BioShuttle-mediated Plasmid Transfer

PubMed Central

Braun, Klaus; von Brasch, Leonie; Pipkorn, Ruediger; Ehemann, Volker; Jenne, Juergen; Spring, Herbert; Debus, Juergen; Didinger, Bernd; Rittgen, Werner; Waldeck, Waldemar

2007-01-01

An efficient gene transfer into target tissues and cells is needed for safe and effective treatment of genetic diseases like cancer. In this paper, we describe the development of a transport system and show its ability for transporting plasmids. This non-viral peptide-based BioShuttle-mediated transfer system consists of a nuclear localization address sequence realizing the delivery of the plasmid phNIS-IRES-EGFP coding for two independent reporter genes into nuclei of HeLa cells. The quantification of the transfer efficiency was achieved by measurements of the sodium iodide symporter activity. EGFP gene expression was measured with Confocal Laser Scanning Microscopy and quantified with biostatistical methods by analysis of the frequency of the amplitude distribution in the CLSM images. The results demonstrate that the “BioShuttle”-Technology is an appropriate tool for an effective transfer of genetic material carried by a plasmid. PMID:18026568

High-level fluorescence labeling of gram-positive pathogens.

PubMed

Aymanns, Simone; Mauerer, Stefanie; van Zandbergen, Ger; Wolz, Christiane; Spellerberg, Barbara

2011-01-01

Fluorescence labeling of bacterial pathogens has a broad range of interesting applications including the observation of living bacteria within host cells. We constructed a novel vector based on the E. coli streptococcal shuttle plasmid pAT28 that can propagate in numerous bacterial species from different genera. The plasmid harbors a promoterless copy of the green fluorescent variant gene egfp under the control of the CAMP-factor gene (cfb) promoter of Streptococcus agalactiae and was designated pBSU101. Upon transfer of the plasmid into streptococci, the bacteria show a distinct and easily detectable fluorescence using a standard fluorescence microscope and quantification by FACS-analysis demonstrated values that were 10-50 times increased over the respective controls. To assess the suitability of the construct for high efficiency fluorescence labeling in different gram-positive pathogens, numerous species were transformed. We successfully labeled Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus dysgalactiae subsp. equisimilis, Enterococcus faecalis, Enterococcus faecium, Streptococcus mutans, Streptococcus anginosus and Staphylococcus aureus strains utilizing the EGFP reporter plasmid pBSU101. In all of these species the presence of the cfb promoter construct resulted in high-level EGFP expression that could be further increased by growing the streptococcal and enterococcal cultures under high oxygen conditions through continuous aeration.

[Hypoxia responsive element regulated herpes simplex virus-thymidine kinase system enhances killing effect of gancyclovir on Ewing's sarcoma cell line under hypoxic condition].

PubMed

Si, Ying-jian; Guang, Li-xia; Yuan, Fa-huan; Zhang, Ke-bin

2006-08-01

To find out a possible approach to improve the effectiveness of radiotherapy and chemotherapy for Ewing's sarcoma by constructing a eukaryotic expression vector expressing herpes simplex virus-thymidine kinase (HSV-TK) regulated by hypoxia responsive element (HRE) under hypoxia and to evaluate the effects of this HRE regulated HSV-TK system on killing effect of gancyclovir (GCV) on Ewing's sarcoma cell line SK-ES under hypoxic condition. The HRE was synthesized according to the literature and cloned into the enhancer site of pIRES(2)-EGFP vector to obtain the pHRE recombinant plasmid. The HSV-TK was amplified by PCR and cloned into the multiple clone site of pIRES(2)-EGFP and pHRE to obtain pTK and pHRE-TK recombinant plasmid. The human Ewing's sarcoma cell line SK-ES was transfected by pTK or pHRE-TK recombinant plasmid with liposome and then was exposed to normoxic (21% oxygen) or hypoxic (3% oxygen) condition. The expression of enhanced green fluorescent protein (EGFP) was monitored by fluorescent microscopy. The sensitivity of human Ewing's sarcoma cell line SK-ES transfected with pTK or pHRE-TK recombinant plasmid to the anti-tumour drug GCV was determined with the method of tetrazolium (MTT) after treating with GCV for five days. (1) The result of sequencing showed that the recombinant plasmid pHRE contained HRE, and that the recombinant plasmid pTK and pHRE-TK contained HSV-TK gene in the sense direction. (2) Comparison of fluorescent optical density (FOD) showed that (1) the EGFP FOD value of pHRE and pHRE-TK group cells exposed to hypoxia was significantly higher than those exposed to normoxia (P < 0.01); (2) when the cells were exposed to hypoxia, the EGFP FOD value of pHRE and pHRE-TK group cells was significantly higher than that of pTK and empty vector group (P < 0.01); (3) there was no significant difference among the four groups of cells when they were exposed to normoxia (P > 0.05). (3) Comparison of the sensitivity of four groups of cells to GCV showed that (1) the cells in pHRE-TK and pTK groups were much more sensitive to GCV than the cells in pHRE group under hypoxia condition (P < 0.01), the higher the GCV concentration, the greater the difference; (2) the cells of pHRE-TK group were more sensitive to GCV than those in pTK group under hypoxic condition (P < 0.01), but was almost equally sensitive under normoxic condition (P > 0.05); (3) the pHRE-TK group cells had higher sensitivity to GCV under hypoxia than normoxia (P < 0.01) while the pTK group cells had almost the same sensitivity to GCV under hypoxia and normoxia (P > 0.05). (1) The eukaryotic expression vector expressing herpes simplex virus-thymidine kinase (HSV-TK) regulated by hypoxia responsive element (HRE) under hypoxia was constructed successfully. (2) HRE could up-regulate expression of EGFP by SK-ES cells under hypoxia condition. (3) HRE could enhance the killing effect of HSV-TK/GCV system on human Ewing's sarcoma cell line SK-ES under hypoxic condition.

Intranasal Delivery of pGDNF Nanoparticles for Parkinson's Disease

NASA Astrophysics Data System (ADS)

Harmon, Brendan Trevor

Parkinson's disease (PD) is a progressive neurodegenerative disorder that primarily affects the dopaminergic A9 nigrostriatal tract. For dopamine neurons specifically, glial cell-derived neurotrophic factor (GDNF) has been shown to promote their survival and proliferation both in culture and in vivo. GDNF has also proven to be neuroprotective and restorative in various animal models of PD and some human clinical trials. However, its delivery to the brain has required invasive surgical routes which are not clinically practical for many patients. The main objective of this project was to test intranasal delivery to the brain of a nanoparticle vector incorporating an expression plasmid for GDNF (pGDNF). The intranasal route circumvents the blood-brain barrier, allowing larger sized vectors into the central nervous system while avoiding peripheral distribution. This approach would provide a renewable source of GDNF within the target areas of the brain, the striatum and the substantia nigra (SN) without the need for surgical injections or frequent re-dosing. A PEGylated polylysine compacted plasmid nanoparticle vector (PEG-CK30), developed by Copernicus Therapeutics, Inc., has been shown to transfect neurons and glial cells in vivo while lacking the safety issues present with other vectors. The first goal of this work was to determine if these PEG-CK30 compacted plasmid nanoparticles can successfully transfect cells and express the reporter protein, enhanced green fluorescent protein (eGFP) in the rat brain after intranasal administration. Initial in vivo experiments utilized the expression plasmid pCG, expressing eGFP under the fast-acting cytomegalovirus (CMV) promoter. Intranasal administration of pCG nanoparticles resulted in evidence of transfection of brain cells, as shown both qualitatively, by GFP-immunohistochemistry, and quantitatively, by GFP-ELISA. Expression was detected throughout the rat brain two days post-administration. Following the proof-of-principle study with pCG, a new plasmid was created by Copernicus Therapeutics, Inc. to better mimic their long-lasting pGDNF plasmid while providing both GDNF as well as the reporter function of eGFP. This eGFP-GDNF plasmid was used to monitor expression and cell-types transfected. This expression plasmid, called pUGG, was first characterized in vitro to verify protein expression. Transfection experiments in SHEP-1 neuroblastoma cells, ventral midbrain cultures, and N27 dopaminergic cells all demonstrated that pUGG expressed bioactive eGFP and GDNF. However, cleavage of the two proteins did not occur and the expressed protein emerged as a fusion construct which was not detectable by GDNF-ELISA, although it was detected by GFP-ELISA. The next goal was to determine if pUGG was able to transfect cells in vivo in rat brain. Direct striatal injection of pUGG nanoparticles showed significant eGFP expression at the site of injection both 7 and 14 days post-administration with no difference in eGFP expression between the two time-points. GFP-immunohistochemistry at the striatal injection site revealed expression of eGFP-positive cells as well as evidence of GDNF's bioactivity as indicated by neurite outgrowth. Moving forward, we administered pUGG nanoparticles intranasally to rats and found significant expression seven days later throughout the brain, with highest levels in the forebrain areas (olfactory bulb and frontal cortex). Significant expression was also seen along the rostral-caudal axis of the brain compared with naked pUGG plasmid. The final goal of this work was to examine whether intranasal pGDNF pre-treatment could generate sufficient GDNF to protect SN dopamine neurons after a unilateral 6-hydroxydopmaine (6-OHDA) lesion, a common animal model for PD. Copernicus' pGDNF plasmid was utilized for the neuroprotection experiments to avoid possible confounds due to the GFP fusion produced by pUGG. Tyrosine hydroxylase-immunostaining density was used as a marker for dopamine neurons in the SN and their nerve terminals in the striatum. Dopamine cell counts were also performed in the SN. Intranasal delivery of pGDNF significantly protected dopamine neurons in the rat 6-OHDA model of PD. This was revealed in three ways. First, pGDNF treatments reduced amphetamine-induced circling behavior, suggesting a prevention of dopamine loss on the 6-OHDA-lesioned side. Second, pGDNF increased TH staining density and dopamine cell counts in the SN on the 6-OHDA-lesioned side. This result was direct evidence of neuroprotection of dopamine cell bodies. Third, pGDNF increased TH staining density in the striatum on the 6-OHDA-lesioned side. This result was direct evidence of protection of dopaminergic nerve terminals. Intranasal pGDNF nanoparticles provided greater neuroprotection than naked pGDNF for all measures. This result was consistent with our previous findings that pGDNF nanoparticles produce more GDNF in brain than the naked plasmid. Collectively, these results demonstrate that intranasal delivery of Copernicus' pGDNF nanoparticles has great clinical potential as a new, non-invasive and non-viral gene therapy approach for early stage Parkinson's disease. By promoting recovery of damaged neurons and preventing further cell loss, symptoms may be reversed and disease progression may be stopped.

Expression of red-shifted green fluorescent protein by Escherichia coli O157:H7 as a marker for the detection of cells on fresh produce.

PubMed

Takeuchi, K; Frank, J F

2001-03-01

Escherichia coli O157:H7 was transformed with a plasmid vector red-shifted green fluorescence protein (pEGFP) to express red-shifted green fluorescence protein (EGFP) from Aequorea victoria. The EGFP expression among total cells and nonviable cells was determined at the cellular level by microscopic observation of immunostained and membrane-impermeable, dye-stained cultures, respectively. E. coli O157:H7 retained pEGFP during frozen storage at -80 degrees C. The percentage of EGFP expression was improved by repeated subculturing, reaching 83.4 +/- 0.1%, although the fluorescence intensity varied among cells. A low percentage of EGFP-expressing cells was nonviable. The percentage of EGFP decreased when the culture plate was kept at 4 degrees C, suggesting that some cells lost pEGFP during refrigeration. The storage of the culture suspension in sterile deionized water at 4 degrees C for 24 h reduced the percentage of EGFP expression, indicating that some EGFP was denatured. The application of EGFP as a marker for E. coli O157:H7 on green leaf lettuce, cauliflower, and tomato was evaluated using confocal scanning laser microscopy. EGFP-transformed cells were readily visible under confocal scanning laser microscopy on all produce types. The numbers of E. coli O157:H7 cells detected with EGFP were equivalent to those detected with immunostaining for green leaf lettuce and cauliflower but less for tomato. E. coli O157:H7 attached preferentially to damaged tissues of green leaf lettuce and tomato over intact tissue surfaces and to flowerets of cauliflower than to stem surfaces. EGFP can serve as a marker to characterize E. coli O157:H7 attachment on green leaf lettuce and cauliflower but may not be suitable on tomato.

[Overexpression of SEPP1 inhibits the proliferation and induces cell cycle G2/M arrest of 786-O and 769-P human renal carcinoma cells].

PubMed

Liu, Kan; Zhao, Chaofei; Chen, Jianwen; Wu, Shengpan; Yao, Yuanxin; Wu, Chong; Luo, Guoxiong; Zhang, Xu

2016-06-01

Objective To establish selenoprotein P, plasma 1 (SEPP1) gene recombinant lentiviral vector and investigate the effect of SEPP1 on the proliferation of human clear cell renal cell carcinoma (ccRCC) cells. Methods cDNA sequence of SEPP1 was cloned from the total cDNA of HEK293T cells by PCR. Then, the cDNA fragment was combined with the pLV-EGFP(2A)Puro vector and the constructed plasmid pLV-EGFP(2A)Puro-SEPP1 was transfected into HEK293T cells for packaging the virus. Forty-eight hours after transfected with the virus supernatant, the level of SEPP1 protein in 769-P and 786-O cells were tested by Western blotting. Cells were divided into recombinant lentivirus-infected cells, empty vector lentivirus-infected cells and the blank control cells. Cell proliferation rate was detected by MTS assay, colony forming ability was evaluated by plate clony formation assay and cell cycle change was assayed by flow cytometry after transfected with pLV-EGFP(2A)Puro-SEPP1 or empty pLV-EGFP(2A)Puro vector. Results Enzyme digestion analysis and DNA sequencing showed that the recombinant plasmid pLV-EGFP(2A)Puro-SEPP1 was constructed successfully. After being infected by the virus supernatant, the 786-O and 769-P cells expressed EGFP. Compared with the empty vector group and the blank control group, expression level of SEPP1 in the experimental group was much higher. The cell proliferative ability was inhibited in the cells overexpressing SEPP1, and the colony forming ability of SEPP1-overexpressed cells evidently decreased. Cell cycle was arrested in G2/M phase in 786-O cells overexpressing SEPP1. Conclusion The recombinant plasmid pLV-EGFP(2A)Puro-SEPP1 has been constructed successfully. Overexpression of SEPP1 could significantly reduce the proliferation rate of 786-O and 769P cells, and cause G2/M phase arrest of 786-O cells.

High-Level Fluorescence Labeling of Gram-Positive Pathogens

PubMed Central

Aymanns, Simone; Mauerer, Stefanie; van Zandbergen, Ger; Wolz, Christiane; Spellerberg, Barbara

2011-01-01

Fluorescence labeling of bacterial pathogens has a broad range of interesting applications including the observation of living bacteria within host cells. We constructed a novel vector based on the E. coli streptococcal shuttle plasmid pAT28 that can propagate in numerous bacterial species from different genera. The plasmid harbors a promoterless copy of the green fluorescent variant gene egfp under the control of the CAMP-factor gene (cfb) promoter of Streptococcus agalactiae and was designated pBSU101. Upon transfer of the plasmid into streptococci, the bacteria show a distinct and easily detectable fluorescence using a standard fluorescence microscope and quantification by FACS-analysis demonstrated values that were 10–50 times increased over the respective controls. To assess the suitability of the construct for high efficiency fluorescence labeling in different gram-positive pathogens, numerous species were transformed. We successfully labeled Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus dysgalactiae subsp. equisimilis, Enterococcus faecalis, Enterococcus faecium, Streptococcus mutans, Streptococcus anginosus and Staphylococcus aureus strains utilizing the EGFP reporter plasmid pBSU101. In all of these species the presence of the cfb promoter construct resulted in high-level EGFP expression that could be further increased by growing the streptococcal and enterococcal cultures under high oxygen conditions through continuous aeration. PMID:21731607

The sustained-release behavior and in vitro and in vivo transfection of pEGFP-loaded core-shell-structured chitosan-based composite particles

PubMed Central

Wang, Yun; Lin, Fu-xing; Zhao, Yu; Wang, Mo-zhen; Ge, Xue-wu; Gong, Zheng-xing; Bao, Dan-dan; Gu, Yu-fang

2014-01-01

Novel submicron core-shell-structured chitosan-based composite particles encapsulated with enhanced green fluorescent protein plasmids (pEGFP) were prepared by complex coacervation method. The core was pEGFP-loaded thiolated N-alkylated chitosan (TACS) and the shell was pH- and temperature-responsive hydroxybutyl chitosan (HBC). pEGFP-loaded TACS-HBC composite particles were spherical, and had a mean diameter of approximately 120 nm, as measured by transmission electron microscopy and particle size analyzer. pEGFP showed sustained release in vitro for >15 days. Furthermore, in vitro transfection in human embryonic kidney 293T and human cervix epithelial cells, and in vivo transfection in mice skeletal muscle of loaded pEGFP, were investigated. Results showed that the expression of loaded pEGFP, both in vitro and in vivo, was slow but could be sustained over a long period. pEGFP expression in mice skeletal muscle was sustained for >60 days. This work indicates that these submicron core-shell-structured chitosan-based composite particles could potentially be used as a gene vector for in vivo controlled gene transfection. PMID:25364253

The sustained-release behavior and in vitro and in vivo transfection of pEGFP-loaded core-shell-structured chitosan-based composite particles.

PubMed

Wang, Yun; Lin, Fu-xing; Zhao, Yu; Wang, Mo-zhen; Ge, Xue-wu; Gong, Zheng-xing; Bao, Dan-dan; Gu, Yu-fang

2014-01-01

Novel submicron core-shell-structured chitosan-based composite particles encapsulated with enhanced green fluorescent protein plasmids (pEGFP) were prepared by complex coacervation method. The core was pEGFP-loaded thiolated N-alkylated chitosan (TACS) and the shell was pH- and temperature-responsive hydroxybutyl chitosan (HBC). pEGFP-loaded TACS-HBC composite particles were spherical, and had a mean diameter of approximately 120 nm, as measured by transmission electron microscopy and particle size analyzer. pEGFP showed sustained release in vitro for >15 days. Furthermore, in vitro transfection in human embryonic kidney 293T and human cervix epithelial cells, and in vivo transfection in mice skeletal muscle of loaded pEGFP, were investigated. Results showed that the expression of loaded pEGFP, both in vitro and in vivo, was slow but could be sustained over a long period. pEGFP expression in mice skeletal muscle was sustained for >60 days. This work indicates that these submicron core-shell-structured chitosan-based composite particles could potentially be used as a gene vector for in vivo controlled gene transfection.

Cell-penetrating DNA-binding protein as a safe and efficient naked DNA delivery carrier in vitro and in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Eun-Sung; Yang, Seung-Woo; Hong, Dong-Ki

Non-viral gene delivery is a safe and suitable alternative to viral vector-mediated delivery to overcome the immunogenicity and tumorigenesis associated with viral vectors. Using the novel, human-origin Hph-1 protein transduction domain that can facilitate the transduction of protein into cells, we developed a new strategy to deliver naked DNA in vitro and in vivo. The new DNA delivery system contains Hph-1-GAL4 DNA-binding domain (DBD) fusion protein and enhanced green fluorescent protein (EGFP) reporter plasmid that includes the five repeats of GAL4 upstream activating sequence (UAS). Hph-1-GAL4-DBD protein formed complex with plasmid DNA through the specific interaction between GAL4-DBD and UAS,more » and delivered into the cells via the Hph-1-PTD. The pEGFP DNA was successfully delivered by the Hph-1-GAL4 system, and the EGFP was effectively expressed in mammalian cells such as HeLa and Jurkat, as well as in Bright Yellow-2 (BY-2) plant cells. When 10 {mu}g of pEGFP DNA was intranasally administered to mice using Hph-1-GAL4 protein, a high level of EGFP expression was detected throughout the lung tissue for 7 days. These results suggest that an Hph-1-PTD-mediated DNA delivery strategy may be an useful non-viral DNA delivery system for gene therapy and DNA vaccines.« less

Dextran and protamine-based solid lipid nanoparticles as potential vectors for the treatment of X-linked juvenile retinoschisis.

PubMed

Delgado, Diego; del Pozo-Rodríguez, Ana; Solinís, Maria Ángeles; Avilés-Triqueros, Marcelino; Weber, Bernhard H F; Fernández, Eduardo; Gascón, Alicia R

2012-04-01

The goal of the present study was to analyze the potential application of nonviral vectors based on solid lipid nanoparticles (SLN) for the treatment of ocular diseases by gene therapy, specifically X-linked juvenile retinoschisis (XLRS). Vectors were prepared with SLN, dextran, protamine, and a plasmid (pCMS-EGFP or pCEP4-RS1). Formulations were characterized and the in vitro transfection capacity as well as the cellular uptake and the intracellular trafficking were studied in ARPE-19 cells. Formulations were also tested in vivo in Wistar rat eyes, and the efficacy was studied by monitoring the expression of enhanced green fluorescent protein (EGFP) after intravitreal, subretinal, and topical administration. The presence of dextran and protamine in the SLN improved greatly the expression of retinoschisin and EGFP in ARPE-19 cells. The nuclear localization signals of protamine, its ability to protect the DNA, and a shift in the entry mechanism from caveola-mediated to clathrin-mediated endocytosis promoted by the dextran, justify the increase in transfection. After ocular administration of the dextran-protamine-DNA-SLN complex to rat eyes, we detected the expression of EGFP in various types of cells depending on the administration route. Our vectors were also able to transfect corneal cells after topical application. We have demonstrated the potential usefulness of our nonviral vectors loaded with XLRS1 plasmid and provided evidence for their potential application for the management or treatment of degenerative retinal disorders as well as ocular surface diseases.

Generation of recombinant rotaviruses expressing fluorescent proteins using an optimized reverse genetics system.

PubMed

Komoto, Satoshi; Fukuda, Saori; Ide, Tomihiko; Ito, Naoto; Sugiyama, Makoto; Yoshikawa, Tetsushi; Murata, Takayuki; Taniguchi, Koki

2018-04-18

An entirely plasmid-based reverse genetics system for rotaviruses was established very recently. We improved the reverse genetics system to generate recombinant rotavirus by transfecting only 11 cDNA plasmids for its 11 gene segments under the condition of increasing the ratio of the cDNA plasmids for NSP2 and NSP5 genes. Utilizing this highly efficient system, we then engineered infectious recombinant rotaviruses expressing bioluminescent (NanoLuc luciferase) and fluorescent (EGFP and mCherry) reporters. These recombinant rotaviruses expressing reporters remained genetically stable during serial passages. Our reverse genetics approach and recombinant rotaviruses carrying reporter genes will be great additions to the tool kit for studying the molecular virology of rotavirus, and for developing future next-generation vaccines and expression vectors. IMPORTANCE Rotavirus is one of the most important pathogens causing severe gastroenteritis in young children worldwide. In this paper, we describe a robust and simple reverse genetics system based on only rotavirus cDNAs, and its application for engineering infectious recombinant rotaviruses harboring bioluminescent (NanoLuc) and fluorescent (EGFP and mCherry) protein genes. This highly efficient reverse genetics system and recombinant RVAs expressing reporters could be powerful tools for the study of different aspects of rotavirus replication. Furthermore, they may be useful for next-generation vaccine production for this medically important virus. Copyright © 2018 American Society for Microbiology.

Effect of Estrogen on Mutagenesis in Human Mammary Epithelial Cells

DTIC Science & Technology

2005-06-01

instability remains undefined in most human cancers, it appears to arise from subtle, intragenic mutations of the genes , whose products play a key role in...cells and is less labor-intensive. A G-G or T-G mismatch was introduced into ATG start codon of the enhanced green fluorescent protein (EGFP) gene ...Repair of the G-G or T-G mismatch to G-C or T-A, respectively in the heteroduplex plasmid generates a functional EGFP gene expression. The heteroduplex

Distribution and expression in vitro and in vivo of DNA vaccine against lymphocystis disease virus in Japanese flounder ( Paralichthys olivaceus)

NASA Astrophysics Data System (ADS)

Zheng, Fengrong; Sun, Xiuqin; Liu, Hongzhan; Wu, Xingan; Zhong, Nan; Wang, Bo; Zhou, Guodong

2010-01-01

Lymphocystis disease, caused by the lymphocystis disease virus (LCDV), is a significant worldwide problem in fish industry causing substantial economic losses. In this study, we aimed to develop the DNA vaccine against LCDV, using DNA vaccination technology. We evaluated plasmid pEGFP-N2-LCDV1.3 kb as a DNA vaccine candidate. The plasmid DNA was transiently expressed after liposome transfection into the eukaryotic COS 7 cell line. The distribution and expression of the DNA vaccine (pEGFP-N2-LCDV1.3kb) were also analyzed in tissues of the vaccinated Japanese flounder by PCR, RT-PCR and fluorescent microscopy. Results from PCR analysis indicated that the vaccine-containing plasmids were distributed in injected muscle, the muscle opposite the injection site, the hind intestine, gill, spleen, head, kidney and liver, 6 and 25 days after vaccination. The vaccine plasmids disappeared 100 d post-vaccination. Fluorescent microscopy revealed green fluorescence in the injected muscle, the muscle opposite the injection site, the hind intestine, gill, spleen, head, kidney and liver of fish 48 h post-vaccination, green fluorescence did not appear in the control treated tissue. Green fluorescence became weak at 60 days post-vaccination. RT-PCR analysis indicated that the mcp gene was expressed in all tested tissues of vaccinated fish 6-50 days post-vaccination. These results demonstrate that the antigen encoded by the DNA vaccine is distributed and expressed in all of the tissues analyzed in the vaccinated fish. The antigen would therefore potentially initiate a specific immune response. the plasmid DNA was injected into Japanese flounder ( Paralichthys olivaceus) intramuscularly and antibodies against LCDV were evaluated. The results indicate that the plasmid encoded DNA vaccine could induce an immune response to LCDV and would therefore offer immune protection against LCD. Further studies are required for the development and application of this promising DNA vaccine.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reed, S.A.; Senf, S.M.; Cornwell, E.W.

Research highlights: {yields} Independent inhibition of Foxo, IKK{alpha} and IKK{beta} activities does not alter muscle fiber size in weight bearing muscles. {yields} Inhibition of Foxo activity plus IKK{alpha} or IKK{beta} activities increases muscle fiber size. {yields} Independent inhibition of Foxo and IKK{beta} activities attenuates cast immobilization-induced muscle fiber atrophy. {yields} Disuse muscle fiber atrophy is abolished by inhibition of Foxo activity plus IKK{alpha} or IKK{beta} activities. -- Abstract: Two transcription factor families that are activated during multiple conditions of skeletal muscle wasting are nuclear factor {kappa}B (NF-{kappa}B) and forkhead box O (Foxo). There is clear evidence that both NF-{kappa}B andmore » Foxo activation are sufficient to cause muscle fiber atrophy and they are individually required for at least half of the fiber atrophy during muscle disuse, but there is no work determining the combined effect of inhibiting these factors during a physiological condition of muscle atrophy. Here, we determined whether inhibition of Foxo activation plus inhibition of NF-{kappa}B activation, the latter by blocking the upstream inhibitor of kappaB kinases (IKK{alpha} and IKK{beta}), would prevent muscle atrophy induced by 7 days of cast immobilization. Results were based on measurements of mean fiber cross-sectional area (CSA) from 72 muscles transfected with 5 different mutant expression plasmids or plasmid combinations. Immobilization caused a 47% decrease in fiber CSA in muscles injected with control plasmids. Fibers from immobilized muscles transfected with dominant negative (d.n.) IKK{alpha}-EGFP, d.n. IKK{beta}-EGFP or d.n. Foxo-DsRed showed a 22%, 57%, and 76% inhibition of atrophy, respectively. Co-expression of d.n. IKK{alpha}-EGFP and d.n. Foxo-DsRed significantly inhibited 89% of the immobilization-induced fiber atrophy. Similarly, co-expression of d.n. IKK{beta}-EGFP and d.n. Foxo-DsRed inhibited the immobilization-induced fiber atrophy by 95%. These findings demonstrate that the combined effects of inhibiting immobilization-induced NF-{kappa}B and Foxo transcriptional activity has an additive effect on preventing immobilization-induced atrophy, indicating that NF-{kappa}B and Foxo have a cumulative effect on atrophy signaling and/or atrophy gene expression.« less

Efficient production of antibody Fab fragment by transient gene expression in insect cells.

PubMed

Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki

2017-08-01

Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Application of the Cre/loxP Site-Specific Recombination System for Gene Transformation in Aurantiochytrium limacinum.

PubMed

Sun, Hengyi; Chen, Hao; Zang, Xiaonan; Hou, Pan; Zhou, Bingbing; Liu, Yuantao; Wu, Fei; Cao, Xiaofei; Zhang, Xuecheng

2015-06-01

The Cre/loxP site-specific recombination system was applied to Aurantiochytrium limacinum to obtain a transformant without the antibiotic resistance marker gene. First, the enhanced green fluorescent protein gene (egfp) and chloramphenicol resistance gene (Cmr), along with the two loxP loci, were integrated into the genome of A. limacinum OUC88 using 18S rDNA sequences as the homologous recombination sites. Then plasmid pSH65, containing a zeocin resistance gene (Bler) was transferred into A. limacinum OUC_CG. After induction with galactose, repeated passage in culture and PCR-based assessment, the pSH65 plasmid was lost and A. limacinum OUC_EG host was shown to no longer have resistance to 100 mg chloramphenicol/L or 5 mg zeocin/L. Through southern blotting and fluorescence detection, egfp was found to be integrated into the genome of A. limacinum OUC_EG, and EGFP was successfully expressed in the cells. The successful application of the Cre/loxP system demonstrates an experimental basis for genetic modification of A. limacinum so as to obtain transformed strains with no antibiotic resistance marker genes.

Using rabies virus vaccine strain SRV9 as viral vector to express exogenous gene.

PubMed

Wang, Hualei; Jin, Hongli; Feng, Na; Zheng, Xuexing; Li, Ling; Qi, Yinglin; Liang, Meng; Zhao, Yongkun; Wang, Tiecheng; Gao, Yuwei; Tu, Changchun; Jin, Ningyi; Yang, Songtao; Xia, Xianzhu

2015-04-01

Rabies virus (RABV) can cause a fatal neurological disease in human and animals, and vaccines were generally applied for the immunoprophylaxis of rabies. Here, a recombinant viral vector carrying the exogenous gene expression component between phosphoprotein (P) and matrix protein (M) genes of RABV was constructed based on the vaccine strain SRV9 used in China. To develop a reverse genetic system, the full-length cDNA plasmids of SRV9 were constructed using the eukaryotic expression vector pCI or pcDNA3.1(+). However, recovery efficiency based on the pcDNA3.1 vector was significantly higher than that of the pCI vector. The exogenous gene expression component PE-PS-BsiWI-PmeI or PS-BsiWI-PmeI-PE was introduced in different locations between the P and M genes of SRV9. When the enhanced green fluorescent protein (eGFP) was used as a reporter gene, both locations could rescue recombinant RABV (rRABV) expressing eGFP with high efficiency. Characterization of rRABV expressing eGFP in vitro revealed that its growth was similar to that of the parental virus. Animal experiments showed that rRABV expressing eGFP could replicate and express eGFP in the brains of suckling mice. Furthermore, rRABV of SRV9 was nonpathogenic for 3-week-old mice and could be cleared from the central nervous system at 5 days post-inoculation. Our results showed that the recombinant SRV9 virus could be used as a useful viral vector for exogenous gene expression.

Inducible expression of photoacoustic reporter gene tyrosinase in cells using a single plasmid

NASA Astrophysics Data System (ADS)

Paproski, Robert J.; Zemp, Roger J.

2012-02-01

We have previously demonstrated that tyrosinase is a reporter gene for photoacoustic imaging since tyrosinase is the rate-limiting step in the synthesis of melanin, a pigment capable of producing strong photoacoustic signals. We previously created a cell line capable of inducible tyrosinase expression (important due to toxicity of melanin) by stably transfecting tyrosinase in MCF-7 Tet-OnR cell line (Clontech) which expresses a doxycycline-controlled transactivator. Unfortunately, Clontech provides few Tet-On Advanced cell lines making it difficult to have inducible tyrosinase expression in cell lines not provided by Clontech. In order to simplify the creation of cell lines with inducible expression of tyrosinase, we created a single plasmid that encodes both the transactivator as well as tyrosinase. PCR was used to amplify both the transactivator and tyrosinase from the Tet-OnR Advanced and pTRE-Tight-TYR plasmids, respectively. Both PCR products were cloned into the pEGFP-N1 plasmid and the newly created plasmid was transfected into ZR-75-1, MCF-7, and MIA PaCa-1 cells using lipofectamine. After several days, brown melanin was only observed in cells incubated with doxycycline, suggesting that the newly created single plasmid allowed inducible tyrosinase expression in many different cells lines.

The study of the intercellular trafficking of the fusion proteins of herpes simplex virus protein VP22.

PubMed

Xue, Xiaodong; Huang, Jianhua; Wang, Huishan

2014-01-01

Genetic modifications can improve the therapeutic efficacy of mesenchymal stem cell (MSC) transplantation in myocardial infarction. However, so far, the efficiency of MSC modification is very low. Seeking for a more efficient way of MSC modification, we investigated the possibility of employing the intercellular trafficking capacity of the herpes simplex virus type-1 tegument protein VP22 on the enhancement of MSC modification. Plasmids pVP22-myc, pVP22-EGFP, pEGFP-VP22, pVP22-hBcl-xL and phBcl-xL-VP22 were constructed for the expressions of the myc-tagged VP22 and the fusion proteins VP22-EGFP, EGFP-VP22, VP22-hBcl-xL and hBcl-xL-VP22. MSCs were isolated from rat bone marrow and the surface markers were identified by Flowcytometry. COS-1 cells were transfected with the above plasmids and co-cultured with untransfected MSCs, the intercellular transportations of the constructed proteins were studied by immunofluorescence. The solubility of VP22-hBcl-xL and hBcl-xL-VP22 was analyzed by Western blot. VP22-myc could be expressed in and spread between COS-1 cells, which indicates the validity of our VP22 expression construct. Flowcytometry analysis revealed that the isolated MSCs were CD29, CD44, and CD90 positive and were negative for the hematopoietic markers, CD34 and CD45. The co-culturing and immunofluorescence assay showed that VP22-myc, VP22-EGFP and EGFP-VP22 could traffic between COS-1 cells and MSCs, while the evidence of intercellular transportation of VP22-hBcl-xL and hBcl-xL-VP22 was not detected. Western blot analysis showed that VP22-hBcl-xL and hBcl-xL-VP22 were both insoluble in the cell lysate suggesting interactions of the fusion proteins with other cellular components. The intercellular trafficking of VP22-myc, VP22-EGFP and EGFP-VP22 between COS-1 cells and MSCs presents an intriguing prospect in the therapeutic application of VP22 as a delivery vehicle which enhances genetic modifications of MSCs. However, VP22-hBcl-xL and hBcl-xL-VP22 failed to spread between cells, which are due to the insolubility of the fusion protein incurred by interactions with other cellular components.

The Study of the Intercellular Trafficking of the Fusion Proteins of Herpes Simplex Virus Protein VP22

PubMed Central

Xue, Xiaodong; Huang, Jianhua; Wang, Huishan

2014-01-01

Background Genetic modifications can improve the therapeutic efficacy of mesenchymal stem cell (MSC) transplantation in myocardial infarction. However, so far, the efficiency of MSC modification is very low. Seeking for a more efficient way of MSC modification, we investigated the possibility of employing the intercellular trafficking capacity of the herpes simplex virus type-1 tegument protein VP22 on the enhancement of MSC modification. Methods Plasmids pVP22-myc, pVP22-EGFP, pEGFP-VP22, pVP22-hBcl-xL and phBcl-xL-VP22 were constructed for the expressions of the myc-tagged VP22 and the fusion proteins VP22-EGFP, EGFP-VP22, VP22-hBcl-xL and hBcl-xL-VP22. MSCs were isolated from rat bone marrow and the surface markers were identified by Flowcytometry. COS-1 cells were transfected with the above plasmids and co-cultured with untransfected MSCs, the intercellular transportations of the constructed proteins were studied by immunofluorescence. The solubility of VP22-hBcl-xL and hBcl-xL-VP22 was analyzed by Western blot. Results VP22-myc could be expressed in and spread between COS-1 cells, which indicates the validity of our VP22 expression construct. Flowcytometry analysis revealed that the isolated MSCs were CD29, CD44, and CD90 positive and were negative for the hematopoietic markers, CD34 and CD45. The co-culturing and immunofluorescence assay showed that VP22-myc, VP22-EGFP and EGFP-VP22 could traffic between COS-1 cells and MSCs, while the evidence of intercellular transportation of VP22-hBcl-xL and hBcl-xL-VP22 was not detected. Western blot analysis showed that VP22-hBcl-xL and hBcl-xL-VP22 were both insoluble in the cell lysate suggesting interactions of the fusion proteins with other cellular components. Conclusions The intercellular trafficking of VP22-myc, VP22-EGFP and EGFP-VP22 between COS-1 cells and MSCs presents an intriguing prospect in the therapeutic application of VP22 as a delivery vehicle which enhances genetic modifications of MSCs. However, VP22-hBcl-xL and hBcl-xL-VP22 failed to spread between cells, which are due to the insolubility of the fusion protein incurred by interactions with other cellular components. PMID:24955582

Functional characterization of Pol III U6 promoters for gene knockdown and knockout in Plutella xylostella.

PubMed

Huang, Yuping; Wang, Yajun; Zeng, Baosheng; Liu, Zhaoxia; Xu, Xuejiao; Meng, Qian; Huang, Yongping; Yang, Guang; Vasseur, Liette; Gurr, Geoff M; You, Minsheng

2017-10-01

RNA polymerase type III (Pol-III) promoters such as U6 are commonly used to express small RNAs, including short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs). Functional U6 promoters are widely used in CRISPR systems, and their characterization can facilitate genome editing of non-model organisms. In the present study, six U6 small nuclear RNA (snRNA) promoters containing two conserved elements of a proximal sequence element (PSEA) and a TATA box, were identified and characterized in the diamondback moth (Plutella xylostella) genome. Relative efficiency of the U6 promoters to express shRNA induced EGFP knockdown was tested in a P. xylostella cell line, revealing that the PxU6:3 promoter had the strongest expression effect. Further work with the PxU6:3 promoter showed its efficacy in EGFP knockout using CRISPR/Cas9 system in the cells. The expression plasmids with versatile Pxabd-A gene specific sgRNA driven by the PxU6:3 promoter, combined with Cas9 mRNA, could induce mutagenesis at specific genomic loci in vivo. The phenotypes induced by sgRNA expression plasmids were similar to those done in vitro transcription sgRNAs. A plasmid with two tandem arranged PxU6:3:sgRNA expression cassettes targeting Pxabd-A loci was generated, which caused a 28,856 bp fragment deletion, suggesting that the multi-sgRNA expression plasmid can be used for multi-targeting. Our work indicates that U6 snRNA promoters can be used for functional studies of genes with the approach of reverse genetics in P. xylostella. These essential promoters also provide valuable potential for CRISPR-derived gene drive as a tactic for population control in this globally significant pest. Copyright © 2017 Elsevier Ltd. All rights reserved.

[Zinc-dependent metalloprotease 1 promotes apoptosis of RAW264.7 macrophages].

PubMed

Li, Peng; He, Yonglin; Zhang, Jiming; Fang, Chencheng

2015-12-01

To construct the eukaryotic expression vector of zinc-dependent metalloprotease 1 (zmp1) gene from Bacillus Calmette-Guerin (BCG) and investigate its impact on the apoptosis of RAW264.7 macrophages. Zmp1 gene was amplified from the genome of BCG by PCR. The zmp1 gene fragment was inserted into multiple cloning sites of pEGFP-N1 to construct the eukaryotic expression vector pEGFP-N1-zmp1. The constructed pEGFP-N1-zmp1 was transfected into RAW264.7 cells by Lipofectamine(TM) 2000. The expression of green fluorescent protein (GFP) was observed by fluorescence microscopy. The zmp1 mRNA was detected by quantitative real-time PCR (qR-PCR). The effect of Zmp1 protein on the apoptosis of RAW264.7 macrophages was detected by flow cytometry (FCM). With zmp1 gene amplified by PCR, we successfully constructed the recombinant vector pEGFP-N1-zmp1 as demonstrated by restriction enzyme analysis and sequencing. GFP was seen in RAW264.7 cells 24 hours after transfected with the recombinant plasmid. As qRT-PCR showed, the expression level of zmp1 mRNA was up-regulated. The early apoptotic rate increased 48 hours after transfection. The increased expression of Zmp1 in RAW264.7 cells promotes the apoptosis of RAW264.7 cells.

Effects of exogenous IL-37 on the biological characteristics of human lung adenocarcinoma A549 cells and the chemotaxis of regulatory T cells.

PubMed

Chen, Yu-Hua; Zhou, Bi-Yun; Wu, Guo-Cai; Liao, De-Quan; Li, Jing; Liang, Si-Si; Wu, Xian-Jin; Xu, Jun-Fa; Chen, Yong-Hua; Di, Xiao-Qing; Lin, Qiong-Yan

2018-02-14

This study aims to investigate the effects of exogenous interleukin (IL)-37 on the biological characteristics of human lung adenocarcinoma A549 cells and the chemotaxis of regulatory T (Treg) cells. After isolating the CD4+ CD25+ Treg cells from the peripheral blood, flow cytometry was used to detect the purity of the Treg cells. A549 cells were divided into blank (no transfection), empty plasmid (transfection with pIRES2-EGFP empty plasmid) or IL-37 group (transfection with pIRES2-EGFP-IL-37 plasmid). RT-PCR was used to detect mRNA expression of IL-37 and ELISA to determine IL-37 and MMP-9 expressions. Western blotting was applied to detect the protein expressions of PCNA, Ki-67, Cyclin D1, CDK4, cleaved caspase-3 and cleaved caspase-9. MTT assay, flow cytometry, scratch test and transwell assay were performed to detect cell proliferation, cycle, apoptosis, migration and invasion. Effect of exogenous IL-37 on the chemotaxis of Treg cells was measured through transwell assay. Xenograft models in nude mice were eastablished to detect the impact of IL-37 on A549 cells. The IL-37 group had a higher IL-37 expression, cell apoptosis in the early stage and percentage of cells in the G0/G1 phase than the blank and empty plasmid groups. The IL-37 group had a lower MMP-9 expression, optical density (OD), percentage of cells in the S and G2/M phases, migration, invasion and chemotaxis of CD4+CD25+ Foxp3+ Treg cells. The xenograft volume and weight of nude mice in the IL-37 group were lower than those in the blank and empty plasmid groups. Compared with the blank and empty plasmid groups, the IL-37 group had significantly reduced expression of PCNA, Ki-67, Cyclin D1 and CDK4 but elevated expression of cleaved caspase-3 and cleaved caspase-9. Therefore, exogenous IL-37 inhibits the proliferation, migration and invasion of human lung adenocarcinoma A549 cells as well as the chemotaxis of Treg cells while promoting the apoptosis of A549 cells.

[Cloning of Chinese Banna minipig inbred-line alpha1,3-galactosyltransferase gene and construction of its recombinant eukaryotic expression vector].

PubMed

Zhu, Shengming; Wang, Yanping; Zheng, Hong; Cheng, Jingqiu; Lu, Yanrong; Zeng, Yangzhi; Wang, Yu; Wang, Zhu

2009-04-01

This study sought to clone Chinese Banna minipig inbred-line (BMI) alpha1,3-galactosyltransferase (alpha1,3-GT) gene and construct its recombinant eukaryotic expression vector. Total RNA was isolated from BMI liver. Full length cDNA of alpha1,3-GT gene was amplified by RT-PCR and cloned into pMD18-T vector to sequence. Subsequently, alpha1,3-GT gene was inserted into pEGFP-N1 to construct eukaryotic expression vector pEGFP-N1-GT. Then the reconstructed plasmid pEGFP-N1-GT was transiently transfected into human lung cancer cell line A549. The expression of alpha1,3-GT mRNA in transfected cells was detected by RT-PCR. FITC-BS-IB4 lectin was used in the direct immunofluorescence method, which was performed to observe the alpha-Gal synthesis function of BMI alpha1,3-GT in transfected cells. The results showed that full length of BMI alpha1,3-GT cDNA was 1116 bp. BMI alpha1,3-GT cDNA sequence was highly homogenous with those of mouse and bovine, and was exactly the same as the complete sequence of those of swine, pEGFP-N1-GT was confirmed by enzyme digestion and PCR. The expression of alpha1,3-GT mRNA was detected in A549 cells transfected by pEGFP-N1-GT. The expression of alpha-Gal was observed on the membrane of A549 cells transfected by pEGFP-N1-GT. Successful cloning of BMI alpha1,3-GT cDNA and construction of its eukaryotic expression vector have established a foundation for further research and application of BMI alpha1,3-GT in the fields of xenotransplantation and immunological therapy of cancer.

Translational initiation in Leishmania tarentolae and Phytomonas serpens (Kinetoplastida) is strongly influenced by pre-ATG triplet and its 5' sequence context.

PubMed

Lukes, Julius; Paris, Zdenek; Regmi, Sandesh; Breitling, Reinhard; Mureev, Sergey; Kushnir, Susanna; Pyatkov, Konstantin; Jirků, Milan; Alexandrov, Kirill A

2006-08-01

To investigate the influence of sequence context of translation initiation codon on translation efficiency in Kinetoplastida, we constructed a library of expression plasmids randomized in the three nucleotides prefacing ATG of a reporter gene encoding enhanced green fluorescent protein (EGFP). All 64 possible combinations of pre-ATG triplets were individually stably integrated into the rDNA locus of Leishmania tarentolae and the resulting cell lines were assessed for EGFP expression. The expression levels were quantified directly by measuring the fluorescence of EGFP protein in living cells and confirmed by Western blotting. We observed a strong influence of the pre-ATG triplet on the level of protein expression over a 20-fold range. To understand the degree of evolutionary conservation of the observed effect, we transformed Phytomonas serpens, a trypanosomatid parasite of plants, with a subset of the constructs. The pattern of translational efficiency mediated by individual pre-ATG triplets in this species was similar to that observed in L. tarentolae. However, the pattern of translational efficiency of two other proteins (red fluorescent protein and tetracycline repressor) containing selected pre-ATG triplets did not correlate with either EGFP or each other. Thus, we conclude that a conserved mechanism of translation initiation site selection exists in kinetoplastids that is strongly influenced not only by the pre-ATG sequences but also by the coding region of the gene.

Characterization of growth and reproduction performance, transgene integration, expression and transmission patterns in transgenic pigs produced by piggyBac transposition-mediated gene transfer

PubMed Central

Zeng, Fang; Li, Zicong; Cai, Gengyuan; Gao, Wenchao; Jiang, Gelong; Liu, Dewu; Urschitz, Johann; Moisyadi, Stefan; Wu, Zhenfang

2016-01-01

Previously we successfully produced a group of EGFP-expressing founder transgenic pigs by a newly developed efficient and simple pig transgenesis method based on cytoplasmic injection of piggyBac plasmids. In this study, we investigated the growth and reproduction performance, and characterized the transgene insertion, transmission and expression patterns in transgenic pigs generated by piggyBac transposition. Results showed that transgene has no injurious effect on the growth and reproduction of transgenic pigs. Multiple copies of monogenic EGFP transgene were inserted at noncoding sequences of host genome, and passed from founder transgenic pigs to their transgenic offspring in segregation or linkage manner. The EGFP transgene was ubiquitously expressed in transgenic pigs, and its expression intensity was associated with transgene copy number but not related to its promoter DNA methylation level. To the best of our knowledge, this is first study that fully described the growth and reproduction performance, transgene insertion, expression and transmission profiles in transgenic pigs produced by piggyBac system. It not only demonstrates that piggyBac transposition-mediated gene transfer is an effective and favourable approach for pig transgenesis, but also provides scientific information for understanding the transgene insertion, expression and transmission patterns in transgenic animals produced by piggyBac transposition. PMID:27565868

A convenient method of preparing gene vector for real time monitoring transfection process based on the quantum dots

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Hai-Li; Zhang, Ming-Zhen; Li, Xiang-Yong

2012-11-15

Highlights: ► An easy and direct way to prepare QDs–DNA complexes was developed. ► Surface charge of QDs was tuned with different ratio of amino and glycolate. ► Transfection efficiency was dependent on the surface zeta potentials of QDs. ► Cellular toxicity of this gene vectors is much lower than commercial liposome. ► Whole intracellular behavior of QDs–DNA complexes can be monitored in real time. -- Abstract: Nanoparticle carrier has been developed by combining water-soluble quantum dots and plasmid DNA expressed enhanced green fluorescent protein (EGFP) in a convenient and direct way. First the QDs with different surface charges weremore » obtained by coating with amino and carboxyl terminals at different ratios. Then plasmid DNA was conjugated to QDs via electrostatic interaction. The resultant QDs–DNA complexes showed enhanced resistance to DNase I digestion. The following transfection experiments demonstrated that the transfection efficiency was dependent on the surface charges on QDs. The real time imaging of the transfection process showed that the nanoparticles experienced binding, penetrating the cell membrane and entering cytoplasm in the first 6 h of transfection. The green fluorescence of EGFP began to appear after 18 h transfection and plasmid DNA was fully expressed in the following 6 h. This new QDs–DNA platform showed great potential as new gene delivery carrier.« less

bmo-miR-275 down-regulates expression of Bombyx mori sericin gene 2 in vitro

PubMed Central

Qian, Ping; Jiang, Tao; Wang, Xin; Song, Fei; Chen, Chen; Shen, Xingjia

2018-01-01

We hypothesized that bmo-miR-275 has a potential regulatory function regarding the expression of sericin gene 2 (BmSer-2). First, we examined the expression of bmo-miR-275 and its target gene BmSer-2 in seven different tissues from 5th instar day-3 silkworm larvae. The results showed that they were both specifically expressed in the middle silk gland, implying that spatio-temporal conditions are required for bmo-miR-275 to regulate the expression of BmSer-2. To test this hypothesis, we constructed a pri-bmo-miR-275 expressing plasmid pcDNA3.0 [ie1-egfp-pri-bmo-miR-275-SV40] and BmSer-2-3´UTR recombinant reporter plasmids pGL3.0 [A3-luc-Ser-2-3′ UTR-SV40]. Finally, BmN cells were harvested and luciferase activity was detected. Results showed that luciferase activity was reduced significantly (P<0.05) in BmN cells co-transfected with pcDNA3.0 [ie1-egfp-pri-bmo-miR-275-SV40] and pGL3.0 [A3-luc-Ser-2-3’UTR-SV40], suggesting that bmo-miR-275 can down-regulate the expression of BmSer-2 in vitro. Our results improve the understanding of the regulatory function of Bombyx mori miRNA on the expression of genes regulating silk formation. PMID:29381729

NanoSMGT: transgene transmission into bovine embryos using halloysite clay nanotubes or nanopolymer to improve transfection efficiency.

PubMed

Campos, Vinicius Farias; de Leon, Priscila Marques Moura; Komninou, Eliza Rossi; Dellagostin, Odir Antônio; Deschamps, João Carlos; Seixas, Fabiana Kömmling; Collares, Tiago

2011-11-01

The objectives were to investigate whether: 1) nanotransfectants are more effective than other common transfection methods for SMGT; 2) NanoSMGT is able to transmit exogenous DNA molecules to bovine embryos; and 3) halloysite clay nanotubes (HCNs) can be used as a transfection reagent to improve transgene transmission. Four transfection systems were used: naked DNA (without transfectant), lipofection, nanopolymer, and halloysite clay nanotubes. Plasmid uptake by sperm and its transfer to embryos were quantified by conventional and real-time PCR, as well as EGFP expression by fluorescence microscopy. Furthermore, sperm motility and viability, and embryo development were investigated. Mean number of plasmids taken up was affected (P < 0.05) by transfection procedure, with the nanopolymer being the most effective transfectant (∼ 153 plasmids per spermatozoon). None of the treatments affected sperm motility or viability. The mean number of plasmids transmitted to four-cell stage embryos was higher (P < 0.05) in nanopolymer and HCNs than liposomes and naked DNA groups. The number of embryos carrying the transgene increased from 8-10% using naked DNA or liposomes to 40-45% using nanopolymer or HCN as transfectants (P < 0.05). There were no significant differences among transfection procedures regarding blastocyst formation rate of resulting embryos. However, no EGFP-expressing embryo was identified in any treatment. Therefore, nanotransfectants improved transgene transmission in bovine embryos without deleterious effects on embryo development. To our knowledge, this was the first time that bovine embryos carrying a transgene were produced by NanoSMGT. Copyright © 2011 Elsevier Inc. All rights reserved.

Critical design criteria for minimal antibiotic-free plasmid vectors necessary to combine robust RNA Pol II and Pol III-mediated eukaryotic expression with high bacterial production yields

PubMed Central

Carnes, Aaron E.; Luke, Jeremy M.; Vincent, Justin M.; Anderson, Sheryl; Schukar, Angela; Hodgson, Clague P.; Williams, James A.

2010-01-01

Background For safety considerations, regulatory agencies recommend elimination of antibiotic resistance markers and nonessential sequences from plasmid DNA-based gene medicines. In the present study we analyzed antibiotic-free (AF) vector design criteria impacting bacterial production and mammalian transgene expression. Methods Both CMV-HTLV-I R RNA Pol II promoter (protein transgene) and murine U6 RNA Pol III promoter (RNA transgene) vector designs were studied. Plasmid production yield was assessed through inducible fed-batch fermentation. RNA Pol II-directed EGFP and RNA Pol III-directed RNA expression were quantified by fluorometry and quantitative real-time polymerase chain reaction (RT-PCR), respectively, after transfection of human HEK293 cells. Results Sucrose-selectable minimalized protein and therapeutic RNA expression vector designs that combined an RNA-based AF selection with highly productive fermentation manufacturing (>1,000 mg/L plasmid DNA) and high level in vivo expression of encoded products were identified. The AF selectable marker was also successfully applied to convert existing kanamycin-resistant DNA vaccine plasmids gWIZ and pVAX1 into AF vectors, demonstrating a general utility for retrofitting existing vectors. A minimum vector size for high yield plasmid fermentation was identified. A strategy for stable fermentation of plasmid dimers with improved vector potency and fermentation yields up to 1,740 mg/L was developed. Conclusions We report the development of potent high yield AF gene medicine expression vectors for protein or RNA (e.g. short hairpin RNA or microRNA) products. These AF expression vectors were optimized to exceed a newly identified size threshold for high copy plasmid replication and direct higher transgene expression levels than alternative vectors. PMID:20806425

[Establishment and application of a Vero cell line stably expressing raccoon dog SLAM, the cellular receptor of canine distemper virus].

PubMed

Zhao, Jianjun; Yan, Ruxun; Zhang, Hailing; Zhang, Lei; Hu, Bo; Bai, Xue; Shao, Xiqun; Chai, Xiuli; Yan, Xijun; Wu, Wei

2012-12-04

The signaling lymphocyte activation molecule (SLAM, also known as CD150), is used as a cellular receptor by canine distemper virus (CDV). Wild-type strains of CDVs can be isolated and propagated efficiently in non-lymphoid cells expressing this protein. Our aim is to establish a Vero cells expressing raccoon dog SLAM (rSLAM) to efficiently isolate CDV from pathological samples. A eukaryotic expression plasmid, pIRES2-EGFP-rSLAMhis, containing rSLAM gene fused with six histidine-coding sequence, EGFP gene, and neomycin resistance gene was constructed. After transfection with the plasmid, a stable cell line, Vero-rSLAM, was screened from Vero cells with the identification of EGFP reporter and G418 resistance. Three CD positive specimens from infected foxes and raccoon dogs were inoculated to Vero-rSLAM cells for CDV isolation. Foxes and raccoon dogs were inoculated subcutaneously LN (10)fl strain with 4 x 10(2.39)TCID50 dose to evaluate pathogenicity of CDV isolations. The rSLAMh fused gene was shown to transcript and express stably in Vero-rSLAM cells by RT-PCR and Immunohistochemistry assay. Three CDV strains were isolated successfully in Vero-rSLAM cells 36 -48 hours after inoculation with spleen or lung specimens from foxes and raccoon dogs with distemper. By contrast, no CDV was recovered from those CD positive specimens when Vero cells were used for virus isolation. Infected foxes and raccoon dogs with LN(10)f1 strain all showed typical CD symptoms and high mortality (2/3 for foxes and 3/3 for raccoon dogs) in 22 days post challenge. Our results indicate that Vero-rSLAM cells stably expressing raccoon dog SLAM are highly sensitive to CDV in clinical specimens and the CDV isolation can maintain high virulence to its host animals.

Human HOXA5 homeodomain enhances protein transduction and its application to vascular inflammation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Ji Young; Park, Kyoung sook; Cho, Eun Jung

2011-07-01

Highlights: {yields} We have developed an E. coli protein expression vector including human specific gene sequences for protein cellular delivery. {yields} The plasmid was generated by ligation the nucleotides 770-817 of the homeobox A5 mRNA sequence. {yields} HOXA5-APE1/Ref-1 inhibited TNF-alpha-induced monocyte adhesion to endothelial cells. {yields} Human HOXA5-PTD vector provides a powerful research tools for uncovering cellular functions of proteins or for the generation of human PTD-containing proteins. -- Abstract: Cellular protein delivery is an emerging technique by which exogenous recombinant proteins are delivered into mammalian cells across the membrane. We have developed an Escherichia coli expression vector including humanmore » specific gene sequences for protein cellular delivery. The plasmid was generated by ligation the nucleotides 770-817 of the homeobox A5 mRNA sequence which was matched with protein transduction domain (PTD) of homeodomain protein A5 (HOXA5) into pET expression vector. The cellular uptake of HOXA5-PTD-EGFP was detected in 1 min and its transduction reached a maximum at 1 h within cell lysates. The cellular uptake of HOXA5-EGFP at 37 {sup o}C was greater than in 4 {sup o}C. For study for the functional role of human HOXA5-PTD, we purified HOXA5-APE1/Ref-1 and applied it on monocyte adhesion. Pretreatment with HOXA5-APE1/Ref-1 (100 nM) inhibited TNF-{alpha}-induced monocyte adhesion to endothelial cells, compared with HOXA5-EGFP. Taken together, our data suggested that human HOXA5-PTD vector provides a powerful research tools for uncovering cellular functions of proteins or for the generation of human PTD-containing proteins.« less

Osteoblast proliferation is enhanced upon the insulin receptor substrate 1 overexpression via PI3K signaling leading to down-regulation of NFκB and BAX pathway.

PubMed

Ma, H; Ma, J X; Xue, P; Gao, Y; Li, Y K

2015-02-01

The insulin receptor substrate 1 (IRS1) promotes bone formation via osteoblast proliferation mediated by PI3K/Akt signaling. A reduction in NFκB activity in osteoblasts results in an increase in bone formation. The NFκB signaling pathway leads to increased expression of BAX, which contributes to osteoblast apoptosis. The purpose of this study was to investigate the expression of recombinant plasmid enhanced green fluorescent protein-N1 (pEGFP-N1) that transferred IRS1 gene into osteoblasts in vitro and evaluate the effects of IRS1 overexpression on NFκBp65 and on BAX. Osteoblasts were transfected with pEGFP-N1 or pEGFP-N1 encoding wild-type IRS1 (pEGFP-N1-IRS1). Cell cycle analysis was performed using flow cytometry. The expression levels of NFκBp65 and BAX were measured by Western blotting. Our results revealed that overexpression of IRS1 stimulated osteoblast proliferation, as evidenced by an increase in the number of cells in the S phase compared to controls. IRS1 overexpression in osteoblasts activated the PI3K/Akt pathway, and inhibited expression of NFκBp65 and BAX. When osteoblasts transfected with pEGFP-N1-IRS1 were exposed to a PI3K inhibitor (LY294002), the effects of IRS1 overexpression were reversed. On the basis of our study, it seems that osteoblasts proliferated upon IRS1 overexpression due to inhibition of the NFκB pathway and downregulation of BAX through PI3K/Akt signaling. © Georg Thieme Verlag KG Stuttgart · New York.

Enhanced green fluorescent protein (egfp) gene expression in Tetraselmis subcordiformis chloroplast with endogenous regulators.

PubMed

Cui, Yulin; Zhao, Jialin; Hou, Shichang; Qin, Song

2016-05-01

On the basis of fundamental genetic transformation technologies, the goal of this study was to optimize Tetraselmis subcordiformis chloroplast transformation through the use of endogenous regulators. The genes rrn16S, rbcL, psbA, and psbC are commonly highly expressed in chloroplasts, and the regulators of these genes are often used in chloroplast transformation. For lack of a known chloroplast genome sequence, the genome-walking method was used here to obtain full sequences of T. subcordiformis endogenous regulators. The resulting regulators, including three promoters, two terminators, and a ribosome combination sequence, were inserted into the previously constructed plasmid pPSC-R, with the egfp gene included as a reporter gene, and five chloroplast expression vectors prepared. These vectors were successfully transformed into T. subcordiformis by particle bombardment and the efficiency of each vector tested by assessing EGFP fluorescence via microscopy. The results showed that these vectors exhibited higher efficiency than the former vector pPSC-G carrying exogenous regulators, and the vector pRFA with Prrn, psbA-5'RE, and TpsbA showed the highest efficiency. This research provides a set of effective endogenous regulators for T. subcordiformis and will facilitate future fundamental studies of this alga.

DNA-encapsulated magnesium phosphate nanoparticles elicit both humoral and cellular immune responses in mice

PubMed Central

Bhakta, Gajadhar; Nurcombe, Victor; Maitra, Amarnath; Shrivastava, Anju

2014-01-01

The efficacy of pEGFP (plasmid expressing enhanced green fluorescent protein)-encapsulated PEGylated (meaning polyethylene glycol coated) magnesium phosphate nanoparticles (referred to as MgPi-pEGFP nanoparticles) for the induction of immune responses was investigated in a mouse model. MgPi-pEGFP nanoparticles induced enhanced serum antibody and antigen-specific T-lymphocyte responses, as well as increased IFN-? and IL-12 levels compared to naked pEGFP when administered via intravenous, intraperitoneal or intramuscular routes. A significant macrophage response, both in size and activity, was also observed when mice were immunized with the nanoparticle formulation. The response was highly specific for the antigen, as the increase in interaction between macrophages and lymphocytes as well as lymphocyte proliferation took place only when they were re-stimulated with recombinant green fluorescence protein (rGFP). Thus the nanoparticle formulation elicited both humoral as well as cellular responses. Cytokine profiling revealed the induction of Th-1 type responses. The results suggest DNA-encapsulated magnesium phosphate (MgPi) nanoparticles may constitute a safer, more stable and cost-efficient DNA vaccine formulation. PMID:24936399

A CD2-green fluorescence protein-transgenic mouse reveals very late antigen-4-dependent CD8+ lymphocyte rolling in inflamed venules.

PubMed

Singbartl, K; Thatte, J; Smith, M L; Wethmar, K; Day, K; Ley, K

2001-06-15

Intravital microscopy allows detailed analysis of leukocyte trafficking in vivo, but fails to identify the nature of leukocytes investigated. Here, we describe the development of a CD2-enhanced green fluorescence protein (EGFP)-transgenic mouse to characterize lymphocyte trafficking during inflammation in vivo. A CD2-EGFP plasmid construct including the CD2 promoter, the EGFP transgene, and the CD2 locus control region was injected into B6CBA/F1 pronuclei. EGFP+ offspring were backcrossed into C57BL/6 mice for six generations. Flow cytometry demonstrated that all peripheral blood EGFP+ cells were positive for CD2 and negative for the granulocyte Ag Ly 6-G (GR-1). EGFP(high) cells stained positive for CD2, CD3, CD8, TCR beta-chain, and NK1.1 but did not express the B cell and monocyte markers CD45RA, CD19, and CD11b. In vitro stimulation assays revealed no difference in lymphocyte proliferation and IL-2 secretion between EGFP+ and EGFP- mice. Intravital microscopy of untreated or TNF-alpha-treated cremaster muscle venules showed EGFP+ cells in vivo, but these cells did not roll or adhere to the vessel wall. In cremaster muscle venules treated with both TNF-alpha and IFN-gamma, EGFP(high) cells rolled, adhered, and transmigrated at a rolling velocity slightly higher (11 microm/s) than that of neutrophils (10 microm/s). Blocking alpha4 integrin with a mAb increased rolling velocity to 24 microm/s. These findings show that CD8+ T cells roll in TNF-alpha/IFN-gamma-pretreated vessels in vivo via an alpha4 integrin-dependent pathway.

Enhanced p53 gene transfer to human ovarian cancer cells using the cationic nonviral vector, DDC.

PubMed

Kim, Chong-Kook; Choi, Eun-Jeong; Choi, Sung-Hee; Park, Jeong-Sook; Haider, Khawaja Hasnain; Ahn, Woong Shick

2003-08-01

Previously we have formulated a new cationic liposome, DDC, composed of dioleoyltrimethylamino propane (DOTAP), 1,2-dioeoyl-3-phosphophatidylethanolamine (DOPE), and cholesterol (Chol), and it efficiently delivered plasmid DNA into ovarian cancer cells. Mutations in the p53 tumor suppressor gene are the most common molecular genetic abnormalities to be described in ovarian cancer. However, there has been so far no report of nonviral vector-mediated p53 gene deliveries in ovarian cancer. In this study, wild-type p53 DNA was transfected into the ovarian cancer cells, using the DDC as a nonviral vector and the expression and activity of p53 gene were evaluated both in vitro and in vivo. DDC liposomes were prepared by mixing DOTAP:DOPE:Chol in a 1:0.7:0.3 molar ratio using the extrusion method. Plasmid DNA (pp53-EGFP) and DDC complexes were transfected into ovarian carcinoma cells (OVCAR-3 cells) and gene expression was determined by reverse transcription-polymerase chain reaction and Western blot analysis. The cellular growth inhibition and apoptosis of DDC-mediated p53 transfection were assessed by trypan blue exclusion assay and annexin-V staining, respectively. The OVCAR-3 cells treated with DDC/pp53-EGFP complexes were inoculated into female balb/c nude mice and tumor growth was observed. The transfection of liposome-complexed p53 gene resulted in a high level of wild-type p53 mRNA and protein expressions in OVCAR-3 cells. In vitro cell growth assay showed growth inhibition of cancer cells transfected with DDC/pp53-EGFP complexes compared with the control cells. The reestablishment of wild-type p53 function in ovarian cancer cells restored the apoptotic pathway. Following the inoculation of DDC/pp53-EGFP complexes, the volumes of tumors in nude mice were significantly reduced more than 60% compared to the control group. The DDC-mediated p53 DNA delivery may have the potential for clinical application as nonviral vector-mediated ovarian cancer therapy due to its effective induction of apoptosis and tumor growth inhibition.

Optimizing Transfection of Primary Human Umbilical Vein Endothelial Cells Using Commercially Available Chemical Transfection Reagents

PubMed Central

Hunt, Michelle A.; Currie, Margaret J.; Robinson, Bridget A.; Dachs, Gabi U.

2010-01-01

Primary cells, such as HUVEC, are notoriously difficult to transfect and are susceptible to the toxic effects of transfection reagents. A transfection reagent with a high transfection efficiency and low cytotoxicity was sought to retain sufficient viability of transfected HUVEC for subsequent assays. Nine chemical transfection reagents, currently commercially available, were compared for their ability to transfect HUVEC in vitro. A plasmid expressing the enhanced GFP (EGFP) was used for transfection, followed by flow cytometry of transfected HUVEC to determine the proportion of EGFP-expressing cells as a measure of transfection efficiency. Lipofectamine 2000 and Lipofectamine LTX (Invitrogen, Carlsbad, CA, USA) gave the highest transfection efficiencies of the reagents tested. Lipofectamine LTX was identified as the optimal transfection reagent as a result of its higher transfection efficiency at shorter periods of time following transfection when cytotoxicity was limited, allowing sufficient yield of transfected HUVEC for use in subsequent assays. PMID:20592869

Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense.

PubMed

Horiuchi, Yuki; Laskaratou, Danai; Sliwa, Michel; Ruckebusch, Cyril; Hatori, Kuniyuki; Mizuno, Hideaki; Hotta, Jun-Ichi

2018-01-26

Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT) 14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense . We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein "ember" from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 10⁵ M -1 ·cm -1 . The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.

Delivery of Plasmid DNA to Vascular Tissue in vivo using Catheter Balloons Coated with Polyelectrolyte Multilayers

PubMed Central

Saurer, Eric M.; Yamanouchi, Dai; Liu, Bo; Lynn, David M.

2010-01-01

We report an approach for the localized delivery of plasmid DNA to vascular tissue from the surfaces of inflatable embolectomy catheter balloons. Using a layer-by-layer approach, ultrathin multilayered polyelectrolyte films were fabricated on embolectomy catheter balloons by alternately adsorbing layers of a hydrolytically degradable poly(β-amino ester) and plasmid DNA. Fluorescence microscopy revealed that the films coated the surfaces of the balloons uniformly. Coated balloons that were incubated in phosphate-buffered saline at 37 °C released ~25 μg DNA/cm2 over 24 hours. Analysis of the DNA by gel electrophoresis showed that the DNA was released in open-circular (‘nicked’) and supercoiled conformations, and in vitro cell transfection assays confirmed that the released DNA was transcriptionally active. Arterial injury was induced in the internal carotid arteries of Sprague-Dawley rats using uncoated balloons, followed by treatment with film-coated balloons for 20 minutes. X-gal, immunohistochemical, and immunofluorescence staining of sectioned arteries indicated high levels of β-galactosidase or enhanced green fluorescent protein (EGFP) expression in arteries treated with film-coated balloons. β-galactosidase and EGFP expression were observed throughout the medial layers of arterial tissue, and around approximately two-thirds of the circumference of the treated arteries. The layer-by-layer approach reported here provides a general platform for the balloon-mediated delivery of DNA to vascular tissue. Our results suggest the potential of this approach to deliver therapeutically relevant DNA to prevent complications such as intimal hyperplasia that arise after vascular interventions. PMID:20933275

Nanoparticles complexed with gene vectors to promote proliferation of human vascular endothelial cells.

PubMed

Li, Qian; Shi, Changcan; Zhang, Wencheng; Behl, Marc; Lendlein, Andreas; Feng, Yakai

2015-06-03

Amphiphilic block copolymers containing biodegradable hydrophobic segments of depsipeptide based copolymers have been synthesized and explored as gene carriers for enhancing proliferation of endothelial cells in vitro. These polymers form nanoparticles (NPs) with positive charges on their surface, which could condense recombinant plasmids of enhanced green fluorescent protein plasmid and ZNF580 gene (pEGFP-ZNF580) and protect them against DNase I. ZNF580 gene is efficiently transported into EA.hy926 cells to promote their proliferation, whereby the transfection efficiency of NPs/pEGFP-ZNF580 is approximately similar to that of Lipofectamine 2000. These results indicate that the NPs might have potential as a carrier for pEGFP-ZNF580, which could support endothelialization of cardiovascular implants. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

CD147 overexpression promotes tumorigenicity in Chinese hamster ovary cells.

PubMed

Yong, Yu-Le; Liao, Cheng-Gong; Wei, Ding; Chen, Zhi-Nan; Bian, Huijie

2016-04-01

CD147 overexpresses in many epithelium-originated tumors and plays an important role in tumor migration and invasion. Most studies aim at the role of CD147 in tumor progression using tumor cell models. However, the influence of abnormal overexpression of CD147 on neoplastic transformation of normal cells is unknown. Here, the role of CD147 in malignant phenotype transformation in CHO cells was investigated. Three CHO cell lines that stably overexpressed CD147 (CHO-CD147), EGFP-CD147 (CHO-EGFP-CD147), and EGFP (CHO-EGFP) were generated by transfection of plasmids containing human CD147, EGFP-human CD147, and EGFP genes into CHO cells. Cell migration and invasion were detected by wound healing and transwell matrix penetration assay. Trypan blue exclusion, MTT, cell cycle analysis, and BrdU cell proliferation assay were used to detect cell viability and cell proliferation. Annexin V-FITC analysis was performed to detect apoptosis. We found that CD147 overexpression promoted the migration and invasion of CHO cells. CD147 accelerated the G1 to S phase transition and enhanced the CHO cell proliferation. Overexpression of CD147 inhibited both early- and late-stages of apoptosis of CHO-CD147 cells, which is caused by serum deprivation. CHO-EGFP-CD147 cells showed an increased anchorage-independent growth compared with CHO-EGFP cells as detected by soft-agar colony formation assay. The tumors formed by CHO-CD147 cells in nude mice were larger and coupled with higher expression of proliferating cell nuclear antigen and Ki-67 than that of CHO cells. In conclusion, human CD147 overexpression induces malignant phenotype in CHO cells. © 2015 International Federation for Cell Biology.

FABP4-mediated homocysteine-induced cholesterol accumulation in THP-1 monocyte-derived macrophages and the potential epigenetic mechanism.

PubMed

Jiang, Yideng; Ma, Shengchao; Zhang, Huiping; Yang, Xiaoling; Lu, Guan Jun; Zhang, Hui; He, Yangyang; Kong, Fanqi; Yang, Anning; Xu, Hua; Zhang, Minghao; Jiao, Yun; Li, Guizhong; Cao, Jun; Jia, Yuexia; Jin, Shaoju; Wei, Jun; Shi, Yingkang

2016-07-01

Hyperhomocysteinemia (HHcy) is an independent risk factor for the development of atherosclerosis (AS), according to overwhelming number of clinical and epidemiological studies. However, the underlying pathogenic molecular mechanisms by which HHcy promotes AS remain to be fully elucidated. Fatty acid binding protein 4 (FABP4) has been shown to be important in macrophage cholesterol trafficking. The objective of the present study was to determine whether homocysteine (Hcy) accelerates AS through regulating FABP4, and then mediates cholesterol accumulation in macrophages. Hcy concentrations of 0, 50, 100, 200 and 500 µM, and 100 µM Hcy+30 µM vitamin B12 (VB12)+30 µM folic acid (FA) were respectively added to cultured THP‑1 monocyte‑derived macrophages for 24 h. The levels of FABP4, which acts as a key factor connecting cellular lipid accumulation to inflammation, were determined using reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR) and western blot analyses in the macrophages. The present study used a nested touchdown methylation‑specific PCR assay to detect the DNA methylation status of the FABP4 promoter region. In addition, the FABP4 gene fragment was inserted into the cloning vector, pcDNA3.1‑EGFP, to construct the recombinant plasmid, pcDNA3.1‑EGFP/FABP4, which was identified using restriction endonuclease digestion analysis and DNA sequencing. The pcDNA3.1‑EGFP/FABP4 expression plasmid was transfected into THP‑1 monocyte‑derived macrophages, mediated by liposome reagent, following which the expression levels of FABP4 were detected using RT‑qPCR and western blot analyses. The present study also determined the intracellular accumulation of total cholesterol in the macrophages. The results indicated that Hcy decreased the levels of FABP4 promoter methylation, but increased the mRNA and protein expression levels of FABP4 in the macrophages, compared with the control group (0 µM Hcy). However, no dose‑dependent changes were observed with increasing concentrations of Hcy. The recombinant fluorescent eukaryotic expression vector, pcDNA3.1‑EGFP/FABP4, was successfully constructed and effectively expressed in the THP‑1 macrophages. The results also showed that FABP4 accelerated the accumulation of cholesterol in the macrophages. Taken together, the results of the present study suggested that FABP4 DNA hypomethylation induced by Hcy may be involved in the overexpression of FABP4, thereby inducing cholesterol accumulation in macrophages.

Targeted gene delivery in the cricket brain, using in vivo electroporation.

PubMed

Matsumoto, Chihiro Sato; Shidara, Hisashi; Matsuda, Koji; Nakamura, Taro; Mito, Taro; Matsumoto, Yukihisa; Oka, Kotaro; Ogawa, Hiroto

2013-12-01

The cricket (Gryllus bimaculatus) is a hemimetabolous insect that is emerging as a model organism for the study of neural and molecular mechanisms of behavioral traits. However, research strategies have been limited by a lack of genetic manipulation techniques that target the nervous system of the cricket. The development of a new method for efficient gene delivery into cricket brains, using in vivo electroporation, is described here. Plasmid DNA, which contained an enhanced green fluorescent protein (eGFP) gene, under the control of a G. bimaculatus actin (Gb'-act) promoter, was injected into adult cricket brains. Injection was followed by electroporation at a sufficient voltage. Expression of eGFP was observed within the brain tissue. Localized gene expression, targeted to specific regions of the brain, was also achieved using a combination of local DNA injection and fine arrangement of the electroporation electrodes. Further studies using this technique will lead to a better understanding of the neural and molecular mechanisms that underlie cricket behaviors. Copyright © 2013 Elsevier Ltd. All rights reserved.

Isolation of chicken embryonic stem cell and preparation of chicken chimeric model.

PubMed

Zhang, Yani; Yang, Haiyan; Zhang, Zhentao; Shi, Qingqing; Wang, Dan; Zheng, Mengmeng; Li, Bichun; Song, Jiuzhou

2013-03-01

Chicken embryonic stem cells (ESCs) were separated from blastoderms at stage-X and cultured in vitro. Alkaline phosphatase activity and stage-specific embryonic antigen-1 staining was conducted to detect ESCs. Then, chicken ESCs were transfected with linearized plasmid pEGFP-N1 in order to produce chimeric chicken. Firstly, the optimal electrotransfection condition was compared; the results showed the highest transfection efficiency was obtained when the field strength and pulse duration was 280 V and 75 μs, respectively. Secondly, the hatchability of shedding methods, drilling a window at the blunt end of egg and drilling a window at the lateral shell of egg was compared, the results showed that the hatchability was the highest for drilling a window at the lateral shell of egg. Thirdly, the hatchability of microinjection (ESCs was microinjected into chick embryo cavity) was compared too, the results showed there were significant difference between the injection group transfected with ESCs and that of other two groups. In addition, five chimeric chickens were obtained in this study and EGFP gene was expressed in some organs, but only two chimeric chicken expressed EGFP gene in the gonad, indicating that the chimeric chicken could be obtained through chick embryo cavity injection by drilling a window at the lateral shell of egg.

[Transfection of hBcl-2 gene protects the liver against ischemia/reperfusion injury in rats during liver transplantation].

PubMed

Liu, Ji-tong; Liu, Jing-shi; Jiang, Jin-yu; Zhou, Li-xue; Liang, Gang; Li, Yan-chun

2010-12-01

To study the effect of hBcl-2 gene transfer on rat liver against ischemia-reperfusion injury, and explore the feasibility of this approach to reduce ischemia-reperfusion injury in liver transplantation. We constructed the replication-deficient recombinant adenoviruses Adv-EGFP and Adv-Bcl-2 and transfected them into 293 cells and packaged into adenovirus particles for amplification and purification. The empty plasmid vector virus was constructed similarly. Male SD rats were randomized into Adv-Bcl-2-transfected group, Adv-EGFP-transfected group, ischemia-reperfusion group, and sham-operated group, and liver allograft transplantation model was established by sleeve method. In the transfected groups, the recombinant viruses were administered by perfusion through the portal vein, and the ischemia-reperfusion and sham-operated groups received no treatment. Real-time quantitative PCR and Western blotting were used to detect the mRNA and protein expressions of bcl-2 in the liver tissue of each group, and at 0, 60 and 180 min after reperfusion, serum AST, LDH, and MDA levels were measured. Histological changes of the liver cells were evaluated by HE staining. Bcl-2 mRNA and protein expressions in Adv-Bcl-2-transfected group, as compared with those in Adv-EGFP-transfected group and control group, were significantly increased (P<0.01); the serum levels of AST, LDH and MDA in Adv-Bcl-2-transfected group were significantly lower than those of Adv-EGFP-transfected group and ischemia-reperfusion group (P<0.05 or 0.01). Compared with the sham-operated group, Adv-Bcl-2 treatment group showed lessened edema and vacuolar degeneration of the liver cells without patches or spots of necrosis. In ischemia-reperfusion and Adv-EGFP group, HE staining revealed hepatic lobular destruction and extensive liver cell swelling, enlargement, vacuolar degeneration, edema and occasional focal necrosis. Adv-Bcl-2 transfection can induce the expression of bcl-2 gene to reduce ischemia-reperfusion injury of the liver graft in rats.

Efficacy of vaccination with plasmid DNA encoding for HER2/neu or HER2/neu-eGFP fusion protein against prostate cancer in rats.

PubMed

Bhattachary, R; Bukkapatnam, R; Prawoko, I; Soto, J; Morgan, M; Salup, R R

2002-05-01

Despite early diagnosis and improved therapy, 31,500 men will die from prostate cancer (PC) this year. The HER2/neu oncoprotein is an important effector of cell growth found in the majority of high-grade prostatic tumors and is capable of rendering immunogenicity. The antigenicity of this oncoprotein might prove useful in the development of PC vaccines. Our goal is to prove the principle that a single DNA vaccine can provide reliable immunity against PC in the MatLyLu (MLL) translational tumor model. The parental rat MatLyLu PC cell line expresses low to moderate levels of the rat neu protein. To simulate in vivo human PC, MatLyLu cells were transfected with a truncated sequence of human HER2/neu cDNA cloned into the pCI-neo vector. This HER2/neu cDNA sequence encodes the first 433 amino acids of the extracellular domain (ECD). MatLyLu cells were also transfected with the same HER2/neu cDNA sequence cloned into the N1-terminal sequence of EGFP reporter gene to produce a fusion protein. The partial ECD sequence of HER2/neu includes five rat major histocompatibility (MHC)-II-restricted peptides with complete human-to-rat cross-species homology. The HER2/neu protein overexpression was documented by Western Blot analysis, and the expression of fusion protein was monitored by confocal microscopy and fluorimetry. Vaccination with a single injection of HER2/neu cDNA protected 50% of animals against HER2/neu-MatLyLu tumors (P < 0.01). When the tumor cells were engineered to express HER2/neu-EGFP fusion protein, the antitumor immunity was enhanced, as following vaccination with HER2/neu-EGFP cDNA, 80% of these rats rejected HER2/neu-EGFP-MatLyLu (P<0.001). Both vaccines induced HER2/neu-specific antibody titers. Rats vaccinated with EGFP-cDNA rejected 80% of EGFP-MatLyLu tumors and, interestingly, 40% of HER2/neu-MatLyLu tumors. None of the cDNA vaccines induced immunity against parental MatLyLu cells. Our data clearly demonstrate that a single injection of HER2/neu-EGFP cDNA is a very effective vaccine against PC tumors expressing the cognate tumor-associated antigen (TA). The antitumor immunity is significantly more pronounced if the tumors express xenogeneic HER2/neu-EGFP fusion protein as opposed to only the syngeneic HER2/neu oncoprotein. Our data suggests that the HER2/neu-EGFP-MatLyLu tumor is a potential animal tumor model for investigating therapeutic vaccine strategies against PC in vivo and demonstrates the limitations of a cDNA vaccine only encoding for MHC-II-restricted HER2/neu-ECD sequence peptides.

Viral Paratransgenesis in the Malaria Vector Anopheles gambiae

PubMed Central

Ren, Xiaoxia; Hoiczyk, Egbert; Rasgon, Jason L.

2008-01-01

Paratransgenesis, the genetic manipulation of insect symbiotic microorganisms, is being considered as a potential method to control vector-borne diseases such as malaria. The feasibility of paratransgenic malaria control has been hampered by the lack of candidate symbiotic microorganisms for the major vector Anopheles gambiae. In other systems, densonucleosis viruses (DNVs) are attractive agents for viral paratransgenesis because they infect important vector insects, can be genetically manipulated and are transmitted to subsequent generations. However, An. gambiae has been shown to be refractory to DNV dissemination. We discovered, cloned and characterized the first known DNV (AgDNV) capable of infection and dissemination in An. gambiae. We developed a flexible AgDNV-based expression vector to express any gene of interest in An. gambiae using a two-plasmid helper-transducer system. To demonstrate proof-of-concept of the viral paratransgenesis strategy, we used this system to transduce expression of an exogenous gene (enhanced green fluorescent protein; EGFP) in An. gambiae mosquitoes. Wild-type and EGFP-transducing AgDNV virions were highly infectious to An. gambiae larvae, disseminated to and expressed EGFP in epidemiologically relevant adult tissues such as midgut, fat body and ovaries and were transmitted to subsequent mosquito generations. These proof-of-principle data suggest that AgDNV could be used as part of a paratransgenic malaria control strategy by transduction of anti-Plasmodium peptides or insect-specific toxins in Anopheles mosquitoes. AgDNV will also be extremely valuable as an effective and easy-to-use laboratory tool for transient gene expression or RNAi in An. gambiae. PMID:18725926

Rational Development of A Polycistronic Plasmid with A CpG-Free Bacterial Backbone as A Potential Tool for Direct Reprogramming.

PubMed

Dormiani, Kianoush; Mir Mohammad Sadeghi, Hamid; Sadeghi-Aliabadi, Hojjat; Forouzanfar, Mahboobeh; Baharvand, Hossein; Ghaedi, Kamran; Nasr-Esfahani, Mohammad Hossein

2017-01-01

Induced pluripotent stem cells are generated from somatic cells by direct reprogramming. These reprogrammed pluripotent cells have different applications in biomedical fields such as regenerative medicine. Although viral vectors are widely used for efficient reprogramming, they have limited applications in the clinic due to the risk for immunogenicity and insertional mutagenesis. Accordingly, we designed and developed a small, non-integrating plasmid named pLENSO/Zeo as a 2A-mediated polycistronic expression vector. In this experimental study, we developed a single plasmid which includes a single expression cassette containing open reading frames of human LIN28, NANOG, SOX2 and OCT4 along with an EGFP reporter gene. Each reprogramming factor is separated by an intervening sequence that encodes a 2A self-processing peptide. The reprogramming cassette is located downstream of a CMV promoter. The vector is easily propagated in the E. coli GT115 strain through a CpG-depleted vector backbone. We evaluated the stability of the constructed vector bioinformatically, and its ability to stoichiometric expression of the reprogramming factors using quantitative molecular methods analysis after transient transfection into HEK293 cells. In the present study, we developed a nonviral episomal vector named pLENSO/ Zeo. Our results demonstrated the general structural stability of the plasmid DNA. This relatively small vector showed concomitant, high-level expression of the four reprogramming factors with similar titers, which are considered as the critical parameters for efficient and consistent reprogramming. According to our experimental results, this stable extrachromosomal plasmid expresses reliable amounts of four reprogramming factors simultaneously. Consequently, these promising results encouraged us to evaluate the capability of pLENSO/Zeo as a simple and feasible tool for generation of induced pluripotent stem cells from primary cells in the future.

Design and Study of Efflux Function of EGFP Fused MexAB-OprM Membrane Transporter in Pseudomonas aeruginosa Using Fluorescence Spectroscopy

PubMed Central

Ding, Feng; Lee, Kerry J.; Vahedi-Faridi, Ardeschir; Yoneyama, Hiroshi; Osgood, Christopher J.; Xu, Xiao-Hong Nancy

2014-01-01

Multidrug membrane transporters (efflux pumps) can selectively extrude a variety of structurally and functionally diverse substrates (e.g., chemotoxics, antibiotics), leading to multidrug resistance (MDR) and ineffective treatment of a wide variety of diseases. In this study, we have designed and constructed fusion gene (egfp-mexB) of N-terminal mexB with C-terminal egfp, inserted it into a plasmid vector (pMMB67EH), and successfully expressed it in ΔMexB (MexB deletion) strain of Pseudomonas aeruginosa to create a new strain that expresses MexA-(EGFP-MexB)-OprM. We characterized the fusion gene using gel electrophoresis and DNA sequencing, and determined their expression in live cells by measuring the fluorescence of EGFP in single live cells using fluorescence microscopy. Efflux function of the new strain was studied by measuring its accumulation kinetics of ethidium bromide (EtBr, a pump substrate) using fluorescence spectroscopy, which was compared with the cells (WT, ΔMexM, ΔABM, and nalB1) with various expression levels of MexAB-OprM. The new strain shows 6-fold lower accumulation rates of EtBr (15 μM) than ΔABM, 4-fold lower than ΔMexB, but only 1.1-fold higher than WT. As EtBr concentration increases to 40 μM, the new strain has nearly the same accumulation rate of EtBr as ΔMexB, but 1.4-fold higher than WT. We observed the nearly same level of inhibitory effect of CCCP (carbonyl cyanide-m-chlorophenylhydrazone) on the efflux of EtBr by the new strain and WT. Antibiotic susceptibility study shows that the minimum inhibitory concentrations (MICs) of aztreonam (AZT) and chloramphenicol (CP) for the new strain are 6-fold or 3-fold lower than WT, respectively, and 2-fold higher than those of ΔMexB. Taken together, the results suggest that the fusion protein partially retains the efflux function of MexAB-OprM. Modeled structure of the fusion protein shows that the position and orientation of the N-terminal fused EGFP domain may either partially block the translocation pore or restrict the movement of the individual pump domains, which leads to partially restrict efflux activity. PMID:24781334

Genomic Analysis and Isolation of RNA Polymerase II Dependent Promoters from Spodoptera frugiperda.

PubMed

Bleckmann, Maren; Fritz, Markus H-Y; Bhuju, Sabin; Jarek, Michael; Schürig, Margitta; Geffers, Robert; Benes, Vladimir; Besir, Hüseyin; van den Heuvel, Joop

2015-01-01

The Baculoviral Expression Vector System (BEVS) is the most commonly used method for high expression of recombinant protein in insect cells. Nevertheless, expression of some target proteins--especially those entering the secretory pathway--provides a severe challenge for the baculovirus infected insect cells, due to the reorganisation of intracellular compounds upon viral infection. Therefore, alternative strategies for recombinant protein production in insect cells like transient plasmid-based expression or stable expression cell lines are becoming more popular. However, the major bottleneck of these systems is the lack of strong endogenous polymerase II dependent promoters, as the strong baculoviral p10 and polH promoters used in BEVS are only functional in presence of the viral transcription machinery during the late phase of infection. In this work we present a draft genome and a transcriptome analysis of Sf21 cells for the identification of the first known endogenous Spodoptera frugiperda promoters. Therefore, putative promoter sequences were identified and selected because of high mRNA level or in analogy to other strong promoters in other eukaryotic organism. The chosen endogenous Sf21 promoters were compared to early viral promoters for their efficiency to trigger eGFP expression using transient plasmid based transfection in a BioLector Microfermentation system. Furthermore, promoter activity was not only shown in Sf21 cells but also in Hi5 cells. The novel endogenous Sf21 promoters were ranked according to their activity and expand the small pool of available promoters for stable insect cell line development and transient plasmid expression in insect cells. The best promoter was used to improve plasmid based transient transfection in insect cells substantially.

Transformation with green fluorescent protein of Trichoderma harzianum 1051, a strain with biocontrol activity against Crinipellis perniciosa, the agent of witches'-broom disease of cocoa.

PubMed

Inglis, Peter W.; Queiroz, Paulo R.; Valadares-Inglis, M. Cléria

1999-04-01

A plasmid vector for fungal expression of an enhanced, red-shifted variant of the Aequoria victoriae green fluorescent protein was constructed by fusion of the EGFP gene to the highly expressed Aspergillus nidulans gpd promoter and the A. nidulans trpC terminator. This construction was introduced by cotransformation, using benomyl selection, into Trichoderma harzianum strain 1051, a strain being evaluated for the biological control of witches'-broom disease of cocoa caused by Crinipellis perniciosa. Epifluorescence microscopy was used to monitor germination and attachment of stable transformant conidia on the surface of C. perniciosa hyphae.

ELF5 in epithelial ovarian carcinoma tissues and biological behavior in ovarian carcinoma cells.

PubMed

Yan, Hongchao; Qiu, Linglin; Xie, Xiaolei; Yang, He; Liu, Yongli; Lin, Xiaoman; Huang, Hongxiang

2017-03-01

The expression of E74-like factor 5 (ELF5) in epithelial ovarian carcinoma tissues and its effects on biological behavior in ovarian carcinoma cells were assessed in search for a new approach for gene treatment of epithelial ovarian carcinoma. RT-PCR technology was applied to detect the expression of ELF5 mRNA in epithelial ovarian carcinoma (n=49), borderline ovarian epithelial tumor (n=19), benign ovarian epithelial tumor (n=31) and normal ovarian tissues (n=40). Then, we transfected recombinant plasmid pcDNA3.1‑ELF5+EGFP into human ovarian carcinoma SKOV3 cells (recombinant plasmid group) in vitro and screened out stably transfected cells to conduct multiplication culture. Western blot analysis was performed to detect the expression of ELF5 protein in the different groups. Flow cytometry was employed to detect cell apoptosis and cycles. ELF5 mRNA in epithelial ovarian carcinoma and borderline ovarian epithelial tumor tissues were significantly lower (P<0.05) than those in benign ovarian epithelial tumor and normal ovarian tissues. ELF5 protein expression in the cells of recombinant plasmid group was significantly higher compared with empty plasmid and blank control groups. The capacity of cell reproductive recombinant plasmid group at each time point decreased (P<0.05). Flow cytometry detection showed that 67.03% of cells in recombinant plasmid group was blocked in G0/G1 phase (P<0.05), compared with empty plasmid group (37.17%) and blank control group (38.24%). Apoptotic rate of recombinant plasmid group was significantly lower (31.4±1.9%; P<0.05), compared with that of empty plasmid group (9.1±2.2%) and blank control group (8.7±1.5%), and the differences were statistically significant. In conclusion, ELF5 interfered with cell cycle of human ovarian carcinoma SKOV3 cells and promoted apoptosis of human ovarian carcinoma SKOV3 cells inhibiting their growth and invasive capacity; and thus providing a new approach to gene treatment of ovarian carcinoma.

CRISPR/Cas9-based genome editing in mice by single plasmid injection.

PubMed

Fujihara, Yoshitaka; Ikawa, Masahito

2014-01-01

CRISPR/Cas-mediated genome modification has opened a new era for elucidating gene function. Gene knockout mice can be generated by injecting humanized Cas9 (hCas9) mRNA and guide RNA (sgRNA) into fertilized eggs. However, delivery of RNA instead of DNA to the fertilized oocyte requires extra preparation and extra care with storage. To simplify the method of delivery, we injected the circular pX330 plasmids expressing both hCas9 and sgRNA and found that mutant mice were generated as efficiently as with RNA injection. Different from the linearized plasmid, the circular plasmid decreased the chance of integration into the host genome. We also developed the pCAG-EGxxFP reporter plasmid for evaluating the sgRNA activity by observing EGFP fluorescence in HEK293T cells. The combination of these techniques allowed us to develop a rapid, easy, and reproducible strategy for targeted mutagenesis in living mice. This chapter provides an experimental protocol for the design of sgRNAs, the construction of pX330-sgRNA and pCAG-EGxxFP-target plasmids, the validation of cleavage efficiency in vitro, and the generation of targeted gene mutant mice. These mice can be generated within a month.

An infectious recombinant equine arteritis virus expressing green fluorescent protein from its replicase gene.

PubMed

van den Born, Erwin; Posthuma, Clara C; Knoops, Kèvin; Snijder, Eric J

2007-04-01

Thus far, systems developed for heterologous gene expression from the genomes of nidoviruses (arteriviruses and coronaviruses) have relied mainly on the translation of foreign genes from subgenomic mRNAs, whose synthesis is a key feature of the nidovirus life cycle. In general, such expression vectors often suffered from relatively low and unpredictable expression levels, as well as genome instability. In an attempt to circumvent these disadvantages, the possibility to express a foreign gene [encoding enhanced green fluorescent protein (eGFP)] from within the nidovirus replicase gene, which encodes two large polyproteins that are processed proteolytically into the non-structural proteins (nsps) required for viral RNA synthesis, has now been explored. A viable recombinant of the arterivirus Equine arteritis virus, EAV-GFP2, was obtained, which contained the eGFP insert at the site specifying the junction between the two most N-proximal replicase-cleavage products, nsp1 and nsp2. EAV-GFP2 replication could be launched by transfection of cells with either in vitro-generated RNA transcripts or a DNA launch plasmid. EAV-GFP2 displayed growth characteristics similar to those of the wild-type virus and was found to maintain the insert stably for at least eight passages. It is proposed that EAV-GFP2 has potential for arterivirus vector development and as a tool in inhibitor screening. It can also be used for fundamental studies into EAV replication, which was illustrated by the fact that the eGFP signal of EAV-GFP2, which largely originated from an eGFP-nsp2 fusion protein, could be used to monitor the formation of the membrane-bound EAV replication complex in real time.

Gold Functionalized Mesoporous Silica Nanoparticle Mediated Protein and DNA Codelivery to Plant Cells Via the Biolistic Method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin-Ortigosa, Susana; Valenstein, Justin S.; Lin, Victor S.-Y.

2012-09-11

The synthesis and characterization of a gold nanoparticle functionalized mesoporous silica nanoparticle (Au-MSN) platform for codelivery of proteins and plasmid DNA to plant tissues using a biolistic particle delivery system is reported. The in vitro uptake and release profiles of fluorescently labeled bovine serum albumin (BSA) and enhanced green fluorescent protein (eGFP) are investigated. As a proof-of-concept demonstration, Au-MSN with large average pore diameters (10 nm) are shown to deliver and subsequently release proteins and plasmid DNA to the same cell after passing through the plant cell wall upon bombardment. Release of fluorescent eGFP indicates the delivery of active, non-denaturedmore » proteins to plant cells. This advance represents the first example of biolistic-mediated codelivery of proteins and plasmid DNA to plant cells via gold-functionalized MSN and provides a powerful tool for both fundamental and applied research of plant sciences.« less

Tula hantavirus L protein is a 250 kDa perinuclear membrane-associated protein.

PubMed

Kukkonen, Sami K J; Vaheri, Antti; Plyusnin, Alexander

2004-05-01

The complete open reading frame of Tula hantavirus (TULV) L RNA was cloned in three parts. The middle third (nt 2191-4344) could be expressed in E. coli and was used to immunize rabbits. The resultant antiserum was then used to immunoblot concentrated TULV and infected Vero E6 cells. The L protein of a hantavirus was detected, for the first time, in infected cells and was found to be expressed as a single protein with an apparent molecular mass of 250 kDa in both virions and infected cells. Using the antiserum, the expression level of the L protein was followed and image analysis of immunoblots indicated that there were 10(4) copies per cell at the peak level of expression. The antiserum was also used to detect the L protein in cell fractionation studies. In cells infected with TULV and cells expressing recombinant L, the protein pelleted with the microsomal membrane fraction. The membrane association was confirmed with membrane flotation assays. To visualize L protein localization in cells, a fusion protein of L and enhanced green fluorescent protein, L-EGFP, was expressed in Vero E6 cells with a plasmid-driven T7 expression system. L-EGFP localized in the perinuclear region where it had partial co-localization with the Golgi matrix protein GM130 and the TULV nucleocapsid protein.

Cholesterol-conjugated supramolecular assemblies of low generations polyamidoamine dendrimers for enhanced EGFP plasmid DNA transfection

NASA Astrophysics Data System (ADS)

Golkar, Nasim; Samani, Soliman Mohammadi; Tamaddon, Ali Mohammad

2016-05-01

Aimed to prepare an enhanced gene delivery system with low cytotoxicity and high transfection efficiency, various cholesterol-conjugated derivates of low generation polyamidoamine (PAMAM) dendrimers were prepared. The conjugates were characterized by TNBS assay, FTIR, and 1H-NMR spectroscopy. Self-assembly of the dendrimer conjugates (G1-Chol, G2-Chol, and G3-Chol) was investigated by pyrene assay. Following formation of the complexes between enhanced green fluorescence protein plasmid and the dendrimer conjugates at various N (primary amine)/P (phosphate) mole ratios, plasmid condensation, biologic stability, cytotoxicity, and protein expression were investigated. The conjugates self-assembled into micellar dispersions with the critical micelle concentration values (<50 µg/ml) depending on the dendrimer generation and cholesterol/amine mole ratio. Cholesterol conjugation resulted in higher resistance of the condensed plasmid DNA in a competition assay with heparin sulfate. Also, the transfection efficiency was determined higher for the cholesterol conjugates than unmodified dendrimers in HepG2 cells, showing the highest for G2-Chol at 40 % degree of cholesterol modification (G2-Chol40 %) among various dendrimer generations. Interestingly, such conjugate showed a complete protection of plasmid against serum nucleases. Our results confirmed that the cholesterol conjugation to PAMAM dendrimers of low generations bearing little cytotoxicity improves their several physicochemical and biological characteristics required for an enhanced delivery of plasmid DNA into cells.

Transformation by complementation of a uracil auxotroph of the hyper lignin-degrading basidiomycete Phanerochaete sordida YK-624.

PubMed

Yamagishi, Kenji; Kimura, Toshiyuki; Oita, Sigeru; Sugiura, Tatsuki; Hirai, Hirofumi

2007-10-01

Phanerochaete sordida YK-624 is a hyper lignin-degrading basidiomycete possessing greater ligninolytic selectivity than either P. chrysosporium or Trametes versicolor. To construct a gene transformation system for P. sordida YK-624, uracil auxotrophic mutants were generated using a combination of ultraviolet (UV) radiation and 5-fluoroorotate resistance as a selection scheme. An uracil auxotrophic strain (UV-64) was transformed into a uracil prototroph using the marker plasmid pPsURA5 containing the orotate phosphoribosyltransferase gene from P. sordida YK-624. This system generated approximately 50 stable transformants using 2 x 10(7) protoplasts. Southern blot analysis demonstrated that the transformed pPsURA5 was ectopically integrated into the chromosomal DNA of all transformants. The enhanced green fluorescent protein (EGFP) gene was also introduced into UV-64. The transformed EGFP was expressed in the co-transformants driven by P. sordida glyceraldehyde-3-phosphate dehydrogenase gene promoter and terminator regions.

Retrotransposon expression and incorporation of cloned human and mouse retroelements in human spermatozoa.

PubMed

Lazaros, Leandros; Kitsou, Chrysoula; Kostoulas, Charilaos; Bellou, Sofia; Hatzi, Elissavet; Ladias, Paris; Stefos, Theodoros; Markoula, Sofia; Galani, Vasiliki; Vartholomatos, Georgios; Tzavaras, Theodore; Georgiou, Ioannis

2017-03-01

To investigate the expression of long interspersed element (LINE) 1, human endogenous retrovirus (HERV) K10, and short interspersed element-VNTR-Alu element (SVA) retrotransposons in ejaculated human spermatozoa by means of reverse-transcription (RT) polymerase chain reaction (PCR) analysis as well as the potential incorporation of cloned human and mouse active retroelements in human sperm cell genome. Laboratory study. University research laboratories and academic hospital. Normozoospermic and oligozoospermic white men. RT-PCR analysis was performed to confirm the retrotransposon expression in human spermatozoa. Exogenous retroelements were tagged with a plasmid containing a green fluorescence (EGFP) retrotransposition cassette, and the de novo retrotransposition events were tested with the use of PCR, fluorescence-activated cell sorting analysis, and confocal microscopy. Retroelement expression in human spermatozoa, incorporation of cloned human and mouse active retroelements in human sperm genome, and de novo retrotransposition events in human spermatozoa. RT-PCR products of expressed human LINE-1, HERV-K10, and SVA retrotransposons were observed in ejaculated human sperm samples. The incubation of human spermatozoa with either retrotransposition-active human LINE-1 and HERV-K10 or mouse reverse transcriptase-deficient VL30 retrotransposons tagged with an EGFP-based retrotransposition cassette led to EGFP-positive spermatozo; 16.67% of the samples were positive for retrotransposition. The respective retrotransposition frequencies for the LINE-1, HERV-K10, and VL30 retrotransposons in the positive samples were 0.34 ± 0.13%, 0.37 ± 0.17%, and 0.30 ± 0.14% per sample of 10,000 spermatozoa. Our results show that: 1) LINE-1, HERV-K10, and SVA retrotransposons are transcriptionally expressed in human spermatozoa; 2) cloned active retroelements of human and mammalian origin can be incorporated in human sperm genome; 3) active reverse transcriptases exist in human spermatozoa; and 4) de novo retrotransposition events occur in human spermatozoa. Copyright © 2017 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

Differential tissue expression of enhanced green fluorescent protein in 'green mice'.

PubMed

Ma, De-Fu; Tezuka, Hideo; Kondo, Tetsuo; Sudo, Katsuko; Niu, Dong-Feng; Nakazawa, Tadao; Kawasaki, Tomonori; Yamane, Tetsu; Nakamura, Nobuki; Katoh, Ryohei

2010-06-01

In order to clarify tissue expression of enhanced green fluorescent protein (EGFP) in 'green mice' from a transgenic line having an EGFP cDNA under the control of a chicken beta-actin promoter and cytomegalovirus enhancer, we studied the expression of EGFP in various organs and tissues from these 'green mice' by immunohistochemistry with anti- EGFP antibody in conjunction with direct observation for EGFP fluorescence using confocal laser scanning microscopy. On immunohistochemical examination and on direct observation by confocal laser scanning microscopy, the level of EGFP expression varied among organs and tissues. EGFP expression was diffusely and strongly observed in the skin, pituitary, thyroid gland, parathyroid gland, heart, gall bladder, pancreas, adrenals and urinary bladder. There was only sporadic and weak expression of EGFP in the epithelium of the trachea, bronchus of the lung, stratified squamous epithelium and gastric glands of the stomach, hepatic bile ducts of the liver, glomeruli and renal tubules of the kidney and endo-metrial glands of the uterus. Furthermore, EGFP was only demonstrated within the goblet and paneth cells in the colon and small intestine, the tall columnar cells in the ductus epididymis, and the leydig cells in the testis. In conclusion, our results show that EGFP is differentially expressed in organs and tissues of 'green mice', which indicates that 'green mice' may prove useful for research involving transplantation and tissue clonality.

Development of human cell biosensor system for genotoxicity detection based on DNA damage-induced gene expression.

PubMed

Zager, Valerija; Cemazar, Maja; Hreljac, Irena; Lah, Tamara T; Sersa, Gregor; Filipic, Metka

2010-03-01

Human exposure to genotoxic agents in the environment and everyday life represents a serious health threat. Fast and reliable assessment of genotoxicity of chemicals is of main importance in the fields of new chemicals and drug development as well as in environmental monitoring. The tumor suppressor gene p21, the major downstream target gene of activated p53 which is responsible for cell cycle arrest following DNA damage, has been shown to be specifically up-regulated by genotoxic carcinogens. The aim of our study was to develop a human cell-based biosensor system for simple and fast detection of genotoxic agents. Metabolically active HepG2 human hepatoma cells were transfected with plasmid encoding Enhanced Green Fluorescent Protein (EGFP) under the control of the p21 promoter (p21HepG2GFP). DNA damage was induced by genotoxic agents with known mechanisms of action. The increase in fluorescence intensity, due to p21 mediated EGFP expression, was measured with a fluorescence microplate reader. The viability of treated cells was determined by the colorimetric MTS assay. The directly acting alkylating agent methylmethane sulphonate (MMS) showed significant increase in EGFP production after 48 h at 20 μg/mL. The indirectly acting carcinogen benzo(a)pyren (BaP) and the cross-linking agent cisplatin (CisPt) induced a dose- dependent increase in EGFP fluorescence, which was already significant at concentrations 0.13 μg/mL and 0.41 μg/mL, respectively. Vinblastine (VLB), a spindle poison that does not induce direct DNA damage, induced only a small increase in EGFP fluorescence intensity after 24 h at the lowest concentration (0.1 μg/mL), while exposure to higher concentrations was associated with significantly reduced cell viability. The results of our study demonstrated that this novel assay based on the stably transformed cell line p21HepG2GFP can be used as a fast and simple biosensor system for detection of genetic damage caused by chemical agents.

Generation of HIV-1 based bi-cistronic lentiviral vectors for stable gene expression and live cell imaging.

PubMed

Sehgal, Lalit; Budnar, Srikanth; Bhatt, Khyati; Sansare, Sneha; Mukhopadhaya, Amitabha; Kalraiya, Rajiv D; Dalal, Sorab N

2012-10-01

The study of protein-protein interactions, protein localization, protein organization into higher order structures and organelle dynamics in live cells, has greatly enhanced the understanding of various cellular processes. Live cell imaging experiments employ plasmid or viral vectors to express the protein/proteins of interest fused to a fluorescent protein. Unlike plasmid vectors, lentiviral vectors can be introduced into both dividing and non dividing cells, can be pseudotyped to infect a broad or narrow range of cells, and can be used to generate transgenic animals. However, the currently available lentiviral vectors are limited by the choice of fluorescent protein tag, choice of restriction enzyme sites in the Multiple Cloning Sites (MCS) and promoter choice for gene expression. In this report, HIV-1 based bi-cistronic lentiviral vectors have been generated that drive the expression of multiple fluorescent tags (EGFP, mCherry, ECFP, EYFP and dsRed), using two different promoters. The presence of a unique MCS with multiple restriction sites allows the generation of fusion proteins with the fluorescent tag of choice, allowing analysis of multiple fusion proteins in live cell imaging experiments. These novel lentiviral vectors are improved delivery vehicles for gene transfer applications and are important tools for live cell imaging in vivo.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Lactococcus lactis expressing either Staphylococcus aureus fibronectin-binding protein A or Listeria monocytogenes internalin A can efficiently internalize and deliver DNA in human epithelial cells.

PubMed

Innocentin, Silvia; Guimarães, Valeria; Miyoshi, Anderson; Azevedo, Vasco; Langella, Philippe; Chatel, Jean-Marc; Lefèvre, François

2009-07-01

Lactococci are noninvasive bacteria frequently used as protein delivery vectors and, more recently, as in vitro and in vivo DNA delivery vehicles. We previously showed that a functional eukaryotic enhanced green fluorescent protein (eGFP) expression plasmid vector was delivered in epithelial cells by Lactococcus lactis producing Listeria monocytogenes internalin A (L. lactis InlA(+)), but this strategy is limited in vivo to transgenic mice and guinea pigs. In this study, we compare the internalization ability of L. lactis InlA(+) and L. lactis producing either the fibronectin-binding protein A of Staphylococcus aureus (L. lactis FnBPA(+)) or its fibronectin binding domains C and D (L. lactis CD(+)). L. lactis FnBPA(+) and L. lactis InlA(+) showed comparable internalization rates in Caco-2 cells, while the internalization rate observed with L. lactis CD(+) was lower. As visualized by conventional and confocal fluorescence microscopy, large clusters of L. lactis FnBPA(+), L. lactis CD(+), and L. lactis InlA(+) were present in the cytoplasm of Caco-2 cells after internalization. Moreover, the internalization rates of Lactobacillus acidophilus NCFM and of an NCFM mutant strain with the gene coding for the fibronectin-binding protein (fbpA) inactivated were also evaluated in Caco-2 cells. Similar low internalization rates were observed for both wild-type L. acidophilus NCFM and the fbpA mutant, suggesting that commensal fibronectin binding proteins have a role in adhesion but not in invasion. L. lactis FnBPA(+), L. lactis CD(+), and L. lactis InlA(+) were then used to deliver a eukaryotic eGFP expression plasmid in Caco-2 cells: flow cytometry analysis showed that the highest percentage of green fluorescent Caco-2 cells was observed after coculture with either L. lactis FnBPA(+) or L. lactis InlA(+). Analysis of the in vivo efficiency of these invasive recombinant strains is currently in progress to validate their potential as DNA vaccine delivery vehicles.

Relationship between expression level of hygromycin B-resistant gene and Agrobacterium tumefaciens-mediated transformation efficiency in Beauveria bassiana JEF-007.

PubMed

Nai, Y S; Lee, M R; Kim, S; Lee, S J; Kim, J C; Yang, Y T; Kim, J S

2017-09-01

Agrobacterium tumefaciens-mediated transformation (AtMT) is an effective method for generation of entomopathogenic Beauveria bassiana transformants. However, some strains grow on the selective medium containing hygromycin B (HygB), which reduces the selection efficiency of the putative transformants. In this work, a relationship between HygB resistance gene promoter and AtMT efficiency was investigated to improve the transformant selection. Ten B. bassiana isolates were grown on 800 μg ml -1 HygB medium, but only JEF-006, -007 and -013 showed susceptibility to the antibiotics. Particularly, JEF-007 showed the most dose-dependent susceptibility. Two different Ti-Plasmids, pCeg (gpdA promoter based) and pCambia-egfp (CaMV 35S promoter based), were constructed to evaluate the promoters on the expression of HygB resistance gene (hph) at 100, 150 and 200 μg ml -1 HygB medium. Eight days after the transformation, wild type, AtMT/pCeg and AtMT/pCambia-egfp colonies were observed on 100 μg ml -1 HygB, but significantly larger numbers of colonies were counted on AtMT/pCeg plates. At higher HygB concentration (150 μg ml -1 ), only AtMT/pCeg colonies were further observed, but very few colonies were observed on the wild type and AtMT/pCambia-egfp plates. Putative transformants were subjected to PCR, RT-PCR and qRT-PCR to investigate the T-DNA insertion rate and gene expression level. Consequently, >80% of colonies showed successful AtMT transformation, and the hph expression level in AtMT/pCeg colonies was higher than that of AtMT/pCambia-egfp colonies. In the HygB-susceptible B. bassianaJEF-007, gpdA promoter works better than CaMV 35S promoter in the expression of HygB resistance gene at 150 μg ml -1 HygB, consequently improving the selection efficiency of putative transformants. These results provide useful information for determining AtMT effectiveness in B. bassiana isolates, particularly antibiotic susceptibility and the role of promoters. © 2017 The Society for Applied Microbiology.

[Experimental study on inhibition of retinal neovascularisation by gene transfer of extracellular 1-3 domain of VEGF receptor KDR].

PubMed

Zuo, Ling; Luan, Yong-xin; Pei, Ying; Sui, Gui-qin; Su, Guan-fang

2011-05-01

To evaluate the effect of liposome mediated plasmids KDRn3 injected into the vitreous to inhibit experimental retinal neovascularization. One-week-old C57BL/6N mice were exposed to 75% ± 2% oxygen for 5 days, then returned to the room air to induce retinal neovascularization. Cationic liposome mediated KDRn3 comp-lex (1 µl) was injected into the vitreous in the treatment group. PBS 1µl or liposome were injected in the control group. The pEGFP-N1/KDRn3 expression was observed by using fluorescence microscope. Retinal neovascularization was evaluated by counting the number of vascular endothelial cell nuclei on the vitreal side of the inner limiting membrane of the retina and measuring the areas of non-perfusions in central retina. KDRn3 protein was expressed both in the ganglion layer and in the inner layer. Retinal wholemount preparation of retinal neovascular animal model showed that prominent neovascular tuft and fluorescein leakage and large areas of non-perfusions in central retina. Fewer neovascular tufts and fewer areas of non-perfusions could be seen after pEGFP-N1/KDRn3 injection. There were statistic differences between control group and pEGFP-N1/KDRn3 injecting group with the number of vascular endothelial cell nuclei on the vitreal side of the inner limiting membrane of the retina (0.20 ± 0.51, 13.58 ± 2.48, 23.05 ± 3.40, 21.70 ± 2.89; F = 1085.25, P < 0.05) and the areas of non-perfusions in central retina [(1.33 ± 0.49), (2.75 ± 0.70), (2.12 ± 0.35) mm(2); F = 17.61, P < 0.01]. pEGFP-N1/KDRn3 gene transfer can inhibit retinal neovascularisation in C57Bl/6J mice of ischaemia-induced retinal neovascularisation on some extent.

A transgenic approach to study argininosuccinate synthetase gene expression

PubMed Central

2014-01-01

Background Argininosuccinate synthetase (ASS) participates in urea, nitric oxide and arginine production. Besides transcriptional regulation, a post-transcriptional regulation affecting nuclear precursor RNA stability has been reported. To study whether such post-transcriptional regulation underlines particular temporal and spatial ASS expression, and to investigate how human ASS gene behaves in a mouse background, a transgenic mouse system using a modified bacterial artificial chromosome carrying the human ASS gene tagged with EGFP was employed. Results Two lines of ASS-EGFP transgenic mice were generated: one with EGFP under transcriptional control similar to that of the endogenous ASS gene, another with EGFP under both transcriptional and post-transcriptional regulation as that of the endogenous ASS mRNA. EGFP expression in the liver, the organ for urea production, and in the intestine and kidney that are responsible for arginine biosynthesis, was examined. Organs taken from embryos E14.5 stage to young adult were examined under a fluorescence microscope either directly or after cryosectioning. The levels of EGFP and endogenous mouse Ass mRNAs were also quantified by S1 nuclease mapping. EGFP fluorescence and EGFP mRNA levels in both the liver and kidney were found to increase progressively from embryonic stage toward birth. In contrast, EGFP expression in the intestine was higher in neonates and started to decline at about 3 weeks after birth. Comparison between the EGFP profiles of the two transgenic lines indicated the developmental and tissue-specific regulation was mainly controlled at the transcriptional level. The ASS transgene was of human origin. EGFP expression in the liver followed essentially the mouse Ass pattern as evidenced by zonation distribution of fluorescence and the level of EGFP mRNA at birth. However, in the small intestine, Ass mRNA level declined sharply at 3 week of age, and yet substantial EGFP mRNA was still detectable at this stage. Thus, the time course of EGFP expression in the transgenic mice resembled that of the human ASS gene. Conclusions We demonstrate that the transgenic mouse system reported here has the merit of sensitivity and direct visualization advantage, and is ideal for annotating temporal and spatial expression profiles and the regulation mode of the ASS gene. PMID:24884799

[Preparation and activity detection of chicken egg yolk IgY antibody against human papillomavirus 16 type L1 main capsid protein].

PubMed

Yang, Jun; Zhang, Ming-juan; Qiang, Lei; Su, Bao-shan; Wang, Yi-li; Si, Lü-sheng

2008-03-01

To prepare highly specific chicken egg yolk IgY antibody against human papillomavirus 16 type L1 main capsid protein (HPV16L1) for detection of HPV16L1. Purified HPV16L1 protein was used to immunize the hens, from which the eggs were collected since one week after the first immunization. The egg yolk was separated and the IgY antibody purified by PEG-6000 method. The bioactivity of the antibody was tested using enzyme-linked immunosorbent assay (ELISA). Immunohistochemistry was performed to detect the HPV16L1 in the CHO cells transfected with the recombinant pcDNA-EGFP-HPV16L1 plasmid (containing EGFP-HPV16L1 fusion gene) for assessing the specific affinity of IgY to HPV16L1. After 3 immunizations of the hens, the titer of the purified IgY antibody against HPV16L1 from the egg yolk reached 1:10240. The IgY bound specifically to the EGFP-HPV16L1 protein expressed in the transfected CHO cells. High titer IgY can be prepared by immunization of the hens with HPV16L1 protein, and the prepared IgY can be used for HPV16L1 detection at the cellular level.

Over-expression of brain-derived neurotrophic factor in mesenchymal stem cells transfected with recombinant lentivirus BDNF gene.

PubMed

Zhang, X; Zhu, J; Zhang, K; Liu, T; Zhang, Z

2016-12-30

This study was aimed at investigating the expression of brain-derived neurotrophic factor (BDNF) in mesenchymal stem cells (MSCs) modified with recombinant lentivirus bearing BDNF gene. Lentivirus vectors bearing BDNF gene were constructed. MSCs were isolated from rats and cultured. The lentiviral vectors containing BDNF gene were transfected into the MSCs, and BDNF gene and protein expressions were monitored with enhanced green fluorescent protein (EGFP). RT-PCR and Western blot were used to measure gene and protein expressions, respectibvely in MSCs, MSCs-EGFP and MSCs-EGFP-BDNF groups. Green fluorescence assay confirmed successful transfection of BDNF gene recombinant lentivirus into MSCs. RT-PCR and Western blot revealed that BDNF gene and protein expressions in the MSCs-EGFP-BDNF group were significantly higher than that in MSCs group and MSCs-EGFP group. There were no statistically significant differences in gene expression between MSCs and MSCs-EGFP groups. MSCs can over-express BDNF when transfected with recombinant lentivirus bearing BDNF gene.

Hydroxyapatite Nanoparticles as a Novel Gene Carrier

NASA Astrophysics Data System (ADS)

Zhu, S. H.; Huang, B. Y.; Zhou, K. C.; Huang, S. P.; Liu, F.; Li, Y. M.; Xue, Z. G.; Long, Z. G.

2004-06-01

Hydroxyapatite crystalline nanoparticles were created by a precipitation hydrothermal technique and the majority of crystal particles were in the size range of 40-60nm and exhibited a colloidal feature when suspended in water. The gastric cancer SGC-7901 cell line cells were cultivated in the presence of10-100 μg ml-1 hydroxyapatite nanoparticle suspension and verified by MTT evaluation for their biocompatibility in vitro. The agarose gel electrophoresis analysis demonstrated that the HA nanoparticles potentially adsorb the green fluorescence protein EGFP-N1 plasmid DNA at pH 2 and 7, but not at pH 12. The DNA-nanoparticle complexes transfected EGFP-N1 pDNA into SGC-7901 cells in vitro with the efficiency about 80% as referenced with Lipofectmine TM 2000. In vivo animal experiment revealed no acute toxic adverse effect 2weeks after tail vein injection into mice, and TEM examination demonstrated their biodistribution and expression within the cytoplasm and also a little in the nuclei of the liver, kidney and brain tissue cells. These results suggest that the HA nanoparticle is a promising material that can be used as gene carrier, vectors.

Formation and loss of large, unstable tandem arrays of the piggyBac transposable element in the yellow fever mosquito, Aedes aegypti.

PubMed

Adelman, Zach N; Jasinskiene, Nijole; Vally, K J M; Peek, Corrie; Travanty, Emily A; Olson, Ken E; Brown, Susan E; Stephens, Janice L; Knudson, Dennis L; Coates, Craig J; James, Anthony A

2004-10-01

The Class II transposable element, piggyBac, was used to transform the yellow fever mosquito, Aedes aegypti. In two transformed lines only 15-30% of progeny inherited the transgene, with these individuals displaying mosaic expression of the EGFP marker gene. Southern analyses, gene amplification of genomic DNA, and plasmid rescue experiments provided evidence that these lines contained a high copy number of piggyBac transformation constructs and that much of this DNA consisted of both donor and helper plasmids. A detailed analysis of one line showed that the majority of piggyBac sequences were unit-length donor or helper plasmids arranged in a large tandem array that could be lost en masse in a single generation. Despite the presence of a transposase source and many intact donor elements, no conservative (cut and paste) transposition of piggyBac was observed in these lines. These results reveal one possible outcome of uncontrolled and/or unexpected recombination in this mosquito, and support the conclusion that further investigation is necessary before transposable elements such as piggyBac can be used as genetic drive mechanisms to move pathogen-resistance genes into mosquito populations.

'Green mice' display limitations in enhanced green fluorescent protein expression in retina and optic nerve cells.

PubMed

Caminos, Elena; Vaquero, Cecilia F; García-Olmo, Dolores C

2014-12-01

Characterization of retinal cells, cell transplants and gene therapies may be helped by pre-labeled retinal cells, such as those transfected with vectors for green fluorescent protein expression. The aim of this study was to analyze retinal cells and optic nerve components from transgenic green mice (GM) with the 'enhanced' green fluorescent protein (EGFP) gene under the control of the CAG promoter (a chicken β-actin promoter and a cytomegalovirus enhancer). The structural analysis and electroretinography recordings showed a normal, healthy retina. Surprisingly, EGFP expression was not ubiquitously located in the retina and optic nerve. Epithelial cells, photoreceptors and bipolar cells presented high green fluorescence levels. In contrast, horizontal cells, specific amacrine cells and ganglion cells exhibited a null EGFP expression level. The synaptic terminals of rod bipolar cells displayed a high green fluorescence level when animals were kept in the dark. Immature retinas exhibited different EGFP expression patterns to those noted in adults. Axons and glial cells in the optic nerve revealed a specific regional EGFP expression pattern, which correlated with the presence of myelin. These results suggest that EGFP expression might be related to the activity of both the CAG promoter and β-actin in mature retinal neurons and oligodendrocytes. Moreover, EGFP expression might be regulated by light in both immature and adult animals. Since GM are used in numerous retina bioassays, it is essential to know the differential EGFP expression in order to select cells of interest for each study.

Production of Mutated Porcine Embryos Using Zinc Finger Nucleases and a Reporter-based Cell Enrichment System.

PubMed

Koo, Ok Jae; Park, Sol Ji; Lee, Choongil; Kang, Jung Taek; Kim, Sujin; Moon, Joon Ho; Choi, Ji Yei; Kim, Hyojin; Jang, Goo; Kim, Jin-Soo; Kim, Seokjoong; Lee, Byeong-Chun

2014-03-01

To facilitate the construction of genetically-modified pigs, we produced cloned embryos derived from porcine fibroblasts transfected with a pair of engineered zinc finger nuclease (ZFN) plasmids to create targeted mutations and enriched using a reporter plasmid system. The reporter expresses RFP and eGFP simultaneously when ZFN-mediated site-specific mutations occur. Thus, double positive cells (RFP(+)/eGFP(+)) were selected and used for somatic cell nuclear transfer. Two types of reporter based enrichment systems were used in this study; the cloned embryos derived from cells enriched using a magnetic sorting-based system showed better developmental competence than did those derived from cells enriched by flow cytometry. Mutated sequences, such as insertions, deletions, or substitutions, together with the wild-type sequence, were found in the cloned porcine blastocysts. Therefore, genetic mutations can be achieved in cloned porcine embryos reconstructed with ZFN-treated cells that were enriched by a reporter-based system.

Recombinant Marburg Virus Expressing EGFP Allows Rapid Screening of Virus Growth and Real-time Visualization of Virus Spread

PubMed Central

Schmidt, Kristina Maria; Schümann, Michael; Olejnik, Judith; Krähling, Verena

2011-01-01

The generation of recombinant enhanced green fluorescent protein (EGFP)--expressing viruses has significantly improved the study of their life cycle and opened up the possibility for the rapid screening of antiviral drugs. Here we report rescue of a recombinant Marburg virus (MARV) expressing EGFP from an additional transcription unit (ATU). The ATU was inserted between the second and third genes, encoding VP35 and VP40, respectively. Live-cell imaging was used to follow virus spread in real time. EGFP expression was detected at 32 hours postinfection (hpi), and infection of neighboring cells was monitored at 55 hpi. Compared to the parental virus, production of progeny rMARV-EGFP was reduced 4-fold and lower protein levels of VP40, but not nucleoprotein, were observed, indicating a decrease in downstream protein expression due to the insertion of an ATU. Interestingly, EGFP concentrated in viral inclusions in infected cells. This was reproduced by transient expression of both EGFP and other fluorescent proteins along with filovirus nucleocapsid proteins, and may suggest that a general increase in protein synthesis occurs at viral inclusion sites. In conclusion, the EGFP-expressing MARV will be a useful tool not only to monitor virus spread and screen for antiviral compounds, but also to investigate the biology of inclusion body formation. PMID:21987762

[Construction and identification of recombinant human platelet-derived growth factor-B adenoviral vector and transfection into periodontal ligament stem cells].

PubMed

Shang, Shu-huan; Zhang, Yu-feng; Shi, Bin; Cheng, Xiang-rong

2008-10-01

To construct a recombinant human platelet-derived growth factor-B (PDGF-B) adenoviral vector and to transfect it into human periodontal ligament stem cells (PDLSC). The recombinant plasmid pAd-PDGF-B was constructed by homologous recombination and confirmed by restriction endonucleases digestion. Recombinant adenovirus was packaged in HEK293 cells. PDLSC were transfected with recombinant adenovirus and PDGF-B expression was confirmed. Expression of collagen type I gene was determined by quantitative analysis of the products of RT-PCR. The cell proliferation was determined with MTT colorimetric assay. The recombinant plasmid pAd-PDGF-B was confirmed by restriction endonucleases digestion. EGFP expression was observed on the third day after transfecting, and the expression of PDGF-B was detected. Immunohistochemical methods revealed that PDGF-B was expressed in PDLSC. Levels of expression of collagen type I gene were increased significantly by transfer of the exogenous PDGF-B gene to PDLSC. At the same time, findings indicated that Ad-PDGF-B stimulated PDLSC proliferation. MTT assay indicated the absorbance of PDLSC by stimulating with Ad-PDGF-B was (0.68 +/- 0.02), P < 0.01. Using the AdEasy system, the human PDGF-B recombinant adenovirus can be rapidly obtained. These results indicate that recombinant adenoviruses encoding PDGF-B transgenes could modulate proliferative activity of PDLSC, enhance the high expression of collagen type I and lay the foundation for periodontal tissue regeneration and dental implant gene therapy.

How the expression of green fluorescent protein and human cardiac actin in the heart influences cardiac function and aerobic performance in zebrafish Danio rerio.

PubMed

Avey, S R; Ojehomon, M; Dawson, J F; Gillis, T E

2018-01-01

The present study examined how the expression of enhanced green fluorescent protein (eGFP) and human cardiac actin (ACTC) in zebrafish Danio rerio influences embryonic heart rate (R H ) and the swim performance and metabolic rate of adult fish. Experiments with the adults involved determining the critical swimming speed (U crit , the highest speed sustainable and measure of aerobic capacity) while measuring oxygen consumption. Two different transgenic D. rerio lines were examined: one expressed eGFP in the heart (tg(cmlc:egfp)), while the second expressed ACTC in the heart and eGFP throughout the body (tg(cmlc:actc,ba:egfp)). It was found that R H was significantly lower in the tg(cmlc:actc,ba:egfp) embryos 4 days post-fertilization compared to wild-type (WT) and tg(cmlc:egfp). The swim experiments demonstrated that there was no significant difference in U crit between the transgenic lines and the wild-type fish, but metabolic rate and cost of transport (oxygen used to travel a set distance) was nearly two-fold higher in the tg(cmlc:actc,ba:egfp) fish compared to WT at their respective U crit . These results suggest that the expression of ACTC in the D. rerio heart and the expression of eGFP throughout the animal, alters cardiac function in the embryo and reduces the aerobic efficiency of the animal at high levels of activity. © 2017 The Fisheries Society of the British Isles.

Overexpression of caudal-related homeobox transcription factor 2 inhibits the growth of transplanted colorectal tumors in nude mice

PubMed Central

ZHENG, JIAN-BAO; QIAO, LI-NA; SUN, XUE-JUN; QI, JIE; REN, HAI-LIANG; WEI, GUANG-BING; ZHOU, PEI-HUA; YAO, JIAN-FENG; ZHANG, LI; JIA, PENG-BO

2015-01-01

Caudal-related homeobox transcription factor 2 (CDX2) is a transcription factor, which is specifically expressed in the adult intestine. It is essential for the development and homeostasis of the intestinal epithelium and its functions as a tumor suppressor have been demonstrated in the adult colon. The present study aimed to examine the inhibitory effects of the overexpression of CDX2 on subcutaneously-transplanted tumors, derived from LoVo colon cancer cells, in nude mice, and to provide experimental evidence for the biotherapy of colon cancer. A pEGFP-C1-CDX2 eukaryotic expression vector was transfected into the LoVo cells via lipofection, and LoVo cells stably-expressing CDX2 (pEGFP-C1-CDX2 cells) were obtained using G418 selection. A nude mouse subcutaneously-transplanted tumor model was established by inoculating the nude mice with the pEGFP-C1-CDX2 cells, and the effects of overexpression of CDX2 on transplanted tumor growth in the LoVo cells were observed. Western blotting results demonstrated that the protein expression of CDX2 in the LoVo cells was higher in the pEGFP-C1-CDX2 cell group, compared with that in the pEGFP-C1 cell group and the untreated cell group. At 20 days post-inoculation with either pEGFP-C1-CDX2 or pEGFP-C1, the transplanted tumor masses were significantly lower in the pEGFP-C1-CDX2 group, compared with those in the pEGFP-C1 and untreated groups. Immunohistochemistry revealed that the expression levels of CDX2 and matrix metalloproteinase-2 (MMP-2) were detected in each group, and the protein expression of CDX2 was increased in the tumor tissues from the nude mice in the pEGFP-C1-CDX2 group. However the expression of MMP-2 was downregulated in the tumor tissues of the nude mice in the pEGFP-C1-CDX2 group. Taken together, these data suggested that pEGFP-C1-CDX2 cells exhibited suppressed tumor growth in vivo. Overexpression of CDX2 was observed in transplanted tumors in the pEGFP-C1-CDX2 group, and the gene expression of MMP-2 was reduced. These results indicate that CDX2 inhibited the growth of colorectal tumor cells, possibly by downregulating the gene expression. PMID:26005051

Dopamine D2 receptor over-expression alters behavior and physiology in Drd2-EGFP mice

PubMed Central

Kramer, Paul F.; Christensen, Christine H.; Hazelwood, Lisa A.; Dobi, Alice; Bock, Roland; Sibley, David R.; Mateo, Yolanda; Alvarez, Veronica A.

2011-01-01

BAC transgenic mice expressing the fluorescent reporter protein EGFP under the control of the D1 and D2 dopamine receptor promoters (Drd1-EGFP and Drd2-EGFP) have been widely used to study striatal function and have contributed to our understanding of the physiological and pathological function of the basal ganglia. These tools were produced and promptly made available to address questions in a cell-specific manner that has transformed the way we frame hypotheses in neuroscience. However, these mice have not been fully characterized until now. We found that Drd2-EGFP mice display a ~40% increase in membrane expression of the dopamine D2 receptor (D2R) and a two-fold increase in D2R mRNA levels in the striatum when compared to wild-type and Drd1-EGFP mice D2R over-expression was accompanied by behavioral hypersensitivity to D2R-like agonists, as well as enhanced electrophysiological responses to D2R activation in midbrain dopaminergic neurons. DA transients evoked by stimulation in the nucleus accumbens showed slower clearance in Drd2-EGFP mice and cocaine actions on DA clearance were impaired in these mice. Thus, it was not surprising to find that Drd2-EGFP mice were hyperactive when exposed to a novel environment and locomotion was suppressed by acute cocaine administration. All together, this study demonstrates that Drd2-EGFP mice over-express D2R and have altered dopaminergic signaling that fundamentally differentiates them from wild-type and Drd1-EGFP mice. PMID:21209197

Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression.

PubMed

Trinh, Alice T; Ball, Bret G; Weber, Erin; Gallaher, Timothy K; Gluzman-Poltorak, Zoya; Anderson, French; Basile, Lena A

2009-12-30

Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency.

Real-time PCR to determine transgene copy number and to quantitate the biolocalization of adoptively transferred cells from EGFP-transgenic mice.

PubMed

Joshi, Molishree; Keith Pittman, H; Haisch, Carl; Verbanac, Kathryn

2008-09-01

Quantitative real-time PCR (qPCR) is a sensitive technique for the detection and quantitation of specific DNA sequences. Here we describe a Taqman qPCR assay for quantification of tissue-localized, adoptively transferred enhanced green fluorescent protein (EGFP)-transgenic cells. A standard curve constructed from serial dilutions of a plasmid containing the EGFP transgene was (i) highly reproducible, (ii) detected as few as two copies, and (iii) was included in each qPCR assay. qPCR analysis of genomic DNA was used to determine transgene copy number in several mouse strains. Fluorescent microscopy of tissue sections showed that adoptively transferred vascular endothelial cells (VEC) from EGFP-transgenic mice specifically localized to tissue with metastatic tumors in syngeneic recipients. VEC microscopic enumeration of liver metastases strongly correlated with qPCR analysis of identical sections (Pearson correlation 0.81). EGFP was undetectable in tissue from control mice by qPCR. In another study using intra-tumor EGFP-VEC delivery to subcutaneous tumors, manual cell count and qPCR analysis of alternating sections also strongly correlated (Pearson correlation 0.82). Confocal microscopy of the subcutaneous tumor sections determined that visual fluorescent signals were frequently tissue artifacts. This qPCR methodology offers specific, objective, and rapid quantitation, uncomplicated by tissue autofluorescence, and should be readily transferable to other in vivo models to quantitate the biolocalization of transplanted cells.

Hydrodynamic gene delivery in human skin using a hollow microneedle device.

PubMed

Dul, M; Stefanidou, M; Porta, P; Serve, J; O'Mahony, C; Malissen, B; Henri, S; Levin, Y; Kochba, E; Wong, F S; Dayan, C; Coulman, S A; Birchall, J C

2017-11-10

Microneedle devices have been proposed as a minimally invasive delivery system for the intradermal administration of nucleic acids, both plasmid DNA (pDNA) and siRNA, to treat localised disease or provide vaccination. Different microneedle types and application methods have been investigated in the laboratory, but limited and irreproducible levels of gene expression have proven to be significant challenges to pre-clinical to clinical progression. This study is the first to explore the potential of a hollow microneedle device for the delivery and subsequent expression of pDNA in human skin. The regulatory approved MicronJet600® (MicronJet hereafter) device was used to deliver reporter plasmids (pCMVβ and pEGFP-N1) into viable excised human skin. Exogenous gene expression was subsequently detected at multiple locations that were distant from the injection site but within the confines of the bleb created by the intradermal bolus. The observed levels of gene expression in the tissue are at least comparable to that achieved by the most invasive microneedle application methods e.g. lateral application of a microneedle. Gene expression was predominantly located in the epidermis, although also evident in the papillary dermis. Optical coherence tomography permitted real time visualisation of the sub-surface skin architecture and, unlike a conventional intradermal injection, MicronJet administration of a 50μL bolus appears to create multiple superficial microdisruptions in the papillary dermis and epidermis. These were co-localised with expression of the pCMVβ reporter plasmid. We have therefore shown, for the first time, that a hollow microneedle device can facilitate efficient and reproducible gene expression of exogenous naked pDNA in human skin using volumes that are considered to be standard for intradermal administration, and postulate a hydrodynamic effect as the mechanism of gene delivery. Copyright © 2017 Elsevier B.V. All rights reserved.

A transgenic reporter under control of an es1 promoter/enhancer marks wound epidermis and apical epithelial cap during tail regeneration in Xenopus laevis tadpole.

PubMed

Sato, Kentaro; Umesono, Yoshihiko; Mochii, Makoto

2018-01-15

Rapid wound healing and subsequent formation of the apical epithelial cap (AEC) are believed to be required for successful appendage regeneration in amphibians. Despite the significant role of AEC in limb regeneration, its role in tail regeneration and the mechanisms that regulate the wound healing and AEC formation are not well understood. We previously identified Xenopus laevis es1, which is preferentially expressed in wounded regions, including the AEC after tail regeneration. In this study we established and characterized transgenic Xenopus laevis lines harboring the enhanced green fluorescent protein (EGFP) gene under control of an es1 gene regulatory sequence (es1:egfp). The EGFP reporter expression was clearly seen in several regions of the embryo and then declined to an undetectable level in larvae, recapitulating the endogenous es1 expression. After amputation of the tadpole tail, EGFP expression was re-activated at the edge of the stump epidermis and then increased in the wound epidermis (WE) covering the amputation surface. As the stump started to regenerate, the EGFP expression became restricted to the most distal epidermal region, including the AEC. EGFP was preferentially expressed in the basal or deep cells but not in the superficial cells of the WE and AEC. We performed a small-scale pharmacological screening for chemicals that affected the expression of EGFP in the stump epidermis after tail amputation. The EGFP expression was attenuated by treatment with an inhibitor for ERK, TGF-β or reactive oxygen species (ROS) signaling. These treatments also impaired wound closure of the amputation surface, suggesting that the three signaling activities are required for es1 expression in the WE and successful wound healing after tail amputation. These findings showed that es1:egfp Xenopus laevis should be a useful tool to analyze molecular mechanisms regulating wound healing and appendage regeneration. Copyright © 2017 Elsevier Inc. All rights reserved.

Direct visualization of membrane architecture of myelinating cells in transgenic mice expressing membrane-anchored EGFP.

PubMed

Deng, Yaqi; Kim, BongWoo; He, Xuelian; Kim, Sunja; Lu, Changqing; Wang, Haibo; Cho, Ssang-Goo; Hou, Yiping; Li, Jianrong; Zhao, Xianghui; Lu, Q Richard

2014-04-01

Myelinogenesis is a complex process that involves substantial and dynamic changes in plasma membrane architecture and myelin interaction with axons. Highly ramified processes of oligodendrocytes in the central nervous system (CNS) make axonal contact and then extrapolate to wrap around axons and form multilayer compact myelin sheathes. Currently, the mechanisms governing myelin sheath assembly and axon selection by myelinating cells are not fully understood. Here, we generated a transgenic mouse line expressing the membrane-anchored green fluorescent protein (mEGFP) in myelinating cells, which allow live imaging of details of myelinogenesis and cellular behaviors in the nervous systems. mEGFP expression is driven by the promoter of 2'-3'-cyclic nucleotide 3'-phosphodiesterase (CNP) that is expressed in the myelinating cell lineage. Robust mEGFP signals appear in the membrane processes of oligodendrocytes in the CNS and Schwann cells in the peripheral nervous system (PNS), wherein mEGFP expression defines the inner layers of myelin sheaths and Schmidt-Lanterman incisures in adult sciatic nerves. In addition, mEGFP expression can be used to track the extent of remyelination after demyelinating injury in a toxin-induced demyelination animal model. Taken together, the membrane-anchored mEGFP expression in the new transgenic line would facilitate direct visualization of dynamic myelin membrane formation and assembly during development and process remodeling during remyelination after various demyelinating injuries.

Core labeling of adenovirus with EGFP

DOE Office of Scientific and Technical Information (OSTI.GOV)

Le, Long P.; Le, Helen N.; Nelson, Amy R.

2006-08-01

The study of adenovirus could greatly benefit from diverse methods of virus detection. Recently, it has been demonstrated that carboxy-terminal EGFP fusions of adenovirus core proteins Mu, V, and VII properly localize to the nucleus and display novel function in the cell. Based on these observations, we hypothesized that the core proteins may serve as targets for labeling the adenovirus core with fluorescent proteins. To this end, we constructed various chimeric expression vectors with fusion core genes (Mu-EGFP, V-EGFP, preVII-EGFP, and matVII-EGFP) while maintaining expression of the native proteins. Expression of the fusion core proteins was suboptimal using E1 expressionmore » vectors with both conventional CMV and modified (with adenovirus tripartite leader sequence) CMV5 promoters, resulting in non-labeled viral particles. However, robust expression equivalent to the native protein was observed when the fusion genes were placed in the deleted E3 region. The efficient Ad-wt-E3-V-EGFP and Ad-wt-E3-preVII-EGFP expression vectors were labeled allowing visualization of purified virus and tracking of the viral core during early infection. The vectors maintained their viral function, including viral DNA replication, viral DNA encapsidation, cytopathic effect, and thermostability. Core labeling offers a means to track the adenovirus core in vector targeting studies as well as basic adenovirus virology.« less

Establishment of Nephrin Reporter Mice and Use for Chemical Screening

PubMed Central

Tsuchida, Junichi; Matsusaka, Taiji; Ohtsuka, Masato; Miura, Hiromi; Okuno, Yukiko; Asanuma, Katsuhiko; Nakagawa, Takahiko; Yanagita, Motoko

2016-01-01

Nephrin is a critical component of glomerular filtration barrier, which is important to maintain glomerular structure and avoid proteinuria. Downregulation of nephrin expression is commonly observed at early stage of glomerular disorders, suggesting that methods to increase nephrin expression in podocytes may have therapeutic utility. Here, we generated a knockin mouse line carrying single copy of 5.5 kb nephrin promoter controlling expression of enhanced green fluorescent protein (EGFP) at Rosa26 genomic locus (Nephrin-EGFP mouse). In these mice, EGFP was specifically expressed in podocytes. Next, we isolated and cultivated glomeruli from these mice, and developed a protocol to automatically quantitate EGFP expression in cultured glomeruli. EGFP signal was markedly reduced after 5 days of culture but reduction was inhibited by vitamin D treatment. We confirmed that vitamin D increased mRNA and protein expression of endogenous nephrin in cultivated glomeruli. Thus, we generated a mouse line converting nephrin promoter activity into fluorescence, which can be used to screen compounds having activity to enhance nephrin gene expression. PMID:27362433

Dynamic expression of Lgr6 in the developing and mature mouse cochlea

PubMed Central

Zhang, Yanping; Chen, Yan; Ni, Wenli; Guo, Luo; Lu, Xiaoling; Liu, Liman; Li, Wen; Sun, Shan; Wang, Lei; Li, Huawei

2015-01-01

The Wnt/β-catenin signaling pathway plays important roles in mammalian inner ear development. Lgr5, one of the downstream target genes of the Wnt/β-catenin signaling pathway, has been reported to be a marker for inner ear hair cell progenitors. Lgr6 shares approximately 50% sequence homology with Lgr5 and has been identified as a stem cell marker in several organs. However, the detailed expression profiles of Lgr6 have not yet been investigated in the mouse inner ear. Here, we first used Lgr6-EGFP-Ires-CreERT2 mice to examine the spatiotemporal expression of Lgr6 protein in the cochlear duct during embryonic and postnatal development. Lgr6-EGFP was first observed in one row of prosensory cells in the middle and basal turn at embryonic day 15.5 (E15.5). From E18.5 to postnatal day 3 (P3), the expression of Lgr6-EGFP was restricted to the inner pillar cells (IPCs). From P7 to P15, the Lgr6-EGFP expression level gradually decreased in the IPCs and gradually increased in the inner border cells (IBCs). At P20, Lgr6-EGFP was only expressed in the IBCs, and by P30 Lgr6-EGFP expression had completely disappeared. Next, we demonstrated that Wnt/β-catenin signaling is required to maintain the Lgr6-EGFP expression in vitro. Finally, we demonstrated that the Lgr6-EGFP-positive cells isolated by flow cytometry could differentiate into myosin 7a-positive hair cells after 10 days in-culture, and this suggests that the Lgr6-positive cells might serve as the hair cell progenitor cells in the cochlea. PMID:26029045

Enhanced gene expression promoted by hybrid magnetic/cationic block copolymer micelles.

PubMed

Haladjova, E; Rangelov, S; Tsvetanov, Ch B; Posheva, V; Peycheva, E; Maximova, V; Momekova, D; Mountrichas, G; Pispas, S; Bakandritsos, A

2014-07-15

We report on novel gene delivery vector systems based on hybrid polymer-magnetic micelles. The hybrid micelles were prepared by codissolution of hydrophobically surface modified iron oxide and amphiphilic polystyrene-b-poly(quaternized 2-vinylpyridine) block copolymer (PS-b-P2QVP) in organic solvent. After extensive dialysis against water, micelles with positively charged hydrophilic corona of PQVP and hydrophobic PS core were prepared, in which magnetic nanoparticles were randomly distributed. The hybrid micelles were used to form complexes with linear (salmon sperm, 2000 bp, corresponding to M(w) of 1.32 × 10(6) Da) and plasmid (pEGFP-N1, 4730 bp, corresponding to M(w) of 3.12 × 10(6) Da) DNA. The resulting magnetopolyplexes of phosphate:amine (P/N) ratios in the 0.05-20 range were characterized by light scattering, ζ-potential measurements, and transmission electron microscopy as well as cytotoxicity and gel retardation assays. The investigated systems displayed a narrow size distribution, particle dimensions below 360 nm, whereas their ζ-potential values varied from positive to negative depending of the P/N ratio. The resulting vector nanosystems exhibited low toxicity. They were able to introduce pEGFP-N1 molecules into the cells. The application of a magnetic field markedly boosted the transgene expression efficiency of the magnetopolyplexes, which was even superior to those of commercial transfectants such as Lipofectamine and dendritic polyethylenimine.

Improved genetically-encoded, FlincG-type fluorescent biosensors for neural cGMP imaging

PubMed Central

Bhargava, Yogesh; Hampden-Smith, Kathryn; Chachlaki, Konstantina; Wood, Katherine C.; Vernon, Jeffrey; Allerston, Charles K.; Batchelor, Andrew M.; Garthwaite, John

2013-01-01

Genetically-encoded biosensors are powerful tools for understanding cellular signal transduction mechanisms. In aiming to investigate cGMP signaling in neurones using the EGFP-based fluorescent biosensor, FlincG (fluorescent indicator for cGMP), we encountered weak or non-existent fluorescence after attempted transfection with plasmid DNA, even in HEK293T cells. Adenoviral infection of HEK293T cells with FlincG, however, had previously proved successful. Both constructs were found to harbor a mutation in the EGFP domain and had a tail of 17 amino acids at the C-terminus that differed from the published sequence. These discrepancies were systematically examined, together with mutations found beneficial for the related GCaMP family of Ca2+ biosensors, in a HEK293T cell line stably expressing both nitric oxide (NO)-activated guanylyl cyclase and phosphodiesterase-5. Restoring the mutated amino acid improved basal fluorescence whereas additional restoration of the correct C-terminal tail resulted in poor cGMP sensing as assessed by superfusion of either 8-bromo-cGMP or NO. Ultimately, two improved FlincGs were identified: one (FlincG2) had the divergent tail and gave moderate basal fluorescence and cGMP response amplitude and the other (FlincG3) had the correct tail, a GCaMP-like mutation in the EGFP region and an N-terminal tag, and was superior in both respects. All variants tested were strongly influenced by pH over the physiological range, in common with other EGFP-based biosensors. Purified FlincG3 protein exhibited a lower cGMP affinity (0.89 μM) than reported for the original FlincG (0.17 μM) but retained rapid kinetics and a 230-fold selectivity over cAMP. Successful expression of FlincG2 or FlincG3 in differentiated N1E-115 neuroblastoma cells and in primary cultures of hippocampal and dorsal root ganglion cells commends them for real-time imaging of cGMP dynamics in neural (and other) cells, and in their subcellular specializations. PMID:24068983

Drug-Induced Trafficking of P-Glycoprotein in Human Brain Capillary Endothelial Cells as Demonstrated by Exposure to Mitomycin C

PubMed Central

Noack, Andreas; Noack, Sandra; Hoffmann, Andrea; Maalouf, Katia; Buettner, Manuela; Couraud, Pierre-Olivier; Romero, Ignacio A.; Weksler, Babette; Alms, Dana; Römermann, Kerstin; Naim, Hassan Y.; Löscher, Wolfgang

2014-01-01

P-glycoprotein (Pgp; ABCB1/MDR1) is a major efflux transporter at the blood-brain barrier (BBB), restricting the penetration of various compounds. In other tissues, trafficking of Pgp from subcellular stores to the cell surface has been demonstrated and may constitute a rapid way of the cell to respond to toxic compounds by functional membrane insertion of the transporter. It is not known whether drug-induced Pgp trafficking also occurs in brain capillary endothelial cells that form the BBB. In this study, trafficking of Pgp was investigated in human brain capillary endothelial cells (hCMEC/D3) that were stably transfected with a doxycycline-inducible MDR1-EGFP fusion plasmid. In the presence of doxycycline, these cells exhibited a 15-fold increase in Pgp-EGFP fusion protein expression, which was associated with an increased efflux of the Pgp substrate rhodamine 123 (Rho123). The chemotherapeutic agent mitomycin C (MMC) was used to study drug-induced trafficking of Pgp. Confocal fluorescence microscopy of single hCMEC/D3-MDR1-EGFP cells revealed that Pgp redistribution from intracellular pools to the cell surface occurred within 2 h of MMC exposure. Pgp-EGFP exhibited a punctuate pattern at the cell surface compatible with concentrated regions of the fusion protein in membrane microdomains, i.e., lipid rafts, which was confirmed by Western blot analysis of biotinylated cell surface proteins in Lubrol-resistant membranes. MMC exposure also increased the functionality of Pgp as assessed in three functional assays with Pgp substrates (Rho123, eFluxx-ID Gold, calcein-AM). However, this increase occurred with some delay after the increased Pgp expression and coincided with the release of Pgp from the Lubrol-resistant membrane complexes. Disrupting rafts by depleting the membrane of cholesterol increased the functionality of Pgp. Our data present the first direct evidence of drug-induced Pgp trafficking at the human BBB and indicate that Pgp has to be released from lipid rafts to gain its full functionality. PMID:24505408

Drug-induced trafficking of p-glycoprotein in human brain capillary endothelial cells as demonstrated by exposure to mitomycin C.

PubMed

Noack, Andreas; Noack, Sandra; Hoffmann, Andrea; Maalouf, Katia; Buettner, Manuela; Couraud, Pierre-Olivier; Romero, Ignacio A; Weksler, Babette; Alms, Dana; Römermann, Kerstin; Naim, Hassan Y; Löscher, Wolfgang

2014-01-01

P-glycoprotein (Pgp; ABCB1/MDR1) is a major efflux transporter at the blood-brain barrier (BBB), restricting the penetration of various compounds. In other tissues, trafficking of Pgp from subcellular stores to the cell surface has been demonstrated and may constitute a rapid way of the cell to respond to toxic compounds by functional membrane insertion of the transporter. It is not known whether drug-induced Pgp trafficking also occurs in brain capillary endothelial cells that form the BBB. In this study, trafficking of Pgp was investigated in human brain capillary endothelial cells (hCMEC/D3) that were stably transfected with a doxycycline-inducible MDR1-EGFP fusion plasmid. In the presence of doxycycline, these cells exhibited a 15-fold increase in Pgp-EGFP fusion protein expression, which was associated with an increased efflux of the Pgp substrate rhodamine 123 (Rho123). The chemotherapeutic agent mitomycin C (MMC) was used to study drug-induced trafficking of Pgp. Confocal fluorescence microscopy of single hCMEC/D3-MDR1-EGFP cells revealed that Pgp redistribution from intracellular pools to the cell surface occurred within 2 h of MMC exposure. Pgp-EGFP exhibited a punctuate pattern at the cell surface compatible with concentrated regions of the fusion protein in membrane microdomains, i.e., lipid rafts, which was confirmed by Western blot analysis of biotinylated cell surface proteins in Lubrol-resistant membranes. MMC exposure also increased the functionality of Pgp as assessed in three functional assays with Pgp substrates (Rho123, eFluxx-ID Gold, calcein-AM). However, this increase occurred with some delay after the increased Pgp expression and coincided with the release of Pgp from the Lubrol-resistant membrane complexes. Disrupting rafts by depleting the membrane of cholesterol increased the functionality of Pgp. Our data present the first direct evidence of drug-induced Pgp trafficking at the human BBB and indicate that Pgp has to be released from lipid rafts to gain its full functionality.

Expression of EGFP and NPTII protein is not associated with organ abnormalities in deceased transgenic cloned cattle.

PubMed

Liu, Yan; Wu, Qian; Cui, Huiting; Li, Qinghe; Zhao, Yiqiang; Luo, Juan; Liu, Qiuyue; Sun, Xiuzhu; Tang, Bo; Zhang, Lei; Dai, Yunping; Li, Ning

2008-12-01

Both enhanced green fluorescence protein (EGFP) and neomycin phosphotransferase type II enzyme (NPTII) are widely used in transgenic studies, but their side effects have not been extensively investigated. In this study, we evaluated the expression profiles of the two marker genes and the relationship between their expression and organ abnormalities. Eight transgenic cloned cattle were studied, four harboring both EGFP and NPTII, and four harboring only the NPTII gene. Four age-matched cloned cattle were used as controls. EGFP and NPTII expression were measured and detected by Q-PCR, Western blot, ELISA, and RIA in heart, liver, and lungs, and the values ranged from 0.3 to 5 microg/g. The expression profiles exhibited differential or mosaic pattern between the organs, the pathologic symptoms of which were identified, but were similar to those of age-matched cloned cattle. All data indicated that the expression of EGFP and NPTII is not associated with organ abnormalities in transgenic cloned cattle.

Site-specific gene transfer into the rat spinal cord by photomechanical waves

NASA Astrophysics Data System (ADS)

Ando, Takahiro; Sato, Shunichi; Toyooka, Terushige; Uozumi, Yoichi; Nawashiro, Hiroshi; Ashida, Hiroshi; Obara, Minoru

2011-10-01

Nonviral, site-specific gene delivery to deep tissue is required for gene therapy of a spinal cord injury. However, an efficient method satisfying these requirements has not been established. This study demonstrates efficient and targeted gene transfer into the spinal cord by using photomechanical waves (PMWs), which were generated by irradiating a black laser absorbing rubber with 532-nm nanosecond Nd:YAG laser pulses. After a solution of plasmid DNA coding for enhanced green fluorescent protein (EGFP) or luciferase was intraparenchymally injected into the spinal cord, PMWs were applied to the target site. In the PMW application group, we observed significant EGFP gene expression in the white matter and remarkably high luciferase activity only in the spinal cord segment exposed to the PMWs. We also assessed hind limb movements 24 h after the application of PMWs based on the Basso-Beattie-Bresnahan (BBB) score to evaluate the noninvasiveness of this method. Locomotor evaluation showed no significant decrease in BBB score under optimum laser irradiation conditions. These findings demonstrated that exogenous genes can be efficiently and site-selectively delivered into the spinal cord by applying PMWs without significant locomotive damage.

Production of transgenic Korean native cattle expressing enhanced green fluorescent protein using a FIV-based lentiviral vector injected into MII oocytes.

PubMed

Xu, Yong-Nan; Uhm, Sang-Jun; Koo, Bon-Chul; Kwon, Mo-Sun; Roh, Ji-Yeol; Yang, Jung-Seok; Choi, Hyun-Yong; Heo, Young-Tae; Cui, Xiang-Shun; Yoon, Joon-Ho; Ko, Dae-Hwan; Kim, Teoan; Kim, Nam-Hyung

2013-01-20

The potential benefits of generating and using transgenic cattle range from improvements in agriculture to the production of large quantities of pharmaceutically relevant proteins. Previous studies have attempted to produce transgenic cattle and other livestock by pronuclear injection and somatic cell nuclear transfer, but these approaches have been largely ineffective; however, a third approach, lentivirus-mediated transgenesis, has successfully produced transgenic livestock. In this study, we generated transgenic (TG) Korean native cattle using perivitelline space injection of viral vectors, which expressed enhanced green fluorescent protein (EGFP) systemically. Two different types of lentiviral vectors derived from feline immunodeficiency virus (FIV) and human immunodeficiency virus (HIV) carrying EGFP were injected into the perivitelline space of MII oocytes. EGFP expression at 8-cell stage was significantly higher in the FIV group compared to the HIV group (47.5%±2.2% v.s. 22.9%±2.9%). Eight-cell embryos that expressed EGFP were cultured into blastocysts and then transferred into 40 heifers. Ten heifers were successfully impregnated and delivered 10 healthy calves. All of these calves expressed EGFP as detected by in vivo imaging, PCR and Southern blotting. In addition, we established an EGFP-expressing cell line from TG calves, which was followed by nuclear transfer (NT). Recloned 8-cell embryos also expressed EGFP, and there were no differences in the rates of fusion, cleavage and development between cells derived from TG and non-TG calves, which were subsequently used for NT. These results illustrate that FIV-based lentiviruses are useful for the production of TG cattle. Moreover, our established EGFP cell line can be used for additional studies that involve induced pluripotent stem cells. Copyright © 2013. Published by Elsevier Ltd.

Knockout of Cytidine Monophospho-N-Acetylneuraminic Acid (CMP-NeuAc) Hydroxylase From Porcine Endothelial Cells by a CRISPR System.

PubMed

Sakai, R; Esaki, Y; Hasuwa, H; Ikawa, M; Lo, P; Matsuura, R; Nakahata, K; Zenitani, M; Asada, M; Maeda, A; Eguchi, H; Okuyama, H; Miyagawa, S

2016-05-01

We attempted to knock out the expression of Hanganutziu-Deicher (H-D) antigens through the use of a CRISPR (clustered regulatory interspaced short palindromic repeat)/Cas9 system for pig cytidine monophospho-N-acetylneuraminic acid hydroxylase (CMAH). Plasmids expressing hCas9 and sgRNA for pCMAH were prepared by ligating oligos into the BbsI site of pX330. The N-terminal and C-terminal EGFP coding regions overlapping 482 bp were PCR-amplified and placed under a ubiquitous CAG promoter. The approximately 400-bp genomic fragments containing the sgRNA target sequence of pCMAH were placed into the multi-cloning sites flanked by the EGFP fragments. The pCAG-EGxxFP-target was mixed with pX330 with/without the sgRNA sequences and then introduced into HEK293T cells. Four oligos and primers, gSO1, gSO3, gSO4, and gSO8, were nominated from 8 candidates. Among them, gSO1 showed the best efficiency. Pig endothelial cells (PECs) from an α-Gal knockout pig were then used to examine the changes in the expression of the H-D antigen by the knockout of the CMAH genome by the pX330-gS01. Changes in the expression of the H-D antigen in the PECs with the CRISPR (gS01) were clear in comparison with those in the parental cells, on the basis of FACS analysis data. The expression of the H-D antigen can be knocked out by use of the CRISPR system for pCMAH, thus confirming that this system is a very convenient system for producing knockout pigs. Copyright © 2016 Elsevier Inc. All rights reserved.

Application of eGFP to label human periodontal ligament stem cells in periodontal tissue engineering.

PubMed

Wen, Yong; Lan, Jing; Huang, Haiyun; Yu, Meijiao; Cui, Jun; Liang, Jin; Jiang, Baoqi; Xu, Xin

2012-09-01

To establish human periodontal ligament stem cells (hPDLSC) with high and stable expression of enhanced green fluorescent protein (eGFP) and to obtain an ideal vector expression system that suitable for gene therapy in periodontal tissue engineering. hPDLSCs were transfected with eGFP for 48h via different MOI (25, 50, 100, 200 and 400) by lentiviral vector, the transfection efficiency was evaluated by fluorescent microscopy and flow cytometry, and transfected hPDLSCs proliferation was evaluated by MTT. Pluripotent, differentiation capacity and ALP expression status were determined further. Osteoblast-associated genes expressions for osteogenesis were evaluated by quantitative-PCR. In addition, rat molar periodontal fenestration defect model was used for evaluating periodontal tissue engineering. The transfection efficiency after 48h were 44.7%, 60.9%, 71.7%, 85.8%, and 86.9% respectively. There was no significant effect of transfection (at different MOI levels of 25, 50, 100, and 200) on the proliferation of hPDLSCs (designated as eGFP-hPDLSCs) compared with hPDLSCs (P>0.05). However, proliferation of eGFP hPDLSCs at MOI 400 became slower (P<0.05). Both eGFP hPDLSCs and hPDLSCs were able to differentiate into osteocytes and adipocytes under certain conditioned media. At 7 days, expression levels of COL-1, RUNX2 in hPDLSCS were higher than those in eGFP hPDLSCs (P<0.05); expression levels of ALP and OPN in eGFP hPDLSCs were similar to those in hPDLSCs (P>0.05). Newly regenerated bone formation was observed in the defect model used. Among the transfection conditions, 48h transfection at MOI 200 is optimal for labelling hPDLSCs with eGFP in a lentiviral vector. There is no change in capability of the eGFP hPDLSCs osteogenesis. The lentiviral vector with eGFP is an appropriate expression vector system and hPDLSCs are ideal seeding cells for gene therapy in periodontal tissue engineering. Copyright © 2012 Elsevier Ltd. All rights reserved.

A combination hepatoma-targeted therapy based on nanotechnology: pHRE-Egr1-HSV-TK/131I-antiAFPMcAb-GCV/MFH

NASA Astrophysics Data System (ADS)

Lin, Mei; Huang, Junxing; Jiang, Xingmao; Zhang, Jia; Yu, Hong; Ye, Jun; Zhang, Dongsheng

2016-09-01

Combination targeted therapy is a promising cancer therapeutic strategy. Here, using PEI-Mn0.5Zn0.5Fe2O4 nanoparticles (PEI-MZF-NPs) as magnetic media for MFH (magnetic fluid hyperthermia) and gene transfer vector for gene-therapy, a combined therapy, pHRE-Egr1-HSV-TK/131I-antiAFPMcAb-GCV/MFH, for hepatoma is developed. AntiAFPMcAb (Monoclonal antibody AFP) is exploited for targeting. The plasmids pHRE-Egr1-HSV-TK are achieved by incorporation of pEgr1-HSV-TK and pHRE-Egr1-EGFP. Restriction enzyme digestion and PCR confirm the recombinant plasmids pHRE-Egr1-HSV-TK are successfully constructed. After exposure to the magnetic field, PEI-MZF-NPs/pHRE-Egr1-EGFP fluid is warmed rapidly and then the temperature is maintained at 43 °C or so, which is quite appropriate for cancer treatment. The gene expression reaches the peak when treated with 200 μCi 131I for 24 hours, indicating that the dose of 200 μCi might be the optimal dose for irradiation and 24 h irradiation later is the best time to initiate MFH. The in vitro and in vivo experiments demonstrate that pHRE-Egr1-HSV-TK/131I-antiAFPMcAb-GCV/MFH can greatly suppress hepatic tumor cell proliferation and induce cell apoptosis and necrosis and effectively inhibit the tumor growth, much better than any monotherapy does alone. Furthermore, the combination therapy has few or no adverse effects. It might be applicable as a strategy to treat hepatic cancer.

A gene delivery system for insect cells mediated by arginine-rich cell-penetrating peptides.

PubMed

Chen, Yung-Jen; Liu, Betty Revon; Dai, Yun-Hao; Lee, Cheng-Yi; Chan, Ming-Huan; Chen, Hwei-Hsien; Chiang, Huey-Jenn; Lee, Han-Jung

2012-02-10

Most bioactive macromolecules, such as protein, DNA and RNA, basically cannot permeate into cells freely from outside the plasma membrane. Cell-penetrating peptides (CPPs) are a group of short peptides that possess the ability to traverse the cell membrane and have been considered as candidates for mediating gene and drug delivery into living cells. In this study, we demonstrate that three arginine-rich CPPs (SR9, HR9 and PR9) are able to form stable complexes with plasmid DNA and deliver DNA into insect Sf9 cells in a noncovalent manner. The transferred plasmid DNA containing enhanced green fluorescent protein (EGFP) and red fluorescent protein (RFP) coding regions could be expressed in cells functionally assayed at both the protein and RNA levels. Furthermore, treatment of cells with CPPs and CPP/DNA complexes resulted in a viability of 84-93% indicating these CPPs are not cytotoxic. These results suggest that arginine-rich CPPs appear to be a promising tool for insect transgenesis. Copyright © 2011 Elsevier B.V. All rights reserved.

Identification of a Short Cell-Penetrating Peptide from Bovine Lactoferricin for Intracellular Delivery of DNA in Human A549 Cells

PubMed Central

Liu, Betty R.; Huang, Yue-Wern; Aronstam, Robert S.; Lee, Han-Jung

2016-01-01

Cell-penetrating peptides (CPPs) have been shown to deliver cargos, including protein, DNA, RNA, and nanomaterials, in fully active forms into live cells. Most of the CPP sequences in use today are based on non-native proteins that may be immunogenic. Here we demonstrate that the L5a CPP (RRWQW) from bovine lactoferricin (LFcin), stably and noncovalently complexed with plasmid DNA and prepared at an optimal nitrogen/phosphate ratio of 12, is able to efficiently enter into human lung cancer A549 cells. The L5a CPP delivered a plasmid containing the enhanced green fluorescent protein (EGFP) coding sequence that was subsequently expressed in cells, as revealed by real-time PCR and fluorescent microscopy at the mRNA and protein levels, respectively. Treatment with calcium chloride increased the level of gene expression, without affecting CPP-mediated transfection efficiency. Zeta-potential analysis revealed that positively electrostatic interactions of CPP/DNA complexes correlated with CPP-mediated transport. The L5a and L5a/DNA complexes were not cytotoxic. This biomimetic LFcin L5a represents one of the shortest effective CPPs and could be a promising lead peptide with less immunogenic for DNA delivery in gene therapy. PMID:26942714

Identification of a Short Cell-Penetrating Peptide from Bovine Lactoferricin for Intracellular Delivery of DNA in Human A549 Cells.

PubMed

Liu, Betty R; Huang, Yue-Wern; Aronstam, Robert S; Lee, Han-Jung

2016-01-01

Cell-penetrating peptides (CPPs) have been shown to deliver cargos, including protein, DNA, RNA, and nanomaterials, in fully active forms into live cells. Most of the CPP sequences in use today are based on non-native proteins that may be immunogenic. Here we demonstrate that the L5a CPP (RRWQW) from bovine lactoferricin (LFcin), stably and noncovalently complexed with plasmid DNA and prepared at an optimal nitrogen/phosphate ratio of 12, is able to efficiently enter into human lung cancer A549 cells. The L5a CPP delivered a plasmid containing the enhanced green fluorescent protein (EGFP) coding sequence that was subsequently expressed in cells, as revealed by real-time PCR and fluorescent microscopy at the mRNA and protein levels, respectively. Treatment with calcium chloride increased the level of gene expression, without affecting CPP-mediated transfection efficiency. Zeta-potential analysis revealed that positively electrostatic interactions of CPP/DNA complexes correlated with CPP-mediated transport. The L5a and L5a/DNA complexes were not cytotoxic. This biomimetic LFcin L5a represents one of the shortest effective CPPs and could be a promising lead peptide with less immunogenic for DNA delivery in gene therapy.

Expression and localization of a novel phosducin-like protein from amphioxus Branchiostoma belcheri

NASA Astrophysics Data System (ADS)

Saren, Gaowa; Zhao, Yonggang

2009-05-01

A full length amphioxus cDNA, encoding a novel phosducin-like protein ( Amphi-PhLP), was identified for the first time from the gut cDNA library of Branchiostoma belcheri. It is comprised of 1 550 bp and an open reading frame (ORF) of 241 amino acids, with a predicted molecular mass of approximately 28 kDa. In situ hybridization histochemistry revealed a tissue-specific expression pattern of Amphi-PhLP with the high levels in the ovary, and at a lower level in the hind gut and testis, hepatic caecum, gill, endostyle, and epipharyngeal groove, while it was absent in the muscle, neural tube and notochord. In the Chinese Hamster Ovary (CHO) cells transfected with the expression plasmid pEGFP-N1/ Amphi-PhLP, the fusion protein was targeted in the cytoplasm of CHO cells, suggesting that Amphi-PhLP is a cytosolic protein. This work may provide a framework for further understanding of the physiological function of Amphi-PhLP in B. belcheri.

Somatodendritic surface expression of epitope-tagged and KChIP binding-deficient Kv4.2 channels in hippocampal neurons.

PubMed

Prechtel, Helena; Hartmann, Sven; Minge, Daniel; Bähring, Robert

2018-01-01

Kv4.2 channels mediate a subthreshold-activating somatodendritic A-type current (ISA) in hippocampal neurons. We examined the role of accessory Kv channel interacting protein (KChIP) binding in somatodendritic surface expression and activity-dependent decrease in the availability of Kv4.2 channels. For this purpose we transfected cultured hippocampal neurons with cDNA coding for Kv4.2 wild-type (wt) or KChIP binding-deficient Kv4.2 mutants. All channels were equipped with an externally accessible hemagglutinin (HA)-tag and an EGFP-tag, which was attached to the C-terminal end. Combined analyses of EGFP self-fluorescence, surface HA immunostaining and patch-clamp recordings demonstrated similar dendritic trafficking and functional surface expression for Kv4.2[wt]HA,EGFP and the KChIP binding-deficient Kv4.2[A14K]HA,EGFP. Coexpression of exogenous KChIP2 augmented the surface expression of Kv4.2[wt]HA,EGFP but not Kv4.2[A14K]HA,EGFP. Notably, activity-dependent decrease in availability was more pronounced in Kv4.2[wt]HA,EGFP + KChIP2 coexpressing than in Kv4.2[A14K]HA,EGFP + KChIP2 coexpressing neurons. Our results do not support the notion that accessory KChIP binding is a prerequisite for dendritic trafficking and functional surface expression of Kv4.2 channels, however, accessory KChIP binding may play a potential role in Kv4.2 modulation during intrinsic plasticity processes.

The expression of VE-cadherin in breast cancer cells modulates cell dynamics as a function of tumor differentiation and promotes tumor-endothelial cell interactions.

PubMed

Rezaei, Maryam; Cao, Jiahui; Friedrich, Katrin; Kemper, Björn; Brendel, Oliver; Grosser, Marianne; Adrian, Manuela; Baretton, Gustavo; Breier, Georg; Schnittler, Hans-Joachim

2018-01-01

The cadherin switch has profound consequences on cancer invasion and metastasis. The endothelial-specific vascular endothelial cadherin (VE-cadherin) has been demonstrated in diverse cancer types including breast cancer and is supposed to modulate tumor progression and metastasis, but underlying mechanisms need to be better understood. First, we evaluated VE-cadherin expression by tissue microarray in 392 cases of breast cancer tumors and found a diverse expression and distribution of VE-cadherin. Experimental expression of fluorescence-tagged VE-cadherin (VE-EGFP) in undifferentiated, fibroblastoid and E-cadherin-negative MDA-231 (MDA-VE-EGFP) as well as in differentiated E-cadherin-positive MCF-7 human breast cancer cell lines (MCF-VE-EGFP), respectively, displayed differentiation-dependent functional differences. VE-EGFP expression reversed the fibroblastoid MDA-231 cells to an epithelial-like phenotype accompanied by increased β-catenin expression, actin and vimentin remodeling, increased cell spreading and barrier function and a reduced migration ability due to formation of VE-cadherin-mediated cell junctions. The effects were largely absent in both MDA-VE-EGFP and in control MCF-EGFP cell lines. However, MCF-7 cells displayed a VE-cadherin-independent planar cell polarity and directed cell migration that both developed in MDA-231 only after VE-EGFP expression. Furthermore, VE-cadherin expression had no effect on tumor cell proliferation in monocultures while co-culturing with endothelial cells enhanced tumor cell proliferation due to integration of the tumor cells into monolayer where they form VE-cadherin-mediated cell contacts with the endothelium. We propose an interactive VE-cadherin-based crosstalk that might activate proliferation-promoting signals. Together, our study shows a VE-cadherin-mediated cell dynamics and an endothelial-dependent proliferation in a differentiation-dependent manner.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Piccioli, Zachary; McKee, Courtney H.; Leszczynski, Anna

We investigated the nuclear import of low risk HPV11 E7 protein using 1) transfection assays in HeLa cells with EGFP fusion plasmids containing 11E7 and its domains and 2) nuclear import assays in digitonin-permeabilized HeLa cells with GST fusion proteins containing 11E7 and its domains. The EGFP-11E7 and EGFP-11cE7{sub 39-98} localized mostly to the nucleus. The GST-11E7 and GST-11cE7{sub 39-98} were imported into the nuclei in the presence of either Ran-GDP or RanG19V-GTP mutant and in the absence of nuclear import receptors. This suggests that 11E7 enters the nucleus via a Ran-dependent pathway, independent of nuclear import receptors, mediated bymore » a nuclear localization signal located in its C-terminal domain (cNLS). This cNLS contains the zinc binding domain consisting of two copies of Cys-X-X-Cys motif. Mutagenesis of Cys residues in these motifs changed the localization of the EGFP-11cE7/-11E7 mutants to cytoplasmic, suggesting that the zinc binding domain is essential for nuclear localization of 11E7.« less

Visualization of Endoplasmic Reticulum and Mitochondria in Aurantiochytrium limacinum by the Expression of EGFP with Cell Organelle-Specific Targeting/Retaining Signals.

PubMed

Okino, Nozomu; Wakisaka, Hiroyoshi; Ishibashi, Yohei; Ito, Makoto

2018-04-01

Thraustochytrids are single cell marine eukaryotes that produce large amounts of polyunsaturated fatty acids such as docosahexaenoic acid. In the present study, we report the visualization of endoplasmic reticulum (ER) and mitochondria in a type strain of the thraustochytrid, Aurantiochytrium limacinum ATCC MYA-1381, using the enhanced green fluorescent protein (EGFP) with specific targeting/retaining signals. We expressed the egfp gene with ER targeting/retaining signals from A. limacinum calreticulin or BiP/GRP78 in the thraustochytrid, resulting in the distribution of EGFP signals at the perinuclear region and near lipid droplets. ER-Tracker™ Red, an authentic fluorescent probe for the visualization of ER in mammalian cells, also stained the same region. We observed small lipid droplets generated from the visualized ER in the early growth phase of cell culture. Expression of the egfp gene with the mitochondria targeting signal from A. limacinum cytochrome c oxidase resulted in the localization of EGFP near the plasma membrane. The distribution of EGFP signals coincided with that of MitoTracker® Red CMXRos, which is used to visualize mitochondria in eukaryotes. The ER and mitochondria of A. limacinum were visualized for the first time by EGFP with thraustochytrid cell organelle-specific targeting/retaining signals. These results will contribute to classification of the intracellular localization of proteins expressed in ER and mitochondria as well as analyses of these cell organelles in thraustochytrids.

The Application of Clinical Lithotripter Shock Waves to RNA Nucleotide Delivery to Cells.

PubMed

Nwokeoha, Sandra; Carlisle, Robert; Cleveland, Robin O

2016-10-01

The delivery of genes into cells through the transfer of ribonucleic acids (RNAs) has been found to cause a change in the level of target protein expression. RNA-based transfection is conceptually more efficient than commonly delivered plasmid DNA because it does not require division or damage of the nuclear envelope, thereby increasing the chances of the cell remaining viable. Shock waves (SWs) have been found to induce cellular uptake by transiently altering the permeability of the plasma membrane, thereby overcoming a critical step in gene therapy. However, accompanying SW bio-effects include dose-dependent irreversible cell injury and cytotoxicity. Here, the effect of SWs generated by a clinical lithotripter on the viability and permeabilisation of three different cell lines in vitro was investigated. Comparison of RNA stability before and after SW exposure revealed no statistically significant difference. Optimal SW exposure parameters were identified to minimise cell death and maximise permeabilisation, and applied to enhanced green fluorescent protein (eGFP) messenger RNA (mRNA) or anti-eGFP small interfering RNA delivery. As a result, eGFP mRNA expression levels increased up to 52-fold in CT26 cells, whereas a 2-fold decrease in GFP expression was achieved after anti-eGFP small interfering RNA delivery to MCF-7/GFP cells. These results indicate that SW parameters can be employed to achieve effective nucleotide delivery, laying the foundation for non-invasive and high-tolerability RNA-based gene therapy. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Establishment of a Nipah virus rescue system.

PubMed

Yoneda, Misako; Guillaume, Vanessa; Ikeda, Fusako; Sakuma, Yuki; Sato, Hiroki; Wild, T Fabian; Kai, Chieko

2006-10-31

Nipah virus (NiV), a paramyxovirus, was first discovered in Malaysia in 1998 in an outbreak of infection in pigs and humans and incurred a high fatality rate in humans. Fruit bats, living in vast areas extending from India to the western Pacific, were identified as the natural reservoir of the virus. However, the mechanisms that resulted in severe pathogenicity in humans (up to 70% mortality) and that enabled crossing the species barrier were not known. In this study, we established a system that enabled the rescue of replicating NiVs from a cloned DNA by cotransfection of a constructed full-length cDNA clone and supporting plasmids coding virus nucleoprotein, phosphoprotein, and polymerase with the infection of the recombinant vaccinia virus, MVAGKT7, expressing T7 RNA polymerase. The rescued NiV (rNiV), by using the newly developed reverse genetics system, showed properties in vitro that were similar to the parent virus and retained the severe pathogenicity in a previously established animal model by experimental infection. A recombinant NiV was also developed, expressing enhanced green fluorescent protein (rNiV-EGFP). Using the virus, permissibility of NiV was compared with the presence of a known cellular receptor, ephrin B2, in a number of cell lines of different origins. Interestingly, two cell lines expressing ephrin B2 were not susceptible for rNiV-EGFP, indicating that additional factors are clearly required for full NiV replication. The reverse genetics for NiV will provide a powerful tool for the analysis of the molecular mechanisms of pathogenicity and cross-species infection.

Elucidation of the new generation fluorescent protein tdTomato for space related radiobiological research

NASA Astrophysics Data System (ADS)

Chishti, Arif Ali; Baumstark-Khan, Christa; Hellweg, Christine; Reitz, Guenther

Astronauts in space are exposed to a potentially harmful radiation field, which does not exist in its quality and quantity on earth. Radiation exposure in space can lead to delayed or acute health effects. A successful long-term space mission requires better risk estimation and development of appropriate countermeasures, therefore study of the cellular radiation response is necessary. Ionizing radiation can provoke active cellular responses (cell cycle arrest, DNA repair, apoptosis or other forms of cell type). Exposure to ionizing radiation also activates various signaling pathways in human cells. In the cellular radiation-response, two pivotal signal transduction pathways have to be comprehensively studied i.e. the p53-pathway and NF-κB-pathway. Discovery of fluorescent proteins has revolutionized biological research by making it possible to carry out functional studies in living cells and understanding complex signaling pathways. Previously the green fluorescent proteins EGFP and d2EGFP were used for signaling pathway studies. In this work the new red fluorescent protein tdTomato will be used for comprehensive investigation of NF-κB and other transcription factor activation after exposure of human cells to ionizing radiation (X-rays, heavy ions; space conditions). tdTomato has many advantages over EGFP because of its high fluorescence signals and a better signal/noise ratio in human cells. The previously constructed reporter system with d2EGFP was used to evaluate NF-kB activation after exposure to heavy ion particles of different biological effectiveness. The sensitivity threshold of this system was determined to be 2 particle traversals per cell nucleus. In the current study a more sensitive reporter assay will be constructed using a GAL4-VP16 turbo system that comprises a receptor plasmid and a reporter plasmid. This reporter assay will be designed and constructed with tdTomato and evaluation will be done with different molecular techniques.

IL-33 activates eosinophils of visceral adipose tissue both directly and via innate lymphoid cells.

PubMed

Hashiguchi, Masaaki; Kashiwakura, Yuji; Kojima, Hidefumi; Kobayashi, Ayano; Kanno, Yumiko; Kobata, Tetsuji

2015-03-01

Eosinophils are multifunctional leukocytes involved in allergic reactions as well as adipose tissue regulation. IL-5 is required for eosinophil survival; however, the in vivo mechanisms of eosinophil regulation are not fully understood. A tg mouse model with il5 promoter-driven EGFP expression was established for detecting the IL-5-producing cells in vivo. Il5-egfp tg mice expressed high levels of EGFP in gonadal adipose tissue (GAT) cells. EGFP(+) cells in GAT were mainly group 2 innate lymphoid cells (ILCs). IL-33 preferentially expanded EGFP(+) cells and eosinophils in GAT in vivo. EGFP(+) ILCs were found to upregulate prg2 mRNA expression in GAT eosinophils. These results demonstrate that ILCs activate eosinophils in GAT. The blockage of IL-33Rα, on the other hand, did not impair EGFP(+) ILC numbers but did impair eosinophil numbers in vivo. GAT eosinophils expressed IL-33Rα and IL-33 expanded eosinophil numbers in CD90(+) cell-depleted mice. IL-33 was further observed to induce the expression of retnla and epx mRNA in eosinophils. These findings demonstrate that IL-33 directly activates eosinophils in GAT, and together with our other findings described above, our findings show that IL-33 has dual pathways via which it activates eosinophils in vivo: a direct activation pathway and a group 2 ILC-mediated pathway. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression

PubMed Central

2009-01-01

Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. Conclusion These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency. PMID:20042112

Germ-line transmission of lentiviral PGK-EGFP integrants in transgenic cattle: new perspectives for experimental embryology.

PubMed

Reichenbach, Myriam; Lim, Tiongti; Reichenbach, Horst-Dieter; Guengoer, Tuna; Habermann, Felix A; Matthiesen, Marieke; Hofmann, Andreas; Weber, Frank; Zerbe, Holm; Grupp, Thomas; Sinowatz, Fred; Pfeifer, Alexander; Wolf, Eckhard

2010-08-01

Lentiviral vectors are a powerful tool for the genetic modification of livestock species. We previously generated transgenic founder cattle with lentiviral integrants carrying enhanced green fluorescent protein (EGFP) under the control of the phosphoglycerate kinase (PGK) promoter. In this study, we investigated the transmission of LV-PGK-EGFP integrants through the female and male germ line in cattle. A transgenic founder heifer (#562, Kiki) was subjected to superovulation treatment and inseminated with semen from a non-transgenic bull. Embryos were recovered and transferred to synchronized recipient heifers, resulting in the birth of a healthy male transgenic calf expressing EGFP as detected by in vivo imaging. Semen from a transgenic founder bull (#561, Jojo) was used for in vitro fertilization (IVF) of in vitro matured (IVM) oocytes from non-transgenic cows. The rates of cleavage and development to blastocyst in vitro corresponded to 52.0 +/- 4.1 and 24.5 +/- 4.4%, respectively. Expression of EGFP was observed at blastocyst stage (day 7 after IVF) and was seen in 93.0% (281/302) of the embryos. 24 EGFP-expressing embryos were transferred to 9 synchronized recipients. Analysis of 2 embryos, flushed from the uterus on day 15, two fetuses recovered on day 45, and a healthy male transgenic calf revealed consistent high-level expression of EGFP in all tissues investigated. Our study shows for the first time transmission of lentiviral integrants through the germ line of female and male transgenic founder cattle. The pattern of inheritance was consistent with Mendelian rules. Importantly, high fidelity expression of EGFP in embryos, fetuses, and offspring of founder #561 provides interesting tools for developmental studies in cattle, including interactions of gametes, embryos and fetuses with their maternal environment.

MicroRNA-7a regulates Müller glia differentiation by attenuating Notch3 expression.

PubMed

Baba, Yukihiro; Aihara, Yuko; Watanabe, Sumiko

2015-09-01

miRNA-7a plays critical roles in various biological aspects in health and disease. We aimed to reveal roles of miR-7a in mouse retinal development by loss- and gain-of-function analyses of miR-7a. Plasmids encoding miR-7a or miR-7a-decoy (anti-sense miR-7a) were introduced into mouse retina at P0, and the retina was cultured as explant. Then, proliferation of retinal progenitors and differentiation of retinal subtypes were examined by immunostaining. miR-7a had no apparent effect on the proliferation of retinal progenitor cells. However, the expression of Müller glia marker, cyclin D3, was reduced by miR-7a overexpression and up-regulated by miR-7a decoy, suggesting that miR-7a negatively regulates differentiation of Müller glia. Targets of miR-7a, which were predicted by using a public program miRNA.org, and Notch3 was suggested to be one of candidate genes of miR-7a target. Notch3 3' UTR appeared to contain complementary sequence to the seed sequence of miR-7a. A reporter assay in NIH3T3 cells using a plasmid containing multiple repeats of potential target sequence of 3' Notch UTR showed that miR-7a suppress expression of reporter EGFP through 3'UTR region. Expression of sh-Notch3 and over-expression of NICD3 in retina suggested that miR-7a regulates Müller glia differentiation through attenuation of Notch3 expression. Taken together, we revealed that the miR-7a regulates the differentiation of Müller glia through the suppression of Notch3 expression. Copyright © 2015 Elsevier Ltd. All rights reserved.

Expression and purification of recombinant nattokinase in Spodoptera frugiperda cells.

PubMed

Li, Xiaoxiang; Wang, Xiaoli; Xiong, Shaoling; Zhang, Jing; Cai, Litao; Yang, Yanyan

2007-10-01

A recombinant baculovirus, rv-egfp-NK, containing a reporter gene encoding the enhanced green fluorescent protein (EGFP), was used to express nattokinase (NK), a fibrinolytic enzyme, in Spodoptera frugiperda (SF-9) cells. The recombinant protein also included a histidine tag for purification using Ni(2+) resins. The recombinant NK, approximately 30 kDa, retained fibrinolytic activity (60 U/ml). The integration of the EGFP expression cassette in the Bac-to-Bac system is thus an effective method for the expression and purification of recombinant NK protein in Spodoptera frugiperda insect cells.

Evaluation of an FRDA-EGFP genomic reporter assay in transgenic mice.

PubMed

Sarsero, Joseph P; Holloway, Timothy P; Li, Lingli; McLenachan, Samuel; Fowler, Kerry J; Bertoncello, Ivan; Voullaire, Lucille; Gazeas, Sophie; Ioannou, Panos A

2005-04-01

Friedreich ataxia is an autosomal recessive neurodegenerative disorder caused by a GAA trinucleotide expansion in the first intron of the Friedreich ataxia gene (FRDA) that causes reduced synthesis of frataxin, a mitochondrial protein likely to be involved in biosynthesis of iron-sulfur clusters. This leads to increased oxidative stress, progressive loss of large sensory neurons, and hypertrophic cardiomyopathy. To elucidate the mechanisms regulating FRDA expression and to develop an in vivo assay for agents that might upregulate FRDA expression in a therapeutically relevant manner, we have generated transgenic mice with a BAC genomic reporter construct consisting of an in-frame fusion between FRDA and the gene coding for enhanced green fluorescent protein (EGFP). Production of full-length frataxin-EGFP fusion protein was demonstrated by immunoblotting. EGFP expression was observed as early as day E3.5 of development. Most tissues of adult transgenic mice were fluorescent. The level of FRDA-EGFP expression in peripheral blood, bone marrow, and cells obtained from enzymatically disaggregated tissues was quantitated by flow cytometry. There was a twofold increase in EGFP expression in mice homozygous for the transgene when compared to hemizygous mice. These transgenic mice are a valuable tool for the examination of spatial and temporal aspects of FRDA gene expression and for the preclinical evaluation of pharmacological inducers of FRDA expression in a whole-animal model. In addition, tissues from these mice should also be valuable for stem cell transplantation studies.

A set of enhanced green fluorescent protein concatemers for quantitative determination of nuclear localization signal strength.

PubMed

Böhm, Jennifer; Thavaraja, Ramya; Giehler, Susanne; Nalaskowski, Marcus M

2017-09-15

Regulated transport of proteins between nucleus and cytoplasm is an important process in the eukaryotic cell. In most cases, active nucleo-cytoplasmic protein transport is mediated by nuclear localization signal (NLS) and/or nuclear export signal (NES) motifs. In this study, we developed a set of vectors expressing enhanced GFP (EGFP) concatemers ranging from 2 to 12 subunits (2xEGFP to 12xEGFP) for analysis of NLS strength. As shown by in gel GFP fluorescence analysis and αGFP Western blotting, EGFP concatemers are expressed as fluorescent full-length proteins in eukaryotic cells. As expected, nuclear localization of concatemeric EGFPs decreases with increasing molecular weight. By oligonucleotide ligation this set of EGFP concatemers can be easily fused to NLS motifs. After determination of intracellular localization of EGFP concatemers alone and fused to different NLS motifs we calculated the size of a hypothetic EGFP concatemer showing a defined distribution of EGFP fluorescence between nucleus and cytoplasm (n/c ratio = 2). Clear differences of the size of the hypothetic EGFP concatemer depending on the fused NLS motif were observed. Therefore, we propose to use the size of this hypothetic concatemer as quantitative indicator for comparing strength of different NLS motifs. Copyright © 2017 Elsevier Inc. All rights reserved.

An efficient Agrobacterium-mediated transformation method for the edible mushroom Hypsizygus marmoreus.

PubMed

Zhang, Jin jing; Shi, Liang; Chen, Hui; Sun, Yun qi; Zhao, Ming wen; Ren, Ang; Chen, Ming jie; Wang, Hong; Feng, Zhi yong

2014-01-01

Hypsizygus marmoreus is one of the major edible mushrooms in East Asia. As no efficient transformation method, the molecular and genetics studies were hindered. The glyceraldehyde-3-phosphate dehydrogenase (GPD) gene of H. marmoreus was isolated and its promoter was used to drive the hygromycin B phosphotransferase (HPH) and enhanced green fluorescent protein (EGFP) in H. marmoreus. Agrobacterium tumefaciens-mediated transformation (ATMT) was successfully applied in H. marmoreus. The transformation parameters were optimized, and it was found that co-cultivation of bacteria with protoplast at a ratio of 1000:1 at a temperature of 26 °C in medium containing 0.3 mM acetosyringone resulted in the highest transformation efficiency for Agrobacterium strain. Besides, three plasmids, each carrying a different promoter (from H. marmoreus, Ganoderma lucidum and Lentinula edodes) driving the expression of an antibiotic resistance marker, were also tested. The construct carrying the H. marmoreus gpd promoter produced more transformants than other constructs. Our analysis showed that over 85% of the transformants tested remained mitotically stable even after five successive rounds of subculturing. Putative transformants were analyzed for the presence of hph gene by PCR and Southern blot. Meanwhile, the expression of EGFP in H. marmoreus transformants was detected by fluorescence imaging. This ATMT system increases the transformation efficiency of H. marmoreus and may represent a useful tool for molecular genetic studies in this mushroom species. Copyright © 2014 Elsevier GmbH. All rights reserved.

Mu-driven transposition of recombinant mini-Mu unit DNA in the Corynebacterium glutamicum chromosome.

PubMed

Gorshkova, Natalya V; Lobanova, Juliya S; Tokmakova, Irina L; Smirnov, Sergey V; Akhverdyan, Valerii Z; Krylov, Alexander A; Mashko, Sergey V

2018-03-01

A dual-component Mu-transposition system was modified for the integration/amplification of genes in Corynebacterium. The system consists of two types of plasmids: (i) a non-replicative integrative plasmid that contains the transposing mini-Mu(LR) unit bracketed by the L/R Mu ends or the mini-Mu(LER) unit, which additionally contains the enhancer element, E, and (ii) an integration helper plasmid that expresses the transposition factor genes for MuA and MuB. Efficient transposition in the C. glutamicum chromosome (≈ 2 × 10 -4 per cell) occurred mainly through the replicative pathway via cointegrate formation followed by possible resolution. Optimizing the E location in the mini-Mu unit significantly increased the efficiency of Mu-driven intramolecular transposition-amplification in C. glutamicum as well as in gram-negative bacteria. The new C. glutamicum genome modification strategy that was developed allows the consequent independent integration/amplification/fixation of target genes at high copy numbers. After integration/amplification of the first mini-Mu(LER) unit in the C. glutamicum chromosome, the E-element, which is bracketed by lox-like sites, is excised by Cre-mediated fashion, thereby fixing the truncated mini-Mu(LR) unit in its position for the subsequent integration/amplification of new mini-Mu(LER) units. This strategy was demonstrated using the genes for the citrine and green fluorescent proteins, yECitrine and yEGFP, respectively.

Generation and characterization of gsuα:EGFP transgenic zebrafish for evaluating endocrine-disrupting effects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, Xiaoxia; University of Chinese Academy of Sciences, Beijing; Chen, Xiaowen

The glycoprotein subunit α (gsuα) gene encodes the shared α subunit of the three pituitary heterodimeric glycoprotein hormones: follicle-stimulating hormone β (Fshβ), luteinizing hormone β (Lhβ) and thyroid stimulating hormone β (Tshβ). In our current study, we identified and characterized the promoter region of zebrafish gsuα and generated a stable gsuα:EGFP transgenic line, which recapitulated the endogenous gsuα expression in the early developing pituitary gland. A relatively conserved regulatory element set is presented in the promoter regions of zebrafish and three other known mammalian gsuα promoters. Our results also demonstrated that the expression patterns of the gsuα:EGFP transgene were allmore » identical to those expression patterns of the endogenous gsuα expression in the pituitary tissue when our transgenic fish were treated with various endocrine chemicals, including forskolin (FSK), SP600125, trichostatin A (TSA), KClO{sub 4}, dexamethasone (Dex), β-estradiol and progesterone. Thus, this gsuα:EGFP transgenic fish reporter line provides another valuable tool for investigating the lineage development of gsuα-expressing gonadotrophins and the coordinated regulation of various glycoprotein hormone subunit genes. These reporter fish can serve as a novel platform to perform screenings of endocrine-disrupting chemicals (EDCs) in vivo as well. - Highlights: • Identification of the promoter of zebrafish glycoprotein subunit α (gsuα) gene • Generation of stable transmission gsuα:EGFP transgenic zebrafish reporter • Demonstration of the recapitulation of the gsuα:EGFP and endogenous gsuα expression • Suggestion of the gsuα:EGFP transgenic zebrafish as a novel platform for EDC study.« less

MLF1-interacting protein is mainly localized in nucleolus through N-terminal bipartite nuclear localization signal.

PubMed

Suzuki, Hideaki; Arakawa, Yasuhiro; Ito, Masaki; Saito, Shinobu; Takeda, Nobuakira; Yamada, Hisashi; Horiguchi-Yamada, Junko

2007-01-01

The myelodysplasia/myeloid leukemia factor 1-interacting protein (MLF1LP, also called KLIP1 and CENP-50) is reported to localize in both the nucleus and the cytoplasm. To investigate the functions of MLF1IP, its subnuclear localization was studied. MLF1IP was tagged with green fluorescent protein (EGFP). Fibrillarin was tagged with red fluorescent protein (DsRed). EGFP-tagged MLF1IP deletion vectors were also constructed. Plasmid-constructs were transfected into human cervical adenocarcinoma HeLa cells or monkey kidney fibroblast COS-7 cells, and the localization was studied by either confocal fluorescence microscopy or fluorescence microscopy. Ectopically expressed MLF1IP was localized mainly in the nucleolus. In some cells, small dot-like particles of MLF1IP fluorescence were observed in the nucleoplasm. Co-staining of fibrillarin disclosed that MLF1IP was co-localized with fibrillarin in the nucleolus. Deletion mutants of MLF1IP revealed that the N-terminal bipartite nuclear localization signal (NLS) was responsible for nucleolar targeting. MLF1IP was localized mainly in the nucleolus through the N-terminal bipartite NLS and partly in the nucleoplasm featuring small dot-like particles. These findings suggest that MLF1IP may have multi-functions and its different localizations may contribute to carcinogenesis.

[Construction and Function Verification of a Novel Shuttle Vector Containing a Marker Gene Self-deletion System].

PubMed

Li, Lili; Wang, Zhan; Zhou, Yubai; Zhang, Fang; Shen, Sisi; Li, Zelin; Zeng, Yi

2015-09-01

For rapid and accurate screening of recombinant modified vaccinia virus Ankara (rMVA) that satisfied the quality standards of clinical trials, a novel shuttle vector that can delete the marker gene automatically during virus propagation was construted: pZL-EGFP. To construct the pZL-EGFP, the original shuttle vector pSC11 was modified by replacing the LacZ marker gene with enhanced green fluorescent protein (EGFP) and then inserting homologous sequences of TKL into the flank regions of EGFP. Baby hamster kidney (BHK)-21 cells were cotransfected with pZL-EGFP and MVA, and underwent ten passages and one plaque screening to obtain the EGFP-free rMVA carrying the exogenous gene. Resulting rMVA was tested by polymerase chain reaction and western blotting to verify pZL-EGFP function. A novel shuttle vector pZL-EGFP containing an EGFP marker gene which could be deleted automatically was constructed. This gene deletion had no effect on the activities of rMVA, and the exogenous gene could be expressed stably. These results suggest that rMVA can be packaged efficiently by homologous recombination between pZL-EGFP and MVA in BHK-21 cells, and that the carried EGFP gene can be removed automatically by intramolecular homologous recombination during virus passage. Meanwhile, the gene deletion had no influence on the activities of rMVA and the expression of exogenous target gene. This study lays a solid foundation for the future research.

Solid lipid nanoparticles mediate non-viral delivery of plasmid DNA to dendritic cells

NASA Astrophysics Data System (ADS)

Penumarthi, Alekhya; Parashar, Deepti; Abraham, Amanda N.; Dekiwadia, Chaitali; Macreadie, Ian; Shukla, Ravi; Smooker, Peter M.

2017-06-01

There is an increasing demand for novel DNA vaccine delivery systems, mainly for the non-viral type as they are considered relatively safe. Therefore, solid lipid nanoparticles (SLNs) were investigated for their suitability as a non-viral DNA vaccine delivery system. SLNs were synthesised by a modified solvent-emulsification method in order to study their potential to conjugate with plasmid DNA and deliver them in vitro to dendritic cells using eGFP as the reporter plasmid. The DNA-SLN complexes were characterised by electron microscopy, gel retardation assays and dynamic light scattering. The cytotoxicity assay data supported their biocompatibility and was used to estimate safe threshold concentration resulting in high transfection rate. The transfection efficiency of these complexes in a dendritic cell line was shown to increase significantly compared to plasmid alone, and was comparable to that mediated by lipofectamine. Transmission electron microscopy studies delineated the pathway of cellular uptake. Endosomal escape was observed supporting the mechanism of transfection.

Bacteriophage T7 RNA polymerase-based expression in Pichia pastoris.

PubMed

Hobl, Birgit; Hock, Björn; Schneck, Sandra; Fischer, Reinhard; Mack, Matthias

2013-11-01

A novel Pichia pastoris expression vector (pEZT7) for the production of recombinant proteins employing prokaryotic bacteriophage T7 RNA polymerase (T7 RNAP) (EC 2.7.7.6) and the corresponding promoter pT7 was constructed. The gene for T7 RNAP was stably introduced into the P. pastoris chromosome 2 under control of the (endogenous) constitutive P. pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter (pGAP). The gene product T7 RNAP was engineered to contain a nuclear localization signal, which directed recombinant T7 RNAP to the P. pastoris nucleus. To promote translation of uncapped T7 RNAP derived transcripts, the internal ribosomal entry site from hepatitis C virus (HCV-IRES) was inserted directly upstream of the multiple cloning site of pEZT7. A P. pastoris autonomous replicating sequence (PARS1) was integrated into pEZT7 enabling propagation and recovery of plasmids from P. pastoris. Rapid amplification of 5' complementary DNA ends (5' RACE) experiments employing the test plasmid pEZT7-EGFP revealed that transcripts indeed initiated at pT7. HCV-IRES mediated translation of the latter mRNAs, however, was not observed. Surprisingly, HCV-IRES and the reverse complement of PARS1 (PARS1rc) were both found to display significant promoter activity as shown by 5' RACE. Copyright © 2013 Elsevier Inc. All rights reserved.

A tissue factor-cascade-targeted strategy to tumor vasculature: a combination of EGFP-EGF1 conjugation nanoparticles with photodynamic therapy.

PubMed

Shi, Wei; Yin, Yanxue; Wang, Yao; Zhang, Bo; Tan, Pei; Jiang, Ting; Mei, Heng; Deng, Jun; Wang, Huafang; Guo, Tao; Pang, Zhiqing; Hu, Yu

2017-05-09

Tumor requires tumor vasculature to supply oxygen and nutrients so as to support its continued growth, as well as provide a main route for metastatic spread. In this study, a TF-cascade-targeted strategy aiming to disrupt tumor blood vessels was developed by combination of TF-targeted HMME-loaded drug delivery system and PDT. PDT is a promising new modality in the treatment of cancers, which employs the interaction between a tumor-localizing photosensitizer and light of an appropriate wavelength to bring about ROS-induced cell death. In vitro results showed that protein EGFP-EGF1modification could significantly contribute to the uptake of nanoparticles by TF over-expressed BCECs. In vivo multispectral fluorescent imaging, the EGFP-EGF1 conjugated nanoparticles showed significantly higher accumulation in tumor tissues than non-conjugated ones. Tumor tissue slides further presented that EGFP-EGF1 conjugated nanoparticles showed significantly higher accumulation in tumor vasculature than non-conjugated ones. In vitro study demonstrated that PDT increased TF expression of BCECs. In vivo imaging, ex vivo imaging and tumor tissue slides showed that PDT further contribute EGFP-EGF1-NP accumulation in tumor. These promising results indicated that PDT enhanced EGFP-EGF1modified PEG-PLGA nanoparticle accumulation in tumor vaculature. Considering that EGFP-EGF1 conjugation enhanced nanoparticles uptake by TF over-expressed endothelium and PDT increased endothelium TF expression. We conclude that PDT triggered a TF cascade targeted effect. A combination of both EGFP-EGF1 modification and PDT provided a positive feed-back target effect to tumor vessels and might have a great potential for tumor therapy.

Quantitative GFP fluorescence as an indicator of arsenite developmental toxicity in mosaic heat shock protein 70 transgenic zebrafish

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seok, Seung-Hyeok; Baek, Min-Won; Lee, Hui-Young

2007-12-01

In transgenic zebrafish (Danio rerio), green fluorescent protein (GFP) is a promising marker for environmental pollutants. In using GFP, one of the obstacles which we faced was how to compare toxicity among different toxicants or among a specific toxicant in different model species with the intensity of GFP expression. Using a fluorescence detection method, we first validated our method for estimating the amount of GFP fluorescence present in transgenic fish, which we used as an indicator of developmental toxicity caused by the well-known toxicant, arsenite. To this end, we developed mosaic transgenic zebrafish with the human heat shock response elementmore » (HSE) fused to the enhanced GFP (EGFP) reporter gene to indicate exposure to arsenite. We confirmed that EGFP expression sites correlate with gross morphological disruption caused by arsenite exposure. Arsenite (300.0 {mu}M) caused stronger EGFP fluorescence intensity and quantity than 50.0 {mu}M and 10.0 {mu}M arsenite in our transgenic zebrafish. Furthermore, arsenite-induced apoptosis was demonstrated by TUNEL assay. Apoptosis was inhibited by the antioxidant, N-acetyl-cystein (NAC) in this transgenic zebrafish. The distribution of TUNEL-positive cells in embryonic tissues was correlated with the sites of arsenite toxicity and EGFP expression. The EGFP values quantified using the standard curve equation from the known GFP quantity were consistent with the arsenite-induced EGFP expression pattern and arsenite concentration, indicating that this technique can be a reliable and applicable measurement. In conclusion, we propose that fluorescence-based EGFP quantification in transgenic fish containing the hsp70 promoter-EGFP reporter-gene construct is a useful indicator of development toxicity caused by arsenite.« less

Tol2 transposon-mediated transgenesis in the Midas cichlid (Amphilophus citrinellus) - towards understanding gene function and regulatory evolution in an ecological model system for rapid phenotypic diversification.

PubMed

Kratochwil, Claudius F; Sefton, Maggie M; Liang, Yipeng; Meyer, Axel

2017-11-23

The Midas cichlid species complex (Amphilophus spp.) is widely known among evolutionary biologists as a model system for sympatric speciation and adaptive phenotypic divergence within extremely short periods of time (a few hundred generations). The repeated parallel evolution of adaptive phenotypes in this radiation, combined with their near genetic identity, makes them an excellent model for studying phenotypic diversification. While many ecological and evolutionary studies have been performed on Midas cichlids, the molecular basis of specific phenotypes, particularly adaptations, and their underlying coding and cis-regulatory changes have not yet been studied thoroughly. For the first time in any New World cichlid, we use Tol2 transposon-mediated transgenesis in the Midas cichlid (Amphilophus citrinellus). By adapting existing microinjection protocols, we established an effective protocol for transgenesis in Midas cichlids. Embryos were injected with a Tol2 plasmid construct that drives enhanced green fluorescent protein (eGFP) expression under the control of the ubiquitin promoter. The transgene was successfully integrated into the germline, driving strong ubiquitous expression of eGFP in the first transgenic Midas cichlid line. Additionally, we show transient expression of two further transgenic constructs, ubiquitin::tdTomato and mitfa::eGFP. Transgenesis in Midas cichlids will facilitate further investigation of the genetic basis of species-specific traits, many of which are adaptations. Transgenesis is a versatile tool not only for studying regulatory elements such as promoters and enhancers, but also for testing gene function through overexpression of allelic gene variants. As such, it is an important first step in establishing the Midas cichlid as a powerful model for studying adaptive coding and non-coding changes in an ecological and evolutionary context.

No evidence of genome editing activity from Natronobacterium gregoryi Argonaute (NgAgo) in human cells.

PubMed

Javidi-Parsijani, Parisa; Niu, Guoguang; Davis, Meghan; Lu, Pin; Atala, Anthony; Lu, Baisong

2017-01-01

The argonaute protein from the thermophilic bacterium Thermus thermophilus shows DNA-guided DNA interfering activity at high temperatures, complicating its application in mammalian cells. A recent work reported that the argonaute protein from Natronobacterium gregoryi (NgAgo) had DNA-guided genome editing activity in mammalian cells. We compared the genome editing activities of NgAgo and Staphylococcus aureus Cas9 (SaCas9) in human HEK293T cells side by side. EGFP reporter assays and DNA sequencing consistently revealed high genome editing activity from SaCas9. However, these assays did not demonstrate genome editing activity by NgAgo. We confirmed that the conditions allowed simultaneous transfection of the NgAgo expressing plasmid DNA and DNA guides, as well as heterologous expression of NgAgo in the HEK293T cells. Our data show that NgAgo is not a robust genome editing tool, although it may have such activity under other conditions.

Schistosoma mansoni miracidia transformed by particle bombardment infect Biomphalaria glabrata snails and develop into transgenic sporocysts.

PubMed

Heyers, Oliver; Walduck, Anna K; Brindley, Paul J; Bleiss, Wilfrid; Lucius, Richard; Dorbic, Tomislav; Wittig, Burghardt; Kalinna, Bernd H

2003-10-01

Miracidia (and adults) of Schistosoma mansoni which had been subjected to particle bombardment with a plasmid DNA encoding enhanced green fluorescent protein (EGFP) under control of the S. mansoni heat shock protein 70 (HSP70) promoter and termination elements were shown to express the reporter gene. Bombarded miracidia were able to penetrate and establish in Biomphalaria glabrata the intermediate host snail. Gold particles could be detected in the germ balls of parasites in paraffin-sections of snail tissue. The bombarded miracidia were able to develop normally and to transform into mother sporocysts. Reporter gene activity could be determined at 10 days post-infection by RT-PCR in snail tissues, but not by microscopy or Western blot which probably reflected sub-optimal expression levels of constructs. Our findings indicated that it is feasible to return transgenic miracidia to the life cycle, a crucial step for the establishment of a transgenesis system for schistosomes.

Increased expression of human leucocyte antigen class I free heavy chains on monocytes of patients with spondyloarthritis and cells transfected with HLA-B27.

PubMed

Ding, Jin; Feng, Yuan; Zheng, Zhao Hui; Li, Xue Yi; Wu, Zhen Biao; Zhu, Ping

2015-02-01

Human leucocyte antigen (HLA)-B27 expression is correlated with spondyloarthritis (SpA), but its role in disease pathogenesis remains unclear. The aim of the study was to determine whether HLA-B27 free heavy chain (FHC) contributes to SpA pathogenesis. Flow cytometry was used to analyse the FHC expression on CD3+ and CD14+ cells in the peripheral blood (PB) and synovial fluid (SF) from SpA patients, healthy controls, and rheumatoid arthritis (RA) patients. Human monocytic U937 cell lines stably expressing enhanced green fluorescence protein (EGFP)/HLA-B27, EGFP/HLA-A2 or EGFP alone were created to further investigate the relation between HLA-B27 and FHC expression. The relative FHC level on CD14+ PB cells was significantly higher in SpA patients than in controls, but lower than on the SF cells of SpA patients. No significant correlation was found for relative FHC expression with HLA-B27 or β2-microglobulin expression. HLA-B27-transfected U937 cells expressed higher FHC levels than either EGFP/HLA-A2- or EGFP-transfected cells. HLA class I FHC expression was significantly increased on monocytes of SpA patients and HLA-B27-transfected cells, implying that FHC, perhaps mostly derived from HLA-B27, plays an important role in SpA pathogenesis. © 2014 John Wiley & Sons Ltd.

Chemical coding and chemosensory properties of cholinergic brush cells in the mouse gastrointestinal and biliary tract.

PubMed

Schütz, Burkhard; Jurastow, Innokentij; Bader, Sandra; Ringer, Cornelia; von Engelhardt, Jakob; Chubanov, Vladimir; Gudermann, Thomas; Diener, Martin; Kummer, Wolfgang; Krasteva-Christ, Gabriela; Weihe, Eberhard

2015-01-01

The mouse gastro-intestinal and biliary tract mucosal epithelia harbor choline acetyltransferase (ChAT)-positive brush cells with taste cell-like traits. With the aid of two transgenic mouse lines that express green fluorescent protein (EGFP) under the control of the ChAT promoter (EGFP (ChAT) ) and by using in situ hybridization and immunohistochemistry we found that EGFP (ChAT) cells were clustered in the epithelium lining the gastric groove. EGFP (ChAT) cells were numerous in the gall bladder and bile duct, and found scattered as solitary cells along the small and large intestine. While all EGFP (ChAT) cells were also ChAT-positive, expression of the high-affinity choline transporter (ChT1) was never detected. Except for the proximal colon, EGFP (ChAT) cells also lacked detectable expression of the vesicular acetylcholine transporter (VAChT). EGFP (ChAT) cells were found to be separate from enteroendocrine cells, however they were all immunoreactive for cytokeratin 18 (CK18), transient receptor potential melastatin-like subtype 5 channel (TRPM5), and for cyclooxygenases 1 (COX1) and 2 (COX2). The ex vivo stimulation of colonic EGFP (ChAT) cells with the bitter substance denatonium resulted in a strong increase in intracellular calcium, while in other epithelial cells such an increase was significantly weaker and also timely delayed. Subsequent stimulation with cycloheximide was ineffective in both cell populations. Given their chemical coding and chemosensory properties, EGFP (ChAT) brush cells thus may have integrative functions and participate in induction of protective reflexes and inflammatory events by utilizing ACh and prostaglandins for paracrine signaling.

Characterization of Aromatase Expression in the Adult Male and Female Mouse Brain. I. Coexistence with Oestrogen Receptors α and β, and Androgen Receptors

PubMed Central

Stanić, Davor; Dubois, Sydney; Chua, Hui Kheng; Tonge, Bruce; Rinehart, Nicole; Horne, Malcolm K.; Boon, Wah Chin

2014-01-01

Aromatase catalyses the last step of oestrogen synthesis. There is growing evidence that local oestrogens influence many brain regions to modulate brain development and behaviour. We examined, by immunohistochemistry, the expression of aromatase in the adult male and female mouse brain, using mice in which enhanced green fluorescent protein (EGFP) is transcribed following the physiological activation of the Cyp19A1 gene. EGFP-immunoreactive processes were distributed in many brain regions, including the bed nucleus of the stria terminalis, olfactory tubercle, medial amygdaloid nucleus and medial preoptic area, with the densest distributions of EGFP-positive cell bodies in the bed nucleus and medial amygdala. Differences between male and female mice were apparent, with the density of EGFP-positive cell bodies and fibres being lower in some brain regions of female mice, including the bed nucleus and medial amygdala. EGFP-positive cell bodies in the bed nucleus, lateral septum, medial amygdala and hypothalamus co-expressed oestrogen receptor (ER) α and β, or the androgen receptor (AR), although single-labelled EGFP-positive cells were also identified. Additionally, single-labelled ERα−, ERβ- or AR-positive cell bodies often appeared to be surrounded by EGFP-immunoreactive nerve fibres/terminals. The widespread distribution of EGFP-positive cell bodies and fibres suggests that aromatase signalling is common in the mouse brain, and that locally synthesised brain oestrogens could mediate biological effects by activating pre- and post-synaptic oestrogen α and β receptors, and androgen receptors. The higher number of EGFP-positive cells in male mice may indicate that the autocrine and paracrine effects of oestrogens are more prominent in males than females. PMID:24646567

Successful construction and stable expression of an anti-CD45RA scFv-EGFP fusion protein in Chinese hamster ovary cells.

PubMed

Wang, Zhujun; Chen, Yuanyuan; Li, Sisi; Cheng, Yuping; Zhao, Haizhao; Jia, Ming; Luo, Zebin; Tang, Yongmin

2014-02-01

CD45RA has been found highly expressed on leukemia cells and may be a potential target of the disease. In this study, an anti-CD45RA single-chain antibody fragment (scFv3A4) was genetically linked to the N terminus of the enhanced green fluorescent protein (EGFP) to generate a scFv3A4-EGFP fusion protein. The scFv3A4-EGFP with a molecular weight of 57kDa was stably expressed and secreted from the transfected CHO cells through the ER/Golgi-dependent pathway. The fusion protein was soluble in the culture supernatant and the yield was 1350μg/L. Flow cytometry analysis showed that the scFv3A4-EGFP had the same binding site and a very similar reactivity pattern with its parental murine monoclonal antibody (mAb) 3A4. Furthermore, comparing to conventional labeled 3A4-FITC antibody, the scFv3A4-EGFP was more resistant to illumination and more suitable for immunofluorescence histology (IFH) detection. Therefore, the scFv3A4-EGFP fusion protein can be a powerful tool to investigate the targeting of CD45RA on leukemia cells, biological activity of the target and possibly for the genetic manipulation of the antibody. Copyright © 2013 Elsevier Inc. All rights reserved.

Genetic manipulation of murine embryonic stem cells with enhanced green fluorescence protein and sulfatase-modifying factor I genes.

PubMed

Zhao, Guoying; Karageorgos, Litsa; Hutchinson, Rhonda G; Hopwood, John J; Hemsley, Kim

2010-05-01

Mucopolysaccharidosis type IIIA (MPS IIIA) is a lysosomal storage disorder (LSD) in which an absence of sulfamidase results in incomplete degradation and subsequent accumulation of its substrate, heparan sulfate. Most neurodegenerative LSD remain untreatable. However, therapy options, such as gene, enzyme end cell therapy, are under investigation. Previously, we have constructed an embryonic stem (ES) cell line (NS21) that over-expresses human sulphamidase as a potential treatment for murine MPS IIIA. In the present study the sulfatase-modifying factor I (SUMF1) and enhanced green fluorescence protein (eGFP) genes were co-introduced under a cytomegalovirus (CMV) promoter into NS21 cells, to enhance further sulfamidase activity and provide a marker for in vivo cell tracking, respectively. eGFP was also introduced under the control of the human elongation factor-1alpha (hEF-1alpha) promoter to compare the stability of transgene expression. During differentiation of ES cells into glial precursors, SUMF1 was down-regulated and was hardly detectable by day 18 of differentiation. Likewise, eGFP expression was heterogeneous and highly unstable. Use of a human EF-1alpha promoter resulted in more homogeneous eGFP expression, with approximately 50% of cells eGFP positive following differentiation into glial precursors. Compared with NS21 cells, the outgrowth of eGFP-expressing cells was not as confluent when differentiated into glial precursors. Our data suggest that SUMF1 enhances sulfamidase activity in ES cells, hEF-1alpha is a stronger promoter than CMV for ES cells and over-expression of eGFP may affect cell growth and contribute to unstable gene expression.

Immunization with a DNA vaccine encoding Toxoplasma gondii Superoxide dismutase (TgSOD) induces partial immune protection against acute toxoplasmosis in BALB/c mice.

PubMed

Liu, Yuan; Cao, Aiping; Li, Yawen; Li, Xun; Cong, Hua; He, Shenyi; Zhou, Huaiyu

2017-06-07

Toxoplasma gondii (T. gondii) is an obligate intracellular protozoan parasite that infects all warm-blooded animals including humans and causes toxoplasmosis. An effective vaccine could be an ideal choice for preventing and controlling toxoplasmosis. T. gondii Superoxide dismutase (TgSOD) might participate in affecting the intracellular growth of both bradyzoite and tachyzoite forms. In the present study, the TgSOD gene was used to construct a DNA vaccine (pEGFP-SOD). TgSOD gene was amplified and inserted into eukaryotic vector pEGFP-C1 and formed the DNA vaccine pEGFP-SOD. Then the BALB/c mice were immunized intramuscularly with the DNA vaccine and those injected with pEGFP-C1, PBS or nothing were treated as controls. Four weeks after the last immunization, all mouse groups followed by challenging intraperitoneally with tachyzoites of T. gondii ME49 strain. Results showed higher levels of total IgG, IgG2α in the sera and interferon gamma (IFN-γ) in the splenocytes from pEGFP-SOD inoculated mice than those unvaccinated, or inoculated with either empty plasmid vector or PBS. The proportions of CD4 + T cells and CD8 + T cells in the spleen from pEGFP-SOD inoculated mice were significantly (p < 0.05) increased compared to control groups. In addition, the survival time of mice immunized with pEGFP-SOD was significantly prolonged as compared to the controls (p < 0.05) although all the mice died. The present study revealed that the DNA vaccine triggered strong humoral and cellular immune responses, and aroused partial protective immunity against acute T. gondii infection in BALB/c mice. The collective data suggests the SOD may be a potential vaccine candidate for further development.

Conversion of immortal liver progenitor cells into pancreatic endocrine progenitor cells by persistent expression of Pdx-1.

PubMed

Jin, Cai-Xia; Li, Wen-Lin; Xu, Fang; Geng, Zhen H; He, Zhi-Ying; Su, Juan; Tao, Xin-Rong; Ding, Xiao-Yan; Wang, Xin; Hu, Yi-Ping

2008-05-01

The conversion of expandable liver progenitor cells into pancreatic beta cells would provide a renewable cell source for diabetes cell therapy. Previously, we reported the establishment of liver epithelial progenitor cells (LEPCs). In this work, LEPCs were modified into EGFP/Pdx-1 LEPCs, cells with stable expression of both Pdx-1 and EGFP. Unlike previous work, with persistent expression of Pdx-1, EGFP/Pdx-1 LEPCs acquired the phenotype of pancreatic endocrine progenitor cells rather than giving rise to insulin-producing cells directly. EGFP/Pdx-1 LEPCs proliferated vigorously and expressed the crucial transcription factors involved in beta cell development, including Ngn3, NeuroD, Nkx2.2, Nkx6.1, Pax4, Pax6, Isl1, MafA and endogenous Pdx-1, but did not secrete insulin. When cultured in high glucose/low serum medium supplemented with cytokines, EGFP/Pdx-1 LEPCs stopped proliferating and gave rise to functional beta cells without any evidence of exocrine or other islet cell lineage differentiation. When transplanted into diabetic SCID mice, EGFP/Pdx-1 LEPCs ameliorated hyperglycemia by secreting insulin in a glucose regulated manner. Considering the limited availability of beta cells, we propose that our experiments will provide a framework for utilizing the immortal liver progenitor cells as a renewable cell source for the generation of functional pancreatic beta cells.

Identification of neurons that express ghrelin receptors in autonomic pathways originating from the spinal cord.

PubMed

Furness, John B; Cho, Hyun-Jung; Hunne, Billie; Hirayama, Haruko; Callaghan, Brid P; Lomax, Alan E; Brock, James A

2012-06-01

Functional studies have shown that subsets of autonomic preganglionic neurons respond to ghrelin and ghrelin mimetics and in situ hybridisation has revealed receptor gene expression in the cell bodies of some preganglionic neurons. Our present goal has been to determine which preganglionic neurons express ghrelin receptors by using mice expressing enhanced green fluorescent protein (EGFP) under the control of the promoter for the ghrelin receptor (also called growth hormone secretagogue receptor). The retrograde tracer Fast Blue was injected into target organs of reporter mice under anaesthesia to identify specific functional subsets of postganglionic sympathetic neurons. Cryo-sections were immunohistochemically stained by using anti-EGFP and antibodies to neuronal markers. EGFP was detected in nerve terminal varicosities in all sympathetic chain, prevertebral and pelvic ganglia and in the adrenal medulla. Non-varicose fibres associated with the ganglia were also immunoreactive. No postganglionic cell bodies contained EGFP. In sympathetic chain ganglia, most neurons were surrounded by EGFP-positive terminals. In the stellate ganglion, neurons with choline acetyltransferase immunoreactivity, some being sudomotor neurons, lacked surrounding ghrelin-receptor-expressing terminals, although these terminals were found around other neurons. In the superior cervical ganglion, the ghrelin receptor terminals innervated subgroups of neurons including neuropeptide Y (NPY)-immunoreactive neurons that projected to the anterior chamber of the eye. However, large NPY-negative neurons projecting to the acini of the submaxillary gland were not innervated by EGFP-positive varicosities. In the celiaco-superior mesenteric ganglion, almost all neurons were surrounded by positive terminals but the VIP-immunoreactive terminals of intestinofugal neurons were EGFP-negative. The pelvic ganglia contained groups of neurons without ghrelin receptor terminal innervation and other groups with positive terminals around them. Ghrelin receptors are therefore expressed by subgroups of preganglionic neurons, including those of vasoconstrictor pathways and of pathways controlling gut function, but are absent from some other neurons, including those innervating sweat glands and the secretomotor neurons that supply the submaxillary salivary glands.

Expression of sall4 in taste buds of zebrafish.

PubMed

Jackson, Robyn; Braubach, Oliver R; Bilkey, Jessica; Zhang, Jing; Akimenko, Marie-Andrée; Fine, Alan; Croll, Roger P; Jonz, Michael G

2013-07-01

We characterized the expression of sall4, a gene encoding a zinc finger transcription factor involved in the maintenance of embryonic stem cells, in taste buds of zebrafish (Danio rerio). Using an enhancer trap line (ET5), we detected enhanced green fluorescent protein (EGFP) in developing and adult transgenic zebrafish in regions containing taste buds: the lips, branchial arches, and the nasal and maxillary barbels. Localization of EGFP to taste cells of the branchial arches and lips was confirmed by co-immunolabeling with antibodies against calretinin and serotonin, and a zebrafish-derived neuronal marker (zn-12). Transgenic insertion of the ET construct into the zebrafish genome was evaluated and mapped to chromosome 23 in proximity (i.e. 23 kb) to the sall4 gene. In situ hybridization and expression analysis between 24 and 96 h post-fertilization (hpf) demonstrated that transgenic egfp expression in ET5 zebrafish was correlated with the spatial and temporal pattern of expression of sall4 in the wild-type. Expression was first observed in the central nervous system and branchial arches at 24 hpf. At 48 hpf, sall4 and egfp expression was observed in taste bud primordia surrounding the mouth and branchial arches. At 72 and 96 hpf, expression was detected in the upper and lower lips and branchial arches. Double fluorescence in situ hybridization at 3 and 10 dpf confirmed colocalization of sall4 and egfp in the lips and branchial arches. These studies reveal sall4 expression in chemosensory cells and implicate this transcription factor in the development and renewal of taste epithelia in zebrafish. Copyright © 2013 Wiley Periodicals, Inc.

Hsp105 reduces the protein aggregation and cytotoxicity by expanded-polyglutamine proteins through the induction of Hsp70

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamagishi, Nobuyuki; Goto, Kazumasa; Nakagawa, Satomi

2010-09-10

Hsp105{alpha} and Hsp105{beta} are major heat shock proteins in mammalian cells and belong to the HSP105/110 family. Hsp105{alpha} is expressed constitutively in the cytoplasm of cells, while Hsp105{beta}, an alternatively spliced form of Hsp105{alpha}, is expressed specifically in the nucleus of cells during mild heat shock. Here, we show that not only Hsp105{beta} but also Hsp105{alpha} accumulated in the nucleus of cells following the expression of enhanced green fluorescent protein with a pathological length polyQ tract (EGFP-polyQ97) and suppressed the intranuclear aggregation of polyQ proteins and apoptosis induced by EGFP-polyQ97. Mutants of Hsp105{alpha} and Hsp105{beta} with changes in the nuclearmore » localization signal sequences, which localized exclusively in the cytoplasm with or without the expression of EGFP-polyQ97, did not suppress the intranuclear aggregation of polyQ proteins and apoptosis induced by EGFP-polyQ97. Furthermore, Hsp70 was induced by the co-expression of Hsp105{alpha} and EGFP-polyQ97, and the knockdown of Hsp70 reduced the inhibitory effect of Hsp105{alpha} and Hsp105{beta} on the intranuclear aggregation of polyQ proteins and apoptosis induced by EGFP-polyQ97. These observations suggested that Hsp105{alpha} and Hsp105{beta} suppressed the expanded polyQ tract-induced protein aggregation and apoptosis through the induction of Hsp70.« less

Establishment and characterization of CAG/EGFP transgenic rabbit line.

PubMed

Takahashi, Ri-ichi; Kuramochi, Takashi; Aoyagi, Kazuki; Hashimoto, Shu; Miyoshi, Ichiro; Kasai, Noriyuki; Hakamata, Yoji; Kobayashi, Eiji; Ueda, Masatsugu

2007-02-01

Cell marking is a very important procedure for identifying donor cells after cell and/or organ transplantation in vivo. Transgenic animals expressing marker proteins such as enhanced green fluorescent protein (EGFP) in their tissues are a powerful tool for research in fields of tissue engineering and regenerative medicine. The purpose of this study was to establish transgenic rabbit lines that ubiquitously express EGFP under the control of the cytomegalovirus immediate early enhancer/beta-actin promoter (CAG) to provide a fluorescent transgenic animal as a bioresource. We microinjected the EGFP expression vector into 945 rabbit eggs and 4 independent transgenic candidate pups were obtained. Two of them died before sexual maturation and one was infertile. One transgenic male candidate founder rabbit was obtained and could be bred by artificial insemination. The rabbit transmitted the transgene in a Mendelian manner. Using fluorescence in situ hybridization analysis, we detected the transgene at 7q11 on chromosome 7 as a large centromeric region in two F1 offspring (one female and one male). Eventually, one transgenic line was established. Ubiquitous EGFP fluorescence was confirmed in all examined organs. There were no gender-related differences in fluorescence. The established CAG/EGFP transgenic rabbit will be an important bioresource and a useful tool for various studies in tissue engineering and regenerative medicine.

Shifts in the fluorescence lifetime of EGFP during bacterial phagocytosis measured by phase-sensitive flow cytometry

NASA Astrophysics Data System (ADS)

Li, Wenyan; Houston, Kevin D.; Houston, Jessica P.

2017-01-01

Phase-sensitive flow cytometry (PSFC) is a technique in which fluorescence excited state decay times are measured as fluorescently labeled cells rapidly transit a finely focused, frequency-modulated laser beam. With PSFC the fluorescence lifetime is taken as a cytometric parameter to differentiate intracellular events that are challenging to distinguish with standard flow cytometry. For example PSFC can report changes in protein conformation, expression, interactions, and movement, as well as differences in intracellular microenvironments. This contribution focuses on the latter case by taking PSFC measurements of macrophage cells when inoculated with enhanced green fluorescent protein (EGFP)-expressing E. coli. During progressive internalization of EGFP-E. coli, fluorescence lifetimes were acquired and compared to control groups. It was hypothesized that fluorescence lifetimes would correlate well with phagocytosis because phagosomes become acidified and the average fluorescence lifetime of EGFP is known to be affected by pH. We confirmed that average EGFP lifetimes consistently decreased (3 to 2 ns) with inoculation time. The broad significance of this work is the demonstration of how high-throughput fluorescence lifetime measurements correlate well to changes that are not easily tracked by intensity-only cytometry, which is affected by heterogeneous protein expression, cell-to-cell differences in phagosome formation, and number of bacterium engulfed.

Detection of cholesterol-rich microdomains in the inner leaflet of the plasma membrane

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hayashi, Masami; Shimada, Yukiko; Inomata, Mitsushi

2006-12-22

The C-terminal domain (D4) of perfringolysin O binds selectively to cholesterol in cholesterol-rich microdomains. To address the issue of whether cholesterol-rich microdomains exist in the inner leaflet of the plasma membrane, we expressed D4 as a fusion protein with EGFP in MEF cells. More than half of the EGFP-D4 expressed in stable cell clones was bound to membranes in raft fractions. Depletion of membrane cholesterol with {beta}-cyclodextrin reduced the amount of EGFP-D4 localized in raft fractions, confirming EGFP-D4 binding to cholesterol-rich microdomains. Subfractionation of the raft fractions showed most of the EGFP-D4 bound to the plasma membrane rather than tomore » intracellular membranes. Taken together, these results strongly suggest the existence of cholesterol-rich microdomains in the inner leaflet of the plasma membrane.« less

Visualization of Sensory Neurons and Their Projections in an Upper Motor Neuron Reporter Line.

PubMed

Genç, Barış; Lagrimas, Amiko Krisa Bunag; Kuru, Pınar; Hess, Robert; Tu, Michael William; Menichella, Daniela Maria; Miller, Richard J; Paller, Amy S; Özdinler, P Hande

2015-01-01

Visualization of peripheral nervous system axons and cell bodies is important to understand their development, target recognition, and integration into complex circuitries. Numerous studies have used protein gene product (PGP) 9.5 [a.k.a. ubiquitin carboxy-terminal hydrolase L1 (UCHL1)] expression as a marker to label sensory neurons and their axons. Enhanced green fluorescent protein (eGFP) expression, under the control of UCHL1 promoter, is stable and long lasting in the UCHL1-eGFP reporter line. In addition to the genetic labeling of corticospinal motor neurons in the motor cortex and degeneration-resistant spinal motor neurons in the spinal cord, here we report that neurons of the peripheral nervous system are also fluorescently labeled in the UCHL1-eGFP reporter line. eGFP expression is turned on at embryonic ages and lasts through adulthood, allowing detailed studies of cell bodies, axons and target innervation patterns of all sensory neurons in vivo. In addition, visualization of both the sensory and the motor neurons in the same animal offers many advantages. In this report, we used UCHL1-eGFP reporter line in two different disease paradigms: diabetes and motor neuron disease. eGFP expression in sensory axons helped determine changes in epidermal nerve fiber density in a high-fat diet induced diabetes model. Our findings corroborate previous studies, and suggest that more than five months is required for significant skin denervation. Crossing UCHL1-eGFP with hSOD1G93A mice generated hSOD1G93A-UeGFP reporter line of amyotrophic lateral sclerosis, and revealed sensory nervous system defects, especially towards disease end-stage. Our studies not only emphasize the complexity of the disease in ALS, but also reveal that UCHL1-eGFP reporter line would be a valuable tool to visualize and study various aspects of sensory nervous system development and degeneration in the context of numerous diseases.

Aging effects on intestinal homeostasis associated with expansion and dysfunction of intestinal epithelial stem cells.

PubMed

Moorefield, Emily C; Andres, Sarah F; Blue, R Eric; Van Landeghem, Laurianne; Mah, Amanda T; Santoro, M Agostina; Ding, Shengli

2017-08-29

Intestinal epithelial stem cells (IESCs) are critical to maintain intestinal epithelial function and homeostasis. We tested the hypothesis that aging promotes IESC dysfunction using old (18-22 months) and young (2-4 month) Sox9-EGFP IESC reporter mice. Different levels of Sox9-EGFP permit analyses of active IESC (Sox9-EGFP Low ), activatable reserve IESC and enteroendocrine cells (Sox9-EGFP High ), Sox9-EGFP Sublow progenitors, and Sox9-EGFP Negative differentiated lineages. Crypt-villus morphology, cellular composition and apoptosis were measured by histology. IESC function was assessed by crypt culture, and proliferation by flow cytometry and histology. Main findings were confirmed in Lgr5-EGFP and Lgr5-LacZ mice. Aging-associated gene expression changes were analyzed by Fluidigm mRNA profiling. Crypts culture from old mice yielded fewer and less complex enteroids. Histology revealed increased villus height and Paneth cells per crypt in old mice. Old mice showed increased numbers and hyperproliferation of Sox9-EGFP Low IESC and Sox9-EGFP High cells. Cleaved caspase-3 staining demonstrated increased apoptotic cells in crypts and villi of old mice. Gene expression profiling revealed aging-associated changes in mRNAs associated with cell cycle, oxidative stress and apoptosis specifically in IESC. These findings provide new, direct evidence for aging associated IESC dysfunction, and define potential biomarkers and targets for translational studies to assess and maintain IESC function during aging.

Enhanced expression of EGFP gene in CHSE-214 cells by an ARS element from mud loach (Misgurnus mizolepis).

PubMed

Kim, Moo-Sang; Lim, Hak-Seob; Ahn, Sang Jung; Jeong, Yong-Kee; Kim, Chul Geun; Lee, Hyung Ho

2007-11-01

The origins of replication are associated with nuclear matrices or are found in close proximity to matrix attachment regions (MARs). In this report, fish MARs were cloned into an autonomously replicating sequence (ARS) cloning vector and were screened for ARS elements in Saccharomyces cerevisiae. Sixteen clones were isolated that were able to grow on the selective plates. In particular, an ARS905 that shows high efficiency among them was selected for this study. Southern hybridization indicated the autonomous replication of the transformation vector containing the ARS905 element. DNA sequences analysis showed that the ARS905 contained two ARS consensus sequences as well as MAR motifs, such as AT tracts, ORI patterns, and ATC tracts. In vitro matrix binding analysis, major matrix binding activity and ARS function coincided in a subfragment of the ARS905. To analyze the effects of ARS905 on expression of a reporter gene, an ARS905(E1158) with ARS activity was inserted into pBaEGFP(+) containing mud loach beta-actin promoter, EGFP as a reporter gene, and SV40 poly(A) signal. The pBaEGFP(+)-ARS905(E1158) was transfected into a fish cell line, CHSE-214. The intensity of EGFP transfected cells was a 7-fold of the control at 11days post-transfection. These results indicate that ARS905 enhances the expression of the EGFP gene and that it should be as a component of expression vectors in further fish biotechnological studies.

Dendrimer-assisted patch-clamp sizing of nuclear pores

PubMed Central

Bustamante, J.O.; Michelette, E.R.F.; Geibel, J.P.; Hanover, J.A.; McDonnell, T.J.; Dean, D.A.

2015-01-01

Macromolecular translocation (MMT) across the nuclear envelope (NE) occurs exclusively through the nuclear pore complex (NPC). Therefore, the diameter of the NPC aqueous/electrolytic channel (NPCC) is important for cellular structure and function. The NPCC diameter was previously determined to be ≅10 nm with electron microscopy (EM) using the translocation of colloidal gold particles. Here we present patch-clamp and fluorescence microscopy data from adult cardiomyocyte nuclei that demonstrate the use of patch-clamp for assessing NPCC diameter. Fluorescence microscopy with B-phycoerythrin (BPE, 240 kDa) conjugated to a nuclear localization signal (NLS) demonstrated that these nuclei were competent for NPC-mediated MMT (NPC-MMT). Furthermore, when exposed to an appropriate cell lysate, the nuclei expressed enhanced green fluorescence protein (EGFP) after 5–10 h of incubation with the plasmid for this protein (pEGFP, 3.1 MDa). Nucleus-attached patch-clamp showed that colloidal gold particles were not useful probes; they modified NPCC gating. As a result of this finding, we searched for an inert class of particles that could be used without irreversibly affecting NPCC gating and found that fluorescently labeled Star-burst dendrimers, a distinct class of polymers, were useful. Our patch-clamp and fluorescence microscopy data with calibrated dendrimers indicate that the cardiomyocyte NPCC diameter varies between 8 and 9 nm. These studies open a new direction in the investigation of live, continuous NPC dynamics under physiological conditions. PMID:10784359

Cell Therapy to Obtain Spinal Fusion

DTIC Science & Technology

2006-02-01

al, 2005). Since our previous studies (first progress report) demonstrated a significant reduction (≥50%) in the amount of BMP2 secreted from human...Ad5eGFP 2,500vp/cell, (3) Ad5eGFP 5,000vp/cell, or (4) Ad5eGFP 10,000vp/cell in the absence (solid columns) or presence ( open columns) of GeneJammer...20-fold reduction in BMP-2 protein compared with the controls (p < 0.001) and the expression was biphasic over the 15 d period with highest expression

Cannabinoid CB2 receptors in the mouse brain: relevance for Alzheimer's disease.

PubMed

López, Alicia; Aparicio, Noelia; Pazos, M Ruth; Grande, M Teresa; Barreda-Manso, M Asunción; Benito-Cuesta, Irene; Vázquez, Carmen; Amores, Mario; Ruiz-Pérez, Gonzalo; García-García, Elena; Beatka, Margaret; Tolón, Rosa M; Dittel, Bonnie N; Hillard, Cecilia J; Romero, Julián

2018-05-24

Because of their low levels of expression and the inadequacy of current research tools, CB 2 cannabinoid receptors (CB 2 R) have been difficult to study, particularly in the brain. This receptor is especially relevant in the context of neuroinflammation, so novel tools are needed to unveil its pathophysiological role(s). We have generated a transgenic mouse model in which the expression of enhanced green fluorescent protein (EGFP) is under the control of the cnr2 gene promoter through the insertion of an Internal Ribosomal Entry Site followed by the EGFP coding region immediately 3' of the cnr2 gene and crossed these mice with mice expressing five familial Alzheimer's disease (AD) mutations (5xFAD). Expression of EGFP in control mice was below the level of detection in all regions of the central nervous system (CNS) that we examined. CB 2 R-dependent-EGFP expression was detected in the CNS of 3-month-old AD mice in areas of intense inflammation and amyloid deposition; expression was coincident with the appearance of plaques in the cortex, hippocampus, brain stem, and thalamus. The expression of EGFP increased as a function of plaque formation and subsequent microgliosis and was restricted to microglial cells located in close proximity to neuritic plaques. AD mice with CB 2 R deletion exhibited decreased neuritic plaques with no changes in IL1β expression. Using a novel reporter mouse line, we found no evidence for CB 2 R expression in the healthy CNS but clear up-regulation in the context of amyloid-triggered neuroinflammation. Data from CB 2 R null mice indicate that they play a complex role in the response to plaque formation.

Investigation on the infection mechanism of the fungus Clonostachys rosea against nematodes using the green fluorescent protein.

PubMed

Zhang, Lin; Yang, Jinkui; Niu, Qiuhong; Zhao, Xuna; Ye, Fengping; Liang, Lianming; Zhang, Ke-Qin

2008-04-01

The fungus Clonostachys rosea (syn. Gliocladium roseum) is a potential biocontrol agent. It can suppress the sporulation of the plant pathogenic fungus Botrytis cinerea and kill pathogenic nematodes, but the process of nematode pathogenesis is poorly understood. To help understand the underlying mechanism, we constructed recombinant strains containing a plasmid with both the enhanced green fluorescent protein gene egfp and the hygromycin resistance gene hph. Expression of the green fluorescent protein (GFP) was monitored using fluorescence microscopy. Our observations reveal that the pathogenesis started from the adherence of conidia to nematode cuticle for germination, followed by the penetration of germ tubes into the nematode body and subsequent death and degradation of the nematodes. These are the first findings on the infection process of the fungal pathogen marked with GFP, and the developed method can become an important tool for studying the molecular mechanisms of nematode infection by C. rosea.

A Novel Class of Metal-Directed Supramolecular DNA-Delivery Systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cruz-Campa, I.; Arzola, A.; Santiago, L.

2009-06-03

The bis-complexes [Cu(L{sub dt}){sub 2}](OTf){sub 2} ( 1) and [Cu(L{sub ot}){sub 2}](OTf){sub 2} ( 2), where L{sub dt} = 1-dodecyl-1,4,7-triazacyclononane, L{sup ot} = 1-octadecyl-1,4,7-triazacyclononane and OTf = trifluoromethanesulfonate, formed a novel class of metallo-liposomes in water that transfect pEGFP-N1 plasmids into HEK 293-T cells at 38% and 4% efficiency, respectively.

A Small Stem Loop Structure Of The Ebola Virus Trailer Is Essential For Replication And Interacts With Heat Shock Protein A8

DTIC Science & Technology

2016-12-02

agarose gel electrophoresis TR-16-205 Nucleic Acids Research, 2016 3 (Seakem GTG , Sigma-Aldrich) and purified using the QI- Aquick Gel Extraction Kit... gtg +cga 1923-1938 3′ LNA2 +caa+aaa+ga+aa+gaa+gaa 3E-5E eGFP, 3E-5E plasmid containing enhanced green fluorescent protein; aiSHAPE, antisense-interfered

Global Expression Profiling of Globose Basal Cells and Neurogenic Progression Within the Olfactory Epithelium

PubMed Central

Krolewski, Richard C.; Packard, Adam; Schwob, James E.

2013-01-01

Ongoing, lifelong neurogenesis maintains the neuronal population of the olfactory epithelium in the face of piecemeal neuronal turnover and restores it following wholesale loss. The molecular phenotypes corresponding to different stages along the progression from multipotent globose basal cell (GBC) progenitor to differentiated olfactory sensory neuron are poorly characterized. We used the transgenic expression of enhanced green fluorescent protein (eGFP) and cell surface markers to FACS-isolate ΔSox2-eGFP(+) GBCs, Neurog1-eGFP(+) GBCs and immature neurons, and ΔOMP-eGFP(+) mature neurons from normal adult mice. In addition, the latter two populations were also collected 3 weeks after olfactory bulb ablation, a lesion that results in persistently elevated neurogenesis. Global profiling of mRNA from the populations indicates that all stages of neurogenesis share a cohort of >2,100 genes that are upregulated compared to sustentacular cells. A further cohort of >1,200 genes are specifically upregulated in GBCs as compared to sustentacular cells and differentiated neurons. The increased rate of neurogenesis caused by olfactory bulbectomy had little effect on the transcriptional profile of the Neurog1-eGFP(+) population. In contrast, the abbreviated lifespan of ΔOMP-eGFP(+) neurons born in the absence of the bulb correlated with substantial differences in gene expression as compared to the mature neurons of the normal epithelium. Detailed examination of the specific genes upregulated in the different progenitor populations revealed that the chromatin modifying complex proteins LSD1 and coREST were expressed sequentially in upstream ΔSox2-eGFP(+) GBCs and Neurog1-eGFP(+) GBCs/immature neurons. The expression patterns of these proteins are dynamically regulated after activation of the epithelium by methyl bromide lesion. PMID:22847514

The mammalian Ced-1 ortholog MEGF10/KIAA1780 displays a novel adhesion pattern

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suzuki, Emiko; Nakayama, Manabu

2007-07-01

Ced-1 protein is a Caenorhabditis elegans cell surface receptor involved in phagocytosis of dead cells. The gene encoding the mammalian ortholog of Ced-1 is yet to be identified. Here, we describe a potential candidate: human MEGF10. MEGF10 has the overall domain organization of Ced-1, containing a signal peptide, a EMI domain, 17 atypical EGF-like repeats, a transmembrane domain, and a cytoplasmic domain with NPXY and YXXL motifs. MEGF10-EGFP fusion protein expressed in HEK293 cells produced an irregular, mosaic-like pattern on the surface of coated glass. Protruded MEGF10 bound tightly to the glass, in effect 'pinning' the cytoplasmic membrane firmly ontomore » the glass, thereby restricting cell motility. These cells also took on a flat appearance. Although MEGF10-EGFP localized throughout the cytoplasmic membrane, no MEGF10-EGFP was found in lamellipodia. The MEGF10-EGFP signal was surrounded by a 1-2-{mu}m-wide dark strip lacking EGFP. Expression analyses of various MEGF10 deletion mutants revealed that the irregular, mosaic-like adhesion pattern characteristic of MEGF10 family members is due to concerted interactions between the EMI and 17 atypical EGF-like domains. Co-culturing of MEGF10-EGFP-expressing cells with apoptotic cells revealed that MEGF10 protein accumulated around the contact region during engulfment of apoptotic cells.« less

Combining Optical Reporter Proteins with Different Half-lives to Detect Temporal Evolution of Hypoxia and Reoxygenation in Tumors

PubMed Central

Danhier, Pierre; Krishnamachary, Balaji; Bharti, Santosh; Kakkad, Samata; Mironchik, Yelena; Bhujwalla, Zaver M.

2015-01-01

Here we have developed a hypoxia response element driven imaging strategy that combined the hypoxia-driven expression of two optical reporters with different half-lives to detect temporal changes in hypoxia and hypoxia inducible factor (HIF) activity. For this purpose, human prostate cancer PC3 cells were transfected with the luciferase gene fused with an oxygen-dependent degradation domain (ODD-luc) and a variant of the enhanced green fluorescent protein (EGFP). Both ODD-luciferase and EGFP were under the promotion of a poly-hypoxia-response element sequence (5xHRE). The cells constitutively expressed tdTomato red fluorescent protein. For validating the imaging strategy, cells were incubated under hypoxia (1% O2) for 48 hours and then reoxygenated. The luciferase activity of PC3-HRE-EGFP/HRE-ODD-luc/tdtomato cells detected by bioluminescent imaging rapidly decreased after reoxygenation, whereas EGFP levels in these cells remained stable for several hours. After in vitro validation, PC3-HRE-EGFP/HRE-ODD-luc/tdtomato tumors were implanted subcutaneously and orthotopically in nude male mice and imaged in vivo and ex vivo using optical imaging in proof-of-principle studies to demonstrate differences in optical patterns between EGFP expression and bioluminescence. This novel "timer" imaging strategy of combining the short-lived ODD-luciferase and the long-lived EGFP can provide a time frame of HRE activation in PC3 prostate cancer cells and will be useful to understand the temporal changes in hypoxia and HIF activity during cancer progression and following treatments including HIF targeting strategies. PMID:26696369

Establishment of an indicator cell line to quantify bovine foamy virus infection.

PubMed

Ma, Zhe; Hao, Peng; Yao, Xue; Liu, Chang; Tan, Juan; Liu, Li; Yang, Rongge; Geng, Yunqi; Chen, Qimin; Qiao, Wentao

2008-08-01

A cell line derived from baby hamster kidney (BHK-21) cells was transfected with the enhanced green fluorescent protein gene driven by the bovine foamy virus (BFV) long terminal repeat (LTR) to establish a BFV indicator cell line (BICL). Among 48 clones, one clone was chosen for its little constitutive enhanced green fluorescent protein (EGFP) expression and high level of EGFP expression after activation by BFV infection. By detecting the EGFP expression of the BFV indicator cell line, the titers of BFV were quantified by the end point method. As a result, the titer determined by the EGFP based assay 5-6 days post infection (d.p.i.) was 100 fold higher than traditional assays measuring cytopathic effects 8-9 d.p.i.. Moreover, the EGFP based assay was also used to determine the titer of those cells infected by BFV without inducing cytopathic effects. Using this simple and rapid assay, we examined the in vitro host range of BFV. It was found that BFV can productively infect various cell lines derived from bovine, human, rat and monkey. (c) 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effect of lentiviruses carrying enhanced green fluorescent protein injected into the scala media through a cochleostomy in rats.

PubMed

Wei, Yan; Fu, Yong; Liu, Shaosheng; Xia, Guihua; Pan, Song

2013-01-01

The purposes of the current study were to assess the feasibility of post-auricular microinjection of lentiviruses carrying enhanced green fluorescent protein (EGFP) into the scala media through cochleostomies in rats, determine the expression of viral gene in the cochlea, and record the post-operative changes in the number and auditory function of cochlear hair cells (HCs). Healthy rats were randomly divided into two groups. The left ears of the animals in group I were injected with lentivirus carrying EGFP (n=10) via scala media lateral wall cochleostomies, and the left ears of the animals in group II were similarly injected with artificial endolymph (n=10). Prior to and 30 days post-injection, auditory function was assessed with click-auditory brainstem response (ABR) testing, EGFP expression was determined with cochlear frozen sections under fluorescence microscopy, and survival of HCs was estimated based on whole mount preparations. Thirty days after surgery, click-ABR testing revealed that there were significant differences in the auditory function, EGFP expression, and survival of HCs in the left ears before and after surgery in the same rats from each group. In group I, EGFP was noted in the strial marginal cells of the scala media, the organ of Corti, spiral nerves, and spiral ganglion cells. Lentiviruses were successfully introduced into the scala media through cochleostomies in rats, and the EGFP reporter gene was efficiently expressed in the organ of Corti, spiral nerves, and spiral ganglion cells. Copyright © 2013 Elsevier Inc. All rights reserved.

[Construction and transfection of eucaryotic expression recombinant vector containing truncated region of UL83 gene of human cytomegalovirus and it's sheltered effect as DNA vaccine].

PubMed

Gao, Rong-Bao; Li, Yan-Qiu; Wang, Ming-Li

2006-06-01

To construct eucaryotic expression recombinant vector containing vivo truncated region of UL83 gene of human cytomegalovirus, realize its steady expression in Hep-2 cell, and study sheltered effect of the eucaryotic expression recombinant vector as DNA vaccine. A vivo truncated UL83 gene fragment encoding for truncated HCMV pp65 was obtained by PCR from human cytomegalovirus AD169 stock genome. By gene recombinant ways, the truncated UL83 gene fragment was cloned into eucaryotic expression vector pEGFP-C1 with reported gene coding GFP to construct recombinant vector pEGFP-C1-UL83. The recombinant vector pEGFP-C1-UL83 was tested by different methods including PCR, restriction digestion and gene sequencing. Test results showed the recombinant vector was constructed successfully. After pEGFP-C1-UL83 was transfected into Hep-2 cell by lipofectin mediation, expression of GFP and truncated pp65 fusion protein in Hep-2 cell was observed at different time points by fluorescence microscope. Results showed that quantity of fusion protein expression was the highest at 36h point. Then, Hep-2 cell was cultured selectively by RPMI-1640 containing G418 (200 microg/mL) to obtain a new cell stock of expressing truncated UL83 Gene fragment steadily. RT-PCR and Western blot results showed the truncated fragment of UL83 gene could be expressed steadily in Hep-2 cell. The result showed a new cell stock of expressing Tpp65 was established. This cell stock could be useful in some HCMV research fields, for example, it could be a tool in study of pp65 and HCMV infection, and it could provide a platform for the research into the therapy of HCMV infection. Immune sheltered effect of pEGFP-C1-UL83 as DNA vaccine was studied in vivo of HCMV congenital infection mouse model. The mouse model was immunized solely by pEGFP-C1-UL83, and was immunized jointly by pEGFP-C1-UL83 and its expression product. When the mouse was pregnant and brought to bed, differential antibody of anti-HCMV pp65 was tested by indirect ELISA in mother mouse, the infectious virus was separated with the method of virus separation, and pp65 antigen was checked up by indirect immunofluorescence staining in fetal mouse. Results showed differential antibody of anti-HCMV pp65 was produced in mouse model. Tilter of the antibody was from 1:2.51 to 1:50.79. Results of virus separation and pp65 checkup of fetal mouse brain tissue were negative. So the conclusion can be reached that pEGFP-C1-UL83 as DNA vaccine in vivo has sheltered effect which can prevent HCMV vertical transmission from mother mouse to her fetus.

Infection of the upper respiratory tract of hamsters by the bovine parainfluenza virus type 3 BN-1 strain expressing enhanced green fluorescent protein.

PubMed

Ohkura, Takashi; Minakuchi, Moeko; Sagai, Mami; Kokuho, Takehiro; Konishi, Misako; Kameyama, Ken-Ichiro; Takeuchi, Kaoru

2015-02-01

Bovine parainfluenza virus type 3 (BPIV3) is an important pathogen associated with bovine respiratory disease complex (BRDC). We have generated a recombinant BPIV3 expressing enhanced green fluorescent protein (rBPIV3-EGFP) based on the BN-1 strain isolated in Japan. After intranasal infection of hamsters with rBPIV3-EGFP, EGFP fluorescence was detected in the upper respiratory tract including the nasal turbinates, pharynx, larynx, and trachea. In the nasal turbinates, rBPIV3-EGFP attained high titers (>10(6) TCID50/g of tissue) 2-4 days after infection. Ciliated epithelial cells in the nasal turbinates and trachea were infected with rBPIV3-EGFP. Histopathological analysis indicated that mucosal epithelial cells in bronchi were shed by 6 days after infection, leaving non-ciliated cells, which may have increased susceptibility to bacterial infection leading to the development of BRDC. These data indicate that rBPIV3-EGFP infection of hamsters is a useful small animal model for studying the development of BPIV3-associated BRDC. Copyright © 2014 Elsevier Inc. All rights reserved.

eGFP expression under the Uchl1 promoter labels corticospinal motor neurons and a subpopulation of degeneration resistant spinal motor neurons in ALS mouse models

NASA Astrophysics Data System (ADS)

Yasvoina, Marina V.

Current understanding of basic cellular and molecular mechanisms for motor neuron vulnerability during motor neuron disease initiation and progression is incomplete. The complex cytoarchitecture and cellular heterogeneity of the cortex and spinal cord greatly impedes our ability to visualize, isolate, and study specific neuron populations in both healthy and diseased states. We generated a novel reporter line, the Uchl1-eGFP mouse, in which cortical and spinal components of motor neuron circuitry are genetically labeled with eGFP under the Uchl1 promoter. A series of cellular and anatomical analyses combined with retrograde labeling, molecular marker expression, and electrophysiology were employed to determine identity of eGFP expressing cells in the motor cortex and the spinal cord of novel Uchl1-eGFP reporter mice. We conclude that eGFP is expressed in corticospinal motor neurons (CSMN) in the motor cortex and a subset of S-type alpha and gamma spinal motor neurons (SMN) in the spinal cord. hSOD1G93A and Alsin-/- mice, mouse models for amyotrophic lateral sclerosis (ALS), were bred to Uchl1-eGFP reporter mouse line to investigate the pathophysiology and underlying mechanisms of CSMN degeneration in vivo. Evidence suggests early and progressive degeneration of CSMN and SMN in the hSOD1G93A transgenic mice. We show an early increase of autophagosome formation in the apical dendrites of vulnerable CSMN in hSOD1G93A-UeGFP mice, which is localized to the apical dendrites. In addition, labeling S-type alpha and gamma SMN in the hSOD1G93A-UeGFP mice provide a unique opportunity to study basis of their resistance to degeneration. Mice lacking alsin show moderate clinical phenotype and mild CSMN axon degeneration in the spinal cord, which suggests vulnerability of CSMN. Therefore, we investigated the CSMN cellular and axon defects in aged Alsin-/- mice bred to Uchl1-eGFP reporter mouse line. We show that while CSMN are preserved and lack signs of degeneration, CSMN axons are vulnerable and show significant loss.

Biological significance of PinX1 telomerase inhibitor in esophageal carcinoma treatment

PubMed Central

Fan, Xiang-Kui; Yan, Rui-Hua; Geng, Xiang-Qun; Li, Jing-Shan; Chen, Xiang-Ming; Li, Jian-Zhe

2016-01-01

In the present study, to investigate the expression of PinX1 gene and its functional effects in human esophageal carcinoma (Eca)-109 cell line, expression vectors of human PinX1 (pEGFP-C3-PinX1) and its small interfering RNA (PinX1-FAM-siRNA) were constructed and transfected into Eca-109 cells using Lipofectamine 2000. Firstly, the mRNA expression level of PinX1 was examined using reverse transcription-polymerase chain reaction (RT-PCR). Once successful transfection was achieved, the effects on the mRNA level of human telomerase reverse transcriptase (hTERT), telomerase activity, cell proliferation and apoptosis were examined by semi-quantitative RT-PCR, stretch PCR, MTT assay and flow cytometry, respectively. Analysis of restriction and sequencing demonstrated that the recombining plasmids were successfully constructed. The results also indicated that transfection with pEGFP-C3-PinX1 and PinX1-FAM-siRNA into Eca-109 cells significantly increased PinX1 mRNA, decreased hTERT mRNA by 29.9% (P<0.05), and significantly reduced telomerase activity (P<0.05), inhibited cell growth, and increased the cell apoptotic index from 19.27±0.76 to 49.73±2%. The transfected PinX1-FAM-SiRNA exhibited PinX1 mRNA expression levels that were significantly decreased by 70% (P<0.05), whereas the remaining characteristics of Eca-109 cells, including cell growth, mRNA level of hTERT, telomerase activity and cell apoptotic index were not altered. Exogenous PinX1 has been demonstrated to be highly expressed in human Eca. PinX1 can inhibit human telomerase activity and the expression of hTERT mRNA, reduce tumor cell growth and induce apoptosis. Notably, these inhibitory functions were inhibited by silencing PinX1 in Eca with PinX1-FAM-siRNA. PinX1 was successfully increased and decreased in the present study, demonstrating that it may be a potential telomerase activity inhibitor. As PinX1 is an endogenous telomerase inhibitor, it may be used as a novel tumor-targeted gene therapy. PMID:27698711

Development of a Reverse Genetic System for Infectious Salmon Anemia Virus: Rescue of Recombinant Fluorescent Virus by Using Salmon Internal Transcribed Spacer Region 1 as a Novel Promoter

PubMed Central

Toro-Ascuy, Daniela; Tambley, Carolina; Beltran, Carolina; Mascayano, Carolina; Sandoval, Nicolas; Olivares, Eduardo; Medina, Rafael A.; Spencer, Eugenio

2014-01-01

Infectious salmon anemia (ISA) is a serious disease of marine-farmed Atlantic salmon (Salmo salar) caused by ISA virus (ISAV), belonging to the genus Isavirus, family Orthomyxoviridae. There is an urgent need to understand the virulence factors and pathogenic mechanisms of ISAV and to develop new vaccine approaches. Using a recombinant molecular biology approach, we report the development of a plasmid-based reverse genetic system for ISAV, which includes the use of a novel fish promoter, the Atlantic salmon internal transcribed spacer region 1 (ITS-1). Salmon cells cotransfected with pSS-URG-based vectors expressing the eight viral RNA segments and four cytomegalovirus (CMV)-based vectors that express the four proteins of the ISAV ribonucleoprotein complex allowed the generation of infectious recombinant ISAV (rISAV). We generated three recombinant viruses, wild-type rISAV901_09 and rISAVrS6-NotI-HPR containing a NotI restriction site and rISAVS6/EGFP-HPR harboring the open reading frame of enhanced green fluorescent protein (EGFP), both within the highly polymorphic region (HPR) of segment 6. All rescued viruses showed replication activity and cytopathic effect in Atlantic salmon kidney-infected cells. The fluorescent recombinant viruses also showed a characteristic cytopathic effect in salmon cells, and the viruses replicated to a titer of 6.5 × 105 PFU/ml, similar to that of the wild-type virus. This novel reverse genetics system offers a powerful tool to study the molecular biology of ISAV and to develop a new generation of ISAV vaccines to prevent and mitigate ISAV infection, which has had a profound effect on the salmon industry. PMID:25480750

Noncontact microsurgery of cell membranes using femtosecond laser pulses for optoinjection of specified substances into cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Il'ina, I V; Ovchinnikov, A V; Chefonov, O V

IR femtosecond laser pulses were used for microsurgery of a cell membrane aimed at local and short-duration change in its permeability and injection of specified extracellular substances into the cells. The possibility of noncontact laser delivery of the propidium iodide fluorescent dye and the pEGFP plasmid, encoding the green fluorescent protein, into the cells with preservation of the cell viability was demonstrated. (extreme light fields and their applications)

Dynamic Expression of Serotonin Receptor 5-HT3A in Developing Sensory Innervation of the Lower Urinary Tract

PubMed Central

Ritter, K. Elaine; Southard-Smith, E. Michelle

2017-01-01

Sensory afferent signaling is required for normal function of the lower urinary tract (LUT). Despite the wide prevalence of bladder dysfunction and pelvic pain syndromes, few effective treatment options are available. Serotonin receptor 5-HT3A is a known mediator of visceral afferent signaling and has been implicated in bladder function. However, basic expression patterns for this gene and others among developing bladder sensory afferents that could be used to inform regenerative efforts aimed at treating deficiencies in pelvic innervation are lacking. To gain greater insight into the molecular characteristics of bladder sensory innervation, we conducted a thorough characterization of Htr3a expression in developing and adult bladder-projecting lumbosacral dorsal root ganglia (DRG) neurons. Using a transgenic Htr3a-EGFP reporter mouse line, we identified 5-HT3A expression at 10 days post coitus (dpc) in neural crest derivatives and in 12 dpc lumbosacral DRG. Using immunohistochemical co-localization we observed Htr3a-EGFP expression in developing lumbosacral DRG that partially coincides with neuropeptides CGRP and Substance P and capsaicin receptor TRPV1. A majority of Htr3a-EGFP+ DRG neurons also express a marker of myelinated Aδ neurons, NF200. There was no co-localization of 5-HT3A with the TRPV4 receptor. We employed retrograde tracing in adult Htr3a-EGFP mice to quantify the contribution of 5-HT3A+ DRG neurons to bladder afferent innervation. We found that 5-HT3A is expressed in a substantial proportion of retrograde traced DRG neurons in both rostral (L1, L2) and caudal (L6, S1) axial levels that supply bladder innervation. Most bladder-projecting Htr3a-EGFP+ neurons that co-express CGRP, Substance P, or TRPV1 are found in L1, L2 DRG, whereas Htr3a-EGFP+, NF200+ bladder-projecting neurons are from the L6, S1 axial levels. Our findings contribute much needed information regarding the development of LUT innervation and highlight the 5-HT3A serotonin receptor as a candidate for future studies of neurally mediated bladder control. PMID:28111539

Epidermal growth factor-like domain 7 is a marker of the endothelial lineage and active angiogenesis.

PubMed

Bambino, Kathryn; Lacko, Lauretta A; Hajjar, Katherine A; Stuhlmann, Heidi

2014-07-01

Epidermal growth factor-like domain 7 (Egfl7) expression in the developing embryo is largely restricted to sites of mesodermal progenitors of angioblasts/hemangioblasts and the vascular endothelium. We hypothesize that Egfl7 marks the endothelial lineage during embryonic development, and can be used to define the emergence of endothelial progenitor cells, as well as to visualize newly-forming vasculature in the embryo and during the processes of physiologic and pathologic angiogenesis in the adult. We have generated a transgenic mouse strain that expresses enhanced green fluorescent protein (eGFP) under the control of a minimal Egfl7 regulatory sequence (Egfl7:eGFP). Expression of the transgene recapitulated that of endogenous Egfl7 at sites of vasculogenesis and angiogenesis in the allantois, yolk sac, and in the embryo proper. The transgene was not expressed in the quiescent endothelium of most adult organs. However, the uterus and ovary, which undergo vascular growth and remodeling throughout the estrus cycle, expressed high levels of Egfl7:eGFP. Importantly, expression of the Egfl7:eGFP transgene was induced in adult neovasculature. We also found that increased Egfl7 expression contributed to pathologic revascularization in the mouse retina. To our knowledge, this is the first mouse model that enables monitoring of endothelial cells at sites of active vasculogenesis and angiogenesis. This model also facilitated the isolation and characterization of EGFL7(+) endothelial cell populations by fluorescence activated cell sorting (FACS). Together, our results demonstrate that the Egfl7:eGFP reporter mouse is a valuable tool that can be used to elucidate the mechanisms by which blood vessels form during development and under pathologic circumstances. © 2014 Wiley Periodicals, Inc.

Generation of transgenic mice expressing EGFP protein fused to NP68 MHC class I epitope using lentivirus vectors.

PubMed

Tomkowiak, Martine; Ghittoni, Raffaella; Teixeira, Marie; Blanquier, Bariza; Szécsi, Judit; Nègre, Didier; Aubert, Denise; Coupet, Charles-Antoine; Brunner, Molly; Verhoeyen, Els; Thoumas, Jean-Louis; Cosset, François-Loïc; Leverrier, Yann; Marvel, Jacqueline

2013-03-01

Immune tolerance to self-antigens is a complex process that utilizes multiple mechanisms working in concert to maintain homeostasis and prevent autoimmunity. Considerable progress in deciphering the mechanisms controlling the activation or deletion of T cells has been made by using T cell receptor (TCR) transgenic mice. One such model is the F5 model in which CD8 T cells express a TCR specific for an epitope derived from the influenza NP68 protein. Our aim was to create transgenic mouse models expressing constitutively the NP68 epitope fused to enhanced green fluorescent protein (EGFP) in order to assess unambiguously the relative levels of NP68 epitope expressed by single cells. We used a lentiviral-based approach to generate two independent transgenic mouse strains expressing the fusion protein EGFP-NP68 under the control of CAG (CMV immediate early enhancer and the chicken β-actin promoter) or spleen focus-forming virus (SFFV) promoters. Analysis of the pattern of EGFP expression in the hematopoietic compartment showed that CAG and SFFV promoters are differentially regulated during T cell development. However, both promoters drove high EGFP-NP68 expression in dendritic cells (pDCs, CD8α(+) cDCs, and CD8α(-) cDCs) from spleen or generated in vitro following differentiation from bone-marrow progenitors. NP68 epitope was properly processed and successfully presented by dendritic cells (DCs) by direct presentation and cross-presentation to F5 CD8 T cells. The models presented here are valuable tools to investigate the priming of F5 CD8 T cells by different subsets of DCs. Copyright © 2013 Wiley Periodicals, Inc.

Part I. Embryonic surgery using femtosecond laser pulses for the delivery of exogenous materials and the analysis of gene expression

NASA Astrophysics Data System (ADS)

Kohli, V.; Elezzabi, A. Y.

2008-02-01

Herein, we demonstrate the application of high-intensity femtosecond (fs) laser pulses for performing laser surgery on the embryonic cells of developing zebrafish (Danio rerio). When fs laser pulses were focused onto individual blastomeres, transient pores were formed exposing the extracellular space to the intracellular environment. Utilizing the transient pores as a pathway for delivery of exogenous material, both chorionated and dechorionated zebrafish embryos were successfully loaded with a fluorescent reporter molecule (fluorescein isothiocyanate (FITC)). Streptavidin-conjugated quantum dots or plasmid DNA (Simian-CMV-EGFP). Both FITC and quantum dots were found to disperse throughout the blastomere cells as the embryo developed. Gene expression was seen in 24 hour post-fertilized embryos, with fluorescence observed in the notochord, floor plates, somites and tails of the larvae. We also determined the survivability of laser-manipulated embryos by rearing zebrafish from early to mid cleavage stage (2-cell to 8/16-cell) to pec-fin stage. Survival rates of 89 and 100 % were found for dechorionated and chorionated embryos, respectively.

Vaccinia virus-free rescue of fluorescent replication-defective vesicular stomatitis virus and pseudotyping with Puumala virus glycoproteins for use in neutralization tests.

PubMed

Paneth Iheozor-Ejiofor, Rommel; Levanov, Lev; Hepojoki, Jussi; Strandin, Tomas; Lundkvist, Åke; Plyusnin, Alexander; Vapalahti, Olli

2016-05-01

Puumala virus (PUUV) grows slowly in cell culture. To study antigenic properties of PUUV, an amenable method for their expression would be beneficial. To achieve this, a replication-defective recombinant vesicular stomatitis virus, rVSVΔG*EGFP, was rescued using BSRT7/5 and encephalomyocarditis virus (EMCV) internal ribosomal entry site (IRES)-enabled rescue plasmids. Using these particles, pseudotypes bearing PUUV Sotkamo strain glycoproteins were produced, with titres in the range 105-108, and were used in pseudotype focus reduction neutralization tests (pFRNTs) with neutralizing monoclonal antibodies and patient sera. The results were compared with those from orthodox focus reduction neutralization tests (oFRNTs) using native PUUV with the same samples and showed a strong positive correlation (rs = 0.82) between the methods. While developing the system we identified three amino acids which were mutated in the Vero E6 cell culture adapted PUUV prototype Sotkamo strain sequence, and changing these residues was critical for expression and neutralizing antibody binding of PUUV glycoproteins.

The use of biodegradable PLGA nanoparticles to mediate SOX9 gene delivery in human mesenchymal stem cells (hMSCs) and induce chondrogenesis.

PubMed

Kim, Jae-Hwan; Park, Ji Sun; Yang, Han Na; Woo, Dae Gyun; Jeon, Su Yeon; Do, Hyun-Jin; Lim, Hye-Young; Kim, Jung Mo; Park, Keun-Hong

2011-01-01

In stem cell therapy, transfection of specific genes into stem cells is an important technique to induce cell differentiation. To perform gene transfection in human mesenchymal stem cells (hMSCs), we designed and fabricated a non-viral vector system for specific stem cell differentiation. Several kinds of gene carriers were evaluated with regard to their transfection efficiency and their ability to enhance hMSCs differentiation. Of these delivery vehicles, biodegradable poly (DL-lactic-co-glycolic acid) (PLGA) nanoparticles yielded the best results, as they complexed with high levels of plasmid DNA (pDNA), allowed robust gene expression in hMSCs, and induced chondrogenesis. Polyplexing with polyethylenimine (PEI) enhanced the cellular uptake of SOX9 DNA complexed with PLGA nanoparticles both in vitro and in vivo. The expression of enhanced green fluorescent protein (EGFP) and SOX9 increased up to 75% in hMSCs transfected with PEI/SOX9 complexed PLGA nanoparticles 2 days after transfection. SOX9 gene expression was evaluated by RT-PCR, real time-qPCR, glycosaminoglycan (GAG)/DNA levels, immunoblotting, histology, and immunofluorescence. Copyright © 2010 Elsevier Ltd. All rights reserved.

Construction of baculovirus expression vector of miRNAs and its expression in insect cells.

PubMed

Huang, Yong; Zou, Quan; Shen, Xing Jia; Yu, Xue Li; Wang, Zhan Bin; Cheng, Xiang Chao

2012-01-01

MicroRNAs (miRNAs) are endogenous small non-protein coding RNAs that play important regulatory roles in animals and plants by binding to target transcripts for cleavage or translational repression. The miR-9a is very conservative in animals from flies to humans. Studies indicated that miR-9a is involved in the regulation of neurogenesis in animals. In our study, the baculovirus expression system was used to transcribe a recombinant vector containing miR-9a for further analysis the function ofmiR-9a. The sequence ofpre-miR-9a from silkworm DNA was first cloned into the donor pFastBac. The enhanced green fluorescent protein (EGFP) was used as reporter gene. The recombinant donor plasmid pFastBac-miR-9a was transformed into E.coli DH10Bac/AcNPV forming Bacmid-9a which was transfected into insect cells with cational lipofectin. The transcription of mature miR-9a was detected by Real-time PCR. The results show the recombinant Bacmid-9a was successfully constructed and effectively transcribed miR-9a in infected Sf21 insect cells.

PSMA-Specific Theranostic Nanoplex for Combination of TRAIL Gene and 5-FC Prodrug Therapy of Prostate Cancer

PubMed Central

Chen, Zhihang; Penet, Marie-France; Krishnamachary, Balaji; Banerjee, Sangeeta R.; Pomper, Martin G.; Bhujwalla, Zaver M.

2015-01-01

Metastatic prostate cancer causes significant morbidity and mortality and there is a critical unmet need for effective treatments. We have developed a theranostic nanoplex platform for combined imaging and therapy of prostate cancer. Our prostate-specific membrane antigen (PSMA) targeted nanoplex is designed to deliver plasmid DNA encoding tumor necrosis factor related apoptosis-inducing ligand (TRAIL), together with bacterial cytosine deaminase (bCD) as a prodrug enzyme. Nanoplex specificity was tested using two variants of human PC3 prostate cancer cells in culture and in tumor xenografts, one with high PSMA expression and the other with negligible expression levels. The expression of EGFP-TRAIL was demonstrated by fluorescence optical imaging and real-time PCR. Noninvasive 19F MR spectroscopy detected the conversion of the nontoxic prodrug 5-fluorocytosine (5-FC) to cytotoxic 5-fluorouracil (5-FU) by bCD. The combination strategy of TRAIL gene and 5-FC/bCD therapy showed significant inhibition of the growth of prostate cancer cells and tumors. These data demonstrate that the PSMA-specific theranostic nanoplex can deliver gene therapy and prodrug enzyme therapy concurrently for precision medicine in metastatic prostate cancer. PMID:26706476

Thiolated trimethyl chitosan nanocomplexes as gene carriers with high in vitro and in vivo transfection efficiency.

PubMed

Zhao, Xin; Yin, Lichen; Ding, Jieying; Tang, Cui; Gu, Shaohua; Yin, Chunhua; Mao, Yumin

2010-05-21

Trimethyl chitosan-cysteine conjugate (TMC-Cys) was evaluated as non-viral gene carriers to combine the advantages of TMC and thiolated chitosan. TMC-Cys with various molecular weights (30, 100, and 200 kDa) and quaternization degrees (15 and 30%) was allowed to form polyelectrolyte nanocomplexes with plasmid encoding enhanced green fluorescence protein (pEGFP), which demonstrated preferable diameters of below 200 nm and zeta potentials of +15 to +20 mV. Cell binding and uptake of TMC-Cys/pEGFP nanocomplexes (TMC-Cys NC) were enhanced 2.4-3.0 and 1.4-3.0 folds, respectively, compared to TMC/pEGFP nanocomplexes (TMC NC). pEGFP could be easily released from TMC-Cys NC at the intracellular glutathione concentration, which promoted its nuclear transport and accumulation. Consequently, TMC-Cys NC showed a 1.4 to 3.2-fold increase in the transfection efficiency in HEK293 cells as compared to TMC NC and the optimal TMC-Cys(100,30) NC showed a 1.5-fold enhancement than Lipofectamine2000. Such results were further confirmed by in vivo transfection with a 2.3-fold and 4.1-fold higher transfection efficiency of TMC-Cys(100,30) NC than TMC(100,30) NC and Lipofectamine2000, respectively. Therefore, TMC-Cys/DNA nanocomplexes could be a promising gene delivery system with in vitro and in vivo superiority to Lipofectamine2000. Copyright 2010 Elsevier B.V. All rights reserved.

Combining Optical Reporter Proteins with Different Half-lives to Detect Temporal Evolution of Hypoxia and Reoxygenation in Tumors.

PubMed

Danhier, Pierre; Krishnamachary, Balaji; Bharti, Santosh; Kakkad, Samata; Mironchik, Yelena; Bhujwalla, Zaver M

2015-12-01

Here we have developed a hypoxia response element driven imaging strategy that combined the hypoxia-driven expression of two optical reporters with different half-lives to detect temporal changes in hypoxia and hypoxia inducible factor (HIF) activity. For this purpose, human prostate cancer PC3 cells were transfected with the luciferase gene fused with an oxygen-dependent degradation domain (ODD-luc) and a variant of the enhanced green fluorescent protein (EGFP). Both ODD-luciferase and EGFP were under the promotion of a poly-hypoxia-response element sequence (5xHRE). The cells constitutively expressed tdTomato red fluorescent protein. For validating the imaging strategy, cells were incubated under hypoxia (1% O2) for 48 hours and then reoxygenated. The luciferase activity of PC3-HRE-EGFP/HRE-ODD-luc/tdtomato cells detected by bioluminescent imaging rapidly decreased after reoxygenation, whereas EGFP levels in these cells remained stable for several hours. After in vitro validation, PC3-HRE-EGFP/HRE-ODD-luc/tdtomato tumors were implanted subcutaneously and orthotopically in nude male mice and imaged in vivo and ex vivo using optical imaging in proof-of-principle studies to demonstrate differences in optical patterns between EGFP expression and bioluminescence. This novel "timer" imaging strategy of combining the short-lived ODD-luciferase and the long-lived EGFP can provide a time frame of HRE activation in PC3 prostate cancer cells and will be useful to understand the temporal changes in hypoxia and HIF activity during cancer progression and following treatments including HIF targeting strategies. Copyright © 2015 Nencki Institute of Experimental Biology, Polish Academy of Sciences,. Published by Elsevier Inc. All rights reserved.

Autophagy-dependent generation of Axin2+ cancer stem-like cells promotes hepatocarcinogenesis in liver cirrhosis.

PubMed

Li, J; Hu, S B; Wang, L Y; Zhang, X; Zhou, X; Yang, B; Li, J H; Xiong, J; Liu, N; Li, Y; Wu, Y Z; Zheng, Q C

2017-11-30

Autophagy is a pathophysiological phenomenon in liver cirrhosis that can further progress into hepatocarcinoma. Liver cancer stem cells (CSCs) are believed to initiate hepatocarcinogenesis. To investigate the precise mechanism related to the origin of CSCs in liver cirrhosis and hepatocarcinogenesis, we labeled Axin2+ hepatic cells with EGFP in Axin2Cre;Rosa26EGFP transgenic rats, and then stratified clinical and rat liver cirrhosis samples by autophagy flux. Clinical follow-up and lineage tracing in transgenic rat liver cirrhosis revealed that while Axin2/EGFP+ hepatic cells were present in normal livers and cirrhotic livers without aberrant autophagy, hepatic Axin2/EGFP+CD90+ cells were generated exclusively in cirrhotic livers with aberrant autophagy and promoted hepatocarcinogenesis. Aberrant autophagy in liver cirrhosis resulted in hepatocyte growth factor (HGF) expression, leading to activation of Met/JNK and Met/STAT3 signaling in sorted hepatic Axin2/EGFP+ cells and their transition into Axin2/EGFP+CD90+ cells that possess CSC properties. In a transgenic rat liver cirrhosis model, induction or inhibition of autophagy in cirrhotic livers by systemic administration of rapamycin or chloroquine or transfection with Atg3- and Atg7-shRNAs significantly induced or suppressed HGF expression, which in turn increased or reduced generation of EGFP+CD90+ hepatic cells by activating or inactivating Met/JNK and Met/STAT3 signaling, thereby promoting or preventing hepatocarcinogenesis. Systemic treatment with HGF-shRNA, SP600125 or stattic also reduced generation of EGFP(Axin2)+ hepatic cell-originated CD90+ CSCs in aberrant autophagic cirrhotic livers by inactivating HGF/Met/JNK or HGF/Met/STAT3 signaling, further preventing hepatocarcinogenesis. These data suggest that activation of Met/JNK and Met/STAT3 signaling in Axin2+ hepatic cells via autophagy-dependent HGF expression and the resultant generation of Axin2+CD90+ CSCs is a major mechanism of hepatocarcinogenesis in cirrhotic livers.

Autophagy-dependent generation of Axin2+ cancer stem-like cells promotes hepatocarcinogenesis in liver cirrhosis

PubMed Central

Li, J; Hu, S B; Wang, L Y; Zhang, X; Zhou, X; Yang, B; Li, J H; Xiong, J; Liu, N; Li, Y; Wu, Y Z; Zheng, Q C

2017-01-01

Autophagy is a pathophysiological phenomenon in liver cirrhosis that can further progress into hepatocarcinoma. Liver cancer stem cells (CSCs) are believed to initiate hepatocarcinogenesis. To investigate the precise mechanism related to the origin of CSCs in liver cirrhosis and hepatocarcinogenesis, we labeled Axin2+ hepatic cells with EGFP in Axin2Cre;Rosa26EGFP transgenic rats, and then stratified clinical and rat liver cirrhosis samples by autophagy flux. Clinical follow-up and lineage tracing in transgenic rat liver cirrhosis revealed that while Axin2/EGFP+ hepatic cells were present in normal livers and cirrhotic livers without aberrant autophagy, hepatic Axin2/EGFP+CD90+ cells were generated exclusively in cirrhotic livers with aberrant autophagy and promoted hepatocarcinogenesis. Aberrant autophagy in liver cirrhosis resulted in hepatocyte growth factor (HGF) expression, leading to activation of Met/JNK and Met/STAT3 signaling in sorted hepatic Axin2/EGFP+ cells and their transition into Axin2/EGFP+CD90+ cells that possess CSC properties. In a transgenic rat liver cirrhosis model, induction or inhibition of autophagy in cirrhotic livers by systemic administration of rapamycin or chloroquine or transfection with Atg3- and Atg7-shRNAs significantly induced or suppressed HGF expression, which in turn increased or reduced generation of EGFP+CD90+ hepatic cells by activating or inactivating Met/JNK and Met/STAT3 signaling, thereby promoting or preventing hepatocarcinogenesis. Systemic treatment with HGF-shRNA, SP600125 or stattic also reduced generation of EGFP(Axin2)+ hepatic cell-originated CD90+ CSCs in aberrant autophagic cirrhotic livers by inactivating HGF/Met/JNK or HGF/Met/STAT3 signaling, further preventing hepatocarcinogenesis. These data suggest that activation of Met/JNK and Met/STAT3 signaling in Axin2+ hepatic cells via autophagy-dependent HGF expression and the resultant generation of Axin2+CD90+ CSCs is a major mechanism of hepatocarcinogenesis in cirrhotic livers. PMID:28783177

Using Green and Red Fluorescent Proteins to Teach Protein Expression, Purification, and Crystallization

ERIC Educational Resources Information Center

Wu, Yifeng; Zhou, Yangbin; Song, Jiaping; Hu, Xiaojian; Ding, Yu; Zhang, Zhihong

2008-01-01

We have designed a laboratory curriculum using the green and red fluorescent proteins (GFP and RFP) to visualize the cloning, expression, chromatography purification, crystallization, and protease-cleavage experiments of protein science. The EGFP and DsRed monomer (mDsRed)-coding sequences were amplified by PCR and cloned into pMAL (MBP-EGFP) or…

Spectroscopy detection of green and red fluorescent proteins in genetically modified plants using a fiber optics system

NASA Astrophysics Data System (ADS)

Liew, Oi Wah; Asundi, Anand K.; Chen, Jun-Wei; Chew, Yiwen; Yu, Shangjuan; Yeo, Gare H.

2001-05-01

In this paper, fiber optic spectroscopy is developed to detect and quantify recombinant green (EGFP) and red (DsRED) fluorescent proteins in vitro and in vivo. The bacterial expression vectors carrying the coding regions of EGFP and DsRED were introduced into Escherichia coli host cells and fluorescent proteins were produced following induction with IPTG. Soluble EGFP and DsRED proteins were isolated from lysed bacterial cells and serially diluted for quantitative analysis by fiber optic spectroscopy. Fluorescence at the appropriate emission wavelengths could be detected up to 64X dilution for EGFP and 40X dilution for DsRED. To determine the capability of spectroscopy detection in vivo, transgenic potato hairy roots expressing EGFP and DsRED were regenerated. This was achieved by cloning the EGFP and DsRED genes into the plant binary vector, pTMV35S, to create the recombinant vectors pGLOWGreen and pGLOWRed. These latter binary vectors were introduced into Agrobacterium rhizogenes strain A4T. Infection of potato cells with transformed agrobacteria was used to insert the fluorescent protein genes into the potato genome. Genetically modified potato cells were then regenerated into hairy roots. A panel of transformed hairy roots expressing varying levels of fluorescent proteins was selected by fluorescence microscopy. We are now assessing the capability of spectroscopic detection system for in vivo quantification of green and red fluorescence levels in transformed roots.

Regulation of zebrafish CYP3A65 transcription by AHR2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, Chin-Teng; Chung, Hsin-Yu; Su, Hsiao-Ting

2013-07-15

CYP3A proteins are the most abundant CYPs in the liver and intestines, and they play a pivotal role in drug metabolism. In mammals, CYP3A genes are induced by various xenobiotics through processes mediated by PXR. We previously identified zebrafish CYP3A65 as a CYP3A ortholog that is constitutively expressed in gastrointestinal tissues, and is upregulated by treatment with dexamethasone, rifampicin or tetrachlorodibenzo-p-dioxin (TCDD). However, the underlying mechanism of TCDD-mediated CYP3A65 transcription is unclear. Here we generated two transgenic zebrafish, Tg(CYP3A65S:EGFP) and Tg(CYP3A65L:EGFP), which contain 2.1 and 5.4 kb 5′ flanking sequences, respectively, of the CYP3A65 gene upstream of EGFP. Both transgenicmore » lines express EGFP in larval gastrointestinal tissues in a pattern similar to that of the endogenous CYP3A65 gene. Moreover, EGFP expression can be significantly induced by TCDD exposure during the larval stage. In addition, EGFP expression can be stimulated by kynurenine, a putative AHR ligand produced during tryptophan metabolism. AHRE elements in the upstream regulatory region of the CYP3A65 gene are indispensible for basal and TCDD-induced transcription. Furthermore, the AHR2 DNA and ligand-binding domains are required to mediate effective CYP3A65 transcription. AHRE sequences are present in the promoters of many teleost CYP3 genes, but not of mammalian CYP3 genes, suggesting that AHR/AHR2-mediated transcription is likely a common regulatory mechanism for teleost CYP3 genes. It may also reflect the different environments that terrestrial and aquatic organisms encounter. - Highlights: • Tg(CYP3A65:EGFP) and CYP3A65 exhibits identical expression pattern. • CYP3A65 can be significantly induced by TCDD or kynurenine. • The AHRE elements are required to mediate CYP3A65 transcription. • The AHR2 DNA and ligand-binding domains are required for CYP3A65 transcription. • AHRE elements are present in many teleost CYP3 genes, but not in mammalian CYP3 genes.« less

Twist functions in vertebral column formation in medaka, Oryzias latipes.

PubMed

Yasutake, Junichi; Inohaya, Keiji; Kudo, Akira

2004-07-01

Medaka twist, a basic helix-loop-helix (bHLH) transcription factor, is expressed in the sclerotome during embryogenesis. We previously established a line of twist-EGFP transgenic medaka, whose EGFP expression is regulated by the twist promoter; therefore, we could observe the behavior of sclerotomal cells in vivo. In the transgenic medaka embryos, EGFP-positive sclerotomal cells migrated dorsally around the notochord and the neural tube, where at a later stage the vertebral column would be formed. This finding strongly suggests that twist-expressing sclerotomal cells participate in vertebral column formation in medaka. To clarify the function of twist gene in the sclerotome, we performed knockdown analysis of twist by using two kinds of morpholino antisense oligonucleotides targeted against twist (MO1 and MO2). Both the MO1 and MO2 morphants exhibited absence of neural arches, which are bilaterally paired, dorsomedially oriented bones on the dorsal aspect of the centrum. In addition, MO2, which blocks translation of only endogenous twist mRNA in the twist-EGFP transgenic medaka, did not affect the migration pattern of EGFP-positive cells, revealing that the migration of sclerotome-derived cells were normal in the absence of twist gene function. These results demonstrate that medaka twist functions in vertebral column formation by regulating the sclerotomal cell differentiation.

Transformation of Beauveria bassiana to produce EGFP in Tenebrio molitor for use as animal feed additives.

PubMed

Kim, Jae Su; Choi, Jae Young; Lee, Se Jin; Lee, Ju Hyun; Fu, Zhenli; Skinner, Margaret; Parker, Bruce L; Je, Yeon Ho

2013-07-01

Efforts are underway to develop more effective and safer animal feed additives. Entomopathogenic fungi can be considered practical expression platforms of functional genes within insects which have been used as animal feed additives. In this work, as a model, the enhanced green fluorescent protein (egfp) gene was expressed in yellow mealworms, Tenebrio molitor by highly infective Beauveria bassiana ERL1170. Among seven test isolates, ERL1170 treatment showed 57.1% and 98.3% mortality of mealworms 2 and 5 days after infection, respectively. The fungal transformation vector, pABeG containing the egfp gene, was inserted into the genomic DNA of ERL1170 using the restriction enzyme-mediated integration method. This resulted in the generation of the transformant, Bb-egfp#3, which showed the highest level of fluorescence. Bb-egfp#3-treated mealworms gradually turned dark brown, and in 7-days mealworm sections showed a strong fluorescence. This did not occur in the wild-type strain. This work suggests that further valuable proteins can be efficiently produced in this mealworm-based fungal expression platform, thereby increasing the value of mealworms in the animal feed additive industry. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Knockout of exogenous EGFP gene in porcine somatic cells using zinc-finger nucleases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watanabe, Masahito; Department of Life Sciences, School of Agriculture, Meiji University, 1-1-1 Higashimita, Tama-ku, Kawasaki, Kanagawa 214-8571; Umeyama, Kazuhiro

2010-11-05

Research highlights: {yields} EGFP gene integrated in porcine somatic cells could be knocked out using the ZFN-KO system. {yields} ZFNs induced targeted mutations in porcine primary cultured cells. {yields} Complete absence of EGFP fluorescence was confirmed in ZFN-treated cells. -- Abstract: Zinc-finger nucleases (ZFNs) are expected as a powerful tool for generating gene knockouts in laboratory and domestic animals. Currently, it is unclear whether this technology can be utilized for knocking-out genes in pigs. Here, we investigated whether knockout (KO) events in which ZFNs recognize and cleave a target sequence occur in porcine primary cultured somatic cells that harbor themore » exogenous enhanced green fluorescent protein (EGFP) gene. ZFN-encoding mRNA designed to target the EGFP gene was introduced by electroporation into the cell. Using the Surveyor nuclease assay and flow cytometric analysis, we confirmed ZFN-induced cleavage of the target sequence and the disappearance of EGFP fluorescence expression in ZFN-treated cells. In addition, sequence analysis revealed that ZFN-induced mutations such as base substitution, deletion, or insertion were generated in the ZFN cleavage site of EGFP-expression negative cells that were cloned from ZFN-treated cells, thereby showing it was possible to disrupt (i.e., knock out) the function of the EGFP gene in porcine somatic cells. To our knowledge, this study provides the first evidence that the ZFN-KO system can be applied to pigs. These findings may open a new avenue to the creation of gene KO pigs using ZFN-treated cells and somatic cell nuclear transfer.« less

Transcriptional Profiling of Cholinergic Neurons From Basal Forebrain Identifies Changes in Expression of Genes Between Sleep and Wake.

PubMed

Nikonova, Elena V; Gilliland, Jason DA; Tanis, Keith Q; Podtelezhnikov, Alexei A; Rigby, Alison M; Galante, Raymond J; Finney, Eva M; Stone, David J; Renger, John J; Pack, Allan I; Winrow, Christopher J

2017-06-01

To assess differences in gene expression in cholinergic basal forebrain cells between sleeping and sleep-deprived mice sacrificed at the same time of day. Tg(ChAT-eGFP)86Gsat mice expressing enhanced green fluorescent protein (eGFP) under control of the choline acetyltransferase (Chat) promoter were utilized to guide laser capture of cholinergic cells in basal forebrain. Messenger RNA expression levels in these cells were profiled using microarrays. Gene expression in eGFP(+) neurons was compared (1) to that in eGFP(-) neurons and to adjacent white matter, (2) between 7:00 am (lights on) and 7:00 pm (lights off), (3) between sleep-deprived and sleeping animals at 0, 3, 6, and 9 hours from lights on. There was a marked enrichment of ChAT and other markers of cholinergic neurons in eGFP(+) cells. Comparison of gene expression in these eGFP(+) neurons between 7:00 am and 7:00 pm revealed expected differences in the expression of clock genes (Arntl2, Per1, Per2, Dbp, Nr1d1) as well as mGluR3. Comparison of expression between spontaneous sleep and sleep-deprived groups sacrificed at the same time of day revealed a number of transcripts (n = 55) that had higher expression in sleep deprivation compared to sleep. Genes upregulated in sleep deprivation predominantly were from the protein folding pathway (25 transcripts, including chaperones). Among 42 transcripts upregulated in sleep was the cold-inducible RNA-binding protein. Cholinergic cell signatures were characterized. Whether the identified genes are changing as a consequence of differences in behavioral state or as part of the molecular regulatory mechanism remains to be determined. © Sleep Research Society 2017. Published by Oxford University Press on behalf of the Sleep Research Society. All rights reserved. For permissions, please e-mail journals.permissions@oup.com.

Targeted transgene insertion into the CHO cell genome using Cre recombinase-incorporating integrase-defective retroviral vectors.

PubMed

Kawabe, Yoshinori; Shimomura, Takuya; Huang, Shuohao; Imanishi, Suguru; Ito, Akira; Kamihira, Masamichi

2016-07-01

Retroviral vectors have served as efficient gene delivery tools in various biotechnology fields. However, viral DNA is randomly inserted into the genome, which can cause problems, such as insertional mutagenesis and gene silencing. Previously, we reported a site-specific gene integration system, in which a transgene is integrated into a predetermined chromosomal locus of Chinese hamster ovary (CHO) cells using integrase-defective retroviral vectors (IDRVs) and Cre recombinase. In this system, a Cre expression plasmid is transfected into founder cells before retroviral transduction. In practical applications of site-specific gene modification such as for hard-to-transfect cells or for in vivo gene delivery, both the transgene and the Cre protein into retroviral virions should be encapsulate. Here, we generated novel hybrid IDRVs in which viral genome and enzymatically active Cre can be delivered (Cre-IDRVs). Cre-IDRVs encoding marker genes, neomycin resistance and enhanced green fluorescent protein (EGFP), flanked by wild-type and mutated loxP sites were produced using an expression plasmid for a chimeric protein of Cre and retroviral gag-pol. After analyzing the incorporation of the Cre protein into retroviral virions by Western blotting, the Cre-IDRV was infected into founder CHO cells, in which marker genes (hygromycin resistance and red fluorescent protein) flanked with corresponding loxP sites are introduced into the genome. G418-resistant colonies expressing GFP appeared and the site-specific integration of the transgene into the expected chromosomal site was confirmed by PCR and sequencing of amplicons. Moreover, when Cre-IDRV carried a gene expression unit for a recombinant antibody, the recombinant cells in which the antibody expression cassette was integrated in a site-specific manner were generated and the cells produced the recombinant antibody. This method may provide a promising tool to perform site-specific gene modification according to Cre-based cell engineering. Biotechnol. Bioeng. 2016;113: 1600-1610. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Distinct projection targets define subpopulations of mouse brainstem vagal neurons that express the autism-associated MET receptor tyrosine kinase.

PubMed

Kamitakahara, Anna; Wu, Hsiao-Huei; Levitt, Pat

2017-12-15

Detailed anatomical tracing and mapping of the viscerotopic organization of the vagal motor nuclei has provided insight into autonomic function in health and disease. To further define specific cellular identities, we paired information based on visceral connectivity with a cell-type specific marker of a subpopulation of neurons in the dorsal motor nucleus of the vagus (DMV) and nucleus ambiguus (nAmb) that express the autism-associated MET receptor tyrosine kinase. As gastrointestinal disturbances are common in children with autism spectrum disorder (ASD), we sought to define the relationship between MET-expressing (MET+) neurons in the DMV and nAmb, and the gastrointestinal tract. Using wholemount tissue staining and clearing, or retrograde tracing in a MET EGFP transgenic mouse, we identify three novel subpopulations of EGFP+ vagal brainstem neurons: (a) EGFP+ neurons in the nAmb projecting to the esophagus or laryngeal muscles, (b) EGFP+ neurons in the medial DMV projecting to the stomach, and (b) EGFP+ neurons in the lateral DMV projecting to the cecum and/or proximal colon. Expression of the MET ligand, hepatocyte growth factor (HGF), by tissues innervated by vagal motor neurons during fetal development reveal potential sites of HGF-MET interaction. Furthermore, similar cellular expression patterns of MET in the brainstem of both the mouse and nonhuman primate suggests that MET expression at these sites is evolutionarily conserved. Together, the data suggest that MET+ neurons in the brainstem vagal motor nuclei are anatomically positioned to regulate distinct portions of the gastrointestinal tract, with implications for the pathophysiology of gastrointestinal comorbidities of ASD. © 2017 Wiley Periodicals, Inc.

In vivo alternative assessment of the chemicals that interfere with anterior pituitary POMC expression and interrenal steroidogenesis in POMC: EGFP transgenic zebrafish

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun Lingli; Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei, 430072; Xu Wei

2010-11-01

Adrenocorticotropin (ACTH) has been considered a classic adrenocorticotropic hormone and the key pituitary-derived peptide controlling steroidogenesis in the adult adrenal. ACTH is encoded by the propiomelanocortin (POMC) gene, and its active form is mainly synthesized and processed from the POMC-encoded multihormone precursor in the anterior pituitary. The ACTH level has always been precisely controlled in the signaling cascade of the hypothalamo-pituitary-adrenal (HPA) axis due to its central role. The purpose of this study was to investigate whether the transgenic zebrafish line with EGFP driven by the POMC promoter can be used as a surrogate marker to detect the interference effectsmore » on anterior pituitary POMC expression caused by chemicals in teleost. The Tg (POMC:EGFP) fish treated for 4 days with the known adrenergic agents, dexamethasone (Dex) or aminoglutethimide (AG), exhibited altered levels of EGFP and POMC expression in the anterior domain of pituitary corticotrophs. Whole-mount in situ hybridization revealed impaired patterns of expression of the zebrafish ftz-fl gene (ff1b), a key molecular marker for early interrenal development. Next, several chemicals and six commonly used organophosphorus compounds (OPs) were tested for their effects on anterior pituitary POMC expression and early interrenal development. Our preliminary screening analyses indicated that simazine and 3,3',4,4'5-pentachlorobiphenyl (PCB126) could interfere with anterior pituitary POMC expression and interrenal development in fish. In summary, our results demonstrated that the Tg (POMC:EGFP) zebrafish line might be employed as a specific and reproductive in vivo assessment model for the effects of endocrine disruption on HPA signaling.« less

Human parainfluenza virus type 3 (HPIV-3); Construction and rescue of an infectious, recombinant virus expressing the enhanced green fluorescent protein (EGFP).

USDA-ARS?s Scientific Manuscript database

The ability to rescue an infectious, recombinant, RNA virus from a cDNA clone, has led to new opportunities for measuring viral replication from a viral expressed reporter gene. In this protocol, the process of inserting enhanced green fluorescent protein (EGFP) gene into the human parainfluenza vi...

Polyamidoamine dendrimer-functionalized carbon nanotubes-mediated GFP gene transfection for HeLa cells: effects of different types of carbon nanotubes.

PubMed

Yang, Keqin; Qin, Weiling; Tang, Hao; Tan, Liang; Xie, Qingji; Ma, Ming; Zhang, Youyu; Yao, Shouzhuo

2011-11-01

Three types of functionalized carbon nanotubes (f-CNTs), polyamidoamine (PAMAM) dendrimer-functionalized single and multi-walled CNTs (MWCNT-PAMAM-1, MWCNT-PAMAM-2, and SWCNT-PAMAM-3), were prepared by covalent linkage approach. The micro-morphologies of the three f-CNTs and the interaction of MWCNT-PAMAM-2 with HeLa cells were characterized by transmission electron microscopy (TEM). The free amine groups on the surface of the three types of CNTs-PAMAM hybrids were quantitatively analyzed. Their cytotoxicity and transfection efficiency of plasmid DNA of enhanced green fluorescent protein (pEGFP-N1) to HeLa cells were investigated in detail. The results suggest that although all three types of CNTs-PAMAM hybrids can deliver pEGFP-N1 into HeLa cells and the exogenous GFP gene has been successfully expressed, MWCNT-PAMAM-2 with shorter length and larger amount of free amine groups on its surface possesses higher transfection efficiency (6.79%), being about 3.0 and 1.7 times as large as those of MWCNT-PAMAM-1 (2.24%) and SWCNT-PAMAM-3 (4.08%), respectively; their cytotoxicity to HeLa cells decrease following the sequence of SWCNT-PAMAM-3 > MWCNT-PAMAM-2 > MWCNT-PAMAM-1. These results may be useful for understanding the effects of the chemical/physical properties of f-CNTs on their gene transfection efficiency and cytotoxicity, allowing for construction of promising CNT-based intracellular delivery vectors for gene therapy. Copyright © 2011 Wiley Periodicals, Inc.

Polyethyleneimine-lipid conjugate-based pH-sensitive micellar carrier for gene delivery

PubMed Central

Sawant, Rupa R.; Sriraman, Shravan Kumar; Navarro, Gemma; Biswas, Swati; Dalvi, Riddhi A.; Torchilin, Vladimir P.

2012-01-01

A low molecular weight polyethyleneimine (PEI 1.8 kDa) was modified with dioleoylphosphatidylethanolamine (PE) to form the PEI-PE conjugate investigated as a transfection vector. The optimized PEI-PE/pDNA complexes at an N/P ratio of 16 had a particle size of 225 nm, a surface charge of +31 mV, and protected the pDNA from the action of DNase I. The PEI-PE conjugate had a critical micelle concentration (CMC) of about 34 μg/ml and exhibited no toxicity compared to a high molecular weight PEI (PEI 25 kDa) as tested with B16-F10 melanoma cells. The B16-F10 cells transfected with PEI-PE/pEGFP complexes showed protein expression levels higher than with PEI-1.8 or PEI-25 vectors. Complexes prepared with YOYO 1-labeled pEGFP confirmed the enhanced delivery of the plasmid with PEI-PE compared to PEI-1.8 and PEI-25. The PEI-PE/pDNA complexes were also mixed with various amounts of micelle-forming material, polyethylene glycol (PEG)-PE to improve biocompatibility. The resulting particles exhibited a neutral surface charge, resistance to salt-induced aggregation, and good transfection activity in the presence of serum in complete media. The use of the low-pH-degradable PEG-hydrazone-PE produced particles with transfection activity sensitive to changes in pH consistent with the relatively acidic tumor environment. PMID:22365809

Plant-Derived Transcription Factors for Orthologous Regulation of Gene Expression in the Yeast Saccharomyces cerevisiae.

PubMed

Naseri, Gita; Balazadeh, Salma; Machens, Fabian; Kamranfar, Iman; Messerschmidt, Katrin; Mueller-Roeber, Bernd

2017-09-15

Control of gene expression by transcription factors (TFs) is central in many synthetic biology projects for which a tailored expression of one or multiple genes is often needed. As TFs from evolutionary distant organisms are unlikely to affect gene expression in a host of choice, they represent excellent candidates for establishing orthogonal control systems. To establish orthogonal regulators for use in yeast (Saccharomyces cerevisiae), we chose TFs from the plant Arabidopsis thaliana. We established a library of 106 different combinations of chromosomally integrated TFs, activation domains (yeast GAL4 AD, herpes simplex virus VP64, and plant EDLL) and synthetic promoters harboring cognate cis-regulatory motifs driving a yEGFP reporter. Transcriptional output of the different driver/reporter combinations varied over a wide spectrum, with EDLL being a considerably stronger transcription activation domain in yeast than the GAL4 activation domain, in particular when fused to Arabidopsis NAC TFs. Notably, the strength of several NAC-EDLL fusions exceeded that of the strong yeast TDH3 promoter by 6- to 10-fold. We furthermore show that plant TFs can be used to build regulatory systems encoded by centromeric or episomal plasmids. Our library of TF-DNA binding site combinations offers an excellent tool for diverse synthetic biology applications in yeast.

Use of TSHβ:EGFP transgenic zebrafish as a rapid in vivo model for assessing thyroid-disrupting chemicals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ji, Cheng; Graduate University of Chinese Academy of Sciences, Beijing; Jin, Xia

Accumulating evidence indicates that a wide range of chemicals have the ability to interfere with the hypothalamic–pituitary–thyroid (HPT) axis. Novel endpoints should be evaluated in addition to existing methods in order to effectively assess the effects of these chemicals on the HPT axis. Thyroid-stimulating hormone subunit β (TSHβ) plays central regulatory roles in the HPT system. We identified the regulatory region that determines the expression level of zebrafish TSHβ in the anterior pituitary. In the transgenic zebrafish with EGFP driven by the TSHβ promoter, the similar responsive patterns between the expression levels of TSHβ:EGFP and endogenous TSHβ mRNA in themore » pituitary are observed following treatments with goitrogen chemicals and exogenous thyroid hormones (THs). These results suggest that the TSHβ:EGFP transgenic reporter zebrafish may be a useful alternative in vivo model for the assessment of chemicals interfering with the HPT system. Highlights: ► The promoter of zebrafish TSHβ gene has been identified. ► The stable TSHβ:EGFP transgenic zebrafish reporter germline has been generated. ► The EGFP in the transgenic fish recapitulated the pattern of pituitary TSHβ mRNA. ► The transgenic zebrafish may be an in vivo model for EDC assessment.« less

Figla-Cre Transgenic Mice Expressing Myristoylated EGFP in Germ Cells Provide a Model for Investigating Perinatal Oocyte Dynamics

PubMed Central

Lin, Ruei-Shiuan; Jimenez-Movilla, Maria; Dean, Jurrien

2014-01-01

FIGLA (Factor in the germline, alpha) is a bHLH transcription factor expressed abundantly in female and less so in male germ cells. Mice lacking FIGLA do not form primordial follicles in the ovary and females are sterile, but there is no obvious phenotype in males. Using the Figla promoter to express Cre recombinase, we have established mEGFP/mTomato reporter mice with green germ cells and red somatic tissue. These mice were crossed into the Figla null background to accelerate perinatal oocyte loss. Live imaging of cultured newborn ovaries provides evidence that few oocytes egress and the vast majority disappear within the confines of the ovary. Although a cohort of mobile, phagocytic cells was observed, macrophage depletion in Csf1op/op mice did not affect oocyte loss. Investigations with TUNEL assays and caspase inhibitors suggest that apoptosis plays a role in the perinatal loss of oocyte in female mice. These results establish the utility of Figla-EGFP/Cre; mTomato/mEGFP in investigating germ cell dynamics in prepubertal mice. PMID:24400092

Functional activity of plasmid DNA after entry into the atmosphere of earth investigated by a new biomarker stability assay for ballistic spaceflight experiments.

PubMed

Thiel, Cora S; Tauber, Svantje; Schütte, Andreas; Schmitz, Burkhard; Nuesse, Harald; Moeller, Ralf; Ullrich, Oliver

2014-01-01

Sounding rockets represent an excellent platform for testing the influence of space conditions during the passage of Earth's atmosphere and re-entry on biological, physical and chemical experiments for astrobiological purposes. We designed a robust functionality biomarker assay to analyze the biological effects of suborbital spaceflights prevailing during ballistic rocket flights. During the TEXUS-49 rocket mission in March 2011, artificial plasmid DNA carrying a fluorescent marker (enhanced green fluorescent protein: EGFP) and an antibiotic resistance cassette (kanamycin/neomycin) was attached on different positions of rocket exterior; (i) circular every 90 degree on the outer surface concentrical of the payload, (ii) in the grooves of screw heads located in between the surface application sites, and (iii) on the surface of the bottom side of the payload. Temperature measurements showed two major peaks at 118 and 130 °C during the 780 seconds lasting flight on the inside of the recovery module, while outer gas temperatures of more than 1000 °C were estimated on the sample application locations. Directly after retrieval and return transport of the payload, the plasmid DNA samples were recovered. Subsequent analyses showed that DNA could be recovered from all application sites with a maximum of 53% in the grooves of the screw heads. We could further show that up to 35% of DNA retained its full biological function, i.e., mediating antibiotic resistance in bacteria and fluorescent marker expression in eukaryotic cells. These experiments show that our plasmid DNA biomarker assay is suitable to characterize the environmental conditions affecting DNA during an atmospheric transit and the re-entry and constitute the first report of the stability of DNA during hypervelocity atmospheric transit indicating that sounding rocket flights can be used to model the high-speed atmospheric entry of organics-laden artificial meteorites.

Functional Activity of Plasmid DNA after Entry into the Atmosphere of Earth Investigated by a New Biomarker Stability Assay for Ballistic Spaceflight Experiments

PubMed Central

Thiel, Cora S.; Tauber, Svantje; Schütte, Andreas; Schmitz, Burkhard; Nuesse, Harald; Moeller, Ralf; Ullrich, Oliver

2014-01-01

Sounding rockets represent an excellent platform for testing the influence of space conditions during the passage of Earth's atmosphere and re-entry on biological, physical and chemical experiments for astrobiological purposes. We designed a robust functionality biomarker assay to analyze the biological effects of suborbital spaceflights prevailing during ballistic rocket flights. During the TEXUS-49 rocket mission in March 2011, artificial plasmid DNA carrying a fluorescent marker (enhanced green fluorescent protein: EGFP) and an antibiotic resistance cassette (kanamycin/neomycin) was attached on different positions of rocket exterior; (i) circular every 90 degree on the outer surface concentrical of the payload, (ii) in the grooves of screw heads located in between the surface application sites, and (iii) on the surface of the bottom side of the payload. Temperature measurements showed two major peaks at 118 and 130°C during the 780 seconds lasting flight on the inside of the recovery module, while outer gas temperatures of more than 1000°C were estimated on the sample application locations. Directly after retrieval and return transport of the payload, the plasmid DNA samples were recovered. Subsequent analyses showed that DNA could be recovered from all application sites with a maximum of 53% in the grooves of the screw heads. We could further show that up to 35% of DNA retained its full biological function, i.e., mediating antibiotic resistance in bacteria and fluorescent marker expression in eukariotic cells. These experiments show that our plasmid DNA biomarker assay is suitable to characterize the environmental conditions affecting DNA during an atmospheric transit and the re-entry and constitute the first report of the stability of DNA during hypervelocity atmospheric transit indicating that sounding rocket flights can be used to model the high-speed atmospheric entry of organics-laden artificial meteorites. PMID:25426925

Development and evaluation of novel recombinant adenovirus-based vaccine candidates for infectious bronchitis virus and Mycoplasma gallisepticum in chickens.

PubMed

Zhang, Dongchao; Long, Yuqing; Li, Meng; Gong, Jianfang; Li, Xiaohui; Lin, Jing; Meng, Jiali; Gao, Keke; Zhao, Ruili; Jin, Tianming

2018-04-01

Avian infectious bronchitis caused by the infectious bronchitis virus (IBV), and mycoplasmosis caused by Mycoplasma gallisepticum (MG) are two major respiratory diseases in chickens that have resulted in severe economic losses in the poultry industry. We constructed a recombinant adenovirus that simultaneously expresses the S1 spike glycoprotein of IBV and the TM-1 protein of MG (pBH-S1-TM-1-EGFP). For comparison, we constructed two recombinant adenoviruses (pBH-S1-EGFP and pBH-TM-1-EGFP) that express either the S1 spike glycoprotein or the TM-1 protein alone. The protective efficacy of these three vaccine constructs against challenge with IBV and/or MG was evaluated in specific pathogen free chickens. Groups of seven-day-old specific pathogen free chicks were immunized twice, two weeks apart, via the oculonasal route with the pBH-S1-TM-1-EGFP, pBH-S1-EGFP, or pBH-TM-1-EGFP vaccine candidates or the commercial attenuated infectious bronchitis vaccine strain H52 and MG vaccine strain F-36 (positive controls), and challenged with virulent IBV or MG two weeks later. Interestingly, by days 7 and 14 after the booster immunization, pBH-S1-TM-1-EGFP-induced antibody titre was significantly higher (P < 0.01) compared to attenuated commercial IBV vaccine; however, there was no significant difference between the pBH-S1-TM-1-EGFP and attenuated commercial MG vaccine groups (P > 0.05). The clinical signs, the gross, and histopathological lesions scores of the adenovirus vaccine constructs were not significantly different from that of the attenuated commercial IBV or MG vaccines (positive controls) (P > 0.05). These results demonstrate the potential of the bivalent pBH-S1-TM-1-EGFP adenovirus construct as a combination vaccine against IB and mycoplasmosis.

In vitro and in vivo characterization of a dual-function green fluorescent protein--HSV1-thymidine kinase reporter gene driven by the human elongation factor 1 alpha promoter.

PubMed

Luker, Gary D; Luker, Kathryn E; Sharma, Vijay; Pica, Christina M; Dahlheimer, Julie L; Ocheskey, Joe A; Fahrner, Timothy J; Milbrandt, Jeffrey; Piwnica-Worms, David

2002-01-01

Toward the goal of monitoring activity of native mammalian promoters with molecular imaging techniques, we stably transfected DU145 prostate carcinoma cells with a fusion construct of enhanced green fluorescent protein (EGFP) and wild-type herpes simplex virus-1 thymidine kinase (HSV1-TK) as a reporter gene driven by the promoter for human elongation factor 1 alpha (EF-1 alpha-EGFP-TK). Using this model system, expression of EGFP was quantified by flow cytometry and fluorescence microscopy, while the HSV1-TK component of the reporter was quantified with 8-[3H]ganciclovir (8-[3H]GCV). As analyzed by flow cytometry, passage of EGFP-TK-DU145 transfected cells (ETK) in vitro resulted in populations of cells with high and low expression of EGFP over time. High and low ETK cells retained 23-fold and 5-fold more GCV, respectively, than control. While differences in uptake and retention of GCV corresponded to relative expression of the reporter gene in each subpopulation of cells as determined by both flow cytometry (EGFP) and quantitative RT-PCR, the correlation was not linear. Furthermore, in high ETK cells, net retention of various radiolabeled nucleoside analogues varied; the rank order was 8-[3H]GCV < 9-(4-fluoro-3-hydroxymethylbutyl)guanine ([18F]FHBG) approximately 8-[3H]penciclovir (8-[3H]PCV) < 2'-fluoro-2'-deoxy-5-iodouracil-beta-D-arabinofuranoside (2-[14C]FIAU). Xenograft tumors of ETK cells in vivo accumulated 2.5-fold more 8-[3H]GCV per gram of tissue and showed greater fluorescence from EGFP than control DU145 cells, demonstrating that the reporter gene functioned in vivo. These data extend previous reports by showing that a human promoter can be detected in vitro and in vivo with a dual-function reporter exploiting optical and radiotracer techniques.

Generation of Pax6-IRES-EGFP knock-in mouse via the cloning-free CRISPR/Cas9 system to reliably visualize neurodevelopmental dynamics.

PubMed

Inoue, Yukiko U; Morimoto, Yuki; Hoshino, Mikio; Inoue, Takayoshi

2018-07-01

Pax6 encodes a transcription factor that plays pivotal roles in eye development, early brain patterning, neocortical arealization, and so forth. Visualization of Pax6 expression dynamics in these events could offer numerous advantages to neurodevelopmental studies. While CRISPR/Cas9 system has dramatically accelerated one-step generation of knock-out mouse, establishment of gene-cassette knock-in mouse via zygote injection has been considered insufficient due to its low efficiency. Recently, an improved CRISPR/Cas9 system for effective gene-cassette knock-in has been reported, where the native form of guide RNAs (crRNA and tracrRNA) assembled with recombinant Cas9 protein are directly delivered into mouse fertilized eggs. Here we apply this strategy to insert IRES-EGFP-pA cassette into Pax6 locus and achieve efficient targeted insertions of the 1.8 kb reporter gene. In Pax6-IRES-EGFP mouse we have generated, EGFP-positive cells reside in the eyes and cerebellum as endogenous Pax6 expressing cells at postnatal day 2. At the early embryonic stages when the embryos are transparent, EGFP-positive regions can be easily identified without PCR-based genotyping, precisely recapitulating the endogenous Pax6 expression patterns. Remarkably, at E12.5, the graded expression patterns of Pax6 in the developing neocortex now become recognizable in our knock-in mice, serving a sufficiently sensitive and useful tool to precisely visualize neurodevelopmental processes. Copyright © 2018 Elsevier B.V. and Japan Neuroscience Society. All rights reserved.

Generation of knock-in mice that express nuclear enhanced green fluorescent protein and tamoxifen-inducible Cre recombinase in the notochord from Foxa2 and T loci.

PubMed

Imuta, Yu; Kiyonari, Hiroshi; Jang, Chuan-Wei; Behringer, Richard R; Sasaki, Hiroshi

2013-03-01

The node and the notochord are important embryonic signaling centers that control embryonic pattern formation. Notochord progenitor cells present in the node and later in the posterior end of the notochord move anteriorly to generate the notochord. To understand the dynamics of cell movement during notochord development and the molecular mechanisms controlling this event, analyses of cell movements using time-lapse imaging and conditional manipulation of gene activities are required. To achieve this goal, we generated two knock-in mouse lines that simultaneously express nuclear enhanced green fluorescent protein (EGFP) and tamoxifen-inducible Cre, CreER(T2) , from two notochord gene loci, Foxa2 and T (Brachury). In Foxa2(nEGFP-CreERT2/+) and T(nEGFP-CreERT2/+) embryos, nuclei of the Foxa2 or T-expressing cells, which include the node, notochord, and endoderm (Foxa2) or wide range of posterior mesoderm (T), were labeled with EGFP at intensities that can be used for live imaging. Cre activity was also induced in cells expressing Foxa2 and T 1 day after tamoxifen administration. These mice are expected to be useful tools for analyzing the mechanisms of notochord development. Copyright © 2013 Wiley Periodicals, Inc.

Gene transduction in mammalian cells using Bombyx mori nucleopolyhedrovirus assisted by glycoprotein 64 of Autographa californica multiple nucleopolyhedrovirus.

PubMed

Kato, Tatsuya; Sugioka, Saki; Itagaki, Kohei; Park, Enoch Y

2016-08-26

Autographa californica multiple nucleopolyhedrovirus (AcMNPV), an alphabaculovirus, has been widely utilized for protein expression in not only insect cells but also mammalian cells. AcMNPV is closely related to Bombyx mori nucleopolyhedrovirus (BmNPV), and nucleotide sequences of AcMNPV genes have high similarity with those of BmNPV. However, the transduction of BmNPV into mammalian cells has not been reported. In this study, we constructed a recombinant BmNPV (BmNPVΔbgp/AcGP64/EGFP) whose surface 64 kDa glycoprotein (BmGP64) was substituted with that from AcMNPV (AcGP64). BmNPVΔbgp/AcGP64/EGFP also carried an EGFP gene under the control of the CMV promoter. BmNPVΔbgp/AcGP64/EGFP successfully transduced HEK293T cells. In comparison, a control construct (BmNPVΔbgp/BmGP64/EGFP) which possessed BmGP64 instead of AcGP64 did not express EGFP in HEK293T cells. The transduction efficiency of BmNPVΔbgp/AcGP64/EGFP was lower than that of an AcMNPV based-BacMam GFP transduction control. This result indicates that AcGP64 facilitates BmNPV transduction into HEK293T cells. BmNPV can be prepared easily on a large scale because BmNPV can infect silkworm larvae without any special equipment, even though specific diet is needed for silkworm rearing. BmNPV gene transduction into mammalian cells can potentially be applied easily for gene delivery into mammalian cells.

Modulation of ColE1-like Plasmid Replication for Recombinant Gene Expression

PubMed Central

Camps, Manel

2010-01-01

ColE1-like plasmids constitute the most popular vectors for recombinant protein expression. ColE1 plasmid replication is tightly controlled by an antisense RNA mechanism that is highly dynamic, tuning plasmid metabolic burden to the physiological state of the host. Plasmid homeostasis is upset upon induction of recombinant protein expression because of non-physiological levels of expression and because of the frequently biased amino acid composition of recombinant proteins. Disregulation of plasmid replication is the main cause of collapse of plasmid-based expression systems because of a simultaneous increase in the metabolic burden (due to increased average copy number) and in the probability of generation of plasmid-free cells (due to increased copy number variation). Interference between regulatory elements of co-resident plasmids causes comparable effects on plasmid stability (plasmid incompatibility). Modulating plasmid copy number for recombinant gene expression aims at achieving a high gene dosage while preserving the stability of the expression system. Here I present strategies targeting plasmid replication for optimizing recombinant gene expression. Specifically, I review approaches aimed at modulating the antisense regulatory system (as well as their implications for plasmid incompatibility) and innovative strategies involving modulation of host factors, of R-loop formation, and of the timing of recombinant gene expression. PMID:20218961

Fluorescent proteins such as eGFP lead to catalytic oxidative stress in cells.

PubMed

Ganini, Douglas; Leinisch, Fabian; Kumar, Ashutosh; Jiang, JinJie; Tokar, Erik J; Malone, Christine C; Petrovich, Robert M; Mason, Ronald P

2017-08-01

Fluorescent proteins are an important tool that has become omnipresent in life sciences research. They are frequently used for localization of proteins and monitoring of cells [1,2]. Green fluorescent protein (GFP) was the first and has been the most used fluorescent protein. Enhanced GFP (eGFP) was optimized from wild-type GFP for increased fluorescence yield and improved expression in mammalian systems [3]. Many GFP-like fluorescent proteins have been discovered, optimized or created, such as the red fluorescent protein TagRFP [4]. Fluorescent proteins are expressed colorless and immature and, for eGFP, the conversion to the fluorescent form, mature, is known to produce one equivalent of hydrogen peroxide (H 2 O 2 ) per molecule of chromophore [5,6]. Even though it has been proposed that this process is non-catalytic and generates nontoxic levels of H 2 O 2 [6], this study investigates the role of fluorescent proteins in generating free radicals and inducing oxidative stress in biological systems. Immature eGFP and TagRFP catalytically generate the free radical superoxide anion (O 2 •- ) and H 2 O 2 in the presence of NADH. Generation of the free radical O 2 •- and H 2 O 2 by eGFP in the presence of NADH affects the gene expression of cells. Many biological pathways are altered, such as a decrease in HIF1α stabilization and activity. The biological pathways altered by eGFP are known to be implicated in the pathophysiology of many diseases associated with oxidative stress; therefore, it is critical that such experiments using fluorescent proteins are validated with alternative methodologies and the results are carefully interpreted. Since cells inevitably experience oxidative stress when fluorescent proteins are expressed, the use of this tool for cell labeling and in vivo cell tracing also requires validation using alternative methodologies. Published by Elsevier B.V.

Co-self-assembly of cationic microparticles to deliver pEGFP-ZNF580 for promoting the transfection and migration of endothelial cells

PubMed Central

Feng, Yakai; Guo, Mengyang; Liu, Wen; Hao, Xuefang; Lu, Wei; Ren, Xiangkui; Shi, Changcan; Zhang, Wencheng

2017-01-01

The gene transfection efficiency of polyethylenimine (PEI) varies with its molecular weight. Usually, high molecular weight of PEI means high gene transfection, as well as high cytotoxicity in gene delivery in vivo. In order to enhance the transfection efficiency and reduce the cytotoxicity of PEI-based gene carriers, a novel cationic gene carrier was developed by co-self-assembly of cationic copolymers. First, a star-shaped copolymer poly(3(S)-methyl-morpholine-2,5-dione-co-lactide) (P(MMD-co-LA)) was synthesized using D-sorbitol as an initiator, and the cationic copolymer (P(MMD-co-LA)-g-PEI) was obtained after grafting low-molecular weight PEI. Then, by co-self-assembly of this cationic copolymer and a diblock copolymer methoxy-poly(ethylene glycol) (mPEG)-b-P(MMD-co-LA), microparticles (MPs) were formed. The core of MPs consisted of a biodegradable block of P(MMD-co-LA), and the shell was formed by mPEG and PEI blocks. Finally, after condensation of pEGFP-ZNF580 by these MPs, the plasmids were protected from enzymatic hydrolysis effectively. The result indicated that pEGFP-ZNF580-loaded MP complexes were suitable for cellular uptake and gene transfection. When the mass ratio of mPEG-b-P(MMD-co-LA) to P(MMD-co-LA)-g-PEI reached 3/1, the cytotoxicity of the complexes was very low at low concentration (20 μg mL−1). Additionally, pEGFP-ZNF580 could be transported into endothelial cells (ECs) effectively via the complexes of MPs/pEGFP-ZNF580. Wound-healing assay showed that the transfected ECs recovered in 24 h. Cationic MPs designed in the present study could be used as an applicable gene carrier for the endothelialization of artificial blood vessels. PMID:28053529

Construction of green fluorescent protein-tagged recombinant iridovirus to assess viral replication.

PubMed

Huang, Youhua; Huang, Xiaohong; Cai, Jia; Ye, Fuzhou; Guan, Liya; Liu, Hong; Qin, Qiwei

2011-09-01

Green fluorescent protein-tagged recombinant virus has been successfully applied to observing the infective dynamics and evaluating viral replication. Here, we identified soft-shelled turtle iridovirus (STIV) ORF55 as an envelope protein (VP55), and developed a recombinant STIV expressing an enhanced green fluorescent protein (EGFP) fused to VP55 (EGFP-STIV). Recombinant EGFP-STIV shared similar single-step growth curves and ultrastructural morphology with wild type STIV (wt-STIV). The green fluorescence distribution during EGFP-STIV infection was consistent with the intracellular distribution of VP55 which was mostly co-localized with virus assembly sites. Furthermore, EGFP-STIV could be used to evaluate viral replication conveniently under drug treatment, and the result showed that STIV replication was significantly inhibited after the addition of antioxidant pyrrolidine dithiocarbamate (PDTC). Thus, the EGFP-tagged recombinant iridovirus will not only be useful for further investigations on the viral replicative dynamics, but also provide an alternative simple strategy to screen for antiviral substances. Copyright © 2011 Elsevier B.V. All rights reserved.

Lifeact-mEGFP Reveals a Dynamic Apical F-Actin Network in Tip Growing Plant Cells

PubMed Central

Hepler, Peter K.; Bezanilla, Magdalena

2009-01-01

Background Actin is essential for tip growth in plants. However, imaging actin in live plant cells has heretofore presented challenges. In previous studies, fluorescent probes derived from actin-binding proteins often alter growth, cause actin bundling and fail to resolve actin microfilaments. Methodology/Principal Findings In this report we use Lifeact-mEGFP, an actin probe that does not affect the dynamics of actin, to visualize actin in the moss Physcomitrella patens and pollen tubes from Lilium formosanum and Nicotiana tobaccum. Lifeact-mEGFP robustly labels actin microfilaments, particularly in the apex, in both moss protonemata and pollen tubes. Lifeact-mEGFP also labels filamentous actin structures in other moss cell types, including cells of the gametophore. Conclusions/Significance Lifeact-mEGFP, when expressed at optimal levels does not alter moss protonemal or pollen tube growth. We suggest that Lifeact-mEGFP represents an exciting new versatile probe for further studies of actin's role in tip growing plant cells. PMID:19478943

Live-cell imaging to compare the transfection and gene silencing efficiency of calcium phosphate nanoparticles and a liposomal transfection agent.

PubMed

Chernousova, S; Epple, M

2017-05-01

The processing of DNA (for transfection) and short interfering RNA (siRNA; for gene silencing), introduced into HeLa cells by triple-shell calcium phosphate nanoparticles, was followed by live-cell imaging. For comparison, the commercial liposomal transfection agent Lipofectamine was used. The cells were incubated with these delivery systems, carrying either enhanced green fluorescent protein (eGFP)-encoding DNA or siRNA against eGFP. In the latter case, HeLa cells that stably expressed eGFP were used. The expression of eGFP started after 5 h in the case of nanoparticles and after 4 h in the case of Lipofectamine. The corresponding times for gene silencing were 5 h (nanoparticles) and immediately after incubation (Lipofectamine). The expression of eGFP was notably enhanced 2-3 h after cell division (mitosis). In general, the transfection and gene silencing efficiencies of the nanoparticles were lower than those of Lipofectamime, even at a substantially higher dose (factor 20) of nucleic acids. However, the cytotoxicity of the nanoparticles was lower than that of Lipofectamine, making them suitable vectors for in vivo application.

Live-cell imaging to compare the transfection and gene silencing efficiency of calcium phosphate nanoparticles and a liposomal transfection agent

PubMed Central

Chernousova, S; Epple, M

2017-01-01

The processing of DNA (for transfection) and short interfering RNA (siRNA; for gene silencing), introduced into HeLa cells by triple-shell calcium phosphate nanoparticles, was followed by live-cell imaging. For comparison, the commercial liposomal transfection agent Lipofectamine was used. The cells were incubated with these delivery systems, carrying either enhanced green fluorescent protein (eGFP)-encoding DNA or siRNA against eGFP. In the latter case, HeLa cells that stably expressed eGFP were used. The expression of eGFP started after 5 h in the case of nanoparticles and after 4 h in the case of Lipofectamine. The corresponding times for gene silencing were 5 h (nanoparticles) and immediately after incubation (Lipofectamine). The expression of eGFP was notably enhanced 2–3 h after cell division (mitosis). In general, the transfection and gene silencing efficiencies of the nanoparticles were lower than those of Lipofectamime, even at a substantially higher dose (factor 20) of nucleic acids. However, the cytotoxicity of the nanoparticles was lower than that of Lipofectamine, making them suitable vectors for in vivo application. PMID:28218744

Social dominance in tilapia is associated with gonadotroph hyperplasia.

PubMed

Golan, Matan; Levavi-Sivan, Berta

2013-10-01

Tilapias are emerging as one of the most important fish in worldwide aquaculture and are also widely used as model fish in the study of reproduction and behavior. During the reproductive season, male tilapia are highly territorial and form spawning pits in which the dominant males court and spawn with available females. Non-territorial males stand a much lower chance of reproducing. Using transgenic tilapia in which follicle stimulating hormone (FSH) gonadotrophs were fluorescently labeled with enhanced green fluorescent protein (EGFP), we studied the effect of social dominance on the hormonal profile and pituitary cell populations in dominant and non-dominant males. Immunofluorescence studies showed that FSH-EGFP-transgenic fish reliably express EGFP in FSH-secreting cells. EGFP expression pattern differed from that of luteinizing hormone. Dominant males had larger gonads as well as higher levels of androgens and gonadotropins in the plasma. Pituitaries of dominant males exhibited higher gonadotropin content and gene expression. Flow cytometry revealed pituitary hyperplasia as well as FSH cell hyperplasia and increased granulation. Taken together, these findings suggest that gonadotroph hyperplasia as well as increased production by individual cells underlie the increased reproductive activity of dominant tilapia males. Copyright © 2013 Elsevier Inc. All rights reserved.

A codon-optimized green fluorescent protein for live cell imaging in Zymoseptoria tritici☆

PubMed Central

Kilaru, S.; Schuster, M.; Studholme, D.; Soanes, D.; Lin, C.; Talbot, N.J.; Steinberg, G.

2015-01-01

Fluorescent proteins (FPs) are powerful tools to investigate intracellular dynamics and protein localization. Cytoplasmic expression of FPs in fungal pathogens allows greater insight into invasion strategies and the host-pathogen interaction. Detection of their fluorescent signal depends on the right combination of microscopic setup and signal brightness. Slow rates of photo-bleaching are pivotal for in vivo observation of FPs over longer periods of time. Here, we test green-fluorescent proteins, including Aequorea coerulescens GFP (AcGFP), enhanced GFP (eGFP) from Aequorea victoria and a novel Zymoseptoria tritici codon-optimized eGFP (ZtGFP), for their usage in conventional and laser-enhanced epi-fluorescence, and confocal laser-scanning microscopy. We show that eGFP, expressed cytoplasmically in Z. tritici, is significantly brighter and more photo-stable than AcGFP. The codon-optimized ZtGFP performed even better than eGFP, showing significantly slower bleaching and a 20–30% further increase in signal intensity. Heterologous expression of all GFP variants did not affect pathogenicity of Z. tritici. Our data establish ZtGFP as the GFP of choice to investigate intracellular protein dynamics in Z. tritici, but also infection stages of this wheat pathogen inside host tissue. PMID:26092799

Retinal Astrocytes and GABAergic Wide-Field Amacrine Cells Express PDGFRα: Connection to Retinal Ganglion Cell Neuroprotection by PDGF-AA.

PubMed

Takahama, Shokichi; Adetunji, Modupe O; Zhao, Tantai; Chen, Shan; Li, Wei; Tomarev, Stanislav I

2017-09-01

Our previous experiments demonstrated that intravitreal injection of platelet-derived growth factor-AA (PDGF-AA) provides retinal ganglion cell (RGC) neuroprotection in a rodent model of glaucoma. Here we used PDGFRα-enhanced green fluorescent protein (EGFP) mice to identify retinal cells that may be essential for RGC protection by PDGF-AA. PDGFRα-EGFP mice expressing nuclear-targeted EGFP under the control of the PDGFRα promoter were used. Localization of PDGFRα in the neural retina was investigated by confocal imaging of EGFP fluorescence and immunofluorescent labeling with a panel of antibodies recognizing different retinal cell types. Primary cultures of mouse RGCs were produced by immunopanning. Neurobiotin injection of amacrine cells in a flat-mounted retina was used for the identification of EGFP-positive amacrine cells in the inner nuclear layer. In the mouse neural retina, PDGFRα was preferentially localized in the ganglion cell and inner nuclear layers. Immunostaining of the retina demonstrated that astrocytes in the ganglion cell layer and a subpopulation of amacrine cells in the inner nuclear layer express PDGFRα, whereas RGCs (in vivo or in vitro) did not. PDGFRα-positive amacrine cells are likely to be Type 45 gamma-aminobutyric acidergic (GABAergic) wide-field amacrine cells. These data indicate that the neuroprotective effect of PDGF-AA in a rodent model of glaucoma could be mediated by astrocytes and/or a subpopulation of amacrine cells. We suggest that after intravitreal injection of PDGF-AA, these cells secrete factors protecting RGCs.

Developing a de novo targeted knock-in method based on in utero electroporation into the mammalian brain.

PubMed

Tsunekawa, Yuji; Terhune, Raymond Kunikane; Fujita, Ikumi; Shitamukai, Atsunori; Suetsugu, Taeko; Matsuzaki, Fumio

2016-09-01

Genome-editing technology has revolutionized the field of biology. Here, we report a novel de novo gene-targeting method mediated by in utero electroporation into the developing mammalian brain. Electroporation of donor DNA with the CRISPR/Cas9 system vectors successfully leads to knock-in of the donor sequence, such as EGFP, to the target site via the homology-directed repair mechanism. We developed a targeting vector system optimized to prevent anomalous leaky expression of the donor gene from the plasmid, which otherwise often occurs depending on the donor sequence. The knock-in efficiency of the electroporated progenitors reached up to 40% in the early stage and 20% in the late stage of the developing mouse brain. Furthermore, we inserted different fluorescent markers into the target gene in each homologous chromosome, successfully distinguishing homozygous knock-in cells by color. We also applied this de novo gene targeting to the ferret model for the study of complex mammalian brains. Our results demonstrate that this technique is widely applicable for monitoring gene expression, visualizing protein localization, lineage analysis and gene knockout, all at the single-cell level, in developmental tissues. © 2016. Published by The Company of Biologists Ltd.

Spatial and Temporal Control of Cavitation Allows High In Vitro Transfection Efficiency in the Absence of Transfection Reagents or Contrast Agents.

PubMed

Chettab, Kamel; Roux, Stéphanie; Mathé, Doriane; Cros-Perrial, Emeline; Lafond, Maxime; Lafon, Cyril; Dumontet, Charles; Mestas, Jean-Louis

2015-01-01

Sonoporation using low-frequency high-pressure ultrasound (US) is a non-viral approach for in vitro and in vivo gene delivery. In this study, we developed a new sonoporation device designed for spatial and temporal control of ultrasound cavitation. The regulation system incorporated in the device allowed a real-time control of the cavitation level during sonoporation. This device was evaluated for the in vitro transfection efficiency of a plasmid coding for Green Fluorescent Protein (pEGFP-C1) in adherent and non-adherent cell lines. The transfection efficiency of the device was compared to those observed with lipofection and nucleofection methods. In both adherent and non-adherent cell lines, the sonoporation device allowed high rate of transfection of pEGFP-C1 (40-80%), as determined by flow cytometry analysis of GFP expression, along with a low rate of mortality assessed by propidium iodide staining. The transfection efficiency and toxicity of sonoporation on the non-adherent cell lines Jurkat and K562 were similar to those of nucleofection, while these two cell lines were resistant to transfection by lipofection. Moreover, sonoporation was used to produce three stably transfected human lymphoma and leukemia lines. Significant transfection efficiency was also observed in two fresh samples of human acute myeloid leukemia cells. In conclusion, we developed a user-friendly and cost-effective ultrasound device, well adapted for routine in vitro high-yield transfection experiments and which does not require the use of any transfection reagent or gas micro-bubbles.

Expression of a model gene in prostate cancer cells lentivirally transduced in vitro and in vivo.

PubMed

Bastide, C; Maroc, N; Bladou, F; Hassoun, J; Maitland, N; Mannoni, P; Bagnis, C

2003-01-01

In a preclinical model for prostate cancer gene therapy, we have tested lentiviral vectors as a practical possibility for the transfer and long-term expression of the EGFP gene both in vitro and in vivo. The human prostate cancer cell lines DU145 and PC3 were transduced using experimental conditions which permitted analysis of the expression from a single proviral vector per cell. The transduced cells stably expressed the EGFP transgene for 4 months. After injection of the transduced cell populations into Nod-SCID mice a decrease in EGFP was only observed in a minority of cases, while the majority of tumors maintained transgene expression at in vitro levels. In vivo injection of viral vector preparations directly into pre-established subcutaneous or orthotopic tumor masses, obtained by implantation of untransduced PC3 and DU145 cells led to a high transduction efficiency. While the efficiency of direct intratumoral transduction was proportional to the dose of virus injected, the results indicated some technical limitations inherent in these approaches to prostate cancer gene therapy.

Mitomycin C retardation of corneal fibroblast migration via sustained dephosphorylation of paxillin at tyrosine 118.

PubMed

Chen, Tsan-Chi; Lai, Chien-Hsueh; Chang, Jie-Ling; Chang, Shu-Wen

2012-03-21

To investigate how mitomycin C (MMC) modulates corneal fibroblast migration and its molecular mechanisms in the wound healing process. After treatment with 0 and 0.2 mg · mL(-1) MMC for 5 minutes, effect of MMC on cell migration of human corneal fibroblasts (HCFs) was examined with a cell migration assay. Both focal adhesion kinase (FAK) and paxillin (PXN) expressions in HCFs were analyzed by semiquantitative real-time PCR, immunoblotting, and immunofluorescence confocal microscopy. Using gene silencing or gene overexpression with lentiviral-based pseudovirion infection, the phosphorylation level of FAK, PXN, and mutated PXNs at tyrosine sites 31 (Y31F-EGFP) and 118 (Y118F-EGFP) were verified in HCFs. MMC retarded HCF migration at 1 and 2 days posttreatment (dpt). MMC reduced levels of FAK transcript and FAK protein, but increased both transcript and protein expression of PXN at 1 and 2 dpt. Furthermore, MMC upregulated FAK-pY397, which subsequently enhanced PXN-pY31 in a dose-dependent manner at 1 dpt. Concurrently, MMC downregulated PXN-pY118 at 1 dpt. However, MMC treatment resulted in dephosphorylation of FAK-pY397, PXN-pY31, and PXN-pY118 at 2 dpt. The FAK/PXN complex in MMC-treated HCFs was detected at focal adhesion sites more than at the leading edge at 1 and 2 dpt, contributing to retardation of HCF migration. Y118F-EGFP-expressing HCFs exhibited lower mobility than that of PXN-EGFP- or Y31F-EGFP-expressing HCFs. The sustained PXN-pY118 dephosphorylation resulted in steadfastness of an incompletely active FAK/PXN complex at focal adhesion sites and played a pivotal role in MMC-retarded HCF migration.

Surface display of monkey metallothionein α tandem repeats and EGFP fusion protein on Pseudomonas putida X4 for biosorption and detection of cadmium.

PubMed

He, Xiaochuan; Chen, Wenli; Huang, Qiaoyun

2012-09-01

Monkey metallothionein α domain tandem repeats (4mMTα), which exhibit high cadmium affinity, have been displayed for the first time on the surface of a bacterium using ice nucleation protein N-domain (inaXN) protein from the Xanthomonas campestris pv (ACCC-10049) as an anchoring motif. The shuttle vector pIME, which codes for INAXN-4mMTα-EGFP fusion, was constructed and used to target 4mMTα and EGFP on the surface of Pseudomonas putida X4 (CCTCC-209319). The surface location of the INAXN-4mMTα-EGFP fusion was further verified by western blot analysis and immunofluorescence microscopy. The growth of X4 showed resistance to cadmium presence. The presence of surface-exposed 4mMTα on the engineered strains was four times higher than that of the wild-type X4. The Cd²⁺ accumulation by X4/pIME was not only four times greater than that of the original host bacterial cells but was also remarkably unaffected by the presence of Cu²⁺ and Zn²⁺. Moreover, the surface-engineered strains could effectively bind Cd²⁺ under a wide range of pH levels, from 4 to 7. P. putida X4/pIME with surface-expressed 4mMTα-EGFP had twice the cadmium binding capacity as well as 1.4 times the fluorescence as the cytoplasmic 4mMTa-EGFP. These results suggest that P. putida X4 expressing 4mMTα-EGFP with the INAXN anchor motif on the surface would be a useful tool for the remediation and biodetection of environmental cadmium contaminants.

In vivo visualization and attenuation of oxidized lipid accumulation in hypercholesterolemic zebrafish

PubMed Central

Fang, Longhou; Green, Simone R.; Baek, Ji Sun; Lee, Sang-Hak; Ellett, Felix; Deer, Elena; Lieschke, Graham J.; Witztum, Joseph L.; Tsimikas, Sotirios; Miller, Yury I.

2011-01-01

Oxidative modification of LDL is an early pathological event in the development of atherosclerosis. Oxidation events such as malondialdehyde (MDA) formation may produce specific, immunogenic epitopes. Indeed, antibodies to MDA-derived epitopes are widely used in atherosclerosis research and have been demonstrated to enable cardiovascular imaging. In this study, we engineered a transgenic zebrafish with temperature-inducible expression of an EGFP-labeled single-chain human monoclonal antibody, IK17, which binds to MDA-LDL, and used optically transparent zebrafish larvae for imaging studies. Feeding a high-cholesterol diet (HCD) supplemented with a red fluorescent lipid marker to the transgenic zebrafish resulted in vascular lipid accumulation, quantified in live animals using confocal microscopy. After heat shock–induced expression of IK17-EGFP, we measured the time course of vascular accumulation of IK17-specific MDA epitopes. Treatment with either an antioxidant or a regression diet resulted in reduced IK17 binding to vascular lesions. Interestingly, homogenates of IK17-EGFP–expressing larvae bound to MDA-LDL and inhibited MDA-LDL binding to macrophages. Moreover, sustained expression of IK17-EGFP effectively prevented HCD-induced lipid accumulation in the vascular wall, suggesting that the antibody itself may have therapeutic effects. Thus, we conclude that HCD-fed zebrafish larvae with conditional expression of EGFP-labeled oxidation-specific antibodies afford an efficient method of testing dietary and/or other therapeutic antioxidant strategies that may ultimately be applied to humans. PMID:22105168

Functional visualization and disruption of targeted genes using CRISPR/Cas9-mediated eGFP reporter integration in zebrafish.

PubMed

Ota, Satoshi; Taimatsu, Kiyohito; Yanagi, Kanoko; Namiki, Tomohiro; Ohga, Rie; Higashijima, Shin-Ichi; Kawahara, Atsuo

2016-10-11

The CRISPR/Cas9 complex, which is composed of a guide RNA (gRNA) and the Cas9 nuclease, is useful for carrying out genome modifications in various organisms. Recently, the CRISPR/Cas9-mediated locus-specific integration of a reporter, which contains the Mbait sequence targeted using Mbait-gRNA, the hsp70 promoter and the eGFP gene, has allowed the visualization of the target gene expression. However, it has not been ascertained whether the reporter integrations at both targeted alleles cause loss-of-function phenotypes in zebrafish. In this study, we have inserted the Mbait-hs-eGFP reporter into the pax2a gene because the disruption of pax2a causes the loss of the midbrain-hindbrain boundary (MHB) in zebrafish. In the heterozygous Tg[pax2a-hs:eGFP] embryos, MHB formed normally and the eGFP expression recapitulated the endogenous pax2a expression, including the MHB. We observed the loss of the MHB in homozygous Tg[pax2a-hs:eGFP] embryos. Furthermore, we succeeded in integrating the Mbait-hs-eGFP reporter into an uncharacterized gene epdr1. The eGFP expression in heterozygous Tg[epdr1-hs:eGFP] embryos overlapped the epdr1 expression, whereas the distribution of eGFP-positive cells was disorganized in the MHB of homozygous Tg[epdr1-hs:eGFP] embryos. We propose that the locus-specific integration of the Mbait-hs-eGFP reporter is a powerful method to investigate both gene expression profiles and loss-of-function phenotypes.

Functional visualization and disruption of targeted genes using CRISPR/Cas9-mediated eGFP reporter integration in zebrafish

PubMed Central

Ota, Satoshi; Taimatsu, Kiyohito; Yanagi, Kanoko; Namiki, Tomohiro; Ohga, Rie; Higashijima, Shin-ichi; Kawahara, Atsuo

2016-01-01

The CRISPR/Cas9 complex, which is composed of a guide RNA (gRNA) and the Cas9 nuclease, is useful for carrying out genome modifications in various organisms. Recently, the CRISPR/Cas9-mediated locus-specific integration of a reporter, which contains the Mbait sequence targeted using Mbait-gRNA, the hsp70 promoter and the eGFP gene, has allowed the visualization of the target gene expression. However, it has not been ascertained whether the reporter integrations at both targeted alleles cause loss-of-function phenotypes in zebrafish. In this study, we have inserted the Mbait-hs-eGFP reporter into the pax2a gene because the disruption of pax2a causes the loss of the midbrain-hindbrain boundary (MHB) in zebrafish. In the heterozygous Tg[pax2a-hs:eGFP] embryos, MHB formed normally and the eGFP expression recapitulated the endogenous pax2a expression, including the MHB. We observed the loss of the MHB in homozygous Tg[pax2a-hs:eGFP] embryos. Furthermore, we succeeded in integrating the Mbait-hs-eGFP reporter into an uncharacterized gene epdr1. The eGFP expression in heterozygous Tg[epdr1-hs:eGFP] embryos overlapped the epdr1 expression, whereas the distribution of eGFP-positive cells was disorganized in the MHB of homozygous Tg[epdr1-hs:eGFP] embryos. We propose that the locus-specific integration of the Mbait-hs-eGFP reporter is a powerful method to investigate both gene expression profiles and loss-of-function phenotypes. PMID:27725766

Transfection using hydroxyapatite nanoparticles in the inner ear via an intact round window membrane in chinchilla

NASA Astrophysics Data System (ADS)

Wu, Xuewen; Ding, Dalian; Jiang, Haiyan; Xing, Xiaowei; Huang, Suping; Liu, Hong; Chen, Zhedong; Sun, Hong

2012-01-01

Hydroxyapatite nanoparticles (nHAT) are known to have excellent biocompatibility, and have attracted increasing attention as new candidates of non-viral vectors for gene therapy. In our previous studies, nHAT carrying a therapeutic gene and a reporter gene were successfully transfected into the spiral ganglion neurons in the inner ear of guinea pigs in vivo as well as in the cultured cell lines, although the transfection efficiencies were never higher than 30%. In this study, the surface modification of nHAT with polyethylenimine (PEI) was made (PEI-nHAT, diameter = 73.09 ± 27.32 nm) and a recombinant plasmid carrying enhanced green fluorescent protein (EGFP) gene and neurotrophin-3 (NT-3) gene was constructed as pEGFPC2-NT3. The PEI modified nHAT and the recombinant plasmid was then connected to form the nHAT-based vector-gene complex (PEI-nHAT-pEGFPC2-NT3). This complex was then placed onto the intact round window membranes of the chinchillas for inner ear transfection. Auditory brainstem response (ABR) was tested to evaluate auditory function. Green fluorescence of EGFP was observed using confocal microscopy 48 h after administering vector-gene complexes. There was no significant threshold shift in tone burst-evoked ABR at any tested frequency. Abundant, condensed green fluorescence was found in dark cells on both sides of the crista and around the macula of the utricle. Scattered EGFP signals were also detected in vestibular hair cells, some Schwann cells in the cochlear spiral ganglion region, some outer pillar cells in the organ of Corti, and a few cells in the stria vascularis. The density of green fluorescence-marked cells was obviously higher in the vestibular dark cell area than in other areas of the inner ear, suggesting that vestibular dark cells may have the ability to actively engulf the nHAT-based vector-gene complexes. Considering the high transfection efficiency in the vestibular system, PEI-nHAT may be a potential vector for gene therapy of inner ear diseases, especially vestibular disorders, and deserves further study.

Gastrin-releasing peptide-induced down-regulation of tumor suppressor protein PTEN (phosphatase and tensin homolog deleted on chromosome ten) in neuroblastomas.

PubMed

Qiao, Jingbo; Kang, Junghee; Cree, Jeremy; Evers, B Mark; Chung, Dai H

2005-05-01

To evaluate whether aggressive, undifferentiated neuroblastomas express tumor suppressor protein PTEN (phosphatase and tensin homolog deleted on chromosome ten) and to examine the effects of gastrin-releasing peptide (GRP) on PTEN gene and protein expression. We have previously shown that neuroblastomas secrete GRP, which binds to its cell surface receptor (GRP-R) to stimulate cell growth in an autocrine fashion. However, the effects of GRP on expression of the tumor suppressor gene PTEN have not been elucidated in neuroblastomas. Paraffin-embedded sections from human neuroblastomas were analyzed for PTEN and phospho-Akt protein expression by immunohistochemistry. Human neuroblastoma cell lines (SK-N-SH and SH-SY5Y) were stably transfected with the plasmid pEGFP-GRP-R to establish GRP-R overexpression cell lines, and the effects of GRP on PTEN gene and protein expression were determined. A decrease in the ratio of PTEN to phospho-Akt protein expression was identified in poorly differentiated neuroblastomas. An increase in GRP binding capacity was confirmed in GRP-R overexpressing cells, which demonstrated an accelerated constitutive cell growth rate. PTEN gene and protein expression was significantly decreased in GRP-R overexpressing cells when compared with controls. Our findings demonstrate decreased expression of the tumor suppressor protein PTEN in more aggressive undifferentiated neuroblastomas. An increase in GRP binding capacity, as a result of GRP-R overexpression, down-regulates PTEN expression. These findings suggest that an inhibition of the tumor suppressor gene PTEN may be an important regulatory mechanism involved in GRP-induced cell proliferation in neuroblastomas.

Development of a transient expression assay for detecting environmental oestrogens in zebrafish and medaka embryos

PubMed Central

2012-01-01

Background Oestrogenic contaminants are widespread in the aquatic environment and have been shown to induce adverse effects in both wildlife (most notably in fish) and humans, raising international concern. Available detecting and testing systems are limited in their capacity to elucidate oestrogen signalling pathways and physiological impacts. Here we developed a transient expression assay to investigate the effects of oestrogenic chemicals in fish early life stages and to identify target organs for oestrogenic effects. To enhance the response sensitivity to oestrogen, we adopted the use of multiple tandem oestrogen responsive elements (EREc38) in a Tol2 transposon mediated Gal4ff-UAS system. The plasmid constructed (pTol2_ERE-TATA-Gal4ff), contains three copies of oestrogen response elements (3ERE) that on exposure to oestrogen induces expression of Gal4ff which this in turn binds Gal4-responsive Upstream Activated Sequence (UAS) elements, driving the expression of a second reporter gene, EGFP (Enhanced Green Fluorescent Protein). Results The response of our construct to oestrogen exposure in zebrafish embryos was examined using a transient expression assay. The two plasmids were injected into 1–2 cell staged zebrafish embryos, and the embryos were exposed to various oestrogens including the natural steroid oestrogen 17ß-oestradiol (E2), the synthetic oestrogen 17α- ethinyloestradiol (EE2), and the relatively weak environmental oestrogen nonylphenol (NP), and GFP expression was examined in the subsequent embryos using fluorescent microscopy. There was no GFP expression detected in unexposed embryos, but specific and mosaic expression of GFP was detected in the liver, heart, somite muscle and some other tissue cells for exposures to steroid oestrogen treatments (EE2; 10 ng/L, E2; 100 ng/L, after 72 h exposures). For the NP exposures, GFP expression was observed at 10 μg NP/L after 72 h (100 μg NP/L was toxic to the fish). We also demonstrate that our construct works in medaka, another model fish test species, suggesting the transient assay is applicable for testing oestrogenic chemicals in fish generally. Conclusion Our results indicate that the transient expression assay system can be used as a rapid integrated testing system for environmental oestrogens and to detect the oestrogenic target sites in developing fish embryos. PMID:22726887

Plasmid expression and maintenance during long-term starvation-survival of bacteria in well water.

PubMed Central

Caldwell, B A; Ye, C; Griffiths, R P; Moyer, C L; Morita, R Y

1989-01-01

Strains of enteric bacteria and pseudomonads containing plasmid R388::Tnl721 (Tpr, Tcr) or pRO101 (Hgr, Tcr) were starved for over 250 days in sterile well water to evaluate effects of starvation-survival on plasmid expression and maintenance. Viable populations dropped to between approximately 0.1 and 1% of the initial populations. Escherichia coli(pRO101) and Pseudomonas cepacia(pRO101) lost both viability and plasmid expression at a lower rate than strains containing R388::Tnl721. Three patterns of host-plasmid interaction were detected: (i) no apparent loss of plasmid expression, (ii) loss of plasmid expression on initial recovery with subsequent expression upon resuscitation, and (iii) loss of capability to produce functional plasmid resistance. PMID:2782868

Primary sensory neuron-specific interference of TRPV1 signaling by adeno-associated virus-encoded TRPV1 peptide aptamer attenuates neuropathic pain

PubMed Central

Xiang, Hongfei; Liu, Zhen; Wang, Fei; Xu, Hao; Roberts, Christopher; Fischer, Gregory; Stucky, Cheryl L; Dean, Caron; Pan, Bin; Hogan, Quinn H; Yu, Hongwei

2017-01-01

Background TRPV1 (transient receptor potential vanilloid subfamily member 1) is a pain signaling channel highly expressed in primary sensory neurons. Attempts for analgesia by systemic TRPV1 blockade produce undesirable side effects, such as hyperthermia and impaired heat pain sensation. One approach for TRPV1 analgesia is to target TRPV1 along the peripheral sensory pathway. Results For functional blockade of TRPV1 signaling, we constructed an adeno-associated virus (AAV) vector expressing a recombinant TRPV1 interfering peptide aptamer, derived from a 38mer tetrameric assembly domain (TAD), encompassing residues 735 to 772 of rat TRPV1, fused to the C-terminus of enhanced green fluorescent protein (EGFP). AAV-targeted sensory neurons expressing EGFP-TAD after vector injection into the dorsal root ganglia (DRG) revealed decreased inward calcium current and diminished intracellular calcium accumulation in response to capsaicin, compared to neurons of naïve or expressing EGFP alone. To examine the potential for treating neuropathic pain, AAV-EGFP-TAD was injected into fourth and fifth lumbar (L) DRGs of rats subjected to neuropathic pain by tibial nerve injury (TNI). Results showed that AAV-directed selective expression of EGFP-TAD in L4/L5 DRG neuron somata, and their peripheral and central axonal projections can limit TNI-induced neuropathic pain behavior, including hypersensitivity to heat and, to a less extent, mechanical stimulation. Conclusion Selective inhibition of TRPV1 activity in primary sensory neurons by DRG delivery of AAV-encoded analgesic interfering peptide aptamers is efficacious in attenuation of neuropathic pain. With further improvements of vector constructs and in vivo application, this approach might have the potential to develop as an alternative gene therapy strategy to treat chronic pain, especially heat hypersensitivity, without complications due to systemic TRPV1 blockade. PMID:28604222

Smooth muscle cells in atherosclerosis originate from the local vessel wall and not circulating progenitor cells in ApoE knockout mice.

PubMed

Bentzon, Jacob F; Weile, Charlotte; Sondergaard, Claus S; Hindkjaer, Johnny; Kassem, Moustapha; Falk, Erling

2006-12-01

Recent studies of bone marrow (BM)-transplanted apoE knockout (apoE-/-) mice have concluded that a substantial fraction of smooth muscle cells (SMCs) in atherosclerosis arise from circulating progenitor cells of hematopoietic origin. This pathway, however, remains controversial. In the present study, we reexamined the origin of plaque SMCs in apoE-/- mice by a series of BM transplantations and in a novel model of atherosclerosis induced in surgically transferred arterial segments. We analyzed plaques in lethally irradiated apoE-/- mice reconstituted with sex-mismatched BM cells from eGFP+ apoE-/- mice, which ubiquitously express enhanced green fluorescent protein (eGFP), but did not find a single SMC of donor BM origin among approximately 10,000 SMC profiles analyzed. We then transplanted arterial segments between eGFP+ apoE-/- and apoE-/- mice (isotransplantation except for the eGFP transgene) and induced atherosclerosis focally within the graft by a recently invented collar technique. No eGFP+ SMCs were found in plaques that developed in apoE-/- artery segments grafted into eGFP+ apoE-/- mice. Concordantly, 96% of SMCs were eGFP+ in plaques induced in eGFP+ apoE-/- artery segments grafted into apoE-/- mice. These experiments show that SMCs in atherosclerotic plaques are exclusively derived from the local vessel wall in apoE-/- mice.

Early-Life Social Isolation Impairs the Gonadotropin-Inhibitory Hormone Neuronal Activity and Serotonergic System in Male Rats.

PubMed

Soga, Tomoko; Teo, Chuin Hau; Cham, Kai Lin; Idris, Marshita Mohd; Parhar, Ishwar S

2015-01-01

Social isolation in early life deregulates the serotonergic system of the brain, compromising reproductive function. Gonadotropin-inhibitory hormone (GnIH) neurons in the dorsomedial hypothalamic nucleus are critical to the inhibitory regulation of gonadotropin-releasing hormone neuronal activity in the brain and release of luteinizing hormone by the pituitary gland. Although GnIH responds to stress, the role of GnIH in social isolation-induced deregulation of the serotonin system and reproductive function remains unclear. We investigated the effect of social isolation in early life on the serotonergic-GnIH neuronal system using enhanced green fluorescent protein (EGFP)-tagged GnIH transgenic rats. Socially isolated rats were observed for anxious and depressive behaviors. Using immunohistochemistry, we examined c-Fos protein expression in EGFP-GnIH neurons in 9-week-old adult male rats after 6 weeks post-weaning isolation or group housing. We also inspected serotonergic fiber juxtapositions in EGFP-GnIH neurons in control and socially isolated male rats. Socially isolated rats exhibited anxious and depressive behaviors. The total number of EGFP-GnIH neurons was the same in control and socially isolated rats, but c-Fos expression in GnIH neurons was significantly reduced in socially isolated rats. Serotonin fiber juxtapositions on EGFP-GnIH neurons were also lower in socially isolated rats. In addition, levels of tryptophan hydroxylase mRNA expression in the dorsal raphe nucleus were significantly attenuated in these rats. These results suggest that social isolation in early-life results in lower serotonin levels, which reduce GnIH neuronal activity and may lead to reproductive failure.

Functional characterization of the vitellogenin promoter in the silkworm, Bombyx mori.

PubMed

Xu, J; Wang, Y Q; Li, Z Q; Ling, L; Zeng, B S; You, L; Chen, Y Z; Aslam, A F M; Huang, Y P; Tan, A J

2014-10-01

Genetic transformation and genome editing technologies have been successfully established in the lepidopteran insect model, the domesticated silkworm, Bombyx mori, providing great potential for functional genomics and practical applications. However, the current lack of cis-regulatory elements in B. mori gene manipulation research limits further exploitation in functional gene analysis. In the present study, we characterized a B. mori endogenous promoter, Bmvgp, which is a 798-bp DNA sequence adjacent to the 5'-end of the vitellogenin gene (Bmvg). PiggyBac-based transgenic analysis shows that Bmvgp precisely directs expression of a reporter gene, enhanced green fluorescent protein (EGFP), in a sex-, tissue- and stage-specific manner. In transgenic animals, EGFP expression can be detected in the female fat body from larval-pupal ecdysis to the following pupal and adult stage. Furthermore, in vitro and in vivo experiments revealed that EGFP expression can be activated by 20-hydroxyecdysone, which is consistent with endogenous Bmvg expression. These data indicate that Bmvgp is an effective endogenous cis-regulatory element in B. mori. © 2014 The Royal Entomological Society.

Genomic localization of the Z/EG transgene in the mouse genome.

PubMed

Colombo, Sophie; Kumasaka, Mayuko; Lobe, Corrinne; Larue, Lionel

2010-02-01

The Z/EG transgenic mouse line, produced by Novak et al., displays tissue-specific EGFP expression after Cre-mediated recombination. The autofluorescence of EGFP allows the visualization of cells of interest displaying Cre recombination. The initial construct was designed such that cells without Cre recombination express the beta-galactosidase marker, facilitating counterselection. We used inverse PCR to identify the site of integration of the Z/EG transgene, to improve the efficiency of homozygous Z/EG mouse production. Recombined cells produced large amounts of EGFP protein, resulting in higher levels of fluorescence and therefore greater contrast with nonrecombined cells. We mapped the transgene to the G1 region of chromosome 5. This random insertion was found to have occurred 230-bp upstream from the start codon of the Rasa4 gene. The insertion of the Z/EG transgene in the C57BL/6 genetic background had no effect on Rasa4 expression. Homozygous Z/EG mice therefore had no obvious phenotype. (c) 2009 Wiley-Liss, Inc.

[Construction, identification and expression of three kinds of shuttle plasmids of adenovirus expression vector of hepatitis C virus structure gene].

PubMed

Cao, Yi-zhan; Hao, Chun-qiu; Feng, Zhi-hua; Zhou, Yong-xing; Li, Jin-ge; Jia, Zhan-sheng; Wang, Ping-zhong

2003-02-01

To construct three recombinant shuttle plasmids of adenovirus expression vector which can express hepatitis C virus(HCV) different structure genes(C, C+E1, C+E1+E2) in order to pack adenovirus expression vectors which can express HCV different structure gene effectively. The different HCV structure genes derived from the plasmid pBRTM/HCV1-3011 by using polymerase chain reaction (PCR) were inserted into the backward position of cytomegalovirus(CMV) immediate early promotor element of shuttle plasmid(pAd.CMV-Link.1) of adenovirus expression vector respectively, then the three recombinant plasmids (pAd.HCV-C, pAd.HCV-CE1, pAd.HCV-S) were obtained. The recombinant plasmids were identified by endonuclease, PCR and sequencing. HCV structure genes were expressed transiently with Lipofectamine 2000 coated in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. Insert DNAs of the three recombinant plasmids' were confirmed to be HCV different structure genes by endonuclease, PCR and sequencing. The three recombinant plasmids can express HCV structure gene (C, C+E1, C+E1+E2) transiently in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. The three recombinant shuttle plasmids of adenovirus expression vector can express HCV structure gene(C, C+E1, C+E1+E2) transiently. This should be useful to pack adenovirus expression vector which can express HCV structure genes.

Development of fiber optic spectroscopy for in-vitro and in-planta detection of fluorescent proteins

NASA Astrophysics Data System (ADS)

Liew, Oi Wah; Chen, Jun-Wei; Asundi, Anand K.

2001-10-01

The objective of this project is to apply photonics technology to bio-safety management of genetically modified (GM) plants. The conventional method for screening GM plants is through selection using antibiotic resistance markers. There is public concern with such approaches and these are associated with food safety issues, escape of antibiotic resistance genes to pathogenic microorganisms and interference with antibiotic therapy. Thus, the strategy taken in this project is to replace antibiotic resistance markers with fluorescent protein markers that allow for rapid and non-invasive optical screening of genetically modified plants. In this paper, fibre optic spectroscopy was developed to detect and quantify recombinant green (EGFP) and red (DsRED) fluorescent proteins in vitro and in planta. In vitro detection was first carried out to optimize the sensitivity of the optical system. The bacterial expression vectors carrying the coding regions of EGFP and DsRED were introduced into Escherichia coli host cells and fluorescent proteins were produced following induction with IPTG. Soluble EGFP and DsRED proteins were isolated from lysed bacterial cells and serially diluted for quantitative analysis by fibre optic spectroscopy using different light sources, namely, blue LED (475 nm), tungsten halogen (350 - 1000 nm) and double frequency Nd:YAG green laser (532 nm). Fluorescence near the expected emission wavelengths could be detected up to 320X dilution for EGFP and DsRED with blue LED and 532 nm green laser, respectively, as the excitation source. Tungsten halogen was found to be unsuitable for excitation of both EGFP and DsRED. EGFP was successfully purified by size separation under non-denaturing electrophoretic conditions and quantified. The minimum concentration of EGFP detectable with blue LED excitation was 5 mg/ml. To determine the capability of spectroscopy detection in planta, transgenic potato hairy roots and whole modified plant lines expressing the fluorescent markers were regenerated. T

MicroRNA-141-3p/200a-3p target and may be involved in post-transcriptional repression of RNA decapping enzyme Dcp2 during renal development.

PubMed

Zhang, Ming-Nan; Tang, Qun-Ye; Li, Rui-Min; Song, Man-Gen

2018-06-18

The RNA decapping enzyme Dcp2 is a crucial enzyme involved in the process of RNA turnover, which can post-transcriptionally regulate gene expression. Dcp2 has been found to be highly expressed in embryonic, but not adult, kidneys. Here we showed that Dcp2 mRNA was expressed, but Dcp2 proteins were absent, in mouse kidneys after postnatal day 10 (P10). In kidneys of adult Dcp2-IRES-EGFP knock-in mice, Dcp2 was undetectable but EGFP was expressed, indicating that Dcp2 mRNA was not completely silenced in adult kidneys. Using luciferase reporter assays, we found that miR-141-3p/200a-3p directly targeted the 3' UTR of Dcp2 mRNA. Overexpression of miR-141-3p and miR-200a-3p downregulated endogenous Dcp2 protein expression. Furthermore, miR-141-3p and miR-200a-3p expression was low in embryonic kidneys but increased dramatically after P10 and was negatively correlated with Dcp2 protein expression during renal development. These results suggest miR-141-3p/200a-3p may be involved in post-transcriptional repression of Dcp2 expression during renal development. IRES: internal ribosome entry site; EGFP: enhanced green fluorescent protein; UTR: untranslated region.

Estrogen receptor {alpha} gene promoter 0/B usage in the rat sexually dimorphic nucleus of the preoptic area.

PubMed

Hamada, Tomohiro; Sakuma, Yasuo

2010-04-01

The volume of the sexually dimorphic nucleus of the preoptic area (SDN-POA) is two to four times larger in male rats than in females; however, the mechanism for the establishment of sexual dimorphism and the function of this nucleus is almost unknown. Perinatal estrogen can cause sexual dimorphism via the estrogen receptor alpha (ERalpha). Recently, transgenic rats were generated that express enhanced green fluorescent protein (EGFP) under the control of the ERalpha gene promoter 0/B to tag ERalpha-positive neurons in the brain. In the present study, we examined whether this EGFP expression could be a marker for the SDN-POA in adults. EGFP-labeled cells were distributed in the core of the SDN-POA (0/B-SDN) of male and female transgenic rats, in accordance with the Nissl staining and immunoreactivity for the SDN marker, calbindin. They were also immunoreactive for ERalpha. The core was bigger in volume and contained more 0/B-SDN neurons in males than in females. The EGFP-tagged cells were packed more densely in the female core than that in males. Subcutaneous injection of 100 mug 17beta-estradiol to females on the day of birth, or orchidectomy of male neonates, reversed the sexually dimorphic phenotype of the volume of the 0/B-SDN, despite not affecting the cell number. We suggest that this EGFP expression in the SDN-POA could be a useful marker to clarify the sexual differentiation and function of the SDN-POA. Moreover, the ERalpha gene promoter 0/B plays a key role in the organization of the sexual differentiation of the SDN-POA.

Connexin36 Expression in Primary Afferent Neurons in Relation to the Axon Reflex and Modality Coding of Somatic Sensation.

PubMed

Nagy, J I; Lynn, B D; Senecal, J M M; Stecina, K

2018-05-07

Electrical coupling mediated by connexin36-containing gap junctions that form electrical synapses is known to be prevalent in the central nervous system, but such coupling was long ago reported also to occur between cutaneous sensory fibers. Here, we provide evidence supporting the capability of primary afferent fibers to engage in electrical coupling. In transgenic mice with enhanced green fluorescent protein (eGFP) serving as a reporter for connexin36 expression, immunofluorescence labeling of eGFP was found in subpopulations of neurons in lumbar dorsal root and trigeminal sensory ganglia, and in fibers within peripheral nerves and tissues. Immunolabeling of connexin36 was robust in the sciatic nerve, weaker in sensory ganglia than in peripheral nerve, and absent in these tissues from Cx36 null mice. Connexin36 mRNA was detected in ganglia from wild-type mice, but not in those from Cx36 null mice. Labeling of eGFP was localized within a subpopulation of ganglion cells containing substance P and calcitonin gene-releasing peptide, and in peripheral fibers containing these peptides. Expression of eGFP was also found in various proportions of sensory ganglion neurons containing transient receptor potential (TRP) channels, including TRPV1 and TRPM8. Ganglion cells labeled for isolectin B4 and tyrosine hydroxylase displayed very little co-localization with eGFP. Our results suggest that previously observed electrical coupling between peripheral sensory fibers occurs via electrical synapses formed by Cx36-containing gap junctions, and that some degree of selectivity in the extent of electrical coupling may occur between fibers belonging to subpopulations of sensory neurons identified according to their sensory modality responsiveness. Copyright © 2018 IBRO. Published by Elsevier Ltd. All rights reserved.

Functional expression of Ca²⁺ dependent mammalian transmembrane gap junction protein Cx43 in slime mold Dictyostelium discoideum.

PubMed

Kaufmann, Stefan; Weiss, Ingrid M; Eckstein, Volker; Tanaka, Motomu

2012-03-09

In this paper, we expressed murine gap junction protein Cx43 in Dictyostelium discoideum by introducing the specific vector pDXA. In the first step, the successful expression of Cx43 and Cx43-eGFP was verified by (a) Western blot (anti-Cx43, anti-GFP), (b) fluorescence microscopy (eGFP-Cx43 co-expression, Cx43 immunostaining), and (c) flow cytometry analysis (eGFP-Cx43 co-expression). Although the fluorescence signals from cells expressing Cx43-eGFP detected by fluorescence microscopy seem relatively low, analysis by flow cytometry demonstrated that more than 60% of cells expressed Cx43-eGFP. In order to evaluate the function of expressed Cx43 in D. discoideum, we examined the hemi-channel function of Cx43. In this series of experiments, the passive uptake of carboxyfluorescein was monitored using flow cytometric analysis. A significant number of the transfected cells showed a prominent dye uptake in the absence of Ca(2+). The dye uptake by transfected cells in the presence of Ca(2+) was even lower than the non-specific dye uptake by non-transformed Ax3 orf+ cells, confirming that Cx43 expressed in D. discoideum retains its Ca(2+)-dependent, specific gating function. The expression of gap junction proteins expressed in slime molds opens a possibility to the biological significance of intercellular communications in development and maintenance of multicellular organisms. Copyright © 2012 Elsevier Inc. All rights reserved.

miR-26a regulates mouse hepatocyte proliferation via directly targeting the 3' untranslated region of CCND2 and CCNE2.

PubMed

Zhou, Jian; Ju, Wei-Qiang; Yuan, Xiao-Peng; Zhu, Xiao-Feng; Wang, Dong-Ping; He, Xiao-Shun

2016-02-01

The deficiency of liver regeneration needs to be addressed in the fields of liver surgery, split liver transplantation and living donor liver transplantation. Researches of microRNAs would broaden our understandings on the mechanisms of various diseases. Our previous research confirmed that miR-26a regulated liver regeneration in mice; however, the relationship between miR-26a and its target, directly or indirectly, remains unclear. Therefore, the present study further investigated the mechanism of miR-26a in regulating mouse hepatocyte proliferation. An established mouse liver cell line, Nctc-1469, was transfected with Ad5-miR-26a-EGFP, Ad5-anti-miR-26a-EGFP or Ad5-EGFP vector. Cell proliferation was assessed by MTS, cell apoptosis and cell cycle by flow cytometry, and gene expression by Western blotting and quantitative real-time PCR. Dual-luciferase reporter assays were used to test targets of miR-26a. Compared with the Ad5-EGFP group, Ad5-anti-miR-26a-EGFP down-regulated miR-26a and increased proliferation of hepatocytes, with more cells entering the G1 phase of cell cycle (82.70%+/-1.45% vs 75.80%+/-3.92%), and decreased apoptosis (5.50%+/-0.35% vs 6.73%+/-0.42%). CCND2 and CCNE2 were the direct targeted genes of miR-26a. miR-26a down-regulation up-regulated CCND2 and CCNE2 expressions and down-regulated p53 expression in Nctc-1469 cells. On the contrary, miR-26a over-expression showed the opposite results. miR-26a regulated mouse hepatocyte proliferation by directly targeting the 3' untranslated regions of cyclin D2/cyclin E2; miR-26a also regulated p53-mediated apoptosis. Our data suggested that miR-26a may be a promising regulator in liver regeneration.

Characteristics and EGFP expression of goat mammary gland epithelial cells.

PubMed

Zheng, Y-M; He, X-Y; Zhang, Y

2010-12-01

The aims of this study were (i) to establish a goat mammary gland epithelial (GMGE) cell line, and (ii) to determine if these GMGE cells could be maintained long-term in culture by continuous subculturing following transfection with a reporter gene, enhanced green fluorescence protein (EGFP). Primary culture of GMGE cells was achieved by outgrowth of migrating cells from the fragments of the mammary gland tissue of a lactating goat. The passage 16 GMGE cells were transfected with EGFP gene using lipofection. The expression of Cell keratins of epithelial cells in GMGE cells was test by immunofluorescence. Βeta-Casein gene mRNA was test for GMGE cells by RT-PCR. The results showed that when grown at low density on a plastic substratum, the GMGE cells formed islands, and when grown to confluency, the cells formed a monolayer and aggregated with the characteristic cobble-stone morphology of epithelial cells. GMGE cells could form dome-like structure which looked like nipple, and the lumen-like structures formed among the cells. Several blister-like structures appeared in the appearance of the cells. The GMGE cells contained different cell types, majority of the cells were short shuttle-like or polygon which were beehive-like. A part of cells were round and flat, a small number of cells were elongated. Some of the GMGE cells contained milk drops. The cell nuclei were round which had 2-4 obvious cores. The expression of Cell keratins demonstrated the property of epithelial cells in GMGE cells by immunofluorescence. The GMGE cells could express transcript encoding a Βeta-Casein protein. EGFP gene was successfully transferred into the GMGE cells, and the transfected cells could be maintained long-term in culture by continuous subculturing. In conclusion, we have established a EGFP gene transfected GMGE (ET-GMGE) cell line and maintained it long-term in culture by continuous subculturing. © 2010 Blackwell Verlag GmbH.

UMG Lenti: novel lentiviral vectors for efficient transgene- and reporter gene expression in human early hematopoietic progenitors.

PubMed

Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B; Grillone, Teresa; Giovannone, Emilia D; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A S; Bond, Heather M; Mesuraca, Maria; Morrone, Giovanni

2014-01-01

Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and progenitor cells, as well as in non-hematopoietic cells.

Poly(amidoamine) Dendrimers Modified with 1,2-Epoxyhexane or 1,2-Epoxydodecane for Enhanced Gene Delivery Applications.

PubMed

Xiao, Tongyu; Cao, Xueyan; Hou, Wenxiu; Peng, Chen; Qiu, Jieru; Shi, Xiangyang

2015-12-01

We report a new non-viral gene delivery system based on hydrophobically modified poly(amidoamine) (PAMAM) dendrimers. In this study, the periphery of amine-terminated generation 5 (G5) PAMAM dendrimers was partially reacted with 1,2-epoxyhexane and 1,2-epoxydodecane, respectively. The formed hydrophobically modified G5 dendrimers (denoted as G5.NH2-C6 or G5.NH2-C12) were used to complex two different plasmid DNAs (pDNAs) encoding luciferase (Luc) and enhanced green fluorescent protein (EGFP), respectively for gene transfection studies. The polyplexes formed between vectors and pDNA were characterized by gel retardation assay, dynamic light scattering, and zeta potential measurements. We show that the G5.NH2-C6 and G5.NH2-C12 vectors are able to effectively compact the pDNA, allowing for highly efficient gene transfection into a model cell line (HeLa cells) as demonstrated by both Luc assay and confocal microscopic imaging of the EGFP expression. Under the studied N/P ratios (the molar ratio of primary amines of the dendrimers to phosphates in the pDNA backbone) at 2.5 or 5, the transfection efficiency of the dendrimer-based vectors followed the order of G5.NH2-C12 > G5.NH2-C6 > G5.NH2. This enhanced gene transfection capacity is believed to be associated with the enhanced hydrophobic interaction between the vector/pDNA complexes and the relatively hydrophobic cell membranes. The developed hydrophobically modified dendrimers may be used as a promising non-viral vector for enhanced gene delivery applications.

Development of canine herpesvirus based antifertility vaccines for foxes using bacterial artificial chromosomes.

PubMed

Strive, Tanja; Hardy, Christopher M; French, Nigel; Wright, John D; Nagaraja, Nitin; Reubel, Gerhard H

2006-02-13

Using bacterial artificial chromosome (BAC) technology, a canine herpesvirus (CHV)-based recombinant vaccine vector was produced for the development of an antifertility vaccine for foxes. Infectious viruses were recovered following transfection of canid cells with a BAC plasmid carrying the complete CHV genome. In vitro growth characteristics of BAC-derived viruses were similar to that of wildtype (wt)-CHV. Two recombinant antigens, fox zona pellucida protein subunit 3 (fZPC) and enhanced green fluorescent protein (EGFP) as control antigen, were inserted into thymidine kinase (TK) locus of the CHV genome and shown to be efficiently expressed in vitro. Inoculation of foxes with transgenic CHVs induced CHV specific antibodies, but was innocuous and failed to elicit transgene-specific antibody responses. Infectious virus or viral DNA was not detected in mucosal secretions or tissues of vaccinated foxes. The CHV-BAC system proved to be a quick and reliable method to manipulate the CHV genome. It will help to readily apply changes in the vector design in order to improve virus replication in vivo.

SPONTANEOUS AND MNNG-INDUCED REVERSION OF AN EGFP CONSTRUCT IN HELA CELLS: AN ASSAY FOR OBSERVING MUTATIONS IN LIVING CELLS BY FLUORESCENT MICROSCOPY

EPA Science Inventory

A HeLa cell line stably expressing the Enhanced Green Fluorescence Protein (EGFP) gene, interrupted by the IVS2-654 intron, was studied without treatment and after treatment with a single standard dose of 15 ?M of N-methyl-N'-nitro-N-nitrosoguanidine (MNNG). This assay was done ...

Expression and purification of RHC-EGFP fusion protein and its application in hyaluronic acid assay.

PubMed

Duan, Ningjun; Lv, Wansheng; Zhu, Lingli; Zheng, Weijuan; Hua, Zichun

2017-03-16

Hyaluronan is a widely distributed glycosaminoglycan which has multiple functions. Hyaluronic acid (HA) accumulation has been reported in many human diseases. Understanding the role of hyaluronan and its binding proteins in the pathobiology of disease will facilitate the development of novel therapeutics for many critical diseases. Current techniques described for the analysis of HA are mainly for HA quantification in solutions, not for the direct detection of HA in tissues or on cell surfaces. In our study, a fusion protein, named C-terminal domain of RHAMM-enhanced green fluorescence protein (RHC-EGFP), combined the HA-binding domain, C-terminal of receptor for hyaluronan-mediated motility, with EGFP, a widely used enhanced green fluorescence protein, was expressed and purified from Escherichia coli with high purity. Based on the sensitivity and convenience of fluorescence detection, methods for direct assay of HA in solutions, on cell surface or in tissues were established using RHC-EGFP. The binding specificity was also confirmed by competitive binding experiment and hyaluronidase degradation experiment. Our results provide an alternative choice for the specific and convenient assay of HA in various samples, and maybe helpful for further understanding of the fundamental and comprehensive functions of HA.

Establishment and characterization of a testicular Sertoli cell line from olive flounder Paralichthys olivaceus

NASA Astrophysics Data System (ADS)

Peng, Limin; Zheng, Yuan; You, Feng; Wu, Zhihao; Zou, Yuxia; Zhang, Peijun

2016-09-01

The culture of Sertoli cells has become an indispensable resource in studying spermatogenesis. A new Sertoli cell line (POSC) that consisted predominantly of fibroblast-like cells was derived from the testis of the olive flounder Paralichthys olivaceus and sub-cultured for 48 passages. Analysis of the mtDNA COI gene partial sequence confirmed that the cell line was from P. olivaceus. Cells were optimally maintained at 25°C in DMEM/F12 medium supplemented with fetal bovine serum, basic fibroblast growth factor, and epidermal growth factor. The growth curve of POSC showed a typical "S" shape. Chromosome analysis revealed that the cell line possessed the normal P. olivaceus diploid karyotype of 2n=48t. POSC expressed dmrt1 but not vasa, which was detected using RT-PCR and sequencing. Immunocytochemistry revealed that the cells exhibited the testicular Sertoli cell marker FasL. Therefore, POSC appeared to consist of testicular Sertoli cells. Bright fluorescent signals were observed after the cells were transfected with pEGFP-N3 plasmid, with the transfection efficiency reaching 10%. This research not only offers an ideal model for further gene expression and regulation studies on P. olivaceus, but also serves as valuable material in studying fish spermatogenesis, Sertoli cell-germ cell interactions, and the mechanism of growth and development of testis.

Demonstration of GTG as an alternative initiation codon for the serpin endopin 2B-2.

PubMed

Hwang, Shin-Rong; Garza, Christina Z; Wegrzyn, Jill L; Hook, Vivian Y H

2005-02-18

This study demonstrates GTG as a novel, alternative initiation codon for translation of bovine endopin 2B-2, a serpin protease inhibitor. Molecular cDNA cloning revealed the endopin 2B-1 and endopin 2B-2 isoforms that are predicted to inhibit papain and elastase. Notably, GTG was demonstrated as the initiation codon for endopin 2B-2, whereas endopin 2B-1 possesses ATG as its initiation codon. GTG mediated in vitro translation of 46kDa endopin 2B-2. GTG also mediated translation of EGFP by in vitro translation and by expression in mammalian cells. Notably, mutagenesis of GTG to GTC resulted in the absence of EGFP expression in cells. GTG produced a lower level of protein expression compared to ATG. The use of GTG as an initiation codon to direct translation of endopin 2B, as well as the heterologous protein EGFP, demonstrates the role of GTG in the regulation of mRNA translation in mammalian cells. Significantly, further analyses of mammalian genomes based on GTG as an alternative initiation codon may predict new candidate gene products expressed by mammalian and human genomes.

Tumor targeting of gene expression through metal-coordinated conjugation with dextran.

PubMed

Hosseinkhani, Hossein; Aoyama, Teruyoshi; Ogawa, Osamu; Tabata, Yasuhiko

2003-03-07

Tumor targeting of plasmid DNA was achieved through the conjugation of dextran derivatives with chelate residues based on metal coordination. Diethylenetriamine pentaacetic acid (DTPA), spermidine (Sd), and spermine (Sm) were chemically introduced to the hydroxyl groups of dextran to obtain dextran-DTPA, dextran-Sd and dextran-Sm derivatives. Conjugation of the dextran derivative by Zn(2+) coordination decreased the apparent size of the plasmid DNA, depending on the derivative type. The negative zeta potential of plasmid DNA became almost 0 mV after Zn(2+)-coordinated conjugation with dextran-Sm. When the dextran derivative-plasmid DNA conjugates with Zn(2+) coordination were intravenously injected subcutaneously into mice bearing Meth-AR-1 fibrosarcoma, the dextran-Sm-plasmid DNA conjugate significantly enhanced the level of gene expression in the tumor, in contrast to the conjugate of other dextran derivatives and free plasmid DNA. The enhanced gene expression produced by the Zn(2+)-coordinated dextran-Sm-plasmid DNA conjugate was specific to the tumor, whereas a simple mixture of dextran-Sm and plasmid DNA was not effective. The level of gene expression depended on the percentage of chelate residues introduced, the mixing weight ratio of the plasmid DNA/Sm residue used for conjugate preparation, and the plasmid DNA dose. A fluorescent microscopic study revealed that localization of plasmid DNA in the tumor tissue was observed only after injection of the dextran-Sm-plasmid DNA conjugate with Zn(2+) coordination. In addition, the gene expression induced by the conjugate lasted for more than 10 days after the injection. We conclude that Zn(2+)-coordinated dextran-Sm conjugation is a promising way to enable plasmid DNA to target the tumor in gene expression as well as to prolong the duration of gene expression.

Double-tagged fluorescent bacterial bioreporter for the study of polycyclic aromatic hydrocarbon diffusion and bioavailability.

PubMed

Tecon, Robin; Binggeli, Olivier; van der Meer, Jan R

2009-09-01

Bacterial degradation of polycyclic aromatic hydrocarbons (PAHs), ubiquitous contaminants from oil and coal, is typically limited by poor accessibility of the contaminant to the bacteria. In order to measure PAH availability in complex systems, we designed a number of diffusion-based assays with a double-tagged bacterial reporter strain Burkholderia sartisoli RP037-mChe. The reporter strain is capable of mineralizing phenanthrene (PHE) and induces the expression of enhanced green fluorescent protein (eGFP) as a function of the PAH flux to the cell. At the same time, it produces a second autofluorescent protein (mCherry) in constitutive manner. Quantitative epifluorescence imaging was deployed in order to record reporter signals as a function of PAH availability. The reporter strain expressed eGFP proportionally to dosages of naphthalene or PHE in batch liquid cultures. To detect PAH diffusion from solid materials the reporter cells were embedded in 2 cm-sized agarose gel patches, and fluorescence was recorded over time for both markers as a function of distance to the PAH source. eGFP fluorescence gradients measured on known amounts of naphthalene or PHE served as calibration for quantifying PAH availability from contaminated soils. To detect reporter gene expression at even smaller diffusion distances, we mixed and immobilized cells with contaminated soils in an agarose gel. eGFP fluorescence measurements confirmed gel patch diffusion results that exposure to 2-3 mg lampblack soil gave four times higher expression than to material contaminated with 10 or 1 (mg PHE) g(-1).

A study of the dynamics of PTEN proteins in living cells using in vivo fluorescence correlation spectroscopy

NASA Astrophysics Data System (ADS)

Du, Zhixue; Dong, Chaoqing; Ren, Jicun

2017-06-01

PTEN (phosphatase and tensin homolog on chromosome 10) is one of the most important tumor-suppressor proteins, which plays a key role in negative regulation of the PI3K/AKT pathway, and governs many cellular processes including growth, proliferation, survival and migration. The dynamics of PTEN proteins in single living cells is as yet unclear owing to a shortage of suitable in vivo approaches. Here, we report a single-molecule method for in vivo study of the dynamics of PTEN proteins in living cells using fluorescence correlation spectroscopy (FCS). First, we established a monoclonal H1299 stable cell line expressing enhanced green fluorescent protein (EGFP) and PTEN (EGFP-PTEN) fusion proteins; we then developed an in vivo FCS method to study the dynamics of EGFP-PTEN both in the nucleus and the cytoplasm. We investigated the diffusion behaviors of EGFP and EGFP-PTEN in solution, nucleus and cytosol, and observed that the motion of PTEN in living cells was restricted compared with EGFP. Finally, we investigated the protein dynamics in living cells under oxidative stress stimulation and a cellular ATP depletion treatment. Under oxidative stress stimulation, the EGFP-PTEN concentration increased in the nucleus, but slightly decreased in the cytoplasm. The diffusion coefficient and alpha value of EGFP-PTEN reduced significantly both in the nucleus and cytoplasm; the significantly decreased alpha parameter indicates a more restricted Brownian diffusion behavior. Under the cellular ATP depletion treatment, the concentration of EGFP-PTEN remained unchanged in the nucleus and decreased significantly in cytosol. The diffusion coefficient of EGFP-PTEN decreased significantly in cytosol, but showed no significant change in the nucleus; the alpha value decreased significantly in both the nucleus and cytoplasm. These results suggest that the concentration and mobility of PTEN in the nucleus and cytoplasm can be regulated by stimulation methods. Our approach provides a unique method for real-time monitoring of protein dynamics in different subcellular compartments under different stimulation treatments.

Genetic control of ColE1 plasmid stability that is independent of plasmid copy number regulation.

PubMed

Standley, Melissa S; Million-Weaver, Samuel; Alexander, David L; Hu, Shuai; Camps, Manel

2018-06-16

ColE1-like plasmid vectors are widely used for expression of recombinant genes in E. coli. For these vectors, segregation of individual plasmids into daughter cells during cell division appears to be random, making them susceptible to loss over time when no mechanisms ensuring their maintenance are present. Here we use the plasmid pGFPuv in a recA relA strain as a sensitized model to study factors affecting plasmid stability in the context of recombinant gene expression. We find that in this model, plasmid stability can be restored by two types of genetic modifications to the plasmid origin of replication (ori) sequence: point mutations and a novel 269 nt duplication at the 5' end of the plasmid ori, which we named DAS (duplicated anti-sense) ori. Combinations of these modifications produce a range of copy numbers and of levels of recombinant expression. In direct contradiction with the classic random distribution model, we find no correlation between increased plasmid copy number and increased plasmid stability. Increased stability cannot be explained by reduced levels of recombinant gene expression either. Our observations would be more compatible with a hybrid clustered and free-distribution model, which has been recently proposed based on detection of individual plasmids in vivo using super-resolution fluorescence microscopy. This work suggests a role for the plasmid ori in the control of segregation of ColE1 plasmids that is distinct from replication initiation, opening the door for the genetic regulation of plasmid stability as a strategy aimed at enhancing large-scale recombinant gene expression or bioremediation.

Monitoring mis-acylated tRNA suppression efficiency in mammalian cells via EGFP fluorescence recovery

PubMed Central

Ilegems, Erwin; Pick, Horst M.; Vogel, Horst

2002-01-01

A reporter assay was developed to detect and quantify nonsense codon suppression by chemically aminoacylated tRNAs in mammalian cells. It is based on the cellular expression of the enhanced green fluorescent protein (EGFP) as a reporter for the site-specific amino acid incorporation in its sequence using an orthogonal suppressor tRNA derived from Escherichia coli. Suppression of an engineered amber codon at position 64 in the EGFP run-off transcript could be achieved by the incorporation of a leucine via an in vitro aminoacylated suppressor tRNA. Microinjection of defined amounts of mutagenized EGFP mRNA and suppressor tRNA into individual cells allowed us to accurately determine suppression efficiencies by measuring the EGFP fluorescence intensity in individual cells using laser-scanning confocal microscopy. Control experiments showed the absence of natural suppression or aminoacylation of the synthetic tRNA by endogenous aminoacyl-tRNA synthetases. This reporter assay opens the way for the optimization of essential experimental parameters for expanding the scope of the suppressor tRNA technology to different cell types. PMID:12466560

Inducible model for β-six-mediated site-specific recombination in mammalian cells

PubMed Central

Servert, Pilar; Garcia-Castro, Javier; Díaz, Vicente; Lucas, Daniel; Gonzalez, Manuel A.; Martínez-A, Carlos; Bernad, Antonio

2006-01-01

The prokaryotic β recombinase catalyzes site-specific recombination between two directly oriented minimal six sites in chromatin-integrated substrates. Here, we demonstrate that an enhanced green fluorescent protein (EGFP)-fused version of β recombinase (β-EGFP) is fully active, retaining most specific activity. It is used to develop a recombination-dependent activatable gene expression (RAGE) system based on the androgen receptor (AR) ligand-binding domain (LBD). Two hybrid molecules, a direct fusion of the LBD-AR to the C-terminus of β recombinase (β-AR) and a triple fusion of β-EGFP to the same ligand-binding domain (β-EGFP-AR), were engineered and their subcellular behavior, stability and catalytic activity were evaluated. Both chimeric β recombinase proteins showed in vivo inducible recombinogenic activity dependent on addition of an androgen receptor agonist, although the β-AR fusion protein demonstrated more accurate ligand-dependent translocation from cytoplasm to nucleus. PMID:16394020

Fluorescent protein tagging of endogenous protein in brain neurons using CRISPR/Cas9-mediated knock-in and in utero electroporation techniques

PubMed Central

Uemura, Takeshi; Mori, Takuma; Kurihara, Taiga; Kawase, Shiori; Koike, Rie; Satoga, Michiru; Cao, Xueshan; Li, Xue; Yanagawa, Toru; Sakurai, Takayuki; Shindo, Takayuki; Tabuchi, Katsuhiko

2016-01-01

Genome editing is a powerful technique for studying gene functions. CRISPR/Cas9-mediated gene knock-in has recently been applied to various cells and organisms. Here, we successfully knocked in an EGFP coding sequence at the site immediately after the first ATG codon of the β-actin gene in neurons in the brain by the combined use of the CRISPR/Cas9 system and in utero electroporation technique, resulting in the expression of the EGFP-tagged β-actin protein in cortical layer 2/3 pyramidal neurons. We detected EGFP fluorescence signals in the soma and neurites of EGFP knock-in neurons. These signals were particularly abundant in the head of dendritic spines, corresponding to the localization of the endogenous β-actin protein. EGFP knock-in neurons showed no detectable changes in spine density and basic electrophysiological properties. In contrast, exogenously overexpressed EGFP-β-actin showed increased spine density and EPSC frequency, and changed resting membrane potential. Thus, our technique provides a potential tool to elucidate the localization of various endogenous proteins in neurons by epitope tagging without altering neuronal and synaptic functions. This technique can be also useful for introducing a specific mutation into genes to study the function of proteins and genomic elements in brain neurons. PMID:27782168

Fluorescent protein tagging of endogenous protein in brain neurons using CRISPR/Cas9-mediated knock-in and in utero electroporation techniques.

PubMed

Uemura, Takeshi; Mori, Takuma; Kurihara, Taiga; Kawase, Shiori; Koike, Rie; Satoga, Michiru; Cao, Xueshan; Li, Xue; Yanagawa, Toru; Sakurai, Takayuki; Shindo, Takayuki; Tabuchi, Katsuhiko

2016-10-26

Genome editing is a powerful technique for studying gene functions. CRISPR/Cas9-mediated gene knock-in has recently been applied to various cells and organisms. Here, we successfully knocked in an EGFP coding sequence at the site immediately after the first ATG codon of the β-actin gene in neurons in the brain by the combined use of the CRISPR/Cas9 system and in utero electroporation technique, resulting in the expression of the EGFP-tagged β-actin protein in cortical layer 2/3 pyramidal neurons. We detected EGFP fluorescence signals in the soma and neurites of EGFP knock-in neurons. These signals were particularly abundant in the head of dendritic spines, corresponding to the localization of the endogenous β-actin protein. EGFP knock-in neurons showed no detectable changes in spine density and basic electrophysiological properties. In contrast, exogenously overexpressed EGFP-β-actin showed increased spine density and EPSC frequency, and changed resting membrane potential. Thus, our technique provides a potential tool to elucidate the localization of various endogenous proteins in neurons by epitope tagging without altering neuronal and synaptic functions. This technique can be also useful for introducing a specific mutation into genes to study the function of proteins and genomic elements in brain neurons.

Targeted DNA delivery to cancer cells using a biotinylated chitosan carrier.

PubMed

Darvishi, Mohammad H; Nomani, Alireza; Hashemzadeh, Hadi; Amini, Mohsen; Shokrgozar, Mohammad A; Dinarvand, Rassoul

2017-05-01

A novel biotinylated chitosan-graft-polyethyleneimine (Bio-Chi-g-PEI) copolymer was synthesized and evaluated as a nonviral gene delivery carrier for improvement of the transfection efficiency, endosomal escape, and targeted gene delivery of a plasmid encoding green fluorescent protein N1 (pEGFP-N1) into two different biotin-overexpressing cell lines including HeLa and OVCAR-3 cells. The structure of the obtained copolymers was confirmed by 1 H nuclear magnetic resonance ( 1 H NMR) and Fourier transform infrared spectroscopy. Physicochemical properties of the Bio-Chi-g-PEI/plasmid DNA (pDNA) complexes such as complex stability, size, zeta potential, and their morphology were investigated at various weight ratios of copolymer to pDNA. Bio-Chi-g-PEI copolymers could effectively condense pDNA into small particles with average diameters less than 164 nm and the zeta potential of +34.8 mV at the N/P ratio of 40/1. As revealed by flow cytometry, Bio-Chi-g-PEI/pDNA complexes had lower cytotoxicity than that of PEI 25 kDa/pDNA complexes in both cell lines. In vitro experiments revealed that the Bio-Chi-gPEI/pDNA complexes not only had much lower cytotoxicity, but also displayed higher transfection efficiency than that of PEI 25kDa/pDNA complexes. High percentage of cancer cells was successfully transfected by Bio-Chi-g-PEI/pDNA and properly expressed GFP protein. This study indicates that this copolymer complex can be a promising gene delivery carrier. © 2016 International Union of Biochemistry and Molecular Biology, Inc.

Type 3 Fimbriae Encoded on Plasmids Are Expressed from a Unique Promoter without Affecting Host Motility, Facilitating an Exceptional Phenotype That Enhances Conjugal Plasmid Transfer

PubMed Central

Madsen, Jonas Stenløkke; Riber, Leise; Kot, Witold; Basfeld, Alrun; Burmølle, Mette; Hansen, Lars Hestbjerg; Sørensen, Søren Johannes

2016-01-01

Horizontal gene transfer (HGT), the transmission of genetic material to a recipient that is not the progeny of the donor, is fundamental in bacterial evolution. HGT is often mediated by mobile genetic elements such as conjugative plasmids, which may be in conflict with the chromosomal elements of the genome because they are independent replicons that may petition their own evolutionary strategy. Here we study differences between type 3 fimbriae encoded on wild type plasmids and in chromosomes. Using known and newly characterized plasmids we show that the expression of type 3 fimbriae encoded on plasmids is systematically different, as MrkH, a c-di-GMP dependent transcriptional activator is not needed for strong expression of the fimbriae. MrkH is required for expression of type 3 fimbriae of the Klebsiella pneumoniae chromosome, wherefrom the fimbriae operon (mrkABCDF) of plasmids is believed to have originated. We find that mrkABCDFs of plasmids are highly expressed via a unique promoter that differs from the original Klebsiella promoter resulting in fundamental behavioral consequences. Plasmid associated mrkABCDFs did not influence the swimming behavior of the host, that hereby acquired an exceptional phenotype being able to both actively swim (planktonic behavior) and express biofilm associated fimbriae (sessile behavior). We show that this exceptional phenotype enhances the conjugal transfer of the plasmid. PMID:27627107

Dual-Color Fluorescence Imaging to Monitor CYP3A4 and CYP3A7 Expression in Human Hepatic Carcinoma HepG2 and HepaRG Cells

PubMed Central

Kubiura, Musashi; Hayashi, Ayaka; Ohbayashi, Tetsuya; Kazuki, Yasuhiro; Chesné, Christophe; Oshimura, Mitsuo; Tada, Masako

2014-01-01

Human adult hepatocytes expressing CYP3A4, a major cytochrome P450 enzyme, are required for cell-based assays to evaluate the potential risk of drug-drug interactions caused by transcriptional induction of P450 enzymes in early-phase drug discovery and development. However, CYP3A7 is preferentially expressed in premature hepatoblasts and major hepatic carcinoma cell lines. The human hepatocellular carcinoma cell line HepaRG possesses a high self-renewal capacity and can differentiate into hepatic cells similar to human adult hepatocytes in vitro. Transgenic HepaRG cells, in which the expression of fluorescent reporters is regulated by 35 kb regulatory elements of CYP3A4, have a distinct advantage over human hepatocytes isolated by collagenase perfusion, which are unstable in culture. Thus, we created transgenic HepaRG and HepG2 cells by replacing the protein-coding regions of human CYP3A4 and CYP3A7 with enhanced green fluorescent protein (EGFP) and DsRed reporters, respectively, in a bacterial artificial chromosome vector that included whole regulatory elements. The intensity of DsRed fluorescence was initially high during the proliferation of transgenic HepaRG cells. However, most EGFP-positive cells were derived from those in which DsRed fluorescence was extinguished. Comparative analyses in these transgenic clones showed that changes in the total fluorescence intensity of EGFP reflected fold changes in the mRNA level of endogenous CYP3A4. Moreover, CYP3A4 induction was monitored by the increase in EGFP fluorescence. Thus, this assay provides a real-time evaluation system for quality assurance of hepatic differentiation into CYP3A4-expressing cells, unfavourable CYP3A4 induction, and fluorescence-activated cell sorting-mediated enrichment of CYP3A4-expressing hepatocytes based on the total fluorescence intensities of fluorescent reporters, without the need for many time-consuming steps. PMID:25101946

Regulation of the gut-specific carboxypeptidase: a study using the binary Gal4/UAS system in the mosquito Aedes aegypti

PubMed Central

Zhao, Bo; Kokoza, Vladimir A.; Saha, Tusar T.; Wang, Stephanie; Roy, Sourav; Raikhel, Alexander S.

2015-01-01

Pathogen transmission by mosquitoes is tightly linked to blood feeding which, in turn, is required for egg development. Studies of these processes would greatly benefit from genetic methods, such as the binary Gal4/UAS system. The latter has been well established for model organisms, but its availability is limited for mosquitoes. The objective of this study was to develop the blood-meal-activated, gut-specific Gal4/UAS system for the yellow-fever mosquito Aedes aegypti and utilize it to investigate the regulation of gut-specific gene expression. A 1.1-kb, 5' upstream region of the carboxypeptidase A (CP) gene was used to genetically engineer the CP-Gal4 driver mosquito line. The CP-Gal4 specifically activated the Enhanced Green Fluorescent Protein (EGFP) reporter only after blood feeding in the gut of the CP-Gal4>UAS-EGFP female Ae. aegypti. We used this system to study the regulation of CP gene expression. In vitro treatments with either amino acids (AAs) or insulin stimulated expression of the CP-Gal4>UAS-EGFP transgene; no effect was observed with 20-hydroxyecdysone (20E) treatments. The transgene activation by AAs and insulin was blocked by rapamycin, the inhibitor of the Target-of-Rapamycin kinase (TOR). RNA interference (RNAi) silence of the insulin receptor (IR) reduced the expression of the CP-Gal4>UAS-EGFP transgene. Thus, in vitro and in vivo experiments have revealed that insulin and TOR pathways control expression of the digestive enzyme CP. In contrast, 20E, the major regulator of post-blood-meal vitellogenic events in female mosquitoes, has no role in regulating the expression of this gene. This novel CP-Gal4/UAS system permits functional testing of midgut-specific genes that are involved in blood digestion and interaction with pathogens in Ae. aegypti mosquitoes. PMID:25152428

Dual-color fluorescence imaging to monitor CYP3A4 and CYP3A7 expression in human hepatic carcinoma HepG2 and HepaRG cells.

PubMed

Tsuji, Saori; Kawamura, Fumihiko; Kubiura, Musashi; Hayashi, Ayaka; Ohbayashi, Tetsuya; Kazuki, Yasuhiro; Chesné, Christophe; Oshimura, Mitsuo; Tada, Masako

2014-01-01

Human adult hepatocytes expressing CYP3A4, a major cytochrome P450 enzyme, are required for cell-based assays to evaluate the potential risk of drug-drug interactions caused by transcriptional induction of P450 enzymes in early-phase drug discovery and development. However, CYP3A7 is preferentially expressed in premature hepatoblasts and major hepatic carcinoma cell lines. The human hepatocellular carcinoma cell line HepaRG possesses a high self-renewal capacity and can differentiate into hepatic cells similar to human adult hepatocytes in vitro. Transgenic HepaRG cells, in which the expression of fluorescent reporters is regulated by 35 kb regulatory elements of CYP3A4, have a distinct advantage over human hepatocytes isolated by collagenase perfusion, which are unstable in culture. Thus, we created transgenic HepaRG and HepG2 cells by replacing the protein-coding regions of human CYP3A4 and CYP3A7 with enhanced green fluorescent protein (EGFP) and DsRed reporters, respectively, in a bacterial artificial chromosome vector that included whole regulatory elements. The intensity of DsRed fluorescence was initially high during the proliferation of transgenic HepaRG cells. However, most EGFP-positive cells were derived from those in which DsRed fluorescence was extinguished. Comparative analyses in these transgenic clones showed that changes in the total fluorescence intensity of EGFP reflected fold changes in the mRNA level of endogenous CYP3A4. Moreover, CYP3A4 induction was monitored by the increase in EGFP fluorescence. Thus, this assay provides a real-time evaluation system for quality assurance of hepatic differentiation into CYP3A4-expressing cells, unfavourable CYP3A4 induction, and fluorescence-activated cell sorting-mediated enrichment of CYP3A4-expressing hepatocytes based on the total fluorescence intensities of fluorescent reporters, without the need for many time-consuming steps.

Foxn1 Transcription Factor Regulates Wound Healing of Skin through Promoting Epithelial-Mesenchymal Transition

PubMed Central

Gawronska-Kozak, Barbara; Grabowska, Anna; Kur-Piotrowska, Anna; Kopcewicz, Marta

2016-01-01

Transcription factors are key molecules that finely tune gene expression in response to injury. We focused on the role of a transcription factor, Foxn1, whose expression is limited to the skin and thymus epithelium. Our previous studies showed that Foxn1 inactivity in nude mice creates a pro-regenerative environment during skin wound healing. To explore the mechanistic role of Foxn1 in the skin wound healing process, we analyzed post-injured skin tissues from Foxn1::Egfp transgenic and C57BL/6 mice with Western Blotting, qRT-PCR, immunofluorescence and flow cytometric assays. Foxn1 expression in non-injured skin localized to the epidermis and hair follicles. Post-injured skin tissues showed an intense Foxn1-eGFP signal at the wound margin and in leading epithelial tongue, where it co-localized with keratin 16, a marker of activated keratinocytes. This data support the concept that suprabasal keratinocytes, expressing Foxn1, are key cells in the process of re-epithelialization. The occurrence of an epithelial-mesenchymal transition (EMT) was confirmed by high levels of Snail1 and Mmp-9 expression as well as through co-localization of vimentin/E-cadherin-positive cells in dermis tissue at four days post-wounding. Involvement of Foxn1 in the EMT process was verified by co-localization of Foxn1-eGFP cells with Snail1 in histological sections. Flow cytometric analysis showed the increase of double positive E-cadherin/N-cadherin cells within Foxn1-eGFP population of post-wounded skin cells isolates, which corroborated histological and gene expression analyses. Together, our findings indicate that Foxn1 acts as regulator of the skin wound healing process through engagement in re-epithelization and possible involvement in scar formation due to Foxn1 activity during the EMT process. PMID:26938103

Quantitative analysis of lentiviral transgene expression in mice over seven generations.

PubMed

Wang, Yong; Song, Yong-tao; Liu, Qin; Liu, Cang'e; Wang, Lu-lu; Liu, Yu; Zhou, Xiao-yang; Wu, Jun; Wei, Hong

2010-10-01

Lentiviral transgenesis is now recognized as an extremely efficient and cost-effective method to produce transgenic animals. Transgenes delivered by lentiviral vectors exhibited inheritable expression in many species including those which are refractory to genetic modification such as non-human primates. However, epigenetic modification was frequently observed in lentiviral integrants, and transgene expression found to be inversely correlated with methylation density. Recent data showed that about one-third lentiviral integrants exhibited hypermethylation and low expression, but did not demonstrate whether those integrants with high expression could remain constant expression and hypomethylated during long term germline transmission. In this study, using lentiviral eGFP transgenic mice as the experimental animals, lentiviral eGFP expression levels and its integrant numbers in genome were quantitatively analyzed by fluorescent quantitative polymerase-chain reaction (FQ-PCR), using the house-keeping gene ribosomal protein S18 (Rps18) and the single copy gene fatty acid binding protein of the intestine (Fabpi) as the internal controls respectively. The methylation densities of the integrants were quantitatively analyzed by bisulfite sequencing. We found that the lentiviral integrants with high expression exhibited a relative constant expression level per integrant over at least seven generations. Besides, the individuals containing these integrants exhibited eGFP expression levels which were positively and almost linearly correlated with the integrant numbers in their genomes, suggesting that no remarkable position effect on transgene expression of the integrants analyzed was observed. In addition, over seven generations the methylation density of these integrants did not increase, but rather decreased remarkably, indicating that these high expressing integrants were not subjected to de novo methylation during at least seven generations of germline transmission. Taken together, these data suggested that transgenic lines with long term stable expression and no position effect can be established by lentiviral transgenesis.

Actin cytoskeleton-dependent Rab GTPase-regulated angiotensin type I receptor lysosomal degradation studied by fluorescence lifetime imaging microscopy

NASA Astrophysics Data System (ADS)

Li, Hewang; Yu, Peiying; Sun, Yuansheng; Felder, Robin A.; Periasamy, Ammasi; Jose, Pedro A.

2010-09-01

The dynamic regulation of the cellular trafficking of human angiotensin (Ang) type 1 receptor (AT1R) is not well understood. Therefore, we investigated the cellular trafficking of AT1R-enhanced green fluorescent protein (EGFP) (AT1R-EGFP) heterologously expressed in HEK293 cells by determining the change in donor lifetime (AT1R-EGFP) in the presence or absence of acceptor(s) using fluorescence lifetime imaging-fluorescence resonance energy transfer (FRET) microscopy. The average lifetime of AT1R-EGFP in our donor-alone samples was ~2.33 ns. The basal state lifetime was shortened slightly in the presence of Rab5 (2.01+/-0.10 ns) or Rab7 (2.11+/-0.11 ns) labeled with Alexa 555, as the acceptor fluorophore. A 5-min Ang II treatment markedly shortened the lifetime of AT1R-EGFP in the presence of Rab5-Alexa 555 (1.78+/-0.31 ns) but was affected minimally in the presence of Rab7-Alexa 555 (2.09+/-0.37 ns). A 30-min Ang II treatment further decreased the AT1R-EGFP lifetime in the presence of both Rab5- and Rab7-Alexa 555. Latrunculin A but not nocodazole pretreatment blocked the ability of Ang II to shorten the AT1R-EGFP lifetime. The occurrence of FRET between AT1R-EGFP (donor) and LAMP1-Alexa 555 (acceptor) with Ang II stimulation was impaired by photobleaching the acceptor. These studies demonstrate that Ang II-induced AT1R lysosomal degradation through its association with LAMP1 is regulated by Rab5/7 via mechanisms that are dependent on intact actin cytoskeletons.

Efficacious cellular codelivery of doxorubicin and EGFP siRNA mediated by the composition of PLGA and PEI protected gold nanoparticles.

PubMed

Kumar, Krishan; Vulugundam, Gururaja; Jaiswal, Pradeep Kumar; Shyamlal, Bharti Rajesh Kumar; Chaudhary, Sandeep

2017-09-15

This study reports the simultaneous delivery of EGFP siRNA and the chemotherapeutic drug, doxorubicin by means of the composition that results from the electrostatic interaction between positively charged siRNA-complexes of gold nanoparticles (AuNPs) capped with PEI, 25kDa (P25-AuNPs) and negatively charged carboxymethyl cellulose formulated PLGA nanoparticles loaded with doxorubicin. The nanoparticles and their facile interaction were studied by means of dynamic light scattering (DLS), zeta potential, transmission electron microscopic (TEM) measurements. The flow cytometric and confocal microscopic analysis evidenced the simultaneous internalization of both labelled siRNA and doxorubin into around 55% of the HeLa cancer cell population. Fluorescence microscopic studies enabled the visual analysis of EGFP expressing HeLa cells which suggested that the composition mediated codelivery resulted in a substantial downregulation of EGFP expression and intracellular accumulation of doxorubicin. Interestingly, codelivery treatment resulted in an increased cellular delivery of doxorubicin when compared to PLGA-DOX alone treatment. On the other hand, the activity of siRNA complexes of PEI-AuNPs was completely retained even when they were part of composition. The results suggest that this formulation can serve as promising tool for delivery applications in combinatorial anticancer therapy. Copyright © 2017 Elsevier Ltd. All rights reserved.

In vivo induction of interferon gamma expression in grey horses with metastatic melanoma resulting from direct injection of plasmid DNA coding for equine interleukin 12.

PubMed

Müller, J-M V; Wissemann, J; Meli, M L; Dasen, G; Lutz, H; Heinzerling, L; Feige, K

2011-11-01

Whole blood pharmacokinetics of intratumourally injected naked plasmid DNA coding for equine Interleukin 12 (IL-12) was assessed as a means of in vivo gene transfer in the treatment of melanoma in grey horses. The expression of induced interferon gamma (IFN-g) was evaluated in order to determine the pharmacodynamic properties of in vivo gene transduction. Seven grey horses bearing melanoma were injected intratumourally with 250 µg naked plasmid DNA coding for IL-12. Peripheral blood and biopsies from the injection site were taken at 13 time points until day 14 post injection (p.i.). Samples were analysed using quantitative real-time PCR. Plasmid DNA was quantified in blood samples and mRNA expression for IFN-g in tissue samples. Plasmid DNA showed fast elimination kinetics with more than 99 % of the plasmid disappearing within 36 hours. IFN-g expression increased quickly after IL-12 plasmid injection, but varied between individual horses. Intratumoural injection of plasmid DNA is a feasible method for inducing transgene expression in vivo. Biological activity of the transgene IL-12 was confirmed by measuring expression of IFN-g.

Antigen Binding and Site-Directed Labeling of Biosilica-Immobilized Fusion Proteins Expressed in Diatoms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ford, Nicole R.; Hecht, Karen A.; Hu, Dehong

2016-01-08

The diatom Thalassiosira pseudonana was genetically modified to express biosilica-targeted fusion proteins incorporating a tetracysteine tag for site-directed labeling with biarsenical affinity probes and either EGFP or single chain antibody to test colocalization of probes with the EGFP-tagged recombinant protein or binding of biosilica-immobilized antibodies to large and small molecule antigens, respectively. Site-directed labeling with the biarsenical probes demonstrated colocalization with EGFP-encoded proteins in nascent and mature biosilica, supporting their use in studying biosilica maturation. Isolated biosilica transformed with a single chain antibody against either the Bacillus anthracis surface layer protein EA1 or small molecule explosive trinitrotoluene (TNT) effectively boundmore » the respective antigens. A marked increase in fluorescence lifetime of the TNT surrogate Alexa Fluor 555-trinitrobenzene reflected the high binding specificity of the transformed isolated biosilica. These results demonstrated the potential use of biosilica-immobilized single chain antibodies as binders for large and small molecule antigens in sensing and therapeutics.« less

UMG Lenti: Novel Lentiviral Vectors for Efficient Transgene- and Reporter Gene Expression in Human Early Hematopoietic Progenitors

PubMed Central

Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G.; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B.; Grillone, Teresa; Giovannone, Emilia D.; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A. S.; Bond, Heather M.; Mesuraca, Maria; Morrone, Giovanni

2014-01-01

Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and –LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG–LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and progenitor cells, as well as in non-hematopoietic cells. PMID:25502183

Monitoring the diffusion behavior of Na,K-ATPase by fluorescence correlation spectroscopy (FCS) upon fluorescence labelling with eGFP or Dreiklang

NASA Astrophysics Data System (ADS)

Junghans, Cornelia; Schmitt, Franz-Josef; Vukojević, Vladana; Friedrich, Thomas

2016-02-01

Measurement of lateral mobility of membraneembedded proteins in living cells with high spatial and temporal precision is a challenging task of optofluidics. Biological membranes are complex structures, whose physico-chemical properties depend on the local lipid composition, cholesterol content and the presence of integral or peripheral membrane proteins, which may be involved in supramolecular complexes or are linked to cellular matrix proteins or the cytoskeleton. The high proteinto- lipid ratios in biomembranes indicate that membrane proteins are particularly subject to molecular crowding, making it difficult to follow the track of individual molecules carrying a fluorescence label. Novel switchable fluorescence proteins such as Dreiklang [1], are, in principle, promising tools to study the diffusion behavior of individual molecules in situations of molecular crowding due to excellent spectral control of the ON- and OFF-switching process. In this work, we expressed an integral membrane transport protein, the Na,K-ATPase comprising the human α2-subunit carrying an N-terminal eGFP or Dreiklang tag and human β1-subunit, in HEK293T cells and measured autocorrelation curves by fluorescence correlation spectroscopy (FCS). Furthermore,we measured diffusion times and diffusion constants of eGFP and Dreiklang by FCS, first, in aqueous solution after purification of the proteins upon expression in E. coli, and, second, upon expression as soluble proteins in the cytoplasm of HEK293T cells. Our data show that the diffusion behavior of the purified eGFP and Dreiklang in solution as well as the properties of the proteins expressed in the cytoplasm are very similar. However, the autocorrelation curves of eGFP- and Dreiklanglabeled Na,K-ATPase measured in the plasma membrane exhibit marked differences, with the Dreiklang-labeled construct showing shorter diffusion times. This may be related to an additional, as yet unrecognized quenching process that occurs on the same time scale as the diffusion of the labeled complexes through the detection volume (1- 100 ms). Since the origin of this quenching process is currently unclear, care has to be taken when the Dreiklang label is intended to be used in FCS applications.

Monitoring the diffusion behavior of Na,K-ATPase by fluorescence correlation spectroscopy (FCS) upon fluorescence labelling with eGFP or Dreiklang

NASA Astrophysics Data System (ADS)

Junghans, Cornelia; Schmitt, Franz-Josef; Vukojević, Vladana; Friedrich, Thomas

2015-12-01

Measurement of lateral mobility of membraneembedded proteins in living cells with high spatial and temporal precision is a challenging task of optofluidics. Biological membranes are complex structures, whose physico-chemical properties depend on the local lipid composition, cholesterol content and the presence of integral or peripheral membrane proteins, which may be involved in supramolecular complexes or are linked to cellular matrix proteins or the cytoskeleton. The high proteinto- lipid ratios in biomembranes indicate that membrane proteins are particularly subject to molecular crowding, making it difficult to follow the track of individual molecules carrying a fluorescence label. Novel switchable fluorescence proteins such as Dreiklang [1], are, in principle, promising tools to study the diffusion behavior of individual molecules in situations of molecular crowding due to excellent spectral control of the ON- and OFF-switching process. In this work, we expressed an integral membrane transport protein, the Na,K-ATPase comprising the human α2-subunit carrying an N-terminal eGFP or Dreiklang tag and human β1-subunit, in HEK293T cells and measured autocorrelation curves by fluorescence correlation spectroscopy (FCS). Furthermore,we measured diffusion times and diffusion constants of eGFP and Dreiklang by FCS, first, in aqueous solution after purification of the proteins upon expression in E. coli, and, second, upon expression as soluble proteins in the cytoplasm of HEK293T cells. Our data show that the diffusion behavior of the purified eGFP and Dreiklang in solution as well as the properties of the proteins expressed in the cytoplasm are very similar. However, the autocorrelation curves of eGFP- and Dreiklanglabeled Na,K-ATPase measured in the plasma membrane exhibit marked differences, with the Dreiklang-labeled construct showing shorter diffusion times. This may be related to an additional, as yet unrecognized quenching process that occurs on the same time scale as the diffusion of the labeled complexes through the detection volume (1- 100 ms). Since the origin of this quenching process is currently unclear, care has to be taken when the Dreiklang label is intended to be used in FCS applications.

Generation of a Recombinant Akabane Virus Expressing Enhanced Green Fluorescent Protein

PubMed Central

Takenaka-Uema, Akiko; Murata, Yousuke; Gen, Fumihiro; Ishihara-Saeki, Yukari; Watanabe, Ken-ichi; Uchida, Kazuyuki; Kato, Kentaro; Murakami, Shin; Haga, Takeshi

2015-01-01

ABSTRACT We generated a recombinant Akabane virus (AKAV) expressing enhanced green fluorescence protein (eGFP-AKAV) by using reverse genetics. We artificially constructed an ambisense AKAV S genome encoding N/NSs on the negative-sense strand, and eGFP on the positive-sense strand with an intergenic region (IGR) derived from the Rift Valley fever virus (RVFV) S genome. The recombinant virus exhibited eGFP fluorescence and had a cytopathic effect in cell cultures, even after several passages. These results indicate that the gene encoding eGFP in the ambisense RNA could be stably maintained. Transcription of N/NSs and eGFP mRNAs of eGFP-AKAV was terminated within the IGR. The mechanism responsible for this appears to be different from that in RVFV, where the termination sites for N and NSs are determined by a defined signal sequence. We inoculated suckling mice intraperitoneally with eGFP-AKAV, which resulted in neurological signs and lethality equivalent to those seen for the parent AKAV. Fluorescence from eGFP in frozen brain slices from the eGFP-AKAV-infected mice was localized to the cerebellum, pons, and medulla oblongata. Our approach to producing a fluorescent virus, using an ambisense genome, helped obtain eGFP-AKAV, a fluorescent bunyavirus whose viral genes are intact and which can be easily visualized. IMPORTANCE AKAV is the etiological agent of arthrogryposis-hydranencephaly syndrome in ruminants, which causes considerable economic loss to the livestock industry. We successfully generated a recombinant enhanced green fluorescent protein-tagged AKAV containing an artificial ambisense S genome. This virus could become a useful tool for analyzing AKAV pathogenesis in host animals. In addition, our approach of using an ambisense genome to generate an orthobunyavirus stably expressing a foreign gene could contribute to establishing alternative vaccine strategies, such as bivalent vaccine virus constructs, for veterinary use against infectious diseases. PMID:26157127

Fetal-Maternal Interactions in the Synepitheliochorial Placenta Using the eGFP Cloned Cattle Model

PubMed Central

Mess, Andrea; Perecin, Felipe; Bressan, Fabiana Fernandes; Mesquita, Ligia Garcia; Miglino, Maria Angelica; Pimentel, José RodrigoValim; Neto, Paulo Fantinato; Meirelles, Flávio Vieira

2013-01-01

Background To investigate mechanisms of fetal-maternal cell interactions in the bovine placenta, we developed a model of transgenic enhanced Green Fluorescent Protein (t-eGFP) expressing bovine embryos produced by nuclear transfer (NT) to assess the distribution of fetal-derived products in the bovine placenta. In addition, we searched for male specific DNA in the blood of females carrying in vitro produced male embryos. Our hypothesis is that the bovine placenta is more permeable to fetal-derived products than described elsewhere. Methodology/Principal Findings Samples of placentomes, chorion, endometrium, maternal peripheral blood leukocytes and blood plasma were collected during early gestation and processed for nested-PCR for eGFP and testis-specific Y-encoded protein (TSPY), western blotting and immunohistochemistry for eGFP detection, as well as transmission electron microscopy to verify the level of interaction between maternal and fetal cells. TSPY and eGFP DNA were present in the blood of cows carrying male pregnancies at day 60 of pregnancy. Protein and mRNA of eGFP were observed in the trophoblast and uterine tissues. In the placentomes, the protein expression was weak in the syncytial regions, but intense in neighboring cells on both sides of the fetal-maternal interface. Ultrastructurally, our samples from t-eGFP expressing NT pregnancies showed to be normal, such as the presence of interdigitating structures between fetal and maternal cells. In addition, channels-like structures were present in the trophoblast cells. Conclusions/Significance Data suggested that there is a delivery of fetal contents to the maternal system on both systemic and local levels that involved nuclear acids and proteins. It not clear the mechanisms involved in the transfer of fetal-derived molecules to the maternal system. This delivery may occur through nonclassical protein secretion; throughout transtrophoblastic-like channels and/or by apoptotic processes previously described. In conclusion, the bovine synepitheliochorial placenta displays an intimate fetal-maternal interaction, similar to other placental types for instance human and mouse. PMID:23724045

Fetal-maternal interactions in the synepitheliochorial placenta using the eGFP cloned cattle model.

PubMed

Pereira, Flavia Thomaz Verechia; Oliveira, Lilian J; Barreto, Rodrigo da Silva Nunes; Mess, Andrea; Perecin, Felipe; Bressan, Fabiana Fernandes; Mesquita, Ligia Garcia; Miglino, Maria Angelica; Pimentel, José RodrigoValim; Fantinato Neto, Paulo; Meirelles, Flávio Vieira

2013-01-01

To investigate mechanisms of fetal-maternal cell interactions in the bovine placenta, we developed a model of transgenic enhanced Green Fluorescent Protein (t-eGFP) expressing bovine embryos produced by nuclear transfer (NT) to assess the distribution of fetal-derived products in the bovine placenta. In addition, we searched for male specific DNA in the blood of females carrying in vitro produced male embryos. Our hypothesis is that the bovine placenta is more permeable to fetal-derived products than described elsewhere. Samples of placentomes, chorion, endometrium, maternal peripheral blood leukocytes and blood plasma were collected during early gestation and processed for nested-PCR for eGFP and testis-specific Y-encoded protein (TSPY), western blotting and immunohistochemistry for eGFP detection, as well as transmission electron microscopy to verify the level of interaction between maternal and fetal cells. TSPY and eGFP DNA were present in the blood of cows carrying male pregnancies at day 60 of pregnancy. Protein and mRNA of eGFP were observed in the trophoblast and uterine tissues. In the placentomes, the protein expression was weak in the syncytial regions, but intense in neighboring cells on both sides of the fetal-maternal interface. Ultrastructurally, our samples from t-eGFP expressing NT pregnancies showed to be normal, such as the presence of interdigitating structures between fetal and maternal cells. In addition, channels-like structures were present in the trophoblast cells. Data suggested that there is a delivery of fetal contents to the maternal system on both systemic and local levels that involved nuclear acids and proteins. It not clear the mechanisms involved in the transfer of fetal-derived molecules to the maternal system. This delivery may occur through nonclassical protein secretion; throughout transtrophoblastic-like channels and/or by apoptotic processes previously described. In conclusion, the bovine synepitheliochorial placenta displays an intimate fetal-maternal interaction, similar to other placental types for instance human and mouse.

KARP-1 works as a heterodimer with Ku70, but the function of KARP-1 cannot perfectly replace that of Ku80 in DSB repair

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koike, Manabu, E-mail: m_koike@nirs.go.jp; Yutoku, Yasutomo; Graduate School of Science, Chiba University, Yayoicho, Inage-ku, Chiba 263-8522

2011-10-01

Ku, the heterodimer of Ku70 and Ku80, plays an essential role in the DNA double-strand break (DSB) repair pathway, i.e., non-homologous end-joining (NHEJ). Two isoforms of Ku80 encoded by the same genes, namely, Ku80 and KARP-1 are expressed and function in primate cells, but not in rodent cells. Ku80 works as a heterodimer with Ku70. However, it is not yet clear whether KARP-1 forms a heterodimer with Ku70 and works as a heterodimer. Although KARP-1 appears to work in NHEJ, its physiological role remains unclear. In this study, we established and characterized EGFP-KARP-1-expressing xrs-6 cell lines, EGFP-KARP-1/xrs-6. We found thatmore » nuclear localization signal (NLS) of KARP-1 is localized in the C-terminal region. Our data showed that KARP-1 localizes within the nucleus in NLS-dependent and NLS-independent manner and forms a heterodimer with Ku70, and stabilizes Ku70. On the other hand, EGFP-KARP-1 could not perfectly complement the radiosensitivity and DSB repair activity of Ku80-deficient xrs-6 cells. Furthermore, KARP-1 could not accumulate at DSBs faster than Ku80, although EGFP-KARP-1 accumulates at DSBs. Our data demonstrate that the function of KARP-1 could not perfectly replace that of Ku80 in DSB repair, although KARP-1 has some biochemical properties, which resemble those of Ku80, and works as a heterodimer with Ku70. On the other hand, the number of EGFP-KARP-1-expressing xrs-6 cells showing pan-nuclear {gamma}-H2AX staining significantly increases following X-irradiation, suggesting that KARP-1 may have a novel role in DSB response.« less

Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.

PubMed

Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W

2010-08-01

The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

In vitro bioactivity of 17alpha-estradiol.

PubMed

Sievernich, André; Wildt, Ludwig; Lichtenberg-Fraté, Hella

2004-12-01

A miniaturised short-term in vitro assay based on the activation of the human estrogen receptor alpha and genetically modified yeast (Saccharomyces cerevisiae) cells was performed to explore the capacity of this system to monitor the bioactivity of estrogenic compounds, particularly 17alpha- and 17beta-estradiol. Together with the human estrogen receptor (hER)-alpha plasmid, the reporter plasmid containing a yeast-optimised version of the green fluorescent protein (yEGFP) linked to three repeats of the cis-acting estrogen hormone-responsive element (ERE) were expressed in a strain being deleted in the pleiotropic drug resistance transporters Pdr5, Snq2 and Yor1, known to facilitate efflux of organic compounds including steroids and chemotherapeutics. Agonists that bind to hER in vitro trigger estrogen receptor-mediated transcriptional activation of the GFP reporter gene monitored by fluorescence emission at 535 nm. The sensitivity of the assay was tested with various 17alpha- and 17beta-estradiol concentrations, yielding a detection limit of 5 pg/ml (0.018 nM) for the agonist 17beta-E2 in solvent and in human charcoal-stripped serum using a S. cerevisiae pdr5, snq2 and yor1 mutant strain. For 17alpha-estradiol only, at approximately 1500 pg/ml a similar fluorescence response compared to 100 pg/ml 17beta-E2 was observed implicating a much weaker potency of this stereoisomer. The specificity of the system was tested by expression of a truncated hER lacking the ligand-binding domain E and by administration of the androgen, 4-androsten 3,17 dione. Both controls did not yield an increase in fluorescence emission. This fluorescence emission assay enables detection of estrogenic biological activity induced by direct agonists, such as 17beta-E2 at concentrations similar to those found in human sera or by estrogen-like chemicals.

Folic acid conjugated mPEG-PEI600 as an efficient non-viral vector for targeted nucleic acid delivery.

PubMed

Xu, Zhenhua; Jin, Jiefu; Siu, Leo K S; Yao, Hong; Sze, Johnny; Sun, Hongzhe; Kung, Hsiang-Fu; Poon, Wai Sang; Ng, Samuel S M; Lin, Marie C

2012-04-15

In this study we describe a novel polymer, mPPS-FA, synthesized as a potential gene transfer vector. To complete mPPS-FA, folic acid was conjugated to a backbone (named mPPS) consisting of a copolymer of methyl PEG-2000, PEI-600, and sebacoyl chloride. (1)H NMR, FT-IR, and UV spectroscopy were used to characterize the structure of mPPS-FA. It was revealed that mPPS-FA holds the ability to bind plasmid DNA yielding positively charged particles (polyplexes). Dynamic light scattering (DLS) and TEM techniques were used to study the size and morphology of the formed mPPS-FA/DNA nanocomplexes. The mPPS-FA/DNA nanoparticles exhibited low cytotoxicity as transfection of B16-F0, U87MG, CHO-1, and Ho-8910 cells produced >80% viability indicating low cytotoxicity of the polymer. The ability of mPPS-FA to deliver EGFP plasmid to melanoma B16-F0, U87, CHO-1, Ho-8910, and A549 cells was investigated in vitro as compared to the lipid-based transfection agent Lipofectamine2000 and Linear PEI 22 kDa (L-PEI 22 kDa). We found that mPPS-FA/DNA complexes yielded the highest GFP transfection efficiency in B16-F0, U87, CHO-1, and Ho-8910 cells, which all highly express folate receptors (FR), at an mPPS-FA/DNA ratio (w/w) of 15. Furthermore, the transfection of mPPS-FA/DNA complexes in CHO-1 cells could be competitively blocked by free folic acid molecules. In contrast, in low FR expressing A549 cells, mPPS-FA showed similar low transfection efficiency as mPPS. Taken together, mPPS-FA showed the highest efficiency in vitro and the potential to be developed as a nonviral gene carrier. Copyright © 2012 Elsevier B.V. All rights reserved.

CRISPR-Cas9D10A Nickase-Assisted Genome Editing in Lactobacillus casei

PubMed Central

Song, Xin; Huang, He; Xiong, Zhiqiang

2017-01-01

ABSTRACT Lactobacillus casei has drawn increasing attention as a health-promoting probiotic, while effective genetic manipulation tools are often not available, e.g., the single-gene knockout in L. casei still depends on the classic homologous recombination-dependent double-crossover strategy, which is quite labor-intensive and time-consuming. In the present study, a rapid and precise genome editing plasmid, pLCNICK, was established for L. casei genome engineering based on CRISPR-Cas9D10A. In addition to the P23-Cas9D10A and Pldh-sgRNA (single guide RNA) expression cassettes, pLCNICK includes the homologous arms of the target gene as repair templates. The ability and efficiency of chromosomal engineering using pLCNICK were evaluated by in-frame deletions of four independent genes and chromosomal insertion of an enhanced green fluorescent protein (eGFP) expression cassette at the LC2W_1628 locus. The efficiencies associated with in-frame deletions and chromosomal insertion is 25 to 62%. pLCNICK has been proved to be an effective, rapid, and precise tool for genome editing in L. casei, and its potential application in other lactic acid bacteria (LAB) is also discussed in this study. IMPORTANCE The lack of efficient genetic tools has limited the investigation and biotechnological application of many LAB. The CRISPR-Cas9D10A nickase-based genome editing in Lactobacillus casei, an important food industrial microorganism, was demonstrated in this study. This genetic tool allows efficient single-gene deletion and insertion to be accomplished by one-step transformation, and the cycle time is reduced to 9 days. It facilitates a rapid and precise chromosomal manipulation in L. casei and overcomes some limitations of previous methods. This editing system can serve as a basic technological platform and offers the possibility to start a comprehensive investigation on L. casei. As a broad-host-range plasmid, pLCNICK has the potential to be adapted to other Lactobacillus species for genome editing. PMID:28864652

Impact of diet-induced obesity on intestinal stem cells: hyperproliferation but impaired intrinsic function that requires insulin/IGF1.

PubMed

Mah, Amanda T; Van Landeghem, Laurianne; Gavin, Hannah E; Magness, Scott T; Lund, P Kay

2014-09-01

Nutrient intake regulates intestinal epithelial mass and crypt proliferation. Recent findings in model organisms and rodents indicate nutrient restriction impacts intestinal stem cells (ISC). Little is known about the impact of diet-induced obesity (DIO), a model of excess nutrient intake on ISC. We used a Sox9-EGFP reporter mouse to test the hypothesis that an adaptive response to DIO or associated hyperinsulinemia involves expansion and hyperproliferation of ISC. The Sox9-EGFP reporter mouse allows study and isolation of ISC, progenitors, and differentiated lineages based on different Sox9-EGFP expression levels. Sox9-EGFP mice were fed a high-fat diet for 20 weeks to induce DIO and compared with littermates fed low-fat rodent chow. Histology, fluorescence activated cell sorting, and mRNA analyses measured impact of DIO on jejunal crypt-villus morphometry, numbers, and proliferation of different Sox9-EGFP cell populations and gene expression. An in vitro culture assay directly assessed functional capacity of isolated ISC. DIO mice exhibited significant increases in body weight, plasma glucose, insulin, and insulin-like growth factor 1 (IGF1) levels and intestinal Igf1 mRNA. DIO mice had increased villus height and crypt density but decreased intestinal length and decreased numbers of Paneth and goblet cells. In vivo, DIO resulted in a selective expansion of Sox9-EGFP(Low) ISC and percentage of ISC in S-phase. ISC expansion significantly correlated with plasma insulin levels. In vitro, isolated ISC from DIO mice formed fewer enteroids in standard 3D Matrigel culture compared to controls, indicating impaired ISC function. This decreased enteroid formation in isolated ISC from DIO mice was rescued by exogenous insulin, IGF1, or both. We conclude that DIO induces specific increases in ISC and ISC hyperproliferation in vivo. However, isolated ISC from DIO mice have impaired intrinsic survival and growth in vitro that can be rescued by exogenous insulin or IGF1.

Actin microfilaments participate in the regulation of the COL1A1 promoter activity in ROS17/2.8 cells under simulated microgravity

NASA Astrophysics Data System (ADS)

Dai, Zhongquan; Li, Yinghui; Ding, Bai; Zhang, Xiaoyou; Tan, Yingjun; Wan, Yumin

2006-01-01

IntroductionMicrogravity is thought to decrease osteoblastic activity and induce osteoporosis during spaceflight, but the mechanisms, particularly the attendant changes in gene expression, are not well understood. It is suspected that the cytoskeletal system is involved in the manifold changes of cell shape, function, and signaling under microgravity conditions. MethodsWe constructed cell lines stably transfected with pJI36EGFP and pJI23EGFP, which contained a 3.6 and a 2.3 kb fragment, respectively, of the α1(I) collagen gene (COL1A1) promoter fused with the enhanced green fluorescence protein (EGFP) reporter gene. We then developed a semi-quantitative analysis of EGFP fluorescence intensity to evaluate the effects of clinorotation and/or cytochalasin B on the activity of the COL1A1 promoter. Simultaneously, we assessed the collagen type I protein content versus total protein content in clinorotated or control osteoblasts, using immunocytochemistry and the Bradford method, respectively. ResultsThe fluorescence intensity analysis revealed that the expression of COL1A1-EGFP increased in GFP-ROS cells clinorotated for 24 or 48 h, as compared with stationary control cultures. We observed a similar trend in collagen type I content, as assessed by immunocytochemistry. We found that the osteoblast microfilaments tended to disassemble and show a reduction in stress fibers under space flight and clinorotation. Treatment with cytochalasin B in normal gravity resulted in a dose-dependent increase of EGFP fluorescence intensity, indicating that disruption of the actin system was associated with increased activity of the COL1A1 promoter. ConclusionOur study demonstrates that disrupting the actin cytoskeleton by treatment with cytochalasin B and real or simulated microgravity conditions led to altered COL1A1 promoter activity. Together, these results suggest that actin may participate in the regulation of the COL1A1 promoter activity under microgravity conditions.

Cloning of the citrate permease gene of Lactococcus lactis subsp. lactis biovar diacetylactis and expression in Escherichia coli.

PubMed Central

Sesma, F; Gardiol, D; de Ruiz Holgado, A P; de Mendoza, D

1990-01-01

The citrate plasmid (Cit+ plasmid) from Lactococcus lactis subsp. lactis biovar diacetylactis was cloned into the EcoRI site of plasmid pUC18. This recombinant plasmid enabled Escherichia coli K-12 to transport and utilize citrate as a source of energy, indicating expression of the citrate permease from L. lactis biovar diacetylactis. The citrate permease was under the control of the lac promoter of pUC18. Genetic expression of the Cit+ plasmid in maxicells revealed that the plasmid encoded two polypeptides of 47 and 32 kilodaltons, determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Images PMID:2117878

Mammary Cancer and Activation of Transposable Elements

DTIC Science & Technology

2015-03-01

EGFP). No other cell type in the mammary fat pad was observed to express EGFP. Wholemount and FACS analyses of mammary fat pads after involution from...were sacrificed for PI-MEC isolation in groups of up to 4 control or cancer-prone uniparous or triparous females. Both 4 th mammary fat pads were...to unknown reason (n=46), and smaller numbers of animals with various conditions (malocclusion, head tilt , dystocia, respiratory complaints, identity

Effect of Yiguanjian decoction on cell differentiation and proliferation in CCl4-treated mice

PubMed Central

Wang, Xiao-Ling; Jia, Dong-Wei; Liu, Hui-Yang; Yan, Xiao-Feng; Ye, Ting-Jie; Hu, Xu-Dong; Li, Bo-Qin; Chen, Yong-Liang; Liu, Ping

2012-01-01

AIM: To investigate the cellular mechanisms of action of Yiguanjian (YGJ) decoction in treatment of chronic hepatic injury. METHODS: One group of mice was irradiated, and received enhanced green fluorescent protein (EGFP)-positive bone marrow transplants followed by 13 wk of CCl4 injection and 6 wk of oral YGJ administration. A second group of Institute for Cancer Research mice was treated with 13 wk of CCl4 injection and 6 wk of oral YGJ administration. Liver function, histological changes in the liver, and Hyp content were analyzed. The expression of α-smooth muscle actin (α-SMA), F4/80, albumin (Alb), EGFP, mitogen-activated protein kinase-2 (PKM2), Ki-67, α fetoprotein (AFP), monocyte chemotaxis protein-1 and CC chemokine receptor 2 were assayed. RESULTS: As hepatic damage progressed, EGFP-positive marrow cells migrated into the liver and were mainly distributed along the fibrous septa. They showed a conspicuous coexpression of EGFP with α-SMA and F4/80 but no coexpression with Alb. Moreover, the expression of PKM2, AFP and Ki-67 was enhanced dynamically and steadily over the course of liver injury. YGJ abrogated the increases in the number of bone marrow-derived fibrogenic cells in the liver, inhibited expression of both progenitor and mature hepatocyte markers, and reduced fibrogenesis. CONCLUSION: YGJ decoction improves liver fibrosis by inhibiting the migration of bone marrow cells into the liver as well as inhibiting their differentiation and suppressing the proliferation of both progenitors and hepatocytes in the injured liver. PMID:22783047

Transgenic fluorescent zebrafish Tg(fli1:EGFP)y¹ for the identification of vasotoxicity within the zFET.

PubMed

Delov, Vera; Muth-Köhne, Elke; Schäfers, Christoph; Fenske, Martina

2014-05-01

The fish embryo toxicity test (FET) is currently one of the most advocated animal alternative tests in ecotoxicology. To date, the application of the FET with zebrafish (zFET) has focused on acute toxicity assessment, where only lethal morphological effects are accounted for. An application of the zFET beyond acute toxicity, however, necessitates the establishment of more refined and quantifiable toxicological endpoints. A valuable tool in this context is the use of gene expression-dependent fluorescent markers that can even be measured in vivo. We investigated the application of embryos of Tg(fli1:EGFP)(y1) for the identification of vasotoxic substances within the zFET. Tg(fli1:EGFP)(y1) fish express enhanced GFP in the entire vasculature under the control of the fli1 promoter, and thus enable the visualization of vascular defects in live zebrafish embryos. We assessed the fli1 driven EGFP-expression in the intersegmental blood vessels (ISVs) qualitatively and quantitatively, and found an exposure concentration related increase in vascular damage for chemicals like triclosan, cartap and genistein. The fluorescence endpoint ISV-length allowed an earlier and more sensitive detection of vasotoxins than the bright field assessment method. In combination with the standard bright field morphological effect assessment, an increase in significance and value of the zFET for a mechanism-specific toxicity evaluation was achieved. This study highlights the benefits of using transgenic zebrafish as convenient tools for identifying toxicity in vivo and to increase sensitivity and specificity of the zFET. Copyright © 2014 Elsevier B.V. All rights reserved.

Layer-by-layer assembly of small interfering RNA and poly(ethyleneimine) for substrate-mediated electroporation with high efficiency.

PubMed

Fujimoto, Hiroyuki; Kato, Koichi; Iwata, Hiroo

2010-05-01

Electroporation microarrays have been developed for the high-throughput transfection of expression constructs and small interfering RNAs (siRNAs) into living mammalian cells. These techniques have potential to provide a platform for the cell-based analysis of gene functions. One of the key issues associated with microarray technology is the efficiency of transfection. The capability of attaining reasonably high transfection efficiency is the basis for obtaining functional data without false negatives. In this study, we aimed at improving the transfection efficiency in the system that siRNA loaded on an electrode is electroporated into cells cultured directly on the electrode. The strategy we adopted here is to increase the surface density of siRNA loaded onto electrodes. For this purpose, the layer-by-layer assembly of siRNA and cationic polymers, branched or linear form of poly(ethyleneimine), was performed. The multilayer thus obtained was characterized by infrared reflection-adsorption spectroscopy and surface plasmon resonance analysis. Transfection efficiency was evaluated in a system that siRNA specific for enhanced green fluorescent protein (EGFP) was electroporated on the electrode into human embryonic kidney cells stably transformed with the EGFP gene. The suppression of EGFP expression was assessed by fluorescence microscopy and flow cytometry. Our data showed that the layer-by-layer assembly of siRNA with branched poly(ethyleneimine) facilitated to increase the surface density of loaded siRNA. As a result, the expression of EGFP gene in the electroporated cells was suppressed much more on the electrodes with the multilayer of siRNA than that with the monolayer.

Cloning of a Recombinant Plasmid Encoding Thiol-Specific Antioxidant Antigen (TSA) Gene of Leishmania majorand Expression in the Chinese Hamster Ovary Cell Line.

PubMed

Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi

2012-01-01

TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.

PSI:Biology-Materials Repository: A Biologist’s Resource for Protein Expression Plasmids

PubMed Central

Cormier, Catherine Y.; Park, Jin G.; Fiacco, Michael; Steel, Jason; Hunter, Preston; Kramer, Jason; Singla, Rajeev; LaBaer, Joshua

2011-01-01

The Protein Structure Initiative:Biology-Materials Repository (PSI:Biology-MR; MR; http://psimr.asu.edu) sequence-verifies, annotates, stores, and distributes the protein expression plasmids and vectors created by the Protein Structure Initiative (PSI). The MR has developed an informatics and sample processing pipeline that manages this process for thousands of samples per month from nearly a dozen PSI centers. DNASU (http://dnasu.asu.edu), a freely searchable database, stores the plasmid annotations, which include the full-length sequence, vector information, and associated publications for over 130,000 plasmids created by our laboratory, by the PSI and other consortia, and by individual laboratories for distribution to researchers worldwide. Each plasmid links to external resources, including the PSI Structural Biology Knowledgebase (http://sbkb.org), which facilitates cross-referencing of a particular plasmid to additional protein annotations and experimental data. To expedite and simplify plasmid requests, the MR uses an expedited material transfer agreement (EP-MTA) network, where researchers from network institutions can order and receive PSI plasmids without institutional delays. Currently over 39,000 protein expression plasmids and 78 empty vectors from the PSI are available upon request from DNASU. Overall, the MR’s repository of expression-ready plasmids, its automated pipeline, and the rapid process for receiving and distributing these plasmids more effectively allows the research community to dissect the biological function of proteins whose structures have been studied by the PSI. PMID:21360289

Establishment and characterization of a brain cell line from sea perch, Lateolabrax japonicus.

PubMed

Le, Yao; Li, Yunlong; Jin, Yilin; Jia, Peng; Jia, Kuntong; Yi, Meisheng

2017-10-01

A continuous cell line, designated LJB, derived from the brain of sea perch (Lateolabrax japonicus) was established. LJB cells have been subcultured for more than 60 times in Dulbecco's modified Eagle's medium (DMEM) supplemented with 15% fetal bovine serum (FBS) since the initial primary culture. LJB cells exhibited maximum growth rate at 28°C in DMEM supplemented with 20% FBS. Cytogenetic analysis indicated that the modal chromosome number was 48, which was identical with the chromosome number of embryonic stem-like cells of sea perch. Comparison of the 18S ribosomal RNA gene sequences of LJB cells and sea perch confirmed that LJB cells originated from sea perch. After transfected with pEGFP-N3 plasmid, LJB cells showed a transfection efficiency of about 40% which was indicated by the percentage of cells expressing green fluorescence protein, indicating the potential application of LJB cells in gene expression studies. Cytopathic effect was clearly observed, and RNA-dependent RNA polymerase gene was also detected in LJB cells post red-spotted grouper nervous necrosis virus (RGNNV) infection. Furthermore, virus replication was confirmed by quantitative RT-PCR, virus titer, and transmission electron microscopy assay in RGNNV-infected LJB cells. The LJB cell line might be used as an ideal in vitro tool for analyzing and understanding the mechanisms of nervous necrosis virus-host interaction.

Bone-Derived Stem Cells Repair the Heart after Myocardial Infarction Through Transdifferentiation and Paracrine Signaling Mechanisms

PubMed Central

Duran, Jason M.; Makarewich, Catherine A.; Sharp, Thomas E.; Starosta, Timothy; Fang, Zhu; Hoffman, Nicholas E.; Chiba, Yumi; Madesh, Muniswamy; Berretta, Remus M.; Kubo, Hajime; Houser, Steven R.

2013-01-01

Rationale Autologous bone marrow- or cardiac-derived stem cell therapy for heart disease has demonstrated safety and efficacy in clinical trials but functional improvements have been limited. Finding the optimal stem cell type best suited for cardiac regeneration is key toward improving clinical outcomes. Objective To determine the mechanism by which novel bone-derived stem cells support the injured heart. Methods and Results Cortical bone stem cells (CBSCs) and cardiac-derived stem cells (CDCs) were isolated from EGFP+ transgenic mice and were shown to express c-kit and Sca-1 as well as 8 paracrine factors involved in cardioprotection, angiogenesis and stem cell function. Wild-type C57BL/6 mice underwent sham operation (n=21) or myocardial infarction (MI) with injection of CBSCs (n=67), CDCs (n=36) or saline (n=60). Cardiac function was monitored using echocardiography. Only 2/8 paracrine factors were detected in EGFP+ CBSCs in vivo (basic fibroblast growth factor and vascular endothelial growth factor) and this expression was associated with increased neovascularization of the infarct border zone. CBSC therapy improved survival, cardiac function, regional strain, attenuated remodeling, and decreased infarct size relative to CDC- or saline-treated MI controls. By 6 weeks, EGFP+ cardiomyocytes, vascular smooth muscle and endothelial cells could be identified in CBSC- but not in CDC-treated animals. EGFP+ CBSC-derived isolated myocytes were smaller and more frequently mononucleated, but were functionally indistinguishable from EGFP- myocytes. Conclusions CBSCs improve survival, cardiac function, and attenuate remodeling through two mechanisms:1) secretion of pro-angiogenic factors that stimulate endogenous neovascularization, and 2) differentiation into functional adult myocytes and vascular cells. PMID:23801066

Development of a green fluorescent tagged strain of Aspergillus carbonarius to monitor fungal colonization in grapes.

PubMed

Crespo-Sempere, A; López-Pérez, M; Martínez-Culebras, P V; González-Candelas, L

2011-08-02

An enhanced green fluorescent protein has been used to tag an OTA-producing strain of Aspergillus carbonarius (W04-40) isolated from naturally infected grape berries. Transformation of the fungus was mediated by Agrobacterium tumefaciens. The most efficient transformation occurred when the co-cultivation was done with 10(4) conidia due to higher frequency of resistance colonies (894 per 10(4) conidia) and lower background obtained. To confirm the presence of the hph gene in hygromycin resistant colonies, 20 putative transformants were screened by PCR analysis. The hph gene was identified in all the transformants. Variation on the expression levels of the eGFP was detected among the transformants and 50% of them appeared bright green fluorescent under the microscope. Microscopic analysis of all the bright fluorescent transformants revealed homogeneity of the fluorescent signal, which was clearly visible in the hyphae as well as in the conidia. eGFP expression in A. carbonarius was shown to be stable in all transformants. Confocal Laser scanning microscopy images of grape berries infected with the eGFP transformant demonstrated fungal penetration into the berry tissues. OTA production was importantly increased in the eGFP transformant in comparison with the wild type strain and pathogenicity on grape berries was slightly decreased after four days of inoculation. However, no differences in virulence were found after seven days of inoculation, thus allowing utilization of this eGFP mutant for in situ analysis of A. carbonarius infection of grape berries. To our knowledge, this is the first report describing the construction of a GFP-tagged strain belonging to Aspergillus section Nigri for monitoring Aspergillus rot on grape berries. Copyright © 2011 Elsevier B.V. All rights reserved.

Lentivirus Vectors Incorporating the Immunoglobulin Heavy Chain Enhancer and Matrix Attachment Regions Provide Position-Independent Expression in B Lymphocytes

PubMed Central

Lutzko, Carolyn; Senadheera, Dinithi; Skelton, Dianne; Petersen, Denise; Kohn, Donald B.

2003-01-01

In the present studies we developed lentivirus vectors with regulated, consistent transgene expression in B lymphocytes by incorporating the immunoglobulin heavy chain enhancer (Eμ) with and without associated matrix attachment regions (EμMAR) into lentivirus vectors. Incorporation of these fragments upstream of phosphoglycerate kinase (PGK) or cytomegalovirus promoters resulted in a two- to threefold increase in enhanced green fluorescent protein (EGFP) mean fluorescence intensity (MFI) in B-lymphoid but not T-lymphoid, myeloid, fibroblast, or carcinoma cell lines. A 1-log increase in EGFP expression was observed in B-lymphoid cells (but not myeloid cells) differentiated from human CD34+ progenitors in vitro transduced with Eμ- and EμMAR-containing lentivectors. Lastly, we evaluated the expression from the EμMAR element in mice 2 to 24 weeks posttransplant with transduced hematopoietic stem cells. In mice receiving vectors with the Eμ and EμMAR elements upstream of the PGK promoter, there was a 2- to 10-fold increase in EGFP expression in B cells (but not other cell types). Evaluation of the coefficient of variation of expression among different cell types demonstrated that consistent, position-independent transgene expression was observed exclusively in B cells transduced with the EμMAR-containing vector and not other cells types or vectors. Proviral genomes with the EμMAR element had increased chromatin accessibility, which likely contributed to the position independence of expression in B lymphocytes. In summary, incorporation of the EμMAR element in lentivirus vectors resulted in enhanced, position-independent expression in primary B lymphocytes. These vectors provide a useful tool for the study of B-lymphocyte biology and the development of gene therapy for disorders affecting B lymphocytes, such as immune deficiencies. PMID:12805432

[Construction of plant expression plasmid of chimera SBR-CT delta A1].

PubMed

Mai, Sui; Ling, Junqi

2003-08-01

The purpose of this study is to construct plant expression plasmid containing the gene encoding chimera SBR-CT delta A1. The target gene fragment P2, including the gene-encoded chimera SBR-CT delta A1 (3,498-5,378 bp), was obtained by standard PCR amplification. The PCR products were ligated with pGEM-easy vector through TA clone to form plasmid pTSC. The plasmid pTSC and plasmid pPOKII were digested by restricted endonuclease BamHI and KpnI, and the digested products were extracted and purified for recombination. Then the purified P2 and plasmid pPOKII were recombined by T4 DNA ligase to form recombinant plasmid pROSC; inserting bar gene into the plasmid and form pROSB plasmid. The recombined plasmids were isolated and identified by restricted endonuclease cutting and Sanger dideoxy DNA sequencing. P2 gene was linked to pPOKII plasmid and formed recombinant plasmid pROSC. The DNA sequence and orientation were corrected. And bar gene was inserted into pPOSC and form recombinant plasmid pROSB. Plant expression vector pROSC and pROSB containing the gene encoding chimera SBR-CT delta A1, which may provide useful experiment foundation for further study on edible vaccine against caries have been successfully constructed.

Enduring high-efficiency in vivo transfection of neurons with non-viral magnetoparticles in the rat visual cortex for optogenetic applications.

PubMed

Soto-Sánchez, Cristina; Martínez-Navarrete, Gema; Humphreys, Lawrence; Puras, Gustavo; Zarate, Jon; Pedraz, José Luis; Fernández, Eduardo

2015-05-01

This work demonstrates the successful long-term transfection in vivo of a DNA plasmid vector in rat visual cortex neurons using the magnetofection technique. The transfection rates reached values of up to 97% of the neurons after 30days, comparable to those achieved by viral vectors. Immunohistochemical treatment with anti-EGFP antibodies enhanced the detection of the EYFP-channelrhodopsin expression throughout the dendritic trees and cell bodies. These results show that magnetic nanoparticles offer highly efficient and enduring in vivo high-rate transfection in identified neurons of an adult mammalian brain and suggest that the magnetotechnique facilitates the introduction of large functional genetic material like channelrhodopsin with safe non-viral vectors using minimally invasive approaches. Gene therapy may be one of the treatment modalities for neurological diseases in the future. The use of viral transfection remains a concern due to restrictions to the size limit of the genetic material able to be packed, as well as safety issues. In this work, the authors evaluated magnetoplexes as an alternative vehicle. The results showed very promising data in that these nanoparticles could offer high transfection efficiency. Copyright © 2015 Elsevier Inc. All rights reserved.

Ultrasound enhances in vivo tumor expression of plasmid DNA by PEG-introduced cationized dextran.

PubMed

Hosseinkhani, Hossein; Tabata, Yasuhiko

2005-11-28

This study is an investigation to experimentally confirm whether or not ultrasound (US) irradiation is effective in enhancing the in vivo gene expression of plasmid DNA in tumor. Dextran was cationized by introducing spermine to the hydroxyl groups to allow to polyionically complex with a plasmid DNA. The cationized dextran prepared was additionally modified with poly(ethylene glycol) (PEG) molecules which have an active ester and methoxy groups at each terminal, to obtain cationized dextran with different percentages of PEG introduced. Various cationized dextrans with or without PEG introduction were mixed with a plasmid DNA of LacZ to form cationized dextran-plasmid DNA complexes. Electrophoretical examination revealed that the plasmid DNA was complexed both with the cationized dextran and PEG-introduced cationized dextran, irrespective of the PEG introduction percentage, although the higher N/P ratio was needed for plasmid DNA complexation with the latter. By complexation with the cationized dextran, the zeta potential of plasmid DNA was changed to be positive. The charge of PEG-introduced cationized dextran-plasmid DNA complexes became close to 0 mV as their percentage of PEG introduced increased, although the molecular size was about 250 nm, irrespective of the PEG introduction. When cationized dextran-plasmid DNA complexes with or without PEG introduction were intravenously injected to mice carrying a subcutaneous Meth-AR-1 fibrosarcoma mass and the subsequent US irradiation to the tumor mass percutaneously, the PEG-introduced cationized dextran-plasmid DNA complex plus US irradiation enhanced the tumor level of gene expression to a significantly high extent compared with the cationized dextran-plasmid DNA complex and free plasmid DNA with or without US irradiation. The enhanced level depended on the time period and timing of US irradiation. Fluorescent microscopic studies revealed that the localization of plasmid DNA and the gene expression were observed in the tumor tissue injected with the PEG-introduced cationized dextran-plasmid DNA complex plus the subsequent US irradiation. We conclude that complexation with the PEG-introduced cationized dextran combined with US irradiation is a promising way to target the plasmid DNA to the tumor for gene expression.

Function analysis of Ac-PCNA and Sf-PCNA during the Autographa californica multiple nucleopolyhedrovirus infection process.

PubMed

Fu, Yuejun; Wang, Ruisheng; Liang, Aihua

2018-06-01

The baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) possesses a gene, ac-pcna or ac49, which encodes a protein with similarity to proliferating cell nuclear antigen (PCNA). Homologs of this gene code for DNA polymerase processivity factors and are essential in the DNA replication systems. But the function of ac-pcna still remains unclear. To define the function of Ac-pcna in AcMNPV and Sf-pcna in host Sf9 cells, Bac-to-Bac baculovirus expression system was used to generate two recombinant baculoviruses: AcMNPV-Ac-pcna-EGFP and AcMNPV-Sf-pcna-EGFP. Results indicated that AcMNPV-mediated overexpression of Ac-PCNA and Sf-PCNA could stimulate replication of AcMNPV genome in the host Sf9 cells. Meanwhile, either AcMNPV-Ac-pcna-EGFP or AcMNPV-Sf-pcna-EGFP had a significant stimulating effect on Sf9 genome replication during infection. We also found that Ac-PCNA and Sf-PCNA could promote the production of budded virus. Ac-PCNA could improve the transcription level of ie2 gene dramatically and further improved the transcription of late gene, for example 38 K and vp39, at 12 h p.i.. Moreover, insecticidal potency test showed that the larvae of Beet armyworm in the AcMNPV-Ac-pcna-EGFP and AcMNPV-Sf-pcna-EGFP groups had a higher mortality rate (83.33 and 91.67%), a lower pupation rate (16.67 and 8.33%), and a lower emergence rate (6.67 and 3.33%), compared with those in AcMNPV-EGFP group. The function of Ac-PCNA and Sf-PCNA was confirmed in this study, which provided the theoretical foundation for using and modifying AcMNPV.

Effect of NeuroD gene silencing on the migration and invasion of human pancreatic cancer cells PANC-1.

PubMed

Wang, Yang; Su, Dong Wei; Gao, Li; Ding, Gui Ling; Ni, Can Rong; Zhu, Ming Hua

2014-07-01

The aim of this study is to investigate the influence of Lenti-EGFP-NeuroD-miR, RNAi lentiviral expression vector, on the expression level of NeuroD and migration, and invasion of PANC-1 cell line. PANC-1 cells were cultured and cotransfected with Lenti-EGFP-NeuroD-miR and Lenti-GFP. The infection rate of lentivirus was determined by fluorescence. The interfering effection by the expression of NeuroD mRNA in PANC-1 cells was analyzed by real-time PCR after transfected. Biological behavior of PANC-1 cells transinfected was observed, and the migration and invasion were studied by transwell assay. Intrapancreatic allografts model in nude mice was established to observe the effects of NeuroD on tumorigenesis, tumor growth, and invasion in vivo. The expression of NeuroD mRNA decreased significantly after RNAi lentivirus transinfecting PANC-1 cell. The cell's migration and invasion ability decreased obviously as soon as down regulate of NeuroD in PANC-1 cells. Comparing with control group, the tumors were smaller in size and the invasiveness was inhibited after 8 weeks intrapancreatic allografts in nude mice. Lenti-EGFP-NeuroD-miR transfected into PANC-1 cells shows a stable, effective, and especial blocking expression of NeuroD in mRNA level. The RNAi of lentiviral vector target NeuroD can reduce the migration and invasion abilities of PANC-1 cells.

High yield expression and purification of equilibrative nucleoside transporter 7 (ENT7) from Arabidopsis thaliana.

PubMed

Girke, Christopher; Arutyunova, Elena; Syed, Maria; Traub, Michaela; Möhlmann, Torsten; Lemieux, M Joanne

2015-09-01

Equilibrative nucleoside transporters (ENTs) facilitate the import of nucleosides and their analogs into cells in a bidirectional, non-concentrative manner. However, in contrast to their name, most characterized plant ENTs act in a concentrative manner. A direct characterization of any ENT protein has been hindered due to difficulties in overexpression and obtaining pure recombinant protein. The equilibrative nucleoside transporter 7 from Arabidopsis thaliana (AtENT7) was expressed in Xenopus laevis oocytes to assess mechanism of substrate uptake. Recombinant protein fused to enhanced green fluorescent protein (eGFP) was expressed in Pichia pastoris to characterize its oligomeric state by gel filtration and substrate binding by microscale thermophoresis (MST). AtENT7 expressed in X. laevis oocytes works as a classic equilibrative transporter. The expression of AtENT7-eGFP in the P. pastoris system yielded milligram amounts of pure protein that exists as stable homodimers. The concentration dependent binding of purine and pyrimidine nucleosides to the purified recombinant protein, assessed by MST, confirmed that AtENT7-eGFP is properly folded. For the first time the binding of nucleobases was observed for AtENT7. The availability of pure recombinant AtENT7 will permit detailed kinetic and structural studies of this unique member of the ENT family and, given the functional similarity to mammalian ENTs, will serve as a good model for understanding the structural basis of translocation mechanism for the family. Copyright © 2015 Elsevier B.V. All rights reserved.

Transgenic mice that accept Luciferase- or GFP-expressing syngeneic tumor cells at high efficiencies.

PubMed

Aoyama, Naoki; Miyoshi, Hiroyuki; Miyachi, Hitoshi; Sonoshita, Masahiro; Okabe, Masaru; Taketo, Makoto Mark

2018-05-11

Jellyfish green fluorescent protein (GFP) and firefly luciferase can serve as versatile tracking markers for identification and quantification of transplanted cancer cells in vivo. However, immune reactions against these markers can hamper the formation of syngraft tumors and metastasis that follows. Here, we report two transgenic (Tg) mouse lines that express nonfunctional mutant marker proteins, namely modified firefly luciferase (Luc2) or enhanced GFP (EGFP). These mice, named as Tg-mLuc2 and Tg-mEGFP, turned out to be immunologically tolerant to the respective tracking markers and thus efficiently accepted syngeneic cancer cells expressing the active forms of the markers. We then injected intrarectally the F 1 hybrid Tg mice (BALB/c × C57BL/6J) with Colon-26 (C26) colon cancer cells that originated from a BALB/c mouse. Even when C26 cells expressed active Luc2 or EGFP, they formed primary tumors in the Tg mice with only 10 4 cells per mouse compared with more than 10 6 cells required in the nontransgenic BALB/c hosts. Furthermore, we detected metastatic foci of C26 cells in the liver and lungs of the Tg mice by tracking the specific reporter activities. These results show the usefulness of the Tg mouse lines as recipients for transplantation experiments with the non-self tracking marker-expressing cells. © 2018 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

Differential secretion pathways of proteins fused to the Escherichia coli maltose binding protein (MBP) in Pichia pastoris.

PubMed

Moua, Pachai S; Gonzalez, Alfonso; Oshiro, Kristin T; Tam, Vivian; Li, Zhiguo Harry; Chang, Jennifer; Leung, Wilson; Yon, Amy; Thor, Der; Venkatram, Sri; Franz, Andreas H; Risser, Douglas D; Lin-Cereghino, Joan; Lin-Cereghino, Geoff P

2016-08-01

The Escherichia coli maltose binding protein (MBP) is an N-terminal fusion partner that was shown to enhance the secretion of some heterologous proteins from the yeast Pichia pastoris, a popular host for recombinant protein expression. The amount of increase in secretion was dependent on the identity of the cargo protein, and the fusions were proteolyzed prior to secretion, limiting its use as a purification tag. In order to overcome these obstacles, we used the MBP as C-terminal partner for several cargo peptides. While the Cargo-MBP proteins were no longer proteolyzed in between these two moieties when the MBP was in this relative position, the secretion efficiency of several fusions was lower than when MBP was located at the opposite end of the cargo protein (MBP-Cargo). Furthermore, fluorescence analysis suggested that the MBP-EGFP and EGFP-MBP proteins followed different routes within the cell. The effect of several Pichia pastoris beta-galactosidase supersecretion (bgs) strains, mutants showing enhanced secretion of select reporters, was also investigated on both MBP-EGFP and EGFP-MBP. While the secretion efficiency, proteolysis and localization of the MBP-EGFP was influenced by the modified function of Bgs13, EGFP-MBP behavior was not affected in the bgs strain. Taken together, these results indicate that the location of the MBP in a fusion affects the pathway and trans-acting factors regulating secretion in P. pastoris. Copyright © 2016 Elsevier Inc. All rights reserved.

Fluorescence lifetime dynamics of eGFP in protein aggregates with expanded polyQ

NASA Astrophysics Data System (ADS)

Ghukasyan, Vladimir; Hsu, Chih-Chun; Liu, Chia-Rung; Kao, Fu-Jen; Cheng, Tzu-Hao

2009-02-01

Expanding a polyglutamine (polyQ) stretch at the N-terminus of huntingtin protein is the main cause of the neurodegenerative disorder Huntington's disease (HD). Expansion of polyQ above 39 residues has an inherent propensity to form amyloid-like fibrils and aggregation of the mutant protein is found to be a critical component for abnormal pathology of HD. Using yeast Saccharomyces cerevisiae as a model system, we have observed a decrease in fluorescence lifetime of the enhanced green fluorescence protein (eGFP) fused to 97 successive glutamine residues (97Q). Compared to the sample expressing evenly distributed eGFP, the 97Q-eGFP fusion proteins show the formation of grain-like particles and the reduction of eGFP lifetime by ~250 ps as measured by time-correlated single-photon counting technique (TCSPC). More importantly, this phenomenon does not appear in Hsp104-deficient cells. The gene product of HSP104 is required for the formation of polyQ aggregates in yeast cells; therefore, the cellular 97Q-eGFP become soluble and evenly distributive in the absence of Hsp104. Under this condition, the lifetime value of 97Q-eGFP is close to the one exhibited by eGFP alone. The independence of the effect of the environmental parameters, such as pH and refraction index is demonstrated. These data indicate that the fluorescence lifetime dynamics of eGFP is linked to the process of polyQ protein aggregation per se.

Expression Plasmids for Use in Candida glabrata

PubMed Central

Zordan, Rebecca E.; Ren, Yuxia; Pan, Shih-Jung; Rotondo, Giuseppe; Peñas, Alejandro De Las; Iluore, Joseph; Cormack, Brendan P.

2013-01-01

We describe a series of CEN/ARS episomal plasmids containing different Candida glabrata promoters, allowing for a range of constitutive or regulated expression of proteins in C. glabrata. The set of promoters includes three constitutive promoters (EGD2pr, HHT2pr, PDC1pr), two macrophage/phagocytosis-induced promoters (ACO2pr, LYS21pr), and one nutritionally regulated promoter (MET3pr). Each promoter was cloned into two plasmid backbones that differ in their selectable marker, URA3, or the dominant-selectable NAT1 gene, which confers resistance to the drug nourseothricin. Expression from the 12 resulting plasmids was assessed using GFP as a reporter and flow cytometry or quantitative reverse-transcription polymerase chain reaction to assess expression levels. Together this set of plasmids expands the toolkit of expression vectors available for use with C. glabrata. PMID:23934995

Identification of the Doublesex protein binding sites that activate expression of lozenge in the female genital disc in Drosophila melanogaster.

PubMed

Wagamitsu, Shunsuke; Takase, Dan; Aoki, Fugaku; Suzuki, Masataka G

2017-02-01

Normal sexual differentiation in the genital organs is essential for the animal species that use sexual reproduction. Although it is known that doublesex (dsx) is required for the sexual development of the genitalia in various insect species, the direct target genes responsible for the sexual differentiation of the genitalia have not been identified. The lozenge (lz) gene is expressed in the female genital disc and is essential for developments of spermathecae and accessory glands in Drosophila melanogaster. The female-specific isoform of DSX (DSXF) is required for activating lz expression in the female genital disc. However, it still remains unclear whether the DSXF directly activates the transcription of lz in the female genital disc. In this study, we found two sequences (lz-DBS1 and lz-DBS2) within lz locus that showed high homoloty to the DSX binding motif identified previously. Competition assays using recombinant DSX DNA-binding domain (DSX-DBD) protein verified that the DSX-DBD protein bound to lz-DBS1 and lz-DBS2 in a sequence-specific manner with lower affinity than to the known DSX binding site in the bric-à-brac 1 (bab1) gene. Reporter gene analyses revealed that a 2.5-kbp lz genomic fragment containing lz-DBS1 and lz-DBS2 drove reporter gene (EGFP) expression in a manner similar to endogenous lz expression in the female genital disc. Mutations in lz-DBS1 alone significantly reduced the area of EGFP-expressing region, while EGFP expression in the female genital disc was abolished when both sites were mutated. These results demonstrated that DSX directly activates female-specific lz expression in the genital disc through lz-DBS1 and lz-DBS2. Copyright © 2017 Elsevier B.V. All rights reserved.

Quantification of green fluorescent protein by in vivo imaging, PCR, and flow cytometry: comparison of transgenic strains and relevance for fetal cell microchimerism.

PubMed

Fujiki, Yutaka; Tao, Kai; Bianchi, Diana W; Giel-Moloney, Maryann; Leiter, Andrew B; Johnson, Kirby L

2008-02-01

Animal models are increasingly being used for the assessment of fetal cell microchimerism in maternal tissue. We wished to determine the optimal transgenic mouse strain and analytic technique to facilitate the detection of rare transgenic microchimeric fetal cells amongst a large number of maternal wild-type cells. We evaluated two strains of mice transgenic for the enhanced green fluorescent protein (EGFP): a commercially available, commonly used strain (C57BL/6-Tg(ACTB-EGFP)10sb/J) (CAG) and a newly created strain (ROSA26-EGFP) using three different techniques: in vivo and ex vivo fluorescent imaging (for whole body and dissected organs, respectively), PCR amplification of gfp, and flow cytometry (FCM). By fluorescent imaging, organs from CAG mice were 10-fold brighter than organs from ROSA26-EGFP mice (P < 0.0001). By PCR, more transgene from CAG mice was detected compared to ROSA26-EGFP mice (P = 0.04). By FCM, ROSA26-EGFP cell fluorescence was more uniform than CAG cells. A greater proportion of cells from ROSA26-EGFP organs were positive for EGFP than cells from CAG organs, but CAG mice had a greater proportion of cells with the brightest fluorescent intensity. Each transgenic strain possesses characteristics that make it useful under specific experimental circumstances. The CAG mouse model is preferable when experiments require brighter cells, whereas ROSA26-EGFP is more appropriate when uniform or ubiquitous expression is more important than brightness. Investigators must carefully select the transgenic strain most suited to the experimental design to obtain the most consistent and reproducible data. In vivo imaging allows for phenotypic evaluation of whole animals and intact organs; however, we did not evaluate its utility for the detection of rare, fetal microchimeric cells in the maternal organs. Finally, while PCR amplification of a paternally inherited transgene does allow for the quantitative determination of rare microchimeric cells, FCM allows for both quantitative and qualitative evaluations of fetal cells at very high sensitivity in a plethora of maternal organs. (c) 2008 International Society for Analytical Cytology

Genetic transformation of a clinical (genital tract), plasmid-free isolate of Chlamydia trachomatis: engineering the plasmid as a cloning vector.

PubMed

Wang, Yibing; Kahane, Simona; Cutcliffe, Lesley T; Skilton, Rachel J; Lambden, Paul R; Persson, Kenneth; Bjartling, Carina; Clarke, Ian N

2013-01-01

Our study had three objectives: to extend the plasmid-based transformation protocol to a clinical isolate of C. trachomatis belonging to the trachoma biovar, to provide "proof of principle" that it is possible to "knock out" selected plasmid genes (retaining a replication competent plasmid) and to investigate the plasticity of the plasmid. A recently developed, plasmid-based transformation protocol for LGV isolates of C. trachomatis was modified and a plasmid-free, genital tract C. trachomatis isolate from Sweden (SWFP-) was genetically transformed. Transformation of this non-LGV C. trachomatis host required a centrifugation step, but the absence of the natural plasmid removed the need for plaque purification of transformants. Transformants expressed GFP, were penicillin resistant and iodine stain positive for accumulated glycogen. The transforming plasmid did not recombine with the host chromosome. A derivative of pGFP::SW2 carrying a deletion of the plasmid CDS5 gene was engineered. CDS5 encodes pgp3, a protein secreted from the inclusion into the cell cytoplasm. This plasmid (pCDS5KO) was used to transform C. trachomatis SWFP-, and established that pgp3 is dispensable for plasmid function. The work shows it is possible to selectively delete segments of the chlamydial plasmid, and this is the first step towards a detailed molecular dissection of the role of the plasmid. The 3.6 kb β-galactosidase cassette was inserted into the deletion site of CDS5 to produce plasmid placZ-CDS5KO. Transformants were penicillin resistant, expressed GFP and stained for glycogen. In addition, they expressed β-galactosidase showing that the lacZ cassette was functional in C. trachomatis. An assay was developed that allowed the visualisation of individual inclusions by X-gal staining. The ability to express active β-galactosidase within chlamydial inclusions is an important advance as it allows simple, rapid assays to measure directly chlamydial infectivity without the need for plaquing, fluorescence or antibody staining.

Plasmids for variable expression of proteins targeted to the mitochondrial matrix or intermembrane space.

PubMed

Newman, Laura E; Schiavon, Cara; Kahn, Richard A

2016-01-01

We describe the construction and uses of a series of plasmids for directing expression to varied levels of exogenous proteins targeted to the mitochondrial matrix or intermembrane space. We found that the level of protein expression achieved, the kinetics of expression and mitochondrial import, and half-life after import can each vary with the protein examined. These factors should be considered when directing localization of an exogenous protein to mitochondria for rescue, proteomics, or other approaches. We describe the construction of a collection of plasmids for varied expression of proteins targeted to the mitochondrial matrix or intermembrane space, using previously defined targeting sequences and strength CMV promoters. The limited size of these compartments makes them particularly vulnerable to artifacts from over-expression. We found that different proteins display different kinetics of expression and import that should be considered when analyzing results from this approach. Finally, this collection of plasmids has been deposited in the Addgene plasmid repository to facilitate the ready access and use of these tools.

Primitive erythrocytes are generated from hemogenic endothelial cells.

PubMed

Stefanska, Monika; Batta, Kiran; Patel, Rahima; Florkowska, Magdalena; Kouskoff, Valerie; Lacaud, Georges

2017-07-25

Primitive erythroblasts are the first blood cells generated during embryonic hematopoiesis. Tracking their emergence both in vivo and in vitro has remained challenging due to the lack of specific cell surface markers. To selectively investigate primitive erythropoiesis, we have engineered a new transgenic embryonic stem (ES) cell line, where eGFP expression is driven by the regulatory sequences of the embryonic βH1 hemoglobin gene expressed specifically in primitive erythroid cells. Using this ES cell line, we observed that the first primitive erythroblasts are detected in vitro around day 1.5 of blast colony differentiation, within the cell population positive for the early hematopoietic progenitor marker CD41. Moreover, we establish that these eGFP + cells emerge from a hemogenic endothelial cell population similarly to their definitive hematopoietic counterparts. We further generated a corresponding βH1-eGFP transgenic mouse model and demonstrated the presence of a primitive erythroid primed hemogenic endothelial cell population in the developing embryo. Taken together, our findings demonstrate that both in vivo and in vitro primitive erythrocytes are generated from hemogenic endothelial cells.

Development of Neutralization Assay Using an eGFP Chikungunya Virus.

PubMed

Deng, Cheng-Lin; Liu, Si-Qing; Zhou, Dong-Gen; Xu, Lin-Lin; Li, Xiao-Dan; Zhang, Pan-Tao; Li, Peng-Hui; Ye, Han-Qing; Wei, Hong-Ping; Yuan, Zhi-Ming; Qin, Cheng-Feng; Zhang, Bo

2016-06-28

Chikungunya virus (CHIKV), a member of the Alphavirus genus, is an important human emerging/re-emerging pathogen. Currently, there are no effective antiviral drugs or vaccines against CHIKV infection. Herein, we construct an infectious clone of CHIKV and an eGFP reporter CHIKV (eGFP-CHIKV) with an isolated strain (assigned to Asian lineage) from CHIKV-infected patients. The eGFP-CHIKV reporter virus allows for direct visualization of viral replication through the levels of eGFP expression. Using a known CHIKV inhibitor, ribavirin, we confirmed that the eGFP-CHIKV reporter virus could be used to identify inhibitors against CHIKV. Importantly, we developed a novel and reliable eGFP-CHIKV reporter virus-based neutralization assay that could be used for rapid screening neutralizing antibodies against CHIKV.

ФC31 Integrase-Mediated Isolation and Characterization of Novel Safe Harbors for Transgene Expression in the Pig Genome

PubMed Central

Bi, Yanzhen; Hua, Zaidong; Ren, Hongyan; Zhang, Liping; Xiao, Hongwei; Liu, Ximei; Hua, Wenjun; Mei, Shuqi; Molenaar, Adrian; Laible, Götz; Zheng, Xinmin

2018-01-01

Programmable nucleases have allowed the rapid development of gene editing and transgenics, but the technology still suffers from the lack of predefined genetic loci for reliable transgene expression and maintenance. To address this issue, we used ФC31 integrase to navigate the porcine genome and identify the pseudo attP sites suitable as safe harbors for sustained transgene expression. The combined ФC31 integrase mRNA and an enhanced green fluorescence protein (EGFP) reporter donor were microinjected into one-cell zygotes for transgene integration. Among the resulting seven EGFP-positive piglets, two had transgene integrations at pseudo attP sites, located in an intergenic region of chromosome 1 (chr1-attP) and the 6th intron of the TRABD2A gene on chromosome 3 (chr3-attP), respectively. The integration structure was determined by TAIL-PCR and Southern blotting. Primary fibroblast cells were isolated from the two piglets and examined using fluorescence-activated cell sorting (FACS) and enzyme-linked immunosorbent assay (ELISA), which demonstrated that the chr1-attP site was more potent than chr3-attP site in supporting the EGFP expression. Both piglets had green feet under the emission of UV light, and pelleted primary fibroblast cells were green-colored under natural light, corroborating that the two pseudo attP sites are beneficial to transgene expression. The discovery of these two novel safe harbors for robust and durable transgene expression will greatly facilitate the use of transgenic pigs for basic, biomedical and agricultural studies and applications. PMID:29300364

Tissue- and agonist-specific regulation of human and murine plasminogen activator inhibitor-1 promoters in transgenic mice.

PubMed

Eren, M; Painter, C A; Gleaves, L A; Schoenhard, J A; Atkinson, J B; Brown, N J; Vaughan, D E

2003-11-01

Numerous studies have described regulatory factors and sequences that control transcriptional responses in vitro. However, there is a paucity of information on the qualitative and quantitative regulation of heterologous promoters using transgenic strategies. In order to investigate the physiological regulation of human plasminogen activator inhibitor type-1 (hPAI-1) expression in vivo compared to murine PAI-1 (mPAI-1) and to test the physiological relevance of regulatory mechanisms described in vitro, we generated transgenic mice expressing enhanced green fluorescent protein (EGFP) driven by the proximal -2.9 kb of the hPAI-1 promoter. Transgenic animals were treated with Ang II, TGF-beta1 and lipopolysaccharide (LPS) to compare the relative activation of the human and murine PAI-1 promoters. Ang II increased EGFP expression most effectively in brain, kidney and spleen, while mPAI-1 expression was quantitatively enhanced most prominently in heart and spleen. TGF-beta1 failed to induce activation of the hPAI-1 promoter but potently stimulated mPAI-1 in kidney and spleen. LPS administration triggered robust expression of mPAI-1 in liver, kidney, pancreas, spleen and lung, while EGFP was induced only modestly in heart and kidney. These results indicate that the transcriptional response of the endogenous mPAI-1 promoter varies widely in terms of location and magnitude of response to specific stimuli. Moreover, the physiological regulation of PAI-1 expression likely involves a complex interaction of transcription factors and DNA sequences that are not adequately replicated by in vitro functional studies focused on the proximal -2.9 kb promoter.

Structural and physiological studies of the Escherichia coli histidine operon inserted into plasmid vectors.

PubMed Central

Bruni, C B; Musti, A M; Frunzio, R; Blasi, F

1980-01-01

A fragment of deoxyribonucleic acid 5,300 base paris long and containing the promoter-proximal portion of the histidine operon of Escherichia coli K-12, has been cloned in plasmid pBR313 (plasmids pCB2 and pCB3). Restriction mapping, partial nucleotide sequencing, and studies on functional expression in vivo and on protein synthesis in minicells have shown that the fragment contains the regulatory region of the operon, the hisG, hisD genes, and part of the hisC gene. Another plasmid (pCB5) contained the hisG gene and part of the hisD gene. Expression of the hisG gene in the latter plasmid was under control of the tetracycline promoter of the pBR313 plasmid. The in vivo expression of the two groups of plasmids described above, as well as their effect on the expression of the histidine genes not carried by the plasmids but present on the host chromosome, has been studied. The presence of multiple copies of pCB2 or pCB3, but not of pCB5, prevented derepression of the chromosomal histidine operon. Possible interpretations of this phenomenon are discussed. Images PMID:6246067

Using the CRISPR/Cas9 system to eliminate native plasmids of Zymomonas mobilis ZM4.

PubMed

Cao, Qing-Hua; Shao, Huan-Huan; Qiu, Hui; Li, Tao; Zhang, Yi-Zheng; Tan, Xue-Mei

2017-03-01

The CRISPR/Cas system can be used to simply and efficiently edit the genomes of various species, including animals, plants, and microbes. Zymomonas mobilis ZM4 is a highly efficient, ethanol-producing bacterium that contains five native plasmids. Here, we constructed the pSUZM2a-Cas9 plasmid and a single-guide RNA expression plasmid. The pSUZM2a-Cas9 plasmid was used to express the Cas9 gene cloned from Streptococcus pyogenes CICC 10464. The single-guide RNA expression plasmid pUC-T7sgRNA, with a T7 promoter, can be used for the in vitro synthesis of single-guide RNAs. This system was successfully employed to knockout the upp gene of Escherichia coli and the replicase genes of native Z. mobilis plasmids. This is the first study to apply the CRISPR/Cas9 system of S. pyogenes to eliminate native plasmids in Z. mobilis. It provides a new method for plasmid curing and paves the way for the genomic engineering of Z. mobilis.

Development of a PCR-Based Reverse Genetics System for an Attenuated Duck Tembusu Virus Strain

PubMed Central

Wu, Xiaogang; Shi, Ying; Yan, Dawei; Li, Xuesong; Yan, Pixi; Gao, Xuyuan; Zhang, Yuee; Yu, Lei; Ren, Chaochao; Li, Guoxin; Yan, Liping; Teng, Qiaoyang; Li, Zejun

2016-01-01

The infectious disease caused by the duck Tembusu virus (DTMUV) has resulted in massive economic losses to the Chinese duck industry in China since 2010. Research on the molecular basis of DTMUV pathogenicity has been hampered by the lack of a reliable reverse genetics system for this virus. Here we developed a PCR-based reverse genetics system with high fidelity for the attenuated DTMUV strain FX2010-180P. The rescued virus was characterized by using both indirect immunofluorescence assays (IFA) and whole genome sequencing. The rescued virus (rFX2010-180P) grew to similar titers as compared with the wild-type virus in DF-1 cells, and had similar replication and immunogenicity properties in ducks. To determine whether exogenous proteins could be expressed from DTMUV, both an internal ribosomal entry site (IRES) and the enhanced green fluorescent protein (eGFP) gene were introduced between the NS5 gene and the 3' non-coding sequence of FX2010-180P. A recombinant DTMUV expressing eGFP was rescued, but eGFP expression was unstable after 4 passages in DF-1 cells due to a deletion of 1,294 nucleotides. The establishment of a reliable reverse genetics system for FX2010-180P provides a foundation for future studies of DTMUV. PMID:27248497

Development of a PCR-Based Reverse Genetics System for an Attenuated Duck Tembusu Virus Strain.

PubMed

Wu, Xiaogang; Shi, Ying; Yan, Dawei; Li, Xuesong; Yan, Pixi; Gao, Xuyuan; Zhang, Yuee; Yu, Lei; Ren, Chaochao; Li, Guoxin; Yan, Liping; Teng, Qiaoyang; Li, Zejun

2016-01-01

The infectious disease caused by the duck Tembusu virus (DTMUV) has resulted in massive economic losses to the Chinese duck industry in China since 2010. Research on the molecular basis of DTMUV pathogenicity has been hampered by the lack of a reliable reverse genetics system for this virus. Here we developed a PCR-based reverse genetics system with high fidelity for the attenuated DTMUV strain FX2010-180P. The rescued virus was characterized by using both indirect immunofluorescence assays (IFA) and whole genome sequencing. The rescued virus (rFX2010-180P) grew to similar titers as compared with the wild-type virus in DF-1 cells, and had similar replication and immunogenicity properties in ducks. To determine whether exogenous proteins could be expressed from DTMUV, both an internal ribosomal entry site (IRES) and the enhanced green fluorescent protein (eGFP) gene were introduced between the NS5 gene and the 3' non-coding sequence of FX2010-180P. A recombinant DTMUV expressing eGFP was rescued, but eGFP expression was unstable after 4 passages in DF-1 cells due to a deletion of 1,294 nucleotides. The establishment of a reliable reverse genetics system for FX2010-180P provides a foundation for future studies of DTMUV.

A highly sensitive quantitative cytosensor technique for the identification of receptor ligands in tissue extracts.

PubMed

Lenkei, Z; Beaudet, A; Chartrel, N; De Mota, N; Irinopoulou, T; Braun, B; Vaudry, H; Llorens-Cortes, C

2000-11-01

Because G-protein-coupled receptors (GPCRs) constitute excellent putative therapeutic targets, functional characterization of orphan GPCRs through identification of their endogenous ligands has great potential for drug discovery. We propose here a novel single cell-based assay for identification of these ligands. This assay involves (a) fluorescent tagging of the GPCR, (b) expression of the tagged receptor in a heterologous expression system, (c) incubation of the transfected cells with fractions purified from tissue extracts, and (d) imaging of ligand-induced receptor internalization by confocal microscopy coupled to digital image quantification. We tested this approach in CHO cells stably expressing the NT1 neurotensin receptor fused to EGFP (enhanced green fluorescent protein), in which neurotensin promoted internalization of the NT1-EGFP receptor in a dose-dependent fashion (EC(50) = 0.98 nM). Similarly, four of 120 consecutive reversed-phase HPLC fractions of frog brain extracts promoted internalization of the NT1-EGFP receptor. The same four fractions selectively contained neurotensin, an endogenous ligand of the NT1 receptor, as detected by radioimmunoassay and inositol phosphate production. The present internalization assay provides a highly specific quantitative cytosensor technique with sensitivity in the nanomolar range that should prove useful for the identification of putative natural and synthetic ligands for GPCRs.

A Stable Human-Cell System Overexpressing Cystic Fibrosis Transmembrane Conductance Regulator Recombinant Protein at the Cell Surface

PubMed Central

Dai, Qun; Aleksandrov, Andrei A.; Bajrami, Bekim; Diego, Pamela Ann; Wu, Xing; Ray, Marjorie; Naren, Anjaparavanda P.; Riordan, John R.; Yao, Xudong; DeLucas, Lawrence J.; Urbatsch, Ina L.; Kappes, John C.

2015-01-01

Recent human clinical trials results demonstrated successful treatment for certain genetic forms of cystic fibrosis (CF). To extend treatment opportunities to those afflicted with other genetic forms of CF disease, structural and biophysical characterization of CF transmembrane conductance regulator (CFTR) is urgently needed. In this study, CFTR was modified with various tags, including a His10 purification tag, the SUMOstar (SUMO*) domain, an extracellular FLAG epitope, or an enhanced green fluorescent protein (EGFP), each alone or in various combinations. Expressed in HEK293 cells, recombinant CFTR proteins underwent complex glycosylation, compartmentalized with the plasma membrane, and exhibited regulated chloride-channel activity with only modest alterations in channel conductance and gating kinetics. Surface CFTR expression level was enhanced by the presence of SUMO* on the N-terminus. Quantitative mass-spectrometric analysis indicated approximately 10% of the total recombinant CFTR (SUMO*-CFTRFLAG-EGFP) localized to the plasma membrane. Trial purification using dodecylmaltoside for membrane protein extraction reproducibly recovered 178 ± 56 μg SUMO*-CFTRFLAG-EGFP per billion cells at 80% purity. Fluorescence size-exclusion chromatography indicated purified CFTR was monodisperse. These findings demonstrate a stable mammalian cell expression system capable of producing human CFTR of sufficient quality and quantity to augment futrure CF drug discovery efforts, including biophysical and structural studies. PMID:25577540

Reprint of "versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16".

PubMed

Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra

2014-12-20

The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.

Versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16.

PubMed

Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra

2014-09-30

The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96 h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.

Developmental Activation of the Proteolipid Protein Promoter Transgene in Neuronal and Oligodendroglial Cells of Neostriatum in Mice

PubMed Central

Fulton, Daniel; Paez, Pablo; Spreur, Vilma; Handley, Vance; Colwell, Christopher S.; Campagnoni, Anthony; Fisher, Robin

2011-01-01

Prior studies suggest that non-canonical proteolipid protein (PLP) gene expression occurs during development in non-myelinating neurons as well as myelinating oligodendroglia in mammalian brain. To assess this possibility in neostriatum, a region of uncertain PLP gene expression in neurons, morphological and electrophysiological tools were used to determine phenotypes of cells with activation of a PLP promoter transgene during the early postnatal period in mice. PLP gene expression is evident in both neuronal and oligodendroglial phenotypes in developing neostriatum, a conclusion based on three novel observations: (1) An enhanced green fluorescent protein (EGFP) reporter of PLP promoter activation was localized in two distinct populations of cells, which exhibit collective, developmental differences of morphological and electrophysiological characteristics in accord with neuronal and oligodendroglial phenotypes of neostriatal cells found during the early postnatal period in both transgenic and wild-type mice. (2) The EGFP reporter of PLP promoter activation was appropriately positioned to serve as a regulator of PLP gene expression. It colocalized with native PLP proteins in both neuronal and oligodendroglial phenotypes; however, only soma-restricted PLP protein isoforms were found in the neuronal phenotype, while classic and soma-restricted PLP protein isoforms were found in the oligodendroglial phenotype. (3) As shown by EGFP reporter, PLP promoter activation was placed to regulate PLP gene expression in only one neuronal phenotype among the several that constitute neostriatum. It was localized in medium spiny neurons, but not large aspiny neurons. These outcomes have significant implications for the non-canonical functional roles of PLP gene expression in addition to myelinogenesis in mammalian brain, and are consistent with potentially independent pathologic loci in neurons during the course of human mutational disorders of PLP gene expression. PMID:21912090

Expression of solute carrier 7A4 (SLC7A4) in the plasma membrane is not sufficient to mediate amino acid transport activity.

PubMed

Wolf, Sabine; Janzen, Annette; Vékony, Nicole; Martiné, Ursula; Strand, Dennis; Closs, Ellen I

2002-06-15

Member 4 of human solute carrier family 7 (SLC7A4) exhibits significant sequence homology with the SLC7 subfamily of human cationic amino acid transporters (hCATs) [Sperandeo, Borsani, Incerti, Zollo, Rossi, Zuffardi, Castaldo, Taglialatela, Andria and Sebastio (1998) Genomics 49, 230-236]. It is therefore often referred to as hCAT-4 even though no convincing transport activity has been shown for this protein. We expressed SLC7A4 in Xenopus laevis oocytes, but could not detect any transport activity for cationic, neutral or anionic amino acids or for the polyamine putrescine. In addition, human glioblastoma cells stably overexpressing a fusion protein between SLC7A4 and the enhanced green fluorescent protein (EGFP) did not exhibit an increased transport activity for l-arginine. The lack of transport activity was not due to a lack of SLC7A4 protein expression in the plasma membrane, as in both cell types SLC7A4-EGFP exhibited a similar subcellular localization and level of protein expression as functional hCAT-EGFP proteins. The expression of SLC7A4 can be induced in NT2 teratocarcinoma cells by treatment with retinoic acid. However, also for this endogenously expressed SLC7A4, we could not detect any transport activity for l-arginine. Our data demonstrate that the expression of SLC7A4 in the plasma membrane is not sufficient to induce an amino acid transport activity in X. laevis oocytes or human cells. Therefore, SLC7A4 is either not an amino acid transporter or it needs additional (protein) factor(s) to be functional.

Expression of solute carrier 7A4 (SLC7A4) in the plasma membrane is not sufficient to mediate amino acid transport activity.

PubMed Central

Wolf, Sabine; Janzen, Annette; Vékony, Nicole; Martiné, Ursula; Strand, Dennis; Closs, Ellen I

2002-01-01

Member 4 of human solute carrier family 7 (SLC7A4) exhibits significant sequence homology with the SLC7 subfamily of human cationic amino acid transporters (hCATs) [Sperandeo, Borsani, Incerti, Zollo, Rossi, Zuffardi, Castaldo, Taglialatela, Andria and Sebastio (1998) Genomics 49, 230-236]. It is therefore often referred to as hCAT-4 even though no convincing transport activity has been shown for this protein. We expressed SLC7A4 in Xenopus laevis oocytes, but could not detect any transport activity for cationic, neutral or anionic amino acids or for the polyamine putrescine. In addition, human glioblastoma cells stably overexpressing a fusion protein between SLC7A4 and the enhanced green fluorescent protein (EGFP) did not exhibit an increased transport activity for l-arginine. The lack of transport activity was not due to a lack of SLC7A4 protein expression in the plasma membrane, as in both cell types SLC7A4-EGFP exhibited a similar subcellular localization and level of protein expression as functional hCAT-EGFP proteins. The expression of SLC7A4 can be induced in NT2 teratocarcinoma cells by treatment with retinoic acid. However, also for this endogenously expressed SLC7A4, we could not detect any transport activity for l-arginine. Our data demonstrate that the expression of SLC7A4 in the plasma membrane is not sufficient to induce an amino acid transport activity in X. laevis oocytes or human cells. Therefore, SLC7A4 is either not an amino acid transporter or it needs additional (protein) factor(s) to be functional. PMID:12049641

Fluorescent Arc/Arg3.1 indicator mice: a versatile tool to study brain activity changes in vitro and in vivo

PubMed Central

Grinevich, Valery; Kolleker, Alexander; Eliava, Marina; Takada, Naoki; Takuma, Hiroshi; Fukazawa, Yugo; Shigemoto, Ryuichi; Kuhl, Dietmar; Waters, Jack; Seeburg, Peter H.; Osten, Pavel

2014-01-01

The brain-specific immediate early gene Arc/Arg3.1 is induced in response to a variety of stimuli, including sensory and behavior-linked neural activity. Here we report the generation of transgenic mice, termed TgArc/Arg3.1-d4EGFP, expressing a 4-hour half-life form of enhanced green fluorescent protein (d4EGFP) under the control of the Arc/Arg3.1 promoter. We show that d4EGFP-mediated fluorescence faithfully reports Arc/Arg3.1 induction in response to physiological, pathological and pharmacological stimuli, and that this fluorescence permits electrical recording from activated neurons in the live mouse. Moreover, the fluorescent Arc/Arg3.1 indicator revealed activity changes in circumscribed brain areas in distinct modes of stress and in a mouse model of Alzheimer’s disease. These findings identify the TgArc/Arg3.1-d4EGFP mouse as a versatile tool to monitor Arc/Arg3.1 induction in neural circuits, both in vitro and in vivo. PMID:19628007

Transcriptional Response of Human Cells to Microbeam Irradiation with 2.1 MeV Alpha Particles

NASA Astrophysics Data System (ADS)

Hellweg, C. E.; Bogner, S.; Spitta, L.; Arenz, A.; Baumstark-Khan, C.; Greif, K. D.; Giesen, U.

Within the next decades an increasing number of human beings in space will be simultaneously exposed to different stimuli especially microgravity and radiation To assess the risks for humans during long-duration space missions the complex interplay of these parameters at the cellular level must be understood Cellular stress protection responses lead to increased transcription of several genes via modulation of transcription factors Activation of the Nuclear Factor kappa B NF- kappa B pathway as a possible anti-apoptotic route represents such an important cellular stress response A screening assay for detection of NF- kappa B-dependent gene activation using the destabilized variant of Enhanced Green Fluorescent Protein d2EGFP as reporter protein had been developed It consists of Human Embryonic Kidney HEK 293 Cells stably transfected with a receptor-reporter-construct carrying d2EGFP under the control of a NF- kappa B response element Clones positive for Tumor Necrosis Factor alpha TNF- alpha inducible d2EGFP expression were selected as cellular reporters Irradiation was performed either with X-rays 150 kV 19 mA at DLR Cologne or with 2 1 MeV alpha particles LET sim 160 keV mu m at PTB Braunschweig After irradiation the following biological endpoints were determined i cell survival via the colony forming ability test ii time-dependent activation of NF- kappa B dependent d2EGFP gene expression using flow cytometry iii quantitative RT-PCR

Production of transgenic pigs using a pGFAP-CreERT2/EGFP LoxP inducible system for central nervous system disease models.

PubMed

Hwang, Seon-Ung; Eun, Kiyoung; Yoon, Junchul David; Kim, Hyunggee; Hyun, Sang-Hwan

2018-05-31

Transgenic (TG) pigs are important in biomedical research and are used in disease modeling, pharmaceutical toxicity testing, and regenerative medicine. In this study, we constructed two vector systems by using the promoter of the pig glial fibrillary acidic protein ( pGFAP ) gene, which is an astrocyte cell marker. We established donor TG fibroblasts with pGFAP-CreER T2 /LCMV-EGFP LoxP and evaluated the effect of the transgenes on TG-somatic cell nuclear transfer (SCNT) embryo development. Cleavage rates were not significantly different between control and transgene-donor groups. Embryo transfer was performed thrice just before ovulation of the surrogate sows. One sow delivered 5 TG piglets at 115 days after pregnancy. Polymerase chain reaction (PCR) analysis with genomic DNA isolated from skin tissues of TG pigs revealed that all 5 TG pigs had the transgenes. EGFP expression in all organs tested was confirmed by immunofluorescence staining and PCR. Real-time PCR analysis showed that pGFAP promoter-driven Cre fused to the mutated human ligand-binding domain of the estrogen receptor ( CreER T2 ) mRNA was highly expressed in the cerebrum. Semi-nested PCR analysis revealed that CreER T2 -mediated recombination was induced in cerebrum and cerebellum but not in skin. Thus, we successfully generated a TG pig with a 4-hydroxytamoxifen (TM)-inducible pGFAP-CreER T2 /EGFP LoxP recombination system via SCNT.

Multivalent Chromosomal Expression of the Clostridium botulinum Serotype A Neurotoxin Heavy-Chain Antigen and the Bacillus anthracis Protective Antigen in Lactobacillus acidophilus.

PubMed

O'Flaherty, Sarah; Klaenhammer, Todd R

2016-10-15

Clostridium botulinum and Bacillus anthracis produce potent toxins that cause severe disease in humans. New and improved vaccines are needed for both of these pathogens. For mucosal vaccine delivery using lactic acid bacteria, chromosomal expression of antigens is preferred over plasmid-based expression systems, as chromosomal expression circumvents plasmid instability and the need for antibiotic pressure. In this study, we constructed three strains of Lactobacillus acidophilus NCFM expressing from the chromosome (i) the nontoxic host receptor-binding domain of the heavy chain of Clostridium botulinum serotype A neurotoxin (BoNT/A-Hc), (ii) the anthrax protective antigen (PA), and (iii) both the BoNT/A-Hc and the PA. The BoNT/A-Hc vaccine cassette was engineered to contain the signal peptide from the S-layer protein A from L. acidophilus and a dendritic-cell-targeting peptide. A chromosomal region downstream of lba0889 carrying a highly expressed enolase gene was selected for insertion of the vaccine cassettes. Western blot analysis confirmed the heterologous expression of the two antigens from plasmid and chromosome locations. Stability assays demonstrated loss of the vaccine cassettes from expression plasmids without antibiotic maintenance. RNA sequencing showed high expression of each antigen and that insertion of the vaccine cassettes had little to no effect on the transcription of other genes in the chromosome. This study demonstrated that chromosomal integrative recombinant strains are promising vaccine delivery vehicles when targeted into high-expression chromosomal regions. Levels of expression match high-copy-number plasmids and eliminate the requirement for antibiotic selective maintenance of recombinant plasmids. Clostridium botulinum and Bacillus anthracis produce potent neurotoxins that pose a biochemical warfare concern; therefore, effective vaccines against these bacteria are required. Chromosomal expression of antigens is preferred over plasmid-based expression systems since expressing antigens from a chromosomal location confers an advantage to the vaccine strains by eliminating the antibiotic maintenance required for plasmids and negates issues with plasmid instability that would result in loss of the antigen. Lactic acid bacteria, including Lactobacillus acidophilus, have shown potential for mucosal vaccine delivery, as L. acidophilus is bile and acid tolerant, allowing transit through the gastrointestinal tract where cells interact with host epithelial and immune cells, including dendritic cells. In this study, we successfully expressed C. botulinum and B. anthracis antigens in the probiotic L. acidophilus strain NCFM. Both antigens were highly expressed individually or in tandem from the chromosome of L. acidophilus. Copyright © 2016 O'Flaherty and Klaenhammer.

Multivalent Chromosomal Expression of the Clostridium botulinum Serotype A Neurotoxin Heavy-Chain Antigen and the Bacillus anthracis Protective Antigen in Lactobacillus acidophilus

PubMed Central

Klaenhammer, Todd R.

2016-01-01

ABSTRACT Clostridium botulinum and Bacillus anthracis produce potent toxins that cause severe disease in humans. New and improved vaccines are needed for both of these pathogens. For mucosal vaccine delivery using lactic acid bacteria, chromosomal expression of antigens is preferred over plasmid-based expression systems, as chromosomal expression circumvents plasmid instability and the need for antibiotic pressure. In this study, we constructed three strains of Lactobacillus acidophilus NCFM expressing from the chromosome (i) the nontoxic host receptor-binding domain of the heavy chain of Clostridium botulinum serotype A neurotoxin (BoNT/A-Hc), (ii) the anthrax protective antigen (PA), and (iii) both the BoNT/A-Hc and the PA. The BoNT/A-Hc vaccine cassette was engineered to contain the signal peptide from the S-layer protein A from L. acidophilus and a dendritic-cell-targeting peptide. A chromosomal region downstream of lba0889 carrying a highly expressed enolase gene was selected for insertion of the vaccine cassettes. Western blot analysis confirmed the heterologous expression of the two antigens from plasmid and chromosome locations. Stability assays demonstrated loss of the vaccine cassettes from expression plasmids without antibiotic maintenance. RNA sequencing showed high expression of each antigen and that insertion of the vaccine cassettes had little to no effect on the transcription of other genes in the chromosome. This study demonstrated that chromosomal integrative recombinant strains are promising vaccine delivery vehicles when targeted into high-expression chromosomal regions. Levels of expression match high-copy-number plasmids and eliminate the requirement for antibiotic selective maintenance of recombinant plasmids. IMPORTANCE Clostridium botulinum and Bacillus anthracis produce potent neurotoxins that pose a biochemical warfare concern; therefore, effective vaccines against these bacteria are required. Chromosomal expression of antigens is preferred over plasmid-based expression systems since expressing antigens from a chromosomal location confers an advantage to the vaccine strains by eliminating the antibiotic maintenance required for plasmids and negates issues with plasmid instability that would result in loss of the antigen. Lactic acid bacteria, including Lactobacillus acidophilus, have shown potential for mucosal vaccine delivery, as L. acidophilus is bile and acid tolerant, allowing transit through the gastrointestinal tract where cells interact with host epithelial and immune cells, including dendritic cells. In this study, we successfully expressed C. botulinum and B. anthracis antigens in the probiotic L. acidophilus strain NCFM. Both antigens were highly expressed individually or in tandem from the chromosome of L. acidophilus. PMID:27496774

Anatomical and Electrophysiological Changes in Striatal TH Interneurons after Loss of the Nigrostriatal Dopaminergic Pathway

PubMed Central

Ünal, Bengi; Shah, Fulva; Kothari, Janish; Tepper, James M.

2013-01-01

Using transgenic mice that express enhanced green fluorescent protein (EGFP) under the control of the tyrosine hydroxylase (TH) promoter, we have previously shown that there are approximately 3000 striatal EGFP-TH interneurons per hemisphere in mice. Here we report that striatal TH-EGFP interneurons exhibit a small, transient but significant increase in number after unilateral destruction of the nigrostriatal dopaminergic pathway. The increase in cell number is accompanied by electrophysiological and morphological changes. The intrinsic electrophysiological properties of EGFP-TH interneurons ipsilateral to 6-OHDA lesion were similar to those originally reported in intact mice except for a significant reduction in the duration of a characteristic depolarization induced plateau potential. There was a significant change in the distribution of the four previously described electrophysiologically distinct subtypes of striatal TH interneurons. There was a concomitant increase in the frequency of both spontaneous excitatory and inhibitory postsynaptic currents, while their amplitudes did not change. Nigrostriatal lesions did not affect somatic size or dendritic length or branching, but resulted in an increase in the density of proximal dendritic spines and spine-like appendages in EGFP-TH interneurons. The changes indicate that electrophysiology properties and morphology of striatal EGFP-TH interneurons depend on endogenous levels of dopamine arising from the nigrostriatal pathway. Furthermore, these changes may serve to help compensate for the changes in activity of spiny projection neurons that occur following loss of the nigrostriatal innervation in experimental or in early idiopathic Parkinson’s disease by increasing feedforward GABAergic inhibition exerted by these interneurons. PMID:24173616

Anatomical and electrophysiological changes in striatal TH interneurons after loss of the nigrostriatal dopaminergic pathway.

PubMed

Ünal, Bengi; Shah, Fulva; Kothari, Janish; Tepper, James M

2015-01-01

Using transgenic mice that express enhanced green fluorescent protein (EGFP) under the control of the tyrosine hydroxylase (TH) promoter, we have previously shown that there are approximately 3,000 striatal EGFP-TH interneurons per hemisphere in mice. Here, we report that striatal TH-EGFP interneurons exhibit a small, transient but significant increase in number after unilateral destruction of the nigrostriatal dopaminergic pathway. The increase in cell number is accompanied by electrophysiological and morphological changes. The intrinsic electrophysiological properties of EGFP-TH interneurons ipsilateral to 6-OHDA lesion were similar to those originally reported in intact mice except for a significant reduction in the duration of a characteristic depolarization induced plateau potential. There was a significant change in the distribution of the four previously described electrophysiologically distinct subtypes of striatal TH interneurons. There was a concomitant increase in the frequency of both spontaneous excitatory and inhibitory post-synaptic currents, while their amplitudes did not change. Nigrostriatal lesions did not affect somatic size or dendritic length or branching, but resulted in an increase in the density of proximal dendritic spines and spine-like appendages in EGFP-TH interneurons. The changes indicate that electrophysiology properties and morphology of striatal EGFP-TH interneurons depend on endogenous levels of dopamine arising from the nigrostriatal pathway. Furthermore, these changes may serve to help compensate for the changes in activity of spiny projection neurons that occur following loss of the nigrostriatal innervation in experimental or in early idiopathic Parkinson's disease by increasing feedforward GABAergic inhibition exerted by these interneurons.

Development of Novel Peptide Inhibitors of the Estrogen Receptor

DTIC Science & Technology

1997-10-01

plasmids used for the transfection experiments described below included pERE-TK- CAT , an estrogen responsive chloramphenicol acetylase reporter plasmid...The inhibitory potential of expressed fragments of ER were assessed by measuring the activity of chloramphenicol acetyltransferase ( CAT ) enzyme...with an ER expression plasmid (pCMV-ER) and an estrogen-responsive reporter plasmid (pERE-TK- CAT ) in order to look for inhibition of an ER mediated

Tailor-made fibroblast-specific and antibiotic-free interleukin 12 plasmid for gene electrotransfer-mediated cancer immunotherapy.

PubMed

Kamensek, Urska; Tesic, Natasa; Sersa, Gregor; Kos, Spela; Cemazar, Maja

2017-01-01

Electrotransfer mediated delivery of interleukin-12 (IL-12) gene, encoded on a plasmid vector, has already been demonstrated to have a potent antitumor efficacy and great potential for clinical application. In the present study, our aim was to construct an optimized IL-12-encoding plasmid that is safe from the regulatory point of view. In light of previous studies demonstrating that IL-12 should be released in a tumor localized manner for optimal efficacy, the strong ubiquitous promoter was replaced with a weak endogenous promoter of the collagen 2 gene, which is specific for fibroblasts. Next, to comply with increasing regulatory demands for clinically used plasmids, the expression cassette was cloned in a plasmid lacking the antibiotic resistance gene. The constructed fibroblast-specific and antibiotic-free IL-12 plasmid was demonstrated to support low IL-12 expression after gene electrotransfer in selected cell lines. Furthermore, the removal of antibiotic resistance did not affect the plasmid expression profile and lowered its cytotoxicity. With optimal IL-12 expression and minimal transgene non-specific effects, i.e., low cytotoxicity, the constructed plasmid could be especially valuable for different modern immunological approaches to achieve localized boosting of the host's immune system. Copyright © 2016 Elsevier Inc. All rights reserved.

Transient knockdown and overexpression reveal a developmental role for the zebrafish enosf1b gene.

PubMed

Finckbeiner, Steve; Ko, Pin-Joe; Carrington, Blake; Sood, Raman; Gross, Kenneth; Dolnick, Bruce; Sufrin, Janice; Liu, Paul

2011-09-26

Despite detailed in vivo knowledge of glycolytic enolases and many bacterial non-enolase members of the superfamily, little is known about the in vivo function of vertebrate non-enolase enolase superfamily members (ENOSF1s). Results of previous studies suggest involvement of the β splice form of ENOSF1 in breast and colon cancers. This study used the zebrafish (Danio rerio) as a vertebrate model of ENOSF1β function. Whole mount in situ hybridization (WISH) showed that zebrafish ENOSF1β (enosf1b) is zygotic and expressed ubiquitously through the first 24 hours post fertilization (hpf). After 24 hpf, enosf1b expression is restricted to the notochord. Embryos injected with enosf1b-EGFP mRNA grew slower than EGFP mRNA-injected embryos but caught up to the EGFP-injected embryos by 48 hpf. Embryos injected with ATG or exon 10 enosf1b mRNA-targeting morpholinos had kinked notochords, shortened anterior-posterior axes, and circulatory edema. WISH for ntl or pax2a expression showed that embryos injected with either morpholino have deformed notochord and pronephros. TUNEL staining revealed increased apoptosis in the peri-notochord region. This study is the first report of ENOSF1 function in a vertebrate and shows that ENOSF1 is required for embryonic development. Increased apoptosis following enosf1b knockdown suggests a potential survival advantage for increased ENOSF1β expression in human cancers.

Transient knockdown and overexpression reveal a developmental role for the zebrafish enosf1b gene

PubMed Central

2011-01-01

Background Despite detailed in vivo knowledge of glycolytic enolases and many bacterial non-enolase members of the superfamily, little is known about the in vivo function of vertebrate non-enolase enolase superfamily members (ENOSF1s). Results of previous studies suggest involvement of the β splice form of ENOSF1 in breast and colon cancers. This study used the zebrafish (Danio rerio) as a vertebrate model of ENOSF1β function. Results Whole mount in situ hybridization (WISH) showed that zebrafish ENOSF1β (enosf1b) is zygotic and expressed ubiquitously through the first 24 hours post fertilization (hpf). After 24 hpf, enosf1b expression is restricted to the notochord. Embryos injected with enosf1b-EGFP mRNA grew slower than EGFP mRNA-injected embryos but caught up to the EGFP-injected embryos by 48 hpf. Embryos injected with ATG or exon 10 enosf1b mRNA-targeting morpholinos had kinked notochords, shortened anterior-posterior axes, and circulatory edema. WISH for ntl or pax2a expression showed that embryos injected with either morpholino have deformed notochord and pronephros. TUNEL staining revealed increased apoptosis in the peri-notochord region. Conclusions This study is the first report of ENOSF1 function in a vertebrate and shows that ENOSF1 is required for embryonic development. Increased apoptosis following enosf1b knockdown suggests a potential survival advantage for increased ENOSF1β expression in human cancers. PMID:21943404

Osimertinib induces autophagy and apoptosis via reactive oxygen species generation in non-small cell lung cancer cells.

PubMed

Tang, Zheng-Hai; Cao, Wen-Xiang; Su, Min-Xia; Chen, Xiuping; Lu, Jin-Jian

2017-04-15

Osimertinib (OSI), also known as AZD9291, is a third-generation epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor that has been approved for the treatment of non-small cell lung cancer (NSCLC) patients harboring EGFR T790M mutation. Herein, we indicated for the first time that OSI increased the accumulations of cytoplasmic vacuoles, the expression of phosphatidylethanolamine-modified microtubule-associated protein light-chain 3 (LC3-II), and the formation of GFP-LC3 puncta in various cancer cells. The OSI-induced expression of LC3-II was further increased when combined treatment with chloroquine (CQ), an autophagy inhibitor, and the mRFP-EGFP-LC3 plasmid-transfected cells exposed to OSI led to the production of more red-fluorescent puncta than green-fluorescent puncta, indicating OSI induced autophagic flux in the NSCLC cells. Knockdown of EGFR showed no effect on the OSI-induced expression of LC3-II in NCI-H1975 cells. In addition, OSI increased reactive oxygen species (ROS) generation and scavenge of ROS via pretreatment with N-acetyl-l-cysteine (NAC), catalase (CAT), or vitamin E (Vita E) significantly inhibited OSI-induced the accumulations of cytoplasmic vacuoles, the expression of LC3-II, as well as the formation of GFP-LC3 puncta. Combinative treatment with CQ could not remarkably change the OSI-induced cell viability decrease, whereas the OSI-induced cell viability decrease and apoptosis could be reversed through pretreatment with NAC, CAT, and Vita E, respectively. Taken together, this is the first report that OSI induces an accompanied autophagy and the generation of ROS is critical for the OSI-induced autophagy, cell viability decrease, and apoptosis in NSCLC cells. Copyright © 2017 Elsevier Inc. All rights reserved.

The mouse Pol I terminator is more efficient than the hepatitis delta virus ribozyme in generating influenza-virus-like RNAs with precise 3' ends in a plasmid-only-based virus rescue system.

PubMed

Feng, Liqiang; Li, Feng; Zheng, Xuehua; Pan, Weiqi; Zhou, Kai; Liu, Yichu; He, Hongxuan; Chen, Ling

2009-01-01

Reverse genetics systems for generating recombinant influenza viruses are based on two different mechanisms for obtaining the 3' end of the viral RNA: one uses the self-cleaving hepatitis delta virus ribozyme (HDVR), and the other uses the murine RNA polymerase I (Pol I) terminator. In this study, we employed EGFP and Renilla luciferase reporter constructs to compare the efficiency of both methods. Our results indicate that the murine Pol I terminator was more efficient than the HDVR, which will be helpful in choosing an influenza virus rescue system, as well as in establishing other RNA virus rescue systems.

Expression of gastrin-releasing peptide by excitatory interneurons in the mouse superficial dorsal horn.

PubMed

Gutierrez-Mecinas, Maria; Watanabe, Masahiko; Todd, Andrew J

2014-12-11

Gastrin-releasing peptide (GRP) and its receptor have been shown to play an important role in the sensation of itch. However, although GRP immunoreactivity has been detected in the spinal dorsal horn, there is debate about whether this originates from primary afferents or local excitatory interneurons. We therefore examined the relation of GRP immunoreactivity to that seen with antibodies that label primary afferent or excitatory interneuron terminals. We tested the specificity of the GRP antibody by preincubating with peptides with which it could potentially cross-react. We also examined tissue from a mouse line in which enhanced green fluorescent protein (EGFP) is expressed under control of the GRP promoter. GRP immunoreactivity was seen in both primary afferent and non-primary glutamatergic axon terminals in the superficial dorsal horn. However, immunostaining was blocked by pre-incubation of the antibody with substance P, which is present at high levels in many nociceptive primary afferents. EGFP+ cells in the GRP-EGFP mouse did not express Pax2, and their axons contained the vesicular glutamate transporter 2 (VGLUT2), indicating that they are excitatory interneurons. In most cases, their axons were also GRP-immunoreactive. Multiple-labelling immunocytochemical studies indicated that these cells did not express either of the preprotachykinin peptides, and that they generally lacked protein kinase Cγ, which is expressed by a subset of the excitatory interneurons in this region. These results show that GRP is expressed by a distinct population of excitatory interneurons in laminae I-II that are likely to be involved in the itch pathway. They also suggest that the GRP immunoreactivity seen in primary afferents in previous studies may have resulted from cross-reaction of the GRP antibody with substance P or the closely related peptide neurokinin A.

Leptin modulates dose-dependently the metabolic and cytolytic activities of NK-92 cells.

PubMed

Lamas, Bruno; Goncalves-Mendes, Nicolas; Nachat-Kappes, Rachida; Rossary, Adrien; Caldefie-Chezet, Florence; Vasson, Marie-Paule; Farges, Marie-Chantal

2013-06-01

Leptin, a hormone-cytokine produced primarily in the adipose tissue, has pleiotropic effects on many biological systems and in several cell types, including immune cells. Hyperleptinemia is associated with immune dysfunction and carcinogenesis. Natural killer (NK) cells are critical mediators of anti-tumor immunity, and leptin receptor deficiency in mice leads to impaired NK function. It was thus decided to explore the in vitro effects of leptin on human NK cell function. NK-92 cells were cultured during 48 h with different leptin concentrations [absence, 10 (physiological), 100 (obesity), or 200 ng/ml (pharmacology)]. Their metabolic activity was assessed using the resazurin test. NK-92 cell cytotoxicity and intracellular IFN-γ production were analyzed by flow cytometry. NK-92 cell mRNA and protein expression levels of cytotoxic effectors were determined by RT-qPCR and Western blot. In our conditions, leptin exerted a dose-dependent stimulatory effect on NK-92 cell metabolic activity. In addition, high leptin concentrations enhanced NK-92 cell cytotoxicity against K562-EGFP and MDA-MB-231-EGFP target cells and inversely reduced cytotoxicity against the MCF-7-EGFP target. At 100 ng/ml, leptin up-regulated both NK cell granzyme B and TRAIL protein expressions and concomitantly down-regulated perforin expression without affecting Fas-L expression. In response to PMA/ionomycin stimulation, the proportion of IFN-γ expressing NK-92 cells increased with 100 and 200 ng/ml of leptin. In conclusion, leptin concentration, at obesity level, variably increased NK-92 cell metabolic activity and modulated NK cell cytotoxicity according to the target cells. The underlying mechanisms are partly due to an up-regulation of TRAIL and IFN-γ expression and a down-regulation of perforin. Copyright © 2012 Wiley Periodicals, Inc.

Subcellular localization of acyl-CoA binding protein in Aspergillus oryzae is regulated by autophagy machinery.

PubMed

Kawaguchi, Kouhei; Kikuma, Takashi; Higuchi, Yujiro; Takegawa, Kaoru; Kitamoto, Katsuhiko

2016-11-04

In eukaryotic cells, acyl-CoA binding protein (ACBP) is important for cellular activities, such as in lipid metabolism. In the industrially important fungus Aspergillus oryzae, the ACBP, known as AoACBP, has been biochemically characterized, but its physiological function is not known. In the present study, although we could not find any phenotype of AoACBP disruptants in the normal growth conditions, we examined the subcellular localization of AoACBP to understand its physiological function. Using an enhanced green fluorescent protein (EGFP)-tagged AoACBP construct we showed that AoACBP localized to punctate structures in the cytoplasm, some of which moved inside the cells in a microtubule-dependent manner. Further microscopic analyses showed that AoACBP-EGFP co-localized with the autophagy marker protein AoAtg8 tagged with red fluorescent protein (mDsRed). Expression of AoACBP-EGFP in disruptants of autophagy-related genes revealed aggregation of AoACBP-EGFP fluorescence in the cytoplasm of Aoatg1, Aoatg4 and Aoatg8 disruptant cells. However, in cells harboring disruption of Aoatg15, which encodes a lipase for autophagic body, puncta of AoACBP-EGFP fluorescence accumulated in vacuoles, indicating that AoACBP is transported to vacuoles via the autophagy machinery. Collectively, these results suggest the existence of a regulatory mechanism between AoACBP localization and autophagy. Copyright © 2016 Elsevier Inc. All rights reserved.

Method for screening inhibitors of the toxicity of Bacillus anthracis

DOEpatents

Cirino, Nick M.; Jackson, Paul J.; Lehnert, Bruce E.

2001-01-01

The protective antigen (PA) of Bacillus anthracis is integral to the mechanism of anthrax poisoning. The cloning, expression and purification of a 32 kDa B. anthracis PA fragment (PA32) is described. This fragment has also been expressed as a fusion construct to stabilized green fluorescent protein (EGFP-PA32). Both proteins were capable of binding to specific cell surface receptors as determined by fluorescent microscopy and a flow cytometric assay. To confirm binding specificity in the flow cytometric assay, non-fluorescent PA83 or PA32 was used to competitively inhibit fluorescent EGFP-PA32 binding to cell receptors. This assay can be employed as a rapid screen for compounds which disrupts binding of PA to cells. Additionally, the high intracellular expression levels and ease of purification make this recombinant protein an attractive vaccine candidate or therapeutic treatment for anthrax poisoning.

A 5′ Noncoding Exon Containing Engineered Intron Enhances Transgene Expression from Recombinant AAV Vectors in vivo

PubMed Central

Lu, Jiamiao; Williams, James A.; Luke, Jeremy; Zhang, Feijie; Chu, Kirk; Kay, Mark A.

2017-01-01

We previously developed a mini-intronic plasmid (MIP) expression system in which the essential bacterial elements for plasmid replication and selection are placed within an engineered intron contained within a universal 5′ UTR noncoding exon. Like minicircle DNA plasmids (devoid of bacterial backbone sequences), MIP plasmids overcome transcriptional silencing of the transgene. However, in addition MIP plasmids increase transgene expression by 2 and often >10 times higher than minicircle vectors in vivo and in vitro. Based on these findings, we examined the effects of the MIP intronic sequences in a recombinant adeno-associated virus (AAV) vector system. Recombinant AAV vectors containing an intron with a bacterial replication origin and bacterial selectable marker increased transgene expression by 40 to 100 times in vivo when compared with conventional AAV vectors. Therefore, inclusion of this noncoding exon/intron sequence upstream of the coding region can substantially enhance AAV-mediated gene expression in vivo. PMID:27903072

Functional Geno,ic Analysis of Breast Cancer Cell Tumorigenicity Using a Noval Gene Silencing Resource

DTIC Science & Technology

2006-04-01

Fig. 2B). In addition, luciferase assay on cells co-transfected with constructs expressing firefly and renilla luciferase genes showed a significant...positive cells. (C) BT474 cells were co-transfected with pGL3 plasmid expressing firefly luciferase, pRL plasmid expressing renilla luciferase, and...genes Per1 (A) and Bmal1 (B). BT474 cells were transfected with Per1 (A) and Bmal1 (B) firefly luciferase reporters, pRL plasmid expressing renilla

Intraganglionic AAV6 results in efficient and long-term gene transfer to peripheral sensory nervous system in adult rats.

PubMed

Yu, Hongwei; Fischer, Gregory; Ferhatovic, Lejla; Fan, Fan; Light, Alan R; Weihrauch, Dorothee; Sapunar, Damir; Nakai, Hiroyuki; Park, Frank; Hogan, Quinn H

2013-01-01

We previously demonstrated safe and reliable gene transfer to the dorsal root ganglion (DRG) using a direct microinjection procedure to deliver recombinant adeno-associated virus (AAV) vector. In this study, we proceed to compare the in vivo transduction patterns of self-complementary (sc) AAV6 and AAV8 in the peripheral sensory pathway. A single, direct microinjection of either AAV6 or AAV8 expressing EGFP, at the adjusted titer of 2×10(9) viral particle per DRG, into the lumbar (L) 4 and L5 DRGs of adult rats resulted in efficient EGFP expression (48±20% for AAV6 and 25±4% for AAV8, mean ± SD) selectively in sensory neurons and their axonal projections 3 weeks after injection, which remained stable for up to 3 months. AAV6 efficiently transfers EGFP to all neuronal size groups without differential neurotropism, while AAV8 predominantly targets large-sized neurons. Neurons transduced with AAV6 penetrate into the spinal dorsal horn (DH) and terminate predominantly in superficial DH laminae, as well as in the dorsal columns and deeper laminae III-V. Only few AAV8-transduced afferents were evident in the superficial laminae, and spinal EGFP was mostly present in the deeper dorsal horn (lamina III-V) and dorsal columns, with substantial projections to the ventral horn. AAV6-mediated EGFP-positive nerve fibers were widely observed in the medial plantar skin of ipsilateral hindpaws. No apparent inflammation, tissue damage, or major pain behaviors were observed for either AAV serotype. Taken together, both AAV6 and AAV8 are efficient and safe vectors for transgene delivery to primary sensory neurons, but they exhibit distinct functional features. Intraganglionic delivery of AAV6 is more uniform and efficient compared to AAV8 in gene transfer to peripheral sensory neurons and their axonal processes.

[Application of dhfr gene negative Chinese hamster ovary cell line to express hepatitis B virus surface antigen].

PubMed

Yi, Y; Zhang, M; Liu, C

2001-06-01

To set up an efficient expressing system for recombinant hepatitis B virus surface antigen (HBsAg) in dhfr gene negative CHO cell line. HBsAg gene expressing plasmid pCI-dhfr-S was constructed by integrating HBsAg gene into plasmid pCI which carries dhfr gene. The HBsAg expressing cell line was set up by transfection of plasmid pCI-dhfr-S into dhfr gene negative CHO cell line in the way of lipofectin. Under the selective pressure of MTX, 18 of 28 clonized cell lines expressed HBsAg, 4 of them reached a high titer of 1:32 and protein content 1-3 micrograms/ml. In this study, the high level expression of HBsAg demonstrated that the dhfr negative mammalian cell line when recombined with plasmid harboring the corresponding deleted gene can efficiently express the foreign gene. The further steps toward building optimum conditions of the expressing system and the increase of expressed product are under study.

[Experimental study on dog's bone marrow stem cells transfected by pIRES2-EGFP-IGF-1 gene].

PubMed

Zhu, Guo-qiang; Wu, Zhi-fen; Li, Yuan-fei; Hu, De-hua; Wang, Qin-tao

2006-12-01

To establish the bone marrow stem cells (MSC) model which could highly express the insulin-like growth factor 1 (IGF-1) transfected by dog's IGF-1 gene. pIRES2-EGFP-IGF-1 was transfected into MSC by lipofectamine. Positive clones were selected with G418. The expression of IGF-1 protein in the MSC was determined by immunohistochemistry and Western blot analysis. The IGF-1 in the supernatant of the transfected MSC was detected by sandwich-in ELISA. The periodontal ligament cells (PDLC) were cultured in the supernatant of the transfected MSC. The changes of PDLC' proliferation were observed by MTT. IGF-1-transfected MSC could apparently express IGF-1. The IGF-1 protein in the supernatant of the transfected MSC was confirmed by sandwich-in ELISA. IGF-1 could promote the PDLC' proliferation. The MSC transfected by dog's IGF-1 gene can highly express IGF-1, which may lay the foundation for further study on periodontal regeneration.

Antigen Binding and Site-Directed Labeling of Biosilica-Immobilized Fusion Proteins Expressed in Diatoms.

PubMed

Ford, Nicole R; Hecht, Karen A; Hu, DeHong; Orr, Galya; Xiong, Yijia; Squier, Thomas C; Rorrer, Gregory L; Roesijadi, Guritno

2016-03-18

The diatom Thalassiosira pseudonana was genetically modified to express biosilica-targeted fusion proteins comprising either enhanced green fluorescent protein (EGFP) or single chain antibodies engineered with a tetracysteine tagging sequence. Of interest were the site-specific binding of (1) the fluorescent biarsenical probe AsCy3 and AsCy3e to the tetracysteine tagged fusion proteins and (2) high and low molecular mass antigens, the Bacillus anthracis surface layer protein EA1 or small molecule explosive trinitrotoluene (TNT), to biosilica-immobilized single chain antibodies. Analysis of biarsenical probe binding using fluorescence and structured illumination microscopy indicated differential colocalization with EGFP in nascent and mature biosilica, supporting the use of either EGFP or bound AsCy3 and AsCy3e in studying biosilica maturation. Large increases in the lifetime of a fluorescent analogue of TNT upon binding single chain antibodies provided a robust signal capable of discriminating binding to immobilized antibodies in the transformed frustule from nonspecific binding to the biosilica matrix. In conclusion, our results demonstrate an ability to engineer diatoms to create antibody-functionalized mesoporous silica able to selectively bind chemical and biological agents for the development of sensing platforms.

Enhanced green fluorescent protein in optofluidic Fabry-Perot microcavity to detect laser induced temperature changes in a bacterial culture

NASA Astrophysics Data System (ADS)

Lahoz, F.; Martín, I. R.; Walo, D.; Freire, R.; Gil-Rostra, J.; Yubero, F.; Gonzalez-Elipe, A. R.

2017-09-01

Thermal therapy using laser sources can be used in combination with other cancer therapies to eliminate tumors. However, high precision temperature control is required to avoid damage in healthy surrounding tissues. Therefore, in order to detect laser induced temperature changes, we have used the fluorescence signal of the enhanced Green Fluorescent Protein (eGFP) over-expressed in an E. coli bacterial culture. For that purpose, the bacteria expressing eGFP are injected in a Fabry-Perot (FP) optofluidic planar microcavity. In order to locally heat the bacterial culture, external infrared or ultraviolet lasers were used. Shifts in the wavelengths of the resonant FP modes are used to determine the temperature increase as a function of the heating laser pump power. Laser induced local temperature increments up to 6-7 °C were measured. These results show a relatively easy way to measure laser induced local temperature changes using a FP microcavity and using eGFP as a molecular probe instead of external nanoparticles, which could damage/alter the cell. Therefore, we believe that this approach can be of interest for the study of thermal effects in laser induced thermal therapies.

Abortive replication of Bombyx mori nucleopolyhedrovirus in Sf9 and High Five cells: Defective nuclear transport of the virions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Katou, Yasuhiro; Ikeda, Motoko; Kobayashi, Michihiro

2006-04-10

Despite close genetic relationship, Bombyx mori nucleopolyhedrovirus (BmNPV) and Autographa californica multicapsid NPV (AcMNPV) display a distinct host range property. Here, BmNPV replication was examined in Sf9 and High Five cells that were nonproductive for BmNPV infection but supported high titers of AcMNPV replication. Recombinant BmNPV, vBm/gfp/lac, containing bm-ie1 promoter-driven egfp showed that few Sf9 and High Five cells infected with vBm/gfp/lac expressed EGFP, while large proportion of EGFP-expressing cells was observed when transfected with vBm/gfp/lac DNA. Immunocytochemical analysis showed that BmNPV was not imported into the nucleus of these two cell lines, while recombinant BmNPV, vBm{delta}64/ac-gp64 possessing AcMNPV gp64more » was imported into the nucleus, yielding progeny virions in High Five cells, but not Sf9 cells. These results indicate that the defective nuclear import of infected virions due to insufficient BmNPV GP64 function is involved in the restricted BmNPV replication in Sf9 and High Five cells.« less

Functional properties of cells obtained from human cord blood CD34+ stem cells and mouse cardiac myocytes in coculture.

PubMed

Orlandi, Alessia; Pagani, Francesca; Avitabile, Daniele; Bonanno, Giuseppina; Scambia, Giovanni; Vigna, Elisa; Grassi, Francesca; Eusebi, Fabrizio; Fucile, Sergio; Pesce, Maurizio; Capogrossi, Maurizio C

2008-04-01

Prior in vitro studies suggested that different types of hematopoietic stem cells may differentiate into cardiomyocytes. The present work examined whether human CD34(+) cells from the human umbilical cord blood (hUCB), cocultured with neonatal mouse cardiomyocytes, acquire the functional properties of myocardial cells and express human cardiac genes. hUCB CD34(+) cells were cocultured onto cardiomyocytes following an infection with a lentivirus-encoding enhanced green fluorescent protein (EGFP). After 7 days, mononucleated EGFP(+) cells were tested for their electrophysiological features by patch clamp and for cytosolic [Ca(2+)] ([Ca(2+)](i)) homeostasis by [Ca(2+)](i) imaging of X-rhod1-loaded cells. Human Nkx2.5 and GATA-4 expression was examined in cocultured cell populations by real-time RT-PCR. EGFP(+) cells were connected to surrounding cells by gap junctions, acquired electrophysiological properties similar to those of cardiomyocytes, and showed action potential-associated [Ca(2+)](i) transients. These cells also exhibited spontaneous sarcoplasmic reticulum [Ca(2+)](i) oscillations and the associated membrane potential depolarization. However, RT-PCR of both cell populations showed no upregulation of human-specific cardiac genes. In conclusion, under our experimental conditions, hUCB CD34(+) cells cocultured with murine cardiomyocytes formed cells that exhibited excitation-contraction coupling features similar to those of cardiomyocytes. However, the expression of human-specific cardiac genes was undetectable by RT-PCR.

Long non-coding RNA Gm2199 rescues liver injury and promotes hepatocyte proliferation through the upregulation of ERK1/2.

PubMed

Gao, Qiang; Gu, Yunyan; Jiang, Yanan; Fan, Li; Wei, Zixiang; Jin, Haobin; Yang, Xirui; Wang, Lijuan; Li, Xuguang; Tai, Sheng; Yang, Baofeng; Liu, Yan

2018-05-22

Long non-coding RNAs (lncRNAs) are a new class of regulators of various human diseases. This study was designed to explore the potential role of lncRNAs in experimental hepatic damage. In vivo hepatic damage in mice and in vitro hepatocyte damage in AML12 and NCTC1469 cells were induced by carbon tetrachloride (CCl 4 ) treatments. Expression profiles of lncRNAs and mRNAs were analyzed by microarray. Bioinformatics analyses were conducted to predict the potential functions of differentially expressed lncRNAs with respect to hepatic damage. Overexpression of lncRNA Gm2199 was achieved by transfection of the pEGFP-N1-Gm2199 plasmid in vitro and adeno-associated virus-Gm2199 in vivo. Cell proliferation and viability was detected by cell counting kit-8 and 5-ethynyl-2'-deoxyuridine assay. Protein and mRNA expressions of extracellular signal-regulated kinase-1/2 (ERK1/2) were detected by western blot and quantitative real-time reverse-transcription PCR (qRT-PCR). Microarray analysis identified 190 and 148 significantly differentially expressed lncRNAs and mRNAs, respectively. The analyses of lncRNA-mRNA co-expression and lncRNA-biological process networks unraveled potential roles of the differentially expressed lncRNAs including Gm2199 in the pathophysiological processes leading to hepatic damage. Gm2199 was downregulated in both damaged livers and hepatocyte lines. Overexpression of Gm2199 restored the reduced proliferation of damaged hepatocyte lines and increased the expression of ERK1/2. Overexpression of Gm2199 also promoted the proliferation and viability of normal hepatocyte lines and increased the level of p-ERK1/2. Overexpression of Gm2199 in vivo also protected mouse liver injury induced by CCl 4 , evidenced by more proliferating hepatocytes, less serum alanine aminotransferase, less serum aspartate aminotransferase, and decreased hepatic hydroxyproline. The ability of Gm2199 to maintain hepatic proliferation capacity indicates it as a novel anti-liver damage lncRNA.

Role of the 85-Kilobase Plasmid and Plasmid-Encoded Virulence-Associated Protein A in Intracellular Survival and Virulence of Rhodococcus equi

PubMed Central

Giguère, Steeve; Hondalus, Mary K.; Yager, Julie A.; Darrah, Patricia; Mosser, David M.; Prescott, John F.

1999-01-01

Rhodococcus equi is a facultative intracellular pathogen of macrophages and a cause of pneumonia in young horses (foals) and immunocompromised people. Isolates of R. equi from pneumonic foals typically contain large, 85- or 90-kb plasmids encoding a highly immunogenic virulence-associated protein (VapA). The objective of this study was to determine the role of the 85-kb plasmid and VapA in the intracellular survival and virulence of R. equi. Clinical isolates containing the plasmid and expressing VapA efficiently replicated within mouse macrophages in vitro, while plasmid-cured derivatives of these organisms did not multiply intracellularly. An isolate harboring the large plasmid also replicated in the tissues of experimentally infected mice, whereas its plasmid-cured derivative was rapidly cleared. All foals experimentally infected with a plasmid-containing clinical isolate developed severe bronchopneumonia, whereas the foals infected with its plasmid-cured derivative remained asymptomatic and free of visible lung lesions. By day 14 postinfection, lung bacterial burdens had increased considerably in foals challenged with the plasmid-containing clinical isolate. In contrast, bacteria could no longer be cultured from the lungs of foals challenged with the isogenic plasmid-cured derivative. A recombinant, plasmid-cured derivative expressing wild-type levels of VapA failed to replicate in macrophages and remained avirulent for both mice and foals. These results show that the 85-kb plasmid of R. equi is essential for intracellular replication within macrophages and for development of disease in the native host, the foal. However, expression of VapA alone is not sufficient to restore the virulence phenotype. PMID:10377138

High GC Content Cas9-Mediated Genome-Editing and Biosynthetic Gene Cluster Activation in Saccharopolyspora erythraea.

PubMed

Liu, Yong; Wei, Wen-Ping; Ye, Bang-Ce

2018-05-18

The overexpression of bacterial secondary metabolite biosynthetic enzymes is the basis for industrial overproducing strains. Genome editing tools can be used to further improve gene expression and yield. Saccharopolyspora erythraea produces erythromycin, which has extensive clinical applications. In this study, the CRISPR-Cas9 system was used to edit genes in the S. erythraea genome. A temperature-sensitive plasmid containing the PermE promoter, to drive Cas9 expression, and the Pj23119 and PkasO promoters, to drive sgRNAs, was designed. Erythromycin esterase, encoded by S. erythraea SACE_1765, inactivates erythromycin by hydrolyzing the macrolactone ring. Sequencing and qRT-PCR confirmed that reporter genes were successfully inserted into the SACE_1765 gene. Deletion of SACE_1765 in a high-producing strain resulted in a 12.7% increase in erythromycin levels. Subsequent PermE- egfp knock-in at the SACE_0712 locus resulted in an 80.3% increase in erythromycin production compared with that of wild type. Further investigation showed that PermE promoter knock-in activated the erythromycin biosynthetic gene clusters at the SACE_0712 locus. Additionally, deletion of indA (SACE_1229) using dual sgRNA targeting without markers increased the editing efficiency to 65%. In summary, we have successfully applied Cas9-based genome editing to a bacterial strain, S. erythraea, with a high GC content. This system has potential application for both genome-editing and biosynthetic gene cluster activation in Actinobacteria.

Protective effects of a freeze-dried extract of vegetables and fruits on the hydroxyl radical-mediated oxidative damage of DNA and decrease of erythrocytes deformability.

PubMed

Wang, Hsiao-Ning; Liu, Tsan-Zon; Chen, Ya-Lei; Shiuan, David

2007-01-01

The protective effects of a freeze-dried extracts of vegetables and fruits (BauYuan; BY) on the hydroxyl radical-mediated DNA strand breakages and the structural integrity of human red blood cells (RBCs) were investigated. First, the supercoiled plasmid (pEGFP-C1) DNA was subjected to oxidation damage by an ascorbate-fortified Fenton reaction and the protective effects were analyzed by agarose gel electrophoresis. In the absence of BY extracts, exposure of the high-throughput .OH-generating system (Fe2+ concentration >1.0 microM) caused a complete fragmentation of DNA. Supplementation of BY extract (1 mg/mL) to the plasmid DNA prior to the exposure could prevent it significantly. In contrast, as the plasmid exposed to a low-grade .OH-generating system (Fe2+<0.1 microM), the BY extract (1 mg/mL) provided an almost complete protection. Next, the cell deformabilities were measured to assess the protection effects of various BY extracts on human erythrocytes exposed to the oxidative insults. We found that both the aqueous extract and the organic solvent-derived extracts could strongly protect human RBCs from the reactive oxygen species (ROS)-mediated decrease in the deformability indices. The results implicated that the BY extracts could effectively protect the cell membrane integrity via scavenging ROS which enabling RBCs to maintain a balance of water content and surface area to prevent the drop of cell deformability.

On the use of nonfluorescent dye labeled ligands in FRET-based receptor binding studies.

PubMed

Tahtaoui, Chouaib; Guillier, Fabrice; Klotz, Philippe; Galzi, Jean-Luc; Hibert, Marcel; Ilien, Brigitte

2005-12-01

The efficiency of fluorescence resonance energy transfer (FRET) is dependent upon donor-acceptor proximity and spectral overlap, whether the acceptor partner is fluorescent or not. We report here on the design, synthesis, and characterization of two novel pirenzepine derivatives that were coupled to patent blue VF and pinacyanol dyes. These nonfluorescent compounds, when added to cells stably expressing enhanced green fluorescent protein (EGFP)-fused muscarinic M1 receptors, promote EGFP fluorescence extinction in a time-, concentration-, and atropine-dependent manner. They display nanomolar affinity for the muscarinic receptor, determined using either FRET or classical radioligand binding conditions. We provide evidence that these compounds behave as potent acceptors of energy from excited EGFP with quenching efficiencies comparable to those of analogous fluorescent bodipy or rhodamine red pirenzepine derivatives. The advantages they offer over fluorescent ligands are illustrated and discussed in terms of reliability, sensitivity, and wider applicability of FRET-based receptor binding assays.

Gold Nanobeacons for Tracking Gene Silencing in Zebrafish

PubMed Central

Cordeiro, Milton; Carvalho, Lara; Silva, Joana; Saúde, Leonor; Fernandes, Alexandra R.; Baptista, Pedro V.

2017-01-01

The use of gold nanoparticles for effective gene silencing has demonstrated its potential as a tool for gene expression experiments and for the treatment of several diseases. Here, we used a gold nanobeacon designed to specifically silence the enhanced green fluorescence protein (EGFP) mRNA in embryos of a fli-EGFP transgenic zebrafish line, while simultaneously allowing the tracking and localization of the silencing events via the beacon’s emission. Fluorescence imaging measurements demonstrated a decrease of the EGFP emission with a concomitant increase in the fluorescence of the Au-nanobeacon. Furthermore, microinjection of the Au-nanobeacon led to a negligible difference in mortality and malformations in comparison to the free oligonucleotide, indicating that this system is a biocompatible platform for the administration of gene silencing moieties. Together, these data illustrate the potential of Au-nanobeacons as tools for in vivo zebrafish gene modulation with low toxicity which may be used towards any gene of interest. PMID:28336844

Development of a promoter shutoff system in Aspergillus oryzae using a sorbitol-sensitive promoter.

PubMed

Oda, Ken; Terado, Shiho; Toyoura, Rieko; Fukuda, Hisashi; Kawauchi, Moriyuki; Iwashita, Kazuhiro

2016-09-01

Promoter shutoff is a general method for analyzing essential genes, but in the fungus Aspergillus oryzae, no tightly repressed promoters have been reported. To overcome the current limitations of conditional promoters, we examined sorbitol- and galactose-responsive genes using microarrays to identify regulatable genes with only minor physiological and genetic effects. We identified two sorbitol-induced genes (designated as sorA and sorB), cloned their promoters, and built a regulated egfp and brlA expression system. Growth medium-dependent enhanced green fluorescence protein (EGFP) fluorescence and conidiation were confirmed for egfp and brlA under the control of their respective promoters. We also used this shutoff system to regulate the essential rhoA, which demonstrated the expected growth inhibition under repressed growth conditions. Our new sorbitol promoter shutoff system developed can serve as a valuable new tool for essential gene analyses of filamentous fungi.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Endow, Joshua K.; Rocha, Agostinho Gomes; Baldwin, Amy J.

PolyGly is present in many proteins in various organisms. One example is found in a transmembrane β-barrel protein, translocon at the outer-envelope-membrane of chloroplasts 75 (Toc75). Toc75 requires its N-terminal extension (t75) for proper localization. t75 comprises signals for chloroplast import (n75) and envelope sorting (c75) in tandem. n75 and c75 are removed by stromal processing peptidase and plastidic type I signal peptidase 1, respectively. PolyGly is present within c75 and its deletion or substitution causes mistargeting of Toc75 to the stroma. Here in this study we have examined the properties of polyGly-dependent protein targeting using two soluble passenger proteins,more » the mature portion of the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (mSS) and enhanced green fluorescent protein (EGFP). Both t75-mSS and t75-EGFP were imported into isolated chloroplasts and their n75 removed. Resultant c75-mSS was associated with the envelope at the intermembrane space, whereas c75-EGFP was partially exposed outside the envelope. Deletion of polyGly or substitution of tri-Ala for the critical tri-Gly segment within polyGly caused each passenger to be targeted to the stroma. Transient expression of t75-EGFP in Nicotiana benthamiana resulted in accumulation of c75-EGFP exposed at the surface of the chloroplast, but the majority of the EGFP passenger was found free in the cytosol with most of its c75 attachment removed. Results of circular dichroism analyses suggest that polyGly within c75 may form an extended conformation, which is disrupted by tri-Ala substitution. These data suggest that polyGly is distinct from a canonical stop-transfer sequence and acts as a rejection signal at the chloroplast inner envelope.« less

[Construction of Lactobacillus rhamnosus GG particles surface display system].

PubMed

Su, Runyu; Nie, Boyao; Yuan, Shengling; Tao, Haoxia; Liu, Chunjie; Yang, Bailiang; Wang, Yanchun

2017-01-25

To describe a novel particles surface display system which is consisted of gram-positive enhancer matrix (GEM) particles and anchor proteins for bacteria-like particles vaccines, we treated Lactobacillus rhamnosus GG bacteria with 10% heated-TCA for preparing GEM particles, and then identified the harvested GEM particles by electron microscopy, RT-PCR and SDS-PAGE. Meanwhile, Escherichia coli was induced to express hybrid proteins PA3-EGFP and P60-EGFP, and GEM particles were incubated with them. Then binding of anchor proteins were determined by Western blotting, transmission electron microscopy, fluorescence microscopy and spectrofluorometry. GEM particles preserved original size and shape, and proteins and DNA contents of GEM particles were released substantially. The two anchor proteins both had efficiently immobilized on the surface of GEM. GEM particles that were bounded by anchor proteins were brushy. The fluorescence of GEM particles anchoring PA3 was slightly brighter than P60, but the difference was not significant (P>0.05). GEM particles prepared from L. rhamnosus GG have a good binding efficiency with anchor proteins PA3-EGFP and P60-EGFP. Therefore, this novel foreign protein surface display system could be used for bacteria-like particle vaccines.

Co-liposomes having anisamide tagged lipid and cholesteryl tryptophan trigger enhanced gene transfection in sigma receptor positive cells.

PubMed

Misra, Santosh K; Moitra, Parikshit; Kondaiah, Paturu; Bhattacharya, Santanu

2016-06-01

Selective gene transfection could be strategy of interest for reducing off-target gene expression and toxicity. In this respect, sigma receptors are found to be over-expressed in many human tumors and liposomal formulations with ability to target these sigma receptors may improve the transfection efficiency to a significant level. To this direction, six novel lipids have been synthesized with different hydrophobic segments such as a long hydrophobic chain or a cholesteryl group and L-tryptophan as the head group. Three of them, Lipid 1, 3 and 5 possessed cationic Me3N(+) moiety at the distal end. In contrast each of the other three Lipid 2, 4 and 6 possessed sigma receptor targeting anisamide group with no cationic charge. Mixing of cationic and anisamide counterparts of the same lipid in a molar ratio of 1:1 produced co-liposomes L-M-1 (Lipid 1+2), L-M-2 (Lipid 3+4) and L-M-3 (Lipid 5+6). These co-liposomes, while keeping the sigma targeting anisamide tag intact, showed good DNA binding and release which were optimized from EB intercalation and gel electrophoresis assays. Inclusion of a zwitterionic, fusogenic natural lipid, DOPE, into the co-liposomes further improved the binding efficiencies of the lipid mixtures with DNA. These co-liposomes having cationic and anisamide lipids and DOPE were highly selective toward sigma positive HEK293 and HEK293T cells compared to the sigma negative HeLa cells. As evidenced from both FACS and luciferase assay, a lipid mixture comprising Lipid 3, 4 and DOPE in a molar ratio of 1:1:1 (L-M-2D1) was the best for transfection of reporter pEGFP-C3 and functional pCEP4-p53 gene plasmids. Anisamide mediated sigma receptor selectivity was further probed by pre-incubating the transfecting cells with lipids possessing anisamide and by quantification of the un-transfected plasmid DNA. Also each formulation was highly non-toxic in the cell lines examined. Copyright © 2016. Published by Elsevier B.V.

Transduction of Schistosoma mansoni by vesicular stomatitis virus glycoprotein-pseudotyped Moloney murine leukemia retrovirus.

PubMed

Kines, Kristine J; Mann, Victoria H; Morales, Maria E; Shelby, Bryan D; Kalinna, Bernd H; Gobert, Geoffrey N; Chirgwin, Sharon R; Brindley, Paul J

2006-04-01

Retroviral transduction of cultured schistosomes offers a potential means to establish transgenic lines of schistosomes and thereby to facilitate the elucidation of schistosome gene function and expression. The Moloney murine leukemia retroviral (MMLV) vector pLNHX was modified to incorporate EGFP or luciferase reporter genes under control of schistosome endogenous gene promoters from the spliced leader RNA and HSP70 genes. These constructs and a plasmid encoding vesicular stomatitis virus glycoprotein (VSVG) were utilized along with GP2-293 cells to produce replication incompetent retrovirus particles pseudotyped with the VSVG envelope. Exposure of several developmental stages, including sporocysts, of Schistosoma mansoni to these virions was facilitated by incubation with polybrene and/or by centrifugation. The early stages of binding and uptake of virus to the parasite tegument were demonstrated by the immunofluorescence colocalization of VSVG envelope and retroviral capsid proteins. Southern hybridization analysis indicated the integration of proviral forms of the MMLV constructs in genomic DNA isolated from the virus exposed schistosomes. Furthermore, analysis of RNA isolated from virus treated parasites demonstrated the presence of transcripts encoding reporter transgenes. Together these results indicated productive transduction by VSVG pseudotyped MMLV of cultured schistosomes, and suggest a tractable route forward towards heritable schistosome transgenesis.

Electrotransfer of Plasmid Vector DNA into Muscle

NASA Astrophysics Data System (ADS)

Miyazaki, Satsuki; Miyazaki, Jun-Ichi

Wolff et al. (1990) first reported that plasmid DNA injected into skeletal muscle is taken up by muscle cells and the genes in the plasmid are expressed for more than two months thereafter, although the transfected DNA does not usually undergo chromosomal integration (Wolff et al., 1991, 1992). However, the relatively low expression levels attained by this method have hampered its applications for uses other than as a DNA vaccine (Davis et al., 1995). There are a number of reports analyzing the conditions that affect the efficiency of gene transfer by intramuscular DNA injection and assessing the fine structures of expression plasmid vectors that may affect expression levels (Davis et al., 1993; Liang et al., 1996; Norman et al., 1997). Furthermore, various attempts were done to improve the efficiency of gene transfer by intramus cular DNA injection. Consequently, regenerating muscle was shown to produce 80-fold or more protein than did normal muscle, following injection of an expression plas-mid. Muscle regeneration was induced by treatment with cardiotoxin or bupivacaine (Wells, 1993; Vitadello et al., 1994). We previously demonstrated that by combining a strong promoter and bupivacaine pretreatment intramuscular injection of an IL-5 expression plasmid results in IL-5 production in muscle at a level sufficient to induce marked proliferation of eosinophils in the bone marrow and eosinophil infiltration of various organs (Tokui et al., 1997). It was also reported that a single intramuscular injection of an erythropoietin expression plasmid produced physiologically significant elevations in serum erythropoietin levels and increased hematocrits in adult mice (Tripathy et al., 1996). Hematocrits in these animals remained elevated at >60% for at least 90 days after a single injection. However, improvements to this method have not been sufficient to extend its applications including clinical use.

Back to basics: pBR322 and protein expression systems in E. coli.

PubMed

Balbás, Paulina; Bolívar, Francisco

2004-01-01

The extensive variety of plasmid-based expression systems in E. coli resulted from the fact that there is no single strategy for achieving maximal expression of every cloned gene. Although a number of strategies have been implemented to deal with problems associated to gene transcription and translation, protein folding, secretion, location, posttranslational modifications, particularities of different strains, and the like and more integrated processes have been developed, the basic plasmid-borne elements and their interaction with the particular host strain will influence the overall expression system and final productivity. Plasmid vector pBR322 is a well-established multipurpose cloning vector in laboratories worldwide, and a large number of derivatives have been created for specific applications and research purposes, including gene expression in its natural host, E. coli, and few other bacteria. The early characterization of the molecule, including its nucleotide sequence, replication and maintenance mechanisms, and determination of its coding regions, accounted for its success, not only as a universal cloning vector, but also as a provider of genes and an origin of replication for other intraspecies vectors. Since the publication of the aforementioned reviews, novel discoveries pertaining to these issues have appeared in the literature that deepen the understanding of the plasmid's features, behavior, and impact in gene expression systems, as well as some important strain characteristics that affect plasmid replication and stability. The objectives of this review include updating and discussing the new information about (1) the replication and maintenance of pBR322; (2) the host-related modulation mechanisms of plasmid replication; (3) the effects of growth rate on replication control, stability, and recombinant gene expression; (4) ways for plasmid amplification and elimination. Finally, (5) a summary of novel ancillary studies about pBR322 is presented.

The immune response induced by DNA vaccine expressing nfa1 gene against Naegleria fowleri.

PubMed

Kim, Jong-Hyun; Lee, Sang-Hee; Sohn, Hae-Jin; Lee, Jinyoung; Chwae, Yong-Joon; Park, Sun; Kim, Kyongmin; Shin, Ho-Joon

2012-12-01

The pathogenic free-living amoeba, Naegleria fowleri, causes fatal primary amoebic meningoencephalitis in experimental animals and in humans. The nfa1 gene that was cloned from N. fowleri is located on pseudopodia, especially amoebic food cups and plays an important role in the pathogenesis of N. fowleri. In this study, we constructed and characterized retroviral vector and lentiviral vector systems for nfa1 DNA vaccination in mice. We constructed the retroviral vector (pQCXIN) and the lentiviral vector (pCDH) cloned with the egfp-nfa1 gene. The expression of nfa1 gene in Chinese hamster ovary cell and human primary nasal epithelial cell transfected with the pQCXIN/egfp-nfa1 vector or pCDH/egfp-nfa1 vector was observed by fluorescent microscopy and Western blotting analysis. Our viral vector systems effectively delivered the nfa1 gene to the target cells and expressed the Nfa1 protein within the target cells. To evaluate immune responses of nfa1-vaccinated mice, BALB/c mice were intranasally vaccinated with viral particles of each retro- or lentiviral vector expressing nfa1 gene. DNA vaccination using viral vectors expressing nfa1 significantly stimulated the production of Nfa1-specific IgG subclass, as well as IgG levels. In particular, both levels of IgG2a (Th1) and IgG1 (Th2) were significantly increased in mice vaccinated with viral vectors. These results show the nfa1-vaccination induce efficiently Th1 type, as well as Th2 type immune responses. This is the first report to construct viral vector systems and to evaluate immune responses as DNA vaccination in N. fowleri infection. Furthermore, these results suggest that nfal vaccination may be an effective method for treatment of N. fowleri infection.

Analysis of illegitimate genomic integration mediated by zinc-finger nucleases: implications for specificity of targeted gene correction

PubMed Central

2010-01-01

Background Formation of site specific genomic double strand breaks (DSBs), induced by the expression of a pair of engineered zinc-finger nucleases (ZFNs), dramatically increases the rates of homologous recombination (HR) between a specific genomic target and a donor plasmid. However, for the safe use of ZFN induced HR in practical applications, possible adverse effects of the technology such as cytotoxicity and genotoxicity need to be well understood. In this work, off-target activity of a pair of ZFNs has been examined by measuring the ratio between HR and illegitimate genomic integration in cells that are growing exponentially, and in cells that have been arrested in the G2/M phase. Results A reporter cell line that contained consensus ZFN binding sites in an enhanced green fluorescent protein (EGFP) reporter gene was used to measure ratios between HR and non-homologous integration of a plasmid template. Both in human cells (HEK 293) containing the consensus ZFN binding sites and in cells lacking the ZFN binding sites, a 3.5 fold increase in the level of illegitimate integration was observed upon ZFN expression. Since the reporter gene containing the consensus ZFN target sites was found to be intact in cells where illegitimate integration had occurred, increased rates of illegitimate integration most likely resulted from the formation of off-target genomic DSBs. Additionally, in a fraction of the ZFN treated cells the co-occurrence of both specific HR and illegitimate integration was observed. As a mean to minimize unspecific effects, cell cycle manipulation of the target cells by induction of a transient G2/M cell cycle arrest was shown to stimulate the activity of HR while having little effect on the levels of illegitimate integration, thus resulting in a nearly eight fold increase in the ratio between the two processes. Conclusions The demonstration that ZFN expression, in addition to stimulating specific gene targeting by HR, leads to increased rates of illegitimate integration emphasizes the importance of careful characterization of ZFN treated cells. In order to reduce off-target events, reversible cell cycle arrest of the target cells in the G2/M phase is an efficient way for increasing the ratio between specific HR and illegitimate integration. PMID:20459736

Bromodomain and Extra-terminal (BET) Protein Inhibitors Suppress Chondrocyte Differentiation and Restrain Bone Growth.

PubMed

Niu, Ningning; Shao, Rui; Yan, Guang; Zou, Weiguo

2016-12-23

Small molecule inhibitors for bromodomain and extra-terminal (BET) proteins have recently emerged as potential therapeutic agents in clinical trials for various cancers. However, to date, it is unknown whether these inhibitors have side effects on bone structures. Here, we report that inhibition of BET bromodomain proteins may suppress chondrocyte differentiation and restrain bone growth. We generated a luciferase reporter system using the chondrogenic cell line ATDC5 in which the luciferase gene was driven by the promoter of Col2a1, an elementary collagen of the chondrocyte. The Col2a1-luciferase ATDC5 system was used for rapidly screening both activators and repressors of human collagen Col2a1 gene expression, and we found that BET bromodomain inhibitors reduce the Col2a1-luciferase. Consistent with the luciferase assay, BET inhibitors decrease the expression of Col2a1 Furthermore, we constructed a zebrafish line in which the enhanced green fluorescent protein (EGFP) expression was driven by col2a1 promoter. The transgenic (col2a1-EGFP) zebrafish line demonstrated that BET inhibitors I-BET151 and (+)-JQ1 may affect EGFP expression in zebrafish. Furthermore, we found that I-BET151 and (+)-JQ1 may affect chondrocyte differentiation in vitro and inhibit zebrafish growth in vivo Mechanistic analysis revealed that BET inhibitors influenced the depletion of RNA polymerase II from the Col2a1 promoter. Collectively, these results suggest that BET bromodomain inhibition may have side effects on skeletal bone structures. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Overexpression of adrenomedullin protects mesenchymal stem cells against hypoxia and serum deprivation-induced apoptosis via the Akt/GSK3β and Bcl-2 signaling pathways

PubMed Central

Song, Yuqing; Li, Lili

2018-01-01

The poor survival rate of transplanted mesenchymal stem cells (MSCs) within the ischemic heart limits their therapeutic potential for cardiac repair. Adrenomedullin (ADM) has been identified as a potent apoptotic inhibitor. The present study aimed to investigate the protective effects of ADM on MSCs against hypoxia and serum deprivation (H/SD)-induced apoptosis, and to determine the potential underlying mechanisms. In the present study, a recombinant adenovirus expressing the ADM gene was established and was infected into MSCs. The infection rate was determined via microscopic detection of green fluorescence and flow cytometric analysis. The mRNA expression levels of ADM were detected by reverse transcription-polymerase chain reaction. In addition, a model of H/SD was generated. The MSCs were randomly separated into six groups: Control, enhanced green fluorescent protein (EGFP)-Adv, EGFP-ADM, H/SD, EGFP-Adv + H/SD and EGFP-ADM + H/SD. Cell viability and proliferation were determined using the Cell Counting kit-8 assay. Apoptosis was assessed by terminal deoxynucleotidyl transferase-mediated-dUTP nick-end labeling assay and flow cytometric analysis using Annexin V-phycoerythrin/7-aminoactinomycin D staining. The protein expression levels of total protein kinase B (Akt), phosphorylated (p)-Akt, total glycogen synthase kinase (GSK)3β, p-GSK3β, B-cell lymphoma 2 (Bcl-2), Bcl-2-associated X protein (Bax), caspase-3 and cleaved caspase-3 were detected by western blot analysis. The results indicated that ADM overexpression could improve MSC proliferation and viability, and protect MSCs against H/SD-induced apoptosis. In addition, ADM overexpression increased Akt and GSK3β phosphorylation, and Bcl-2/Bax ratio, and decreased the activation of caspase-3. These results suggested that ADM protects MSCs against H/SD-induced apoptosis, which may be mediated via the Akt/GSK3β and Bcl-2 signaling pathways. PMID:29512737

Silencing heat shock protein 27 (HSP27) inhibits the proliferation and migration of vascular smooth muscle cells in vitro.

PubMed

Huang, Jie; Xie, Liang-di; Luo, Li; Zheng, Su-Li; Wang, Hua-Jun; Xu, Chang-Sheng

2014-05-01

The objective of this study was to examine the role of heat shock protein 27 (HSP27) in proliferation and migration of vascular smooth muscle cells (VSMCs). Three complementary DNA sequences targeting rat HSP27 gene were designed, synthesized, and subcloned into lentiviral vector. The interfering efficiency was detected by reverse transcriptase-polymerase chain reaction and Western blot. Methyl thiazolyl tetrazolium bromide assay was used for examining cell proliferation. F-actin polymerization was detected by FITC-Phalloidin staining using confocal microscopy. Modified Boyden chamber technique was used to assess VSMCs migration. The recombinant lentivirus containing RNAi targeting HSP27 gene significantly inhibited expression of HSP27 at both mRNA and protein levels. The interfering efficiencies of pNL-HSP27-EGFP-1, pNL-HSP27-EGFP-2, and pNL-HSP27-EGFP-3 were 71 %, 77 %, and 43 %, respectively. Reorganization of actin stimulated by PDGF-BB was markedly blocked by pretreatment with pNL-HSP27-EGFP-2. Proliferation and migration rates of VSMCs induced by PDGF-BB were inhibited by 30.8 % and 45.6 %, respectively, by pNL-HSP27-EGFP-2 (all P < 0.01). To conclude, these data indicate that HSP27 may regulate the proliferation, actin reorganization, and the migration of VSMCs. RNAi targeting at HSP27 may be a potential approach for inhibition of cell migration involved in pathogenesis of proliferative vascular diseases.

Number and brightness image analysis reveals ATF-induced dimerization kinetics of uPAR in the cell membrane

PubMed Central

Hellriegel, Christian; Caiolfa, Valeria R.; Corti, Valeria; Sidenius, Nicolai; Zamai, Moreno

2011-01-01

We studied the molecular forms of the GPI-anchored urokinase plasminogen activator receptor (uPAR-mEGFP) in the human embryo kidney (HEK293) cell membrane and demonstrated that the binding of the amino-terminal fragment (ATF) of urokinase plasminogen activator is sufficient to induce the dimerization of the receptor. We followed the association kinetics and determined precisely the dimeric stoichiometry of uPAR-mEGFP complexes by applying number and brightness (N&B) image analysis. N&B is a novel fluctuation-based approach for measuring the molecular brightness of fluorophores in an image time sequence in live cells. Because N&B is very sensitive to long-term temporal fluctuations and photobleaching, we have introduced a filtering protocol that corrects for these important sources of error. Critical experimental parameters in N&B analysis are illustrated and analyzed by simulation studies. Control experiments are based on mEGFP-GPI, mEGFP-mEGFP-GPI, and mCherry-GPI, expressed in HEK293. This work provides a first direct demonstration of the dimerization of uPAR in live cells. We also provide the first methodological guide on N&B to discern minor changes in molecular composition such as those due to dimerization events, which are involved in fundamental cell signaling mechanisms.—Hellriegel, C., Caiolfa, V. R., Corti, V., Sidenius, N., Zamai, M. Number and brightness image analysis reveals ATF-induced dimerization kinetics of uPAR in the cell membrane. PMID:21602447

Genetic Stability of Streptomyces Lividans pIJ702 in Response to Spaceflight

NASA Astrophysics Data System (ADS)

Lim, K. S.; Goins, T. L.; Voeikova, T. A.; Pyle, B. H.

2008-06-01

Streptomyces lividans carrying plasmid pIJ702 encoding genes for thiostrepton resistance (tsr-) and melanin production (mel+) was plated on agar and flown on the Russian satellite Foton-M3 for 16 days. The percentage loss of plasmid expression in flight samples was lower than that in ground samples when both samples were grown in enriched (ISP) media. Differences in media content also affect plasmid expression rate; ISP media have a higher loss of plasmid expression than samples in minimum media when both were grown on ground conditions. Results suggest that stress resulted in the increased expression of plasmid pIJ702 by S. lividans. Screening of thiostrepton resistant white (tsr+ mel-) mutants showed similar proportions of variants in ground samples and flight samples. To determine if there are mutations in the mel gene, DNA extracted from flight and control white mutants was amplified and gel electrophoresis of amplified products show no major mutation in the products. Sequencing of amplified products is required to identify mutations resulting in loss of pigmentation.

The Kinetics of G2 and M Transitions Regulated by B Cyclins

PubMed Central

Huang, Yehong; Sramkoski, R. Michael; Jacobberger, James W.

2013-01-01

B cyclins regulate G2-M transition. Because human somatic cells continue to cycle after reduction of cyclin B1 (cycB1) or cyclin B2 (cycB2) by RNA interference (RNAi), and because cycB2 knockout mice are viable, the existence of two genes should be an optimization. To explore this idea, we generated HeLa BD™ Tet-Off cell lines with inducible cyclin B1- or B2-EGFP that were RNAi resistant. Cultures were treated with RNAi and/or doxycycline (Dox) and bromodeoxyuridine. We measured G2 and M transit times and 4C cell accumulation. In the absence of ectopic B cyclin expression, knockdown (kd) of either cyclin increased G2 transit. M transit was increased by cycB1 kd but decreased by cycB2 depletion. This novel difference was further supported by time-lapse microscopy. This suggests that cycB2 tunes mitotic timing, and we speculate that this is through regulation of a Golgi checkpoint. In the presence of endogenous cyclins, expression of active B cyclin-EGFPs did not affect G2 or M phase times. As previously shown, B cyclin co-depletion induced G2 arrest. Expression of either B cyclin-EGFP completely rescued knockdown of the respective endogenous cyclin in single kd experiments, and either cyclin-EGFP completely rescued endogenous cyclin co-depletion. Most of the rescue occurred at relatively low levels of exogenous cyclin expression. Therefore, cycB1 and cycB2 are interchangeable for ability to promote G2 and M transition in this experimental setting. Cyclin B1 is thought to be required for the mammalian somatic cell cycle, while cyclin B2 is thought to be dispensable. However, residual levels of cyclin B1 or cyclin B2 in double knockdown experiments are not sufficient to promote successful mitosis, yet residual levels are sufficient to promote mitosis in the presence of the dispensible cyclin B2. We discuss a simple model that would explain most data if cyclin B1 is necessary. PMID:24324638

Development of inducer-free expression plasmids based on IPTG-inducible promoters for Bacillus subtilis.

PubMed

Tran, Dinh Thi Minh; Phan, Trang Thi Phuong; Huynh, Thanh Kieu; Dang, Ngan Thi Kim; Huynh, Phuong Thi Kim; Nguyen, Tri Minh; Truong, Tuom Thi Tinh; Tran, Thuoc Linh; Schumann, Wolfgang; Nguyen, Hoang Duc

2017-07-25

Besides Escherichia coli, Bacillus subtilis is an important bacterial species for the production of recombinant proteins. Recombinant genes are inserted into shuttle expression vectors which replicate in both E. coli and in B. subtilis. The ligation products are first transformed into E. coli cells, analyzed for correct insertions, and the correct recombinant plasmids are then transformed into B. subtilis. A major problem using E. coli cells can be the strong basal level of expression of the recombinant protein which may interfere with the stability of the cells. To minimize this problem, we developed strong expression vectors being repressed in E. coli and inducer-free in B. subtilis. In general, induction of IPTG-inducible expression vectors is determined by the regulatory lacI gene encoding the LacI repressor in combination with the lacO operator on the promoter. To investigate the inducer-free properties of the vectors, we constructed inducer-free expression plasmids by removing the lacI gene and characterized their properties. First, we examined the ability to repress a reporter gene in E. coli, which is a prominent property facilitating the construction of the expression vectors carrying a target gene. The β-galactosidase (bgaB gene) basal levels expressed from Pgrac01-bgaB could be repressed at least twice in the E. coli cloning strain. Second, the inducer-free production of BgaB from four different plasmids with the Pgrac01 promoter in B. subtilis was investigated. As expected, BgaB expression levels of inducer-free constructs are at least 37 times higher than that of the inducible constructs in the absence of IPTG, and comparable to those in the presence of the inducer. Third, using efficient IPTG-inducible expression vectors containing the strong promoter Pgrac100, we could convert them into inducer-free expression plasmids. The BgaB production levels from the inducer-free plasmid in the absence of the inducer were at least 4.5 times higher than that of the inducible vector using the same promoter. Finally, we used gfp as a reporter gene in combination with the two promoters Pgrac01 and Pgrac100 to test the new vector types. The GFP expression levels could be repressed at least 1.5 times for the Pgrac01-gfp+ inducer-free construct in E. coli. The inducer-free constructs Pgrac01-gfp+ and Pgrac100-gfp+ allowed GFP expression at high levels from 23 × 10 4 to 32 × 10 4 RFU units and 9-13% of total intracellular proteins. We could reconfirm the two major advantages of the new inducer-free expression plasmids: (1) Strong repression of the target gene expression in the E. coli cloning strain, and (2) production of the target protein at high levels in B. subtilis in the absence of the inducer. We propose a general strategy to generate inducer-free expression vector by using IPTG-inducible vectors, and more specifically we developed inducer-free expression plasmids using IPTG-inducible promoters in the absence of the LacI repressor. These plasmids could be an excellent choice for high-level production of recombinant proteins in B. subtilis without the addition of inducer and at the same time maintaining a low basal level of the recombinant proteins in E. coli. The repression of the recombinant gene expression would facilitate cloning of genes that potentially inhibit the growth of E. coli cloning strains. The inducer-free expression plasmids will be extended versions of the current available IPTG-inducible expression vectors for B. subtilis, in which all these vectors use the same cognate promoters. These inducer-free and previously developed IPTG-inducible expression plasmids will be a useful cassette to study gene expression at a small scale up to a larger scale up for the production of recombinant proteins.

Duck Enteritis Virus Glycoprotein D and B DNA Vaccines Induce Immune Responses and Immunoprotection in Pekin Ducks

PubMed Central

Zhao, Yan; Cao, Yongsheng; Cui, Lihong; Ma, Bo; Mu, Xiaoyu; Li, Yanwei; Zhang, Zhihui; Li, Dan; Wei, Wei; Gao, Mingchun; Wang, Junwei

2014-01-01

DNA vaccine is a promising strategy for protection against virus infection. However, little is known on the efficacy of vaccination with two plasmids for expressing the glycoprotein D (gD) and glycoprotein B (gB) of duck enteritis virus (DEV) in inducing immune response and immunoprotection against virulent virus infection in Pekin ducks. In this study, two eukaryotic expressing plasmids of pcDNA3.1-gB and pcDNA3.1-gD were constructed. Following transfection, the gB and gD expressions in DF1 cells were detected. Groups of ducks were vaccinated with pcDNA3.1-gB and/or pcDNA3.1-gD, and boosted with the same vaccine on day 14 post primary vaccination. We found that intramuscular vaccinations with pcDNA3.1-gB and/or pcDNA3.1-gD, but not control plasmid, stimulated a high frequency of CD4+ and CD8+ T cells in Pekin ducks, particularly with both plasmids. Similarly, vaccination with these plasmids, particularly with both plasmids, promoted higher levels of neutralization antibodies against DEV in Pekin ducks. More importantly, vaccination with both plasmids significantly reduced the virulent DEV-induced mortality in Pekin ducks. Our data indicated that vaccination with plasmids for expressing both gB and gD induced potent cellular and humoral immunity against DEV in Pekin ducks. Therefore, this vaccination strategy may be used for the prevention of DEV infection in Pekin ducks. PMID:24736466

Duck enteritis virus glycoprotein D and B DNA vaccines induce immune responses and immunoprotection in Pekin ducks.

PubMed

Zhao, Yan; Cao, Yongsheng; Cui, Lihong; Ma, Bo; Mu, Xiaoyu; Li, Yanwei; Zhang, Zhihui; Li, Dan; Wei, Wei; Gao, Mingchun; Wang, Junwei

2014-01-01

DNA vaccine is a promising strategy for protection against virus infection. However, little is known on the efficacy of vaccination with two plasmids for expressing the glycoprotein D (gD) and glycoprotein B (gB) of duck enteritis virus (DEV) in inducing immune response and immunoprotection against virulent virus infection in Pekin ducks. In this study, two eukaryotic expressing plasmids of pcDNA3.1-gB and pcDNA3.1-gD were constructed. Following transfection, the gB and gD expressions in DF1 cells were detected. Groups of ducks were vaccinated with pcDNA3.1-gB and/or pcDNA3.1-gD, and boosted with the same vaccine on day 14 post primary vaccination. We found that intramuscular vaccinations with pcDNA3.1-gB and/or pcDNA3.1-gD, but not control plasmid, stimulated a high frequency of CD4+ and CD8+ T cells in Pekin ducks, particularly with both plasmids. Similarly, vaccination with these plasmids, particularly with both plasmids, promoted higher levels of neutralization antibodies against DEV in Pekin ducks. More importantly, vaccination with both plasmids significantly reduced the virulent DEV-induced mortality in Pekin ducks. Our data indicated that vaccination with plasmids for expressing both gB and gD induced potent cellular and humoral immunity against DEV in Pekin ducks. Therefore, this vaccination strategy may be used for the prevention of DEV infection in Pekin ducks.

Manipulation of VviAGL11 expression changes the seed content in grapevine (Vitis vinifera L.).

PubMed

Malabarba, Jaiana; Buffon, Vanessa; Mariath, Jorge E A; Maraschin, Felipe S; Margis-Pinheiro, Márcia; Pasquali, Giancarlo; Revers, Luís F

2018-04-01

Seedlessness in grapes is a desirable trait, especially for in natura consumption. Previously, we showed that VviAGL11 is the main responsible gene for seed morphogenesis in grapevine. Here we tested the function of this gene in grapevine with the use of plant plasmids. VviAGL11 was cloned into silencing and overexpression versions of p28iIR plasmid. Reproductive grapevine bunches from different seeded and seedless cultivars were separately treated with VviAGL11-harboring plasmids, along with controls. Plasmids were detected in leaves after a month of treatment, and berries, leaves, stems and seeds were analyzed for ectopic gene expression by RT-qPCR after 90 days of plasmid injection. Fruits from the seedless 'Linda' treated with the VviAGL11-overexpression plasmid showed high expression levels of VviAGL11 and exhibited small seeds that were not found in the untreated control samples. Mature grapes from seeded 'Italia' and 'Ruby' bunches treated with the VviAGL11-silencing plasmid showed decreased VviAGL11 expression, reduced number of seeds and increased number of seed traces. The present study confirms that VviAGL11 is a key master regulator of seed morphogenesis in grapevine and corroborates with the applicability of plant plasmids as promising biotechnological tools to functionally test genes in perennial plants in a rapid and confident way. Copyright © 2018 Elsevier B.V. All rights reserved.

Construction of pTM series plasmids for gene expression in Brucella species.

PubMed

Tian, Mingxing; Qu, Jing; Bao, Yanqing; Gao, Jianpeng; Liu, Jiameng; Wang, Shaohui; Sun, Yingjie; Ding, Chan; Yu, Shengqing

2016-04-01

Brucellosis, the most common widespread zoonotic disease, is caused by Brucella spp., which are facultative, intracellular, Gram-negative bacteria. With the development of molecular biology techniques, more and more virulence-associated factors have been identified in Brucella spp. A suitable plasmid system is an important tool to study virulence genes in Brucella. In this study, we constructed three constitutive replication plasmids (pTM1-Cm, pTM2-Amp, and pTM3-Km) using the replication origin (rep) region derived from the pBBR1-MCS vector. Also, a DNA fragment containing multiple cloning sites (MCSs) and a terminator sequence derived from the pCold vector were produced for complementation of the deleted genes. Besides pGH-6×His, a plasmid containing the groE promoter of Brucella spp. was constructed to express exogenous proteins in Brucella with high efficiency. Furthermore, we constructed the inducible expression plasmid pZT-6×His, containing the tetracycline-inducible promoter pzt1, which can induce expression by the addition of tetracycline in the Brucella culture medium. The constructed pTM series plasmids will play an important role in the functional investigation of Brucella spp. Copyright © 2016 Elsevier B.V. All rights reserved.

Dextransucrase Expression Is Concomitant with that of Replication and Maintenance Functions of the pMN1 Plasmid in Lactobacillus sakei MN1

PubMed Central

Nácher-Vázquez, Montserrat; Ruiz-Masó, José A.; Mohedano, María L.; del Solar, Gloria; Aznar, Rosa; López, Paloma

2017-01-01

The exopolysaccharide synthesized by Lactobacillus sakei MN1 is a dextran with antiviral and immunomodulatory properties of potential utility in aquaculture. In this work we have investigated the genetic basis of dextran production by this bacterium. Southern blot hybridization experiments demonstrated the plasmidic location of the dsrLS gene, which encodes the dextransucrase involved in dextran synthesis. DNA sequencing of the 11,126 kbp plasmid (pMN1) revealed that it belongs to a family which replicates by the theta mechanism, whose prototype is pUCL287. The plasmid comprises the origin of replication, repA, repB, and dsrLS genes, as well as seven open reading frames of uncharacterized function. Lb. sakei MN1 produces dextran when sucrose, but not glucose, is present in the growth medium. Therefore, plasmid copy number and stability, as well as dsrLS expression, were investigated in cultures grown in the presence of either sucrose or glucose. The results revealed that pMN1 is a stable low-copy-number plasmid in both conditions. Gene expression studies showed that dsrLS is constitutively expressed, irrespective of the carbon source present in the medium. Moreover, dsrLS is expressed from a monocistronic transcript as well as from a polycistronic repA-repB-orf1-dsrLS mRNA. To our knowledge, this is the first report of a plasmid-borne dextransucrase-encoding gene, as well as the first time that co-transcription of genes involved in plasmid maintenance and replication with a gene encoding an enzyme has been established. PMID:29209293

Expression of hygromycin B resistance in oyster culinary-medicinal mushroom, Pleurotus ostreatus (Jacq.:Fr.)P. Kumm. (higher Basidiomycetes) using three gene expression systems.

PubMed

Dong, Xiaoya; Zhang, Ke; Gao, Yuqian; Qi, Yuancheng; Shen, Jinwen; Qiu, Liyou

2012-01-01

Three hygromycin B phosphotransferase (hph) gene expression systems for culinary-medicinal Oyster mushroom, Pleurotus ostreatus, plasmid pSHC, pAN7-1, and pBHt1 were evaluated through PEG/CaCl(2)-mediated protoplast transformation. Plasmid pSHC is a newly constructed hph gene expression system, composed of Escherichia coli hph gene, the P. ostreatus sdi promoter, and the CaMV35S terminator. The vector pAN7-1 was commonly used for integrative transformation in filamentous fungi. Plasmid pBHtl is a T-DNA binary vector, usually introduced into fungi by Agrobacterium-mediated transformation. The results showed that plasmids pSHC, pAN7-1, and pBHt1 were all integrated into the host chromosomes and expressed hygromycin B resistance in P. ostreatus. pAN7-1 had the highest transformation efficiency and hph gene expression level, pSHC the second, and pBHt1 the lowest. Growth rates of the transformants on plates containing hygromycin B were in correspondence with their hph gene expression levels. To our knowledge, this is the first report on integrated transformation of plasmid pAN7-1 and pBHt1 in P. ostreatus.

Characterization of dopamine D1 and D2 receptor-expressing neurons in the mouse hippocampus.

PubMed

Gangarossa, Giuseppe; Longueville, Sophie; De Bundel, Dimitri; Perroy, Julie; Hervé, Denis; Girault, Jean-Antoine; Valjent, Emmanuel

2012-12-01

The hippocampal formation is part of an anatomical system critically involved in learning and memory. Increasing evidence suggests that dopamine plays an important role in learning and memory as well as in several forms of synaptic plasticity. However, the precise identification of neuronal populations expressing D1 or D2 dopamine receptors within the hippocampus is still lacking. To clarify this issue, we used BAC transgenic mice expressing enhanced green fluorescent protein (EGFP) under the control of the promoter of dopamine D1 or D2 receptors. In Drd1a-EGFP mice, sparse GFP-expressing neurons were detected among glutamatergic projecting neurons of the granular layer of the dentate gyrus and GABAergic interneurons located in the hilus. A dense immunofluorescence was observed in the outer and medial part of the molecular layer of the dentate gyrus as well as in the inner part of the molecular layer of CA1 corresponding to the terminals of pyramidal neurons of the entorhinal cortex defining the perforant and the temporo-ammonic pathway respectively. Finally, scattered D1 receptor-expressing neurons were also identified as GABAergic interneurons in the CA3/CA1 fields of the hippocampus. In Drd2-EGFP transgenic mice, GFP was exclusively detected in the glutamatergic mossy cells located in the polymorphic layer of the dentate gyrus. This pattern was confirmed in Drd2-Cre mice crossed with NLS-LacZ-Tau(mGFP) :LoxP and RCE:LoxP reporter lines. Our results demonstrate that D1 and D2 receptor-expressing neurons are strictly segregated in the mouse hippocampus. By clarifying the identity of D1 and D2 receptor-expressing neurons in the hippocampus, this study establishes a basis for future investigations aiming at elucidating their roles in the hippocampal network. Copyright © 2012 Wiley Periodicals, Inc.

Live Cell Imaging and 3D Analysis of Angiotensin Receptor Type 1a Trafficking in Transfected Human Embryonic Kidney Cells Using Confocal Microscopy.

PubMed

Kadam, Parnika; McAllister, Ryan; Urbach, Jeffrey S; Sandberg, Kathryn; Mueller, Susette C

2017-03-27

Live-cell imaging is used to simultaneously capture time-lapse images of angiotensin type 1a receptors (AT1aR) and intracellular compartments in transfected human embryonic kidney-293 (HEK) cells following stimulation with angiotensin II (Ang II). HEK cells are transiently transfected with plasmid DNA containing AT1aR tagged with enhanced green fluorescent protein (EGFP). Lysosomes are identified with a red fluorescent dye. Live-cell images are captured on a laser scanning confocal microscope after Ang II stimulation and analyzed by software in three dimensions (3D, voxels) over time. Live-cell imaging enables investigations into receptor trafficking and avoids confounds associated with fixation, and in particular, the loss or artefactual displacement of EGFP-tagged membrane receptors. Thus, as individual cells are tracked through time, the subcellular localization of receptors can be imaged and measured. Images must be acquired sufficiently rapidly to capture rapid vesicle movement. Yet, at faster imaging speeds, the number of photons collected is reduced. Compromises must also be made in the selection of imaging parameters like voxel size in order to gain imaging speed. Significant applications of live-cell imaging are to study protein trafficking, migration, proliferation, cell cycle, apoptosis, autophagy and protein-protein interaction and dynamics, to name but a few.

Evaluation of sterol transport from the endoplasmic reticulum to mitochondria using mitochondrially targeted bacterial sterol acyltransferase in Saccharomyces cerevisiae.

PubMed

Tian, Siqi; Ohta, Akinori; Horiuchi, Hiroyuki; Fukuda, Ryouichi

2015-01-01

To elucidate the mechanism of interorganelle sterol transport, a system to evaluate sterol transport from the endoplasmic reticulum (ER) to the mitochondria was constructed. A bacterial glycerophospholipid: cholesterol acyltransferase fused with a mitochondria-targeting sequence and a membrane-spanning domain of the mitochondrial inner membrane protein Pet100 and enhanced green fluorescent protein was expressed in a Saccharomyces cerevisiae mutant deleted for ARE1 and ARE2 encoding acyl-CoA:sterol acyltransferases. Microscopic observation and subcellular fractionation suggested that this fusion protein, which was named mito-SatA-EGFP, was localized in the mitochondria. Steryl esters were synthesized in the mutant expressing mito-SatA-EGFP. This system will be applicable for evaluations of sterol transport from the ER to the mitochondria in yeast by examining sterol esterification in the mitochondria.

Capillary arterialization requires the bone-marrow-derived cell (BMC)-specific expression of chemokine (C-C motif) receptor-2, but BMCs do not transdifferentiate into microvascular smooth muscle.

PubMed

Nickerson, Meghan M; Burke, Caitlin W; Meisner, Joshua K; Shuptrine, Casey W; Song, Ji; Price, Richard J

2009-01-01

Chemokine (C-C motif) receptor-2 (CCR2) regulates arteriogenesis and angiogenesis, facilitating the MCP-1-dependent recruitment of growth factor-secreting bone marrow-derived cells (BMCs). Here, we tested the hypothesis that the BMC-specific expression of CCR2 is also required for new arteriole formation via capillary arterialization. Following non-ischemic saphenous artery occlusion, we measured the following in gracilis muscles: monocyte chemotactic protein-1 (MCP-1) in wild-type (WT) C57Bl/6J mice by ELISA, and capillary arterialization in WT-WT and CCR2(-/-)-WT (donor-host) bone marrow chimeric mice, as well as BMC transdifferentiation in EGFP(+)-WT mice, by smooth muscle (SM) alpha-actin immunochemistry. MCP-1 levels were significantly elevated 1 day after occlusion in WT mice. In WT-WT mice at day 7, compared to sham controls, arterial occlusion induced a 34% increase in arteriole length density, a 46% increase in SM alpha-actin(+) vessels, and a 45% increase in the fraction of vessels coated with SM alpha-actin, indicating significant capillary arterialization. However, in CCR2(-/-)-WT mice, no differences were observed between arterial occlusion and sham surgery. In EGFP(+)-WT mice, EGFP and SM alpha-actin never colocalized. We conclude that BMC-specific CCR2 expression is required for skeletal muscle capillary arterialization following arterial occlusion; however, BMCs do not transdifferentiate into smooth muscle.

PEGylation enhances tumor targeting of plasmid DNA by an artificial cationized protein with repeated RGD sequences, Pronectin.

PubMed

Hosseinkhani, Hossein; Tabata, Yasuhiko

2004-05-31

The objective of this study is to investigate feasibility of a non-viral gene carrier with repeated RGD sequences (Pronectin F+) in tumor targeting for gene expression. The Pronectin F+ was cationized by introducing spermine (Sm) to the hydroxyl groups to allow to polyionically complex with plasmid DNA. The cationized Pronectin F+ prepared was additionally modified with poly(ethylene glycol) (PEG) molecules which have active ester and methoxy groups at the terminal, to form various PEG-introduced cationized Pronectin F+. The cationized Pronectin F+ with or without PEGylation at different extents was mixed with a plasmid DNA of LacZ to form respective cationized Pronectin F+-plasmid DNA complexes. The plasmid DNA was electrophoretically complexed with cationized Pronectin F+ and PEG-introduced cationized Pronectin F+, irrespective of the PEGylation extent, although the higher N/P ratio of complexes was needed for complexation with the latter Pronectin F+. The molecular size and zeta potential measurements revealed that the plasmid DNA was reduced in size to about 250 nm and the charge was changed to be positive by the complexation with cationized Pronectin F+. For the complexation with PEG-introduced cationized Pronectin F+, the charge of complex became neutral being almost 0 mV with the increasing PEGylation extents, while the molecular size was similar to that of cationized Pronectin F+. When cationized Pronectin F+-plasmid DNA complexes with or without PEGylation were intravenously injected to mice carrying a subcutaneous Meth-AR-1 fibrosarcoma mass, the PEG-introduced cationized Pronectin F+-plasmid DNA complex specifically enhanced the level of gene expression in the tumor, to a significantly high extent compared with the cationized Pronectin F+-plasmid DNA complexes and free plasmid DNA. The enhanced level of gene expression depended on the percentage of PEG introduced, the N/P ratio, and the plasmid DNA dose. A fluorescent microscopic study revealed that the localization of plasmid DNA in the tumor tissue was observed only for the PEG-introduced cationized Pronectin F+-plasmid DNA complex injected. We conclude that the PEGylation of cationized Pronectin F+ is a promising way to enable the plasmid DNA to target to the tumor for gene expression. Coyright 2004 Elsevier B.V.

Understanding the role of Arg96 in structure and stability of green fluorescent protein

PubMed Central

Stepanenko, Olesya V.; Verkhusha, Vladislav V.; Shavlovsky, Michail M.; Kuznetsova, Irina M.; Uversky, Vladimir N.; Turoverov, Konstantin K.

2010-01-01

Arg96 is a highly conservative residue known to catalyze spontaneous green fluorescent protein (GFP) chromophore biosynthesis. To understand a role of Arg96 in conformational stability and structural behavior of EGFP, the properties of a series of the EGFP mutants bearing substitutions at this position were studied using circular dichroism, steady state fluorescence spectroscopy, fluorescence lifetime, kinetics and equilibrium unfolding analysis, and acrylamide-induced fluorescence quenching. During the protein production and purification, high yield was achieved for EGFP/Arg96Cys variant, whereas EGFP/Arg96Ser and EGFP/Arg96Ala were characterized by essentially lower yields and no protein was produced when Arg96 was substituted by Gly. We have also shown that only EGFP/Arg96Cys possessed relatively fast chromophore maturation, whereas it took EGFP/Arg96Ser and EGFP/Arg96Ala about a year to develop a noticeable green fluorescence. The intensity of the characteristic green fluorescence measured for the EGFP/Arg96Cys and EGFP/Arg96Ser (or EGFP/Arg96Ala) was 5- and 50-times lower than that of the nonmodified EGFP. Intriguingly, EGFP/Arg96Cys was shown to be more stable than EGFP toward the GdmCl-induced unfolding both in kinetics and in the quasi-equilibrium experiments. In comparison with EGFP, tryptophan residues of EGFP/Arg96Cys were more accessible to the solvent. These data taken together suggest that besides established earlier crucial catalytic role, Arg96 is important for the overall folding and conformational stability of GFP. PMID:18470931

Quantitative Analysis of Cell Migration Using Optical Flow

PubMed Central

Boric, Katica; Orio, Patricio; Viéville, Thierry; Whitlock, Kathleen

2013-01-01

Neural crest cells exhibit dramatic migration behaviors as they populate their distant targets. Using a line of zebrafish expressing green fluorescent protein (sox10:EGFP) in neural crest cells we developed an assay to analyze and quantify cell migration as a population, and use it here to characterize in detail the subtle defects in cell migration caused by ethanol exposure during early development. The challenge was to quantify changes in the in vivo migration of all Sox10:EGFP expressing cells in the visual field of time-lapse movies. To perform this analysis we used an Optical Flow algorithm for motion detection and combined the analysis with a fit to an affine transformation. Through this analysis we detected and quantified significant differences in the cell migrations of Sox10:EGFP positive cranial neural crest populations in ethanol treated versus untreated embryos. Specifically, treatment affected migration by increasing the left-right asymmetry of the migrating cells and by altering the direction of cell movements. Thus, by applying this novel computational analysis, we were able to quantify the movements of populations of cells, allowing us to detect subtle changes in cell behaviors. Because cranial neural crest cells contribute to the formation of the frontal mass these subtle differences may underlie commonly observed facial asymmetries in normal human populations. PMID:23936049

Efficient and heritable transformation of Phalaenopsis orchids.

PubMed

Hsing, Hong-Xian; Lin, Yi-Jyun; Tong, Chii-Gong; Li, Min-Jeng; Chen, Yun-Jin; Ko, Swee-Suak

2016-12-01

Phalaenopsis orchid (Phal. orchid) is visually attractive and it is important economic floriculture species. Phal. orchids have many unique biological features. However, investigation of these features and validation on their biological functions are limited due to the lack of an efficient transformation method. We developed a heritable and efficient Agrobacterium- mediated transformation using protocorms derived from tetraploid or diploid Phal. orchids. A T-DNA vector construct containing eGFP driven by ubiquitin promoter was subjected to transformation. An approximate 1.2-5.2 % transformation rate was achieved. Genomic PCR confirmed that hygromycin selection marker, HptII gene and target gene eGFP were integrated into the orchid genome. Southern blotting indicated a low T-DNA insertion number in the orchid genome of the transformants. Western blot confirmed the expression of eGFP protein in the transgenic orchids. Furthermore, the GFP signal was detected in the transgenic orchids under microscopy. After backcrossing the pollinia of the transgenic plants to four different Phal. orchid varieties, the BC1 progenies showed hygromycin resistance and all surviving BC1 seedlings were HptII positive in PCR and expressed GFP protein as shown by western blot. This study demonstrated a stable transformation system was generated for Phal. orchids. This useful transformation protocol enables functional genomics studies and molecular breeding.

Effects of the nuclear localization of the N(pro) protein of classical swine fever virus on its virulence in pigs.

PubMed

Li, Yongfeng; Shen, Liang; Sun, Yuan; Wang, Xiao; Li, Chao; Huang, Junhua; Chen, Jianing; Li, Lianfeng; Zhao, Bibo; Luo, Yuzi; Li, Su; Qiu, Hua-Ji

2014-12-05

The N(pro) protein of classical swine fever virus (CSFV) is localized in the cytoplasm and nucleus. However, it is unknown whether the nuclear localization of N(pro) correlates with the virulence of CSFV in the host. Previously, we showed that the N(pro) protein fused with interferon regulatory factor 3 (IRF3) was present only in the cytoplasm. Here, we generated and evaluated a recombinant CSFV vSM-IRF3 harboring the IRF3 gene inserted into the N(pro) gene of the highly virulent CSFV Shimen strain. Compared to the even nuclear and cytoplasmic distribution of the enhanced green fluorescent protein (EGFP)-N(pro) fusion expressed by the recombinant CSFV EGFP-CSFV, vSM-IRF3 expressed an IRF3-N(pro) fusion protein that only was localized in the cytoplasm. vSM-IRF3 was markedly attenuated in vitro and in vivo, and the inoculated pigs were completely protected from lethal CSFV challenge, whereas the parental virus as well as EGFP-CSFV exhibited a typical virulent phenotype. Taken together, the nuclear localization of N(pro) plays a significant role in the CSFV replication and virulence. Copyright © 2014 Elsevier B.V. All rights reserved.

Localization of herpes simplex virus type 1 UL37 in the Golgi complex requires UL36 but not capsid structures.

PubMed

Desai, Prashant; Sexton, Gerry L; Huang, Eugene; Person, Stanley

2008-11-01

The herpes simplex virus type 1 (HSV-1) UL37 gene encodes a 120-kDa polypeptide which resides in the tegument structure of the virion and is important for morphogenesis. The goal of this study was to use green fluorescent protein (GFP) to follow the fate of UL37 within cells during the normal course of virus replication. GFP was inserted in frame at the C terminus of UL37 to generate a fluorescent-protein-tagged UL37 polypeptide. A virus designated K37eGFP, which replicated normally on Vero cells, was isolated and was shown to express the fusion polypeptide. When cells infected with this virus were examined by confocal microscopy, the fluorescence was observed to be predominantly cytoplasmic. As the infection progressed, fluorescence began to accumulate in a juxtanuclear structure. Mannosidase II and giantin were observed to colocalize with UL37eGFP at these structures, as judged by immunofluorescence assays. Therefore, UL37 traffics to the Golgi complex during infection. A VP26mRFP marker (red fluorescent protein fused to VP26) was recombined into K37eGFP, and when cells infected with this "dual-color" virus were examined, colocalization of the red (capsid) and green (UL37) fluorescence in the Golgi structure was observed. Null mutations in VP5 (DeltaVP5), which abolished capsid assembly, and in UL36 (Delta36) were recombined into the K37eGFP virus genome. In cells infected with K37eGFP/DeltaVP5, localization of UL37eGFP to the Golgi complex was similar to that for the parental virus (K37eGFP), indicating that trafficking of UL37eGFP to the Golgi complex did not require capsid structures. Confocal analysis of cells infected with K37eGFP/Delta36 showed that, in the absence of UL36, accumulation of UL37eGFP at the Golgi complex was not evident. This indicates an interaction between these two proteins that is important for localization of UL37 in the Golgi complex and thus possibly for cytoplasmic envelopment of the capsid. This is the first demonstration of a functional role for UL36:UL37 interaction in HSV-1-infected cells.

Complete genome sequence and the expression pattern of plasmids of the model ethanologen Zymomonas mobilis ZM4 and its xylose-utilizing derivatives 8b and 2032.

PubMed

Yang, Shihui; Vera, Jessica M; Grass, Jeff; Savvakis, Giannis; Moskvin, Oleg V; Yang, Yongfu; McIlwain, Sean J; Lyu, Yucai; Zinonos, Irene; Hebert, Alexander S; Coon, Joshua J; Bates, Donna M; Sato, Trey K; Brown, Steven D; Himmel, Michael E; Zhang, Min; Landick, Robert; Pappas, Katherine M; Zhang, Yaoping

2018-01-01

Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4 and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.

Expression of Heterogenous Arsenic Resistance Genes in the Obligately Autotrophic Biomining Bacterium Thiobacillus ferrooxidans.

PubMed

Peng, J B; Yan, W M; Bao, X Z

1994-07-01

Two arsenic-resistant plasmids were constructed and introduced into Thiobacillus ferrooxidans strains by conjugation. The plasmids with the replicon of wide-host-range plasmid RSF1010 were stable in T. ferrooxidans. The arsenic resistance genes originating from the heterotroph were expressed in this obligately autotrophic bacterium, but the promoter derived from T. ferrooxidans showed no special function in its original host.

Turnover of bone marrow-derived cells in the irradiated mouse cornea

PubMed Central

Chinnery, Holly R; Humphries, Timothy; Clare, Adam; Dixon, Ariane E; Howes, Kristen; Moran, Caitlin B; Scott, Danielle; Zakrzewski, Marianna; Pearlman, Eric; McMenamin, Paul G

2008-01-01

In light of an increasing awareness of the presence of bone marrow (BM)-derived macrophages in the normal cornea and their uncertain role in corneal diseases, it is important that the turnover rate of these resident immune cells be established. The baseline density and distribution of macrophages in the corneal stroma was investigated in Cx3cr1gfp transgenic mice in which all monocyte-derived cells express enhanced green fluorescent protein (eGFP). To quantify turnover, BM-derived cells from transgenic eGFP mice were transplanted into whole-body irradiated wild-type recipients. Additionally, wild-type BM-derived cells were injected into irradiated Cx3cr1+/gfp recipients, creating reverse chimeras. At 2, 4 and 8 weeks post-reconstitution, the number of eGFP+ cells in each corneal whole mount was calculated using epifluorescence microscopy, immunofluorescence staining and confocal microscopy. The total density of myeloid-derived cells in the normal Cx3cr1+/gfp cornea was 366 cells/mm2. In BM chimeras 2 weeks post-reconstitution, 24% of the myeloid-derived cells had been replenished and were predominantly located in the anterior stroma. By 8 weeks post-reconstitution 75% of the myeloid-derived cells had been replaced and these cells were distributed uniformly throughout the stroma. All donor eGFP+ cells expressed low to moderate levels of CD45 and CD11b, with approximately 25% coexpressing major histocompatibility complex class II, a phenotype characteristic of previous descriptions of corneal stromal macrophages. In conclusion, 75% of the myeloid-derived cells in the mouse corneal stroma are replenished after 8 weeks. These data provide a strong basis for functional investigations of the role of resident stromal macrophages versus non-haematopoietic cells using BM chimeric mice in models of corneal inflammation. PMID:18540963

The Prx1 limb enhancers: targeted gene expression in developing zebrafish pectoral fins.

PubMed

Hernández-Vega, Amayra; Minguillón, Carolina

2011-08-01

Limbs represent an excellent model to study the induction, growth, and patterning of several organs. A breakthrough to study gene function in various tissues has been the characterization of regulatory elements that allow tissue-specific interference of gene function. The mouse Prx1 promoter has been used to generate limb-specific mutants and overexpress genes in tetrapod limbs. Although zebrafish possess advantages that favor their use to study limb morphogenesis, there is no driver described suitable for specifically interfering with gene function in developing fins. We report the generation of zebrafish lines that express enhanced green fluorescent protein (EGFP) driven by the mouse Prx1 enhancer in developing pectoral fins. We also describe the expression pattern of the zebrafish prrx1 genes and identify three conserved non-coding elements (CNEs) that we use to generate fin-specific EGFP reporter lines. Finally, we show that the mouse and zebrafish regulatory elements may be used to modify gene function in pectoral fins. Copyright © 2011 Wiley-Liss, Inc.

Gene Overexpression and RNA Silencing Tools for the Genetic Manipulation of the S-(+)-Abscisic Acid Producing Ascomycete Botrytis cinerea

PubMed Central

Ding, Zhong-Tao; Zhang, Zhi; Luo, Di; Zhou, Jin-Yan; Zhong, Juan; Yang, Jie; Xiao, Liang; Shu, Dan; Tan, Hong

2015-01-01

The phytopathogenic ascomycete Botrytis cinerea produces several secondary metabolites that have biotechnical significance and has been particularly used for S-(+)-abscisic acid production at the industrial scale. To manipulate the expression levels of specific secondary metabolite biosynthetic genes of B. cinerea with Agrobacterium tumefaciens-mediated transformation system, two expression vectors (pCBh1 and pCBg1 with different selection markers) and one RNA silencing vector, pCBSilent1, were developed with the In-Fusion assembly method. Both expression vectors were highly effective in constitutively expressing eGFP, and pCBSilent1 effectively silenced the eGFP gene in B. cinerea. Bcaba4, a gene suggested to participate in ABA biosynthesis in B. cinerea, was then targeted for gene overexpression and RNA silencing with these reverse genetic tools. The overexpression of bcaba4 dramatically induced ABA formation in the B. cinerea wild type strain Bc-6, and the gene silencing of bcaba4 significantly reduced ABA-production in an ABA-producing B. cinerea strain. PMID:25955649

Position- and Hippo signaling-dependent plasticity during lineage segregation in the early mouse embryo

PubMed Central

Posfai, Eszter; Petropoulos, Sophie; de Barros, Flavia Regina Oliveira; Schell, John Paul; Jurisica, Igor; Sandberg, Rickard; Lanner, Fredrik; Rossant, Janet

2017-01-01

The segregation of the trophectoderm (TE) from the inner cell mass (ICM) in the mouse blastocyst is determined by position-dependent Hippo signaling. However, the window of responsiveness to Hippo signaling, the exact timing of lineage commitment and the overall relationship between cell commitment and global gene expression changes are still unclear. Single-cell RNA sequencing during lineage segregation revealed that the TE transcriptional profile stabilizes earlier than the ICM and prior to blastocyst formation. Using quantitative Cdx2-eGFP expression as a readout of Hippo signaling activity, we assessed the experimental potential of individual blastomeres based on their level of Cdx2-eGFP expression and correlated potential with gene expression dynamics. We find that TE specification and commitment coincide and occur at the time of transcriptional stabilization, whereas ICM cells still retain the ability to regenerate TE up to the early blastocyst stage. Plasticity of both lineages is coincident with their window of sensitivity to Hippo signaling. DOI: http://dx.doi.org/10.7554/eLife.22906.001 PMID:28226240

Negative modulation of the chicken infectious anemia virus promoter by COUP-TF1 and an E box-like element at the transcription start site binding deltaEF1.

PubMed

Miller, Myrna M; Jarosinski, Keith W; Schat, Karel A

2008-12-01

Expression of enhanced green fluorescent protein (EGFP) under control of the promoter-enhancer of chicken infectious anemia virus (CAV) is increased in an oestrogen receptor-enhanced cell line when treated with oestrogen and the promoter-enhancer binds unidentified proteins that recognize a consensus oestrogen response element (ERE). Co-transfection assays with the CAV promoter and the nuclear receptor chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1) showed that expression of EGFP was decreased by 50 to 60 % in DF-1 and LMH cells. The CAV promoter that included sequences at and downstream of the transcription start point had less expression than a short promoter construct. Mutation of a putative E box at this site restored expression levels. Electromobility shift assays showed that the transcription regulator delta-EF1 (deltaEF1) binds to this E box region. These findings indicate that the CAV promoter activity can be affected directly or indirectly by COUP-TF1 and deltaEF1.

Plasmid-Encoded Tetracycline Efflux Pump Protein Alters Bacterial Stress Responses and Ecological Fitness of Acinetobacter oleivorans

PubMed Central

Hong, Hyerim; Jung, Jaejoon; Park, Woojun

2014-01-01

Acquisition of the extracellular tetracycline (TC) resistance plasmid pAST2 affected host gene expression and phenotype in the oil-degrading soil bacterium, Acinetobacter oleivorans DR1. Whole-transcriptome profiling of DR1 cells harboring pAST2 revealed that all the plasmid genes were highly expressed under TC conditions, and the expression levels of many host chromosomal genes were modulated by the presence of pAST2. The host energy burden imposed by replication of pAST2 led to (i) lowered ATP concentrations, (ii) downregulated expression of many genes involved in cellular growth, and (iii) reduced growth rate. Interestingly, some phenotypes were restored by deleting the plasmid-encoded efflux pump gene tetH, suggesting that the membrane integrity changes resulting from the incorporation of efflux pump proteins also resulted in altered host response under the tested conditions. Alteration of membrane integrity by tetH deletion was shown by measuring permeability of fluorescent probe and membrane hydrophobicity. The presence of the plasmid conferred peroxide and superoxide resistance to cells, but only peroxide resistance was diminished by tetH gene deletion, suggesting that the plasmid-encoded membrane-bound efflux pump protein provided peroxide resistance. The downregulation of fimbriae-related genes presumably led to reduced swimming motility, but this phenotype was recovered by tetH gene deletion. Our data suggest that not only the plasmid replication burden, but also its encoded efflux pump protein altered host chromosomal gene expression and phenotype, which also alters the ecological fitness of the host in the environment. PMID:25229538

Plasmid-encoded tetracycline efflux pump protein alters bacterial stress responses and ecological fitness of Acinetobacter oleivorans.

PubMed

Hong, Hyerim; Jung, Jaejoon; Park, Woojun

2014-01-01

Acquisition of the extracellular tetracycline (TC) resistance plasmid pAST2 affected host gene expression and phenotype in the oil-degrading soil bacterium, Acinetobacter oleivorans DR1. Whole-transcriptome profiling of DR1 cells harboring pAST2 revealed that all the plasmid genes were highly expressed under TC conditions, and the expression levels of many host chromosomal genes were modulated by the presence of pAST2. The host energy burden imposed by replication of pAST2 led to (i) lowered ATP concentrations, (ii) downregulated expression of many genes involved in cellular growth, and (iii) reduced growth rate. Interestingly, some phenotypes were restored by deleting the plasmid-encoded efflux pump gene tetH, suggesting that the membrane integrity changes resulting from the incorporation of efflux pump proteins also resulted in altered host response under the tested conditions. Alteration of membrane integrity by tetH deletion was shown by measuring permeability of fluorescent probe and membrane hydrophobicity. The presence of the plasmid conferred peroxide and superoxide resistance to cells, but only peroxide resistance was diminished by tetH gene deletion, suggesting that the plasmid-encoded membrane-bound efflux pump protein provided peroxide resistance. The downregulation of fimbriae-related genes presumably led to reduced swimming motility, but this phenotype was recovered by tetH gene deletion. Our data suggest that not only the plasmid replication burden, but also its encoded efflux pump protein altered host chromosomal gene expression and phenotype, which also alters the ecological fitness of the host in the environment.

Elimination of the cryptic plasmid in Leuconostoc citreum by CRISPR/Cas9 system.

PubMed

Jang, Ye-Ji; Seo, Seung-Oh; Kim, Seul-Ah; Li, Ling; Kim, Tae-Jip; Kim, Sun Chang; Jin, Yong-Su; Han, Nam Soo

2017-06-10

Leuconostoc spp. are important lactic acid bacteria for the fermentation of foods. In particular, L. citreum strains isolated from various foods have been used as host strains for genetic and metabolic engineering studies. In order to develop a food-grade genetic engineering system, L. citreum CB2567 was isolated from Kimchi. However, the isolated bacterium contained a cryptic plasmid which was difficult to eliminate. As the existence of the plasmid might hinder strain engineering, we eliminated the plasmid using an RNA-guided DNA endonuclease CRISPR/Cas9 system. We demonstrated that a plasmid-free L. citreum CB2567 host strain could be efficiently constructed through a two-step procedure: 1) transformation of the "killer" plasmid expressing Cas9 endonuclease and a guide RNA (gRNA) targeting for a specific sequence in the cryptic plasmid, and 2) serial subculture without antibiotics for curing the killer plasmid. When the crude extract of L. citreum expressing Cas9 and the guide RNA was incubated with a PCR fragment containing the specific sequence recognized by the guide RNA, the PCR fragment was cleaved. Also, the cryptic plasmid pCB42 was successfully eliminated from the host strain after transforming the plasmid harboring Cas9 and the guide RNA. The Cas9 and gRNA expression plasmid used in this study can be applied for genome engineering purposes by additionally introducing an editing DNA template to repair the double strand DNA breakage caused by Cas9 in the genome of L. citreum. This study demonstrates the feasibility of developing CRISPR/Cas9-based genetic engineering tools to develop a safe host strain and construct food-grade lactic acid bacteria without residual antibiotic markers. Copyright © 2017 Elsevier B.V. All rights reserved.

Identification of Id4 as a regulator of BRCA1 expression by using a ribozyme-library-based inverse genomics approach

PubMed Central

Beger, Carmela; Pierce, Leigh N.; Krüger, Martin; Marcusson, Eric G.; Robbins, Joan M.; Welcsh, Piri; Welch, Peter J.; Welte, Karl; King, Mary-Claire; Barber, Jack R.; Wong-Staal, Flossie

2001-01-01

Expression of the breast and ovarian cancer susceptibility gene BRCA1 is down-regulated in sporadic breast and ovarian cancer cases. Therefore, the identification of genes involved in the regulation of BRCA1 expression might lead to new insights into the pathogenesis and treatment of these tumors. In the present study, an “inverse genomics” approach based on a randomized ribozyme gene library was applied to identify cellular genes regulating BRCA1 expression. A ribozyme gene library with randomized target recognition sequences was introduced into human ovarian cancer-derived cells stably expressing a selectable marker [enhanced green fluorescence protein (EGFP)] under the control of the BRCA1 promoter. Cells in which BRCA1 expression was upregulated by particular ribozymes were selected through their concomitant increase in EGFP expression. The cellular target gene of one ribozyme was identified to be the dominant negative transcriptional regulator Id4. Modulation of Id4 expression resulted in inversely regulated expression of BRCA1. In addition, increase in Id4 expression was associated with the ability of cells to exhibit anchorage-independent growth, demonstrating the biological relevance of this gene. Our data suggest that Id4 is a crucial gene regulating BRCA1 expression and might therefore be important for the BRCA1 regulatory pathway involved in the pathogenesis of sporadic breast and ovarian cancer. PMID:11136250

A plasmid-based reverse genetics system for influenza A virus.

PubMed Central

Pleschka, S; Jaskunas, R; Engelhardt, O G; Zürcher, T; Palese, P; García-Sastre, A

1996-01-01

A reverse genetics system for negative-strand RNA viruses was first successfully developed for influenza viruses. This technology involved the transfection of in vitro-reconstituted ribonucleoprotein (RNP) complexes into influenza virus-infected cells. We have now developed a method that allows intracellular reconstitution of RNP complexes from plasmid-based expression vectors. Expression of a viral RNA-like transcript is achieved from a plasmid containing a truncated human polymerase I (polI) promoter and a ribozyme sequence that generates the desired 3' end by autocatalytic cleavage. The polI-driven plasmid is cotransfected into human 293 cells with polII-responsive plasmids that express the viral PB1, PB2, PA, and NP proteins. This exclusively plasmid-driven system results in the efficient transcription and replication of the viral RNA-like reporter and allows the study of cis- and trans-acting signals involved in the transcription and replication of influenza virus RNAs. Using this system, we have also been able to rescue a synthetic neuraminidase gene into a recombinant influenza virus. This method represents a convenient alternative to the previously established RNP transfection system. PMID:8648766

Ricin A chain reaches the endoplasmic reticulum after endocytosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu Qiong; Department of Biochemistry and Molecular Biology, Ningbo University Medical School, Ningbo 315211; Zhan Jinbiao

Ricin is a potent ribosome inactivating protein and now has been widely used for synthesis of immunotoxins. To target ribosome in the mammalian cytosol, ricin must firstly retrograde transport from the endomembrane system to reach the endoplasmic reticulum (ER) where the ricin A chain (RTA) is recognized by ER components that facilitate its membrane translocation to the cytosol. In the study, the fusion gene of enhanced green fluorescent protein (EGFP)-RTA was expressed with the pET-28a (+) system in Escherichia coli under the control of a T7 promoter. The fusion protein showed a green fluorescence. The recombinant protein can be purifiedmore » by metal chelated affinity chromatography on a column of NTA. The rabbit anti-GFP antibody can recognize the fusion protein of EGFP-RTA just like the EGFP protein. The cytotoxicity of EGFP-RTA and RTA was evaluated by the MTT assay in HeLa and HEP-G2 cells following fluid-phase endocytosis. The fusion protein had a similar cytotoxicity of RTA. After endocytosis, the subcellular location of the fusion protein can be observed with the laser scanning confocal microscopy and the immuno-gold labeling Electro Microscopy. This study provided important evidence by a visualized way to prove that RTA does reach the endoplasmic reticulum.« less

Seeing red; the development of pON.mCherry, a broad-host range constitutive expression plasmid for Gram-negative bacteria.

PubMed

Gebhardt, Michael J; Jacobson, Rachael K; Shuman, Howard A

2017-01-01

The development of plasmid-mediated gene expression control in bacteria revolutionized the field of bacteriology. Many of these expression control systems rely on the addition of small molecules, generally metabolites or non-metabolized analogs thereof, to the growth medium to induce expression of the genes of interest. The paradigmatic example of an expression control system is the lac system from Escherichia coli, which typically relies on the Ptac promoter and the Lac repressor, LacI. In many cases, however, constitutive gene expression is desired, and other experimental approaches require the coordinated control of multiple genes. While multiple systems have been developed for use in E. coli and its close relatives, the utility and/or functionality of these tools does not always translate to other species. For example, for the Gram-negative pathogen, Legionella pneumophila, a causative agent of Legionnaires' Disease, the aforementioned Ptac system represents the only well-established expression control system. In order to enhance the tools available to study bacterial gene expression in L. pneumophila, we developed a plasmid, pON.mCherry, which confers constitutive gene expression from a mutagenized LacI binding site. We demonstrate that pON.mCherry neither interferes with other plasmids harboring an intact LacI-Ptac expression system nor alters the growth of Legionella species during intracellular growth. Furthermore, the broad-host range plasmid backbone of pON.mCherry allows constitutive gene expression in a wide variety of Gram-negative bacterial species, making pON.mCherry a useful tool for the greater research community.

Expression of Heterogenous Arsenic Resistance Genes in the Obligately Autotrophic Biomining Bacterium Thiobacillus ferrooxidans

PubMed Central

Peng, Ji-Bin; Yan, Wang-Ming; Bao, Xue-Zhen

1994-01-01

Two arsenic-resistant plasmids were constructed and introduced into Thiobacillus ferrooxidans strains by conjugation. The plasmids with the replicon of wide-host-range plasmid RSF1010 were stable in T. ferrooxidans. The arsenic resistance genes originating from the heterotroph were expressed in this obligately autotrophic bacterium, but the promoter derived from T. ferrooxidans showed no special function in its original host. PMID:16349341

CFTR RECRUITMENT TO PHAGOSOMES IN NEUTROPHILS

PubMed Central

Zhou, Yun; Song, Kejing; Painter, Richard G.; Aiken, Martha; Reiser, Jakob; Stanton, Bruce A.; Nauseef, William M.; Wang, Guoshun

2013-01-01

Optimal microbicidal activity of human polymorphonuclear leukocytes (PMN) relies on generation of toxic agents such as hypochlorous acid (HOCl) in phagosomes. HOCl formation requires H2O2 produced by the NADPH oxidase, myeloperoxidase derived from azurophilic granules, and chloride ion. Chloride transport from cytoplasm into phagosomes requires chloride channels which include cystic fibrosis transmembrane conductance regulator (CFTR), a cAMP-activated chloride channel. However, the phagosomal targeting of CFTR in PMN has not been defined. Using human peripheral blood PMN, we determined that ~95–99% of LAMP-1 positive mature phagosomes were CFTR-positive, as judged by immunostaining and flow cytometric analysis. To establish a model cell system to evaluate CFTR phagosomal recruitment, we stably expressed EGFP alone, EGFP-wt-CFTR and EGFP-ΔF508-CFTR fusion proteins in promyelocytic PLB-985 cells, respectively. After differentiation into neutrophil-like cells, CFTR presentation to phagosomes was examined. EGFP-wt-CFTR was observed to associate with phagosomes and co-localize with LAMP-1. Flow cytometric analysis of the isolated phagosomes indicated that such a phagosomal targeting was determined by the CFTR portion of the fusion protein. In contrast, significantly less EGFP-ΔF508-CFTR was found in phagosomes, indicating a defective targeting of the molecule to the organelle. Importantly, CFTR corrector compound VRT-325 facilitated the recruitment of ΔF508-CFTR to phagosomes. These data demonstrate the possibility of pharmacologic correction of impaired recruitment of mutant CFTR, thereby providing a potential means to augment chloride supply to the phagosomes of PMN in patients with cystic fibrosis to enhance their microbicidal function. PMID:23486169

Fluorescence lifetime dynamics of enhanced green fluorescent protein in protein aggregates with expanded polyglutamine

NASA Astrophysics Data System (ADS)

Ghukasyan, Vladimir; Hsu, Chih-Chun; Liu, Chia-Rung; Kao, Fu-Jen; Cheng, Tzu-Hao

2010-01-01

Protein aggregation is one of the characteristic steps in a number of neurodegenerative diseases eventually leading to neuronal death and thorough study of aggregation is required for the development of effective therapy. We apply fluorescence lifetime imaging for the characterization of the fluorescence dynamics of the enhanced green fluorescent protein (eGFP) in fusion with the polyQ-expanded polyglutamine stretch. At the expansion of polyQ above 39 residues, it has an inherent propensity to form amyloid-like fibrils and aggregates, and is responsible for Huntington's disease. The results of the experiments show that expression of the eGFP in fusion with the 97Q protein leads to the decrease of the eGFP fluorescence lifetime by ~300 ps. This phenomenon does not appear in Hsp104-deficient cells, where the aggregation in polyQ is prevented. We demonstrate that the lifetime decrease observed is related to the aggregation per se and discuss the possible role of refractive index and homo-FRET in these dynamics.

The reversed terminator of octopine synthase gene on the Agrobacterium Ti plasmid has a weak promoter activity in prokaryotes.

PubMed

Shao, Jun-Li; Long, Yue-Sheng; Chen, Gu; Xie, Jun; Xu, Zeng-Fu

2010-06-01

Agrobacterium tumefaciens transfers DNA from its Ti plasmid to plant host cells. The genes located within the transferred DNA of Ti plasmid including the octopine synthase gene (OCS) are expressed in plant host cells. The 3'-flanking region of OCS gene, known as OCS terminator, is widely used as a transcriptional terminator of the transgenes in plant expression vectors. In this study, we found the reversed OCS terminator (3'-OCS-r) could drive expression of hygromycin phosphotransferase II gene (hpt II) and beta-glucuronidase gene in Escherichia coli, and expression of hpt II in A. tumefaciens. Furthermore, reverse transcription-polymerase chain reaction analysis revealed that an open reading frame (ORF12) that is located downstream to the 3'-OCS-r was transcribed in A. tumefaciens, which overlaps in reverse with the coding region of the OCS gene in octopine Ti plasmid.

Expression of recombinant myostatin propeptide pPIC9K-Msp plasmid in Pichia pastoris.

PubMed

Du, W; Xia, J; Zhang, Y; Liu, M J; Li, H B; Yan, X M; Zhang, J S; Li, N; Zhou, Z Y; Xie, W Z

2015-12-28

Myostatin propeptide can inhibit the biological activity of myostatin protein and promote muscle growth. To express myostatin propeptide in vitro with a higher biological activity, we performed codon optimization on the sheep myostatin propeptide gene sequence, and mutated aspartic acid-76 to alanine based on the codon usage bias of Pichia pastoris and the enhanced biological activity of myostatin propeptide mutant. Modified myostatin propeptide gene was cloned into the pPIC9K plasmid to form the recombinant plasmid pPIC9K-Msp. Recombinant plasmid pPIC9K-Msp was transformed into Pichia pastoris GS115 by electrotransformation. Transformed cells were screened, and methanol was used to induce expression. SDS-PAGE and western blotting were used to verify the successful expression of myostatin propeptide with biological activity in Pichia pastoris, providing the basis for characterization of this protein.

Vectors for co-expression of an unrestricted number of proteins

PubMed Central

Scheich, Christoph; Kümmel, Daniel; Soumailakakis, Dimitri; Heinemann, Udo; Büssow, Konrad

2007-01-01

A vector system is presented that allows generation of E. coli co-expression clones by a standardized, robust cloning procedure. The number of co-expressed proteins is not limited. Five ‘pQLink’ vectors for expression of His-tag and GST-tag fusion proteins as well as untagged proteins and for cloning by restriction enzymes or Gateway cloning were generated. The vectors allow proteins to be expressed individually; to achieve co-expression, two pQLink plasmids are combined by ligation-independent cloning. pQLink co-expression plasmids can accept an unrestricted number of genes. As an example, the co-expression of a heterotetrameric human transport protein particle (TRAPP) complex from a single plasmid, its isolation and analysis of its stoichiometry are shown. pQLink clones can be used directly for pull-down experiments if the proteins are expressed with different tags. We demonstrate pull-down experiments of human valosin-containing protein (VCP) with fragments of the autocrine motility factor receptor (AMFR). The cloning method avoids PCR or gel isolation of restriction fragments, and a single resistance marker and origin of replication are used, allowing over-expression of rare tRNAs from a second plasmid. It is expected that applications are not restricted to bacteria, but could include co-expression in other hosts such as Bacluovirus/insect cells. PMID:17311810

Effects of an intravitreal injection of interleukin-35-expressing plasmid on pro-inflammatory and anti-inflammatory cytokines.

PubMed

Hou, Chao; Wu, Qianni; Ouyang, Chen; Huang, Ting

2016-09-01

In order to explore the potential effects of interleukin (IL)-35 on IL-10, transforming growth factor-β (TGF-β), interferon-γ (INF)-γ, IL-12 and IL-17, a pcDNA3.1‑IL-35 plasmid was injected into the vitreous cavity of BALB/c mice. Enzyme-linked immunosorbent assay, western blot analysis and quantitative PCR analysis were performed to confirm the successful expression of IL-35. Slit-lamp biomicroscopy, hematoxylin and eosin staining and immunofluorescence were employed to detect the status of eyes, and western blot analysis was performed to examine the expression of corneal graft rejection-related cytokines. There were no abnormalities in the eyes pre-mydriasis or post-mydriasis and no injuries to the cornea or retina following the injection of IL-35-expressing plasmid. An immunofluorescence assay detected the positive expression of IL-35 in corneal epithelial cells from IL-35‑injected mice and negative staining in the control group. Further study revealed that IL-35 enhanced the expression of IL-10 and TGF-β which reached their highest levels at 1 and 2 weeks after injection, respectively (p<0.01). Moreover, the expression of INF-γ and IL-12 was decreased significantly at 2 weeks after the injection of IL-35-expressing plasmid (p<0.05), and the expression of IL-17 was suppressed notably at 4 weeks after the injection (p<0.05). The intravitreal injection of IL-35-expressing plasmid in mice downregulates the expression of pro-inflammatory cytokines and upregulates the expression of anti-inflammatory cytokines. Thus, IL-35 may further be assessed as a potential target for the treatment of corneal graft rejection.

Polyglycine Acts as a Rejection Signal for Protein Transport at the Chloroplast Envelope.

PubMed

Endow, Joshua K; Rocha, Agostinho Gomes; Baldwin, Amy J; Roston, Rebecca L; Yamaguchi, Toshio; Kamikubo, Hironari; Inoue, Kentaro

2016-01-01

PolyGly is present in many proteins in various organisms. One example is found in a transmembrane β-barrel protein, translocon at the outer-envelope-membrane of chloroplasts 75 (Toc75). Toc75 requires its N-terminal extension (t75) for proper localization. t75 comprises signals for chloroplast import (n75) and envelope sorting (c75) in tandem. n75 and c75 are removed by stromal processing peptidase and plastidic type I signal peptidase 1, respectively. PolyGly is present within c75 and its deletion or substitution causes mistargeting of Toc75 to the stroma. Here we have examined the properties of polyGly-dependent protein targeting using two soluble passenger proteins, the mature portion of the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (mSS) and enhanced green fluorescent protein (EGFP). Both t75-mSS and t75-EGFP were imported into isolated chloroplasts and their n75 removed. Resultant c75-mSS was associated with the envelope at the intermembrane space, whereas c75-EGFP was partially exposed outside the envelope. Deletion of polyGly or substitution of tri-Ala for the critical tri-Gly segment within polyGly caused each passenger to be targeted to the stroma. Transient expression of t75-EGFP in Nicotiana benthamiana resulted in accumulation of c75-EGFP exposed at the surface of the chloroplast, but the majority of the EGFP passenger was found free in the cytosol with most of its c75 attachment removed. Results of circular dichroism analyses suggest that polyGly within c75 may form an extended conformation, which is disrupted by tri-Ala substitution. These data suggest that polyGly is distinct from a canonical stop-transfer sequence and acts as a rejection signal at the chloroplast inner envelope.

Polyglycine Acts as a Rejection Signal for Protein Transport at the Chloroplast Envelope

DOE PAGES

Endow, Joshua K.; Rocha, Agostinho Gomes; Baldwin, Amy J.; ...

2016-12-09

PolyGly is present in many proteins in various organisms. One example is found in a transmembrane β-barrel protein, translocon at the outer-envelope-membrane of chloroplasts 75 (Toc75). Toc75 requires its N-terminal extension (t75) for proper localization. t75 comprises signals for chloroplast import (n75) and envelope sorting (c75) in tandem. n75 and c75 are removed by stromal processing peptidase and plastidic type I signal peptidase 1, respectively. PolyGly is present within c75 and its deletion or substitution causes mistargeting of Toc75 to the stroma. Here in this study we have examined the properties of polyGly-dependent protein targeting using two soluble passenger proteins,more » the mature portion of the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (mSS) and enhanced green fluorescent protein (EGFP). Both t75-mSS and t75-EGFP were imported into isolated chloroplasts and their n75 removed. Resultant c75-mSS was associated with the envelope at the intermembrane space, whereas c75-EGFP was partially exposed outside the envelope. Deletion of polyGly or substitution of tri-Ala for the critical tri-Gly segment within polyGly caused each passenger to be targeted to the stroma. Transient expression of t75-EGFP in Nicotiana benthamiana resulted in accumulation of c75-EGFP exposed at the surface of the chloroplast, but the majority of the EGFP passenger was found free in the cytosol with most of its c75 attachment removed. Results of circular dichroism analyses suggest that polyGly within c75 may form an extended conformation, which is disrupted by tri-Ala substitution. These data suggest that polyGly is distinct from a canonical stop-transfer sequence and acts as a rejection signal at the chloroplast inner envelope.« less

Protein Structure Initiative Material Repository: an open shared public resource of structural genomics plasmids for the biological community

PubMed Central

Cormier, Catherine Y.; Mohr, Stephanie E.; Zuo, Dongmei; Hu, Yanhui; Rolfs, Andreas; Kramer, Jason; Taycher, Elena; Kelley, Fontina; Fiacco, Michael; Turnbull, Greggory; LaBaer, Joshua

2010-01-01

The Protein Structure Initiative Material Repository (PSI-MR; http://psimr.asu.edu) provides centralized storage and distribution for the protein expression plasmids created by PSI researchers. These plasmids are a resource that allows the research community to dissect the biological function of proteins whose structures have been identified by the PSI. The plasmid annotation, which includes the full length sequence, vector information and associated publications, is stored in a freely available, searchable database called DNASU (http://dnasu.asu.edu). Each PSI plasmid is also linked to a variety of additional resources, which facilitates cross-referencing of a particular plasmid to protein annotations and experimental data. Plasmid samples can be requested directly through the website. We have also developed a novel strategy to avoid the most common concern encountered when distributing plasmids namely, the complexity of material transfer agreement (MTA) processing and the resulting delays this causes. The Expedited Process MTA, in which we created a network of institutions that agree to the terms of transfer in advance of a material request, eliminates these delays. Our hope is that by creating a repository of expression-ready plasmids and expediting the process for receiving these plasmids, we will help accelerate the accessibility and pace of scientific discovery. PMID:19906724

Next generation tools for high-throughput promoter and expression analysis employing single-copy knock-ins at the Hprt1 locus.

PubMed

Yang, G S; Banks, K G; Bonaguro, R J; Wilson, G; Dreolini, L; de Leeuw, C N; Liu, L; Swanson, D J; Goldowitz, D; Holt, R A; Simpson, E M

2009-03-01

We have engineered a set of useful tools that facilitate targeted single copy knock-in (KI) at the hypoxanthine guanine phosphoribosyl transferase 1 (Hprt1) locus. We employed fine scale mapping to delineate the precise breakpoint location at the Hprt1(b-m3) locus allowing allele specific PCR assays to be established. Our suite of tools contains four targeting expression vectors and a complementing series of embryonic stem cell lines. Two of these vectors encode enhanced green fluorescent protein (EGFP) driven by the human cytomegalovirus immediate-early enhancer/modified chicken beta-actin (CAG) promoter, whereas the other two permit flexible combinations of a chosen promoter combined with a reporter and/or gene of choice. We have validated our tools as part of the Pleiades Promoter Project (http://www.pleiades.org), with the generation of brain-specific EGFP positive germline mouse strains.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dinh, Phat X.; Panda, Debasis; Das, Phani B.

Using a recombinant vesicular stomatitis virus encoding eGFP fused in-frame with an essential viral replication protein, the phosphoprotein P, we show that during passage in culture, the virus mutates the nucleotide C289 within eGFP of the fusion protein PeGFP to A or T, resulting in R97S/C amino acid substitution and loss of fluorescence. The resultant non-fluorescent virus exhibits increased fitness and growth advantage over its fluorescent counterpart. The growth advantage of the non-fluorescent virus appears to be due to increased transcription and replication activities of the PeGFP protein carrying the R97S/C substitution. Further, our results show that the R97S/C mutationmore » occurs prior to accumulation of mutations that can result in loss of expression of the gene inserted at the G-L gene junction. These results suggest that fitness gain is more important for the recombinant virus than elimination of expression of the heterologous gene.« less

Plasmids of corynebacteria.

PubMed

Deb, J K; Nath, N

1999-06-01

Corynebacteria are pleomorphic, asporogenous, Gram-positive bacteria. Included in this group are nonpathogenic soil corynebacteria, which are widely used for the industrial production of amino acids and detergents, and in biotransformation of steroids. Other members of this group are plant and animal pathogens. This review summarizes the current information available about the plasmids of corynebacteria. The emphasis is mainly on the small plasmids, which have been used for construction of vectors for expression of genes in these bacteria. Moreover, considerable information is now available on their nucleotide sequence, gene organization and modes of replication, which would make it possible to further manipulate these plasmids. Other plasmid properties, such as incompatibility and host range, are also discussed. Finally, use of these plasmids as cloning vectors for the expression of heterologous proteins using corynebacteria as hosts is also summarized to highlight the potential of these bacteria as hosts for recombinant DNA.

Live, attenuated Salmonella typhimurium vectoring Campylobacter antigens.

PubMed

Sizemore, Donata R; Warner, Beth; Lawrence, Julie; Jones, Amy; Killeen, Kevin P

2006-05-01

We describe the evaluation of three live, attenuated deltaphoP/Q Salmonella enteric serovar Typhimurium strains expressing PEB1 minus its signal sequence (PEB1-ss) from three different plasmids: a pBR-based asd plasmid, an arabinose-based runaway plasmid, which each expressed PEB1-ss in the bacterial cytosol, and a PEB1::HlyA fusion plasmid that directs secretion of PEB1-ss into the extracellular milieu. Serum IgG responses specific for PEB1-ss were induced by pBR-derived and runaway plasmids, with 100 and 90% seroconversion, respectively, at a 1:500 dilution of anti-sera as measured by Western blot analysis, while the PEB1-ss::HlyA fusion plasmid induced serum IgG in only 20% of the mice. Although significant levels of anti-PEB serum IgG were induced, no protection against oral Campylobacter jejuni challenge was observed.

Imipenem-resistance in Serratia marcescens is mediated by plasmid expression of KPC-2.

PubMed

Su, W-Q; Zhu, Y-Q; Deng, N-M; Li, L

2017-04-01

Imipenem is a broad-spectrum carbapenem antibiotic with applications against severe bacterial infections. Here, we describe the identification of imipenem-resistant Serratia marcescens in our hospital and the role of plasmid-mediated KPC-2 expression in imipenem resistance. We used the modified Hodge test to detect carbapenemase produced in imipenem-resistant strains. His resistance can be transferred to E. coli in co-culture tests, which implicates the plasmid in imipenem resistance. PCR amplification from the plasmid identified two products consistent with KPC-2 of 583 and 1050 bp that were also present in E. coli after co-culture. The restriction pattern for both plasmids was identical, supporting the transfer from the S. marcescens isolate to E. coli. Finally, gene sequencing confirmed KPC-2 in the plasmid. Due to the presence of KPC-2 in the imipenem-resistant S. marcescens, we propose that KPC-2 mediates antibiotic resistance in the S. marcescens isolate.

Development of a plasmid-based expression system in Clostridium thermocellum and its use to screen heterologous expression of bifunctional alcohol dehydrogenases (adhEs)

DOE PAGES

Hon, Shuen; Lanahan, Anthony; Tian, Liang; ...

2016-04-22

Clostridium thermocellum is a promising candidate for ethanol production from cellulosic biomass, but requires metabolic engineering to improve ethanol yield. A key gene in the ethanol production pathway is the bifunctional aldehyde and alcohol dehydrogenase, adhE. To explore the effects of overexpressing wild-type, mutant, and exogenous adhEs, we developed a new expression plasmid, pDGO144, that exhibited improved transformation efficiency and better gene expression than its predecessor, pDGO-66. This new expression plasmid will allow for many other metabolic engineering and basic research efforts in C. thermocellum. As proof of concept, we used this plasmid to express 12 different adhE genes (bothmore » wild type and mutant) from several organisms. Ethanol production varied between clones immediately after transformation, but tended to converge to a single value after several rounds of serial transfer. The previously described mutant C. thermocellum D494G adhE gave the best ethanol production, which is consistent with previously published results.« less

Development of a plasmid-based expression system in Clostridium thermocellum and its use to screen heterologous expression of bifunctional alcohol dehydrogenases (adhEs)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hon, Shuen; Lanahan, Anthony; Tian, Liang

Clostridium thermocellum is a promising candidate for ethanol production from cellulosic biomass, but requires metabolic engineering to improve ethanol yield. A key gene in the ethanol production pathway is the bifunctional aldehyde and alcohol dehydrogenase, adhE. To explore the effects of overexpressing wild-type, mutant, and exogenous adhEs, we developed a new expression plasmid, pDGO144, that exhibited improved transformation efficiency and better gene expression than its predecessor, pDGO-66. This new expression plasmid will allow for many other metabolic engineering and basic research efforts in C. thermocellum. As proof of concept, we used this plasmid to express 12 different adhE genes (bothmore » wild type and mutant) from several organisms. Ethanol production varied between clones immediately after transformation, but tended to converge to a single value after several rounds of serial transfer. The previously described mutant C. thermocellum D494G adhE gave the best ethanol production, which is consistent with previously published results.« less

Development of a plasmid-based expression system in Clostridium thermocellum and its use to screen heterologous expression of bifunctional alcohol dehydrogenases (adhEs).

PubMed

Hon, Shuen; Lanahan, Anthony A; Tian, Liang; Giannone, Richard J; Hettich, Robert L; Olson, Daniel G; Lynd, Lee R

2016-12-01

Clostridium thermocellum is a promising candidate for ethanol production from cellulosic biomass, but requires metabolic engineering to improve ethanol yield. A key gene in the ethanol production pathway is the bifunctional aldehyde and alcohol dehydrogenase, adhE . To explore the effects of overexpressing wild-type, mutant, and exogenous adhE s, we developed a new expression plasmid, pDGO144, that exhibited improved transformation efficiency and better gene expression than its predecessor, pDGO-66. This new expression plasmid will allow for many other metabolic engineering and basic research efforts in C. thermocellum . As proof of concept, we used this plasmid to express 12 different adhE genes (both wild type and mutant) from several organisms. Ethanol production varied between clones immediately after transformation, but tended to converge to a single value after several rounds of serial transfer. The previously described mutant C. thermocellum D494G adhE gave the best ethanol production, which is consistent with previously published results.

Liposomal lipid and plasmid DNA delivery to B16/BL6 tumors after intraperitoneal administration of cationic liposome DNA aggregates.

PubMed

Reimer, D L; Kong, S; Monck, M; Wyles, J; Tam, P; Wasan, E K; Bally, M B

1999-05-01

The transfer of plasmid expression vectors to cells is essential for transfection after administration of lipid-based DNA formulations (lipoplexes). A murine i.p. B16/BL6 tumor model was used to characterize DNA delivery, liposomal lipid delivery, and gene transfer after regional (i.p.) administration of free plasmid DNA and DNA lipoplexes. DNA lipoplexes were prepared using cationic dioleoyldimethylammonium chloride/dioleoylphosphatidylethanolamine (50:50 mol ratio) liposomes mixed with plasmid DNA (1 microgram DNA/10 nmol lipid). The plasmid used contained the chloramphenicol acetyltransferase gene and chloramphenicol acetyltransferase expression (mU/g tumor) was measured to estimate transfection efficiency. Tumor-associated DNA and liposomal lipid levels were measured to estimate the efficiency of lipid-mediated DNA delivery to tumors. Plasmid DNA delivery was estimated using [3H]-labeled plasmid as a tracer, dot blot analysis, and/or Southern analysis. Liposomal lipid delivery was estimated using [14C]-dioleoylphosphatidylethanolamine as a liposomal lipid marker. Gene expression in the B16/BL6 tumors was highly variable, with values ranging from greater than 2,000 mU/g tumor to less than 100 mU/g tumor. There was a tendency to observe enhanced transfection in small (<250 mg) tumors. Approximately 18% of the injected dose of DNA was associated with these small tumors 2 h after i.p. administration. Southern analysis of extracted tumor DNA indicated that plasmid DNA associated with tumors was intact 24 h after administration. DNA and associated liposomal lipid are efficiently bound to tumors after regional administration; however, it is unclear whether delivery is sufficient to abet internalization and appropriate subcellular localization of the expression vector.

Complete genome sequence and the expression pattern of plasmids of the model ethanologen Zymomonas mobilis ZM4 and its xylose-utilizing derivatives 8b and 2032

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Shihui; Vera, Jessica M.; Grass, Jeff

Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4more » and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Furthermore, plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.« less

Complete genome sequence and the expression pattern of plasmids of the model ethanologen Zymomonas mobilis ZM4 and its xylose-utilizing derivatives 8b and 2032

DOE PAGES

Yang, Shihui; Vera, Jessica M.; Grass, Jeff; ...

2018-05-02

Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4more » and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Furthermore, plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.« less

Exploiting translational coupling for the selection of cells producing toxic recombinant proteins from expression vectors.

PubMed

Tagliavia, Marcello; Cuttitta, Angela

2016-01-01

High rates of plasmid instability are associated with the use of some expression vectors in Escherichia coli, resulting in the loss of recombinant protein expression. This is due to sequence alterations in vector promoter elements caused by the background expression of the cloned gene, which leads to the selection of fast-growing, plasmid-containing cells that do not express the target protein. This phenomenon, which is worsened when expressing toxic proteins, results in preparations containing very little or no recombinant protein, or even in clone loss; however, no methods to prevent loss of recombinant protein expression are currently available. We have exploited the phenomenon of translational coupling, a mechanism of prokaryotic gene expression regulation, in order to select cells containing plasmids still able to express recombinant proteins. Here we designed an expression vector in which the cloned gene and selection marker are co-expressed. Our approach allowed for the selection of the recombinant protein-expressing cells and proved effective even for clones encoding toxic proteins.

Ferritin heavy chain as a molecular imaging reporter gene in glioma xenografts.

PubMed

Cheng, Sen; Mi, Ruifang; Xu, Yu; Jin, Guishan; Zhang, Junwen; Zhou, Yiqiang; Chen, Zhengguang; Liu, Fusheng

2017-06-01

The development of glioma therapy in clinical practice (e.g., gene therapy) calls for efficiently visualizing and tracking glioma cells in vivo. Human ferritin heavy chain is a novel gene reporter in magnetic resonance imaging. This study proposes hFTH as a reporter gene for MR molecular imaging in glioma xenografts. Rat C6 glioma cells were infected by packaged lentivirus carrying hFTH and EGFP genes and obtained by fluorescence-activated cell sorting. The iron-loaded ability was analyzed by the total iron reagent kit. Glioma nude mouse models were established subcutaneously and intracranially. Then, in vivo tumor bioluminescence was performed via the IVIS spectrum imaging system. The MR imaging analysis was analyzed on a 7T animal MRI scanner. Finally, the expression of hFTH was analyzed by western blotting and histological analysis. Stable glioma cells carrying hFTH and EGFP reporter genes were successfully obtained. The intracellular iron concentration was increased without impairing the cell proliferation rate. Glioma cells overexpressing hFTH showed significantly decreased signal intensity on T 2 -weighted MRI both in vitro and in vivo. EGFP fluorescent imaging could also be detected in the subcutaneous and intracranial glioma xenografts. Moreover, the expression of the transferritin receptor was significantly increased in glioma cells carrying the hFTH reporter gene. Our study illustrated that hFTH generated cellular MR imaging contrast efficiently in glioma via regulating the expression of transferritin receptor. This might be a useful reporter gene in cell tracking and MR molecular imaging for glioma diagnosis, gene therapy and tumor metastasis.

Identification of the subgenomic promoter of the coat protein gene of cucumber fruit mottle mosaic virus and development of a heterologous expression vector.

PubMed

Rhee, Sun-Ju; Jang, Yoon Jeong; Lee, Gung Pyo

2016-06-01

Heterologous gene expression using plant virus vectors enables research on host-virus interactions and the production of useful proteins, but the host range of plant viruses limits the practical applications of such vectors. Here, we aimed to develop a viral vector based on cucumber fruit mottle mosaic virus (CFMMV), a member of the genus Tobamovirus, whose members infect cucurbits. The subgenomic promoter (SGP) in the coat protein (CP) gene, which was used to drive heterologous expression, was mapped by analyzing deletion mutants from a CaMV 35S promoter-driven infectious CFMMV clone. The region from nucleotides (nt) -55 to +160 relative to the start codon of the open reading frame (ORF) of CP was found to be a fully active promoter, and the region from nt -55 to +100 was identified as the active core promoter. Based on these SGPs, we constructed a cloning site in the CFMMV vector and successfully expressed enhanced green fluorescent protein (EGFP) in Nicotiana benthamiana and watermelon (Citrullus lanatus). Co-inoculation with the P19 suppressor increased EGFP expression and viral replication by blocking degradation of the viral genome. Our CFMMV vector will be useful as an expression vector in cucurbits.

Manipulation of gene expression by infrared laser heat shock and its application to the study of tracheal development in Drosophila.

PubMed

Miao, Guangxia; Hayashi, Shigeo

2015-03-01

Induction of gene expression in a specific cell and a defined time window is desirable to investigate gene function at the cellular level during morphogenesis. To achieve this, we attempted to introduce the infrared laser-evoked gene operator system (IR-LEGO, Kamei et al., 2009) in the Drosophila embryo. In this technique, infrared laser light illumination induces genes to be expressed under the control of heat shock promoters at the single cell level. We applied IR-LEGO to a transgenic fly stock, HS-eGFP, in which the enhanced green fluorescent protein (eGFP) gene is placed under the control of heat shock protein 70 promoter, and showed that eGFP expression can be induced in single cells within 1-2 hr after IR illumination. Furthermore, induction of HS-Branchless transgene encoding the Drosophila fibroblast growth factor (FGF) effectively altered the migration and branching patterns of the tracheal system. Our results indicated that IR-LEGO is a promising choice for the timely control of gene expression in a small group of cells in the Drosophila embryo. By using IR-LEGO, we further demonstrated that the tracheal terminal branching program is sensitive to localized expression of exogenous FGF. © 2014 Wiley Periodicals, Inc.

A Simple And Rapid Minicircle DNA Vector Manufacturing System

PubMed Central

Kay, Mark A; He, Cheng-Yi; Chen, Zhi-Ying

2010-01-01

Minicircle DNA vectors consisting of a circular expression cassette devoid of the bacterial plasmid DNA backbone provides several advantages including sustained transgene expression in quiescent cells/tissues. Their use has been limited by labor-intensive production. We report on a strategy for making multiple genetic modifications in E.coli to construct a producer strain that stably expresses a set of inducible minicircle-assembly enzymes, the øC31-integrase and I-SceI homing-endonuclease. This bacterial strain is capable of producing highly purified minicircle yields in the same time frame as routine plasmid DNA. It is now feasible for minicircle DNA vectors to replace routine plasmids in mammalian transgene expression studies. PMID:21102455

[The induction of neovascularization in chorioallantoic membrane of chicken embryos transfected by a recombinant plasmid containing human angiogenin gene].

PubMed

Avdeeva, S V; Khaĭdarova, N V; Logunov, D Iu; Neugodova, G L; Sevast'ianova, G A; Tarantul, V Z; Naroditskiĭ, B S

2003-01-01

A method was elaborated to evaluate the biological activity of expression products of gene in the plasmid vectors, which are crucial for the synthesis of growth factor of blood vessels. It was proven as possible that the chrioallantonic membrane (CAM) of chicken's embryos could be transfected by recombinant plasmids containing both the reporter and target genes. The efficiency of CAM transfection was assessed by a plasmid carrying the reporter gene of green fluorescent protein (GFP). Finally, it was demonstrated that, at an infiltration of the recombinant plasmid containing the human angiogenine gene, its expression products induce the neovascularization in the CAM cells of chicken's embryos and stimulate an accretion in vessels of the 1st, 2nd and 3d orders.

Expression of membrane targeted aequorin in Xenopus laevis oocytes.

PubMed

Daguzan, C; Nicolas, M T; Mazars, C; Leclerc, C; Moreau, M

1995-08-01

We described here a system for high level of expression of the calcium activated photoprotein aequorin. This protein has been targeted to the plasma membrane of Xenopus oocyte by nuclear microinjection of a plasmid containing a construction of a chimeric cDNA encoding a fusion protein composed of the photoprotein aequorin and the 5-HT1A receptor. The expression of this fusion protein is placed under the control of RSV promoter. Functional photoprotein was reconstituted in the oocyte by incubation with coelenterazine. The amount of photoprotein 24 h after nuclear microinjection of the plasmid was sufficient to trigger a detectable light emission following calcium entry. The efficiency of the expression is correlated with the dose of plasmid injected. Intracytoplasmic injection of the plasmid always failed in photoprotein expression. Targeting of the apoprotein was demonstrated by immunolocalization under confocal microscopy. In our experimental conditions, the apoprotein was always localized at the animal pole above the nucleus. We never observed expression and targeting to the plasma membrane of the vegetal pole. WE suggest that such expression might be of great interest for the study of numerous problems of developmental biology, in which calcium-dependent pathways are involved.

Development of an expression plasmid and its use in genetic manipulation of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (higher Basidiomycetes).

PubMed

Yu, Xuya; Ji, Sen-Lin; He, Yi-Long; Ren, Meng-Fei; Xu, Jun-Wei

2014-01-01

We report the construction of a plasmid, pJW-EXP, designed for the expression of homologous and heterologous genes in Ganoderma lucidum. pJW-EXP was generated from the plasmid pMD19-T by inserting the G. lucidum glyceraldehyde-3-phosphate dehydrogenase gene promoter, the G. lucidum iron-sulfur protein subunit of succinate dehydrogenase gene terminator and the homologous carboxin-resistance gene as selection marker. This expression plasmid can be efficiently transformed into Ganoderma through polyethylene glycol-mediated protoplast transformation. Southern blot analysis showed that most of the integrated DNA appeared as multiple copies in the genome. The applicability of the constructed plasmid was tested by expression of the truncated G. lucidum 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) gene that encodes the catalytic domain of HMGR. Overexpression of the truncated HMGR gene, which is a key gene in the biosynthetic pathway of the antitumor compounds, ganoderic acids, increased the transcription of the HMGR gene and enhanced ganoderic acid accumulation. pJW-EXP can serve as a useful tool in the genetic improvement and metabolic engineering of Ganoderma.

Aging effects on intestinal homeostasis associated with expansion and dysfunction of intestinal epithelial stem cells

PubMed Central

Moorefield, Emily C.; Andres, Sarah F.; Blue, R. Eric; Van Landeghem, Laurianne; Mah, Amanda T.; Santoro, M. Agostina; Ding, Shengli

2017-01-01

Intestinal epithelial stem cells (IESCs) are critical to maintain intestinal epithelial function and homeostasis. We tested the hypothesis that aging promotes IESC dysfunction using old (18-22 months) and young (2-4 month) Sox9-EGFP IESC reporter mice. Different levels of Sox9-EGFP permit analyses of active IESC (Sox9-EGFPLow), activatable reserve IESC and enteroendocrine cells (Sox9-EGFPHigh), Sox9-EGFPSublow progenitors, and Sox9-EGFPNegative differentiated lineages. Crypt-villus morphology, cellular composition and apoptosis were measured by histology. IESC function was assessed by crypt culture, and proliferation by flow cytometry and histology. Main findings were confirmed in Lgr5-EGFP and Lgr5-LacZ mice. Aging-associated gene expression changes were analyzed by Fluidigm mRNA profiling. Crypts culture from old mice yielded fewer and less complex enteroids. Histology revealed increased villus height and Paneth cells per crypt in old mice. Old mice showed increased numbers and hyperproliferation of Sox9-EGFPLow IESC and Sox9-EGFPHigh cells. Cleaved caspase-3 staining demonstrated increased apoptotic cells in crypts and villi of old mice. Gene expression profiling revealed aging-associated changes in mRNAs associated with cell cycle, oxidative stress and apoptosis specifically in IESC. These findings provide new, direct evidence for aging associated IESC dysfunction, and define potential biomarkers and targets for translational studies to assess and maintain IESC function during aging. PMID:28854151

Analyzing Intracellular Binding and Diffusion with Continuous Fluorescence Photobleaching

PubMed Central

Wachsmuth, Malte; Weidemann, Thomas; Müller, Gabriele; Hoffmann-Rohrer, Urs W.; Knoch, Tobias A.; Waldeck, Waldemar; Langowski, Jörg

2003-01-01

Transport and binding of molecules to specific sites are necessary for the assembly and function of ordered supramolecular structures in cells. For analyzing these processes in vivo, we have developed a confocal fluorescence fluctuation microscope that allows both imaging of the spatial distribution of fluorescent molecules with confocal laser scanning microscopy and probing their mobility at specific positions in the cell with fluorescence correlation spectroscopy and continuous fluorescence photobleaching (CP). Because fluorescence correlation spectroscopy is restricted to rapidly diffusing particles and CP to slower processes, these two methods complement each other. For the analysis of binding-related contributions to mobility we have derived analytical expressions for the temporal behavior of CP curves from which the bound fraction and/or the dissociation rate or residence time at binding sites, respectively, can be obtained. In experiments, we investigated HeLa cells expressing different fluorescent proteins: Although enhanced green fluorescent protein (EGFP) shows high mobility, fusions of histone H2B with the yellow fluorescent protein are incorporated into chromatin, and these nuclei exhibit the presence of a stably bound and a freely diffusing species. Nonpermanent binding was found for mTTF-I, a transcription termination factor for RNA polymerase I, fused with EGFP. The cells show fluorescent nucleoli, and binding is transient. CP yields residence times for mTTF-I-EGFP of ∼13 s. PMID:12719264

Analyzing intracellular binding and diffusion with continuous fluorescence photobleaching.

PubMed

Wachsmuth, Malte; Weidemann, Thomas; Müller, Gabriele; Hoffmann-Rohrer, Urs W; Knoch, Tobias A; Waldeck, Waldemar; Langowski, Jörg

2003-05-01

Transport and binding of molecules to specific sites are necessary for the assembly and function of ordered supramolecular structures in cells. For analyzing these processes in vivo, we have developed a confocal fluorescence fluctuation microscope that allows both imaging of the spatial distribution of fluorescent molecules with confocal laser scanning microscopy and probing their mobility at specific positions in the cell with fluorescence correlation spectroscopy and continuous fluorescence photobleaching (CP). Because fluorescence correlation spectroscopy is restricted to rapidly diffusing particles and CP to slower processes, these two methods complement each other. For the analysis of binding-related contributions to mobility we have derived analytical expressions for the temporal behavior of CP curves from which the bound fraction and/or the dissociation rate or residence time at binding sites, respectively, can be obtained. In experiments, we investigated HeLa cells expressing different fluorescent proteins: Although enhanced green fluorescent protein (EGFP) shows high mobility, fusions of histone H2B with the yellow fluorescent protein are incorporated into chromatin, and these nuclei exhibit the presence of a stably bound and a freely diffusing species. Nonpermanent binding was found for mTTF-I, a transcription termination factor for RNA polymerase I, fused with EGFP. The cells show fluorescent nucleoli, and binding is transient. CP yields residence times for mTTF-I-EGFP of approximately 13 s.

Identification, functional characterization and expression pattern of myeloid differentiation factor 88 (MyD88) in Sepiella japonica.

PubMed

Huo, Liping; Bao, Miaomiao; Lv, Zhenming; Chi, Changfeng; Wang, Tianming; Liu, Huihui

2018-05-01

Myeloid differentiation factor 88 (MyD88) is an adaptor protein involved in the interleukin-1 receptor and Toll-like receptor-induced activation of nuclear factor-κB (NF-κB). In this study a novel isoform of MyD88 in Sepiella japonica (SjMyD88) was cloned and functionally characterized (GenBank accession no. AQY56781.1). The complete cDNA sequence of SjMyD88 was 1912 bp and contained a 1017 bp open reading frame encoding 338 amino acid residues, which was similar to its mollusk orthologues in the length. BLASTp analysis suggested the deduced amino acids sequence of SjMyD88 shared high identity to the known MyD88, for instance, 64% identity with Octopus bimaculoides. Sequence analysis revealed two conserved domains, the N-terminal DD and the C-terminal TIR domain appeared in SjMyD88, which was consistent with MyD88 proteins from other species. The fusion expression of SjMyD88 and green fluorescent protein (EGFP) in HEK293 cells was conducted and cytoplasm localization was detected. Meanwhile, the TIR-pmCherry fusion protein showed red fluorescence and mainly distributed in the cytoplasm. After cotransfection MyD88-EGFP and TIR-pmCherry red obviously overlapped and changed to yellowish green. The results suggested that there was the interaction between homologous TIR-pmcherry and MyD88-EGFP. Tissues expression profiles analysis showed that SjMyD88 ubiquitously expressed in all tested tissues with the highest expression in the gills and livers except reproductive related tissue, and it was significantly induced in livers under LPS stress. These data provide insight into the roles of SjMyD88 in the TLR signaling pathway of S. japonica in response to pathogenic bacteria. Copyright © 2018. Published by Elsevier Ltd.

Development of a keratinocyte-based screening model for antipsoriatic drugs using green fluorescent protein under the control of an endogenous promoter.

PubMed

Pol, Arno; van Ruissen, Fred; Schalkwijk, Joost

2002-08-01

Inflamed epidermis (psoriasis, wound healing, ultraviolet-irradiated skin) harbors keratinocytes that are hyperproliferative and display an abnormal differentiation program. A distinct feature of this so-called regenerative maturation pathway is the expression of proteins such as the cytokeratins CK6, CK16, and CK17 and the antiinflammatory protein SKALP/elafin. These proteins are absent in normal skin but highly induced in lesional psoriatic skin. Expression of these genes can be used as a surrogate marker for psoriasis in drug-screening procedures of large compound libraries. The aim of this study was to develop a keratinocyte cell line that contained a reporter gene under the control of a psoriasis-associated endogenous promoter and demonstrate its use in an assay suitable for screening. We generated a stably transfected keratinocyte cell line that expresses enhanced green fluorescent protein (EGFP), under the control of a 0.8-kb fragment derived from the promoter of the SKALP/elafin gene, which confers high levels of tissue-specific expression at the mRNA level. Induction of the SKALP promoter by tumor necrosis factor-alpha resulted in increased expression levels of the secreted SKALP-EGFP fusion protein as assessed by direct readout of fluorescence and fluorescence polarization in 96-well cell culture plates. The fold stimulation of the reporter gene was comparable to that of the endogenous SKALP gene as assessed by enzyme-linked immunosorbent assay. Although the dynamic range of the screening system is limited, the small standard deviation yields a Z factor of 0.49. This indicates that the assay is suitable as a high-throughput screen, and provides proof of the concept that a secreted EGFP fusion protein under the control of a physiologically relevant endogenous promoter can be used as a fluorescence-based high-throughput screen for differentiation-modifying or antiinflammatory compounds that act via the keratinocyte.

Ganoderic acid Me induces the apoptosis of competent T cells and increases the proportion of Treg cells through enhancing the expression and activation of indoleamine 2,3-dioxygenase in mouse lewis lung cancer cells.

PubMed

Que, Zujun; Zou, Fangyuan; Zhang, Anle; Zheng, Yuanhong; Bi, Ling; Zhong, Jianjiang; Tian, Jianhui; Liu, Jianwen

2014-11-01

The indoleamine 2,3-dioxygenase-(IDO-) mediated microenvironment plays an important role in tumor immune escape. It is known that ganoderic acid Me can enhance IFN-γ expression and IDO is preferentially induced by IFN-γ. However, whether GA-Me can induce IDO expression has not been clarified yet. We established stable clones of IDO-overexpressing 2 LL cells (2LL-EGFP-IDO). After co-culturing with IDO expressing or control vector-transfected 2LL-EGFP cells, T cell apoptosis was determined and the proportion of the regulatory T cells (Tregs) and CD8+ T cell subset was measured. The total cellular protein samples of 2 LL-EGFP-IDO cells were isolated for detecting JAK-STAT1 signalling pathway. Co-culture supernatants were used to detect amino acids and cytokines. IDO transfected 2 LL cells yielded high level of IDO enzymatic activity, resulting in complete depletion of tryptophan from the culture medium. We found that apoptosis occurred in T cells after cocultured with IDO+2LL cells and the proportion of CD4+CD25+ cells and FoxP3+ cells increased while CD8+ cells decreased. The specific inhibitor of IDO, 1-D-MT and GA-Me efficiently enhanced T cell apoptosis, increased Tregs, and reduced CD8+ T cells in vitro. Increased expression of IDO, p-JAK1 and p-STAT1 were confirmed by Western blot analysis. The levels of IFN-γ, IL-10, LDH and kynurenine in co-culture supernatant correspondingly increased, while tryptophan reduced. These results suggest that GA-Me contributing to IDO helps to create a tolerogenic milieu in lung tumors by directly inducing T cell apoptosis, restraining CD8+ T cell activation, and enhancing Treg-mediated immunosuppression. Copyright © 2014 Elsevier B.V. All rights reserved.

Inhibitor of endocytosis impairs gene electrotransfer to mouse muscle in vivo.

PubMed

Markelc, Bostjan; Skvarca, Eva; Dolinsek, Tanja; Kloboves, Veronika Prevodnik; Coer, Andrej; Sersa, Gregor; Cemazar, Maja

2015-06-01

Application of electric pulses (electroporation/electropermeabilization) is an effective method for gene transfer (i.e. gene electrotransfer (GET)) in vitro and in vivo. Currently, the mechanisms by which the DNA enters the cell are not yet fully understood. Experimental evidence is building up that endocytosis is the main mechanism by which the DNA, which is later expressed, enters the cell. Therefore the aim of our study was to elucidate whether inhibitors of endocytosis, methyl-β-cyclodextrin (MβCD), Concanavalin A (ConA) and Dynasore, can impair the transfection efficacy of GET in vitro in B16F1 murine melanoma and in vivo in m. tibialis cranialis in mice. We show that MβCD--general inhibitor of endocytosis--can almost prevent GET of EGFP-N1 plasmid in vitro, that ConA--inhibitor of clathrin mediated endocytosis--also abrogates GET but to a lesser extent, and when using Dynasore--reversible inhibitor of dynamin--there is no effect on GET efficacy, if endocytosis is blocked for only 5 min after GET. Moreover, MβCD also reduced GET efficacy in vivo in m. tibialis cranialis and this effect was long lasting. The results of this study show that endocytosis is probably the main mechanism of entrance of DNA after GET in vitro and also in vivo. Copyright © 2014 Elsevier B.V. All rights reserved.

The pathway to muscle fibrosis depends on myostatin stimulating the differentiation of fibro/adipogenic progenitor cells in chronic kidney disease

PubMed Central

Dong, Jiangling; Dong, Yanjun; Chen, Zihong; Mitch, William E.; Zhang, Liping

2016-01-01

Fibrosis in skeletal muscle develops after injury or in response to chronic kidney disease (CKD) but the origin of cells becoming fibrous tissue and the initiating and sustaining mechanisms causing muscle fibrosis are unclear. We have identified muscle fibro/adipogenic progenitor cells (FAPs) that potentially differentiate into adipose tissues or fibrosis. We also demonstrated that CKD stimulates myostatin production in muscle. Therefore, we tested whether CKD induces myostatin which stimulates fibrotic differentiation of FAPs leading to fibrosis in skeletal muscles. We isolated FAPs from mouse muscles and found that myostatin stimulates their proliferation and conversion into fibrocytes. In vivo, FAPs isolated from EGFP-transgenic mice (FAPs-EGFP) were transplanted into muscles of mice with CKD or into mouse muscles that were treated with myostatin. CKD or myostatin stimulated FAPs-EGFP proliferation in muscle and increased α-smooth muscle actin expression in FAP-EGFP cells. When myostatin was inhibited with a neutralizing peptibody (a chimeric peptide-Fc fusion protein), the FAP proliferation and muscle fibrosis induced by CKD were both suppressed. Knocking down Smad3 in cultured FAPs interrupted their conversion into fibrocytes indicating that myostatin directly converts FAPs into fibrocytes. Thus, counteracting myostatin may be a strategy for preventing the development of fibrosis in skeletal muscles of patients with CKD. PMID:27653838

The pathway to muscle fibrosis depends on myostatin stimulating the differentiation of fibro/adipogenic progenitor cells in chronic kidney disease.

PubMed

Dong, Jiangling; Dong, Yanjun; Chen, Zihong; Mitch, William E; Zhang, Liping

2017-01-01

Fibrosis in skeletal muscle develops after injury or in response to chronic kidney disease (CKD), but the origin of cells becoming fibrous tissue and the initiating and sustaining mechanisms causing muscle fibrosis are unclear. We identified muscle fibro/adipogenic progenitor cells (FAPs) that potentially differentiate into adipose tissues or fibrosis. We also demonstrated that CKD stimulates myostatin production in muscle. Therefore, we tested whether CKD induces myostatin, which stimulates fibrotic differentiation of FAPs leading to fibrosis in skeletal muscles. We isolated FAPs from mouse muscles and found that myostatin stimulates their proliferation and conversion into fibrocytes. In vivo, FAPs isolated from EGFP-transgenic mice (FAPs-EGFP) were transplanted into muscles of mice with CKD or into mouse muscles that were treated with myostatin. CKD or myostatin stimulated FAPs-EGFP proliferation in muscle and increased α-smooth muscle actin expression in FAP-EGFP cells. When myostatin was inhibited with a neutralizing peptibody (a chimeric peptide-Fc fusion protein), the FAP proliferation and muscle fibrosis induced by CKD were both suppressed. Knocking down Smad3 in cultured FAPs interrupted their conversion into fibrocytes, indicating that myostatin directly converts FAPs into fibrocytes. Thus, counteracting myostatin may be a strategy for preventing the development of fibrosis in skeletal muscles of patients with CKD. Copyright © 2016 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

The relationship between PSD-95 clustering and spine stability in vivo.

PubMed

Cane, Michele; Maco, Bohumil; Knott, Graham; Holtmaat, Anthony

2014-02-05

The appearance and disappearance of dendritic spines, accompanied by synapse formation and elimination may underlie the experience-dependent reorganization of cortical circuits. The exact temporal relationship between spine and synapse formation in vivo remains unclear, as does the extent to which synapse formation enhances the stability of newly formed spines and whether transient spines produce synapses. We used in utero electroporation of DsRedExpress- and eGFP-tagged postsynaptic density protein 95 (PSD-95) to investigate the relationship between spine and PSD stability in mouse neocortical L2/3 pyramidal cells in vivo. Similar to previous studies, spines and synapses appeared and disappeared, even in naive animals. Cytosolic spine volumes and PSD-95-eGFP levels in spines covaried over time, suggesting that the strength of many individual synapses continuously changes in the adult neocortex. The minority of newly formed spines acquired PSD-95-eGFP puncta. Spines that failed to acquire a PSD rarely survived for more than a day. Although PSD-95-eGFP accumulation was associated with increased spine lifetimes, most new spines with a PSD did not convert into persistent spines. This indicates that transient spines may serve to produce short-lived synaptic contacts. Persistent spines that were destined to disappear showed, on average, reduced PSD-95-eGFP levels well before the actual pruning event. Altogether, our data indicate that the PSD size relates to spine stability in vivo.

Effects of AC/DC magnetic fields, frequency, and nanoparticle aspect ratio on cellular transfection of gene vectors

NASA Astrophysics Data System (ADS)

Ford, Kris; Mair, Lamar; Fisher, Mike; Rowshon Alam, Md.; Juliano, Rudolph; Superfine, Richard

2008-10-01

In order to make non-viral gene delivery a useful tool in the study and treatment of genetic disorders, it is imperative that these methodologies be further refined to yield optimal results. Transfection of magnetic nanoparticles and nanorods are used as non-viral gene vectors to transfect HeLa EGFP-654 cells that stably express a mutated enhanced green fluorescent protein (EGFP) gene. We deliver antisense oligonucleotides to these cells designed to correct the aberrant splicing caused by the mutation in the EGFP gene. We also transfect human bronchial endothelial cells and immortalized WI-38 lung cells with pEGFP-N1 vectors. To achieve this we bind the genes to magnetic nanoparticles and nanorods and introduce magnetic fields to effect transfection. We wish to examine the effects of magnetic fields on the transfection of these particles and the benefits of using alternating (AC) magnetic fields in improving transfection rates over direct (DC) magnetic fields. We specifically look at the frequency dependence of the AC field and particle aspect ratio as it pertains to influencing transfection rate. We posit that the increase in angular momentum brought about by the AC field and the high aspect ratio of the nanorod particles, is vital to generating the force needed to move the particle through the cell membrane.

LDL oxidation by THP-1 monocytes: implication of HNP-1, SgIII and DMT-1.

PubMed

He, Chunyan; Huang, Rui; Du, Fen; Zheng, Fang; Wei, Lei; Wu, Junzhu

2009-04-01

Oxidized low-density lipoprotein (oxLDL) plays an important role in the pathogenesis of atherosclerosis. However, the mechanisms of the initiation and progression of LDL oxidation by cells are still unknown. We investigated the molecular mechanism underlying THP-1 cell-mediated LDL oxidation. LDL oxidation was monitored at 234 nm by detecting the formation of conjugated dienes. cDNA array analysis was applied to profile changes in gene expression of human THP-1 monocytes in response to LDL stimulation. The mRNA and protein levels of secretogranin III (SgIII), divalent metal transporter (DMT-1) and human alpha-defensin 1 (HNP-1) were determined by real-time RT-PCR and Western blotting respectively. Eukaryotic expression vectors containing full-length cDNA sequence of HNP-1 (pEGFP-C1/HNP-1) SgIII (pEGFP-C1/SgIII) or DMT-1 (pEGFP-C1/DMT-1) were constructed and transfected to THP-1 cells. The effects of overexpression of these three genes on THP-1 cell-mediated LDL oxidation were observed. LDL oxidation was most pronounced after LDL was incubated with THP-1 cells for 9 h. 1651 genes in total were detected by cDNA array analysis in THP-1 cells with or without LDL treatment for 9 h. Thirteen genes with >2-fold relative expression difference were identified, including nine genes whose expression was up-regulated and four genes whose expression was down-regulated. Among the up-regulated genes, SgIII, DMT-1 and HNP-1 were reported to be associated with atherosclerosis. The increased mRNA expressions of these three genes were confirmed by real-time RT-PCR. Western blotting analysis demonstrated that protein expressions of SgIII and DMT-1 were also enhanced in THP-1 cells in response to LDL. Furthermore, transient overexpression of HNP-1, SgIII or DMT-1 in THP-1 cells significantly increased THP-1 cell-mediated LDL oxidation. Our data suggest that SgIII, DMT-1 and HNP-1 are implicated in cell-mediated LDL oxidation.

DDX3 binding with CK1ε was closely related to motor neuron degeneration of ALS by affecting neurite outgrowth.

PubMed

Chen, Yanchun; Wang, Qing; Wang, Qiaozhen; Liu, Huancai; Zhou, Fenghua; Zhang, Yawen; Yuan, Meng; Zhao, Chunyan; Guan, Yingjun; Wang, Xin

2017-01-01

Amyotrophic lateral sclerosis (ALS) is a chronic neurodegenerative disease characterized by progressive degeneration of motor neurons. The pathogenesis of ALS remains largely unknown. RNA helicase DDX3 is a multifunctional protein involved in several steps of gene expression. Casein kinase 1ε (CK1ε) is an important signal molecule of Wnt signaling pathway and is closely related to neurite growth. However, the roles of DDX3 and CK1ε in the pathogenesis of ALS remain unclear. In this study, we first investigated the expression of DDX3 and CK1ε in the spinal cord of SOD1-G93A ALS transgenic mice using RT-PCR, Western blot and immunohistochemical technique. Results showed that the altered expression of DDX3 and CK1ε was found in the spinal cord of ALS mice. DDX3 and CK1ε positive cells were mainly distributed in the anterior horn of spinal cord and co-localized with neurons not with glial cells, suggesting that the altered expression of DDX3 and CK1ε was closely related to motor neuron degeneration of ALS. Moreover, we selected NSC34 cell line and transfected pEGFP-G93A-SOD1 plasmid to further examine the mechanism. Knockdown of DDX3 that uses small interfering RNA (siRNA) decreased the mRNA and protein levels of CK1ε significantly and inhibited neurite outgrowth of SOD1 mutant NSC34 cells in vitro. Co-immunoprecipitation kit confirmed that DDX3 could band with CK1ε in vivo. Our data suggested that DDX3 binding with CK1ε was closely related to motor neuron degeneration of ALS by affecting neurite outgrowth. Thus, elucidating the underlying mechanisms of ALS is crucial for future development of ALS treatments.

MSH3-deficiency initiates EMAST without oncogenic transformation of human colon epithelial cells.

PubMed

Campregher, Christoph; Schmid, Gerald; Ferk, Franziska; Knasmüller, Siegfried; Khare, Vineeta; Kortüm, Benedikt; Dammann, Kyle; Lang, Michaela; Scharl, Theresa; Spittler, Andreas; Roig, Andres I; Shay, Jerry W; Gerner, Christopher; Gasche, Christoph

2012-01-01

Elevated microsatellite instability at selected tetranucleotide repeats (EMAST) is a genetic signature in certain cases of sporadic colorectal cancer and has been linked to MSH3-deficiency. It is currently controversial whether EMAST is associated with oncogenic properties in humans, specifically as cancer development in Msh3-deficient mice is not enhanced. However, a mutator phenotype is different between species as the genetic positions of repetitive sequences are not conserved. Here we studied the molecular effects of human MSH3-deficiency. HCT116 and HCT116+chr3 (both MSH3-deficient) and primary human colon epithelial cells (HCEC, MSH3-wildtype) were stably transfected with an EGFP-based reporter plasmid for the detection of frameshift mutations within an [AAAG]17 repeat. MSH3 was silenced by shRNA and changes in protein expression were analyzed by shotgun proteomics. Colony forming assay was used to determine oncogenic transformation and double strand breaks (DSBs) were assessed by Comet assay. Despite differential MLH1 expression, both HCT116 and HCT116+chr3 cells displayed comparable high mutation rates (about 4×10(-4)) at [AAAG]17 repeats. Silencing of MSH3 in HCECs leads to a remarkable increased frameshift mutations in [AAAG]17 repeats whereas [CA]13 repeats were less affected. Upon MSH3-silencing, significant changes in the expression of 202 proteins were detected. Pathway analysis revealed overexpression of proteins involved in double strand break repair (MRE11 and RAD50), apoptosis, L1 recycling, and repression of proteins involved in metabolism, tRNA aminoacylation, and gene expression. MSH3-silencing did not induce oncogenic transformation and DSBs increased 2-fold. MSH3-deficiency in human colon epithelial cells results in EMAST, formation of DSBs and significant changes of the proteome but lacks oncogenic transformation. Thus, MSH3-deficiency alone is unlikely to drive human colon carcinogenesis.

MSH3-Deficiency Initiates EMAST without Oncogenic Transformation of Human Colon Epithelial Cells

PubMed Central

Campregher, Christoph; Schmid, Gerald; Ferk, Franziska; Knasmüller, Siegfried; Khare, Vineeta; Kortüm, Benedikt; Dammann, Kyle; Lang, Michaela; Scharl, Theresa; Spittler, Andreas; Roig, Andres I.; Shay, Jerry W.; Gerner, Christopher; Gasche, Christoph

2012-01-01

Background/Aim Elevated microsatellite instability at selected tetranucleotide repeats (EMAST) is a genetic signature in certain cases of sporadic colorectal cancer and has been linked to MSH3-deficiency. It is currently controversial whether EMAST is associated with oncogenic properties in humans, specifically as cancer development in Msh3-deficient mice is not enhanced. However, a mutator phenotype is different between species as the genetic positions of repetitive sequences are not conserved. Here we studied the molecular effects of human MSH3-deficiency. Methods HCT116 and HCT116+chr3 (both MSH3-deficient) and primary human colon epithelial cells (HCEC, MSH3-wildtype) were stably transfected with an EGFP-based reporter plasmid for the detection of frameshift mutations within an [AAAG]17 repeat. MSH3 was silenced by shRNA and changes in protein expression were analyzed by shotgun proteomics. Colony forming assay was used to determine oncogenic transformation and double strand breaks (DSBs) were assessed by Comet assay. Results Despite differential MLH1 expression, both HCT116 and HCT116+chr3 cells displayed comparable high mutation rates (about 4×10−4) at [AAAG]17 repeats. Silencing of MSH3 in HCECs leads to a remarkable increased frameshift mutations in [AAAG]17 repeats whereas [CA]13 repeats were less affected. Upon MSH3-silencing, significant changes in the expression of 202 proteins were detected. Pathway analysis revealed overexpression of proteins involved in double strand break repair (MRE11 and RAD50), apoptosis, L1 recycling, and repression of proteins involved in metabolism, tRNA aminoacylation, and gene expression. MSH3-silencing did not induce oncogenic transformation and DSBs increased 2-fold. Conclusions MSH3-deficiency in human colon epithelial cells results in EMAST, formation of DSBs and significant changes of the proteome but lacks oncogenic transformation. Thus, MSH3-deficiency alone is unlikely to drive human colon carcinogenesis. PMID:23209772

The 987P fimbrial gene cluster of enterotoxigenic Escherichia coli is plasmid encoded.

PubMed Central

Schifferli, D M; Beachey, E H; Taylor, R K

1990-01-01

A clone containing the 987P fimbrial gene cluster was selected from a cosmid library of total DNA of the prototype Escherichia coli strain 987 by using 987P-specific antiserum. A subclone of 12 kilobases containing all of the genes required for fimbrial expression on a nonfimbriated K-12 strain of E. coli and a DNA fragment internal to the fimbrial subunit gene were used to probe the prototype strain and various isolates of 987P-fimbriated enterotoxigenic E. coli. All strains had several plasmids, as shown by agarose gel electrophoresis, and each of five strains which expressed 987P fimbriae showed a plasmid of 35 to 40 megadaltons (MDa) hybridizing to both 987P-specific probes. Hybridization to restricted DNA of strain 987 supported a plasmid origin for the cloned 987P gene cluster. Moreover, an isogenic strain which had lost its 35-MDa plasmid was no longer capable of synthesizing fimbrial subunits, but regained fimbrial expression after reintroduction of the TnphoA (Tn5 IS50L::phoA)-tagged 35-MDa plasmid. Absence of fimbrial subunit synthesis in K-12 strains transformed with the 35-MDa plasmid alone suggested the requirement of regulatory elements existing in strain 987 but missing in K-12 strains. A probe for the heat-stable enterotoxin STIa hybridized in each of the 987P-fimbriated strains to the plasmid containing the 987P genes and in most of these strains to an additional plasmid which contained the gene for the heat-stable enterotoxin STII. Occurrence of the 987P and STIa genes on the same replicon correlates with epidemiological observations, STIa being the most prevalent toxin produced by 987P-fimbriated E. coli. Images PMID:1967167

Xuhuai goat H-FABP gene clone, subcellular localization of expression products and the preparation of transgenic mice.

PubMed

Yin, Yan-hui; Li, Bi-chun; Wei, Guang-hui; Zhu, Cai-ye; Li, Wei; Zhang, Ya-ni; Du, Li-xin; Cao, Wen-guang

2012-05-01

The aim of this study was to clone the heart-type fatty acid binding protein (H-FABP) gene of Xuhuai goat, to explore it bioinformatically, and analyze the subcellular localization using enhanced green fluorescent protein (EGFP). The results showed that the coding sequence (CDS) length of Xuhuai goat H-FABP gene was 402 bp, encoding 133 amino acids (GenBank accession number AY466498.1). The H-FABP cDNA coding sequence was compared with the corresponding region of human, chicken, brown rat, cow, wild boar, donkey, and zebrafish. The similarity were 89%, 76%, 85%, 84%, 93%, 91%, 70%, respectively. For the corresponding amino acid sequences, the similarity were 90%, 79%, 88%, 97%, 95%, 94%, 72%, respectively. This study did not find the signal peptide region in the H-FABP protein; it revealed that H-FABP protein might be a nonsecreted protein. H-FABP expression was detected in vitro by reverse transcription-polymerase chain reaction (RT-PCR), and the EGFP-H-FABP fusion protein was localized to the cytoplasm. The gene could also be transiently and permanently expressed in mice.

Food-grade host/vector expression system for Lactobacillus casei based on complementation of plasmid-associated phospho-beta-galactosidase gene lacG.

PubMed

Takala, T M; Saris, P E J; Tynkkynen, S S H

2003-01-01

A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.

A freeze-thaw method for disintegration of Escherichia coli cells producing T7 lysozyme used in pBAD expression systems.

PubMed

Wanarska, Marta; Hildebrandt, Piotr; Kur, Józef

2007-01-01

The pLysN plasmid containing the T7 lysozyme gene under control of the lac promoter was constructed to facilitate cell disintegration after expression of recombinant proteins in arabinose-induced expression systems. The usefulness of this plasmid was tested in Escherichia coli TOP10 and E. coli LMG194 cells carrying pBADMHADgeSSB plasmid containing Deinococcus geothermalis SSB protein gene under control of the araBAD promoter. The results showed that low-level expression of T7 lysozyme did not interfere with the target SSB protein production, and that the freezing-thawing treatment was sufficient for disruption of the E. coli cells producing low amounts of T7 lysozyme.

Exploring the Role of Ubiquitination in Progesterone Receptor Transcriptional Activation and Turnover in Breast Cancer Cells

DTIC Science & Technology

2006-06-01

factors. T47DY cells were cotransfected with a PR construct, a PRE- luciferase plasmid and a renilla plasmid, for transfection control. The cells...PR-B or S294A PR-B, PRE-luciferase reporter constructs and a Renilla control plasmid. Cells were treated for 24hrs with or without R5020 (10nM...plasmid and a plasmid constitutively expressing renilla luciferase for transfection control. Cell were starved for one day and treated with or without

MACF1 Overexpression by Transfecting the 21 kbp Large Plasmid PEGFP-C1A-ACF7 Promotes Osteoblast Differentiation and Bone Formation.

PubMed

Zhang, Yan; Yin, Chong; Hu, Lifang; Chen, Zhihao; Zhao, Fan; Li, Dijie; Ma, Jianhua; Ma, Xiaoli; Su, Peihong; Qiu, Wuxia; Yang, Chaofei; Wang, Pai; Li, Siyu; Zhang, Ge; Wang, Liping; Qian, Airong; Xian, Cory J

2018-02-01

Microtubule actin crosslinking factor 1 (MACF1) is a large spectraplakin protein known to have crucial roles in regulating cytoskeletal dynamics, cell migration, growth, and differentiation. However, its role and action mechanism in bone remain unclear. The present study investigated optimal conditions for effective transfection of the large plasmid PEGFP-C1A-ACF7 (∼21 kbp) containing full-length human MACF1 cDNA, as well as the potential role of MACF1 in bone formation. To enhance MACF1 expression, the plasmid was transfected into osteogenic cells by electroporation in vitro and into mouse calvaria with nanoparticles. Then, transfection efficiency, osteogenic marker expression, calvarial thickness, and bone formation were analyzed. Notably, MACF1 overexpression triggered a drastic increase in osteogenic gene expression, alkaline phosphatase activity, and matrix mineralization in vitro. Mouse calvarial thickness, mineral apposition rate, and osteogenic marker protein expression were significantly enhanced by local transfection. In addition, MACF1 overexpression promoted β-catenin expression and signaling. In conclusion, MACF1 overexpression by transfecting the large plasmid containing full-length MACF1 cDNA promotes osteoblast differentiation and bone formation via β-catenin signaling. Current data will provide useful experimental parameters for the transfection of large plasmids and a novel strategy based on promoting bone formation for prevention and therapy of bone disorders.

Transgenic breeding of anti-Bombyx mori L. nuclear polyhedrosis virus silkworm Bombyx mori.

PubMed

Yang, Huijuan; Fan, Wei; Wei, Hao; Zhang, Jinwei; Zhou, Zhonghua; Li, Jianying; Lin, Jianrong; Ding, Nong; Zhong, Boxiong

2008-10-01

Silkworm strains resistant to Bombyx mori L. nuclear polyhedrosis virus were obtained through transgenic experiments. piggyBac transposon with an A3 promoter were randomly inserted into the silkworm, driving the enhanced green fluorescent protein (EGFP) reporter gene into the silkworm genome. Polymerase chain reaction results verified the insertion of the extraneous EGFP gene, and fluorescence microscopy showed that the EGFP was expressed in the midgut tissue. The morbidity ratio of the nuclear polyhedrosis decreased from 90% in the original silkworm strain to 66.7% in the transgenic silkworm strain. Compared with the resistance to the Bombyx mori L. nuclear polyhedrosis virus in the Qiufeng strain, which is commonly used in the production, there was an increase of 33 centesimal points in the transgenic silkworms. The antivirotic character in the Chunhua x Qiuyue strain, which was bred from a different transgenic family, was about 10 centesimal points higher than that in the Qiufeng x Baiyu, another crossbreed used in production. Our results indicated a good application value of the transposon-inserted mutation in the breeding of anti-BmNPV silkworm strain.

Roles for SH2 and SH3 domains in Lyn kinase association with activated FcepsilonRI in RBL mast cells revealed by patterned surface analysis.

PubMed

Hammond, Stephanie; Wagenknecht-Wiesner, Alice; Veatch, Sarah L; Holowka, David; Baird, Barbara

2009-10-01

In mast cells, antigen-mediated cross-linking of IgE bound to its high-affinity surface receptor, FcepsilonRI, initiates a signaling cascade that culminates in degranulation and release of allergic mediators. Antigen-patterned surfaces, in which the antigen is deposited in micron-sized features on a silicon substrate, were used to examine the spatial relationship between clustered IgE-FcepsilonRI complexes and Lyn, the signal-initiating tyrosine kinase. RBL mast cells expressing wild-type Lyn-EGFP showed co-redistribution of this protein with clustered IgE receptors on antigen-patterned surfaces, whereas Lyn-EGFP containing an inhibitory point mutation in its SH2 domain did not significantly accumulate with the patterned antigen, and Lyn-EGFP with an inhibitory point mutation in its SH3 domain exhibited reduced interactions. Our results using antigen-patterned surfaces and quantitative cross-correlation image analysis reveal that both the SH2 and SH3 domains contribute to interactions between Lyn kinase and cross-linked IgE receptors in stimulated mast cells.

[Expression of the fusion protein CFP10-ESAT6 of Mycobacterium tuberculosis and the study of its immunogenicity].

PubMed

Wang, Xiao-ying; Bao, Lang; Zhao, Ming-cai; Zhang, Hui-dong; Long, Yang

2006-05-01

To express a recombinant fusion protein CFP10-ESAT6 of Mycobacterium tuberculosis, and obtain the polyclonal antibodies of this fusion protein by immune rabbit. The 630 bp cfpl0-esat6 fusion gene fragments were amplified from the genomic DNA of a Mycobacterium tuberculosis reference strain H37Rv and inserted into the expression plasmid pET32a (+) to generate the recombinant plasmid pET-cfp10-esat6. The recombinat expression plasmid was transformed into E. coli BL21 (DE3). The fused protein CFP10-ESAT6 with His-tag was expressed after inducing with IPTG and purified with affinity chromatography. This protein was used to immune the rabbit to obtained the polyclonal antibodies, and been analyzed with Western-blot and ELISA. The recombinant plasmid pET-cfp10-esat6 was success fully constructed, the recombinant fusion protein CFP10-ESAT6 could be expressed at relatively high levels, and the polyclonal antibodies of fusion protein were obtained. The successful construction and expression of the recombinant fusion protein CFP10-ESAT6 and the obtained polyclonal antibodies will be very helpful for the development of new anti-tuberculosis vaccine and the clinical serologic diagnosis.

[Clone, construct, expression and verification of lactoferricin B gene and several sequence mutations in yeast].

PubMed

Feng, Yong-qian; Zha, Xiao-jun; Zhai, Chao-yang

2007-07-01

To construct the eucaryotic recombinant plasmid of pYES2/LactoferricinB expressing in yeast of S. cerevisiae, of which the expressed protein antibacterial activity was verified in preliminary. By self-template PCR method, the gene of Lactoferricin B and its several sequence mutations were amplified with the parts of the pre-synthesized single chains. And then Lactoferricin B gene and its mutants were cloned into the vector of pYES2 to construct the recombined expression plasmid pYES2/Lactoferricin B etc. extracted and used to transform the yeast S. cerevisiae. The expressions of proteins were determined after induced by galactose. The expression proteins were collected and purified by hydronium-exchange column, and the bacterial inhibited test was applied to identify the protein antibacterial activities. The PCR amplifying and DNA sequencing tests indicated that the purpose plasmid contained the Lactoferricin B gene and several mutations. The induced target proteins were confirmed by SDS-PAGE electrophoresis and mass spectrum test. The protein antibacterial activities of mutations were verified in preliminary. The recombined plasmid pYES2/Lactoferricin B etc. are successfully constructed and induced to express in yeast cell of S. cerevisiae; the obtained recombined protein of Lactoferricin B provides a basis for further research work on the biological function and antibacterial activity.

Immune Responses Induced by Gene Gun or Intramuscular Injection of DNA Vaccines That Express Immunogenic Regions of the Serine Repeat Antigen from Plasmodium falciparum

PubMed Central

Belperron, Alexia A.; Feltquate, David; Fox, Barbara A.; Horii, Toshihiro; Bzik, David J.

1999-01-01

The liver- and blood-stage-expressed serine repeat antigen (SERA) of Plasmodium falciparum is a candidate protein for a human malaria vaccine. We compared the immune responses induced in mice immunized with SERA-expressing plasmid DNA vaccines delivered by intramuscular (i.m.) injection or delivered intradermally by Gene Gun immunization. Mice were immunized with a pcdna3 plasmid encoding the entire 47-kDa domain of SERA (amino acids 17 to 382) or the N-terminal domain (amino acids 17 to 110) of SERA. Minimal antibody responses were detected following DNA vaccination with the N-terminal domain of SERA, suggesting that the N-terminal domain alone is not highly immunogenic by this route of vaccine delivery. Immunization of mice by Gene Gun delivery of the 47-kDa domain of SERA elicited a significantly higher serum antibody titer to the antigen than immunization of mice by i.m. injection with the same plasmid did. The predominant isotype subclass of the antibodies elicited to the SERA protein following i.m. and Gene Gun immunizations with SERA plasmid DNA was immunoglobulin G1. Coimmunization of mice with SERA plasmid DNA and a plasmid expressing the hepatitis B surface antigen (pCMV-s) by the i.m. route resulted in higher anti-SERA titers than those generated in mice immunized with the SERA DNA plasmid alone. Vaccination with DNA may provide a viable alternative or may be used in conjunction with protein-based subunit vaccines to maximize the efficacy of a human malaria vaccine that includes immunogenic regions of the SERA protein. PMID:10496891

Effects of different cytokines on immune responses of rainbow trout in a virus DNA vaccination model

PubMed Central

Cao, Yongsheng; Zhang, Qiya; Xu, Liming; Li, Shaowu; Wang, Di; Zhao, Jingzhuang; Liu, Hongbai; Feng, Jian; Lu, Tongyan

2017-01-01

Seven rainbow trout cytokine genes (interleukin (IL)-2, IL-8, IL-15, IL-17, IL-1β, intracellular interferon (iIFN) 1a, and IFN-γ2) were evaluated for their adjuvant effects on a DNA vaccine, called pG, containing the glycoprotein gene of infectious hematopoietic necrosis virus (IHNV). Distinct DNA constructs in expression plasmid pcDNA3.1 encoding a cytokine gene were generated. Immunofluorescence assays in rainbow trout gonadal cells demonstrated successful protein expression from all these constructs. Subsequently, fish were immunized with pG alone or together with a cytokine expression plasmid. Results showed that each cytokine plasmids at an appropriate dose showed notable effects on immune gene expression. IL-17 and IFN-γ2 can enhance early specific IgM response. All cytokines, except IL-8, can benefit initial neutralizing antibody (NAb) titers. At 35 days post immunization (dpi), NAb titers of fish immunized with pG and IL-2, iIFN1a, or IFN-γ2 plasmids remained at high levels (1:160). NAb titers of fish immunized with pG alone decreased to 1:40. IL-8 or IL-1β can enhance antigen-specific proliferative T-cell responses at 14 dpi. At 28 dpi, coinjection of pG with IL-2, IL-8, IL-15, or IL-17 plasmids induced considerably stronger lymphocyte proliferation than that with injection of pG alone. All cytokine plasmids delivered with pG plasmid enhanced protection of trout against IHNV-mediated mortality. These results indicate that the type and dose of trout cytokine genes injected into fish affect quality of immune response to DNA vaccination. PMID:29348820

Novel Polymeric Nanoparticles for Pulmonary Gene Delivery

NASA Astrophysics Data System (ADS)

Fields, Rachel Jennifer

The lung is an important target for gene and drug therapy of many diseases such as chronic obstructive pulmonary disease (COPD), cystic fibrosis (CF), tubuerculosis (TB) and lung cancer. In fact, the pulmonary route has been employed as a means of delivering drugs for centuries, dating back 4000 years to India where inhaled vapors were used for medicinal purpose. Currently, pulmonary administration of small, hydrophobic drugs leads to rapid local and systemic absorption. However, delivery of large biomacromolecules, such as therapeutic genes, has not yet been accomplished. Here, I test the hypothesis that a rationally engineered nanoparticle (NP) vector can improve delivery of large biomacromolecules. . In this dissertation I tested this hypothesis using a hybrid NP delivery system consisting of a blend of poly(lactic-co-glycolic acid) (PLGA) and a poly(beta-amino ester) (PBAE), a cationic polymer that is particularly useful for delivery of nucleic acids.. PBAE/PLGA nanoparticles (15% PBAE) loaded with plasmid DNA were surface modified with cell-penetrating peptides (CPPs) via a PEGylated phospholipid linker. This optimized NP formulation was able to induce substantial intracellular uptake and transfect lung epithelial cells in vitro while imparting minimal cellular toxicity. In order to determine the most effective method to deliver these NPs to the lung I used fluorescently labeled particles to study the biodistribution of particles after administration to the lung of mice via various administration routes. I determined that the intranasal route was most effective. I further investigated this route and determined that an average of 37.1 +/- 15.1 % of lung cells had NP association after 4hrs. I also investigated the association of particles with different lung cell types like macrophages and alveolar epithelial cells and determined that our best particle formulations associated with approximately 80% of both of these cell types. To demonstrate the ability of the NPs to deliver difficult to gene therapy reagents, such as PNAs, to cells within the lung, I loaded NPs with PNA and DNA and administered them via the intranasal route. Triplex forming peptide nucleic acids (PNAs) are gene therapy reagents that can mediate site-specific homologous recombination with genomic DNA when successfully delivered to the nucleus of cells in combination with donor DNA oligos. Delivery of NPs resulted in EGFP expression in transgenic mice with an aberrant EGFP gene that could be corrected and effectively expressed with nuclear delivery of a PNA/DNA. This work represents the first successful use of PNA/DNA mediated homologous recombination to target cells of the lung.

Enhanced EGFP-chromophore-assisted laser inactivation using deficient cells rescued with functional EGFP-fusion proteins.

PubMed

Vitriol, Eric A; Uetrecht, Andrea C; Shen, Feimo; Jacobson, Ken; Bear, James E

2007-04-17

Chromophore-assisted laser inactivation (CALI) is a light-mediated technique that offers precise spatiotemporal control of protein inactivation, enabling better understanding of the protein's role in cell function. EGFP has been used effectively as a CALI chromophore, and its cotranslational attachment to the target protein avoids having to use exogenously added labeling reagents. A potential drawback to EGFP-CALI is that the CALI phenotype can be obscured by the endogenous, unlabeled protein that is not susceptible to light inactivation. Performing EGFP-CALI experiments in deficient cells rescued with functional EGFP-fusion proteins permits more complete loss of function to be achieved. Here, we present a modified lentiviral system for rapid and efficient generation of knockdown cell lines complemented with physiological levels of EGFP-fusion proteins. We demonstrate that CALI of EGFP-CapZbeta increases uncapped actin filaments, resulting in enhanced filament growth and the formation of numerous protrusive structures. We show that these effects are completely dependent upon knocking down the endogenous protein. We also demonstrate that CALI of EGFP-Mena in Mena/VASP-deficient cells stabilizes lamellipodial protrusions.

Intratracheal administration of p38α short-hairpin RNA plasmid ameliorates lung ischemia-reperfusion injury in rats.

PubMed

Lv, Xiangqi; Tan, Jing; Liu, Dongdong; Wu, Ping; Cui, Xiaoguang

2012-06-01

Lung ischemia-reperfusion injury (LIRI) remains a significant problem after lung transplantation. A crucial signaling enzyme involved in inflammation and apoptosis during LIRI is p38 mitogen-activated protein kinase (MAPK). Gene silencing of p38α by short hairpin RNA (shRNA) can downregulate p38α expression. The lungs have an extremely large surface area, which makes the absorption of shRNA highly effective. Therefore, we evaluated the therapeutic efficacy of p38α shRNA plasmids in a rat model of lung transplantation. The delivery of p38α shRNA plasmid was performed by intratracheal administration 48 hours before transplantation into donor rats. Control animals received scrambled shRNA plasmids. Reverse-transcription polymerase chain reaction and Western blots were used to assess gene silencing efficacy. The therapeutic effects of shRNA plasmids were evaluated by lung function tests. We determined the levels of inflammatory cytokines, the level of intercellular adhesion molecule 1 (ICAM-1), c-Myc mRNA expression, and ICAM-1 protein expression, and the presence of cell apoptosis. Rats administered p38α shRNA plasmids showed a significant downregulation in lung expression of p38α transcripts and protein levels. Compared with the control group, the p38α shRNA group showed a higher pulmonary vein oxygen level, lower wet weight-to-dry weight ratio, lower lung injury score, and lower serum levels of tumor necrosis factor-α, interleukin-6, and interleukin-8. Messenger RNA levels of ICAM-1 and c-Myc in the p38α shRNA group were dramatically lower than in the control group. Levels of ICAM-1 protein expression exhibited a similar trend. Cell apoptosis decreased in the p38α shRNA group vs the control group. Intratracheal administration of p38α shRNA plasmids provided therapeutic effects in a rat model of lung transplantation. Crown Copyright © 2012. Published by Elsevier Inc. All rights reserved.

The effect of mutation on Rhodococcus equi virulence plasmid gene expression and mouse virulence.

PubMed

Ren, Jun; Prescott, John F

2004-11-15

An 81 kb virulence plasmid containing a pathogenicity island (PI) plays a crucial role in the pathogenesis of Rhodococcus equi pneumonia in foals but its specific function in virulence and regulation of plasmid-encoded virulence genes is unclear. Using a LacZ selection marker developed for R. equi in this study, in combination with an apramycin resistance gene, an efficient two-stage homologous recombination targeted gene mutation procedure was used to mutate three virulence plasmid genes, a LysR regulatory gene homologue (ORF4), a ResD-like two-component response regulator homologue (ORF8), and a gene (ORF10) of unknown function that is highly expressed by R. equi inside macrophages, as well as the chromosomal gene operon, phoPR. Virulence testing by liver clearance after intravenous injection in mice showed that the ORF4 and ORF8 mutants were fully attenuated, that the phoPR mutant was hypervirulent, and that virulence of the ORF10 mutant remained unchanged. A virulence plasmid DNA microarray was used to compare the plasmid gene expression profile of each of the four gene-targeted mutants against the parental R. equi strain. Changes were limited to PI genes and gene induction was observed for all mutants, suggesting that expression of virulence plasmid genes is dominated by a negative regulatory network. The finding of attenuation of ORF4 and ORF8 mutants despite enhanced transcription of vapA suggests that factors other than VapA are important for full expression of virulence. ORF1, a putative Lsr antigen gene, was strongly and similarly induced in all mutants, implying a common regulatory pathway affecting this gene for all four mutated genes. ORF8 is apparently the centre of this common pathway. Two distinct highly correlated gene induction patterns were observed, that of the ORF4 and ORF8 mutants, and that of the ORF10 and phoPR mutants. The gene induction pattern distinguishing these two groups paralleled their virulence in mice.

Preclinical development of BCG.HIVA2auxo.int, harboring an integrative expression vector, for a HIV-TB Pediatric vaccine. Enhancement of stability and specific HIV-1 T-cell immunity.

PubMed

Mahant, Aakash; Saubi, Narcís; Eto, Yoshiki; Guitart, Núria; Gatell, Josep Ma; Hanke, Tomáš; Joseph, Joan

2017-08-03

One of the critical issues that should be addressed in the development of a BCG-based HIV vaccine is genetic plasmid stability. Therefore, to address this issue we have considered using integrative vectors and the auxotrophic mutant of BCG complemented with a plasmid carrying a wild-type complementing gene. In this study, we have constructed an integrative E. coli-mycobacterial shuttle plasmid, p2auxo.HIVA int , expressing the HIV-1 clade A immunogen HIVA. This shuttle vector uses an antibiotic resistance-free mechanism for plasmid selection and maintenance. It was first transformed into a glycine auxotrophic E. coli strain and subsequently transformed into a lysine auxotrophic Mycobacterium bovis BCG strain to generate the vaccine BCG.HIVA 2auxo.int . Presence of the HIVA gene sequence and protein expression was confirmed. We demonstrated that the in vitro stability of the integrative plasmid p2auxo.HIVA int was increased 4-fold, as compared with the BCG strain harboring the episomal plasmid, and was genetically and phenotypically characterized. The BCG.HIVA 2auxo.int vaccine in combination with modified vaccinia virus Ankara (MVA).HIVA was found to be safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. We have engineered a more stable and immunogenic BCG-vectored vaccine using the prototype immunogen HIVA. Thus, the use of integrative expression vectors and the antibiotic-free plasmid selection system based on "double" auxotrophic complementation are likely to improve the mycobacterial vaccine stability in vivo and immunogenicity to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective responses shortly following birth.

Construction and characterization of recombinant flaviviruses bearing insertions between E and NS1 genes

PubMed Central

Bonaldo, Myrna C; Mello, Samanta M; Trindade, Gisela F; Rangel, Aymara A; Duarte, Adriana S; Oliveira, Prisciliana J; Freire, Marcos S; Kubelka, Claire F; Galler, Ricardo

2007-01-01

Background The yellow fever virus, a member of the genus Flavivirus, is an arthropod-borne pathogen causing severe disease in humans. The attenuated yellow fever 17D virus strain has been used for human vaccination for 70 years and has several characteristics that are desirable for the development of new, live attenuated vaccines. We described here a methodology to construct a viable, and immunogenic recombinant yellow fever 17D virus expressing a green fluorescent protein variant (EGFP). This approach took into account the presence of functional motifs and amino acid sequence conservation flanking the E and NS1 intergenic region to duplicate and fuse them to the exogenous gene and thereby allow the correct processing of the viral polyprotein precursor. Results YF 17D EGFP recombinant virus was grew in Vero cells and reached a peak titer of approximately 6.45 ± 0.4 log10 PFU/mL at 96 hours post-infection. Immunoprecipitation and confocal laser scanning microscopy demonstrated the expression of the EGFP, which was retained in the endoplasmic reticulum and not secreted from infected cells. The association with the ER compartment did not interfere with YF assembly, since the recombinant virus was fully competent to replicate and exit the cell. This virus was genetically stable up to the tenth serial passage in Vero cells. The recombinant virus was capable to elicit a neutralizing antibody response to YF and antibodies to EGFP as evidenced by an ELISA test. The applicability of this cloning strategy to clone gene foreign sequences in other flavivirus genomes was demonstrated by the construction of a chimeric recombinant YF 17D/DEN4 virus. Conclusion This system is likely to be useful for a broader live attenuated YF 17D virus-based vaccine development for human diseases. Moreover, insertion of foreign genes into the flavivirus genome may also allow in vivo studies on flavivirus cell and tissue tropism as well as cellular processes related to flavivirus infection. PMID:17971212

Voltage-dependent dynamic FRET signals from the transverse tubules in mammalian skeletal muscle fibers.

PubMed

DiFranco, Marino; Capote, Joana; Quiñonez, Marbella; Vergara, Julio L

2007-12-01

Two hybrid voltage-sensing systems based on fluorescence resonance energy transfer (FRET) were used to record membrane potential changes in the transverse tubular system (TTS) and surface membranes of adult mice skeletal muscle fibers. Farnesylated EGFP or ECFP (EGFP-F and ECFP-F) were used as immobile FRET donors, and either non-fluorescent (dipicrylamine [DPA]) or fluorescent (oxonol dye DiBAC(4)(5)) lipophilic anions were used as mobile energy acceptors. Flexor digitorum brevis (FDB) muscles were transfected by in vivo electroporation with pEGFP-F and pECFP-F. Farnesylated fluorescent proteins were efficiently expressed in the TTS and surface membranes. Voltage-dependent optical signals resulting from resonance energy transfer from fluorescent proteins to DPA were named QRET transients, to distinguish them from FRET transients recorded using DiBAC(4)(5). The peak DeltaF/F of QRET transients elicited by action potential stimulation is twice larger in fibers expressing ECFP-F as those with EGFP-F (7.1% vs. 3.6%). These data provide a unique experimental demonstration of the importance of the spectral overlap in FRET. The voltage sensitivity of QRET and FRET signals was demonstrated to correspond to the voltage-dependent translocation of the charged acceptors, which manifest as nonlinear components in current records. For DPA, both electrical and QRET data were predicted by radial cable model simulations in which the maximal time constant of charge translocation was 0.6 ms. FRET signals recorded in response to action potentials in fibers stained with DiBAC(4)(5) exhibit DeltaF/F amplitudes as large as 28%, but their rising phase was slower than those of QRET signals. Model simulations require a time constant for charge translocation of 1.6 ms in order to predict current and FRET data. Our results provide the basis for the potential use of lipophilic ions as tools to test for fast voltage-dependent conformational changes of membrane proteins in the TTS.

Differentiation and characteristics of the enhanced green fluorescent protein gene transgenic goat neural stem cells cultured in attached and non-attached plates.

PubMed

Zheng, Yue-Mao; Dang, Yong-Hui; Qiu, Shuang; Qi, Ying-Pei; Xu, Yong-Ping; Sai, Wu-Jia-Fu

2011-08-01

The aims of this study were (i) to determine whether NSCs (neural stem cells) could be isolated from the brain of embryonic day 98 fetal goat, (ii) to determine if these stem cells have the capability of multipotent differentiation following transfection with a reporter gene, EGFP (enhanced green fluorescent protein) and (iii) to study the characteristics of the stem cells cultured in attached and non-attached plates. NSCs were isolated from embryonic day 98 fetal goat brain, transfected with EGFP gene using lipofection, and subcultured in attached and non-attached plates respectively. The transgenic stem cells were induced to differentiate into osteogenic and endothelial cells in vitro respectively. Markers associated with undifferentiated NSCs and their differentiated cells were tested by RT-PCR (reverse transcription-PCR). The results demonstrated that stem cells could be isolated from embryonic day 98 fetal goat brain, and EGFP gene could be transfected into the cells. The transgenic NSCs were capable of self-renewal, a defining property of stem cells, and were grown as free-floating neurospheres in non-attached plates. When the neurospheres were transferred and cultured in attached plates, cells migrate from the neurospheres and are grown as spindle cells. The stem cells were grown as quasi-circular cells when the single stem cells were cultured in attached plates. Both the NSCs cultured in non-attached and attached plates could express Hes1 (hairy and enhancer of split 1), Oct4 (octamer-binding protein 4), Nanog, Sox2 [SRY (sex-determining region Y)-box 2] and Nestin, while following differentiation cells expressed markers for osteogenic cells (Osteocalcin+ and Osteonectin+) and endothelium (CD34+ and eNOS+). The results demonstrated that the goat EGFP gene transgenic NSCs have the capability of multipotent differentiation, which means that the transgenic NSCs may be useful in cell transplantation studies in future.

Lentivirus-ABCG1 instillation reduces lipid accumulation and improves lung compliance in GM-CSF knock-out mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Malur, Anagha; Huizar, Isham; Wells, Greg

2011-11-18

Highlights: Black-Right-Pointing-Pointer Lentivirus-ABCG1 reduces lipid accumulation in lungs of GM-CSF knock-out mice. Black-Right-Pointing-Pointer Up-regulation of ABCG1 improves lung function. Black-Right-Pointing-Pointer Upregulation of ABCG1 improves surfactant metabolism. -- Abstract: We have shown decreased expression of the nuclear transcription factor, peroxisome proliferator-activated receptor-gamma (PPAR{gamma}) and the PPAR{gamma}-regulated ATP-binding cassette transporter G1 (ABCG1) in alveolar macrophages from patients with pulmonary alveolar proteinosis (PAP). PAP patients also exhibit neutralizing antibodies to granulocyte-macrophage colony stimulating factor (GM-CSF), an upregulator of PPAR{gamma}. In association with functional GM-CSF deficiency, PAP lung is characterized by surfactant-filled alveolar spaces and lipid-filled alveolar macrophages. Similar pathology characterizes GM-CSF knock-out (KO)more » mice. We reported previously that intratracheal instillation of a lentivirus (lenti)-PPAR{gamma} plasmid into GM-CSF KO animals elevated ABCG1 and reduced alveolar macrophage lipid accumulation. Here, we hypothesized that instillation of lenti-ABCG1 might be sufficient to decrease lipid accumulation and improve pulmonary function in GM-CSF KO mice. Animals received intratracheal instillation of lenti-ABCG1 or control lenti-enhanced Green Fluorescent Protein (eGFP) plasmids and alveolar macrophages were harvested 10 days later. Alveolar macrophage transduction efficiency was 79% as shown by lenti-eGFP fluorescence. Quantitative PCR analyses indicated a threefold (p = 0.0005) increase in ABCG1 expression with no change of PPAR{gamma} or ABCA1 in alveolar macrophages of lenti-ABCG1 treated mice. ABCG1 was unchanged in control lenti-eGFP and PBS-instilled groups. Oil Red O staining detected reduced intracellular neutral lipid in alveolar macrophages from lenti-ABCG1 treated mice. Extracellular cholesterol and phospholipids were also decreased as shown by analysis of bronchoalveolar lavage fluid. Lung compliance was diminished in untreated GMCSF KO mice but improved significantly after lenti-ABCG1 treatment. Data demonstrate that in vivo instillation of lenti-ABCG1 in GM-CSF KO mice is sufficient to restore pulmonary homeostasis by: (1) upregulating ABCG1; (2) reducing intra and extracellular lipids; and (3) improving lung function. Results suggest that the ABCG1 lipid transporter is the key downstream target of GM-CSF-induced PPAR{gamma} necessary for surfactant catabolism.« less

Plasmid-Mediated Bioaugmentation for the Bioremediation of Contaminated Soils

PubMed Central

Garbisu, Carlos; Garaiyurrebaso, Olatz; Epelde, Lur; Grohmann, Elisabeth; Alkorta, Itziar

2017-01-01

Bioaugmentation, or the inoculation of microorganisms (e.g., bacteria harboring the required catabolic genes) into soil to enhance the rate of contaminant degradation, has great potential for the bioremediation of soils contaminated with organic compounds. Regrettably, cell bioaugmentation frequently turns into an unsuccessful initiative, owing to the rapid decrease of bacterial viability and abundance after inoculation, as well as the limited dispersal of the inoculated bacteria in the soil matrix. Genes that encode the degradation of organic compounds are often located on plasmids and, consequently, they can be spread by horizontal gene transfer into well-established, ecologically competitive, indigenous bacterial populations. Plasmid-mediated bioaugmentation aims to stimulate the spread of contaminant degradation genes among indigenous soil bacteria by the introduction of plasmids, located in donor cells, harboring such genes. But the acquisition of plasmids by recipient cells can affect the host’s fitness, a crucial aspect for the success of plasmid-mediated bioaugmentation. Besides, environmental factors (e.g., soil moisture, temperature, organic matter content) can play important roles for the transfer efficiency of catabolic plasmids, the expression of horizontally acquired genes and, finally, the contaminant degradation activity. For plasmid-mediated bioaugmentation to be reproducible, much more research is needed for a better selection of donor bacterial strains and accompanying plasmids, together with an in-depth understanding of indigenous soil bacterial populations and the environmental conditions that affect plasmid acquisition and the expression and functioning of the catabolic genes of interest. PMID:29062312

Functional analysis of a weak viral RNA silencing suppressor using two GFP variants as silencing inducers.

PubMed

Mann, Krin S; Dietzgen, Ralf G

2017-01-01

RNA silencing in plants can be triggered by the introduction of an exogenous gene. Green fluorescent protein (GFP) has been widely used as a visual reporter to study RNA silencing and viral-mediated suppression of RNA silencing in the model plant Nicotiana benthamiana. In transgenic N. benthamiana plants expressing an endoplasmic reticulum targeted GFP variant (16c) known as mGFP5, RNA silencing can be induced by ectopic over-expression of mGFP5. However, other GFP variants can also be used to induce GFP silencing in these plants. We compared the efficiency to induce local and systemic silencing of two commonly used GFP variants: enhanced GFP (eGFP) and mGFP5. Using lettuce necrotic yellows virus (LNYV) P protein to suppress GFP silencing, we demonstrate that eGFP gene, which is 76% identical at the nucleotide level to the endogenously expressed mGFP5 in 16c plants, triggers silencing more slowly and concurrently prolongs detectable silencing suppressor activity of the weak LNYV P suppressor, compared to the homologous mGFP5 gene. The use of eGFP as RNA silencing inducer in wild type or 16c plants appears to be a useful tool in identifying and analysing weak viral RNA silencing suppressor proteins whose activity might otherwise have been masked when challenged by a stronger RNA silencing response. We also show that reducing the dosage of strong dsRNA silencing inducers in conjunction with their homologous GFP targets facilitates the discovery and analysis of "weaker" RNA silencing suppressor activities. Copyright © 2016 Elsevier B.V. All rights reserved.

Profound prevention of experimental brain metastases of breast cancer by temozolomide in an MGMT-dependent manner

PubMed Central

Palmieri, Diane; Duchnowska, Renata; Woditschka, Stephan; Hua, Emily; Qian, Yongzhen; Biernat, Wojciech; Sosińska-Mielcarek, Katarzyna; Gril, Brunilde; Stark, Andreas; Hewitt, Stephen; Liewehr, David J; Steinberg, Seth M; Jassem, Jacek; Steeg, Patricia S

2014-01-01

Purpose Brain metastases of breast cancer cause neurocognitive damage and are incurable. We evaluated a role for temozolomide in the prevention of brain metastases of breast cancer in experimental brain metastasis models. Experimental Design Temozolomide was administered in mice following earlier injection of brain-tropic human epidermal growth factor receptor 2 (HER2)-positive Jimt1-BR3 and triple negative 231-BR-EGFP sublines, the latter with and without expression of 06-methylguanine-DNA methyltransferase (MGMT). Additionally, the percentage of MGMT-positive tumor cells in 62 patient-matched sets of breast cancer primary tumors and resected brain metastases was determined immunohistochemically. Results Temozolomide, when dosed at 50, 25, 10 or 5 mg/kg, 5 days/week, beginning 3 days after inoculation, completely prevented the formation of experimental brain metastases from MGMT-negative 231-BR-EGFP cells. At a 1 mg/kg dose, temozolomide prevented 68% of large brain metastases, and was ineffective at a dose of 0.5 mg/kg. When the 50 mg/kg dose was administered beginning on days 18 or 24, temozolomide efficacy was reduced or absent. Temozolomide was ineffective at preventing brain metastases in MGMT-transduced 231-BR-EGFP and MGMT-expressing Jimt-1-BR3 sublines. In 62 patient-matched sets of primary breast tumors and resected brain metastases, 43.5% of the specimens had concordant low MGMT expression, while in another 14.5% of sets high MGMT staining in the primary tumor corresponded with low staining in the brain metastasis. Conclusions Temozolomide profoundly prevented the outgrowth of experimental brain metastases of breast cancer in an MGMT-dependent manner. These data provide compelling rationale for investigating the preventive efficacy of temozolomide in a clinical setting. PMID:24634373

Profound prevention of experimental brain metastases of breast cancer by temozolomide in an MGMT-dependent manner.

PubMed

Palmieri, Diane; Duchnowska, Renata; Woditschka, Stephan; Hua, Emily; Qian, Yongzhen; Biernat, Wojciech; Sosińska-Mielcarek, Katarzyna; Gril, Brunilde; Stark, Andreas M; Hewitt, Stephen M; Liewehr, David J; Steinberg, Seth M; Jassem, Jacek; Steeg, Patricia S

2014-05-15

Brain metastases of breast cancer cause neurocognitive damage and are incurable. We evaluated a role for temozolomide in the prevention of brain metastases of breast cancer in experimental brain metastasis models. Temozolomide was administered in mice following earlier injection of brain-tropic HER2-positive JIMT-1-BR3 and triple-negative 231-BR-EGFP sublines, the latter with and without expression of O(6)-methylguanine-DNA methyltransferase (MGMT). In addition, the percentage of MGMT-positive tumor cells in 62 patient-matched sets of breast cancer primary tumors and resected brain metastases was determined immunohistochemically. Temozolomide, when dosed at 50, 25, 10, or 5 mg/kg, 5 days per week, beginning 3 days after inoculation, completely prevented the formation of experimental brain metastases from MGMT-negative 231-BR-EGFP cells. At a 1 mg/kg dose, temozolomide prevented 68% of large brain metastases, and was ineffective at a dose of 0.5 mg/kg. When the 50 mg/kg dose was administered beginning on days 18 or 24, temozolomide efficacy was reduced or absent. Temozolomide was ineffective at preventing brain metastases in MGMT-transduced 231-BR-EGFP and MGMT-expressing JIMT-1-BR3 sublines. In 62 patient-matched sets of primary breast tumors and resected brain metastases, 43.5% of the specimens had concordant low MGMT expression, whereas in another 14.5% of sets high MGMT staining in the primary tumor corresponded with low staining in the brain metastasis. Temozolomide profoundly prevented the outgrowth of experimental brain metastases of breast cancer in an MGMT-dependent manner. These data provide compelling rationale for investigating the preventive efficacy of temozolomide in a clinical setting. ©2014 American Association for Cancer Research.

Tir Is Essential for the Recruitment of Tks5 to Enteropathogenic Escherichia coli Pedestals.

PubMed

Jensen, Helene H; Pedersen, Hans N; Stenkjær, Eva; Pedersen, Gitte A; Login, Frédéric H; Nejsum, Lene N

2015-01-01

Enteropathogenic Escherichia coli (EPEC) is a bacterial pathogen that infects the epithelial lining of the small intestine and causes diarrhea. Upon attachment to the intestinal epithelium, EPEC uses a Type III Secretion System to inject its own high affinity receptor Translocated intimin receptor (Tir) into the host cell. Tir facilitates tight adhesion and recruitment of actin-regulating proteins leading to formation of an actin pedestal beneath the infecting bacterium. The pedestal has several similarities with podosomes, which are basolateral actin-rich extensions found in some migrating animal cells. Formation of podosomes is dependent upon the early podosome-specific scavenger protein Tks5, which is involved in actin recruitment. Although Tks5 is expressed in epithelial cells, and podosomes and EPEC pedestals share many components in their structure and mechanism of formation, the potential role of Tks5 in EPEC infections has not been studied. The aim of this study was to determine the subcellular localization of Tks5 in epithelial cells and to investigate if Tks5 is recruited to the EPEC pedestal. In an epithelial MDCK cell line stably expressing Tks5-EGFP, Tks5 localized to actin bundles. Upon infection, EPEC recruited Tks5-EGFP. Tir, but not Tir phosphorylation was essential for the recruitment. Time-lapse microscopy revealed that Tks5-EGFP was recruited instantly upon EPEC attachment to host cells, simultaneously with actin and N-WASp. EPEC infection of cells expressing a ΔPX-Tks5 deletion version of Tks5 showed that EPEC was able to both infect and form pedestals when the PX domain was deleted from Tks5. Future investigations will clarify the role of Tks5 in EPEC infection and pedestal formation.

Tir Is Essential for the Recruitment of Tks5 to Enteropathogenic Escherichia coli Pedestals

PubMed Central

Jensen, Helene H.; Pedersen, Hans N.; Stenkjær, Eva; Pedersen, Gitte A.; Login, Frédéric H.; Nejsum, Lene N.

2015-01-01

Enteropathogenic Escherichia coli (EPEC) is a bacterial pathogen that infects the epithelial lining of the small intestine and causes diarrhea. Upon attachment to the intestinal epithelium, EPEC uses a Type III Secretion System to inject its own high affinity receptor Translocated intimin receptor (Tir) into the host cell. Tir facilitates tight adhesion and recruitment of actin-regulating proteins leading to formation of an actin pedestal beneath the infecting bacterium. The pedestal has several similarities with podosomes, which are basolateral actin-rich extensions found in some migrating animal cells. Formation of podosomes is dependent upon the early podosome-specific scavenger protein Tks5, which is involved in actin recruitment. Although Tks5 is expressed in epithelial cells, and podosomes and EPEC pedestals share many components in their structure and mechanism of formation, the potential role of Tks5 in EPEC infections has not been studied. The aim of this study was to determine the subcellular localization of Tks5 in epithelial cells and to investigate if Tks5 is recruited to the EPEC pedestal. In an epithelial MDCK cell line stably expressing Tks5-EGFP, Tks5 localized to actin bundles. Upon infection, EPEC recruited Tks5-EGFP. Tir, but not Tir phosphorylation was essential for the recruitment. Time-lapse microscopy revealed that Tks5-EGFP was recruited instantly upon EPEC attachment to host cells, simultaneously with actin and N-WASp. EPEC infection of cells expressing a ΔPX-Tks5 deletion version of Tks5 showed that EPEC was able to both infect and form pedestals when the PX domain was deleted from Tks5. Future investigations will clarify the role of Tks5 in EPEC infection and pedestal formation. PMID:26536015

Deficit of heat shock transcription factor 1-heat shock 70 kDa protein 1A axis determines the cell death vulnerability in a model of spinocerebellar ataxia type 6.

PubMed

Li, Li; Saegusa, Hironao; Tanabe, Tsutomu

2009-11-01

Spinocerebellar ataxia type 6 (SCA6) is caused by a small expansion of polyglutamine (polyQ)-encoding CAG repeat in Ca(v)2.1 calcium channel gene. To gain insights into pathogenic mechanism of SCA6, we used HEK293 cells expressing fusion protein of enhanced green fluorescent protein and Ca(v)2.1 carboxyl terminal fragment (EGFP-Ca(v)2.1CT) [L24 and S13 cells containing 24 polyQ (disease range) and 13 polyQ (normal range), respectively] and examined their responses to some stressors. When exposed to CdCl(2), L24 cells showed lower viability than the control S13 cells and caspase-dependent apoptosis was enhanced more in L24 cells. Localization of EGFP-Ca(v)2.1CT was almost confined to the nucleus, where it existed as speckle-like structures. Interestingly, CdCl(2) treatment resulted in disruption of more promyelocytic leukemia nuclear bodies (PML-NBs) in L24 cells than in S13 cells and in cells where PML-NBs were disrupted, aggregates of EGFP-Ca(v)2.1CT became larger. Furthermore, a large number of aggregates were formed in L24 cells than in S13 cells. Results of RNAi experiments indicated that HSPA1A determined the difference against CdCl(2) toxicity. Furthermore, protein expression of heat shock transcription factor 1 (HSF1), which activates HSPA1A expression, was down-regulated in L24 cells. Therefore, HSF1-HSPA1A axis is critical for the vulnerability in L24 cells.

Dynamics in copy numbers of five plasmids of a dairy Lactococcus lactis in dairy-related conditions including near-zero growth rates.

PubMed

van Mastrigt, Oscar; Lommers, Marcel M A N; de Vries, Yorick C; Abee, Tjakko; Smid, Eddy J

2018-03-23

Lactic acid bacteria can carry multiple plasmids affecting their performance in dairy fermentations. The expression of plasmid-encoded genes and the activity of the corresponding proteins is severely affected by changes in the number of plasmid copies. We studied the impact of growth rate on dynamics of plasmid copy numbers at high growth rates in chemostat cultures and down to near-zero growth rates in retentostat cultures. Five plasmids of the dairy strain Lactococcus lactis FM03-V1 were selected which varied in size (3 to 39 kb), in replication mechanism (theta or rolling-circle) and in putative (dairy-associated) functions. Copy numbers ranged from 1.5 to 40.5 and the copy number of theta-type replicating plasmids were negatively correlated to the plasmid size. Despite the extremely wide range of growth rates (0.0003 h -1 to 0.6 h -1 ), copy numbers of the five plasmids were stable and only slightly increased at near-zero growth rates showing that the plasmid replication rate was strictly controlled. One low-copy number plasmid, carrying a large exopolysaccharide gene cluster, was segregationally unstable during retentostat cultivations reflected in complete loss of the plasmid in one of the retentostat cultures. The copy number of the five plasmids was also hardly affected by varying the pH value, nutrient limitation or presence of citrate (maximum 2.2-fold) signifying the stability in copy number of the plasmids. Importance Lactococcus lactis is extensively used in starter cultures for dairy fermentations. Important traits for growth and survival of L. lactis in dairy fermentations are encoded by genes located on plasmids, such as genes involved in lactose and citrate metabolism, protein degradation and oligopeptide uptake and bacteriophage resistance. Because the number of plasmid copies could affect the expression of plasmid-encoded genes, it is important to know the factors that influence the plasmid copy numbers. We monitored plasmid copy numbers of L. lactis at near-zero growth rates, characteristic for cheese ripening. Moreover, we analysed the effect of pH, nutrient limitation and presence of citrate. This showed that plasmid copy numbers were stable giving insight into plasmid copy number dynamics in dairy fermentations. Copyright © 2018 American Society for Microbiology.

Imaging Prostate Cancer with Positron Emission Tomography

DTIC Science & Technology

2014-07-01

critical role in tumor development. The purpose of this proposal is to utilize fibroblast activation protein alpha ( FAP ) expression on TAFs within...based cell lines, which stably express eGFP and FAP . Ongoing experiments are focused on the in vitro and in vivo evaluation of each radiopharmaceutical...and on understanding the growth characteristics of each transfected cell line in vivo. 15. SUBJECT TERMS PET, Prostate Cancer, FAP , molecular

Fast and efficient three-step target-specific curing of a virulence plasmid in Salmonella enterica.

PubMed

de Moraes, Marcos H; Teplitski, Max

2015-12-01

Virulence plasmids borne by serovars of Salmonella enterica carry genes involved in its pathogenicity, as well as other functions. Characterization of phenotypes associated with virulence plasmids requires a system for efficiently curing strains of their virulence plasmids. Here, we developed a 3-step protocol for targeted curing of virulence plasmids. The protocol involves insertion of an I-SecI restriction site linked to an antibiotic resistance gene into the target plasmid using λ-Red mutagenesis, followed by the transformation with a temperature-sensitive auxiliary plasmid which carries I-SecI nuclease expressed from a tetracycline-inducible promoter. Finally, the auxiliary plasmid is removed by incubation at 42 °C and the plasmid-less strains are verified on antibiotic-containing media. This method is fast and very efficient: over 90 % of recovered colonies lacked their virulence plasmid.

Enhanced synergistic anti-Lewis lung carcinoma effect of a DNA vaccine harboring a MUC1-VEGFR2 fusion gene used with GM-CSF as an adjuvant.

PubMed

Ruan, Junzhong; Duan, Yong; Li, Fugen; Wang, Zitong

2017-01-01

In order to achieve a synergistic effect on anti-tumour and anti-angiogenesis activity, we designed and constructed a DNA vaccine that expresses MUC1and VEGFR2 in the same reading frame. The aim of this study was to investigate the anti-tumour activity of this DNA vaccine. Furthermore, we also investigated the enhanced synergistic anti-Lewis lung carcinoma effect of this DNA vaccine by using GM-CSF as an adjuvant. A series of DNA plasmids encoding MUC1, VEGFR2, GM-CSF, and their conjugates were constructed and injected into mice intramuscularly (i.m.) followed by an electric pulse. The humoral and cellular immune responses after immunization were detected by enzyme-linked immunosorbent assay (ELISA) and enzyme-linked immunospot (ELISPOT), respectively. To evaluate the anti-tumour efficacy of these plasmids, murine models with MUC1-expressing tumours were generated. After injection into the tumour-bearing mouse model, the plasmid carrying the fusion gene of MUC1 and VEGFR2 showed stronger inhibition of tumour growth than the plasmid expressing MUC1 or VEGFR2 alone, which indicated that MUC1 and VEGFR2 could exert a synergistic anti-tumour effect. Furthermore, mice vaccinated with the combination of the GM-CSF expressing plasmid and the plasmid carrying the fusion gene of MUC1 and VEGFR2 showed an increased inhibition in the growth of MUC1-expressing tumours and prolonged mouse survival. These observations emphasize the potential of the synergistic anti-tumour and anti-angiogenesis strategy used in DNA vaccines, and the potential of the GM-CSF gene as an adjuvant for DNA vaccines, which could represent a promising approach for tumour immunotherapy. © 2016 John Wiley & Sons Australia, Ltd.

Synthetic Biology of Proteins: Tuning GFPs Folding and Stability with Fluoroproline

PubMed Central

Steiner, Thomas; Hess, Petra; Bae, Jae Hyun; Wiltschi, Birgit; Moroder, Luis; Budisa, Nediljko

2008-01-01

Background Proline residues affect protein folding and stability via cis/trans isomerization of peptide bonds and by the Cγ-exo or -endo puckering of their pyrrolidine rings. Peptide bond conformation as well as puckering propensity can be manipulated by proper choice of ring substituents, e.g. Cγ-fluorination. Synthetic chemistry has routinely exploited ring-substituted proline analogs in order to change, modulate or control folding and stability of peptides. Methodology/Principal Findings In order to transmit this synthetic strategy to complex proteins, the ten proline residues of enhanced green fluorescent protein (EGFP) were globally replaced by (4R)- and (4S)-fluoroprolines (FPro). By this approach, we expected to affect the cis/trans peptidyl-proline bond isomerization and pyrrolidine ring puckering, which are responsible for the slow folding of this protein. Expression of both protein variants occurred at levels comparable to the parent protein, but the (4R)-FPro-EGFP resulted in irreversibly unfolded inclusion bodies, whereas the (4S)-FPro-EGFP led to a soluble fluorescent protein. Upon thermal denaturation, refolding of this variant occurs at significantly higher rates than the parent EGFP. Comparative inspection of the X-ray structures of EGFP and (4S)-FPro-EGFP allowed to correlate the significantly improved refolding with the Cγ-endo puckering of the pyrrolidine rings, which is favored by 4S-fluorination, and to lesser extents with the cis/trans isomerization of the prolines. Conclusions/Significance We discovered that the folding rates and stability of GFP are affected to a lesser extent by cis/trans isomerization of the proline bonds than by the puckering of pyrrolidine rings. In the Cγ-endo conformation the fluorine atoms are positioned in the structural context of the GFP such that a network of favorable local interactions is established. From these results the combined use of synthetic amino acids along with detailed structural knowledge and existing protein engineering methods can be envisioned as a promising strategy for the design of complex tailor-made proteins and even cellular structures of superior properties compared to the native forms. PMID:18301757

A novel cell model to study the function of the adrenoleukodystrophy-related protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gueugnon, Fabien; Volodina, Natalia; Taouil, Jaoued Et

2006-03-03

X-linked adrenoleukodystrophy (X-ALD) is a neurodegenerative disorder due to mutations in the ABCD1 (ALD) gene. ALDRP, the closest homolog of ALDP, has been shown to have partial functional redundancy with ALDP and, when overexpressed, can compensate for the loss-of-function of ALDP. In order to characterize the function of ALDRP and to understand the phenomenon of gene redundancy, we have developed a novel system that allows the controlled expression of the ALDRP-EGFP fusion protein (normal or non-functional mutated ALDRP) using the Tet-On system in H4IIEC3 rat hepatoma cells. The generated stable cell lines express negligible levels of endogenous ALDRP and doxycyclinemore » dosage-dependent levels of normal or mutated ALDRP. Importantly, the ALDRP-EGFP protein is targeted correctly to peroxisome and is functional. The obtained cell lines will be an indispensable tool in our further studies aimed at the resolution of the function of ALDRP to characterize its potential substrates in a natural context.« less

Intracellular spectral recompositioning of light enhances algal photosynthetic efficiency

PubMed Central

Fu, Weiqi; Chaiboonchoe, Amphun; Khraiwesh, Basel; Sultana, Mehar; Jaiswal, Ashish; Jijakli, Kenan; Nelson, David R.; Al-Hrout, Ala’a; Baig, Badriya; Amin, Amr; Salehi-Ashtiani, Kourosh

2017-01-01

Diatoms, considered as one of the most diverse and largest groups of algae, can provide the means to reach a sustainable production of petrochemical substitutes and bioactive compounds. However, a prerequisite to achieving this goal is to increase the solar-to-biomass conversion efficiency of photosynthesis, which generally remains less than 5% for most photosynthetic organisms. We have developed and implemented a rapid and effective approach, herein referred to as intracellular spectral recompositioning (ISR) of light, which, through absorption of excess blue light and its intracellular emission in the green spectral band, can improve light utilization. We demonstrate that ISR can be used chemogenically, by using lipophilic fluorophores, or biogenically, through the expression of an enhanced green fluorescent protein (eGFP) in the model diatom Phaeodactylum tricornutum. Engineered P. tricornutum cells expressing eGFP achieved 28% higher efficiency in photosynthesis than the parental strain, along with an increased effective quantum yield and reduced nonphotochemical quenching (NPQ) induction levels under high-light conditions. Further, pond simulator experiments demonstrated that eGFP transformants could outperform their wild-type parental strain by 50% in biomass production rate under simulated outdoor sunlight conditions. Transcriptome analysis identified up-regulation of major photosynthesis genes in the engineered strain in comparison with the wild type, along with down-regulation of NPQ genes involved in light stress response. Our findings provide a proof of concept for a strategy of developing more efficient photosynthetic cell factories to produce algae-based biofuels and bioactive products. PMID:28879232

Ontogeny and localization of the cells produce IL-2 in healthy animals.

PubMed

Yamamoto, Mutsumi; Seki, Yoichi; Iwai, Kazuyuki; Ko, Iei; Martin, Alicia; Tsuji, Noriko; Miyagawa, Shuji; Love, Robert B; Iwashima, Makio

2013-03-01

IL-2 is a growth factor for activated T cells and is required for maintenance of naturally arising regulatory T cells (nTregs). Mice defective in IL-2/IL-2 receptor signaling pathways have impaired nTregs and suffer from lymphoproliferative disorders, suggesting that IL-2 is present and functional in healthy animals. However, the cellular source of IL-2 is currently unknown. To determine which cells produce IL-2 in healthy animals, we established mice carrying cre gene knock in at the il-2 locus (termed IL-2(cre)). When IL-2(cre) mice were crossed with EGFP reporter mice, EGFP was exclusively expressed by a fraction of CD4 T cells present in both lymphoid and non-lymphoid tissues. Live imaging of IL-2(cre) mice that carry the luciferase reporter showed concentrated localization of luciferase(+) cells in Peyer's patches. These cells were not observed in new born mice but appeared within 3days after birth. Reduction of antigen receptor repertoire by transgene expression reduced their number, indicating that recognition of environmental antigens is necessary for generation of these IL-2 producers in healthy animals. A substantial fraction of EGFP(+) cells also produce IL-10 and IFN-γ, a characteristic profile of type 1 regulatory T cells (Tr1). The data suggest that a group of Tr1 cells have addition roles in immune homeostasis by producing IL-2 along with other cytokines and help maintaining Tregs. Copyright © 2012 Elsevier Ltd. All rights reserved.

BMP15 gene is activated during human amniotic fluid stem cell differentiation into oocyte-like cells.

PubMed

Cheng, Xiang; Chen, Shuai; Yu, Xiaoli; Zheng, Pengsheng; Wang, Huayan

2012-07-01

The generation of oocyte-like cells (OLCs) from stem cell differentiation in vitro provides an optimal approach for studying the mechanism of oocyte development and maturation. The aim of this study was to investigate the activation of bone morphogenetic protein 15 gene (BMP15) during the differentiation of human amniotic fluid stem cells (hAFSCs) into OLCs. After 15 days of differentiation, OLCs with a diameter of 50-60 μm and zona pellucida (ZP)-like morphology were observed. Reverse transcription-polymerase chain reaction (RT-PCR) analysis showed the BMP15 was activated from approximately day 10 of differentiating hAFSCs and thereafter. The reporter construct pBMP15-enhanced green fluorescent protein (EGFP) was transiently transfected into the differentiated hAFSCs and the EGFP expression driven by the BMP15 promoter was positive in the OLCs. Moreover, RT-PCR analysis showed that the oocyte-specific markers including ZP1, ZP2, ZP3, and c-kit were expressed in the differentiated hAFSCs, and the immunofluorescence assay confirmed that the ZP2 was detected in the OLCs. Quantitative RT-PCR revealed that ZP2 and ZP3 were significantly elevated in the differentiated hAFSCs. Further, in the OLCs derived from hAFSCs, the BMP15 promoter directing the EGFP reporter was colocalized with ZP2. Together, these results illustrated that the BMP15 could be used as an oogenesis marker to track hAFSCs differentiation into the OLCs.

Riboswitch-based sensor in low optical background

NASA Astrophysics Data System (ADS)

Harbaugh, Svetlana V.; Davidson, Molly E.; Chushak, Yaroslav G.; Kelley-Loughnane, Nancy; Stone, Morley O.

2008-08-01

Riboswitches are a type of natural genetic control element that use untranslated sequence in the RNA to recognize and bind to small molecules that regulate expression of that gene. Creation of synthetic riboswitches to novel ligands depends on the ability to screen for analyte binding sensitivity and specificity. In our work, we have coupled a synthetic riboswitch to an optical reporter assay based on fluorescence resonance energy transfer (FRET) between two genetically-coded fluorescent proteins. Specifically, a theophylline-sensitive riboswitch was placed upstream of the Tobacco Etch Virus (TEV) protease coding sequence, and a FRET-based construct, BFP-eGFP or eGFP-REACh, was linked by a peptide encoding the recognition sequence for TEV protease. Cells expressing the riboswitch showed a marked optical difference in fluorescence emission in the presence of theophylline. However, the BFP-eGFP FRET pair posses significant optical background that reduces the sensitivity of a FRET-based assay. To improve the optical assay, we designed a nonfluorescent yellow fluorescent protein (YFP) mutant called REACh (for Resonance Energy-Accepting Chromoprotein) as the FRET acceptor for eGFP. The advantage of using an eGFP-REACh pair is the elimination of acceptor fluorescence which leads to an improved detection of FRET via better signal-to-noise ratio. The EGFP-REACh fusion protein was constructed with the TEV protease cleavage site; thus upon TEV translation, cleavage occurs diminishing REACh quenching and increasing eGFP emission resulting in a 4.5-fold improvement in assay sensitivity.

Varicella-zoster virus induces the formation of dynamic nuclear capsid aggregates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lebrun, Marielle; Thelen, Nicolas; Thiry, Marc

2014-04-15

The first step of herpesviruses virion assembly occurs in the nucleus. However, the exact site where nucleocapsids are assembled, where the genome and the inner tegument are acquired, remains controversial. We created a recombinant VZV expressing ORF23 (homologous to HSV-1 VP26) fused to the eGFP and dually fluorescent viruses with a tegument protein additionally fused to a red tag (ORF9, ORF21 and ORF22 corresponding to HSV-1 UL49, UL37 and UL36). We identified nuclear dense structures containing the major capsid protein, the scaffold protein and maturing protease, as well as ORF21 and ORF22. Correlative microscopy demonstrated that the structures correspond tomore » capsid aggregates and time-lapse video imaging showed that they appear prior to the accumulation of cytoplasmic capsids, presumably undergoing the secondary egress, and are highly dynamic. Our observations suggest that these structures might represent a nuclear area important for capsid assembly and/or maturation before the budding at the inner nuclear membrane. - Highlights: • We created a recombinant VZV expressing the small capsid protein fused to the eGFP. • We identified nuclear dense structures containing capsid and procapsid proteins. • Correlative microscopy showed that the structures correspond to capsid aggregates. • Procapsids and partial capsids are found within the aggregates of WT and eGFP-23 VZV. • FRAP and FLIP experiments demonstrated that they are dynamic structures.« less

Multimodality Imaging of Gene Transfer with a Receptor-Based Reporter Gene

PubMed Central

Chen, Ron; Parry, Jesse J.; Akers, Walter J.; Berezin, Mikhail Y.; El Naqa, Issam M.; Achilefu, Samuel; Edwards, W. Barry; Rogers, Buck E.

2010-01-01

Gene therapy trials have traditionally used tumor and tissue biopsies for assessing the efficacy of gene transfer. Non-invasive imaging techniques offer a distinct advantage over tissue biopsies in that the magnitude and duration of gene transfer can be monitored repeatedly. Human somatostatin receptor subtype 2 (SSTR2) has been used for the nuclear imaging of gene transfer. To extend this concept, we have developed a somatostatin receptor–enhanced green fluorescent protein fusion construct (SSTR2-EGFP) for nuclear and fluorescent multimodality imaging. Methods An adenovirus containing SSTR2-EGFP (AdSSTR2-EGFP) was constructed and evaluated in vitro and in vivo. SCC-9 human squamous cell carcinoma cells were infected with AdEGFP, AdSSTR2, or AdSSTR2-EGFP for in vitro evaluation by saturation binding, internalization, and fluorescence spectroscopy assays. In vivo biodistribution and nano-SPECT imaging studies were conducted with mice bearing SCC-9 tumor xenografts directly injected with AdSSTR2-EGFP or AdSSTR2 to determine the tumor localization of 111In-diethylenetriaminepentaacetic acid (DTPA)-Tyr3-octreotate. Fluorescence imaging was conducted in vivo with mice receiving intratumoral injections of AdSSTR2, AdSSTR2-EGFP, or AdEGFP as well as ex vivo with tissues extracted from mice. Results The similarity between AdSSTR2-EGFP and wild-type AdSSTR2 was demonstrated in vitro by the saturation binding and internalization assays, and the fluorescence emission spectra of cells infected with AdSSTR2-EGFP was almost identical to the spectra of cells infected with wild-type AdEGFP. Biodistribution studies demonstrated that the tumor uptake of 111In-DTPA-Tyr3-octreotate was not significantly different (P > 0.05) when tumors (n = 5) were injected with AdSSTR2 or AdSSTR2-EGFP but was significantly greater than the uptake in control tumors. Fluorescence was observed in tumors injected with AdSSTR2-EGFP and AdEGFP in vivo and ex vivo but not in tumors injected with AdSSTR2. Although fluorescence was observed, there were discrepancies between in vivo imaging and ex vivo imaging as well as between nuclear imaging and fluorescent imaging. Conclusion These studies showed that the SSTR2-EGFP fusion construct can be used for in vivo nuclear and optical imaging of gene transfer. PMID:20720053

Engineered Saccharomyces cerevisiae strain for improved xylose utilization with a three-plasmid SUMO yeast expression system

USDA-ARS?s Scientific Manuscript database

A three-plasmid yeast expression system utilizing the portable small ubiquitin-like modifier (SUMO) vector set combined with the efficient endogenous yeast protease Ulp1 was developed for production of large amounts of soluble functional protein in Saccharomyces cerevisiae. Each vector has a differ...

Genetic engineering of Lactobacillus diolivorans.

PubMed

Pflügl, Stefan; Marx, Hans; Mattanovich, Diethard; Sauer, Michael

2013-07-01

In this study, we developed a toolbox for genetic manipulation of Lactobacillus diolivorans, a promising production organism for 1,3-propanediol from glycerol. Two major findings play a key role for successful transformation of this organism: (1) the absence of a native plasmid, because a native plasmid is a major obstacle for transformation of L. diolivorans, and (2) the absence of DNA methylation. A suitable expression plasmid, pSHM, for homologous and heterologous protein expression in L. diolivorans was constructed. This plasmid is based on the replication origin repA of L. diolivorans. The native glyceraldehyde-3-phosphate dehydrogenase promoter is used for constitutive expression of the genes of interest. Functional expression of genes in L. diolivorans was shown with two examples: production of green fluorescent protein resulted in a 40- to 60-fold higher fluorescence of the obtained clones compared with the wild-type strain. Finally, the homologous overexpression of a putatively NADPH-dependent 1,3-propanediol oxidoreductase improved 1,3-propanediol production by 20% in batch cultures. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Construction of armored RNA containing long-size chimeric RNA by increasing the number and affinity of the pac site in exogenous rna and sequence coding coat protein of the MS2 bacteriophage.

PubMed

Wei, Baojun; Wei, Yuxiang; Zhang, Kuo; Yang, Changmei; Wang, Jing; Xu, Ruihuan; Zhan, Sien; Lin, Guigao; Wang, Wei; Liu, Min; Wang, Lunan; Zhang, Rui; Li, Jinming

2008-01-01

To construct a one-plasmid expression system of the armored RNA containing long chimeric RNA by increasing the number and affinity of the pac site. The plasmid pET-MS2-pac was constructed with one C-variant pac site, and then the plasmid pM-CR-2C containing 1,891-bp chimeric sequences and two C-variant pac sites was produced. Meanwhile, three plasmids (pM-CR-C, pM-CR-2W and pM-CR-W) were obtained as parallel controls with a different number and affinity of the pac site. Finally, the armored RNA was expressed and purified. The armored RNA with 1,891 bases target RNA was expressed successfully by the one-plasmid expression system with two C-variant pac sites, while for one pac site, no matter whether the affinity was changed or not, only the 1,200 bases target RNA was packaged. It was also found that the C-variant pac site could increase the expression efficiency of the armored RNA. The armored RNA with 1,891-bp exogenous RNA in our study showed the characterization of ribonuclease resistance and stability at different time points and temperature conditions. The armored RNA with 1,891 bases exogenous RNA was constructed and the expression system can be used as a platform for preparation of the armored RNA containing long RNA sequences. Copyright 2008 S. Karger AG, Basel.

Effects of Gene Orientation and Use of Multiple Promoters on the Expression of XYL1 and XYL2 in Saccharomyces cerevisiae

NASA Astrophysics Data System (ADS)

Bae, Ju Yun; Laplaza, José; Jeffries, Thomas W.

Orientation of adjacent genes has been reported to affect their expression in eukaryotic systems, and metabolic engineering also often makes repeated use of a few promoters to obtain high expression. To improve transcriptional control in heterologous expression, we examined how these factors affect gene expression and enzymatic activity in Saccharomyces cerevisiae. We assembled d-xylose reductase (XYL1) and d-xylitol dehydrogenase (XYL2) in four ways. Each pair of genes was placed in two different tandem (l→2→ or √1√2), convergent (1→√2), and divergent (√1 2→) orientations in autonomous plasmids. The TEF1 promoter was used to drive XYL1 and the TDH3 promoter to drive XYL2 in each of the constructs. The effects of gene orientation on growth, transcription, and enzyme activity were analyzed. The transcription level as measured by quantitative PCR (q-PCR) correlated with enzyme activities, but our data did not show a significant effect of gene orientation. To test the possible dilution of promoter strength due to multiple use of the same promoter, we examined the level of expression of XYL1 driven by either the TEF1 or TDH3 promoter when carried on a single copy plasmid. We then coexpressed XYL2 from either a single or multicopy plasmid, which was also driven by the same promoter. XYL2 transcript and enzyme expression increased with plasmid copy number, while the expression of XYLl was constant regardless of the number of other TEF1 or TDH3 promoters present in the cell. According to our data, there is no significant effect of gene orientation or multiple promoter use on gene transcription and translation when genes are expressed from plasmids; however, other factors could affect expression of adjacent genes in chromosomes.

Effects of the TAT peptide orientation and relative location on the protein transduction efficiency.

PubMed

Guo, Qingguo; Zhao, Guojie; Hao, Fengjin; Guan, Yifu

2012-05-01

To understand the protein transduction domain (PTD)-mediated protein transduction behavior and to explore its potential in delivering biopharmaceutic drugs, we prepared four TAT-EGFP conjugates: TAT(+)-EGFP, TAT(-)-EGFP, EGFP-TAT(+) and EGFP-TAT(-), where TAT(+) and TAT(-) represent the original and the reversed TAT sequence, respectively. These four TAT-EGFP conjugates were incubated with HeLa and PC12 cells for in vitro study as well as injected intraperitoneally to mice for in vivo study. Flow cytometric results showed that four TAT-EGFP conjugates were able to traverse HeLa and PC12 cells with almost equal transduction efficiency. The in vivo study showed that the TAT-EGFP conjugates could be delivered into different organs of mice with different transduction capabilities. Bioinformatic analyses and CD spectroscopic data revealed that the TAT peptide has no defined secondary structure, and conjugating the TAT peptide to the EGFP cargo protein would not alter the native structure and the function of the EGFP protein. These results conclude that the sequence orientation, the spatial structure, and the relative location of the TAT peptide have much less effect on the TAT-mediated protein transduction. Thus, the TAT-fused conjugates could be constructed in more convenient and flexible formats for a wide range of biopharmaceutical applications. © 2011 John Wiley & Sons A/S.

[Construction of a plant effective expression vector containing the gene of hepatitis B virus surface antigen].

PubMed

Lin, Bing-Ying; Jin, Zhi-Qiang; Li, Mei

2006-11-01

To construct a plant effective expression vector driven by a fruit specific promoter for the expression of hepatitis B virus surface antigen (HBsAg), to further improve the expression of exogenous gene in plant, and to prepare for the development of an effective anti-hepatitis vaccine. Tomato fruit-specific promoters' gene 2A12 and E8 were respectively introduced to pBPFOmega7 to form pB2A12 and pBE8. The DNA fragment containing HBsAg-s gene from plasmid YEP-HBs was inserted respectively into pB2A12 and pBE8 to form pB2A12-HBs and pBE8-HBs. The fragment containing "p35S+2A12+Omega+HBsAg-s+Tnos" of the pB2A12-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the reconstructed plant binary expression plasmid pCAM2A12-HBs, and the fragment containing "p35S+E8+Omega+HBsAg-s+Tnos" of the pBE8-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the plasmid pCAME8-HBs. The inserted gene HBsAg and fruit-specific promoters in the reconstructed plant binary expression vectors were confirmed by sequencing. Then, pCAM2A12-HBs and pCAME8-HBs were directly introduced into Agrobacterium tumefaciens strain EHA105. Digestion with restriction enzymes proved that all recombinant vectors had the inserts with expected length of the target fragments, and the sequencing results were confirmed correct. In this study, plant expression vector containing HBsAg gene driven by fruit specific promoter and CaMV35s promoter was successfully constructed.

Overexpression of Human Papillomavirus Type 16 Oncoproteins Enhances Epithelial-Mesenchymal Transition via STAT3 Signaling Pathway in Non-Small Cell Lung Cancer Cells.

PubMed

Zhang, Wenzhang; Wu, Xin; Hu, Liang; Ma, Yuefan; Xiu, Zihan; Huang, Bingyu; Feng, Yun; Tang, Xudong

2017-05-24

The human papillomavirus (HPV) infection may be associated with the development and progression of non-small cell lung cancer (NSCLC). However, the role of HPV-16 oncoproteins in the development and progression of NSCLC is not completely clear. Epithelial-mesenchymal transition (EMT), a crucial step for invasion and metastasis, plays a key role in the development and progression of NSCLC. Here we explored the effect of HPV-16 oncoproteins on EMT and the underlying mechanisms. NSCLC cell lines, A549 and NCI-H460, were transiently transfected with the EGFP-N1-HPV-16 E6 or E7 plasmid. Real-time PCR and Western blot analysis were performed to analyze the expression of EMT markers. A protein microarray was used to screen the involved signaling pathway. Our results showed that overexpression of HPV-16 E6 and E7 oncoproteins in NSCLC cells significantly promoted EMT-like morphologic changes, downregulated the mRNA and protein levels of EMT epithelial markers (E-cadherin and ZO-1), and upregulated the mRNA and protein levels of EMT mesenchymal markers (N-cadherin and vimentin) and transcription factors (ZEB-1 and Snail-1). Furthermore, the HPV-16 E6 oncoprotein promoted STAT3 activation. Moreover, WP1066, a specific signal transducer and activator of transcription 3 (STAT3) inhibitor, reversed the effect of HPV-16 E6 on the expression of ZO-1, vimentin, and ZEB-1 in transfected NSCLC cells. Taken together, our results suggest that overexpression of HPV-16 E6 and E7 oncoproteins enhances EMT, and the STAT3 signaling pathway may be involved in HPV-16 E6-induced EMT in NSCLC cells.

Cationic microparticle [poly(D,L-lactide-co-glycolide)]-coated DNA vaccination induces a long-term immune response against foot and mouth disease in guinea pigs.

PubMed

Reddy, Kotla S; Rashmi, Brabhi R; Dechamma, Hosur J; Gopalakrishna, Susarla; Banumathi, N; Suryanarayana, Veluvarthy V S; Reddy, Golla R

2012-05-01

Foot and mouth disease (FMD) can be controlled by regular vaccination and restriction of the movement of infected animals in the endemic countries. Although presently used, tissue culture inactivated vaccine gives protection, it has several limitations, including a short duration of immunity. DNA vaccine delivered through microparticles could comprise an alternative approach to conventional vaccine when aiming to circumvent these limitations. We constructed the expression plasmid (pVAC-1D) containing 1D gene FMD virus serotype Asia 1. Poly(D,L-lactide-co-glycolide) (PLG) microparticles were prepared and coated with the pVAC-1D plasmid. Guinea pigs were vaccinated with PLG-coated and naked DNA vaccine constructs intramuscularly. The humoral response was measured by an enzyme-linked immunosorbent assay (ELISA) and the serum neutralization test (SNT). Analysis of the persistence and the expression of pVAC-1D plasmid construct was carried out by quantitative polymerase chain reaction (qPCR). The humoral response lasted for 1 year, as measured by ELISA and SNT. Analysis of the persistence and the expression of pVAC-1D plasmid construct by qPCR has shown that pVAC-1D expression was seen for a longer duration compared to the naked DNA vaccine. Microparticles coated plasmid DNA-injected guinea pigs were protected when challenged with FMD virus. The present study has shown that the delivery of plasmid coated on cationic PLG microparticles enhance the duration of immunity of the DNA vaccine constructs. Copyright © 2012 John Wiley & Sons, Ltd.