Instrumental, theoretical, and experimental aspects of determining thermodynamic and kinetic parameters from steady-state and non-steady-state cyclic voltammetry at microelectrodes in high-resistance solvents: Application to the fac/mer-[Cr(CO){sub 3}({eta}{sup 3}-Ph{sub 2}PCH{sub 2}CH{sub 2}P(Ph)CH{sub 2}CH{sub 2}PPh{sub 2})]{sup +/0} square reaction sheme in dichloromethane

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bond, A.M.; Feldberg, S.W.; Greenhill, H.B.

1992-05-01

Instrumental, experimental and theoretical approaches required to quantify the thermodynamic and kinetic aspects of the square reaction scheme relating the fac{sup +/0} and mer{sup +/0} redox couples in the high-resistance solvent dichloromethane, at microelectrodes, under both steady-state and fast scan rate (transient) conditions, are presented. fac{sup +}, mer{sup +}, fac{sup 0}, and mer{sup 0} represent the facial and meridional isomers of Cr-(CO){sub 3}({eta}{sup 3}-Ph{sub 2}PCH{sub 2}CH{sub 2}P(Ph)CH{sub 2}CH{sub 2}PPh{sub 2}) in the oxidized 17 electron (fac{sup +}, mer{sup +}) and reduced 18 electron (fac{sup 0}, mer{sup 0}) configurations, respectively. A computationally efficient simulation method based on the DuFort-Frankel algorithm ismore » readily applied to microelectrodes and enables simulations to be undertaken for both steady-state and transient voltammetry at electrodes of microdisk geometry. The minimal ohmic drop present under steady-state conditions enables a limited set of parameters to be calculated for the square scheme. However, data relevant to species generated as a product of electron transfer have to be determined from the transient voltammetry at fast scans rates. For the latter experiments, a newly designed electrochemical cell was developed along with relevant electronic circuitry to minimize the background current and uncompensated resistance. The cell contains two matched working microelectrodes (one in the test solution and one in the separated electrolyte solution) and a common quasi-reference electrode which passes through both compartments of the cell. It is concluded that a judicious choice of steady-state and transient techniques, such as those described in this work, are necessary to characterize complex reaction schemes in high-resistance solvents. 46 refs., 7 figs., 3 tabs.« less

Enhanced Regulatory Sequence Prediction Using Gapped k-mer Features

PubMed Central

Mohammad-Noori, Morteza; Beer, Michael A.

2014-01-01

Abstract Oligomers of length k, or k-mers, are convenient and widely used features for modeling the properties and functions of DNA and protein sequences. However, k-mers suffer from the inherent limitation that if the parameter k is increased to resolve longer features, the probability of observing any specific k-mer becomes very small, and k-mer counts approach a binary variable, with most k-mers absent and a few present once. Thus, any statistical learning approach using k-mers as features becomes susceptible to noisy training set k-mer frequencies once k becomes large. To address this problem, we introduce alternative feature sets using gapped k-mers, a new classifier, gkm-SVM, and a general method for robust estimation of k-mer frequencies. To make the method applicable to large-scale genome wide applications, we develop an efficient tree data structure for computing the kernel matrix. We show that compared to our original kmer-SVM and alternative approaches, our gkm-SVM predicts functional genomic regulatory elements and tissue specific enhancers with significantly improved accuracy, increasing the precision by up to a factor of two. We then show that gkm-SVM consistently outperforms kmer-SVM on human ENCODE ChIP-seq datasets, and further demonstrate the general utility of our method using a Naïve-Bayes classifier. Although developed for regulatory sequence analysis, these methods can be applied to any sequence classification problem. PMID:25033408

Enhanced regulatory sequence prediction using gapped k-mer features.

PubMed

Ghandi, Mahmoud; Lee, Dongwon; Mohammad-Noori, Morteza; Beer, Michael A

2014-07-01

Oligomers of length k, or k-mers, are convenient and widely used features for modeling the properties and functions of DNA and protein sequences. However, k-mers suffer from the inherent limitation that if the parameter k is increased to resolve longer features, the probability of observing any specific k-mer becomes very small, and k-mer counts approach a binary variable, with most k-mers absent and a few present once. Thus, any statistical learning approach using k-mers as features becomes susceptible to noisy training set k-mer frequencies once k becomes large. To address this problem, we introduce alternative feature sets using gapped k-mers, a new classifier, gkm-SVM, and a general method for robust estimation of k-mer frequencies. To make the method applicable to large-scale genome wide applications, we develop an efficient tree data structure for computing the kernel matrix. We show that compared to our original kmer-SVM and alternative approaches, our gkm-SVM predicts functional genomic regulatory elements and tissue specific enhancers with significantly improved accuracy, increasing the precision by up to a factor of two. We then show that gkm-SVM consistently outperforms kmer-SVM on human ENCODE ChIP-seq datasets, and further demonstrate the general utility of our method using a Naïve-Bayes classifier. Although developed for regulatory sequence analysis, these methods can be applied to any sequence classification problem.

Middle East Respiratory Syndrome Infection Control and Prevention Guideline for Healthcare Facilities

PubMed Central

Kim, Jin Yong; Song, Joon Young; Yoon, Young Kyung; Choi, Seong-Ho; Song, Young Goo; Kim, Sung-Ran; Son, Hee-Jung; Jeong, Sun-Young; Choi, Jung-Hwa; Kim, Kyung Mi; Yoon, Hee Jung; Choi, Jun Yong; Kim, Tae Hyong; Choi, Young Hwa; Kim, Hong Bin; Yoon, Ji Hyun; Lee, Jacob; Eom, Joong Sik; Lee, Sang-Oh; Oh, Won Sup; Choi, Jung-Hyun; Yoo, Jin-Hong; Kim, Woo Joo

2015-01-01

Middle East Respiratory Syndrome (MERS) is an acute viral respiratory illness with high mortality caused by a new strain of betacoronavirus (MERS-CoV). Since the report of the first patient in Saudi Arabia in 2012, large-scale outbreaks through hospital-acquired infection and inter-hospital transmission have been reported. Most of the patients reported in South Korea were also infected in hospital settings. Therefore, to eliminate the spread of MERS-CoV, infection prevention and control measures should be implemented with rigor. The present guideline has been drafted on the basis of the experiences of infection control in the South Korean hospitals involved in the recent MERS outbreak and on domestic and international infection prevention and control guidelines. To ensure efficient MERS-CoV infection prevention and control, care should be taken to provide comprehensive infection control measures including contact control, hand hygiene, personal protective equipment, disinfection, and environmental cleaning. PMID:26788414

Middle East Respiratory Syndrome Infection Control and Prevention Guideline for Healthcare Facilities.

PubMed

Kim, Jin Yong; Song, Joon Young; Yoon, Young Kyung; Choi, Seong-Ho; Song, Young Goo; Kim, Sung-Ran; Son, Hee-Jung; Jeong, Sun-Young; Choi, Jung-Hwa; Kim, Kyung Mi; Yoon, Hee Jung; Choi, Jun Yong; Kim, Tae Hyong; Choi, Young Hwa; Kim, Hong Bin; Yoon, Ji Hyun; Lee, Jacob; Eom, Joong Sik; Lee, Sang-Oh; Oh, Won Sup; Choi, Jung-Hyun; Yoo, Jin-Hong; Kim, Woo Joo; Cheong, Hee Jin

2015-12-01

Middle East Respiratory Syndrome (MERS) is an acute viral respiratory illness with high mortality caused by a new strain of betacoronavirus (MERS-CoV). Since the report of the first patient in Saudi Arabia in 2012, large-scale outbreaks through hospital-acquired infection and inter-hospital transmission have been reported. Most of the patients reported in South Korea were also infected in hospital settings. Therefore, to eliminate the spread of MERS-CoV, infection prevention and control measures should be implemented with rigor. The present guideline has been drafted on the basis of the experiences of infection control in the South Korean hospitals involved in the recent MERS outbreak and on domestic and international infection prevention and control guidelines. To ensure efficient MERS-CoV infection prevention and control, care should be taken to provide comprehensive infection control measures including contact control, hand hygiene, personal protective equipment, disinfection, and environmental cleaning.

Effective inhibition of MERS-CoV infection by resveratrol.

PubMed

Lin, Shih-Chao; Ho, Chi-Tang; Chuo, Wen-Ho; Li, Shiming; Wang, Tony T; Lin, Chi-Chen

2017-02-13

Middle East Respiratory Syndrome coronavirus (MERS-CoV) is an emerging viral pathogen that causes severe morbidity and mortality. Up to date, there is no approved or licensed vaccine or antiviral medicines can be used to treat MERS-CoV-infected patients. Here, we analyzed the antiviral activities of resveratrol, a natural compound found in grape seeds and skin and in red wine, against MERS-CoV infection. We performed MTT and neutral red uptake assays to assess the survival rates of MERS-infected Vero E6 cells. In addition, quantitative PCR, western blotting, and immunofluorescent assays determined the intracellular viral RNA and protein expression. For viral productivity, we utilized plaque assays to confirm the antiviral properties of resveratrol against MERS-CoV. Resveratrol significantly inhibited MERS-CoV infection and prolonged cellular survival after virus infection. We also found that the expression of nucleocapsid (N) protein essential for MERS-CoV replication was decreased after resveratrol treatment. Furthermore, resveratrol down-regulated the apoptosis induced by MERS-CoV in vitro. By consecutive administration of resveratrol, we were able to reduce the concentration of resveratrol while achieving inhibitory effectiveness against MERS-CoV. In this study, we first demonstrated that resveratrol is a potent anti-MERS agent in vitro. We perceive that resveratrol can be a potential antiviral agent against MERS-CoV infection in the near future.

The receptor tyrosine kinase MerTK activates phospholipase C γ2 during recognition of apoptotic thymocytes by murine macrophages

PubMed Central

Todt, Jill C.; Hu, Bin; Curtis, Jeffrey L.

2008-01-01

Apoptotic leukocytes must be cleared efficiently by macrophages (Mø). Apoptotic cell phagocytosis by Mø requires the receptor tyrosine kinase (RTK) MerTK (also known as c-Mer and Tyro12), the phosphatidylserine receptor (PS-R), and the classical protein kinase C (PKC) isoform βII, which translocates to Mø membrane and cytoskeletal fractions in a PS-R-dependent fashion. How these molecules cooperate to induce phagocytosis is unknown. Because the phosphatidylinositol-specific phospholipase (PI-PLC) PLC γ2 is downstream of RTKs in some cell types and can activate classical PKCs, we hypothesized that MerTK signals via PLC γ2. To test this hypothesis, we examined the interaction of MerTK and PLC γ2 in resident murine PMø and in the murine Mø cell line J774A.1 (J774) following exposure to apoptotic thymocytes. We found that, as with PMø, J774 phagocytosis of apoptotic thymocytes was inhibited by antibody against MerTK. Western blotting and immunoprecipitation showed that exposure to apoptotic cells produced three time-dependent changes in PMø and J774: (1) tyrosine phosphorylation of MerTK; (2) association of PLC γ2 with MerTK; and (3) tyrosine phosphorylation of PLC γ2. Phosphorylation of PLC γ2 and its association with MerTK was also induced by cross-linking MerTK using antibody. A PI-PLC appears to be required for phagocytosis of apoptotic cells because the PI-PLC inhibitor Et-18-OCH3 and the PLC inhibitor U73122, but not the inactive control U73343, blocked phagocytosis without impairing adhesion. On apoptotic cell adhesion to Mø, MerTK signals at least in part via PLC γ2. PMID:14704368

Inactivation and safety testing of Middle East Respiratory Syndrome Coronavirus

PubMed Central

Kumar, Mia; Mazur, Steven; Ork, Britini L.; Postnikova, Elena; Hensley, Lisa E.; Jahrling, Peter B.; Johnson, Reed; Holbrook, Michael R.

2015-01-01

Middle East Respiratory Syndrome Coronavirus (MERS-CoV) is a recently emerged virus that has caused a number of human infections and deaths, primarily in the Middle East. The transmission of MERS-CoV to humans has been proposed to be as a result of contact with camels, but evidence of human-to-human transmission also exists. In order to work with MERS-CoV in a laboratory setting, the US Centers for Disease Control and Prevention (CDC) has determined that MERS-CoV should be handled at a biosafety level (BSL) 3 (BSL-3) biocontainment level. Many processes and procedures used to characterize MERS-CoV and to evaluate samples from MERS-CoV infected animals are more easily and efficiently completed at BSL-2 or lower containment. In order to complete experimental work at BSL-2, demonstration or proof of inactivation is required before removal of specimens from biocontainment laboratories. In the studies presented here, we evaluated typical means of inactivating viruses prior to handling specimens at a lower biocontainment level. We found that Trizol, AVL buffer and gamma irradiation were effective at inactivating MERS-CoV, that formaldehyde-based solutions required at least 30 minutes of contact time in a cell culture system while a mixture of methanol and acetone required 60 minutes to inactivate MERS-CoV. Together, these data provide a foundation for safely inactivating MERS-CoV, and potentially other coronaviruses, prior to removal from biocontainment facilities. PMID:26190637

Disulfiram can inhibit MERS and SARS coronavirus papain-like proteases via different modes.

PubMed

Lin, Min-Han; Moses, David C; Hsieh, Chih-Hua; Cheng, Shu-Chun; Chen, Yau-Hung; Sun, Chiao-Yin; Chou, Chi-Yuan

2018-02-01

Severe acute respiratory syndrome coronavirus (SARS-CoV) emerged in southern China in late 2002 and caused a global outbreak with a fatality rate around 10% in 2003. Ten years later, a second highly pathogenic human CoV, MERS-CoV, emerged in the Middle East and has spread to other countries in Europe, North Africa, North America and Asia. As of November 2017, MERS-CoV had infected at least 2102 people with a fatality rate of about 35% globally, and hence there is an urgent need to identify antiviral drugs that are active against MERS-CoV. Here we show that a clinically available alcohol-aversive drug, disulfiram, can inhibit the papain-like proteases (PL pro s) of MERS-CoV and SARS-CoV. Our findings suggest that disulfiram acts as an allosteric inhibitor of MERS-CoV PL pro but as a competitive (or mixed) inhibitor of SARS-CoV PL pro . The phenomenon of slow-binding inhibition and the irrecoverability of enzyme activity after removing unbound disulfiram indicate covalent inactivation of SARS-CoV PL pro by disulfiram, while synergistic inhibition of MERS-CoV PL pro by disulfiram and 6-thioguanine or mycophenolic acid implies the potential for combination treatments using these three clinically available drugs. Copyright © 2017 Elsevier B.V. All rights reserved.

3B11-N, a monoclonal antibody against MERS-CoV, reduces lung pathology in rhesus monkeys following intratracheal inoculation of MERS-CoV Jordan-n3/2012.

PubMed

Johnson, Reed F; Bagci, Ulas; Keith, Lauren; Tang, Xianchun; Mollura, Daniel J; Zeitlin, Larry; Qin, Jing; Huzella, Louis; Bartos, Christopher J; Bohorova, Natasha; Bohorov, Ognian; Goodman, Charles; Kim, Do H; Paulty, Michael H; Velasco, Jesus; Whaley, Kevin J; Johnson, Joshua C; Pettitt, James; Ork, Britini L; Solomon, Jeffrey; Oberlander, Nicholas; Zhu, Quan; Sun, Jiusong; Holbrook, Michael R; Olinger, Gene G; Baric, Ralph S; Hensley, Lisa E; Jahrling, Peter B; Marasco, Wayne A

2016-03-01

Middle East Respiratory Syndrome Coronavirus (MERS-CoV) was identified in 2012 as the causative agent of a severe, lethal respiratory disease occurring across several countries in the Middle East. To date there have been over 1600 laboratory confirmed cases of MERS-CoV in 26 countries with a case fatality rate of 36%. Given the endemic region, it is possible that MERS-CoV could spread during the annual Hajj pilgrimage, necessitating countermeasure development. In this report, we describe the clinical and radiographic changes of rhesus monkeys following infection with 5×10(6) PFU MERS-CoV Jordan-n3/2012. Two groups of NHPs were treated with either a human anti-MERS monoclonal antibody 3B11-N or E410-N, an anti-HIV antibody. MERS-CoV Jordan-n3/2012 infection resulted in quantifiable changes by computed tomography, but limited other clinical signs of disease. 3B11-N treated subjects developed significantly reduced lung pathology when compared to infected, untreated subjects, indicating that this antibody may be a suitable MERS-CoV treatment. Published by Elsevier Inc.

Comparative Genomic Analysis MERS CoV Isolated from Humans and Camels with Special Reference to Virus Encoded Helicase.

PubMed

Alnazawi, Mohamed; Altaher, Abdallah; Kandeel, Mahmoud

2017-01-01

Middle East Respiratory Syndrome Coronavirus (MERS CoV) is a new emerging viral disease characterized by high fatality rate. Understanding MERS CoV genetic aspects and codon usage pattern is important to understand MERS CoV survival, adaptation, evolution, resistance to innate immunity, and help in finding the unique aspects of the virus for future drug discovery experiments. In this work, we provide comprehensive analysis of 238 MERS CoV full genomes comprised of human (hMERS) and camel (cMERS) isolates of the virus. MERS CoV genome shaping seems to be under compositional and mutational bias, as revealed by preference of A/T over G/C nucleotides, preferred codons, nucleotides at the third position of codons (NT3s), relative synonymous codon usage, hydropathicity (Gravy), and aromaticity (Aromo) indices. Effective number of codons (ENc) analysis reveals a general slight codon usage bias. Codon adaptation index reveals incomplete adaptation to host environment. MERS CoV showed high ability to resist the innate immune response by showing lower CpG frequencies. Neutrality evolution analysis revealed a more significant role of mutation pressure in cMERS over hMERS. Correspondence analysis revealed that MERS CoV genomes have three genetic clusters, which were distinct in their codon usage, host, and geographic distribution. Additionally, virtual screening and binding experiments were able to identify three new virus-encoded helicase binding compounds. These compounds can be used for further optimization of inhibitors.

Antibodies against MERS coronavirus in dromedary camels, United Arab Emirates, 2003 and 2013.

PubMed

Meyer, Benjamin; Müller, Marcel A; Corman, Victor M; Reusken, Chantal B E M; Ritz, Daniel; Godeke, Gert-Jan; Lattwein, Erik; Kallies, Stephan; Siemens, Artem; van Beek, Janko; Drexler, Jan F; Muth, Doreen; Bosch, Berend-Jan; Wernery, Ulrich; Koopmans, Marion P G; Wernery, Renate; Drosten, Christian

2014-04-01

Middle East respiratory syndrome coronavirus (MERS-CoV) has caused an ongoing outbreak of severe acute respiratory tract infection in humans in the Arabian Peninsula since 2012. Dromedary camels have been implicated as possible viral reservoirs. We used serologic assays to analyze 651 dromedary camel serum samples from the United Arab Emirates; 151 of 651 samples were obtained in 2003, well before onset of the current epidemic, and 500 serum samples were obtained in 2013. Recombinant spike protein-specific immunofluorescence and virus neutralization tests enabled clear discrimination between MERS-CoV and bovine CoV infections. Most (632/651, 97.1%) camels had antibodies against MERS-CoV. This result included all 151 serum samples obtained in 2003. Most (389/651, 59.8%) serum samples had MERS-CoV-neutralizing antibody titers >1,280. Dromedary camels from the United Arab Emirates were infected at high rates with MERS-CoV or a closely related, probably conspecific, virus long before the first human MERS cases.

Total synthesis of mycobacterial arabinogalactan containing 92 monosaccharide units

NASA Astrophysics Data System (ADS)

Wu, Yong; Xiong, De-Cai; Chen, Si-Cong; Wang, Yong-Shi; Ye, Xin-Shan

2017-03-01

Carbohydrates are diverse bio-macromolecules with highly complex structures that are involved in numerous biological processes. Well-defined carbohydrates obtained by chemical synthesis are essential to the understanding of their functions. However, synthesis of carbohydrates is greatly hampered by its insufficient efficiency. So far, assembly of long carbohydrate chains remains one of the most challenging tasks for synthetic chemists. Here we describe a highly efficient assembly of a 92-mer polysaccharide by the preactivation-based one-pot glycosylation protocol. Several linear and branched oligosaccharide/polysaccharide fragments ranging from 5-mer to 31-mer in length have been rapidly constructed in one-pot manner, which enables the first total synthesis of a biologically important mycobacterial arabinogalactan through a highly convergent [31+31+30] coupling reaction. Our results show that the preactivation-based one-pot glycosylation protocol may provide access to the construction of long and complicated carbohydrate chains.

Viscosity Relaxation in Molten HgZnTe

NASA Technical Reports Server (NTRS)

Su, Ching-Hua; Lehoczky, S. L.; Kim, Yeong Woo; Baird, James K.; Whitaker, Ann F. (Technical Monitor)

2001-01-01

Rotating cup measurements of the viscosity of the pseudo-binary melt, HgZnTe have shown that the isothermal liquid with zinc mole fraction 0.16 requires tens of hours of equilibration time before a steady viscous state can be achieved. Over this relaxation period, the viscosity at 790 C increases by a factor of two, while the viscosity at 810 C increases by 40%. Noting that the Group VI elements tend to polymerize when molten, we suggest that the viscosity of the melt is enhanced by the slow formation of Te atom chains. To explain the build-up of linear Te n-mers, we propose a scheme, which contains formation reactions with second order kinetics that increase the molecular weight, and decomposition reactions with first order kinetics that inactivate the chains. The resulting rate equations can be solved for the time dependence of each molecular weight fraction. Using these molecular weight fractions, we calculate the time dependence of the average molecular weight. Using the standard semi-empirical relation between polymer average molecular weight and viscosity, we then calculate the viscosity relaxation curve. By curve fitting, we find that the data imply that the rate constant for n-mer formation is much smaller than the rate constant for n-mer deactivation, suggesting that Te atoms only weakly polymerize in molten HgZnTe. The steady state toward which the melt relaxes occurs as the rate of formation of an n-mer becomes exactly balanced by the sum of the rate for its deactivation and the rate for its polymerization to form an (n+1)-mer.

Replication and Shedding of MERS-CoV in Upper Respiratory Tract of Inoculated Dromedary Camels

PubMed Central

Adney, Danielle R.; van Doremalen, Neeltje; Brown, Vienna R.; Bushmaker, Trenton; Scott, Dana; de Wit, Emmie; Munster, Vincent J.

2014-01-01

In 2012, a novel coronavirus associated with severe respiratory disease in humans emerged in the Middle East. Epidemiologic investigations identified dromedary camels as the likely source of zoonotic transmission of Middle East respiratory syndrome coronavirus (MERS-CoV). Here we provide experimental support for camels as a reservoir for MERS-CoV. We inoculated 3 adult camels with a human isolate of MERS-CoV and a transient, primarily upper respiratory tract infection developed in each of the 3 animals. Clinical signs of the MERS-CoV infection were benign, but each of the camels shed large quantities of virus from the upper respiratory tract. We detected infectious virus in nasal secretions through 7 days postinoculation, and viral RNA up to 35 days postinoculation. The pattern of shedding and propensity for the upper respiratory tract infection in dromedary camels may help explain the lack of systemic illness among naturally infected camels and the means of efficient camel-to-camel and camel-to-human transmission. PMID:25418529

The proprotein convertase SKI-1/S1P. In vitro analysis of Lassa virus glycoprotein-derived substrates and ex vivo validation of irreversible peptide inhibitors.

PubMed

Pasquato, Antonella; Pullikotil, Philomena; Asselin, Marie-Claude; Vacatello, Manuela; Paolillo, Livio; Ghezzo, Francesca; Basso, Federica; Di Bello, Carlo; Dettin, Monica; Seidah, Nabil G

2006-08-18

Herein we designed, synthesized, tested, and validated fluorogenic methylcoumarinamide (MCA) and chloromethylketone-peptides spanning the Lassa virus GPC cleavage site as substrates and inhibitors for the proprotein convertase SKI-1/S1P. The 7-mer MCA (YISRRLL-MCA) and 8-mer MCA (IYISRRLL-MCA) are very efficiently cleaved with respect to both the 6-mer MCA (ISRRLL-MCA) and point mutated fluorogenic analogues, except for the 7-mer mutant Y253F. The importance of the P7 phenylic residue was confirmed by digestions of two 16-mer non-fluorogenic peptidyl substrates that differ by a single point mutation (Y253A). Because NMR analysis of these 16-mer peptides did not reveal significant structural differences at recognition motif RRLL, the P7 Tyr residue is likely important in establishing key interactions within the catalytic pocket of SKI-1. Based on these data, we established through analysis of pro-ATF6 and pro-SREBP-2 cellular processing that decanoylated chloromethylketone 7-mer, 6-mer, and 4-mer peptides containing the core RRLL sequence are irreversible and potent ex vivo SKI-1 inhibitors. Although caution must be exercised in using these inhibitors in in vitro reactions, as they can also inhibit the basic amino acid-specific convertase furin, within cells and when used at concentrations < or = 100 microM these inhibitors are relatively specific for inhibition of SKI-1 processing events, as opposed to those performed by furin-like convertases.

From SARS to MERS: evidence and speculation.

PubMed

Gao, Hainv; Yao, Hangping; Yang, Shigui; Li, Lanjuan

2016-12-01

The Middle East respiratory syndrome coronavirus (MERS-CoV) is a novel zoonotic pathogen. In 2012, the infectious outbreak caused by MERS-CoV in Saudi Arabia has spread to more than 1600 patients in 26 countries, resulting in over 600 deaths.Without a travel history, few clinical and radiological features can reliably differentiate MERS from SARS. But in real world, comparing with SARS, MERS presents more vaguely defined epidemiology, more severe symptoms, and higher case fatality rate. In this review, we summarize the recent findings in the field of MERS-CoV, especially its molecular virology, interspecies mechanisms, clinical features, antiviral therapies, and the further investigation into this disease. As a newly emerging virus, many questions are not fully answered, including the exact mode of transmission chain, geographical distribution, and animal origins. Furthermore, a new protocol needs to be launched to rapidly evaluate the effects of unproven antiviral drugs and vaccine to fasten the clinical application of new drugs.

Fluorescence-based characterization of genetically encoded peptides that fold in live cells: progress toward a generic hairpin scaffold

NASA Astrophysics Data System (ADS)

Cheng, Zihao; Campbell, Robert E.

2007-02-01

Binding proteins suitable for expression and high affinity molecular recognition in the cytoplasm or nucleus of live cells have numerous applications in the biological sciences. In an effort to add a new minimal motif to the growing repertoire of validated non-immunoglobulin binding proteins, we have undertaken the development of a generic protein scaffold based on a single β-hairpin that can fold efficiently in the cytoplasm. We have developed a method, based on the measurement of fluorescence resonance energy transfer (FRET) between a genetically fused cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP), that allows the structural stability of recombinant β-hairpin peptides to be rapidly assessed both in vitro and in vivo. We have previously reported the validation of this method when applied to a 16mer tryptophan zipper β-hairpin. We now describe the use of this method to evaluate the potential of a designed 20mer β-hairpin peptide with a 3rd Trp/Trp cross-strand pair to function as a generic protein scaffold. Quantitative analysis of the FRET efficiency, resistance to proteolysis (assayed by loss of FRET), and circular dichroism spectra revealed that the 20mer peptide is significantly more tolerant of destabilizing mutations than the 16mer peptide. Furthermore, we experimentally demonstrate that the in vitro determined β-hairpin stabilities are well correlated with in vivo β-hairpin stabilities as determined by FRET measurements of colonies of live bacteria expressing the recombinant peptides flanked by CFP and YFP. Finally, we report on our progress to develop highly folded 24mer and 28mer β-hairpin peptides through the use of fluorescence-based library screening.

Mouse-adapted MERS coronavirus causes lethal lung disease in human DPP4 knockin mice.

PubMed

Li, Kun; Wohlford-Lenane, Christine L; Channappanavar, Rudragouda; Park, Jung-Eun; Earnest, James T; Bair, Thomas B; Bates, Amber M; Brogden, Kim A; Flaherty, Heather A; Gallagher, Tom; Meyerholz, David K; Perlman, Stanley; McCray, Paul B

2017-04-11

The Middle East respiratory syndrome (MERS) emerged in Saudi Arabia in 2012, caused by a zoonotically transmitted coronavirus (CoV). Over 1,900 cases have been reported to date, with ∼36% fatality rate. Lack of autopsies from MERS cases has hindered understanding of MERS-CoV pathogenesis. A small animal model that develops progressive pulmonary manifestations when infected with MERS-CoV would advance the field. As mice are restricted to infection at the level of DPP4, the MERS-CoV receptor, we generated mice with humanized exons 10-12 of the mouse Dpp4 locus. Upon inoculation with MERS-CoV, human DPP4 knockin (KI) mice supported virus replication in the lungs, but developed no illness. After 30 serial passages through the lungs of KI mice, a mouse-adapted virus emerged (MERS MA ) that grew in lungs to over 100 times higher titers than the starting virus. A plaque-purified MERS MA clone caused weight loss and fatal infection. Virus antigen was observed in airway epithelia, pneumocytes, and macrophages. Pathologic findings included diffuse alveolar damage with pulmonary edema and hyaline membrane formation associated with accumulation of activated inflammatory monocyte-macrophages and neutrophils in the lungs. Relative to the parental MERS-CoV, MERS MA viruses contained 13-22 mutations, including several within the spike (S) glycoprotein gene. S-protein mutations sensitized viruses to entry-activating serine proteases and conferred more rapid entry kinetics. Recombinant MERS MA bearing mutant S proteins were more virulent than the parental virus in hDPP4 KI mice. The hDPP4 KI mouse and the MERS MA provide tools to investigate disease causes and develop new therapies.

SARS and MERS: recent insights into emerging coronaviruses.

PubMed

de Wit, Emmie; van Doremalen, Neeltje; Falzarano, Darryl; Munster, Vincent J

2016-08-01

The emergence of Middle East respiratory syndrome coronavirus (MERS-CoV) in 2012 marked the second introduction of a highly pathogenic coronavirus into the human population in the twenty-first century. The continuing introductions of MERS-CoV from dromedary camels, the subsequent travel-related viral spread, the unprecedented nosocomial outbreaks and the high case-fatality rates highlight the need for prophylactic and therapeutic measures. Scientific advancements since the 2002-2003 severe acute respiratory syndrome coronavirus (SARS-CoV) pandemic allowed for rapid progress in our understanding of the epidemiology and pathogenesis of MERS-CoV and the development of therapeutics. In this Review, we detail our present understanding of the transmission and pathogenesis of SARS-CoV and MERS-CoV, and discuss the current state of development of measures to combat emerging coronaviruses.

Prophylaxis With a Middle East Respiratory Syndrome Coronavirus (MERS-CoV)–Specific Human Monoclonal Antibody Protects Rabbits From MERS-CoV Infection

PubMed Central

Houser, Katherine V.; Gretebeck, Lisa; Ying, Tianlei; Wang, Yanping; Vogel, Leatrice; Lamirande, Elaine W.; Bock, Kevin W.; Moore, Ian N.; Dimitrov, Dimiter S.; Subbarao, Kanta

2016-01-01

With >1600 documented human infections with Middle East respiratory syndrome coronavirus (MERS-CoV) and a case fatality rate of approximately 36%, medical countermeasures are needed to prevent and limit the disease. We examined the in vivo efficacy of the human monoclonal antibody m336, which has high neutralizing activity against MERS-CoV in vitro. m336 was administered to rabbits intravenously or intranasally before infection with MERS-CoV. Prophylaxis with m336 resulted in a reduction of pulmonary viral RNA titers by 40–9000-fold, compared with an irrelevant control antibody with little to no inflammation or viral antigen detected. This protection in rabbits supports further clinical development of m336. PMID:26941283

Middle East respiratory syndrome coronavirus: current situation and travel-associated concerns.

PubMed

Al-Tawfiq, Jaffar A; Omrani, Ali S; Memish, Ziad A

2016-06-01

The emergence of Middle East respiratory syndrome coronavirus (MERS-CoV) in 2012 brought back memories of the occurrence of severe acute respiratory syndrome coronavirus (SARS-CoV) in 2002. More than 1500 MERS-CoV cases were recorded in 42 months with a case fatality rate (CFR) of 40%. Meanwhile, 8000 cases of SARS-CoV were confirmed in six months with a CFR of 10%. The clinical presentation of MERS-CoV ranges from mild and non-specific presentation to progressive and severe pneumonia. No predictive signs or symptoms exist to differentiate MERS-CoV from community-acquired pneumonia in hospitalized patients. An apparent heterogeneity was observed in transmission. Most MERS-CoV cases were secondary to large outbreaks in healthcare settings. These cases were secondary to community-acquired cases, which may also cause family outbreaks. Travel-associated MERS infection remains low. However, the virus exhibited a clear tendency to cause large outbreaks outside the Arabian Peninsula as exemplified by the outbreak in the Republic of Korea. In this review, we summarize the current knowledge about MERS-CoV and highlight travel-related issues.

Molecular basis for methoxyamine initiated mutagenesis. 1H nuclear magnetic resonance studies of base-modified oligodeoxynucleotides.

PubMed

Stone, M J; Nedderman, A N; Williams, D H; Lin, P K; Brown, D M

1991-12-05

In order to reach a more detailed understanding of the mechanism of the mutagenic action of methoxyamine and of N4-methoxycytidine and its 2'-deoxyribo-analogue, the solution structures of the self-complementary octanucleotide, d(CGAATTCG) and its analogues, d(CGAATCCG), d(CGAATMCG) and d(CGAATPCG) (designated 8mer-AT, 8mer-AC, 8mer-AM, and 8mer-AP, respectively), were investigated by 1H nuclear magnetic resonance spectroscopy; M is N4-methoxycytosine (mo4C) and P is an analogue, the bicyclic dihydropyrimido[4,5-c][1,2]oxazin-7-one, in which the N-O bond is held in the anti configuration with respect to N3 of the cytosine ring. Correlated spectroscopy and nuclear Overhauser spectroscopy allowed assignment of the base, anomeric and H2'/H2" protons in 8mers-AT, -AM and -AP, and showed that all three had features consistent with a regular B-DNA duplex structure. Duplex-to-coil transition temperatures were determined to be 52(+/- 2) degrees C (8mer-AT), 51(+/- 2) degrees C (8mer-AP), 32(+/- 2) degrees C (8mer-AM); on the chemical shift timescale, the melting transition was fast for 8mer-AT and 8mer-AP, but slow for 8mer-AM. Imino proton spectra were indicative of Watson-Crick base-pairing in 8mers-AT, -AP and -AM. The 8mer-AP duplex had a structure and melting characteristics virtually identical with those of the 8mer-AT duplex. The preferred syn configuration of the methoxyl group in M had a destabilising effect on the 8mer-AM duplex. At low temperatures, the A.M base-pair was in fast equilibrium between Watson-Crick and wobble configurations, with the methoxyl function anti-oriented, but the melting transition was accompanied by isomerization of the methoxyl group to the syn conformation. This syn-anti isomerization was the rate-determining step in the duplex-to-coil transition. The 8mer-AC oligomer did not form a stable duplex.

Surgical Space Suits Increase Particle and Microbiological Emission Rates in a Simulated Surgical Environment.

PubMed

Vijaysegaran, Praveen; Knibbs, Luke D; Morawska, Lidia; Crawford, Ross W

2018-05-01

The role of space suits in the prevention of orthopedic prosthetic joint infection remains unclear. Recent evidence suggests that space suits may in fact contribute to increased infection rates, with bioaerosol emissions from space suits identified as a potential cause. This study aimed to compare the particle and microbiological emission rates (PER and MER) of space suits and standard surgical clothing. A comparison of emission rates between space suits and standard surgical clothing was performed in a simulated surgical environment during 5 separate experiments. Particle counts were analyzed with 2 separate particle counters capable of detecting particles between 0.1 and 20 μm. An Andersen impactor was used to sample bacteria, with culture counts performed at 24 and 48 hours. Four experiments consistently showed statistically significant increases in both PER and MER when space suits are used compared with standard surgical clothing. One experiment showed inconsistent results, with a trend toward increases in both PER and MER when space suits are used compared with standard surgical clothing. Space suits cause increased PER and MER compared with standard surgical clothing. This finding provides mechanistic evidence to support the increased prosthetic joint infection rates observed in clinical studies. Copyright © 2017 Elsevier Inc. All rights reserved.

The United States Remains Unprepared for Oil Import Disruptions. Volume II. Detailed Review of Current Emergency Programs and Alternative Approaches.

DTIC Science & Technology

1981-09-29

limited to one tank of gas per week, while 40 percent could fill up twice. If gas stations were closed on Sundays, the percentages, respectively, would be...Mixing Gas and Coal in Existing Electric Facilities X-1 Establishing a Strategic Natural Gas Reserve X-2 Exploring the Possibility of Negotiating...Advisory Group LNG Liquefied Natural Gas MBD Thousand Barrels Per Day MER Maximum Efficient Rate of Production MMB Million Barrels MMBD Million Barrels

3B11-N, a monoclonal antibody against MERS-CoV, reduces lung pathology in rhesus monkeys following intratracheal inoculation of MERS-CoV Jordan-n3/2012

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Reed F., E-mail: johnsonreed@mail.nih.gov; Bagci, Ulas; Center for Research in Computer Vision

Middle East Respiratory Syndrome Coronavirus (MERS-CoV) was identified in 2012 as the causative agent of a severe, lethal respiratory disease occurring across several countries in the Middle East. To date there have been over 1600 laboratory confirmed cases of MERS-CoV in 26 countries with a case fatality rate of 36%. Given the endemic region, it is possible that MERS-CoV could spread during the annual Hajj pilgrimage, necessitating countermeasure development. In this report, we describe the clinical and radiographic changes of rhesus monkeys following infection with 5×10{sup 6} PFU MERS-CoV Jordan-n3/2012. Two groups of NHPs were treated with either a humanmore » anti-MERS monoclonal antibody 3B11-N or E410-N, an anti-HIV antibody. MERS-CoV Jordan-n3/2012 infection resulted in quantifiable changes by computed tomography, but limited other clinical signs of disease. 3B11-N treated subjects developed significantly reduced lung pathology when compared to infected, untreated subjects, indicating that this antibody may be a suitable MERS-CoV treatment. - Highlights: • MERS-CoV Jordan-n3/2012 challenge of rhesus monkeys results in a mild disease. • CT can be used to monitor disease progression to aid models of human disease. • Treatment with the human monoclonal antibody 3B11-N resulted in decreased disease.« less

Development of Fluorescent Reverse Transcription Loop-mediated Isothermal Amplification (RT-LAMP) using Quenching Probes for the Detection of the Middle East Respiratory Syndrome Coronavirus.

PubMed

Shirato, Kazuya; Semba, Shohei; El-Kafrawy, Sherif A; Hassan, Ahmed M; Tolah, Ahmed M; Takayama, Ikuyo; Kageyama, Tsutomu; Notomi, Tsugunori; Kamitani, Wataru; Matsuyama, Shutoku; Azhar, Esam Ibraheem

2018-05-12

Clinical detection of Middle East respiratory syndrome (MERS) coronavirus (MERS-CoV) in patients is achieved using genetic diagnostic methods, such as real-time RT-PCR assay. Previously, we developed a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay for the detection of MERS-CoV [Virol J. 2014. 11:139]. Generally, amplification of RT-LAMP is monitored by the turbidity induced by precipitation of magnesium pyrophosphate with newly synthesized DNA. However, this mechanism cannot completely exclude the possibility of unexpected reactions. Therefore, in this study, fluorescent RT-LAMP assays using quenching probes (QProbes) were developed specifically to monitor only primer-derived signals. Two primer sets (targeting nucleocapsid and ORF1a sequences) were constructed to confirm MERS cases by RT-LAMP assay only. Our data indicate that both primer sets were capable of detecting MERS-CoV RNA to the same level as existing genetic diagnostic methods, and that both were highly specific with no cross-reactivity observed with other respiratory viruses. These primer sets were highly efficient in amplifying target sequences derived from different MERS-CoV strains, including camel MERS-CoV. In addition, the detection efficacy of QProbe RT-LAMP was comparable to that of real-time RT-PCR assay using clinical specimens from patients in Saudi Arabia. Altogether, these results indicate that QProbe RT-LAMP assays described here can be used as powerful diagnostic tools for rapid detection and surveillance of MERS-CoV infections. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Comparative Epidemiology of Human Infections with Middle East Respiratory Syndrome and Severe Acute Respiratory Syndrome Coronaviruses among Healthcare Personnel

PubMed Central

Chu, Yu-Tseng; Wu, Joseph Tsung-Shu; Geng, Xingyi; Zhao, Na; Cheng, Wei; Chen, Enfu; King, Chwan-Chuen

2016-01-01

The largest nosocomial outbreak of Middle East respiratory syndrome (MERS) occurred in South Korea in 2015. Health Care Personnel (HCP) are at high risk of acquiring MERS-Coronavirus (MERS-CoV) infections, similar to the severe acute respiratory syndrome (SARS)-Coronavirus (SARS-CoV) infections first identified in 2003. This study described the similarities and differences in epidemiological and clinical characteristics of 183 confirmed global MERS cases and 98 SARS cases in Taiwan associated with HCP. The epidemiological findings showed that the mean age of MERS-HCP and total MERS cases were 40 (24~74) and 49 (2~90) years, respectively, much older than those in SARS [SARS-HCP: 35 (21~68) years, p = 0.006; total SARS: 42 (0~94) years, p = 0.0002]. The case fatality rates (CFR) was much lower in MERS-HCP [7.03% (9/128)] or SARS-HCP [12.24% (12/98)] than the MERS-non-HCP [36.96% (34/92), p<0.001] or SARS-non-HCP [24.50% (61/249), p<0.001], however, no difference was found between MERS-HCP and SARS-HCP [p = 0.181]. In terms of clinical period, the days from onset to death [13 (4~17) vs 14.5 (0~52), p = 0.045] and to discharge [11 (5~24) vs 24 (0~74), p = 0.010] and be hospitalized days [9.5 (3~22) vs 22 (0~69), p = 0.040] were much shorter in MERS-HCP than SARS-HCP. Similarly, days from onset to confirmation were shorter in MERS-HCP than MERS-non-HCP [6 (1~14) vs 10 (1~21), p = 0.044]. In conclusion, the severity of MERS-HCP and SARS-HCP was lower than that of MERS-non-HCP and SARS-non-HCP due to younger age and early confirmation in HCP groups. However, no statistical difference was found in MERS-HCP and SARS-HCP. Thus, prevention of nosocomial infections involving both novel Coronavirus is crucially important to protect HCP. PMID:26930074

Phytoremediation of Mercury and Organomercurials in Chloroplast Transgenic Plants: Enhanced Root Uptake, Translocation to Shoots, and Volatilization

PubMed Central

Hussein, Hussein S.; Ruiz, Oscar N.; Terry, Norman; Daniell, Henry

2008-01-01

Transgenic tobacco plants engineered with bacterial merA and merB genes via the chloroplast genome were investigated to study the uptake, translocation of different forms of mercury (Hg) from roots to shoots, and their volatilization. Untransformed plants, regardless of the form of Hg supplied, reached a saturation point at 200 µM of phenylmercuric acetate (PMA) or HgCl2, accumulating Hg concentrations up to 500 µg g−1 with significant reduction in growth. In contrast, chloroplast transgenic lines continued to grow well with Hg concentrations in root tissues up to 2000 µg g−1. Chloroplast transgenic lines accumulated both the organic and inorganic Hg forms to levels surpassing the concentrations found in the soil. The organic-Hg form was absorbed and translocated more efficiently than the inorganic-Hg form in transgenic lines, whereas no such difference was observed in untransformed plants. Chloroplast-transgenic lines showed about 100-fold increase in the efficiency of Hg accumulation in shoots compared to untransformed plants. This is the first report of such high levels of Hg accumulation in green leaves or tissues. Transgenic plants attained a maximum rate of elemental-Hg volatilization in two days when supplied with PMA and in three days when supplied with inorganic-Hg, attaining complete volatilization within a week. The combined expression of merAB via the chloroplast genome enhanced conversion of Hg2+ into Hg,0 conferred tolerance by rapid volatilization and increased uptake of different forms of mercury, surpassing the concentrations found in the soil. These investigations provide novel insights for improvement of plant tolerance and detoxification of mercury. PMID:18200876

Methods for automatic detection of artifacts in microelectrode recordings.

PubMed

Bakštein, Eduard; Sieger, Tomáš; Wild, Jiří; Novák, Daniel; Schneider, Jakub; Vostatek, Pavel; Urgošík, Dušan; Jech, Robert

2017-10-01

Extracellular microelectrode recording (MER) is a prominent technique for studies of extracellular single-unit neuronal activity. In order to achieve robust results in more complex analysis pipelines, it is necessary to have high quality input data with a low amount of artifacts. We show that noise (mainly electromagnetic interference and motion artifacts) may affect more than 25% of the recording length in a clinical MER database. We present several methods for automatic detection of noise in MER signals, based on (i) unsupervised detection of stationary segments, (ii) large peaks in the power spectral density, and (iii) a classifier based on multiple time- and frequency-domain features. We evaluate the proposed methods on a manually annotated database of 5735 ten-second MER signals from 58 Parkinson's disease patients. The existing methods for artifact detection in single-channel MER that have been rigorously tested, are based on unsupervised change-point detection. We show on an extensive real MER database that the presented techniques are better suited for the task of artifact identification and achieve much better results. The best-performing classifiers (bagging and decision tree) achieved artifact classification accuracy of up to 89% on an unseen test set and outperformed the unsupervised techniques by 5-10%. This was close to the level of agreement among raters using manual annotation (93.5%). We conclude that the proposed methods are suitable for automatic MER denoising and may help in the efficient elimination of undesirable signal artifacts. Copyright © 2017 Elsevier B.V. All rights reserved.

On the Five-Moment Hamburger Maximum Entropy Reconstruction

NASA Astrophysics Data System (ADS)

Summy, D. P.; Pullin, D. I.

2018-05-01

We consider the Maximum Entropy Reconstruction (MER) as a solution to the five-moment truncated Hamburger moment problem in one dimension. In the case of five monomial moment constraints, the probability density function (PDF) of the MER takes the form of the exponential of a quartic polynomial. This implies a possible bimodal structure in regions of moment space. An analytical model is developed for the MER PDF applicable near a known singular line in a centered, two-component, third- and fourth-order moment (μ _3 , μ _4 ) space, consistent with the general problem of five moments. The model consists of the superposition of a perturbed, centered Gaussian PDF and a small-amplitude packet of PDF-density, called the outlying moment packet (OMP), sitting far from the mean. Asymptotic solutions are obtained which predict the shape of the perturbed Gaussian and both the amplitude and position on the real line of the OMP. The asymptotic solutions show that the presence of the OMP gives rise to an MER solution that is singular along a line in (μ _3 , μ _4 ) space emanating from, but not including, the point representing a standard normal distribution, or thermodynamic equilibrium. We use this analysis of the OMP to develop a numerical regularization of the MER, creating a procedure we call the Hybrid MER (HMER). Compared with the MER, the HMER is a significant improvement in terms of robustness and efficiency while preserving accuracy in its prediction of other important distribution features, such as higher order moments.

Head rice rate measurement based on concave point matching

PubMed Central

Yao, Yuan; Wu, Wei; Yang, Tianle; Liu, Tao; Chen, Wen; Chen, Chen; Li, Rui; Zhou, Tong; Sun, Chengming; Zhou, Yue; Li, Xinlu

2017-01-01

Head rice rate is an important factor affecting rice quality. In this study, an inflection point detection-based technology was applied to measure the head rice rate by combining a vibrator and a conveyor belt for bulk grain image acquisition. The edge center mode proportion method (ECMP) was applied for concave points matching in which concave matching and separation was performed with collaborative constraint conditions followed by rice length calculation with a minimum enclosing rectangle (MER) to identify the head rice. Finally, the head rice rate was calculated using the sum area of head rice to the overall coverage of rice. Results showed that bulk grain image acquisition can be realized with test equipment, and the accuracy rate of separation of both indica rice and japonica rice exceeded 95%. An increase in the number of rice did not significantly affect ECMP and MER. High accuracy can be ensured with MER to calculate head rice rate by narrowing down its relative error between real values less than 3%. The test results show that the method is reliable as a reference for head rice rate calculation studies. PMID:28128315

Nucleation and Growth Kinetics from LaMer Burst Data.

PubMed

Chu, Daniel B K; Owen, Jonathan S; Peters, Baron

2017-10-12

In LaMer burst nucleation, the individual nucleation events happen en masse, quasi-simultaneously, and at nearly identical homogeneous conditions. These properties make LaMer burst nucleation important for applications that require monodispersed particles and also for theoretical analyses. Sugimoto and co-workers predicted that the number of nuclei generated during a LaMer burst depends only on the solute supply rate and the growth rate, independent of the nucleation kinetics. Some experiments confirm that solute supply kinetics control the number of nuclei, but flaws in the original theoretical analysis raise questions about the predicted roles of growth and nucleation kinetics. We provide a rigorous analysis of the coupled equations that govern concentrations of nuclei and solutes. Our analysis confirms that the number of nuclei is largely determined by the solute supply and growth rates, but our predicted relationship differs from that of Sugimoto et al. Moreover, we find that additional nucleus size dependent corrections should emerge in systems with slow growth kinetics. Finally, we show how the nucleation kinetics determine the particle size distribution. We suggest that measured particle size distributions might therefore provide ways to test theoretical models of homogeneous nucleation kinetics.

Monte Carlo simulation of evaporation-driven self-assembly in suspensions of colloidal rods

NASA Astrophysics Data System (ADS)

Lebovka, Nikolai I.; Vygornitskii, Nikolai V.; Gigiberiya, Volodymyr A.; Tarasevich, Yuri Yu.

2016-12-01

The vertical drying of a colloidal film containing rodlike particles was studied by means of kinetic Monte Carlo (MC) simulation. The problem was approached using a two-dimensional square lattice, and the rods were represented as linear k -mers (i.e., particles occupying k adjacent sites). The initial state before drying was produced using a model of random sequential adsorption (RSA) with isotropic orientations of the k -mers (orientation of the k -mers along horizontal x and vertical y directions are equiprobable). In the RSA model, overlapping of the k -mers is forbidden. During the evaporation, an upper interface falls with a linear velocity of u in the vertical direction and the k -mers undergo translation Brownian motion. The MC simulations were run at different initial concentrations, pi, (pi∈[0 ,pj] , where pj is the jamming concentration), lengths of k -mers (k ∈[1 ,12 ] ), and solvent evaporation rates, u . For completely dried films, the spatial distributions of k -mers and their electrical conductivities in both x and y directions were examined. Significant evaporation-driven self-assembly and orientation stratification of the k -mers oriented along the x and y directions were observed. The extent of stratification increased with increasing value of k . The anisotropy of the electrical conductivity of the film can be finely regulated by changes in the values of pi, k , and u .

K-mer Content, Correlation, and Position Analysis of Genome DNA Sequences for the Identification of Function and Evolutionary Features

PubMed Central

Sievers, Aaron; Bosiek, Katharina; Bisch, Marc; Dreessen, Chris; Riedel, Jascha; Froß, Patrick; Hausmann, Michael; Hildenbrand, Georg

2017-01-01

In genome analysis, k-mer-based comparison methods have become standard tools. However, even though they are able to deliver reliable results, other algorithms seem to work better in some cases. To improve k-mer-based DNA sequence analysis and comparison, we successfully checked whether adding positional resolution is beneficial for finding and/or comparing interesting organizational structures. A simple but efficient algorithm for extracting and saving local k-mer spectra (frequency distribution of k-mers) was developed and used. The results were analyzed by including positional information based on visualizations as genomic maps and by applying basic vector correlation methods. This analysis was concentrated on small word lengths (1 ≤ k ≤ 4) on relatively small viral genomes of Papillomaviridae and Herpesviridae, while also checking its usability for larger sequences, namely human chromosome 2 and the homologous chromosomes (2A, 2B) of a chimpanzee. Using this alignment-free analysis, several regions with specific characteristics in Papillomaviridae and Herpesviridae formerly identified by independent, mostly alignment-based methods, were confirmed. Correlations between the k-mer content and several genes in these genomes have been found, showing similarities between classified and unclassified viruses, which may be potentially useful for further taxonomic research. Furthermore, unknown k-mer correlations in the genomes of Human Herpesviruses (HHVs), which are probably of major biological function, are found and described. Using the chromosomes of a chimpanzee and human that are currently known, identities between the species on every analyzed chromosome were reproduced. This demonstrates the feasibility of our approach for large data sets of complex genomes. Based on these results, we suggest k-mer analysis with positional resolution as a method for closing a gap between the effectiveness of alignment-based methods (like NCBI BLAST) and the high pace of standard k-mer analysis. PMID:28422050

Differences in the rate of carbapenem-resistant Enterobacteriaceae colonisation or Clostridium difficile infection following frontline treatment with tigecycline vs. meropenem for intra-abdominal infections.

PubMed

Bartoletti, Michele; Tedeschi, Sara; Pascale, Renato; Raumer, Luigi; Maraolo, Alberto Enrico; Palmiero, Giulia; Tumietto, Fabio; Cristini, Francesco; Ambretti, Simone; Giannella, Maddalena; Lewis, Russell Edward; Viale, Pierluigi

2018-03-01

We hypothesised that treatment with a tigecycline-based antimicrobial regimen for intra-abdominal infection (IAI) could be associated with lower rates of subsequent carbapenem-resistant Enterobacteriaceae (CRE) colonisation or Clostridium difficile infection (CDI) compared with a meropenem-based regimen. We performed a retrospective, single-centre, matched (1:1) cohort analysis of all patients who received at least 5 days of empirical or targeted tigecycline (TIG)- or meropenem (MER)-based treatment regimens for IAI over a 50-month period. Patients with previous CRE colonisation and CDI were excluded. Risk factors for CRE and CDI were assessed with a Cox regression model that included treatment duration as a time-dependent variable. Thirty-day mortality was assessed with Kaplan-Meier curves. We identified 168 TIG-treated and 168 MER-treated patients. The cumulative incidence rate ratio of CDI was 10-fold lower in TIG-treated vs. MER-treated patients (incidence rate ratio [IRR] 0.10/1000 patient-days, 95%CI 0.002-0.72, P = 0.007), but similar incidence rates were found for CRE colonisation (IRR 1.39/1000 patient-days, 95%CI 0.68-2.78, P = 0.36). In a multivariate Cox regression model, the receipt of a TIG- vs. MER-based regimen was associated with significantly lower rates of CDI (HR 0.07, 95%CI 0.03-0.71, P = 0.02), but not CRE (HR 1.12, 95% CI 0.45-2.83, P = 0.80). All-cause 30-day mortality was similar in the two groups (P = 0.46). TIG-based regimens for IAI were associated with a 10-fold lower incidence of CDI compared with MER-based regimens, but there was no difference in the incidence of CRE colonisation. Copyright © 2018 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

A camel-derived MERS-CoV with a variant spike protein cleavage site and distinct fusion activation properties

PubMed Central

Millet, Jean Kaoru; Goldstein, Monty E; Labitt, Rachael N; Hsu, Hung-Lun; Daniel, Susan; Whittaker, Gary R

2016-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) continues to circulate in both humans and camels, and the origin and evolution of the virus remain unclear. Here we characterize the spike protein of a camel-derived MERS-CoV (NRCE-HKU205) identified in 2013, early in the MERS outbreak. NRCE-HKU205 spike protein has a variant cleavage motif with regard to the S2′ fusion activation site—notably, a novel substitution of isoleucine for the otherwise invariant serine at the critical P1′ cleavage site position. The substitutions resulted in a loss of furin-mediated cleavage, as shown by fluorogenic peptide cleavage and western blot assays. Cell–cell fusion and pseudotyped virus infectivity assays demonstrated that the S2′ substitutions decreased spike-mediated fusion and viral entry. However, cathepsin and trypsin-like protease activation were retained, albeit with much reduced efficiency compared with the prototypical EMC/2012 human strain. We show that NRCE-HKU205 has more limited fusion activation properties possibly resulting in more restricted viral tropism and may represent an intermediate in the complex pattern of MERS-CoV ecology and evolution. PMID:27999426

Searching for animal models and potential target species for emerging pathogens: Experience gained from Middle East respiratory syndrome (MERS) coronavirus.

PubMed

Vergara-Alert, Júlia; Vidal, Enric; Bensaid, Albert; Segalés, Joaquim

2017-06-01

Emerging and re-emerging pathogens represent a substantial threat to public health, as demonstrated with numerous outbreaks over the past years, including the 2013-2016 outbreak of Ebola virus in western Africa. Coronaviruses are also a threat for humans, as evidenced in 2002/2003 with infection by the severe acute respiratory syndrome coronavirus (SARS-CoV), which caused more than 8000 human infections with 10% fatality rate in 37 countries. Ten years later, a novel human coronavirus (Middle East respiratory syndrome coronavirus, MERS-CoV), associated with severe pneumonia, arose in the Kingdom of Saudi Arabia. Until December 2016, MERS has accounted for more than 1800 cases and 35% fatality rate. Finding an animal model of disease is key to develop vaccines or antivirals against such emerging pathogens and to understand its pathogenesis. Knowledge of the potential role of domestic livestock and other animal species in the transmission of pathogens is of importance to understand the epidemiology of the disease. Little is known about MERS-CoV animal host range. In this paper, experimental data on potential hosts for MERS-CoV is reviewed. Advantages and limitations of different animal models are evaluated in relation to viral pathogenesis and transmission studies. Finally, the relevance of potential new target species is discussed.

Interaction of SARS and MERS Coronaviruses with the Antiviral Interferon Response.

PubMed

Kindler, E; Thiel, V; Weber, F

2016-01-01

Severe Acute Respiratory Syndrome (SARS) and Middle East Respiratory Syndrome (MERS) are the most severe coronavirus (CoV)-associated diseases in humans. The causative agents, SARS-CoV and MERS-CoV, are of zoonotic origin but may be transmitted to humans, causing severe and often fatal respiratory disease in their new host. The two coronaviruses are thought to encode an unusually large number of factors that allow them to thrive and replicate in the presence of efficient host defense mechanisms, especially the antiviral interferon system. Here, we review the recent progress in our understanding of the strategies that highly pathogenic coronaviruses employ to escape, dampen, or block the antiviral interferon response in human cells. © 2016 Elsevier Inc. All rights reserved.

Risk factors for MERS coronavirus infection in dromedary camels in Burkina Faso, Ethiopia, and Morocco, 2015

PubMed Central

Miguel, Eve; Chevalier, Véronique; Ayelet, Gelagay; Ben Bencheikh, Med Nadir; Boussini, Hiver; Chu, Daniel KW; El Berbri, Ikhlass; Fassi-Fihri, Ouaffa; Faye, Bernard; Fekadu, Getnet; Grosbois, Vladimir; Ng, Bryan CY; Perera, Ranawaka APM; So, TY; Traore, Amadou; Roger, François; Peiris, Malik

2017-01-01

Understanding Middle East respiratory syndrome coronavirus (MERS-CoV) transmission in dromedary camels is important, as they consitute a source of zoonotic infection to humans. To identify risk factors for MERS-CoV infection in camels bred in diverse conditions in Burkina Faso, Ethiopia and Morocco, blood samples and nasal swabs were sampled in February–March 2015. A relatively high MERS-CoV RNA rate was detected in Ethiopia (up to 15.7%; 95% confidence interval (CI): 8.2–28.0), followed by Burkina Faso (up to 12.2%; 95% CI: 7–20.4) and Morocco (up to 7.6%; 95% CI: 1.9–26.1). The RNA detection rate was higher in camels bred for milk or meat than in camels for transport (p = 0.01) as well as in younger camels (p = 0.06). High seropositivity rates (up to 100%; 95% CI: 100–100 and 99.4%; 95% CI: 95.4–99.9) were found in Morocco and Ethiopia, followed by Burkina Faso (up to 84.6%; 95% CI: 77.2–89.9). Seropositivity rates were higher in large/medium herds (≥51 camels) than small herds (p = 0.061), in camels raised for meat or milk than for transport (p = 0.01), and in nomadic or sedentary herds than in herds with a mix of these lifestyles (p < 0.005). PMID:28382915

Risk factors for MERS coronavirus infection in dromedary camels in Burkina Faso, Ethiopia, and Morocco, 2015.

PubMed

Miguel, Eve; Chevalier, Véronique; Ayelet, Gelagay; Ben Bencheikh, Med Nadir; Boussini, Hiver; Chu, Daniel Kw; El Berbri, Ikhlass; Fassi-Fihri, Ouaffa; Faye, Bernard; Fekadu, Getnet; Grosbois, Vladimir; Ng, Bryan Cy; Perera, Ranawaka Apm; So, T Y; Traore, Amadou; Roger, François; Peiris, Malik

2017-03-30

Understanding Middle East respiratory syndrome coronavirus (MERS-CoV) transmission in dromedary camels is important, as they consitute a source of zoonotic infection to humans. To identify risk factors for MERS-CoV infection in camels bred in diverse conditions in Burkina Faso, Ethiopia and Morocco, blood samples and nasal swabs were sampled in February-March 2015. A relatively high MERS-CoV RNA rate was detected in Ethiopia (up to 15.7%; 95% confidence interval (CI): 8.2-28.0), followed by Burkina Faso (up to 12.2%; 95% CI: 7-20.4) and Morocco (up to 7.6%; 95% CI: 1.9-26.1). The RNA detection rate was higher in camels bred for milk or meat than in camels for transport (p = 0.01) as well as in younger camels (p = 0.06). High seropositivity rates (up to 100%; 95% CI: 100-100 and 99.4%; 95% CI: 95.4-99.9) were found in Morocco and Ethiopia, followed by Burkina Faso (up to 84.6%; 95% CI: 77.2-89.9). Seropositivity rates were higher in large/medium herds (≥51 camels) than small herds (p = 0.061), in camels raised for meat or milk than for transport (p = 0.01), and in nomadic or sedentary herds than in herds with a mix of these lifestyles (p < 0.005). This article is copyright of The Authors, 2017.

A Highly Immunogenic and Protective Middle East Respiratory Syndrome Coronavirus Vaccine Based on a Recombinant Measles Virus Vaccine Platform

PubMed Central

Malczyk, Anna H.; Kupke, Alexandra; Prüfer, Steffen; Scheuplein, Vivian A.; Hutzler, Stefan; Kreuz, Dorothea; Beissert, Tim; Bauer, Stefanie; Hubich-Rau, Stefanie; Tondera, Christiane; Eldin, Hosam Shams; Schmidt, Jörg; Vergara-Alert, Júlia; Süzer, Yasemin; Seifried, Janna; Hanschmann, Kay-Martin; Kalinke, Ulrich; Herold, Susanne; Sahin, Ugur; Cichutek, Klaus; Waibler, Zoe; Eickmann, Markus; Becker, Stephan

2015-01-01

ABSTRACT In 2012, the first cases of infection with the Middle East respiratory syndrome coronavirus (MERS-CoV) were identified. Since then, more than 1,000 cases of MERS-CoV infection have been confirmed; infection is typically associated with considerable morbidity and, in approximately 30% of cases, mortality. Currently, there is no protective vaccine available. Replication-competent recombinant measles virus (MV) expressing foreign antigens constitutes a promising tool to induce protective immunity against corresponding pathogens. Therefore, we generated MVs expressing the spike glycoprotein of MERS-CoV in its full-length (MERS-S) or a truncated, soluble variant of MERS-S (MERS-solS). The genes encoding MERS-S and MERS-solS were cloned into the vaccine strain MVvac2 genome, and the respective viruses were rescued (MVvac2-CoV-S and MVvac2-CoV-solS). These recombinant MVs were amplified and characterized at passages 3 and 10. The replication of MVvac2-CoV-S in Vero cells turned out to be comparable to that of the control virus MVvac2-GFP (encoding green fluorescent protein), while titers of MVvac2-CoV-solS were impaired approximately 3-fold. The genomic stability and expression of the inserted antigens were confirmed via sequencing of viral cDNA and immunoblot analysis. In vivo, immunization of type I interferon receptor-deficient (IFNAR−/−)-CD46Ge mice with 2 × 105 50% tissue culture infective doses of MVvac2-CoV-S(H) or MVvac2-CoV-solS(H) in a prime-boost regimen induced robust levels of both MV- and MERS-CoV-neutralizing antibodies. Additionally, induction of specific T cells was demonstrated by T cell proliferation, antigen-specific T cell cytotoxicity, and gamma interferon secretion after stimulation of splenocytes with MERS-CoV-S presented by murine dendritic cells. MERS-CoV challenge experiments indicated the protective capacity of these immune responses in vaccinated mice. IMPORTANCE Although MERS-CoV has not yet acquired extensive distribution, being mainly confined to the Arabic and Korean peninsulas, it could adapt to spread more readily among humans and thereby become pandemic. Therefore, the development of a vaccine is mandatory. The integration of antigen-coding genes into recombinant MV resulting in coexpression of MV and foreign antigens can efficiently be achieved. Thus, in combination with the excellent safety profile of the MV vaccine, recombinant MV seems to constitute an ideal vaccine platform. The present study shows that a recombinant MV expressing MERS-S is genetically stable and induces strong humoral and cellular immunity against MERS-CoV in vaccinated mice. Subsequent challenge experiments indicated protection of vaccinated animals, illustrating the potential of MV as a vaccine platform with the potential to target emerging infections, such as MERS-CoV. PMID:26355094

A phylogenetically distinct Middle East respiratory syndrome coronavirus detected in a dromedary calf from a closed dairy herd in Dubai with rising seroprevalence with age

PubMed Central

Wernery, Ulrich; Rasoul, IHassab El; Wong, Emily YM; Joseph, Marina; Chen, Yixin; Jose, Shanty; Tsang, Alan KL; Patteril, Nissy Annie Georgy; Chen, Honglin; Elizabeth, Shyna K; Yuen, Kwok-Yung; Joseph, Sunitha; Xia, Ningshao; Wernery, Renate; Lau, Susanna KP; Woo, Patrick CY

2015-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) was detected by monoclonal antibody-based nucleocapsid protein-capture enzyme-linked immunosorbent assay (ELISA), RNA detection, and viral culture from the nasal sample of a 1-month-old dromedary calf in Dubai with sudden death. Whole genome phylogeny showed that this MERS-CoV strain did not cluster with the other MERS-CoV strains from Dubai that we reported recently. Instead, it formed a unique branch more closely related to other MERS-CoV strains from patients in Qatar and Hafr-Al-Batin in Saudi Arabia, as well as the MERS-CoV strains from patients in the recent Korean outbreak, in which the index patient acquired the infection during travel in the eastern part of the Arabian Peninsula. Non-synonymous mutations, resulting in 11 unique amino acid differences, were observed between the MERS-CoV genome from the present study and all the other available MERS-CoV genomes. Among these 11 unique amino acid differences, four were found in ORF1ab, three were found in the S1 domain of the spike protein, and one each was found in the proteins encoded by ORF4b, ORF5, envelope gene, and ORF8. MERS-CoV detection for all other 254 dromedaries in this closed dairy herd was negative by nucleocapsid protein-capture ELISA and RNA detection. MERS-CoV IgG sero-positivity gradually increased in dromedary calves with increasing age, with positivity rates of 75% at zero to three months, 79% at four months, 89% at five to six months, and 90% at seven to twelve months. The development of a rapid antigen detection kit for instantaneous diagnosis is warranted. PMID:26632876

Depth-time interpolation of feature trends extracted from mobile microelectrode data with kernel functions.

PubMed

Wong, Stephen; Hargreaves, Eric L; Baltuch, Gordon H; Jaggi, Jurg L; Danish, Shabbar F

2012-01-01

Microelectrode recording (MER) is necessary for precision localization of target structures such as the subthalamic nucleus during deep brain stimulation (DBS) surgery. Attempts to automate this process have produced quantitative temporal trends (feature activity vs. time) extracted from mobile MER data. Our goal was to evaluate computational methods of generating spatial profiles (feature activity vs. depth) from temporal trends that would decouple automated MER localization from the clinical procedure and enhance functional localization in DBS surgery. We evaluated two methods of interpolation (standard vs. kernel) that generated spatial profiles from temporal trends. We compared interpolated spatial profiles to true spatial profiles that were calculated with depth windows, using correlation coefficient analysis. Excellent approximation of true spatial profiles is achieved by interpolation. Kernel-interpolated spatial profiles produced superior correlation coefficient values at optimal kernel widths (r = 0.932-0.940) compared to standard interpolation (r = 0.891). The choice of kernel function and kernel width resulted in trade-offs in smoothing and resolution. Interpolation of feature activity to create spatial profiles from temporal trends is accurate and can standardize and facilitate MER functional localization of subcortical structures. The methods are computationally efficient, enhancing localization without imposing additional constraints on the MER clinical procedure during DBS surgery. Copyright © 2012 S. Karger AG, Basel.

A novel alignment-free method for detection of lateral genetic transfer based on TF-IDF.

PubMed

Cong, Yingnan; Chan, Yao-Ban; Ragan, Mark A

2016-07-25

Lateral genetic transfer (LGT) plays an important role in the evolution of microbes. Existing computational methods for detecting genomic regions of putative lateral origin scale poorly to large data. Here, we propose a novel method based on TF-IDF (Term Frequency-Inverse Document Frequency) statistics to detect not only regions of lateral origin, but also their origin and direction of transfer, in sets of hierarchically structured nucleotide or protein sequences. This approach is based on the frequency distributions of k-mers in the sequences. If a set of contiguous k-mers appears sufficiently more frequently in another phyletic group than in its own, we infer that they have been transferred from the first group to the second. We performed rigorous tests of TF-IDF using simulated and empirical datasets. With the simulated data, we tested our method under different parameter settings for sequence length, substitution rate between and within groups and post-LGT, deletion rate, length of transferred region and k size, and found that we can detect LGT events with high precision and recall. Our method performs better than an established method, ALFY, which has high recall but low precision. Our method is efficient, with runtime increasing approximately linearly with sequence length.

Designing small universal k-mer hitting sets for improved analysis of high-throughput sequencing

PubMed Central

Kingsford, Carl

2017-01-01

With the rapidly increasing volume of deep sequencing data, more efficient algorithms and data structures are needed. Minimizers are a central recent paradigm that has improved various sequence analysis tasks, including hashing for faster read overlap detection, sparse suffix arrays for creating smaller indexes, and Bloom filters for speeding up sequence search. Here, we propose an alternative paradigm that can lead to substantial further improvement in these and other tasks. For integers k and L > k, we say that a set of k-mers is a universal hitting set (UHS) if every possible L-long sequence must contain a k-mer from the set. We develop a heuristic called DOCKS to find a compact UHS, which works in two phases: The first phase is solved optimally, and for the second we propose several efficient heuristics, trading set size for speed and memory. The use of heuristics is motivated by showing the NP-hardness of a closely related problem. We show that DOCKS works well in practice and produces UHSs that are very close to a theoretical lower bound. We present results for various values of k and L and by applying them to real genomes show that UHSs indeed improve over minimizers. In particular, DOCKS uses less than 30% of the 10-mers needed to span the human genome compared to minimizers. The software and computed UHSs are freely available at github.com/Shamir-Lab/DOCKS/ and acgt.cs.tau.ac.il/docks/, respectively. PMID:28968408

Disk-based k-mer counting on a PC

PubMed Central

2013-01-01

Background The k-mer counting problem, which is to build the histogram of occurrences of every k-symbol long substring in a given text, is important for many bioinformatics applications. They include developing de Bruijn graph genome assemblers, fast multiple sequence alignment and repeat detection. Results We propose a simple, yet efficient, parallel disk-based algorithm for counting k-mers. Experiments show that it usually offers the fastest solution to the considered problem, while demanding a relatively small amount of memory. In particular, it is capable of counting the statistics for short-read human genome data, in input gzipped FASTQ file, in less than 40 minutes on a PC with 16 GB of RAM and 6 CPU cores, and for long-read human genome data in less than 70 minutes. On a more powerful machine, using 32 GB of RAM and 32 CPU cores, the tasks are accomplished in less than half the time. No other algorithm for most tested settings of this problem and mammalian-size data can accomplish this task in comparable time. Our solution also belongs to memory-frugal ones; most competitive algorithms cannot efficiently work on a PC with 16 GB of memory for such massive data. Conclusions By making use of cheap disk space and exploiting CPU and I/O parallelism we propose a very competitive k-mer counting procedure, called KMC. Our results suggest that judicious resource management may allow to solve at least some bioinformatics problems with massive data on a commodity personal computer. PMID:23679007

RNA-Skim: a rapid method for RNA-Seq quantification at transcript level

PubMed Central

Zhang, Zhaojun; Wang, Wei

2014-01-01

Motivation: RNA-Seq technique has been demonstrated as a revolutionary means for exploring transcriptome because it provides deep coverage and base pair-level resolution. RNA-Seq quantification is proven to be an efficient alternative to Microarray technique in gene expression study, and it is a critical component in RNA-Seq differential expression analysis. Most existing RNA-Seq quantification tools require the alignments of fragments to either a genome or a transcriptome, entailing a time-consuming and intricate alignment step. To improve the performance of RNA-Seq quantification, an alignment-free method, Sailfish, has been recently proposed to quantify transcript abundances using all k-mers in the transcriptome, demonstrating the feasibility of designing an efficient alignment-free method for transcriptome quantification. Even though Sailfish is substantially faster than alternative alignment-dependent methods such as Cufflinks, using all k-mers in the transcriptome quantification impedes the scalability of the method. Results: We propose a novel RNA-Seq quantification method, RNA-Skim, which partitions the transcriptome into disjoint transcript clusters based on sequence similarity, and introduces the notion of sig-mers, which are a special type of k-mers uniquely associated with each cluster. We demonstrate that the sig-mer counts within a cluster are sufficient for estimating transcript abundances with accuracy comparable with any state-of-the-art method. This enables RNA-Skim to perform transcript quantification on each cluster independently, reducing a complex optimization problem into smaller optimization tasks that can be run in parallel. As a result, RNA-Skim uses <4% of the k-mers and <10% of the CPU time required by Sailfish. It is able to finish transcriptome quantification in <10 min per sample by using just a single thread on a commodity computer, which represents >100 speedup over the state-of-the-art alignment-based methods, while delivering comparable or higher accuracy. Availability and implementation: The software is available at http://www.csbio.unc.edu/rs. Contact: weiwang@cs.ucla.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:24931995

Human Neutralizing Monoclonal Antibody Inhibition of Middle East Respiratory Syndrome Coronavirus Replication in the Common Marmoset.

PubMed

Chen, Zhe; Bao, Linlin; Chen, Cong; Zou, Tingting; Xue, Ying; Li, Fengdi; Lv, Qi; Gu, Songzhi; Gao, Xiaopan; Cui, Sheng; Wang, Jianmin; Qin, Chuan; Jin, Qi

2017-06-15

Middle East respiratory syndrome coronavirus (MERS-CoV) infection in humans is highly lethal, with a fatality rate of 35%. New prophylactic and therapeutic strategies to combat human infections are urgently needed. We isolated a fully human neutralizing antibody, MCA1, from a human survivor. The antibody recognizes the receptor-binding domain of MERS-CoV S glycoprotein and interferes with the interaction between viral S and the human cellular receptor human dipeptidyl peptidase 4 (DPP4). To our knowledge, this study is the first to report a human neutralizing monoclonal antibody that completely inhibits MERS-CoV replication in common marmosets. Monotherapy with MCA1 represents a potential alternative treatment for human infections with MERS-CoV worthy of evaluation in clinical settings. © Crown copyright 2017.

Viral peptides-MHC interaction: Binding probability and distance from human peptides.

PubMed

Santoni, Daniele

2018-05-23

Identification of peptides binding to MHC class I complex can play a crucial role in retrieving potential targets able to trigger an immune response. Affinity binding of viral peptides can be estimated through effective computational methods that in the most of cases are based on machine learning approach. Achieving a better insight into peptide features that impact on the affinity binding rate is a challenging issue. In the present work we focused on 9-mer peptides of Human immunodeficiency virus type 1 and Human herpes simplex virus 1, studying their binding to MHC class I. Viral 9-mers were partitioned into different classes, where each class is characterized by how far (in terms of mutation steps) the peptides belonging to that class are from human 9-mers. Viral 9-mers were partitioned in different classes, based on the number of mutation steps they are far from human 9-mers. We showed that the overall binding probability significantly differs among classes, and it typically increases as the distance, computed in terms of number of mutation steps from the human set of 9-mers, increases. The binding probability is particularly high when considering viral 9-mers that are far from all human 9-mers more than three mutation steps. A further evidence, providing significance to those special viral peptides and suggesting a potential role they can play, comes from the analysis of their distribution along viral genomes, as it revealed they are not randomly located, but they preferentially occur in specific genes. Copyright © 2018 Elsevier B.V. All rights reserved.

Rcorrector: efficient and accurate error correction for Illumina RNA-seq reads.

PubMed

Song, Li; Florea, Liliana

2015-01-01

Next-generation sequencing of cellular RNA (RNA-seq) is rapidly becoming the cornerstone of transcriptomic analysis. However, sequencing errors in the already short RNA-seq reads complicate bioinformatics analyses, in particular alignment and assembly. Error correction methods have been highly effective for whole-genome sequencing (WGS) reads, but are unsuitable for RNA-seq reads, owing to the variation in gene expression levels and alternative splicing. We developed a k-mer based method, Rcorrector, to correct random sequencing errors in Illumina RNA-seq reads. Rcorrector uses a De Bruijn graph to compactly represent all trusted k-mers in the input reads. Unlike WGS read correctors, which use a global threshold to determine trusted k-mers, Rcorrector computes a local threshold at every position in a read. Rcorrector has an accuracy higher than or comparable to existing methods, including the only other method (SEECER) designed for RNA-seq reads, and is more time and memory efficient. With a 5 GB memory footprint for 100 million reads, it can be run on virtually any desktop or server. The software is available free of charge under the GNU General Public License from https://github.com/mourisl/Rcorrector/.

PEDF and PEDF-derived peptide 44mer inhibit oxygen-glucose deprivation-induced oxidative stress through upregulating PPARγ via PEDF-R in H9c2 cells.

PubMed

Zhuang, Wei; Zhang, Hao; Pan, Jiajun; Li, Zhimin; Wei, Tengteng; Cui, Huazhu; Liu, Zhiwei; Guan, Qiuhua; Dong, Hongyan; Zhang, Zhongming

2016-04-08

Pigment epithelial-derived factor (PEDF) is a glycoprotein with broad biological activities including inhibiting oxygen-glucose deprivation(OGD)-induced cardiomyocytes apoptosis through its anti-oxidative properties. PEDF derived peptide-44mer shows similar cytoprotective effect to PEDF. However, the molecular mechanisms mediating cardiomyocytes apoptosis have not been fully established. Here we found that PEDF and 44mer decreased the content of ROS. This content was abolished by either PEDF-R small interfering RNA (siRNA) or PPARγ antagonist. The level of Lysophosphatidic acid (LPA) and phospholipase A2 (PLA2) was observed as drawn from the ELISA assays. PEDF and 44mer sequentially induced PPARγ expression was observed both in qPCR and Western blot assays. The level of LPA and PLA2 and PPARγ expression increased by PEDF and 44mer was significantly attenuated by PEDF-R siRNA. However, PEDF and 44mer inhibited the H9c2 cells and cultured neonatal rat myocardial cells apoptosis rate. On the other hand, TUNEL assay and cleavage of procaspase-3 showed that PEDF-R siRNA or PPARγ antagonist increased the apoptosis again. We conclude that under OGD condition, PEDF and 44mer reduce H9c2 cells apoptosis and inhibit OGD-induced oxidative stress via its receptor PEDF-R and the PPARγ signaling pathway. Copyright © 2016 Elsevier Inc. All rights reserved.

Differential mercury volatilization by tobacco organs expressing a modified bacterial merA gene.

PubMed

He, Y K; Sun, J G; Feng, X Z; Czakó, M; Márton, L

2001-09-01

Mercury pollution is a major environmental problem accompanying industrial activities. Most of the mercury released ends up and retained in the soil as complexes of the toxic ionic mercury (Hg2+), which then can be converted by microbes into the even more toxic methylmercury which tends to bioaccumulate. Mercury detoxification of the soil can also occur by microbes converting the ionic mercury into the least toxic metallic mercury (Hg0) form, which then evaporates. The remediation potential of transgenic plants carrying the MerA gene from E. coli encoding mercuric ion reductase could be evaluated. A modified version of the gene, optimized for plant codon preferences (merApe9, Rugh et al. 1996), was introduced into tobacco by Agrobacterium-mediated leaf disk transformation. Transgenic seeds were resistant to HgCl2 at 50 microM, and some of them (10-20% ) could germinate on media containing as much as 350 microM HgCl2, while the control plants were fully inhibited or died on 50 microM HgCl2. The rate of elemental mercury evolution from Hg2+ (added as HgCl2) was 5-8 times higher for transgenic plants than the control. Mercury volatilization by isolated organs standardized for fresh weight was higher (up to 5 times) in the roots than in shoots or the leaves. The data suggest that it is the root system of the transgenic plants that volatilizes most of the reduced mercury (Hg0). It also suggests that much of the mercury need not enter the vascular system to be transported to the leaves for volatilization. Transgenic plants with the merApe9 gene may be used to mercury detoxification for environmental improvement in mercury-contaminated regions more efficiently than it had been predicted based on data on volatilization of whole plants via the upper parts only (Rugh et al. 1996).

Infection control and prevention practices implemented to reduce transmission risk of Middle East respiratory syndrome-coronavirus in a tertiary care institution in Saudi Arabia.

PubMed

Butt, Taimur S; Koutlakis-Barron, Irene; AlJumaah, Suliman; AlThawadi, Sahar; AlMofada, Saleh

2016-05-01

Transmission of Middle East respiratory syndrome-coronavirus (MERS-CoV) among health care workers (HCWs) and patients has been documented with mortality rate approximating 36%. We propose advanced infection control measures (A-IC) used in conjunction with basic infection control measures (B-IC) help reduce pathogen transmission. B-IC include standard and transmission-based precautions. A-IC are initiatives implemented within our center to enhance effectiveness of B-IC. Study effectiveness of combining B-IC and A-IC to prevent transmission of MERS-CoV to HCWs. A retrospective observational study was undertaken. A-IC measures include administrative support with daily rounds; infection control risk assessment; timely screening, isolation, and specimen analysis; collaboration; epidemic planning; stockpiling; implementation of contingency plans; full personal protective equipment use for advanced airway management; use of a real-time electronic isolation flagging system; infection prevention and control team on-call protocols; pretransfer MERS-CoV testing; and education. A total of 874 real-time polymerase chain reaction MERS-CoV tests were performed during the period beginning July 1, 2013, and ending January 31, 2015. Six hundred ninety-four non-HCWs were tested, of these 16 tested positive for MERS-CoV and their infection was community acquired. Sixty-nine percent of the confirmed MERS-CoV-positive cases were men, with an average age of 56 years (range, 19-84 years). Of the total tested for MERS-CoV, 180 individuals were HCWs with zero positivity. Adhering to a combination of B-IC and A-IC reduces the risk of MERS-CoV transmission to HCWs. Copyright © 2016 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

A phylogenetically distinct Middle East respiratory syndrome coronavirus detected in a dromedary calf from a closed dairy herd in Dubai with rising seroprevalence with age.

PubMed

Wernery, Ulrich; El Rasoul, I Hassab; Wong, Emily Y M; Joseph, Marina; Chen, Yixin; Jose, Shanty; Tsang, Alan K L; Patteril, Nissy Annie Georgy; Chen, Honglin; Elizabeth, Shyna K; Yuen, Kwok-Yung; Joseph, Sunitha; Xia, Ningshao; Wernery, Renate; Lau, Susanna K P; Woo, Patrick C Y

2015-12-02

Middle East respiratory syndrome coronavirus (MERS-CoV) was detected by monoclonal antibody-based nucleocapsid protein-capture enzyme-linked immunosorbent assay (ELISA), RNA detection, and viral culture from the nasal sample of a 1-month-old dromedary calf in Dubai with sudden death. Whole genome phylogeny showed that this MERS-CoV strain did not cluster with the other MERS-CoV strains from Dubai that we reported recently. Instead, it formed a unique branch more closely related to other MERS-CoV strains from patients in Qatar and Hafr-Al-Batin in Saudi Arabia, as well as the MERS-CoV strains from patients in the recent Korean outbreak, in which the index patient acquired the infection during travel in the eastern part of the Arabian Peninsula. Non-synonymous mutations, resulting in 11 unique amino acid differences, were observed between the MERS-CoV genome from the present study and all the other available MERS-CoV genomes. Among these 11 unique amino acid differences, four were found in ORF1ab, three were found in the S1 domain of the spike protein, and one each was found in the proteins encoded by ORF4b, ORF5, envelope gene, and ORF8. MERS-CoV detection for all other 254 dromedaries in this closed dairy herd was negative by nucleocapsid protein-capture ELISA and RNA detection. MERS-CoV IgG sero-positivity gradually increased in dromedary calves with increasing age, with positivity rates of 75% at zero to three months, 79% at four months, 89% at five to six months, and 90% at seven to twelve months. The development of a rapid antigen detection kit for instantaneous diagnosis is warranted.Emerging Microbes & Infections (2015) 4, e74; doi:10.1038/emi.2015.74; published online 2 December 2015.

Improved modified energy ratio method using a multi-window approach for accurate arrival picking

NASA Astrophysics Data System (ADS)

Lee, Minho; Byun, Joongmoo; Kim, Dowan; Choi, Jihun; Kim, Myungsun

2017-04-01

To identify accurately the location of microseismic events generated during hydraulic fracture stimulation, it is necessary to detect the first break of the P- and S-wave arrival times recorded at multiple receivers. These microseismic data often contain high-amplitude noise, which makes it difficult to identify the P- and S-wave arrival times. The short-term-average to long-term-average (STA/LTA) and modified energy ratio (MER) methods are based on the differences in the energy densities of the noise and signal, and are widely used to identify the P-wave arrival times. The MER method yields more consistent results than the STA/LTA method for data with a low signal-to-noise (S/N) ratio. However, although the MER method shows good results regardless of the delay of the signal wavelet for signals with a high S/N ratio, it may yield poor results if the signal is contaminated by high-amplitude noise and does not have the minimum delay. Here we describe an improved MER (IMER) method, whereby we apply a multiple-windowing approach to overcome the limitations of the MER method. The IMER method contains calculations of an additional MER value using a third window (in addition to the original MER window), as well as the application of a moving average filter to each MER data point to eliminate high-frequency fluctuations in the original MER distributions. The resulting distribution makes it easier to apply thresholding. The proposed IMER method was applied to synthetic and real datasets with various S/N ratios and mixed-delay wavelets. The results show that the IMER method yields a high accuracy rate of around 80% within five sample errors for the synthetic datasets. Likewise, in the case of real datasets, 94.56% of the P-wave picking results obtained by the IMER method had a deviation of less than 0.5 ms (corresponding to 2 samples) from the manual picks.

The use of a mercury biosensor to evaluate the bioavailability of mercury-thiol complexes and mechanisms of mercury uptake in bacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ndu, Udonna; Barkay, Tamar; Mason, Robert P.

We discuss as mercury (Hg) biosensors are sensitive to only intracellular Hg, they are useful in the investigation of Hg uptake mechanisms and the effects of speciation on Hg bioavailability to microbes. In this study, bacterial biosensors were used to evaluate the roles that several transporters such as the glutathione, cystine/cysteine, and Mer transporters play in the uptake of Hg from Hg-thiol complexes by comparing uptake rates in strains with functioning transport systems to strains where these transporters had been knocked out by deletion of key genes. The Hg uptake into the biosensors was quantified based on the intracellular conversionmore » of inorganic mercury (Hg(II)) to elemental mercury (Hg(0)) by the enzyme MerA. It was found that uptake of Hg from Hg-cysteine (Hg(CYS) 2) and Hg-glutathione (Hg(GSH) 2) complexes occurred at the same rate as that of inorganic complexes of Hg(II) into Escherichia coli strains with and without intact Mer transport systems. However, higher rates of Hg uptake were observed in the strain with a functioning Mer transport system. These results demonstrate that thiol-bound Hg is bioavailable to E. coli and that this bioavailability is higher in Hg-resistant bacteria with a complete Mer system than in non-resistant strains. No difference in the uptake rate of Hg from Hg(GSH) 2 was observed in E. coli strains with or without functioning glutathione transport systems. There was also no difference in uptake rates between a wildtype Bacillus subtilis strain with a functioning cystine/cysteine transport system, and a mutant strain where this transport system had been knocked out. These results cast doubt on the viability of the hypothesis that the entire Hg-thiol complex is taken up into the cell by a thiol transporter. It is more likely that the Hg in the Hg-thiol complex is transferred to a transport protein on the cell membrane and is subsequently internalized.« less

The use of a mercury biosensor to evaluate the bioavailability of mercury-thiol complexes and mechanisms of mercury uptake in bacteria

DOE PAGES

Ndu, Udonna; Barkay, Tamar; Mason, Robert P.; ...

2015-09-15

We discuss as mercury (Hg) biosensors are sensitive to only intracellular Hg, they are useful in the investigation of Hg uptake mechanisms and the effects of speciation on Hg bioavailability to microbes. In this study, bacterial biosensors were used to evaluate the roles that several transporters such as the glutathione, cystine/cysteine, and Mer transporters play in the uptake of Hg from Hg-thiol complexes by comparing uptake rates in strains with functioning transport systems to strains where these transporters had been knocked out by deletion of key genes. The Hg uptake into the biosensors was quantified based on the intracellular conversionmore » of inorganic mercury (Hg(II)) to elemental mercury (Hg(0)) by the enzyme MerA. It was found that uptake of Hg from Hg-cysteine (Hg(CYS) 2) and Hg-glutathione (Hg(GSH) 2) complexes occurred at the same rate as that of inorganic complexes of Hg(II) into Escherichia coli strains with and without intact Mer transport systems. However, higher rates of Hg uptake were observed in the strain with a functioning Mer transport system. These results demonstrate that thiol-bound Hg is bioavailable to E. coli and that this bioavailability is higher in Hg-resistant bacteria with a complete Mer system than in non-resistant strains. No difference in the uptake rate of Hg from Hg(GSH) 2 was observed in E. coli strains with or without functioning glutathione transport systems. There was also no difference in uptake rates between a wildtype Bacillus subtilis strain with a functioning cystine/cysteine transport system, and a mutant strain where this transport system had been knocked out. These results cast doubt on the viability of the hypothesis that the entire Hg-thiol complex is taken up into the cell by a thiol transporter. It is more likely that the Hg in the Hg-thiol complex is transferred to a transport protein on the cell membrane and is subsequently internalized.« less

Outbreak of Middle East respiratory syndrome coronavirus in Saudi Arabia: a retrospective study.

PubMed

Aleanizy, Fadilah Sfouq; Mohmed, Nahla; Alqahtani, Fulwah Y; El Hadi Mohamed, Rania Ali

2017-01-05

The Middle East respiratory syndrome (MERS) is proposed to be a zoonotic disease. Dromedary camels have been implicated due to reports that some confirmed cases were exposed to camels. Risk factors for MERS coronavirus (MERS-CoV) infections in humans are incompletely understood. This study aimed to describe the demographic characteristics, mortality rate, clinical manifestations and comorbidities with confirmed cases of MERS-CoV. Retrospective chart review were performed to identify all laboratory-confirmed cases of MERS-CoV in Saudi Arabia who reported to the Ministry of Health (MOH) of Saudi Arabia and WHO between April 23, 2014 and August 31, 2015. Patients' charts were also reviewed for demographic information, mortality, comorbidities, clinical presentations, health care facility and presented with descriptive and comparative statistics using non parametric binomial test and Chi-square test. Confirmed cases of male patients (61.1%) exceeded those of female patients (38.9%). Infections among Saudi patients (62.6%) exceeded those among non-Saudi patients (37.4%; P = 0.001). The majority of the patients were aged 21-40 years (37.4%) or 41-60 years (35.8%); 43 (22.6%) were aged >61 years, and (8) 4.2% were aged 0-20 years. There was a difference in mortality between confirmed MERS-CoV cases (63.7% alive versus 36.3% dead cases, respectively). Furthermore, fever with cough and shortness of breath (SOB) (n = 39; 20.5%), fever with cough (n = 29; 15.3%), fever (n = 18; 9.5%), and fever with SOB (n = 13; 6.8%), were the most common clinical manifestations associated with confirmed MERS-CoV cases. MERS-CoV is considered an epidemic in Saudi Arabia. The results of the present study showed that the frequency of cases is higher among men than women, in Saudi patients than non-Saudi, and those between 21 to 60 years are most affected. Further studies are required to improve the surveillance associated with MERS-CoV to get definite and clear answers and better understanding of the MERS-CoV outbreak as well the source, and route of infection transmission in Saudi Arabia.

Novel chimeric virus-like particles vaccine displaying MERS-CoV receptor-binding domain induce specific humoral and cellular immune response in mice.

PubMed

Wang, Chong; Zheng, Xuexing; Gai, Weiwei; Wong, Gary; Wang, Hualei; Jin, Hongli; Feng, Na; Zhao, Yongkun; Zhang, Weijiao; Li, Nan; Zhao, Guoxing; Li, Junfu; Yan, Jinghua; Gao, Yuwei; Hu, Guixue; Yang, Songtao; Xia, Xianzhu

2017-04-01

Middle East respiratory syndrome coronavirus (MERS-CoV) has continued spreading since its emergence in 2012 with a mortality rate of 35.6%, and is a potential pandemic threat. Prophylactics and therapies are urgently needed to address this public health problem. We report here the efficacy of a vaccine consisting of chimeric virus-like particles (VLP) expressing the receptor binding domain (RBD) of MERS-CoV. In this study, a fusion of the canine parvovirus (CPV) VP2 structural protein gene with the RBD of MERS-CoV can self-assemble into chimeric, spherical VLP (sVLP). sVLP retained certain parvovirus characteristics, such as the ability to agglutinate pig erythrocytes, and structural morphology similar to CPV virions. Immunization with sVLP induced RBD-specific humoral and cellular immune responses in mice. sVLP-specific antisera from these animals were able to prevent pseudotyped MERS-CoV entry into susceptible cells, with neutralizing antibody titers reaching 1: 320. IFN-γ, IL-4 and IL-2 secreting cells induced by the RBD were detected in the splenocytes of vaccinated mice by ELISpot. Furthermore, mice inoculated with sVLP or an adjuvanted sVLP vaccine elicited T-helper 1 (Th1) and T-helper 2 (Th2) cell-mediated immunity. Our study demonstrates that sVLP displaying the RBD of MERS-CoV are promising prophylactic candidates against MERS-CoV in a potential outbreak situation. Copyright © 2017 Elsevier B.V. All rights reserved.

Saracatinib Inhibits Middle East Respiratory Syndrome-Coronavirus Replication In Vitro.

PubMed

Shin, Jin Soo; Jung, Eunhye; Kim, Meehyein; Baric, Ralph S; Go, Yun Young

2018-05-24

The Middle East respiratory syndrome-coronavirus (MERS-CoV), first identified in Saudi Arabia, is an emerging zoonotic pathogen that causes severe acute respiratory illness in humans with a high fatality rate. Since its emergence, MERS-CoV continues to spread to countries outside of the Arabian Peninsula and gives rise to sporadic human infections following the entry of infected individuals to other countries, which can precipitate outbreaks similar to the one that occurred in South Korea in 2015. Current therapeutics against MERS-CoV infection have primarily been adapted from previous drugs used for the treatment of severe acute respiratory syndrome. In search of new potential drug candidates, we screened a library composed of 2334 clinically approved drugs and pharmacologically active compounds. The drug saracatinib, a potent inhibitor of Src-family of tyrosine kinases (SFK), was identified as an inhibitor of MERS-CoV replication in vitro. Our results suggest that saracatinib potently inhibits MERS-CoV at the early stages of the viral life cycle in Huh-7 cells, possibly through the suppression of SFK signaling pathways. Furthermore, saracatinib exhibited a synergistic effect with gemcitabine, an anticancer drug with antiviral activity against several RNA viruses. These data indicate that saracatinib alone or in combination with gemcitabine can provide a new therapeutic option for the treatment of MERS-CoV infection.

Structure of the detoxification catalyst mercuric ion reductase from Bacillus sp. strain RC607

NASA Astrophysics Data System (ADS)

Schiering, N.; Kabsch, W.; Moore, M. J.; Distefano, M. D.; Walsh, C. T.; Pai, E. F.

1991-07-01

SEVERAL hundred million tons of toxic mercurials are dispersed in the biosphere1. Microbes can detoxify organo-mercurials and mercury salts through sequential action of two enzymes, organomercury lyase2 and mercuric ion reductase (MerA) 3-5. The latter, a homodimer with homology to the FAD-dependent disulphide oxidoreductases6, catalyses the reaction NADPH + Hg(II) --> NADP+ + H+Hg(0), one of the very rare enzymic reactions with metal substrates. Human glutathione reductase7,8 serves as a reference molecule for FAD-dependent disulphide reductases and between its primary structure9 and that of MerA from Tn501 (Pseudomonas), Tn21 (Shigella), pI258 (Staphylococcus) and Bacillus, 25-30% of the residues have been conserved10,11. All MerAs have a C-terminal extension about 15 residues long but have very varied N termini. Although the enzyme from Streptomyces lividans has no addition, from Pseudomonas aeruginosa Tn5Ol and Bacillus sp. strain RC607 it has one and two copies respectively of a domain of 80-85 residues, highly homologous to MerP, the periplasmic component of proteins encoded by the mer operon11. These domains can be proteolytically cleaved off without changing the catalytic efficiency3. We report here the crystal structure of MerA from the Gram-positive bacterium Bacillus sp. strain RC607. Analysis of its complexes with nicotinamide dinucleotide substrates and the inhibitor Cd(II) reveals how limited structural changes enable an enzyme to accept as substrate what used to be a dangerous inhibitor. Knowledge of the mode of mercury ligation is a prerequisite for understanding this unique detoxification mechanism.

Immunogenicity and structures of a rationally designed prefusion MERS-CoV spike antigen

PubMed Central

Pallesen, Jesper; Wang, Nianshuang; Corbett, Kizzmekia S.; Wrapp, Daniel; Kirchdoerfer, Robert N.; Turner, Hannah L.; Cottrell, Christopher A.; Becker, Michelle M.; Wang, Lingshu; Shi, Wei; Kong, Wing-Pui; Andres, Erica L.; Kettenbach, Arminja N.; Denison, Mark R.; Chappell, James D.; Graham, Barney S.; Ward, Andrew B.

2017-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) is a lineage C betacoronavirus that since its emergence in 2012 has caused outbreaks in human populations with case-fatality rates of ∼36%. As in other coronaviruses, the spike (S) glycoprotein of MERS-CoV mediates receptor recognition and membrane fusion and is the primary target of the humoral immune response during infection. Here we use structure-based design to develop a generalizable strategy for retaining coronavirus S proteins in the antigenically optimal prefusion conformation and demonstrate that our engineered immunogen is able to elicit high neutralizing antibody titers against MERS-CoV. We also determined high-resolution structures of the trimeric MERS-CoV S ectodomain in complex with G4, a stem-directed neutralizing antibody. The structures reveal that G4 recognizes a glycosylated loop that is variable among coronaviruses and they define four conformational states of the trimer wherein each receptor-binding domain is either tightly packed at the membrane-distal apex or rotated into a receptor-accessible conformation. Our studies suggest a potential mechanism for fusion initiation through sequential receptor-binding events and provide a foundation for the structure-based design of coronavirus vaccines. PMID:28807998

Real-Time Sequence-Validated Loop-Mediated Isothermal Amplification Assays for Detection of Middle East Respiratory Syndrome Coronavirus (MERS-CoV)

PubMed Central

Bhadra, Sanchita; Jiang, Yu Sherry; Kumar, Mia R.; Johnson, Reed F.; Hensley, Lisa E.; Ellington, Andrew D.

2015-01-01

The Middle East respiratory syndrome coronavirus (MERS-CoV), an emerging human coronavirus, causes severe acute respiratory illness with a 35% mortality rate. In light of the recent surge in reported infections we have developed asymmetric five-primer reverse transcription loop-mediated isothermal amplification (RT-LAMP) assays for detection of MERS-CoV. Isothermal amplification assays will facilitate the development of portable point-of-care diagnostics that are crucial for management of emerging infections. The RT-LAMP assays are designed to amplify MERS-CoV genomic loci located within the open reading frame (ORF)1a and ORF1b genes and upstream of the E gene. Additionally we applied one-step strand displacement probes (OSD) for real-time sequence-specific verification of LAMP amplicons. Asymmetric amplification effected by incorporating a single loop primer in each assay accelerated the time-to-result of the OSD-RT-LAMP assays. The resulting assays could detect 0.02 to 0.2 plaque forming units (PFU) (5 to 50 PFU/ml) of MERS-CoV in infected cell culture supernatants within 30 to 50 min and did not cross-react with common human respiratory pathogens. PMID:25856093

kWIP: The k-mer weighted inner product, a de novo estimator of genetic similarity.

PubMed

Murray, Kevin D; Webers, Christfried; Ong, Cheng Soon; Borevitz, Justin; Warthmann, Norman

2017-09-01

Modern genomics techniques generate overwhelming quantities of data. Extracting population genetic variation demands computationally efficient methods to determine genetic relatedness between individuals (or "samples") in an unbiased manner, preferably de novo. Rapid estimation of genetic relatedness directly from sequencing data has the potential to overcome reference genome bias, and to verify that individuals belong to the correct genetic lineage before conclusions are drawn using mislabelled, or misidentified samples. We present the k-mer Weighted Inner Product (kWIP), an assembly-, and alignment-free estimator of genetic similarity. kWIP combines a probabilistic data structure with a novel metric, the weighted inner product (WIP), to efficiently calculate pairwise similarity between sequencing runs from their k-mer counts. It produces a distance matrix, which can then be further analysed and visualised. Our method does not require prior knowledge of the underlying genomes and applications include establishing sample identity and detecting mix-up, non-obvious genomic variation, and population structure. We show that kWIP can reconstruct the true relatedness between samples from simulated populations. By re-analysing several published datasets we show that our results are consistent with marker-based analyses. kWIP is written in C++, licensed under the GNU GPL, and is available from https://github.com/kdmurray91/kwip.

Middle East respiratory syndrome coronavirus (MERS-CoV) outbreak in South Korea, 2015: epidemiology, characteristics and public health implications.

PubMed

Kim, K H; Tandi, T E; Choi, J W; Moon, J M; Kim, M S

2017-02-01

Since the first case of Middle East respiratory syndrome coronavirus (MERS-CoV) in South Korea was reported on 20 th May 2015, there have been 186 confirmed cases, 38 deaths and 16,752 suspected cases. Previously published research on South Korea's MERS outbreak was limited to the early stages, when few data were available. Now that the outbreak has ended, albeit unofficially, a more comprehensive review is appropriate. Data were obtained through the MERS portal by the Ministry for Health and Welfare (MOHW) and Korea Centres for Disease Control and Prevention, press releases by MOHW, and reports by the MERS Policy Committee of the Korean Medical Association. Cases were analysed for general characteristics, exposure source, timeline and infection generation. Sex, age and underlying diseases were analysed for the 38 deaths. Beginning with the index case that infected 28 others, an in-depth analysis was conducted. The average age was 55 years, which was a little higher than the global average of 50 years. As in most other countries, more men than women were affected. The case fatality rate was 19.9%, which was lower than the global rate of 38.7% and the rate in Saudi Arabia (36.5%). In total, 184 patients were infected nosocomially and there were no community-acquired infections. The main underlying diseases were respiratory diseases, cancer and hypertension. The main contributors to the outbreak were late diagnosis, quarantine failure of 'super spreaders', familial care-giving and visiting, non-disclosure by patients, poor communication by the South Korean Government, inadequate hospital infection management, and 'doctor shopping'. The outbreak was entirely nosocomial, and was largely attributable to infection management and policy failures, rather than biomedical factors. Copyright © 2016 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

Best Practices in Shift Handover Communication: Mars Exploration Rover Surface Operations

NASA Astrophysics Data System (ADS)

Parke, Bonny; Mishkin, Andrew

2005-12-01

During its prime mission, Mars Exploration Rover (MER) had many shift handovers in its surface operations. Because of the increased rates of accidents and errors historically associated with shift handovers, MER Mission management paid close attention to shift handovers and, when possible, developed them in accordance with best handover practices.We review the most important of these best practices, and include a generic "Checklist for Effective Handovers" to aid in the development of handovers.We present charts that depict structured information transfer across shifts. These charts show personnel schedules, meetings attended, handovers, and hand-offs on both the MER and on the earlier Mars Pathfinder Mission (MPF). It is apparent from these charts that although the MER Mission had a much larger number of surface operations personnel than MPF (approximately 300 vs. 178), and had three shifts instead of two, that it used many of the successful MPF communication strategies. Charts such as these can be helpful to those designing complicated and unique mission surface operations.

Overview of preparedness and response for Middle East respiratory syndrome coronavirus (MERS-CoV) in Oman.

PubMed

Al-Abaidani, I S; Al-Maani, A S; Al-Kindi, H S; Al-Jardani, A K; Abdel-Hady, D M; Zayed, B E; Al-Harthy, K S; Al-Shaqsi, K H; Al-Abri, S S

2014-12-01

Several countries in the Middle East and around 22 countries worldwide have reported cases of human infection with the Middle East respiratory syndrome coronavirus (MERS-CoV). The exceptionally high fatality rate resulting from MERS-CoV infection in conjunction with the paucity of knowledge about this emerging virus has led to major public and international concern. Within the framework of the national acute respiratory illness surveillance, the Ministry of Health in the Sultanate of Oman has announced two confirmed cases of MERS-CoV to date. The aim of this report is to describe the epidemiological aspects of these two cases and to highlight the importance of public health preparedness and response. The absence of secondary cases among contacts of the reported cases can be seen as evidence of the effectiveness of infection prevention and control precautions as an important pillar of the national preparedness and response plan applied in the health care institutions in Oman. Copyright © 2014. Published by Elsevier Ltd.

Treatment outcomes for patients with Middle Eastern Respiratory Syndrome Coronavirus (MERS CoV) infection at a coronavirus referral center in the Kingdom of Saudi Arabia.

PubMed

Al Ghamdi, Mohammed; Alghamdi, Khalid M; Ghandoora, Yasmeen; Alzahrani, Ameera; Salah, Fatmah; Alsulami, Abdulmoatani; Bawayan, Mayada F; Vaidya, Dhananjay; Perl, Trish M; Sood, Geeta

2016-04-21

Middle Eastern Respiratory Syndrome coronavirus (MERS-CoV) is a poorly understood disease with no known treatments. We describe the clinical features and treatment outcomes of patients with laboratory confirmed MERS-CoV at a regional referral center in the Kingdom of Saudi Arabia. In 2014, a retrospective chart review was performed on patients with a laboratory confirmed diagnosis of MERS-CoV to determine clinical and treatment characteristics associated with death. Confounding was evaluated and a multivariate logistic regression was performed to assess the independent effect of treatments administered. Fifty-one patients had an overall mortality of 37 %. Most patients were male (78 %) with a mean age of 54 years. Almost a quarter of the patients were healthcare workers (23.5 %) and 41 % had a known exposure to another person with MERS-CoV. Survival was associated with male gender, working as a healthcare worker, history of hypertension, vomiting on admission, elevated respiratory rate, abnormal lung exam, elevated alanine transaminase (ALT), clearance of MERS-CoV on repeat PCR polymerase chain reaction (PCR) testing, and mycophenolate mofetil treatment. Survival was reduced in the presence of coronary artery disease, hypotension, hypoxemia, CXR (chest X-ray) abnormalities, leukocytosis, creatinine >1 · 5 mg/dL, thrombocytopenia, anemia, and renal failure. In a multivariate analysis of treatments administered, severity of illness was the greatest predictor of reduced survival. Care for patients with MERS-CoV remains a challenge. In this retrospective cohort, interferon beta and mycophenolate mofetil treatment were predictors of increased survival in the univariate analysis. Severity of illness was the greatest predictor of reduced survival in the multivariate analysis. Larger randomized trials are needed to better evaluate the efficacy of these treatment regimens for MERS-CoV.

Stochastic precision analysis of 2D cardiac strain estimation in vivo

NASA Astrophysics Data System (ADS)

Bunting, E. A.; Provost, J.; Konofagou, E. E.

2014-11-01

Ultrasonic strain imaging has been applied to echocardiography and carries great potential to be used as a tool in the clinical setting. Two-dimensional (2D) strain estimation may be useful when studying the heart due to the complex, 3D deformation of the cardiac tissue. Increasing the framerate used for motion estimation, i.e. motion estimation rate (MER), has been shown to improve the precision of the strain estimation, although maintaining the spatial resolution necessary to view the entire heart structure in a single heartbeat remains challenging at high MERs. Two previously developed methods, the temporally unequispaced acquisition sequence (TUAS) and the diverging beam sequence (DBS), have been used in the past to successfully estimate in vivo axial strain at high MERs without compromising spatial resolution. In this study, a stochastic assessment of 2D strain estimation precision is performed in vivo for both sequences at varying MERs (65, 272, 544, 815 Hz for TUAS; 250, 500, 1000, 2000 Hz for DBS). 2D incremental strains were estimated during left ventricular contraction in five healthy volunteers using a normalized cross-correlation function and a least-squares strain estimator. Both sequences were shown capable of estimating 2D incremental strains in vivo. The conditional expected value of the elastographic signal-to-noise ratio (E(SNRe|ɛ)) was used to compare strain estimation precision of both sequences at multiple MERs over a wide range of clinical strain values. The results here indicate that axial strain estimation precision is much more dependent on MER than lateral strain estimation, while lateral estimation is more affected by strain magnitude. MER should be increased at least above 544 Hz to avoid suboptimal axial strain estimation. Radial and circumferential strain estimations were influenced by the axial and lateral strain in different ways. Furthermore, the TUAS and DBS were found to be of comparable precision at similar MERs.

Mass dependent stable isotope fractionation of mercury during mer mediated microbial degradation of monomethylmercury

NASA Astrophysics Data System (ADS)

Kritee, K.; Barkay, Tamar; Blum, Joel D.

2009-03-01

Controlling bioaccumulation of toxic monomethylmercury (MMHg) in aquatic food chains requires differentiation between biotic and abiotic pathways that lead to its production and degradation. Recent mercury (Hg) stable isotope measurements of natural samples suggest that Hg isotope ratios can be a powerful proxy for tracing dominant Hg transforming pathways in aquatic ecosystems. Specifically, it has been shown that photo-degradation of MMHg causes both mass dependent (MDF) and mass independent fractionation (MIF) of Hg isotopes. Because the extent of MDF and MIF observed in natural samples (e.g., fish, soil and sediments) can potentially be used to determine the relative importance of pathways leading to MMHg accumulation, it is important to determine the potential role of microbial pathways in contributing to the fractionation, especially MIF, observed in these samples. This study reports the extent of fractionation of Hg stable isotopes during degradation of MMHg to volatile elemental Hg and methane via the microbial Hg resistance ( mer) pathway in Escherichia coli carrying a mercury resistance ( mer) genetic system on a multi-copy plasmid. During experimental microbial degradation of MMHg, MMHg remaining in reactors became progressively heavier (increasing δ202Hg) with time and underwent mass dependent Rayleigh fractionation with a fractionation factor α202/198 = 1.0004 ± 0.0002 (2SD). However, MIF was not observed in any of the microbial MMHg degradation experiments indicating that the isotopic signature left by mer mediated MMHg degradation is significantly different from fractionation observed during DOC mediated photo-degradation of MMHg. Additionally, a clear suppression of Hg isotope fractionation, both during reduction of Hg(II) and degradation of MMHg, was observed when the cell densities increased, possibly due to a reduction in substrate bioavailability. We propose a multi-step framework for understanding the extent of fractionation seen in our MMHg degradation experiments and, based on estimates of the rates of the various steps involved in this mer mediated pathway, suggest which steps in the process could contribute towards the observed extent of fractionation. This framework suggests that at lower cell densities catalysis by MerB was the rate limiting step while at higher cell densities transport into the cell, which does not cause fractionation, became the rate limiting step. In addition to presenting evidence for absence of MIF during mer mediated Hg transformations, based on the nature of Hg compounds and microbe-Hg interactions, we suggest that the nuclear spin dependent MIF (i.e., the magnetic isotope effect) is also unlikely to occur during other non mer mediated 'dark' microbial Hg transformations (e.g., formation of MMHg and oxidative degradation of MMHg). Because of the important implications of the absence of MIF during biological processes on Hg isotope systematics, we discuss theoretical considerations and experimental strategies that could be used to confirm this suggestion.

Diagnostic delays in 537 symptomatic cases of Middle East respiratory syndrome coronavirus infection in Saudi Arabia.

PubMed

Ahmed, Anwar E

2017-09-01

Although the literature indicates that patient delays in seeking medical support for Middle East respiratory syndrome coronavirus (MERS-CoV) infections are associated with poor clinical outcomes, delays in the diagnosis itself remain poorly understood in these patients. This study aimed to determine the median time interval from symptom onset to a confirmed diagnosis and to identify the potential predictors of this interval in Saudi Arabian MERS patients. This was a retrospective study of patients with confirmed MERS who were publicly reported by the World Health Organization (WHO). Five hundred and thirty-seven symptomatic cases of MERS-CoV infection were included. The median time interval between symptom onset and confirmation of the MERS diagnosis was 4 days (interquartile range 2-7 days), ranging from 0 to 36 days. According to the negative binomial model, the unadjusted rate ratio (RR) of delays in the diagnosis was significantly higher in older patients (>65 years) (RR 1.42), non-healthcare workers (RR 1.74), patients with severe illness (RR 1.22), those with an unknown source of infection (RR 1.84), and those who had been in close contact with camels (RR 1.74). After accounting for confounders, the adjusted rate ratio (aRR) of delays in the diagnosis was independently associated with unknown source of infection (aRR 1.68) and close contact with camels (aRR 1.58). The time interval from symptom onset to diagnosis was greater in older patients, non-healthcare workers, patients with severe illness, patients with an unknown source of infection, and patients who had been in close contact with camels. The findings warrant educational interventions to raise general public awareness of the importance of early symptom notification. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Lectin Affinity Plasmapheresis for Middle East Respiratory Syndrome-Coronavirus and Marburg Virus Glycoprotein Elimination.

PubMed

Koch, Benjamin; Schult-Dietrich, Patricia; Büttner, Stefan; Dilmaghani, Bijan; Lohmann, Dario; Baer, Patrick C; Dietrich, Ursula; Geiger, Helmut

2018-04-26

Middle East respiratory syndrome coronavirus (MERS-CoV) and Marburg virus (MARV) are among the World Health Organization's top 8 emerging pathogens. Both zoonoses share nonspecific early symptoms, a high lethality rate, and a reduced number of specific treatment options. Therefore, we evaluated extracorporeal virus and glycoprotein (GP) elimination by lectin affinity plasmapheresis (LAP). For both MERS-CoV (pseudovirus) as well as MARV (GPs), 4 LAP devices (Mini Hemopurifiers, Aethlon Medical, San Diego, CA, USA) and 4 negative controls were tested. Samples were collected every 30 min and analyzed for reduction in virus infectivity by a flow cytometry-based infectivity assay (MERS-CoV) and in soluble GP content (MARV) by an immunoassay. The experiments show a time-dependent clearance of MERS-CoV of up to 80% within 3 h (pseudovirus). Up to 70% of MARV-soluble GPs were eliminated at the same time. Substantial saturation of the binding resins was detected within the first treatment hour. MERS-CoV (pseudovirus) and MARV soluble GPs are eliminated by LAP in vitro. Considering the high lethality and missing established treatment options, LAP should be evaluated in vivo. Especially early initiation, continuous therapy, and timed cartridge exchanges could be of importance. The Author(s). Published by S. Karger AG, Basel.

Synthesis of high-quality libraries of long (150mer) oligonucleotides by a novel depurination controlled process

PubMed Central

LeProust, Emily M.; Peck, Bill J.; Spirin, Konstantin; McCuen, Heather Brummel; Moore, Bridget; Namsaraev, Eugeni; Caruthers, Marvin H.

2010-01-01

We have achieved the ability to synthesize thousands of unique, long oligonucleotides (150mers) in fmol amounts using parallel synthesis of DNA on microarrays. The sequence accuracy of the oligonucleotides in such large-scale syntheses has been limited by the yields and side reactions of the DNA synthesis process used. While there has been significant demand for libraries of long oligos (150mer and more), the yields in conventional DNA synthesis and the associated side reactions have previously limited the availability of oligonucleotide pools to lengths <100 nt. Using novel array based depurination assays, we show that the depurination side reaction is the limiting factor for the synthesis of libraries of long oligonucleotides on Agilent Technologies’ SurePrint® DNA microarray platform. We also demonstrate how depurination can be controlled and reduced by a novel detritylation process to enable the synthesis of high quality, long (150mer) oligonucleotide libraries and we report the characterization of synthesis efficiency for such libraries. Oligonucleotide libraries prepared with this method have changed the economics and availability of several existing applications (e.g. targeted resequencing, preparation of shRNA libraries, site-directed mutagenesis), and have the potential to enable even more novel applications (e.g. high-complexity synthetic biology). PMID:20308161

Analysis of Ebola Virus Entry Into Macrophages

PubMed Central

Dahlmann, Franziska; Biedenkopf, Nadine; Babler, Anne; Jahnen-Dechent, Willi; Karsten, Christina B.; Gnirß, Kerstin; Schneider, Heike; Wrensch, Florian; O'Callaghan, Christopher A.; Bertram, Stephanie; Herrler, Georg; Becker, Stephan; Pöhlmann, Stefan; Hofmann-Winkler, Heike

2015-01-01

Ebolaviruses constitute a public health threat, particularly in Central and Western Africa. Host cell factors required for spread of ebolaviruses may serve as targets for antiviral intervention. Lectins, TAM receptor tyrosine kinases (Tyro3, Axl, Mer), T cell immunoglobulin and mucin domain (TIM) proteins, integrins, and Niemann-Pick C1 (NPC1) have been reported to promote entry of ebolaviruses into certain cellular systems. However, the factors used by ebolaviruses to invade macrophages, major viral targets, are poorly defined. Here, we show that mannose-specific lectins, TIM-1 and Axl augment entry into certain cell lines but do not contribute to Ebola virus (EBOV)-glycoprotein (GP)–driven transduction of macrophages. In contrast, expression of Mer, integrin αV, and NPC1 was required for efficient GP-mediated transduction and EBOV infection of macrophages. These results define cellular factors hijacked by EBOV for entry into macrophages and, considering that Mer and integrin αV promote phagocytosis of apoptotic cells, support the concept that EBOV relies on apoptotic mimicry to invade target cells. PMID:25877552

An mRNA-Derived Noncoding RNA Targets and Regulates the Ribosome

PubMed Central

Pircher, Andreas; Bakowska-Zywicka, Kamilla; Schneider, Lukas; Zywicki, Marek; Polacek, Norbert

2014-01-01

Summary The structural and functional repertoire of small non-protein-coding RNAs (ncRNAs) is central for establishing gene regulation networks in cells and organisms. Here, we show that an mRNA-derived 18-nucleotide-long ncRNA is capable of downregulating translation in Saccharomyces cerevisiae by targeting the ribosome. This 18-mer ncRNA binds to polysomes upon salt stress and is crucial for efficient growth under hyperosmotic conditions. Although the 18-mer RNA originates from the TRM10 locus, which encodes a tRNA methyltransferase, genetic analyses revealed the 18-mer RNA nucleotide sequence, rather than the mRNA-encoded enzyme, as the translation regulator. Our data reveal the ribosome as a target for a small regulatory ncRNA and demonstrate the existence of a yet unkown mechanism of translation regulation. Ribosome-targeted small ncRNAs are found in all domains of life and represent a prevalent but so far largely unexplored class of regulatory molecules. PMID:24685157

CAFE: aCcelerated Alignment-FrEe sequence analysis.

PubMed

Lu, Yang Young; Tang, Kujin; Ren, Jie; Fuhrman, Jed A; Waterman, Michael S; Sun, Fengzhu

2017-07-03

Alignment-free genome and metagenome comparisons are increasingly important with the development of next generation sequencing (NGS) technologies. Recently developed state-of-the-art k-mer based alignment-free dissimilarity measures including CVTree, $d_2^*$ and $d_2^S$ are more computationally expensive than measures based solely on the k-mer frequencies. Here, we report a standalone software, aCcelerated Alignment-FrEe sequence analysis (CAFE), for efficient calculation of 28 alignment-free dissimilarity measures. CAFE allows for both assembled genome sequences and unassembled NGS shotgun reads as input, and wraps the output in a standard PHYLIP format. In downstream analyses, CAFE can also be used to visualize the pairwise dissimilarity measures, including dendrograms, heatmap, principal coordinate analysis and network display. CAFE serves as a general k-mer based alignment-free analysis platform for studying the relationships among genomes and metagenomes, and is freely available at https://github.com/younglululu/CAFE. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Kinetic and mechanistic analysis of dinucleotide and oligonucleotide formation from the 5'-phosphorimidazolide of adenosine on Na(+)-montmorillonite

NASA Technical Reports Server (NTRS)

Kawamura, K.; Ferris, J. P.

1994-01-01

The rate constants for the condensation reaction of the 5'-phosphorimidazolide of adenosine (ImpA) to form dinucleotides and oligonucleotides have been measured in the presence of Na(+)-volclay (a Na(+)-montmorillonite) in pH 8 aqueous solution at 25 degrees C. The rates of the reaction of ImpA with an excess of adenosine 5'-monophosphoramidate (NH2pA), P1,P2-diadenosine 5',5'-pyrophosphate (A5'ppA), or adenosine 5'-monophosphate (5'-AMP or pA) in the presence of the montmorillonite to form NH2pA3'pA, A5'ppA3'pA, and pA3'pA, respectively, were measured. Only 3',5'-linked products were observed. The magnitude of the rate constants decrease in the order NH2pA3'pA > A5'-ppA3'pA > pA3'pA. The binding of ImpA to montmorillonite was measured, and the adsorption isotherm was determined. The binding of ImpA to montmorillonite and the formation of higher oligonucleotides is not observed in the absence of salts. Mg2+ enhances binding and oligonucleotide formation more than Ca2+ and Na+. The rate constants for the oligonucleotide formation were determined from the reaction products formed from 10 to 40 mM ImpA in the presence of Na(+)-montmorillonite using the computer program SIMFIT. The magnitudes of the rate constants for the formation of oligonucleotides increased in the order 2-mer < 3-mer < 4-mer ... 7-mer. The rate constants for dinucleotide and trinucleotide formation are more than 1000 times larger than those measured in the absence of montmorillonite. The rate constants for the formation of dinucleotide, trinucleotide, and tetranucleotide are 41,2.6, and 3.7 times larger than those for the formation of oligo(G)s with a poly(C) template. The hydrolysis of ImpA was accelerated 35 times in the presence of the montmorillonite. The catalytic ability of montmorillonite to form dinucleotides and oligonucleotides is quantitatively evaluated and possible pathways for oligo(A) formation are proposed.

Neptune: a bioinformatics tool for rapid discovery of genomic variation in bacterial populations

PubMed Central

Marinier, Eric; Zaheer, Rahat; Berry, Chrystal; Weedmark, Kelly A.; Domaratzki, Michael; Mabon, Philip; Knox, Natalie C.; Reimer, Aleisha R.; Graham, Morag R.; Chui, Linda; Patterson-Fortin, Laura; Zhang, Jian; Pagotto, Franco; Farber, Jeff; Mahony, Jim; Seyer, Karine; Bekal, Sadjia; Tremblay, Cécile; Isaac-Renton, Judy; Prystajecky, Natalie; Chen, Jessica; Slade, Peter

2017-01-01

Abstract The ready availability of vast amounts of genomic sequence data has created the need to rethink comparative genomics algorithms using ‘big data’ approaches. Neptune is an efficient system for rapidly locating differentially abundant genomic content in bacterial populations using an exact k-mer matching strategy, while accommodating k-mer mismatches. Neptune’s loci discovery process identifies sequences that are sufficiently common to a group of target sequences and sufficiently absent from non-targets using probabilistic models. Neptune uses parallel computing to efficiently identify and extract these loci from draft genome assemblies without requiring multiple sequence alignments or other computationally expensive comparative sequence analyses. Tests on simulated and real datasets showed that Neptune rapidly identifies regions that are both sensitive and specific. We demonstrate that this system can identify trait-specific loci from different bacterial lineages. Neptune is broadly applicable for comparative bacterial analyses, yet will particularly benefit pathogenomic applications, owing to efficient and sensitive discovery of differentially abundant genomic loci. The software is available for download at: http://github.com/phac-nml/neptune. PMID:29048594

The Middle East Respiratory Syndrome Coronavirus - A Continuing Risk to Global Health Security.

PubMed

Azhar, Esam I; Lanini, Simone; Ippolito, Giuseppe; Zumla, Alimuddin

2017-01-01

Two new zoonotic coronaviruses causing disease in humans (Zumla et al. 2015a; Hui and Zumla 2015; Peiris et al. 2003; Yu et al. 2014) have been the focus of international attention for the past 14 years due to their epidemic potential; (1) The Severe Acute Respiratory Syndrome coronavirus (SARS-CoV) (Peiris et al. 2003) first discovered in China in 2001 caused a major global epidemic of the Severe Acute Respiratory Syndrome (SARS). (2) The Middle East respiratory syndrome coronavirus (MERS-CoV) is a new corona virus isolated for the first time in a patients who died of severe lower respiratory tract infection in Jeddah (Saudi Arabia) in June 2012 (Zaki et al. 2012). The disease has been named Middle East Respiratory Syndrome (MERS) and it has remained on the radar of global public health authorities because of recurrent nosocomial and community outbreaks, and its association with severe disease and high mortality rates (Assiri et al. 2013a; Al-Abdallat et al. 2014; Memish et al. 2013a; Oboho et al. 2015; The WHO MERS-CoV Research Group 2013; Cotten et al. 2013a; Assiri et al. 2013b; Memish et al. 2013b; Azhar et al. 2014; Kim et al. 2015; Wang et al. 2015; Hui et al. 2015a). Cases of MERS have been reported from all continents and have been linked with travel to the Middle East (Hui et al. 2015a; WHO 2015c). The World Health Organization (WHO) have held nine meetings of the Emergency Committee (EC) convened by the Director-General under the International Health Regulations (IHR 2005) regarding MERS-CoV (WHO 2015c). There is wishful anticipation in the political and scientific communities that MERS-CoV like SARS-CoV will disappear with time. However it's been nearly 4 years since the first discovery of MERS-CoV, and MERS cases continue to be reported throughout the year from the Middle East (WHO 2015c). There is a large MERS-CoV camel reservoir, and there is no specific treatment or vaccine (Zumla et al. 2015a). With 10 million people visiting Saudi Arabia every year for Umrah and/or Hajj, the potential risk of global spread is ever present (Memish et al. 2014a; McCloskey et al. 2014; Al-Tawfiq et al. 2014a).

LDsplit: screening for cis-regulatory motifs stimulating meiotic recombination hotspots by analysis of DNA sequence polymorphisms.

PubMed

Yang, Peng; Wu, Min; Guo, Jing; Kwoh, Chee Keong; Przytycka, Teresa M; Zheng, Jie

2014-02-17

As a fundamental genomic element, meiotic recombination hotspot plays important roles in life sciences. Thus uncovering its regulatory mechanisms has broad impact on biomedical research. Despite the recent identification of the zinc finger protein PRDM9 and its 13-mer binding motif as major regulators for meiotic recombination hotspots, other regulators remain to be discovered. Existing methods for finding DNA sequence motifs of recombination hotspots often rely on the enrichment of co-localizations between hotspots and short DNA patterns, which ignore the cross-individual variation of recombination rates and sequence polymorphisms in the population. Our objective in this paper is to capture signals encoded in genetic variations for the discovery of recombination-associated DNA motifs. Recently, an algorithm called "LDsplit" has been designed to detect the association between single nucleotide polymorphisms (SNPs) and proximal meiotic recombination hotspots. The association is measured by the difference of population recombination rates at a hotspot between two alleles of a candidate SNP. Here we present an open source software tool of LDsplit, with integrative data visualization for recombination hotspots and their proximal SNPs. Applying LDsplit on SNPs inside an established 7-mer motif bound by PRDM9 we observed that SNP alleles preserving the original motif tend to have higher recombination rates than the opposite alleles that disrupt the motif. Running on SNP windows around hotspots each containing an occurrence of the 7-mer motif, LDsplit is able to guide the established motif finding algorithm of MEME to recover the 7-mer motif. In contrast, without LDsplit the 7-mer motif could not be identified. LDsplit is a software tool for the discovery of cis-regulatory DNA sequence motifs stimulating meiotic recombination hotspots by screening and narrowing down to hotspot associated SNPs. It is the first computational method that utilizes the genetic variation of recombination hotspots among individuals, opening a new avenue for motif finding. Tested on an established motif and simulated datasets, LDsplit shows promise to discover novel DNA motifs for meiotic recombination hotspots.

LDsplit: screening for cis-regulatory motifs stimulating meiotic recombination hotspots by analysis of DNA sequence polymorphisms

PubMed Central

2014-01-01

Background As a fundamental genomic element, meiotic recombination hotspot plays important roles in life sciences. Thus uncovering its regulatory mechanisms has broad impact on biomedical research. Despite the recent identification of the zinc finger protein PRDM9 and its 13-mer binding motif as major regulators for meiotic recombination hotspots, other regulators remain to be discovered. Existing methods for finding DNA sequence motifs of recombination hotspots often rely on the enrichment of co-localizations between hotspots and short DNA patterns, which ignore the cross-individual variation of recombination rates and sequence polymorphisms in the population. Our objective in this paper is to capture signals encoded in genetic variations for the discovery of recombination-associated DNA motifs. Results Recently, an algorithm called “LDsplit” has been designed to detect the association between single nucleotide polymorphisms (SNPs) and proximal meiotic recombination hotspots. The association is measured by the difference of population recombination rates at a hotspot between two alleles of a candidate SNP. Here we present an open source software tool of LDsplit, with integrative data visualization for recombination hotspots and their proximal SNPs. Applying LDsplit on SNPs inside an established 7-mer motif bound by PRDM9 we observed that SNP alleles preserving the original motif tend to have higher recombination rates than the opposite alleles that disrupt the motif. Running on SNP windows around hotspots each containing an occurrence of the 7-mer motif, LDsplit is able to guide the established motif finding algorithm of MEME to recover the 7-mer motif. In contrast, without LDsplit the 7-mer motif could not be identified. Conclusions LDsplit is a software tool for the discovery of cis-regulatory DNA sequence motifs stimulating meiotic recombination hotspots by screening and narrowing down to hotspot associated SNPs. It is the first computational method that utilizes the genetic variation of recombination hotspots among individuals, opening a new avenue for motif finding. Tested on an established motif and simulated datasets, LDsplit shows promise to discover novel DNA motifs for meiotic recombination hotspots. PMID:24533858

Biocompatible artificial DNA linker that is read through by DNA polymerases and is functional in Escherichia coli

PubMed Central

El-Sagheer, Afaf H.; Sanzone, A. Pia; Gao, Rachel; Tavassoli, Ali; Brown, Tom

2011-01-01

A triazole mimic of a DNA phosphodiester linkage has been produced by templated chemical ligation of oligonucleotides functionalized with 5′-azide and 3′-alkyne. The individual azide and alkyne oligonucleotides were synthesized by standard phosphoramidite methods and assembled using a straightforward ligation procedure. This highly efficient chemical equivalent of enzymatic DNA ligation has been used to assemble a 300-mer from three 100-mer oligonucleotides, demonstrating the total chemical synthesis of very long oligonucleotides. The base sequences of the DNA strands containing this artificial linkage were copied during PCR with high fidelity and a gene containing the triazole linker was functional in Escherichia coli. PMID:21709264

A systematic investigation of aluminium ion speciation at high temperature. Part 1. Solution studies.

PubMed

Shafran, Kirill L; Perry, Carole C

2005-06-21

Speciation diagrams of aluminium ions in aqueous solution (0.2 M) at high temperature (90 degrees C) have been obtained from 48 h time-resolved multi-batch titration experiments monitored by 27Al NMR spectroscopy, potentiometry and dynamic light scattering. The quantitative speciation patterns and kinetic data obtained offer a dynamic picture of the distribution of soluble and insoluble Al species as a function of hydrolysis ratio h(h=[OH-]/[Al3+]) over a very broad range of conditions (-1.0 < or =h < or = 4.0). Monomeric, small oligomeric, tridecameric (the 'Al13-mer') and the recently characterised 30-meric aluminium species (the 'Al30-mer') as well as aluminium hydroxide have been identified and quantified. The Al13-mer species dominates over a relatively broad range of hydrolysis ratios (1.5 < or =h< or = 2.7) during the first 6 h of experiment, but are gradually replaced by Al30-mers at longer reaction times. Kinetic profiles indicate that the formation of the Al30-mer is limited by the disappearance of the Al13 species at mildly acidic conditions. The estimated rate constants of both hydrolytic processes show good internal correlation at h> or = 1.5. The effect of local perturbations leading to the formation of aluminium hydroxide below the electroneutrality point (h= 3.0) has been estimated quantitatively.

Extraterrestrial Virtual Field Experience: Water at Meridiani

NASA Astrophysics Data System (ADS)

Duggan-Haas, D.; Million, C.; Sullivan, R. J., Jr.; Hayes, A. G., Jr.; Ross, R. M.; St Clair, M.

2014-12-01

The Spacecraft Planetary Imaging Facility (SPIF) at Cornell University, in collaboration with Million Concepts and the Paleontological Research Institute (PRI), has developed the Extraterrestrial Virtual Field Experience (EVFE), a web-based, game-like and inquiry-driven classroom activity targeted to middle school through undergraduate introductory Earth science classrooms. Students play the role of mission scientists for a NASA rover mission, tasked with targeting the rover's scientific instruments to investigate a specific scientific question about the landing site. As with the real mission, the student operators must optimize the efficient use of limited resources and time against the need to make observations to address working hypotheses. The activity uses only real--not artificial or simulated--mission data, and students are guided throughout by a "Mission Manager" who provides hints and advice about the scientific meaning of observations within the broader context of the mission objectives. The MER Opportunity EVFE is a pilot effort, the first of five EVFE modules planned a rate of one per year that will feature different NASA missions and scientific topics. The MER Opportunity EVFE has already been developed and focuses on the investigation of the history of water on Mars at the Meridiani landing site of the Opportunity rover. The module includes a teacher guide and is currently available to educators through the SPIF website.

Identification of a Novel Inhibitor against Middle East Respiratory Syndrome Coronavirus

PubMed Central

Sun, Yaping; Zhang, Huaidong; Shi, Jian; Zhang, Zhe; Gong, Rui

2017-01-01

The Middle East respiratory syndrome coronavirus (MERS-CoV) was first isolated in 2012, and circulated worldwide with high mortality. The continual outbreaks of MERS-CoV highlight the importance of developing antiviral therapeutics. Here, we rationally designed a novel fusion inhibitor named MERS-five-helix bundle (MERS-5HB) derived from the six-helix bundle (MERS-6HB) which was formed by the process of membrane fusion. MERS-5HB consists of three copies of heptad repeat 1 (HR1) and two copies of heptad repeat 2 (HR2) while MERS-6HB includes three copies each of HR1 and HR2. As it lacks one HR2, MERS-5HB was expected to interact with viral HR2 to interrupt the fusion step. What we found was that MERS-5HB could bind to HR2P, a peptide derived from HR2, with a strong affinity value (KD) of up to 0.24 nM. Subsequent assays indicated that MERS-5HB could inhibit pseudotyped MERS-CoV entry effectively with 50% inhibitory concentration (IC50) of about 1 μM. In addition, MERS-5HB significantly inhibited spike (S) glycoprotein-mediated syncytial formation in a dose-dependent manner. Further biophysical characterization showed that MERS-5HB was a thermo-stable α-helical secondary structure. The inhibitory potency of MERS-5HB may provide an attractive basis for identification of a novel inhibitor against MERS-CoV, as a potential antiviral agent. PMID:28906430

Improvement of an enzyme-linked immunosorbent assay for equine herpesvirus type 4 by using a synthetic-peptide 24-mer repeat sequence of glycoprotein G as an antigen

PubMed Central

BANNAI, Hiroshi; NEMOTO, Manabu; TSUJIMURA, Koji; YAMANAKA, Takashi; MAEDA, Ken; KONDO, Takashi

2015-01-01

To increase the sensitivity of an enzyme-linked immunosorbent assay (ELISA) for equine herpesvirus type 4 (EHV-4) that uses a 12-mer peptide of glycoprotein G (gG4-12-mer: MKNNPIYSEGSL) [4], we used a longer peptide consisting of a 24-mer repeat sequence (gG4-24-mer: MKNNPIYSEGSLMLNVQHDDSIHT) as an antigen. Sera of horses experimentally infected with EHV-4 reacted much more strongly to the gG4-24-mer peptide than to the gG4-12-mer peptide. We used peptide ELISAs to test paired sera from horses naturally infected with EHV-4 (n=40). gG4-24-mer ELISA detected 37 positive samples (92.5%), whereas gG4-12-mer ELISA detected only 28 (70.0%). gG4-24-mer ELISA was much more sensitive than gG4-12-mer ELISA. PMID:26424485

Improvement of an enzyme-linked immunosorbent assay for equine herpesvirus type 4 by using a synthetic-peptide 24-mer repeat sequence of glycoprotein G as an antigen.

PubMed

Bannai, Hiroshi; Nemoto, Manabu; Tsujimura, Koji; Yamanaka, Takashi; Maeda, Ken; Kondo, Takashi

2016-02-01

To increase the sensitivity of an enzyme-linked immunosorbent assay (ELISA) for equine herpesvirus type 4 (EHV-4) that uses a 12-mer peptide of glycoprotein G (gG4-12-mer: MKNNPIYSEGSL) [4], we used a longer peptide consisting of a 24-mer repeat sequence (gG4-24-mer: MKNNPIYSEGSLMLNVQHDDSIHT) as an antigen. Sera of horses experimentally infected with EHV-4 reacted much more strongly to the gG4-24-mer peptide than to the gG4-12-mer peptide. We used peptide ELISAs to test paired sera from horses naturally infected with EHV-4 (n=40). gG4-24-mer ELISA detected 37 positive samples (92.5%), whereas gG4-12-mer ELISA detected only 28 (70.0%). gG4-24-mer ELISA was much more sensitive than gG4-12-mer ELISA.

Robust k-mer frequency estimation using gapped k-mers

PubMed Central

Ghandi, Mahmoud; Mohammad-Noori, Morteza

2013-01-01

Oligomers of fixed length, k, commonly known as k-mers, are often used as fundamental elements in the description of DNA sequence features of diverse biological function, or as intermediate elements in the constuction of more complex descriptors of sequence features such as position weight matrices. k-mers are very useful as general sequence features because they constitute a complete and unbiased feature set, and do not require parameterization based on incomplete knowledge of biological mechanisms. However, a fundamental limitation in the use of k-mers as sequence features is that as k is increased, larger spatial correlations in DNA sequence elements can be described, but the frequency of observing any specific k-mer becomes very small, and rapidly approaches a sparse matrix of binary counts. Thus any statistical learning approach using k-mers will be susceptible to noisy estimation of k-mer frequencies once k becomes large. Because all molecular DNA interactions have limited spatial extent, gapped k-mers often carry the relevant biological signal. Here we use gapped k-mer counts to more robustly estimate the ungapped k-mer frequencies, by deriving an equation for the minimum norm estimate of k-mer frequencies given an observed set of gapped k-mer frequencies. We demonstrate that this approach provides a more accurate estimate of the k-mer frequencies in real biological sequences using a sample of CTCF binding sites in the human genome. PMID:23861010

Robust k-mer frequency estimation using gapped k-mers.

PubMed

Ghandi, Mahmoud; Mohammad-Noori, Morteza; Beer, Michael A

2014-08-01

Oligomers of fixed length, k, commonly known as k-mers, are often used as fundamental elements in the description of DNA sequence features of diverse biological function, or as intermediate elements in the constuction of more complex descriptors of sequence features such as position weight matrices. k-mers are very useful as general sequence features because they constitute a complete and unbiased feature set, and do not require parameterization based on incomplete knowledge of biological mechanisms. However, a fundamental limitation in the use of k-mers as sequence features is that as k is increased, larger spatial correlations in DNA sequence elements can be described, but the frequency of observing any specific k-mer becomes very small, and rapidly approaches a sparse matrix of binary counts. Thus any statistical learning approach using k-mers will be susceptible to noisy estimation of k-mer frequencies once k becomes large. Because all molecular DNA interactions have limited spatial extent, gapped k-mers often carry the relevant biological signal. Here we use gapped k-mer counts to more robustly estimate the ungapped k-mer frequencies, by deriving an equation for the minimum norm estimate of k-mer frequencies given an observed set of gapped k-mer frequencies. We demonstrate that this approach provides a more accurate estimate of the k-mer frequencies in real biological sequences using a sample of CTCF binding sites in the human genome.

Identification of Electrode Respiring, Hydrocarbonoclastic Bacterial Strain Stenotrophomonas maltophilia MK2 Highlights the Untapped Potential for Environmental Bioremediation

PubMed Central

Venkidusamy, Krishnaveni; Megharaj, Mallavarapu

2016-01-01

Electrode respiring bacteria (ERB) possess a great potential for many biotechnological applications such as microbial electrochemical remediation systems (MERS) because of their exoelectrogenic capabilities to degrade xenobiotic pollutants. Very few ERB have been isolated from MERS, those exhibited a bioremediation potential toward organic contaminants. Here we report once such bacterial strain, Stenotrophomonas maltophilia MK2, a facultative anaerobic bacterium isolated from a hydrocarbon fed MERS, showed a potent hydrocarbonoclastic behavior under aerobic and anaerobic environments. Distinct properties of the strain MK2 were anaerobic fermentation of the amino acids, electrode respiration, anaerobic nitrate reduction and the ability to metabolize n-alkane components (C8–C36) of petroleum hydrocarbons (PH) including the biomarkers, pristine and phytane. The characteristic of diazoic dye decolorization was used as a criterion for pre-screening the possible electrochemically active microbial candidates. Bioelectricity generation with concomitant dye decolorization in MERS showed that the strain is electrochemically active. In acetate fed microbial fuel cells (MFCs), maximum current density of 273 ± 8 mA/m2 (1000 Ω) was produced (power density 113 ± 7 mW/m2) by strain MK2 with a coulombic efficiency of 34.8%. Further, the presence of possible alkane hydroxylase genes (alkB and rubA) in the strain MK2 indicated that the genes involved in hydrocarbon degradation are of diverse origin. Such observations demonstrated the potential of facultative hydrocarbon degradation in contaminated environments. Identification of such a novel petrochemical hydrocarbon degrading ERB is likely to offer a new route to the sustainable bioremedial process of source zone contamination with simultaneous energy generation through MERS. PMID:28018304

Development of a transgenic tobacco plant for phytoremediation of methylmercury pollution.

PubMed

Nagata, Takeshi; Morita, Hirofumi; Akizawa, Toshifumi; Pan-Hou, Hidemitsu

2010-06-01

To develop the potential of plant for phytoremediation of methylmercury pollution, a genetically engineered tobacco plant that coexpresses organomercurial lyase (MerB) with the ppk-specified polyphosphate (polyP) and merT-encoding mercury transporter was constructed by integrating a bacterial merB gene into ppk/merT-transgenic tobacco. A large number of independent transgenic tobaccos was obtained, in some of which the merB gene was stably integrated in the plant genome and substantially translated to the expected MerB enzyme in the transgenic tobacco. The ppk/merT/merB-transgenic tobacco callus showed more resistance to methylmercury (CH3Hg+) and accumulated more mercury from CH3Hg+-containing medium than the ppk/merT-transgenic and wild-type progenitors. These results suggest that the MerB enzyme encoded by merB degraded the incorporated CH3Hg+ to Hg2+, which then accumulated as a less toxic Hg-polyP complex in the tobacco cells. Phytoremediation of CH3Hg+ and Hg2+ in the environment with this engineered ppk/merT/merB-transgenic plant, which prevents the release mercury vapor (Hg0) into the atmosphere in addition to generating potentially recyclable mercury-rich plant residues, is believed to be more acceptable to the public than other competing technologies, including phytovolatilization.

DNA-length-dependent quenching of fluorescently labeled iron oxide nanoparticles with gold, graphene oxide and MoS2 nanostructures.

PubMed

Balcioglu, Mustafa; Rana, Muhit; Robertson, Neil; Yigit, Mehmet V

2014-08-13

We controlled the fluorescence emission of a fluorescently labeled iron oxide nanoparticle using three different nanomaterials with ultraefficient quenching capabilities. The control over the fluorescence emission was investigated via spacing introduced by the surface-functionalized single-stranded DNA molecules. DNA molecules were conjugated on different templates, either on the surface of the fluorescently labeled iron oxide nanoparticles or gold and nanographene oxide. The efficiency of the quenching was determined and compared with various fluorescently labeled iron oxide nanoparticle and nanoquencher combinations using DNA molecules with three different lengths. We have found that the template for DNA conjugation plays significant role on quenching the fluorescence emission of the fluorescently labeled iron oxide nanoparticles. We have observed that the size of the DNA controls the quenching efficiency when conjugated only on the fluorescently labeled iron oxide nanoparticles by setting a spacer between the surfaces and resulting change in the hydrodynamic size. The quenching efficiency with 12mer, 23mer and 36mer oligonucleotides decreased to 56%, 54% and 53% with gold nanoparticles, 58%, 38% and 32% with nanographene oxide, 46%, 38% and 35% with MoS2, respectively. On the other hand, the presence, not the size, of the DNA molecules on the other surfaces quenched the fluorescence significantly with different degrees. To understand the effect of the mobility of the DNA molecules on the nanoparticle surface, DNA molecules were attached to the surface with two different approaches. Covalently immobilized oligonucleotides decreased the quenching efficiency of nanographene oxide and gold nanoparticles to ∼22% and ∼21%, respectively, whereas noncovalently adsorbed oligonucleotides decreased it to ∼25% and ∼55%, respectively. As a result, we have found that each nanoquencher has a powerful quenching capability against a fluorescent nanoparticle, which can be tuned with surface functionalized DNA molecules.

Ash-plume dynamics and eruption source parameters by infrasound and thermal imagery: The 2010 Eyjafjallajökull eruption

NASA Astrophysics Data System (ADS)

Ripepe, M.; Bonadonna, C.; Folch, A.; Delle Donne, D.; Lacanna, G.; Marchetti, E.; Höskuldsson, A.

2013-03-01

During operational ash-cloud forecasting, prediction of ash concentration and total erupted mass directly depends on the determination of mass eruption rate (MER), which is typically inferred from plume height. Uncertainties for plume heights are large, especially for bent-over plumes in which the ascent dynamics are strongly affected by the surrounding wind field. Here we show how uncertainties can be reduced if MER is derived directly from geophysical observations of source dynamics. The combination of infrasound measurements and thermal camera imagery allows for the infrasonic type of source to be constrained (a dipole in this case) and for the plume exit velocity to be calculated (54-142 m/s) based on the acoustic signal recorded during the 2010 Eyjafjallajökull eruption from 4 to 21 May. Exit velocities are converted into MER using additional information on vent diameter (50±10 m) and mixture density (5.4±1.1 kg/m3), resulting in an average ∼9×105 kg/s MER during the considered period of the eruption. We validate our acoustic-derived MER by using independent measurements of plume heights (Icelandic Meteorological Office radar observations). Acoustically derived MER are converted into plume heights using field-based relationships and a 1D radially averaged buoyant plume theory model using a reconstructed total grain size distribution. We conclude that the use of infrasonic monitoring may lead to important understanding of the plume dynamics and allows for real-time determination of eruption source parameters. This could improve substantially the forecasting of volcano-related hazards, with important implications for civil aviation safety.

Informational and linguistic analysis of large genomic sequence collections via efficient Hadoop cluster algorithms.

PubMed

Ferraro Petrillo, Umberto; Roscigno, Gianluca; Cattaneo, Giuseppe; Giancarlo, Raffaele

2018-06-01

Information theoretic and compositional/linguistic analysis of genomes have a central role in bioinformatics, even more so since the associated methodologies are becoming very valuable also for epigenomic and meta-genomic studies. The kernel of those methods is based on the collection of k-mer statistics, i.e. how many times each k-mer in {A,C,G,T}k occurs in a DNA sequence. Although this problem is computationally very simple and efficiently solvable on a conventional computer, the sheer amount of data available now in applications demands to resort to parallel and distributed computing. Indeed, those type of algorithms have been developed to collect k-mer statistics in the realm of genome assembly. However, they are so specialized to this domain that they do not extend easily to the computation of informational and linguistic indices, concurrently on sets of genomes. Following the well-established approach in many disciplines, and with a growing success also in bioinformatics, to resort to MapReduce and Hadoop to deal with 'Big Data' problems, we present KCH, the first set of MapReduce algorithms able to perform concurrently informational and linguistic analysis of large collections of genomic sequences on a Hadoop cluster. The benchmarking of KCH that we provide indicates that it is quite effective and versatile. It is also competitive with respect to the parallel and distributed algorithms highly specialized to k-mer statistics collection for genome assembly problems. In conclusion, KCH is a much needed addition to the growing number of algorithms and tools that use MapReduce for bioinformatics core applications. The software, including instructions for running it over Amazon AWS, as well as the datasets are available at http://www.di-srv.unisa.it/KCH. umberto.ferraro@uniroma1.it. Supplementary data are available at Bioinformatics online.

SWAP-Assembler 2: Optimization of De Novo Genome Assembler at Large Scale

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meng, Jintao; Seo, Sangmin; Balaji, Pavan

2016-08-16

In this paper, we analyze and optimize the most time-consuming steps of the SWAP-Assembler, a parallel genome assembler, so that it can scale to a large number of cores for huge genomes with the size of sequencing data ranging from terabyes to petabytes. According to the performance analysis results, the most time-consuming steps are input parallelization, k-mer graph construction, and graph simplification (edge merging). For the input parallelization, the input data is divided into virtual fragments with nearly equal size, and the start position and end position of each fragment are automatically separated at the beginning of the reads. Inmore » k-mer graph construction, in order to improve the communication efficiency, the message size is kept constant between any two processes by proportionally increasing the number of nucleotides to the number of processes in the input parallelization step for each round. The memory usage is also decreased because only a small part of the input data is processed in each round. With graph simplification, the communication protocol reduces the number of communication loops from four to two loops and decreases the idle communication time. The optimized assembler is denoted as SWAP-Assembler 2 (SWAP2). In our experiments using a 1000 Genomes project dataset of 4 terabytes (the largest dataset ever used for assembling) on the supercomputer Mira, the results show that SWAP2 scales to 131,072 cores with an efficiency of 40%. We also compared our work with both the HipMER assembler and the SWAP-Assembler. On the Yanhuang dataset of 300 gigabytes, SWAP2 shows a 3X speedup and 4X better scalability compared with the HipMer assembler and is 45 times faster than the SWAP-Assembler. The SWAP2 software is available at https://sourceforge.net/projects/swapassembler.« less

Analysis of Ebola Virus Entry Into Macrophages.

PubMed

Dahlmann, Franziska; Biedenkopf, Nadine; Babler, Anne; Jahnen-Dechent, Willi; Karsten, Christina B; Gnirß, Kerstin; Schneider, Heike; Wrensch, Florian; O'Callaghan, Christopher A; Bertram, Stephanie; Herrler, Georg; Becker, Stephan; Pöhlmann, Stefan; Hofmann-Winkler, Heike

2015-10-01

Ebolaviruses constitute a public health threat, particularly in Central and Western Africa. Host cell factors required for spread of ebolaviruses may serve as targets for antiviral intervention. Lectins, TAM receptor tyrosine kinases (Tyro3, Axl, Mer), T cell immunoglobulin and mucin domain (TIM) proteins, integrins, and Niemann-Pick C1 (NPC1) have been reported to promote entry of ebolaviruses into certain cellular systems. However, the factors used by ebolaviruses to invade macrophages, major viral targets, are poorly defined. Here, we show that mannose-specific lectins, TIM-1 and Axl augment entry into certain cell lines but do not contribute to Ebola virus (EBOV)-glycoprotein (GP)-driven transduction of macrophages. In contrast, expression of Mer, integrin αV, and NPC1 was required for efficient GP-mediated transduction and EBOV infection of macrophages. These results define cellular factors hijacked by EBOV for entry into macrophages and, considering that Mer and integrin αV promote phagocytosis of apoptotic cells, support the concept that EBOV relies on apoptotic mimicry to invade target cells. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

Professional tennis players' serve: correlation between segmental angular momentums and ball velocity.

PubMed

Martin, Caroline; Kulpa, Richard; Delamarche, Paul; Bideau, Benoit

2013-03-01

The purpose of the study was to identify the relationships between segmental angular momentum and ball velocity between the following events: ball toss, maximal elbow flexion (MEF), racket lowest point (RLP), maximal shoulder external rotation (MER), and ball impact (BI). Ten tennis players performed serves recorded with a real-time motion capture. Mean angular momentums of the trunk, upper arm, forearm, and the hand-racket were calculated. The anteroposterior axis angular momentum of the trunk was significantly related with ball velocity during the MEF-RLP, RLP-MER, and MER-BI phases. The strongest relationships between the transverse-axis angular momentums and ball velocity followed a proximal-to-distal timing sequence that allows the transfer of angular momentum from the trunk (MEF-RLP and RLP-MER phases) to the upper arm (RLP-MER phase), forearm (RLP-MER and MER-BI phases), and the hand-racket (MER-BI phase). Since sequence is crucial for ball velocity, players should increase angular momentums of the trunk during MEF-MER, upper arm during RLP-MER, forearm during RLP-BI, and the hand-racket during MER-BI.

Development and validation of novel AAV2 random libraries displaying peptides of diverse lengths and at diverse capsid positions.

PubMed

Naumer, Matthias; Ying, Ying; Michelfelder, Stefan; Reuter, Antje; Trepel, Martin; Müller, Oliver J; Kleinschmidt, Jürgen A

2012-05-01

Libraries based on the insertion of random peptide ligands into the capsid of adeno-associated virus type 2 (AAV2) have been widely used to improve the efficiency and selectivity of the AAV vector system. However, so far only libraries of 7-mer peptide ligands have been inserted at one well-characterized capsid position. Here, we expanded the combinatorial AAV2 display system to a panel of novel AAV libraries, displaying peptides of 5, 7, 12, 19, or 26 amino acids in length at capsid position 588 or displaying 7-mer peptides at position 453, the most prominently exposed region of the viral capsid. Library selections on two unrelated cell types-human coronary artery endothelial cells and rat cardiomyoblasts-revealed the isolation of cell type-characteristic peptides of different lengths mediating strongly improved target-cell transduction, except for the 26-mer peptide ligands. Characterization of vector selectivity by transduction of nontarget cells and comparative gene-transduction analysis using a panel of 44 human tumor cell lines revealed that insertion of different-length peptides allows targeting of distinct cellular receptors for cell entry with similar efficiency, but with different selectivity. The application of such novel AAV2 libraries broadens the spectrum of targetable receptors by capsid-modified AAV vectors and provides the opportunity to choose the best suited targeting ligand for a certain application from a number of different candidates.

R4SA for Controlling Robots

NASA Technical Reports Server (NTRS)

Aghazarian, Hrand

2009-01-01

The R4SA GUI mentioned in the immediately preceding article is a userfriendly interface for controlling one or more robot(s). This GUI makes it possible to perform meaningful real-time field experiments and research in robotics at an unmatched level of fidelity, within minutes of setup. It provides such powerful graphing modes as that of a digitizing oscilloscope that displays up to 250 variables at rates between 1 and 200 Hz. This GUI can be configured as multiple intuitive interfaces for acquisition of data, command, and control to enable rapid testing of subsystems or an entire robot system while simultaneously performing analysis of data. The R4SA software establishes an intuitive component-based design environment that can be easily reconfigured for any robotic platform by creating or editing setup configuration files. The R4SA GUI enables event-driven and conditional sequencing similar to those of Mars Exploration Rover (MER) operations. It has been certified as part of the MER ground support equipment and, therefore, is allowed to be utilized in conjunction with MER flight hardware. The R4SA GUI could also be adapted to use in embedded computing systems, other than that of the MER, for commanding and real-time analysis of data.

Preventing cleavage of Mer promotes efferocytosis and suppresses acute lung injury in bleomycin treated mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Ye-Ji; Tissue Injury Defense Research Center, School of Medicine, Ewha Womans University, Seoul; Lee, Seung-Hae

2012-08-15

Mer receptor tyrosine kinase (Mer) regulates macrophage activation and promotes apoptotic cell clearance. Mer activation is regulated through proteolytic cleavage of the extracellular domain. To determine if membrane-bound Mer is cleaved during bleomycin-induced lung injury, and, if so, how preventing the cleavage of Mer enhances apoptotic cell uptake and down-regulates pulmonary immune responses. During bleomycin-induced acute lung injury in mice, membrane-bound Mer expression decreased, but production of soluble Mer and activity as well as expression of disintegrin and metalloproteinase 17 (ADAM17) were enhanced . Treatment with the ADAM inhibitor TAPI-0 restored Mer expression and diminished soluble Mer production. Furthermore, TAPI-0more » increased Mer activation in alveolar macrophages and lung tissue resulting in enhanced apoptotic cell clearance in vivo and ex vivo by alveolar macrophages. Suppression of bleomycin-induced pro-inflammatory mediators, but enhancement of hepatocyte growth factor induction were seen after TAPI-0 treatment. Additional bleomycin-induced inflammatory responses reduced by TAPI-0 treatment included inflammatory cell recruitment into the lungs, levels of total protein and lactate dehydrogenase activity in bronchoalveolar lavage fluid, as well as caspase-3 and caspase-9 activity and alveolar epithelial cell apoptosis in lung tissue. Importantly, the effects of TAPI-0 on bleomycin-induced inflammation and apoptosis were reversed by coadministration of specific Mer-neutralizing antibodies. These findings suggest that restored membrane-bound Mer expression by TAPI-0 treatment may help resolve lung inflammation and apoptosis after bleomycin treatment. -- Highlights: ►Mer expression is restored by TAPI-0 treatment in bleomycin-stimulated lung. ►Mer signaling is enhanced by TAPI-0 treatment in bleomycin-stimulated lung. ►TAPI-0 enhances efferocytosis and promotes resolution of lung injury.« less

Combining Orthogonal Chain-End Deprotections and Thiol-Maleimide Michael Coupling: Engineering Discrete Oligomers by an Iterative Growth Strategy.

PubMed

Huang, Zhihao; Zhao, Junfei; Wang, Zimu; Meng, Fanying; Ding, Kunshan; Pan, Xiangqiang; Zhou, Nianchen; Li, Xiaopeng; Zhang, Zhengbiao; Zhu, Xiulin

2017-10-23

Orthogonal maleimide and thiol deprotections were combined with thiol-maleimide coupling to synthesize discrete oligomers/macromolecules on a gram scale with molecular weights up to 27.4 kDa (128mer, 7.9 g) using an iterative exponential growth strategy with a degree of polymerization (DP) of 2 n -1. Using the same chemistry, a "readable" sequence-defined oligomer and a discrete cyclic topology were also created. Furthermore, uniform dendrons were fabricated using sequential growth (DP=2 n -1) or double exponential dendrimer growth approaches (DP=22n -1) with significantly accelerated growth rates. A versatile, efficient, and metal-free method for construction of discrete oligomers with tailored structures and a high growth rate would greatly facilitate research into the structure-property relationships of sophisticated polymeric materials. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Effects of Clock Drift on the Mars Exploration Rovers

NASA Technical Reports Server (NTRS)

Ali, Khaled S.; Vanelli, C. Anthony

2012-01-01

All clocks drift by some amount, and the mission clock on the Mars Exploration Rovers (MER) is no exception. The mission clock on both MER rovers drifted significantly since the rovers were launched, and it is still drifting on the Opportunity rover. The drift rate is temperature dependent. Clock drift causes problems for onboard behaviors and spacecraft operations, such as attitude estimation, driving, operation of the robotic arm, pointing for imaging, power analysis, and telecom analysis. The MER operations team has techniques to deal with some of these problems. There are a few techniques for reducing and eliminating the clock drift, but each has drawbacks. This paper presents an explanation of what is meant by clock drift on the rovers, its relationship to temperature, how we measure it, what problems it causes, how we deal with those problems, and techniques for reducing the drift.

TAM receptors Tyro3 and Mer as novel targets in colorectal cancer.

PubMed

Schmitz, Robin; Valls, Aida Freire; Yerbes, Rosario; von Richter, Sophie; Kahlert, Christoph; Loges, Sonja; Weitz, Jürgen; Schneider, Martin; Ruiz de Almodovar, Carmen; Ulrich, Alexis; Schmidt, Thomas

2016-08-30

CRC remains the third most common cancer worldwide with a high 5-year mortality rate in advanced cases. Combined with chemotherapy, targeted therapy is an additional treatment option. However as CRC still escapes targeted therapy the vigorous search for new targets is warranted to increase patients´ overall survival. In this study we describe a new role for Gas6/protein S-TAM receptor interaction in CRC. Gas6, expressed by tumor-infiltrating M2-like macrophages, enhances malignant properties of tumor cells including proliferation, invasion and colony formation. Upon chemotherapy macrophages increase Gas6 synthesis, which significantly attenuates the cytotoxic effect of 5-FU chemotherapy on tumor cells. The anti-coagulant protein S has similar effects as Gas6.In CRC patient samples Tyro3 was overexpressed within the tumor. In-vitro inhibition of Tyro3 and Mer reduces tumor cell proliferation and sensitizes tumor cells to chemotherapy. Moreover high expression of Tyro3 and Mer in tumor tissue significantly shortens CRC patients´ survival. Various in vitro models were used to investigate the role of Gas6 and its TAM receptors in human CRC cells, by stimulation (rhGas6) and knockdown (siRNA) of Axl, Tyro3 and Mer. In terms of a translational research, we additionally performed an expression analysis in human CRC tissue and analyzed the medical record of these patients. Tyro3 and Mer represent novel therapeutic targets in CRC and warrant further preclinical and clinical investigation in the future.

Extreme-Scale De Novo Genome Assembly

DOE Office of Scientific and Technical Information (OSTI.GOV)

Georganas, Evangelos; Hofmeyr, Steven; Egan, Rob

De novo whole genome assembly reconstructs genomic sequence from short, overlapping, and potentially erroneous DNA segments and is one of the most important computations in modern genomics. This work presents HipMER, a high-quality end-to-end de novo assembler designed for extreme scale analysis, via efficient parallelization of the Meraculous code. Genome assembly software has many components, each of which stresses different components of a computer system. This chapter explains the computational challenges involved in each step of the HipMer pipeline, the key distributed data structures, and communication costs in detail. We present performance results of assembling the human genome and themore » large hexaploid wheat genome on large supercomputers up to tens of thousands of cores.« less

A Novel Role of MerC in Methylmercury Transport and Phytoremediation of Methylmercury Contamination.

PubMed

Sone, Yuka; Uraguchi, Shimpei; Takanezawa, Yasukazu; Nakamura, Ryosuke; Pan-Hou, Hidemitsu; Kiyono, Masako

2017-01-01

MerC, encoded by merC in the transposon Tn21 mer operon, is a heavy metal transporter with potential applications for phytoremediation of heavy metals such as mercuric ion and cadmium. In this study, we demonstrate that MerC also acts as a transporter for methylmercury. When MerC was expressed in Escherichia coli XL1-Blue, cells became hypersensitive to CH 3 Hg(I) and the uptake of CH 3 Hg(I) by these cells was higher than that by cells of the isogenic strain. Moreover, transgenic Arabidopsis plants expressing bacterial MerC or MerC fused to plant soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs) accumulated CH 3 Hg(I) effectively and their growth was comparable to the wild-type plants. These results demonstrate that when the bacterium-derived merC gene is ectopically introduced in genetically modified plants, MerC expression in the transgenic plants promotes the transport and sequestration of methylmercury. Thus, our results show that the expression of merC in Arabidopsis results in transgenic plants that could be used for the phytoremediation and elimination of toxic methylmercury from the environment.

Phytoremediation of Ionic and Methyl Mercury P

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meagher, Richard B.

1999-06-01

Our long-term goal is to enable highly productive plant species to extract, resist, detoxify, and/or sequester toxic heavy metal pollutants as an environmentally friendly alternative to physical remediation methods. We have focused this phytoremediation research on soil and water-borne ionic and methylmercury. Mercury pollution is a serious world-wide problem affecting the health of human and wild-life populations. Methylmercury, produced by native bacteria at mercury-contaminated wetland sites, is a particularly serious problem due to its extreme toxicity and efficient biomagnification in the food chain. We engineered several plant species (e.g., Arabidopsis, tobacco, canola, yellow poplar, rice) to express the bacterial genes,more » merB and/or merA, under the control of plant regulatory sequences. These transgenic plants acquired remarkable properties for mercury remediation. (1) Transgenic plants expressing merB (organomercury lyase) extract methylmercury from their growth substrate and degrade it to less toxic ionic mercury. They grow on concentrations of methylmercury that kill normal plants and accumulate low levels of ionic mercury. (2) Transgenic plants expressing merA (mercuric ion reductase) extract and electrochemically reduce toxic, reactive ionic mercury to much less toxic and volatile metallic mercury. This metal transformation is driven by the powerful photosynthetic reducing capacity of higher plants that generates excess NADPH using solar energy. MerA plants grow vigorously on levels of ionic mercury that kill control plants. Plants expressing both merB and merA degrade high levels of methylmercury and volatilize metallic mercury. These properties were shown to be genetically stable for several generations in the two plant species examined. Our work demonstrates that native trees, shrubs, and grasses can be engineered to remediate the most abundant toxic mercury pollutants. Building on these data our working hypothesis for the next grant period is that transgenic plants expressing the bacterial merB and merA genes will (a) remove mercury from polluted soil and water and (b) prevent methylmercury from entering the food chain. Our specific aims center on understanding the mechanisms by which plants process the various forms of mercury and volatilize or transpire mercury vapor. This information will allow us to improve the design of our current phytoremediation strategies. As an alternative to volatilizing mercury, we are using several new genes to construct plants that will hyperaccumulate mercury in above-ground tissues for later harvest. The Department of Energy's Oak Ridge National Laboratory and Brookhaven National Laboratory have sites with significant levels of mercury contamination that could be cleaned by applying the scientific discoveries and new phytoremediation technologies described in this proposal. The knowledge and expertise gained by engineering plants to hyperaccumulate mercury can be applied to the remediation of other heavy metals pollutants (e.g., arsenic, cesium, cadmium, chromium, lead, strontium, technetium, uranium) found at several DOE facilities.« less

Structural and Biochemical Characterization of a Copper-Binding Mutant of the Organomercurial Lyase MerB: Insight into the Key Role of the Active Site Aspartic Acid in Hg-Carbon Bond Cleavage and Metal Binding Specificity.

PubMed

Wahba, Haytham M; Lecoq, Lauriane; Stevenson, Michael; Mansour, Ahmed; Cappadocia, Laurent; Lafrance-Vanasse, Julien; Wilkinson, Kevin J; Sygusch, Jurgen; Wilcox, Dean E; Omichinski, James G

2016-02-23

In bacterial resistance to mercury, the organomercurial lyase (MerB) plays a key role in the detoxification pathway through its ability to cleave Hg-carbon bonds. Two cysteines (C96 and C159; Escherichia coli MerB numbering) and an aspartic acid (D99) have been identified as the key catalytic residues, and these three residues are conserved in all but four known MerB variants, where the aspartic acid is replaced with a serine. To understand the role of the active site serine, we characterized the structure and metal binding properties of an E. coli MerB mutant with a serine substituted for D99 (MerB D99S) as well as one of the native MerB variants containing a serine residue in the active site (Bacillus megaterium MerB2). Surprisingly, the MerB D99S protein copurified with a bound metal that was determined to be Cu(II) from UV-vis absorption, inductively coupled plasma mass spectrometry, nuclear magnetic resonance, and electron paramagnetic resonance studies. X-ray structural studies revealed that the Cu(II) is bound to the active site cysteine residues of MerB D99S, but that it is displaced following the addition of either an organomercurial substrate or an ionic mercury product. In contrast, the B. megaterium MerB2 protein does not copurify with copper, but the structure of the B. megaterium MerB2-Hg complex is highly similar to the structure of the MerB D99S-Hg complexes. These results demonstrate that the active site aspartic acid is crucial for both the enzymatic activity and metal binding specificity of MerB proteins and suggest a possible functional relationship between MerB and its only known structural homologue, the copper-binding protein NosL.

Role of MR-DWI and MR-PWI in the radiotherapy of implanted pulmonary VX-2 carcinoma in rabbits.

PubMed

Zhang, Qiang; Zhang, Mingmin; Liu, Zhaoxin; Shi, Baoqi; Qi, Fuliang; Wang, Haijiang; Lv, Yuan; Jin, Haijiao; Zhang, Weijing

2014-10-01

To detect the activity of tumor cells and tumor blood flow before and after the radiotherapy of implanted pulmonary VX-2 carcinoma in rabbit models by using magnetic resonance diffusion-weighted imaging (MR-DWI) and magnetic resonance perfusion weighted imaging (MR-PWI), and to evaluate the effectiveness and safety of the radiotherapy based on the changes in the MR-DWI and MR-PWI parameters at different treatment stages. A total of 56 rabbit models with implanted pulmonary VX-2 carcinoma were established, and then equally divided into treatment group and control group. MR-DWI and MR-PWI were separately performed using a Philips Acheiva 1.5T MRI machine (Philips, Netherland). MRI image processing was performed using special perfusion software and the WORKSPACE advanced workstation for MRI. MR-DWI was applied for the observation of tumor signals and the measurement of apparent diffusion coefficient (ADC) values; whereas MR-PWI was used for the measurement of wash in rate (WIR), wash out rate (WOR), and maximum enhancement rate (MER). The radiation treatment was performed using Siemens PRIMUS linear accelerator. In the treatment group, the radiotherapy was performed 21 days later on a once weekly dosage of 1,000 cGy to yield a total dosage of 5,000 cGy. THE ADC PARAMETERS IN THE REGION OF INTEREST ON DWI WERE AS FOLLOWS: on the treatment day for the implanted pulmonary VX-2 carcinoma, the t values at the center and the edge of the lesions were 1.352 and 1.461 in the treatment group and control group (P>0.05). During weeks 0-1 after treatment, the t values at the center and the edge of the lesions were 1.336 and 1.137 (P>0.05). During weeks 1-2, the t values were 1.731 and 1.736 (P<0.05). During weeks 2-3, the t values were 1.742 and 1.749 (P<0.05). During weeks 3-4, the t values were 2.050 and 2.127 (P<0.05). During weeks 4-5, the t values were 2.764 and 2.985 (P<0.05). The ADC values in the treatment group were significantly higher than in the control group. After the radiotherapy (5,000 cGy), the tumors remarkably shrank, along with low signal on DWI, decreased signal on ADC map, and remarkably increased ADC values. As shown on PWI, on the treatment day for the implanted pulmonary VX-2 carcinoma, the t values of the WIR, WOR, and MER at the center of the lesions were 1.05, 1.31, and 1.33 in the treatment group and control group (P>0.05); in addition, the t values of the WIR, WOR, and MER at the edge of the lesions were 1.35, 1.07, and 1.51 (P>0.05). During weeks 0-1 after treatment, the t values of the WIR, WOR, and MER at the center of the lesions were 1.821, 1.856, and 1.931 (P<0.05); in addition, the t values of the WIR, WOR, and MER at the edge of the lesions were 1.799, 2.016, and 2.137 (P<0.05). During weeks 1-1 after treatment, the t values of the WIR, WOR, and MER at the center of the lesions were 2.574, 2.156, and 2.059 (P<0.05) and the t values of the WIR, WOR, and MER at the edge of the lesions were 1.869, 2.058, and 2.057 (P<0.05). During weeks 2-3 after treatment, the t values of the WIR, WOR, and MER at the center of the lesions were 2.461, 2.098, and 2.739 (P<0.05) and the t values of the WIR, WOR, and MER at the edge of the lesions were 2.951, 2.625, and 2.154 (P<0.05). During weeks 3-4 after treatment, the t values of the WIR, WOR, and MER at the center of the lesions were 2.584, 2.107, and 2.869 (P<0.05) and the t values of the WIR, WOR, and MER at the edge of the lesions were 2.057, 2.637, and 2.951 (P<0.05). During weeks 4-5 after treatment, the t values of the WIR, WOR, and MER at the center of the lesions were 2.894, 2.827, and 3.285 (P<0.05) and the t values of the WIR, WOR, and MER at the edge of the lesions were 3.45, 3.246, and 3.614 (P<0.05). After the radiotherapy (500 cGy), the tumors shrank on the T1WI, WIR, WOR, and MER; meanwhile, the PWI parameter gradually decreased and reached its minimum value. MR-DWI and MR-PWI can accurately and directly reflect the inactivation of tumor cells and the tumor hemodynamics in rabbit models with implanted pulmonary VX-2 carcinoma, and thus provide theoretical evidences for judging the clinical effectiveness of radiotherapy for the squamous cell carcinoma of the lung.

Analysis of mercuric reductase (merA) gene diversity in an anaerobic mercury-contaminated sediment enrichment.

PubMed

Ní Chadhain, Sinéad M; Schaefer, Jeffra K; Crane, Sharron; Zylstra, Gerben J; Barkay, Tamar

2006-10-01

The reduction of ionic mercury to elemental mercury by the mercuric reductase (MerA) enzyme plays an important role in the biogeochemical cycling of mercury in contaminated environments by partitioning mercury to the atmosphere. This activity, common in aerobic environments, has rarely been examined in anoxic sediments where production of highly toxic methylmercury occurs. Novel degenerate PCR primers were developed which span the known diversity of merA genes in Gram-negative bacteria and amplify a 285 bp fragment at the 3' end of merA. These primers were used to create a clone library and to analyse merA diversity in an anaerobic sediment enrichment collected from a mercury-contaminated site in the Meadowlands, New Jersey. A total of 174 sequences were analysed, representing 71 merA phylotypes and four novel MerA clades. This first examination of merA diversity in anoxic environments suggests an untapped resource for novel merA sequences.

Discovery of Novel Bat Coronaviruses in South China That Use the Same Receptor as Middle East Respiratory Syndrome Coronavirus.

PubMed

Luo, Chu-Ming; Wang, Ning; Yang, Xing-Lou; Liu, Hai-Zhou; Zhang, Wei; Li, Bei; Hu, Ben; Peng, Cheng; Geng, Qi-Bin; Zhu, Guang-Jian; Li, Fang; Shi, Zheng-Li

2018-07-01

Middle East respiratory syndrome coronavirus (MERS-CoV) has represented a human health threat since 2012. Although several MERS-related CoVs that belong to the same species as MERS-CoV have been identified from bats, they do not use the MERS-CoV receptor, dipeptidyl peptidase 4 (DPP4). Here, we screened 1,059 bat samples from at least 30 bat species collected in different regions in south China and identified 89 strains of lineage C betacoronaviruses, including Tylonycteris pachypus coronavirus HKU4 , Pipistrellus pipistrellus coronavirus HKU5 , and MERS-related CoVs. We sequenced the full-length genomes of two positive samples collected from the great evening bat, Ia io , from Guangdong Province. The two genomes were highly similar and exhibited genomic structures identical to those of other lineage C betacoronaviruses. While they exhibited genome-wide nucleotide identities of only 75.3 to 81.2% with other MERS-related CoVs, their gene-coding regions were highly similar to their counterparts, except in the case of the spike proteins. Further protein-protein interaction assays demonstrated that the spike proteins of these MERS-related CoVs bind to the receptor DPP4. Recombination analysis suggested that the newly discovered MERS-related CoVs have acquired their spike genes from a DPP4-recognizing bat coronavirus HKU4. Our study provides further evidence that bats represent the evolutionary origins of MERS-CoV. IMPORTANCE Previous studies suggested that MERS-CoV originated in bats. However, its evolutionary path from bats to humans remains unclear. In this study, we discovered 89 novel lineage C betacoronaviruses in eight bat species. We provide evidence of a MERS-related CoV derived from the great evening bat that uses the same host receptor as human MERS-CoV. This virus also provides evidence for a natural recombination event between the bat MERS-related CoV and another bat coronavirus, HKU4. Our study expands the host ranges of MERS-related CoV and represents an important step toward establishing bats as the natural reservoir of MERS-CoV. These findings may lead to improved epidemiological surveillance of MERS-CoV and the prevention and control of the spread of MERS-CoV to humans. Copyright © 2018 American Society for Microbiology.

High correlation of Middle East respiratory syndrome spread with Google search and Twitter trends in Korea.

PubMed

Shin, Soo-Yong; Seo, Dong-Woo; An, Jisun; Kwak, Haewoon; Kim, Sung-Han; Gwack, Jin; Jo, Min-Woo

2016-09-06

The Middle East respiratory syndrome coronavirus (MERS-CoV) was exported to Korea in 2015, resulting in a threat to neighboring nations. We evaluated the possibility of using a digital surveillance system based on web searches and social media data to monitor this MERS outbreak. We collected the number of daily laboratory-confirmed MERS cases and quarantined cases from May 11, 2015 to June 26, 2015 using the Korean government MERS portal. The daily trends observed via Google search and Twitter during the same time period were also ascertained using Google Trends and Topsy. Correlations among the data were then examined using Spearman correlation analysis. We found high correlations (>0.7) between Google search and Twitter results and the number of confirmed MERS cases for the previous three days using only four simple keywords: "MERS", " ("MERS (in Korean)"), " ("MERS symptoms (in Korean)"), and " ("MERS hospital (in Korean)"). Additionally, we found high correlations between the Google search and Twitter results and the number of quarantined cases using the above keywords. This study demonstrates the possibility of using a digital surveillance system to monitor the outbreak of MERS.

Mild encephalitis/encephalopathy with reversible splenial lesion (MERS) in adults-a case report and literature review.

PubMed

Yuan, Junliang; Yang, Shuna; Wang, Shuangkun; Qin, Wei; Yang, Lei; Hu, Wenli

2017-05-25

Mild encephalitis/encephalopathy with reversible splenial lesion (MERS) is a rare clinico-radiological entity characterized by the magnetic resonance imaging (MRI) finding of a reversible lesion in the corpus callosum, sometimes involved the symmetrical white matters. Many cases of child-onset MERS with various causes have been reported. However, adult-onset MERS is relatively rare. The clinical characteristics and pathophysiologiccal mechanisms of adult-onset MERS are not well understood. We reviewed the literature on adult-onset MERS in order to describe the characteristics of MERS in adults and to provide experiences for clinician. We reported a case of adult-onset MERS with acute urinary retension and performed literature search from PubMed and web of science databases to identify other adult-onset MERS reports from Januarary 2004 to March 2016. Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guideline was followed on selection process. And then we summarized the clinico-radiological features of adult-onset MERS. Twenty-nine adult-onset MERS cases were reviewed from available literature including the case we have. 86.2% of the cases (25/29) were reported in Asia, especially in Japan. Ages varied between 18 and 59 years old with a 12:17 female-to-male ratio. The major cause was infection by virus or bacteria. Fever and headache were the most common clinical manifestation, and acute urinary retention was observed in 6 patients. All patients recovered completely within a month. Adult-onset MERS is an entity with a broad clinico-radiological spectrum because of the various diseases and conditions. There are similar characteristics between MERS in adults and children, also some differences.

Extensive Viable Middle East Respiratory Syndrome (MERS) Coronavirus Contamination in Air and Surrounding Environment in MERS Isolation Wards.

PubMed

Kim, Sung-Han; Chang, So Young; Sung, Minki; Park, Ji Hoon; Bin Kim, Hong; Lee, Heeyoung; Choi, Jae-Phil; Choi, Won Suk; Min, Ji-Young

2016-08-01

The largest outbreak of Middle East respiratory syndrome coronavirus (MERS-CoV) outside the Middle East occurred in South Korea in 2015 and resulted in 186 laboratory-confirmed infections, including 36 (19%) deaths. Some hospitals were considered epicenters of infection and voluntarily shut down most of their operations after nearly half of all transmissions occurred in hospital settings. However, the ways that MERS-CoV is transmitted in healthcare settings are not well defined. We explored the possible contribution of contaminated hospital air and surfaces to MERS transmission by collecting air and swabbing environmental surfaces in 2 hospitals treating MERS-CoV patients. The samples were tested by viral culture with reverse transcription polymerase chain reaction (RT-PCR) and immunofluorescence assay (IFA) using MERS-CoV Spike antibody, and electron microscopy (EM). The presence of MERS-CoV was confirmed by RT-PCR of viral cultures of 4 of 7 air samples from 2 patients' rooms, 1 patient's restroom, and 1 common corridor. In addition, MERS-CoV was detected in 15 of 68 surface swabs by viral cultures. IFA on the cultures of the air and swab samples revealed the presence of MERS-CoV. EM images also revealed intact particles of MERS-CoV in viral cultures of the air and swab samples. These data provide experimental evidence for extensive viable MERS-CoV contamination of the air and surrounding materials in MERS outbreak units. Thus, our findings call for epidemiologic investigation of the possible scenarios for contact and airborne transmission, and raise concern regarding the adequacy of current infection control procedures. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Rare k-mer DNA: Identification of sequence motifs and prediction of CpG island and promoter.

PubMed

Mohamed Hashim, Ezzeddin Kamil; Abdullah, Rosni

2015-12-21

Empirical analysis on k-mer DNA has been proven as an effective tool in finding unique patterns in DNA sequences which can lead to the discovery of potential sequence motifs. In an extensive study of empirical k-mer DNA on hundreds of organisms, the researchers found unique multi-modal k-mer spectra occur in the genomes of organisms from the tetrapod clade only which includes all mammals. The multi-modality is caused by the formation of the two lowest modes where k-mers under them are referred as the rare k-mers. The suppression of the two lowest modes (or the rare k-mers) can be attributed to the CG dinucleotide inclusions in them. Apart from that, the rare k-mers are selectively distributed in certain genomic features of CpG Island (CGI), promoter, 5' UTR, and exon. We correlated the rare k-mers with hundreds of annotated features using several bioinformatic tools, performed further intrinsic rare k-mer analyses within the correlated features, and modeled the elucidated rare k-mer clustering feature into a classifier to predict the correlated CGI and promoter features. Our correlation results show that rare k-mers are highly associated with several annotated features of CGI, promoter, 5' UTR, and open chromatin regions. Our intrinsic results show that rare k-mers have several unique topological, compositional, and clustering properties in CGI and promoter features. Finally, the performances of our RWC (rare-word clustering) method in predicting the CGI and promoter features are ranked among the top three, in eight of the CGI and promoter evaluations, among eight of the benchmarked datasets. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.

Origin and Possible Genetic Recombination of the Middle East Respiratory Syndrome Coronavirus from the First Imported Case in China: Phylogenetics and Coalescence Analysis.

PubMed

Wang, Yanqun; Liu, Di; Shi, Weifeng; Lu, Roujian; Wang, Wenling; Zhao, Yanjie; Deng, Yao; Zhou, Weimin; Ren, Hongguang; Wu, Jun; Wang, Yu; Wu, Guizhen; Gao, George F; Tan, Wenjie

2015-09-08

The Middle East respiratory syndrome coronavirus (MERS-CoV) causes a severe acute respiratory tract infection with a high fatality rate in humans. Coronaviruses are capable of infecting multiple species and can evolve rapidly through recombination events. Here, we report the complete genomic sequence analysis of a MERS-CoV strain imported to China from South Korea. The imported virus, provisionally named ChinaGD01, belongs to group 3 in clade B in the whole-genome phylogenetic tree and also has a similar tree topology structure in the open reading frame 1a and -b (ORF1ab) gene segment but clusters with group 5 of clade B in the tree constructed using the S gene. Genetic recombination analysis and lineage-specific single-nucleotide polymorphism (SNP) comparison suggest that the imported virus is a recombinant comprising group 3 and group 5 elements. The time-resolved phylogenetic estimation indicates that the recombination event likely occurred in the second half of 2014. Genetic recombination events between group 3 and group 5 of clade B may have implications for the transmissibility of the virus. The recent outbreak of MERS-CoV in South Korea has attracted global media attention due to the speed of spread and onward transmission. Here, we present the complete genome of the first imported MERS-CoV case in China and demonstrate genetic recombination events between group 3 and group 5 of clade B that may have implications for the transmissibility of MERS-CoV. Copyright © 2015 Wang et al.

The MER/CIP Portal for Ground Operations

NASA Technical Reports Server (NTRS)

Chan, Louise; Desai, Sanjay; DOrtenzio, Matthew; Filman, Robtert E.; Heher, Dennis M.; Hubbard, Kim; Johan, Sandra; Keely, Leslie; Magapu, Vish; Mak, Ronald

2003-01-01

We developed the Mars Exploration Rover/Collaborative Information Portal (MER/CIP) to facilitate MER operations. MER/CIP provides a centralized, one-stop delivery platform integrating science and engineering data from several distributed heterogeneous data sources. Key issues for MER/CIP include: 1) Scheduling and schedule reminders; 2) Tracking the status of daily predicted outputs; 3) Finding and analyzing data products; 4) Collaboration; 5) Announcements; 6) Personalization.

CAFE: aCcelerated Alignment-FrEe sequence analysis

PubMed Central

Lu, Yang Young; Tang, Kujin; Ren, Jie; Fuhrman, Jed A.; Waterman, Michael S.

2017-01-01

Abstract Alignment-free genome and metagenome comparisons are increasingly important with the development of next generation sequencing (NGS) technologies. Recently developed state-of-the-art k-mer based alignment-free dissimilarity measures including CVTree, \\documentclass[12pt]{minimal} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{amsbsy} \\usepackage{upgreek} \\usepackage{mathrsfs} \\setlength{\\oddsidemargin}{-69pt} \\begin{document} }{}$d_2^*$\\end{document} and \\documentclass[12pt]{minimal} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{amsbsy} \\usepackage{upgreek} \\usepackage{mathrsfs} \\setlength{\\oddsidemargin}{-69pt} \\begin{document} }{}$d_2^S$\\end{document} are more computationally expensive than measures based solely on the k-mer frequencies. Here, we report a standalone software, aCcelerated Alignment-FrEe sequence analysis (CAFE), for efficient calculation of 28 alignment-free dissimilarity measures. CAFE allows for both assembled genome sequences and unassembled NGS shotgun reads as input, and wraps the output in a standard PHYLIP format. In downstream analyses, CAFE can also be used to visualize the pairwise dissimilarity measures, including dendrograms, heatmap, principal coordinate analysis and network display. CAFE serves as a general k-mer based alignment-free analysis platform for studying the relationships among genomes and metagenomes, and is freely available at https://github.com/younglululu/CAFE. PMID:28472388

Control of silicification by genetically engineered fusion proteins: silk-silica binding peptides.

PubMed

Zhou, Shun; Huang, Wenwen; Belton, David J; Simmons, Leo O; Perry, Carole C; Wang, Xiaoqin; Kaplan, David L

2015-03-01

In the present study, an artificial spider silk gene, 6mer, derived from the consensus sequence of Nephila clavipes dragline silk gene, was fused with different silica-binding peptides (SiBPs), A1, A3 and R5, to study the impact of the fusion protein sequence chemistry on silica formation and the ability to generate a silk-silica composite in two different bioinspired silicification systems: solution-solution and solution-solid. Condensed silica nanoscale particles (600-800 nm) were formed in the presence of the recombinant silk and chimeras, which were smaller than those formed by 15mer-SiBP chimeras, revealing that the molecular weight of the silk domain correlated to the sizes of the condensed silica particles in the solution system. In addition, the chimeras (6mer-A1/A3/R5) produced smaller condensed silica particles than the control (6mer), revealing that the silica particle size formed in the solution system is controlled by the size of protein assemblies in solution. In the solution-solid interface system, silicification reactions were performed on the surface of films fabricated from the recombinant silk proteins and chimeras and then treated to induce β-sheet formation. A higher density of condensed silica formed on the films containing the lowest β-sheet content while the films with the highest β-sheet content precipitated the lowest density of silica, revealing an inverse correlation between the β-sheet secondary structure and the silica content formed on the films. Intriguingly, the 6mer-A3 showed the highest rate of silica condensation but the lowest density of silica deposition on the films, compared with 6mer-A1 and -R5, revealing antagonistic crosstalk between the silk and the SiBP domains in terms of protein assembly. These findings offer a path forward in the tailoring of biopolymer-silica composites for biomaterial related needs. Copyright © 2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Control of silicification by genetically engineered fusion proteins: Silk–silica binding peptides

PubMed Central

Zhou, Shun; Huang, Wenwen; Belton, David J.; Simmons, Leo O.; Perry, Carole C.; Wang, Xiaoqin; Kaplan, David L.

2014-01-01

In the present study, an artificial spider silk gene, 6mer, derived from the consensus sequence of Nephila clavipes dragline silk gene, was fused with different silica-binding peptides (SiBPs), A1, A3 and R5, to study the impact of the fusion protein sequence chemistry on silica formation and the ability to generate a silk–silica composite in two different bioinspired silicification systems: solution–solution and solution– solid. Condensed silica nanoscale particles (600–800 nm) were formed in the presence of the recombinant silk and chimeras, which were smaller than those formed by 15mer-SiBP chimeras [1], revealing that the molecular weight of the silk domain correlated to the sizes of the condensed silica particles in the solution system. In addition, the chimeras (6mer-A1/A3/R5) produced smaller condensed silica particles than the control (6mer), revealing that the silica particle size formed in the solution system is controlled by the size of protein assemblies in solution. In the solution–solid interface system, silicification reactions were performed on the surface of films fabricated from the recombinant silk proteins and chimeras and then treated to induce β-sheet formation. A higher density of condensed silica formed on the films containing the lowest β-sheet content while the films with the highest β-sheet content precipitated the lowest density of silica, revealing an inverse correlation between the β-sheet secondary structure and the silica content formed on the films. Intriguingly, the 6mer-A3 showed the highest rate of silica condensation but the lowest density of silica deposition on the films, compared with 6mer-A1 and -R5, revealing antagonistic crosstalk between the silk and the SiBP domains in terms of protein assembly. These findings offer a path forward in the tailoring of biopolymer–silica composites for biomaterial related needs. PMID:25462851

MERS-CoV infection: Mind the public knowledge gap.

PubMed

Bawazir, Amen; Al-Mazroo, Eman; Jradi, Hoda; Ahmed, Anwar; Badri, Motasim

In August 2015, the Corona outbreak caused by Middle East respiratory syndrome coronavirus (MERS-CoV) was the 9th episode since June 2012 in Saudi Arabia. Little is known about the public awareness toward the nature or prevention of the disease. The aim of this work was to assess the knowledge of the adult population in Riyadh toward the MERS-CoV. In this cross-sectional survey, a self-administrated questionnaire was distributed to randomly selected participants visiting malls in Riyadh. The questionnaire contained measurable epidemiological and clinical MERS-CoV knowledge level variables and relevant source of information. The study included 676 participants. Mean age was 32.5 (±SD 8.6) years and 353 (47.8%) were males. Almost all participants heard about the corona disease and causative agent. The study showed a fair overall knowledge (66.0%), less knowledge on epidemiological features of the disease (58.3%), and good knowledge (90.7%) on the clinical manifestation of the MERS-CoV. Internet was the major (89.0%) source of disease information, and other sources including health care providers, SMS, television, magazines and books were low rated (all <25%). In a multivariate logistic regression analysis age ≤30 years (Odds Ratio (OR)=1.647, 95%CI 1.048-2.584, P=0.030), male gender (OR=1.536, 95%CI 1.105-2.134, P=0.01), and no tertiary education (OR=1.957, 95%CI 1.264-3.030, P=0.003) were independent significant predictors of poor epidemiological knowledge. This study concludes that there was inadequate epidemiological knowledge received by the public and the reliance mostly on the clinical manifestations to recognizing the MERS-CoV disease. Comprehensive public health education programs is important to increase awareness of simple epidemiological determinants of the disease is warranted. Copyright © 2017. Published by Elsevier Ltd.

“Don’t forget the migrants”: exploring preparedness and response strategies to combat the potential spread of MERS-CoV virus through migrant workers in Sri Lanka

PubMed Central

Agampodi, Suneth B

2013-01-01

From September 2012 to July 2013, 81 laboratory-confirmed cases of infection with Middle East respiratory syndrome coronavirus (MERS-CoV), including 45 deaths (a case fatality ratio of 55%) have been reported from eight countries. Human-to-human transmission is now confirmed showing potential for another pandemic of zoonotic disease, with an extremely high mortality rate. Effective surveillance strategies are required in countries with a high influx of migrants from the Middle East to mitigate the probable importation of MERS-CoV. We discuss here the risk of MERS-CoV in major labor sending countries and list the probable strategies for control and prevention of MERS-CoV using Sri Lanka as an example. It is conservatively estimated that 10% of Sri Lanka’s population work as international labor migrants (1.8 to 2 million workers), with 93% residing in the Middle East. An average of 720 workers depart each day, with the majority of these workers (71%) departing to the Kingdom of Saudi Arabia (the country with 81.5% of total MERS-CoV cases). We also describe other inbound migration categories such as tourists and resident visa holders relevant to the context of preparedness and planning. The importance of partnerships between public health authorities at national and regional levels with labor migration networks to establish institutional and/or policy mechanisms are highlighted for ensuring effective preparedness and response planning. Strategies that can be taken by public health authorities working in both labor sending and labor receiving counties are also described.  The strategies described here may be useful for other labor sending country contexts in Asia with a high frequency and volume of migrant workers to and from the Gulf region. PMID:24555078

Cardiac-Specific Deletion of Pyruvate Dehydrogenase Impairs Glucose Oxidation Rates and Induces Diastolic Dysfunction.

PubMed

Gopal, Keshav; Almutairi, Malak; Al Batran, Rami; Eaton, Farah; Gandhi, Manoj; Ussher, John Reyes

2018-01-01

Obesity and type 2 diabetes (T2D) increase the risk for cardiomyopathy, which is the presence of ventricular dysfunction in the absence of underlying coronary artery disease and/or hypertension. As myocardial energy metabolism is altered during obesity/T2D (increased fatty acid oxidation and decreased glucose oxidation), we hypothesized that restricting myocardial glucose oxidation in lean mice devoid of the perturbed metabolic milieu observed in obesity/T2D would produce a cardiomyopathy phenotype, characterized via diastolic dysfunction. We tested our hypothesis via producing mice with a cardiac-specific gene knockout for pyruvate dehydrogenase (PDH, gene name Pdha1 ), the rate-limiting enzyme for glucose oxidation. Cardiac-specific Pdha1 deficient ( Pdha1 Cardiac-/- ) mice were generated via crossing a tamoxifen-inducible Cre expressing mouse under the control of the alpha-myosin heavy chain (αMHC-MerCreMer) promoter with a floxed Pdha1 mouse. Energy metabolism and cardiac function were assessed via isolated working heart perfusions and ultrasound echocardiography, respectively. Tamoxifen administration produced an ~85% reduction in PDH protein expression in Pdha1 Cardiac-/- mice versus their control littermates, which resulted in a marked reduction in myocardial glucose oxidation and a corresponding increase in palmitate oxidation. This myocardial metabolism profile did not impair systolic function in Pdha1 Cardiac-/- mice, which had comparable left ventricular ejection fractions and fractional shortenings as their αMHC-MerCreMer control littermates, but did produce diastolic dysfunction as seen via the reduced mitral E/A ratio. Therefore, it does appear that forced restriction of glucose oxidation in the hearts of Pdha1 Cardiac-/- mice is sufficient to produce a cardiomyopathy-like phenotype, independent of the perturbed metabolic milieu observed in obesity and/or T2D.

A novel measure and significance testing in data analysis of cell image segmentation.

PubMed

Wu, Jin Chu; Halter, Michael; Kacker, Raghu N; Elliott, John T; Plant, Anne L

2017-03-14

Cell image segmentation (CIS) is an essential part of quantitative imaging of biological cells. Designing a performance measure and conducting significance testing are critical for evaluating and comparing the CIS algorithms for image-based cell assays in cytometry. Many measures and methods have been proposed and implemented to evaluate segmentation methods. However, computing the standard errors (SE) of the measures and their correlation coefficient is not described, and thus the statistical significance of performance differences between CIS algorithms cannot be assessed. We propose the total error rate (TER), a novel performance measure for segmenting all cells in the supervised evaluation. The TER statistically aggregates all misclassification error rates (MER) by taking cell sizes as weights. The MERs are for segmenting each single cell in the population. The TER is fully supported by the pairwise comparisons of MERs using 106 manually segmented ground-truth cells with different sizes and seven CIS algorithms taken from ImageJ. Further, the SE and 95% confidence interval (CI) of TER are computed based on the SE of MER that is calculated using the bootstrap method. An algorithm for computing the correlation coefficient of TERs between two CIS algorithms is also provided. Hence, the 95% CI error bars can be used to classify CIS algorithms. The SEs of TERs and their correlation coefficient can be employed to conduct the hypothesis testing, while the CIs overlap, to determine the statistical significance of the performance differences between CIS algorithms. A novel measure TER of CIS is proposed. The TER's SEs and correlation coefficient are computed. Thereafter, CIS algorithms can be evaluated and compared statistically by conducting the significance testing.

Impact of hardwood species on production cost of second generation ethanol.

PubMed

Santos, Ricardo B; Treasure, Trevor; Gonzalez, Ronalds; Phillips, Richard; Lee, Jung Myoung; Jameel, Hasan; Chang, Hou-min

2012-08-01

The present work targeted the understanding of the influence of nine different hardwood species as feedstock on ethanol production yield and costs. It was found that the minimum ethanol revenue (MER) ($ per gallon to the producer) to achieve a 12% internal rate of return (IRR) on invested capital was smaller for low lignin content samples and the influence of species characteristics remained restricted to high residual lignin content. We show that if the pretreatment being applied to the feedstock targets or is limited to low lignin removal, one can expect the species to have a significant impact on overall economics, playing important role to project success. This study also showed a variation of up to 40% in relative MER among hardwood species, where maple, globulus and sweet gum varied the least. Sensitivity analysis showed ethanol yield per ton of feedstock had the largest influence in MER, followed by CAPEX. Copyright © 2012 Elsevier Ltd. All rights reserved.

Asy2/Mer2: an evolutionarily conserved mediator of meiotic recombination, pairing, and global chromosome compaction

PubMed Central

Tessé, Sophie; Bourbon, Henri-Marc; Debuchy, Robert; Budin, Karine; Dubois, Emeline; Liangran, Zhang; Antoine, Romain; Piolot, Tristan; Kleckner, Nancy; Zickler, Denise; Espagne, Eric

2017-01-01

Meiosis is the cellular program by which a diploid cell gives rise to haploid gametes for sexual reproduction. Meiotic progression depends on tight physical and functional coupling of recombination steps at the DNA level with specific organizational features of meiotic-prophase chromosomes. The present study reveals that every step of this coupling is mediated by a single molecule: Asy2/Mer2. We show that Mer2, identified so far only in budding and fission yeasts, is in fact evolutionarily conserved from fungi (Mer2/Rec15/Asy2/Bad42) to plants (PRD3/PAIR1) and mammals (IHO1). In yeasts, Mer2 mediates assembly of recombination–initiation complexes and double-strand breaks (DSBs). This role is conserved in the fungus Sordaria. However, functional analysis of 13 mer2 mutants and successive localization of Mer2 to axis, synaptonemal complex (SC), and chromatin revealed, in addition, three further important functions. First, after DSB formation, Mer2 is required for pairing by mediating homolog spatial juxtaposition, with implications for crossover (CO) patterning/interference. Second, Mer2 participates in the transfer/maintenance and release of recombination complexes to/from the SC central region. Third, after completion of recombination, potentially dependent on SUMOylation, Mer2 mediates global chromosome compaction and post-recombination chiasma development. Thus, beyond its role as a recombinosome–axis/SC linker molecule, Mer2 has important functions in relation to basic chromosome structure. PMID:29021238

A Novel Morpholino Oligomer Targeting ISS-N1 Improves Rescue of Severe Spinal Muscular Atrophy Transgenic Mice

PubMed Central

Janghra, Narinder; Mitrpant, Chalermchai; Dickinson, Rachel L.; Anthony, Karen; Price, Loren; Eperon, Ian C.; Wilton, Stephen D.; Morgan, Jennifer

2013-01-01

Abstract In the search for the most efficacious antisense oligonucleotides (AOs) aimed at inducing SMN2 exon 7 inclusion, we systematically assessed three AOs, PMO25 (−10, −34), PMO18 (−10, −27), and PMO20 (−10, −29), complementary to the SMN2 intron 7 splicing silencer (ISS-N1). PMO25 was the most efficacious in augmenting exon 7 inclusion in vitro in spinal muscular atrophy (SMA) patient fibroblasts and in vitro splicing assays. PMO25 and PMO18 were compared further in a mouse model of severe SMA. After a single intracerebroventricular (ICV) injection in neonatal mice, PMO25 increased the life span of severe SMA mice up to 30-fold, with average survival greater by 3-fold compared with PMO18 at a dose of 20 μg/g and 2-fold at 40 μg/g. Exon 7 inclusion was increased in the CNS but not in peripheral tissues. Systemic delivery of PMO25 at birth achieved a similar outcome and produced increased exon 7 inclusion both in the CNS and peripherally. Systemic administration of a 10-μg/g concentration of PMO25 conjugated to an octaguanidine dendrimer (VMO25) increased the life span only 2-fold in neonatal type I SMA mice, although it prevented tail necrosis in mild SMA mice. Higher doses and ICV injection of VMO25 were associated with toxicity. We conclude that (1) the 25-mer AO is more efficient than the 18-mer and 20-mer in modifying SMN2 splicing in vitro; (2) it is more efficient in prolonging survival in SMA mice; and (3) naked Morpholino oligomers are more efficient and safer than the Vivo-Morpholino and have potential for future SMA clinical applications. PMID:23339722

Middle East respiratory syndrome coronavirus (MERS-CoV): animal to human interaction

PubMed Central

Omrani, Ali S.; Al-Tawfiq, Jaffar A.

2015-01-01

The Middle East respiratory syndrome coronavirus (MERS-CoV) is a novel enzootic betacoronavirus that was first described in September 2012. The clinical spectrum of MERS-CoV infection in humans ranges from an asymptomatic or mild respiratory illness to severe pneumonia and multi-organ failure; overall mortality is around 35.7%. Bats harbour several betacoronaviruses that are closely related to MERS-CoV but more research is needed to establish the relationship between bats and MERS-CoV. The seroprevalence of MERS-CoV antibodies is very high in dromedary camels in Eastern Africa and the Arabian Peninsula. MERS-CoV RNA and viable virus have been isolated from dromedary camels, including some with respiratory symptoms. Furthermore, near-identical strains of MERS-CoV have been isolated from epidemiologically linked humans and camels, confirming inter-transmission, most probably from camels to humans. Though inter-human spread within health care settings is responsible for the majority of reported MERS-CoV cases, the virus is incapable at present of causing sustained human-to-human transmission. Clusters can be readily controlled with implementation of appropriate infection control procedures. Phylogenetic and sequencing data strongly suggest that MERS-CoV originated from bat ancestors after undergoing a recombination event in the spike protein, possibly in dromedary camels in Africa, before its exportation to the Arabian Peninsula along the camel trading routes. MERS-CoV serosurveys are needed to investigate possible unrecognized human infections in Africa. Amongst the important measures to control MERS-CoV spread are strict regulation of camel movement, regular herd screening and isolation of infected camels, use of personal protective equipment by camel handlers and enforcing rules banning all consumption of unpasteurized camel milk and urine. PMID:26924345

Engineered Single-Chain, Antiparallel, Coiled Coil Mimics the MerR Metal Binding Site

PubMed Central

Song, Lingyun; Caguiat, Jonathan; Li, Zhongrui; Shokes, Jacob; Scott, Robert A.; Olliff, Lynda; Summers, Anne O.

2004-01-01

The repressor-activator MerR that controls transcription of the mercury resistance (mer) operon is unusual for its high sensitivity and specificity for Hg(II) in in vivo and in vitro transcriptional assays. The metal-recognition domain of MerR resides at the homodimer interface in a novel antiparallel arrangement of α-helix 5 that forms a coiled-coil motif. To facilitate the study of this novel metal binding motif, we assembled this antiparallel coiled coil into a single chain by directly fusing two copies of the 48-residue α-helix 5 of MerR. The resulting 107-residue polypeptide, called the metal binding domain (MBD), and wild-type MerR were overproduced and purified, and their metal-binding properties were determined in vivo and in vitro. In vitro MBD bound ca. 1.0 equivalent of Hg(II) per pair of binding sites, just as MerR does, and it showed only a slightly lower affinity for Hg(II) than did MerR. Extended X-ray absorption fine structure data showed that MBD has essentially the same Hg(II) coordination environment as MerR. In vivo, cells overexpressing MBD accumulated 70 to 100% more 203Hg(II) than cells bearing the vector alone, without deleterious effects on cell growth. Both MerR and MBD variously bound other thiophilic metal ions, including Cd(II), Zn(II), Pb(II), and As(III), in vitro and in vivo. We conclude that (i) it is possible to simulate in a single polypeptide chain the in vitro and in vivo metal-binding ability of dimeric, full-length MerR and (ii) MerR's specificity in transcriptional activation does not reside solely in the metal-binding step. PMID:14996817

Engineering tobacco to remove mercury from polluted soil.

PubMed

Chang, S; Wei, F; Yang, Y; Wang, A; Jin, Z; Li, J; He, Y; Shu, H

2015-04-01

Tobacco is an ideal plant for modification to remove mercury from soil. Although several transgenic tobacco strains have been developed, they either release elemental mercury directly into the air or are only capable of accumulating small quantities of mercury. In this study, we constructed two transgenic tobacco lines: Ntk-7 (a tobacco plant transformed with merT-merP-merB1-merB2-ppk) and Ntp-36 (tobacco transformed with merT-merP-merB1-merB2-pcs1). The genes merT, merP, merB1, and merB2 were obtained from the well-known mercury-resistant bacterium Pseudomonas K-62. Ppk is a gene that encodes polyphosphate kinase, a key enzyme for synthesizing polyphosphate in Enterobacter aerogenes. Pcs1 is a tobacco gene that encodes phytochelatin synthase, which is the key enzyme for phytochelatin synthesis. The genes were linked with LP4/2A, a sequence that encodes a well-known linker peptide. The results demonstrate that all foreign genes can be abundantly expressed. The mercury resistance of Ntk-7 and Ntp-36 was much higher than that of the wild type whether tested with organic mercury or with mercuric ions. The transformed plants can accumulate significantly more mercury than the wild type, and Ntp-36 can accumulate more mercury from soil than Ntk-7. In mercury-polluted soil, the mercury content in Ntp-36's root can reach up to 251 μg/g. This is the first report to indicate that engineered tobacco can not only accumulate mercury from soil but also retain this mercury within the plant. Ntp-36 has good prospects for application in bioremediation for mercury pollution.

Molecular interaction study of commercial cyclic peptides and MERS-COV papain-like protease as novel drug candidate for MERS-COV

NASA Astrophysics Data System (ADS)

Nasution, M. A. F.; Azzuhdi, M. G.; Tambunan, U. S. F.

2017-07-01

Middle-east respiratory syndrome coronavirus (MERS-CoV) has become the current outbreak, MERS-CoV infection results in illness at the respiratory system, digestive, and even lead to death with an average mortality caused by MERS-CoV infection reaches 50 %. Until now, there is not any effective vaccine or drug to ward off MERS-CoV infection. Papain-like protease (PLpro) is responsible for cleavage of a nonstructural protein that is essential for viral maturation. Inhibition of PLpro with a ligand will block the cleavage process of nonstructural protein, thus reduce the infection of MERS-CoV. Through of bioinformatics study with molecular docking and binding interaction analysis of commercial cyclic peptides, aldosterone secretion inhibiting factor (1-35) (bovine) was obtained as an inhibitor for PLpro. Thus, aldosterone secretion inhibiting factor (1-35) (bovine) has a potential as a novel candidate drug for treating MERS-CoV.

Middle East respiratory syndrome in children. Dental considerations.

PubMed

Al-Sehaibany, Fares S

2017-04-01

As of January 2016, 1,633 laboratory-confirmed cases of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) infection and 587 MERS-related deaths have been reported by the World Health Organization globally. Middle East Respiratory Syndrome Coronavirus  may occur sporadically in communities or may be transmitted within families or hospitals. The number of confirmed MERS-CoV cases among healthcare workers has been increasing. Middle East Respiratory Syndrome Coronavirus may also spread through aerosols generated during various dental treatments, resulting in transmission between patients and dentists. As MERS-CoV cases have also been reported among children, pediatric dentists are at risk of MERS-CoV infection. This review discusses MERS-CoV infection in children and healthcare workers, especially pediatric dentists, and considerations pertaining to pediatric dentistry. Although no cases of MERS-CoV transmission between a patient and a dentist have yet been reported, the risk of MERS-CoV transmission from an infected patient may be high due to the unique work environment of dentists (aerosol generation).

Phagocytosis of microparticles by alveolar macrophages during acute lung injury requires MerTK.

PubMed

Mohning, Michael P; Thomas, Stacey M; Barthel, Lea; Mould, Kara J; McCubbrey, Alexandria L; Frasch, S Courtney; Bratton, Donna L; Henson, Peter M; Janssen, William J

2018-01-01

Microparticles are a newly recognized class of mediators in the pathophysiology of lung inflammation and injury, but little is known about the factors that regulate their accumulation and clearance. The primary objective of our study was to determine whether alveolar macrophages engulf microparticles and to elucidate the mechanisms by which this occurs. Alveolar microparticles were quantified in bronchoalveolar fluid of mice with lung injury induced by LPS and hydrochloric acid. Microparticle numbers were greatest at the peak of inflammation and declined as inflammation resolved. Isolated, fluorescently labeled particles were placed in culture with macrophages to evaluate ingestion in the presence of endocytosis inhibitors. Ingestion was blocked with cytochalasin D and wortmannin, consistent with a phagocytic process. In separate experiments, mice were treated intratracheally with labeled microparticles, and their uptake was assessed though microscopy and flow cytometry. Resident alveolar macrophages, not recruited macrophages, were the primary cell-ingesting microparticles in the alveolus during lung injury. In vitro, microparticles promoted inflammatory signaling in LPS primed epithelial cells, signifying the importance of microparticle clearance in resolving lung injury. Microparticles were found to have phosphatidylserine exposed on their surfaces. Accordingly, we measured expression of phosphatidylserine receptors on macrophages and found high expression of MerTK and Axl in the resident macrophage population. Endocytosis of microparticles was markedly reduced in MerTK-deficient macrophages in vitro and in vivo. In conclusion, microparticles are released during acute lung injury and peak in number at the height of inflammation. Resident alveolar macrophages efficiently clear these microparticles through MerTK-mediated phagocytosis.

Managing PV Power on Mars - MER Rovers

NASA Technical Reports Server (NTRS)

Stella, Paul M.; Chin, Keith; Wood, Eric; Herman, Jennifer; Ewell, Richard

2009-01-01

The MER Rovers have recently completed over 5 years of operation! This is a remarkable demonstration of the capabilities of PV power on the Martian surface. The extended mission required the development of an efficient process to predict the power available to the rovers on a day-to-day basis. The performance of the MER solar arrays is quite unlike that of any other Space array and perhaps more akin to Terrestrial PV operation, although even severe by that comparison. The impact of unpredictable factors, such as atmospheric conditions and dust accumulation (and removal) on the panels limits the accurate prediction of array power to short time spans. Based on the above, it is clear that long term power predictions are not sufficiently accurate to allow for detailed long term planning. Instead, the power assessment is essentially a daily activity, effectively resetting the boundary points for the overall predictive power model. A typical analysis begins with the importing of the telemetry from each rover's previous day's power subsystem activities. This includes the array power generated, battery state-of-charge, rover power loads, and rover orientation, all as functions of time. The predicted performance for that day is compared to the actual performance to identify the extent of any differences. The model is then corrected for these changes. Details of JPL's MER power analysis procedure are presented, including the description of steps needed to provide the final prediction for the mission planners. A dust cleaning event of the solar array is also highlighted to illustrate the impact of Martian weather on solar array performance

KAnalyze: a fast versatile pipelined K-mer toolkit

PubMed Central

Audano, Peter; Vannberg, Fredrik

2014-01-01

Motivation: Converting nucleotide sequences into short overlapping fragments of uniform length, k-mers, is a common step in many bioinformatics applications. While existing software packages count k-mers, few are optimized for speed, offer an application programming interface (API), a graphical interface or contain features that make it extensible and maintainable. We designed KAnalyze to compete with the fastest k-mer counters, to produce reliable output and to support future development efforts through well-architected, documented and testable code. Currently, KAnalyze can output k-mer counts in a sorted tab-delimited file or stream k-mers as they are read. KAnalyze can process large datasets with 2 GB of memory. This project is implemented in Java 7, and the command line interface (CLI) is designed to integrate into pipelines written in any language. Results: As a k-mer counter, KAnalyze outperforms Jellyfish, DSK and a pipeline built on Perl and Linux utilities. Through extensive unit and system testing, we have verified that KAnalyze produces the correct k-mer counts over multiple datasets and k-mer sizes. Availability and implementation: KAnalyze is available on SourceForge: https://sourceforge.net/projects/kanalyze/ Contact: fredrik.vannberg@biology.gatech.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:24642064

KAnalyze: a fast versatile pipelined k-mer toolkit.

PubMed

Audano, Peter; Vannberg, Fredrik

2014-07-15

Converting nucleotide sequences into short overlapping fragments of uniform length, k-mers, is a common step in many bioinformatics applications. While existing software packages count k-mers, few are optimized for speed, offer an application programming interface (API), a graphical interface or contain features that make it extensible and maintainable. We designed KAnalyze to compete with the fastest k-mer counters, to produce reliable output and to support future development efforts through well-architected, documented and testable code. Currently, KAnalyze can output k-mer counts in a sorted tab-delimited file or stream k-mers as they are read. KAnalyze can process large datasets with 2 GB of memory. This project is implemented in Java 7, and the command line interface (CLI) is designed to integrate into pipelines written in any language. As a k-mer counter, KAnalyze outperforms Jellyfish, DSK and a pipeline built on Perl and Linux utilities. Through extensive unit and system testing, we have verified that KAnalyze produces the correct k-mer counts over multiple datasets and k-mer sizes. KAnalyze is available on SourceForge: https://sourceforge.net/projects/kanalyze/. © The Author 2014. Published by Oxford University Press.

Efficacy of a Mer and Flt3 tyrosine kinase small molecule inhibitor, UNC1666, in acute myeloid leukemia

PubMed Central

Lee-Sherick, Alisa B.; Zhang, Weihe; Menachof, Kelly K.; Hill, Amanda A.; Rinella, Sean; Kirkpatrick, Gregory; Page, Lauren S.; Stashko, Michael A.; Jordan, Craig T.; Wei, Qi; Liu, Jing; Zhang, Dehui; DeRyckere, Deborah; Wang, Xiaodong; Frye, Stephen; Earp, H. Shelton; Graham, Douglas K.

2015-01-01

Mer and Flt3 receptor tyrosine kinases have been implicated as therapeutic targets in acute myeloid leukemia (AML). In this manuscript we describe UNC1666, a novel ATP-competitive small molecule tyrosine kinase inhibitor, which potently diminishes Mer and Flt3 phosphorylation in AML. Treatment with UNC1666 mediated biochemical and functional effects in AML cell lines expressing Mer or Flt3 internal tandem duplication (ITD), including decreased phosphorylation of Mer, Flt3 and downstream effectors Stat, Akt and Erk, induction of apoptosis in up to 98% of cells, and reduction of colony formation by greater than 90%, compared to treatment with vehicle. These effects were dose-dependent, with inhibition of downstream signaling and functional effects correlating with the degree of Mer or Flt3 kinase inhibition. Treatment of primary AML patient samples expressing Mer and/or Flt3-ITD with UNC1666 also inhibited Mer and Flt3 intracellular signaling, induced apoptosis, and inhibited colony formation. In summary, UNC1666 is a novel potent small molecule tyrosine kinase inhibitor that decreases oncogenic signaling and myeloblast survival, thereby validating dual Mer/Flt3 inhibition as an attractive treatment strategy for AML. PMID:25762638

Human Centered Design and Development for NASA's MerBoard

NASA Technical Reports Server (NTRS)

Trimble, Jay

2003-01-01

This viewgraph presentation provides an overview of the design and development process for NASA's MerBoard. These devices are large interactive display screens which can be shown on the user's computer, which will allow scientists in many locations to interpret and evaluate mission data in real-time. These tools are scheduled to be used during the 2003 Mars Exploration Rover (MER) expeditions. Topics covered include: mission overview, Mer Human Centered Computers, FIDO 2001 observations and MerBoard prototypes.

Intratracheal exposure of common marmosets to MERS-CoV Jordan-n3/2012 or MERS-CoV EMC/2012 isolates does not result in lethal disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Reed F., E-mail: johnsonreed@mail.nih.gov; Via, Laura E.; Kumar, Mia R.

Middle East Respiratory Syndrome Coronavirus (MERS-CoV) continues to be a threat to human health in the Middle East. Development of countermeasures is ongoing; however, an animal model that faithfully recapitulates human disease has yet to be defined. A recent study indicated that inoculation of common marmosets resulted in inconsistent lethality. Based on these data we sought to compare two isolates of MERS-CoV. We followed disease progression in common marmosets after intratracheal exposure with: MERS-CoV-EMC/2012, MERS-CoV-Jordan-n3/2012, media, or inactivated virus. Our data suggest that common marmosets developed a mild to moderate non-lethal respiratory disease, which was quantifiable by computed tomography (CT),more » with limited other clinical signs. Based on CT data, clinical data, and virological data, MERS-CoV inoculation of common marmosets results in mild to moderate clinical signs of disease that are likely due to manipulations of the marmoset rather than as a result of robust viral replication. - Highlights: • Common marmosets infected with MERS-EMC and MERS-JOR did not develop lethal disease. • Infected subjects developed transient signs of clinical disease. • CT indicated few differences between the infected and control groups. • Marmosets do not faithfully replicate human MERS pathogenesis.« less

Transmission characteristics of MERS and SARS in the healthcare setting: a comparative study.

PubMed

Chowell, Gerardo; Abdirizak, Fatima; Lee, Sunmi; Lee, Jonggul; Jung, Eunok; Nishiura, Hiroshi; Viboud, Cécile

2015-09-03

The Middle East respiratory syndrome (MERS) coronavirus has caused recurrent outbreaks in the Arabian Peninsula since 2012. Although MERS has low overall human-to-human transmission potential, there is occasional amplification in the healthcare setting, a pattern reminiscent of the dynamics of the severe acute respiratory syndrome (SARS) outbreaks in 2003. Here we provide a head-to-head comparison of exposure patterns and transmission dynamics of large hospital clusters of MERS and SARS, including the most recent South Korean outbreak of MERS in 2015. To assess the unexpected nature of the recent South Korean nosocomial outbreak of MERS and estimate the probability of future large hospital clusters, we compared exposure and transmission patterns for previously reported hospital clusters of MERS and SARS, based on individual-level data and transmission tree information. We carried out simulations of nosocomial outbreaks of MERS and SARS using branching process models rooted in transmission tree data, and inferred the probability and characteristics of large outbreaks. A significant fraction of MERS cases were linked to the healthcare setting, ranging from 43.5 % for the nosocomial outbreak in Jeddah, Saudi Arabia, in 2014 to 100 % for both the outbreak in Al-Hasa, Saudi Arabia, in 2013 and the outbreak in South Korea in 2015. Both MERS and SARS nosocomial outbreaks are characterized by early nosocomial super-spreading events, with the reproduction number dropping below 1 within three to five disease generations. There was a systematic difference in the exposure patterns of MERS and SARS: a majority of MERS cases occurred among patients who sought care in the same facilities as the index case, whereas there was a greater concentration of SARS cases among healthcare workers throughout the outbreak. Exposure patterns differed slightly by disease generation, however, especially for SARS. Moreover, the distributions of secondary cases per single primary case varied highly across individual hospital outbreaks (Kruskal-Wallis test; P < 0.0001), with significantly higher transmission heterogeneity in the distribution of secondary cases for MERS than SARS. Simulations indicate a 2-fold higher probability of occurrence of large outbreaks (>100 cases) for SARS than MERS (2 % versus 1 %); however, owing to higher transmission heterogeneity, the largest outbreaks of MERS are characterized by sharper incidence peaks. The probability of occurrence of MERS outbreaks larger than the South Korean cluster (n = 186) is of the order of 1 %. Our study suggests that the South Korean outbreak followed a similar progression to previously described hospital clusters involving coronaviruses, with early super-spreading events generating a disproportionately large number of secondary infections, and the transmission potential diminishing greatly in subsequent generations. Differences in relative exposure patterns and transmission heterogeneity of MERS and SARS could point to changes in hospital practices since 2003 or differences in transmission mechanisms of these coronaviruses.

Asy2/Mer2: an evolutionarily conserved mediator of meiotic recombination, pairing, and global chromosome compaction.

PubMed

Tessé, Sophie; Bourbon, Henri-Marc; Debuchy, Robert; Budin, Karine; Dubois, Emeline; Liangran, Zhang; Antoine, Romain; Piolot, Tristan; Kleckner, Nancy; Zickler, Denise; Espagne, Eric

2017-09-15

Meiosis is the cellular program by which a diploid cell gives rise to haploid gametes for sexual reproduction. Meiotic progression depends on tight physical and functional coupling of recombination steps at the DNA level with specific organizational features of meiotic-prophase chromosomes. The present study reveals that every step of this coupling is mediated by a single molecule: Asy2/Mer2. We show that Mer2, identified so far only in budding and fission yeasts, is in fact evolutionarily conserved from fungi (Mer2/Rec15/Asy2/Bad42) to plants (PRD3/PAIR1) and mammals (IHO1). In yeasts, Mer2 mediates assembly of recombination-initiation complexes and double-strand breaks (DSBs). This role is conserved in the fungus Sordaria However, functional analysis of 13 mer2 mutants and successive localization of Mer2 to axis, synaptonemal complex (SC), and chromatin revealed, in addition, three further important functions. First, after DSB formation, Mer2 is required for pairing by mediating homolog spatial juxtaposition, with implications for crossover (CO) patterning/interference. Second, Mer2 participates in the transfer/maintenance and release of recombination complexes to/from the SC central region. Third, after completion of recombination, potentially dependent on SUMOylation, Mer2 mediates global chromosome compaction and post-recombination chiasma development. Thus, beyond its role as a recombinosome-axis/SC linker molecule, Mer2 has important functions in relation to basic chromosome structure. © 2017 Tessé et al.; Published by Cold Spring Harbor Laboratory Press.

High reproduction number of Middle East respiratory syndrome coronavirus in nosocomial outbreaks: mathematical modelling in Saudi Arabia and South Korea.

PubMed

Choi, S; Jung, E; Choi, B Y; Hur, Y J; Ki, M

2018-06-01

Effective countermeasures against emerging infectious diseases require an understanding of transmission rate and basic reproduction number (R 0 ). R 0 for severe acute respiratory syndrome is generally considered to be >1, whereas that for Middle East respiratory syndrome (MERS) is considered to be <1. However, this does not explain the large-scale outbreaks of MERS that occurred in Kingdom of Saudi Arabia (KSA) and South Korean hospitals. To estimate R 0 in nosocomial outbreaks of MERS. R 0 was estimated using the incidence decay with an exponential adjustment model. The KSA and Korean outbreaks were compared using a line listing of MERS cases compiled using publicly available sources. Serial intervals to estimate R 0 were assumed to be six to eight days. Study parameters [R 0 and countermeasures (d)] were estimated by fitting a model to the cumulative incidence epidemic curves using Matlab. The estimated R 0 in Korea was 3.9 in the best-fit model, with a serial interval of six days. The first outbreak cluster in a hospital in Pyeongtaek had an R 0 of 4.04, and the largest outbreak cluster in a hospital in Samsung had an R 0 of 5.0. Assuming a six-day serial interval, the KSA outbreaks in Jeddah and Riyadh had R 0 values of 3.9 and 1.9, respectively. R 0 for the nosocomial MERS outbreaks in KSA and South Korea was estimated to be in the range of 2-5, which is significantly higher than the previous estimate of <1. Therefore, more comprehensive countermeasures are needed to address these infections. Copyright © 2017 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

From SARS coronavirus to novel animal and human coronaviruses.

PubMed

To, Kelvin K W; Hung, Ivan F N; Chan, Jasper F W; Yuen, Kwok-Yung

2013-08-01

In 2003, severe acute respiratory syndrome coronavirus (SARS-CoV) caused one of the most devastating epidemics known to the developed world. There were two important lessons from this epidemic. Firstly, coronaviruses, in addition to influenza viruses, can cause severe and rapidly spreading human infections. Secondly, bats can serve as the origin and natural animal reservoir of deadly human viruses. Since then, researchers around the world, especially those in Asia where SARS-CoV was first identified, have turned their focus to find novel coronaviruses infecting humans, bats, and other animals. Two human coronaviruses, HCoV-HKU1 and HCoV-NL63, were identified shortly after the SARS-CoV epidemic as common causes of human respiratory tract infections. In 2012, a novel human coronavirus, now called Middle East respiratory syndrome coronavirus (MERS-CoV), has emerged in the Middle East to cause fatal human infections in three continents. MERS-CoV human infection is similar to SARS-CoV in having a high fatality rate and the ability to spread from person to person which resulted in secondary cases among close contacts including healthcare workers without travel history to the Middle East. Both viruses also have close relationships with bat coronaviruses. New cases of MERS-CoV infection in humans continue to occur with the origins of the virus still unknown in many cases. A multifaceted approach is necessary to control this evolving MERS-CoV outbreak. Source identification requires detailed epidemiological studies of the infected patients and enhanced surveillance of MERS-CoV or similar coronaviruses in humans and animals. Early diagnosis of infected patients and appropriate infection control measures will limit the spread in hospitals, while social distancing strategies may be necessary to control the outbreak in communities if it remained uncontrolled as in the SARS epidemic.

Diet influences rates of carbon and nitrogen mineralization from decomposing grasshopper frass and cadavers

USDA-ARS?s Scientific Manuscript database

Insect herbivory can produce a pulse of mineral nitrogen (N) in soil from the decomposition of frass and cadavers. In this study we examined how diet quality affects rates of N and carbon (C) mineralization from grasshopper frass and cadavers. Frass was collected from grasshoppers fed natural or mer...

Using max entropy ratio of recurrence plot to measure electrocorticogram changes in epilepsy patients

NASA Astrophysics Data System (ADS)

Yan, Jiaqing; Wang, Yinghua; Ouyang, Gaoxiang; Yu, Tao; Li, Xiaoli

2016-02-01

A maximum entropy ratio (MER) method is firstly adapted to investigate the high-dimensional Electrocorticogram (ECoG) data from epilepsy patients. MER is a symbolic analysis approach for the detection of recurrence domains of complex dynamical systems from time series. Data were chosen from eight patients undergoing pre-surgical evaluation for drug-resistant temporal lobe epilepsy. MERs for interictal and ictal data were calculated and compared. A statistical test was performed to evaluate the ability of MER to separate the interictal state from the ictal state. MER showed significant changes from the interictal state into the ictal state, where MER was low at the ictal state and is significantly different with that at the interictal state. These suggest that MER is able to separate the ictal state from the interictal state based on ECoG data. It has the potential of detecting the transition between normal brain activity and the ictal state.

KENNEDY SPACE CENTER, FLA. - The overhead crane settles the Mars Exploration Rover 2 (MER-2) entry vehicle onto a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - The overhead crane settles the Mars Exploration Rover 2 (MER-2) entry vehicle onto a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

Allostery and the dynamic oligomerization of porphobilinogen synthase

PubMed Central

Jaffe, Eileen K.; Lawrence, Sarah H.

2011-01-01

The structural basis for allosteric regulation of porphobilinogen synthase (PBGS) is modulation of a quaternary structure equilibrium between octamer and hexamer (via dimers), which is represented schematically as 8mer ⇔ 2mer ⇔ 2mer* ⇔ 6mer*. The “*” represents a reorientation between two domains of each subunit that occurs in the dissociated state because it is sterically forbidden in the larger multimers. Allosteric effectors of PBGS are both intrinsic and extrinsic and are phylogenetically variable. In some species this equilibrium is modulated intrinsically by magnesium which binds at a site specific to the 8mer. In other species this equilibrium is modulated intrinsically by pH; the guanidinium group of an arginine being spatially equivalent to the allosteric magnesium ion. In humans, disease associated variants all shift the equilibrium toward the 6mer* relative to wild type. The 6mer* has a surface cavity that is not present in the 8mer and is proposed as a small molecule allosteric binding site. In silico and in vitro approaches have revealed species-specific allosteric PBGS inhibitors that stabilize the 6mer*. Some of these inhibitors are drugs in clinical use leading to the hypothesis that extrinsic allosteric inhibition of human PBGS could be a mechanism for drug side effects. PMID:22037356

Deterministic and stochastic models for middle east respiratory syndrome (MERS)

NASA Astrophysics Data System (ADS)

Suryani, Dessy Rizki; Zevika, Mona; Nuraini, Nuning

2018-03-01

World Health Organization (WHO) data stated that since September 2012, there were 1,733 cases of Middle East Respiratory Syndrome (MERS) with 628 death cases that occurred in 27 countries. MERS was first identified in Saudi Arabia in 2012 and the largest cases of MERS outside Saudi Arabia occurred in South Korea in 2015. MERS is a disease that attacks the respiratory system caused by infection of MERS-CoV. MERS-CoV transmission occurs directly through direct contact between infected individual with non-infected individual or indirectly through contaminated object by the free virus. Suspected, MERS can spread quickly because of the free virus in environment. Mathematical modeling is used to illustrate the transmission of MERS disease using deterministic model and stochastic model. Deterministic model is used to investigate the temporal dynamic from the system to analyze the steady state condition. Stochastic model approach using Continuous Time Markov Chain (CTMC) is used to predict the future states by using random variables. From the models that were built, the threshold value for deterministic models and stochastic models obtained in the same form and the probability of disease extinction can be computed by stochastic model. Simulations for both models using several of different parameters are shown, and the probability of disease extinction will be compared with several initial conditions.

KENNEDY SPACE CENTER, FLA. - In the foreground, three solid rocket boosters (SRBs) suspended in the launch tower flank the Delta II rocket (in the background) that will launch Mars Exploration Rover 2 (MER-2). NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - In the foreground, three solid rocket boosters (SRBs) suspended in the launch tower flank the Delta II rocket (in the background) that will launch Mars Exploration Rover 2 (MER-2). NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

Integration of a splicing regulatory network within the meiotic gene expression program of Saccharomyces cerevisiae

PubMed Central

Munding, Elizabeth M.; Igel, A. Haller; Shiue, Lily; Dorighi, Kristel M.; Treviño, Lisa R.; Ares, Manuel

2010-01-01

Splicing regulatory networks are essential components of eukaryotic gene expression programs, yet little is known about how they are integrated with transcriptional regulatory networks into coherent gene expression programs. Here we define the MER1 splicing regulatory network and examine its role in the gene expression program during meiosis in budding yeast. Mer1p splicing factor promotes splicing of just four pre-mRNAs. All four Mer1p-responsive genes also require Nam8p for splicing activation by Mer1p; however, other genes require Nam8p but not Mer1p, exposing an overlapping meiotic splicing network controlled by Nam8p. MER1 mRNA and three of the four Mer1p substrate pre-mRNAs are induced by the transcriptional regulator Ume6p. This unusual arrangement delays expression of Mer1p-responsive genes relative to other genes under Ume6p control. Products of Mer1p-responsive genes are required for initiating and completing recombination and for activation of Ndt80p, the activator of the transcriptional network required for subsequent steps in the program. Thus, the MER1 splicing regulatory network mediates the dependent relationship between the UME6 and NDT80 transcriptional regulatory networks in the meiotic gene expression program. This study reveals how splicing regulatory networks can be interlaced with transcriptional regulatory networks in eukaryotic gene expression programs. PMID:21123654

Environmental Conditions Constrain the Distribution and Diversity of Archaeal merA in Yellowstone National Park, Wyoming, U.S.A.

USGS Publications Warehouse

Wang, Y.; Boyd, E.; Crane, S.; Lu-Irving, P.; Krabbenhoft, D.; King, S.; Dighton, J.; Geesey, G.; Barkay, T.

2011-01-01

The distribution and phylogeny of extant protein-encoding genes recovered from geochemically diverse environments can provide insight into the physical and chemical parameters that led to the origin and which constrained the evolution of a functional process. Mercuric reductase (MerA) plays an integral role in mercury (Hg) biogeochemistry by catalyzing the transformation of Hg(II) to Hg(0). Putative merA sequences were amplified from DNA extracts of microbial communities associated with mats and sulfur precipitates from physicochemically diverse Hg-containing springs in Yellowstone National Park, Wyoming, using four PCR primer sets that were designed to capture the known diversity of merA. The recovery of novel and deeply rooted MerA lineages from these habitats supports previous evidence that indicates merA originated in a thermophilic environment. Generalized linear models indicate that the distribution of putative archaeal merA lineages was constrained by a combination of pH, dissolved organic carbon, dissolved total mercury and sulfide. The models failed to identify statistically well supported trends for the distribution of putative bacterial merA lineages as a function of these or other measured environmental variables, suggesting that these lineages were either influenced by environmental parameters not considered in the present study, or the bacterial primer sets were designed to target too broad of a class of genes which may have responded differently to environmental stimuli. The widespread occurrence of merA in the geothermal environments implies a prominent role for Hg detoxification in these environments. Moreover, the differences in the distribution of the merA genes amplified with the four merA primer sets suggests that the organisms putatively engaged in this activity have evolved to occupy different ecological niches within the geothermal gradient. ?? 2011 Springer Science+Business Media, LLC.

Environmental conditions constrain the distribution and diversity of archaeal merA in Yellowstone National Park, Wyoming, U.S.A.

PubMed

Wang, Yanping; Boyd, Eric; Crane, Sharron; Lu-Irving, Patricia; Krabbenhoft, David; King, Susan; Dighton, John; Geesey, Gill; Barkay, Tamar

2011-11-01

The distribution and phylogeny of extant protein-encoding genes recovered from geochemically diverse environments can provide insight into the physical and chemical parameters that led to the origin and which constrained the evolution of a functional process. Mercuric reductase (MerA) plays an integral role in mercury (Hg) biogeochemistry by catalyzing the transformation of Hg(II) to Hg(0). Putative merA sequences were amplified from DNA extracts of microbial communities associated with mats and sulfur precipitates from physicochemically diverse Hg-containing springs in Yellowstone National Park, Wyoming, using four PCR primer sets that were designed to capture the known diversity of merA. The recovery of novel and deeply rooted MerA lineages from these habitats supports previous evidence that indicates merA originated in a thermophilic environment. Generalized linear models indicate that the distribution of putative archaeal merA lineages was constrained by a combination of pH, dissolved organic carbon, dissolved total mercury and sulfide. The models failed to identify statistically well supported trends for the distribution of putative bacterial merA lineages as a function of these or other measured environmental variables, suggesting that these lineages were either influenced by environmental parameters not considered in the present study, or the bacterial primer sets were designed to target too broad of a class of genes which may have responded differently to environmental stimuli. The widespread occurrence of merA in the geothermal environments implies a prominent role for Hg detoxification in these environments. Moreover, the differences in the distribution of the merA genes amplified with the four merA primer sets suggests that the organisms putatively engaged in this activity have evolved to occupy different ecological niches within the geothermal gradient.

Comparing fixed sampling with minimizer sampling when using k-mer indexes to find maximal exact matches.

PubMed

Almutairy, Meznah; Torng, Eric

2018-01-01

Bioinformatics applications and pipelines increasingly use k-mer indexes to search for similar sequences. The major problem with k-mer indexes is that they require lots of memory. Sampling is often used to reduce index size and query time. Most applications use one of two major types of sampling: fixed sampling and minimizer sampling. It is well known that fixed sampling will produce a smaller index, typically by roughly a factor of two, whereas it is generally assumed that minimizer sampling will produce faster query times since query k-mers can also be sampled. However, no direct comparison of fixed and minimizer sampling has been performed to verify these assumptions. We systematically compare fixed and minimizer sampling using the human genome as our database. We use the resulting k-mer indexes for fixed sampling and minimizer sampling to find all maximal exact matches between our database, the human genome, and three separate query sets, the mouse genome, the chimp genome, and an NGS data set. We reach the following conclusions. First, using larger k-mers reduces query time for both fixed sampling and minimizer sampling at a cost of requiring more space. If we use the same k-mer size for both methods, fixed sampling requires typically half as much space whereas minimizer sampling processes queries only slightly faster. If we are allowed to use any k-mer size for each method, then we can choose a k-mer size such that fixed sampling both uses less space and processes queries faster than minimizer sampling. The reason is that although minimizer sampling is able to sample query k-mers, the number of shared k-mer occurrences that must be processed is much larger for minimizer sampling than fixed sampling. In conclusion, we argue that for any application where each shared k-mer occurrence must be processed, fixed sampling is the right sampling method.

Comparing fixed sampling with minimizer sampling when using k-mer indexes to find maximal exact matches

PubMed Central

Torng, Eric

2018-01-01

Bioinformatics applications and pipelines increasingly use k-mer indexes to search for similar sequences. The major problem with k-mer indexes is that they require lots of memory. Sampling is often used to reduce index size and query time. Most applications use one of two major types of sampling: fixed sampling and minimizer sampling. It is well known that fixed sampling will produce a smaller index, typically by roughly a factor of two, whereas it is generally assumed that minimizer sampling will produce faster query times since query k-mers can also be sampled. However, no direct comparison of fixed and minimizer sampling has been performed to verify these assumptions. We systematically compare fixed and minimizer sampling using the human genome as our database. We use the resulting k-mer indexes for fixed sampling and minimizer sampling to find all maximal exact matches between our database, the human genome, and three separate query sets, the mouse genome, the chimp genome, and an NGS data set. We reach the following conclusions. First, using larger k-mers reduces query time for both fixed sampling and minimizer sampling at a cost of requiring more space. If we use the same k-mer size for both methods, fixed sampling requires typically half as much space whereas minimizer sampling processes queries only slightly faster. If we are allowed to use any k-mer size for each method, then we can choose a k-mer size such that fixed sampling both uses less space and processes queries faster than minimizer sampling. The reason is that although minimizer sampling is able to sample query k-mers, the number of shared k-mer occurrences that must be processed is much larger for minimizer sampling than fixed sampling. In conclusion, we argue that for any application where each shared k-mer occurrence must be processed, fixed sampling is the right sampling method. PMID:29389989

FSH: fast spaced seed hashing exploiting adjacent hashes.

PubMed

Girotto, Samuele; Comin, Matteo; Pizzi, Cinzia

2018-01-01

Patterns with wildcards in specified positions, namely spaced seeds , are increasingly used instead of k -mers in many bioinformatics applications that require indexing, querying and rapid similarity search, as they can provide better sensitivity. Many of these applications require to compute the hashing of each position in the input sequences with respect to the given spaced seed, or to multiple spaced seeds. While the hashing of k -mers can be rapidly computed by exploiting the large overlap between consecutive k -mers, spaced seeds hashing is usually computed from scratch for each position in the input sequence, thus resulting in slower processing. The method proposed in this paper, fast spaced-seed hashing (FSH), exploits the similarity of the hash values of spaced seeds computed at adjacent positions in the input sequence. In our experiments we compute the hash for each positions of metagenomics reads from several datasets, with respect to different spaced seeds. We also propose a generalized version of the algorithm for the simultaneous computation of multiple spaced seeds hashing. In the experiments, our algorithm can compute the hashing values of spaced seeds with a speedup, with respect to the traditional approach, between 1.6[Formula: see text] to 5.3[Formula: see text], depending on the structure of the spaced seed. Spaced seed hashing is a routine task for several bioinformatics application. FSH allows to perform this task efficiently and raise the question of whether other hashing can be exploited to further improve the speed up. This has the potential of major impact in the field, making spaced seed applications not only accurate, but also faster and more efficient. The software FSH is freely available for academic use at: https://bitbucket.org/samu661/fsh/overview.

Sulforaphane rescues amyloid-β peptide-mediated decrease in MerTK expression through its anti-inflammatory effect in human THP-1 macrophages.

PubMed

Jhang, Kyoung A; Park, Jin-Sun; Kim, Hee-Sun; Chong, Young Hae

2018-03-12

Mer tyrosine kinase (MerTK) activity necessary for amyloid-stimulated phagocytosis strongly implicates that MerTK dysregulation might contribute to chronic inflammation implicated in Alzheimer's disease (AD) pathology. However, the precise mechanism involved in the regulation of MerTK expression by amyloid-β (Aβ) in proinflammatory environment has not yet been ascertained. The objective of this study was to determine the underlying mechanism involved in Aβ-mediated decrease in MerTK expression through Aβ-mediated regulation of MerTK expression and its modulation by sulforaphane in human THP-1 macrophages challenged with Aβ1-42. We used protein preparation, Ca 2+ influx fluorescence imaging, nuclear fractionation, Western blotting techniques, and small interfering RNA (siRNA) knockdown to perform our study. Aβ1-42 elicited a marked decrease in MerTK expression along with increased intracellular Ca 2+ level and induction of proinflammatory cytokines such as IL-1β and TNF-α. Ionomycin A and thapsigargin also increased intracellular Ca 2+ levels and production of IL-1β and TNF-α, mimicking the effect of Aβ1-42. In contrast, the Aβ1-42-evoked responses were attenuated by depletion of Ca 2+ with ethylene glycol tetraacetic acid. Furthermore, recombinant IL-1β or TNF-α elicited a decrease in MerTK expression. However, immunodepletion of IL-1β or TNF-α with neutralizing antibodies significantly inhibited Aβ1-42-mediated downregulation of MerTK expression. Notably, sulforaphane treatment potently inhibited Aβ1-42-induced intracellular Ca 2+ level and rescued the decrease in MerTK expression by blocking nuclear factor-κB (NF-κB) nuclear translocation, thereby decreasing IL-1β and TNF-α production upon Aβ1-42 stimulation. Such adverse effects of sulforaphane were replicated by BAY 11-7082, a NF-κB inhibitor. Moreover, sulforaphane's anti-inflammatory effects on Aβ1-42-induced production of IL-1β and TNF-α were significantly diminished by siRNA-mediated knockdown of MerTK, confirming a critical role of MerTK in suppressing Aβ1-42-induced innate immune response. These findings implicate that targeting of MerTK with phytochemical sulforaphane as a mechanism for preventing Aβ1-42-induced neuroinflammation has potential to be applied in AD therapeutics.

Characterization and Demonstration of the Value of a Lethal Mouse Model of Middle East Respiratory Syndrome Coronavirus Infection and Disease.

PubMed

Tao, Xinrong; Garron, Tania; Agrawal, Anurodh Shankar; Algaissi, Abdullah; Peng, Bi-Hung; Wakamiya, Maki; Chan, Teh-Sheng; Lu, Lu; Du, Lanying; Jiang, Shibo; Couch, Robert B; Tseng, Chien-Te K

2016-01-01

Characterized animal models are needed for studying the pathogenesis of and evaluating medical countermeasures for persisting Middle East respiratory syndrome-coronavirus (MERS-CoV) infections. Here, we further characterized a lethal transgenic mouse model of MERS-CoV infection and disease that globally expresses human CD26 (hCD26)/DPP4. The 50% infectious dose (ID50) and lethal dose (LD50) of virus were estimated to be <1 and 10 TCID50 of MERS-CoV, respectively. Neutralizing antibody developed in the surviving mice from the ID50/LD50 determinations, and all were fully immune to challenge with 100 LD50 of MERS-CoV. The tissue distribution and histopathology in mice challenged with a potential working dose of 10 LD50 of MERS-CoV were subsequently evaluated. In contrast to the overwhelming infection seen in the mice challenged with 10(5) LD50 of MERS-CoV, we were able to recover infectious virus from these mice only infrequently, although quantitative reverse transcription-PCR (qRT-PCR) tests indicated early and persistent lung infection and delayed occurrence of brain infection. Persistent inflammatory infiltrates were seen in the lungs and brain stems at day 2 and day 6 after infection, respectively. While focal infiltrates were also noted in the liver, definite pathology was not seen in other tissues. Finally, using a receptor binding domain protein vaccine and a MERS-CoV fusion inhibitor, we demonstrated the value of this model for evaluating vaccines and antivirals against MERS. As outcomes of MERS-CoV infection in patients differ greatly, ranging from asymptomatic to overwhelming disease and death, having available both an infection model and a lethal model makes this transgenic mouse model relevant for advancing MERS research. Fully characterized animal models are essential for studying pathogenesis and for preclinical screening of vaccines and drugs against MERS-CoV infection and disease. When given a high dose of MERS-CoV, our transgenic mice expressing hCD26/DPP4 viral receptor uniformly succumbed to death within 6 days, making it difficult to evaluate host responses to infection and disease. We further characterized this model by determining both the ID50 and the LD50 of MERS-CoV in order to establish both an infection model and a lethal model for MERS and followed this by investigating the antibody responses and immunity of the mice that survived MERS-CoV infection. Using the estimated LD50 and ID50 data, we dissected the kinetics of viral tissue distribution and pathology in mice challenged with 10 LD50 of virus and utilized the model for preclinical evaluation of a vaccine and drug for treatment of MERS-CoV infection. This further-characterized transgenic mouse model will be useful for advancing MERS research. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

High-Efficiency Synthesis of Human α-Endorphin and Magainin in the Erythrocytes of Transgenic Mice: A Production System for Therapeutic Peptides

NASA Astrophysics Data System (ADS)

Sharma, Ajay; Khoury-Christianson, Anastasia M.; White, Steven P.; Dhanjal, Nirpal K.; Huang, Wen; Paulhiac, Clara; Friedman, Eric J.; Manjula, Belur N.; Kumar, Ramesh

1994-09-01

Chemical synthesis of peptides, though feasible, is hindered by considerations of cost, purity, and efficiency of synthesizing longer chains. Here we describe a transgenic system for producing peptides of therapeutic interest as fusion proteins at low cost and high purity. Transgenic hemoglobin expression technology using the locus control region was employed to produce fusion hemoglobins in the erythrocytes of mice. The fusion hemoglobin contains the desired peptide as an extension at the C end of human α-globin. A protein cleavage site is inserted between the C end of the α-globin chain and the N-terminal residue of the desired peptide. The peptide is recovered after cleavage of the fusion protein with enzymes that recognize this cleavage signal as their substrate. Due to the selective compartmentalization of hemoglobin in the erythrocytes, purification of the fusion hemoglobin is easy and efficient. Because of its compact and highly ordered structure, the internal sites of hemoglobin are resistant to protease digestion and the desired peptide is efficiently released and recovered. The applicability of this approach was established by producing a 16-mer α-endorphin peptide and a 26-mer magainin peptide in transgenic mice. Transgenic animals and their progeny expressing these fusion proteins remain healthy, even when the fusion protein is expressed at >25% of the total hemoglobin in the erythrocytes. Additional applications and potential improvements of this methodology are discussed.

MerCat: a versatile k-mer counter and diversity estimator for database-independent property analysis obtained from metagenomic and/or metatranscriptomic sequencing data

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, Richard A.; Panyala, Ajay R.; Glass, Kevin A.

MerCat is a parallel, highly scalable and modular property software package for robust analysis of features in next-generation sequencing data. MerCat inputs include assembled contigs and raw sequence reads from any platform resulting in feature abundance counts tables. MerCat allows for direct analysis of data properties without reference sequence database dependency commonly used by search tools such as BLAST and/or DIAMOND for compositional analysis of whole community shotgun sequencing (e.g. metagenomes and metatranscriptomes).

Sparse evidence of MERS-CoV infection among animal workers living in Southern Saudi Arabia during 2012

PubMed Central

Memish, Ziad A; Alsahly, Ahmad; Masri, Malak al; Heil, Gary L; Anderson, Benjamin D; Peiris, Malik; Khan, Salah Uddin; Gray, Gregory C

2015-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) is an emerging viral pathogen that primarily causes respiratory illness. We conducted a seroprevalence study of banked human serum samples collected in 2012 from Southern Saudi Arabia. Sera from 300 animal workers (17% with daily camel exposure) and 50 non-animal-exposed controls were examined for serological evidence of MERS-CoV infection by a pseudoparticle MERS-CoV spike protein neutralization assay. None of the sera reproducibly neutralized the MERS-CoV-pseudotyped lentiviral vector. These data suggest that serological evidence of zoonotic transmission of MERS-CoV was not common among animal workers in Southern Saudi Arabia during July 2012. PMID:25470665

Importance of specific purine amino and hydroxyl groups for efficient cleavage by a hammerhead ribozyme.

PubMed Central

Fu, D J; McLaughlin, L W

1992-01-01

Eight modified ribozymes of 19 residues have been prepared with individual purine amino or hydroxyl groups excised. The modified ribozymes were chemically synthesized with the substitution of a single 2'-deoxyadenosine, 2'-deoxyguanosine, inosine, or purine riboside for residues G10, A11, G13, or A14. Five of the modified ribozymes cleaved the 24-mer substrate with little change in rate as monitored by simple first-order kinetics. However, deletion of the 2-amino group at G10 (replacement with inosine) or deletion of either of the 2'-hydroxyls at G10 or G13 (replacement with 2'-deoxyguanosine) resulted in ribozymes with a drastic decrease in cleavage efficiency. Increasing the concentration of the Mg2+ cofactor from 10 mM to 50 mM significantly enhanced cleavage efficiency by these three derivatives. Steady-state kinetic assays for these three ribozymes indicated that the modifications result in both an increase in Km and a decrease in kcat. These results suggest that the exocyclic amino group at-G10 and the hydroxyls at G10 and G13 are important both for ribozyme-substrate binding and for the Mg(2+)-catalyzed cleavage reaction. PMID:1570323

Chimeric Antisense Oligonucleotide Conjugated to α-Tocopherol

PubMed Central

Nishina, Tomoko; Numata, Junna; Nishina, Kazutaka; Yoshida-Tanaka, Kie; Nitta, Keiko; Piao, Wenying; Iwata, Rintaro; Ito, Shingo; Kuwahara, Hiroya; Wada, Takeshi; Mizusawa, Hidehiro; Yokota, Takanori

2015-01-01

We developed an efficient system for delivering short interfering RNA (siRNA) to the liver by using α-tocopherol conjugation. The α-tocopherol–conjugated siRNA was effective and safe for RNA interference–mediated gene silencing in vivo. In contrast, when the 13-mer LNA (locked nucleic acid)-DNA gapmer antisense oligonucleotide (ASO) was directly conjugated with α-tocopherol it showed markedly reduced silencing activity in mouse liver. Here, therefore, we tried to extend the 5′-end of the ASO sequence by using 5′-α-tocopherol–conjugated 4- to 7-mers of unlocked nucleic acid (UNA) as a “second wing.” Intravenous injection of mice with this α-tocopherol–conjugated chimeric ASO achieved more potent silencing than ASO alone in the liver, suggesting increased delivery of the ASO to the liver. Within the cells, the UNA wing was cleaved or degraded and α-tocopherol was released from the 13-mer gapmer ASO, resulting in activation of the gapmer. The α-tocopherol–conjugated chimeric ASO showed high efficacy, with hepatic tropism, and was effective and safe for gene silencing in vivo. We have thus identified a new, effective LNA-DNA gapmer structure in which drug delivery system (DDS) molecules are bound to ASO with UNA sequences. PMID:25584900

Inhibition of HIV Replication by Cyclic and Hairpin PNAs Targeting the HIV-1 TAR RNA Loop

PubMed Central

Upert, Gregory; Di Giorgio, Audrey; Upadhyay, Alok; Manvar, Dinesh; Pandey, Nootan; Pandey, Virendra N.; Patino, Nadia

2012-01-01

Human immunodeficiency virus-1 (HIV-1) replication and gene expression entails specific interaction of the viral protein Tat with its transactivation responsive element (TAR), to form a highly stable stem-bulge-loop structure. Previously, we described triphenylphosphonium (TPP) cation-based vectors that efficiently deliver nucleotide analogs (PNAs) into the cytoplasm of cells. In particular, we showed that the TPP conjugate of a linear 16-mer PNA targeting the apical stem-loop region of TAR impedes Tat-mediated transactivation of the HIV-1 LTR in vitro and also in cell culture systems. In this communication, we conjugated TPP to cyclic and hairpin PNAs targeting the loop region of HIV-1 TAR and evaluated their antiviral efficacy in a cell culture system. We found that TPP-cyclic PNAs containing only 8 residues, showed higher antiviral potency compared to hairpin PNAs of 12 or 16 residues. We further noted that the TPP-conjugates of the 8-mer cyclic PNA as well as the 16-mer linear PNA displayed similar antiviral efficacy. However, cyclic PNAs were shown to be highly specific to their target sequences. This communication emphasizes on the importance of small constrained cyclic PNAs over both linear and hairpin structures for targeting biologically relevant RNA hairpins. PMID:23029603

Petroleum production at Maximum Efficient Rate Naval Petroleum Reserve No. 1 (Elk Hills), Kern County, California. Final Supplemental Environmental Impact Statement

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1993-07-01

This document provides an analysis of the potential impacts associated with the proposed action, which is continued operation of Naval Petroleum Reserve No. I (NPR-1) at the Maximum Efficient Rate (MER) as authorized by Public law 94-258, the Naval Petroleum Reserves Production Act of 1976 (Act). The document also provides a similar analysis of alternatives to the proposed action, which also involve continued operations, but under lower development scenarios and lower rates of production. NPR-1 is a large oil and gas field jointly owned and operated by the federal government and Chevron U.SA Inc. (CUSA) pursuant to a Unit Planmore » Contract that became effective in 1944; the government`s interest is approximately 78% and CUSA`s interest is approximately 22%. The government`s interest is under the jurisdiction of the United States Department of Energy (DOE). The facility is approximately 17,409 acres (74 square miles), and it is located in Kern County, California, about 25 miles southwest of Bakersfield and 100 miles north of Los Angeles in the south central portion of the state. The environmental analysis presented herein is a supplement to the NPR-1 Final Environmental Impact Statement of that was issued by DOE in 1979 (1979 EIS). As such, this document is a Supplemental Environmental Impact Statement (SEIS).« less

Assessment of the risk posed to Singapore by the 2015 Middle East respiratory syndrome outbreak in the Republic of Korea

PubMed Central

Zhang, Emma Xuxiao; Oh, Olivia Seen Huey; See, Wanhan; Raj, Pream; James, Lyn; Khan, Kamran

2016-01-01

Objective To assess the public health risk to Singapore posed by the Middle East respiratory syndrome (MERS) outbreak in the Republic of Korea in 2015. Methods The likelihood of importation of MERS cases and the magnitude of the public health impact in Singapore were assessed to determine overall risk. Literature on the epidemiology and contextual factors associated with MERS coronavirus infection was collected and reviewed. Connectivity between the Republic of Korea and Singapore was analysed. Public health measures implemented by the two countries were reviewed. Results The epidemiology of the 2015 MERS outbreak in the Republic of Korea remained similar to the MERS outbreaks in Saudi Arabia. In addition, strong infection control and response measures were effective in controlling the outbreak. In view of the air traffic between Singapore and MERS-affected areas, importation of MERS cases into Singapore is possible. Nonetheless, the risk of a serious public health impact to Singapore in the event of an imported case of MERS would be mitigated by its strong health-care system and established infection control practices. Discussion The MERS outbreak was sparked by an exported case from the Middle East, which remains a concern as the reservoir of infection (thought to be camels) continues to exist in the Middle East, and sporadic cases in the community and outbreaks in health-care settings continue to occur there. This risk assessment highlights the need for Singapore to stay vigilant and to continue enhancing core public health capacities to detect and respond to MERS coronavirus. PMID:27508087

Assessment of the risk posed to Singapore by the 2015 Middle East respiratory syndrome outbreak in the Republic of Korea.

PubMed

Zhang, Emma Xuxiao; Oh, Olivia Seen Huey; See, Wanhan; Raj, Pream; James, Lyn; Khan, Kamran; Tey, Jeannie Su Hui

2016-01-01

To assess the public health risk to Singapore posed by the Middle East respiratory syndrome (MERS) outbreak in the Republic of Korea in 2015. The likelihood of importation of MERS cases and the magnitude of the public health impact in Singapore were assessed to determine overall risk. Literature on the epidemiology and contextual factors associated with MERS coronavirus infection was collected and reviewed. Connectivity between the Republic of Korea and Singapore was analysed. Public health measures implemented by the two countries were reviewed. The epidemiology of the 2015 MERS outbreak in the Republic of Korea remained similar to the MERS outbreaks in Saudi Arabia. In addition, strong infection control and response measures were effective in controlling the outbreak. In view of the air traffic between Singapore and MERS-affected areas, importation of MERS cases into Singapore is possible. Nonetheless, the risk of a serious public health impact to Singapore in the event of an imported case of MERS would be mitigated by its strong health-care system and established infection control practices. The MERS outbreak was sparked by an exported case from the Middle East, which remains a concern as the reservoir of infection (thought to be camels) continues to exist in the Middle East, and sporadic cases in the community and outbreaks in health-care settings continue to occur there. This risk assessment highlights the need for Singapore to stay vigilant and to continue enhancing core public health capacities to detect and respond to MERS coronavirus.

Characterization of novel monoclonal antibodies against the MERS-coronavirus spike protein and their application in species-independent antibody detection by competitive ELISA.

PubMed

Fukushi, Shuetsu; Fukuma, Aiko; Kurosu, Takeshi; Watanabe, Shumpei; Shimojima, Masayuki; Shirato, Kazuya; Iwata-Yoshikawa, Naoko; Nagata, Noriyo; Ohnishi, Kazuo; Ato, Manabu; Melaku, Simenew Keskes; Sentsui, Hiroshi; Saijo, Masayuki

2018-01-01

Since discovering the Middle East respiratory syndrome coronavirus (MERS-CoV) as a causative agent of severe respiratory illness in the Middle East in 2012, serological testing has been conducted to assess antibody responses in patients and to investigate the zoonotic reservoir of the virus. Although the virus neutralization test is the gold standard assay for MERS diagnosis and for investigating the zoonotic reservoir, it uses live virus and so must be performed in high containment laboratories. Competitive ELISA (cELISA), in which a labeled monoclonal antibody (MAb) competes with test serum antibodies for target epitopes, may be a suitable alternative because it detects antibodies in a species-independent manner. In this study, novel MAbs against the spike protein of MERS-CoV were produced and characterized. One of these MAbs was used to develop a cELISA. The cELISA detected MERS-CoV-specific antibodies in sera from MERS-CoV-infected rats and rabbits immunized with the spike protein of MERS-CoV. The MAb-based cELISA was validated using sera from Ethiopian dromedary camels. Relative to the neutralization test, the cELISA detected MERS-CoV-specific antibodies in 66 Ethiopian dromedary camels with a sensitivity and specificity of 98% and 100%, respectively. The cELISA and neutralization test results correlated well (Pearson's correlation coefficients=0.71-0.76, depending on the cELISA serum dilution). This cELISA may be useful for MERS epidemiological investigations on MERS-CoV infection. Copyright © 2017 Elsevier B.V. All rights reserved.

Restructuring the vocal fold lamina propria with endoscopic microdissection.

PubMed

Bartlett, Rebecca S; Hoffman, Henry T; Dailey, Seth H; Bock, Jonathan M; Klemuk, Sarah A; Askeland, Ryan W; Ahlrichs-Hanson, Jan S; Heaford, Andrew C; Thibeault, Susan L

2013-11-01

The purposes of this preclinical study were to investigate histologic and rheologic outcomes of Microendoscopy of Reinke's space (MERS)-guided minithyrotomy and to assess its instrumentation. Human cadaveric and in vivo animal study. Three human cadaveric larynges were treated with MERS-guided placement of Radiesse VoiceGel and immediately evaluated histologically for biomaterial location. In the second part of this investigation, two scarred porcine larynges were treated with MERS-guided placement of HyStem-VF and rheologically evaluated 6 weeks later. Student t tests determined differences in viscoelastic properties of treated/untreated vocal folds. Sialendoscopes and microendoscopes were subjectively compared for their visualization capacity. MERS imaged the subepithelial area and vocal ligament, guiding both tissue dissection and biomaterial positioning. Sialendoscopes provided adequate visualization and feature incorporated working channels. Enhanced image clarity was created in a gas-filled rather than saline-filled environment, per rater judgment. Histological analysis revealed desirable biomaterial positioning with MERS. Per rheological analysis, viscoelastic properties of the MERS-treated porcine vocal folds compared to uninjured vocal folds 6 weeks following treatment did not statistically differ. MERS-guided laryngoplasty using sialendoscopes yielded satisfactory biomaterial positioning in the short-term and normalized rheologic tissue properties in the long-term, contributing to proof of concept for MERS in the treatment of scarring. Strengths of MERS include direct, real-time visualization of Reinke's space and an ability to manipulate surgical instruments parallel to the vocal fold edge while maintaining an intact epithelium. Future work will explore the clinical utility of MERS for addressing scarring, sulcus vocalis, and other intracordal processes. Copyright © 2013 The American Laryngological, Rhinological and Otological Society, Inc.

Biological assessment of the effects of petroleum production at maximum efficient rate, Naval Petroleum Reserve No. 1 (Elk Hills), Kern County, California, on the endangered blunt-nosed leopard lizard, Gambelia silus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kato, T.T.; O'Farrell, T.P.

1986-06-01

Surveys to determine the distribution and relative abundance of blunt-nosed leopard lizards on Naval Petroleum Reserve-1 were conducted in 1980 and 1981. In 1982 radiotelemetry and pitfall trapping techniques were used to gain additional information on the species and develop alternative methods of study. Incidental observations of blunt-nosed leopard lizards were recorded and used in the distribution information for NPR-1. DOE determined during this biological assessment that the construction projects and operational activities necessary to achieve and sustain MER have not adversely affected the blunt-nosed leopard lizard and its habitat, because only approximately 6% of the potential blunt-nosed leopard lizardmore » habitat on NPR-1 was disturbed by construction and operational activities. DOE believes that the direct, indirect, and cumulative effects of MER will not jeopardize the continued existence of the species, because results of surveys indicated that blunt-nosed leopard lizards are mainly distributed near the periphery of Elk Hills where few petroleum developments occurred in the past and where they are unlikely to occur in the future. A policy of conducting preconstruction surveys to protect blunt-nosed leopard lizard habitat was initiated, a habitat restoration plan was developed and implemented, and administrative policies to reduce vehicle speeds, contain oil spills, restrict off-road vehicle (ORV) travel, and to prohibit public access, livestock grazing, and agricultural activities were maintained.« less

Taking aim at Mer and Axl receptor tyrosine kinases as novel therapeutic targets in solid tumors

PubMed Central

Linger, Rachel M.A.; Keating, Amy K.; Earp, H. Shelton

2010-01-01

Importance of the field Axl and/or Mer expression correlates with poor prognosis in several cancers. Until recently, the specific role of these receptor tyrosine kinases (RTKs) in the development and progression of cancer remained unexplained. Studies demonstrating that Axl and Mer contribute to mechanisms of cell survival, migration, invasion, metastasis, and chemosensitivity justify further investigation of Axl and Mer as novel therapeutic targets in cancer. Areas covered in this review Axl and Mer signaling pathways in cancer cells are summarized and evidence validating these RTKs as therapeutic targets in glioblastoma multiforme, non-small cell lung cancer, and breast cancer is examined. A comprehensive discussion of Axl and/or Mer inhibitors in development is also provided. What the reader will gain Potential toxicities associated with Axl or Mer inhibition are addressed. We hypothesize that the probable action of Mer and Axl inhibitors on cells within the tumor microenvironment will provide a unique therapeutic opportunity to target both tumor cells and the stromal components which facilitate disease progression. Take home message Axl and Mer mediate multiple oncogenic phenotypes and activation of these RTKs constitutes a mechanism of chemoresistance in a variety of solid tumors. Targeted inhibition of these RTKs may be effective as anti-tumor and/or anti-metastatic therapy, particularly if combined with standard cytotoxic therapies. PMID:20809868

Pedagogical Affordances of Multiple External Representations in Scientific Processes

NASA Astrophysics Data System (ADS)

Wu, Hsin-Kai; Puntambekar, Sadhana

2012-12-01

Multiple external representations (MERs) have been widely used in science teaching and learning. Theories such as dual coding theory and cognitive flexibility theory have been developed to explain why the use of MERs is beneficial to learning, but they do not provide much information on pedagogical issues such as how and in what conditions MERs could be introduced and used to support students' engagement in scientific processes and develop competent scientific practices (e.g., asking questions, planning investigations, and analyzing data). Additionally, little is understood about complex interactions among scientific processes and affordances of MERs. Therefore, this article focuses on pedagogical affordances of MERs in learning environments that engage students in various scientific processes. By reviewing literature in science education and cognitive psychology and integrating multiple perspectives, this article aims at exploring (1) how MERs can be integrated with science processes due to their different affordances, and (2) how student learning with MERs can be scaffolded, especially in a classroom situation. We argue that pairing representations and scientific processes in a principled way based on the affordances of the representations and the goals of the activities is a powerful way to use MERs in science education. Finally, we outline types of scaffolding that could help effective use of MERs including dynamic linking, model progression, support in instructional materials, teacher support, and active engagement.

Middle East Respiratory Syndrome (MERS)

MedlinePlus

Middle East Respiratory Syndrome Coronavirus; MERS-CoV; Novel coronavirus; nCoV ... for Disease Control and Prevention website. Middle East Respiratory Syndrome (MERS): Frequently asked questions and answers. www. ...

Deciphering MERS-CoV Evolution in Dromedary Camels.

PubMed

Du, Lin; Han, Guan-Zhu

2016-02-01

The emergence of the Middle East respiratory syndrome coronavirus (MERS-CoV) poses a potential threat to global public health. Many aspects of the evolution and transmission of MERS-CoV in its animal reservoir remain unclear. A recent study provides new insights into the evolution and transmission of MERS-CoV in dromedary camels. Copyright © 2015 Elsevier Ltd. All rights reserved.

Primer design for a prokaryotic differential display RT-PCR.

PubMed Central

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-01-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168

Primer design for a prokaryotic differential display RT-PCR.

PubMed

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

KENNEDY SPACE CENTER, FLA. - An overhead crane lifts the Mars Exploration Rover 2 (MER-2) entry vehicle from its stand to move it to a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - An overhead crane lifts the Mars Exploration Rover 2 (MER-2) entry vehicle from its stand to move it to a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - With help from workers, the overhead crane lowers the Mars Exploration Rover 2 (MER-2) entry vehicle onto a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - With help from workers, the overhead crane lowers the Mars Exploration Rover 2 (MER-2) entry vehicle onto a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - An overhead crane moves the Mars Exploration Rover 2 (MER-2) entry vehicle across the Payload Hazardous Servicing Facility toward a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - An overhead crane moves the Mars Exploration Rover 2 (MER-2) entry vehicle across the Payload Hazardous Servicing Facility toward a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - Workers in the Payload Hazardous Servicing Facility help guide the Mars Exploration Rover 2 (MER-2) entry vehicle toward a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - Workers in the Payload Hazardous Servicing Facility help guide the Mars Exploration Rover 2 (MER-2) entry vehicle toward a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - An overhead crane is in place to lift the Mars Exploration Rover 2 (MER-2) entry vehicle to move it to a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - An overhead crane is in place to lift the Mars Exploration Rover 2 (MER-2) entry vehicle to move it to a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

Characterisation of a DNA sequence element that directs Dictyostelium stalk cell-specific gene expression.

PubMed

Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J

2000-12-01

The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.

SigHunt: horizontal gene transfer finder optimized for eukaryotic genomes.

PubMed

Jaron, Kamil S; Moravec, Jiří C; Martínková, Natália

2014-04-15

Genomic islands (GIs) are DNA fragments incorporated into a genome through horizontal gene transfer (also called lateral gene transfer), often with functions novel for a given organism. While methods for their detection are well researched in prokaryotes, the complexity of eukaryotic genomes makes direct utilization of these methods unreliable, and so labour-intensive phylogenetic searches are used instead. We present a surrogate method that investigates nucleotide base composition of the DNA sequence in a eukaryotic genome and identifies putative GIs. We calculate a genomic signature as a vector of tetranucleotide (4-mer) frequencies using a sliding window approach. Extending the neighbourhood of the sliding window, we establish a local kernel density estimate of the 4-mer frequency. We score the number of 4-mer frequencies in the sliding window that deviate from the credibility interval of their local genomic density using a newly developed discrete interval accumulative score (DIAS). To further improve the effectiveness of DIAS, we select informative 4-mers in a range of organisms using the tetranucleotide quality score developed herein. We show that the SigHunt method is computationally efficient and able to detect GIs in eukaryotic genomes that represent non-ameliorated integration. Thus, it is suited to scanning for change in organisms with different DNA composition. Source code and scripts freely available for download at http://www.iba.muni.cz/index-en.php?pg=research-data-analysis-tools-sighunt are implemented in C and R and are platform-independent. 376090@mail.muni.cz or martinkova@ivb.cz. © The Author 2013. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Isomerization Reaction of mer- to fac-Tris(2-phenylpyridinato-N,C2')Iridium(III) Monitored by Using Surface-Enhanced Raman Spectroscopy.

PubMed

Wu, Bo-Han; Huang, Min-Jie; Lai, Cheng-Chang; Cheng, Chien-Hong; Chen, I-Chia

2018-04-16

We developed a new method by enclosing the complex tris(2-phenylpyridinato-N,C2')Iridium(III), Ir(ppy) 3 with surfactant cetyltrimethylammonium bromide (CATB), coated with a thin layer of silica then bonded to the surface of silver nanoparticle. These samples were used to acquire surface-enhanced Raman scattering (SERS) spectra. The thickness of silica layer was controlled to have efficient phosphorescence quenching and Raman enhancement by metal nanoparticle. The SERS spectra of fac- and mer-Ir(ppy) 3 , recorded at 633 nm excitation, display distinct ring breathing mode features because the total symmetric vibrational bands were enhanced. This provides a convenient means to differentiate these isomers with great sensitivity and to study their isomerization process. A direct conversion reaction of mer- to fac- isomerization is identified with time constant 3.1 min when mer was irradiated with Xe light. Via thermal activation, under moderate conditions (pH 5.5 and 343 K), we observed an intermediate particularly with new bands 320/662 cm -1 after heating for 17.5 h, and then those bands disappeared to form fac-Ir(ppy) 3 . On the basis of DFT calculations, the intermediate is proposed to contain octahedral N-N Ir(ppy) 3 -HO-silica structure; band at 320 cm -1 is assigned to iridium oxygen stretching mode ν Ir-O of this intermediate. Under acidic conditions, pH 1-2 catalyzed by silanol in silica, byproduct with band at 353 cm -1 was observed. According to the SERS bands and the calculation, this byproduct is assigned to be iridium(III) siloxide, and the new band is assigned to ν Ir-O .

Development of Animal Models Against Emerging Coronaviruses: From SARS to MERS coronavirus

PubMed Central

Sutton, Troy C; Subbarao, Kanta

2016-01-01

Two novel coronaviruses have emerged to cause severe disease in humans. While bats may be the primary reservoir for both viruses, SARS coronavirus (SARS-CoV) likely crossed into humans from civets in China, and MERS coronavirus (MERS-CoV) has been transmitted from camels in the Middle East. Unlike SARS-CoV that resolved within a year, continued introductions of MERS-CoV present an on-going public health threat. Animal models are needed to evaluate countermeasures against emerging viruses. With SARS-CoV, several animal species were permissive to infection. In contrast, most laboratory animals are refractory or only semi-permissive to infection with MERS-CoV. This host-range restriction is largely determined by sequence heterogeneity in the MERS-CoV receptor. We describe animal models developed to study coronaviruses, with a focus on host-range restriction at the level of the viral receptor and discuss approaches to consider in developing a model to evaluate countermeasures against MERS-CoV. PMID:25791336

Development of animal models against emerging coronaviruses: From SARS to MERS coronavirus.

PubMed

Sutton, Troy C; Subbarao, Kanta

2015-05-01

Two novel coronaviruses have emerged to cause severe disease in humans. While bats may be the primary reservoir for both viruses, SARS coronavirus (SARS-CoV) likely crossed into humans from civets in China, and MERS coronavirus (MERS-CoV) has been transmitted from camels in the Middle East. Unlike SARS-CoV that resolved within a year, continued introductions of MERS-CoV present an on-going public health threat. Animal models are needed to evaluate countermeasures against emerging viruses. With SARS-CoV, several animal species were permissive to infection. In contrast, most laboratory animals are refractory or only semi-permissive to infection with MERS-CoV. This host-range restriction is largely determined by sequence heterogeneity in the MERS-CoV receptor. We describe animal models developed to study coronaviruses, with a focus on host-range restriction at the level of the viral receptor and discuss approaches to consider in developing a model to evaluate countermeasures against MERS-CoV. Copyright © 2015. Published by Elsevier Inc.

Thermal Protection System Mass Estimating Relationships For Blunt-Body, Earth Entry Spacecraft

NASA Technical Reports Server (NTRS)

Sepka, Steven A.; Samareh, Jamshid A.

2015-01-01

Mass estimating relationships (MERs) are developed to predict the amount of thermal protection system (TPS) necessary for safe Earth entry for blunt-body spacecraft using simple correlations that are non-ITAR and closely match estimates from NASA's highfidelity ablation modeling tool, the Fully Implicit Ablation and Thermal Analysis Program (FIAT). These MERs provide a first order estimate for rapid feasibility studies. There are 840 different trajectories considered in this study, and each TPS MER has a peak heating limit. MERs for the vehicle forebody include the ablators Phenolic Impregnated Carbon Ablator (PICA) and Carbon Phenolic atop Advanced Carbon-Carbon. For the aftbody, the materials are Silicone Impregnated Reusable Ceramic Ablator (SIRCA), Acusil II, SLA- 561V, and LI-900. The MERs are accurate to within 14% (at one standard deviation) of FIAT prediction, and the most any MER can under predict FIAT TPS thickness is 18.7%. This work focuses on the development of these MERs, the resulting equations, model limitations, and model accuracy.

Prevalence of Middle East respiratory syndrome coronavirus (MERS-CoV) in dromedary camels in Abu Dhabi Emirate, United Arab Emirates.

PubMed

Yusof, Mohammed F; Eltahir, Yassir M; Serhan, Wissam S; Hashem, Farouk M; Elsayed, Elsaeid A; Marzoug, Bahaaeldin A; Abdelazim, Assem Si; Bensalah, Oum Keltoum A; Al Muhairi, Salama S

2015-06-01

High seroprevalence of Middle East respiratory syndrome corona virus (MERS-CoV) in dromedary camels has been previously reported in United Arab Emirates (UAE). However, the molecular detection of the virus has never been reported before in UAE. Of the 7,803 nasal swabs tested in the epidemiological survey, MERS-CoV nucleic acid was detected by real-time PCR in a total of 126 (1.6 %) camels. Positive camels were detected at the borders with Saudi Arabia and Oman and in camels' slaughter houses. MERS-CoV partial sequences obtained from UAE camels were clustering with human- and camel-derived MERS-CoV sequences in the same geographic area. Results provide further evidence of MERS-CoV zoonosis.

Middle East respiratory syndrome: obstacles and prospects for vaccine development

PubMed Central

Papaneri, Amy B.; Johnson, Reed F.; Wada, Jiro; Bollinger, Laura; Jahrling, Peter B.; Kuhn, Jens H.

2016-01-01

Summary The recent emergence of Middle East respiratory syndrome (MERS) highlights the need to engineer new methods for expediting vaccine development against emerging diseases. However, several obstacles prevent pursuit of a licensable MERS vaccine. First, the lack of a suitable animal model for MERS complicates in vivo testing of candidate vaccines. Second, due to the low number of MERS cases, pharmaceutical companies have little incentive to pursue MERS vaccine production as the costs of clinical trials are high. In addition, the timeline from bench research to approved vaccine use is 10 years or longer. Using novel methods and cost-saving strategies, genetically engineered vaccines can be produced quickly and cost-effectively. Along with progress in MERS animal model development, these obstacles can be circumvented or at least mitigated. PMID:25864502

Bioinspired construction of multi-enzyme catalytic systems.

PubMed

Shi, Jiafu; Wu, Yizhou; Zhang, Shaohua; Tian, Yu; Yang, Dong; Jiang, Zhongyi

2018-06-18

Enzyme catalysis, as a green, efficient process, displays exceptional functionality, adaptivity and sustainability. Multi-enzyme catalysis, which can accomplish the tandem synthesis of valuable materials/chemicals from renewable feedstocks, establishes a bridge between single-enzyme catalysis and whole-cell catalysis. Multi-enzyme catalysis occupies a unique and indispensable position in the realm of biological reactions for energy and environmental applications. Two complementary strategies, i.e., compartmentalization and substrate channeling, have been evolved by living organisms for implementing the complex in vivo multi-enzyme reactions (MERs), which have been applied to construct multi-enzyme catalytic systems (MECSs) with superior catalytic activity and stabilities in practical biocatalysis. This tutorial review aims to present the recent advances and future prospects in this burgeoning research area, stressing the features and applications of the two strategies for constructing MECSs and implementing in vitro MERs. The concluding remarks are presented with a perspective on the construction of MECSs through rational combination of compartmentalization and substrate channeling.

Results from Automated Cloud and Dust Devil Detection Onboard the MER

NASA Technical Reports Server (NTRS)

Chien, Steve; Castano, Rebecca; Bornstein, Benjamin; Fukunaga, Alex; Castano, Andres; Biesiadecki, Jeffrey; Greeley, Ron; Whelley, Patrick; Lemmon, Mark

2008-01-01

We describe a new capability to automatically detect dust devils and clouds in imagery onboard rovers, enabling downlink of just the images with the targets or only portions of the images containing the targets. Previously, the MER rovers conducted campaigns to image dust devils and clouds by commanding a set of images be collected at fixed times and downloading the entire image set. By increasing the efficiency of the campaigns, more campaigns can be executed. Software for these new capabilities was developed, tested, integrated, uploaded, and operationally checked out on both rovers as part of the R9.2 software upgrade. In April 2007 on Sol 1147 a dust devil was automatically detected onboard the Spirit rover for the first time. We discuss the operational usage of the capability and present initial dust devil results showing how this preliminary application has demonstrated the feasibility and potential benefits of the approach.

Quantum-dot-based quantitative identification of pathogens in complex mixture

NASA Astrophysics Data System (ADS)

Lim, Sun Hee; Bestwater, Felix; Buchy, Philippe; Mardy, Sek; Yu, Alexey Dan Chin

2010-02-01

In the present study we describe sandwich design hybridization probes consisting of magnetic particles (MP) and quantum dots (QD) with target DNA, and their application in the detection of avian influenza virus (H5N1) sequences. Hybridization of 25-, 40-, and 100-mer target DNA with both probes was analyzed and quantified by flow cytometry and fluorescence microscopy on the scale of single particles. The following steps were used in the assay: (i) target selection by MP probes and (ii) target detection by QD probes. Hybridization efficiency between MP conjugated probes and target DNA hybrids was controlled by a fluorescent dye specific for nucleic acids. Fluorescence was detected by flow cytometry to distinguish differences in oligo sequences as short as 25-mer capturing in target DNA and by gel-electrophoresis in the case of QD probes. This report shows that effective manipulation and control of micro- and nanoparticles in hybridization assays is possible.

MER-DIMES : a planetary landing application of computer vision

NASA Technical Reports Server (NTRS)

Cheng, Yang; Johnson, Andrew; Matthies, Larry

2005-01-01

During the Mars Exploration Rovers (MER) landings, the Descent Image Motion Estimation System (DIMES) was used for horizontal velocity estimation. The DIMES algorithm combines measurements from a descent camera, a radar altimeter and an inertial measurement unit. To deal with large changes in scale and orientation between descent images, the algorithm uses altitude and attitude measurements to rectify image data to level ground plane. Feature selection and tracking is employed in the rectified data to compute the horizontal motion between images. Differences of motion estimates are then compared to inertial measurements to verify correct feature tracking. DIMES combines sensor data from multiple sources in a novel way to create a low-cost, robust and computationally efficient velocity estimation solution, and DIMES is the first use of computer vision to control a spacecraft during planetary landing. In this paper, the detailed implementation of the DIMES algorithm and the results from the two landings on Mars are presented.

An assessment of the level of concern among hospital-based health-care workers regarding MERS outbreaks in Saudi Arabia.

PubMed

Abolfotouh, Mostafa A; AlQarni, Ali A; Al-Ghamdi, Suliman M; Salam, Mahmoud; Al-Assiri, Mohammed H; Balkhy, Hanan H

2017-01-03

Middle East Respiratory Syndrome (MERS) is caused by MERS coronavirus (MERS-CoV). More than 80% of reported cases have occurred in Saudi Arabia, with a mortality exceeding 50%. Health-care workers (HCWs) are at risk of acquiring and transmitting this virus, so the concerns of HCWs in Saudi Arabia regarding MERS were evaluated. An anonymous, self-administered, previously validated questionnaire was given to 1031 HCWs at three tertiary hospitals in Saudi Arabia from October to December, 2014. Concerns regarding the disease, its severity and governmental efforts to contain it, as well as disease outcomes were assessed using 31 concern statements in five distinct domains. A total concern score was calculated for each HCW. Multiple regression analyses were used to identify predictors of high concern scores. The average age of participants was 37.1 ± 9.0 years, 65.8% were married and 59.1% were nurses. The majority of respondents (70.4%) felt at risk of contracting a MERS-CoV infection at work, 69.1% felt threatened if a colleague contracted MERS-CoV, 60.9% felt obliged to care for patients infected with MERS-CoV and 87.8% did not feel safe at work using standard precautions. In addition, 87.7% believed that the government should isolate patients with MERS in specialized hospitals, 73.7% agreed with travel restriction to and from areas affected by MERS and 65.3% agreed with avoiding inviting expatriates from such areas. After adjustment for covariates, high concern scores were significantly associated with being a Saudi national (p < 0.001), a non-physician (p < 0.001) and working in the central region (p < 0.001). The majority of respondents reported concern regarding MERS-CoV infection from exposure at work. The overall level of concern may be influenced by previous experience of MERS outbreaks and related cultural issues. The concerns of HCWs may affect their overall effectiveness in an outbreak and should be addressed by incorporating management strategies in outbreak planning.

Pigment Epithelium Derived Factor Peptide Protects Murine Hepatocytes from Carbon Tetrachloride-Induced Injury

PubMed Central

Shih, Shou-Chuan; Ho, Tsung-Chuan; Chen, Show-Li; Tsao, Yeou-Ping

2016-01-01

Fibrogenesis is induced by repeated injury to the liver and reactive regeneration and leads eventually to liver cirrhosis. Pigment epithelium derived factor (PEDF) has been shown to prevent liver fibrosis induced by carbon tetrachloride (CCl4). A 44 amino acid domain of PEDF (44-mer) was found to have a protective effect against various insults to several cell types. In this study, we investigated the capability of synthetic 44-mer to protect against liver injury in mice and in primary cultured hepatocytes. Acute liver injury, induced by CCl4, was evident from histological changes, such as cell necrosis, inflammation and apoptosis, and a concomitant reduction of glutathione (GSH) and GSH redox enzyme activities in the liver. Intraperitoneal injection of the 44-mer into CCl4-treated mice abolished the induction of AST and ALT and markedly reduced histological signs of liver injury. The 44-mer treatment can reduce hepatic oxidative stress as evident from lower levels of lipid hydroperoxide, and higher levels of GSH. CCl4 caused a reduction of Bcl-xL, PEDF and PPARγ, which was markedly restored by the 44-mer treatment. Consequently, the 44-mer suppressed liver fibrosis induced by repeated CCl4 injury. Furthermore, our observations in primary culture of rat hepatocytes showed that PEDF and the 44-mer protected primary rat hepatocytes against apoptosis induced by serum deprivation and TGF-β1. PEDF/44-mer induced cell protective STAT3 phosphorylation. Pharmacological STAT3 inhibition prevented the antiapoptotic action of PEDF/44-mer. Among several PEDF receptor candidates that may be responsible for hepatocyte protection, we demonstrated that PNPLA2 was essential for PEDF/44-mer-mediated STAT3 phosphorylation and antiapoptotic activity by using siRNA to selectively knockdown PNPLA2. In conclusion, the PEDF 44-mer protects hepatocytes from single and repeated CCl4 injury. This protective effect may stem from strengthening the counter oxidative stress capacity and induction of hepatoprotective factors. PMID:27384427

Middle East Respiratory Syndrome (MERS)

MedlinePlus

... Controls Cancel Submit Search The CDC Middle East Respiratory Syndrome (MERS) Note: Javascript is disabled or is ... Recommend on Facebook Tweet Share Compartir Middle East Respiratory Syndrome (MERS) is viral respiratory illness that was ...

MERS transmission and risk factors: a systematic review.

PubMed

Park, Ji-Eun; Jung, Soyoung; Kim, Aeran; Park, Ji-Eun

2018-05-02

Since Middle East respiratory syndrome (MERS) infection was first reported in 2012, many studies have analysed its transmissibility and severity. However, the methodology and results of these studies have varied, and there has been no systematic review of MERS. This study reviews the characteristics and associated risk factors of MERS. We searched international (PubMed, ScienceDirect, Cochrane) and Korean databases (DBpia, KISS) for English- or Korean-language articles using the terms "MERS" and "Middle East respiratory syndrome". Only human studies with > 20 participants were analysed to exclude studies with low representation. Epidemiologic studies with information on transmissibility and severity of MERS as well as studies containing MERS risk factors were included. A total of 59 studies were included. Most studies from Saudi Arabia reported higher mortality (22-69.2%) than those from South Korea (20.4%). While the R 0 value in Saudi Arabia was < 1 in all but one study, in South Korea, the R 0 value was 2.5-8.09 in the early stage and decreased to < 1 in the later stage. The incubation period was 4.5-5.2 days in Saudi Arabia and 6-7.8 days in South Korea. Duration from onset was 4-10 days to confirmation, 2.9-5.3 days to hospitalization, 11-17 days to death, and 14-20 days to discharge. Older age and concomitant disease were the most common factors related to MERS infection, severity, and mortality. The transmissibility and severity of MERS differed by outbreak region and patient characteristics. Further studies assessing the risk of MERS should consider these factors.

Activated Microglia Desialylate and Phagocytose Cells via Neuraminidase, Galectin-3, and Mer Tyrosine Kinase

PubMed Central

Nomura, Koji; Vilalta, Anna; Allendorf, David H.; Hornik, Tamara C.

2017-01-01

Activated microglia can phagocytose dying, stressed, or excess neurons and synapses via the phagocytic receptor Mer tyrosine kinase (MerTK). Galectin-3 (Gal-3) can cross-link surface glycoproteins by binding galactose residues that are normally hidden below terminal sialic acid residues. Gal-3 was recently reported to opsonize cells via activating MerTK. We found that LPS-activated BV-2 microglia rapidly released Gal-3, which was blocked by calcineurin inhibitors. Gal-3 bound to MerTK on microglia and to stressed PC12 (neuron-like) cells, and it increased microglial phagocytosis of PC12 cells or primary neurons, which was blocked by inhibition of MerTK. LPS-activated microglia exhibited a sialidase activity that desialylated PC12 cells and could be inhibited by Tamiflu, a neuraminidase (sialidase) inhibitor. Sialidase treatment of PC12 cells enabled Gal-3 to bind and opsonize the live cells for phagocytosis by microglia. LPS-induced microglial phagocytosis of PC12 was prevented by small interfering RNA knockdown of Gal-3 in microglia, lactose inhibition of Gal-3 binding, inhibition of neuraminidase with Tamiflu, or inhibition of MerTK by UNC569. LPS-induced phagocytosis of primary neurons by primary microglia was also blocked by inhibition of MerTK. We conclude that activated microglia release Gal-3 and a neuraminidase that desialylates microglial and PC12 surfaces, enabling Gal-3 binding to PC12 cells and their phagocytosis via MerTK. Thus, Gal-3 acts as an opsonin of desialylated surfaces, and inflammatory loss of neurons or synapses may potentially be blocked by inhibiting neuraminidases, Gal-3, or MerTK. PMID:28500071

KENNEDY SPACE CENTER, FLA. - At right is the Delta II rocket on Launch Complex 17-A, Cape Canaveral Air Force Station, that will launch Mars Exploration Rover 2 (MER-2) on June 5. In the center are three more solid rocket boosters that will be added to the Delta, which will carry nine in all. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - At right is the Delta II rocket on Launch Complex 17-A, Cape Canaveral Air Force Station, that will launch Mars Exploration Rover 2 (MER-2) on June 5. In the center are three more solid rocket boosters that will be added to the Delta, which will carry nine in all. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch as MER-A. MER-1 (MER-B) will launch June 25.

KENNEDY SPACE CENTER, FLA. - The Delta II rocket on Launch Complex 17-A, Cape Canaveral Air Force Station, is having solid rocket boosters (SRBs) installed that will help launch Mars Exploration Rover 2 (MER-2) on June 5. In the center are three more solid rocket boosters that will be added to the Delta, which will carry nine in all. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - The Delta II rocket on Launch Complex 17-A, Cape Canaveral Air Force Station, is having solid rocket boosters (SRBs) installed that will help launch Mars Exploration Rover 2 (MER-2) on June 5. In the center are three more solid rocket boosters that will be added to the Delta, which will carry nine in all. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch as MER-A. MER-1 (MER-B) will launch June 25.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2) is installed around the Mars Exploration Rover 2 (MER-2). MER-2 is one of NASA's twin Mars Exploration Rovers designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-2 is scheduled to launch no earlier than June 8 as MER-A, with two launch opportunities each day during the launch period that closes on June 19.

NASA Image and Video Library

2003-05-31

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2) is installed around the Mars Exploration Rover 2 (MER-2). MER-2 is one of NASA's twin Mars Exploration Rovers designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-2 is scheduled to launch no earlier than June 8 as MER-A, with two launch opportunities each day during the launch period that closes on June 19.

KENNEDY SPACE CENTER, FLA. - Workers on the launch tower of Complex 17-A, Cape Canaveral Air Force Station, stand by while a solid rocket booster (SRB) is lifted to vertical. It is one of nine that will help launch Mars Exploration Rover 2 (MER-2). NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - Workers on the launch tower of Complex 17-A, Cape Canaveral Air Force Station, stand by while a solid rocket booster (SRB) is lifted to vertical. It is one of nine that will help launch Mars Exploration Rover 2 (MER-2). NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

Diffusion-driven self-assembly of rodlike particles: Monte Carlo simulation on a square lattice

NASA Astrophysics Data System (ADS)

Lebovka, Nikolai I.; Tarasevich, Yuri Yu.; Gigiberiya, Volodymyr A.; Vygornitskii, Nikolai V.

2017-05-01

The diffusion-driven self-assembly of rodlike particles was studied by means of Monte Carlo simulation. The rods were represented as linear k -mers (i.e., particles occupying k adjacent sites). In the initial state, they were deposited onto a two-dimensional square lattice of size L ×L up to the jamming concentration using a random sequential adsorption algorithm. The size of the lattice, L , was varied from 128 to 2048, and periodic boundary conditions were applied along both x and y axes, while the length of the k -mers (determining the aspect ratio) was varied from 2 to 12. The k -mers oriented along the x and y directions (kx-mers and ky-mers, respectively) were deposited equiprobably. In the course of the simulation, the numbers of intraspecific and interspecific contacts between the same sort and between different sorts of k -mers, respectively, were calculated. Both the shift ratio of the actual number of shifts along the longitudinal or transverse axes of the k -mers and the electrical conductivity of the system were also examined. For the initial random configuration, quite different self-organization behavior was observed for short and long k -mers. For long k -mers (k ≥6 ), three main stages of diffusion-driven spatial segregation (self-assembly) were identified: the initial stage, reflecting destruction of the jamming state; the intermediate stage, reflecting continuous cluster coarsening and labyrinth pattern formation; and the final stage, reflecting the formation of diagonal stripe domains. Additional examination of two artificially constructed initial configurations showed that this pattern of diagonal stripe domains is an attractor, i.e., any spatial distribution of k -mers tends to transform into diagonal stripes. Nevertheless, the time for relaxation to the steady state essentially increases as the lattice size growth.

Increased Circulating and Urinary Levels of Soluble TAM Receptors in Diabetic Nephropathy.

PubMed

Ochodnicky, Peter; Lattenist, Lionel; Ahdi, Mohamed; Kers, Jesper; Uil, Melissa; Claessen, Nike; Leemans, Jaklien C; Florquin, Sandrine; Meijers, Joost C M; Gerdes, Victor E A; Roelofs, Joris J T H

2017-09-01

TAM receptors (Tyro3, Axl, and Mer) have been implicated in innate immunity. Circulating TAM receptor soluble forms (sTyro3, sAxl, sMer) are related to autoimmune disorders. We investigated TAM and their ligand protein S in patients with diabetes. Urinary and plasma levels of protein S, sTyro3, sAxl, and sMer were determined in 126 patients with diabetes assigned to a normoalbuminuric or macroalbuminuric (urinary albumin excretion <30 mg/24 hours and >300 mg/24 hours, respectively) study group and 18 healthy volunteers. TAM and protein S immunostaining was performed on kidney biopsy specimens from patients with diabetic nephropathy (n = 9) and controls (n = 6). TAM expression and shedding by tubular epithelial cells were investigated by PCR and enzyme-linked immunosorbent assay in an in vitro diabetes model. Patients with macroalbuminuria diabetes had higher circulating levels of sMer and more urinary sTyro3 and sMer than normoalbuminuric diabetics. Increased clearance of sTyro3 and sMer was associated with loss of tubular Tyro3 and Mer expression in diabetic nephropathy tissue and glomerular depositions of protein S. During in vitro diabetes, human kidney cells had down-regulation of Tyro3 and Mer mRNA and increased shedding of sTyro3 and sMer. Renal injury in diabetes is associated with elevated systemic and urine levels of sMer and sTyro3. This is the first study reporting excretion of sTAM receptors in urine, identifying the kidney as a source of sTAM. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Case characteristics among Middle East respiratory syndrome coronavirus outbreak and non-outbreak cases in Saudi Arabia from 2012 to 2015.

PubMed

Alhamlan, F S; Majumder, M S; Brownstein, J S; Hawkins, J; Al-Abdely, H M; Alzahrani, A; Obaid, D A; Al-Ahdal, M N; BinSaeed, A

2017-01-12

As of 1 November 2015, the Saudi Ministry of Health had reported 1273 cases of Middle East respiratory syndrome (MERS); among these cases, which included 9 outbreaks at several hospitals, 717 (56%) patients recovered, 14 (1%) remain hospitalised and 543 (43%) died. This study aimed to determine the epidemiological, demographic and clinical characteristics that distinguished cases of MERS contracted during outbreaks from those contracted sporadically (ie, non-outbreak) between 2012 and 2015 in Saudi Arabia. Data from the Saudi Ministry of Health of confirmed outbreak and non-outbreak cases of MERS coronavirus (CoV) infections from September 2012 through October 2015 were abstracted and analysed. Univariate and descriptive statistical analyses were conducted, and the time between disease onset and confirmation, onset and notification and onset and death were examined. A total of 1250 patients (aged 0-109 years; mean, 50.825 years) were reported infected with MERS-CoV. Approximately two-thirds of all MERS cases were diagnosed in men for outbreak and non-outbreak cases. Healthcare workers comprised 22% of all MERS cases for outbreak and non-outbreak cases. Nosocomial infections comprised one-third of all Saudi MERS cases; however, nosocomial infections occurred more frequently in outbreak than non-outbreak cases (p<0.001). Patients contracting MERS during an outbreak were significantly more likely to die of MERS (p<0.001). To date, nosocomial infections have fuelled MERS outbreaks. Given that the Kingdom of Saudi Arabia is a worldwide religious travel destination, localised outbreaks may have massive global implications and effective outbreak preventive measures are needed. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Case characteristics among Middle East respiratory syndrome coronavirus outbreak and non-outbreak cases in Saudi Arabia from 2012 to 2015

PubMed Central

Alhamlan, F S; Majumder, M S; Brownstein, J S; Hawkins, J; Al-Abdely, H M; Alzahrani, A; Obaid, D A; Al-Ahdal, M N; BinSaeed, A

2017-01-01

Objectives As of 1 November 2015, the Saudi Ministry of Health had reported 1273 cases of Middle East respiratory syndrome (MERS); among these cases, which included 9 outbreaks at several hospitals, 717 (56%) patients recovered, 14 (1%) remain hospitalised and 543 (43%) died. This study aimed to determine the epidemiological, demographic and clinical characteristics that distinguished cases of MERS contracted during outbreaks from those contracted sporadically (ie, non-outbreak) between 2012 and 2015 in Saudi Arabia. Design Data from the Saudi Ministry of Health of confirmed outbreak and non-outbreak cases of MERS coronavirus (CoV) infections from September 2012 through October 2015 were abstracted and analysed. Univariate and descriptive statistical analyses were conducted, and the time between disease onset and confirmation, onset and notification and onset and death were examined. Results A total of 1250 patients (aged 0–109 years; mean, 50.825 years) were reported infected with MERS-CoV. Approximately two-thirds of all MERS cases were diagnosed in men for outbreak and non-outbreak cases. Healthcare workers comprised 22% of all MERS cases for outbreak and non-outbreak cases. Nosocomial infections comprised one-third of all Saudi MERS cases; however, nosocomial infections occurred more frequently in outbreak than non-outbreak cases (p<0.001). Patients contracting MERS during an outbreak were significantly more likely to die of MERS (p<0.001). Conclusions To date, nosocomial infections have fuelled MERS outbreaks. Given that the Kingdom of Saudi Arabia is a worldwide religious travel destination, localised outbreaks may have massive global implications and effective outbreak preventive measures are needed. PMID:28082362

Up-Regulation of Soluble Axl and Mer Receptor Tyrosine Kinases Negatively Correlates with Gas6 in Established Multiple Sclerosis Lesions

PubMed Central

Weinger, Jason G.; Omari, Kakuri M.; Marsden, Kurt; Raine, Cedric S.; Shafit-Zagardo, Bridget

2009-01-01

Multiple sclerosis is a disease that is characterized by inflammation, demyelination, and axonal damage; it ultimately forms gliotic scars and lesions that severely compromise the function of the central nervous system. Evidence has shown previously that altered growth factor receptor signaling contributes to lesion formation, impedes recovery, and plays a role in disease progression. Growth arrest-specific protein 6 (Gas6), the ligand for the TAM receptor tyrosine kinase family, consisting of Tyro3, Axl, and Mer, is important for cell growth, survival, and clearance of debris. In this study, we show that levels of membrane-bound Mer (205 kd), soluble Mer (∼150 kd), and soluble Axl (80 kd) were all significantly elevated in homogenates from established multiple sclerosis lesions comprised of both chronic active and chronic silent lesions. Whereas in normal tissue Gas6 positively correlated with soluble Axl and Mer, there was a negative correlation between Gas6 and soluble Axl and Mer in established multiple sclerosis lesions. In addition, increased levels of soluble Axl and Mer were associated with increased levels of mature ADAM17, mature ADAM10, and Furin, proteins that are associated with Axl and Mer solubilization. Soluble Axl and Mer are both known to act as decoy receptors and block Gas6 binding to membrane-bound receptors. These data suggest that in multiple sclerosis lesions, dysregulation of protective Gas6 receptor signaling may prolong lesion activity. PMID:19541935

28-mer Fragment Derived from Enterocin CRL35 Displays an Unexpected Bactericidal Effect on Listeria Cells.

PubMed

Masias, Emilse; Sanches, Paulo R S; Dupuy, Fernando G; Acuna, Leonardo; Bellomio, Augusto; Cilli, Eduardo; Saavedra, Lucila; Minahk, Carlos

2015-01-01

Two shorter peptides derived from enterocin CRL35, a 43-mer bacteriocin, were synthesized i.e. the N-terminal fragment spanning from residues 1 to 15, and a 28-mer fragment that represents the C-terminal of enterocin CRL35, the residues 16 to 43. The separate peptides showed no activity when combined. On one hand, the 28-mer peptide displayed an unpredicted antimicrobial activity. On the other, 15- mer peptide had no consistent anti-Listeria effect. The dissociation constants calculated from experimental data indicated that all peptides could bind at similar extent to the sensitive cells. However, transmembrane electrical potential was not dissipated to the same level by the different peptides; whereas the full-length and the C-terminal 28-mer fragment induced almost full dissipation, 15-mer fragment produced only a slow and incomplete effect. Furthermore, a different interaction of each peptide with membranes was demonstrated based on studies carried out with liposomes, which led us to conclude that activity was related to structure rather than to net positive charges. These results open up the possibility of designing new peptides based on the 28-mer fragment with enhanced activity, which would represent a promising approach for combating Listeria and other pathogens.

Reverse Transcription Recombinase Polymerase Amplification Assay for the Detection of Middle East Respiratory Syndrome Coronavirus

PubMed Central

Abd El Wahed, Ahmed; Patel, Pranav; Heidenreich, Doris; Hufert, Frank T.; Weidmann, Manfred

2013-01-01

The emergence of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in the eastern Mediterranean and imported cases to Europe has alerted public health authorities. Currently, detection of MERS-CoV in patient samples is done by real-time RT-PCR. Samples collected from suspected cases are sent to highly-equipped centralized laboratories for screening. A rapid point-of-care test is needed to allow more widespread mobile detection of the virus directly from patient material. In this study, we describe the development of a reverse transcription isothermal Recombinase Polymerase Amplification (RT-RPA) assay for the identification of MERS-CoV. A partial nucleocapsid gene RNA molecular standard of MERS-coronavirus was used to determine the assay sensitivity. The isothermal (42°C) MERS-CoV RT-RPA was as sensitive as real-time RT-PCR (10 RNA molecules), rapid (3-7 minutes) and mobile (using tubescanner weighing 1kg). The MERS-CoV RT-RPA showed cross-detection neither of any of the RNAs of several coronaviruses and respiratory viruses affecting humans nor of the human genome. The developed isothermal real-time RT-RPA is ideal for rapid mobile molecular MERS-CoV monitoring in acute patients and may also facilitate the search for the animal reservoir of MERS-CoV. PMID:24459611

Korean Society for Laboratory Medicine Practice Guidelines for the Molecular Diagnosis of Middle East Respiratory Syndrome During an Outbreak in Korea in 2015.

PubMed

Ki, Chang Seok; Lee, Hyukmin; Sung, Heungsup; Kim, Sinyoung; Seong, Moon Woo; Yong, Dongeun; Kim, Jae Seok; Lee, Mi Kyung; Kim, Mi Na; Choi, Jong Rak; Kim, Jeong Ho

2016-05-01

For two months between May and July 2015, a nationwide outbreak of Middle East respiratory syndrome coronavirus (MERS-CoV) occurred in Korea. On June 3, 2015, the Korean Society for Laboratory Medicine (KSLM) launched a MERS-CoV Laboratory Response Task Force (LR-TF) to facilitate clinical laboratories to set up the diagnosis of MERS-CoV infection. Based on the WHO interim recommendations, the Centers for Disease Control and Prevention of United States guidelines for MERS-CoV laboratory testing, and other available resources, the KSLM MERS-CoV LR-TF provided the first version of the laboratory practice guidelines for the molecular diagnosis of MERS-CoV to the clinical laboratories on June 12, 2015. The guidelines described here are an updated version that includes case definition, indications for testing, specimen type and protocols for specimen collection, specimen packing and transport, specimen handling and nucleic acid extraction, molecular detection of MERS-CoV, interpretation of results and reporting, and laboratory safety. The KSLM guidelines mainly focus on the molecular diagnosis of MERS-CoV, reflecting the unique situation in Korea and the state of knowledge at the time of publication.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, a crane is in place to lift the fairing for the Mars Exploration Rover 2 (MER-2/MER-A). The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, a crane is in place to lift the fairing for the Mars Exploration Rover 2 (MER-2/MER-A). The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - The fairing for the Mars Exploration Rover 2 (MER-2/MER-A) arrives at Launch Complex 17-A, Cape Canaveral Air Force Station. It will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - The fairing for the Mars Exploration Rover 2 (MER-2/MER-A) arrives at Launch Complex 17-A, Cape Canaveral Air Force Station. It will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

[A Case of Clinically Mild Encephalitis/encephalopathy with a Reversible Splenial Lesion due to Dengue Fever].

PubMed

Saito, Nobuo; Kitashouji, Emi; Kojiro, Maiko; Furumoto, Akitugu; Morimoto, Konosuke; Morita, Kouichi; Ariyoshi, Koya

2015-07-01

Clinically mild encephalitis/encephalopathy with a reversible splenial lesion (MERS) has been recently proposed as a clinical-radiological syndrome. Several causes of MERS have been reported including infectious diseases. We present herein on a case of MERS induced by dengue fever in a Japanese traveler. A 48-year-old male returning from Thailand and Cambodia was admitted for an unknown fever. Following admission, the dengue virus was diagnosed with a positive RT-PCR result. On day 5 of the illness, regardless of reduced fever, weakness suddenly developed in both upper limbs. A cerebral MRI showed hyperintensities in the splenium of the corpus callosum on T2-weighted and diffusion-weighted images. The symptoms resolved completely within two days of onset. The patient was diagnosed as having MERS due to the MRI features and the mild clinical course. Although only a few cases of MERS caused by dengue fever have been reported, the condition is possibly underdiagnosed. It is hypothesized that dengue fever can induce MERS as dengue fever can cause increased endothelium permeability and hypo-sodium which have been proposed in the pathogenesis of MERS. However, there is currently limited evidence for this. Further research is recommended to demonstrate a causal association between dengue fever and MERS.

Thermal Protection System Mass Estimating Relationships for Blunt-Body, Earth Entry Spacecraft

NASA Technical Reports Server (NTRS)

Sepka, Steven A.; Samareh, Jamshid A.

2015-01-01

System analysis and design of any entry system must balance the level fidelity for each discipline against the project timeline. One way to inject high fidelity analysis earlier in the design effort is to develop surrogate models for the high-fidelity disciplines. Surrogate models for the Thermal Protection System (TPS) are formulated as Mass Estimating Relationships (MERs). The TPS MERs are presented that predict the amount of TPS necessary for safe Earth entry for blunt-body spacecraft using simple correlations that closely match estimates from NASA's high-fidelity ablation modeling tool, the Fully Implicit Ablation and Thermal Analysis Program (FIAT). These MERs provide a first order estimate for rapid feasibility studies. There are 840 different trajectories considered in this study, and each TPS MER has a peak heating limit. MERs for the vehicle forebody include the ablators Phenolic Impregnated Carbon Ablator (PICA) and Carbon Phenolic atop Advanced Carbon-Carbon. For the aftbody, the materials are Silicone Impregnated Reusable Ceramic Ablator (SIRCA), Acusil II, SLA-561V, and LI-900. The MERs are accurate to within 14% (at one standard deviation) of FIAT prediction, and the most any MER under predicts FIAT TPS thickness is 18.7%. This work focuses on the development of these MERs, the resulting equations, model limitations, and model accuracy.

Clinical outcomes of current medical approaches for Middle East respiratory syndrome: A systematic review and meta-analysis.

PubMed

Morra, Mostafa Ebraheem; Van Thanh, Le; Kamel, Mohamed Gomaa; Ghazy, Ahmed Abdelmotaleb; Altibi, Ahmed M A; Dat, Lu Minh; Thy, Tran Ngoc Xuan; Vuong, Nguyen Lam; Mostafa, Mostafa Reda; Ahmed, Sarah Ibrahim; Elabd, Sahar Samy; Fathima, Samreen; Le Huy Vu, Tran; Omrani, Ali S; Memish, Ziad A; Hirayama, Kenji; Huy, Nguyen Tien

2018-05-01

Middle East respiratory syndrome (MERS) is a respiratory disease caused by MERS coronavirus. Because of lack of vaccination, various studies investigated the therapeutic efficacy of antiviral drugs and supportive remedies. A systematic literature search from 10 databases was conducted and screened for relevant articles. Studies reporting information about the treatment of MERS coronavirus infection were extracted and analyzed. Despite receiving treatment with ribavirin plus IFN, the case fatality rate was as high as 71% in the IFN-treatment group and exactly the same in patients who received supportive treatment only. Having chronic renal disease, diabetes mellitus and hypertension increased the risk of mortality (P < .05), and chronic renal disease is the best parameter to predict the mortality. The mean of survival days from onset of illness to death was 46.6 (95% CI, 30.5-62.6) for the IFN group compared with 18.8 (95% CI, 10.3-27.4) for the supportive-only group (P = .001). Delay in starting treatment, older age group, and preexisting comorbidities are associated with worse outcomes. In conclusion, there is no difference between IFN treatment and supportive treatment for MERS patients in terms of mortality. However, ribavirin and IFN combination might have efficacious effects with timely administration and monitoring of adverse events. Large-scale prospective randomized studies are required to assess the role of antiviral drugs for the treatment of this high mortality infection. Copyright © 2018 John Wiley & Sons, Ltd.

Debate on MERS-CoV respiratory precautions: surgical mask or N95 respirators?

PubMed Central

Chung, Jasmine Shimin; Ling, Moi Lin; Seto, Wing Hong; Ang, Brenda Sze Peng; Tambyah, Paul Anantharajah

2014-01-01

Since the emergence of Middle East respiratory syndrome coronavirus (MERS-CoV) in mid-2012, there has been controversy over the respiratory precaution recommendations in different guidelines from various international bodies. Our understanding of MERS-CoV is still evolving. Current recommendations on infection control practices are heavily influenced by the lessons learnt from severe acute respiratory syndrome. A debate on respiratory precautions for MERS-CoV was organised by Infection Control Association (Singapore) and the Society of Infectious Disease (Singapore). We herein discuss and present the evidence for surgical masks for the protection of healthcare workers from MERS-CoV. PMID:25017402

High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling

PubMed Central

Jones, Joshua D.; Chung, Betty Y.-W.; Siddell, Stuart G.; Brierley, Ian

2016-01-01

Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global “snap-shot” of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal frameshift site. To our knowledge this is the first application of ribosome profiling to an RNA virus. PMID:26919232

Transmission of Middle East Respiratory Syndrome Coronavirus Infections in Healthcare Settings, Abu Dhabi

PubMed Central

Nguyen, Duc; Aden, Bashir; Al Bandar, Zyad; Al Dhaheri, Wafa; Abu Elkheir, Kheir; Khudair, Ahmed; Al Mulla, Mariam; El Saleh, Feda; Imambaccus, Hala; Al Kaabi, Nawal; Sheikh, Farrukh Amin; Sasse, Jurgen; Turner, Andrew; Abdel Wareth, Laila; Weber, Stefan; Al Ameri, Asma; Abu Amer, Wesal; Alami, Negar N.; Bunga, Sudhir; Haynes, Lia M.; Hall, Aron J.; Kallen, Alexander J.; Kuhar, David; Pham, Huong; Pringle, Kimberly; Tong, Suxiang; Whitaker, Brett L.; Gerber, Susan I.; Al Hosani, Farida Ismail

2016-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) infections sharply increased in the Arabian Peninsula during spring 2014. In Abu Dhabi, United Arab Emirates, these infections occurred primarily among healthcare workers and patients. To identify and describe epidemiologic and clinical characteristics of persons with healthcare-associated infection, we reviewed laboratory-confirmed MERS-CoV cases reported to the Health Authority of Abu Dhabi during January 1, 2013–May 9, 2014. Of 65 case-patients identified with MERS-CoV infection, 27 (42%) had healthcare-associated cases. Epidemiologic and genetic sequencing findings suggest that 3 healthcare clusters of MERS-CoV infection occurred, including 1 that resulted in 20 infected persons in 1 hospital. MERS-CoV in healthcare settings spread predominantly before MERS-CoV infection was diagnosed, underscoring the importance of increasing awareness and infection control measures at first points of entry to healthcare facilities. PMID:26981708

Nucleocapsid protein-dependent assembly of the RNA packaging signal of Middle East respiratory syndrome coronavirus.

PubMed

Hsin, Wei-Chen; Chang, Chan-Hua; Chang, Chi-You; Peng, Wei-Hao; Chien, Chung-Liang; Chang, Ming-Fu; Chang, Shin C

2018-05-24

Middle East respiratory syndrome coronavirus (MERS-CoV) consists of a positive-sense, single-stranded RNA genome and four structural proteins: the spike, envelope, membrane, and nucleocapsid protein. The assembly of the viral genome into virus particles involves viral structural proteins and is believed to be mediated through recognition of specific sequences and RNA structures of the viral genome. A culture system for the production of MERS coronavirus-like particles (MERS VLPs) was determined and established by electron microscopy and the detection of coexpressed viral structural proteins. Using the VLP system, a 258-nucleotide RNA fragment, which spans nucleotides 19,712 to 19,969 of the MERS-CoV genome (designated PS258(19712-19969) ME ), was identified to function as a packaging signal. Assembly of the RNA packaging signal into MERS VLPs is dependent on the viral nucleocapsid protein. In addition, a 45-nucleotide stable stem-loop substructure of the PS258(19712-19969) ME interacted with both the N-terminal domain and the C-terminal domain of the viral nucleocapsid protein. Furthermore, a functional SARS-CoV RNA packaging signal failed to assemble into the MERS VLPs, which indicated virus-specific assembly of the RNA genome. A MERS-oV RNA packaging signal was identified by the detection of GFP expression following an incubation of MERS VLPs carrying the heterologous mRNA GFP-PS258(19712-19969) ME with virus permissive Huh7 cells. The MERS VLP system could help us in understanding virus infection and morphogenesis.

Public response to MERS-CoV in the Middle East: iPhone survey in six countries.

PubMed

Alqahtani, Amani S; Rashid, Harunor; Basyouni, Mada H; Alhawassi, Tariq M; BinDhim, Nasser F

Gulf Cooperation Council (GCC) countries bear the heaviest brunt of MERS-CoV. This study aims to compare public awareness and practice around MERS-CoV across GCC countries. A cross-sectional survey was conducted using the Gulf Indicators (GI) smartphone app among people in the six GCC countries, namely Saudi Arabia, Kuwait, the United Arab Emirates, Qatar, Bahrain, and Oman. A total of 1812 participants recruited. All were aware of MERS-CoV, yet the perception and practice around MERS-CoV varied widely between countries. Over two thirds were either "not concerned" or "slightly concerned" about contracting MERS-CoV; believing that they were under Allah's (God's) protection (40%) was the most cited reason. While 79% were aware that the disease can transmit through droplet from infected person, only 12% stated that MERS-CoV transmits via camels; people in Saudi Arabia were better aware of the transmission. Nevertheless, only 22% of respondents believed that camels are the zoonotic reservoir of MERS-CoV. Those who were concerned about contracting MERS-CoV (aOR: 1.6, 95% CI: 1.2-2.1, p<0.01) and those who thought MERS-CoV to be a severe disease only for those with high-risk conditions (aOR: 1.5, 95% CI: 1.1-2.1, p<0.01) were more likely to believe that camels are the zoonotic source. However, residents of KSA (aOR: 0.03, 95% CI: 0.01-0.07, p<0.01), UAE (aOR: 0.01, 95% CI: 0.004-0.02, p<0.01) and Kuwait (aOR: 0.03, 95% CI: 0.01-0.07, p<0.01) were less likely to believe that camels are the main zoonotic source compared to respondents from the other countries. Hygienic measures were more commonly adopted than avoidance of camels or their raw products, yet there was a discrepancy between the countries. This study highlights that despite being aware of the ongoing MERS-CoV epidemic; many people lack accurate understanding about MERS-CoV transmission, prevention, and are not fully compliant with preventive measures. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Computational modeling of the bat HKU4 coronavirus 3CLpro inhibitors as a tool for the development of antivirals against the emerging Middle East respiratory syndrome (MERS) coronavirus.

PubMed

Abuhammad, Areej; Al-Aqtash, Rua'a A; Anson, Brandon J; Mesecar, Andrew D; Taha, Mutasem O

2017-11-01

The Middle East respiratory syndrome coronavirus (MERS-CoV) is an emerging virus that poses a major challenge to clinical management. The 3C-like protease (3CL pro ) is essential for viral replication and thus represents a potential target for antiviral drug development. Presently, very few data are available on MERS-CoV 3CL pro inhibition by small molecules. We conducted extensive exploration of the pharmacophoric space of a recently identified set of peptidomimetic inhibitors of the bat HKU4-CoV 3CL pro . HKU4-CoV 3CL pro shares high sequence identity (81%) with the MERS-CoV enzyme and thus represents a potential surrogate model for anti-MERS drug discovery. We used 2 well-established methods: Quantitative structure-activity relationship (QSAR)-guided modeling and docking-based comparative intermolecular contacts analysis. The established pharmacophore models highlight structural features needed for ligand recognition and revealed important binding-pocket regions involved in 3CL pro -ligand interactions. The best models were used as 3D queries to screen the National Cancer Institute database for novel nonpeptidomimetic 3CL pro inhibitors. The identified hits were tested for HKU4-CoV and MERS-CoV 3CL pro inhibition. Two hits, which share the phenylsulfonamide fragment, showed moderate inhibitory activity against the MERS-CoV 3CL pro and represent a potential starting point for the development of novel anti-MERS agents. To the best of our knowledge, this is the first pharmacophore modeling study supported by in vitro validation on the MERS-CoV 3CL pro . MERS-CoV is an emerging virus that is closely related to the bat HKU4-CoV. 3CL pro is a potential drug target for coronavirus infection. HKU4-CoV 3CL pro is a useful surrogate model for the identification of MERS-CoV 3CL pro enzyme inhibitors. dbCICA is a very robust modeling method for hit identification. The phenylsulfonamide scaffold represents a potential starting point for MERS coronavirus 3CL pro inhibitors development. Copyright © 2017 John Wiley & Sons, Ltd.

Active screening and surveillance in the United Kingdom for Middle East respiratory syndrome coronavirus in returning travellers and pilgrims from the Middle East: a prospective descriptive study for the period 2013-2015.

PubMed

Atabani, Sowsan F; Wilson, Steven; Overton-Lewis, Clare; Workman, Judith; Kidd, I Michael; Petersen, Eskild; Zumla, Alimuddin; Smit, Erasmus; Osman, Husam

2016-06-01

Over 25000 pilgrims from the UK visit Saudi Arabia every year for the Umrah and Hajj pilgrimages. The recent outbreak of Middle East respiratory syndrome coronavirus (MERS-CoV) in South Korea and the continuing reports of MERS-CoV cases from Saudi Arabia highlight the need for active surveillance for MERS-CoV in returning pilgrims or travellers from the Middle East. Public Health England Birmingham Laboratory (PHEBL) is one of a few selected UK public health laboratories responsible for MERS-CoV screening in travellers returning to the UK from the Middle East who present to hospital with severe respiratory symptoms. The results of the PHEBL MERS-CoV screening and surveillance over the past 3 years is presented. UK travellers/pilgrims who returned from the Middle East and presented to a hospital with respiratory symptoms were studied over the period February 1, 2013 to December 31, 2015. Patients with respiratory symptoms, who satisfied the Public Health England MERS-CoV case algorithm, were tested for MERS-CoV and other respiratory tract viruses on admission to hospital. Two hundred and two patients suspected of having MERS-CoV were tested. None of them had a laboratory-confirmed MERS-CoV infection. A viral aetiology was detected in half (50.3%) of the cases, with rhinoviruses, influenza A (H1N1 and H3N2), and influenza B being most frequent. Peak testing occurred following the annual Hajj season and in other periods of raised national awareness. Respiratory tract infections in travellers/pilgrims returning to the UK from the Middle East are mainly due to rhinoviruses, influenza A, and influenza B. Whilst MERS-CoV was not detected in the 202 patients studied, heightened awareness of the possibility of MERS-CoV and continuous proactive surveillance are essential to rapidly identify cases of MERS-CoV and other seasonal respiratory tract viruses such as avian influenza, in patients presenting to hospital. Early identification and isolation may prevent outbreaks in nosocomial settings. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Serological Evidence of MERS-CoV Antibodies in Dromedary Camels (Camelus dromedaries) in Laikipia County, Kenya

PubMed Central

Deem, Sharon L.; Fèvre, Eric M.; Kinnaird, Margaret; Browne, A. Springer; Muloi, Dishon; Godeke, Gert-Jan; Koopmans, Marion; Reusken, Chantal B.

2015-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) is a recently identified virus causing severe viral respiratory illness in people. Little is known about the reservoir in the Horn of Africa. In Kenya, where no human MERS cases have been reported, our survey of 335 dromedary camels, representing nine herds in Laikipia County, showed a high seroprevalence (46.9%) to MERS-CoV antibodies. Between herd differences were present (14.3%– 82.9%), but was not related to management type or herd isolation. Further research should focus on identifying similarity between MERS-CoV viral isolates in Kenya and clinical isolates from the Middle East and elsewhere. PMID:26473733

Serological Evidence of MERS-CoV Antibodies in Dromedary Camels (Camelus dromedaries) in Laikipia County, Kenya.

PubMed

Deem, Sharon L; Fèvre, Eric M; Kinnaird, Margaret; Browne, A Springer; Muloi, Dishon; Godeke, Gert-Jan; Koopmans, Marion; Reusken, Chantal B

2015-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) is a recently identified virus causing severe viral respiratory illness in people. Little is known about the reservoir in the Horn of Africa. In Kenya, where no human MERS cases have been reported, our survey of 335 dromedary camels, representing nine herds in Laikipia County, showed a high seroprevalence (46.9%) to MERS-CoV antibodies. Between herd differences were present (14.3%- 82.9%), but was not related to management type or herd isolation. Further research should focus on identifying similarity between MERS-CoV viral isolates in Kenya and clinical isolates from the Middle East and elsewhere.

Successful recovery of MERS CoV pneumonia in a patient with acquired immunodeficiency syndrome: a case report.

PubMed

Shalhoub, Sarah; AlZahrani, Abdulwahab; Simhairi, Raed; Mushtaq, Adnan

2015-01-01

Middle East Respiratory Syndrome Coronavirus (MERS CoV) may cause severe pneumonia with significant morbidity and mortality, particularly in patients with multiple comorbid condition. MERS CoV pneumonia has not been previously reported in patients with Human Immunodeficiency Virus (HIV). Herein, we report a case of MERS CoV pneumonia with a successful outcome in a patient recently diagnosed with HIV. Copyright © 2014 Elsevier B.V. All rights reserved.

The Synechocystis PCC6803 MerA-like enzyme operates in the reduction of both mercury and uranium under the control of the glutaredoxin 1 enzyme.

PubMed

Marteyn, Benoit; Sakr, Samer; Farci, Sandrine; Bedhomme, Mariette; Chardonnet, Solenne; Decottignies, Paulette; Lemaire, Stéphane D; Cassier-Chauvat, Corinne; Chauvat, Franck

2013-09-01

In a continuing effort to analyze the selectivity/redundancy of the three glutaredoxin (Grx) enzymes of the model cyanobacterium Synechocystis PCC6803, we have characterized an enzyme system that plays a crucial role in protection against two toxic metal pollutants, mercury and uranium. The present data show that Grx1 (Slr1562 in CyanoBase) selectively interacts with the presumptive mercuric reductase protein (Slr1849). This MerA enzyme plays a crucial role in cell defense against both mercuric and uranyl ions, in catalyzing their NADPH-driven reduction. Like MerA, Grx1 operates in cell protection against both mercury and uranium. The Grx1-MerA interaction requires cysteine 86 (C86) of Grx1 and C78 of MerA, which is critical for its reductase activity. MerA can be inhibited by glutathionylation and subsequently reactivated by Grx1, likely through deglutathionylation. The two Grx1 residues C31, which belongs to the redox active site (CX(2)C), and C86, which operates in MerA interactions, are both required for reactivation of MerA. These novel findings emphasize the role of glutaredoxins in tolerance to metal stress as well as the evolutionary conservation of the glutathionylation process, so far described mostly for eukaryotes.

The Synechocystis PCC6803 MerA-Like Enzyme Operates in the Reduction of Both Mercury and Uranium under the Control of the Glutaredoxin 1 Enzyme

PubMed Central

Marteyn, Benoit; Sakr, Samer; Farci, Sandrine; Bedhomme, Mariette; Chardonnet, Solenne; Decottignies, Paulette; Lemaire, Stéphane D.; Cassier-Chauvat, Corinne

2013-01-01

In a continuing effort to analyze the selectivity/redundancy of the three glutaredoxin (Grx) enzymes of the model cyanobacterium Synechocystis PCC6803, we have characterized an enzyme system that plays a crucial role in protection against two toxic metal pollutants, mercury and uranium. The present data show that Grx1 (Slr1562 in CyanoBase) selectively interacts with the presumptive mercuric reductase protein (Slr1849). This MerA enzyme plays a crucial role in cell defense against both mercuric and uranyl ions, in catalyzing their NADPH-driven reduction. Like MerA, Grx1 operates in cell protection against both mercury and uranium. The Grx1-MerA interaction requires cysteine 86 (C86) of Grx1 and C78 of MerA, which is critical for its reductase activity. MerA can be inhibited by glutathionylation and subsequently reactivated by Grx1, likely through deglutathionylation. The two Grx1 residues C31, which belongs to the redox active site (CX2C), and C86, which operates in MerA interactions, are both required for reactivation of MerA. These novel findings emphasize the role of glutaredoxins in tolerance to metal stress as well as the evolutionary conservation of the glutathionylation process, so far described mostly for eukaryotes. PMID:23852862

KENNEDY SPACE CENTER, FLA. - After arriving at Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted off its transporter. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - After arriving at Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted off its transporter. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted up the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted up the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) reaches the top of the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) reaches the top of the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted off the transporter. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted off the transporter. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is moved inside the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5..

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is moved inside the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5..

Exploring stakeholders' views of medical education research priorities: a national survey.

PubMed

Dennis, Ashley A; Cleland, Jennifer A; Johnston, Peter; Ker, Jean S; Lough, Murray; Rees, Charlotte E

2014-11-01

Setting research priorities is important when exploring complex issues with limited resources. Only two countries (Canada and New Zealand) have previously conducted priority-setting exercises for medical education research (MER). This study aimed to identify the views of multiple stakeholders on MER priorities in Scotland. This study utilised a two-stage design to explore the views of stakeholders across the medical education continuum using online questionnaires. In Stage 1, key informants outlined their top three MER priorities and justified their choices. In Stage 2, participants rated 21 topics generated in Stage 1 according to importance and identified or justified their top priorities. A combination of qualitative (i.e. framework analysis) and quantitative (e.g. exploratory factor analysis) data analyses were employed. Views were gathered from over 1300 stakeholders. A total of 21 subthemes (or priority areas) identified in Stage 1 were explored further in Stage 2. The 21 items loaded onto five factors: the culture of learning together in the workplace; enhancing and valuing the role of educators; curriculum integration and innovation; bridging the gap between assessment and feedback, and building a resilient workforce. Within Stage 2, the top priority subthemes were: balancing conflicts between service and training; providing useful feedback; promoting resiliency and well-being; creating an effective workplace learning culture; selecting and recruiting doctors to reflect need, and ensuring that curricula prepare trainees for practice. Participant characteristics were related to the perceived importance of the factors. Finally, five themes explaining why participants prioritised items were identified: patient safety; quality of care; investing for the future; policy and political agendas, and evidence-based education. This study indicates that, across the spectrum of stakeholders and geography, certain MER priorities are consistently identified. These priority areas are in harmony with a range of current drivers in UK medical education. They provide a platform of evidence on which to base decisions about MER programmes in Scotland and beyond. © 2014 John Wiley & Sons Ltd.

Polyphony: A Workflow Orchestration Framework for Cloud Computing

NASA Technical Reports Server (NTRS)

Shams, Khawaja S.; Powell, Mark W.; Crockett, Tom M.; Norris, Jeffrey S.; Rossi, Ryan; Soderstrom, Tom

2010-01-01

Cloud Computing has delivered unprecedented compute capacity to NASA missions at affordable rates. Missions like the Mars Exploration Rovers (MER) and Mars Science Lab (MSL) are enjoying the elasticity that enables them to leverage hundreds, if not thousands, or machines for short durations without making any hardware procurements. In this paper, we describe Polyphony, a resilient, scalable, and modular framework that efficiently leverages a large set of computing resources to perform parallel computations. Polyphony can employ resources on the cloud, excess capacity on local machines, as well as spare resources on the supercomputing center, and it enables these resources to work in concert to accomplish a common goal. Polyphony is resilient to node failures, even if they occur in the middle of a transaction. We will conclude with an evaluation of a production-ready application built on top of Polyphony to perform image-processing operations of images from around the solar system, including Mars, Saturn, and Titan.

Challenges presented by MERS corona virus, and SARS corona virus to global health.

PubMed

Al-Hazmi, Ali

2016-07-01

Numerous viral infections have arisen and affected global healthcare facilities. Millions of people are at severe risk of acquiring several evolving viral infections through several factors. In the present article we have described about risk factors, chance of infection, and prevention methods of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) and severe acute respiratory syndrome (SARS-CoV), human coronaviruses (CoVs) frequently cause a normal cold which is mild and self-restricting. Zoonotic transmission of CoVs such as the newly discovered MERS-CoV and SARS-CoV, may be associated with severe lower respiratory tract infection. The present review provides the recent clinical and pathological information on MERS and SARS. The task is to transform these discoveries about MERS and SARS pathogenesis and to develop intervention methods that will eventually allow the effective control of these recently arising severe viral infections. Global health sector has learnt many lessons through the recent outbreak of MERS and SARS, but the need for identifying new antiviral treatment was not learned. In the present article we have reviewed the literature on the several facets like transmission, precautions and effectiveness of treatments used in patients with MERS-CoV and SARS infections.

Influence of anisotropy on percolation and jamming of linear k-mers on square lattice with defects

NASA Astrophysics Data System (ADS)

Tarasevich, Yu Yu; Laptev, V. V.; Burmistrov, A. S.; Shinyaeva, T. S.

2015-09-01

By means of the Monte Carlo simulation, we study the layers produced by the random sequential adsorption of the linear rigid objects (k-mers also known as rigid or stiff rods, sticks, needles) onto the square lattice with defects in the presence of an external field. The value of k varies from 2 to 32. The point defects randomly and uniformly placed on the substrate hinder adsorption of the elongated objects. The external field affects isotropic deposition of the particles, consequently the deposited layers are anisotropic. We study the influence of the defect concentration, the length of the objects, and the external field on the percolation threshold and the jamming concentration. Our main findings are (i) the critical defect concentration at which the percolation never occurs even at jammed state decreases for short k-mers (k < 16) and increases for long k-mers (k > 16) as anisotropy increases, (ii) the corresponding critical k-mer concentration decreases with anisotropy growth, (iii) the jamming concentration decreases drastically with growth of k-mer length for any anisotropy, (iv) for short k-mers, the percolation threshold is almost insensitive to the defect concentration for any anisotropy.

GPS Constraints on the Spatial Distribution of Extension in the Ethiopian Highlands and Main Ethiopian Rift

NASA Astrophysics Data System (ADS)

Amere, Y. B.; Bendick, R. O.; Fisseha, S.; Lewi, E.; Reilinger, R. E.; King, R. W.; Kianji, G.

2014-12-01

27 campaign and 17 continuous GPS sites spanning the Ethiopian Highlands, Main Ethiopian Rift (MER), and Somali Platform in Ethiopia and Eritrea were measured for varying durations between 1995 and 2014. Velocities at these sites show that present day strain in NE Africa is not localized only in the Afar depression and MER system. Rather, velocities as high as 6 mm/yr relative to stable Nubia occur in the central Ethiopian highlands west of the rift bounding faults; the northern and southern Ethiopian highlands host velocities as high as 3 mm/yr. These approach the magnitude of Nubia-Somalia spreading accommodated within the rift itself of 6 + 1 mm/yr with an azimuth of N770E. The combination of distributed low strain rate deformation contiguous with higher strain rate plate boundary deformation is similar to that expressed in other tectonically active continental settings like Basin and Range and Tibetan Plateau.Keywords: deformation, localized, distributed, strain, stable Nubia.

High Prevalence of Middle East Respiratory Coronavirus in Young Dromedary Camels in Jordan.

PubMed

van Doremalen, Neeltje; Hijazeen, Zaidoun S K; Holloway, Peter; Al Omari, Bilal; McDowell, Chester; Adney, Danielle; Talafha, Hani A; Guitian, Javier; Steel, John; Amarin, Nadim; Tibbo, Markos; Abu-Basha, Ehab; Al-Majali, Ahmad M; Munster, Vincent J; Richt, Juergen A

2017-02-01

Prevalence of Middle East respiratory syndrome coronavirus (MERS-CoV) was determined in 45 dromedary camels from two geographically separated herds in Jordan. Virus shedding was only detected in swabs obtained from the respiratory tract and primarily observed in camels younger than 3 years. MERS-CoV seroprevalence increased with age of camels. Bovine and sheep sera were seronegative. Phylogenetic analysis of partial S2 clustered the Jordanian MERS-CoV strains with contemporary MERS-CoV strains associated with nosocomial outbreaks.

Mitogenic signals and transforming potential of Nyk, a newly identified neural cell adhesion molecule-related receptor tyrosine kinase.

PubMed Central

Ling, L; Kung, H J

1995-01-01

Nyk/Mer is a recently identified receptor tyrosine kinase with neural cell adhesion molecule-like structure (two immunoglobulin G-like domains and two fibronectin III-like domains) in its extracellular region and belongs to the Ufo/Axl family of receptors. The ligand for Nyk/Mer is presently unknown, as are the signal transduction pathways mediated by this receptor. We constructed and expressed a chimeric receptor (Fms-Nyk) composed of the extracellular domain of the human colony-stimulating factor 1 receptor (Fms) and the transmembrane and cytoplasmic domains of human Nyk/Mer in NIH 3T3 fibroblasts in order to investigate the mitogenic signaling and biochemical properties of Nyk/Mer. Colony-stimulating factor 1 stimulation of the Fms-Nyk chimeric receptor in transfected NIH 3T3 fibroblasts leads to a transformed phenotype and generates a proliferative response in the absence of other growth factors. We show that phospholipase C gamma, phosphatidylinositol 3-kinase/p70 S6 kinase, Shc, Grb2, Raf-1, and mitogen-activated protein kinase are downstream components of the Nyk/Mer signal transduction pathways. In addition, Nyk/Mer weakly activates p90rsk, while stress-activated protein kinase, Ras GTPase-activating protein (GAP), and GAP-associated p62 and p190 proteins are not activated or tyrosine phosphorylated by Nyk/Mer. An analysis comparing the Nyk/Mer signal cascade with that of the epidermal growth factor receptor indicates substrate preferences by these two receptors. Our results provide a detailed description of the Nyk/Mer signaling pathways. Given the structural similarity between the Ufo/Axl family receptors, some of the information may also be applied to other members of this receptor tyrosine kinase family. PMID:8524223

Immunodominant epitopes in herpes simplex virus type 2 glycoprotein D are recognized by CD4 lymphocytes from both HSV-1 and HSV-2 seropositive subjects.

PubMed

Kim, Min; Taylor, Janette; Sidney, John; Mikloska, Zorka; Bodsworth, Neil; Lagios, Katerina; Dunckley, Heather; Byth-Wilson, Karen; Denis, Martine; Finlayson, Robert; Khanna, Rajiv; Sette, Alessandro; Cunningham, Anthony L

2008-11-01

In human recurrent cutaneous herpes simplex, there is a sequential infiltrate of CD4 and then CD8 lymphocytes into lesions. CD4 lymphocytes are the major producers of the key cytokine IFN-gamma in lesions. They recognize mainly structural proteins and especially glycoproteins D and B (gD and gB) when restimulated in vitro. Recent human vaccine trials using recombinant gD showed partial protection of HSV seronegative women against genital herpes disease and also, in placebo recipients, showed protection by prior HSV1 infection. In this study, we have defined immunodominant peptide epitopes recognized by 8 HSV1(+) and/or 16 HSV2(+) patients using (51)Cr-release cytotoxicity and IFN-gamma ELISPOT assays. Using a set of 39 overlapping 20-mer peptides, more than six immunodominant epitopes were defined in gD2 (two to six peptide epitopes were recognized for each subject). Further fine mapping of these responses for 4 of the 20-mers, using a panel of 9 internal 12-mers for each 20-mers, combined with MHC II typing and also direct in vitro binding assay of these peptides to individual DR molecules, showed more than one epitope per 20-mers and promiscuous binding of individual 20-mers and 12-mers to multiple DR types. All four 20-mer peptides were cross-recognized by both HSV1(+)/HSV2(-) and HSV1(-)/HSV2(+) subjects, but the sites of recognition differed within the 20-mers where their sequences were divergent. This work provides a basis for CD4 lymphocyte cross-recognition of gD2 and possibly cross-protection observed in previous clinical studies and in vaccine trials.

Epidemiological investigation of Middle East respiratory syndrome coronavirus in dromedary camel farms linked with human infection in Abu Dhabi Emirate, United Arab Emirates.

PubMed

Muhairi, Salama Al; Hosani, Farida Al; Eltahir, Yassir M; Mulla, Mariam Al; Yusof, Mohammed F; Serhan, Wissam S; Hashem, Farouq M; Elsayed, Elsaeid A; Marzoug, Bahaaeldin A; Abdelazim, Assem S

2016-12-01

The objective of this research was to investigate the prevalence of Middle East respiratory syndrome coronavirus (MERS-CoV) infection primarily in dromedary camel farms and the relationship of those infections with infections in humans in the Emirate of Abu Dhabi. Nasal swabs from 1113 dromedary camels (39 farms) and 34 sheep (1 farm) and sputum samples from 2 MERS-CoV-infected camel farm owners and 1 MERS-CoV-infected sheep farm owner were collected. Samples from camels and humans underwent real-time reverse-transcription quantitative PCR screening to detect MERS-CoV. In addition, sequencing and phylogenetic analysis of partially characterized MERS-CoV genome fragments obtained from camels were performed. Among the 40 farms, 6 camel farms were positive for MERS-CoV; the virus was not detected in the single sheep farm. The maximum duration of viral shedding from infected camels was 2 weeks after the first positive test result as detected in nasal swabs and in rectal swabs obtained from infected calves. Three partial camel sequences characterized in this study (open reading frames 1a and 1ab, Spike1, Spike2, and ORF4b) together with the corresponding regions of previously reported MERS-CoV sequence obtained from one farm owner were clustering together within the larger MERS-CoV sequences cluster containing human and camel isolates reported for the Arabian Peninsula. Data provided further evidence of the zoonotic potential of MERS-CoV infection and strongly suggested that camels may have a role in the transmission of the virus to humans.

Aeolian Grain Evolution on Mars: Implications for Regolith Origins

NASA Astrophysics Data System (ADS)

Sullivan, R. J.; Cabrol, N. A.; Golombek, M.; Herkenhoff, K. E.; Landis, G.; Mer Athena Science Team

2010-12-01

Early wind tunnel experiments and the Viking Lander experience led to concepts of grain evolution and regolith development on Mars. Wind tunnel experiments showed that 100-150 μm grains are easiest to entrain on Mars, but at 10 times higher wind speeds than on Earth. Even if trajectory speeds of martian saltating grains achieve smaller fractions of entraining wind speeds than on Earth, kinetic energies of these grains would be much higher, with greater potential for damage to the grains during return collisions with the particle bed. On this basis Sagan et al. [1977] JGR 82, 28, 4430 proposed that aeolian grain evolution on Mars followed a “kamikaze” pattern in which an initially coarse grain, entrained only relatively rarely by the strongest winds, would be abraded by high kinetic energy impacts and migrate through successively smaller size-frequencies at an ever-increasing rate (as entrainment became easier and thus more likely) until the grain was essentially turned to dust. On this basis it was proposed that sand-sized grains might be relatively short-lived and perhaps rare on Mars. MER observations motivate adjustments to these concepts, with implications for origins of martian regolith reworked by wind. Along both MER traverses, on opposite sides of the planet, regolith is volumetrically dominated by very fine sand mixed with unresolved finer grains. Sorting probably is poor, based on weakly cohesive remolding by rover wheel cleats. The size-frequency of this material, even if not precisely known, is consistent with grains that have evolved by attrition to sizes smaller than the most easily-moved 100-150 μm interval, to where entrainment becomes more difficult due to the increasing relative importance of inter-particle surface forces. At these smaller sizes also, kinetic energies have been reduced proportionally by the cube of the particle radius, so grain-to-grain attrition is less effective for further evolution to even smaller grain sizes. Characteristics of the most ubiquitous, volumetrically dominant regolith component at both MER sites are consistent with a residuum of grains developed by aeolian grain-to-grain collisions. At both MER sites also: (1) there is a paucity of grains between 300 and 850 μm; and (2) grains >850 μm have participated in creep movements (driven by saltation of finer grains) during past migrations of coarse-grained ripples. These and other observations suggest aeolian grain evolution in which (1) the coarsest grains initially would be driven in creep only, where attrition efficiency might be limited; (2) probability of saltation increases when grain size evolves somewhere below ~900 μm, accelerating further grain evolution to smaller sizes until slowed by decreasing susceptibility to entrainment and (more importantly) decreased collisional effectiveness at grain sizes of <100 μm. We speculate that on a planet where aeolian working of surface materials is common, this grain evolution scenario could have widespread applicability and that regolith grain size-frequency characteristics encountered at both MER sites might be common in many regolith units across the martian surface that have been processed by wind.

Occurrence of the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) across the Gulf Corporation Council countries: Four years update.

PubMed

Aly, Mahmoud; Elrobh, Mohamed; Alzayer, Maha; Aljuhani, Sameera; Balkhy, Hanan

2017-01-01

The emergence of the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) infections has become a global issue of dire concerns. MERS-CoV infections have been identified in many countries all over the world whereas high level occurrences have been documented in the Middle East and Korea. MERS-CoV is mainly spreading across the geographical region of the Middle East, especially in the Arabian Peninsula, while some imported sporadic cases were reported from the Europe, North America, Africa, and lately Asia. The prevalence of MERS-CoV infections across the Gulf Corporation Council (GCC) countries still remains unclear. Therefore, the objective of the current study was to report the prevalence of MERS-CoV in the GCC countries and to also elucidate on its demographics in the Arabian Peninsula. To date, the World Health Organization (WHO) has reported 1,797 laboratory-confirmed cases of MERS-CoV infection since June 2012, involving 687 deaths in 27 different countries worldwide. Within a time span of 4 years from June 2012 to July 2016, we collect samples form MERS-CoV infected individuals from National Guard Hospital, Riyadh, and Ministry of health Saudi Arabia and other GCC countries. Our data comprise a total of 1550 cases (67.1% male and 32.9% female). The age-specific prevalence and distribution of MERS-CoV was as follow: <20 yrs (36 cases: 3.28%), 20-39 yrs (331 cases: 30.15%), 40-59 yrs (314 cases: 28.60%), and the highest-risk elderly group aged ≥60 yrs (417 cases: 37.98%). The case distribution among GCC countries was as follows: Saudi Arabia (1441 cases: 93%), Kuwait (4 cases: 0.3%), Bahrain (1 case: 0.1%), Oman (8 cases: 0.5%), Qatar (16 cases: 1.0%), and United Arab Emirates (80 cases: 5.2%). Thus, MERS-CoV was found to be more prevalent in Saudi Arabia especially in Riyadh, where 756 cases (52.4%) were the worst hit area of the country identified, followed by the western region Makkah where 298 cases (20.6%) were recorded. This prevalence update indicates that the Arabian Peninsula, particularly Saudi Arabia, is the hardest hit region regarding the emerging MERS-CoV infections worldwide. GCC countries including Saudi Arabia now have the infrastructure in place that allows physicians and scientific community to identify and immediately respond to the potential risks posed by new outbreaks of MERS-CoV infections in the region. Given the continuum of emergence and the large magnitude of the disease in our region, more studies will be required to bolster capabilities for timely detection and effective control and prevention of MERS-CoV in our region.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and Mars Exploration Rover 2 (MER-A) are ready for the third launch attempt after weather concerns postponed earlier attempts. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and Mars Exploration Rover 2 (MER-A) are ready for the third launch attempt after weather concerns postponed earlier attempts. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is raised to a vertical position for its lift up the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is raised to a vertical position for its lift up the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is raised to a vertical position for its lift up the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is raised to a vertical position for its lift up the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) nears the top of the launch tower. The fairing will be installed around the payload for protection during launch on a Delta II rocket. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) nears the top of the launch tower. The fairing will be installed around the payload for protection during launch on a Delta II rocket. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

Source mass eruption rate retrieved from satellite-based data using statistical modelling

NASA Astrophysics Data System (ADS)

Gouhier, Mathieu; Guillin, Arnaud; Azzaoui, Nourddine; Eychenne, Julia; Valade, Sébastien

2015-04-01

Ash clouds emitted during volcanic eruptions have long been recognized as a major hazard likely to have dramatic consequences on aircrafts, environment and people. Thus, the International Civil Aviation Organization (ICAO) established nine Volcanic Ash Advisory Centers (VAACs) around the world, whose mission is to forecast the location and concentration of ash clouds over hours to days, using volcanic ash transport and dispersion models (VATDs). Those models use input parameters such as plume height (PH), particle size distribution (PSD), and mass eruption rate (MER), the latter being a key parameter as it directly controls the amount of ash injected into the atmosphere. The MER can be obtained rather accurately from detailed ground deposit studies, but this method does not match the operational requirements in case of a volcanic crisis. Thus, VAACs use empirical laws to determine the MER from the estimation of the plume height. In some cases, this method can be difficult to apply, either because plume height data are not available or because uncertainties related to this method are too large. We propose here an alternative method based on the utilization of satellite data to assess the MER at the source, during explosive eruptions. Satellite-based techniques allow fine ash cloud loading to be quantitatively retrieved far from the source vent. Those measurements can be carried out in a systematic and real-time fashion using geostationary satellite, in particular. We tested here the relationship likely to exist between the amount of fine ash dispersed in the atmosphere and of coarser tephra deposited on the ground. The sum of both contributions yielding an estimate of the MER. For this purpose we examined 19 eruptions (of known duration) in detail for which both (i) the amount of fine ash dispersed in the atmosphere, and (ii) the mass of tephra deposited on the ground have been estimated and published. We combined these data with contextual information that may influence the statistical relationship such as the magma composition or the existence of phreatomagmatism. In order to infer the relationship between ash content in the atmosphere and the amount of tephra on the ground, we used advanced statistic modelling using model selection, with AIC-type (Akaike Information Criterion) penalization, and classification. First we show that a reliable statistical relationship does exist between atmospheric fine ash and tephra fall deposits. Then we show that magma composition does have an effect on this relationship. It follows a power function in the form S_1=c_0{S_2}c_1(P_n))Hc_2 having a coefficient of determination r2=0.91 and a prediction error of 2.16 at a confidence level of 95%. S1 is the mass of tephra fall deposits and S2 is the fine ash cloud mass as retrieved from satellite measurements. H is the plume height, c0 and c2 are constant coefficients while c1 is variable and depends on the magma composition type (Pn=1:3). This method greatly improves the prediction capability of the source MER as compared to the one based on the plume height solely. If available in real-time, satellite data might be advantageously used as a proxy by the VAACs, to derive key source parameters such as the MER.

Enhancement by O6-benzyl-N2-acetylguanosine of N'-[2-chloroethyl]-N-[2-(methylsulphonyl)ethyl]-N'-nitrosourea therapeutic index on nude mice bearing resistant human melanoma.

PubMed Central

Debiton, E.; Cussac-Buchdhal, C.; Mounetou, E.; Rapp, M.; Dupuy, J. M.; Maurizis, J. C.; Veyre, A.; Madelmont, J. C.

1997-01-01

The exposure of cells to O6-benzyl-N2-acetylguanosine (BNAG) and several guanine derivatives is known to reduce the activity of O6-alkylguanine-DNA alkyltransferase (MGMT) and to enhance the sensitivity of Mer+ (methyl enzyme repair positive) tumour cells to chloroethylnitrosoureas (CENUs) in vitro and in vivo. High water solubility and the pharmacokinetic properties of BNAG make it a candidate for simultaneous administration with CENUs by the i.v. route in human clinical use. In vivo we have shown previously that BNAG significantly increases the efficiency of N'-[2-chloroethyl]-N-[2-(methylsulphonyl)ethyl]-N'-nitrosourea (cystemustine) against M4Beu melanoma cells (Mer+) through its cytostatic activity by the i.p. route, but also increases its toxicity. To investigate the toxicity of BNAG and cystemustine when administered simultaneously in mice, we compared the maximum tolerated dose and LD50 doses of cystemustine alone or in combination with 40 mg kg(-1) BNAG by the i.p. route. The toxicity of cystemustine was enhanced by a factor of almost 1.44 when combined with BNAG. To compare the therapeutic index of cystemustine alone and the cystemustine/BNAG combination, pharmacological tests were carried out in nude mice bearing Mer+ M4Beu human melanoma cells. Isotoxic doses were calculated using the 1.44 ratio. The treatments were administered three times by the i.v. route on days 1, 5 and 9 after s.c. inoculation of tumour cells. Although the toxicities of the treatments were equal, BNAG strongly enhanced tumour growth inhibition. These results demonstrate the increase of the therapeutic index of cystemustine by BNAG and justify the use of BNAG to enhance nitrosourea efficiency in vivo by i.v. co-injection. PMID:9365163

Representational Competence: Towards a Distributed and Embodied Cognition Account

ERIC Educational Resources Information Center

Pande, Prajakt; Chandrasekharan, Sanjay

2017-01-01

Multiple external representations (MERs) are central to the practice and learning of science, mathematics and engineering, as the phenomena and entities investigated and controlled in these domains are often not available for perception and action. MERs therefore play a twofold constitutive role in reasoning in these domains. Firstly, MERs stand…

High Prevalence of Middle East Respiratory Coronavirus in Young Dromedary Camels in Jordan

PubMed Central

van Doremalen, Neeltje; Hijazeen, Zaidoun S.K.; Holloway, Peter; Al Omari, Bilal; McDowell, Chester; Adney, Danielle; Talafha, Hani A.; Guitian, Javier; Steel, John; Amarin, Nadim; Tibbo, Markos; Abu-Basha, Ehab; Al-Majali, Ahmad M.

2017-01-01

Abstract Prevalence of Middle East respiratory syndrome coronavirus (MERS-CoV) was determined in 45 dromedary camels from two geographically separated herds in Jordan. Virus shedding was only detected in swabs obtained from the respiratory tract and primarily observed in camels younger than 3 years. MERS-CoV seroprevalence increased with age of camels. Bovine and sheep sera were seronegative. Phylogenetic analysis of partial S2 clustered the Jordanian MERS-CoV strains with contemporary MERS-CoV strains associated with nosocomial outbreaks. PMID:28009529

The impact of multichannel microelectrode recording (MER) in deep brain stimulation of the basal ganglia.

PubMed

Kinfe, Thomas M; Vesper, Jan

2013-01-01

Deep brain stimulation (DBS) of the basal ganglia (Ncl. subthalamicus, Ncl. ventralis intermedius thalami, globus pallidus internus) has become an evidence-based and well-established treatment option in otherwise refractory movement disorders. The Ncl. subthalamicus (STN) is the target of choice in Parkinson's disease.However, a considerable discussion is currently ongoing with regard to the necessity for micro-electrode recording (MER) in DBS surgery.The present review provides an overview on deep brain stimulation and (MER) of the STN in patients with Parkinson's disease. Detailed description is given concerning the multichannel MER systems nowadays available for DBS of the basal ganglia, especially of the STN, as a useful tool for target refinement. Furthermore, an overview is given of the historical aspects, spatial mapping of the STN by MER, and its impact for accuracy and precision in current functional stereotactic neurosurgery.The pros concerning target refinement by MER means on the one hand, and cons including increased bleeding risk, increased operation time, local or general anesthesia, and single versus multichannel microelectrode recording are discussed in detail. Finally, the authors favor the use of MER with intraoperative testing combined with imaging to achieve a more precise electrode placement, aiming to ameliorate clinical outcome in therapy-resistant movement disorders.

Conserved antigenic sites between MERS-CoV and Bat-coronavirus are revealed through sequence analysis.

PubMed

Sharmin, Refat; Islam, Abul B M M K

2016-01-01

MERS-CoV is a newly emerged human coronavirus reported closely related with HKU4 and HKU5 Bat coronaviruses. Bat and MERS corona-viruses are structurally related. Therefore, it is of interest to estimate the degree of conserved antigenic sites among them. It is of importance to elucidate the shared antigenic-sites and extent of conservation between them to understand the evolutionary dynamics of MERS-CoV. Multiple sequence alignment of the spike (S), membrane (M), enveloped (E) and nucleocapsid (N) proteins was employed to identify the sequence conservation among MERS and Bat (HKU4, HKU5) coronaviruses. We used various in silico tools to predict the conserved antigenic sites. We found that MERS-CoV shared 30 % of its S protein antigenic sites with HKU4 and 70 % with HKU5 bat-CoV. Whereas 100 % of its E, M and N protein's antigenic sites are found to be conserved with those in HKU4 and HKU5. This sharing suggests that in case of pathogenicity MERS-CoV is more closely related to HKU5 bat-CoV than HKU4 bat-CoV. The conserved epitopes indicates their evolutionary relationship and ancestry of pathogenicity.

Promiscuity and selectivity of small-molecule inhibitors across TAM receptor tyrosine kinases in pediatric leukemia.

PubMed

Liu, Mao-Hua; Chen, Shi-Bing; Yu, Juan; Liu, Cheng-Jun; Zhang, Xiao-Jing

2017-08-01

The TAM receptor tyrosine kinase family member Mer has been recognized as an attractive therapeutic target for pediatric leukemia. Beside Mer the family contains other two kinases, namely, Tyro3 and Axl, which are highly homologues with Mer and thus most existing small-molecule inhibitors show moderate or high promiscuity across the three kinases. Here, the structural basis and energetic property of selective binding of small-molecule inhibitors to the three kinases were investigated at molecular level. It is found that the selectivity is primarily determined by the size, shape and configuration of kinase's ATP-binding site; the Mer and Axl possess a small, closed active pocket as compared to the bulky, open pocket of Tyro3. The location and conformation of active-site residues of Mer and Axl are highly consistent, suggesting that small-molecule inhibitors generally have a low Mer-over-Axl selectivity and a high Mer-over-Tyro3 selectivity. We demonstrated that the difference in ATP binding potency to the three kinases is also responsible for inhibitor selectivity. We also found that the long-range interactions and allosteric effect arising from rest of the kinase's active site can indirectly influence inhibitor binding and selectivity. Copyright © 2017 Elsevier Inc. All rights reserved.

Knowledge and Attitude of Dental Health Professionals about Middle East Respiratory Syndrome in Saudi Arabia

PubMed Central

Althomairy, Sameer Abdullah; Baseer, Mohammad Abdul; Assery, Mansour; Alsaffan, Abdulrahman Dahham

2018-01-01

Aim and Objective: This study aims to evaluate the knowledge and attitude of practicing dental health professionals (DHPs) (dentist and dental auxiliaries) toward Middle East Respiratory Syndrome coronavirus (MERS-CoV) in Saudi Arabia. Materials and Methods: A cross-sectional descriptive study was undertaken among practicing DHPs in Saudi Arabia. A total of 202 DHPs participated in this study. Knowledge and attitude were assessed using self-administered and pretested questionnaire. The questionnaire was administered online through Survey Monkey® program by sending link to the registered E-mail. Descriptive statistics were performed on demographic data. Mean knowledge and mean attitude scores of DHPs were calculated. Mann–Whitney U-test and Kruskal–Wallis tests were used to disclose the differences between study variables. Chi-square tests and Spearman's correlation tests were applied to find the associations between the variables. Results: The study participants showed mean knowledge score of 12.26 ± 2.27 (based on 17 knowledge questions) and attitude score of 8.63 ± 1.68 (based on 10 attitude questions). The spearman's test showed the positive correlation between knowledge and attitude of DHPs about MERS (r = 0.093, P = 0.188). Knowledge gaps were reflected in questions related to the duration of infectivity (47.5%), treatment of MERS (39.6%), reservoir of MERS-CoV (38.1%), availability of vaccination against MERS-CoV (25.2%), the likelihood of infection (24.3%), and the type of MERS-CoV (23.3%). DHPs showed a positive attitude toward adherence to universal precautions given by CDC and WHO (0.94 ± 0.25), active participation infection control program (0.94 ± 0.24), and use of gowns, gloves, mask, and goggles while dealing with MERS-CoV patients (0.97 ± 0.17). Male DHPs showed significantly higher knowledge and positive attitude toward MERS-CoV infection compared to females. Conclusion: DHPs participated in this study showed good knowledge and positive attitude toward MERS. However, still few lacunae in the knowledge and attitudes toward MERS-CoV were found requiring extensive educational programs. PMID:29780739

Rapid detection of MERS coronavirus-like viruses in bats: pote1ntial for tracking MERS coronavirus transmission and animal origin.

PubMed

Woo, Patrick C Y; Lau, Susanna K P; Chen, Yixin; Wong, Emily Y M; Chan, Kwok-Hung; Chen, Honglin; Zhang, Libiao; Xia, Ningshao; Yuen, Kwok-Yung

2018-03-07

Recently, we developed a monoclonal antibody-based rapid nucleocapsid protein detection assay for diagnosis of MERS coronavirus (MERS-CoV) in humans and dromedary camels. In this study, we examined the usefulness of this assay to detect other lineage C betacoronaviruses closely related to MERS-CoV in bats. The rapid MERS-CoV nucleocapsid protein detection assay was tested positive in 24 (88.9%) of 27 Tylonycteris bat CoV HKU4 (Ty-BatCoV-HKU4) RNA-positive alimentary samples of Tylonycteris pachypus and 4 (19.0%) of 21 Pipistrellus bat CoV HKU5 (Pi-BatCoV-HKU5) RNA-positive alimentary samples of Pipistrellus abramus. There was significantly more Ty-BatCoV-HKU4 RNA-positive alimentary samples than Pi-BatCoV-HKU5 RNA-positive alimentary samples that were tested positive by the rapid MERS-CoV nucleocapsid protein detection assay (P < 0.001 by Chi-square test). The rapid assay was tested negative in all 51 alimentary samples RNA-positive for alphacoronaviruses (Rhinolophus bat CoV HKU2, Myotis bat CoV HKU6, Miniopterus bat CoV HKU8 and Hipposideros batCoV HKU10) and 32 alimentary samples positive for lineage B (SARS-related Rhinolophus bat CoV HKU3) and lineage D (Rousettus bat CoV HKU9) betacoronaviruses. No significant difference was observed between the viral loads of Ty-BatCoV-HKU4/Pi-BatCoV-HKU5 RNA-positive alimentary samples that were tested positive and negative by the rapid test (Mann-Witney U test). The rapid MERS-CoV nucleocapsid protein detection assay is able to rapidly detect lineage C betacoronaviruses in bats. It detected significantly more Ty-BatCoV-HKU4 than Pi-BatCoV-HKU5 because MERS-CoV is more closely related to Ty-BatCoV-HKU4 than Pi-BatCoV-HKU5. This assay will facilitate rapid on-site mass screening of animal samples for ancestors of MERS-CoV and tracking transmission in the related bat species.

Electrical conductivity of a monolayer produced by random sequential adsorption of linear k -mers onto a square lattice

NASA Astrophysics Data System (ADS)

Tarasevich, Yuri Yu.; Goltseva, Valeria A.; Laptev, Valeri V.; Lebovka, Nikolai I.

2016-10-01

The electrical conductivity of a monolayer produced by the random sequential adsorption (RSA) of linear k -mers (particles occupying k adjacent adsorption sites) onto a square lattice was studied by means of computer simulation. Overlapping with predeposited k -mers and detachment from the surface were forbidden. The RSA process continued until the saturation jamming limit, pj. The isotropic (equiprobable orientations of k -mers along x and y axes) and anisotropic (all k -mers aligned along the y axis) depositions for two different models—of an insulating substrate and conducting k -mers (C model) and of a conducting substrate and insulating k -mers (I model)—were examined. The Frank-Lobb algorithm was applied to calculate the electrical conductivity in both the x and y directions for different lengths (k =1 - 128) and concentrations (p =0 - pj) of the k -mers. The "intrinsic electrical conductivity" and concentration dependence of the relative electrical conductivity Σ (p ) (Σ =σ /σm for the C model and Σ =σm/σ for the I model, where σm is the electrical conductivity of substrate) in different directions were analyzed. At large values of k the Σ (p ) curves became very similar and they almost coincided at k =128 . Moreover, for both models the greater the length of the k -mers the smoother the functions Σx y(p ) ,Σx(p ) and Σy(p ) . For the more practically important C model, the other interesting findings are (i) for large values of k (k =64 ,128 ), the values of Σx y and Σy increase rapidly with the initial increase of p from 0 to 0.1; (ii) for k ≥16 , all the Σx y(p ) and Σx(p ) curves intersect with each other at the same isoconductivity points; (iii) for anisotropic deposition, the percolation concentrations are the same in the x and y directions, whereas, at the percolation point the greater the length of the k -mers the larger the anisotropy of the electrical conductivity, i.e., the ratio σy/σx (>1 ).

Performance optimization of a hybrid micro-grid based on double-loop MPPT and SVC-MERS

NASA Astrophysics Data System (ADS)

Wei, Yewen; Hou, Xilun; Zhang, Xiang; Xiong, Shengnan; Peng, Fei

2018-02-01

With ever-increasing concerns on environmental pollution and energy shortage, the development of renewable resource has attracted a lot of attention. This paper first reviews both the wind and photovoltaic (PV) generation techniques and approaches of micro-grid voltage control. Then, a novel islanded micro-grid, which consists of wind & PV generation and hybrid-energy storage device, is built for application to remote and isolated areas. For the PV power generation branch, a double- maximum power point tracking (MPPT) technique is developed to trace the sunlight and regulate the tilt angle of PV panels. For wind-power generation branch, squirrel cage induction generator (SCIG) is used as its simple structure, robustness and less cost. In order to stabilize the output voltage of SCIGs, a new Static Var Compensator named magnetic energy recovery switch (SVC-MERS) is applied. Finally, experimental results confirm that both of the proposed methods can improve the efficiency of PV power generation and voltage stability of the micro-grid, respectively.

Multijunction Solar Cell Technology for Mars Surface Applications

NASA Technical Reports Server (NTRS)

Stella, Paul M.; Mardesich, Nick; Ewell, Richard C.; Mueller, Robert L.; Endicter, Scott; Aiken, Daniel; Edmondson, Kenneth; Fetze, Chris

2006-01-01

Solar cells used for Mars surface applications have been commercial space qualified AM0 optimized devices. Due to the Martian atmosphere, these cells are not optimized for the Mars surface and as a result operate at a reduced efficiency. A multi-year program, MOST (Mars Optimized Solar Cell Technology), managed by JPL and funded by NASA Code S, was initiated in 2004, to develop tools to modify commercial AM0 cells for the Mars surface solar spectrum and to fabricate Mars optimized devices for verification. This effort required defining the surface incident spectrum, developing an appropriate laboratory solar simulator measurement capability, and to develop and test commercial cells modified for the Mars surface spectrum. This paper discusses the program, including results for the initial modified cells. Simulated Mars surface measurements of MER cells and Phoenix Lander cells (2007 launch) are provided to characterize the performance loss for those missions. In addition, the performance of the MER rover solar arrays is updated to reflect their more than two (2) year operation.

A Novel Electrophototrophic Bacterium Rhodopseudomonas palustris Strain RP2, Exhibits Hydrocarbonoclastic Potential in Anaerobic Environments

PubMed Central

Venkidusamy, Krishnaveni; Megharaj, Mallavarapu

2016-01-01

An electrophototrophic, hydrocarbonoclastic bacterium Rhodopseudomonas palustris stain RP2 was isolated from the anodic biofilms of hydrocarbon fed microbial electrochemical remediation systems (MERS). Salient properties of the strain RP2 were direct electrode respiration, dissimilatory metal oxide reduction, spore formation, anaerobic nitrate reduction, free living diazotrophy and the ability to degrade n-alkane components of petroleum hydrocarbons (PH) in anoxic, photic environments. In acetate fed microbial electrochemical cells, a maximum current density of 305 ± 10 mA/m2 (1000Ω) was generated (power density 131.65 ± 10 mW/m2) by strain RP2 with a coulombic efficiency of 46.7 ± 1.3%. Cyclic voltammetry studies showed that anaerobically grown cells of strain RP2 is electrochemically active and likely to transfer electrons extracellularly to solid electron acceptors through membrane bound compounds, however, aerobically grown cells lacked the electrochemical activity. The ability of strain RP2 to produce current (maximum current density 21 ± 3 mA/m2; power density 720 ± 7 μW/m2, 1000 Ω) using PH as a sole energy source was also examined using an initial concentration of 800 mg l-1 of diesel range hydrocarbons (C9-C36) with a concomitant removal of 47.4 ± 2.7% hydrocarbons in MERS. Here, we also report the first study that shows an initial evidence for the existence of a hydrocarbonoclastic behavior in the strain RP2 when grown in different electron accepting and illuminated conditions (anaerobic and MERS degradation). Such observations reveal the importance of photoorganotrophic growth in the utilization of hydrocarbons from contaminated environments. Identification of such novel petrochemical hydrocarbon degrading electricigens, not only expands the knowledge on the range of bacteria known for the hydrocarbon bioremediation but also shows a biotechnological potential that goes well beyond its applications to MERS. PMID:27462307

Worry experienced during the 2015 Middle East Respiratory Syndrome (MERS) pandemic in Korea

PubMed Central

Ro, Jun-Soo; Lee, Jin-Seok; Kang, Sung-Chan; Jung, Hye-Min

2017-01-01

Background Korea failed in its risk communication during the early stage of the Middle East Respiratory Syndrome (MERS) outbreak; consequently, it faced difficulties in managing MERS, while disease-related worry increased. Disease-related worry can help disease prevention and management, but can also have a detrimental effect. This study measured the overall level of disease-related worry during the MERS outbreak period in Korea and the influencing factors and levels of disease-related worry during key outbreak periods. Methods The cross-sectional survey included 1,000 adults who resided in Korea. An ordinal logistic regression was performed for the overall level of MERS-related worry, and influencing factors of worry were analyzed. A reliability test was performed on the levels of MERS-related worry during key outbreak periods. Results The overall level of MERS-related worry was 2.44. Multivariate analysis revealed that women and respondents w very poor subjective health status had higher levels of worry. Respondents with very high stress in daily life had higher levels of worry than those who reported having little stress. The reliability test results on MERS-related worry scores during key outbreak periods showed consistent scores during each period. Conclusion Level of worry increased in cases having higher perceived susceptibility and greater trust in informal information, while initial stage of outbreak was closely associated with that at later stages. These findings suggest the importance of managing the level of worry by providing timely and accurate disease-related information during the initial stage of disease outbreak. PMID:28273131

KENNEDY SPACE CENTER, FLA. - A solid rocket booster arrives at Launch Complex 17-A, Cape Canaveral Air Force Station. It is one of nine that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-14

KENNEDY SPACE CENTER, FLA. - A solid rocket booster arrives at Launch Complex 17-A, Cape Canaveral Air Force Station. It is one of nine that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted up the outside of the launch tower. Visible on another side is the Delta II rocket that will carry the payload into space. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted up the outside of the launch tower. Visible on another side is the Delta II rocket that will carry the payload into space. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

Effect of parallel radiofrequency transmission on arterial input function selection in dynamic contrast-enhanced 3 Tesla pelvic MRI.

PubMed

Chafi, Hatim; Elias, Saba N; Nguyen, Huyen T; Friel, Harry T; Knopp, Michael V; Guo, BeiBei; Heymsfield, Steven B; Jia, Guang

2016-01-01

To evaluate whether parallel radiofrequency transmission (mTX) can improve the symmetry of the left and right femoral arteries in dynamic contrast enhanced magnetic resonance imaging (DCE-MRI) of prostate and bladder cancer. Eighteen prostate and 24 bladder cancer patients underwent 3.0 Tesla DCE-MRI scan with a single transmission channel coil. Subsequently, 21 prostate and 21 bladder cancer patients were scanned using the dual channel mTX upgrade. The precontrast signal ( S0) and the maximum enhancement ratio (MER) were measured in both the left and the right femoral arteries. Within the patient cohort, the ratio of S0 and MER in the left artery to that in the right artery ( S0_LR, MER_LR) was calculated with and without the use of mTX. Left to right asymmetry indices for S0 ( S0_LRasym) and MER ( MER_LRasym) were defined as the absolute values of the difference between S0_LR and 1, and the difference between MER_LR and 1, respectively. S0_LRasym, and MER_LRasym were 0.21 and 0.19 for prostate cancer patients with mTX, and 0.43 and 0.45 for the ones imaged without it (P < 0.001). Also, for the bladder cancer patients, S0_LRasym, and MER_LRasym were 0.11 and 0.9 with mTX, while imaging without it yielded 0.52 and 0.39 (P < 0.001). mTX can significantly improve left-to-right symmetry of femoral artery precontrast signal and contrast enhancement. © 2015 Wiley Periodicals, Inc.

LightAssembler: fast and memory-efficient assembly algorithm for high-throughput sequencing reads.

PubMed

El-Metwally, Sara; Zakaria, Magdi; Hamza, Taher

2016-11-01

The deluge of current sequenced data has exceeded Moore's Law, more than doubling every 2 years since the next-generation sequencing (NGS) technologies were invented. Accordingly, we will able to generate more and more data with high speed at fixed cost, but lack the computational resources to store, process and analyze it. With error prone high throughput NGS reads and genomic repeats, the assembly graph contains massive amount of redundant nodes and branching edges. Most assembly pipelines require this large graph to reside in memory to start their workflows, which is intractable for mammalian genomes. Resource-efficient genome assemblers combine both the power of advanced computing techniques and innovative data structures to encode the assembly graph efficiently in a computer memory. LightAssembler is a lightweight assembly algorithm designed to be executed on a desktop machine. It uses a pair of cache oblivious Bloom filters, one holding a uniform sample of [Formula: see text]-spaced sequenced [Formula: see text]-mers and the other holding [Formula: see text]-mers classified as likely correct, using a simple statistical test. LightAssembler contains a light implementation of the graph traversal and simplification modules that achieves comparable assembly accuracy and contiguity to other competing tools. Our method reduces the memory usage by [Formula: see text] compared to the resource-efficient assemblers using benchmark datasets from GAGE and Assemblathon projects. While LightAssembler can be considered as a gap-based sequence assembler, different gap sizes result in an almost constant assembly size and genome coverage. https://github.com/SaraEl-Metwally/LightAssembler CONTACT: sarah_almetwally4@mans.edu.egSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

40 CFR Appendix E to Part 75 - Optional NOX Emissions Estimation Protocol for Gas-Fired Peaking Units and Oil-Fired Peaking Units

Code of Federal Regulations, 2010 CFR

2010-07-01

... the boiler at a normal or conservatively high excess oxygen level in conjunction with these tests....2Substitute 1.25 times the highest NOX emission rate from the baseline correlation tests for the fuel (or fuel... potential NOX emission rate (MER) (as defined in § 72.2 of this chapter) for each unit operating hour...

40 CFR Appendix E to Part 75 - Optional NOX Emissions Estimation Protocol for Gas-Fired Peaking Units and Oil-Fired Peaking Units

Code of Federal Regulations, 2012 CFR

2012-07-01

... the boiler at a normal or conservatively high excess oxygen level in conjunction with these tests....2Substitute 1.25 times the highest NOX emission rate from the baseline correlation tests for the fuel (or fuel... potential NOX emission rate (MER) (as defined in § 72.2 of this chapter) for each unit operating hour...

Petrophilic, Fe(III) Reducing Exoelectrogen Citrobacter sp. KVM11, Isolated From Hydrocarbon Fed Microbial Electrochemical Remediation Systems

PubMed Central

Venkidusamy, Krishnaveni; Hari, Ananda Rao; Megharaj, Mallavarapu

2018-01-01

Exoelectrogenic biofilms capable of extracellular electron transfer are important in advanced technologies such as those used in microbial electrochemical remediation systems (MERS) Few bacterial strains have been, nevertheless, obtained from MERS exoelectrogenic biofilms and characterized for bioremediation potential. Here we report the identification of one such bacterial strain, Citrobacter sp. KVM11, a petrophilic, iron reducing bacterial strain isolated from hydrocarbon fed MERS, producing anodic currents in microbial electrochemical systems. Fe(III) reduction of 90.01 ± 0.43% was observed during 5 weeks of incubation with Fe(III) supplemented liquid cultures. Biodegradation screening assays showed that the hydrocarbon degradation had been carried out by metabolically active cells accompanied by growth. The characteristic feature of diazo dye decolorization was used as a simple criterion for evaluating the electrochemical activity in the candidate microbe. The electrochemical activities of the strain KVM11 were characterized in a single chamber fuel cell and three electrode electrochemical cells. The inoculation of strain KVM11 amended with acetate and citrate as the sole carbon and energy sources has resulted in an increase in anodic currents (maximum current density) of 212 ± 3 and 359 ± mA/m2 with respective coulombic efficiencies of 19.5 and 34.9% in a single chamber fuel cells. Cyclic voltammetry studies showed that anaerobically grown cells of strain KVM11 are electrochemically active whereas aerobically grown cells lacked the electrochemical activity. Electrobioremediation potential of the strain KVM11 was investigated in hydrocarbonoclastic and dye detoxification conditions using MERS. About 89.60% of 400 mg l-1 azo dye was removed during the first 24 h of operation and it reached below detection limits by the end of the batch operation (60 h). Current generation and biodegradation capabilities of strain KVM11 were examined using an initial concentration of 800 mg l-1 of diesel range hydrocarbons (C9-C36) in MERS (maximum currentdensity 50.64 ± 7 mA/m2; power density 4.08 ± 2 mW/m2, 1000 ω, hydrocarbon removal 60.14 ± 0.7%). Such observations reveal the potential of electroactive biofilms in the simultaneous remediation of hydrocarbon contaminated environments with generation of energy. PMID:29593662

Petrophilic, Fe(III) Reducing Exoelectrogen Citrobacter sp. KVM11, Isolated From Hydrocarbon Fed Microbial Electrochemical Remediation Systems.

PubMed

Venkidusamy, Krishnaveni; Hari, Ananda Rao; Megharaj, Mallavarapu

2018-01-01

Exoelectrogenic biofilms capable of extracellular electron transfer are important in advanced technologies such as those used in microbial electrochemical remediation systems (MERS) Few bacterial strains have been, nevertheless, obtained from MERS exoelectrogenic biofilms and characterized for bioremediation potential. Here we report the identification of one such bacterial strain, Citrobacter sp. KVM11, a petrophilic, iron reducing bacterial strain isolated from hydrocarbon fed MERS, producing anodic currents in microbial electrochemical systems. Fe(III) reduction of 90.01 ± 0.43% was observed during 5 weeks of incubation with Fe(III) supplemented liquid cultures. Biodegradation screening assays showed that the hydrocarbon degradation had been carried out by metabolically active cells accompanied by growth. The characteristic feature of diazo dye decolorization was used as a simple criterion for evaluating the electrochemical activity in the candidate microbe. The electrochemical activities of the strain KVM11 were characterized in a single chamber fuel cell and three electrode electrochemical cells. The inoculation of strain KVM11 amended with acetate and citrate as the sole carbon and energy sources has resulted in an increase in anodic currents (maximum current density) of 212 ± 3 and 359 ± mA/m 2 with respective coulombic efficiencies of 19.5 and 34.9% in a single chamber fuel cells. Cyclic voltammetry studies showed that anaerobically grown cells of strain KVM11 are electrochemically active whereas aerobically grown cells lacked the electrochemical activity. Electrobioremediation potential of the strain KVM11 was investigated in hydrocarbonoclastic and dye detoxification conditions using MERS. About 89.60% of 400 mg l -1 azo dye was removed during the first 24 h of operation and it reached below detection limits by the end of the batch operation (60 h). Current generation and biodegradation capabilities of strain KVM11 were examined using an initial concentration of 800 mg l -1 of diesel range hydrocarbons (C9-C36) in MERS (maximum currentdensity 50.64 ± 7 mA/m 2 ; power density 4.08 ± 2 mW/m 2 , 1000 ω, hydrocarbon removal 60.14 ± 0.7%). Such observations reveal the potential of electroactive biofilms in the simultaneous remediation of hydrocarbon contaminated environments with generation of energy.

Evaluation of candidate vaccine approaches for MERS-CoV

DOE PAGES

Wang, Lingshu; Shi, Wei; Joyce, M. Gordon; ...

2015-07-28

The emergence of Middle East respiratory syndrome coronavirus (MERS-CoV) as a cause of severe respiratory disease highlights the need for effective approaches to CoV vaccine development. Efforts focused solely on the receptor-binding domain (RBD) of the viral Spike (S) glycoprotein may not optimize neutralizing antibody (NAb) responses. Here we show that immunogens based on full-length S DNA and S1 subunit protein elicit robust serum-neutralizing activity against several MERS-CoV strains in mice and non-human primates. Serological analysis and isolation of murine monoclonal antibodies revealed that immunization elicits NAbs to RBD and, non-RBD portions of S1 and S2 subunit. Multiple neutralization mechanismsmore » were demonstrated by solving the atomic structure of a NAb-RBD complex, through sequencing of neutralization escape viruses and by constructing MERS-CoV S variants for serological assays. Immunization of rhesus macaques confers protection against MERS-CoV-induced radiographic pneumonia, as assessed using computerized tomography, supporting this strategy as a promising approach for MERS-CoV vaccine development.« less

Large supramolecular structures of 33-mer gliadin peptide activate toll-like receptors in macrophages.

PubMed

Herrera, María Georgina; Pizzuto, Malvina; Lonez, Caroline; Rott, Karsten; Hütten, Andreas; Sewald, Norbert; Ruysschaert, Jean-Marie; Dodero, Veronica Isabel

2018-04-22

Gliadin, an immunogenic protein present in wheat, is not fully degraded by humans and after the normal gastric and pancreatic digestion, the immunodominant 33-mer gliadin peptide remains unprocessed. The 33-mer gliadin peptide is found in human faeces and urine, proving not only its proteolytic resistance in vivo but more importantly its transport through the entire human body. Here, we demonstrate that 33-mer supramolecular structures larger than 220 nm induce the overexpression of nuclear factor kappa B (NF-κB) via a specific Toll-like Receptor (TLR) 2 and (TLR) 4 dependent pathway and the secretion of pro-inflammatory cytokines such as IP-10/CXCL10 and TNF-α. Using helium ion microscopy, we elucidated the initial stages of oligomerisation of 33-mer gliadin peptide, showing that rod-like oligomers are nucleation sites for protofilament formation. The relevance of the 33-mer supramolecular structures in the early stages of the disease is paving new perspectives in the understanding of gluten-related disorders. Copyright © 2018. Published by Elsevier Inc.

Inactivation of Ebola virus and Middle East respiratory syndrome coronavirus in platelet concentrates and plasma by ultraviolet C light and methylene blue plus visible light, respectively.

PubMed

Eickmann, Markus; Gravemann, Ute; Handke, Wiebke; Tolksdorf, Frank; Reichenberg, Stefan; Müller, Thomas H; Seltsam, Axel

2018-05-06

Ebola virus (EBOV) and Middle East respiratory syndrome coronavirus (MERS-CoV) have been identified as potential threats to blood safety. This study investigated the efficacy of the THERAFLEX UV-Platelets and THERAFLEX MB-Plasma pathogen inactivation systems to inactivate EBOV and MERS-CoV in platelet concentrates (PCs) and plasma, respectively. PCs and plasma were spiked with high titers of cell culture-derived EBOV and MERS-CoV, treated with various light doses of ultraviolet C (UVC; THERAFLEX UV-Platelets) or methylene blue (MB) plus visible light (MB/light; THERAFLEX MB-Plasma), and assessed for residual viral infectivity. UVC reduced EBOV (≥4.5 log) and MERS-CoV (≥3.7 log) infectivity in PCs to the limit of detection, and MB/light decreased EBOV (≥4.6 log) and MERS-CoV (≥3.3 log) titers in plasma to nondetectable levels. Both THERAFLEX UV-Platelets (UVC) and THERAFLEX MB-Plasma (MB/light) effectively reduce EBOV and MERS-CoV infectivity in platelets and plasma, respectively. © 2018 AABB.

Biochemical and Structural Properties of a Thermostable Mercuric Ion Reductase from Metallosphaera sedula

PubMed Central

Artz, Jacob H.; White, Spencer N.; Zadvornyy, Oleg A.; Fugate, Corey J.; Hicks, Danny; Gauss, George H.; Posewitz, Matthew C.; Boyd, Eric S.; Peters, John W.

2015-01-01

Mercuric ion reductase (MerA), a mercury detoxification enzyme, has been tuned by evolution to have high specificity for mercuric ions (Hg2+) and to catalyze their reduction to a more volatile, less toxic elemental form. Here, we present a biochemical and structural characterization of MerA from the thermophilic crenarchaeon Metallosphaera sedula. MerA from M. sedula is a thermostable enzyme, and remains active after extended incubation at 97°C. At 37°C, the NADPH oxidation-linked Hg2+ reduction specific activity was found to be 1.9 μmol/min⋅mg, increasing to 3.1 μmol/min⋅mg at 70°C. M. sedula MerA crystals were obtained and the structure was solved to 1.6 Å, representing the first solved crystal structure of a thermophilic MerA. Comparison of both the crystal structure and amino acid sequence of MerA from M. sedula to mesophillic counterparts provides new insights into the structural determinants that underpin the thermal stability of the enzyme. PMID:26217660

Evaluation of candidate vaccine approaches for MERS-CoV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Lingshu; Shi, Wei; Joyce, M. Gordon

The emergence of Middle East respiratory syndrome coronavirus (MERS-CoV) as a cause of severe respiratory disease highlights the need for effective approaches to CoV vaccine development. Efforts focused solely on the receptor-binding domain (RBD) of the viral Spike (S) glycoprotein may not optimize neutralizing antibody (NAb) responses. Here we show that immunogens based on full-length S DNA and S1 subunit protein elicit robust serum-neutralizing activity against several MERS-CoV strains in mice and non-human primates. Serological analysis and isolation of murine monoclonal antibodies revealed that immunization elicits NAbs to RBD and, non-RBD portions of S1 and S2 subunit. Multiple neutralization mechanismsmore » were demonstrated by solving the atomic structure of a NAb-RBD complex, through sequencing of neutralization escape viruses and by constructing MERS-CoV S variants for serological assays. Immunization of rhesus macaques confers protection against MERS-CoV-induced radiographic pneumonia, as assessed using computerized tomography, supporting this strategy as a promising approach for MERS-CoV vaccine development.« less

Impact of mercury on denitrification and denitrifying microbial communities in nitrate enrichments of subsurface sediments.

PubMed

Wang, Yanping; Wiatrowski, Heather A; John, Ria; Lin, Chu-Ching; Young, Lily Y; Kerkhof, Lee J; Yee, Nathan; Barkay, Tamar

2013-02-01

The contamination of groundwater with mercury (Hg) is an increasing problem worldwide. Yet, little is known about the interactions of Hg with microorganisms and their processes in subsurface environments. We tested the impact of Hg on denitrification in nitrate reducing enrichment cultures derived from subsurface sediments from the Oak Ridge Integrated Field Research Challenge site, where nitrate is a major contaminant and where bioremediation efforts are in progress. We observed an inverse relationship between Hg concentrations and onset and rates of denitrification in nitrate enrichment cultures containing between 53 and 1.1 μM of inorganic Hg; higher Hg concentrations increasingly extended the time to onset of denitrification and inhibited denitrification rates. Microbial community complexity, as indicated by terminal restriction fragment length polymorphism (tRFLP) analysis of the 16S rRNA genes, declined with increasing Hg concentrations; at the 312 nM Hg treatment, a single tRFLP peak was detected representing a culture of Bradyrhizobium sp. that possessed the merA gene indicating a potential for Hg reduction. A culture identified as Bradyrhizobium sp. strain FRC01 with an identical 16S rRNA sequence to that of the enriched peak in the tRFLP patterns, reduced Hg(II) to Hg(0) and carried merA whose amino acid sequence has 97 % identity to merA from the Proteobacteria and Firmicutes. This study demonstrates that in subsurface sediment incubations, Hg may inhibit denitrification and that inhibition may be alleviated when Hg resistant denitrifying Bradyrhizobium spp. detoxify Hg by its reduction to the volatile elemental form.

Maintenance energy requirements in miniature colony dogs.

PubMed

Serisier, S; Weber, M; Feugier, A; Fardet, M-O; Garnier, F; Biourge, V; German, A J

2013-05-01

There are numerous reports of maintenance energy requirements (MER) in dogs, but little information is available about energy requirements of miniature dog breeds. In this prospective, observational, cohort study, we aimed to determine MER in dogs from a number of miniature breeds and to determine which factors were associated with it. Forty-two dogs participated in the study. MER was calculated by determining daily energy intake (EI) during a period of 196 days (28-359 days) when body weight did not change significantly (e.g. ±2% in 12 weeks). Estimated median MER was 473 kJ/kg(0.75) /day (285-766 kJ/kg(0.75) /day), that is, median 113 kcal/kg(0.75) /day (68-183 kcal/kg(0.75) /day). In the obese dogs that lost weight, median MER after weight loss was completed was 360 kJ/kg(0.75) /day (285-515 kJ/kg(0.75) /day), that is, 86 kcal/kg(0.75) /day, (68-123 kcal/kg(0.75) /day). Simple linear regression analysis suggested that three breeds (e.g. Chihuahua, p = 0.002; Yorkshire terrier, p = 0.039; dachshund, p = 0.035) had an effect on MER. In addition to breed, simple linear regression revealed that neuter status (p = 0.079) and having previously been overweight (p = 0.002) were also of significance. However, with multiple linear regression analysis, only previous overweight status (MER less in dogs previously overweight p = 0.008) and breed (MER greater in Yorkshire terriers [p = 0.029] and less in Chihuahuas [p = 0.089]) remained in the final model. This study is the first to estimate MER in dogs of miniature breeds. Although further information from pet dogs is now needed, the current work will be useful for setting energy and nutrient requirement in such dogs for the future. Journal of Animal Physiology and Animal Nutrition © 2013 Blackwell Verlag GmbH.

Structural and Biochemical Characterization of Organotin and Organolead Compounds Binding to the Organomercurial Lyase MerB Provide New Insights into Its Mechanism of Carbon–Metal Bond Cleavage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wahba, Haytham M.; Stevenson, Michael J.; Mansour, Ahmed

2017-01-03

The organomercurial lyase MerB has the unique ability to cleave carbon–Hg bonds, and structural studies indicate that three residues in the active site (C96, D99, and C159 in E. coli MerB) play important roles in the carbon–Hg bond cleavage. However, the role of each residue in carbon–metal bond cleavage has not been well-defined. To do so, we have structurally and biophysically characterized the interaction of MerB with a series of organotin and organolead compounds. Studies with two known inhibitors of MerB, dimethyltin (DMT) and triethyltin (TET), reveal that they inhibit by different mechanisms. In both cases the initial binding ismore » to D99, but DMT subsequently binds to C96, which induces a conformation change in the active site. In contrast, diethyltin (DET) is a substrate for MerB and the SnIV product remains bound in the active site in a coordination similar to that of HgII following cleavage of organomercurial compounds. The results with analogous organolead compounds are similar in that trimethyllead (TML) is not cleaved and binds only to D99, whereas diethyllead (DEL) is a substrate and the PbIV product remains bound in the active site. Binding and cleavage is an exothermic reaction, while binding to D99 has negligible net heat flow. These results show that initial binding of organometallic compounds to MerB occurs at D99 followed, in some cases, by cleavage and loss of the organic moieties and binding of the metal ion product to C96, D99, and C159. The N-terminus of MerA is able to extract the bound PbVI but not the bound SnIV. These results suggest that MerB could be utilized for bioremediation applications, but certain organolead and organotin compounds may present an obstacle by inhibiting the enzyme.« less

Rapid and Effective Virucidal Activity of Povidone-Iodine Products Against Middle East Respiratory Syndrome Coronavirus (MERS-CoV) and Modified Vaccinia Virus Ankara (MVA).

PubMed

Eggers, Maren; Eickmann, Markus; Zorn, Juergen

2015-12-01

Since the first case of Middle East Respiratory Syndrome coronavirus (MERS-CoV) infection was reported in 2012, the virus has infected more than 1300 individuals in 26 countries, and caused more than 480 deaths. Human-to-human transmission requires close contact, and has typically occurred in the healthcare setting. Improved global awareness, together with improved hygiene practices in healthcare facilities, has been highlighted as key strategies in controlling the spread of MERS-CoV. This study tested the in vitro efficacy of three formulations of povidone iodine (PVP-I: 4% PVP-I skin cleanser, 7.5% PVP-I surgical scrub, and 1% PVP-I gargle/mouthwash) against a reference virus (Modified vaccinia virus Ankara, MVA) and MERS-CoV. According to EN14476, a standard suspension test was used to assess virucidal activity against MVA and large volume plating was used for MERS-CoV. All products were tested under clean (0.3 g/L bovine serum albumin, BSA) and dirty conditions (3.0 g/L BSA + 3.0 mL/L erythrocytes), with application times of 15, 30, and 60 s for MVA, and 15 s for MERS-CoV. The products were tested undiluted, 1:10 and 1:100 diluted against MVA, and undiluted against MERS-CoV. A reduction in virus titer of ≥4 log10 (corresponding to an inactivation of ≥99.99%) was regarded as evidence of virucidal activity. This was achieved versus MVA and MERS-CoV, under both clean and dirty conditions, within 15 s of application of each undiluted PVP-I product. These data indicate that PVP-I-based hand wash products for potentially contaminated skin, and PVP-I gargle/mouthwash for reduction of viral load in the oral cavity and the oropharynx, may help to support hygiene measures to prevent transmission of MERS-CoV. Mundipharma Research GmbH & Co.

Effects of Human Recombinant PEDF Protein and PEDF-Derived Peptide 34-mer on Choroidal Neovascularization

PubMed Central

Amaral, Juan

2010-01-01

Purpose. Pigment epithelium-derived factor (PEDF) is a serpin with antiangiogenic properties. Previously, the authors showed that PEDF injected into the subconjunctiva reaches the choroid. Here, they examined the effects of PEDF polypeptide fragments on vessel sprouting and on choroidal neovascularization (CNV) after subconjunctival administration. Methods. Recombinant human PEDF (rhuPEDF) was cleaved at its serpin-exposed loop by limited chymotrypsin proteolysis. Synthetic PEDF peptides 34-mer (Asp44-Asn77) and 44-mer (Val78-Thr121) were used. Ex vivo chick aortic vessel sprouting assays were performed. CNV was induced in rats by laser injury of Bruch's membrane. Daily subconjunctival injections (0.01–10 pmol/d protein) were performed for 5 days starting at day of injury or at the seventh day after injury. New vessel volumes were quantified using optical sections of choroid/RPE flat-mounts labeled with isolectin-Ib4. PEDF distribution was evaluated by immunofluorescence of choroid/RPE/retina cross-sections. Results. Full-length rhuPEDF, cleaved rhuPEDF, or peptide 34-mer exhibited ex vivo antiangiogenic activity, but peptide 44-mer was inefficient. PEDF immunostaining around CNV lesions diminished after laser injury. Subconjunctival administration of rhuPEDF or 34-mer at 0.1 pmol/d decreased CNV lesion volumes by 52% and 47%, respectively, whereas those of 44-mer were similar to vehicle injections. Doses of 0.1 and 1 pmol/d rhuPEDF decreased fully developed CNV complex volumes by 45% and 50%, respectively, compared with vehicle injections. Conclusions. A functional region for the inhibition of vessel sprouting and CNV resides within the 34-mer region of PEDF. Furthermore, subconjunctival administration of optimal range dosages of rhuPEDF or 34-mer can suppress and regress rat CNV lesions, demonstrating that these agents reach the choroid/RPE complex as functionally active molecules. PMID:19850839

Energy requirements of the red kangaroo (Macropus rufus): impacts of age, growth and body size in a large desert-dwelling herbivore.

PubMed

Munn, A J; Dawson, T J

2003-09-01

Generally, young growing mammals have resting metabolic rates (RMRs) that are proportionally greater than those of adult animals. This is seen in the red kangaroo ( Macropus rufus), a large (>20 kg) herbivorous marsupial common to arid and semi-arid inland Australia. Juvenile red kangaroos have RMRs 1.5-1.6 times those expected for adult marsupials of an equivalent body mass. When fed high-quality chopped lucerne hay, young-at-foot (YAF) kangaroos, which have permanently left the mother's pouch but are still sucking, and recently weaned red kangaroos had digestible energy intakes of 641+/-27 kJ kg(-0.75) day(-1) and 677+/-26 kJ kg(-0.75) day(-1), respectively, significantly higher than the 385+/-37 kJ kg(-0.75) day(-1) ingested by mature, non-lactating females. However, YAF and weaned red kangaroos had maintenance energy requirements (MERs) that were not significantly higher than those of mature, non-lactating females, the values ranging between 384 kJ kg(-0.75) day(-1) and 390 kJ kg(-0.75) day(-1) digestible energy. Importantly, the MER of mature female red kangaroos was 84% of that previously reported for similarly sized, but still growing, male red kangaroos. Growth was the main factor affecting the proportionally higher energy requirements of the juvenile red kangaroos relative to non-reproductive mature females. On a good quality diet, juvenile red kangaroos from permanent pouch exit until shortly after weaning (ca. 220-400 days) had average growth rates of 55 g body mass day(-1). At this level of growth, juveniles had total daily digestible energy requirements (i.e. MER plus growth energy requirements) that were 1.7-1.8 times the MER of mature, non-reproductive females. Our data suggest that the proportionally higher RMR of juvenile red kangaroos is largely explained by the additional energy needed for growth. Energy contents of the tissue gained by the YAF and weaned red kangaroos during growth were estimated to be 5.3 kJ g(-1), within the range found for most young growing mammals.

Supervised segmentation of microelectrode recording artifacts using power spectral density.

PubMed

Bakstein, Eduard; Schneider, Jakub; Sieger, Tomas; Novak, Daniel; Wild, Jiri; Jech, Robert

2015-08-01

Appropriate detection of clean signal segments in extracellular microelectrode recordings (MER) is vital for maintaining high signal-to-noise ratio in MER studies. Existing alternatives to manual signal inspection are based on unsupervised change-point detection. We present a method of supervised MER artifact classification, based on power spectral density (PSD) and evaluate its performance on a database of 95 labelled MER signals. The proposed method yielded test-set accuracy of 90%, which was close to the accuracy of annotation (94%). The unsupervised methods achieved accuracy of about 77% on both training and testing data.

Efficient error correction for next-generation sequencing of viral amplicons

PubMed Central

2012-01-01

Background Next-generation sequencing allows the analysis of an unprecedented number of viral sequence variants from infected patients, presenting a novel opportunity for understanding virus evolution, drug resistance and immune escape. However, sequencing in bulk is error prone. Thus, the generated data require error identification and correction. Most error-correction methods to date are not optimized for amplicon analysis and assume that the error rate is randomly distributed. Recent quality assessment of amplicon sequences obtained using 454-sequencing showed that the error rate is strongly linked to the presence and size of homopolymers, position in the sequence and length of the amplicon. All these parameters are strongly sequence specific and should be incorporated into the calibration of error-correction algorithms designed for amplicon sequencing. Results In this paper, we present two new efficient error correction algorithms optimized for viral amplicons: (i) k-mer-based error correction (KEC) and (ii) empirical frequency threshold (ET). Both were compared to a previously published clustering algorithm (SHORAH), in order to evaluate their relative performance on 24 experimental datasets obtained by 454-sequencing of amplicons with known sequences. All three algorithms show similar accuracy in finding true haplotypes. However, KEC and ET were significantly more efficient than SHORAH in removing false haplotypes and estimating the frequency of true ones. Conclusions Both algorithms, KEC and ET, are highly suitable for rapid recovery of error-free haplotypes obtained by 454-sequencing of amplicons from heterogeneous viruses. The implementations of the algorithms and data sets used for their testing are available at: http://alan.cs.gsu.edu/NGS/?q=content/pyrosequencing-error-correction-algorithm PMID:22759430

Efficient error correction for next-generation sequencing of viral amplicons.

PubMed

Skums, Pavel; Dimitrova, Zoya; Campo, David S; Vaughan, Gilberto; Rossi, Livia; Forbi, Joseph C; Yokosawa, Jonny; Zelikovsky, Alex; Khudyakov, Yury

2012-06-25

Next-generation sequencing allows the analysis of an unprecedented number of viral sequence variants from infected patients, presenting a novel opportunity for understanding virus evolution, drug resistance and immune escape. However, sequencing in bulk is error prone. Thus, the generated data require error identification and correction. Most error-correction methods to date are not optimized for amplicon analysis and assume that the error rate is randomly distributed. Recent quality assessment of amplicon sequences obtained using 454-sequencing showed that the error rate is strongly linked to the presence and size of homopolymers, position in the sequence and length of the amplicon. All these parameters are strongly sequence specific and should be incorporated into the calibration of error-correction algorithms designed for amplicon sequencing. In this paper, we present two new efficient error correction algorithms optimized for viral amplicons: (i) k-mer-based error correction (KEC) and (ii) empirical frequency threshold (ET). Both were compared to a previously published clustering algorithm (SHORAH), in order to evaluate their relative performance on 24 experimental datasets obtained by 454-sequencing of amplicons with known sequences. All three algorithms show similar accuracy in finding true haplotypes. However, KEC and ET were significantly more efficient than SHORAH in removing false haplotypes and estimating the frequency of true ones. Both algorithms, KEC and ET, are highly suitable for rapid recovery of error-free haplotypes obtained by 454-sequencing of amplicons from heterogeneous viruses.The implementations of the algorithms and data sets used for their testing are available at: http://alan.cs.gsu.edu/NGS/?q=content/pyrosequencing-error-correction-algorithm.

MicroRNA categorization using sequence motifs and k-mers.

PubMed

Yousef, Malik; Khalifa, Waleed; Acar, İlhan Erkin; Allmer, Jens

2017-03-14

Post-transcriptional gene dysregulation can be a hallmark of diseases like cancer and microRNAs (miRNAs) play a key role in the modulation of translation efficiency. Known pre-miRNAs are listed in miRBase, and they have been discovered in a variety of organisms ranging from viruses and microbes to eukaryotic organisms. The computational detection of pre-miRNAs is of great interest, and such approaches usually employ machine learning to discriminate between miRNAs and other sequences. Many features have been proposed describing pre-miRNAs, and we have previously introduced the use of sequence motifs and k-mers as useful ones. There have been reports of xeno-miRNAs detected via next generation sequencing. However, they may be contaminations and to aid that important decision-making process, we aimed to establish a means to differentiate pre-miRNAs from different species. To achieve distinction into species, we used one species' pre-miRNAs as the positive and another species' pre-miRNAs as the negative training and test data for the establishment of machine learned models based on sequence motifs and k-mers as features. This approach resulted in higher accuracy values between distantly related species while species with closer relation produced lower accuracy values. We were able to differentiate among species with increasing success when the evolutionary distance increases. This conclusion is supported by previous reports of fast evolutionary changes in miRNAs since even in relatively closely related species a fairly good discrimination was possible.

Knowledge and awareness of Middle East respiratory syndrome coronavirus among Saudi and Non-Saudi Arabian pilgrims.

PubMed

Althobaity, Hosam M; Alharthi, Raed A S; Altowairqi, Mohammed H; Alsufyani, Ziyad A; Aloufi, Nahar S; Altowairqi, Abdulrahman E; Alqahtani, Abdulrahman S; Alzahrani, Ali K; Abdel-Moneim, Ahmed S

2017-01-01

The current study was intended to evaluate the knowledge and awareness toward Middle East respiratory syndrome coronavirus (MERS-CoV) of pilgrims from Saudi Arabia and from different Arabian countries. A prospective study was conducted among pilgrims from Saudi Arabia and those from other Arab nations. A total number of 2120 participants including 736 Saudi pilgrims (436 males and 300 females) and 1384 non-Saudi Arabian pilgrims (1384; 909 males and 475 females) were included in the study. The responses of the participants were descriptively analyzed. Pearson correlation coefficient was used to screen the possible correlations among different variables. The differences in the responses between the two groups were evaluated using Mann-Whitney analysis. The responses of the Saudi pilgrims showed statistically significant results in comparison to non-Saudi pilgrims in answering all questions except those related to the presence of efficient vaccination or treatment and the source of information. It was clear that the Saudi pilgrims were more oriented about different aspects of MERS-CoV including the nature of the causative agent, the signs, the severity of the disease, the animals that can transmit the infection to humans, the risk groups, and when one need to be screened for infection. In both Saudi and non-Saudi pilgrims, the official websites of health organizations constitute the main source of their information. It was concluded that Saudi pilgrims possess good knowledge about the MERS-CoV although more orientation is still required.

Histopathology of Middle East respiratory syndrome coronovirus (MERS-CoV) infection - clinicopathological and ultrastructural study.

PubMed

Alsaad, Khaled O; Hajeer, Ali H; Al Balwi, Mohammed; Al Moaiqel, Mohammed; Al Oudah, Nourah; Al Ajlan, Abdulaziz; AlJohani, Sameera; Alsolamy, Sami; Gmati, Giamal E; Balkhy, Hanan; Al-Jahdali, Hamdan H; Baharoon, Salim A; Arabi, Yaseen M

2018-02-01

The pathogenesis, viral localization and histopathological features of Middle East respiratory syndrome - coronavirus (MERS-CoV) in humans are not described sufficiently. The aims of this study were to explore and define the spectrum of histological and ultrastructural pathological changes affecting various organs in a patient with MERS-CoV infection and represent a base of MERS-CoV histopathology. We analysed the post-mortem histopathological findings and investigated localisation of viral particles in the pulmonary and extrapulmonary tissue by transmission electron microscopic examination in a 33-year-old male patient of T cell lymphoma, who acquired MERS-CoV infection. Tissue needle biopsies were obtained from brain, heart, lung, liver, kidney and skeletal muscle. All samples were collected within 45 min from death to reduce tissue decomposition and artefact. Histopathological examination showed necrotising pneumonia, pulmonary diffuse alveolar damage, acute kidney injury, portal and lobular hepatitis and myositis with muscle atrophic changes. The brain and heart were histologically unremarkable. Ultrastructurally, viral particles were localised in the pneumocytes, pulmonary macrophages, renal proximal tubular epithelial cells and macrophages infiltrating the skeletal muscles. The results highlight the pulmonary and extrapulmonary pathological changes of MERS-CoV infection and provide the first evidence of the viral presence in human renal tissue, which suggests tissue trophism for MERS-CoV in kidney. © 2017 John Wiley & Sons Ltd.

Middle East respiratory syndrome.

PubMed

Zumla, Alimuddin; Hui, David S; Perlman, Stanley

2015-09-05

Middle East respiratory syndrome (MERS) is a highly lethal respiratory disease caused by a novel single-stranded, positive-sense RNA betacoronavirus (MERS-CoV). Dromedary camels, hosts for MERS-CoV, are implicated in direct or indirect transmission to human beings, although the exact mode of transmission is unknown. The virus was first isolated from a patient who died from a severe respiratory illness in June, 2012, in Jeddah, Saudi Arabia. As of May 31, 2015, 1180 laboratory-confirmed cases (483 deaths; 40% mortality) have been reported to WHO. Both community-acquired and hospital-acquired cases have been reported with little human-to-human transmission reported in the community. Although most cases of MERS have occurred in Saudi Arabia and the United Arab Emirates, cases have been reported in Europe, the USA, and Asia in people who travelled from the Middle East or their contacts. Clinical features of MERS range from asymptomatic or mild disease to acute respiratory distress syndrome and multiorgan failure resulting in death, especially in individuals with underlying comorbidities. No specific drug treatment exists for MERS and infection prevention and control measures are crucial to prevent spread in health-care facilities. MERS-CoV continues to be an endemic, low-level public health threat. However, the virus could mutate to have increased interhuman transmissibility, increasing its pandemic potential. Copyright © 2015 Elsevier Ltd. All rights reserved.

Structural Analysis of the Hg(II)-Regulatory Protein Tn501 MerR from Pseudomonas aeruginosa

NASA Astrophysics Data System (ADS)

Wang, Dan; Huang, Shanqing; Liu, Pingying; Liu, Xichun; He, Yafeng; Chen, Weizhong; Hu, Qingyuan; Wei, Tianbiao; Gan, Jianhua; Ma, Jing; Chen, Hao

2016-09-01

The metalloprotein MerR is a mercury(II)-dependent transcriptional repressor-activator that responds to mercury(II) with extraordinary sensitivity and selectivity. It’s widely distributed in both Gram-negative and Gram-positive bacteria but with barely detectable sequence identities between the two sources. To provide structural basis for the considerable biochemical and biophysical experiments previously performed on Tn501 and Tn21 MerR from Gram-negative bacteria, we analyzed the crystal structure of mercury(II)-bound Tn501 MerR. The structure in the metal-binding domain provides Tn501 MerR with a high affinity for mercury(II) and the ability to distinguish mercury(II) from other metals with its unique planar trigonal coordination geometry, which is adopted by both Gram-negative and Gram-positive bacteria. The mercury(II) coordination state in the C-terminal metal-binding domain is transmitted through the allosteric network across the dimer interface to the N-terminal DNA-binding domain. Together with the previous mutagenesis analyses, the present data indicate that the residues in the allosteric pathway have a central role in maintaining the functions of Tn501 MerR. In addition, the complex structure exhibits significant differences in tertiary and quaternary structural arrangements compared to those of Bacillus MerR from Gram-positive bacteria, which probably enable them to function with specific promoter DNA with different spacers between -35 and -10 elements.

Coding, modulation, and relays for deep space communication Mars Rovers Case Study

NASA Technical Reports Server (NTRS)

Statman, Joseph I.; Edwards, Charles D.

2004-01-01

This paper presents the communications challenges for the MER mission, the use of DSN and MER tools to maximize the science return, and the application of standards-based relays to the problem. To date, more than 90% of the data returned from MER has been returned via relays, not direct-to-Earath (DTE).

Nordic Winter and Cold: Their Correspondence with Tomas Tranströmer's Poetry

ERIC Educational Resources Information Center

Hosian, Mohammad Akbar

2015-01-01

The Nobel Prize winning poet Tomas Tranströmer was born and bred in Sweden, a remarkably Scandinavian country. Topographically, Scandinavian countries are locations of extreme cold and snowing. This distinguishing climatic condition has had a dominant influence and impact on almost all Scandinavian art and literature, including Tomas Tranströmer's…

78 FR 33842 - Determination and Declaration Regarding Emergency Use of In Vitro Diagnostics for Detection of...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-06-05

... In Vitro Diagnostics for Detection of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) AGENCY... Middle East respiratory syndrome coronavirus (MERS-CoV). On the basis of this determination, she also... detection of Middle East respiratory syndrome coronavirus (MERS-CoV) pursuant to section 564 of the FD&C Act...

MERS coronaviruses from camels in Africa exhibit region-dependent genetic diversity.

PubMed

Chu, Daniel K W; Hui, Kenrie P Y; Perera, Ranawaka A P M; Miguel, Eve; Niemeyer, Daniela; Zhao, Jincun; Channappanavar, Rudragouda; Dudas, Gytis; Oladipo, Jamiu O; Traoré, Amadou; Fassi-Fihri, Ouafaa; Ali, Abraham; Demissié, Getnet F; Muth, Doreen; Chan, Michael C W; Nicholls, John M; Meyerholz, David K; Kuranga, Sulyman A; Mamo, Gezahegne; Zhou, Ziqi; So, Ray T Y; Hemida, Maged G; Webby, Richard J; Roger, Francois; Rambaut, Andrew; Poon, Leo L M; Perlman, Stanley; Drosten, Christian; Chevalier, Veronique; Peiris, Malik

2018-03-20

Middle East respiratory syndrome coronavirus (MERS-CoV) causes a zoonotic respiratory disease of global public health concern, and dromedary camels are the only proven source of zoonotic infection. Although MERS-CoV infection is ubiquitous in dromedaries across Africa as well as in the Arabian Peninsula, zoonotic disease appears confined to the Arabian Peninsula. MERS-CoVs from Africa have hitherto been poorly studied. We genetically and phenotypically characterized MERS-CoV from dromedaries sampled in Morocco, Burkina Faso, Nigeria, and Ethiopia. Viruses from Africa (clade C) are phylogenetically distinct from contemporary viruses from the Arabian Peninsula (clades A and B) but remain antigenically similar in microneutralization tests. Viruses from West (Nigeria, Burkina Faso) and North (Morocco) Africa form a subclade, C1, that shares clade-defining genetic signatures including deletions in the accessory gene ORF4b Compared with human and camel MERS-CoV from Saudi Arabia, virus isolates from Burkina Faso (BF785) and Nigeria (Nig1657) had lower virus replication competence in Calu-3 cells and in ex vivo cultures of human bronchus and lung. BF785 replicated to lower titer in lungs of human DPP4-transduced mice. A reverse genetics-derived recombinant MERS-CoV (EMC) lacking ORF4b elicited higher type I and III IFN responses than the isogenic EMC virus in Calu-3 cells. However, ORF4b deletions may not be the major determinant of the reduced replication competence of BF785 and Nig1657. Genetic and phenotypic differences in West African viruses may be relevant to zoonotic potential. There is an urgent need for studies of MERS-CoV at the animal-human interface. Copyright © 2018 the Author(s). Published by PNAS.

In vitro and in vivo characterization of a reversible synthetic heparin analog.

PubMed

Whelihan, Matthew F; Cooley, Brian; Xu, Yongmei; Pawlinski, Rafal; Liu, Jian; Key, Nigel S

2016-02-01

The global supply of unfractionated heparin (UFH) and all commercially available low molecular weight heparins (LMWH) remain dependent on animal sources, such as porcine intestine or bovine lung. Recent experience has shown that contamination of the supply chain (with over-sulfated chondroitin sulfates) can result in lethal toxicity. Fondaparinux is currently the only commercially available synthetic analog of heparin. We recently described a new class of chemoenzymatically synthesized heparin analogs. One of these compounds (S12-mer) is a dodecasaccharide consisting of an antithrombin-binding moiety with repeating units of IdoA2S-GlcNS6S and two 3-O-sulfate groups that confer the ability to bind protamine. We sought to further characterize this new compound in vitro using biochemical and global coagulation assays and in vivo using thrombosis and hemostasis assays. The anticoagulant activities of the Super 12-mer (S12-mer) and Enoxaparin in anti-factor Xa and plasma-based thrombin generation assays were roughly equivalent with a 50% reduction in peak thrombin generation occurring at approximately 325nM. When protamine was titrated against a fixed concentration of S12-mer in plasma or blood, the S12-mer displayed a significant restitution of thrombin generation and clot formation. In vivo, S12-mer inhibited venous thrombosis to a similar extent as Enoxaparin, with similar bleeding profiles. These data show that the S12-mer has almost identical efficacy to Enoxaparin in terms of FXa inhibition, while displaying significant reversibility with protamine. Taken together with the ability to ensure purity and homogeneity from batch to batch, the S12-mer is a promising new synthetic heparin analog with a potentially enhanced safety profile. Copyright © 2015 Elsevier Ltd. All rights reserved.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the launch tower begins to roll back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-09

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the launch tower begins to roll back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - The launch tower on Launch Complex 17-A, Cape Canaveral Air Force Station, clears the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-09

KENNEDY SPACE CENTER, FLA. - The launch tower on Launch Complex 17-A, Cape Canaveral Air Force Station, clears the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are in the clear after tower rollback in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-09

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are in the clear after tower rollback in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - The Delta II rocket with its Mars Exploration Rover (MER-A) payload leaps off the launch pad into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - The Delta II rocket with its Mars Exploration Rover (MER-A) payload leaps off the launch pad into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are free of the tower and ready for launch. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are free of the tower and ready for launch. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - With smoke and steam billowing beneath, the Delta II rocket with its Mars Exploration Rover (MER-A) payload leaps off the launch pad into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - With smoke and steam billowing beneath, the Delta II rocket with its Mars Exploration Rover (MER-A) payload leaps off the launch pad into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - Leaving smoke and steam behind, the Delta II rocket with its Mars Exploration Rover (MER-A) payload lifts off the pad on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - Leaving smoke and steam behind, the Delta II rocket with its Mars Exploration Rover (MER-A) payload lifts off the pad on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are free of the tower (right) and ready for launch. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are free of the tower (right) and ready for launch. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the launch tower begins to roll back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for another launch attempt. The first two attempts were postponed due to weather concerns. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the launch tower begins to roll back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for another launch attempt. The first two attempts were postponed due to weather concerns. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are viewed as the launch tower overhead rolls back. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are viewed as the launch tower overhead rolls back. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are free of the tower and ready for launch. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are free of the tower and ready for launch. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - The Delta II rocket with its Mars Exploration Rover (MER-A) payload breaks forth from the smoke and steam into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - The Delta II rocket with its Mars Exploration Rover (MER-A) payload breaks forth from the smoke and steam into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25

KENNEDY SPACE CENTER, FLA. - The Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload is viewed from under the launch tower as it moves away on Launch Complex 17-A, Cape Canaveral Air Force Station. This will be a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-09

KENNEDY SPACE CENTER, FLA. - The Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload is viewed from under the launch tower as it moves away on Launch Complex 17-A, Cape Canaveral Air Force Station. This will be a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - The launch tower (right) on Launch Complex 17-A, Cape Canaveral Air Force Station, has been rolled back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload (left) in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-09

KENNEDY SPACE CENTER, FLA. - The launch tower (right) on Launch Complex 17-A, Cape Canaveral Air Force Station, has been rolled back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload (left) in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - Amid billows of smoke and steam, the Delta II rocket with its Mars Exploration Rover (MER-A) payload lifts off the pad on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - Amid billows of smoke and steam, the Delta II rocket with its Mars Exploration Rover (MER-A) payload lifts off the pad on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload waits for rollback of the launch tower in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-09

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload waits for rollback of the launch tower in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the launch tower rolls back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for another launch attempt. The first two attempts, June 8 and June 9, were postponed due to weather concerns. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the launch tower rolls back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for another launch attempt. The first two attempts, June 8 and June 9, were postponed due to weather concerns. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - Blue sky and sun give a dramatic backdrop for the launch of the Delta II rocket with its Mars Exploration Rover (MER-A) payload. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - Blue sky and sun give a dramatic backdrop for the launch of the Delta II rocket with its Mars Exploration Rover (MER-A) payload. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

Middle East respiratory syndrome coronavirus neutralising serum antibodies in dromedary camels: a comparative serological study.

PubMed

Reusken, Chantal B E M; Haagmans, Bart L; Müller, Marcel A; Gutierrez, Carlos; Godeke, Gert-Jan; Meyer, Benjamin; Muth, Doreen; Raj, V Stalin; Smits-De Vries, Laura; Corman, Victor M; Drexler, Jan-Felix; Smits, Saskia L; El Tahir, Yasmin E; De Sousa, Rita; van Beek, Janko; Nowotny, Norbert; van Maanen, Kees; Hidalgo-Hermoso, Ezequiel; Bosch, Berend-Jan; Rottier, Peter; Osterhaus, Albert; Gortázar-Schmidt, Christian; Drosten, Christian; Koopmans, Marion P G

2013-10-01

A new betacoronavirus-Middle East respiratory syndrome coronavirus (MERS-CoV)-has been identified in patients with severe acute respiratory infection. Although related viruses infect bats, molecular clock analyses have been unable to identify direct ancestors of MERS-CoV. Anecdotal exposure histories suggest that patients had been in contact with dromedary camels or goats. We investigated possible animal reservoirs of MERS-CoV by assessing specific serum antibodies in livestock. We took sera from animals in the Middle East (Oman) and from elsewhere (Spain, Netherlands, Chile). Cattle (n=80), sheep (n=40), goats (n=40), dromedary camels (n=155), and various other camelid species (n=34) were tested for specific serum IgG by protein microarray using the receptor-binding S1 subunits of spike proteins of MERS-CoV, severe acute respiratory syndrome coronavirus, and human coronavirus OC43. Results were confirmed by virus neutralisation tests for MERS-CoV and bovine coronavirus. 50 of 50 (100%) sera from Omani camels and 15 of 105 (14%) from Spanish camels had protein-specific antibodies against MERS-CoV spike. Sera from European sheep, goats, cattle, and other camelids had no such antibodies. MERS-CoV neutralising antibody titres varied between 1/320 and 1/2560 for the Omani camel sera and between 1/20 and 1/320 for the Spanish camel sera. There was no evidence for cross-neutralisation by bovine coronavirus antibodies. MERS-CoV or a related virus has infected camel populations. Both titres and seroprevalences in sera from different locations in Oman suggest widespread infection. European Union, European Centre For Disease Prevention and Control, Deutsche Forschungsgemeinschaft. Copyright © 2013 Elsevier Ltd. All rights reserved.

Host cell entry of Middle East respiratory syndrome coronavirus after two-step, furin-mediated activation of the spike protein

PubMed Central

Millet, Jean Kaoru; Whittaker, Gary R.

2014-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) is a newly identified betacoronavirus causing high morbidity and mortality in humans. The coronavirus spike (S) protein is the main determinant of viral entry, and although it was previously shown that MERS-CoV S can be activated by various proteases, the details of the mechanisms of proteolytic activation of fusion are still incompletely characterized. Here, we have uncovered distinctive characteristics of MERS-CoV S. We identify, by bioinformatics and peptide cleavage assays, two cleavage sites for furin, a ubiquitously expressed protease, which are located at the S1/S2 interface and at the S2′ position of the S protein. We show that although the S1/S2 site is proteolytically processed by furin during protein biosynthesis, the S2′ site is cleaved upon viral entry. MERS-CoV pseudovirion infection was shown to be enhanced by elevated levels of furin expression, and entry could be decreased by furin siRNA silencing. Enhanced furin activity appeared to partially override the low pH-dependent nature of MERS-CoV entry. Inhibition of furin activity was shown to decrease MERS-CoV S-mediated entry, as well as infection by the virus. Overall, we show that MERS-CoV has evolved an unusual two-step furin activation for fusion, suggestive of a role during the process of emergence into the human population. The ability of MERS-CoV to use furin in this manner, along with other proteases, may explain the polytropic nature of the virus. PMID:25288733

Mapping Potential Amplification and Transmission Hotspots for MERS-CoV, Kenya.

PubMed

Gikonyo, Stephen; Kimani, Tabitha; Matere, Joseph; Kimutai, Joshua; Kiambi, Stella G; Bitek, Austine O; Juma Ngeiywa, K J Z; Makonnen, Yilma J; Tripodi, Astrid; Morzaria, Subhash; Lubroth, Juan; Rugalema, Gabriel; Fasina, Folorunso Oludayo

2018-03-16

Dromedary camels have been implicated consistently as the source of Middle East respiratory syndrome coronavirus (MERS-CoV) human infections and attention to prevent and control it has focused on camels. To understanding the epidemiological role of camels in the transmission of MERS-CoV, we utilized an iterative empirical process in Geographic Information System (GIS) to identify and qualify potential hotspots for maintenance and circulation of MERS-CoV, and produced risk-based surveillance sites in Kenya. Data on camel population and distribution were used to develop camel density map, while camel farming system was defined using multi-factorial criteria including the agro-ecological zones (AEZs), production and marketing practices. Primary and secondary MERS-CoV seroprevalence data from specific sites were analyzed, and location-based prevalence matching with camel densities was conducted. High-risk convergence points (migration zones, trade routes, camel markets, slaughter slabs) were profiled and frequent cross-border camel movement mapped. Results showed that high camel-dense areas and interaction (markets and migration zones) were potential hotspot for transmission and spread. Cross-border contacts occurred with in-migrated herds at hotspot locations. AEZ differential did not influence risk distribution and plausible risk factors for spatial MERS-CoV hotspots were camel densities, previous cases of MERS-CoV, high seroprevalence and points of camel convergences. Although Kenyan camels are predisposed to MERS-CoV, no shedding is documented to date. These potential hotspots, determined using anthropogenic, system and trade characterizations should guide selection of sampling/surveillance sites, high-risk locations, critical areas for interventions and policy development in Kenya, as well as instigate further virological examination of camels.

Inhibitor recognition specificity of MERS-CoV papain-like protease may differ from that of SARS-CoV.

PubMed

Lee, Hyun; Lei, Hao; Santarsiero, Bernard D; Gatuz, Joseph L; Cao, Shuyi; Rice, Amy J; Patel, Kavankumar; Szypulinski, Michael Z; Ojeda, Isabel; Ghosh, Arun K; Johnson, Michael E

2015-06-19

The Middle East Respiratory Syndrome coronavirus (MERS-CoV) papain-like protease (PLpro) blocking loop 2 (BL2) structure differs significantly from that of SARS-CoV PLpro, where it has been proven to play a crucial role in SARS-CoV PLpro inhibitor binding. Four SARS-CoV PLpro lead inhibitors were tested against MERS-CoV PLpro, none of which were effective against MERS-CoV PLpro. Structure and sequence alignments revealed that two residues, Y269 and Q270, responsible for inhibitor binding to SARS-CoV PLpro, were replaced by T274 and A275 in MERS-CoV PLpro, making critical binding interactions difficult to form for similar types of inhibitors. High-throughput screening (HTS) of 25 000 compounds against both PLpro enzymes identified a small fragment-like noncovalent dual inhibitor. Mode of inhibition studies by enzyme kinetics and competition surface plasmon resonance (SPR) analyses suggested that this compound acts as a competitive inhibitor with an IC50 of 6 μM against MERS-CoV PLpro, indicating that it binds to the active site, whereas it acts as an allosteric inhibitor against SARS-CoV PLpro with an IC50 of 11 μM. These results raised the possibility that inhibitor recognition specificity of MERS-CoV PLpro may differ from that of SARS-CoV PLpro. In addition, inhibitory activity of this compound was selective for SARS-CoV and MERS-CoV PLpro enzymes over two human homologues, the ubiquitin C-terminal hydrolases 1 and 3 (hUCH-L1 and hUCH-L3).

KENNEDY SPACE CENTER, FLA. - A third solid rocket booster (SRB) is lifted up the launch tower on Launch Complex 17-A, Cape Canaveral Air Force Station. They are three of nine SRBs that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-14

KENNEDY SPACE CENTER, FLA. - A third solid rocket booster (SRB) is lifted up the launch tower on Launch Complex 17-A, Cape Canaveral Air Force Station. They are three of nine SRBs that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, workers complete raising a solid rocket booster to a vertical position. It will be lifted up the launch tower and mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-14

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, workers complete raising a solid rocket booster to a vertical position. It will be lifted up the launch tower and mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, a solid rocket booster is raised off the transporter. When vertical, it will be lifted up the launch tower and mated to the Delta rocket (in the background) to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-14

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, a solid rocket booster is raised off the transporter. When vertical, it will be lifted up the launch tower and mated to the Delta rocket (in the background) to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, a solid rocket booster is moved into position to raise to vertical and lift up the launch tower. It is one of nine that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-14

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, a solid rocket booster is moved into position to raise to vertical and lift up the launch tower. It is one of nine that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

Impact of defects on percolation in random sequential adsorption of linear k-mers on square lattices.

PubMed

Tarasevich, Yuri Yu; Laptev, Valeri V; Vygornitskii, Nikolai V; Lebovka, Nikolai I

2015-01-01

The effect of defects on the percolation of linear k-mers (particles occupying k adjacent sites) on a square lattice is studied by means of Monte Carlo simulation. The k-mers are deposited using a random sequential adsorption mechanism. Two models L(d) and K(d) are analyzed. In the L(d) model it is assumed that the initial square lattice is nonideal and some fraction of sites d is occupied by nonconducting point defects (impurities). In the K(d) model the initial square lattice is perfect. However, it is assumed that some fraction of the sites in the k-mers d consists of defects, i.e., is nonconducting. The length of the k-mers k varies from 2 to 256. Periodic boundary conditions are applied to the square lattice. The dependences of the percolation threshold concentration of the conducting sites p(c) vs the concentration of defects d are analyzed for different values of k. Above some critical concentration of defects d(m), percolation is blocked in both models, even at the jamming concentration of k-mers. For long k-mers, the values of d(m) are well fitted by the functions d(m)∝k(m)(-α)-k(-α) (α=1.28±0.01 and k(m)=5900±500) and d(m)∝log(10)(k(m)/k) (k(m)=4700±1000) for the L(d) and K(d) models, respectively. Thus, our estimation indicates that the percolation of k-mers on a square lattice is impossible even for a lattice without any defects if k⪆6×10(3).

The effect of aqueous speciation and cellular ligand binding on the biotransformation and bioavailability of methylmercury in mercury-resistant bacteria.

PubMed

Ndu, Udonna; Barkay, Tamar; Schartup, Amina Traore; Mason, Robert P; Reinfelder, John R

2016-02-01

Mercury resistant bacteria play a critical role in mercury biogeochemical cycling in that they convert methylmercury (MeHg) and inorganic mercury to elemental mercury, Hg(0). To date there are very few studies on the effects of speciation and bioavailability of MeHg in these organisms, and even fewer studies on the role that binding to cellular ligands plays on MeHg uptake. The objective of this study was to investigate the effects of thiol complexation on the uptake of MeHg by measuring the intracellular demethylation-reduction (transformation) of MeHg to Hg(0) in Hg-resistant bacteria. Short-term intracellular transformation of MeHg was quantified by monitoring the loss of volatile Hg(0) generated during incubations of bacteria containing the complete mer operon (including genes from putative mercury transporters) exposed to MeHg in minimal media compared to negative controls with non-mer or heat-killed cells. The results indicate that the complexes MeHgOH, MeHg-cysteine, and MeHg-glutathione are all bioavailable in these bacteria, and without the mer operon there is very little biological degradation of MeHg. In both Pseudomonas stutzeri and Escherichia coli, there was a pool of MeHg that was not transformed to elemental Hg(0), which was likely rendered unavailable to Mer enzymes by non-specific binding to cellular ligands. Since the rates of MeHg accumulation and transformation varied more between the two species of bacteria examined than among MeHg complexes, microbial bioavailability, and therefore microbial demethylation, of MeHg in aquatic systems likely depends more on the species of microorganism than on the types and relative concentrations of thiols or other MeHg ligands present.

Characterizing submarine ground‐water discharge using fiber‐optic distributed temperature sensing and marine electrical resistivity

USGS Publications Warehouse

Henderson, Rory; Day-Lewis, Frederick D.; Lane, John W.; Harvey, Charles F.; Liu, Lanbo

2008-01-01

Submarine ground‐water discharge (SGD) contributes important solute fluxes to coastal waters. Pollutants are transported to coastal ecosystems by SGD at spatially and temporally variable rates. New approaches are needed to characterize the effects of storm‐event, tidal, and seasonal forcing on SGD. Here, we evaluate the utility of two geophysical methods‐fiber‐optic distributed temperature sensing (FO‐DTS) and marine electrical resistivity (MER)—for observing the spatial and temporal variations in SGD and the configuration of the freshwater/saltwater interface within submarine sediments. FO‐DTS and MER cables were permanently installed into the estuary floor on a transect extending 50 meters offshore under Waquoit Bay, Massachusetts, at the Waquoit Bay National Estuarine Research Reserve, and nearly continuous data were collected for 4 weeks in summer 2007. Initial results indicate that the methods are extremely useful for monitoring changes in the complex estuarine environment. The FO‐DTS produced time‐series data at approximately 1‐meter increments along the length of the fiber at approximately 29‐second intervals. The temperature time‐series data show that the temperature at near‐shore locations appears to be dominated by a semi‐diurnal (tidal) signal, whereas the temperature at off‐shore locations is dominated by a diurnal signal (day/night heating and cooling). Dipole‐dipole MER surveys were completed about every 50 minutes, allowing for production of high‐resolution time‐lapse tomograms, which provide insight into the variations of the subsurface freshwater/saltwater interface. Preliminary results from the MER data show a high‐resistivity zone near the shore at low tide, indicative of SGD, and consistent with the FO‐DTS results.

Phytoremediation of Ionic and Methyl Mercury Pollution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meagher, Richard B.

Phytoremediation is defined as the use of plants to extract, resist, detoxify, and/or sequester toxic environmental pollutants. The long-term goal of the proposed research is to develop and test highly productive, field-adapted plant species that have been engineered for the phytoremediation of mercury. A variety of different genes, which should enable plants to clean mercury polluted sites are being tested as tools for mercury phytoremediation, first in model laboratory plants and then in potential field species. Several of these genes have already been shown to enhance mercury phytoremediation. Mercury pollution is a serious, world-wide problem affecting the health of humanmore » and wildlife populations. Environmentally, the most serious mercury threat is the production of methylmercury (CH3Hg+) by native bacteria at mercury contaminated wetland sites. Methylmercury is inherently more toxic than metallic (Hg(0)) or ionic (Hg(II)) mercury, and because methylmercury is prolifically biomagnified up the food chain, it poses the most immediate danger to animal populations. We have successfully engineered two model plants, Arabidopsis and tobacco, to use the bacterial merB gene to convert methylmercury to less toxic ionic mercury and to use the bacterial merA gene to further detoxify ionic mercury to the least toxic form of mercury, metallic mercury. Plants expressing both MerA and MerB proteins detoxify methylmercury in two steps to the metallic form. These plants germinate, grow, and set seed at normal growth rates on levels of methylmercury or ionic mercury that are lethal to normal plants. Our newest efforts involve engineering plants with several additional bacterial and plant genes that allow for higher levels of mercury resistance and mercury hyperaccumulation. The potential for these plants to hyperaccumulate mercury was further advanced by developing constitutive, aboveground, and root-specific gene expression systems.« less

Dromedary camels and the transmission of Middle East Respiratory Syndrome Coronavirus (MERS-CoV)

PubMed Central

Hemida, Maged G; Elmoslemany, Ahmed; Al-Hizab, Fahad; Alnaeem, Abdulmohsen; Almathen, Faisal; Faye, Bernard; Chu, Daniel KW; Perera, Ranawaka A; Peiris, Malik

2015-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) is an existential threat to global public health. The virus has been repeatedly detected in dromedary camels (Camelus dromedarius). Adult animals in many countries in the Middle East as well as in North and East Africa showed high (>90%) sero-prevalence to the virus. MERS-CoV isolated from dromedaries is genetically and phenotypically similar to viruses from humans. We summarise current understanding of the ecology of MERS-CoV in animals and transmission at the animal-human interface. We review aspects of husbandry, animal movements and trade and the use and consumption of camel dairy and meat products in the Middle East that may be relevant to the epidemiology of MERS. We also highlight the gaps in understanding the transmission of this virus in animals and from animals to humans. PMID:26256102

Response to Emergence of Middle East Respiratory Syndrome Coronavirus, Abu Dhabi, United Arab Emirates, 2013-2014.

PubMed

Al Hosani, Farida Ismail; Pringle, Kimberly; Al Mulla, Mariam; Kim, Lindsay; Pham, Huong; Alami, Negar N; Khudhair, Ahmed; Hall, Aron J; Aden, Bashir; El Saleh, Feda; Al Dhaheri, Wafa; Al Bandar, Zyad; Bunga, Sudhir; Abou Elkheir, Kheir; Tao, Ying; Hunter, Jennifer C; Nguyen, Duc; Turner, Andrew; Pradeep, Krishna; Sasse, Jurgen; Weber, Stefan; Tong, Suxiang; Whitaker, Brett L; Haynes, Lia M; Curns, Aaron; Gerber, Susan I

2016-07-01

In January 2013, several months after Middle East respiratory syndrome coronavirus (MERS-CoV) was first identified in Saudi Arabia, Abu Dhabi, United Arab Emirates, began surveillance for MERS-CoV. We analyzed medical chart and laboratory data collected by the Health Authority-Abu Dhabi during January 2013-May 2014. Using real-time reverse transcription PCR, we tested respiratory tract samples for MERS-CoV and identified 65 case-patients. Of these patients, 23 (35%) were asymptomatic at the time of testing, and 4 (6%) showed positive test results for >3 weeks (1 had severe symptoms and 3 had mild symptoms). We also identified 6 clusters of MERS-CoV cases. This report highlights the potential for virus shedding by mildly ill and asymptomatic case-patients. These findings will be useful for MERS-CoV management and infection prevention strategies.

Response to Emergence of Middle East Respiratory Syndrome Coronavirus, Abu Dhabi, United Arab Emirates, 2013–2014

PubMed Central

Al Hosani, Farida Ismail; Al Mulla, Mariam; Kim, Lindsay; Pham, Huong; Alami, Negar N.; Khudhair, Ahmed; Hall, Aron J.; Aden, Bashir; El Saleh, Feda; Al Dhaheri, Wafa; Al Bandar, Zyad; Bunga, Sudhir; Abou Elkheir, Kheir; Tao, Ying; Hunter, Jennifer C.; Nguyen, Duc; Turner, Andrew; Pradeep, Krishna; Sasse, Jurgen; Weber, Stefan; Tong, Suxiang; Whitaker, Brett L.; Haynes, Lia M.; Curns, Aaron; Gerber, Susan I.

2016-01-01

In January 2013, several months after Middle East respiratory syndrome coronavirus (MERS-CoV) was first identified in Saudi Arabia, Abu Dhabi, United Arab Emirates, began surveillance for MERS-CoV. We analyzed medical chart and laboratory data collected by the Health Authority–Abu Dhabi during January 2013–May 2014. Using real-time reverse transcription PCR, we tested respiratory tract samples for MERS-CoV and identified 65 case-patients. Of these patients, 23 (35%) were asymptomatic at the time of testing, and 4 (6%) showed positive test results for >3 weeks (1 had severe symptoms and 3 had mild symptoms). We also identified 6 clusters of MERS-CoV cases. This report highlights the potential for virus shedding by mildly ill and asymptomatic case-patients. These findings will be useful for MERS-CoV management and infection prevention strategies. PMID:27314227

Characterization of the Metabolically Modified Heavy Metal-Resistant Cupriavidus metallidurans Strain MSR33 Generated for Mercury Bioremediation

PubMed Central

Rojas, Luis A.; Yáñez, Carolina; González, Myriam; Lobos, Soledad; Smalla, Kornelia; Seeger, Michael

2011-01-01

Background Mercury-polluted environments are often contaminated with other heavy metals. Therefore, bacteria with resistance to several heavy metals may be useful for bioremediation. Cupriavidus metallidurans CH34 is a model heavy metal-resistant bacterium, but possesses a low resistance to mercury compounds. Methodology/Principal Findings To improve inorganic and organic mercury resistance of strain CH34, the IncP-1β plasmid pTP6 that provides novel merB, merG genes and additional other mer genes was introduced into the bacterium by biparental mating. The transconjugant Cupriavidus metallidurans strain MSR33 was genetically and biochemically characterized. Strain MSR33 maintained stably the plasmid pTP6 over 70 generations under non-selective conditions. The organomercurial lyase protein MerB and the mercuric reductase MerA of strain MSR33 were synthesized in presence of Hg2+. The minimum inhibitory concentrations (mM) for strain MSR33 were: Hg2+, 0.12 and CH3Hg+, 0.08. The addition of Hg2+ (0.04 mM) at exponential phase had not an effect on the growth rate of strain MSR33. In contrast, after Hg2+ addition at exponential phase the parental strain CH34 showed an immediate cessation of cell growth. During exposure to Hg2+ no effects in the morphology of MSR33 cells were observed, whereas CH34 cells exposed to Hg2+ showed a fuzzy outer membrane. Bioremediation with strain MSR33 of two mercury-contaminated aqueous solutions was evaluated. Hg2+ (0.10 and 0.15 mM) was completely volatilized by strain MSR33 from the polluted waters in presence of thioglycolate (5 mM) after 2 h. Conclusions/Significance A broad-spectrum mercury-resistant strain MSR33 was generated by incorporation of plasmid pTP6 that was directly isolated from the environment into C. metallidurans CH34. Strain MSR33 is capable to remove mercury from polluted waters. This is the first study to use an IncP-1β plasmid directly isolated from the environment, to generate a novel and stable bacterial strain useful for mercury bioremediation. PMID:21423734

Accuracy of entrainment coefficients in one-dimensional volcanic plume models

NASA Astrophysics Data System (ADS)

McNeal, J. S.; Freedland, G.; Cal, R. B.; Mastin, L. G.; Solovitz, S.

2017-12-01

During and after volcanic eruptions, ash clouds can present a danger to human activities, notably to air travel. Ash dispersal models can forecast the location and downwind path of the ash cloud, which are critical for mitigating potential threats. The accuracy of the ash dispersal model depends on the reliability of input parameters, one of which is the mass eruption rate (MER). Uncertainties in MER translate to uncertainties in forecasts of ash-cloud concentration. One-dimensional plume models can quickly estimate the MER from plume height, relying on empirical entrainment coefficients, α and β, which describe air inflow perpendicular and parallel to the centerline of the plume, respectively. While much work has been done to quantify α for strong plumes (0.06-0.09 in most cases), consensus has not been reached for α and β in moderate to weak plumes (i.e. plumes bent over by the wind). We conducted high precision jet entrainment measurements in a wind tunnel using particle image velocimetry (PIV). Observed centerline trajectories were compared to modeled ones using the one-dimensional plume model Plumeria. Test conditions produced Reynolds numbers (Re) on the order of 103 to 105 and jet-to-cross flow velocity ratios (Vr) from 6 to 34. Over this range, α and β were adjusted to match the modeled trajectories with measured ones. Additionally, we compared historical observations of plume height and MER during volcanic eruptions against Plumeria predictions. Uncertainties in MER were considered with additional model simulations to quantify their impact on the optimal entrainment coefficients. Our comparisons reveal a clear linear α-β relationship, where multiple α and β values could be found that produced accurate plume height predictions. For example, similar accuracy was found using both (α,β) = (0.07,0.35) and (α,β) = (0.04,0.95) for the test case based on the 2002 eruption of Reventador volcano in Ecuador. However, in some cases that we studied, the response was largely independent of the vertical entrainment coefficient α for weak plumes, such as for the 1996 eruption of Ruapehu volcano in New Zealand, where the optimal β was near 0.75 in all simulations.

Elution kinetics, antimicrobial activity, and mechanical properties of 11 different antibiotic loaded acrylic bone cement.

PubMed

Gálvez-López, Ruben; Peña-Monje, Alejandro; Antelo-Lorenzo, Ramón; Guardia-Olmedo, Juan; Moliz, Juan; Hernández-Quero, José; Parra-Ruiz, Jorge

2014-01-01

Antibiotic-loaded acrylic bone cements (ALABC) spacers are routinely used in the treatment of prosthetic joint infections. The objectives of our study were to evaluate different ALABC for elution kinetics, thermal stability, and mechanical properties. A 10 or 20% mixture (w/w) beads of medium viscosity bone cement (DePuy, Inc) and vancomycin (VAN), gentamycin (GM), daptomycin (DAP), moxifloxacin (MOX), rifampicin (RIF), cefotaxime (CTX), cefepime (FEP), amoxicillin clavulanate (AmC), ampicillin (AMP), meropenem (MER), and ertapenem (ERT) were formed and placed into wells filled with phosphate-buffered saline. Antibiotic concentrations were determined using high-performance liquid chromatography. Antimicrobial activity was tested against Micrococcus luteus ATCC 9341 or Escherichia coli ATCC 25922. AmC, AMP, and FEP concentration rapidly decreased after day 2, being almost undetectable at day 4. Sustained and high elution rates were observed with VAN, GM, MOX, and RIF for the 30-day duration of the experiment. DAP, MER, ERT, and CTX elution rates constantly decreased from day 4. All antibiotics tested retained antimicrobial activity proving thermal stability. Mechanical properties of ALABC were maintained except when RIF was used. © 2013.

Addition of deep brain stimulation signal to a local field potential driven Izhikevich model masks the pathological firing pattern of an STN neuron.

PubMed

Michmizos, Kostis P; Nikita, Konstantina S

2011-01-01

The crucial engagement of the subthalamic nucleus (STN) with the neurosurgical procedure of deep brain stimulation (DBS) that alleviates medically intractable Parkinsonian tremor augments the need to refine our current understanding of STN. To enhance the efficacy of DBS as a result of precise targeting, STN boundaries are accurately mapped using extracellular microelectrode recordings (MERs). We utilized the intranuclear MER to acquire the local field potential (LFP) and drive an Izhikevich model of an STN neuron. Using the model as the test bed for clinically acquired data, we demonstrated that stimulation of the STN neuron produces excitatory responses that tonically increase its average firing rate and alter the pattern of its neuronal activity. We also found that the spiking rhythm increases linearly with the increase of amplitude, frequency, and duration of the DBS pulse, inside the clinical range. Our results are in agreement with the current hypothesis that DBS increases the firing rate of STN and masks its pathological bursting firing pattern.

Identification of Information Types and Sources by the Public for Promoting Awareness of Middle East Respiratory Syndrome Coronavirus in Saudi Arabia

ERIC Educational Resources Information Center

Hoda, Jradi

2016-01-01

Middle East Respiratory Syndrome (MERS) is a viral respiratory disease of serious consequences caused by MERS Coronavirus (MERS-CoV). Saudi communities still lack awareness of available protective measures to prevent the transmission of the virus. It is necessary to explore the current information-seeking strategies and preferences for…

Monoclonal Antibody Shows Promise as Potential Therapeutic for MERS | Poster

Cancer.gov

A monoclonal antibody has proven effective in preventing Middle Eastern Respiratory Syndrome (MERS) in lab animals, suggesting further development as a potential intervention for the deadly disease in humans, according to new research. MERS is a newly emerged coronavirus first detected in humans in 2012. Most cases have occurred in the Middle East, but the disease has appeared

The Mars Exploration Rovers Entry Descent and Landing and the Use of Aerodynamic Decelerators

NASA Technical Reports Server (NTRS)

Steltzner, Adam; Desai, Prasun; Lee, Wayne; Bruno, Robin

2003-01-01

The Mars Exploration Rovers (MER) project, the next United States mission to the surface of Mars, uses aerodynamic decelerators in during its entry, descent and landing (EDL) phase. These two identical missions (MER-A and MER-B), which deliver NASA s largest mobile science suite to date to the surface of Mars, employ hypersonic entry with an ablative energy dissipating aeroshell, a supersonic/subsonic disk-gap-band parachute and an airbag landing system within EDL. This paper gives an overview of the MER EDL system and speaks to some of the challenges faced by the various aerodynamic decelerators.

Monoclonal Antibody Shows Promise as Potential Therapeutic for MERS | Poster

Cancer.gov

A monoclonal antibody has proven effective in preventing Middle Eastern Respiratory Syndrome (MERS) in lab animals, suggesting further development as a potential intervention for the deadly disease in humans, according to new research. MERS is a newly emerged coronavirus first detected in humans in 2012. Most cases have occurred in the Middle East, but the disease has appeared elsewhere. In all, MERS has infected more than 1,700 individuals and killed more than 600, according to the World Health Organization. No vaccines or antiviral therapies currently exist. Several candidate vaccines are being developed, and some have been tested in animal models, a prerequisite to human clinical trials.

Two deletion variants of Middle East respiratory syndrome coronavirus found in a patient with characteristic symptoms.

PubMed

Xie, Qian; Cao, Yujuan; Su, Juan; Wu, Jie; Wu, Xianbo; Wan, Chengsong; He, Mingliang; Ke, Changwen; Zhang, Bao; Zhao, Wei

2017-08-01

Significant sequence variation of Middle East respiratory syndrome coronavirus (MERS CoV) has never been detected since it was first reported in 2012. A MERS patient came from Korea to China in late May 2015. The patient was 44 years old and had symptoms including high fever, dry cough with a little phlegm, and shortness of breath, which are roughly consistent with those associated with MERS, and had had close contact with individuals with confirmed cases of MERS.After one month of therapy with antiviral, anti-infection, and immune-enhancing agents, the patient recovered in the hospital and was discharged. A nasopharyngeal swab sample was collected for direct sequencing, which revealed two deletion variants of MERS CoV. Deletions of 414 and 419 nt occurred between ORF5 and the E protein, resulting in a partial protein fusion or truncation of ORF5 and the E protein. Functional analysis by bioinformatics and comparison to previous studies implied that the two variants might be defective in their ability to package MERS CoV. However, the mechanism of how these deletions occurred and what effects they have need to be further investigated.

Structural Analysis of the Hg(II)-Regulatory Protein Tn501 MerR from Pseudomonas aeruginosa

PubMed Central

Wang, Dan; Huang, Shanqing; Liu, Pingying; Liu, Xichun; He, Yafeng; Chen, Weizhong; Hu, Qingyuan; Wei, Tianbiao; Gan, Jianhua; Ma, Jing; Chen, Hao

2016-01-01

The metalloprotein MerR is a mercury(II)-dependent transcriptional repressor-activator that responds to mercury(II) with extraordinary sensitivity and selectivity. It’s widely distributed in both Gram-negative and Gram-positive bacteria but with barely detectable sequence identities between the two sources. To provide structural basis for the considerable biochemical and biophysical experiments previously performed on Tn501 and Tn21 MerR from Gram-negative bacteria, we analyzed the crystal structure of mercury(II)-bound Tn501 MerR. The structure in the metal-binding domain provides Tn501 MerR with a high affinity for mercury(II) and the ability to distinguish mercury(II) from other metals with its unique planar trigonal coordination geometry, which is adopted by both Gram-negative and Gram-positive bacteria. The mercury(II) coordination state in the C-terminal metal-binding domain is transmitted through the allosteric network across the dimer interface to the N-terminal DNA-binding domain. Together with the previous mutagenesis analyses, the present data indicate that the residues in the allosteric pathway have a central role in maintaining the functions of Tn501 MerR. In addition, the complex structure exhibits significant differences in tertiary and quaternary structural arrangements compared to those of Bacillus MerR from Gram-positive bacteria, which probably enable them to function with specific promoter DNA with different spacers between −35 and −10 elements. PMID:27641146

First confirmed cases of Middle East respiratory syndrome coronavirus (MERS-CoV) infection in the United States, updated information on the epidemiology of MERS-CoV infection, and guidance for the public, clinicians, and public health authorities - May 2014.

PubMed

Bialek, Stephanie R; Allen, Donna; Alvarado-Ramy, Francisco; Arthur, Ray; Balajee, Arunmozhi; Bell, David; Best, Susan; Blackmore, Carina; Breakwell, Lucy; Cannons, Andrew; Brown, Clive; Cetron, Martin; Chea, Nora; Chommanard, Christina; Cohen, Nicole; Conover, Craig; Crespo, Antonio; Creviston, Jeanean; Curns, Aaron T; Dahl, Rebecca; Dearth, Stephanie; DeMaria, Alfred; Echols, Fred; Erdman, Dean D; Feikin, Daniel; Frias, Mabel; Gerber, Susan I; Gulati, Reena; Hale, Christa; Haynes, Lia M; Heberlein-Larson, Lea; Holton, Kelly; Ijaz, Kashef; Kapoor, Minal; Kohl, Katrin; Kuhar, David T; Kumar, Alan M; Kundich, Marianne; Lippold, Susan; Liu, Lixia; Lovchik, Judith C; Madoff, Larry; Martell, Sandra; Matthews, Sarah; Moore, Jessica; Murray, Linda R; Onofrey, Shauna; Pallansch, Mark A; Pesik, Nicki; Pham, Huong; Pillai, Satish; Pontones, Pam; Pringle, Kimberly; Pritchard, Scott; Rasmussen, Sonja; Richards, Shawn; Sandoval, Michelle; Schneider, Eileen; Schuchat, Anne; Sheedy, Kristine; Sherin, Kevin; Swerdlow, David L; Tappero, Jordan W; Vernon, Michael O; Watkins, Sharon; Watson, John

2014-05-16

Since mid-March 2014, the frequency with which cases of Middle East respiratory syndrome coronavirus (MERS-CoV) infection have been reported has increased, with the majority of recent cases reported from Saudi Arabia and United Arab Emirates (UAE). In addition, the frequency with which travel-associated MERS cases have been reported and the number of countries that have reported them to the World Health Organization (WHO) have also increased. The first case of MERS in the United States, identified in a traveler recently returned from Saudi Arabia, was reported to CDC by the Indiana State Department of Health on May 1, 2014, and confirmed by CDC on May 2. A second imported case of MERS in the United States, identified in a traveler from Saudi Arabia having no connection with the first case, was reported to CDC by the Florida Department of Health on May 11, 2014. The purpose of this report is to alert clinicians, health officials, and others to increase awareness of the need to consider MERS-CoV infection in persons who have recently traveled from countries in or near the Arabian Peninsula. This report summarizes recent epidemiologic information, provides preliminary descriptions of the cases reported from Indiana and Florida, and updates CDC guidance about patient evaluation, home care and isolation, specimen collection, and travel as of May 13, 2014.

Transformation of a transposon into a derived prolactin promoter with function during human pregnancy

PubMed Central

Emera, Deena; Wagner, Günter P.

2012-01-01

Transposable elements (TEs) are known to provide DNA for host regulatory functions, but the mechanisms underlying the transformation of TEs into cis-regulatory elements are unclear. In humans two TEs—MER20 and MER39—contribute the enhancer/promoter for decidual prolactin (dPRL), which is dramatically induced during pregnancy. We show that evolution of the strong human dPRL promoter was a multistep process that took millions of years. First, MER39 inserted near MER20 in the primate/rodent ancestor, and then there were two phases of activity enhancement in primates. Through the mapping of causal nucleotide substitutions, we demonstrate that strong promoter activity in apes involves epistasis between transcription factor binding sites (TFBSs) ancestral to MER39 and derived sites. We propose a mode of molecular evolution that describes the process by which MER20/MER39 was transformed into a strong promoter, called “epistatic capture.” Epistatic capture is the stabilization of a TFBS that is ancestral but variable in outgroup lineages, and is fixed in the ingroup because of epistatic interactions with derived TFBSs. Finally, we note that evolution of human promoter activity coincides with the emergence of a unique reproductive character in apes, highly invasive placentation. Because prolactin communicates with immune cells during pregnancy, which regulate fetal invasion into maternal tissues, we speculate that ape dPRL promoter activity evolved in response to increased invasiveness of ape fetal tissue. PMID:22733751

Thermally induced defluorination during a mer to fac transformation of a blue-green phosphorescent cyclometalated iridium(III) complex.

PubMed

Zheng, Yonghao; Batsanov, Andrei S; Edkins, Robert M; Beeby, Andrew; Bryce, Martin R

2012-01-02

The new homoleptic tris-cyclometalated [Ir(C^N)(3)] complexes mer-8, fac-8, and fac-9 incorporating γ-carboline ligands are reported. Reaction of 3-(2,4-difluorophenyl)-5-(2-ethylhexyl)-pyrido[4,3-b]indole 6 with iridium(III) chloride under standard cyclometalating conditions gave the homoleptic complex mer-8 in 63% yield. The X-ray crystal structure of mer-8 is described. The Ir-C and Ir-N bonds show the expected bond length alternations for the differing trans influence of phenyl and pyridyl ligands. mer-8 quantitatively isomerized to fac-8 upon irradiation with UV light. However, heating mer-8 at 290 °C in glycerol led to an unusual regioselective loss of one fluorine atom from each of the ligands, yielding fac-9 in 58% yield. fac-8 is thermally very stable: no decomposition was observed when fac-8 was heated in glycerol at 290 °C for 48 h. The γ-carboline system of fac-8 enhances thermal stability compared to the pyridyl analogue fac-Ir(46dfppy)(3)10, which decomposes extensively upon being heated in glycerol at 290 °C for 2 h. Complexes mer-8, fac-8, and fac-9 are emitters of blue-green light (λ(max)(em) = 477, 476, and 494 nm, respectively). The triplet lifetimes for fac-8 and fac-9 are ~4.5 μs at room temperature; solution Φ(PL) values are 0.31 and 0.22, respectively.

Fatality risks for nosocomial outbreaks of Middle East respiratory syndrome coronavirus in the Middle East and South Korea.

PubMed

Sha, Jianping; Li, Yuan; Chen, Xiaowen; Hu, Yan; Ren, Yajin; Geng, Xingyi; Zhang, Zhiruo; Liu, Shelan

2017-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) was first isolated in 2012. The largest known outbreak outside the Middle East occurred in South Korea in 2015. As of 29 June 2016, 1769 laboratory-confirmed cases (630 deaths; 35.6 % case fatality rate [CFR]) had been reported from 26 countries, particularly in the Middle East. However, the CFR for hospital outbreaks was higher than that of family clusters in the Middle East and Korea. Here, we compared the mortality rates for 51 nosocomial outbreaks in the Middle East and one outbreak of MERS-CoV in South Korea. Our findings showed the CFR in the Middle East was much higher than that in South Korea (25.9 % [56/216] vs. 13.8 % [24/174], p = 0.003). Infected individuals who died were, on average, older than those who survived in both the Middle East (64 years [25-98] vs. 46 years [2-85], p = 0.000) and South Korea (68 years [49-82] vs. 53.5 years [16-87], p = 0.000). Similarly, the co-morbidity rates for the fatal cases were statistically higher than for the nonfatal cases in both the Middle East (64.3 % [36/56] vs. 28.1 % [45/160], p = 0.000) and South Korea (45.8 % [11/24] vs. 12.0 % [18/150], p = 0.000). The median number of days from onset to confirmation of infection in the fatal cases was longer than that for survivors from the Middle East (8 days [1-47] vs. 4 days [0-14], p = 0.009). Thus, older age, pre-existing concurrent diseases, and delayed confirmation increase the odds of a fatal outcome in nosocomial MERS-CoV outbreaks in the Middle East and South Korea.

Identifying Monoclonal Antibodies that Potently Inhibit MERS-CoV | Center for Cancer Research

Cancer.gov

The Middle East respiratory syndrome coronavirus (MERS-CoV), first isolated in September 2012, infects cells lining the human airway, causing severe flu-like symptoms that, in some cases, lead to death. As of July 2, 2014, 824 confirmed cases of MERS-CoV infection, including at least 286 related deaths, have been reported to the World Health Organization. While there are

Risk of global spread of Middle East respiratory syndrome coronavirus (MERS-CoV) via the air transport network.

PubMed

Gardner, Lauren M; Chughtai, Abrar A; MacIntyre, C Raina

2016-06-01

Middle East respiratory syndrome coronavirus (MERS-CoV) emerged from the Kingdom of Saudi Arabia (KSA) in 2012 and has since spread to 26 countries. All cases reported so far have either been in the Middle East or linked to the region through passenger air travel, with the largest outbreak outside KSA occurring in South Korea. Further international spread is likely due to the high travel volumes of global travel, as well as the occurrence of large annual mass gathering such as the Haj and Umrah pilgrimages that take place in the region. In this study, a transport network modelling framework was used to quantify the risk of MERS-CoV spreading internationally via air travellers. All regions connected to MERS-CoV affected countries via air travel are considered, and the countries at highest risk of travel-related importations of MERS-CoV were identified, ranked and compared with actual spread of MERS cases. The model identifies all countries that have previously reported a travel acquired case to be in the top 50 at-risk countries. India, Pakistan and Bangladesh are the highest risk countries which have yet to report a case, and should be prepared for the possibility of (pilgrims and general) travellers returning infected with MERS-CoV. In addition, the UK, Egypt, Turkey and the USA are at risk of more cases. We have demonstrated a risk-analysis approach, using travel patterns, to prioritize countries at highest risk for MERS-CoV importations. In order to prevent global outbreaks such as the one seen in South Korea, it is critical for high-risk countries to be prepared and have appropriate screening and triage protocols in place to identify travel-related cases of MERS-CoV. The results from the model can be used by countries to prioritize their airport and hospital screening and triage protocols. © International Society of Travel Medicine, 2016. All rights reserved. Published by Oxford University Press. For permissions, please e-mail: journals.permissions@oup.com.

Determining geographical spread pattern of MERS-CoV by distance method using Kimura model

NASA Astrophysics Data System (ADS)

Amiroch, Siti; Rohmatullah, Arif

2017-03-01

MERS-CoV or generally called as Middle East Respiratory Syndrome Coronavirus, a respiratory disease syndrome caused by a corona virus that attacks the respiratory tract ranging from mild to severe acute indication of fever, cough and shortness of breath. The cases happened relate to the countries in the Arabian Peninsula (Middle East) and there were 356 deaths have been reported due to the spread of the epidemic MERS. The data used in the case of MERS are the data DNA sequences taken from Genbank, the online database of the United States that stores the results of molecular biological experiments from all over the world (http://www.ncbi.nlm.nih.gov). In this case, bioinformatics plays an important role of reading sequences of DNA and genetic information by using the main device in the form of software that is supported by the availability of the Internet, while the analysis there in made and proven with mathematical methods. In similar research conducted by molecular biologists and physicians, the process of DNA sequencing is done with software that is already available like BLAST. In order to determine the MERS geographical distribution patterns in the Arabian Peninsula is done with program Clustal W, Bayesian, Phylip, etc. In this study, the writer use the Matlab simulation for all processes starting sequence alignment, counting the number of transitions and transversion substitutions for each sequence and its location up to the process of forming a phylogenetic tree that figures out the pattern of spread of the epidemic MERS. Mathematical analysis performed on a decline in the formula is to find Kimura evolutionary models and the process of forming a phylogenetic tree (the pattern of the epidemic MERS distribution) with neighbor joining algorithm. Finally it was obtained the pattern of geographical spread with 6 groups epidemic of MERS which ultimately turns out that all the MERS viruses that were spread in the Arabian Peninsula everything are almost the same as the virus sequence found in al-Hasa.

Estimation of basic reproduction number of the Middle East respiratory syndrome coronavirus (MERS-CoV) during the outbreak in South Korea, 2015.

PubMed

Chang, Hyuk-Jun

2017-06-13

In South Korea, an outbreak of Middle East respiratory syndrome (MERS) occurred in 2015. It was the second largest MERS outbreak. As a result of the outbreak in South Korea, 186 infections were reported, and 36 patients died. At least 16,693 people were isolated with suspicious symptoms. This paper estimates the basic reproduction number of the MERS coronavirus (CoV), using data on the spread of MERS in South Korea. The basic reproduction number of an epidemic is defined as the average number of secondary cases that an infected subject produces over its infectious period in a susceptible and uninfected population. To estimate the basic reproduction number of the MERS-CoV, we employ data from the 2015 South Korea MERS outbreak and the susceptible-infected-removed (SIR) model, a mathematical model that uses a set of ordinary differential equations (ODEs). We fit the model to the epidemic data of the South Korea outbreak minimizing the sum of the squared errors to identify model parameters. Also we derive the basic reproductive number as the terms of the parameters of the SIR model. Then we determine the basic reproduction number of the MERS-CoV in South Korea in 2015 as 8.0977. It is worth comparing with the basic reproductive number of the 2014 Ebola outbreak in West Africa including Guinea, Sierra Leone, and Liberia, which had values of 1.5-2.5. There was no intervention to control the infection in the early phase of the outbreak, thus the data used here provide the best conditions to evaluate the epidemic characteristics of MERS, such as the basic reproduction number. An evaluation of basic reproduction number using epidemic data could be problematic if there are stochastic fluctuations in the early phase of the outbreak, or if the report is not accurate and there is bias in the data. Such problems are not relevant to this study because the data used here were precisely reported and verified by Korea Hospital Association.

Prevalence of Diabetes in the 2009 Influenza A (H1N1) and the Middle East Respiratory Syndrome Coronavirus: A Systematic Review and Meta-Analysis.

PubMed

Badawi, Alaa; Ryoo, Seung Gwan

2016-12-09

Over the past two decades a number of severe acute respiratory infection outbreaks such as the 2009 influenza A (H1N1) and the Middle East respiratory syndrome coronavirus (MERS-CoV) have emerged and presented a considerable global public health threat. Epidemiologic evidence suggests that diabetic subjects are more susceptible to these conditions. However, the prevalence of diabetes in H1N1 and MERS-CoV has not been systematically described. The aim of this study is to conduct a systematic review and meta-analysis of published reports documenting the prevalence of diabetes in H1N1 and MERS-CoV and compare its frequency in the two viral conditions. Meta-analysis for the proportions of subjects with diabetes was carried out in 29 studies for H1N1 ( n =92,948) and 9 for MERS-CoV ( n =308). Average age of H1N1 patients (36.2±6.0 years) was significantly younger than that of subjects with MERS-CoV (54.3±7.4 years, P<0.05). Compared to MERS-CoV patients, subjects with H1N1 exhibited 3-fold lower frequency of cardiovascular diseases and 2- and 4-fold higher prevalence of obesity and immunosuppression, respectively. The overall prevalence of diabetes in H1N1 was 14.6% (95% CI: 12.3-17.0%; P<0.001), a 3.6-fold lower than in MERS-CoV (54.4%; 95% CI: 29.4-79.5; P<0.001). The prevalence of diabetes among H1N1 cases from Asia and North America was ~two-fold higher than those from South America and Europe. The prevalence of diabetes in MERS-CoV cases is higher than in H1N1. Regional comparisons suggest that an etiologic role of diabetes in MERS-CoV may exist distinctive from that in H1N1.

Photochemistry of Iron and Ruthenium Carbonyl Complexes: Evidence for Light-Induced Loss of Carbon Monoxide and Reductive Elimination of Triethylsilane from cis-mer-HM(SiEt3)(CO)3(PPh3).

DTIC Science & Technology

1983-05-21

JEOL FX9OQ Fourier transform or Bruker 250 or 270 MHz Fourier transform spectrometer. Irradiations. Photochemical reactions were carried out using a...Ph 3 ) 3nd -t-Etin V,- a 313 nm quantum yield of -0.6. The process is photochemically everse if the cis-mer-HM(SiPh 3 )(CO) 3 (PPh 3) is irradiated...process is photochemically reversed if the cis-mer-HM(SiPh 3 )(CO)3 (PPh 3 ) is irradiated in t.e presence of excess Et3SiH. Irradiation of cis-mer-HM

NCI Researchers Discover Exceptionally Potent Antibodies with Potential for Prophylaxis and Therapy of MERS-Coronavirus Infections | Poster

Cancer.gov

By Andrea Frydl, Contributing Writer In a recent article published in the Journal of Virology, Tianlei Ying, Ph.D., Dimiter Dimitrov, Ph.D., and their colleagues in the Laboratory of Experimental Immunology (LEI), Cancer and Inflammation Program, NCI Center for Cancer Research, reported the identification of three human monoclonal antibodies (m336, m337, and m338) that target the part of the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) that is responsible for binding to its receptor. These antibodies are exceptionally potent inhibitors of MERS-CoV infection and also provide a basis for creating a future MERS-CoV vaccine.

T-cell immunity of SARS-CoV: Implications for vaccine development against MERS-CoV.

PubMed

Liu, William J; Zhao, Min; Liu, Kefang; Xu, Kun; Wong, Gary; Tan, Wenjie; Gao, George F

2017-01-01

Over 12 years have elapsed since severe acute respiratory syndrome (SARS) triggered the first global alert for coronavirus infections. Virus transmission in humans was quickly halted by public health measures and human infections of SARS coronavirus (SARS-CoV) have not been observed since. However, other coronaviruses still pose a continuous threat to human health, as exemplified by the recent emergence of Middle East respiratory syndrome (MERS) in humans. The work on SARS-CoV widens our knowledge on the epidemiology, pathophysiology and immunology of coronaviruses and may shed light on MERS coronavirus (MERS-CoV). It has been confirmed that T-cell immunity plays an important role in recovery from SARS-CoV infection. Herein, we summarize T-cell immunological studies of SARS-CoV and discuss the potential cross-reactivity of the SARS-CoV-specific immunity against MERS-CoV, which may provide useful recommendations for the development of broad-spectrum vaccines against coronavirus infections. Copyright © 2016 Elsevier B.V. All rights reserved.

The effect of multiple external representations (MERs) worksheets toward complex system reasoning achievement

NASA Astrophysics Data System (ADS)

Sumarno; Ibrahim, M.; Supardi, Z. A. I.

2018-03-01

The application of a systems approach to assessing biological systems provides hope for a coherent understanding of cell dynamics patterns and their relationship to plant life. This action required the reasoning about complex systems. In other sides, there were a lot of researchers who provided the proof about the instructional successions. They involved the multiple external representations which improved the biological learning. The researcher conducted an investigation using one shoot case study design which involved 30 students in proving that the MERs worksheets could affect the student's achievement of reasoning about complex system. The data had been collected based on test of reasoning about complex system and student's identification result who worked through MERs. The result showed that only partially students could achieve reasoning about system complex, but their MERs skill could support their reasoning ability of complex system. This study could bring a new hope to develop the MERs worksheet as a tool to facilitate the reasoning about complex system.

Association between Australian Hajj Pilgrims' awareness of MERS-CoV, and their compliance with preventive measures and exposure to camels.

PubMed

Alqahtani, Amani S; Wiley, Kerrie E; Mushta, Sami M; Yamazaki, Kaoruko; BinDhim, Nasser F; Heywood, Anita E; Booy, Robert; Rashid, Harunor

2016-05-01

Through a prospective cohort study the relationship between travellers' awareness of MERS-CoV, and compliance with preventive measures and exposure to camels was evaluated among Australian Hajj pilgrims who attended Hajj in 2015. Only 28% of Australian Hajj pilgrims were aware of MERS-CoV in Saudi Arabia. Those who were aware of MERS-CoV were more likely to receive recommended vaccines [odds ratio (OR) 3.1, 95% confidence interval (CI): 1.5-5.9, P < 0.01], but there was no significant difference in avoiding camels or their raw products during Hajj between those who were aware of MERS-CoV and those who were not (OR 1.2, 95% CI: 0.3-5.2, P = 0.7). Hajj pilgrims' awareness is reflected in some of their practices but not in all. © International Society of Travel Medicine, 2016. All rights reserved. Published by Oxford University Press. For permissions, please e-mail: journals.permissions@oup.com.

Differential TAM receptor-ligand-phospholipid interactions delimit differential TAM bioactivities.

PubMed

Lew, Erin D; Oh, Jennifer; Burrola, Patrick G; Lax, Irit; Zagórska, Anna; Través, Paqui G; Schlessinger, Joseph; Lemke, Greg

2014-09-29

The TAM receptor tyrosine kinases Tyro3, Axl, and Mer regulate key features of cellular physiology, yet the differential activities of the TAM ligands Gas6 and Protein S are poorly understood. We have used biochemical and genetic analyses to delineate the rules for TAM receptor-ligand engagement and find that the TAMs segregate into two groups based on ligand specificity, regulation by phosphatidylserine, and function. Tyro3 and Mer are activated by both ligands but only Gas6 activates Axl. Optimal TAM signaling requires coincident TAM ligand engagement of both its receptor and the phospholipid phosphatidylserine (PtdSer): Gas6 lacking its PtdSer-binding 'Gla domain' is significantly weakened as a Tyro3/Mer agonist and is inert as an Axl agonist, even though it binds to Axl with wild-type affinity. In two settings of TAM-dependent homeostatic phagocytosis, Mer plays a predominant role while Axl is dispensable, and activation of Mer by Protein S is sufficient to drive phagocytosis.

KSC-03pd0536

NASA Image and Video Library

2003-02-24

KENNEDY SPACE CENTER, FLA. -- The cruise stage, aeroshell and lander for the Mars Exploration Rover-1 mission and the MER-2 rover arrive at KSC. The same flight hardware for the MER-2 rover arrived Jan. 27; however, the MER-2 rover is scheduled to arrive at KSC in March. While at KSC, each of the two rovers, the aeroshells and the landers will undergo a full mission simulation. All of these flight elements will then be integrated together. After spin balance testing, each spacecraft will be mated to a solid propellant upper stage booster that will propel the spacecraft out of Earth orbit. Approximately 10 days before launch they will be transported to the launch pad for mating with their respective Boeing Delta II rockets. The rovers will serve as robotic geologists to seek answers about the evolution of Mars, particularly for a history of water. The rovers will be identical to each other, but will land at different regions of Mars. Launch of the MER-1 is scheduled for May 30. MER-2 will follow June 25.

Feasibility of Using Convalescent Plasma Immunotherapy for MERS-CoV Infection, Saudi Arabia.

PubMed

Arabi, Yaseen M; Hajeer, Ali H; Luke, Thomas; Raviprakash, Kanakatte; Balkhy, Hanan; Johani, Sameera; Al-Dawood, Abdulaziz; Al-Qahtani, Saad; Al-Omari, Awad; Al-Hameed, Fahad; Hayden, Frederick G; Fowler, Robert; Bouchama, Abderrezak; Shindo, Nahoko; Al-Khairy, Khalid; Carson, Gail; Taha, Yusri; Sadat, Musharaf; Alahmadi, Mashail

2016-09-01

We explored the feasibility of collecting convalescent plasma for passive immunotherapy of Middle East respiratory syndrome coronavirus (MERS-CoV) infection by using ELISA to screen serum samples from 443 potential plasma donors: 196 patients with suspected or laboratory-confirmed MERS-CoV infection, 230 healthcare workers, and 17 household contacts exposed to MERS-CoV. ELISA-reactive samples were further tested by indirect fluorescent antibody and microneutralization assays. Of the 443 tested samples, 12 (2.7%) had a reactive ELISA result, and 9 of the 12 had reactive indirect fluorescent antibody and microneutralization assay titers. Undertaking clinical trials of convalescent plasma for passive immunotherapy of MERS-CoV infection may be feasible, but such trials would be challenging because of the small pool of potential donors with sufficiently high antibody titers. Alternative strategies to identify convalescent plasma donors with adequate antibody titers should be explored, including the sampling of serum from patients with more severe disease and sampling at earlier points during illness.

WATER ON MARS: EVIDENCE FROM MER MISSION RESULTS

NASA Technical Reports Server (NTRS)

Landis, Geoffrey A.

2006-01-01

The Mars Exploration Rover (MER) mission landed two rovers on Mars, equipped with a highly-capable suite of science instruments. The Spirit rover landed on the inside Gusev Crater on January 5, 2004, and the Opportunity rover three weeks later on Meridiani Planum. This paper summarizes some of the findings from the MER rovers related to the NASA science strategy of investigating past and present water on Mars.

Development of FIAT-Based Parametric Thermal Protection System Mass Estimating Relationships for NASA's Multi-Mission Earth Entry Concept

NASA Technical Reports Server (NTRS)

Sepka, Steven A.; Zarchi, Kerry; Maddock, Robert W.; Samareh, Jamshid A.

2013-01-01

Part of NASAs In-Space Propulsion Technology (ISPT) program is the development of the tradespace to support the design of a family of multi-mission Earth Entry Vehicles (MMEEV) to meet a wide range of mission requirements. An integrated tool called the Multi Mission System Analysis for Planetary Entry Descent and Landing or M-SAPE tool is being developed as part of Entry Vehicle Technology project under In-Space Technology program. The analysis and design of an Earth Entry Vehicle (EEV) is multidisciplinary in nature, requiring the application many disciplines. Part of M-SAPE's application required the development of parametric mass estimating relationships (MERs) to determine the vehicle's required Thermal Protection System (TPS) for safe Earth entry. For this analysis, the heat shield was assumed to be made of a constant thickness TPS. This resulting MERs will then e used to determine the pre-flight mass of the TPS. Two Mers have been developed for the vehicle forebaody. One MER was developed for PICA and the other consisting of Carbon Phenolic atop an Advanced Carbon-Carbon composition. For the the backshell, MERs have been developed for SIRCA, Acusil II, and LI-900. How these MERs were developed, the resulting equations, model limitations, and model accuracy are discussed in this poster.

Cell Surface Display of MerR on Saccharomyces cerevisiae for Biosorption of Mercury.

PubMed

Wei, Qinguo; Yan, Jiakuo; Chen, Yao; Zhang, Lei; Wu, Xiaoyang; Shang, Shuai; Ma, Shisheng; Xia, Tian; Xue, Shuyu; Zhang, Honghai

2018-01-01

The metalloregulatory protein MerR which plays important roles in mer operon system exhibits high affinity and selectivity toward mercury (II) (Hg 2+ ). In order to improve the adsorption ability of Saccharomyces cerevisiae for Hg 2+ , MerR was displayed on the surface of S. cerevisiae for the first time with an α-agglutinin-based display system in this study. The merR gene was synthesized after being optimized and added restriction endonuclease sites EcoR I and Mlu I. The display of MerR was indirectly confirmed by the enhanced adsorption ability of S. cerevisiae for Hg 2+ and colony PCR. The hydride generation atomic absorption spectrometry was applied to measure the Hg 2+ content in water. The engineered yeast strain not only showed higher tolerance to Hg, but also their adsorption ability was much higher than that of origin and control strains. The engineered yeast could adsorb Hg 2+ under a wide range of pH levels, and it could also adsorb Hg 2+ effectively with Cd 2+ and Cu 2+ coexistence. Furthermore, the engineered yeast strain could adsorb ultra-trace Hg 2+ effectively. The results above showed that the surface-engineered yeast strain could adsorb Hg 2+ under complex environmental conditions and could be used for the biosorption and bioremediation of environmental Hg contaminants.

Exploring Gusev Crater with Spirit: Review of science objectives and testable hypotheses

USGS Publications Warehouse

Cabrol, N.A.; Grin, E.A.; Carr, M.H.; Sutter, B.; Moore, Johnnie N.; Farmer, J.D.; Greeley, R.; Kuzmin, R.O.; DesMarais, D.J.; Kramer, M.G.; Newsom, H.; Barber, C.; Thorsos, I.; Tanaka, K.L.; Barlow, N.G.; Fike, D.A.; Urquhart, M.L.; Grigsby, B.; Grant, F.D.; de Goursac, O.

2003-01-01

Gusev Crater was selected as the landing site for the Mars Exploration Rover (MER) Spirit mission. Located at the outlet of Ma'adim Vallis and 250 km south of the volcano Apollinaris Patera, Gusev is an outstanding site to achieve the goals of the MER mission. The crater could have collected sediments from a variety of sources during its 3.9 Ga history, including fluvial, lacustrine, volcanic, glacial, impact, regional and local aeolian, and global air falls. It is a unique site to investigate the past history of water on Mars, climate and geological changes, and the potential habitability of the planet, which are central science objectives of the MER mission. Because of its complex history and potential diversity, Gusev will allow the testing of a large spectrum of hypotheses with the complete suite of MER instruments. Evidence consistent with long-lived lake episodes exist in the landing ellipse area. They might offer a unique opportunity to study, for the first time, Martian aqueous sediments and minerals formed in situ in their geological context. We review the geological history and diversity of the landing site, the science hypotheses that can be tested during the MER mission, and the relevance of Gusev to the MER mission objectives and payload. Copyright 2003 by the American Geophysical Union.

Reduction of soluble dipeptidyl peptidase 4 levels in plasma of patients infected with Middle East respiratory syndrome coronavirus.

PubMed

Inn, Kyung-Soo; Kim, Yuri; Aigerim, Abdimadiyeva; Park, Uni; Hwang, Eung-Soo; Choi, Myung-Sik; Kim, Yeon-Sook; Cho, Nam-Hyuk

2018-05-01

Dipeptidyl peptidase 4 (DPP4) is a receptor for MERS-CoV. The soluble form of DPP4 (sDPP4) circulates systematically and can competitively inhibit MERS-CoV entry into host cells. Here, we measured the concentration of sDPP4 in the plasma and sputa of 14 MERS-CoV-infected patients of various degrees of disease severity. The concentration of sDPP4 in the plasma of MERS patients (474.76 ± 108.06 ng/ml) was significantly lower than those of healthy controls (703.42 ± 169.96 ng/ml), but there were no significant differences among the patient groups. Interestingly, plasma levels of IL-10 and EGF were negatively and positively correlated with sDPP4 concentrations, respectively. The sDPP4 levels in sputa were less than 300 ng/ml. Viral infection was inhibited by 50% in the presence of more than 8000 ng/ml of sDPP4. Therefore, sDPP4 levels in the plasma of MERS patients are significantly reduced below the threshold needed to exert an antiviral effect against MERS-CoV infection. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

KMC 2: fast and resource-frugal k-mer counting.

PubMed

Deorowicz, Sebastian; Kokot, Marek; Grabowski, Szymon; Debudaj-Grabysz, Agnieszka

2015-05-15

Building the histogram of occurrences of every k-symbol long substring of nucleotide data is a standard step in many bioinformatics applications, known under the name of k-mer counting. Its applications include developing de Bruijn graph genome assemblers, fast multiple sequence alignment and repeat detection. The tremendous amounts of NGS data require fast algorithms for k-mer counting, preferably using moderate amounts of memory. We present a novel method for k-mer counting, on large datasets about twice faster than the strongest competitors (Jellyfish 2, KMC 1), using about 12 GB (or less) of RAM. Our disk-based method bears some resemblance to MSPKmerCounter, yet replacing the original minimizers with signatures (a carefully selected subset of all minimizers) and using (k, x)-mers allows to significantly reduce the I/O and a highly parallel overall architecture allows to achieve unprecedented processing speeds. For example, KMC 2 counts the 28-mers of a human reads collection with 44-fold coverage (106 GB of compressed size) in about 20 min, on a 6-core Intel i7 PC with an solid-state disk. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Chemical synthesis of a very long oligoribonucleotide with 2-cyanoethoxymethyl (CEM) as the 2′-O-protecting group: structural identification and biological activity of a synthetic 110mer precursor-microRNA candidate

PubMed Central

Shiba, Yoshinobu; Masuda, Hirofumi; Watanabe, Naoki; Ego, Takeshi; Takagaki, Kazuchika; Ishiyama, Kouichi; Ohgi, Tadaaki; Yano, Junichi

2007-01-01

A long RNA oligomer, a 110mer with the sequence of a precursor-microRNA candidate, has been chemically synthesized in a single synthesizer run by means of standard automated phosphoramidite chemistry. The synthetic method involved the use of 2-cyanoethoxymethyl (CEM), a 2′-hydroxyl protecting group recently developed in our laboratory. We improved the methodology, introducing better coupling and capping conditions. The overall isolated yield of highly pure 110mer was 5.5%. Such a yield on a 1-μmol scale corresponds to 1 mg of product and emphasizes the practicality of the CEM method for synthesizing oligomers of more than 100 nt in sufficient quantity for biological research. We confirmed the identity of the 110mer by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, as well as HPLC, electrophoretic methods, and RNase-digestion experiments. The 110mer also showed sense-selective specific gene-silencing activity. As far as we know, this is the longest chemically synthesized RNA oligomer reported to date. Furthermore, the identity of the 110mer was confirmed by both physicochemical and biological methods. PMID:17459888

The effect of substituted moiety on the optoelectronic and photophysical properties of tris (phenylbenzimidazolinato) Ir (III) carbene complexes and the OLED performance: a theoretical study

NASA Astrophysics Data System (ADS)

Srivastava, Ruby

2015-06-01

Density functional theory (DFT) and time-dependent density functional theory (TDDFT) are used to analyse theoretically the optoelectronic, photophysical properties and organic light-emitting diode performance of a series of fac-mer blue-emitting Iridium (III) carbene complexes. Swain-Lupton constant is used to discuss the substituents effect. 5d-orbital splitting and d-d* transitions are calculated to assess the efficiency of the studied complexes. The reorganisation energies (λ), transfer integrals, mobilities, radiative decay rate (kr), and triplet exciton generation fraction (χT) are also calculated. Due to the higher χT of these complexes, the formation of triplet exciton will be more and it will cause a faster intersystem crossing. Two host materials are proposed and host-guest match (Dexter-Förster energy) is also discussed. We hope that this unified work will surely help to design new blue-emitting phosphorescent materials in future.

Cross-sectional surveillance of Middle East respiratory syndrome coronavirus (MERS-CoV) in dromedary camels and other mammals in Egypt, August 2015 to January 2016

PubMed Central

Ali, Mohamed; El-Shesheny, Rabeh; Kandeil, Ahmed; Shehata, Mahmoud; Elsokary, Basma; Gomaa, Mokhtar; Hassan, Naglaa; El Sayed, Ahmed; El-Taweel, Ahmed; Sobhy, Heba; Oludayo, Fasina Folorunso; Dauphin, Gwenaelle; El Masry, Ihab; Wolde, Abebe Wossene; Daszak, Peter; Miller, Maureen; VonDobschuetz, Sophie; Gardner, Emma; Morzaria, Subhash; Lubroth, Juan; Makonnen, Yilma Jobre

2017-01-01

A cross-sectional study was conducted in Egypt to determine the prevalence of Middle East respiratory syndrome coronavirus (MERS-CoV) in imported and resident camels and bats, as well as to assess possible transmission of the virus to domestic ruminants and equines. A total of 1,031 sera, 1,078 nasal swabs, 13 rectal swabs, and 38 milk samples were collected from 1,078 camels in different types of sites. In addition, 145 domestic animals and 109 bats were sampled. Overall, of 1,031 serologically-tested camels, 871 (84.5%) had MERS-CoV neutralising antibodies. Seroprevalence was significantly higher in imported (614/692; 88.7%) than resident camels (257/339; 5.8%) (p < 0.05). Camels from Sudan (543/594; 91.4%) had a higher seroprevalence than those from East Africa (71/98; 72.4%) (p < 0.05). Sampling site and age were also associated with MERS-CoV seroprevalence (p < 0.05). All tested samples from domestic animals and bats were negative for MERS-CoV antibodies except one sheep sample which showed a 1:640 titre. Of 1,078 camels, 41 (3.8%) were positive for MERS-CoV genetic material. Sequences obtained were not found to cluster with clade A or B MERS-CoV sequences and were genetically diverse. The presence of neutralising antibodies in one sheep apparently in contact with seropositive camels calls for further studies on domestic animals in contact with camels. PMID:28333616

Active antitumor immunity elicited by vaccine based on recombinant form of epidermal growth factor receptor.

PubMed

Hu, Bing; Wei, Yuquan; Tian, Ling; Zhao, Xia; Lu, You; Wu, Yang; Yao, Bing; Liu, Jiyan; Niu, Ting; Wen, Yanjun; He, Qiuming; Su, Jingmei; Huang, Meijuan; Lou, Yanyan; Luo, Yan; Kan, Bing

2005-01-01

Active immunotherapy targeting epidermal growth factor receptor (EGFR) should be another attractive approach to the treatment of EGFR-positive tumors. To test this concept, the authors evaluated the potential immune responses and antitumor activities elicited by dendritic cells pulsed with recombinant ectodomain of mouse EGFR (DC-edMER). Spleen cells isolated from DC-edMER-vaccinated mice showed a high quantity of EGFR-specific antibody-producing cells. EGFR-reactive antibody in sera isolated from vaccinated mice was identified and shown to be effective against tumors in vitro and in vivo by adoptive transfer. DC-edMER vaccine also elicited cytotoxic T-lymphocyte responses that could mediate antitumor effects in vitro and adoptive transfer in vivo. In addition, EGFR-specific cytokines responses were elicited by DC-edMER vaccine. Immunization with DC-edMER resulted in tumor regression and prolonged survival in mice challenged with Lewis lung carcinomas and mammary cancer models. Depletion of CD4+ T lymphocytes could completely abrogate the antitumor activity and EGFR-specific antibody responses, whereas the depletion of CD8+ T lymphocytes showed partial abrogation of the antitumor activity but antibody was still detected. Furthermore, tumor-induced angiogenesis was suppressed in DC-edMER-vaccinated mice or mice treated with antibody adoptive transfer. Taken together, these findings suggest the antitumor immunity could be induced by DC-edMER, which may involve both humoral and cellular immunity, and may provide insight into the treatment of EGFR-positive tumors through the induction of active immunity against EGFR.

KENNEDY SPACE CENTER, FLA. - With a glimpse of the Atlantic Ocean over the horizon, the Delta II rocket with its Mars Exploration Rover (MER-A) payload leaps off the launch pad into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - With a glimpse of the Atlantic Ocean over the horizon, the Delta II rocket with its Mars Exploration Rover (MER-A) payload leaps off the launch pad into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25

KENNEDY SPACE CENTER, FLA. - With a glimpse of the Atlantic Ocean over the horizon, the Delta II rocket with its Mars Exploration Rover (MER-A) payload leaps off the launch pad into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - With a glimpse of the Atlantic Ocean over the horizon, the Delta II rocket with its Mars Exploration Rover (MER-A) payload leaps off the launch pad into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

Protection of rat liver against hepatic ischemia-reperfusion injury by a novel selenocysteine-containing 7-mer peptide

PubMed Central

Jiang, Qianqian; Pan, Yu; Cheng, Yupeng; Li, Huiling; Li, Hui

2016-01-01

Hepatic ischemia-reperfusion (I-R) injury causes acute organ damage or dysfunction, and remains a problem for liver transplantation. In the I-R phase, the generation of reactive oxygen species aggravates the injury. In the current study, a novel selenocysteine-containing 7-mer peptide (H-Arg-Sec-Gly-Arg-Asn-Ala-Gln-OH) was constructed to imitate the active site of an antioxidant enzyme, glutathione peroxidase (GPX). The 7-mer peptide which has a lower molecular weight, and improved water-solubility, higher stability and improved cell membrane permeability compared with other GPX mimics. Its GPX activity reached 13 U/µmol, which was 13 times that of ebselen (a representative GPX mimic). The effect of this GPX mimic on I-R injury of the liver was assessed in rats. The 7-mer peptide significantly inhibited the increase in serum hepatic amino-transferases, tissue malondialdehyde, nitric oxide contents, myeloperoxidase activity and decrease of GPX activity compared with I-R tissue. Following treatment with the 7-mer peptide, the expression of B-cell CLL/lymphoma-2 (Bcl-2) was significantly upregulated at the mRNA and protein level compared with the I-R group, as determined by reverse transcription-polymerase chain reaction and immunohistochemistry, respectively. By contrast, Bcl-2 associated X protein (Bax) was downregulated by the 7-mer peptide compared the I-R group. Histological and ultrastructural changes of the rat liver tissue were also compared among the experimental groups. The results of the current study suggest that the 7-mer peptide protected the liver against hepatic I-R injury via suppression of oxygen-derived free radicals and regulation of Bcl-2 and Bax expression, which are involved in the apoptosis of liver cells. The findings of the present study will further the investigation of the 7-mer peptide as an effective therapeutic agent in hepatic I-R injury. PMID:27431272

Chromatin accessibility prediction via convolutional long short-term memory networks with k-mer embedding.

PubMed

Min, Xu; Zeng, Wanwen; Chen, Ning; Chen, Ting; Jiang, Rui

2017-07-15

Experimental techniques for measuring chromatin accessibility are expensive and time consuming, appealing for the development of computational approaches to predict open chromatin regions from DNA sequences. Along this direction, existing methods fall into two classes: one based on handcrafted k -mer features and the other based on convolutional neural networks. Although both categories have shown good performance in specific applications thus far, there still lacks a comprehensive framework to integrate useful k -mer co-occurrence information with recent advances in deep learning. We fill this gap by addressing the problem of chromatin accessibility prediction with a convolutional Long Short-Term Memory (LSTM) network with k -mer embedding. We first split DNA sequences into k -mers and pre-train k -mer embedding vectors based on the co-occurrence matrix of k -mers by using an unsupervised representation learning approach. We then construct a supervised deep learning architecture comprised of an embedding layer, three convolutional layers and a Bidirectional LSTM (BLSTM) layer for feature learning and classification. We demonstrate that our method gains high-quality fixed-length features from variable-length sequences and consistently outperforms baseline methods. We show that k -mer embedding can effectively enhance model performance by exploring different embedding strategies. We also prove the efficacy of both the convolution and the BLSTM layers by comparing two variations of the network architecture. We confirm the robustness of our model to hyper-parameters by performing sensitivity analysis. We hope our method can eventually reinforce our understanding of employing deep learning in genomic studies and shed light on research regarding mechanisms of chromatin accessibility. The source code can be downloaded from https://github.com/minxueric/ismb2017_lstm . tingchen@tsinghua.edu.cn or ruijiang@tsinghua.edu.cn. Supplementary materials are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Chromatin accessibility prediction via convolutional long short-term memory networks with k-mer embedding

PubMed Central

Min, Xu; Zeng, Wanwen; Chen, Ning; Chen, Ting; Jiang, Rui

2017-01-01

Abstract Motivation: Experimental techniques for measuring chromatin accessibility are expensive and time consuming, appealing for the development of computational approaches to predict open chromatin regions from DNA sequences. Along this direction, existing methods fall into two classes: one based on handcrafted k-mer features and the other based on convolutional neural networks. Although both categories have shown good performance in specific applications thus far, there still lacks a comprehensive framework to integrate useful k-mer co-occurrence information with recent advances in deep learning. Results: We fill this gap by addressing the problem of chromatin accessibility prediction with a convolutional Long Short-Term Memory (LSTM) network with k-mer embedding. We first split DNA sequences into k-mers and pre-train k-mer embedding vectors based on the co-occurrence matrix of k-mers by using an unsupervised representation learning approach. We then construct a supervised deep learning architecture comprised of an embedding layer, three convolutional layers and a Bidirectional LSTM (BLSTM) layer for feature learning and classification. We demonstrate that our method gains high-quality fixed-length features from variable-length sequences and consistently outperforms baseline methods. We show that k-mer embedding can effectively enhance model performance by exploring different embedding strategies. We also prove the efficacy of both the convolution and the BLSTM layers by comparing two variations of the network architecture. We confirm the robustness of our model to hyper-parameters by performing sensitivity analysis. We hope our method can eventually reinforce our understanding of employing deep learning in genomic studies and shed light on research regarding mechanisms of chromatin accessibility. Availability and implementation: The source code can be downloaded from https://github.com/minxueric/ismb2017_lstm. Contact: tingchen@tsinghua.edu.cn or ruijiang@tsinghua.edu.cn Supplementary information: Supplementary materials are available at Bioinformatics online. PMID:28881969

One-Pot Reverse Transcriptional Loop-Mediated Isothermal Amplification (RT-LAMP) for Detecting MERS-CoV

PubMed Central

Lee, Se Hee; Baek, Yun Hee; Kim, Yang-Hoon; Choi, Young-Ki; Song, Min-Suk; Ahn, Ji-Young

2017-01-01

Due to the limitation of rapid development of specific antiviral drug or vaccine for novel emerging viruses, an accurate and rapid diagnosis is a key to manage the virus spread. We developed an efficient and rapid method with high specificity for the Middle East Respiratory Syndrome coronavirus (MERS-CoV), based on one-pot reverse transcription loop-mediated isothermal amplification (one-pot RT-LAMP). A set of six LAMP primers [F3, B3, FIP, BIP, LF (Loop-F), and LB (Loop-B)] were designed using the sequence of nucleocapsid (N) gene with optimized RT-LAMP enzyme conditions: 100 U M-MLV RTase and 4 U Bst polymerase, implying that the reaction was able to detect four infectious viral genome copies of MERS-CoV within a 60 min reaction time period. Significantly, EvaGreen dye has better signal read-out properties in one-pot RT-LAMP reaction and is more compatible with DNA polymerase than SYBR green I. Isothermally amplified specific N genes were further evaluated using field-deployable microchamber devices, leading to the specific identification of as few as 0.4 infectious viral genome copies, with no cross-reaction to the other acute respiratory disease viruses, including influenza type A (H1N1 and H3N2), type B, human coronavirus 229E, and human metapneumovirus. This sensitive, specific and feasible method provides a large-scale technical support in emergencies, and is also applied as a sample-to-detection module in Point of Care Testing devices. PMID:28119682

Knowledge and awareness of Middle East respiratory syndrome coronavirus among Saudi and Non-Saudi Arabian pilgrims

PubMed Central

Althobaity, Hosam M.; Alharthi, Raed A. S.; Altowairqi, Mohammed H.; Alsufyani, Ziyad A.; Aloufi, Nahar S.; Altowairqi, Abdulrahman E.; Alqahtani, Abdulrahman S.; Alzahrani, Ali K.; Abdel-Moneim, Ahmed S.

2017-01-01

Objective: The current study was intended to evaluate the knowledge and awareness toward Middle East respiratory syndrome coronavirus (MERS-CoV) of pilgrims from Saudi Arabia and from different Arabian countries. Methods: A prospective study was conducted among pilgrims from Saudi Arabia and those from other Arab nations. A total number of 2120 participants including 736 Saudi pilgrims (436 males and 300 females) and 1384 non-Saudi Arabian pilgrims (1384; 909 males and 475 females) were included in the study. The responses of the participants were descriptively analyzed. Pearson correlation coefficient was used to screen the possible correlations among different variables. The differences in the responses between the two groups were evaluated using Mann–Whitney analysis. Results: The responses of the Saudi pilgrims showed statistically significant results in comparison to non-Saudi pilgrims in answering all questions except those related to the presence of efficient vaccination or treatment and the source of information. It was clear that the Saudi pilgrims were more oriented about different aspects of MERS-CoV including the nature of the causative agent, the signs, the severity of the disease, the animals that can transmit the infection to humans, the risk groups, and when one need to be screened for infection. In both Saudi and non-Saudi pilgrims, the official websites of health organizations constitute the main source of their information. Conclusion: It was concluded that Saudi pilgrims possess good knowledge about the MERS-CoV although more orientation is still required. PMID:29114190

Memory-Efficient Onboard Rock Segmentation

NASA Technical Reports Server (NTRS)

Burl, Michael C.; Thompson, David R.; Bornstein, Benjamin J.; deGranville, Charles K.

2013-01-01

Rockster-MER is an autonomous perception capability that was uploaded to the Mars Exploration Rover Opportunity in December 2009. This software provides the vision front end for a larger software system known as AEGIS (Autonomous Exploration for Gathering Increased Science), which was recently named 2011 NASA Software of the Year. As the first step in AEGIS, Rockster-MER analyzes an image captured by the rover, and detects and automatically identifies the boundary contours of rocks and regions of outcrop present in the scene. This initial segmentation step reduces the data volume from millions of pixels into hundreds (or fewer) of rock contours. Subsequent stages of AEGIS then prioritize the best rocks according to scientist- defined preferences and take high-resolution, follow-up observations. Rockster-MER has performed robustly from the outset on the Mars surface under challenging conditions. Rockster-MER is a specially adapted, embedded version of the original Rockster algorithm ("Rock Segmentation Through Edge Regrouping," (NPO- 44417) Software Tech Briefs, September 2008, p. 25). Although the new version performs the same basic task as the original code, the software has been (1) significantly upgraded to overcome the severe onboard re source limitations (CPU, memory, power, time) and (2) "bulletproofed" through code reviews and extensive testing and profiling to avoid the occurrence of faults. Because of the limited computational power of the RAD6000 flight processor on Opportunity (roughly two orders of magnitude slower than a modern workstation), the algorithm was heavily tuned to improve its speed. Several functional elements of the original algorithm were removed as a result of an extensive cost/benefit analysis conducted on a large set of archived rover images. The algorithm was also required to operate below a stringent 4MB high-water memory ceiling; hence, numerous tricks and strategies were introduced to reduce the memory footprint. Local filtering operations were re-coded to operate on horizontal data stripes across the image. Data types were reduced to smaller sizes where possible. Binary- valued intermediate results were squeezed into a more compact, one-bit-per-pixel representation through bit packing and bit manipulation macros. An estimated 16-fold reduction in memory footprint relative to the original Rockster algorithm was achieved. The resulting memory footprint is less than four times the base image size. Also, memory allocation calls were modified to draw from a static pool and consolidated to reduce memory management overhead and fragmentation. Rockster-MER has now been run onboard Opportunity numerous times as part of AEGIS with exceptional performance. Sample results are available on the AEGIS website at http://aegis.jpl.nasa.gov.

Trust or robustness? An ecological approach to the study of auction and bilateral markets.

PubMed

Hernández, Laura; Vignes, Annick; Saba, Stéphanie

2018-01-01

Centralized markets are often considered more efficient than bilateral exchanges because information is public and the same for all the agents. On decentralized markets, where the information is private, the influence of trust on the market outcome has been underlined by many authors. We present an empirical study of the distinctive Boulogne-sur-Mer Fish Market (where both buyers and sellers can choose to trade by either bidding or bargaining), focused on the interactions between agents. Our approach is inspired by studies of mutualistic ecosystems, where the agents are of two different types (as in plant-pollinator networks) and the interactions only take place between agents of different kinds, naturally providing benefits to both. In our context, where the two kinds of agents are buyers and sellers, our study shows that not only do their interactions bring economic benefits for the agents directly involved, but they also contribute to the stability of the market. Our results help to explain the surprising coexistence of the two forms of market in the distinctive Boulogne sur Mer Fish Market.

Trust or robustness? An ecological approach to the study of auction and bilateral markets

PubMed Central

Vignes, Annick; Saba, Stéphanie

2018-01-01

Centralized markets are often considered more efficient than bilateral exchanges because information is public and the same for all the agents. On decentralized markets, where the information is private, the influence of trust on the market outcome has been underlined by many authors. We present an empirical study of the distinctive Boulogne-sur-Mer Fish Market (where both buyers and sellers can choose to trade by either bidding or bargaining), focused on the interactions between agents. Our approach is inspired by studies of mutualistic ecosystems, where the agents are of two different types (as in plant-pollinator networks) and the interactions only take place between agents of different kinds, naturally providing benefits to both. In our context, where the two kinds of agents are buyers and sellers, our study shows that not only do their interactions bring economic benefits for the agents directly involved, but they also contribute to the stability of the market. Our results help to explain the surprising coexistence of the two forms of market in the distinctive Boulogne sur Mer Fish Market. PMID:29734331

Development of bisphenol A-removing recombinant Escherichia coli by monomeric and dimeric surface display of bisphenol A-binding peptide.

PubMed

Maruthamuthu, Murali Kannan; Hong, Jiyeon; Arulsamy, Kulandaisamy; Somasundaram, Sivachandiran; Hong, SoonHo; Choe, Woo-Seok; Yoo, Ik-Keun

2018-04-01

Peptide-displaying Escherichia coli cells were investigated for use in adsorptive removal of bisphenol A (BPA) both in Luria-Bertani medium including BPA or ATM thermal paper eluted wastewater. Two recombinant strains were constructed with monomeric and dimeric repeats of the 7-mer BPA-binding peptide (KSLENSY), respectively. Greater than threefold increased adsorption of BPA [230.4 µmol BPA per g dry cell weight (DCW)] was found in dimeric peptide-displaying cells compared to monomeric strains (63.4 µmol per g DCW) in 15 ppm BPA solution. The selective removal of BPA from a mixture of BPA analogs (bisphenol F and bisphenol S) was verified in both monomeric and dimeric peptide-displaying cells. The binding chemistry of BPA with the peptide was assumed, based on molecular docking analysis, to be the interaction of BPA with serine and asparagine residues within the 7-mer peptide sequence. The peptide-displaying cells also functioned efficiently in thermal paper eluted wastewater containing 14.5 ppm BPA.

MIMOS II on MER One Year of Mossbauer Spectroscopy on the Surface of Mars: From Jarosite at Meridiani Planum to Goethite at Gusev Crater

NASA Technical Reports Server (NTRS)

Klingelhoefer, G.; Rodionov, D. S.; Morris, R. V.; Schroeder, C.; deSouza, P. A.; Ming, D. W.; Yen, A. S.; Bernhardt, B.; Renz, F.; Fleischer, I.

2005-01-01

The miniaturized Mossbauer (MB) spectrometer MIMOS II [1] is part of the Athena payload of NASA s twin Mars Exploration Rovers "Spirit" (MER-A) and "Opportunity" (MER-B). It determines the Fe-bearing mineralogy of Martian soils and rocks at the Rovers respective landing sites, Gusev crater and Meridiani Planum. Both spectrometers performed successfully during first year of operation. Total integration time is about 49 days for MERA (79 samples) and 34 days for MER-B (85 samples). For curiosity it might be interesting to mention that the total odometry of the oscillating part of the MB drive exceeds 35 km for both rovers.

MERS-CoV at the Animal–Human Interface: Inputs on Exposure Pathways from an Expert-Opinion Elicitation

PubMed Central

Funk, Anna L.; Goutard, Flavie Luce; Miguel, Eve; Bourgarel, Mathieu; Chevalier, Veronique; Faye, Bernard; Peiris, J. S. Malik; Van Kerkhove, Maria D.; Roger, Francois Louis

2016-01-01

Nearly 4 years after the first report of the emergence of Middle-East respiratory syndrome Coronavirus (MERS-CoV) and nearly 1800 human cases later, the ecology of MERS-CoV, its epidemiology, and more than risk factors of MERS-CoV transmission between camels are poorly understood. Knowledge about the pathways and mechanisms of transmission from animals to humans is limited; as of yet, transmission risks have not been quantified. Moreover the divergent sanitary situations and exposures to animals among populations in the Arabian Peninsula, where human primary cases appear to dominate, vs. other regions in the Middle East and Africa, with no reported human clinical cases and where the virus has been detected only in dromedaries, represents huge scientific and health challenges. Here, we have used expert-opinion elicitation in order to obtain ideas on relative importance of MERS-CoV risk factors and estimates of transmission risks from various types of contact between humans and dromedaries. Fourteen experts with diverse and extensive experience in MERS-CoV relevant fields were enrolled and completed an online questionnaire that examined pathways based on several scenarios, e.g., camels–camels, camels–human, bats/other species to camels/humans, and the role of diverse biological substances (milk, urine, etc.) and potential fomites. Experts believed that dromedary camels play the largest role in MERS-CoV infection of other dromedaries; however, they also indicated a significant influence of the season (i.e. calving or weaning periods) on transmission risk. All experts thought that MERS-CoV-infected dromedaries and asymptomatic humans play the most important role in infection of humans, with bats and other species presenting a possible, but yet undefined, risk. Direct and indirect contact of humans with dromedary camels were identified as the most risky types of contact, when compared to consumption of various camel products, with estimated “most likely” incidence risks of at least 22 and 13% for direct and indirect contact, respectively. The results of our study are consistent with available, yet very limited, published data regarding the potential pathways of transmission of MERS-CoV at the animal–human interface. These results identify key knowledge gaps and highlight the need for more comprehensive, yet focused research to be conducted to better understand transmission between dromedaries and humans. PMID:27761437

Reaction mechanism of CO oxidation on Cu2O(111): A density functional study

NASA Astrophysics Data System (ADS)

Sun, Bao-Zhen; Chen, Wen-Kai; Xu, Yi-Jun

2010-10-01

The possible reaction mechanisms for CO oxidation on the perfect Cu2O(111) surface have been investigated by performing periodic density functional theoretical calculations. We find that Cu2O(111) is able to facilitate the CO oxidation with different mechanisms. Four possible mechanisms are explored (denoted as MER1, MER2, MLH1, and MLH2, respectively): MER1 is CO(gas)+O2(ads)-->CO2(gas) MER2 is CO(gas)+O2(ads)-->CO3(ads)-->O(ads)+CO2(gas) MLH1 refers to CO(ads)+O2(ads)-->O(ads)+CO2(ads) and MLH2 refers to CO(ads)+O2(ads)-->OOCO(ads)-->O(ads)+CO2(ads). Our transition state calculations clearly reveal that MER1 and MLH2 are both viable; but MER1 mechanism preferentially operates, in which only a moderate energy barrier (60.22 kJ/mol) needs to be overcome. When CO oxidation takes place along MER2 path, it is facile for CO3 formation, but is difficult for its decomposition, thereby CO3 species can stably exist on Cu2O(111). Of course, the reaction of CO with lattice O of Cu2O(111) is also considered. However, the calculated barrier is 600.00 kJ/mol, which is too large to make the path feasible. So, we believe that on Cu2O(111), CO reacts with adsorbed O, rather than lattice O, to form CO2. This is different from the usual Mars-van Krevene mechanism. The present results enrich our understanding of the catalytic oxidation of CO by copper-based and metal-oxide catalysts.

Value, Market Preferences and Trade of Beche-De-Mer from Pacific Island Sea Cucumbers

PubMed Central

Purcell, Steven W.

2014-01-01

Market preferences of natural resources contribute to shape their exploitation and production. Beche-de-mer, the product after gutting, cooking, salting and drying sea cucumbers, is exported worldwide to Asian dried seafood markets. A better understanding of the trade, value and market preferences of Pacific island beche-de-mer could identify critical postharvest processing techniques and management strategies for fisheries and aquaculture. Data were collected on export prices and trade of beche-de-mer from Kiribati, Fiji, Tonga and New Caledonia, and the selling prices, respective sizes and organoleptic properties of the products in stores in China. Export prices varied considerably within and among the four countries and low-value species were the most exported by volume. Most of the beche-de-mer from the four Pacific islands is exported to Hong Kong, where quality products are sold and others are distributed to mainland China. Prices of the beche-de-mer in Chinese stores varied up to ten-fold and were mostly influenced by species, body size and, to a lesser extent, physical damage to the products. Market prices across species (averaging US$15–385 kg−1) appear to have mostly increased six- to twelve-fold over the past decade. The data allude that fisheries for Holothuria scabra, H. lessoni, H. fuscogilva, H. whitmaei and Thelenota ananas should be most carefully managed because they were the highest-value species and under greatest demand. The relationships between size of beche-de-mer and sale price were species specific and highly varied. This study also highlights the need for better regulations and/or enforcement of minimum size limits in sea cucumber fisheries, which can help to maximise economic benefits of wild stocks. PMID:24736374

Value, market preferences and trade of Beche-de-mer from Pacific Island sea cucumbers.

PubMed

Purcell, Steven W

2014-01-01

Market preferences of natural resources contribute to shape their exploitation and production. Beche-de-mer, the product after gutting, cooking, salting and drying sea cucumbers, is exported worldwide to Asian dried seafood markets. A better understanding of the trade, value and market preferences of Pacific island beche-de-mer could identify critical postharvest processing techniques and management strategies for fisheries and aquaculture. Data were collected on export prices and trade of beche-de-mer from Kiribati, Fiji, Tonga and New Caledonia, and the selling prices, respective sizes and organoleptic properties of the products in stores in China. Export prices varied considerably within and among the four countries and low-value species were the most exported by volume. Most of the beche-de-mer from the four Pacific islands is exported to Hong Kong, where quality products are sold and others are distributed to mainland China. Prices of the beche-de-mer in Chinese stores varied up to ten-fold and were mostly influenced by species, body size and, to a lesser extent, physical damage to the products. Market prices across species (averaging US$15-385 kg-1) appear to have mostly increased six- to twelve-fold over the past decade. The data allude that fisheries for Holothuria scabra, H. lessoni, H. fuscogilva, H. whitmaei and Thelenota ananas should be most carefully managed because they were the highest-value species and under greatest demand. The relationships between size of beche-de-mer and sale price were species specific and highly varied. This study also highlights the need for better regulations and/or enforcement of minimum size limits in sea cucumber fisheries, which can help to maximise economic benefits of wild stocks.

Factors Influencing Emergency Nurses' Burnout During an Outbreak of Middle East Respiratory Syndrome Coronavirus in Korea.

PubMed

Kim, Ji Soo; Choi, Jeong Sil

2016-12-01

Emergency department (ED) nurses suffer from persistent stress after experiencing the traumatic event of exposure to Middle East respiratory syndrome coronavirus (MERS-CoV), which can subsequently lead to burnout. This study aimed to assess ED nurses' burnout level during an outbreak of MERS-CoV and to identify influencing factors in order to provide basic information for lowering and preventing the level of burnout. Study participants were ED nurses working in eight hospitals designated for treating MERS-CoV-infected patients in Korea. We performed multiple regression analysis to explore the factors influencing burnout. The ED nurses' burnout was affected by job stress (β=0.59, p<.001), poor hospital resources for the treatment of MERS-CoV (β = -0.19, p<.001) and poor support from family and friends (β = -0.14, p<.05). These three variables explained 47.3% of the variance in burnout. ED nurses taking care of MERS-CoV-infected patients should be aware that burnout is higher for nurses in their divisions than nurses in other hospital departments and that job stress is the biggest influential factor of burnout. To be ready for the outbreak of emerging contagious diseases such as MERS-CoV, efforts and preparations should be made to reduce burnout. Job stress should be managed and resolved. Working conditions for mitigating job stress and systematic stress management programs should be provided, and hospital resources for the treatment of MERS-CoV need to be reinforced. Moreover, promoting support from family and friends is required. Copyright © 2016. Published by Elsevier B.V.

Comparative study of microelectrode recording-based STN location and MRI-based STN location in low to ultra-high field (7.0 T) T2-weighted MRI images

NASA Astrophysics Data System (ADS)

Verhagen, Rens; Schuurman, P. Richard; van den Munckhof, Pepijn; Fiorella Contarino, M.; de Bie, Rob M. A.; Bour, Lo J.

2016-12-01

Objective. The correspondence between the anatomical STN and the STN observed in T2-weighted MRI images used for deep brain stimulation (DBS) targeting remains unclear. Using a new method, we compared the STN borders seen on MRI images with those estimated by intraoperative microelectrode recordings (MER). Approach. We developed a method to automatically generate a detailed estimation of STN shape and the location of its borders, based on multiple-channel MER measurements. In 33 STNs of 19 Parkinson patients, we quantitatively compared the dorsal and lateral borders of this MER-based STN model with the STN borders visualized by 1.5 T (n = 14), 3.0 T (n = 10) and 7.0 T (n = 9) T2-weighted MRI. Main results. The dorsal border was identified more dorsally on coronal T2 MRI than by the MER-based STN model, with a significant difference in the 3.0 T (range 0.97-1.19 mm) and 7.0 T (range 1.23-1.25 mm) groups. The lateral border was significantly more medial on 1.5 T (mean: 1.97 mm) and 3.0 T (mean: 2.49 mm) MRI than in the MER-based STN; a difference that was not found in the 7.0 T group. Significance. The STN extends further in the dorsal direction on coronal T2 MRI images than is measured by MER. Increasing MRI field strength to 3.0 T or 7.0 T yields similar discrepancies between MER and MRI at the dorsal STN border. In contrast, increasing MRI field strength to 7.0 T may be useful for identification of the lateral STN border and thereby improve DBS targeting.

Healthcare Workers Emotions, Perceived Stressors and Coping Strategies During a MERS-CoV Outbreak.

PubMed

Khalid, Imran; Khalid, Tabindeh J; Qabajah, Mohammed R; Barnard, Aletta G; Qushmaq, Ismael A

2016-03-01

Healthcare workers (HCWs) are at high risk of contracting Middle East respiratory syndrome coronavirus (MERS-CoV) during an epidemic. We explored the emotions, perceived stressors, and coping strategies of healthcare workers who worked during a MERS-CoV outbreak in our hospital. A cross-sectional descriptive survey design. A tertiary care hospital. HCWs (150) who worked in high risk areas during the April-May 2014 MERS-CoV outbreak that occurred in Jeddah, Saudi Arabia. We developed and administered a "MERS-CoV staff questionnaire" to study participants. The questionnaire consisted of 5 sections with 72 questions. The sections evaluated hospital staffs emotions, perceived stressors, factors that reduced their stress, coping strategies, and motivators to work during future outbreaks. Responses were scored on a scale from 0-3. The varying levels of stress or effectiveness of measures were reported as mean and standard deviation, as appropriate. Completed questionnaires were returned by 117 (78%) of the participants. The results had many unique elements. HCWs ethical obligation to their profession pushed them to continue with their jobs. The main sentiments centered upon fear of personal safety and well-being of colleagues and family. Positive attitudes in the workplace, clinical improvement of infected colleagues, and stoppage of disease transmission among HCWs after adopting strict protective measures alleviated their fear and drove them through the epidemic. They appreciated recognition of their efforts by hospital management and expected similar acknowledgment, infection control guidance, and equipment would entice them to work during future epidemics. The MERS-CoV outbreak was a distressing time for our staff. Hospitals can enhance HCWs experiences during any future MERS-CoV outbreak by focusing on the above mentioned aspects. © 2016 Marshfield Clinic.

Enhanced inflammation in New Zealand white rabbits when MERS-CoV reinfection occurs in the absence of neutralizing antibody

PubMed Central

Houser, Katherine V.; Gretebeck, Lisa; Vogel, Leatrice; Sutton, Troy; Orandle, Marlene; Moore, Ian N.

2017-01-01

The Middle East respiratory syndrome coronavirus (MERS-CoV) is a zoonotic betacoronavirus that was first detected in humans in 2012 as a cause of severe acute respiratory disease. As of July 28, 2017, there have been 2,040 confirmed cases with 712 reported deaths. While many infections have been fatal, there have also been a large number of mild or asymptomatic cases discovered through monitoring and contact tracing. New Zealand white rabbits are a possible model for asymptomatic infection with MERS-CoV. In order to discover more about non-lethal infections and to learn whether a single infection with MERS-CoV would protect against reinfection, we inoculated rabbits with MERS-CoV and monitored the antibody and inflammatory response. Following intranasal infection, rabbits developed a transient dose-dependent pulmonary infection with moderately high levels of viral RNA, viral antigen, and perivascular inflammation in multiple lung lobes that was not associated with clinical signs. The rabbits developed antibodies against viral proteins that lacked neutralizing activity and the animals were not protected from reinfection. In fact, reinfection resulted in enhanced pulmonary inflammation, without an associated increase in viral RNA titers. Interestingly, passive transfer of serum from previously infected rabbits to naïve rabbits was associated with enhanced inflammation upon infection. We further found this inflammation was accompanied by increased recruitment of complement proteins compared to primary infection. However, reinfection elicited neutralizing antibodies that protected rabbits from subsequent viral challenge. Our data from the rabbit model suggests that people exposed to MERS-CoV who fail to develop a neutralizing antibody response, or persons whose neutralizing antibody titers have waned, may be at risk for severe lung disease on re-exposure to MERS-CoV. PMID:28817732

Antiviral Potential of ERK/MAPK and PI3K/AKT/mTOR Signaling Modulation for Middle East Respiratory Syndrome Coronavirus Infection as Identified by Temporal Kinome Analysis

PubMed Central

Ork, Britini; Hart, Brit J.; Holbrook, Michael R.; Frieman, Matthew B.; Traynor, Dawn; Johnson, Reed F.; Dyall, Julie; Olinger, Gene G.; Hensley, Lisa E.

2014-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) is a lineage C betacoronavirus, and infections with this virus can result in acute respiratory syndrome with renal failure. Globally, MERS-CoV has been responsible for 877 laboratory-confirmed infections, including 317 deaths, since September 2012. As there is a paucity of information regarding the molecular pathogenesis associated with this virus or the identities of novel antiviral drug targets, we performed temporal kinome analysis on human hepatocytes infected with the Erasmus isolate of MERS-CoV with peptide kinome arrays. bioinformatics analysis of our kinome data, including pathway overrepresentation analysis (ORA) and functional network analysis, suggested that extracellular signal-regulated kinase (ERK)/mitogen-activated protein kinase (MAPK) and phosphoinositol 3-kinase (PI3K)/serine-threonine kinase (AKT)/mammalian target of rapamycin (mTOR) signaling responses were specifically modulated in response to MERS-CoV infection in vitro throughout the course of infection. The overrepresentation of specific intermediates within these pathways determined by pathway and functional network analysis of our kinome data correlated with similar patterns of phosphorylation determined through Western blot array analysis. In addition, analysis of the effects of specific kinase inhibitors on MERS-CoV infection in tissue culture models confirmed these cellular response observations. Further, we have demonstrated that a subset of licensed kinase inhibitors targeting the ERK/MAPK and PI3K/AKT/mTOR pathways significantly inhibited MERS-CoV replication in vitro whether they were added before or after viral infection. Taken together, our data suggest that ERK/MAPK and PI3K/AKT/mTOR signaling responses play important roles in MERS-CoV infection and may represent novel drug targets for therapeutic intervention strategies. PMID:25487801

MERS-CoV Accessory ORFs Play Key Role for Infection and Pathogenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Menachery, Vineet D.; Mitchell, Hugh D.; Cockrell, Adam S.

ABSTRACT While dispensable for viral replication, coronavirus (CoV) accessory open reading frame (ORF) proteins often play critical roles during infection and pathogenesis. Utilizing a previously generated mutant, we demonstrate that the absence of all four Middle East respiratory syndrome CoV (MERS-CoV) accessory ORFs (deletion of ORF3, -4a, -4b, and -5 [dORF3-5]) has major implications for viral replication and pathogenesis. Importantly, attenuation of the dORF3-5 mutant is primarily driven by dysregulated host responses, including disrupted cell processes, augmented interferon (IFN) pathway activation, and robust inflammation.In vitroreplication attenuation also extends toin vivomodels, allowing use of dORF3-5 as a live attenuated vaccine platform.more » Finally, examination of ORF5 implicates a partial role in modulation of NF-κB-mediated inflammation. Together, the results demonstrate the importance of MERS-CoV accessory ORFs for pathogenesis and highlight them as potential targets for surveillance and therapeutic treatments moving forward. IMPORTANCEThe initial emergence and periodic outbreaks of MERS-CoV highlight a continuing threat posed by zoonotic pathogens to global public health. In these studies, mutant virus generation demonstrates the necessity of accessory ORFs in regard to MERS-CoV infection and pathogenesis. With this in mind, accessory ORF functions can be targeted for both therapeutic and vaccine treatments in response to MERS-CoV and related group 2C coronaviruses. In addition, disruption of accessory ORFs in parallel may offer a rapid response platform to attenuation of future emergent strains based on both SARS- and MERS-CoV accessory ORF mutants.« less

Money Laundering in China: Why PACOM Should Place High Priority on this Issue

DTIC Science & Technology

2012-10-06

Financial Action Task Force ( FATF ), a multi-national organization responsible for anti-money laundering (AML) regulation and enforcement standards...29, 2007, 7. www.fatf- gafi.org/media/ fatf /documents/reports/mer/MER%20China%20full.pdf Accessed on 12Sep12. 14 George W. Russell, “Dirty Money...Evaluation, 8 th Follow-up Report, Financial Action Task Force, February 17, 2012. www.fatf- gafi.org/media/ fatf /documents/reports/mer/Follow%20Up

Clinically mild encephalitis/encephalopathy with a reversible splenial lesion associated with febrile urinary tract infection.

PubMed

Okamoto, Takayuki; Sato, Yasuyuki; Yamazaki, Takeshi; Hayashi, Asako

2014-04-01

Common pathogens of clinically mild encephalitis/encephalopathy with a reversible splenial lesion (MERS) are viruses, such as influenza virus. However, bacteria are rare pathogens for MERS. We report the first patient with MERS associated with febrile urinary tract infection. A 16-year-old lupus patient was admitted to our hospital. She had fever, headache, vomiting, and right back pain. Urinary analysis showed leukocyturia, and urinary culture identified Klebsiella pneumoniae. Cerebrospinal fluid examination and brain single-photon emission computed tomography showed no abnormalities. Therefore, she was diagnosed with febrile urinary tract infection. For further examinations, 99mTc-dimercaptosuccinic acid renal scintigraphy showed right cortical defects, and a voiding cystourethrogram demonstrated right vesicoureteral reflux (grade II). Therefore, she was diagnosed with right pyelonephritis. Although treatment with antibiotics administered intravenously improved the fever, laboratory findings, and right back pain, she had prolonged headaches, nausea, and vomiting. T2-weighted, diffusion-weighted, and fluid attenuated inversion recovery images in brain magnetic resonance imaging showed high intensity lesions in the splenium of the corpus callosum, which completely disappeared 1 week later. These results were compatible with MERS. To the best of our knowledge, our patient is the first patient who showed clinical features of MERS associated with febrile urinary tract infection. In patients with pyelonephritis and an atypical clinical course, such as prolonged headache, nausea, vomiting, and neurological disorders, the possibility of MERS should be considered.

MERS-CoV and H5N1 influenza virus antagonize antigen presentation by altering the epigenetic landscape

DOE PAGES

Menachery, Vineet D.; Schafer, Alexandra; Burnum-Johnson, Kristin E.; ...

2018-01-16

Convergent evolution dictates that diverse groups of viruses will target both similar and distinct host pathways in order to manipulate the immune response and improve infection. In this study, we sought to leverage this uneven viral antagonism to identify critical host factors that govern disease outcome. Utilizing a systems based approach, we examined differential regulation of IFNγ dependent genes following infection with highly pathogenic viruses including influenza (H5N1-VN1203, H1N1-CA04) and coronaviruses (SARS-CoV, MERS-CoV). Categorizing by function, we observed down regulation of genes associated with antigen presentation following both H5N1-VN1203 and MERS-CoV infection. Further examination revealed global down regulation of antigenmore » presentation genes and was confirmed by proteomics for both H5N1-VN1203 and MERS-CoV infection. Importantly, epigenetic analysis suggested that DNA methylation rather than histone modification plays a crucial role in MERS-CoV mediated antagonism of antigen presentation genes; in contrast, H5N1-VN1203 likely utilizes a combination of epigenetic mechanisms to target antigen presentation. Altogether, the results indicate a common approach utilized by H5N1-VN1203 and MERS-CoV to modulate antigen presentation and the host adaptive immune response.« less

MERS-CoV and H5N1 influenza virus antagonize antigen presentation by altering the epigenetic landscape

DOE Office of Scientific and Technical Information (OSTI.GOV)

Menachery, Vineet D.; Schäfer, Alexandra; Burnum-Johnson, Kristin E.

Convergent evolution dictates that diverse groups of viruses will target both similar and distinct host pathways in order to manipulate the immune response and improve infection. In this study, we sought to leverage this uneven viral antagonism to identify critical host factors that govern disease outcome. Utilizing a systems based approach, we examined differential regulation of IFNγ dependent genes following infection with highly pathogenic viruses including influenza (H5N1-VN1203, H1N1-CA04) and coronaviruses (SARS-CoV, MERS-CoV). Categorizing by function, we observed down regulation of genes associated with antigen presentation following both H5N1-VN1203 and MERS-CoV infection. Further examination revealed global down regulation of antigenmore » presentation genes and was confirmed by proteomics for both H5N1-VN1203 and MERS-CoV infection. Importantly, epigenetic analysis suggested that DNA methylation rather than histone modification plays a crucial role in MERS-CoV mediated antagonism of antigen presentation genes; in contrast, H5N1-VN1203 likely utilizes a combination of epigenetic mechanisms to target antigen presentation. Together, the results indicate a common approach utilized by H5N1-VN1203 and MERS-CoV to modulate antigen presentation and the host adaptive immune response.« less

Small RNA analysis in Petunia hybrida identifies unusual tissue-specific expression patterns of conserved miRNAs and of a 24mer RNA

PubMed Central

Tedder, Philip; Zubko, Elena; Westhead, David R.; Meyer, Peter

2009-01-01

Two pools of small RNAs were cloned from inflorescences of Petunia hybrida using a 5′-ligation dependent and a 5′-ligation independent approach. The two libraries were integrated into a public website that allows the screening of individual sequences against 359,769 unique clones. The library contains 15 clones with 100% identity and 53 clones with one mismatch to miRNAs described for other plant species. For two conserved miRNAs, miR159 and miR390, we find clear differences in tissue-specific distribution, compared with other species. This shows that evolutionary conservation of miRNA sequences does not necessarily include a conservation of the miRNA expression profile. Almost 60% of all clones in the database are 24-nucleotide clones. In accordance with the role of 24mers in marking repetitive regions, we find them distributed across retroviral and transposable element sequences but other 24mers map to promoter regions and to different transcript regions. For one target region we observe tissue-specific variation of matching 24mers, which demonstrates that, as for 21mers, 24mer concentrations are not necessarily identical in different tissues. Asymmetric distribution of a putative novel miRNA in the two libraries suggests that the cloning method can be selective for the representation of certain small RNAs in a collection. PMID:19369427

G-triplex structure and formation propensity

PubMed Central

Cerofolini, Linda; Amato, Jussara; Giachetti, Andrea; Limongelli, Vittorio; Novellino, Ettore; Parrinello, Michele; Fragai, Marco; Randazzo, Antonio; Luchinat, Claudio

2014-01-01

The occurrence of a G-triplex folding intermediate of thrombin binding aptamer (TBA) has been recently predicted by metadynamics calculations, and experimentally supported by Nuclear Magnetic Resonance (NMR), Circular Dichroism (CD) and Differential Scanning Calorimetry (DSC) data collected on a 3′ end TBA-truncated 11-mer oligonucleotide (11-mer-3′-t-TBA). Here we present the solution structure of 11-mer-3′-t-TBA in the presence of potassium ions. This structure is the first experimental example of a G-triplex folding, where a network of Hoogsteen-like hydrogen bonds stabilizes six guanines to form two G:G:G triad planes. The G-triplex folding of 11-mer-3′-t-TBA is stabilized by the potassium ion and destabilized by increasing the temperature. The superimposition of the experimental structure with that predicted by metadynamics shows a great similarity, with only significant differences involving two loops. These new structural data show that 11-mer-3′-t-TBA assumes a G-triplex DNA conformation as its stable form, reinforcing the idea that G-triplex folding intermediates may occur in vivo in human guanine-rich sequences. NMR and CD screening of eight different constructs obtained by removing from one to four bases at either the 3′ and the 5′ ends show that only the 11-mer-3′-t-TBA yields a relatively stable G-triplex. PMID:25378342

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers prepare to mate the Mars Exploration Rover-2 (MER-2) to the third stage of a Delta II rocket for launch on June 5. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-23

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers prepare to mate the Mars Exploration Rover-2 (MER-2) to the third stage of a Delta II rocket for launch on June 5. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-1 (MER-B) will launch June 25.

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers mate the Mars Exploration Rover-2 (MER-2) to the third stage of a Delta II rocket for launch on June 5. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-23

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers mate the Mars Exploration Rover-2 (MER-2) to the third stage of a Delta II rocket for launch on June 5. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-1 (MER-B) will launch June 25.

Concerted action of the MutLβ heterodimer and Mer3 helicase regulates the global extent of meiotic gene conversion

PubMed Central

Duroc, Yann; Kumar, Rajeev; Ranjha, Lepakshi; Adam, Céline; Guérois, Raphaël; Md Muntaz, Khan; Marsolier-Kergoat, Marie-Claude; Dingli, Florent; Laureau, Raphaëlle; Loew, Damarys; Llorente, Bertrand; Charbonnier, Jean-Baptiste; Cejka, Petr; Borde, Valérie

2017-01-01

Gene conversions resulting from meiotic recombination are critical in shaping genome diversification and evolution. How the extent of gene conversions is regulated is unknown. Here we show that the budding yeast mismatch repair related MutLβ complex, Mlh1-Mlh2, specifically interacts with the conserved meiotic Mer3 helicase, which recruits it to recombination hotspots, independently of mismatch recognition. This recruitment is essential to limit gene conversion tract lengths genome-wide, without affecting crossover formation. Contrary to expectations, Mer3 helicase activity, proposed to extend the displacement loop (D-loop) recombination intermediate, does not influence the length of gene conversion events, revealing non-catalytical roles of Mer3. In addition, both purified Mer3 and MutLβ preferentially recognize D-loops, providing a mechanism for limiting gene conversion in vivo. These findings show that MutLβ is an integral part of a new regulatory step of meiotic recombination, which has implications to prevent rapid allele fixation and hotspot erosion in populations. DOI: http://dx.doi.org/10.7554/eLife.21900.001 PMID:28051769

Estimating Potential Incidence of MERS-CoV Associated with Hajj Pilgrims to Saudi Arabia, 2014

PubMed Central

Lessler, Justin; Rodriguez-Barraquer, Isabel; Cummings, Derek A.T.; Garske, Tini; Van Kerkhove, Maria; Mills, Harriet; Truelove, Shaun; Hakeem, Rafat; Albarrak, Ali; Ferguson, Neil M.; Aguas, Ricardo; Algarni, Homud; AlHarbi, Khalid; Cauchemez, Simon; Clapham, Hannah; Collins, Caitlin; Cori, Anne; Donnelly, Christl; Fraser, Christophe; Jombart, Thibaut; Moore, Sean M.; Nouvellet, Pierre; Riley, Steven; Salje, Henrik; Turkistani, Abdulhafiz

2014-01-01

Between March and June 2014 the Kingdom of Saudi Arabia (KSA) had a large outbreak of MERS-CoV, renewing fears of a major outbreak during the Hajj this October. Using KSA Ministry of Health data, the MERS-CoV Scenario and Modeling Working Group forecast incidence under three scenarios. In the expected incidence scenario, we estimate 6.2 (95% Prediction Interval [PI]: 1–17) pilgrims will develop MERS-CoV symptoms during the Hajj, and 4.0 (95% PI: 0–12) foreign pilgrims will be infected but return home before developing symptoms. In the most pessimistic scenario, 47.6 (95% PI: 32–66) cases will develop symptoms during the Hajj, and 29.0 (95% PI: 17–43) will be infected but return home asymptomatic. Large numbers of MERS-CoV cases are unlikely to occur during the 2014 Hajj even under pessimistic assumptions, but careful monitoring is still needed to detect possible mass infection events and minimize introductions into other countries.   PMID:25685624

AFM study of morphology and mechanical properties of a chimeric spider silk and bone sialoprotein protein for bone regeneration

PubMed Central

Gomes, Sílvia; Numata, Keiji; Leonor, Isabel B.; Mano, João F.; Reis, Rui L.; Kaplan, David L.

2011-01-01

Atomic force microscopy (AFM) was used to assess a new chimeric protein consisting of a fusion protein of the consensus repeat for Nephila clavipes spider dragline protein and bone sialoprotein (6mer+BSP). The elastic modulus of this protein in film form was assessed through force curves, and film surface roughness was also determined. The results showed a significant difference between the elastic modulus of the chimeric silk protein, 6mer+BSP, and control films consisting of only the silk component (6mer). The behaviour of the 6mer+BSP and 6mer proteins in aqueous solution in the presence of calcium (Ca) ions was also assessed to determine interactions between the inorganic and organic components related to bone interactions, anchoring and biomaterial network formation. The results demonstrated the formation of protein networks in the presence of Ca2+ ions, characteristics that may be important in the context of controlling materials assembly and properties related to bone-formation with this new chimeric silk-BSP protein. PMID:21370930

AFM study of morphology and mechanical properties of a chimeric spider silk and bone sialoprotein protein for bone regeneration.

PubMed

Gomes, Sílvia; Numata, Keiji; Leonor, Isabel B; Mano, João F; Reis, Rui L; Kaplan, David L

2011-05-09

Atomic force microscopy (AFM) was used to assess a new chimeric protein consisting of a fusion protein of the consensus repeat for Nephila clavipes spider dragline protein and bone sialoprotein (6mer+BSP). The elastic modulus of this protein in film form was assessed through force curves, and film surface roughness was also determined. The results showed a significant difference among the elastic modulus of the chimeric silk protein, 6mer+BSP, and control films consisting of only the silk component (6mer). The behavior of the 6mer+BSP and 6mer proteins in aqueous solution in the presence of calcium (Ca) ions was also assessed to determine interactions between the inorganic and organic components related to bone interactions, anchoring, and biomaterial network formation. The results demonstrated the formation of protein networks in the presence of Ca(2+) ions, characteristics that may be important in the context of controlling materials assembly and properties related to bone formation with this new chimeric silk-BSP protein.

GAS6/Mer axis regulates the homing and survival of the E2A/PBX1 positive B-cell precursor acute lymphoblastic leukemia in the bone marrow niche

PubMed Central

Shiozawa, Yusuke; Pedersen, Elisabeth A.; Taichman, Russell S.

2009-01-01

Despite improvements in current combinational chemotherapy regimens, the prognosis of the (1;19)(q23;p13) translocation (E2A/PBX1) positive B-cell precursor acute lymphoblastic leukemia (ALL) is poor in pediatric leukemia patients. In this study, we examined the roles of GAS6/Mer axis in the interactions between E2A/PBX1 positive B-cell precursor ALL cells and the osteoblastic niche in the bone marrow. The data show that primary human osteoblasts secrete GAS6 in response to the Mer-over-expressed E2A/PBX1 positive ALL cells through MAPK signaling pathway and that leukemia cells migrate toward GAS6 using pathways activated by Mer. Importantly, GAS6 supports the survival and prevents apoptosis from chemotherapy of E2A/PBX1 positive ALL cells by inducing dormancy. Together, these data suggest that GAS6/Mer axis regulates the homing and survival of the E2A/PBX1 positive B-cell precursor ALL in the bone marrow niche. PMID:19922767

MER Telemetry Processor

NASA Technical Reports Server (NTRS)

Lee, Hyun H.

2012-01-01

MERTELEMPROC processes telemetered data in data product format and generates Experiment Data Records (EDRs) for many instruments (HAZCAM, NAVCAM, PANCAM, microscopic imager, Moessbauer spectrometer, APXS, RAT, and EDLCAM) on the Mars Exploration Rover (MER). If the data is compressed, then MERTELEMPROC decompresses the data with an appropriate decompression algorithm. There are two compression algorithms (ICER and LOCO) used in MER. This program fulfills a MER specific need to generate Level 1 products within a 60-second time requirement. EDRs generated by this program are used by merinverter, marscahv, marsrad, and marsjplstereo to generate higher-level products for the mission operations. MERTELEPROC was the first GDS program to process the data product. Metadata of the data product is in XML format. The software allows user-configurable input parameters, per-product processing (not streambased processing), and fail-over is allowed if the leading image header is corrupted. It is used within the MER automated pipeline. MERTELEMPROC is part of the OPGS (Operational Product Generation Subsystem) automated pipeline, which analyzes images returned by in situ spacecraft and creates level 1 products to assist in operations, science, and outreach.

Differential TAM receptor–ligand–phospholipid interactions delimit differential TAM bioactivities

PubMed Central

Lew, Erin D; Oh, Jennifer; Burrola, Patrick G; Lax, Irit; Zagórska, Anna; Través, Paqui G; Schlessinger, Joseph; Lemke, Greg

2014-01-01

The TAM receptor tyrosine kinases Tyro3, Axl, and Mer regulate key features of cellular physiology, yet the differential activities of the TAM ligands Gas6 and Protein S are poorly understood. We have used biochemical and genetic analyses to delineate the rules for TAM receptor–ligand engagement and find that the TAMs segregate into two groups based on ligand specificity, regulation by phosphatidylserine, and function. Tyro3 and Mer are activated by both ligands but only Gas6 activates Axl. Optimal TAM signaling requires coincident TAM ligand engagement of both its receptor and the phospholipid phosphatidylserine (PtdSer): Gas6 lacking its PtdSer-binding ‘Gla domain’ is significantly weakened as a Tyro3/Mer agonist and is inert as an Axl agonist, even though it binds to Axl with wild-type affinity. In two settings of TAM-dependent homeostatic phagocytosis, Mer plays a predominant role while Axl is dispensable, and activation of Mer by Protein S is sufficient to drive phagocytosis. DOI: http://dx.doi.org/10.7554/eLife.03385.001 PMID:25265470

Simple and rapid enzymatic method for the synthesis of single-strand oligonucleotides containing trifluorothymidine.

PubMed

Suzuki, Norihiko; Fukushima, Masakazu

2010-11-01

To investigate the mechanism of trifluorothymidine (TFT)-induced DNA damage, we developed an enzymatic method for the synthesis of single-strand oligonucleotides containing TFT-monophosphate residues. Sixteen-mer oligonucleotides and 14-mer 5'-phosphorylated oligonucleotides were annealed to the template of 25-mer, so as to empty one nucleotide site. TFT-triphosphate was incorporated into the site by DNA polymerase and then ligated to 5'-phosphorylated oligonucleotides by DNA ligase. The synthesized 31-mer oligonucleotides containing TFT residues were isolated from the 25-mer complementary template by denaturing polyacrylamide electrophoresis. Using these single-strand oligonucleotides containing TFT residues, the cleavage of TFT residues from DNA, using mismatch uracil-DNA glycosylase (MUG) of E.coli origin, was compared with that of 5-fluorouracil (5FU) and 5-bromodeoxyuridine (BrdU). The TFT/A pair was not cleaved by MUG, while the other pairs, namely, 5FU/A, 5FU/G, BrdU/A, BrdU/G, and TFT/G, were easily cleaved from each synthesized DNA. Thus, this method is useful for obtaining some site-specifically modified oligonucleotides.

KSC-03pd1832

NASA Image and Video Library

2003-06-06

KENNEDY SPACE CENTER, FLA. - A science briefing on the Mars Exploration Rover (MER) missions is held for the media at Kennedy Space Center. From left, the participants are Donald Savage, NASA Public Information Officer; Dr. Ed Weiler, Associate Administrator for Space Science, NASA Headquarters; Dr. Jim Garvin, Mars lead scientist, NASA Headquarters; Dr. Cathy Weitz, MER program scientist, NASA Headquarters; Dr. Joy Crisp, MER project scientist, Jet Propulsion Laboratory; and Dr. Steve Squyres, Mer principal investigator, Cornell Univeristy, Ithaca, N.Y. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans are not yet able to go. MER-A is scheduled to launch on June 8 at 2:06 p.m. EDT, with two launch opportunities each day during a launch period that closes on June 24.

KSC-03pd0537

NASA Image and Video Library

2003-02-24

KENNEDY SPACE CENTER, FLA. -- The cruise stage, aeroshell and lander for the Mars Exploration Rover-1 mission and the MER-2 rover arrive at KSC's Multi-Payload Processing Facility. The same flight hardware for the MER-2 rover arrived Jan. 27; however, the MER-2 rover is scheduled to arrive at KSC in March. While at KSC, each of the two rovers, the aeroshells and the landers will undergo a full mission simulation. All of these flight elements will then be integrated together. After spin balance testing, each spacecraft will be mated to a solid propellant upper stage booster that will propel the spacecraft out of Earth orbit. Approximately 10 days before launch they will be transported to the launch pad for mating with their respective Boeing Delta II rockets. The rovers will serve as robotic geologists to seek answers about the evolution of Mars, particularly for a history of water. The rovers will be identical to each other, but will land at different regions of Mars. Launch of the MER-1 is scheduled for May 30. MER-2 will follow June 25.

Identifying Monoclonal Antibodies that Potently Inhibit MERS-CoV | Center for Cancer Research

Cancer.gov

The Middle East respiratory syndrome coronavirus (MERS-CoV), first isolated in September 2012, infects cells lining the human airway, causing severe flu-like symptoms that, in some cases, lead to death. As of July 2, 2014, 824 confirmed cases of MERS-CoV infection, including at least 286 related deaths, have been reported to the World Health Organization. While there are currently no effective therapies against the virus, monoclonal antibodies (MAbs) may be a promising candidate. Having previously developed MAbs against other viruses, including the related severe acute respiratory syndrome coronavirus or SARS-CoV, Dimiter Dimitrov, Ph.D., of CCR’s Laboratory of Experimental Immunology (LEI), and his colleagues decided to pan a library of antigen binding fragments (Fab) for activity against MERS-CoV.

The Effects of the Mars Exploration Rovers (MER) Work Schedule Regime on Locomotor Activity Circadian Rhythms, Sleep and Fatigue

NASA Technical Reports Server (NTRS)

DeRoshia, Charles W.; Colletti, Laura C.; Mallis, Melissa M.

2008-01-01

This study assessed human adaptation to a Mars sol by evaluating sleep metrics obtained by actigraphy and subjective responses in 22 participants, and circadian rhythmicity in locomotor activity in 9 participants assigned to Mars Exploration Rover (MER) operational work schedules (24.65 hour days) at the Jet Propulsion Laboratory in 2004. During MER operations, increased work shift durations and reduced sleep durations and time in bed were associated with the appearance of pronounced 12-hr (circasemidian) rhythms with reduced activity levels. Sleep duration, workload, and circadian rhythm stability have important implications for adaptability and maintenance of operational performance not only of MER operations personnel but also in space crews exposed to a Mars sol of 24.65 hours during future Mars missions.

KSC-03PD-1587

NASA Technical Reports Server (NTRS)

2003-01-01

KENNEDY SPACE CENTER, FLA. A solid rocket booster arrives at Launch Complex 17-A, Cape Canaveral Air Force Station. It is one of nine that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASAs twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans cant yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

Molecular analysis of mercury-resistant Bacillus isolates from sediment of Minamata Bay, Japan.

PubMed Central

Nakamura, K; Silver, S

1994-01-01

Bacillus isolates from Minamata Bay sediment were selected for the ability to volatilize mercury from a range of organomercurials (including methylmercury). Chromosomal DNA from 74 of 78 such strains hybridized with the mer mercury resistance operon DNA from marine Bacillus sp. strain RC607 (Y. Wang, M. Moore, H. S. Levinson, S. Silver, C. Walsh, and I. Mahler, J. Bacteriol. 171:83-92, 1989). The most frequent classes with regard to restriction nuclease site maps of the mer operon for the new isolates were identical to or closely related to the mer determinant of strain RC607. PCR amplification analysis with primers designed from the strain RC607 mer operon gave products of precisely the predicted size with the 74 Minamata Bay isolates. Images PMID:7811095

Calculation of Operations Efficiency Factors for Mars Surface Missions

NASA Technical Reports Server (NTRS)

Laubach, Sharon

2014-01-01

The duration of a mission--and subsequently, the minimum spacecraft lifetime--is a key component in designing the capabilities of a spacecraft during mission formulation. However, determining the duration is not simply a function of how long it will take the spacecraft to execute the activities needed to achieve mission objectives. Instead, the effects of the interaction between the spacecraft and ground operators must also be taken into account. This paper describes a method, using "operations efficiency factors", to account for these effects for Mars surface missions. Typically, this level of analysis has not been performed until much later in the mission development cycle, and has not been able to influence mission or spacecraft design. Further, the notion of moving to sustainable operations during Prime Mission--and the effect that change would have on operations productivity and mission objective choices--has not been encountered until the most recent rover missions (MSL, the (now-cancelled) joint NASA-ESA 2018 Mars rover, and the proposed rover for Mars 2020). Since MSL had a single control center and sun-synchronous relay assets (like MER), estimates of productivity derived from MER prime and extended missions were used. However, Mars 2018's anticipated complexity (there would have been control centers in California and Italy, and a non-sun-synchronous relay asset) required the development of an explicit model of operations efficiency that could handle these complexities. In the case of the proposed Mars 2018 mission, the model was employed to assess the mission return of competing operations concepts, and as an input to component lifetime requirements. In this paper we provide examples of how to calculate the operations efficiency factor for a given operational configuration, and how to apply the factors to surface mission scenarios. This model can be applied to future missions to enable early effective trades between operations design, science mission planning, and spacecraft design.

deBGR: an efficient and near-exact representation of the weighted de Bruijn graph

PubMed Central

Pandey, Prashant; Bender, Michael A.; Johnson, Rob; Patro, Rob

2017-01-01

Abstract Motivation: Almost all de novo short-read genome and transcriptome assemblers start by building a representation of the de Bruijn Graph of the reads they are given as input. Even when other approaches are used for subsequent assembly (e.g. when one is using ‘long read’ technologies like those offered by PacBio or Oxford Nanopore), efficient k-mer processing is still crucial for accurate assembly, and state-of-the-art long-read error-correction methods use de Bruijn Graphs. Because of the centrality of de Bruijn Graphs, researchers have proposed numerous methods for representing de Bruijn Graphs compactly. Some of these proposals sacrifice accuracy to save space. Further, none of these methods store abundance information, i.e. the number of times that each k-mer occurs, which is key in transcriptome assemblers. Results: We present a method for compactly representing the weighted de Bruijn Graph (i.e. with abundance information) with essentially no errors. Our representation yields zero errors while increasing the space requirements by less than 18–28% compared to the approximate de Bruijn graph representation in Squeakr. Our technique is based on a simple invariant that all weighted de Bruijn Graphs must satisfy, and hence is likely to be of general interest and applicable in most weighted de Bruijn Graph-based systems. Availability and implementation: https://github.com/splatlab/debgr. Contact: rob.patro@cs.stonybrook.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:28881995

Middle East respiratory syndrome in South Korea during 2015: Risk-related perceptions and quarantine attitudes.

PubMed

Kim, E Y; Liao, Q; Yu, E S; Kim, J H; Yoon, S W; Lam, W W T; Fielding, R

2016-11-01

A telephone survey involving 200 household members in and around Seoul, South Korea, was completed during the maturity stage of the outbreak of Middle East respiratory syndrome (MERS) in Korea during June 2015. The study found that respondents perceived low risk from contracting MERS, had low trust in government in controlling MERS, and generally held unfavorable attitudes toward quarantine. Copyright © 2016 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

The Role of an Aggrecan 32mer Fragment in Post-Traumatic Osteoarthritis

DTIC Science & Technology

2017-10-01

Award Number: W81XWH-16-1-0706 TITLE: The Role of an Aggrecan 32mer Fragment in Post -Traumatic Osteoarthritis PRINCIPAL INVESTIGATOR: Professor...TITLE AND SUBTITLE The Role of an Aggrecan 32mer Fragment in Post - Traumatic Osteoarthritis 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-16-1-0706 5c...reduction in knee hyperalgesia, but not mechanical allodynia, in mice at 8 weeks post -surgery. This trend was not statistically significant, however, we are

Development of FIAT-based Thermal Protection System Mass Estimating Relationships for NASA's Multi-Mission Earth Entry Concep

NASA Technical Reports Server (NTRS)

Sepka, Steven Andrew; Zarchi, Kerry Agnes; Maddock, Robert W.; Samareh, Jamshid A.

2011-01-01

Mass Estimating Relationships (MERs) have been developed for use in the Program to Optimize Simulated Trajectories II (POST2) as part of NASA's multi-mission Earth Entry Vehicle (MMEEV) concept. MERs have been developed for the thermal protection systems of PICA and of Carbon Phenolic atop Advanced Carbon-Carbon on the forebody and for SIRCA and Acusil II on the backshell. How these MERs were developed, the resulting equations, model limitations, and model accuracy are discussed herein.

MERS, SARS and other coronaviruses as causes of pneumonia.

PubMed

Yin, Yudong; Wunderink, Richard G

2018-02-01

Human coronaviruses (HCoVs) have been considered to be relatively harmless respiratory pathogens in the past. However, after the outbreak of the severe acute respiratory syndrome (SARS) and emergence of the Middle East respiratory syndrome (MERS), HCoVs have received worldwide attention as important pathogens in respiratory tract infection. This review focuses on the epidemiology, pathogenesis and clinical characteristics among SARS-coronaviruses (CoV), MERS-CoV and other HCoV infections. © 2017 Asian Pacific Society of Respirology.

Development Of FIAT-Based Thermal Protection System Mass Estimating Relationships For NASA's Multi-Mission Earth Entry Concept

NASA Technical Reports Server (NTRS)

Sepka, Steven; Trumble, Kerry A.; Maddock, Robert W.; Samareh, Jamshid

2012-01-01

Mass Estimating Relationships (MERs) have been developed for use in the Program to Optimize Simulated Trajectories II (POST2) as part of NASA's multi-mission Earth Entry Vehicle (MMEEV) concept. MERs have been developed for the thermal protection systems of PICA and of Carbon Phenolic atop Advanced Carbon-Carbon on the forebody and for SIRCA and Acusil II on the backshell. How these MERs were developed, the resulting equations, model limitations, and model accuracy are discussed herein.

Building predictive models for MERS-CoV infections using data mining techniques.

PubMed

Al-Turaiki, Isra; Alshahrani, Mona; Almutairi, Tahani

Recently, the outbreak of MERS-CoV infections caused worldwide attention to Saudi Arabia. The novel virus belongs to the coronaviruses family, which is responsible for causing mild to moderate colds. The control and command center of Saudi Ministry of Health issues a daily report on MERS-CoV infection cases. The infection with MERS-CoV can lead to fatal complications, however little information is known about this novel virus. In this paper, we apply two data mining techniques in order to better understand the stability and the possibility of recovery from MERS-CoV infections. The Naive Bayes classifier and J48 decision tree algorithm were used to build our models. The dataset used consists of 1082 records of cases reported between 2013 and 2015. In order to build our prediction models, we split the dataset into two groups. The first group combined recovery and death records. A new attribute was created to indicate the record type, such that the dataset can be used to predict the recovery from MERS-CoV. The second group contained the new case records to be used to predict the stability of the infection based on the current status attribute. The resulting recovery models indicate that healthcare workers are more likely to survive. This could be due to the vaccinations that healthcare workers are required to get on regular basis. As for the stability models using J48, two attributes were found to be important for predicting stability: symptomatic and age. Old patients are at high risk of developing MERS-CoV complications. Finally, the performance of all the models was evaluated using three measures: accuracy, precision, and recall. In general, the accuracy of the models is between 53.6% and 71.58%. We believe that the performance of the prediction models can be enhanced with the use of more patient data. As future work, we plan to directly contact hospitals in Riyadh in order to collect more information related to patients with MERS-CoV infections. Copyright © 2016 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

System effectiveness of detection, brief intervention and refer to treatment for the people with post-traumatic emotional distress by MERS: a case report of community-based proactive intervention in South Korea.

PubMed

Yoon, Mi-Kyung; Kim, Soon-Young; Ko, Hye-Sun; Lee, Myung-Soo

2016-01-01

Korea has experienced diverse kind of disasters these days. Among them the 2015 middle eastern respiratory syndrome (MERS) outbreak imposed great psychological stress on almost all Korean citizens. Following the MERS outbreak, government is reviewing overall infectious disease management system and prioritizing the establishment of mental health service systems for infectious disease. This study makes suggestions for implementing disaster-related mental health service systems by analyzing the example of Gyeonggi Province, which proactively intervened with residents' psychological problems caused by the large-scale outbreak of an infectious disease. Mental health service system for MERS victims had the following two parts: a mental health service for people who had been placed in quarantine and a service provided to families of patients who had died or recovered patients. The government of Gyeonggi province, public health centers, regional and local Community Mental Health Centers and the National Center for Crisis Mental Health Management participated in this service system. Among 1221 Gyeonggi people placed in quarantine and who experienced psychological and emotional difficulties, 350 required continuing services; 124 of this group received continuing services. That is, 35 % of people who required psychological intervention received contact from service providers and received the required services. This study reflects a proactive monitoring system for thousands of people placed under quarantine for the first time in Korea. It is significant that the service utilization rate by a proactive manner, that is the professionals administering it actively approached and contacted people with problems rather than passively providing information was much higher than other general mental health situation in Korea. The core value of public mental health services is adequate public accessibility; it is therefore essential for governments to strengthen their professional competence and establish effective systems. These criteria should also be applied to psychological problems caused by disastrous infectious disease outbreaks.

Seasonal changes of mercury reduction and methylation in Gulf of Trieste (north Adriatic Sea)

NASA Astrophysics Data System (ADS)

Horvat, M.; Bratkic, A.; Koron, N.; Faganeli, J.; Ribeiro Guevara, S.; Tinta, T.

2014-12-01

We have successfully improved and applied the 197Hg radiotracer method during the sampling campaign from March until November 2011, collecting and incubating sediments and waters with low 197Hg2+ additions without significantly increasing natural levels. The evolution of Me197Hg and DGM197 was followed. In addition, we have performed Hg speciation of the water column and sediment, determined diversity of microbial community and investigated microbial resistance to Hg through presence of merA and merB genes. Our results showed repeatedly that methylation does not occur in the water column of the GoT, and confirmed that sediments are the principal methylation site, as well as the source of MeHg to the water column. Its formation seems to be closely linked to nutrient cycling at the sediment-water interface, where degradation of organic matter with accompanying oxygen consumption significantly stimulates MeHg production (range 0.85 pM - 3.39 pM). The water column showed a pronounced capability for 197Hg2+ reduction (up to 25% d-1), confirming that the GoT is a source of Hg to the atmosphere. Whether reduction was directly linked to genetic resistance; was a consequence of non-specific redox reactions or of other microbial mechanisms could not be demonstrated. Neither merA nor merB genes were detected, but the microbial community structure was changing in the water column seasonally, as did the reduction rates in the experiments. Most importantly, it was shown that 197Hg methodology is sensitive enough to follow Hg biogeochemical transformations at environmental levels. The advantage is that the minimal additions of 197Hg do not disturb the natural processes occurring in the environment and that very small changes can be detected. Hg stress in the Gulf can directly manifest itself in biota and consequently result in a threat to environmental and public health and therefore needs to be seen in the light of changing global climate and marine environment.

Organization of model helical peptides in lipid bilayers: insight into the behavior of single-span protein transmembrane domains.

PubMed Central

Sharpe, Simon; Barber, Kathryn R; Grant, Chris W M; Goodyear, David; Morrow, Michael R

2002-01-01

Selectively deuterated transmembrane peptides comprising alternating leucine-alanine subunits were examined in fluid bilayer membranes by solid-state nuclear magnetic resonance (NMR) spectroscopy in an effort to gain insight into the behavior of membrane proteins. Two groups of peptides were studied: 21-mers having a 17-amino-acid hydrophobic domain calculated to be close in length to the hydrophobic thickness of 1-palmitoyl-2-oleoyl phosphatidylcholine and 26-mers having a 22-amino-acid hydrophobic domain calculated to exceed the membrane hydrophobic thickness. (2)H NMR spectral features similar to ones observed for transmembrane peptides from single-span receptors of higher animal cells were identified which apparently correspond to effectively monomeric peptide. Spectral observations suggested significant distortion of the transmembrane alpha-helix, and/or potential for restriction of rotation about the tilted helix long axis for even simple peptides. Quadrupole splittings arising from the 26-mer were consistent with greater peptide "tilt" than were those of the analogous 21-mer. Quadrupole splittings associated with monomeric peptide were relatively insensitive to concentration and temperature over the range studied, indicating stable average conformations, and a well-ordered rotation axis. At high peptide concentration (6 mol% relative to phospholipid) it appeared that the peptide predicted to be longer than the membrane thickness had a particular tendency toward reversible peptide-peptide interactions occurring on a timescale comparable with or faster than approximately 10(-5) s. This interaction may be direct or lipid-mediated and was manifest as line broadening. Peptide rotational diffusion rates within the membrane, calculated from quadrupolar relaxation times, T(2e), were consistent with such interactions. In the case of the peptide predicted to be equal to the membrane thickness, at low peptide concentration spectral lineshape indicated the additional presence of a population of peptide having rotational motion that was restricted on a timescale of 10(-5) s. PMID:12080125

Phytoremediation of Ionic and Methyl Mercury Pollution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meagher, Richard B.

Phytoremediation is defined as the use of plants to extract, resist, detoxify, and/or sequester toxic environmental pollutants. The long-term goal of the proposed research is to develop and test highly productive, field-adapted plant species that have been engineered for the phytoremediation of mercury. A variety of different genes, which should enable plants to clean mercury polluted sites are being tested as tools for mercury phytoremediation, first in model laboratory plants and then in potential field species. Several of these genes have already been shown to enhance mercury phytoremediation. Mercury pollution is a serious, world-wide problem affecting the health of humanmore » and wildlife populations. Environmentally, the most serious mercury threat is the production of methylmercury (CH3Hg+) by native bacteria at mercury contaminated wetland sites. Methylmercury is inherently more toxic than metallic (Hg(0)) or ionic (Hg(II)) mercury, and because methylmercury is prolifically biomagnified up the food chain, it poses the most immediate danger to animal populations. We have successfully engineered two model plants, Arabidopsis and tobacco, to use the bacterial merB gene to convert methylmercury to less toxic ionic mercury and to use the bacterial merA gene to further detoxify ionic mercury to the least toxic form of mercury, metallic mercury. Plants expressing both MerA and MerB proteins detoxify methylmercury in two steps to the metallic form. These plants germinate, grow, and set seed at normal growth rates on levels of methylmercury or ionic mercury that are lethal to normal plants. Our newest efforts involve engineering plants with several additional bacterial and plant genes that allow for higher levels of mercury resistance and mercury hyperaccumulation. The potential for these plants to hyperaccumulate mercury was further advanced by developing constitutive, aboveground, and root-specific gene expression systems. Our current strategy is to engineer plants to control the chemical speciation, electrochemical state, transport, and aboveground binding of mercury in order to manage this toxicant.« less

MERS in the U.S.

MedlinePlus

... traveler departed Riyadh, Saudi Arabia and traveled by plane to London, England, then to Chicago, Illinois. The ... MERS. On May 1, the patient traveled by plane from Jeddah, Saudi Arabia to London, England; to ...

Community Case Clusters of Middle East Respiratory Syndrome Coronavirus in Hafr Al-Batin, Kingdom of Saudi Arabia: A Descriptive Genomic study

PubMed Central

Memish, Ziad A.; Cotten, Matthew; Watson, Simon J.; Kellam, Paul; Zumla, Alimuddin; Alhakeem, Rafat F.; Assiri, Abdullah; Rabeeah, Abdullah A. Al; Al-Tawfiq, Jaffar A.

2014-01-01

Summary The Middle East respiratory syndrome coronavirus (MERS-CoV) was first described in September 2012 and to date 86 deaths from a total of 206 cases of MERS-CoV infection have been reported to the WHO. Camels have been implicated as the reservoir of MERS-CoV, but the exact source and mode of transmission for most patients remain unknown. During a 3 month period, June to August 2013, there were 12 positive MERS-CoV cases reported from the Hafr Al-Batin region district in the north east region of the Kingdom of Saudi Arabia. In addition to the different regional camel festivals in neighboring countries, Hafr Al-Batin has the biggest camel market in the entire Kingdom and hosts an annual camel festival. Thus, we conducted a detailed epidemiological, clinical and genomic study to ascertain common exposure and transmission patterns of all cases of MERS-CoV reported from Hafr Al-Batin. Analysis of previously reported genetic data indicated that at least two of the infected contacts could not have been directly infected from the index patient and alternate source should be considered. While camels appear as the likely source, other sources have not been ruled out. More detailed case control studies with detailed case histories, epidemiological information and genomic analysis are being conducted to delineate the missing pieces in the transmission dynamics of MERS-CoV outbreak. PMID:24699184

The backshell for the Mars Exploration Rover 1 (MER-1) is moved toward the rover (foreground, left). The backshell is a protective cover for the rover. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-10

The backshell for the Mars Exploration Rover 1 (MER-1) is moved toward the rover (foreground, left). The backshell is a protective cover for the rover. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

KENNEDY SPACE CENTER, FLA. - Workers in the Payload Hazardous Servicing Facility prepare to lift and move the backshell that will cover the Mars Exploration Rover 1 (MER-1) and its lander. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-10

KENNEDY SPACE CENTER, FLA. - Workers in the Payload Hazardous Servicing Facility prepare to lift and move the backshell that will cover the Mars Exploration Rover 1 (MER-1) and its lander. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

The TAM-family receptor Mer mediates production of HGF through the RhoA-dependent pathway in response to apoptotic cells.

PubMed

Park, Hyun-Jung; Baen, Ji-Yeon; Lee, Ye-Ji; Choi, Youn-Hee; Kang, Jihee Lee

2012-08-01

The TAM receptor protein tyrosine kinases Tyro3, Axl, and Mer play important roles in macrophage function. We investigated the roles of the TAM receptors in mediating the induction of hepatocyte growth factor (HGF) during the interaction of macrophages with apoptotic cells. Mer-specific neutralizing antibody, small interfering RNA (siRNA), and a recombinant Mer protein (Mer/Fc) inhibited HGF mRNA and protein expression, as well as activation of RhoA, Akt, and specific mitogen-activated protein (MAP) kinases in response to apoptotic cells. Inhibition of Axl or Tyro3 with specific antibodies, siRNA, or Fc-fusion proteins did not prevent apoptotic cell-induced HGF mRNA and protein expression and did not inhibit activation of the postreceptor signaling molecules RhoA and certain MAP kinases, including extracellular signal-regulated protein kinase and c-Jun NH(2)-terminal kinase. However, Axl- and Tyro3-specific blockers did inhibit the activation of Akt and p38 MAP kinase in response to apoptotic cells. In addition, none of the TAM receptors mediated the effects of apoptotic cells on transforming growth factor-β or epidermal growth factor mRNA expression. However, they were involved in the induction of vascular endothelial growth factor mRNA expression. Our data provide evidence that when macrophages interact with apoptotic cells, only Mer of the TAM-family receptors is responsible for mediating transcriptional HGF production through a RhoA-dependent pathway.

Serologic follow-up of Middle East Respiratory Syndrome Coronavirus Cases and Contacts - Abu Dhabi, United Arab Emirates.

PubMed

Al Hosani, Farida Ismail; Kim, Lindsay; Khudhair, Ahmed; Pham, Huong; Al Mulla, Mariam; Al Bandar, Zyad; Pradeep, Krishna; Elkheir, Kheir Abou; Weber, Stefan; Khoury, Mary; Donnelly, George; Younis, Naima; El Saleh, Feda; Abdalla, Muna; Imambaccus, Hala; Haynes, Lia M; Thornburg, Natalie J; Harcourt, Jennifer L; Miao, Congrong; Tamin, Azaibi; Hall, Aron J; Russell, Elizabeth S; Harris, Aaron M; Kiebler, Craig; Mir, Roger A; Pringle, Kimberly; Alami, Negar N; Abedi, Glen R; Gerber, Susan I

2018-06-13

Although there is evidence of person-to-person transmission of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in household and healthcare settings, more data are needed to describe and better understand the risk factors and transmission routes in both settings, as well as the extent that disease severity affects transmission. A sero-epidemiological investigation was conducted among Middle East Respiratory Syndrome Coronavirus (MERS-CoV) case-patients and their household contacts to investigate transmission risk in Abu Dhabi, United Arab Emirates. Cases diagnosed between January 1, 2013-May 9, 2014 and their household contacts were approached for enrollment. Demographic, clinical, and exposure history data were collected. Sera were screened by MERS-CoV nucleocapsid protein (N) ELISA and indirect immunofluorescence, with results confirmed by microneutralization assay. Ninety-one percent (n=31/34) of case-patients were asymptomatic or mildly symptomatic and did not require oxygen during hospitalization. MERS-CoV antibodies were detected in 13 of 24 (54%) cases with available sera, including 3 asymptomatic, 9 mildly symptomatic, and 1 severely symptomatic case-patient. No serologic evidence of MERS-CoV transmission was found among 105 household contacts with available sera. Transmission of MERS-CoV was not documented in this investigation of mostly asymptomatic and mildly symptomatic cases and their household contacts. These results have implications for clinical management of cases and formulation of isolation policies to reduce the risk of transmission.

EDs on heightened alert for MERS-CoV as first cases reach the US.

PubMed

2014-07-01

The first cases of Middle East Respiratory Syndrome coronavirus (MERS-CoV) have turned up in the United States. First, in late April, a patient tested positive for the virus at a hospital in Munster, IN, and then shortly thereafter, a second patient tested positive at a hospital in Orlando, FL. While both patients have since recovered from the virus and been released, the cases have raised awareness of the infectious threat of MERS-CoV, and they have put EDs and other frontline providers on heightened alert for patients with severe respiratory symptoms and other risk factors. While MERS-CoV is not yet as contagious as seasonal influenza or the severe acute respiratory syndrome (SARS) that started in China and then swept around the globe in 2003, it is more deadly. The World Health Organization reports that roughly one-quarter of 514 people who have tested positive for the virus have died. Experts note that health care workers make up a large percentage of the documented cases of MERS-CoV, and they point out that most human-to-human transmissions of the virus occur in the hospital setting. Public health officials urge emergency personnel to pay strict attention to infection control practices, and to query patients who present with fever and respiratory distress about recent travel to the Arabian Peninsula and/or close contact with a person who has a confirmed or probable case of MERS-CoV.

Caudal Zona Incerta/VOP Radiofrequency Lesioning Guided by Combined Stereotactic MRI and Microelectrode Recording for Posttraumatic Midbrain Resting-Kinetic Tremor.

PubMed

Contreras Lopez, William Omar; Azevedo, Angelo R; Cury, Rubens G; Alencar, Francisco; Neville, Iuri S; Reis, Paul R; Navarro, Jessie; Monaco, Bernardo; da Silva, Fabio E Fernandes; Teixeira, Manoel J; Fonoff, Erich T

2016-02-01

Reporting the outcome of two patients who underwent unilateral ablative stereotactic surgery to treat pharmacologic resistant posttraumatic tremor (PTT). We present two patients (31 and 47 years old) with refractory PTT severely affecting their quality of life. Under stereotactic guidance, refined by T2-weighted magnetic resonance imaging and double-channel multiunit microelectrode recording (MER), three sequential radiofrequency lesions were performed in the caudal zona incerta (cZi) up to the base of thalamus (VOP). Effects of cZi/VOP lesion were prospectively rated with a tremor rating scale. Both patients demonstrated intraoperative tremor suppression with sustained results up to 18 months follow-up, with improvement of 92% and 84%, respectively, on the tremor rating scale. Tremor improvement was associated with enhancement functionality and quality of life for the patients. The patients returned to their work after the procedure. No adverse effects were observed up to the last follow-up. Radiofrequency lesion of the cZi/VOP target was effective for posttraumatic tremor in both cases. The use of T2-weighted images and MER was found helpful in increasing the precision and safety of the procedure, because it leads the RF probe by relying on neighbor structures based on thalamus and subthalamic nucleus. Copyright © 2016 Elsevier Inc. All rights reserved.

A novel probe density controllable electrochemiluminescence biosensor for ultra-sensitive detection of Hg2+ based on DNA hybridization optimization with gold nanoparticles array patterned self-assembly platform.

PubMed

Gao, Wenhua; Zhang, An; Chen, Yunsheng; Chen, Zixuan; Chen, Yaowen; Lu, Fushen; Chen, Zhanguang

2013-11-15

Biosensor based on DNA hybridization holds great potential to get higher sensitivity as the optimal DNA hybridization efficiency can be achieved by controlling the distribution and orientation of probe strands on the transducer surface. In this work, an innovative strategy is reported to tap the sensitivity potential of current electrochemiluminescence (ECL) biosensing system by dispersedly anchoring the DNA beacons on the gold nanoparticles (GNPs) array which was electrodeposited on the glassy carbon electrode surface, rather than simply sprawling the coil-like strands onto planar gold surface. The strategy was developed by designing a "signal-on" ECL biosensing switch fabricated on the GNPs nanopatterned electrode surface for enhanced ultra-sensitivity detection of Hg(2+). A 57-mer hairpin-DNA labeled with ferrocene as ECL quencher and a 13-mer DNA labeled with Ru(bpy)3(2+) as reporter were hybridized to construct the signal generator in off-state. A 31-mer thymine (T)-rich capture-DNA was introduced to form T-T mismatches with the loop sequence of the hairpin-DNA in the presence of Hg(2+) and induce the stem-loop open, meanwhile the ECL "signal-on" was triggered. The peak sensitivity with the lowest detection limit of 0.1 nM was achieved with the optimal GNPs number density while exorbitant GNPs deposition resulted in sensitivity deterioration for the biosensor. We expect the present strategy could lead the renovation of the existing probe-immobilized ECL genosensor design to get an even higher sensitivity in ultralow level of target detection such as the identification of genetic diseases and disorders in basic research and clinical application. Copyright © 2013 Elsevier B.V. All rights reserved.

Importance of Neutralizing Monoclonal Antibodies Targeting Multiple Antigenic Sites on the Middle East Respiratory Syndrome Coronavirus Spike Glycoprotein To Avoid Neutralization Escape

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Lingshu; Shi, Wei; Chappell, James D.

ABSTRACT Middle East respiratory syndrome coronavirus (MERS-CoV) causes a highly lethal pulmonary infection with ~35% mortality. The potential for a future pandemic originating from animal reservoirs or health care-associated events is a major public health concern. There are no vaccines or therapeutic agents currently available for MERS-CoV. Using a probe-based single B cell cloning strategy, we have identified and characterized multiple neutralizing monoclonal antibodies (MAbs) specifically binding to the receptor-binding domain (RBD) or S1 (non-RBD) regions from a convalescent MERS-CoV-infected patient and from immunized rhesus macaques. RBD-specific MAbs tended to have greater neutralizing potency than non-RBD S1-specific MAbs. Six RBD-specificmore » and five S1-specific MAbs could be sorted into four RBD and three non-RBD distinct binding patterns, based on competition assays, mapping neutralization escape variants, and structural analysis. We determined cocrystal structures for two MAbs targeting the RBD from different angles and show they can bind the RBD only in the “out” position. We then showed that selected RBD-specific, non-RBD S1-specific, and S2-specific MAbs given prophylactically prevented MERS-CoV replication in lungs and protected mice from lethal challenge. Importantly, combining RBD- and non-RBD MAbs delayed the emergence of escape mutations in a cell-based virus escape assay. These studies identify MAbs targeting different antigenic sites on S that will be useful for defining mechanisms of MERS-CoV neutralization and for developing more effective interventions to prevent or treat MERS-CoV infections. IMPORTANCEMERS-CoV causes a highly lethal respiratory infection for which no vaccines or antiviral therapeutic options are currently available. Based on continuing exposure from established reservoirs in dromedary camels and bats, transmission of MERS-CoV into humans and future outbreaks are expected. Using structurally defined probes for the MERS-CoV spike glycoprotein (S), the target for neutralizing antibodies, single B cells were sorted from a convalescent human and immunized nonhuman primates (NHPs). MAbs produced from paired immunoglobulin gene sequences were mapped to multiple epitopes within and outside the receptor-binding domain (RBD) and protected against lethal MERS infection in a murine model following passive immunization. Importantly, combining MAbs targeting distinct epitopes prevented viral neutralization escape from RBD-directed MAbs. These data suggest that antibody responses to multiple domains on CoV spike protein may improve immunity and will guide future vaccine and therapeutic development efforts.« less

The DnaK Chaperone Uses Different Mechanisms To Promote and Inhibit Replication of Vibrio cholerae Chromosome 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jha, Jyoti K.; Li, Mi; Ghirlando, Rodolfo

Replication of Vibrio cholerae chromosome 2 (Chr2) depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB) to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations inrctBthat reduce DnaK binding also reduce 12-mer binding and initiation. The initiation defect is suppressed by second-site mutations that increase 12-mer binding only marginally. Instead, they reduce replication inhibitory mechanisms: RctB dimerization and 39-mer binding. One suppressing change was in amore » dimerization domain which is folded similarly to the initiator of an iteron plasmid—the presumed progenitor of Chr2. In plasmids, DnaK promotes initiation by reducing dimerization. A different mutation was in the 39-mer binding domain of RctB and inactivated it, indicating an alternative suppression mechanism. Paradoxically, although DnaK increases 39-mer binding, the increase was also achieved by inactivating the DnaK binding site of RctB. This result suggests that the site inhibits the 39-mer binding domain (via autoinhibition) when prevented from binding DnaK. Taken together, our results reveal an important feature of the transition from plasmid to chromosome: the Chr2 initiator retains the plasmid-like dimerization domain and its control by chaperones but uses the chaperones in an unprecedented way to control the inhibitory 39-mer binding. IMPORTANCE The capacity of proteins to undergo remodeling provides opportunities to control their function. However, remodeling remains a poorly understood aspect of the structure-function paradigm due to its dynamic nature. Here we have studied remodeling of the initiator of replication ofVibrio choleraeChr2 by the molecular chaperone, DnaK. We show that DnaK binds to a site on the Chr2 initiator (RctB) that promotes initiation by reducing the initiator’s propensity to dimerize. Dimerization of the initiator of the putative plasmid progenitor of Chr2 is also reduced by DnaK, which promotes initiation. Paradoxically, the DnaK binding also promotes replication inhibition by reducing an autoinhibitory activity of RctB. In the plasmid-to-chromosome transition, it appears that the initiator has acquired an autoinhibitory activity and along with it a new chaperone activity that apparently helps to control replication inhibition independently of replication promotion.« less

Non-genomic oestrogen receptor signal in B lymphocytes: An approach towards therapeutic interventions for infection, autoimmunity and cancer.

PubMed

Seto, Karsen; Hoang, Minh; Santos, Thaddeus; Bandyopadhyay, Mausumi; Kindy, Mark S; Dasgupta, Subhajit

2016-07-01

The non-genomic membrane bound oestrogen receptor (mER) regulates intracellular signals through receptor-ligand interactions. The mER, along with G-protein coupled oestrogen receptor GPR 30 (GPER), induces diverse cell signalling pathways in murine lymphocytes. The mER isoform ER-alpha46 has recently been demonstrated in human B and T lymphocytes as an analogue receptor for chemokine CCL18, the signalling events of which are not clearly understood. Ligand-induced mER and GPER signalling events are shared with BCR, CD19 mediated intracellular signalling through phospholipase C, PIP2/IP3/PI3 mediated activation of Akt, MAP kinase, and mTOR. Oestrogen has the ability to induce CD40-mediated activation of B cells. The complete signalling pathways of mER, GPR30 and their interaction with other signals are targeted areas for novel drug development in B cells during infection, autoimmunity and cancer. Therefore, an in depth investigation is critical for determining shared signal outputs during B cell activation. Here, we focus on the mode of action of membrane bound ER in B cells as therapeutic checkpoints. Copyright © 2016 Elsevier Ltd. All rights reserved.

Potential MER Landing Site in Melas Chasma

NASA Technical Reports Server (NTRS)

Weitz, C. M.; Parker, Timothy J.; Anderson, F. Scott

2001-01-01

We have selected one area in Valles Marineris as a potential landing site for the Mars Exploration Rover (MER) mission. After 30 years of analyses, the formation of the Valles Marineris system of troughs and its associated deposits still remains an enigma. Understanding all aspects of the Valles Marineris would significantly contribute to deciphering the internal and external history of Mars. A landing site within Melas Chasma could provide insight into both the formation of Valles Marineris and the composition and origin of the interior layered deposits (ILDs). The ILDs have been proposed as: (1) sedimentary deposits formed in lakes mass wasted material from the walls; (3) remnants of the wall rock; (4) carbonate deposits; (5) aeolian deposits; and (6) volcanic. More recently, Malin and Edgett suggest that the fine-scale, rhythmic layering seen in the interior deposits, as well as other layered deposits in craters, supports a sedimentary origin. Because an understanding of the formation of Valles Marineris and its interior deposits is so important to deciphering the history of Mars, we have proposed a landing site for the MER mission on an exposure of interior deposits in western Melas Chasma. Either MER-A and MER-B could land at this same location.

Adaptive evolution influences the infectious dose of MERS-CoV necessary to achieve severe respiratory disease.

PubMed

Douglas, Madeline G; Kocher, Jacob F; Scobey, Trevor; Baric, Ralph S; Cockrell, Adam S

2018-04-01

We recently established a mouse model (288-330 +/+ ) that developed acute respiratory disease resembling human pathology following infection with a high dose (5 × 10 6 PFU) of mouse-adapted MERS-CoV (icMERSma1). Although this high dose conferred fatal respiratory disease in mice, achieving similar pathology at lower viral doses may more closely reflect naturally acquired infections. Through continued adaptive evolution of icMERSma1 we generated a novel mouse-adapted MERS-CoV (maM35c4) capable of achieving severe respiratory disease at doses between 10 3 and 10 5 PFU. Novel mutations were identified in the maM35c4 genome that may be responsible for eliciting etiologies of acute respiratory distress syndrome at 10-1000 fold lower viral doses. Importantly, comparative genetics of the two mouse-adapted MERS strains allowed us to identify specific mutations that remained fixed through an additional 20 cycles of adaptive evolution. Our data indicate that the extent of MERS-CoV adaptation determines the minimal infectious dose required to achieve severe respiratory disease. Copyright © 2017 Elsevier Inc. All rights reserved.

Synthetic oligosaccharides can replace animal-sourced low-molecular weight heparins.

PubMed

Xu, Yongmei; Chandarajoti, Kasemsiri; Zhang, Xing; Pagadala, Vijayakanth; Dou, Wenfang; Hoppensteadt, Debra Moorman; Sparkenbaugh, Erica M; Cooley, Brian; Daily, Sharon; Key, Nigel S; Severynse-Stevens, Diana; Fareed, Jawed; Linhardt, Robert J; Pawlinski, Rafal; Liu, Jian

2017-09-06

Low-molecular weight heparin (LMWH) is used clinically to treat clotting disorders. As an animal-sourced product, LMWH is a highly heterogeneous mixture, and its anticoagulant activity is not fully reversible by protamine. Furthermore, the reliability of the LMWH supply chain is a concern for regulatory agencies. We demonstrate the synthesis of heparin dodecasaccharides (12-mers) at the gram scale. In vitro experiments demonstrate that the anticoagulant activity of the 12-mers could be reversed using protamine. One of these, labeled as 12-mer-1, reduced the size of blood clots in the mouse model of deep vein thrombosis and attenuated circulating procoagulant markers in the mouse model of sickle cell disease. An ex vivo experiment demonstrates that the anticoagulant activity of 12-mer-1 could be reversed by protamine. 12-mer-1 was also examined in a nonhuman primate model to determine its pharmacodynamic parameters. A 7-day toxicity study in a rat model showed no toxic effects. The data suggest that a synthetic homogeneous oligosaccharide can replace animal-sourced LMWHs. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

Microbial Certification of the MER spacecraft

NASA Technical Reports Server (NTRS)

Schubert, W. W.; Arakelian, T.; Barengoltz, J. B.; Chough, N. G.; Chung, S. Y.; Law, J.; Kirschner, L.; Koukol, R. C.; Newlin, L. E.; Morales, F.

2003-01-01

Spacecraft such as the Mars Exploration Rovers (MER) must meet acceptable microbial population levels prior to launch. Sensitive parts and materials prevent any single sterilization method from being used as a final step on the assembled spacecraft.

The MER Mossbauer Spectrometers: 40 Months of Operation on the Martian Surface

NASA Technical Reports Server (NTRS)

Fleischer, Iris; Rodionov, D.; Schroeder, C.; Morris, R.; Yen, A.; Ming, D.; McCoy, T.; Mittlefehldt, D.; Gellert, R.; Cohen, B.;

The Department of Defense Global, Laboratory-Based Influenza Surveillance Program: Technical Report on Program Methods for the 2012-2013 Influenza Season

DTIC Science & Technology

2013-10-01

revealed the emergence of two novel respiratory pathogens: Middle East Respiratory Syndrome Coronavirus (MERS-CoV) and influenza A( H7N9 ). MERS-CoV was...first identified in patients who lived in or had recent travel to the Saudi Arabian Peninsula, while influenza A( H7N9 ) was first identified in several...individuals in Eastern China. To date, MERS-CoV has shown limited human-to-human transmission, while influenza A( H7N9 ) has not shown sustained

KSC-03pd1231

NASA Image and Video Library

2003-04-24

KENNEDY SPACE CENTER, FLA. - Tom Shain, the MER ATLO logistics manager, holds a computer chip with about 35,000 laser-engraved signatures of visitors to the Mars Exploration Rovers at the Jet Propulsion Laboratory. He and Jim Lloyd, also with the program, will place the chip on the second rover to be launched to Mars (MER-1/MER-B); the first rover already has one. The signatures include those of senators, artists, and John Glenn. The identical Mars rovers are scheduled to launch June 5 and June 25 from Cape Canaveral Air Force Station.

KMC 3: counting and manipulating k-mer statistics.

PubMed

Kokot, Marek; Dlugosz, Maciej; Deorowicz, Sebastian

2017-09-01

Counting all k -mers in a given dataset is a standard procedure in many bioinformatics applications. We introduce KMC3, a significant improvement of the former KMC2 algorithm together with KMC tools for manipulating k -mer databases. Usefulness of the tools is shown on a few real problems. Program is freely available at http://sun.aei.polsl.pl/REFRESH/kmc . sebastian.deorowicz@polsl.pl. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Demonstration of Mer-Cure Technology for Enhanced Mercury Control

DOE Office of Scientific and Technical Information (OSTI.GOV)

John Marion; Dave O'Neill; Kevin Taugher

2008-06-01

Alstom Power Inc. has completed a DOE/NETL-sponsored program (under DOE Cooperative Agreement No. De-FC26-07NT42776) to demonstrate Mer-Cure{trademark}, one of Alstom's mercury control technologies for coal-fired boilers. The Mer-Cure{trademark}system utilizes a small amount of Mer-Clean{trademark} sorbent that is injected into the flue gas stream for oxidation and adsorption of gaseous mercury. Mer-Clean{trademark} sorbents are carbon-based and prepared with chemical additives that promote oxidation and capture of mercury. The Mer-Cure{trademark} system is unique in that the sorbent is injected into an environment where the mercury capture kinetics is accelerated. The full-scale demonstration program originally included test campaigns at two host sites: LCRA's 480-MW{sub e} Fayette Unit No.3 and Reliant Energy's 190-MW{sub e} Shawville Unit No.3. The only demonstration tests actually done were the short-term tests at LCRA due to budget constraints. This report gives a summary of the demonstration testing at Fayette Unit No.3. The goals for this Mercury Round 3 program, established by DOE/NETL under the original solicitation, were to reduce the uncontrolled mercury emissions by 90% at a cost significantly less than 50% of the previous target ofmore » $$60,000/lb mercury removed. The results indicated that Mer-Cure{trademark} technology could achieve mercury removal of 90% based on uncontrolled stack emissions. The estimated costs for 90% mercury control, at a sorbent cost of $$0.75 to $2.00/lb respectively, were $13,400 to $18,700/lb Hg removed. In summary, the results from demonstration testing show that the goals established by DOE/NETL were met during this test program. The goal of 90% mercury reduction was achieved. Estimated mercury removal costs were 69-78% lower than the benchmark of $60,000/lb mercury removed, significantly less than 50% of the baseline removal cost.« less

Production of Titanium Metal by an Electrochemical Molten Salt Process

NASA Astrophysics Data System (ADS)

Fatollahi-Fard, Farzin

Titanium production is a long and complicated process. What we often consider to be the standard method of primary titanium production (the Kroll process), involves many complex steps both before and after to make a useful product from titanium ore. Thus new methods of titanium production, especially electrochemical processes, which can utilize less-processed feedstocks have the potential to be both cheaper and less energy intensive than current titanium production processes. This project is investigating the use of lower-grade titanium ores with the electrochemical MER process for making titanium via a molten salt process. The experimental work carried out has investigated making the MER process feedstock (titanium oxycarbide) with natural titanium ores--such as rutile and ilmenite--and new ways of using the MER electrochemical reactor to "upgrade" titanium ores or the titanium oxycarbide feedstock. It is feasible to use the existing MER electrochemical reactor to both purify the titanium oxycarbide feedstock and produce titanium metal.

Simrank: Rapid and sensitive general-purpose k-mer search tool

PubMed Central

2011-01-01

Background Terabyte-scale collections of string-encoded data are expected from consortia efforts such as the Human Microbiome Project http://nihroadmap.nih.gov/hmp. Intra- and inter-project data similarity searches are enabled by rapid k-mer matching strategies. Software applications for sequence database partitioning, guide tree estimation, molecular classification and alignment acceleration have benefited from embedded k-mer searches as sub-routines. However, a rapid, general-purpose, open-source, flexible, stand-alone k-mer tool has not been available. Results Here we present a stand-alone utility, Simrank, which allows users to rapidly identify database strings the most similar to query strings. Performance testing of Simrank and related tools against DNA, RNA, protein and human-languages found Simrank 10X to 928X faster depending on the dataset. Conclusions Simrank provides molecular ecologists with a high-throughput, open source choice for comparing large sequence sets to find similarity. PMID:21524302

Mars Exploration Rover -2

NASA Image and Video Library

2003-03-06

Components of the two Mars Exploration Rovers (MER) reside in the Payload Hazardous Servicing Facility. At right MER-2. At left is a lander. In the background is one of the aeroshells. MER-1 and MER-2, their aeroshells and landers will undergo a full mission simulation before being integrated. After spin balance testing, each spacecraft will be mated to a solid propellant upper stage booster that will propel the spacecraft out of Earth orbit. Approximately 10 days before launch they will be transported to the launch pad for mating with their respective Boeing Delta II rockets. The rovers will serve as robotic geologists to seek answers about the evolution of Mars, particularly for a history of water. The rovers are identical to each other, but will land at different regions of Mars. Launch of the first rover is scheduled for May 30 from Cape Canaveral Air Force Station. The second will follow June 25.

Nosocomial infection control in healthcare settings: Protection against emerging infectious diseases.

PubMed

Fu, Chuanxi; Wang, Shengyong

2016-04-12

The Middle East respiratory syndrome (MERS) outbreak in Korea in 2015 may be attributable to poor nosocomial infection control procedures implemented. Strict infection control measures were taken in the hospital where an imported case with MERS was treated in southern China and 53 health care workers were confirmed to be MERS-CoV negative. Infection control in healthcare settings, in which patients with emerging infectious diseases such as MERS, Ebola virus disease, and the severe acute respiratory syndrome (SARS) are diagnosed and treated, are often imperfect. When it comes to emerging or unknown infectious diseases, before the imported case was finally identified or community transmission was reported, cases have often occurred in clusters in healthcare settings. Nosocomial infection control measures should be further strengthened among the workers and inpatients in designated healthcare settings that accommodate suspected cases suffering from emerging or unknown infectious diseases.

KSC-03PD-1593

NASA Technical Reports Server (NTRS)

2003-01-01

KENNEDY SPACE CENTER, FLA. While one solid rocket booster (SRB) is suspended in the launch tower on Launch Complex 17-A, Cape Canaveral Air Force Station, another is raised from its transporter for a similar lift. They are two of nine SRBs that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASAs twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans cant yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

KGCAK: a K-mer based database for genome-wide phylogeny and complexity evaluation.

PubMed

Wang, Dapeng; Xu, Jiayue; Yu, Jun

2015-09-16

The K-mer approach, treating genomic sequences as simple characters and counting the relative abundance of each string upon a fixed K, has been extensively applied to phylogeny inference for genome assembly, annotation, and comparison. To meet increasing demands for comparing large genome sequences and to promote the use of the K-mer approach, we develop a versatile database, KGCAK ( http://kgcak.big.ac.cn/KGCAK/ ), containing ~8,000 genomes that include genome sequences of diverse life forms (viruses, prokaryotes, protists, animals, and plants) and cellular organelles of eukaryotic lineages. It builds phylogeny based on genomic elements in an alignment-free fashion and provides in-depth data processing enabling users to compare the complexity of genome sequences based on K-mer distribution. We hope that KGCAK becomes a powerful tool for exploring relationship within and among groups of species in a tree of life based on genomic data.

Multimode marine engine room simulation system based on field bus technology

NASA Astrophysics Data System (ADS)

Zheng, Huayao; Deng, Linlin; Guo, Yi

2003-09-01

Developing multi mode MER (Marine Engine Room) Labs is the main work in Marine Simulation Center, which is the key lab of Communication Ministry of China. It includes FPP (Fixed Pitch Propeller) and CPP (Controllable Pitch Propeller) mode MER simulation systems, integrated electrical propulsion mode MER simulation system, physical mode MER lab, etc. FPP mode simulation system, which was oriented to large container ship, had been completed since 1999, and got second level of Shanghai Municipal Science and Technical Progress award. This paper mainly introduces the recent development and achievements of Marine Simulation Center. Based on the Lon Works field bus, the structure characteristics and control strategies of completely distributed intelligent control network are discussed. The experiment mode of multi-nodes field bus detection and control system is described. Besides, intelligent fault diagnosis technology about some mechatronics integration control systems explored is also involved.

Identification of species based on DNA barcode using k-mer feature vector and Random forest classifier.

PubMed

Meher, Prabina Kumar; Sahu, Tanmaya Kumar; Rao, A R

2016-11-05

DNA barcoding is a molecular diagnostic method that allows automated and accurate identification of species based on a short and standardized fragment of DNA. To this end, an attempt has been made in this study to develop a computational approach for identifying the species by comparing its barcode with the barcode sequence of known species present in the reference library. Each barcode sequence was first mapped onto a numeric feature vector based on k-mer frequencies and then Random forest methodology was employed on the transformed dataset for species identification. The proposed approach outperformed similarity-based, tree-based, diagnostic-based approaches and found comparable with existing supervised learning based approaches in terms of species identification success rate, while compared using real and simulated datasets. Based on the proposed approach, an online web interface SPIDBAR has also been developed and made freely available at http://cabgrid.res.in:8080/spidbar/ for species identification by the taxonomists. Copyright © 2016 Elsevier B.V. All rights reserved.

Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays

NASA Technical Reports Server (NTRS)

Urakawa, Hidetoshi; El Fantroussi, Said; Smidt, Hauke; Smoot, James C.; Tribou, Erik H.; Kelly, John J.; Noble, Peter A.; Stahl, David A.

2003-01-01

The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis (38 nucleotides) and Nitrosomonas eutropha (39 nucleotides) were hybridized to perfect-match probes (18-mer and 19-mer) and to a set of probes having all possible single-base-pair mismatches. The melting profiles of all probe-target duplexes were determined in parallel by using an imposed temperature step gradient. We derived an optimum wash temperature for each probe and target by using a simple formula to calculate a discrimination index for each temperature of the step gradient. This optimum corresponded to the output of an independent analysis using a customized neural network program. These results together provide an experimental and analytical framework for optimizing mismatch discrimination among all probes on a DNA microarray.

Effect of chain length on the conformation and T cell recognition of synthetic hemagglutinin fragments

NASA Astrophysics Data System (ADS)

Tóth, Gábor K.; Holly, Sándor; Majer, Zsuzsa; Hollósi, Miklós; Rajnavölgyi, Éva; Laczkó, Ilona

2000-01-01

Circular dichroism and Fourier-transform infrared spectroscopies were used to compare the conformational mobility of 13-mer peptides covering the 317-329 region of the envelope protein hemagglutinin of human influenza A virus subtypes H1, H2 and H3 with that of their truncated deca- and nonapeptide analogs. These peptides were demonstrated to bind to the murine I-E d major histocompatibility complex encoded class II and human HLA-B*2705 class I molecules. Despite the amino acid substitutions in the three 13-mer subtype sequences, no significant differences in the conformational properties could be shown. Deletion of the N-terminal three residues resulted in a shift to an increased α-helical conformer population in the 317-329 H1 peptide and the breakage of the 3 10 or weakly H-bonded (nascent) α-helix in the H2 and H3 peptides. The conformational change observed upon deletion did not influence the efficiency of I-E d-peptide interaction, however, the C-terminal Arg had a beneficial effect both on MHC class II and class I binding without causing any remarkable change in solution conformation.

SlideSort: all pairs similarity search for short reads

PubMed Central

Shimizu, Kana; Tsuda, Koji

2011-01-01

Motivation: Recent progress in DNA sequencing technologies calls for fast and accurate algorithms that can evaluate sequence similarity for a huge amount of short reads. Searching similar pairs from a string pool is a fundamental process of de novo genome assembly, genome-wide alignment and other important analyses. Results: In this study, we designed and implemented an exact algorithm SlideSort that finds all similar pairs from a string pool in terms of edit distance. Using an efficient pattern growth algorithm, SlideSort discovers chains of common k-mers to narrow down the search. Compared to existing methods based on single k-mers, our method is more effective in reducing the number of edit distance calculations. In comparison to backtracking methods such as BWA, our method is much faster in finding remote matches, scaling easily to tens of millions of sequences. Our software has an additional function of single link clustering, which is useful in summarizing short reads for further processing. Availability: Executable binary files and C++ libraries are available at http://www.cbrc.jp/~shimizu/slidesort/ for Linux and Windows. Contact: slidesort@m.aist.go.jp; shimizu-kana@aist.go.jp Supplementary information: Supplementary data are available at Bioinformatics online. PMID:21148542

Carbo-biphenyls and Carbo-terphenyls: Oligo(phenylene ethynylene) Ring Carbo-mers.

PubMed

Zhu, Chongwei; Poater, Albert; Duhayon, Carine; Kauffmann, Brice; Saquet, Alix; Maraval, Valérie; Chauvin, Remi

2018-05-14

Ring carbo-mers of oligo(phenylene ethynylene)s (OPEn, n=0-2), made of C 2 -catenated C 18 carbo-benzene rings, have been synthesized and characterized by NMR and UV-vis spectroscopy, crystallography and voltammetry. Analyses of crystal and DFT-optimized structures show that the C 18 rings preserve their individual aromatic character according to structural and magnetic criteria (NICS indices). Carbo-terphenyls (n=2) are reversibly reduced at ca. -0.42 V/SCE, i.e. 0.41 V more readily than the corresponding carbo-benzene (-0.83 V/SCE), thus revealing efficient inter-ring π-conjugation. An accurate linear fit of E 1/2 red1 vs. the DFT LUMO energy suggests a notably higher value (-0.30 V/SCE) for a carbo-quaterphenyl congener (n=3). Increase with n of the effective π-conjugation is also evidenced by a red shift of two of the three main visible light absorption bands, all being assigned to TDDFT-calculated excited states, one of them restricting to a HOMO→LUMO main one-electron transition. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Role of Clinical Endoscopy in Emphasizing Endoscope Disinfection

PubMed Central

Ryu, Ji Kon; Kim, Eun Young; Kwon, Kwang An; Choi, Il Ju

2015-01-01

Based on the unexpected Middle East respiratory syndrome (MERS) outbreak in Korea, it was established that the virus can spread easily, MERS exposure in hospitals carries an extreme risk for infection as well as mortality, and the sharing of information was essential for infection control. Although the incidence of exogenous infections related to contaminated endoscopes is very low, the majority of published outbreaks have been caused by various shortcomings in reprocessing procedures, including insufficient training or awareness. Ever since the inauguration of "Clinical Endoscopy" as an English-language journal of the Korean Society of Gastrointestinal Endoscopy in 2011, it has published several articles on disinfection of the endoscope and its accessories. Many Science Citation Index journals have also emphasized high-level disinfection of the gastrointestinal endoscope. Many papers have been produced specifically, since the outbreak of carbapenem-resistant Enterobacteriaceae in 2013. The recent review papers concluded that quality control is the most important issue among all the aspects of procedural care, including the efficiency of the gastrointestinal endoscopy unit and reprocessing room. Thorough reprocessing of endoscopes using high-level disinfection and sterilization methods may be essential for reducing the risk of infection. PMID:26473114

Two novel solvent system compositions for protected synthetic peptide purification by centrifugal partition chromatography.

PubMed

Amarouche, Nassima; Giraud, Matthieu; Forni, Luciano; Butte, Alessandro; Edwards, F; Borie, Nicolas; Renault, Jean-Hugues

2014-04-11

Protected synthetic peptide intermediates are often hydrophobic and not soluble in most common solvents. They are thus difficult to purify by preparative reversed-phase high-performance liquid chromatography (RP-HPLC), usually used for industrial production. It is then challenging to develop alternative chromatographic purification processes. Support-free liquid-liquid chromatographic techniques, including both hydrostatic (centrifugal partition chromatography or CPC) and hydrodynamic (counter-current chromatography or CCC) devices, are mainly involved in phytochemical studies but have also been applied to synthetic peptide purification. In this framework, two new biphasic solvent system compositions covering a wide range of polarity were developed to overcome solubility problems mentioned above. The new systems composed of heptane/tetrahydrofuran/acetonitrile/dimethylsulfoxide/water and heptane/methyl-tetrahydrofuran/N-methylpyrrolidone/water were efficiently used for the CPC purification of a 39-mer protected exenatide (Byetta®) and a 8-mer protected peptide intermediate of bivalirudin (Angiox®) synthesis. Phase compositions of the different biphasic solvent systems were determined by (1)H nuclear magnetic resonance. Physico-chemical properties including viscosity, density and interfacial tension of these biphasic systems are also described. Copyright © 2014 Elsevier B.V. All rights reserved.

Characterization and potential application in mercury bioremediation of highly mercury-resistant marine bacterium Bacillus thuringiensis PW-05.

PubMed

Dash, Hirak R; Mangwani, Neelam; Das, Surajit

2014-02-01

Bacillus thuringiensis PW-05 was isolated from the Odisha coast and was found to resist 50 ppm of Hg as HgCl2 as well as higher concentrations of CdCl2, ZnSO4, PbNO3 and Na2HAsO4. Resistance towards several antibiotics, viz amoxycillin, ampicillin, methicillin, azithromycin and cephradine (CV) was also observed. The mer operon possessed by most of the mercury-resistant bacteria was also found in this isolate. Atomic absorption spectroscopy revealed that the isolate can volatilize >90 % of inorganic mercury. It showed biofilm formation in the presence of 50 ppm HgCl2 and can produce exopolysaccharide under same conditions. The isolate was found to volatilize mercury efficiently under a wide range of environmental parameters, i.e. pH (7 to 8), temperature (25 °C to 40 °C) and salinity (5 to 25 ppt). merA gene expression has been confirmed by real-time reverse transcriptase PCR study. Fourier transform infrared study revealed that -SH and -COOH groups play a major role in the process of adaptation to Hg. Hence, this isolate B. thuringiensis PW-05 shows an interesting potential for bioremediation of mercury.

Unraveling the drivers of MERS-CoV transmission

PubMed Central

Cauchemez, Simon; Nouvellet, Pierre; Cori, Anne; Jombart, Thibaut; Clapham, Hannah; Moore, Sean; Mills, Harriet Linden; Salje, Henrik; Collins, Caitlin; Rodriquez-Barraquer, Isabel; Riley, Steven; Truelove, Shaun; Algarni, Homoud; Alhakeem, Rafat; AlHarbi, Khalid; Turkistani, Abdulhafiz; Aguas, Ricardo J.; Cummings, Derek A. T.; Van Kerkhove, Maria D.; Donnelly, Christl A.; Lessler, Justin; Fraser, Christophe; Al-Barrak, Ali; Ferguson, Neil M.

2016-01-01

With more than 1,700 laboratory-confirmed infections, Middle East respiratory syndrome coronavirus (MERS-CoV) remains a significant threat for public health. However, the lack of detailed data on modes of transmission from the animal reservoir and between humans means that the drivers of MERS-CoV epidemics remain poorly characterized. Here, we develop a statistical framework to provide a comprehensive analysis of the transmission patterns underlying the 681 MERS-CoV cases detected in the Kingdom of Saudi Arabia (KSA) between January 2013 and July 2014. We assess how infections from the animal reservoir, the different levels of mixing, and heterogeneities in transmission have contributed to the buildup of MERS-CoV epidemics in KSA. We estimate that 12% [95% credible interval (CI): 9%, 15%] of cases were infected from the reservoir, the rest via human-to-human transmission in clusters (60%; CI: 57%, 63%), within (23%; CI: 20%, 27%), or between (5%; CI: 2%, 8%) regions. The reproduction number at the start of a cluster was 0.45 (CI: 0.33, 0.58) on average, but with large SD (0.53; CI: 0.35, 0.78). It was >1 in 12% (CI: 6%, 18%) of clusters but fell by approximately one-half (47% CI: 34%, 63%) its original value after 10 cases on average. The ongoing exposure of humans to MERS-CoV from the reservoir is of major concern, given the continued risk of substantial outbreaks in health care systems. The approach we present allows the study of infectious disease transmission when data linking cases to each other remain limited and uncertain. PMID:27457935

Phenomenological Partial Specific Volumes for G-Quadruplex DNAs

PubMed Central

Hellman, Lance M.; Rodgers, David W.; Fried, Michael G.

2009-01-01

Accurate partial specific volume (ν̄) values are required for sedimentation velocity and sedimentation equilibrium analyses. For nucleic acids, the estimation of these values is complicated by the fact that ν̄ depends on base composition, secondary structure, solvation and the concentrations and identities of ions in the surrounding buffer. Here we describe sedimentation equilibrium measurements of the apparent isopotential partial specific volume φ′ for two G-quadruplex DNAs and a single-stranded DNA of similar molecular weight and base composition. The G-quadruplex DNAs are a 22 nucleotide fragment of the human telomere consensus sequence and a 27 nucleotide fragment from the human c-myc promoter. The single-stranded DNA is 26 nucleotides long and is designed to have low propensity to form secondary structures. Parallel measurements were made in buffers containing NaCl and in buffers containing KCl, spanning the range 0.09M ≤ [salt] ≤ 2.3M. Limiting values of φ′, extrapolated to [salt] = 0M, were: 22-mer (NaCl-form), 0.525 ± 0.004 mL/g; 22-mer (KCl-form), 0.531 ± 0.006 mL/g; 27-mer (NaCl-form), 0.548 ± 0.005 mL/g; 27-mer (KCl-form), 0.557 ± 0.006 mL/g; 26-mer (NaCl-form), 0.555 ± 0.004 mL/g; 26-mer (KCl-form), 0.564 ± 0.006 mL/g. Small changes in φ′ with [salt] suggest that large changes in counterion association or hydration are unlikely to take place over these concentration ranges. PMID:19238377

Membrane estrogen receptors - is it an alternative way of estrogen action?

PubMed

Soltysik, K; Czekaj, P

2013-04-01

The functions of estrogens are relatively well known, however the molecular mechanism of their action is not clear. The classical pathway of estrogen action is dependent on ERα and ERβ which act as transcription factors. The effects of this pathway occur within hours or days. In addition, so-called, non-classical mechanism of steroid action dependent on membrane estrogen receptors (mER) was described. In this mechanism the effects of estrogen action are observed in a much shorter time. Here we review the structure and cellular localization of mER, molecular basis of non-classical mER action, physiological role of mER as well as implications of mER action for cancer biology. Finally, some concerns about the new estrogen receptor - GPER and candidates for estrogen receptors - ER-X and ERx, are briefly discussed. It seems that mER is a complex containing signal proteins (signalosome), as IGF receptor, EGF receptor, Ras protein, adaptor protein Shc, non-receptor kinase c-Src and PI-3K, what rationalizes production of second messengers. Some features of membrane receptors are almost identical if compared to nuclear receptors. Probably, membrane and nuclear estrogen receptors are not separate units, but rather the components of a complex mechanism in which they both cooperate with each other. We conclude that the image of the estrogen receptor as a simple transcription factor is a far-reaching simplification. A better understanding of the mechanisms of estrogen action will help us to design more effective drugs affecting signal pathways depending on both membrane and nuclear receptors.

KENNEDY SPACE CENTER, FLA. - Workers watch as an overhead crane begins to lift the backshell with the Mars Exploration Rover 1 (MER-1) inside. The backshell will be moved and attached to the lower heat shield. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - Workers watch as an overhead crane begins to lift the backshell with the Mars Exploration Rover 1 (MER-1) inside. The backshell will be moved and attached to the lower heat shield. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

KENNEDY SPACE CENTER, FLA. - A closeup of the cruise stage to be mated to the Mars Exploration Rover 2 (MER-2) entry vehicle. The cruise stage includes fuel tanks, thruster clusters and avionics for steering and propulsion. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-2 is scheduled to launch June 5 as MER-A aboard a Delta rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-06

KENNEDY SPACE CENTER, FLA. - A closeup of the cruise stage to be mated to the Mars Exploration Rover 2 (MER-2) entry vehicle. The cruise stage includes fuel tanks, thruster clusters and avionics for steering and propulsion. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-2 is scheduled to launch June 5 as MER-A aboard a Delta rocket from Cape Canaveral Air Force Station.

KENNEDY SPACE CENTER, FLA. - Assembly of the backshell and heat shield surrounding the Mars Exploration Rover 1 (MER-1) is complete. The resulting aeroshell will protect the rover on its journey to Mars. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - Assembly of the backshell and heat shield surrounding the Mars Exploration Rover 1 (MER-1) is complete. The resulting aeroshell will protect the rover on its journey to Mars. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

A Computerized Microelectrode Recording to Magnetic Resonance Imaging Mapping System for Subthalamic Nucleus Deep Brain Stimulation Surgery.

PubMed

Dodani, Sunjay S; Lu, Charles W; Aldridge, J Wayne; Chou, Kelvin L; Patil, Parag G

2018-06-01

Accurate electrode placement is critical to the success of deep brain stimulation (DBS) surgery. Suboptimal targeting may arise from poor initial target localization, frame-based targeting error, or intraoperative brain shift. These uncertainties can make DBS surgery challenging. To develop a computerized system to guide subthalamic nucleus (STN) DBS electrode localization and to estimate the trajectory of intraoperative microelectrode recording (MER) on magnetic resonance (MR) images algorithmically during DBS surgery. Our method is based upon the relationship between the high-frequency band (HFB; 500-2000 Hz) signal from MER and voxel intensity on MR images. The HFB profile along an MER trajectory recorded during surgery is compared to voxel intensity profiles along many potential trajectories in the region of the surgically planned trajectory. From these comparisons of HFB recordings and potential trajectories, an estimate of the MER trajectory is calculated. This calculated trajectory is then compared to actual trajectory, as estimated by postoperative high-resolution computed tomography. We compared 20 planned, calculated, and actual trajectories in 13 patients who underwent STN DBS surgery. Targeting errors for our calculated trajectories (2.33 mm ± 0.2 mm) were significantly less than errors for surgically planned trajectories (2.83 mm ± 0.2 mm; P = .01), improving targeting prediction in 70% of individual cases (14/20). Moreover, in 4 of 4 initial MER trajectories that missed the STN, our method correctly indicated the required direction of targeting adjustment for the DBS lead to intersect the STN. A computer-based algorithm simultaneously utilizing MER and MR information potentially eases electrode localization during STN DBS surgery.

Community case clusters of Middle East respiratory syndrome coronavirus in Hafr Al-Batin, Kingdom of Saudi Arabia: a descriptive genomic study.

PubMed

Memish, Ziad A; Cotten, Matthew; Watson, Simon J; Kellam, Paul; Zumla, Alimuddin; Alhakeem, Rafat F; Assiri, Abdullah; Rabeeah, Abdullah A Al; Al-Tawfiq, Jaffar A

2014-06-01

The Middle East respiratory syndrome coronavirus (MERS-CoV) was first described in September 2012 and to date 86 deaths from a total of 206 cases of MERS-CoV infection have been reported to the WHO. Camels have been implicated as the reservoir of MERS-CoV, but the exact source and mode of transmission for most patients remain unknown. During a 3 month period, June to August 2013, there were 12 positive MERS-CoV cases reported from the Hafr Al-Batin region district in the north east region of the Kingdom of Saudi Arabia. In addition to the different regional camel festivals in neighboring countries, Hafr Al-Batin has the biggest camel market in the entire Kingdom and hosts an annual camel festival. Thus, we conducted a detailed epidemiological, clinical and genomic study to ascertain common exposure and transmission patterns of all cases of MERS-CoV reported from Hafr Al-Batin. Analysis of previously reported genetic data indicated that at least two of the infected contacts could not have been directly infected from the index patient and alternate source should be considered. While camels appear as the likely source, other sources have not been ruled out. More detailed case control studies with detailed case histories, epidemiological information and genomic analysis are being conducted to delineate the missing pieces in the transmission dynamics of MERS-CoV outbreak. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

Evaluation of Serologic and Antigenic Relationships Between Middle Eastern Respiratory Syndrome Coronavirus and Other Coronaviruses to Develop Vaccine Platforms for the Rapid Response to Emerging Coronaviruses

PubMed Central

Agnihothram, Sudhakar; Gopal, Robin; Yount, Boyd L.; Donaldson, Eric F.; Menachery, Vineet D.; Graham, Rachel L.; Scobey, Trevor D.; Gralinski, Lisa E.; Denison, Mark R.; Zambon, Maria; Baric, Ralph S.

2014-01-01

Background. Middle East respiratory syndrome coronavirus (MERS-CoV) emerged in 2012, causing severe acute respiratory disease and pneumonia, with 44% mortality among 136 cases to date. Design of vaccines to limit the virus spread or diagnostic tests to track newly emerging strains requires knowledge of antigenic and serologic relationships between MERS-CoV and other CoVs. Methods. Using synthetic genomics and Venezuelan equine encephalitis virus replicons (VRPs) expressing spike and nucleocapsid proteins from MERS-CoV and other human and bat CoVs, we characterize the antigenic responses (using Western blot and enzyme-linked immunosorbent assay) and serologic responses (using neutralization assays) against 2 MERS-CoV isolates in comparison with those of other human and bat CoVs. Results. Serologic and neutralization responses against the spike glycoprotein were primarily strain specific, with a very low level of cross-reactivity within or across subgroups. CoV N proteins within but not across subgroups share cross-reactive epitopes with MERS-CoV isolates. Our findings were validated using a convalescent-phase serum specimen from a patient infected with MERS-CoV (NA 01) and human antiserum against SARS-CoV, human CoV NL63, and human CoV OC43. Conclusions. Vaccine design for emerging CoVs should involve chimeric spike protein containing neutralizing epitopes from multiple virus strains across subgroups to reduce immune pathology, and a diagnostic platform should include a panel of nucleocapsid and spike proteins from phylogenetically distinct CoVs. PMID:24253287

KENNEDY SPACE CENTER, FLA. - Workers walk with the suspended backshell/ Mars Exploration Rover 1 (MER-1) as it travels across the floor of the Payload Hazardous Servicing Facility. The backshell will be attached to the lower heat shield. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - Workers walk with the suspended backshell/ Mars Exploration Rover 1 (MER-1) as it travels across the floor of the Payload Hazardous Servicing Facility. The backshell will be attached to the lower heat shield. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

Rapid generation of a mouse model for Middle East respiratory syndrome

PubMed Central

Zhao, Jincun; Li, Kun; Wohlford-Lenane, Christine; Agnihothram, Sudhakar S.; Fett, Craig; Zhao, Jingxian; Gale, Michael J.; Baric, Ralph S.; Enjuanes, Luis; Gallagher, Tom; McCray, Paul B.; Perlman, Stanley

2014-01-01

In this era of continued emergence of zoonotic virus infections, the rapid development of rodent models represents a critical barrier to public health preparedness, including the testing of antivirus therapy and vaccines. The Middle East respiratory syndrome coronavirus (MERS-CoV) was recently identified as the causative agent of a severe pneumonia. Given the ability of coronavirus to rapidly adapt to new hosts, a major public health concern is that MERS-CoV will further adapt to replication in humans, triggering a pandemic. No small-animal model for this infection is currently available, but studies suggest that virus entry factors can confer virus susceptibility. Here, we show that mice were sensitized to MERS-CoV infection by prior transduction with adenoviral vectors expressing the human host-cell receptor dipeptidyl peptidase 4. Mice developed a pneumonia characterized by extensive inflammatory-cell infiltration with virus clearance occurring 6–8 d after infection. Clinical disease and histopathological changes were more severe in the absence of type-I IFN signaling whereas the T-cell response was required for virus clearance. Using these mice, we demonstrated the efficacy of a therapeutic intervention (poly I:C) and a potential vaccine [Venezuelan equine encephalitis replicon particles expressing MERS-CoV spike protein]. We also found little protective cross-reactivity between MERS-CoV and the severe acute respiratory syndrome-CoV. Our results demonstrate that this system will be useful for MERS-CoV studies and for the rapid development of relevant animal models for emerging respiratory viral infections. PMID:24599590

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Strength and Deformability of Light-toned Layered Deposits Observed by MER Opportunity: Eagle to Erebus Craters

NASA Astrophysics Data System (ADS)

Okubo, C. H.; Schultz, R. A.; Nahm, A. L.

2007-07-01

The strength and deformability of light-toned layered deposits are estimated based on measurements of porosity from Microscopic Imager data acquired by MER Opportunity during its traverse from Eagle Crater to Erebus Crater.

First Confirmed Case of Middle East Respiratory Syndrome Coronavirus Infection in the Kingdom of Bahrain: In a Saudi Gentleman after Cardiac Bypass Surgery

PubMed Central

Al-Qahtani, Manaf; Al-Tawfiq, Jaffar A.; Bukamal, Nazar

2017-01-01

Middle East Respiratory Syndrome Coronavirus (MERS-CoV) is well known to cause severe respiratory infection and was first reported in the Kingdom of Saudi Arabia in 2012. We report here the first confirmed MERS-CoV infection in the Kingdom of Bahrain in a Saudi gentleman who was admitted electively for coronary bypass surgery, postoperatively developed an acute respiratory illness, and tested positive for MERS-CoV. 40 close contacts, all healthcare workers, were traced and followed with no documented secondary cases. PMID:28948054

Planetary Defense. Department of Defense Cost for the Detection, Exploration, and Rendezvous Mission of Near-Earth Objects

DTIC Science & Technology

1997-01-01

or even impact the Earth. In the past 15 years, research on NEOs has dra­ mati cally increased as astrono mers and ge­ olo gists real ize the Earth...fig. 7). In 1989, astrono mers discov ered an aster­ oid labeled 1989FC after its closest approach to Earth. This illus trates a disturb ing fact...Cur rently only astrono mers on shoestring, aca demic budgets are trying to locate and track NEOs, making esti mates of NEO popu­ la tions very impre

Large-scale machine learning of media outlets for understanding public reactions to nation-wide viral infection outbreaks.

PubMed

Choi, Sungwoon; Lee, Jangho; Kang, Min-Gyu; Min, Hyeyoung; Chang, Yoon-Seok; Yoon, Sungroh

2017-10-01

From May to July 2015, there was a nation-wide outbreak of Middle East respiratory syndrome (MERS) in Korea. MERS is caused by MERS-CoV, an enveloped, positive-sense, single-stranded RNA virus belonging to the family Coronaviridae. Despite expert opinions that the danger of MERS might be exaggerated, there was an overreaction by the public according to the Korean mass media, which led to a noticeable reduction in social and economic activities during the outbreak. To explain this phenomenon, we presumed that machine learning-based analysis of media outlets would be helpful and collected a number of Korean mass media articles and short-text comments produced during the 10-week outbreak. To process and analyze the collected data (over 86 million words in total) effectively, we created a methodology composed of machine-learning and information-theoretic approaches. Our proposal included techniques for extracting emotions from emoticons and Internet slang, which allowed us to significantly (approximately 73%) increase the number of emotion-bearing texts needed for robust sentiment analysis of social media. As a result, we discovered a plausible explanation for the public overreaction to MERS in terms of the interplay between the disease, mass media, and public emotions. Copyright © 2017 Elsevier Inc. All rights reserved.

Multi-Agent Modeling and Simulation Approach for Design and Analysis of MER Mission Operations

NASA Technical Reports Server (NTRS)

Seah, Chin; Sierhuis, Maarten; Clancey, William J.

2005-01-01

A space mission operations system is a complex network of human organizations, information and deep-space network systems and spacecraft hardware. As in other organizations, one of the problems in mission operations is managing the relationship of the mission information systems related to how people actually work (practices). Brahms, a multi-agent modeling and simulation tool, was used to model and simulate NASA's Mars Exploration Rover (MER) mission work practice. The objective was to investigate the value of work practice modeling for mission operations design. From spring 2002 until winter 2003, a Brahms modeler participated in mission systems design sessions and operations testing for the MER mission held at Jet Propulsion Laboratory (JPL). He observed how designers interacted with the Brahms tool. This paper discussed mission system designers' reactions to the simulation output during model validation and the presentation of generated work procedures. This project spurred JPL's interest in the Brahms model, but it was never included as part of the formal mission design process. We discuss why this occurred. Subsequently, we used the MER model to develop a future mission operations concept. Team members were reluctant to use the MER model, even though it appeared to be highly relevant to their effort. We describe some of the tool issues we encountered.

Pervasive sequence patents cover the entire human genome.

PubMed

Rosenfeld, Jeffrey A; Mason, Christopher E

2013-01-01

The scope and eligibility of patents for genetic sequences have been debated for decades, but a critical case regarding gene patents (Association of Molecular Pathologists v. Myriad Genetics) is now reaching the US Supreme Court. Recent court rulings have supported the assertion that such patents can provide intellectual property rights on sequences as small as 15 nucleotides (15mers), but an analysis of all current US patent claims and the human genome presented here shows that 15mer sequences from all human genes match at least one other gene. The average gene matches 364 other genes as 15mers; the breast-cancer-associated gene BRCA1 has 15mers matching at least 689 other genes. Longer sequences (1,000 bp) still showed extensive cross-gene matches. Furthermore, 15mer-length claims from bovine and other animal patents could also claim as much as 84% of the genes in the human genome. In addition, when we expanded our analysis to full-length patent claims on DNA from all US patents to date, we found that 41% of the genes in the human genome have been claimed. Thus, current patents for both short and long nucleotide sequences are extraordinarily non-specific and create an uncertain, problematic liability for genomic medicine, especially in regard to targeted re-sequencing and other sequence diagnostic assays.

Monocyte and plasma expression of TAM ligand and receptor in renal failure: Links to unregulated immunity and chronic inflammation.

PubMed

Lee, Iris J; Hilliard, Brendan A; Ulas, Mehriban; Yu, Daohai; Vangala, Chandan; Rao, Swati; Lee, Jean; Gadegbeku, Crystal A; Cohen, Philip L

2015-06-01

Chronic inflammation is increased in patients with chronic kidney disease (CKD) and contributes to cardiovascular morbidity and mortality. Specific immune mechanisms and pathways that drive and maintain chronic inflammation in CKD are not well described. The TAM ligands (Gas6 and protein S) and receptors (Axl and Mer) have been recently recognized as playing a prominent role in immune regulation. The receptors exist in both soluble and cell-bound forms; the soluble receptors (sAxl and sMer) are believed to compete with the bound receptors and thus inhibit their function. In this study, we determined the expression of cell-bound and soluble TAM proteins in patients with CKD. CKD patients had significantly lower expression of Mer in monocytes, yet increased expression of soluble TAM receptors sAxl and sMer in plasma compared to controls. The metalloproteinase ADAM 17, responsible for cleavage of Mer to its soluble form, was increased in patient monocytes. Elevated levels of soluble TAM receptors were more evident in patients with progressive renal failure. These observations suggest that functional deficiency of TAM receptor-mediated regulation of inflammation may contribute to chronic inflammation in patients with CKD. Copyright © 2015 Elsevier Inc. All rights reserved.

Length of encapsidated cargo impacts stability and structure of in vitro assembled alphavirus core-like particles

NASA Astrophysics Data System (ADS)

Rayaprolu, Vamseedhar; Moore, Alan; Che-Yen Wang, Joseph; Goh, Boon Chong; Perilla, Juan R.; Zlotnick, Adam; Mukhopadhyay, Suchetana

2017-12-01

In vitro assembly of alphavirus nucleocapsid cores, called core-like particles (CLPs), requires a polyanionic cargo. There are no sequence or structure requirements to encapsidate single-stranded nucleic acid cargo. In this work, we wanted to determine how the length of the cargo impacts the stability and structure of the assembled CLPs. We hypothesized that cargo neutralizes the basic region of the alphavirus capsid protein and if the cargo is long enough, it will also act to scaffold the CP monomers together. Experimentally we found that CLPs encapsidating short 27mer oligonucleotides were less stable than CLPs encapsidating 48mer or 90mer oligonucleotides under different chemical and thermal conditions. Furthermore, cryo-EM studies showed there were structural differences between CLPs assembled with 27mer and 48mer cargo. To mimic the role of the cargo in CLP assembly we made a mutant (4D) where we substituted a cluster of four Lys residues in the CP with four Asp residues. We found that these few amino acid substitutions were enough to initiate CLP assembly in the absence of cargo. The cargo-free 4D CLPs show higher resistance to ionic strength and increased temperature compared to wild-type cargo containing CLPs suggesting their CLP assembly mechanism might also be different.

Montmorillonite, Oligonucleotides, RNA and Origin of Life

NASA Astrophysics Data System (ADS)

Ertem, Gözen

2004-12-01

Na-montmorillonite prepared from Volclay by the titration method facilitates the self-condensation of ImpA, the 5'-phosphorimidazolide derivative of adenosine. As was shown by AE-HPLC analysis and selective enzymatic hydrolysis of products, oligo(A)s formed in this reaction are 10 monomer units long and contain 67% 3',5'-phosphodiester bonds (Ferris and Ertem, 1992a). Under the same reaction conditions, 5'-phosphorimidazolide derivatives of cytidine, uridine and guanosine also undergo self-condensation producing oligomers containing up to 12-14 monomer units for oligo(C)s to 6 monomer units for oligo(G)s. In oligo(C)s and oligo(U)s, 75-80% of the monomers are linked by 2',5'-phosphodiester bonds. Hexamer and higher oligomers isolated from synthetic oligo(C)s formed by montmorillonite catalysis, which contain both 3',5'- and 2',5'-linkages, serve as catalysts for the non-enzymatic template directed synthesis of oligo(G)s from activated monomer 2-MeImpG, guanosine 5'-phospho-2-methylimidazolide (Ertem and Ferris, 1996). Pentamer and higher oligomers containing exclusively 2',5'-linkages, which were isolated from the synthetic oligo(C)s, also serve as templates and produce oligo(G)s with both 2',5'- and 3',5'-phosphodiester bonds. Kinetic studies on montmorillonite catalyzed elongation rates of oligomers using the computer program SIMFIT demonstrated that the rate constants for the formation of oligo(A)s increased in the order of 2-mer <3-mer <4-mer ... <7-mer (Kawamura and Ferris, 1994). A decameric primer, dA(pdA)8pA bound to montmorillonite was elongated to contain up to 50 monomer units by daily addition of activated monomer ImpA to the reaction mixture (Ferris, Hill and Orgel, 1996). Analysis of dimer fractions formed in the montmorillonite catalyzed reaction of binary and quaternary mixtures of ImpA, ImpC, 2-MeImpG and ImpU suggested that only a limited number of oligomers could have formed on the primitive Earth rather than equal amounts of all possible isomers (Ertem and Ferris, 2000). Formation of phosphodiester bonds between mononucleotides by montmorillonite catalysis is a fascinating discovery, and a significant step forward in efforts to find out how the first RNA-like oligomers might have formed in the course of chemical evolution. However, as has been pointed out in several publications, these systems should be regarded as models rather than a literal representation of prebiotic chemistry (Orgel, 1998; Joyce and Orgel, 1999; Schwartz, 1999).

Montmorillonite, oligonucleotides, RNA and origin of life

NASA Technical Reports Server (NTRS)

Ertem, Gozen

2004-01-01

Na-montmorillonite prepared from Volclay by the titration method facilitates the self-condensation of ImpA, the 5'-phosphorimidazolide derivative of adenosine. As was shown by AE-HPLC analysis and selective enzymatic hydrolysis of products, oligo(A)s formed in this reaction are 10 monomer units long and contain 67% 3',5'-phosphodiester bonds (Ferris and Ertem, 1992a). Under the same reaction conditions, 5'-phosphorimidazolide derivatives of cytidine, uridine and guanosine also undergo self-condensation producing oligomers containing up to 12-14 monomer units for oligo(C)s to 6 monomer units for oligo(G)s. In oligo(C)s and oligo(U)s, 75-80% of the monomers are linked by 2',5'-phosphodiester bonds. Hexamer and higher oligomers isolated from synthetic oligo(C)s formed by montmorillonite catalysis, which contain both 3',5'- and 2',5'-linkages, serve as catalysts for the non-enzymatic template directed synthesis of oligo(G)s from activated monomer 2-MeImpG, guanosine 5'-phospho-2-methylimidazolide (Ertem and Ferris, 1996). Pentamer and higher oligomers containing exclusively 2',5'-linkages, which were isolated from the synthetic oligo(C)s, also serve as templates and produce oligo(G)s with both 2',5'- and 3',5'-phosphodiester bonds. Kinetic studies on montmorillonite catalyzed elongation rates of oligomers using the computer program SIMFIT demonstrated that the rate constants for the formation of oligo(A)s increased in the order of 2-mer < 3-mer < 4-mer ... < 7-mer (Kawamura and Ferris, 1994). A decameric primer, dA(pdA)8pA bound to montmorillonite was elongated to contain up to 50 monomer units by daily addition of activated monomer ImpA to the reaction mixture (Ferris, Hill and Orgel, 1996). Analysis of dimer fractions formed in the montmorillonite catalyzed reaction of binary and quaternary mixtures of ImpA, ImpC, 2-MeImpG and ImpU suggested that only a limited number of oligomers could have formed on the primitive Earth rather than equal amounts of all possible isomers (Ertem and Ferris, 2000). Formation of phosphodiester bonds between mononucleotides by montmorillonite catalysis is a fascinating discovery, and a significant step forward in efforts to find out how the first RNA-like oligomers might have formed in the course of chemical evolution. However, as has been pointed out in several publications, these systems should be regarded as models rather than a literal representation of prebiotic chemistry (Orgel, 1998; Joyce and Orgel, 1999; Schwartz, 1999).

Planning Mars Memory: Learning from the MER Mission

NASA Technical Reports Server (NTRS)

Charlotte, Linde

2004-01-01

This viewgraph presentation discusses ways in which the lessons learned from a mission can be systematically remembered, retained, and applied by individuals and by an organization as a whole. The presentation cites lessons learned from the Mars Exploration Rover (MER) Mission as examples.

The clinical and virological features of the first imported case causing MERS-CoV outbreak in South Korea, 2015.

PubMed

Lee, Ji Yeon; Kim, You-Jin; Chung, Eun Hee; Kim, Dae-Won; Jeong, Ina; Kim, Yeonjae; Yun, Mi-Ran; Kim, Sung Soon; Kim, Gayeon; Joh, Joon-Sung

2017-07-14

In 2015, the largest outbreak of Middle East respiratory syndrome coronavirus (MERS-CoV) infection outside the Middle East occurred in South Korea. We summarized the epidemiological, clinical, and laboratory findings of the first Korean case of MERS-CoV and analyzed whole-genome sequences of MERS-CoV derived from the patient. A 68-year-old man developed fever and myalgia 7 days after returning to Korea, following a 10-day trip to the Middle East. Before diagnosis, he visited 4 hospitals, potentially resulting in secondary transmission to 28 patients. On admission to the National Medical Center (day 9, post-onset of clinical illness), he presented with drowsiness, hypoxia, and multiple patchy infiltrations on the chest radiograph. He was intubated (day 12) because of progressive acute respiratory distress syndrome (ARDS) and INF-α2a and ribavirin treatment was commenced. The treatment course was prolonged by superimposed ventilator associated pneumonia. MERS-CoV PCR results converted to negative from day 47 and the patient was discharged (day 137), following rehabilitation therapy. The complete genome sequence obtained from a sputum sample (taken on day 11) showed the highest sequence similarity (99.59%) with the virus from an outbreak in Riyadh, Saudi Arabia, in February 2015. The first case of MERS-CoV infection had high transmissibility and was associated with a severe clinical course. The patient made a successful recovery after early treatment with antiviral agents and adequate supportive care. This first case in South Korea became a super-spreader because of improper infection control measures, rather than variations of the virus.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Wenfei; Wang, Ying; Wang, Nianshuang

Middle East respiratory syndrome coronavirus (MERS-CoV) infects host cells through binding the receptor binding domain (RBD) on its spike glycoprotein to human receptor dipeptidyl peptidase 4 (hDPP4). Here, we report identification of critical residues on hDPP4 for RBD binding and virus entry through analysis of a panel of hDPP4 mutants. Based on the RBD–hDPP4 crystal structure we reported, the mutated residues were located at the interface between RBD and hDPP4, which potentially changed the polarity, hydrophobic or hydrophilic properties of hDPP4, thereby interfering or disrupting their interaction with RBD. Using surface plasmon resonance (SPR) binding analysis and pseudovirus infection assay,more » we showed that several residues in hDPP4–RBD binding interface were important on hDPP4–RBD binding and viral entry. These results provide atomic insights into the features of interactions between hDPP4 and MERS-CoV RBD, and also provide potential explanation for cellular and species tropism of MERS-CoV infection. - Highlights: • It has been demonstrated that MERS-CoV infects host cells through binding its envelope spike (S) glycoprotein to the host cellular receptor dipeptidyl peptidase 4 (DPP4). • To identify the critical residues on hDPP4 for RBD binding and virus entry, we constructed a panel of hDPP4 mutants based on structure-guided mutagenesis. • Using surface plasmon resonance (SPR) binding analysis and pseudovirus infection assay, we showed that several residues on hDPP4 had significant impacts on virus/receptor interactions and viral entry. • Our study has provided new insights into the features of interactions between hDPP4 and MERS-CoV RBD, and provides potential explanation for cellular and species tropism of MERS-CoV infection.« less

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers lower the backshell with the Mars Exploration Rover 1 (MER-1) onto the heat shield. The two components form the aeroshell that will protect the rover on its journey to Mars. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers lower the backshell with the Mars Exploration Rover 1 (MER-1) onto the heat shield. The two components form the aeroshell that will protect the rover on its journey to Mars. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.