzyme, the changes in (1) the titration curve for the enzyme-chromatin interaction, (2) the number of initiation sites, (3) the rate of elongation of RNA chains, and (4) the kinetics of the formation of stable initiation complexes revealed the unmasking of DNA in elongated spermatids and the masking of DNA in spermatozoa. In both cases the stability of the DNA duplex in the initiation region for RNA synthesis greatly increased. In contrast with the E. coli enzyme, the wheat-germ RNA polymerase II was relatively inefficient at transcribing chromatin of elongated spermatids. Such behaviour can be predicted if unmasked double-stranded DNA is present in elongated spermatids. PMID:346018

NMR solution structure of poliovirus uridylyated peptide linked to the genome (VPgpU)

PubMed Central

Schein, Catherine H.; Oezguen, Numan; van der Heden van Noort, Gerbrand J.; Filippov, Dmitri V.; Paul, Aniko; Kumar, Eric; Braun, Werner

2010-01-01

Picornaviruses have a 22–24 amino acid peptide, VPg, bound covalently at the 5’ end of their RNA, that is essential for replication. VPgs are uridylylated at a conserved Tyrosine to form VPgpU, the primer of RNA synthesis by the viral polymerase. This first complete structure for any uridylylated VPg, of poliovirus type 1 (PV1)-VPgpU, shows that conserved amino acids in VPg stabilize the bound UMP, with the uridine atoms involved in base pairing and chain elongation projected outward. Comparing this structure to PV1-VPg and partial structures of VPg/VPgpU from other picornaviruses suggests that enteroviral polymerases require a more stable VPg structure than does the distantly related aphthovirus, foot and mouth disease virus (FMDV). The glutamine residue at the C-terminus of PV1-VPgpU lies in back of the uridine base and may stabilize its position during chain elongation and/or contribute to base specificity. Under in vivo-like conditions with the authentic cre(2C) hairpin RNA and Mg++, 5-methylUTP cannot compete with UTP for VPg uridylyation in an in vitro uridylyation assay, but both nucleotides are equally incorporated by PV1-polymerase with Mn++ and a poly-A RNA template. This indicates the 5 position is recognized under in vivo conditions. The compact VPgpU structure docks within the active site cavity of the PV-polymerase, close to the position seen for the fragment of FMDV-VPgpU with its polymerase. This structure could aid in design of novel enterovirus inhibitors, and stabilization upon uridylylation may also be pertinent for post-translational uridylylation reactions that underlie other biological processes. PMID:20441784

Characterization of an Avipoxvirus From a Bald Eagle ( Haliaeetus leucocephalus ) Using Novel Consensus PCR Protocols for the rpo147 and DNA-Dependent DNA Polymerase Genes.

PubMed

Stephen, Alexa A; Leone, Angelique M; Toplon, David E; Archer, Linda L; Wellehan, James F X

2016-12-01

A juvenile female bald eagle ( Haliaeetus leucocephalus ) was presented with emaciation and proliferative periocular lesions. The eagle did not respond to supportive therapy and was euthanatized. Histopathologic examination of the skin lesions revealed plaques of marked epidermal hyperplasia parakeratosis, marked acanthosis and spongiosis, and eosinophilic intracytoplasmic inclusion bodies. Novel polymerase chain reaction (PCR) assays were done to amplify and sequence DNA polymerase and rpo147 genes. The 4b gene was also analyzed by a previously developed assay. Bayesian and maximum likelihood phylogenetic analyses of the obtained sequences found it to be poxvirus of the genus Avipoxvirus and clustered with other raptor isolates. Better phylogenetic resolution was found in rpo147 rather than the commonly used DNA polymerase. The novel consensus rpo147 PCR assay will create more accurate phylogenic trees and allow better insight into poxvirus history.

Knockdown of stromal interaction molecule 1 inhibits proliferation of colorectal cancer cells by inducing apoptosis.

PubMed

Yang, Dong; Dai, Xiaoyu; Li, Keqiang; Xie, Yangyang; Zhao, Jianpei; Dong, Mingjun; Yu, Hua; Kong, Zhenfang

2018-06-01

Stromal interaction molecule 1 (STIM1) is an endoplasmic reticulum Ca 2+ sensor which has been reported to be overexpressed in numerous types of cancer, and is involved in the cell proliferation, invasion, migration and metastasis frequently observed in cancer. However, the role of STIM1 in colorectal cancer (CRC) remains unknown. The purpose of the present study was to investigate the effect of STIM1 in human CRC. The expression of STIM1 was specifically knocked down using lentivirus-mediated small hairpin RNA (shRNA) interference techniques in the CRC cell lines HCT116 and SW1116. Subsequently, the efficiency of infection was confirmed using green fluorescent protein (GFP)-positive signals. The knockdown efficiency was further determined using the reverse transcription-quantitative polymerase chain reaction and western blotting analysis. As a result, CRC cell lines with STIM1 silenced were successfully constructed and subsequently employed in a series of cell function assays. Knockdown of STIM1 significantly suppressed cell proliferation and colony formation, as revealed by an MTT and colony formation assay. Furthermore, it was identified that STIM1 silencing may promote cell apoptosis through the induction of mitochondria-associated apoptosis, as was identified by increased expression levels of B-cell lymphoma 2 (Bcl-2)-associated death promoter, Bcl-2-associated X protein and poly(ADP-ribose) polymerase cleavage. Therefore, STIM1 may serve a critical role in the progression of CRC by regulating cell proliferation and apoptosis, which may provide a potential therapeutic target for the treatment of CRC.

Analysis of Acquisition and Titer of Maize Mosaic Rhabdovirus in Its Vector, Peregrinus maidis (Hemiptera: Delphacidae)

PubMed Central

Barandoc-Alviar, Karen; Ramirez, Girly M.; Rotenberg, Dorith; Whitfield, Anna E.

2016-01-01

The corn planthopper, Peregrinus maidis (Ashmead) (Hemiptera: Delphacidae), transmits Maize mosaic rhabdovirus (MMV), an important pathogen of maize and sorghum, in a persistent propagative manner. To better understand the vectorial capacity of P. maidis, we determined the efficiency of MMV acquisition by nymphal and adult stages, and characterized MMV titer through development. Acquisition efficiency, i.e., proportion of insects that acquired the virus, was determined by reverse transcriptase polymerase chain reaction (RT-PCR) and virus titer of individual insects was estimated by quantitative RT-PCR. Acquisition efficiency of MMV differed significantly between nymphs and adults. MMV titer increased significantly over time and throughout insect development from nymphal to adult stage, indication of virus replication in the vector during development. There was a positive association between the vector developmental stage and virus titer. Also, the average titer in male insects was threefold higher than female titers, and this difference persisted up to 30 d post adult eclosion. Overall, our findings indicate that nymphs are more efficient than adults at acquiring MMV and virus accumulated in the vector over the course of nymphal development. Furthermore, sustained infection over the lifespan of P. maidis indicates a potentially high capacity of this vector to transmit MMV. PMID:28076276

Synthesis of amino-rich silica-coated magnetic nanoparticles for the efficient capture of DNA for PCR.

PubMed

Bai, Yalong; Cui, Yan; Paoli, George C; Shi, Chunlei; Wang, Dapeng; Zhou, Min; Zhang, Lida; Shi, Xianming

2016-09-01

Magnetic separation has great advantages over traditional bio-separation methods and has become popular in the development of methods for the detection of bacterial pathogens, viruses, and transgenic crops. Functionalization of magnetic nanoparticles is a key factor for efficient capture of the target analytes. In this paper, we report the synthesis of amino-rich silica-coated magnetic nanoparticles using a one-pot method. This type of magnetic nanoparticle has a rough surface and a higher density of amino groups than the nanoparticles prepared by a post-modification method. Furthermore, the results of hydrochloric acid treatment indicated that the magnetic nanoparticles were stably coated. The developed amino-rich silica-coated magnetic nanoparticles were used to directly adsorb DNA. After magnetic separation and blocking, the magnetic nanoparticles and DNA complexes were used directly for the polymerase chain reaction (PCR), without onerous and time-consuming purification and elution steps. The results of real-time quantitative PCR showed that the nanoparticles with higher amino group density resulted in improved DNA capture efficiency. The results suggest that amino-rich silica-coated magnetic nanoparticles are of great potential for efficient bio-separation of DNA prior to detection by PCR. Copyright © 2016. Published by Elsevier B.V.

Association between mitochondrial DNA haplotype compatibility and increased efficiency of bovine intersubspecies cloning.

PubMed

Yan, Hao; Yan, Zhonghai; Ma, Qingwen; Jiao, Fei; Huang, Shuzhen; Zeng, Fanyi; Zeng, Yitao

2011-01-01

Reconstructed embryos derived from intersubspecies somatic cell nuclear transfer (SCNT) have poorer developmental potential than those from intrasubspecies SCNT. Based on our previous study that Holstein dairy bovine (HD) mitochondrial DNA (mtDNA) haplotype compatibility between donor karyoplast and recipient cytoplast is crucial for SCNT embryo development, we performed intersubspecies SCNT using HD as donor karyoplast and Luxi yellow heifer (LY) as recipient cytoplast according to mtDNA haplotypes determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. The results demonstrated that intersubspecies mtDNA homotype SCNT embryos had higher pre- and post-implantation developmental competence than intrasubspecies mtDNA heterotype embryos as well as improved blastocyst reprogramming status, including normal H3K9 dimethylation pattern and promoter hypomethylation of pluripotent genes such as Oct4 and Sox2, suggesting that intersubspecies SCNT using LY oocytes maintains HD cloning efficiency and may reprogram HD nuclei to develop into a normal cloned animal ultimately. Our results indicated that karyoplast-cytoplast interactions and mtDNA haplotype compatibility may affect bovine intersubspecies SCNT efficiency. This study on bovine intersubspecies SCNT is valuable for understanding the mechanisms of mtDNA haplotype compatibility between karyoplast and cytoplast impacting the bovine SCNT efficiency, and provides an alternative and economic resource for HD cloning. Copyright © 2011. Published by Elsevier Ltd.

Bypass of a Nick by the Replisome of Bacteriophage T7*

PubMed Central

Zhu, Bin; Lee, Seung-Joo; Richardson, Charles C.

2011-01-01

DNA polymerase and DNA helicase are essential components of DNA replication. The helicase unwinds duplex DNA to provide single-stranded templates for DNA synthesis by the DNA polymerase. In bacteriophage T7, movement of either the DNA helicase or the DNA polymerase alone terminates upon encountering a nick in duplex DNA. Using a minicircular DNA, we show that the helicase·polymerase complex can bypass a nick, albeit at reduced efficiency of 7%, on the non-template strand to continue rolling circle DNA synthesis. A gap in the non-template strand cannot be bypassed. The efficiency of bypass synthesis depends on the DNA sequence downstream of the nick. A nick on the template strand cannot be bypassed. Addition of T7 single-stranded DNA-binding protein to the complex stimulates nick bypass 2-fold. We propose that the association of helicase with the polymerase prevents dissociation of the helicase upon encountering a nick, allowing the helicase to continue unwinding of the duplex downstream of the nick. PMID:21701044

Bypass of a nick by the replisome of bacteriophage T7.

PubMed

Zhu, Bin; Lee, Seung-Joo; Richardson, Charles C

2011-08-12

DNA polymerase and DNA helicase are essential components of DNA replication. The helicase unwinds duplex DNA to provide single-stranded templates for DNA synthesis by the DNA polymerase. In bacteriophage T7, movement of either the DNA helicase or the DNA polymerase alone terminates upon encountering a nick in duplex DNA. Using a minicircular DNA, we show that the helicase · polymerase complex can bypass a nick, albeit at reduced efficiency of 7%, on the non-template strand to continue rolling circle DNA synthesis. A gap in the non-template strand cannot be bypassed. The efficiency of bypass synthesis depends on the DNA sequence downstream of the nick. A nick on the template strand cannot be bypassed. Addition of T7 single-stranded DNA-binding protein to the complex stimulates nick bypass 2-fold. We propose that the association of helicase with the polymerase prevents dissociation of the helicase upon encountering a nick, allowing the helicase to continue unwinding of the duplex downstream of the nick.

KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

PubMed

Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

2012-07-01

Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

Initiation, extension, and termination of RNA synthesis by a paramyxovirus polymerase.

PubMed

Jordan, Paul C; Liu, Cheng; Raynaud, Pauline; Lo, Michael K; Spiropoulou, Christina F; Symons, Julian A; Beigelman, Leo; Deval, Jerome

2018-02-01

Paramyxoviruses represent a family of RNA viruses causing significant human diseases. These include measles virus, the most infectious virus ever reported, in addition to parainfluenza virus, and other emerging viruses. Paramyxoviruses likely share common replication machinery but their mechanisms of RNA biosynthesis activities and details of their complex polymerase structures are unknown. Mechanistic and functional details of a paramyxovirus polymerase would have sweeping implications for understanding RNA virus replication and for the development of new antiviral medicines. To study paramyxovirus polymerase structure and function, we expressed an active recombinant Nipah virus (NiV) polymerase complex assembled from the multifunctional NiV L protein bound to its phosphoprotein cofactor. NiV is an emerging highly pathogenic virus that causes severe encephalitis and has been declared a global public health concern due to its high mortality rate. Using negative-stain electron microscopy, we demonstrated NiV polymerase forms ring-like particles resembling related RNA polymerases. We identified conserved sequence elements driving recognition of the 3'-terminal genomic promoter by NiV polymerase, and leading to initiation of RNA synthesis, primer extension, and transition to elongation mode. Polyadenylation resulting from NiV polymerase stuttering provides a mechanistic basis for transcription termination. It also suggests a divergent adaptation in promoter recognition between pneumo- and paramyxoviruses. The lack of available antiviral therapy for NiV prompted us to identify the triphosphate forms of R1479 and GS-5734, two clinically relevant nucleotide analogs, as substrates and inhibitors of NiV polymerase activity by delayed chain termination. Overall, these findings provide low-resolution structural details and the mechanism of an RNA polymerase from a previously uncharacterized virus family. This work illustrates important functional differences yet remarkable similarities between the polymerases of nonsegmented negative-strand RNA viruses.

Role of disulfide bridges in archaeal family-B DNA polymerases.

PubMed

Killelea, Tom; Connolly, Bernard A

2011-06-14

The family-B DNA polymerases obtained from the order Thermococcales, for example, Pyrococcus furiosus (Pfu-Pol) are commonly used in the polymerase chain reaction (PCR) because of their high thermostability and low error rates. Most of these polymerases contain four cysteines, arranged as two disulfide bridges. With Pfu-Pol C429-C443 forms one of the disulfides (DB1) and C507-C510 (DB2) the other. Although the disulfides are well conserved in the enzymes from the hyperthermophilic Thermococcales, they are less prevalent in euryarchaeal polymerases from other orders, and tend to be only found in other hyperthermophiles. Here, we report on the effects of deleting the disulfide bridges by mutating the relevant cysteines to serines. A variety of techniques, including differential scanning calorimetry and differential scanning fluorimetry, have shown that both disulfides make a contribution to thermostability, with DB1 being more important than DB2. However, even when both disulfides are removed, sufficient thermostability remains for normal (identical to the wild type) performance in PCR and quantitative (real-time) PCR. Therefore, polymerases totally lacking cysteine are fully compatible with most PCR-based applications. This observation opens the way to further engineering of polymerases by introduction of a single cysteine followed by appropriate chemical modification. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

MAMMALIAN DNA IN PCR REAGENTS

EPA Science Inventory

Ancient DNA analysis is becoming widespread. These studies use polymerase chain reaction (PCR) to amplify minute quantities of heavily damaged template. Unusual steps are taken to achieve the sensitivity necessary to detect ancient DNA, including high- cycle PCR amplification t...

Validation of a polymerase chain reaction aided transcript titration assay (PATTY) for topoisomerase II in lung cancer samples.

PubMed

Dingemans, A M; Van Ark-Otte, J; Smit, E F; Postmus, P E; Giaccone, G

This report describes the validation of a polymerase chain reaction aided transcript titration assay (PATTY) for tumor samples. The results obtained with the PATTY were compared to those of RNase protection in a set of 7 human lung cancer cell lines and in 23 non-small cell lung cancer samples derived from resected patients. Whereas between PATTY and RNase protection assay a good correlation was observed in the cell lines (r = 0.74, p = 0.057), no correlation was observed within the tumor samples (r = 0.06, p = 0.78). This was also the case when only tumors with a high percentage of tumor cells (> 90%) were selected. Although PATTY is a valuable tool to measure mRNA expression in cell lines, our results caution the use of PATTY in human tumor samples without proper validation. The possible causes of these results are discussed.

[The development and implementation of polymerase chain reaction to detect in real-time operation mode yersinia pestis in field material].

PubMed

Afanas'ev, M V; Chipanin, E V; Shestakov, V E; Denisov, A V; Fomina, L A; Ostiak, A S; Balakhonov, S V

2013-03-01

The article presents the results of development and practical implementation of system of polymerase chain reaction testing in real-time operation mode to detect agent of plague infield material. In laboratory conditions the system demonstrated good results and hence it was applied in conditions of field laboratory of epidemiologic team during planned epizootologic examination of Gorno-Altaisk hot spot of plague. The sampling consisted of more than 1400 objects. It was demonstrated that high sensitivity and specificity is immanent to proposed system. The adaptation of the system to the real time amplifier "Smart Cycler" (Cephid, USA) having some specific technical characteristics makes it possible to consider the proposed test-system as an effective sensitive and precise instrument for screening studies in the process of regular epizootologic examinations of hot spots of plague.

Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

PubMed

Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

2013-01-01

A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

Simultaneous detection of hemagglutinin and neuraminidase genes of novel influenza A (H7N9) by duplex real-time reverse transcription polymerase chain reaction.

PubMed

Li, Yan; Wu, Tao; Qi, Xian; Ge, Yiyue; Guo, Xiling; Wu, Bin; Yu, Huiyan; Zhu, Yefei; Shi, Zhiyang; Wang, Hua; Cui, Lunbiao; Zhou, Minghao

2013-12-01

A novel reassortant influenza A (H7N9) virus emerged recently in China. In this study, a duplex real-time reverse transcription polymerase chain reaction (rRT-PCR) assay was developed for the simultaneous detection of hemagglutinin (HA) and neuraminidase (NA) genes of H7N9 influenza viruses. The sensitivity of the assay was determined to be 10 RNA copies per reaction for both HA and NA genes. No cross-reactivity was observed with other influenza virus subtypes or respiratory tract viruses. One hundred and forty-six clinical and environmental specimens were tested and compared with reference methods and were found to be consistent. The assay is suitable for large-scale screening due to short turnaround times and high specificity, sensitivity, and reproducibility. Copyright © 2013 Elsevier B.V. All rights reserved.

Detection and genotyping of bovine diarrhea virus by reverse transcription-polymerase chain amplification of the 5' untranslated region.

PubMed

Letellier, C; Kerkhofs, P; Wellemans, G; Vanopdenbosch, E

1999-01-01

A reverse-transcription polymerase chain reaction (RT-PCR) was developed to differentiate the bovine diarrhea virus (BVDV) from other pestiviruses, and to determine the genotype of the BVDV isolates. For this purpose, primer pairs were selected in the 5' untranslated region (5'UTR). The primers BE and B2 were located in highly conserved regions and were pestivirus-specific. Two primer pairs named B3B4 and B5B6 were specific of BVDV genotypes I and II, respectively. With this technique, an amplification product of the expected size was obtained with either the B3B4 or the B5B6 primer pairs for the 107 BVDV isolates tested but not for BDV or CSFV. For some isolates that were grouped in the genotype II, sequence analysis of the PCR fragments confirmed their classification into this genotype.

Successful treatment of toxoplasmic encephalitis diagnosed early by polymerase chain reaction after allogeneic hematopoietic stem cell transplantation: two case reports and review of the literature.

PubMed

Miyagi, T; Itonaga, H; Aosai, F; Taguchi, J; Norose, K; Mochizuki, K; Fujii, H; Furumoto, A; Ohama, M; Karimata, K; Yamanoha, A; Taniguchi, H; Sato, S; Taira, N; Moriuchi, Y; Fukushima, T; Masuzaki, H; Miyazaki, Y

2015-08-01

Toxoplasmic encephalitis represents a rare, but often fatal infection after allogeneic hematopoietic stem cell transplantation. Polymerase chain reaction (PCR)-based preemptive therapy is considered promising for this disease, but is not routinely applied, especially in low seroprevalence countries including Japan. We encountered 2 cases of toxoplasmic encephalitis after transplantation that were successfully treated. The diagnosis of toxoplasmic encephalitis in these cases was confirmed by PCR testing when neurological symptoms were observed. Both patients received pyrimethamine and sulfadiazine treatments within 2 weeks of the development of neurological symptoms, and remained free of recurrence for 32 and 12 months. These results emphasized the importance of the PCR test and immediate treatment after diagnosis for the management of toxoplasmic encephalitis. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Removal of inhibitor(s) of the polymerase chain reaction from formalin fixed, paraffin wax embedded tissues.

PubMed

An, S F; Fleming, K A

1991-11-01

A problem associated with use of the polymerase chain reaction to amplify specific DNA fragments from formalin fixed, paraffin wax embedded tissues is the not infrequent failure of amplification. One possible reason for this could be the presence of inhibitor(s), which interfere with the activity of the reaction. It has been shown that such inhibitor(s) exist when amplifying the human beta globin gene (which exists in human genomic DNA as a single copy gene) from routine clinical samples. A variety of methods to remove such inhibitor(s) were investigated. The results indicate that inhibitor(s) are removed by proteinase K digestion, followed by purification with phenol/chloroform, and centrifugation through a Centricon-30 membrane (30,000 molecular weight cut off). Other factors, including the length and concentration of the DNA sequence to be amplified, can also affect amplification.

Detection of human papillomaviruses type 16, 18 and 33 in bronchial aspirates of lung carcinoma patients by polymerase chain reaction: a study of 84 cases in Croatia.

PubMed

Branica, Bozica Vrabec; Smojver-Jezek, Silvana; Juros, Zrinka; Grgić, Sandra; Srpak, Nives; Mitrecić, Dinko; Gajović, Srećko

2010-03-01

Besides its well-known role in cervical carcinoma, HPV is also suggested to be involved in lung cancer development. A number of authors have been investigating the presence of HPV in histological materials. We used routine bronchial aspirates from 84 patients with lung carcinoma for DNA extraction and then performed polymerase chain reaction for high-risk HPV types 16, 18 and 33. The results were compared to those obtained from buccal and eyelid mucosa. Only three patients were positive for HPV in bronchial aspirates: one for HPV 16 type, one for HPV 18 type, and one for HPV 33. Our data indicated the low prevalence of HPV in patients with lung carcinomas in Croatia, therefore it seems unlikely that HPV contributes to the development of lung carcinomas in this region.

Detection of human Pneumocystis carinii by the polymerase chain reaction.

PubMed

Becker-Hapak, M; Liberator, P; Graves, D

1991-01-01

Oligonucleotide primers were prepared from a clone (B12) which has been shown to be a repetitive sequence in the rat P. carinii genome. Polymerase chain reaction was employed to amplify both rat and human P. carinii DNA. The detection limit of the assay was approximately 600 ng of total nucleic acid. Amplification products from both the rat and human isolates (ca. 780 bp) were characterized by denaturing gradient gel electrophoresis after digestion with Sau3A. No amplification products were obtained when DNA from the following potential pulmonary pathogens were used in identical reactions: Aspergillus fumigatus, Cryptococcus neoformans, Candida albicans, Mycobacterium avium-intracellulare and cytomegalovirus. In a blind study using the B12 primers, P. carinii DNA was successfully amplified in clinical samples which were positive by direct immunofluorescence assay (IFA) as well as in some specimens not identified by direct IFA.

Aspergillus vertebral osteomyelitis in chronic leukocyte leukemia patient diagnosed by a novel panfungal polymerase chain reaction method.

PubMed

Dayan, Lior; Sprecher, Hannah; Hananni, Amos; Rosenbaum, Hana; Milloul, Victor; Oren, Ilana

2007-01-01

Vertebral osteomyelitis and disciitis caused by Aspergillus spp is a rare event. Early diagnosis and early antifungal therapy are critical in improving the prognosis for these patients. The diagnosis of invasive fungal infections is, in many cases, not straightforward and requires invasive procedures so that histological examination and culture can be performed. Furthermore, current traditional microbiological tests (ie, cultures and stains) lack the sensitivity for diagnosis of invasive aspergillosis. To present a case of vertebral osteomyelitis caused by Aspergillus spp diagnosed using a novel polymerase chain reaction (PCR) assay. Case report. Aspergillus DNA was detected in DNA extracted from the necrotic bone tissue by using a "panfungal" PCR novel method. Treatment with voriconazole was started based on the diagnosis. Using this novel technique enabled us to diagnose accurately an unusual bone pathogen that requires a unique treatment.

Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

PubMed Central

Narihiro, Takashi; Sekiguchi, Yuji

2011-01-01

Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

Relationship Between Ebola Virus Real-Time Quantitative Polymerase Chain Reaction-Based Threshold Cycle Value and Virus Isolation From Human Plasma.

PubMed

Spengler, Jessica R; McElroy, Anita K; Harmon, Jessica R; Ströher, Ute; Nichol, Stuart T; Spiropoulou, Christina F

2015-10-01

We performed a longitudinal analysis of plasma samples obtained from 4 patients with Ebola virus (EBOV) disease (EVD) to determine the relationship between the real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)-based threshold cycle (Ct) value and the presence of infectious EBOV. EBOV was not isolated from plasma samples with a Ct value of >35.5 or >12 days after onset of symptoms. EBOV was not isolated from plasma samples in which anti-EBOV nucleoprotein immunoglobulin G was detected. These data demonstrate the utility of interpreting qRT-PCR results in the context of the course of EBOV infection and associated serological responses for patient-management decisions. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Analysis of raw meats and fats of pigs using polymerase chain reaction for Halal authentication.

PubMed

Aida, A A; Che Man, Y B; Wong, C M V L; Raha, A R; Son, R

2005-01-01

A method for species identification from pork and lard samples using polymerase chain reaction (PCR) analysis of a conserved region in the mitochondrial (mt) cytochrome b (cyt b) gene has been developed. Genomic DNA of pork and lard were extracted using Qiagen DNeasy(®) Tissue Kits and subjected to PCR amplification targeting the mt cyt b gene. The genomic DNA from lard was found to be of good quality and produced clear PCR products on the amplification of the mt cyt b gene of approximately 360 base pairs. To distinguish between species, the amplified PCR products were cut with restriction enzyme BsaJI resulting in porcine-specific restriction fragment length polymorphisms (RFLP). The cyt b PCR-RFLP species identification assay yielded excellent results for identification of pig species. It is a potentially reliable technique for detection of pig meat and fat from other animals for Halal authentication.

Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction

PubMed Central

Dong, X. Y.; Li, W. H.; Zhu, J. L.; Liu, W. J.; Zhao, M. Q.; Luo, Y. W.; Chen, J. D.

2015-01-01

Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance. PMID:27175171

Identification of the five human Plasmodium species including P. knowlesi by real-time polymerase chain reaction.

PubMed

Oddoux, O; Debourgogne, A; Kantele, A; Kocken, C H; Jokiranta, T S; Vedy, S; Puyhardy, J M; Machouart, M

2011-04-01

Recently, Plasmodium knowlesi has been recognised as the fifth Plasmodium species causing malaria in humans. Hundreds of human cases infected with this originally simian Plasmodium species have been described in Asian countries and increasing numbers are reported in Europe from travellers. The growing impact of tourism and economic development in South and Southeast Asia are expected to subsequently lead to a further increase in cases both among locals and among travellers. P. knowlesi is easily misidentified in microscopy as P. malariae or P. falciparum. We developed new primers for the rapid and specific detection of this species by low-cost real-time polymerase chain reaction (PCR) and added this method to an already existing panel of primers used for the molecular identification of the other four species in one reaction. Reference laboratories should now be able to identify undisputably and rapidly P. knowlesi, as it is a potentially fatal pathogen.

Apparent polyploidization after gamma irradiation: pitfalls in the use of quantitative polymerase chain reaction (qPCR) for the estimation of mitochondrial and nuclear DNA gene copy numbers.

PubMed

Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard

2013-05-30

Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.

Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation.

PubMed

Rahman, Md Mahfujur; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Mustafa, Shuhaimi; Hashim, Uda; Hanapi, Ummi Kalthum

2014-08-01

A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods. Copyright © 2014 Elsevier Ltd. All rights reserved.

Mycobacterium avium restriction fragment length polymorphism-IS IS1245 and the simple double repetitive element polymerase chain reaction typing method to screen genetic diversity in Brazilian strains.

PubMed

Sequeira, Patrícia Carvalho de; Fonseca, Leila de Souza; Silva, Marlei Gomes da; Saad, Maria Helena Féres

2005-11-01

Simple double repetitive element polymerase chain reaction (MaDRE-PCR) and Pvu II-IS1245 restriction fragment length polymorphism (RFLP) typing methods were used to type 41 Mycobacterium avium isolates obtained from 14 AIDS inpatients and 10 environment and animals specimens identified among 53 mycobacteria isolated from 237 food, chicken, and pig. All environmental and animals strains showed orphan patterns by both methods. By MaDRE-PCR four patients, with multiple isolates, showed different patterns, suggesting polyclonal infection that was confirmed by RFLP in two of them. This first evaluation of MaDRE-PCR on Brazilian M. avium strains demonstrated that the method seems to be useful as simple and less expensive typing method for screening genetic diversity in M. avium strains on selected epidemiological studies, although with limitation on analysis identical patterns except for one band.

Peptostreptococcus micros in primary endodontic infections as detected by 16S rDNA-based polymerase chain reaction.

PubMed

Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton

2003-02-01

A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.

Polymerase chain reaction technology as analytical tool in agricultural biotechnology.

PubMed

Lipp, Markus; Shillito, Raymond; Giroux, Randal; Spiegelhalter, Frank; Charlton, Stacy; Pinero, David; Song, Ping

2005-01-01

The agricultural biotechnology industry applies polymerase chain reaction (PCR) technology at numerous points in product development. Commodity and food companies as well as third-party diagnostic testing companies also rely on PCR technology for a number of purposes. The primary use of the technology is to verify the presence or absence of genetically modified (GM) material in a product or to quantify the amount of GM material present in a product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains. The document highlights the many areas to which attention must be paid in order to produce reliable test results. These include sample preparation, method validation, choice of appropriate reference materials, and biological and instrumental sources of error. The article also discusses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.

PubMed

Ririe, K M; Rasmussen, R P; Wittwer, C T

1997-02-15

A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.

Principles and applications of polymerase chain reaction in medical diagnostic fields: a review

PubMed Central

Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

2009-01-01

Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances. PMID:24031310

Bacterial Polysaccharide Co-Polymerases Share a Common Framework for Control of Polymer Length

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tocilj,A.; Munger, C.; Proteau, A.

2008-01-01

The chain length distribution of complex polysaccharides present on the bacterial surface is determined by polysaccharide co-polymerases (PCPs) anchored in the inner membrane. We report crystal structures of the periplasmic domains of three PCPs that impart substantially different chain length distributions to surface polysaccharides. Despite very low sequence similarities, they have a common protomer structure with a long central alpha-helix extending 100 Angstroms into the periplasm. The protomers self-assemble into bell-shaped oligomers of variable sizes, with a large internal cavity. Electron microscopy shows that one of the full-length PCPs has a similar organization as that observed in the crystal formore » its periplasmic domain alone. Functional studies suggest that the top of the PCP oligomers is an important region for determining polysaccharide modal length. These structures provide a detailed view of components of the bacterial polysaccharide assembly machinery.« less

Electrically controlled microvalves to integrate microchip polymerase chain reaction and capillary electrophoresis.

PubMed

Kaigala, Govind V; Hoang, Viet N; Backhouse, Christopher J

2008-07-01

Microvalves are key in realizing portable miniaturized diagnostic platforms. We present a scalable microvalve that integrates well with standard lab on a chip (LOC) implementations, yet which requires essentially no external infrastructure for its operation. This electrically controlled, phase-change microvalve is used to integrate genetic amplification and analysis via capillary electrophoresis--the basis of many diagnostics. The microvalve is actuated using a polymer (polyethylene glycol, PEG) that exhibits a large volumetric change between its solid and liquid phases. Both the phase change of the PEG and the genetic amplification via polymerase chain reaction (PCR) are thermally controlled using thin film resistive elements that are patterned using standard microfabrication methods. By contrast with many other valve technologies, these microvalves and their control interface scale down in size readily. The novelty here lies in the use of fully integrated microvalves that require only electrical connections to realize a portable and inexpensive genetic analysis platform.

Dual phase multiplex polymerase chain reaction

DOEpatents

Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

2008-10-07

Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

USGS Publications Warehouse

Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

2010-01-01

A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

Effective characterization of Salmonella Enteritidis by most probable number (MPN) followed by multiplex polymerase chain reaction (PCR) methods.

PubMed

Zappelini, Lincohn; Martone-Rocha, Solange; Dropa, Milena; Matté, Maria Helena; Tiba, Monique Ribeiro; Breternitz, Bruna Suellen; Razzolini, Maria Tereza Pepe

2017-02-01

Nontyphoidal Salmonella (NTS) is a relevant pathogen involved in gastroenteritis outbreaks worldwide. In this study, we determined the capacity to combine the most probable number (MPN) and multiplex polymerase chain reaction (PCR) methods to characterize the most important Salmonella serotypes in raw sewage. A total of 499 isolates were recovered from 27 raw sewage samples and screened using two previously described multiplex PCR methods. From those, 123 isolates were selected based on PCR banding pattern-identical or similar to Salmonella Enteritidis and Salmonella Typhimurium-and submitted to conventional serotyping. Results showed that both PCR assays correctly serotyped Salmonella Enteritidis, however, they presented ambiguous results for Salmonella Typhimurium identification. These data highlight that MPN and multiplex PCR can be useful methods to describe microbial quality in raw sewage and suggest two new PCR patterns for Salmonella Enteritidis identification.

Allele related mutation specific-polymerase chain reaction for rapid diagnosis of Hb New York (beta 113 (G15) Val-->Glu, beta(CD113 GTG-->GAG)).

PubMed

Viprakasit, Vip; Tachavanich, Kalaya; Suwantol, Lerlugsn; Pung-Amritt, Parichat; Chinchang, Worawut; Tanphaichitr, Voravarn S

2002-08-01

Hemoglobin New York (beta 113 (G15) Val-->Glu), a beta-globin variant, was first reported in a Chinese family living in New York. Subsequently, this abnormal hemoglobin was reported in many Chinese descendants from several groups and it was also known as Hb Kaohsiung. The subtle change in alpha1beta1 contact region apart from the heme group connecting area by Val-->Glu substitution has minor changes in both the electrophoretic mobility and stability making this hemoglobin variant difficult to distinguish from Hb A using routine hemoglobin analysis. The authors described a case of heterozygosity of Hb New York diagnosed by a molecular technique and revealed a mutation in beta(CD113 GTG-->GAG). A novel Allele Related Mutation Specific-Polymerase Chain Reaction (ARMS-PCR) for rapid diagnosis of this mutation has been proposed.

Theory and applications of the polymerase chain reaction.

PubMed

Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A

1990-04-01

The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.

Capillary sample introduction of polymerase chain reaction (PCR) products separated in ultrathin slab gels.

PubMed

Bullard, K M; Hietpas, P B; Ewing, A G

1998-01-01

Polymerase chain reaction (PCR) amplified short tandem repeat (STR) samples from the HUMVWF locus have been analyzed using a unique sample introduction and separation technique. A single capillary is used to transfer samples onto an ultrathin slab gel (57 microm thin). This ultrathin nondenaturing polyacrylamide gel is used to separate the amplified fragments, and laser-induced fluorescence with ethidium bromide is used for detection. The feasibility of performing STR analysis using this system has been investigated by examining the reproducibility for repeated samples. Reproducibility is examined by comparing the migration of the 14 and 17 HUMVWF alleles on three consecutive separations on the ultrathin slab gel. Using one locus, separations match in migration time with the two alleles 42 s apart for each of the three consecutive separations. This technique shows potential to increase sample throughput in STR analysis techniques although separation resolution still needs to be improved.

DNA interaction with platinum-based cytostatics revealed by DNA sequencing.

PubMed

Smerkova, Kristyna; Vaculovic, Tomas; Vaculovicova, Marketa; Kynicky, Jindrich; Brtnicky, Martin; Eckschlager, Tomas; Stiborova, Marie; Hubalek, Jaromir; Adam, Vojtech

2017-12-15

The main mechanism of action of platinum-based cytostatic drugs - cisplatin, oxaliplatin and carboplatin - is the formation of DNA cross-links, which restricts the transcription due to the disability of DNA to enter the active site of the polymerase. The polymerase chain reaction (PCR) was employed as a simplified model of the amplification process in the cell nucleus. PCR with fluorescently labelled dideoxynucleotides commonly employed for DNA sequencing was used to monitor the effect of platinum-based cytostatics on DNA in terms of decrease in labeling efficiency dependent on a presence of the DNA-drug cross-link. It was found that significantly different amounts of the drugs - cisplatin (0.21 μg/mL), oxaliplatin (5.23 μg/mL), and carboplatin (71.11 μg/mL) - were required to cause the same quenching effect (50%) on the fluorescent labelling of 50 μg/mL of DNA. Moreover, it was found that even though the amounts of the drugs was applied to the reaction mixture differing by several orders of magnitude, the amount of incorporated platinum, quantified by inductively coupled plasma mass spectrometry, was in all cases at the level of tenths of μg per 5 μg of DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

Use of RNA amplification and electrophoresis for studying virus aerosol collection efficiency and their comparison with plaque assays.

PubMed

Jiang, Xiao; Pan, Maohua; Hering, Susanne V; Lednicky, John A; Wu, Chang-Yu; Fan, Z Hugh

2016-10-01

The spread of virus-induced infectious diseases through airborne routes of transmission is a global concern for economic and medical reasons. To study virus transmission, it is essential to have an effective aerosol collector such as the growth tube collector (GTC) system that utilizes water-based condensation for collecting virus-containing aerosols. In this work, we characterized the GTC system using bacteriophage MS2 as a surrogate for a small RNA virus. We investigated using RNA extraction and reverse transcription- polymerase chain reaction (RT-PCR) to study the total virus collection efficiency of the GTC system. Plaque assays were also used to enumerate viable viruses collected by the GTC system compared to that by a commercially available apparatus, the SKC® Biosampler. The plaque assay counts were used to enumerate viable viruses whereas RT-PCR provides a total virus count, including those viruses inactivated during collection. The effects of relative humidity (RH) and other conditions on collection efficiency were also investigated. Our results suggest that the GTC has a collection efficiency for viable viruses between 0.24 and 1.8% and a total virus collection efficiency between 18.3 and 79.0%, which is 1-2 orders of magnitude higher than that of the SKC® Biosampler. Moreover, higher RH significantly increases both the viable and total collection efficiency of the GTC, while its effect on the collection efficiency of the SKC® Biosampler is not significant. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA polymerases eta and kappa exchange with the polymerase delta holoenzyme to complete common fragile site synthesis.

PubMed

Barnes, Ryan P; Hile, Suzanne E; Lee, Marietta Y; Eckert, Kristin A

2017-09-01

Common fragile sites (CFSs) are inherently unstable genomic loci that are recurrently altered in human tumor cells. Despite their instability, CFS are ubiquitous throughout the human genome and associated with large tumor suppressor genes or oncogenes. CFSs are enriched with repetitive DNA sequences, one feature postulated to explain why these loci are inherently difficult to replicate, and sensitive to replication stress. We have shown that specialized DNA polymerases (Pols) η and κ replicate CFS-derived sequences more efficiently than the replicative Pol δ. However, we lacked an understanding of how these enzymes cooperate to ensure efficient CFS replication. Here, we designed a model of lagging strand replication with RFC loaded PCNA that allows for maximal activity of the four-subunit human Pol δ holoenzyme, Pol η, and Pol κ in polymerase mixing assays. We discovered that Pol η and κ are both able to exchange with Pol δ stalled at repetitive CFS sequences, enhancing Normalized Replication Efficiency. We used this model to test the impact of PCNA mono-ubiquitination on polymerase exchange, and found no change in polymerase cooperativity in CFS replication compared with unmodified PCNA. Finally, we modeled replication stress in vitro using aphidicolin and found that Pol δ holoenzyme synthesis was significantly inhibited in a dose-dependent manner, preventing any replication past the CFS. Importantly, Pol η and κ were still proficient in rescuing this stalled Pol δ synthesis, which may explain, in part, the CFS instability phenotype of aphidicolin-treated Pol η and Pol κ-deficient cells. In total, our data support a model wherein Pol δ stalling at CFSs allows for free exchange with a specialized polymerase that is not driven by PCNA. Copyright © 2017 Elsevier B.V. All rights reserved.

Generation of human scFv antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences.

PubMed

Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F

2011-09-01

The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human scFv (single chain antibody fragment) libraries using a short linker (GGSSRSS) or a long linker (GGSSRSSSSGGGGSGGGG). In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final scFv products that are used for cloning.

The Recent Emergence of Clostridium difficile Infection in Romanian Hospitals is Associated with a High Prevalence of Polymerase Chain Reaction Ribotype 027.

PubMed

Popescu, Gabriel Adrian; Serban, Roxana; Pistol, Adriana; Niculcea, Andreea; Preda, Andreea; Lemeni, Daniela; Macovei, Ioana Sabina; Tălăpan, Daniela; Rafila, Alexandru; Florea, Dragoş

2018-03-15

To investigate the epidemiology of Clostridium difficile infection in Romanian hospitals. A survey was conducted at nine hospitals throughout Romania between November 2013 and February 2014. The survey identified 393 patients with Clostridium difficile infection. The median age was 67 years (range: 2-94 years); 56% of patients were aged >65 years. The mean prevalence of Clostridium difficile infection was 5.2 cases per 10.000 patient-days. The highest prevalences were 24.9 and 20 per 10.000 patient-days in hospitals specializing in gastroenterology and infectious diseases, respectively. Clostridium difficile infections were health care-associated in 70.5% patients and community-acquired in 10.2%. The origin was not determined in 19.3%. Clostridium difficile infection was severe in 12.3% of patients, and the in-hospital all-cause mortality was 8.8%. Polymerase chain reaction ribotype 027 had the highest prevalence in all participating hospitals and represented 82.6% of the total ribotyped isolates. The minimum inhibitory concentration of moxifloxacin was >4 μg/mL for 59 of 80 tested isolates (73.8%). Of 59 isolates, 54 were highly resistant to moxifloxacin (minimum inhibitory concentration ≥32 μg/mL), and the majority were polymerase chain reaction ribotype 027 (p<0.0001). The ribotype 027 was the predominant cause of Clostridium difficile infections in Romania. In some specialized hospitals, the prevalence of Clostridium difficile infection was higher than the European mean prevalence, and this demonstrates the need for strict adherence to infection control programs.

Sustained high-throughput polymerase chain reaction diagnostics during the European epidemic of Bluetongue virus serotype 8.

PubMed

van Rijn, Piet A; Heutink, René G; Boonstra, Jan; Kramps, Hans A; van Gennip, René G P

2012-05-01

A real-time reverse transcription polymerase chain reaction assay (PCR test) based on genome segment 10 of Bluetongue virus (BTV) was developed. The PCR test consists of robotized viral RNA isolation from blood samples and an all-in-one method including initial denaturation of genomic double-stranded RNA, reverse transcription polymerase chain reaction (RT-PCR), and real-time detection and analysis. Reference strains of the 24 recognized BTV serotypes, isolates from different years, and geographic origins were detected. Other orbiviruses such as African horse sickness virus, Epizootic hemorrhagic disease virus, and Equine encephalosis virus were not detected. Experimentally infected animals were PCR positive from 2 days postinoculation, which was earlier than fever, other clinical signs, or seroconversion. The diagnostic sensitivity and specificity were very close to or even 100%. The PCR test played a key role in the detection of BTV serotype 8 in August 2006 in The Netherlands. The outbreak in a completely naive ruminant population allowed for further evaluation of the PCR test with field samples. In 2006, the correlation between enzyme-linked immunosorbent assay and PCR results was estimated to be 95%. In the following years, the PCR test was used for diagnosis of diseased animals, for testing of healthy animals for trade purposes, and for detection of BTV RNA in different species of the insect vector, Culicoides. In the autumn of 2008, BTV serotype 6 unexpectedly emerged in northwest Europe and was also detected with the PCR test developed in the current study. The performance in routine use over 5 years has been recorded and evaluated.

COLD-PCR Technologies in the Area of Personalized Medicine: Methodology and Applications.

PubMed

Mauger, Florence; How-Kit, Alexandre; Tost, Jörg

2017-06-01

Somatic mutations bear great promise for use as biomarkers for personalized medicine, but are often present only in low abundance in biological material and are therefore difficult to detect. Many assays for mutation analysis in cancer-related genes (hotspots) have been developed to improve diagnosis, prognosis, prediction of drug resistance, and monitoring of the response to treatment. Two major approaches have been developed: mutation-specific amplification methods and methods that enrich and detect mutations without prior knowledge on the exact location and identity of the mutation. CO-amplification at Lower Denaturation temperature Polymerase Chain Reaction (COLD-PCR) methods such as full-, fast-, ice- (improved and complete enrichment), enhanced-ice, and temperature-tolerant COLD-PCR make use of a critical temperature in the polymerase chain reaction to selectively denature wild-type-mutant heteroduplexes, allowing the enrichment of rare mutations. Mutations can subsequently be identified using a variety of laboratory technologies such as high-resolution melting, digital polymerase chain reaction, pyrosequencing, Sanger sequencing, or next-generation sequencing. COLD-PCR methods are sensitive, specific, and accurate if appropriately optimized and have a short time to results. A large variety of clinical samples (tumor DNA, circulating cell-free DNA, circulating cell-free fetal DNA, and circulating tumor cells) have been studied using COLD-PCR in many different applications including the detection of genetic changes in cancer and infectious diseases, non-invasive prenatal diagnosis, detection of microorganisms, or DNA methylation analysis. In this review, we describe in detail the different COLD-PCR approaches, highlighting their specificities, advantages, and inconveniences and demonstrating their use in different fields of biological and biomedical research.

An evaluation of microbial profile in halitosis with tongue coating using PCR (polymerase chain reaction)- a clinical and microbiological study.

PubMed

Kamaraj R, Dinesh; Bhushan, Kala S; K L, Vandana

2014-01-01

Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load.

Screening test recommendations for methicillin-resistant Staphylococcus aureus surveillance practices: A cost-minimization analysis.

PubMed

Whittington, Melanie D; Curtis, Donna J; Atherly, Adam J; Bradley, Cathy J; Lindrooth, Richard C; Campbell, Jonathan D

2017-07-01

To mitigate methicillin-resistant Staphylococcus aureus (MRSA) infections, intensive care units (ICUs) conduct surveillance through screening patients upon admission followed by adhering to isolation precautions. Two surveillance approaches commonly implemented are universal preemptive isolation and targeted isolation of only MRSA-positive patients. Decision analysis was used to calculate the total cost of universal preemptive isolation and targeted isolation. The screening test used as part of the surveillance practice was varied to identify which screening test minimized inappropriate and total costs. A probabilistic sensitivity analysis was conducted to evaluate the range of total costs resulting from variation in inputs. The total cost of the universal preemptive isolation surveillance practice was minimized when a polymerase chain reaction screening test was used ($82.51 per patient). Costs were $207.60 more per patient when a conventional culture was used due to the longer turnaround time and thus higher isolation costs. The total cost of the targeted isolation surveillance practice was minimized when chromogenic agar 24-hour testing was used ($8.54 per patient). Costs were $22.41 more per patient when polymerase chain reaction was used. For ICUs that preemptively isolate all patients, the use of a polymerase chain reaction screening test is recommended because it can minimize total costs by reducing inappropriate isolation costs. For ICUs that only isolate MRSA-positive patients, the use of chromogenic agar 24-hour testing is recommended to minimize total costs. Copyright © 2017 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

Allele-Specific Polymerase Chain Reaction for the Imatinib-Resistant KIT D816V and D816F Mutations in Mastocytosis and Acute Myelogenous Leukemia

PubMed Central

Corless, Christopher L.; Harrell, Patina; Lacouture, Mario; Bainbridge, Troy; Le, Claudia; Gatter, Ken; White, Clifton; Granter, Scott; Heinrich, Michael C.

2006-01-01

Oncogenic mutations of the receptor tyrosine kinase KIT contribute to the pathogenesis of gastrointestinal stromal tumors, systemic mastocytosis (SM), and some cases of acute myelogenous leukemia (AML). The D816V substitution in the activation loop of KIT results in relative resistance to the kinase inhibitor imatinib (Gleevec). Because this mutation occurs in 80 to 95% of adult SM, its detection has diagnostic and predictive significance. Unfortunately, the fraction of mutation-positive cells in clinical SM samples is often below the 20 to 30% threshold needed for detection by direct DNA sequencing. We have developed an allele-specific polymerase chain reaction assay using a mutation-specific primer combined with a wild-type blocking oligonucleotide that amplifies D816V at the level of 1% mutant allele in DNA extracted from formalin-fixed, paraffin-embedded tissue. There were no amplifications among 64 KIT wild-type tumors and cell lines, whereas all D816V-mutant samples (eight AML and 11 mast cell disease) were positive. Other D816 substitutions associated with resistance to imatinib in vitro are rare in SM. Among these D816F was detectable with the assay whereas D816H, D816Y, and D816G did not amplify. Nine biopsies (bone marrow, skin, or colon) with suspected SM were negative by denaturing high performance liquid chromatography and/or DNA sequencing but positive by allele-specific polymerase chain reaction. Thus, the assay may be useful in confirming the diagnosis of SM. PMID:17065430

Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

NASA Astrophysics Data System (ADS)

Pérez Urquiza, M.; Acatzi Silva, A. I.

2014-02-01

Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

Molecular screening by polymerase chain reaction detects panleukopenia virus DNA in formalin-fixed hearts from cats with idiopathic cardiomyopathy and myocarditis.

PubMed

Meurs, K M; Fox, P R; Magnon, A L; Liu, S; Towbin, J A

2000-01-01

Viral myocarditis has been suggested as an etiology for cardiomyopathy in several mammalian species. Myocarditis and idiopathic cardiomyopathy have been reported in the domestic cat, although a viral etiology has not been demonstrated. Because of the continuing interest in the potential relationship between viral myocarditis and cardiomyopathy, we evaluated hearts from cats with spontaneous, idiopathic cardiomyopathy for viral genomic material within myocytes by polymerase chain reaction, and for the presence of myocarditis by light microscopy. Thirty-one (31) formalin-fixed hearts from domestic cats who died of idiopathic cardiomyopathy were randomly selected from pathology archives. Seventeen (17) formalin-fixed hearts from healthy cats were similarly selected as normal controls. The polymerase chain reaction (PCR) was used to evaluate myocardial tissue for the presence of viral genome from feline panleukopenia virus, herpes virus, calici virus, and corona virus. Hearts were examined using light microscopy for histologic evidence of myocarditis according to the Dallas criteria. Panleukopenia virus was identified by PCR in 10 of 31 cats with cardiomyopathy but in none of the controls. Neither cardiomyopathic or control cats tested positive by PCR for herpes virus, calici virus, and corona virus. Myocarditis was detected by histologic examination in 18 of 31 cardiomyopathic cats and in none of 17 control cats. Myocarditis and or feline panleukopenia virus genome was detected in felines with idiopathic hypertrophic, dilated, and restrictive cardiomyopathy, suggesting a possible role of viral infection and inflammation in the pathogenesis of cardiomyopathy in this species.

Sensitivity, specificity and comparison of three commercially available immunological tests in the diagnosis of Cryptosporidium species in animals.

PubMed

Danišová, Olga; Halánová, Monika; Valenčáková, Alexandra; Luptáková, Lenka

The study was conducted to compare the specificity of immunological diagnostic methods used for the diagnosis of Cryptosporidium species capable of causing life-threatening infection in both immunosuppressed and immunocompetent patients. For the detection of Cryptosporidium species in 79 animals with diarrhoea, we used three Copro-antigen tests: RIDASCREEN ® Cryptosporidium test, Cryptosporidium 2nd Generation (ELISA) and RIDA ® QUICK Cryptosporidium. For immunoassays we used positive and negative samples detected by means of polymerase chain reaction and validated by sequencing and nested polymerase chain reaction to confirm the presence six different species of Cryptosporidium species. Prevalence of cryptosporidiosis in the entire group determined by enzyme immunoassay, enzyme linked immunosorbent assay, immuno-chromatographic test and polymerase chain reaction was 34.17%, 27.84%, 6.33% and 27.84%, respectively. Sensitivity of animal samples with enzyme immunoassay, enzyme linked immunosorbent assay, and immuno-chromatographic test was 63.6%, 40.9% and 22.7%, resp., when questionable samples were considered positive, whereas specificity of enzyme immunoassay, enzyme linked immunosorbent assay and immuno-chromatographic test was 75.9%, 78.9% and 100%, respectively. Positive predictive values and negative predictive values were different for all the tests. These differences results are controversial and therefore reliability and reproducibility of immunoassays as the only diagnostic method is questionable. The use of various Cryptosporidium species in diagnosis based on immunological testing and different results obtained by individual tests indicate potential differences in Copro-antigens produced by individual Cryptosporidium species. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Generation of human Fab antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences.

PubMed

Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F

2011-09-01

The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human Fab (fragment antigen binding) antibody libraries. In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final Fab products that are used for cloning.

A Two-State Model for the Dynamics of the Pyrophosphate Ion Release in Bacterial RNA Polymerase

PubMed Central

Da, Lin-Tai; Pardo Avila, Fátima; Wang, Dong; Huang, Xuhui

2013-01-01

The dynamics of the PPi release during the transcription elongation of bacterial RNA polymerase and its effects on the Trigger Loop (TL) opening motion are still elusive. Here, we built a Markov State Model (MSM) from extensive all-atom molecular dynamics (MD) simulations to investigate the mechanism of the PPi release. Our MSM has identified a simple two-state mechanism for the PPi release instead of a more complex four-state mechanism observed in RNA polymerase II (Pol II). We observed that the PPi release in bacterial RNA polymerase occurs at sub-microsecond timescale, which is ∼3-fold faster than that in Pol II. After escaping from the active site, the (Mg-PPi)2− group passes through a single elongated metastable region where several positively charged residues on the secondary channel provide favorable interactions. Surprisingly, we found that the PPi release is not coupled with the TL unfolding but correlates tightly with the side-chain rotation of the TL residue R1239. Our work sheds light on the dynamics underlying the transcription elongation of the bacterial RNA polymerase. PMID:23592966

Differentiation among isolates of prunus necrotic ringspot virus by transcript conformation polymorphism.

PubMed

Rosner, A; Maslenin, L; Spiegel, S

1998-09-01

A method based on differences in electrophoretic mobility of RNA transcripts made from polymerase chain reaction (PCR) products was used for differentiation among virus isolates. A T7 RNA polymerase promoter was attached to amplified prunus necrotic ringspot virus (PNRSV) sequences by PCR. The PCR products then served as a template for transcription. Single-stranded transcripts originated from different PNRSV isolates varied in electrophoretic mobility in polyacrylamide gels, presumably because of transcript conformation polymorphism (TCP). This procedure was applied for the differentiation of PNRSV isolates.

An optimized protocol for DNA extraction in plants with a high content of secondary metabolites, based on leaves of Mimosa tenuiflora (Willd.) Poir. (Leguminosae).

PubMed

Arruda, S R; Pereira, D G; Silva-Castro, M M; Brito, M G; Waldschmidt, A M

2017-07-06

Some species are characterized by a high content of tannins, alkaloids, and phenols in their leaves. These secondary metabolites are released during DNA extraction and might hinder molecular studies based on PCR (polymerase chain reaction). To provide an efficient method to extract DNA, Mimosa tenuiflora, an important leguminous plant from Brazilian semiarid region used in popular medicine and as a source of fuelwood or forage, was used. Eight procedures previously reported for plants were tested and adapted from leaf tissues of M. tenuiflora stored at -20°C. The optimized procedure in this study encompassed the utilization of phenol during deproteinization, increased concentrations of cetyltrimethylammonium bromide and sodium chloride, and a shorter period and lower temperature of incubation concerning other methods. The extracted DNA did not present degradation, and amplification via PCR was successful using ISSR, trnL, ITS, and ETS primers. Besides M. tenuiflora, this procedure was also tested and proved to be efficient in genetic studies of other plant species.

High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System

PubMed Central

Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C. T.; Shui, Lingling

2017-01-01

DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1–10 Kbp fragment lengths with a yield of 75.30–91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future. PMID:28098208

Development and validation of qualitative SYBR®Green real-time PCR for detection and discrimination of Listeria spp. and Listeria monocytogenes.

PubMed

Barbau-Piednoir, Elodie; Botteldoorn, Nadine; Yde, Marc; Mahillon, Jacques; Roosens, Nancy H

2013-05-01

A combination of four qualitative SYBR®Green qPCR screening assays targeting two levels of discrimination: Listeria genus (except Listeria grayi) and Listeria monocytogenes, is presented. These assays have been developed to be run simultaneously using the same polymerase chain reaction (PCR) programme. The paper also proposes a new validation procedure to specifically validate qPCR assays applied to food microbiology according to two guidelines: the ISO 22118 norm and the "Definition of minimum performance requirements for analytical methods of GMO testing". The developed assays target the iap, prs and hlyA genes that belong to or neighbour the virulence cluster of Listeria spp. The selected primers were designed to amplify short fragments (60 to 103 bp) in order to obtain optimal PCR efficiency (between 97 and 107 % efficiency). The limit of detection of the SYBR®Green qPCR assays is two to five copies of target genes per qPCR reaction. These assays are highly accurate (98.08 and 100 % accuracy for the Listeria spp. and L. monocytogenes assays, respectively).

Metagenomic investigation of gastrointestinal microbiome in cattle

PubMed Central

Kim, Minseok; Park, Tansol; Yu, Zhongtang

2017-01-01

The gastrointestinal (GI) tract, including the rumen and the other intestinal segments of cattle, harbors a diverse, complex, and dynamic microbiome that drives feed digestion and fermentation in cattle, determining feed efficiency and output of pollutants. This microbiome also plays an important role in affecting host health. Research has been conducted for more than a century to understand the microbiome and its relationship to feed efficiency and host health. The traditional cultivation-based research elucidated some of the major metabolism, but studies using molecular biology techniques conducted from late 1980’s to the late early 2000’s greatly expanded our view of the diversity of the rumen and intestinal microbiome of cattle. Recently, metagenomics has been the primary technology to characterize the GI microbiome and its relationship with host nutrition and health. This review addresses the main methods/techniques in current use, the knowledge gained, and some of the challenges that remain. Most of the primers used in quantitative real-time polymerase chain reaction quantification and diversity analysis using metagenomics of ruminal bacteria, archaea, fungi, and protozoa were also compiled. PMID:28830126

High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

PubMed

Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

2017-01-18

DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

Effects of glucose on microcystin-LR removal and the bacterial community composition through anoxic biodegradation in drinking water sludge.

PubMed

Ma, Guangxiang; Pei, Haiyan; Hu, Wenrong; Xu, Xiangchao; Ma, Chunxia; Pei, Ruoting

2016-01-01

To enhance the degradation efficiency of microcystin (MC) in drinking water sludge (DWS), the underlying mechanisms between organic carbon (glucose) and the biodegradation of MC-LR under anoxic conditions were investigated by polymerase chain reaction-denaturing gradient gel electrophoresis technology. The addition of glucose reduced the rate of the MC-LR biodegradation indicating the occurrence of inhibition of degradation, and an increased inhibition was observed with increases in glucose concentration (0-10,000 mg/L). In addition, the community analysis indicated that the variety and the number of the microbes increased with the concentration of glucose amended (0 -1000 mg/L), but they decreased substantially with the addition of 10,000 mg/L of glucose. The phyla Firmicutes, Proteobacteria and Chloroflexi were found to be the dominant. Methylobacterium and Sphingomonas were MC-degrading bacteria and used glucose as a prior carbon source instead of MC, resulting in the decrease in the MC-LR biodegradation rate under anoxic conditions. Thus, reducing organic carbon could improve the anoxic biodegradation efficiency of MC in DWS.

Multiplex Droplet Digital PCR Protocols for Quantification of GM Maize Events.

PubMed

Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Štebih, Dejan; Morisset, Dany; Holst-Jensen, Arne; Žel, Jana

2018-01-01

The standard-curve based simplex quantitative polymerase chain reaction (qPCR) has been the gold standard for DNA target quantification for more than a decade. The large and growing number of individual analyses needed to test for genetically modified organisms (GMOs) is reducing the cost-effectiveness of qPCR. Droplet digital PCR (ddPCR) enables absolute quantification without standard curves, avoids the amplification efficiency bias observed with qPCR, allows more accurate estimations at low target copy numbers and, in combination with multiplexing, significantly improves cost efficiency. Here we describe two protocols for multiplex quantification of GM maize events: (1) nondiscriminating, with multiplex quantification of targets as a group (12 GM maize lines) and (2) discriminating, with multiplex quantification of individual targets (events). The first enables the quantification of twelve European Union authorized GM maize events as a group with only two assays, but does not permit determination of the individual events present. The second protocol enables the quantification of four individual targets (three GM events and one endogene) in a single reaction. Both protocols can be modified for quantification of any other DNA target.

Thermophilic biofilter for SO2 removal: performance and microbial characteristics.

PubMed

Zhang, Jingying; Li, Lin; Liu, Junxin

2015-03-01

A bench-scale thermophilic biofilter was applied to remove SO2 at 60°C in the present study. The SO2 concentration in the inlet stream ranged from 100mg/m(3) to 200mg/m(3). An average SO2 removal efficiency of 93.10% was achieved after developing acclimated organisms that can degrade SO2. The thermophilic biofilter effectively reduced SO2, with a maximum elimination capacity of 50.67g/m(3)/h at a loading rate of 51.44g/m(3)/h. Removal efficiency of the thermophilic biofilter was largely influenced by the water containing rate of the packing materials. The SO2 transfer in the biofilter included adsorption by the packing materials, dissolution in liquid, and microbial degradation. The main product of SO2 degradation was SO4(2-). The temporal shifts in the bacterial community that formed in the biofilter were determined through polymerase chain reaction-denaturing gradient gel electrophoresis and DNA sequence analysis. These shifts revealed a correlation between biofilter performance and bacterial community structure. Copyright © 2014 Elsevier Ltd. All rights reserved.

The growth performance of F1 transgenic mutiara catfish

NASA Astrophysics Data System (ADS)

Iskandar; Buwono, I. D.; Agung, M. U. K.

2018-04-01

The growth of catfish (African or Sangkuriang strain) these days is tend to decreased. One of the solutions due to this problem is to improve the genetics of growth using transgenesis technology, toward more profitable. The specific objective of the research is to detect the transmission of exogenous GH (African catfish GH inserts) inside the F1 transgenic Mutiara catfish using PCR (Polymerase Chain Reaction) method and to evaluate the growth performance of transgenic Mutiara catfish made using the parameters of feed conversion (FCR = Feed Conversion Ratio). Transgenic catfish (strain mutiara) F0 and F1 carried African catfish GH (600 bp) can be produced. Superiority characters of transgenic catfish represented heritability (h2 ) and heterosis (H), indicating that the offspring of hybrid F1 transgenic mutiara catfish had phenotypes rapid growth (h2 = 17.55 % and H = 42.83 %) compared to non-transgenic catfish (h 2 = 10.07 % and H = 18.56 %). Evaluation of the efficiency of feed use parameters feed conversion ratio, shows that F1 transgenic mutiara catfish (FCR = 0.85) more efficient in converting feed into meat.

Medium-based noninvasive preimplantation genetic diagnosis for human α-thalassemias-SEA.

PubMed

Wu, Haitao; Ding, Chenhui; Shen, Xiaoting; Wang, Jing; Li, Rong; Cai, Bing; Xu, Yanwen; Zhong, Yiping; Zhou, Canquan

2015-03-01

To develop a noninvasive medium-based preimplantation genetic diagnosis (PGD) test for α-thalassemias-SEA. The embryos of α-thalassemia-SEA carriers undergoing in vitro fertilization (IVF) were cultured. Single cells were biopsied from blastomeres and subjected to fluorescent gap polymerase chain reaction (PCR) analysis; the spent culture media that contained embryo genomic DNA and corresponding blastocysts as verification were subjected to quantitative-PCR (Q-PCR) detection of α-thalassemia-SEA. The diagnosis efficiency and allele dropout (ADO) ratio were calculated, and the cell-free DNA concentration was quantitatively assessed in the culture medium. The diagnosis efficiency of medium-based α-thalassemias-SEA detection significantly increased compared with that of biopsy-based fluorescent gap PCR analysis (88.6% vs 82.1%, P < 0.05). There is no significant difference regarding ADO ratio between them. The optimal time for medium-based α-thalassemias-SEA detection is Day 5 (D5) following IVF. Medium-based α-thalassemias-SEA detection could represent a novel, quick, and noninvasive approach for carriers to undergo IVF and PGD.

Integrating T7 RNA Polymerase and Its Cognate Transcriptional Units for a Host-Independent and Stable Expression System in Single Plasmid.

PubMed

Liang, Xiao; Li, Chenmeng; Wang, Wenya; Li, Qiang

2018-05-18

Metabolic engineering and synthetic biology usually require universal expression systems for stable and efficient gene expression in various organisms. In this study, a host-independent and stable T7 expression system had been developed by integrating T7 RNA polymerase and its cognate transcriptional units in single plasmid. The expression of T7 RNA polymerase was restricted below its lethal threshold using a T7 RNA polymerase antisense gene cassette, which allowed long periods of cultivation and protein production. In addition, by designing ribosome binding sites, we further tuned the expression capacity of this novel T7 system within a wide range. This host-independent expression system efficiently expressed genes in five different Gram-negative strains and one Gram-positive strain and was also shown to be applicable in a real industrial d- p-hydroxyphenylglycine production system.

Ultrasensitive electrochemical DNA detection based on dual amplification of circular strand-displacement polymerase reaction and hybridization chain reaction.

PubMed

Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

2013-09-15

We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.

The mechanism of nucleosome traversal by RNA polymerase II

PubMed Central

2011-01-01

RNA polymerase II traverses nucleosomes rapidly and efficiently in the cell but it has not been possible to duplicate this process in the test tube. A single nucleosome has generally been found to provide a strong barrier to transcript elongation in vitro. Recent studies have shown that effective transcript elongation can occur on nucleosomal templates in vitro, but this depends on both facilitated uncoiling of DNA from the octamer surface and the presence of transcription factors that maintain polymerase in the transcriptionally competent state. These findings indicate that the efficiency and rate of transcription through chromatin could be regulated through controlled DNA uncoiling. These studies also demonstrate that nucleosome traversal need not result in nucleosome displacement. PMID:21519186

DIFFERENTIATING HUMAN FROM ANIMAL ISOLATES OF CRYPTOSPORIDIUM PARVUM

EPA Science Inventory

We analyzed 9s Cryptosporidium parvum isolates from humans and animals by a polymerase chain reaction/restriction fragment length polymorphism method based on the thrombospondin-related anonymous protein 2 gene sequence. Used as a molecular marker, this method can differentiate ...

QUALITY ASSURANCE FOR PCR

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) held a workshop in January 2003 on the detection of viruses in water using polymerase chain reaction (PCR)-based methods. Speakers were asked to address a series of specific questions, including whether a single standard method coul...

Convectively driven PCR thermal-cycling

DOEpatents

Benett, William J.; Richards, James B.; Milanovich, Fred P.

2003-07-01

A polymerase chain reaction system provides an upper temperature zone and a lower temperature zone in a fluid sample. Channels set up convection cells in the fluid sample and move the fluid sample repeatedly through the upper and lower temperature zone creating thermal cycling.

A Technical Approach to Marking Explosives, Propellants, and Precursor Chemicals

DTIC Science & Technology

1998-08-01

polymerase chain reaction (PCR) methods whereby small strands are cut and analyzed under specified temperature mediated enzymatic /molecular reactions (4...such as these are often overlooked. Several other companies have been investigating other methods including immunoassay techniques, microencapsulated

Evaluation of Four RNA Extraction Methods for Gene Expression Analyses of Cryptosporidium parvum and Toxoplasma gondii Oocys

EPA Science Inventory

Cryptosporidium spp. and Toxoplasma gondii are important coccidian parasites that have caused waterborne and foodborne disease outbreaks worldwide. Techniques like subtractive hybridization, microarrays, and quantitative reverse transcriptase real-time polymerase chain reaction (...

ANIMAL DNA IN PCR REAGENTS PLAGUES ANCIENT DNA RESEARCH

EPA Science Inventory

Ancient DNA analysis is becoming widespread. These studies use polymerase chain reaction (PCR) to amplify minute quantities of heavily damaged template. Unusual steps are taken to achieve the sensitivity necessary to detect ancient DNA, including high-cycle PCR amplification targ...

DETECTION OF PATHOGENS IN DRINKING WATER (SEER 2)

EPA Science Inventory

Project investigators developed a polymerase chain reaction (PCR)-based technique to detect E. coli 0157:H7 cells in environmental samples using previously reported PCR primers for the specific detection of genes involved in biosynthesis of 0157 polysacchari...

The cellular level of O-antigen polymerase Wzy determines chain length regulation by WzzB and WzzpHS-2 in Shigella flexneri 2a.

PubMed

Carter, Javier A; Jiménez, Juan C; Zaldívar, Mercedes; Alvarez, Sergio A; Marolda, Cristina L; Valvano, Miguel A; Contreras, Inés

2009-10-01

The lipopolysaccharide O antigen of Shigella flexneri 2a has two preferred chain lengths, a short (S-OAg) composed of an average of 17 repeated units and a very long (VL-OAg) of about 90 repeated units. These chain length distributions are controlled by the chromosomally encoded WzzB and the plasmid-encoded Wzz(pHS-2) proteins, respectively. In this study, genes wzzB, wzz(pHS-2) and wzy (encoding the O-antigen polymerase) were cloned under the control of arabinose- and rhamnose-inducible promoters to investigate the effect of varying their relative expression levels on O antigen polysaccharide chain length distribution. Controlled expression of the chain length regulators wzzB and wzz(pHS-2) revealed a dose-dependent production of each modal length. Increase in one mode resulted in a parallel decrease in the other, indicating that chain length regulators compete to control the degree of O antigen polymerization. Also, when expression of the wzy gene is low, S-OAg but not VL-OAg is produced. Production of VL-OAg requires high induction levels of wzy. Thus, the level of expression of wzy is critical in determining O antigen modal distribution. Western blot analyses of membrane proteins showed comparable high levels of the WzzB and Wzz(pHS-2) proteins, but very low levels of Wzy. In vivo cross-linking experiments and immunoprecipitation of membrane proteins did not detect any direct interaction between Wzy and WzzB, suggesting the possibility that these two proteins may not interact physically but rather by other means such as via translocated O antigen precursors.

T7 RNA polymerase-driven inducible cell lysis for DNA transfer from Escherichia coli to Bacillus subtilis.

PubMed

Juhas, Mario; Ajioka, James W

2017-11-01

The majority of the good DNA editing techniques have been developed in Escherichia coli; however, Bacillus subtilis is better host for a plethora of synthetic biology and biotechnology applications. Reliable and efficient systems for the transfer of synthetic DNA between E. coli and B. subtilis are therefore of the highest importance. Using synthetic biology approaches, such as streamlined lambda Red recombineering and Gibson Isothermal Assembly, we integrated genetic circuits pT7L123, Repr-ts-1 and pLT7pol encoding the lysis genes of bacteriophages MS2, ΦX174 and lambda, the thermosensitive repressor and the T7 RNA polymerase into the E. coli chromosome. In this system, T7 RNA polymerase regulated by the thermosensitive repressor drives the expression of the phage lysis genes. We showed that T7 RNA polymerase significantly increases efficiency of cell lysis and transfer of the plasmid and bacterial artificial chromosome-encoded DNA from the lysed E. coli into B. subtilis. The T7 RNA polymerase-driven inducible cell lysis system is suitable for the efficient cell lysis and transfer of the DNA engineered in E. coli to other naturally competent hosts, such as B. subtilis. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

Bypass of a psoralen DNA interstrand cross-link by DNA polymerases beta, iota, and kappa in vitro

PubMed Central

Smith, Leigh A.; Makarova, Alena V.; Samson, Laura; Thiesen, Katherine E.; Dhar, Alok; Bessho, Tadayoshi

2012-01-01

Repair of DNA inter-strand cross-links in mammalian cells involves several biochemically distinctive processes, including the release of one of the cross-linked strands and translesion DNA synthesis (TLS). In this report, we investigated in vitro TLS activity of psoralen DNA inter-strand cross-link by three DNA repair polymerases, DNA polymerase beta, kappa and iota. DNA polymerase beta is capable of bypassing a psoralen cross-link with a low efficiency. Cell extracts prepared from DNA polymerase beta knockout mouse embryonic fibroblast showed a reduced bypass activity of the psoralen cross-link and purified DNA polymerase beta restored the bypass activity. In addition, DNA polymerase iota mis-incorporated thymine across the psoralen cross-link and DNA polymerase kappa extended these mis-paired primer ends, suggesting that DNA polymerase iota may serve as an inserter and DNA polymerase kappa may play a role as an extender in the repair of psoralen DNA inter-strand cross-links. The results demonstrated here indicate that multiple DNA polymerases could participate in TLS steps in mammalian DNA inter-strand cross-link repair. PMID:23106263

Detection of Entamoeba histolytica by Recombinase Polymerase Amplification

PubMed Central

Nair, Gayatri; Rebolledo, Mauricio; White, A. Clinton; Crannell, Zachary; Richards-Kortum, R. Rebecca; Pinilla, A. Elizabeth; Ramírez, Juan David; López, M. Consuelo; Castellanos-Gonzalez, Alejandro

2015-01-01

Amebiasis is an important cause of diarrheal disease worldwide and has been associated with childhood malnutrition. Traditional microscopy approaches are neither sensitive nor specific for Entamoeba histolytica. Antigen assays are more specific, but many cases are missed unless tested by molecular methods. Although polymerase chain reaction (PCR) is effective, the need for sophisticated, expensive equipment, infrastructure, and trained personnel limits its usefulness, especially in the resource-limited, endemic areas. Here, we report development of a recombinase polymerase amplification (RPA) method to detect E. histolytica specifically. Using visual detection by lateral flow (LF), the test was highly sensitive and specific and could be performed without additional equipment. The availability of this inexpensive, sensitive, and field-applicable diagnostic test could facilitate rapid diagnosis and treatment of amebiasis in endemic regions. PMID:26123960

Bacillus subtilis DNA polymerases, PolC and DnaE, are required for both leading and lagging strand synthesis in SPP1 origin-dependent DNA replication

PubMed Central

Seco, Elena M.

2017-01-01

Abstract Firmicutes have two distinct replicative DNA polymerases, the PolC leading strand polymerase, and PolC and DnaE synthesizing the lagging strand. We have reconstituted in vitro Bacillus subtilis bacteriophage SPP1 θ-type DNA replication, which initiates unidirectionally at oriL. With this system we show that DnaE is not only restricted to lagging strand synthesis as previously suggested. DnaG primase and DnaE polymerase are required for initiation of DNA replication on both strands. DnaE and DnaG synthesize in concert a hybrid RNA/DNA ‘initiation primer’ on both leading and lagging strands at the SPP1 oriL region, as it does the eukaryotic Pol α complex. DnaE, as a RNA-primed DNA polymerase, extends this initial primer in a reaction modulated by DnaG and one single-strand binding protein (SSB, SsbA or G36P), and hands off the initiation primer to PolC, a DNA-primed DNA polymerase. Then, PolC, stimulated by DnaG and the SSBs, performs the bulk of DNA chain elongation at both leading and lagging strands. Overall, these modulations by the SSBs and DnaG may contribute to the mechanism of polymerase switch at Firmicutes replisomes. PMID:28575448

Biochemical Characterization of the Active Anti-Hepatitis C Virus Metabolites of 2,6-Diaminopurine Ribonucleoside Prodrug Compared to Sofosbuvir and BMS-986094

PubMed Central

Ehteshami, Maryam; Tao, Sijia; Ozturk, Tugba; Zhou, Longhu; Cho, Jong Hyun; Zhang, Hongwang; Amiralaei, Sheida; Shelton, Jadd R.; Lu, Xiao; Khalil, Ahmed; Domaoal, Robert A.; Stanton, Richard A.; Suesserman, Justin E.; Lin, Biing; Lee, Sam S.; Amblard, Franck; Whitaker, Tony; Coats, Steven J.

2016-01-01

Ribonucleoside analog inhibitors (rNAI) target the hepatitis C virus (HCV) RNA-dependent RNA polymerase nonstructural protein 5B (NS5B) and cause RNA chain termination. Here, we expand our studies on β-d-2′-C-methyl-2,6-diaminopurine-ribonucleotide (DAPN) phosphoramidate prodrug 1 (PD1) as a novel investigational inhibitor of HCV. DAPN-PD1 is metabolized intracellularly into two distinct bioactive nucleoside triphosphate (TP) analogs. The first metabolite, 2′-C-methyl-GTP, is a well-characterized inhibitor of NS5B polymerase, whereas the second metabolite, 2′-C-methyl-DAPN-TP, behaves as an adenosine base analog. In vitro assays suggest that both metabolites are inhibitors of NS5B-mediated RNA polymerization. Additional factors, such as rNAI-TP incorporation efficiencies, intracellular rNAI-TP levels, and competition with natural ribonucleotides, were examined in order to further characterize the potential role of each nucleotide metabolite in vivo. Finally, we found that although both 2′-C-methyl-GTP and 2′-C-methyl-DAPN-TP were weak substrates for human mitochondrial RNA (mtRNA) polymerase (POLRMT) in vitro, DAPN-PD1 did not cause off-target inhibition of mtRNA transcription in Huh-7 cells. In contrast, administration of BMS-986094, which also generates 2′-C-methyl-GTP and previously has been associated with toxicity in humans, caused detectable inhibition of mtRNA transcription. Metabolism of BMS-986094 in Huh-7 cells leads to 87-fold higher levels of intracellular 2′-C-methyl-GTP than DAPN-PD1. Collectively, our data characterize DAPN-PD1 as a novel and potent antiviral agent that combines the delivery of two active metabolites. PMID:27216050

tRNAHis guanylyltransferase catalyzes a 3'-5' polymerization reaction that is distinct from G-1 addition.

PubMed

Jackman, Jane E; Phizicky, Eric M

2006-06-06

Yeast tRNA(His) guanylyltransferase, Thg1, is an essential protein that adds a single guanine to the 5' end (G(-1)) of tRNA(His). This G(-1) residue is required for aminoacylation of tRNA(His) by histidyl-tRNA synthetase, both in vitro and in vivo. The guanine nucleotide addition reaction catalyzed by Thg1 extends the polynucleotide chain in the reverse (3'-5') direction of other known polymerases, albeit by one nucleotide. Here, we show that alteration of the 3' end of the Thg1 substrate tRNA(His) unleashes an unexpected reverse polymerase activity of wild-type Thg1, resulting in the 3'-5' addition of multiple nucleotides to the tRNA, with efficiency comparable to the G(-1) addition reaction. The addition of G(-1) forms a mismatched G.A base pair at the 5' end of tRNA(His), and, with monophosphorylated tRNA substrates, it is absolutely specific for tRNA(His). By contrast, reverse polymerization forms multiple G.C or C.G base pairs, and, with preactivated tRNA species, it can initiate at positions other than -1 and is not specific for tRNA(His). Thus, wild-type Thg1 catalyzes a templated polymerization reaction acting in the reverse direction of that of canonical DNA and RNA polymerases. Surprisingly, Thg1 can also readily use dNTPs for nucleotide addition. These results suggest that 3'-5' polymerization represents either an uncharacterized role for Thg1 in RNA or DNA repair or metabolism, or it may be a remnant of an earlier catalytic strategy used in nature.

Detection of Genetically Modified Food: Has Your Food Been Genetically Modified?

ERIC Educational Resources Information Center

Brandner, Diana L.

2002-01-01

Explains the benefits and risks of genetically-modified foods and describes methods for genetically modifying food. Presents a laboratory experiment using a polymerase chain reaction (PCR) test to detect foreign DNA in genetically-modified food. (Contains 18 references.) (YDS)

Microsatellite primers for red drum (Sciaenops ocellatus)

USDA-ARS?s Scientific Manuscript database

In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...

A SIMPLE MULTIPLEX POLYMERASE CHAIN REACTION ASSAY FOR THE IDENTIFICATION OF FOUR ENVIRONMENTALLY RELEVANT FUNGAL CONTAMINANTS

EPA Science Inventory

Historically, identification of filamentous fungal (mold) species has been based on morphological characteristics, both macroscopic and microscopic. These methods have proven to be time consuming and inaccurate, necessitating the development of identification protocols that are ...

Comparison of EPA Method 1615 RT-qPCR Assays in Standard and Kit Format

EPA Science Inventory

EPA Method 1615 contains protocols for measuring enterovirus and norovirus by reverse transcription quantitative polymerase chain reaction. A commercial kit based upon these protocols was designed and compared to the method's standard approach. Reagent grade, secondary effluent, ...

Detection of Strawberry Viruses in Egypt

USDA-ARS?s Scientific Manuscript database

As part of a USAID-MERC funded project, ‘Disease-indexing and mass propagation of superior strawberry cultivars’, an effort was made to evaluate the virus status of strawberries in Egypt. Diagnostic reverse transcription-polymerase chain reaction (RT-PCR) tests for Strawberry mottle, Strawberry cri...

USE OF TAQMAN TO ENUMERATE ENTEROCOCCUS FAECALIS IN WATER

EPA Science Inventory

The Polymerase Chain Reaction (PCR) has become a useful tool in the detection of microorganisms. However, conventional PCR is somewhat time-consuming considering that additional steps (e.g., gel electrophoresis and gene sequencing) are required to confirm the presence of the tar...

MATERIALS SUPPORTING THE NEW RECREATIONAL WATER QUALITY CRITERIA FOR PATHOGENS

EPA Science Inventory

EPA is developing new, rapid methods for monitoring water quality at beaches to determine adequacy of water quality for swimming. The methods being developed rely upon quantitive polymerase chain reaction technology. They will permit real time decisions regarding beach closures...

77 FR 71191 - 2012 Recreational Water Quality Criteria

Federal Register 2010, 2011, 2012, 2013, 2014

2012-11-29

... Criteria AGENCY: Environmental Protection Agency (EPA). ACTION: Notice of availability of the 2012... for beach monitoring, quantitative polymerase chain reaction (qPCR), for the detection of enterococci... managing recreational waters, such as predictive modeling; the EPA is providing a beach action value for...

78 FR 25274 - Findings of Research Misconduct

Federal Register 2010, 2011, 2012, 2013, 2014

2013-04-30

... AGENCY: Office of the Secretary, HHS. ACTION: Notice. SUMMARY: Notice is hereby given that the Office of Research Integrity (ORI) has taken final action in the following case: Matthew Poore, Advanced Liquid Logic... that Respondent knowingly and intentionally falsified reverse transcription-polymerase chain reaction...

Thermodynamics of Oligonucleotide Duplex Melting

ERIC Educational Resources Information Center

Schreiber-Gosche, Sherrie; Edwards, Robert A.

2009-01-01

Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply…

Competitive fitness during feast and famine: how SOS DNA polymerases influence physiology and evolution in Escherichia coli.

PubMed

Corzett, Christopher H; Goodman, Myron F; Finkel, Steven E

2013-06-01

Escherichia coli DNA polymerases (Pol) II, IV, and V serve dual roles by facilitating efficient translesion DNA synthesis while simultaneously introducing genetic variation that can promote adaptive evolution. Here we show that these alternative polymerases are induced as cells transition from exponential to long-term stationary-phase growth in the absence of induction of the SOS regulon by external agents that damage DNA. By monitoring the relative fitness of isogenic mutant strains expressing only one alternative polymerase over time, spanning hours to weeks, we establish distinct growth phase-dependent hierarchies of polymerase mutant strain competitiveness. Pol II confers a significant physiological advantage by facilitating efficient replication and creating genetic diversity during periods of rapid growth. Pol IV and Pol V make the largest contributions to evolutionary fitness during long-term stationary phase. Consistent with their roles providing both a physiological and an adaptive advantage during stationary phase, the expression patterns of all three SOS polymerases change during the transition from log phase to long-term stationary phase. Compared to the alternative polymerases, Pol III transcription dominates during mid-exponential phase; however, its abundance decreases to <20% during long-term stationary phase. Pol IV transcription dominates as cells transition out of exponential phase into stationary phase and a burst of Pol V transcription is observed as cells transition from death phase to long-term stationary phase. These changes in alternative DNA polymerase transcription occur in the absence of SOS induction by exogenous agents and indicate that cell populations require appropriate expression of all three alternative DNA polymerases during exponential, stationary, and long-term stationary phases to attain optimal fitness and undergo adaptive evolution.

Nanoparticles Affect PCR Primarily via Surface Interactions with PCR Components: Using Amino-Modified Silica-Coated Magnetic Nanoparticles as a Main Model.

PubMed

Bai, Yalong; Cui, Yan; Paoli, George C; Shi, Chunlei; Wang, Dapeng; Shi, Xianming

2015-06-24

Nanomaterials have been widely reported to affect the polymerase chain reaction (PCR). However, many studies in which these effects were observed were not comprehensive, and many of the proposed mechanisms have been primarily speculative. In this work, we used amino-modified silica-coated magnetic nanoparticles (ASMNPs, which can be collected very easily using an external magnetic field) as a model and compared them with gold nanoparticles (AuNPs, which have been studied extensively) to reveal the mechanisms by which nanoparticles affect PCR. We found that nanoparticles affect PCR primarily by binding to PCR components: (1) inhibition, (2) specifity, and (3) efficiency and yield of PCR are impacted. (1) Excess nanomaterials inhibit PCR by adsorbing to DNA polymerase, Mg(2+), oligonucleotide primers, or DNA templates. Nanoparticle surface-active groups are particularly important to this effect. (2, a) Nanomaterials do not inhibit nonspecific amplification products caused by false priming as previously surmised. It was shown that relatively low concentrations of nanoparticles inhibited the amplification of long amplicons, and increasing the amount of nanoparticles inhibited the amplification of short amplicons. This concentration phenomenon appears to be the result of the formation of "joints" upon the adsorption of ASMNPs to DNA templates. (b) Nanomaterials are able to inhibit nonspecific amplification products due to incomplete amplification by preferably adsorbing single-stranded incomplete amplification products. (3) Some types of nanomaterials, such as AuNPs, enhance the efficiency and yield of PCR because these types of nanoparticles can adsorb to single-stranded DNA more strongly than to double-stranded DNA. This behavior assists in the rapid and thorough denaturation of double-stranded DNA templates. Therefore, the interaction between the surface of nanoparticles and PCR components is sufficient to explain most of the effects of nanoparticles on PCR.

Multiplexed resequencing analysis to identify rare variants in pooled DNA with barcode indexing using next-generation sequencer.

PubMed

Mitsui, Jun; Fukuda, Yoko; Azuma, Kyo; Tozaki, Hirokazu; Ishiura, Hiroyuki; Takahashi, Yuji; Goto, Jun; Tsuji, Shoji

2010-07-01

We have recently found that multiple rare variants of the glucocerebrosidase gene (GBA) confer a robust risk for Parkinson disease, supporting the 'common disease-multiple rare variants' hypothesis. To develop an efficient method of identifying rare variants in a large number of samples, we applied multiplexed resequencing using a next-generation sequencer to identification of rare variants of GBA. Sixteen sets of pooled DNAs from six pooled DNA samples were prepared. Each set of pooled DNAs was subjected to polymerase chain reaction to amplify the target gene (GBA) covering 6.5 kb, pooled into one tube with barcode indexing, and then subjected to extensive sequence analysis using the SOLiD System. Individual samples were also subjected to direct nucleotide sequence analysis. With the optimization of data processing, we were able to extract all the variants from 96 samples with acceptable rates of false-positive single-nucleotide variants.

Rapid and effective processing of blood specimens for diagnostic PCR using filter paper and Chelex-100.

PubMed Central

Polski, J M; Kimzey, S; Percival, R W; Grosso, L E

1998-01-01

AIM: To provide a more efficient method for isolating DNA from peripheral blood for use in diagnostic DNA mutation analysis. METHODS: The use of blood impregnated filter paper and Chelex-100 in DNA isolation was evaluated and compared with standard DNA isolation techniques. RESULTS: In polymerase chain reaction (PCR) based assays of five point mutations, identical results were obtained with DNA isolated routinely from peripheral blood and isolated using the filter paper and Chelex-100 method. CONCLUSION: In the clinical setting, this method provides a useful alternative to conventional DNA isolation. It is easily implemented and inexpensive, and provides sufficient, stable DNA for multiple assays. The potential for specimen contamination is reduced because most of the steps are performed in a single microcentrifuge tube. In addition, this method provides for easy storage and transport of samples from the point of acquisition. PMID:9893748

Rapid and effective processing of blood specimens for diagnostic PCR using filter paper and Chelex-100.

PubMed

Polski, J M; Kimzey, S; Percival, R W; Grosso, L E

1998-08-01

To provide a more efficient method for isolating DNA from peripheral blood for use in diagnostic DNA mutation analysis. The use of blood impregnated filter paper and Chelex-100 in DNA isolation was evaluated and compared with standard DNA isolation techniques. In polymerase chain reaction (PCR) based assays of five point mutations, identical results were obtained with DNA isolated routinely from peripheral blood and isolated using the filter paper and Chelex-100 method. In the clinical setting, this method provides a useful alternative to conventional DNA isolation. It is easily implemented and inexpensive, and provides sufficient, stable DNA for multiple assays. The potential for specimen contamination is reduced because most of the steps are performed in a single microcentrifuge tube. In addition, this method provides for easy storage and transport of samples from the point of acquisition.

Jatropha (Jatropha curcas L.).

PubMed

Maravi, Devendra Kumar; Mazumdar, Purabi; Alam, Shamsher; Goud, Vaibhav V; Sahoo, Lingaraj

2015-01-01

The seed oil of Jatropha (Jatropha curcas L.) as a source of biodiesel fuel is gaining worldwide importance. Commercial-scale exploration of Jatropha has not succeeded due to low and unstable seed yield in semiarid lands unsuitable for the food production and infestation to diseases. Genetic engineering is promising to improve various agronomic traits in Jatropha and to understand the molecular functions of key Jatropha genes for molecular breeding. We describe a protocol routinely followed in our laboratory for stable and efficient Agrobacterium tumefaciens-mediated transformation of Jatropha using cotyledonary leaf as explants. The 4-day-old explants are infected with Agrobacterium tumefaciens strain EHA105 harboring pBI121 plant binary vector, which contains nptII as plant selectable marker and gus as reporter. The putative transformed plants are selected on kanamycin, and stable integration of transgene(s) is confirmed by histochemical GUS assay, polymerase chain reaction, and Southern hybridization.

Topography-Assisted Electromagnetic Platform for Blood-to-PCR in a Droplet

PubMed Central

Chiou, Chi-Han; Shin, Dong Jin; Zhang, Yi; Wang, Tza-Huei

2013-01-01

This paper presents an electromagnetically actuated platform for automated sample preparation and detection of nucleic acids. The proposed platform integrates nucleic acid extraction using silica-coated magnetic particles with real-time polymerase chain reaction (PCR) on a single cartridge. Extraction of genomic material was automated by manipulating magnetic particles in droplets using a series of planar coil electromagnets assisted by topographical features, enabling efficient fluidic processing over a variety of buffers and reagents. The functionality of the platform was demonstrated by performing nucleic acid extraction from whole blood, followed by real-time PCR detection of KRAS oncogene. Automated sample processing from whole blood to PCR-ready droplet was performed in 15 minutes. We took a modular approach of decoupling the modules of magnetic manipulation and optical detection from the device itself, enabling a low-complexity cartridge that operates in tandem with simple external instruments. PMID:23835223

Chicken microsatellite markers isolated from libraries enriched for simple tandem repeats.

PubMed

Gibbs, M; Dawson, D A; McCamley, C; Wardle, A F; Armour, J A; Burke, T

1997-12-01

The total number of microsatellite loci is considered to be at least 10-fold lower in avian species than in mammalian species. Therefore, efficient large-scale cloning of chicken microsatellites, as required for the construction of a high-resolution linkage map, is facilitated by the construction of libraries using an enrichment strategy. In this study, a plasmid library enriched for tandem repeats was constructed from chicken genomic DNA by hybridization selection. Using this technique the proportion of recombinant clones that cross-hybridized to probes containing simple tandem repeats was raised to 16%, compared with < 0.1% in a non-enriched library. Primers were designed from 121 different sequences. Polymerase chain reaction (PCR) analysis of two chicken reference pedigrees enabled 72 loci to be localized within the collaborative chicken genetic map, and at least 30 of the remaining loci have been shown to be informative in these or other crosses.

Co-amplification at lower denaturation temperature-PCR: methodology and applications.

PubMed

Liang, Hui; Chen, Guo-Jie; Yu, Yan; Xiong, Li-Kuan

2018-03-20

Co-amplification at lower denaturation temperature-polymerase chain reaction (COLD-PCR) is a novel form of PCR that selectively denatures and amplifies low-abundance mutations from mixtures of wild-type and mutation-containing sequences, enriching the mutation 10 to 100 folds. Due to the slightly altered melting temperature (Tm) of the double-stranded DNA and the formation of the mutation/wild-type heteroduplex DNA, COLD-PCR methods are sensitive, specific, accurate, cost-effective and easy to maneuver, and can enrich mutations of any type and at any position, even unknown mutations within amplicons. COLD-PCR and its improved methods are now applied in cancer, microorganisms, prenatal screening, animals and plants. They are extremely useful for early diagnosis, monitoring the prognosis of disease and the efficiency of the treatment, drug selection, prediction of prognosis, plant breeding and etc. In this review, we introduce the principles, key techniques, derived methods and applications of COLD-PCR.

An immortalized goat mammary epithelial cell line induced with human telomerase reverse transcriptase (hTERT) gene transfer.

PubMed

He, Y L; Wu, Y H; He, X N; Liu, F J; He, X Y; Zhang, Y

2009-06-01

Although mammary epithelial cell lines can provide a rapid and reliable indicator of gene expression efficiency of transgenic animals, their short lifespan greatly limits this application. To provide stable and long lifespan cells, goat mammary epithelial cells (GMECs) were transduced with pLNCX2-hTERT by retrovirus-mediated gene transfer. Transduced GMECs were evaluated by reverse transcriptase polymerase chain reaction (RT-PCR), proliferation assays, karyotype analysis, telomerase activity assay, western blotting, soft agar assay, and injection into nude mice. Non-transduced GMECs were used as a control. The hTERT-GMECs had higher telomerase activity and extended proliferative lifespan compared to non-transfected GMECs; even after Passage 50, hTERT-GMECs had a near diploid complement of chromosomes. Furthermore, they did not gain the anchorage-independent growth property and were not associated with a malignant phenotype in vitro or in vivo.

A novel approach for evaluating the performance of real time quantitative loop-mediated isothermal amplification-based methods.

PubMed

Nixon, Gavin J; Svenstrup, Helle F; Donald, Carol E; Carder, Caroline; Stephenson, Judith M; Morris-Jones, Stephen; Huggett, Jim F; Foy, Carole A

2014-12-01

Molecular diagnostic measurements are currently underpinned by the polymerase chain reaction (PCR). There are also a number of alternative nucleic acid amplification technologies, which unlike PCR, work at a single temperature. These 'isothermal' methods, reportedly offer potential advantages over PCR such as simplicity, speed and resistance to inhibitors and could also be used for quantitative molecular analysis. However there are currently limited mechanisms to evaluate their quantitative performance, which would assist assay development and study comparisons. This study uses a sexually transmitted infection diagnostic model in combination with an adapted metric termed isothermal doubling time (IDT), akin to PCR efficiency, to compare quantitative PCR and quantitative loop-mediated isothermal amplification (qLAMP) assays, and to quantify the impact of matrix interference. The performance metric described here facilitates the comparison of qLAMP assays that could assist assay development and validation activities.

The effectiveness of the biodegradation of raw and processed polystyrene by mealworms

NASA Astrophysics Data System (ADS)

Leluk, Karol; Hanus-Lorenz, Beata; Rybak, Justyna; Bożek, Magdalena

2017-11-01

In our studies biodegradation of four variants of polystyrene was performed. We tested: raw material (PS), processed polystyrene (PSr), building insulation material (EPS) and food packaging boxes (PSp). Materials were characterized by means melt flow ratio (MFR), shore hardness and gloss. The biochemical assessment of macromolecules (proteins, lipids and sugars) in the mealworms organisms fed with tested forms of polystyrene allowed us to set how efficient and beneficial the biodegradation of types of polystyrene is. We also evaluated the variability of bacterial community in larval guts by the use of denaturing gradient gel electrophoresis (DGGE) on the bacterial DNA of 16S rRNA genes amplified in polymerase chain reaction (PCR). The results suggest that EPS and PSp polystyrene are the most digestible for T. molitor larvae. The metabolic degradation of polystyrene is probably strictly connected with the changes in biodiversity of gut bacteria.

Combinatorial codon scrambling enables scalable gene synthesis and amplification of repetitive proteins

NASA Astrophysics Data System (ADS)

Tang, Nicholas C.; Chilkoti, Ashutosh

2016-04-01

Most genes are synthesized using seamless assembly methods that rely on the polymerase chain reaction (PCR). However, PCR of genes encoding repetitive proteins either fails or generates nonspecific products. Motivated by the need to efficiently generate new protein polymers through high-throughput gene synthesis, here we report a codon-scrambling algorithm that enables the PCR-based gene synthesis of repetitive proteins by exploiting the codon redundancy of amino acids and finding the least-repetitive synonymous gene sequence. We also show that the codon-scrambling problem is analogous to the well-known travelling salesman problem, and obtain an exact solution to it by using De Bruijn graphs and a modern mixed integer linear programme solver. As experimental proof of the utility of this approach, we use it to optimize the synthetic genes for 19 repetitive proteins, and show that the gene fragments are amenable to PCR-based gene assembly and recombinant expression.

Rapid detection of Prunus necrotic ringspot virus using magnetic nanoparticle-assisted reverse transcription loop-mediated isothermal amplification.

PubMed

Zong, Xiaojuan; Wang, Wenwen; Wei, Hairong; Wang, Jiawei; Chen, Xin; Xu, Li; Zhu, Dongzi; Tan, Yue; Liu, Qingzhong

2014-11-01

Prunus necrotic ringspot virus (PNRSV) has seriously reduced the yield of Prunus species worldwide. In this study, a highly efficient and specific two-step reverse transcription loop-mediated isothermal amplification (RT-LAMP) was developed to detect PNRSV. Total RNA was extracted from sweet cherry leaf samples using a commercial kit based on a magnetic nanoparticle technique. Transcripts were used as the templates for the assay. The results of this assay can be detected using agarose gel electrophoresis or by assessing in-tube fluorescence after adding SYBR Green I. The assay is highly specific for PNRSV, and it is more sensitive than reverse-transcription polymerase chain reaction (RT-PCR). Restriction enzyme digestion verified further the reliability of this RT-LAMP assay. To our knowledge, this is the first report of the application of RT-LAMP to PNRSV detection in Prunus species. Copyright © 2014 Elsevier B.V. All rights reserved.

Genetic traits of avascular necrosis of the femoral head analyzed by array comparative genomic hybridization and real-time polymerase chain reaction.

PubMed

Hwang, Jung-Taek; Baik, Seung-Ho; Choi, Jin-Soo; Lee, Kweon-Haeng; Rhee, Seung-Koo

2011-01-03

In an attempt to observe the genetic traits of avascular necrosis of the femoral head, we analyzed the genomic alterations in blood samples of 18 patients with avascular necrosis of the femoral head (9 idiopathic and 9 alcoholic cases) using the array comparative genomic hybridization method and real-time polymerase chain reaction. Several candidate genes were identified that may induce avascular necrosis of the femoral head, and we investigated their role in the pathomechanism of osteonecrosis of bone. The frequency of each candidate gene over all the categories of avascular necrosis of the femoral head was also calculated by real-time polymerase chain reaction. The highest frequency specific genes in each category were FLJ40296, CYP27C1, and CTDP1. FLJ40296 and CYP27C1 had the highest frequency (55.6%) in the idiopathic category. FLJ40296 had a high frequency (44.4%) in the alcoholic category, but CYP27C1 had a relatively low frequency (33.3%) in the alcoholic category. However, CTDP1 showed a significantly high frequency (55.6%) in the alcoholic category and a low frequency (22.2%) in the idiopathic category. Although we statistically analyzed the frequency of each gene with Fisher's exact test, we could not prove statistical significance due to the small number of samples. Further studies are needed with larger sample numbers. If the causal genes of avascular necrosis of the femoral head are found, they may be used for early detection, prognosis prediction, and genomic treatment of avascular necrosis of the femoral head in the future. Copyright 2011, SLACK Incorporated.

Implications of Measurement Assay Type in Design of HIV Experiments.

PubMed

Cannon, LaMont; Jagarapu, Aditya; Vargas-Garcia, Cesar A; Piovoso, Michael J; Zurakowski, Ryan

2017-12-01

Time series measurements of circular viral episome (2-LTR) concentrations enable indirect quantification of persistent low-level Human Immunodeficiency Virus (HIV) replication in patients on Integrase-Inhibitor intensified Combined Antiretroviral Therapy (cART). In order to determine the magnitude of these low level infection events, blood has to be drawn from a patients at a frequency and volume that is strictly regulated by the Institutional Review Board (IRB). Once the blood is drawn, the 2-LTR concentration is determined by quantifying the amount of HIV DNA present in the sample via a PCR (Polymerase Chain Reaction) assay. Real time quantitative Polymerase Chain Reaction (qPCR) is a widely used method of performing PCR; however, a newer droplet digital Polymerase Chain Reaction (ddPCR) method has been shown to provide more accurate quantification of DNA. Using a validated model of HIV viral replication, this paper demonstrates the importance of considering DNA quantification assay type when optimizing experiment design conditions. Experiments are optimized using a Genetic Algorithm (GA) to locate a family of suboptimal sample schedules which yield the highest fitness. Fitness is defined as the expected information gained in the experiment, measured by the Kullback-Leibler Divergence (KLD) between the prior and posterior distributions of the model parameters. We compare the information content of the optimized schedules to uniform schedules as well as two clinical schedules implemented by researchers at UCSF and the University of Melbourne. This work shows that there is a significantly greater gain information in experiments using a ddPCR assay vs. a qPCR assay and that certain experiment design considerations should be taken when using either assay.

Mutations blocking side chain assembly, polymerization, or transport of a Wzy-dependent Streptococcus pneumoniae capsule are lethal in the absence of suppressor mutations and can affect polymer transfer to the cell wall.

PubMed

Xayarath, Bobbi; Yother, Janet

2007-05-01

Extracellular polysaccharides of many bacteria are synthesized by the Wzy polymerase-dependent mechanism, where long-chain polymers are assembled from undecaprenyl-phosphate-linked repeat units on the outer face of the cytoplasmic membrane. In gram-positive bacteria, Wzy-dependent capsules remain largely cell associated via membrane and peptidoglycan linkages. Like many Wzy-dependent capsules, the Streptococcus pneumoniae serotype 2 capsule is branched. In this study, we found that deletions of cps2K, cps2J, or cps2H, which encode a UDP-glucose dehydrogenase necessary for side chain synthesis, the putative Wzx transporter (flippase), and the putative Wzy polymerase, respectively, were obtained only in the presence of suppressor mutations. Most of the suppressor mutations were in cps2E, which encodes the initiating glycosyltransferase for capsule synthesis. The cps2K mutants containing the suppressor mutations produced low levels of high-molecular-weight polymer that was detected only in membrane fractions. cps2K-repaired mutants exhibited only modest increases in capsule production due to the effect of the secondary mutation, but capsule was detectable in both membrane and cell wall fractions. Lethality of the cps2K, cps2J, and cps2H mutations was likely due to sequestration of undecaprenyl-phosphate in the capsule pathway and either preclusion of its turnover for utilization in essential pathways or destabilization of the membrane due to an accumulation of lipid-linked intermediates. The results demonstrate that proper polymer assembly requires not only a functional transporter and polymerase but also complete repeat units. A central role for the initiating glycosyltransferase in controlling capsule synthesis is also suggested.

Diagnosing leprosy: revisiting the role of the slit-skin smear with critical analysis of the applicability of polymerase chain reaction in diagnosis.

PubMed

Banerjee, Surajita; Biswas, Nibir; Kanti Das, Nilay; Sil, Amrita; Ghosh, Pramit; Hasanoor Raja, Abu Hena; Dasgupta, Sarbani; Kanti Datta, Pijush; Bhattacharya, Basudev

2011-12-01

Diagnosing leprosy is challenging, especially in early-stage cases, and the need for a sensitive diagnostic tool is urgent. Polymerase chain reaction (PCR) holds promise as a simple and sensitive diagnostic tool, but its usefulness in the Indian context requires further evaluation. Slit-skin smear (SSS) remains the conventional method of leprosy detection. Hence, this study was undertaken to evaluate and compare the diagnostic efficacy of PCR versus that of SSS. Punch biopsy of skin and SSS were obtained from the active margins of lesions. Cases were clinically grouped according to whether they were multibacillary (MB) or paucibacillary (PB) and classified into tuberculoid (TT), borderline tuberculoid (BT), borderline lepromatous (BL), lepromatous (LL), histoid, and indeterminate groups after clinicopathological correlation. DNA was extracted from biopsy specimens, and multiplex PCR was carried out incorporating primers intended for the amplification of a specific 372-bp fragment of a repetitive sequence of Mycobacterium leprae DNA. Among 164 patients, PCR was positive in 82.3%. The sensitivity of PCR was significantly greater (P < 0.0001) than that of SSS in both the MB (85.9% vs. 59.8%) and PB (75.4% vs. 1.8%) subgroups; the difference in sensitivity in the PB subgroup is remarkable. Positivity by PCR and SSS was found in 100% of LL and histoid leprosy, but PCR had significantly greater (P < 0.0001) positivity in BT leprosy and was of definite increased value in indeterminate and TT leprosy. Polymerase chain reaction had higher sensitivity compared with SSS, especially in diagnostically challenging and PB cases. Thus, the use of this costly but sensitive tool should be restricted to this subgroup, because SSS is sufficiently sensitive in the diagnosis of LL and histoid leprosy. © 2011 The International Society of Dermatology.

Differentiation of human-induced pluripotent stem cells into insulin-producing clusters.

PubMed

Shaer, Anahita; Azarpira, Negar; Vahdati, Akbar; Karimi, Mohammad Hosein; Shariati, Mehrdad

2015-02-01

In diabetes mellitus type 1, beta cells are mostly destroyed; while in diabetes mellitus type 2, beta cells are reduced by 40% to 60%. We hope that soon, stem cells can be used in diabetes therapy via pancreatic beta cell replacement. Induced pluripotent stem cells are a kind of stem cell taken from an adult somatic cell by "stimulating" certain genes. These induced pluripotent stem cells may be a promising source of cell therapy. This study sought to produce isletlike clusters of insulin-producing cells taken from induced pluripotent stem cells. A human-induced pluripotent stem cell line was induced into isletlike clusters via a 4-step protocol, by adding insulin, transferrin, and selenium (ITS), N2, B27, fibroblast growth factor, and nicotinamide. During differentiation, expression of pancreatic β-cell genes was evaluated by reverse transcriptase-polymerase chain reaction; the morphologic changes of induced pluripotent stem cells toward isletlike clusters were observed by a light microscope. Dithizone staining was used to stain these isletlike clusters. Insulin produced by these clusters was evaluated by radio immunosorbent assay, and the secretion capacity was analyzed with a glucose challenge test. Differentiation was evaluated by analyzing the morphology, dithizone staining, real-time quantitative polymerase chain reaction, and immunocytochemistry. Gene expression of insulin, glucagon, PDX1, NGN3, PAX4, PAX6, NKX6.1, KIR6.2, and GLUT2 were documented by analyzing real-time quantitative polymerase chain reaction. Dithizone-stained cellular clusters were observed after 23 days. The isletlike clusters significantly produced insulin. The isletlike clusters could increase insulin secretion after a glucose challenge test. This work provides a model for studying the differentiation of human-induced pluripotent stem cells to insulin-producing cells.

An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food

PubMed Central

Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

2015-01-01

Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features. PMID:26579116

Antibiotic resistance and molecular typing among cockle (Anadara granosa) strains of Vibrio parahaemolyticus by polymerase chain reaction (PCR)-based analysis.

PubMed

Sahilah, A M; Laila, R A S; Sallehuddin, H Mohd; Osman, H; Aminah, A; Ahmad Azuhairi, A

2014-02-01

Genomic DNA of Vibrio parahaemolyticus were characterized by antibiotic resistance, enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR) and random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) analysis. These isolates originated from 3 distantly locations of Selangor, Negeri Sembilan and Melaka (East coastal areas), Malaysia. A total of 44 (n = 44) of tentatively V. parahaemolyticus were also examined for the presence of toxR, tdh and trh gene. Of 44 isolates, 37 were positive towards toxR gene; while, none were positive to tdh and trh gene. Antibiotic resistance analysis showed the V. parahaemolyticus isolates were highly resistant to bacitracin (92%, 34/37) and penicillin (89%, 33/37) followed by resistance towards ampicillin (68%, 25/37), cefuroxime (38%, 14/37), amikacin (6%, 2/37) and ceftazidime (14%, 5/37). None of the V. parahaemolyticus isolates were resistant towards chloramphenicol, ciprofloxacin, ceftriaxone, enrofloxacin, norfloxacin, streptomycin and vancomycin. Antibiogram patterns exhibited, 9 patterns and phenotypically less heterogenous when compared to PCR-based techniques using ERIC- and RAPD-PCR. The results of the ERIC- and RAPD-PCR were analyzed using GelCompare software. ERIC-PCR with primers ERIC1R and ERIC2 discriminated the V. parahaemolyticus isolates into 6 clusters and 21 single isolates at a similarity level of 80%. While, RAPD-PCR with primer Gen8 discriminated the V. parahaemolyticus isolates into 11 clusters and 10 single isolates and Gen9 into 8 clusters and 16 single isolates at the same similarity level examined. Results in the presence study demonstrated combination of phenotypically and genotypically methods show a wide heterogeneity among cockle isolates of V. parahaemolyticus.

Fatal hemorrhagic fever caused by West Nile virus in the United States.

PubMed

Paddock, Christopher D; Nicholson, William L; Bhatnagar, Julu; Goldsmith, Cynthia S; Greer, Patricia W; Hayes, Edward B; Risko, Joseph A; Henderson, Corey; Blackmore, Carina G; Lanciotti, Robert S; Campbell, Grant L; Zaki, Sherif R

2006-06-01

Most West Nile virus (WNV) infections in humans are asymptomatic; severe disease occurs in relatively few patients and typically manifests as encephalitis, meningitis, or acute flaccid paralysis. A few cases of life-threatening disease with diffuse hemorrhagic manifestations have been reported in Africa; however, this clinical presentation has not been documented for any of the >16,700 cases of WNV disease reported in the United States during 1999-2004. We describe a case of fulminant WNV infection in a 59-year-old Florida man who died following a brief illness that resembled hemorrhagic disease caused by Rickettsia reckettsii, dengue virus or yellow fever virus. Traditional and contemporary diagnostic assays, including culture isolation, electron microscopic examination, reverse-transcriptase polymerase chain reaction amplification, and immunohistochemical stains, were used to confirm systemic WNV infection in the patient. WNV was isolated in a cell culture from a skin biopsy specimen obtained from the patient shortly prior to death. Electron microscopic examination identified the isolate as a flavivirus, and reverse-transcriptase polymerase chain reaction amplified specific WNV sequences from the isolate and patient tissue. Quantitative polymerase chain reaction identified approximately 1x10(7) viral copies/mL in the patient's serum. WNV antigens were detected by immunohistochemical stains in intravascular mononuclear cells and endothelium in skin, lung, liver, kidney, spleen, bone marrow, and central nervous system; no viral antigens were identified in neurons or glial cells of the central nervous system. Although hemorrhagic disease is a rare manifestation of WNV infection, the findings provided by this report may offer new insights regarding the clinical spectrum and pathogenesis of WNV disease in humans.

A Degradome-Based Polymerase Chain Reaction to Resolve the Potential of Environmental Samples for 2,4-Dichlorophenol Biodegradation.

PubMed

Ibrahim, Eslam S; Kashef, Mona T; Essam, Tamer M; Ramadan, Mohammed A

2017-12-01

A clean way to overcome environmental pollution is biodegradation. In this perspective, at the intersection of biodegradation and metagenomics, the degradome is defined as the totality of genes related to the biodegradation of a certain compound. It includes the genetic elements from both culturable and uncultured microorganisms. The possibility of assessing the biodegradation potential of an environmental samples, using a degradome-based polymerase chain reaction, was explored. 2,4-Dichlorophenol (2,4-DCP) was chosen as a model and the use of tfdB gene as a biodegradation marker was confirmed by bioinformatics study of TfdB protein. Five primer pairs were designed for the detection of different tfdB gene families. A total of 16 environmental samples were collected from Egyptian agricultural soils and wastewaters and tested for the presence of 2,4-DCP. The biodegradation capacity of 2,4-DCP was determined, for all isolated consortia, to reach up to 350 mg/l. Metagenomic DNA was extracted directly from the soil samples while successive 2,4-DCP-degrading microbial communities were enriched, with increasing concentrations of 2,4-DCP, then their DNA was extracted. The extracted DNA was tested for the distribution of the tfdB gene using a degradome-based polymerase chain reaction. tfdB-1 and tfdB-2 were detected in 5 and 9 samples, respectively. However, the co-existence of both genes was detected only in five samples. All tfdB positive samples were capable of 2,4-DCP degradation. The developed approach of assessing the potential of different environments for degrading 2,4-DCP was successfully measured in terms of accuracy (81.25%) and specificity (100%).

Expression of Connexin 43 in Synovial Tissue of Patients With Rheumatoid Arthritis

PubMed Central

MATSUKI, Tomohiro; TSUCHIDA, Shinji; TERAUCHI, Ryu; ODA, Ryo; FUJIWARA, Hiroyoshi; MAZDA, Osam; KUBO, Toshikazu

2016-01-01

Objectives This study aims to identify the distribution and expression level of connexin 43 (Cx43) in synovial tissue in patients with rheumatoid arthritis (RA). Patients and methods The expression of Cx43 in synovial tissue from eight patients with RA (2 males, 6 females; mean age 59.5±2.7 years; range 52 to 71 years), five patients with osteoarthritis (2 males, 3 females; mean age 68.4±2.7 years; range 61 to 81 years), and one normal female subject (mean age 61 year) was analyzed by quantitative reverse transcriptase polymerase chain reaction and immunohistochemistry of tissue sections. Induction of Cx43 following stimulation of human RA synovial fibroblasts with tumor necrosis factor-alpha (TNF-a) cultures was examined by quantitative reverse transcriptase polymerase chain reaction. The effect of small interfering ribonucleic acid targeting Cx43 (siCx43) on the expression of TNF-a and interleukin-6 was examined using quantitative reverse transcriptase polymerase chain reaction and enzyme-linked immunosorbent assays. Results Connexin 43 was highly expressed in RA synovial tissue, which also expressed TNF-a, but was expressed lower in osteoarthritis and normal synovial tissue. Expression of Cx43 was markedly up-regulated in RA synovial fibroblasts after stimulation with TNF-a. The over-expression of pro- inflammatory cytokines was suppressed by transfection of siCx43. Conclusion This study shows that Cx43 is expressed in RA synovial tissue and that its expression is induced by stimulation with TNF-a. The expression of the pro-inflammatory cytokines was inhibited by transfection of siCx43. Cx43 may be a novel marker of inflammation in RA synovial tissue. PMID:29900991

Molecular analysis and association with clinical and laboratory manifestations in children with sickle cell anemia

PubMed Central

Camilo-Araújo, Roberta Faria; Amancio, Olga Maria Silverio; Figueiredo, Maria Stella; Cabanãs-Pedro, Ana Carolina; Braga, Josefina Aparecida Pellegrini

2014-01-01

Objectives To analyze the frequency of βS-globin haplotypes and alpha-thalassemia, and their influence on clinical manifestations and the hematological profile of children with sickle cell anemia. Method The frequency of βS-globin haplotypes and alpha-thalassemia and any association with clinical and laboratorial manifestations were determined in 117 sickle cell anemia children aged 3–71 months. The confirmation of hemoglobin SS and determination of the haplotypes were achieved by polymerase chain reaction-restriction fragment length polymorphism, and alpha-thalassemia genotyping was by multiplex polymerase chain reaction (single-tube multiplex-polymerase chain reaction). Results The genotype distribution of haplotypes was 43 (36.7%) Central African Republic/Benin, 41 (35.0%) Central African Republic/Central African Republic, 20 (17.0%) Rare/atypical, and 13 (11.1%) Benin/Benin. The frequency of the α3.7 deletion was 1.71% as homozygous (−α3.7/−α3.7) and 11.9% as heterozygous (−α3.7/αα). The only significant association in respect to haplotypes was related to the mean corpuscular volume. The presence of alpha-thalassemia was significantly associated to decreases in mean corpuscular volume, mean corpuscular hemoglobin and reticulocyte count and to an increase in the red blood cell count. There were no significant associations of βS-globin haplotypes and alpha-thalassemia with clinical manifestations. Conclusions In the study population, the frequency of alpha-thalassemia was similar to published data in Brazil with the Central African Republic haplotype being the most common, followed by the Benin haplotype. βS-globin haplotypes and interaction between alpha-thalassemia and sickle cell anemia did not influence fetal hemoglobin concentrations or the number of clinical manifestations. PMID:25305165

An Evaluation of Microbial Profile in Halitosis with Tongue Coating Using PCR (Polymerase Chain Reaction)- A Clinical and Microbiological Study

PubMed Central

Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana

2014-01-01

Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. Materials and Methods: The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. Result: The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. Conclusion: The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load. PMID:24596791

An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food.

PubMed

Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

2015-01-01

Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

Development of a Novel, Rapid Multiplex Polymerase Chain Reaction Assay for the Detection and Differentiation of Salmonella enterica Serovars Enteritidis and Typhimurium Using Ultra-Fast Convection Polymerase Chain Reaction.

PubMed

Kim, Tae-Hoon; Hwang, Hyun Jin; Kim, Jeong Hee

2017-10-01

Salmonella enterica serovars Enteritidis and Typhimurium are the most common causative agents of human nontyphoidal salmonellosis. The rapid detection and timely treatment of salmonellosis are important to increase the curative ratio and prevent spreading of the disease. In this study, we developed a rapid multiplex convection polymerase chain reaction (PCR) method to detect Salmonella spp. and differentiate Salmonella Enteritidis and Salmonella Typhimurium. We used the invA gene for Salmonella spp. detection. Salmonella Enteritidis-specific primers and Salmonella Typhimurium-specific primers were designed using the insertion element (IE) and spy genes, respectively. The primer set for Salmonella spp. detection clearly detected both Salmonella Enteritidis and Salmonella Typhimurium after a 21-min amplification reaction. Serovar-specific primer sets for Salmonella Enteritidis and Salmonella Typhimurium specifically detected each target species in a 21-min amplification reaction. We were able to detect Salmonella spp. at a single copy level in the singleplex mode. The limits of detection for Salmonella Enteritidis and Salmonella Typhimurium were 30 copies in both the singleplex and multiplex modes. The PCR run time could be reduced to 10.5 min/15 cycles. The multiplex convection PCR method developed in this study could detect the Salmonella spp. Salmonella Enteritidis and Salmonella Typhimurium in artificially contaminated milk with as few as 10 0 colony-forming unit/mL after 4-h enrichment. The PCR assay developed in this study provides a rapid, specific, and sensitive method for the detection of Salmonella spp. and the differentiation of Salmonella Enteritidis and Salmonella Typhimurium.

First report of Toxoplasma gondii sporulated oocysts and Giardia duodenalis in commercial green-lipped mussels (Perna canaliculus) in New Zealand.

PubMed

Coupe, Alicia; Howe, Laryssa; Burrows, Elizabeth; Sine, Abigail; Pita, Anthony; Velathanthiri, Niluka; Vallée, Emilie; Hayman, David; Shapiro, Karen; Roe, Wendi D

2018-05-01

Pollution of marine ecosystems with the protozoan parasites Toxoplasma gondii, Cryptosporidium spp. and Giardia duodenalis can be studied using bivalve shellfish as biosentinels. Although evidence suggests that these parasites are present in New Zealand coastal waters, the extent of protozoal pollution has not been investigated. This study used optimised molecular methods to detect the presence of Cryptosporidium spp., G. duodenalis and T. gondii in commercially sourced green-lipped mussel (Perna canaliculus), an endemic species found throughout coastal New Zealand. A nested polymerase chain reaction was validated for detection of T. gondii DNA and applied to 104 commercially sourced mussels. Thirteen mussels were positive for T. gondii DNA with an estimated true prevalence of 16.4% using Bayesian statistics, and the presence of T. gondii in mussels was significantly associated with collection during the summer compared with that in the winter (P = 0.003). Consumption of contaminated shellfish may also pose a health risk for humans and marine wildlife. As only sporulated T. gondii oocysts can be infectious, a reverse transcriptase-polymerase chain reaction was used to confirm presence of a sporozoite-specific marker (SporoSAG), detected in four mussels. G. duodenalis assemblage B, known to be pathogenic in humans, was also discovered in 1% mussels, tested by polymerase chain reaction (n = 90). Cryptosporidium spp. was not detected in the sampled mussel haemolymph. Results suggest that New Zealand may have high levels of coastal contamination with T. gondii, particularly in summer months, and that naturally exposed mussels can ingest and retain sporulated oocysts, further establishing shellfish consumption as a health concern.

Analysis of Acquisition and Titer of Maize Mosaic Rhabdovirus in Its Vector, Peregrinus maidis (Hemiptera: Delphacidae).

PubMed

Barandoc-Alviar, Karen; Ramirez, Girly M; Rotenberg, Dorith; Whitfield, Anna E

2016-01-01

The corn planthopper, Peregrinus maidis (Ashmead) (Hemiptera: Delphacidae), transmits Maize mosaic rhabdovirus (MMV), an important pathogen of maize and sorghum, in a persistent propagative manner. To better understand the vectorial capacity of P. maidis, we determined the efficiency of MMV acquisition by nymphal and adult stages, and characterized MMV titer through development. Acquisition efficiency, i.e., proportion of insects that acquired the virus, was determined by reverse transcriptase polymerase chain reaction (RT-PCR) and virus titer of individual insects was estimated by quantitative RT-PCR. Acquisition efficiency of MMV differed significantly between nymphs and adults. MMV titer increased significantly over time and throughout insect development from nymphal to adult stage, indication of virus replication in the vector during development. There was a positive association between the vector developmental stage and virus titer. Also, the average titer in male insects was threefold higher than female titers, and this difference persisted up to 30 d post adult eclosion. Overall, our findings indicate that nymphs are more efficient than adults at acquiring MMV and virus accumulated in the vector over the course of nymphal development. Furthermore, sustained infection over the lifespan of P. maidis indicates a potentially high capacity of this vector to transmit MMV. © The Author 2016. Published by Oxford University Press on behalf of the Entomological Society of America.

Cloning and expression of the gene for bacteriophage T7 RNA polymerase

DOEpatents

Studier, F.W.; Davanloo, P.; Rosenberg, A.H.

1984-03-30

This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the T7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties.

Plasma micro-nanotextured polymeric micromixer for DNA purification with high efficiency and dynamic range.

PubMed

Kastania, Athina S; Tsougeni, Katerina; Papadakis, George; Gizeli, Electra; Kokkoris, George; Tserepi, Angeliki; Gogolides, Evangelos

2016-10-26

We present a polymeric microfluidic chip capable of purifying DNA through solid phase extraction. It is designed to be used as a module of an integrated Lab-on-chip platform for pathogen detection, but it can also be used as a stand-alone device. The microfluidic channels are oxygen plasma micro-nanotextured, i.e. randomly roughened in the micro-nano scale, a process creating high surface area as well as high density of carboxyl groups (COOH). The COOH groups together with a buffer that contains polyethylene glycol (PEG), NaCl and ethanol are able to bind DNA on the microchannel surface. The chip design incorporates a mixer so that sample and buffer can be efficiently mixed on chip under continuous flow. DNA is subsequently eluted in water. The chip is able to isolate DNA with high recovery efficiency (96± 11%) in an extremely large dynamic range of prepurified Salmonella DNA as well as from Salmonella cell lysates that correspond to a range of 5 to 1.9 × 10 8  cells (0.263 fg to 2 × 500 ng). The chip was evaluated via absorbance measurements, polymerase chain reaction (PCR), and gel electrophoresis. Copyright © 2016 Elsevier B.V. All rights reserved.

A highly efficient strategy to determine genotypes of genetically-engineered mice using genomic DNA purified from hair roots.

PubMed

Otaño-Rivera, Víctor; Boakye, Amma; Grobe, Nadja; Almutairi, Mohammed M; Kursan, Shams; Mattis, Lesan K; Castrop, Hayo; Gurley, Susan B; Elased, Khalid M; Boivin, Gregory P; Di Fulvio, Mauricio

2017-04-01

Genotyping of genetically-engineered mice is necessary for the effective design of breeding strategies and identification of mutant mice. This process relies on the identification of DNA markers introduced into genomic sequences of mice, a task usually performed using the polymerase chain reaction (PCR). Clearly, the limiting step in genotyping is isolating pure genomic DNA. Isolation of mouse DNA for genotyping typically involves painful procedures such as tail snip, digit removal, or ear punch. Although the harvesting of hair has previously been proposed as a source of genomic DNA, there has been a perceived complication and reluctance to use this non-painful technique because of low DNA yields and fear of contamination. In this study we developed a simple, economic, and efficient strategy using Chelex® resins to purify genomic DNA from hair roots of mice which are suitable for genotyping. Upon comparison with standard DNA purification methods using a commercially available kit, we demonstrate that Chelex® efficiently and consistently purifies high-quality DNA from hair roots, minimizing pain, shortening time and reducing costs associated with the determination of accurate genotypes. Therefore, the use of hair roots combined with Chelex® is a reliable and more humane alternative for DNA genotyping.