Stimulation of nitric oxide synthesis by the aqueous extract of Panax ginseng root in RAW 264.7 cells

PubMed Central

Friedl, Roswitha; Moeslinger, Thomas; Kopp, Brigitte; Spieckermann, Paul Gerhard

2001-01-01

In this study, we investigated the effect of Panax ginseng root aqueous extracts upon inducible nitric oxide synthesis in RAW 264.7 cells. Panax ginseng root extract has been used in the Asian world for centuries as a traditional herb to enhance physical strength and resistance and is becoming more and more popular in Europe and North America. Incubation of murine macrophages (RAW 264.7 cells) with increasing amounts of aqueous extracts of Panax ginseng (0.05 – 0.8 μg μl−1) showed a dose dependent stimulation of inducible nitric oxide synthesis. Polysaccharides isolated from Panax ginseng showed strong stimulation of inducible nitric oxide synthesis, whereas a triterpene-enriched fraction from an aqueous extract of Panax ginseng did not show any stimulation. Inducible nitric oxide synthase protein expression was enhanced in a dose dependent manner as revealed by immunoblotting when cells were incubated with increasing amounts of Panax ginseng extract. This was associated with an incline in inducible nitric oxide synthase mRNA-levels as determined by semiquantitative polymerase chain reaction and electromobility shift assay studies indicated enhanced nuclear factor-κB DNA binding activity. As nitric oxide plays an important role in immune function, Panax ginseng treatment could modulate several aspects of host defense mechanisms due to stimulation of the inducible nitric oxide synthase. PMID:11739242

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parl, Angelika; Mitchell, Sabrina L.; Clay, Hayley B.

Highlights: •The function of the mitochondria fatty acid synthesis pathway is partially unknown. •Overexpression of the pathway causes transcriptional activation through PPARs. •Knock down of the pathway attenuates that activation. •The last enzyme in the pathway regulates its own transcription. •Products of the mtFASII pathway are able to drive nuclear transcription. -- Abstract: Mammalian cells contain two fatty acid synthesis pathways, the cytosolic FASI pathway, and the mitochondrial FASII pathway. The selection behind the conservation of the mitochondrial pathway is not completely understood, given the presence of the cytosolic FAS pathway. In this study, we show through heterologous gene reportermore » systems and PCR-based arrays that overexpression of MECR, the last step in the mtFASII pathway, causes modulation of gene expression through the PPAR pathway. Electromobility shift assays (EMSAs) demonstrate that overexpression of MECR causes increased binding of PPARs to DNA, while cell fractionation and imaging studies show that MECR remains localized to the mitochondria. Interestingly, knock down of the mtFASII pathway lessens the effect of MECR on this transcriptional modulation. Our data are most consistent with MECR-mediated transcriptional activation through products of the mtFASII pathway, although we cannot rule out MECR acting as a coactivator. Further investigation into the physiological relevance of this communication will be necessary to better understand some of the phenotypic consequences of deficits in this pathway observed in animal models and human disease.« less

Indoline-3-propionate and 3-aminopropyl carbamates reduce lung injury and pro-inflammatory cytokines induced in mice by LPS.

PubMed

Finkin-Groner, E; Moradov, D; Shifrin, H; Bejar, C; Nudelman, A; Weinstock, M

2015-02-01

In the search for safer and effective anti-inflammatory agents, we investigated the effect of methyl indoline-3-propionate and indoline-3-(3-aminopropyl) carbamates on LPS-induced lung injury and pro-inflammatory cytokines in mice. Their mechanism of action was determined in murine peritoneal macrophages. Lung injury was induced by intratracheal infusion of LPS and assessed by the change in lung weight and structure by light microscopy after staining by haematoxylin and eosin. In LPS-activated macrophages, MAPK proteins and IκBα were measured by Western blotting and the transcription factors, AP-1 and NF-κB by electromobility shift assay. Cytokines in the plasma and spleen of mice injected with LPS were measured by elisa-based assay. AN917 and AN680 (1-10 pM) decreased TNF-α protein in macrophages by inhibiting phosphorylation of p38 MAPK, IκBα degradation and activation of AP-1 and NF-κB without affecting cell viability. In vivo, these compounds (10 μmol · kg(-1)) markedly decreased lung injury induced by LPS and the elevation of TNF-α and IL-6 in lung, plasma and spleen. Activation of α-7nACh receptors contributed to the reduction of TNF-α by AN917, which inhibited AChE in the spleen by 35%. Indoline carbamates are potent inhibitors of pro-inflammatory mediators in murine macrophages and in mice injected with LPS, acting via the p38 MAPK, AP-1 and NF-κB cascades. Indirect α-7nACh receptor activation by AN917, through inhibition of AChE, contributes to its anti-inflammatory effect. Indoline carbamates may have therapeutic potential for lung injury and other diseases associated with chronic inflammation without causing immunosuppression. © 2014 The British Pharmacological Society.

Isolation and characterization of an RNA aptamer for the HPV-16 E7 oncoprotein.

PubMed

Toscano-Garibay, Julia D; Benítez-Hess, María L; Alvarez-Salas, Luis M

2011-02-01

Cervical cancer is a common neoplastic disease affecting women worldwide. Expression of human papillomavirus type 16 (HPV-16) E6/E7 genes is frequently associated with cervical cancer, representing ideal targets for diagnostic and therapeutic strategies. Aptamers are oligonucleotide ligands capable of binding with high affinity and specificity to relevant markers in therapeutics and disease detection. The aim of the study was to isolate an RNA aptamer specific for the HPV-16 E7 protein. Aptamers were selected from a randomized oligonucleotide library using a modified SELEX method and recombinant HPV-16 E7 protein. Isolated aptamers were cloned and sequenced for in silico analysis. Interaction and electromobility shift assays (EMSA) were performed to establish aptamer specificity and affinity for E7. RNase footprinting and serial deletions of the aptamer and the E7 protein were made to characterize the aptamer-protein complex. Sandwich slot-blot assays were used for K(D) determination. After several rounds of SELEX, an aptamer (G5α3N.4) exhibited specificity for E7 using cell-free and protein extracts. G5α3N.4 binding yielded a K(D) comparable to aptamers directed to other small targets. Enzymatic and genetic analysis of G5α3N.4 binding showed a secondary structure with two stem-loop domains joined by single-stranded region contacting E7 in a clamp-like manner. The G5α3N.4 aptamer also produced specific complexes in HPV-positive cervical carcinoma cells. The affinity and specificity of G5α3N.4 binding domains for the HPV-16 E7 protein may be used for the detection of papillomavirus infection and cervical cancer. Copyright © 2011 IMSS. Published by Elsevier Inc. All rights reserved.

Assembly Architecture and DNA Binding of the Bacteriophage P22 Terminase Small Subunit

PubMed Central

Němeček, Daniel; Lander, Gabriel C.; Johnson, John E.; Casjens, Sherwood R.; Thomas, George J.

2008-01-01

Summary Morphogenesis of bacteriophage P22 involves the packaging of double-stranded DNA into a preassembled procapsid. DNA is translocated by a powerful virally-encoded molecular motor called terminase, which comprises large (gp2, 499 residues) and small (gp3, 162 residues) subunits. While gp2 contains the phosphohydrolase and endonuclease activities of terminase, the function of gp3 may be to regulate specific and nonspecific modes of DNA recognition as well as the enzymatic activities of gp2. Electron microscopy shows that wildtype gp3 self-assembles into a stable and monodisperse nonameric ring. A three-dimensional reconstruction at 18 Å resolution provides the first glimpse of P22 terminase architecture and implies two distinct modes of interaction with DNA – involving a central channel of 20 Å diameter and radial spikes separated by 34 Å. Electromobility shift assays indicate that the gp3 ring binds dsDNA nonspecifically in vitro via electrostatic interactions between the positively charged C-terminus of gp3 (residues 143–152) and phosphates of the DNA backbone. Raman spectra show that nonameric rings formed by subunits truncated at residue 142 retain the subunit fold, despite the loss of DNA-binding activity. Difference density maps between gp3 rings containing full-length and C-terminally truncated subunits are consistent with localization of residues 143–152 along the central channel of the nonameric ring. The results suggest a plausible molecular mechanism for gp3 function in DNA recognition and translocation. PMID:18775728

Disruption of a Novel Krüppel-like Transcription Factor p300-regulated Pathway for Insulin Biosynthesis Revealed by Studies of the c.-331 INS Mutation Found in Neonatal Diabetes Mellitus*

PubMed Central

Bonnefond, Amélie; Lomberk, Gwen; Buttar, Navtej; Busiah, Kanetee; Vaillant, Emmanuel; Lobbens, Stéphane; Yengo, Loïc; Dechaume, Aurélie; Mignot, Brigitte; Simon, Albane; Scharfmann, Raphaël; Neve, Bernadette; Tanyolaç, Sinan; Hodoglugil, Ugur; Pattou, François; Cavé, Hélène; Iovanna, Juan; Stein, Roland; Polak, Michel; Vaxillaire, Martine; Froguel, Philippe; Urrutia, Raul

2011-01-01

Krüppel-like transcription factors (KLFs) have elicited significant attention because of their regulation of essential biochemical pathways and, more recently, because of their fundamental role in the mechanisms of human diseases. Neonatal diabetes mellitus is a monogenic disorder with primary alterations in insulin secretion. We here describe a key biochemical mechanism that underlies neonatal diabetes mellitus insulin biosynthesis impairment, namely a homozygous mutation within the insulin gene (INS) promoter, c.-331C>G, which affects a novel KLF-binding site. The combination of careful expression profiling, electromobility shift assays, reporter experiments, and chromatin immunoprecipitation demonstrates that, among 16 different KLF proteins tested, KLF11 is the most reliable activator of this site. Congruently, the c.-331C>G INS mutation fails to bind KLF11, thus inhibiting activation by this transcription factor. Klf11−/− mice recapitulate the disruption in insulin production and blood levels observed in patients. Thus, these data demonstrate an important role for KLF11 in the regulation of INS transcription via the novel c.-331 KLF site. Lastly, our screening data raised the possibility that other members of the KLF family may also regulate this promoter under distinct, yet unidentified, cellular contexts. Collectively, this study underscores a key role for KLF proteins in biochemical mechanisms of human diseases, in particular, early infancy onset diabetes mellitus. PMID:21592955

cAMP inhibits inducible nitric oxide synthase expression and NF-kappaB-binding activity in cultured rat hepatocytes.

PubMed

Harbrecht, B G; Taylor, B S; Xu, Z; Ramalakshmi, S; Ganster, R W; Geller, D A

2001-08-01

The inducible nitric oxide synthase (iNOS) is strongly expressed following inflammatory stimuli. Adenosine 3',5'-cyclic monophosphate (cAMP) increases iNOS expression and activity in a number of cell types but decreases cytokine-stimulated iNOS expression in hepatocytes. The mechanisms for this effect are unknown. Rat hepatocytes were stimulated with cytokines to induce iNOS and cultured with cAMP agonists dibutyryl-cAMP (dbcAMP), 8-bromo-cAMP, and forskolin (FSK). Nitric oxide synthesis was assessed by supernatant nitrite levels and iNOS expression was measured by Northern and Western blot analyses. Nuclear factor kappaB binding was assessed by electromobility shift assay. Cyclic AMP dose dependently decreased NO synthesis in response to a combination of proinflammatory cytokines or interleukin-1beta (IL-1beta) alone. The adenylate cyclase inhibitor SQ 22,536 increased cytokine- or IL-1beta-stimulated NO synthesis. dbcAMP decreased iNOS mRNA expression and iNOS protein expression. Both dbcAMP and glucagon decreased iNOS promoter activity in rat hepatocytes transfected with the murine iNOS promoter and decreased DNA binding of the transcription factor NF-kappaB. These data suggest that cAMP is important in hepatocyte iNOS expression and agents that alter cAMP levels may profoundly alter the response of hepatocytes to inflammatory stimuli through effects onthe iNOS promoter region and NF-kappaB. Copyright 2001 Academic Press.

Charging stations location model based on spatiotemporal electromobility use patterns

NASA Astrophysics Data System (ADS)

Pagany, Raphaela; Marquardt, Anna; Zink, Roland

2016-04-01

One of the major challenges for mainstream adoption of electric vehicles is the provision of infrastructure for charging the batteries of the vehicles. The charging stations must not only be located dense enough to allow users to complete their journeys, but the electric energy must also be provided from renewable sources in order to truly offer a transportation with less CO2 emissions. The examination of potential locations for the charging of electric vehicles can facilitate the adaption of electromobility and the integration of electronic vehicles in everyday life. A geographic information system (GIS) based model for optimal location of charging stations in a small and regional scale is presented. This considers parameters such as the forecast of electric vehicle use penetration, the relevant weight of diverse point of interests and the distance between parking area and destination for different vehicle users. In addition to the spatial scale the temporal modelling of the energy demand at the different charging locations has to be considerate. Depending on different user profiles (commuters, short haul drivers etc.) the frequency of charging vary during the day, the week and the year. In consequence, the spatiotemporal variability is a challenge for a reliable energy supply inside a decentralized renewable energy system. The presented model delivers on the one side the most adequate identified locations for charging stations and on the other side the interaction between energy supply and demand for electromobility under the consideration of temporal aspects. Using ESRI ArcGIS Desktop, first results for the case study region of Lower Bavaria are generated. The aim of the concept is to keep the model transferable to other regions and also open to integrate further and more detailed user profiles, derived from social studies about i.e. the daily behavior and the perception of electromobility in a next step.

Anti-Inflammatory Effect of Titrated Extract of Centella asiatica in Phthalic Anhydride-Induced Allergic Dermatitis Animal Model

PubMed Central

Park, Ju Ho; Choi, Ji Yeon; Son, Dong Ju; Park, Eun Kyung; Song, Min Jong; Hellström, Mats; Hong, Jin Tae

2017-01-01

Centella asiatica has potent antioxidant and anti-inflammatory properties. However, its anti-dermatitic effect has not yet been reported. In this study, we investigated the anti-dermatitic effects of titrated extract of Centella asiatica (TECA) in a phthalic anhydride (PA)-induced atopic dermatitis (AD) animal model as well as in vitro model. An AD-like lesion was induced by the topical application of five percent PA to the dorsal skin or ear of Hos:HR-1 mouse. After AD induction, 100 μL of 0.2% and 0.4% of TECA (40 μg or 80 μg/cm2) was spread on the dorsum of the ear or back skin three times a week for four weeks. We evaluated dermatitis severity, histopathological changes and changes in protein expression by Western blotting for inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), and NF-κB activity, which were determined by electromobility shift assay (EMSA). We also measured TNF-α, IL-1β, IL-6, and IgE concentration in the blood of AD mice by enzyme-linked immunosorbent assay (ELISA). TECA treatment attenuated the development of PA-induced atopic dermatitis. Histological analysis showed that TECA inhibited hyperkeratosis, mast cells and infiltration of inflammatory cells. TECA treatment inhibited expression of iNOS and COX-2, and NF-κB activity as well as the release of TNF-α, IL-1β, IL-6, and IgE. In addition, TECA (1, 2, 5 μg/mL) potently inhibited Lipopolysaccharide (LPS) (1 μg/mL)-induced NO production, expression of iNOS and COX-2, and NF-κB DNA binding activities in RAW264.7 macrophage cells. Our data demonstrated that TECA could be a promising agent for AD by inhibition of NF-κB signaling. PMID:28358324

Indoline-3-propionate and 3-aminopropyl carbamates reduce lung injury and pro-inflammatory cytokines induced in mice by LPS

PubMed Central

Finkin-Groner, E; Moradov, D; Shifrin, H; Bejar, C; Nudelman, A; Weinstock, M

2015-01-01

Background and Purpose In the search for safer and effective anti-inflammatory agents, we investigated the effect of methyl indoline-3-propionate and indoline-3-(3-aminopropyl) carbamates on LPS-induced lung injury and pro-inflammatory cytokines in mice. Their mechanism of action was determined in murine peritoneal macrophages. Experimental Approach Lung injury was induced by intratracheal infusion of LPS and assessed by the change in lung weight and structure by light microscopy after staining by haematoxylin and eosin. In LPS-activated macrophages, MAPK proteins and IκBα were measured by Western blotting and the transcription factors, AP-1 and NF-κB by electromobility shift assay. Cytokines in the plasma and spleen of mice injected with LPS were measured by elisa-based assay. Key Results AN917 and AN680 (1–10 pM) decreased TNF-α protein in macrophages by inhibiting phosphorylation of p38 MAPK, IκBα degradation and activation of AP-1 and NF-κB without affecting cell viability. In vivo, these compounds (10 μmol·kg−1) markedly decreased lung injury induced by LPS and the elevation of TNF-α and IL-6 in lung, plasma and spleen. Activation of α-7nACh receptors contributed to the reduction of TNF-α by AN917, which inhibited AChE in the spleen by 35%. Conclusion and Implications Indoline carbamates are potent inhibitors of pro-inflammatory mediators in murine macrophages and in mice injected with LPS, acting via the p38 MAPK, AP-1 and NF-κB cascades. Indirect α-7nACh receptor activation by AN917, through inhibition of AChE, contributes to its anti-inflammatory effect. Indoline carbamates may have therapeutic potential for lung injury and other diseases associated with chronic inflammation without causing immunosuppression. PMID:25322956

Monoacylglycerol O-acyltransferase 1 is regulated by peroxisome proliferator-activated receptor γ in human hepatocytes and increases lipid accumulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu, Jung Hwan; Brain Korea 21 PLUS Project for Medical Science, Yonsei University, Seoul 120-752; Lee, Yoo Jeong

2015-05-08

Monoacylglycerol O-acyltransferase (MGAT) is an enzyme that is involved in triglyceride synthesis by catalyzing the formation of diacylglycerol from monoacylglycerol and fatty acyl CoAs. Recently, we reported that MGAT1 has a critical role in hepatic TG accumulation and that its suppression ameliorates hepatic steatosis in a mouse model. However, the function of MGAT enzymes in hepatic lipid accumulation has not been investigated in humans. Unlike in rodents, MGAT3 as well as MGAT1 and MGAT2 are present in humans. In this study, we evaluated the differences between MGAT subtypes and their association with peroxisome proliferator-activated receptor γ (PPARγ), a regulator ofmore » mouse MGAT1 expression. In human primary hepatocytes, basal expression of MGAT1 was lower than that of MGAT2 or MGAT3, but was strongly induced by PPARγ overexpression. A luciferase assay as well as an electromobility shift assay revealed that human MGAT1 promoter activity is driven by PPARγ by direct binding to at least two regions of the promoter in 293T and HepG2 cells. Moreover, siRNA-mediated suppression of MGAT1 expression significantly attenuated lipid accumulation by PPARγ overexpression in HepG2 cells, as evidenced by oil-red-O staining. These results suggest that human MGAT1 has an important role in fatty liver formation as a target gene of PPARγ, and blocking MGAT1 activity could be an efficient therapeutic way to reduce nonalcoholic fatty liver diseases in humans. - Highlights: • PPARγ promotes MGAT1 expression in human primary hepatocytes. • PPARγ directly regulates MGAT1 promoter activity. • Human MGAT1 promoter has at least two PPARγ-binding elements. • Inhibition of MGAT1 expression attenuates hepatic lipid accumulation in humans.« less

Growth hormone action in hypothyroid infant rats.

PubMed

Humbert, J T; Bergad, P L; Masha, O; Stolz, A M; Kaul, S; Berry, S A

2000-02-01

In neonatal rats, expression of serine protease inhibitors 2.1 and 2.3 mRNA peaks on d 2 of life and declines shortly thereafter, coinciding with levels of circulating GH. To evaluate the role of GH in this increase and to test the hypothesis that GH is active in perinatal life, we studied GH action in a model of GH deficiency. Maternal/neonatal hypothyroidism with consequent GH deficiency was induced by methimazole administration to pregnant dams. The resultant hypothyroid neonates were treated at d 2 or 7 of age with GH or saline for 1 h before exsanguination. In d-7 neonates, but not at d 2, GH administration resulted in significant serine protease inhibitors 2.1 and 2.3 mRNA induction. This treatment did not result in increased production of either GH receptor or IGF-I mRNA at either age. There was a slight GH-independent increase in GH receptor and IGF-I mRNA expression by d 7. Electromobility shift assays using hepatic nuclear extracts from these neonates and the GH response element from the serine protease inhibitor 2.1 promoter showed signal transducer and activator of transcription 5 (Stat5) binding in response to GH in extracts from d-7 rats only. Immunoblots of these extracts showed twice as much Stat5 in the nuclei of d-7 treated neonates compared with d-2 treated neonates. We conclude that there is apparent insensitivity to GH treatment in d-2 neonates that remits by d 7 and that this remission correlates with increased abundance of GH receptor and Stat5.

The SARS coronavirus papain like protease can inhibit IRF3 at a post activation step that requires deubiquitination activity.

PubMed

Matthews, Krystal; Schäfer, Alexandra; Pham, Alissa; Frieman, Matthew

2014-12-07

The outcome of a viral infection is regulated by complex interactions of viral and host factors. SARS coronavirus (SARS-CoV) engages and regulates several innate immune response pathways during infection. We have previously shown that the SARS-CoV Papain-like Protease (PLpro) inhibits type I interferon (IFN) by inhibiting IRF3 phosphorylation thereby blocking downstream Interferon induction. This finding prompted us to identify other potential mechanisms of inhibition of PLpro on IFN induction. We have used plasmids expressing PLpro and IRF3 including an IRF3 mutant that is constitutively active, called IRF3(5D). In these experiments we utilize transfections, chromatin immunoprecipitation, Electro-mobility Shift Assays (EMSA) and protein localization to identify where IRF3 and IRF3(5D) are inhibited by PLpro. Here we show that PLpro also inhibits IRF3 activation at a step after phosphorylation and that this inhibition is dependent on the de-ubiquitination (DUB) activity of PLpro. We found that PLpro is able to block the type I IFN induction of a constitutively active IRF3, but does not inhibit IRF3 dimerization, nuclear localization or DNA binding. However, inhibition of PLpro's DUB activity by mutagenesis blocked the IRF3 inhibition activity of PLpro, suggesting a role for IRF3 ubiquitination in induction of a type I IFN innate immune response. These results demonstrate an additional mechanism that PLpro is able to inhibit IRF3 signaling. These data suggest novel innate immune antagonism activities of PLpro that may contribute to SARS-CoV pathogenesis.

Repression of myoblast proliferation and fibroblast growth factor receptor 1 promoter activity by KLF10 protein.

PubMed

Parakati, Rajini; DiMario, Joseph X

2013-05-10

FGFR1 gene expression regulates myoblast proliferation and differentiation, and its expression is controlled by Krüppel-like transcription factors. KLF10 interacts with the FGFR1 promoter, repressing its activity and cell proliferation. KLF10 represses FGFR1 promoter activity and thereby myoblast proliferation. A model of transcriptional control of chicken FGFR1 gene regulation during myogenesis is presented. Skeletal muscle development is controlled by regulation of myoblast proliferation and differentiation into muscle fibers. Growth factors such as fibroblast growth factors (FGFs) and their receptors (FGFRs) regulate cell proliferation and differentiation in numerous tissues, including skeletal muscle. Transcriptional regulation of FGFR1 gene expression is developmentally regulated by the Sp1 transcription factor, a member of the Krüppel-like factor (KLF) family of transcriptional regulators. Here, we show that another KLF transcription factor, KLF10, also regulates myoblast proliferation and FGFR1 promoter activity. Expression of KLF10 reduced myoblast proliferation by 86%. KLF10 expression also significantly reduced FGFR1 promoter activity in myoblasts and Sp1-mediated FGFR1 promoter activity in Drosophila SL2 cells. Southwestern blot, electromobility shift, and chromatin immunoprecipitation assays demonstrated that KLF10 bound to the proximal Sp factor binding site of the FGFR1 promoter and reduced Sp1 complex formation with the FGFR1 promoter at that site. These results indicate that KLF10 is an effective repressor of myoblast proliferation and represses FGFR1 promoter activity in these cells via an Sp1 binding site.

Tacr1 gene variation and neurokinin 1 receptor expression is associated with antagonist efficacy in genetically selected alcohol-preferring rats.

PubMed

Schank, Jesse R; Tapocik, Jenica D; Barbier, Estelle; Damadzic, Ruslan; Eskay, Robert L; Sun, Hui; Rowe, Kelly E; King, Courtney E; Yao, Mengdi; Flanigan, Meghan E; Solomon, Matthew G; Karlsson, Camilla; Cheng, Kejun; Rice, Kenner C; Heilig, Markus

2013-04-15

Genetic deletion or antagonism of the neurokinin 1 receptor (NK1R) decreases alcohol intake, alcohol reward, and stress-induced alcohol relapse in rodents, while TACR1 variation is associated with alcoholism in humans. We used L822429, a specific antagonist with high affinity for the rat NK1R, and examined whether sensitivity to NK1R blockade is altered in alcohol-preferring (P) rats. Operant alcohol self-administration and progressive ratio responding were analyzed in P-rats and their founder Wistar line. We also analyzed Tacr1 expression and binding and sequenced the Tacr1 promoter from both lines. Systemic L822429 decreased alcohol self-administration in P-rats but did not affect the lower rates of alcohol self-administration in Wistar rats. Tacr1 expression was elevated in the prefrontal cortex and the amygdala of P-rats. In central amygdala, elevated Tacr1 expression was accompanied by elevated NK1R binding. Central amygdala (but not prefrontal cortex) infusion of L822429 replicated the systemic antagonist effects on alcohol self-administration in P-rats. All P-rats, but only 18% of their founder Wistar population, were CC homozygous for a-1372G/C single nucleotide polymorphism. In silico analysis indicated that the Tacr1-1372 genotype could modulate binding of the transcription factors GATA-2 and E2F-1. Electromobility shift and luciferase reporter assays suggested that the-1372C allele confers increased transcription factor binding and transcription. Genetic variation at the Tacr1 locus may contribute to elevated rates of alcohol self-administration, while at the same time increasing sensitivity to NK1R antagonist treatment. Published by Elsevier Inc.

Identifying the Deleterious Effect of Rare LHX4 Allelic Variants, a Challenging Issue

PubMed Central

Rochette, Claire; Jullien, Nicolas; Saveanu, Alexandru; Caldagues, Emmanuelle; Bergada, Ignacio; Braslavsky, Debora; Pfeifer, Marija; Reynaud, Rachel; Herman, Jean-Paul; Barlier, Anne; Brue, Thierry; Enjalbert, Alain; Castinetti, Frederic

2015-01-01

LHX4 is a LIM homeodomain transcription factor involved in the early steps of pituitary ontogenesis. To date, 8 heterozygous LHX4 mutations have been reported as responsible of combined pituitary hormone deficiency (CPHD) in Humans. We identified 4 new LHX4 heterozygous allelic variants in patients with congenital hypopituitarism: W204X, delK242, N271S and Q346R. Our objective was to determine the role of LHX4 variants in patients’ phenotypes. Heterologous HEK293T cells were transfected with plasmids encoding for wild-type or mutant LHX4. Protein expression was analysed by Western Blot, and DNA binding by electro-mobility shift assay experiments. Target promoters of LHX4 were cotransfected with wild type or mutant LHX4 to test the transactivating abilities of each variant. Our results show that the W204X mutation was associated with early GH and TSH deficiencies and later onset ACTH deficiency. It led to a truncated protein unable to bind to alpha-Gsu promoter binding consensus sequence. W204X was not able to activate target promoters in vitro. Cotransfection experiments did not favour a dominant negative effect. In contrast, all other mutants were able to bind the promoters and led to an activation similar as that observed with wild type LHX4, suggesting that they were likely polymorphisms. To conclude, our study underlines the need for functional in vitro studies to ascertain the role of rare allelic variants of LHX4 in disease phenotypes. It supports the causative role of the W204X mutation in CPHD and adds up childhood onset ACTH deficiency to the clinical spectrum of the various phenotypes related to LHX4 mutations. PMID:25955177

Direct methylation of FXR by Set7/9, a lysine methyltransferase, regulates the expression of FXR target genes

PubMed Central

Balasubramaniyan, Natarajan; Ananthanarayanan, Meena

2012-01-01

The farnesoid X receptor (FXR) is a ligand (bile acid)-dependent nuclear receptor that regulates target genes involved in every aspect of bile acid homeostasis. Upon binding of ligand, FXR recruits an array of coactivators and associated proteins, some of which have intrinsic enzymatic activity that modify histones or even components of the transcriptional complex. In this study, we show chromatin occupancy by the Set7/9 methyltransferase at the FXR response element (FXRE) and direct methylation of FXR in vivo and in vitro at lysine 206. siRNA depletion of Set7/9 in the Huh-7 liver cell line decreased endogenous mRNAs of the FXR target genes, the short heterodimer partner (SHP) and bile salt export pump (BSEP). Mutation of the methylation site at K206 of FXR to an arginine prevented methylation by Set7/9. A pan-methyllysine antibody recognized the wild-type FXR but not the K206R mutant form. An electromobility shift assay showed that methylation by Set7/9 enhanced binding of FXR/retinoic X receptor-α to the FXRE. Interaction between hinge domain of FXR (containing K206) and Set7/9 was confirmed by coimmunoprecipitation, GST pull down, and mammalian two-hybrid experiments. Set7/9 overexpression in Huh-7 cells significantly enhanced transactivation of the SHP and BSEP promoters in a ligand-dependent fashion by wild-type FXR but not the K206R mutant FXR. A Set7/9 mutant deficient in methyltransferase activity was also not effective in increasing transactivation of the BSEP promoter. These studies demonstrate that posttranslational methylation of FXR by Set7/9 contributes to the transcriptional activation of FXR-target genes. PMID:22345554

The human pregnane X receptor: genomic structure and identification and functional characterization of natural allelic variants.

PubMed

Zhang, J; Kuehl, P; Green, E D; Touchman, J W; Watkins, P B; Daly, A; Hall, S D; Maurel, P; Relling, M; Brimer, C; Yasuda, K; Wrighton, S A; Hancock, M; Kim, R B; Strom, S; Thummel, K; Russell, C G; Hudson, J R; Schuetz, E G; Boguski, M S

2001-10-01

The pregnane X receptor (PXR)/steroid and xenobiotic receptor (SXR) transcriptionally activates cytochrome P4503A4 (CYP3A4) when ligand activated by endobiotics and xenobiotics. We cloned the human PXR gene and analysed the sequence in DNAs of individuals whose CYP3A phenotype was known. The PXR gene spans 35 kb, contains nine exons, and mapped to chromosome 13q11-13. Thirty-eight single nucleotide polymorphisms (SNPs) were identified including six SNPs in the coding region. Three of the coding SNPs are non-synonymous creating new PXR alleles [PXR*2, P27S (79C to T); PXR*3, G36R (106G to A); and PXR*4, R122Q (4321G to A)]. The frequency of PXR*2 was 0.20 in African Americans and was never found in Caucasians. Hepatic expression of CYP3A4 protein was not significantly different between African Americans homozygous for PXR*1 compared to those with one PXR*2 allele. PXR*4 was a rare variant found in only one Caucasian person. Homology modelling suggested that R122Q, (PXR*4) is a direct DNA contact site variation in the third alpha-helix in the DNA binding domain. Compared with PXR*1, and variants PXR*2 and PXR*3, only the variant PXR*4 protein had significantly decreased affinity for the PXR binding sequence in electromobility shift assays and attenuated ligand activation of the CYP3A4 reporter plasmids in transient transfection assays. However, the person heterozygous for PXR*4 is normal for CYP3A4 metabolism phenotype. The relevance of each of the 38 PXR SNPs identified in DNA of individuals whose CYP3A basal and rifampin-inducible CYP3A4 expression was determined in vivo and/or in vitro was demonstrated by univariate statistical analysis. Because ligand activation of PXR and upregulation of a system of drug detoxification genes are major determinants of drug interactions, it will now be useful to extend this work to determine the association of these common PXR SNPs to human variation in induction of other drug detoxification gene targets.

Molecular events involved in the increased expression of matrix metalloproteinase-9 by T lymphocytes of mammary tumor-bearing mice.

PubMed

Owen, Jennifer L; Torroella-Kouri, Marta; Iragavarapu-Charyulu, Vijaya

2008-01-01

Matrix metalloproteinases (MMPs) are a family of extracellular proteinases whose contributions to cancer progression have been studied because of their matrix-degrading abilities and elevated expression in advanced stage tumors. Recent findings suggest a role for MMPs during the multiple stages of tumor progression including establishment and growth, migration, invasion, metastasis, and angiogenesis. MMP-9 regulation at the molecular level can be studied by measuring the effect(s) of a variety of physiological and pharmacological agents on cells. Multiple signaling molecules such as protein kinase C, pertussis toxin-sensitive guanine nucleotide-binding protein G, and protein tyrosine kinases are known to mediate the secretion of MMPs in cell lines. We previously reported an upregulation of MMP-9 in T cells of mammary tumor-bearing mice. In this study, pharmacologic inhibitors were used to dissect the signaling pathways involved in the upregulation of MMP-9 in the splenic T cells of normal and mammary tumor-bearing mice. Staurosporine, a protein kinase inhibitor, stimulated MMP-9 secretion by normal T lymphocytes, while the constitutively high levels of MMP-9 produced by tumor bearers' T cells were decreased by Genistein, a specific tyrosine kinase inhibitor, and Rottlerin, a PKC inhibitor. Using a NF-kappaB specific probe to the murine MMP-9 promoter, electromobility shift assays of nuclear proteins from normal and tumor bearers' splenic T cells revealed a pattern of higher intensity bands from the tumor bearers' nuclear extracts, indicating a greater amount of these transcription factors bound to the recognition motif. When mammary tumor bearers' T cells were cultured with the NF-kappaB inhibitors, N-p-Tosyl-L-lysine chloromethyl ketone hydrochloride and Bay 11-7082, there was a subsequent decreased production of MMP-9. These results suggest that the tumor burden may be activating various signaling pathways within splenic T lymphocytes to upregulate MMP-9 expression.

Krüppel-like factor 4, a novel transcription factor regulates microglial activation and subsequent neuroinflammation.

PubMed

Kaushik, Deepak K; Gupta, Malvika; Das, Sulagna; Basu, Anirban

2010-10-15

Activation of microglia, the resident macrophages of the central nervous system (CNS), is the hallmark of neuroinflammation in neurodegenerative diseases and other pathological conditions associated with CNS infection. The activation of microglia is often associated with bystander neuronal death. Nuclear factor-κB (NF-κB) is one of the important transcription factors known to be associated with microglial activation which upregulates the expression of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (Cox-2) and other pro-inflammatory cytokines. Recent studies have focused on the role of Krüppel-like factor 4 (Klf4), one of the zinc-finger transcription factors, in mediating inflammation. However, these studies were limited to peripheral system and its role in CNS is not understood. Our studies focused on the possible role of Klf4 in mediating CNS inflammation. For in vitro studies, mouse microglial BV-2 cell lines were treated with 500 ng/ml Salmonella enterica lipopolysacchride (LPS). Brain tissues were isolated from BALB/c mice administered with 5 mg/kg body weight of LPS. Expressions of Klf4, Cox-2, iNOS and pNF-κB were evaluated using western blotting, quantitative real time PCR, and reverse transcriptase polymerase chain reactions (RT-PCRs). Klf4 knockdown was carried out using SiRNA specific for Klf4 mRNA and luciferase assays and electromobility shift assay (EMSA) were performed to study the interaction of Klf4 to iNOS promoter elements in vitro. Co-immunoprecipitation of Klf4 and pNF-κB was done in order to study a possible interaction between the two transcription factors. LPS stimulation increased Klf4 expression in microglial cells in a time- and dose-dependent manner. Knockdown of Klf4 resulted in decreased levels of the pro-inflammatory cytokines TNF-α, MCP-1 and IL-6, along with a significant decrease in iNOS and Cox-2 expression. NO production also decreased as a result of Klf4 knockdown. We found that Klf4 can potentially interact with pNF-κB and is important for iNOS and Cox-2 promoter activity in vitro. These studies demonstrate the role of Klf4 in microglia in mediating neuroinflammation in response to the bacterial endotoxin LPS.

Missed detection of significant positive and negative shifts in gentamicin assay: implications for routine laboratory quality practices.

PubMed

Koerbin, Gus; Liu, Jiakai; Eigenstetter, Alex; Tan, Chin Hon; Badrick, Tony; Loh, Tze Ping

2018-02-15

A product recall was issued for the Roche/Hitachi Cobas Gentamicin II assays on 25 th May 2016 in Australia, after a 15 - 20% positive analytical shift was discovered. Laboratories were advised to employ the Thermo Fisher Gentamicin assay as an alternative. Following the reintroduction of the revised assay on 12 th September 2016, a second reagent recall was made on 20 th March 2017 after the discovery of a 20% negative analytical shift due to erroneous instrument adjustment factor. The practices of an index laboratory were examined to determine how the analytical shifts evaded detection by routine internal quality control (IQC) and external quality assurance (EQA) systems. The ability of the patient result-based approaches, including moving average (MovAvg) and moving sum of outliers (MovSO) approaches in detecting these shifts were examined. Internal quality control data of the index laboratory were acceptable prior to the product recall. The practice of adjusting IQC target following a change in assay method resulted in the missed negative shift when the revised Roche assay was reintroduced. While the EQA data of the Roche subgroup showed clear negative bias relative to other laboratory methods, the results were considered as possible 'matrix effect'. The MovAvg method detected the positive shift before the product recall. The MovSO did not detect the negative shift in the index laboratory but did so in another laboratory 5 days before the second product recall. There are gaps in current laboratory quality practices that leave room for analytical errors to evade detection.

Using Electrophoretic Mobility Shift Assays to Measure Equilibrium Dissociation Constants: GAL4-p53 Binding DNA as a Model System

ERIC Educational Resources Information Center

Heffler, Michael A.; Walters, Ryan D.; Kugel, Jennifer F.

2012-01-01

An undergraduate biochemistry laboratory experiment is described that will teach students the practical and theoretical considerations for measuring the equilibrium dissociation constant (K[subscript D]) for a protein/DNA interaction using electrophoretic mobility shift assays (EMSAs). An EMSA monitors the migration of DNA through a native gel;…

LEGO plot for simultaneous application of multiple quality requirements during trueness verification of quantitative laboratory tests.

PubMed

Park, Hae-il; Chae, Hyojin; Kim, Myungshin; Lee, Jehoon; Kim, Yonggoo

2014-03-01

We developed a two-dimensional plot for viewing trueness that takes into account potential shift and variable quality requirements to verify trueness using certified reference material (CRM). Glucose, total cholesterol (TC), and creatinine levels were determined by two kinds of assay in two levels of a CRM. Available quality requirements were collected, codified, and sorted in an ascending order in the plot's header row. Centering on the mean of measured values from CRM, the "mean ± US CLIA '88 allowable total error" was located in the header of the leftmost and rightmost columns. Twenty points were created in intervening columns as potential shifts. Uncertainties were calculated according to regression between certified values and uncertainties of CRM, and positioned in the corresponding columns. Cells were assigned different colors where column and row intersected based on comparison of the 95% confidence interval of the percentage bias with each quality requirement. A glucose assay failed to meet the highest quality criteria, for which shift of +0.13-0.14 mmol/l was required. A TC assay met the quality requirement and a shift of ±0.03 mmol/l was tolerable. A creatinine assay also met the quality requirement but any shift was not tolerable. The plot provides a systematic view of the trueness of quantitative laboratory tests. © 2014 Wiley Periodicals, Inc.

A microfluidics-based mobility shift assay to identify new inhibitors of β-secretase for Alzheimer's disease.

PubMed

Liu, Rongfeng; Liu, Yu-Chih; Meng, Junwei; Zhu, Haiyan; Zhang, Xuehong

2017-11-01

The β-secretase (BACE1) initiates the generation of toxic amyloid-β peptide (Aβ) from amyloid-β precursor protein (APP), which was widely considered to play a key role in the pathogenesis of Alzheimer's disease (AD). Here, a novel microfluidics-based mobility shift assay (MMSA) was developed, validated, and applied for the screening of BACE1 inhibitors for AD. First, the BACE1 activity assay was established with a new fluorescent peptide substrate (FAM-EVNLDAEF) derived from the Swedish mutant APP, and high-quality ratiometric data were generated in both endpoint and kinetic modes by electrophoretic separation of peptide substrate from the BACE1 cleaved product (FAM-EVNL) before fluorescence quantification. To validate the assay, the inhibition and kinetic parameter values of two known inhibitors (AZD3839 and AZD3293) were evaluated, and the results were in good agreement with those reported by other methods. Finally, the assay was applied to screen for new inhibitors from a 900-compound library in a 384-well format, and one novel hit (IC 50 = 26.5 ± 1.5 μM) was identified. Compared with the common fluorescence-based assays, the primary advantage of the direct MMSA was to discover novel BACE1 inhibitors with lower auto-fluorescence interference, and its superb capability for kinetic study. Graphical abstract Microfluidics-based mobility shift assay for BACE1.

Demonstrating Interactions of Transcription Factors with DNA by Electrophoretic Mobility Shift Assay.

PubMed

Yousaf, Nasim; Gould, David

2017-01-01

Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.

Rapid Detection of Glycogen Synthase Kinase-3 Activity in Mouse Sperm Using Fluorescent Gel Shift Electrophoresis

PubMed Central

Choi, Hoseok; Choi, Bomi; Seo, Ju Tae; Lee, Kyung Jin; Gye, Myung Chan; Kim, Young-Pil

2016-01-01

Assaying the glycogen synthase kinase-3 (GSK3) activity in sperm is of great importance because it is closely implicated in sperm motility and male infertility. While a number of studies on GSK3 activity have relied on labor-intensive immunoblotting to identify phosphorylated GSK3, here we report the simple and rapid detection of GSK3 activity in mouse sperm using conventional agarose gel electrophoresis and a fluorescent peptide substrate. When a dye-tethered and prephosphorylated (primed) peptide substrate for GSK3 was employed, a distinct mobility shift in the fluorescent bands on the agarose was observed by GSK3-induced phosphorylation of the primed peptides. The GSK3 activity in mouse testes and sperm were quantifiable by gel shift assay with low sample consumption and were significantly correlated with the expression levels of GSK3 and p-GSK3. We suggest that our assay can be used for reliable and rapid detection of GSK3 activity in cells and tissue extracts. PMID:27092510

Protein–ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grøftehauge, Morten K., E-mail: m.k.groftehauge@durham.ac.uk; Hajizadeh, Nelly R.; Swann, Marcus J.

2015-01-01

The biophysical characterization of protein–ligand interactions in solution using techniques such as thermal shift assay, or on surfaces using, for example, dual polarization interferometry, plays an increasingly important role in complementing crystal structure determinations. Over the last decades, a wide range of biophysical techniques investigating protein–ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmonmore » resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography.« less

Energy monitoring and managing for electromobility purposes

NASA Astrophysics Data System (ADS)

Slanina, Zdenek; Docekal, Tomas

2016-09-01

This paper describes smart energy meter design and implementation focused on using in charging stations (stands) for electric vehicle (follows as EV) charging support and possible embedding into current smart building technology. In this article there are included results of research of commercial devices available in Czech republic for energy measuring for buildings as well as analysis of energy meter for given purposes. For example in described module there was required measurement of voltage, electric current and frequency of power network. Finally there was designed a communication module with common interface to energy meter for standard communication support between charging station and electric car. After integration into smart buildings (home automation, parking houses) there are pros and cons of such solution mentioned1,2.

Night shift work and levels of 6-sulfatoxymelatonin and cortisol in men.

PubMed

Mirick, Dana K; Bhatti, Parveen; Chen, Chu; Nordt, Frank; Stanczyk, Frank Z; Davis, Scott

2013-06-01

Night shift work is associated with cancer among men, but the biologic mechanism is unclear. We investigated whether male night shift workers showed changes in levels of melatonin and cortisol, potential biomarkers of cancer risk. Urine was collected from 185 night shift and 158 day shift-working male healthcare providers, aged 22 to 55 years, throughout work and sleep periods, and assayed for 6-sulfatoxymelatonin and cortisol. Morning serum was collected within 90 minutes of completing the night and assayed for cortisol. Night shift workers had significantly lower 6-sulfatoxymelatonin levels during daytime sleep, nighttime work, and nighttime sleep on off-nights (57%, 62%, and 40% lower, respectively), relative to the day shift workers during nighttime sleep (P < 0.0001); urinary cortisol in night shift workers was 16% higher during daytime sleep and 13% lower during nighttime sleep on off-nights (P < 0.05). Morning serum cortisol post-work and post-sleep in night shift workers were 24% and 43% lower, respectively, than post-sleep levels among day shift workers (P < 0.0001). Within-subject comparisons among the night shift workers revealed significantly lower melatonin levels and significantly higher urinary cortisol levels during daytime sleep and nighttime work, relative to nighttime sleep (P < 0.01); morning serum cortisol levels post-work were lower than those post-sleep. Night shift workers have substantially lower 6-sulfatoxymelatonin during night work and daytime sleep, and levels remain low when night shift workers sleep at night. Chronic reduction in melatonin among night shift workers may be an important carcinogenic mechanism. Cortisol secretion patterns may be impacted by night shift work, which could affect cancer risk. Shift work could be an important risk factor for many types of cancer.

Electrophoretic Mobility Shift Assay (EMSA) for Detecting Protein-Nucleic Acid Interactions

PubMed Central

Hellman, Lance M.; Fried, Michael G.

2009-01-01

The gel electrophoresis mobility shift assay (EMSA) is used to detect protein complexes with nucleic acids. It is the core technology underlying a wide range of qualitative and quantitative analyses for the characterization of interacting systems. In the classical assay, solutions of protein and nucleic acid are combined and the resulting mixtures are subjected to electrophoresis under native conditions through polyacrylamide or agarose gel. After electrophoresis, the distribution of species containing nucleic acid is determined, usually by autoradiography of 32P-labeled nucleic acid. In general, protein-nucleic acid complexes migrate more slowly than the corresponding free nucleic acid. In this article, we identify the most important factors that determine the stabilities and electrophoretic mobilities of complexes under assay conditions. A representative protocol is provided and commonly used variants are discussed. Expected outcomes are briefly described. References to extensions of the method and a troubleshooting guide are provided. PMID:17703195

Functional assignment of solute-binding proteins of ABC transporters using a fluorescence-based thermal shift assay.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giulliani, S. E.; Frank, A. E.; Collart, F. R.

2008-12-08

We have used a fluorescence-based thermal shift (FTS) assay to identify amino acids that bind to solute-binding proteins in the bacterial ABC transporter family. The assay was validated with a set of six proteins with known binding specificity and was consistently able to map proteins with their known binding ligands. The assay also identified additional candidate binding ligands for several of the amino acid-binding proteins in the validation set. We extended this approach to additional targets and demonstrated the ability of the FTS assay to unambiguously identify preferential binding for several homologues of amino acid-binding proteins with known specificity andmore » to functionally annotate proteins of unknown binding specificity. The assay is implemented in a microwell plate format and provides a rapid approach to validate an anticipated function or to screen proteins of unknown function. The ABC-type transporter family is ubiquitous and transports a variety of biological compounds, but the current annotation of the ligand-binding proteins is limited to mostly generic descriptions of function. The results illustrate the feasibility of the FTS assay to improve the functional annotation of binding proteins associated with ABC-type transporters and suggest this approach that can also be extended to other protein families.« less

Electromobility concept for racing cars based on lithium-ion batteries and supercapacitors

NASA Astrophysics Data System (ADS)

Frenzel, B.; Kurzweil, P.; Rönnebeck, H.

For the construction of an all-electric race car, all aspects from engineering design over cost estimation up to the road capability are illuminated. From the most promising batteries for electric vehicle propulsion, the state-of-the art and commercial availability of lithium-ion secondary batteries is critically discussed with respect to cycle-life and unfavorable charge-discharge conditions. A market-overview is given with respect to a small electric car. Different combinations of electric motors and a recuperation system have been investigated. Weight aspects of central drive systems were considered and compared with decentralized wheel-hub drives. As a result, a centralized high-speed drive train based on a permanent-magnet synchronous engine with high-energy magnets seems to be superior due to limited space for assembly.

A two-fold reduction in measurement time for neutron assay: Initial tests of a prototype dual-gated shift register

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stewart, J.E.; Bourret, S.C.; Krick, M.S.

1996-09-01

Neutron coincidence counting (NCC) is used routinely around the world for nondestructive mass assay of uranium and plutonium in many forms, including waste. Compared with other methods, NCC is generally the most flexible, economic, and rapid. Many applications of NCC would benefit from a reduction in counting time required for a fixed random error. We have developed and tested the first prototype of a dual- gated, shift-register-based electronics unit that offers the potential of decreased measurement time for all passive and active NCC applications.

A two-fold reduction in measurement time for neutron assay: Initial tests of a prototype dual-gated shift register

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stewart, J.E.; Bourret, S.C.; Krick, M.S.

1996-12-31

Neutron coincidence counting (NCC) is used routinely around the world for nondestructive mass assay of uranium and plutonium in many forms, including waste. Compared with other methods, NCC is generally the most flexible, economic, and rapid. Many applications of NCC would benefit from a reduction in counting time required for a fixed random error. The authors have developed and tested the first prototype of a dual-gated, shift-register-based electronics unit that offers the potential of decreased measurement time for all passive and active NCC applications.

Centrifugation assay for measuring adhesion of serially passaged bovine chondrocytes to polystyrene surfaces.

PubMed

Kaplan, David S; Hitchins, Victoria M; Vegella, Thomas J; Malinauskas, Richard A; Ferlin, Kimberly M; Fisher, John P; Frondoza, Carmelita G

2012-07-01

A major obstacle in chondrocyte-based therapy for cartilage repair is the limited availability of cells that maintain their original phenotype. Propagation of chondrocytes as monolayer cultures on polystyrene surfaces is used extensively for amplifying cell numbers. However, chondrocytes undergo a phenotypic shift when propagated in this manner and display characteristics of more adherent fibroblastic cells. Little information is available about the effect of this phenotypic shift on cellular adhesion properties. We evaluated changes in adhesion property as bovine chondrocytes were serially propagated up to five passages in monolayer culture using a centrifugation cell adhesion assay, which was based on counting of cells before and after being exposed to centrifugal dislodgement forces of 120 and 350 g. Chondrocytes proliferated well in a monolayer culture with doubling times of 2-3 days, but they appeared more fibroblastic and exhibited elongated cell morphology with continued passage. The centrifugation cell adhesion assay showed that chondrocytes became more adhesive with passage as the percentage of adherent cells after centrifugation increased and was not statistically different from the adhesion of the fibroblast cell line, L929, starting at passage 3. This increased adhesiveness correlated with a shift to a fibroblastic morphology and increased collagen I mRNA expression starting at passage 2. Our findings indicate that the centrifugation cell adhesion assay may serve as a reproducible tool to track alterations in chondrocyte phenotype during their extended propagation in culture.

Comparative performance of electrochemiluminescence immunoassay and EIA for HIV screening in a multiethnic region of China.

PubMed

Bi, Xiaohui; Ning, Hongxia; Wang, Tingting; Li, Dongdong; Liu, Yongming; Yang, Tingfu; Yu, Jiansheng; Tao, Chuanmin

2012-01-01

The recent approval of 4th generation HIV tests has forced many laboratories to decide whether to shift from 3rd to these tests. There are limited published studies on the comparative evaluation of these two different assays. We compare the performance of fourth-generation electrochemiluminescence immunoassay (ChIA) and third-generation enzyme linked immunosorbent assay (EIA) for human immunodeficiency virus (HIV) screening and gauge whether the shift from EIA to ChIA could be better in a multiethnic region of China. We identified a large number of routine specimens (345,492) using two different assays from Jan 2008 to Aug 2011 in a teaching hospital with high sample throughput. Of the 344,596 specimens with interpretable HIV test results, 526(0.23%) of 228,761 using EIA and 303(0.26%) of 115,835 using ChIA were HIV-1 positive. The false-positive rate of EIA was lower than that of ChIA [0.03% vs. 0.08%, odds ratio 0.33 (95% confidence interval 0.24, 0.45)]. The positive predictive value (PPV) of EIA (89.6%) was significantly higher than that of ChIA (76.1%) (<0.001), reflecting the difference between the two assays. The clinical sensitivities of two assays in this study were 99.64% for EIA and 99.88% for ChIA. Caution is needed before shifting from 3rd to 4th generation HIV tests. Since none of these tests are perfect, different geographic and ethnic area probably require different considerations with regard to HIV testing methods, taking into account the local conditions.

Analysis of protein stability and ligand interactions by thermal shift assay.

PubMed

Huynh, Kathy; Partch, Carrie L

2015-02-02

Purification of recombinant proteins for biochemical assays and structural studies is time-consuming and presents inherent difficulties that depend on the optimization of protein stability. The use of dyes to monitor thermal denaturation of proteins with sensitive fluorescence detection enables rapid and inexpensive determination of protein stability using real-time PCR instruments. By screening a wide range of solution conditions and additives in a 96-well format, the thermal shift assay easily identifies conditions that significantly enhance the stability of recombinant proteins. The same approach can be used as an initial low-cost screen to discover new protein-ligand interactions by capitalizing on increases in protein stability that typically occur upon ligand binding. This unit presents a methodological workflow for small-scale, high-throughput thermal denaturation of recombinant proteins in the presence of SYPRO Orange dye. Copyright © 2015 John Wiley & Sons, Inc.

A nonradioactive assay for poly(a)-specific ribonuclease activity by methylene blue colorimetry.

PubMed

Cheng, Yuan; Liu, Wei-Feng; Yan, Yong-Bin; Zhou, Hai-Meng

2006-01-01

A simple nonradioactive assay, which was based on the specific shift of the absorbance maximum of methylene blue induced by its intercalation into poly(A) molecules, was developed for poly(A)-specific ribonuclease (PARN). A good linear relationship was found between the absorbance at 662 nm and the poly(A) concentration. The assay conditions, including the concentration of methylene blue, the incubation temperature and time, and the poly(A) concentration were evaluated and optimized.

The evolving potential of companion diagnostics.

PubMed

Khoury, Joseph D

2016-01-01

The scope of companion diagnostics in cancer has undergone significant shifts in the past few years, with increased development of targeted therapies and novel testing platforms. This has provided new opportunities to effect unprecedented paradigm shifts in the application of personalized medicine principles for patients with cancer. These shifts involve assay platforms, analytes, regulations, and therapeutic approaches. As opportunities involving each of these facets of companion diagnostics expand, close collaborations between key stakeholders should be enhanced to ensure optimal performance characteristics and patient outcomes.

Regulation of the aceI multidrug efflux pump gene in Acinetobacter baumannii.

PubMed

Liu, Qi; Hassan, Karl A; Ashwood, Heather E; Gamage, Hasinika K A H; Li, Liping; Mabbutt, Bridget C; Paulsen, Ian T

2018-06-01

To investigate the function of AceR, a putative transcriptional regulator of the chlorhexidine efflux pump gene aceI in Acinetobacter baumannii. Chlorhexidine susceptibility and chlorhexidine induction of aceI gene expression were determined by MIC and quantitative real-time PCR, respectively, in A. baumannii WT and ΔaceR mutant strains. Recombinant AceR was prepared as both a full-length protein and as a truncated protein, AceR (86-299), i.e. AceRt, which has the DNA-binding domain deleted. The binding interaction of the purified AceR protein and its putative operator region was investigated by electrophoretic mobility shift assays and DNase I footprinting assays. The binding of AceRt with its putative ligand chlorhexidine was examined using surface plasmon resonance and tryptophan fluorescence quenching assays. MIC determination assays indicated that the ΔaceI and ΔaceR mutant strains both showed lower resistance to chlorhexidine than the parental strain. Chlorhexidine-induced expression of aceI was abolished in a ΔaceR background. Electrophoretic mobility shift assays and DNase I footprinting assays demonstrated chlorhexidine-stimulated binding of AceR with two sites upstream of the putative aceI promoter. Surface plasmon resonance and tryptophan fluorescence quenching assays suggested that the purified ligand-binding domain of the AceR protein was able to bind with chlorhexidine with high affinity. This study provides strong evidence that AceR is an activator of aceI gene expression when challenged with chlorhexidine. This study is the first characterization, to our knowledge, of a regulator controlling expression of a PACE family multidrug efflux pump.

Optimal route scheduling-driven study of a photovoltaic charging-station (parking lot) for electric mini-buses

NASA Astrophysics Data System (ADS)

Zacharaki, V.; Papanikolaou, S.; Voulgaraki, Ch; Karantinos, A.; Sioumpouras, D.; Tsiamitros, D.; Stimoniaris, D.; Maropoulos, S.; Stephanedes, Y.

2016-11-01

The objective of the present study is threefold: To highlight how electro-mobility can: (a) Contribute to the promotion of the environmental conservation of the rural areas (through an integrated solution for reducing the carbon footprint of road facilities and transport), (b) Enhance tourism-based economical development, (c) facilitate students in their daily transport and residents (elderly, disabled, distant-residents) in their daily on-demand transport. The overall goal is to design an energy-efficient, regional intelligent transportation system with innovative solar-energy charging-stations for e-vehicles in municipalities with many geographically scattered small villages and small cities. The innovative character of the study is that it tries to tackle all three specific objectives simultaneously and with the same means, since it utilizes Intelligent Transportation Systems (ITS). The study is adapted and applied to an area with the above characteristics, in order to demonstrate the proof of concept.

Protein-ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI).

PubMed

Grøftehauge, Morten K; Hajizadeh, Nelly R; Swann, Marcus J; Pohl, Ehmke

2015-01-01

Over the last decades, a wide range of biophysical techniques investigating protein-ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmon resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography.

Protein–ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI)

PubMed Central

Grøftehauge, Morten K.; Hajizadeh, Nelly R.; Swann, Marcus J.; Pohl, Ehmke

2015-01-01

Over the last decades, a wide range of biophysical techniques investigating protein–ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmon resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography. PMID:25615858

Strictosidine activation in Apocynaceae: towards a "nuclear time bomb"?

PubMed Central

2010-01-01

Background The first two enzymatic steps of monoterpene indole alkaloid (MIA) biosynthetic pathway are catalysed by strictosidine synthase (STR) that condensates tryptamine and secologanin to form strictosidine and by strictosidine β-D-glucosidase (SGD) that subsequently hydrolyses the glucose moiety of strictosidine. The resulting unstable aglycon is rapidly converted into a highly reactive dialdehyde, from which more than 2,000 MIAs are derived. Many studies were conducted to elucidate the biosynthesis and regulation of pharmacologically valuable MIAs such as vinblastine and vincristine in Catharanthus roseus or ajmaline in Rauvolfia serpentina. However, very few reports focused on the MIA physiological functions. Results In this study we showed that a strictosidine pool existed in planta and that the strictosidine deglucosylation product(s) was (were) specifically responsible for in vitro protein cross-linking and precipitation suggesting a potential role for strictosidine activation in plant defence. The spatial feasibility of such an activation process was evaluated in planta. On the one hand, in situ hybridisation studies showed that CrSTR and CrSGD were coexpressed in the epidermal first barrier of C. roseus aerial organs. However, a combination of GFP-imaging, bimolecular fluorescence complementation and electromobility shift-zymogram experiments revealed that STR from both C. roseus and R. serpentina were localised to the vacuole whereas SGD from both species were shown to accumulate as highly stable supramolecular aggregates within the nucleus. Deletion and fusion studies allowed us to identify and to demonstrate the functionality of CrSTR and CrSGD targeting sequences. Conclusions A spatial model was drawn to explain the role of the subcellular sequestration of STR and SGD to control the MIA metabolic flux under normal physiological conditions. The model also illustrates the possible mechanism of massive activation of the strictosidine vacuolar pool upon enzyme-substrate reunion occurring during potential herbivore feeding constituting a so-called "nuclear time bomb" in reference to the "mustard oil bomb" commonly used to describe the myrosinase-glucosinolate defence system in Brassicaceae. PMID:20723215

Rapid and Simple Detection of Hot Spot Point Mutations of Epidermal Growth Factor Receptor, BRAF, and NRAS in Cancers Using the Loop-Hybrid Mobility Shift Assay

PubMed Central

Matsukuma, Shoichi; Yoshihara, Mitsuyo; Kasai, Fumio; Kato, Akinori; Yoshida, Akira; Akaike, Makoto; Kobayashi, Osamu; Nakayama, Haruhiko; Sakuma, Yuji; Yoshida, Tsutomu; Kameda, Yoichi; Tsuchiya, Eiju; Miyagi, Yohei

2006-01-01

A simple and rapid method to detect the epidermal growth factor receptor hot spot mutation L858R in lung adenocarcinoma was developed based on principles similar to the universal heteroduplex generator technology. A single-stranded oligonucleotide with an internal deletion was used to generate heteroduplexes (loop-hybrids) bearing a loop in the complementary strand derived from the polymerase chain reaction product of the normal or mutant allele. By placing deletion in the oligonucleotide adjacent to the mutational site, difference in electrophoretic mobility between loop-hybrids with normal and mutated DNA was distinguishable in a native polyacrylamide gel. The method was also modified to detect in-frame deletion mutations of epidermal growth factor receptor in lung adenocarcinomas. In addition, the method was adapted to detect hot spot mutations in the B-type Raf kinase (BRAF) at V600 and in a Ras-oncogene (NRAS) at Q61, the mutations commonly found in thyroid carcinomas. Our mutation detection system, designated the loop-hybrid mobility shift assay was sensitive enough to detect mutant DNA comprising 7.5% of the total DNA. As a simple and straightforward mutation detection technique, loop-hybrid mobility shift assay may be useful for the molecular diagnosis of certain types of clinical cancers. Other applications are also discussed. PMID:16931592

Mechanisms of diminished natural killer cell activity in pregnant women and neonates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baley, J.E.; Schacter, B.Z.

1985-05-01

Because alterations in natural killer (NK) activity in the perinatal period may be important in the maintenance of a healthy pregnancy, the mechanisms by which these alterations are mediated in neonates and in pregnant and postpartum women was examined. NK activity, as measured in a 4-hr /sup 51/Cr-release assay and compared with adult controls, is significantly diminished in all three trimesters of pregnancy and in immediately postpartum women. In postpartum women, NK activity appears to be higher than in pregnant women, although this does not reach statistical significance. Pregnant and postpartum women have normal numbers of large granular lymphocytes andmore » normal target cell binding in an agarose single cell assay but decreased lysis of the bound target cells. NK activity of mononuclear cells from postpartum women, in addition, demonstrate a shift in distribution to higher levels of resistance to gamma-irradiation. Further, sera from postpartum women cause a similar shift to increased radioresistance in mononuclear cells from adult controls. Because radioresistance is a property of interleukin 2-stimulated NK, the shift to radioresistance may represent lymphokine-mediated stimulation occurring during parturition. In contrast, cord blood cells have a more profound decrease in NK activity as determined by /sup 51/Cr-release assay and decreases in both binding and lysis of bound target cells in the single cell assay. The resistance of NK activity in cord cells to gamma-irradiation is also increased, as seen in postpartum women. Cord blood serum, however, did not alter radioresistance or inhibit NK activity. The results suggest that the observed diminished NK activity in pregnant women and neonates arise by different mechanisms: an absence of mature NK cells in the neonate and an alteration of the NK cell in pregnancy leading to decreased killing.« less

A robust methodology to subclassify pseudokinases based on their nucleotide-binding properties

PubMed Central

Murphy, James M.; Zhang, Qingwei; Young, Samuel N.; Reese, Michael L.; Bailey, Fiona P.; Eyers, Patrick A.; Ungureanu, Daniela; Hammaren, Henrik; Silvennoinen, Olli; Varghese, Leila N.; Chen, Kelan; Tripaydonis, Anne; Jura, Natalia; Fukuda, Koichi; Qin, Jun; Nimchuk, Zachary; Mudgett, Mary Beth; Elowe, Sabine; Gee, Christine L.; Liu, Ling; Daly, Roger J.; Manning, Gerard; Babon, Jeffrey J.; Lucet, Isabelle S.

2017-01-01

Protein kinase-like domains that lack conserved residues known to catalyse phosphoryl transfer, termed pseudokinases, have emerged as important signalling domains across all kingdoms of life. Although predicted to function principally as catalysis-independent protein-interaction modules, several pseudokinase domains have been attributed unexpected catalytic functions, often amid controversy. We established a thermal-shift assay as a benchmark technique to define the nucleotide-binding properties of kinase-like domains. Unlike in vitro kinase assays, this assay is insensitive to the presence of minor quantities of contaminating kinases that may otherwise lead to incorrect attribution of catalytic functions to pseudokinases. We demonstrated the utility of this method by classifying 31 diverse pseudokinase domains into four groups: devoid of detectable nucleotide or cation binding; cation-independent nucleotide binding; cation binding; and nucleotide binding enhanced by cations. Whereas nine pseudokinases bound ATP in a divalent cation-dependent manner, over half of those examined did not detectably bind nucleotides, illustrating that pseudokinase domains predominantly function as non-catalytic protein-interaction modules within signalling networks and that only a small subset is potentially catalytically active. We propose that henceforth the thermal-shift assay be adopted as the standard technique for establishing the nucleotide-binding and catalytic potential of kinase-like domains. PMID:24107129

Femtomole-Scale High-Throughput Screening of Protein Ligands with Droplet-Based Thermal Shift Assay.

PubMed

Liu, Wen-Wen; Zhu, Ying; Fang, Qun

2017-06-20

There is a great demand to measure protein-ligand interactions in rapid and low cost way. Here, we developed a microfluidic droplet-based thermal shift assay (dTSA) system for high-throughput screening of small-molecule protein ligands. The system is composed of a nanoliter droplet array chip, a microfluidic droplet robot, and a real-time fluorescence detection system. Total 324 assays could be performed in parallel in a single chip with an 18 × 18 droplet array. The consumption of dTSA for each protein or ligand sample was only 5 nL (femtomole scale), which is significantly reduced by over 3 orders of magnitude compared with those in 96- or 384-well plate-based systems. We also observed the implementation of TSA in nanoliter droplet format could substantially improve assay precision with relative standard deviation (RSD) of 0.2% (n = 50), which can be ascribed to the enhanced thermal conduction in small volume reactors. The dTSA system was optimized by studying the effect of droplet volumes, as well as protein and fluorescent dye (SYPRO Orange) concentrations. To demonstrate its potential in drug discovery, we applied the dTSA system in screening inhibitors of human thrombin with a commercial library containing 100 different small molecule compounds, and two inhibitors were successfully identified and confirmed.

A new metabolomic assay to examine inflammation and redox pathways following LPS challenge

PubMed Central

2012-01-01

Background Shifts in intracellular arginine (Arg) and sulfur amino acid (SAA) redox metabolism modulate macrophage activation, polarization and phenotype. Despite their importance in inflammation and redox regulatory pathways, comprehensive analysis of these metabolic networks was not previously possible with existing analytical methods. Methods The Arg/thiol redox LC-MS/MS metabolomics assay permits simultaneous assessment of amino acids and derivative products generated from Arg and SAA metabolism. Using this assay, LPS-induced changes in macrophage amino acid metabolism were monitored to identify pathway shifts during activation and their linkage to cellular redox regulation. Results Metabolite concentrations most significantly changed after treatment of a macrophage-like cell line (RAW) with LPS for 24 hrs were citrulline (Cit) (48-fold increase), ornithine (Orn) (8.5-fold increase), arginine (Arg) (66% decrease), and aspartic acid (Asp) (73% decrease). The ratio Cit + Orn/Arg + Asp (CO/AA) was more sensitive to LPS stimulation than other amino acid ratios commonly used to measure LPS-dependent inflammation (e.g., SAM/SAH, GSH/GSSG) and total media NOx. The CO/AA ratio was also the first ratio to change significantly after LPS treatment (4 hrs). Changes in the overall metabolomic profile over time indicated that metabolic pathways shifted from Arg catabolism to thiol oxidation. Conclusions Simultaneous quantification of Arg and SAA metabolic pathway shifts following LPS challenge of macrophage indicate that, in this system, the Arg-Citrulline/NO cycle and arginase pathways are the amino acid metabolic pathways most sensitive to LPS-challenge. The cellular (Cit + Orn)/(Arg + Asp) ratio, which summarizes this pathway, was more responsive to lower concentrations of LPS and responded earlier than other metabolic biomarkers of macrophage activation including GSH redox. It is suggested that the CO/AA ratio is a redox- independent early biomarker of macrophage activation. The ability to measure both the CO/AA and GSH-redox ratios simultaneously permits quantification of the relative effects of LPS challenge on macrophage inflammation and oxidative stress pathways. The use of this assay in humans is discussed, as are clinical implications. PMID:23036094

Diaphorase Coupling Protocols for Red-Shifting Dehydrogenase Assays

PubMed Central

Davis, Mindy I.; Shen, Min; Simeonov, Anton

2016-01-01

Abstract Dehydrogenases are an important target for the development of cancer therapeutics. Dehydrogenases either produce or consume NAD(P)H, which is fluorescent but at a wavelength where many compounds found in chemical libraries are also fluorescent. By coupling dehydrogenases to diaphorase, which utilizes NAD(P)H to produce the fluorescent molecule resorufin from resazurin, the assay can be red-shifted into a spectral region that reduces interference from compound libraries. Dehydrogenases that produce NAD(P)H, such as isocitrate dehydrogenase 1 (IDH1), can be read in kinetic mode. Dehydrogenases that consume NAD(P)H, such as mutant IDH1 R132H, can be read in endpoint mode. Here, we report protocols for robust and miniaturized 1,536-well assays for WT IDH1 and IDH1 R132H coupled to diaphorase, and the counterassays used to further detect compound interference with the coupling reagents. This coupling technique is applicable to dehydrogenases that either produce or consume NAD(P)H, and the examples provided here can act as guidelines for the development of high-throughput screens against this enzyme class. PMID:27078681

Live Cell Visualization of Multiple Protein-Protein Interactions with BiFC Rainbow.

PubMed

Wang, Sheng; Ding, Miao; Xue, Boxin; Hou, Yingping; Sun, Yujie

2018-05-18

As one of the most powerful tools to visualize PPIs in living cells, bimolecular fluorescence complementation (BiFC) has gained great advancement during recent years, including deep tissue imaging with far-red or near-infrared fluorescent proteins or super-resolution imaging with photochromic fluorescent proteins. However, little progress has been made toward simultaneous detection and visualization of multiple PPIs in the same cell, mainly due to the spectral crosstalk. In this report, we developed novel BiFC assays based on large-Stokes-shift fluorescent proteins (LSS-FPs) to detect and visualize multiple PPIs in living cells. With the large excitation/emission spectral separation, LSS-FPs can be imaged together with normal Stokes shift fluorescent proteins to realize multicolor BiFC imaging using a simple illumination scheme. We also further demonstrated BiFC rainbow combining newly developed BiFC assays with previously established mCerulean/mVenus-based BiFC assays to achieve detection and visualization of four PPI pairs in the same cell. Additionally, we prove that with the complete spectral separation of mT-Sapphire and CyOFP1, LSS-FP-based BiFC assays can be readily combined with intensity-based FRET measurement to detect ternary protein complex formation with minimal spectral crosstalk. Thus, our newly developed LSS-FP-based BiFC assays not only expand the fluorescent protein toolbox available for BiFC but also facilitate the detection and visualization of multiple protein complex interactions in living cells.

Activation of a development-specific gene, dofA, by FruA, an essential transcription factor for development of Myxococcus xanthus.

PubMed

Ueki, Toshiyuki; Inouye, Sumiko

2005-12-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

Detection of DNA damage in workers exposed to JP-8 jet fuel.

PubMed

Krieg, Edward F; Mathias, Patricia I; Toennis, Christine A; Clark, John C; Marlow, Kate L; B'hymer, Clayton; Singh, Narendra P; Gibson, Roger L; Butler, Mary Ann

2012-09-18

The genotoxicity of jet propulsion fuel 8 (JP-8) was assessed in the leukocytes of archived blood specimens from U.S. Air Force personnel using the comet assay. No differences in mean comet assay measurements were found between low, moderate, and high exposure groups before or after a 4h work shift. Before the work shift, mean tail DNA and mean tail (Olive) moment increased as the concentration of benzene measured in end-exhaled breath increased, indicating that prior environmental or work-related exposures to benzene produced DNA damage. The number of cells with highly damaged DNA decreased as the pre-shift benzene concentration in breath increased. It is not clear why the decrease is occurring. Mean tail DNA and mean tail (Olive) moment decreased as the concentrations of benzene and naphthalene measured in breath immediately after the work shift increased. These inverse relationships may reflect a slower rate of absorption or a faster rate of expiration of benzene in the lung. The number of cells with highly damaged DNA increased as the concentration of urinary (2-methoxyethoxy)acetic acid (MEAA) increased. This relationship was not seen in urinary MEAA adjusted for creatinine. MEAA is a metabolite of the deicing agent 2-(2-methoxyethoxy)ethanol contained in JP-8. MEAA or a component of JP-8 correlated with MEAA may have a toxic effect on DNA. Published by Elsevier B.V.

Activation of a Development-Specific Gene, dofA, by FruA, an Essential Transcription Factor for Development of Myxococcus xanthus

PubMed Central

Ueki, Toshiyuki; Inouye, Sumiko

2005-01-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development. PMID:16321956

A novel hsp110-related gene, apg-1, that is abundantly expressed in the testis responds to a low temperature heat shock rather than the traditional elevated temperatures.

PubMed

Kaneko, Y; Nishiyama, H; Nonoguchi, K; Higashitsuji, H; Kishishita, M; Fujita, J

1997-01-31

We isolated a novel hsp110-related gene, apg-1, from a testis cDNA library. The apg-1 transcripts were constitutively expressed in the testicular germ cells and, in some degree, most tissues examined. In a mouse TAMA26 Sertoli cell line, apg-1 transcripts were induced in 2 h by a temperature shift from 32 to 39 degrees C, but not by a shift from 37 to 42 degrees C, the traditional heat stress, or a shift from 32 to 42 degrees C. The heat response pattern of hsp110 expression was similar to that of apg-1. Although induction of a hsp70 transcript was observed in 2 h by a shift from 32 to 39 degrees C, the induction was more apparent by a shift from 37 to 42 degrees C or from 32 to 42 degrees C. Essentially similar differential response patterns were observed among these genes in NIH/3T3 fibroblasts as well. The nuclear run-on assay and the native gel mobility shift assay demonstrated that, by the 32 to 39 degrees C temperature shift, the apg-1 gene was transcriptionally activated, and heat shock factor 1 bound to the heat shock elements in the 5'-flanking region of the apg-1 gene. These results demonstrated that expressions of apg-1, hsp110, and hsp70 could be heat-induced at a temperature lower than the traditional elevated temperatures in somatic cells of both testis and nontestis origin and suggest that the mechanisms regulating the transcript levels of apg-1 and hsp110 are different from those of hsp70. Furthermore, the constitutive expression in germ cells suggests that APG-1 plays a specific role in spermatogenesis as well as in stress response.

Leveraging the contribution of thermodynamics in drug discovery with the help of fluorescence-based thermal shift assays.

PubMed

Hau, Jean Christophe; Fontana, Patrizia; Zimmermann, Catherine; De Pover, Alain; Erdmann, Dirk; Chène, Patrick

2011-06-01

The development of new drugs with better pharmacological and safety properties mandates the optimization of several parameters. Today, potency is often used as the sole biochemical parameter to identify and select new molecules. Surprisingly, thermodynamics, which is at the core of any interaction, is rarely used in drug discovery, even though it has been suggested that the selection of scaffolds according to thermodynamic criteria may be a valuable strategy. This poor integration of thermodynamics in drug discovery might be due to difficulties in implementing calorimetry experiments despite recent technological progress in this area. In this report, the authors show that fluorescence-based thermal shift assays could be used as prescreening methods to identify compounds with different thermodynamic profiles. This approach allows a reduction in the number of compounds to be tested in calorimetry experiments, thus favoring greater integration of thermodynamics in drug discovery.

Quantitation of proteins using a dye-metal-based colorimetric protein assay.

PubMed

Antharavally, Babu S; Mallia, Krishna A; Rangaraj, Priya; Haney, Paul; Bell, Peter A

2009-02-15

We describe a dye-metal (polyhydroxybenzenesulfonephthalein-type dye and a transition metal) complex-based total protein determination method. The binding of the complex to protein causes a shift in the absorption maximum of the dye-metal complex from 450 to 660 nm. The dye-metal complex has a reddish brown color that changes to green on binding to protein. The color produced from this reaction is stable and increases in a proportional manner over a broad range of protein concentrations. The new Pierce 660 nm Protein Assay is very reproducible, rapid, and more linear compared with the Coomassie dye-based Bradford assay. The assay reagent is room temperature stable, and the assay is a simple and convenient mix-and-read format. The assay has a moderate protein-to-protein variation and is compatible with most detergents, reducing agents, and other commonly used reagents. This is an added advantage for researchers needing to determine protein concentrations in samples containing both detergents and reducing agents.

Detection and Spatial Mapping of Mercury Contamination in Water Samples Using a Smart-Phone

DTIC Science & Technology

2014-01-20

Au NP) and aptamer based colorimetric transmission assay that is implemented in disposable test tubes. With this smart-phone attachment that weighs...detection . colorimetric sensor . gold nanoparticles . aptamers A RTIC LE Terms of Use WEI ET AL. VOL. 8 ’ NO. 2 ’ 1121–1129 ’ 2014 www.acsnano.org 1122...a colorimetric assay utilizing citrate-stabilized plasmonic AuNPs and aptamers (Apt) mixed within disposable test tubes. Due to the shift in the

New use for CETSA: monitoring innate immune receptor stability via post-translational modification by OGT.

PubMed

Drake, Walter R; Hou, Ching-Wen; Zachara, Natasha E; Grimes, Catherine Leimkuhler

2018-06-01

O-GlcNAcylation is a dynamic and functionally diverse post-translational modification shown to affect thousands of proteins, including the innate immune receptor nucleotide-binding oligomerization domain-containing protein 2 (Nod2). Mutations of Nod2 (R702W, G908R and 1007 fs) are associated with Crohn's disease and have lower stabilities compared to wild type. Cycloheximide (CHX)-chase half-life assays have been used to show that O-GlcNAcylation increases the stability and response of both wild type and Crohn's variant Nod2, R702W. A more rapid method to assess stability afforded by post-translational modifications is necessary to fully comprehend the correlation between NLR stability and O-GlcNAcylation. Here, a recently developed cellular thermal shift assay (CETSA) that is typically used to demonstrate protein-ligand binding was adapted to detect shifts in protein stabilization upon increasing O-GlcNAcylation levels in Nod2. This assay was used as a method to predict if other Crohn's associated Nod2 variants were O-GlcNAcylated, and also identified the modification on another NLR, Nod1. Classical immunoprecipitations and NF-κB transcriptional assays were used to confirm the presence and effect of this modification on these proteins. The results presented here demonstrate that CETSA is a convenient method that can be used to detect the stability effect of O-GlcNAcylation on O-GlcNAc-transferase (OGT) client proteins and will be a powerful tool in studying post-translational modification.

The impact of chronotype on melatonin levels among shift workers.

PubMed

Bhatti, Parveen; Mirick, Dana K; Davis, Scott

2014-03-01

The association between shift work and cancer, which is thought to be mediated by effects on circulating melatonin levels, may be modified by chronotype (ie, the inherent preference for activity in the morning or the evening); however, few studies have examined the potential impact of chronotype on the carcinogenic effects of shift work. The authors analysed the impact of chronotype on previously reported differences in melatonin levels among healthcare workers that exclusively worked night or day shifts. The cross-sectional study included 664 men and women (310 day shift and 354 night shift workers) from which urine samples were collected throughout work and sleep periods and were assayed for 6-sulfatoxymelatonin. Participants also completed the Composite Scale of Morningness, a questionnaire used to assess chronotype. Among both morning and evening-type night shift workers, 6-sulfatoxymelatonin levels were constitutively lower during daytime sleep, night-time sleep and night work compared with day shift workers during night-time sleep. However, morning-type night shift workers consistently showed 6-sulfatoxymelatonin levels that were closer to levels in day shift workers than did evening-type night shift workers. Differences in 6-sulfatoxymelatonin levels between morning-type and evening-type night shift workers relative to day shift workers were statistically significant in every instance (p<0.05). These results suggest that morning-type night shift workers may be better able to maintain a 'normal' circadian pattern of melatonin production as compared with evening-type night shift workers. The impact of this chronotype effect on cancer risk among shift workers requires further study.

Detection of myxoma viruses encoding a defective M135R gene from clinical cases of myxomatosis; possible implications for the role of the M135R protein as a virulence factor.

PubMed

Belsham, Graham J; Polacek, Charlotta; Breum, Solvej Ø; Larsen, Lars E; Bøtner, Anette

2010-01-16

Myxoma virus is a member of the Poxviridae and causes disease in European rabbits. Laboratory confirmation of the clinical disease, which occurs in the autumn of most years in Denmark, has been achieved previously using antigen ELISA and electron microscopy. An unusually large number of clinically suspected cases of myxomatosis were observed in Denmark during 2007. Myxoma virus DNA was detected, using a new real time PCR assay which targets the M029L gene, in over 70% of the clinical samples submitted for laboratory confirmation. Unexpectedly, further analysis revealed that a high proportion of these viral DNA preparations contained a frame-shift mutation within the M135R gene that has previously been identified as a virulence factor. This frame-shift mutation results in expression of a greatly truncated product. The same frame-shift mutation has also been found recently within an avirulent strain of myxoma virus (6918). However, three other frame-shift mutations found in this strain (in the genes M009L, M036L and M148R) were not shared with the Danish viruses but a single nucleotide deletion in the M138R/M139R intergenic region was a common feature. It appears that expression of the full-length myxoma virus M135R protein is not required for virulence in rabbits. Hence, the frame-shift mutation in the M135R gene in the nonpathogenic 6918 virus strain is not sufficient to explain the attenuation of this myxoma virus but one/some of the other frame-shift mutations alone or in conjunction with one/some of the thirty two amino acid substitutions must also contribute. The real time PCR assay for myxoma virus is a useful diagnostic tool for laboratory confirmation of suspected cases of myxomatosis.

Detection of myxoma viruses encoding a defective M135R gene from clinical cases of myxomatosis; possible implications for the role of the M135R protein as a virulence factor

PubMed Central

2010-01-01

Background Myxoma virus is a member of the Poxviridae and causes disease in European rabbits. Laboratory confirmation of the clinical disease, which occurs in the autumn of most years in Denmark, has been achieved previously using antigen ELISA and electron microscopy. Results An unusually large number of clinically suspected cases of myxomatosis were observed in Denmark during 2007. Myxoma virus DNA was detected, using a new real time PCR assay which targets the M029L gene, in over 70% of the clinical samples submitted for laboratory confirmation. Unexpectedly, further analysis revealed that a high proportion of these viral DNA preparations contained a frame-shift mutation within the M135R gene that has previously been identified as a virulence factor. This frame-shift mutation results in expression of a greatly truncated product. The same frame-shift mutation has also been found recently within an avirulent strain of myxoma virus (6918). However, three other frame-shift mutations found in this strain (in the genes M009L, M036L and M148R) were not shared with the Danish viruses but a single nucleotide deletion in the M138R/M139R intergenic region was a common feature. Conclusions It appears that expression of the full-length myxoma virus M135R protein is not required for virulence in rabbits. Hence, the frame-shift mutation in the M135R gene in the nonpathogenic 6918 virus strain is not sufficient to explain the attenuation of this myxoma virus but one/some of the other frame-shift mutations alone or in conjunction with one/some of the thirty two amino acid substitutions must also contribute. The real time PCR assay for myxoma virus is a useful diagnostic tool for laboratory confirmation of suspected cases of myxomatosis. PMID:20078890

Targeting TMPRSS2 ERG in Prostate Cancer

DTIC Science & Technology

2016-09-01

Assay development for surface Plasmon resonance with purified ERG protein (months 31-36, completed July 2016) 7c. Perform thermal shift and...surface Plasmon resonance on compounds and determine binding constants (months 37-42, completed July 2016) Task 8. Identify FDA approved drugs that

The Impact of Chronotype on Melatonin Levels Among Shift Workers

PubMed Central

Bhatti, Parveen; Mirick, Dana K.; Davis, Scott

2015-01-01

Objectives The association between shift work and cancer, which is thought to be mediated by effects on circulating melatonin levels, may be modified by chronotype (i.e. the inherent preference for activity in the morning or the evening); however, few studies have examined the potential impact of chronotype on the carcinogenic effects of shift work. The authors analyzed the impact of chronotype on previously reported differences in melatonin levels among healthcare workers that exclusively worked night or day shifts. Methods The cross-sectional study included 664 men and women (310 day shift and 354 night shift workers) from which urine samples were collected throughout work and sleep periods and were assayed for 6-sulfatoxymelatonin. Participants also completed the Composite Scale of Morningness, a questionnaire used to assess chronotype. Results Among both morning and evening-type night shift workers, 6-sulfatoxymelatonin levels were constitutively lower during daytime sleep, nighttime sleep and night work compared to dayshift workers during nighttime sleep. However, morning-type shift workers consistently showed 6-sulfatoxymelatonin levels that were closer to levels in day shift workers than did evening-type night shift workers. Differences in 6-sulfatoxymelatonin levels between morning-type and evening-type night shift workers relative to day shift workers were statistically significant in every instance (p < 0.05). Conclusion These results suggest that morning-type night shift workers may be better able to maintain a ‘normal’ circadian pattern of melatonin production as compared to evening-type night shift workers. The impact of this chronotype effect on cancer risk among shift workers requires further study. PMID:24399070

Complex conductivity response to microbial growth and biofilm formation on phenanthrene spiked medium

NASA Astrophysics Data System (ADS)

Albrecht, Remy; Gourry, Jean Christophe; Simonnot, Marie-Odile; Leyval, Corinne

2011-11-01

Several laboratory studies have recently demonstrated the utility of geophysical methods for the investigation of microbial-induced changes over contaminated sites. However, it remains difficult to distinguish the effects due to the new physical properties imparted by microbial processes, to bacterial growth, or to the development of bacterial biofilm. We chose to study the influence of biofilm formation on geophysical response using complex conductivity measurements (0.1-1000 Hz) in phenanthrene-contaminated media. Biotic assays were conducted with two phenanthrene (PHE) degrading bacterial strains: Burkholderia sp (NAH1), which produced biofilm and Stenophomonas maltophilia (MATE10), which did not, and an abiotic control. Results showed that bacterial densities for NAH1 and MATE10 strains continuously increased at the same rate during the experiment. However, the complex conductivity signature showed noticeable differences between the two bacteria, with a phase shift of 50 mrad at 4 Hz for NAH1, which produced biofilm. Biofilm volume was quantified by Scanning Confocal Laser Microscopy (SCLM). Significant correlations were established between phase shift decrease and biofilm volume for NAH1 assays. Results suggest that complex conductivity measurements, specifically phase shift, can be a useful indicator of biofilm formation inside the overall signal of microbial activity on contaminated sites.

Impact of Work Task-Related Acute Occupational Smoke ...

EPA Pesticide Factsheets

Objective: A repeated measures study was used to assess the effect of work tasks on select proinflammatory biomarkers in firefighters working at prescribed burns. Methods: Ten firefighters and two volunteers were monitored for particulate matter and carbon monoxide on workdays, January-July 2015. Before and after work-shift dried blood spots were analyzed for inflammatory mediators using the Meso Scale Discovery assay, while blood smears were used to assess leukocyte parameters. Results: Firefighters lighting with drip-torches had higher cross-work-shift increases in interleukin-8, C-reactive protein, and serum amyloid A compared to holding, a task involving management of fire boundaries. A positive association between interleukin-8 and segmented-neutrophil was observed. Conclusion: Results from this study suggest that intermittent occupational diesel exposures contribute to cross-work-shift changes in host systemic innate inflammation as indicated by elevated interleukin-8 levels and peripheral blood segmented-neutrophils. The decision whether to perform a prescribed burn balances land use, risk of fire and potential health impacts. Understanding the latter requires a quick non intrusive assay which can be used to monitor the health of those exposed to smoke. This is first study to use blood smears to assess changes in systemic differential leukocyte cell populations following wood smoke exposure from prescribed burn. This research is useful for understandi

Detection and Composition of Bacterial Communities in Waters using RNA-based Methods

EPA Science Inventory

In recent years, microbial water quality assessments have shifted from solely relying on pure culture-based methods to monitoring bacterial groups of interest using molecular assays such as PCR and qPCR. Furthermore, coupling next generation sequencing technologies with ribosomal...

Crosslinking transcription factors to their recognition sequences with PtII complexes

NASA Technical Reports Server (NTRS)

Chu, B. C.; Orgel, L. E.

1992-01-01

We have prepared phosphorothioate-containing cyclic oligodeoxynucleotides that fold into 'dumbbells' containing CRE and TRE sequences, the binding sequences for the CREB and JUN proteins, respectively. Six phosphorothioate residues were introduced into each of the recognition sequences. K2PtCl4 crosslinks CRE to CREB and TRE to JUN. The extent of crosslinking is about eight times greater than that observed with standard oligodeoxynucleotides and amounts to 30-50% of the efficiency of non-covalent association as estimated by gel-shift assays. Crosslinking is reversed by incubation with NaCN. The crosslinking reaction is specific--a dumbbell oligonucleotide with six phosphorothioate groups introduced into the Sp1 recognition sequence could not be crosslinked efficiently to CREB or JUN proteins with K2PtCl4. The binding of TRE to CREB is not strong enough for effective detection by gel-shift assays, but the TRE-CREB complex is crosslinked efficiently by K2PtCl4 and can then readily be detected.

Night shift work and hormone levels in women.

PubMed

Davis, Scott; Mirick, Dana K; Chen, Chu; Stanczyk, Frank Z

2012-04-01

Night shift work may disrupt the normal nocturnal rise in melatonin, resulting in increased breast cancer risk, possibly through increased reproductive hormone levels. We investigated whether night shift work is associated with decreased levels of urinary 6-sulfatoxymelatonin, the primary metabolite of melatonin, and increased urinary reproductive hormone levels. Participants were 172 night shift and 151 day shift-working nurses, aged 20-49 years, with regular menstrual cycles. Urine samples were collected throughout work and sleep periods and assayed for 6-sulfatoxymelatonin, luteinizing hormone (LH), follicle-stimulating hormone (FSH), and estrone conjugate (E1C). 6-Sulfatoxymelatonin levels were 62% lower and FSH and LH were 62% and 58% higher, respectively, in night shift-working women during daytime sleep than in day shift-working women during nighttime sleep (P ≤ 0.0001). Nighttime sleep on off-nights was associated with 42% lower 6-sulfatoxymelatonin levels among the night shift workers, relative to the day shift workers (P < 0.0001); no significant differences in LH or FSH were observed. 6-Sulfatoxymelatonin levels during night work were approximately 69% lower and FSH and LH were 35% and 38% higher, compared with day shift workers during nighttime sleep. No differences in E1C levels between night and day shift workers were observed. Within night shift workers, 6-sulfatoxymelatonin levels were lower and reproductive hormone levels were higher during daytime sleep and nighttime work, relative to nighttime sleep (P < 0.05). These results indicate that night shift workers have substantially reduced 6-sulfatoxymelatonin levels during night work and daytime sleep and that levels remain low even when a night shift worker sleeps at night. Shift work could be an important risk factor for many other cancers in addition to breast cancer. ©2012 AACR.

Developmental Effects of the ToxCast™ Phase I and Phase II Chemicals in Caenorhabditis elegans and Corresponding Responses in Zebrafish, Rats, and Rabbits

PubMed Central

Boyd, Windy A.; Smith, Marjolein V.; Co, Caroll A.; Pirone, Jason R.; Rice, Julie R.; Shockley, Keith R.; Freedman, Jonathan H.

2015-01-01

Background: Modern toxicology is shifting from an observational to a mechanistic science. As part of this shift, high-throughput toxicity assays are being developed using alternative, nonmammalian species to prioritize chemicals and develop prediction models of human toxicity. Methods: The nematode Caenorhabditis elegans (C. elegans) was used to screen the U.S. Environmental Protection Agency’s (EPA’s) ToxCast™ Phase I and Phase II libraries, which contain 292 and 676 chemicals, respectively, for chemicals leading to decreased larval development and growth. Chemical toxicity was evaluated using three parameters: a biologically defined effect size threshold, half-maximal activity concentration (AC50), and lowest effective concentration (LEC). Results: Across both the Phase I and Phase II libraries, 62% of the chemicals were classified as active ≤ 200 μM in the C. elegans assay. Chemical activities and potencies in C. elegans were compared with those from two zebrafish embryonic development toxicity studies and developmental toxicity data for rats and rabbits. Concordance of chemical activity was higher between C. elegans and one zebrafish assay across Phase I chemicals (79%) than with a second zebrafish assay (59%). Using C. elegans or zebrafish to predict rat or rabbit developmental toxicity resulted in balanced accuracies (the average value of the sensitivity and specificity for an assay) ranging from 45% to 53%, slightly lower than the concordance between rat and rabbit (58%). Conclusions: Here, we present an assay that quantitatively and reliably describes the effects of chemical toxicants on C. elegans growth and development. We found significant overlap in the activity of chemicals in the ToxCast™ libraries between C. elegans and zebrafish developmental screens. Incorporating C. elegans toxicological assays as part of a battery of in vitro and in vivo assays provides additional information for the development of models to predict a chemical’s potential toxicity to humans. Citation: Boyd WA, Smith MV, Co CA, Pirone JR, Rice JR, Shockley KR, Freedman JH. 2016. Developmental effects of the ToxCast™ Phase I and II chemicals in Caenorhabditis elegans and corresponding responses in zebrafish, rats, and rabbits. Environ Health Perspect 124:586–593; http://dx.doi.org/10.1289/ehp.1409645 PMID:26496690

NEW TARGET AND CONTROL ASSAYS FOR QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) ANALYSIS OF ENTEROCOCCI IN WATER

EPA Science Inventory

Enterococci are frequently monitored in water samples as indicators of fecal pollution. Attention is now shifting from culture based methods for enumerating these organisms to more rapid molecular methods such as QPCR. Accurate quantitative analyses by this method requires highly...

Water Mass Bio-optical Properties in the Monterey Bay Region: Fluorescence-based Inference of Shifts in Phytoplankton Photophysiology

DTIC Science & Technology

2012-07-26

bottle rosette. Macronutrient and chlorophyll assays were performed using methods detailed in Pennington and Chavez [2000]. High Performance Liquid...S = 33.28) Niskin bottle sample contained 10.6 /<M nitrate. Other macronutrients (phosphate, silicilic acid) were detected and generally abundant

How to report and discuss ADME data in medicinal chemistry publications: in vitro data or in vivo extrapolations?

PubMed

Svennebring, Andreas M

2015-01-01

Early drug discovery projects often utilize data from ADME (absorption, distribution, metabolism, elimination) assays to benchmark data and guide discussion, rather than the predicted in vivo consequences of these data. Here, the two paradigms are compared, using evaluations of metabolic stability based on either microsomal clearance assay data or from the predicted in vivo hepatic clearance and half-life calculated through the combination of the venous well-stirred model and Øie-Tozer's model. The need for a shift in paradigm is presented, and its implications discussed. It is suggested that discussions about ADME data should revolve around potential clinical problems that are most likely to surface during the development phase, each benchmarked with a suitable variable derived from the assay data.

Clear distinction between Burkholderia mallei and Burkholderia pseudomallei using fluorescent motB primers.

PubMed

Schmoock, Gernot; Elschner, Mandy; Sprague, Lisa D

2015-03-07

A frame-shift mutation in the flagellum motor gene motB coding for the chemotaxis MotB protein of Burkholderia mallei has been utilized to design a conventional duplex PCR assay with fluorescent labelled primers. Species specificity was tested with a panel of 13 Burkholderia type strains. A total of 41 B. mallei field strains, 36 B. pseudomallei field strains, and 1 B. thailandensis field strain from different geographic regions were tested and correctly identified. Testing of 55 non-Burkholderia bacterial species revealed 100% specificity of the assay. The minimum detection limit was 1 pg DNA or 160 GE for B. mallei and 130 GE for B. pseudomallei, respectively. This assay enables the clear distinction between B. mallei and B. pseudomallei/B. thailandensis.

hnRNP L binds to CA repeats in the 3'UTR of bcl-2 mRNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Dong-Hyoung; Lim, Mi-Hyun; Youn, Dong-Ye

We previously reported that the CA-repeat sequence in the 3'-untranslated region (3'UTR) of bcl-2 mRNA is involved in the decay of bcl-2 mRNA. However, the trans-acting factor for the CA element in bcl-2 mRNA remains unidentified. The heterogeneous nuclear ribonucleoprotein L (hnRNP L), an intron splicing factor, has been reported to bind to CA repeats and CA clusters in the 3'UTR of several genes. We reported herein that the CA repeats of bcl-2 mRNA have the potential to form a distinct ribonuclear protein complex in cytoplasmic extracts of MCF-7 cells, as evidenced by RNA electrophoretic mobility shift assays (REMSA). Amore » super-shift assay using the hnRNP L antibody completely shifted the complex. Immunoprecipitation with the hnRNP L antibody and MCF-7 cells followed by RT-PCR revealed that hnRNP L interacts with endogenous bcl-2 mRNA in vivo. Furthermore, the suppression of hnRNP L in MCF-7 cells by the transfection of siRNA for hnRNP L resulted in a delay in the degradation of RNA transcripts including CA repeats of bcl-2 mRNA in vitro, suggesting that the interaction between hnRNPL and CA repeats of bcl-2 mRNA participates in destabilizing bcl-2 mRNA.« less

Triple helix-forming oligonucleotide corresponding to the polypyrimidine sequence in the rat alpha 1(I) collagen promoter specifically inhibits factor binding and transcription.

PubMed

Kovacs, A; Kandala, J C; Weber, K T; Guntaka, R V

1996-01-19

Type I and III fibrillar collagens are the major structural proteins of the extracellular matrix found in various organs including the myocardium. Abnormal and progressive accumulation of fibrillar type I collagen in the interstitial spaces compromises organ function and therefore, the study of transcriptional regulation of this gene and specific targeting of its expression is of major interest. Transient transfection of adult cardiac fibroblasts indicate that the polypurine-polypyrimidine sequence of alpha 1(I) collagen promoter between nucleotides - 200 and -140 represents an overall positive regulatory element. DNase I footprinting and electrophoretic mobility shift assays suggest that multiple factors bind to different elements of this promoter region. We further demonstrate that the unique polypyrimidine sequence between -172 and -138 of the promoter represents a suitable target for a single-stranded polypurine oligonucleotide (TFO) to form a triple helix DNA structure. Modified electrophoretic mobility shift assays show that this TFO specifically inhibits the protein-DNA interaction within the target region. In vitro transcription assays and transient transfection experiments demonstrate that the transcriptional activity of the promoter is inhibited by this oligonucleotide. We propose that TFOs represent a therapeutic potential to specifically influence the expression of alpha 1(I) collagen gene in various disease states where abnormal type I collagen accumulation is known to occur.

Ligand induced stabilization of the melting temperature of the HSV-1 single-strand DNA binding protein using the thermal shift assay.

PubMed

Rupesh, Kanchi Ravi; Smith, Aaron; Boehmer, Paul E

2014-11-28

We have adapted the thermal shift assay to measure the ligand binding properties of the herpes simplex virus-1 single-strand DNA binding protein, ICP8. By measuring SYPRO Orange fluorescence in microtiter plates using a fluorescence-enabled thermal cycler, we have quantified the effects of oligonucleotide ligands on the melting temperature of ICP8. We found that single-stranded oligomers raise the melting temperature of ICP8 in a length- and concentration-dependent manner, ranging from 1°C for (dT)5 to a maximum of 9°C with oligomers ⩾10 nucleotides, with an apparent Kd of <1μM for (dT)20. Specifically, the results indicate that ICP8 is capable of interacting with oligomers as short as 5 nucleotides. Moreover, the observed increases in melting temperature of up to 9°C, indicates that single-strand DNA binding significantly stabilizes the structure of ICP8. This assay may be applied to investigate the ligand binding proteins of other single-strand DNA binding proteins and used as a high-throughput screen to identify compounds with therapeutic potential that inhibit single-strand DNA binding. As proof of concept, the single-strand DNA binding agent ciprofloxacin reduces the ligand induced stabilization of the melting temperature of ICP8 in a dose-dependent manner. Copyright © 2014 Elsevier Inc. All rights reserved.

External quality assurance of malaria nucleic acid testing for clinical trials and eradication surveillance.

PubMed

Murphy, Sean C; Hermsen, Cornelus C; Douglas, Alexander D; Edwards, Nick J; Petersen, Ines; Fahle, Gary A; Adams, Matthew; Berry, Andrea A; Billman, Zachary P; Gilbert, Sarah C; Laurens, Matthew B; Leroy, Odile; Lyke, Kristen E; Plowe, Christopher V; Seilie, Annette M; Strauss, Kathleen A; Teelen, Karina; Hill, Adrian V S; Sauerwein, Robert W

2014-01-01

Nucleic acid testing (NAT) for malaria parasites is an increasingly recommended diagnostic endpoint in clinical trials of vaccine and drug candidates and is also important in surveillance of malaria control and elimination efforts. A variety of reported NAT assays have been described, yet no formal external quality assurance (EQA) program provides validation for the assays in use. Here, we report results of an EQA exercise for malaria NAT assays. Among five centers conducting controlled human malaria infection trials, all centers achieved 100% specificity and demonstrated limits of detection consistent with each laboratory's pre-stated expectations. Quantitative bias of reported results compared to expected results was generally <0.5 log10 parasites/mL except for one laboratory where the EQA effort identified likely reasons for a general quantitative shift. The within-laboratory variation for all assays was low at <10% coefficient of variation across a range of parasite densities. Based on this study, we propose to create a Molecular Malaria Quality Assessment program that fulfills the need for EQA of malaria NAT assays worldwide.

Amino acids in a targeted versus a non-targeted metabolomics LC-MS/MS assay. Are the results consistent?

PubMed

Klepacki, Jacek; Klawitter, Jost; Klawitter, Jelena; Karimpour-Fard, Anis; Thurman, Joshua; Ingle, Gordon; Patel, Dharmesh; Christians, Uwe

2016-09-01

The results of plasma amino acid patterns in samples from kidney transplant patients with good and impaired renal function using a targeted LC-MS/MS amino acid assay and a non-targeted metabolomics assay were compared. EDTA plasma samples were prospectively collected at baseline, 1, 2, 4 and 6months post-transplant (n=116 patients, n=398 samples). Each sample was analyzed using both a commercial amino acid LC-MS/MS assay and a non-targeted metabolomics assay also based on MS/MS ion transitions. The results of both assays were independently statistically analyzed to identify amino acids associated with estimated glomerular filtration rates using correlation and partial least squares-discriminant analysis. Although there was overlap between the results of the targeted and non-targeted metabolomics assays (tryptophan, 1-methyl histidine), there were also substantial inconsistencies, with the non-targeted assay resulting in more "hits" than the targeted assay. Without further verification of the hits detected by the non-targeted discovery assay, this would have led to different interpretation of the results. There were also false negative results when the non-targeted assay was used (hydroxy proline). Several of said discrepancies could be explained by loss of sensitivity during analytical runs for selected amino acids (serine and threonine), retention time shifts, signals above the range of linear detector response and integration of peaks not separated from background and interferences (aspartate) when the non-targeted metabolomics assay was used. Whenever assessment of a specific pathway such as amino acids is the focus of interest, a targeted seems preferable to a non-targeted metabolomics assay. Copyright © 2016. Published by Elsevier Inc.

Regulatory motifs for CREB-binding protein and Nfe2l2 transcription factors in the upstream enhancer of the mitochondrial uncoupling protein 1 gene.

PubMed

Rim, Jong S; Kozak, Leslie P

2002-09-13

Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.

Characterization of biomolecular nanoconjugates by high-throughput delivery and spectroscopic difference

PubMed Central

DeLong, Robert K; Risor, Azure; Kanomata, Masaaki; Laymon, Amanda; Jones, Brooke; Zimmerman, Scott D; Williams, Joseph; Witkowski, Colette; Warner, Mathew; Ruff, Michael; Garrad, Richard; Fallon, John K; Hickey, Anthony J; Sedaghat-Herati, Reza

2013-01-01

Aims Nanoparticle conjugates have the potential for delivering siRNA, splice-shifting oligomers or nucleic acid vaccines, and can be applicable to anticancer therapeutics. This article compares tripartite conjugates with gold nanoparticles or synthetic methoxypoly(ethylene glycol)-block-polyamidoamine dendrimers. Materials & methods Interactions with model liposomes of a 1:1 molar ratio of tripalmitin:cholesterol or phospholipid:cholesterol were investigated by high-throughput absorbance, as well as fluorescence difference and cellular luminescence assays. Results Spectral differences and dynamic light-scattering spectroscopy shifts demonstrated the interaction of conjugates with liposomes. Biological activity was demonstrated by upregulation of gene expression via splice-shifting oligomers, delivery of anti-B-Raf siRNA in cultured human cancer cells or tuberculosis antigen 85B plasmid expression vector in a coculture model of antigen presentation. Conclusion The data suggests that gold nanoparticles and methoxypoly(ethylene glycol)-block-polyamidoamine dendrimer nanoconjugates may have potential for binding, stabilization and delivery of splice-shifting oligomers, siRNA and nucleic acid vaccines for preclinical trials. PMID:22943129

An Optimized Protocol for Electrophoretic Mobility Shift Assay Using Infrared Fluorescent Dye-labeled Oligonucleotides.

PubMed

Hsieh, Yi-Wen; Alqadah, Amel; Chuang, Chiou-Fen

2016-11-29

Electrophoretic Mobility Shift Assays (EMSA) are an instrumental tool to characterize the interactions between proteins and their target DNA sequences. Radioactivity has been the predominant method of DNA labeling in EMSAs. However, recent advances in fluorescent dyes and scanning methods have prompted the use of fluorescent tagging of DNA as an alternative to radioactivity for the advantages of easy handling, saving time, reducing cost, and improving safety. We have recently used fluorescent EMSA (fEMSA) to successfully address an important biological question. Our fEMSA analysis provides mechanistic insight into the effect of a missense mutation, G73E, in the highly conserved HMG transcription factor SOX-2 on olfactory neuron type diversification. We found that mutant SOX-2 G73E protein alters specific DNA binding activity, thereby causing olfactory neuron identity transformation. Here, we present an optimized and cost-effective step-by-step protocol for fEMSA using infrared fluorescent dye-labeled oligonucleotides containing the LIM-4/SOX-2 adjacent target sites and purified SOX-2 proteins (WT and mutant SOX-2 G73E proteins) as a biological example.

Probing the Intermediacy of Covalent RNA Enzyme Complexes in RNA Modification Enzymes

PubMed Central

Chervin, Stephanie M.; Kittendorf, Jeffrey D.; Garcia, George A.

2009-01-01

Within the large and diverse group of RNA-modifying enzymes, a number of enzymes seem to form stable covalent linkages to their respective RNA substrates. A complete understanding of the chemical and kinetic mechanisms of these enzymes, some of which have identified pathological roles, is lacking. As part of our ongoing work studying the posttranscriptional modification of tRNA with queuine, we wish to understand fully the chemical and kinetic mechanisms involved in this key transglycosylation reaction. In our previous investigations, we have used a gel mobility-shift assay to characterize an apparent covalent enzyme-RNA intermediate believed to be operative in the catalytic pathway. However, the simple observation of a covalent complex is not sufficient to prove intermediacy. To be a true intermediate, the complex must be both chemically and kinetically competent. As a case study for the proof of intermediacy, we report the use of this gel-shift assay under mildly denaturing conditions to probe the kinetic competency of the covalent association between RNA and the tRNA modifying enzyme tRNA-guanine transglycosylase (TGT). PMID:17673081

Dye-binding protein assay using a long-wave-absorbing cyanine probe.

PubMed

Zheng, Hong; Mao, Yu Xia; Li, Dong Hui; Zhu, Chang Qing

2003-07-01

A simple and fast protein assay that involves the binding of water-soluble sulfonate heptamethylene cyanine to protein is described. The binding of the dye to protein causes a shift in the absorption maximum of the dye from 778 to 904 nm, and the increase in absorption at 904 nm is monitored. This assay is very reproducible, of good color stability for at least 80 min, and sensitive at the 100 ng/mL level of human serum albumin (HSA) when a spectrophotometer with near-infrared wavelength is used to measure absorbance. Few chemicals except ionic surfactants such as cetyltrimethylammonium bromide and sodium dodecyl sulfonate interfere with the assay. Purified proteins have different capacities to interact with the dye; under the experimental conditions, the linear ranges of bovine serum albumin (BSA), HSA and gamma-IgG were 200-2000, 100-2400, and 200-3000 ng/mL, respectively. The relative standard deviation for the five replicate determinations of 1200 ng/mL BSA is 2.1%.

A localized surface plasmon resonance (LSPR) immunosensor for CRP detection using 4-chloro-1-naphtol (4-CN) precipitation

NASA Astrophysics Data System (ADS)

Ha, Su-Ji; Park, Jin-Ho; Byun, Ju-Young; Ahn, Young-Deok; Kim, Min-Gon

2017-07-01

In this study, C-reactive protein (CRP) was detected by monitoring of LSPR shift promoted by precipitation of 4-chloro-1-naphthol (4-CN). The precipitation occurred by horseradish peroxide (HRP) catalyst which is modified at CRP-detection antibody utilized in sandwich enzyme-linked immunosorbent assay (ELISA) on gold nano bipyramid (GNBP) substrate. Due to 4-CN precipitates which are located nearby the surface of GNBP, local refractive index (RI) and molecular density were greatly increased. This phenomenon eventually induced strong spectral red-shift of absorption band of GNBP. An excellent linear relationship (R2=0.9895) between the LSPR shift and CRP concentration was obtained in the range from 100 pg/mL to 100 ng/mL and limit of detection (LOD) was reached to 87 pg/mL.

UV damage-specific DNA-binding protein in xeroderma pigmentosum complementation group E

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kataoka, H.; Fujiwara, Y.

1991-03-29

The gel mobility shift assay method revealed a specifically ultraviolet (UV) damage recognizing, DNA-binding protein in nuclear extracts of normal human cells. The resulted DNA/protein complexes caused the two retarded mobility shifts. Four xeroderma pigmentosum complementation group E (XPE) fibroblast strains derived from unrelated Japanese families were not deficient in such a DNA damage recognition/binding protein because of the normal complex formation and gel mobility shifts, although we confirmed the reported lack of the protein in the European XPE (XP2RO and XP3RO) cells. Thus, the absence of this binding protein is not always commonly observed in all the XPE strains,more » and the partially repair-deficient and intermediately UV-hypersensitive phenotype of XPE cells are much similar whether or not they lack the protein.« less

Fragment screening using capillary electrophoresis (CEfrag) for hit identification of heat shock protein 90 ATPase inhibitors.

PubMed

Austin, Carol; Pettit, Simon N; Magnolo, Sharon K; Sanvoisin, Jonathan; Chen, Wenjie; Wood, Stephen P; Freeman, Lauren D; Pengelly, Reuben J; Hughes, Dallas E

2012-08-01

CEfrag is a new fragment screening technology based on affinity capillary electrophoresis (ACE). Here we report on the development of a mobility shift competition assay using full-length human heat shock protein 90α (Hsp90α), radicicol as the competitor probe ligand, and successful screening of the Selcia fragment library. The CEfrag assay was able to detect weaker affinity (IC(50) >500 µM) fragments than were detected by a fluorescence polarization competition assay using FITC-labeled geldanamycin. The binding site of selected fragments was determined by co-crystallization with recombinant Hsp90α N-terminal domain and X-ray analysis. The results of this study confirm that CEfrag is a sensitive microscale technique enabling detection of fragments binding to the biological target in near-physiological solution.

Biochemical analysis of NSs from different tospoviruses.

PubMed

Hedil, Marcio; de Ronde, Dryas; Kormelink, Richard

2017-10-15

Tospoviruses suppress antiviral RNA interference by coding for an RNA silencing suppressor (NSs) protein. Previously, using NSs-containing crude plant and insect cell extracts, the affinity of NSs for double-stranded (ds)RNA molecules was demonstrated by electrophoretic mobility shifts assays (EMSAs). While NSs from tomato spotted wilt virus (TSWV) and groundnut ringspot virus (GRSV) were able to bind small and long dsRNA molecules, the one from tomato yellow ring virus (TYRV), a distinct Asian tospovirus, only bound small dsRNA. Here, using bacterially expressed and purified NSs from GRSV and TYRV, it is shown that they are both able to bind to small and long dsRNA. Binding of siRNAs by NSs revealed two consecutive shifts, i.e. a first shift at low NSs concentrations followed by a second larger one at higher concentrations. When NSs of TSWV resistance inducing (RI) and resistance breaking (RB) isolates were analyzed using extracts from infected plants only a major siRNA shift was observed. In contrast, plant extracts containing the respective transiently expressed NSs proteins showed only the lower shift with NSs RI but no shift with NSs RB . The observed affinity for RNA duplexes, as well as the two-stepwise shift pattern, is discussed in light of NSs as a suppressor of silencing and its importance for tospovirus infection. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

The Impact of Gate Width Setting and Gate Utilization Factors on Plutonium Assay in Passive Correlated Neutron Counting

DOE PAGES

Henzlova, Daniela; Menlove, Howard Olsen; Croft, Stephen; ...

2015-06-15

In the field of nuclear safeguards, passive neutron multiplicity counting (PNMC) is a method typically employed in non-destructive assay (NDA) of special nuclear material (SNM) for nonproliferation, verification and accountability purposes. PNMC is generally performed using a well-type thermal neutron counter and relies on the detection of correlated pairs or higher order multiplets of neutrons emitted by an assayed item. To assay SNM, a set of parameters for a given well-counter is required to link the measured multiplicity rates to the assayed item properties. Detection efficiency, die-away time, gate utilization factors (tightly connected to die-away time) as well as optimummore » gate width setting are among the key parameters. These parameters along with the underlying model assumptions directly affect the accuracy of the SNM assay. In this paper we examine the role of gate utilization factors and the single exponential die-away time assumption and their impact on the measurements for a range of plutonium materials. In addition, we examine the importance of item-optimized coincidence gate width setting as opposed to using a universal gate width value. Finally, the traditional PNMC based on multiplicity shift register electronics is extended to Feynman-type analysis and application of this approach to Pu mass assay is demonstrated.« less

Development of methods to detect occurrence and effects of endocrine-disrupting chemicals: A fundamental shift in regulatory ecotoxicology

EPA Science Inventory

This is an editorial in ET&C describing the newer pathway-specific test methods for EDCs and their effect on ecotoxicology. Work conducted to support the development and application of these types of assays promises to be an important catalyst to advance the field of ecotoxicolo...

Transcriptional regulation of the cytosolic chaperonin theta subunit gene, Cctq, by Ets domain transcription factors Elk-1, Sap-1a, and Net in the absence of serum response factor.

PubMed

Yamazaki, Yuji; Kubota, Hiroshi; Nozaki, Masami; Nagata, Kazuhiro

2003-08-15

The chaperonin-containing t-complex polypeptide 1 (CCT) is a molecular chaperone that facilitates protein folding in eukaryotic cytosol, and the expression of CCT is highly dependent on cell growth. We show here that transcription of the gene encoding the theta subunit of mouse CCT, Cctq, is regulated by the ternary complex factors (TCFs), Elk-1, Sap-1a, and Net (Sap-2). Reporter gene assay using HeLa cells indicated that the Cctq gene promoter contains a cis-acting element of the CCGGAAGT sequence (CQE1) at -36 bp. The major CQE1-binding proteins in HeLa cell nuclear extract was recognized by anti-Elk-1 or anti-Sap-1a antibodies in electrophoretic mobility shift assay, and recombinant Elk-1, Sap-1a, or Net specifically recognized CQE1. The CQE1-dependent transcriptional activity in HeLa cells was virtually abolished by overexpression of the DNA binding domains of TCFs. Overexpression of full-length TCFs with Ras indicated that exogenous TCFs can regulate the CQE1-dependent transcription in a Ras-dependent manner. PD98059, an inhibitor of MAPK, significantly repressed the CQE1-dependent transcription. However, no serum response factor was detected by electrophoretic mobility shift assay using the CQE1 element. These results indicate that transcription of the Cctq gene is regulated by TCFs under the control of the Ras/MAPK pathway, probably independently of serum response factor.

Monitoring multiple myeloma patients treated with daratumumab: teasing out monoclonal antibody interference.

PubMed

McCudden, Christopher; Axel, Amy E; Slaets, Dominique; Dejoie, Thomas; Clemens, Pamela L; Frans, Sandy; Bald, Jaime; Plesner, Torben; Jacobs, Joannes F M; van de Donk, Niels W C J; Moreau, Philippe; Schecter, Jordan M; Ahmadi, Tahamtan; Sasser, A Kate

2016-06-01

Monoclonal antibodies are promising anti-myeloma treatments. As immunoglobulins, monoclonal antibodies have the potential to be identified by serum protein electrophoresis (SPE) and immunofixation electrophoresis (IFE). Therapeutic antibody interference with standard clinical SPE and IFE can confound the use of these tests for response assessment in clinical trials and disease monitoring. To discriminate between endogenous myeloma protein and daratumumab, a daratumumab-specific immunofixation electrophoresis reflex assay (DIRA) was developed using a mouse anti-daratumumab antibody. To evaluate whether anti-daratumumab bound to and shifted the migration pattern of daratumumab, it was spiked into daratumumab-containing serum and resolved by IFE/SPE. The presence (DIRA positive) or absence (DIRA negative) of residual M-protein in daratumumab-treated patient samples was evaluated using predetermined assessment criteria. DIRA was evaluated for specificity, limit of sensitivity, and reproducibility. In all of the tested samples, DIRA distinguished between daratumumab and residual M-protein in commercial serum samples spiked with daratumumab and in daratumumab-treated patient samples. The DIRA limit of sensitivity was 0.2 g/L daratumumab, using spiking experiments. Results from DIRA were reproducible over multiple days, operators, and assays. The anti-daratumumab antibody was highly specific for daratumumab and did not shift endogenous M-protein. As the treatment of myeloma evolves to incorporate novel monoclonal antibodies, additional solutions will be needed for clinical monitoring of patient responses to therapeutic regimens. In the interim, assays such as DIRA can inform clinical outcomes by distinguishing daratumumab from endogenous M-protein by IFE.

A rhodium(III)-based inhibitor of autotaxin with antiproliferative activity.

PubMed

Kang, Tian-Shu; Wang, Wanhe; Zhong, Hai-Jing; Liang, Jia-Xin; Ko, Chung-Nga; Lu, Jin-Jian; Chen, Xiu-Ping; Ma, Dik-Lung; Leung, Chung-Hang

2017-02-01

Cancer of the skin is by far the most common of all cancers. Melanoma accounts for only about 1% of skin cancers but causes a large majority of skin cancer deaths. Autotaxin (ATX), also known as ectonucleotide pyrophosphatase/phosphodiesterase 2 (ENPP2), regulates physiological and pathological functions of lysophosphatidic acid (LPA), and is thus an important therapeutic target. We synthesized ten metal-based complexes and a novel cyclometalated rhodium(III) complex 1 was identified as an ATX enzymatic inhibitor using multiple methods, including ATX enzymatic assay, thermal shift assay, western immunoblotting and so on. Protein thermal shift assays showed that 1 increased the melting temperature (T m ) of ATX by 3.5°C. 1 also reduced ATX-LPA mediated downstream survival signal pathway proteins such as ERK and AKT, and inhibited the activation of the transcription factor nuclear factor κB (NF-κB) and signal transducer and activator of transcription 3 (STAT3). 1 also exhibited strong anti-proliferative activity against A2058 melanoma cells (IC 50 =0.58μM). Structure-activity relationship indicated that both the rhodium(III) center and the auxiliary ligands of complex 1 are important for bioactivity. 1 represents a promising scaffold for the development of small-molecule ATX inhibitors for anti-tumor applications. To our knowledge, complex 1 is the first metal-based ATX inhibitor reported to date. Rhodium complexes will have the increased attention in therapeutic and bioanalytical applications. Copyright © 2016 Elsevier B.V. All rights reserved.

Unattended Multiplicity Shift Register

DOE Office of Scientific and Technical Information (OSTI.GOV)

Newell, Matt; Jones, David C.

2017-01-16

The Unattended Multiplicity Shift Register (UMSR) is a specialized pulse counter used primarily to count neutron events originating in neutron detection instruments. While the counter can be used to count any TTL input pulses, its unique ability to record time correlated events and the multiplicity distributions of these events makes it an ideal instrument for counting neutron events in the nuclear fields of material safeguards, waste assay and process monitoring and control. The UMSR combines the Los Alamos National Laboratory (LANL) simple and robust shift register design with a Commercial-Off-The-Shelf (COTS) processor and Ethernet communications. The UMSR is fully compatiblemore » with existing International Atomic Energy Agency (IAEA) neutron data acquisition instruments such as the Advance Multiplicity Shift Register (AMSR) and JSR-15. The UMSR has three input channels: a multiplicity shift register input and two auxiliary inputs. The UMSR provides 0V to 2kV of programmable High Voltage (HV) bias and both a 12V and a 5V detector power supply output. A serial over USB communication line to the UMSR allows the use of existing versions of INCC or MIC software while the Ethernet port is compatible with the new IAEA RAINSTORM communication protocol.« less

Is Shift Work Associated with Lipid Disturbances and Increased Insulin Resistance?

PubMed

Alefishat, Eman; Abu Farha, Rana

2015-11-01

Shift work is associated with higher risk of metabolic disturbances and cardiovascular diseases. There are contradictory reports on the effect of shift work on lipid parameters in the literature. No studies have investigated any possible association between shift work and the ratio of serum triglyceride to high density lipoprotein cholesterol (TG/HDL-C ratio). This ratio can be used as a predictor for insulin resistance. The main aim of the present cross-sectional study was to investigate the association between shift work and serum TG/HDL-C ratio, TG level, and HDL-C level. One hundred and forty adult Jordanian employees were recruited. Demographic data, lifestyle habits, clinical parameters, and working patterns data were documented through a well-structured questionnaire. Serum TG and HDL-C levels were measured after at least 9 hours fasting using enzymatic assay procedure. Compared with daytime workers (58 subjects), shift workers (82 subjects) displayed higher TG/HDL-C ratio (r = 0.217, P = 0.013), higher serum TG levels (r = 0.220, P = 0.012), and lower HDL-C levels (r = -0.200, P = 0.016). Among shift workers, 30.5% were found to have a TG/HDL-C ratio >3.5 compared with 8.6% of daytime workers (P = 0.002). In the present study, shift work was shown to be associated with higher TG/HDL-C ratio, higher serum TG, and lower HDL-C levels. These findings might indicate that shift work is associated with increased insulin resistance and consequently higher risk of metabolic syndrome and cardiovascular diseases.

Perilipin, a critical regulator of fat storage and breakdown, is a target gene of estrogen receptor-related receptor {alpha}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akter, Mst. Hasina; Yamaguchi, Tomohiro; Hirose, Fumiko

2008-04-11

Perilipin is a protein localized on lipid droplet surfaces in adipocytes and steroidogenic cells, playing a central role in regulated lipolysis. Expression of the perilipin gene is markedly induced during adipogenesis. We found that transcription from the perilipin gene promoter is activated by an orphan nuclear receptor, estrogen receptor-related receptor (ERR){alpha}. A response element to this receptor was identified in the promoter region by a gene reporter assay, the electrophoretic-gel mobility-shift assay and the chromatin immunoprecipitation assay. Peroxisome proliferator-activated receptor {gamma} coactivator (PGC)-1{alpha} enhanced, whereas small heterodimer partner (SHP) repressed, the transactivating function of ERR{alpha} on the promoter. Thus, themore » perilipin gene expression is regulated by a transcriptional network controlling energy metabolism, substantiating the functional importance of perilipin in the maintenance of body energy balance.« less

GAS6 is an estrogen-inducible gene in mammary epithelial cells

PubMed Central

Mo, Rigen; Zhu, Yiwei Tony; Zhang, Zhongyi; Rao, Sambasiva M.; Zhu, Yi-Jun

2007-01-01

To identify estrogen responsive genes in mammary glands, microarray assays were performed. Twenty genes were found to be up-regulated while 16 genes were repressed in the 9h estrogen treated glands. The induction of GAS6, one of the genes up-regulated by estrogen, was confirmed by RNase protection assay. Furthermore, GAS6 was also demonstrated to be induced by estrogen in ER positive breast cancer cells. Analysis of GAS6 promoter revealed that GAS6 promoter was regulated by estrogen. An estrogen response element (ERE) was identified in the GAS6 promoter. Electrophoretic mobility shift assay revealed that ERα interacted with the ERE in the GAS6 promoter. Chromatin immunoprecipitation demonstrated that ERα was recruited to the GAS6 promoter upon estrogen stimulation. These results suggested that GAS6 is an estrogen target gene in mammary epithelial cells. PMID:17174935

Development of digestive enzymes in larvae of Mayan cichlid Cichlasoma urophthalmus.

PubMed

López-Ramírez, G; Cuenca-Soria, C A; Alvarez-González, C A; Tovar-Ramírez, D; Ortiz-Galindo, J L; Perales-García, N; Márquez-Couturier, G; Arias-Rodríguez, L; Indy, J R; Contreras-Sánchez, W M; Gisbert, E; Moyano, F J

2011-03-01

The development of digestive enzymes during the early ontogeny of the Mayan cichlid (Cichlasoma urophthalmus) was studied using biochemical and electrophoretic techniques. From yolk absorption (6 days after hatching: dah), larvae were fed Artemia nauplii until 15 dah, afterward they were fed with commercial microparticulated trout food (45% protein and 16% lipids) from 16 to 60 dah. Several samples were collected including yolk-sac larvae (considered as day 1 after hatching) and specimens up to 60 dah. Most digestive enzymes were present from yolk absorption (5-6 dah), except for the specific acid proteases activity (pepsin-like), which increase rapidly from 8 dah up to 20 dah. Three alkaline proteases isoforms (24.0, 24.8, 84.5 kDa) were detected at 8 dah using SDS-PAGE zymogram, corresponding to trypsin, chymotrypsin and probably leucine aminopeptidase enzymes, and only one isoform was detected (relative electromobility, Rf = 0.54) for acid proteases (pepsin-like) from 3 dah onwards using PAGE zymogram. We concluded that C. urophthamus is a precocious fish with a great capacity to digest all kinds of food items, including artificial diets provided from 13 dah.

Impact of morphological changes of LiNi1/3Mn1/3Co1/3O2 on lithium-ion cathode performances

NASA Astrophysics Data System (ADS)

Cabelguen, Pierre-Etienne; Peralta, David; Cugnet, Mikael; Maillet, Pascal

2017-04-01

Major advances in Li-ion battery technology rely on the nanostructuration of active materials to overcome the severe kinetics limitations of new - cheaper and safer - chemistries. However, opening porosities results in the decrease of volumetric performances, closing the door to significant applications such as portable electronics, electromobility, and grid storage. In this study, we analyze the link between morphologies and performances of model LiNi1/3Mn1/3Co1/3O2 materials. By quantifying exhaustively their microstructures using nitrogen adsorption, mercury intrusion porosimetry, and helium pycnometry, we can discuss how porosities and surface areas are linked to the electrochemical behavior. There is no geometrical parameters that can predict the performances of all our materials. The shape of agglomeration dictates the electrochemical behavior. A huge drop in volumetric performances is measured when microstructure is considered. We show that gravimetric and volumetric power performances are contrary to each other. Highly dense materials exhibit, by far, the best power performances in terms of volumetric figures, so that opening porosities might not be the best strategy, even in non-nanosized materials, for Li-ion battery technology.

A minimal murine Msx-1 gene promoter. Organization of its cis-regulatory motifs and their role in transcriptional activation in cells in culture and in transgenic mice.

PubMed

Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R

1997-09-05

To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient Drosophila cell line cotransfected with Msx-1-luciferase and an Sp1 expression vector pPacSp1. The transgenic mice embryos containing -165/106-bp Msx-1 promoter-LacZ DNA in their genomes abundantly expressed beta-galactosidase in maxillae and mandibles and in the cellular primordia involved in the formation of the meninges and the bones of the skull. Thus, the truncated murine Msx-1 promoter can target expression of a heterologous gene in the craniofacial tissues of transgenic embryos known for high level of expression of the endogenous Msx-1 gene and found to be severely defective in the Msx-1 knock-out mice.

The timing of the human circadian clock is accurately represented by the core body temperature rhythm following phase shifts to a three-cycle light stimulus near the critical zone

NASA Technical Reports Server (NTRS)

Jewett, M. E.; Duffy, J. F.; Czeisler, C. A.

2000-01-01

A double-stimulus experiment was conducted to evaluate the phase of the underlying circadian clock following light-induced phase shifts of the human circadian system. Circadian phase was assayed by constant routine from the rhythm in core body temperature before and after a three-cycle bright-light stimulus applied near the estimated minimum of the core body temperature rhythm. An identical, consecutive three-cycle light stimulus was then applied, and phase was reassessed. Phase shifts to these consecutive stimuli were no different from those obtained in a previous study following light stimuli applied under steady-state conditions over a range of circadian phases similar to those at which the consecutive stimuli were applied. These data suggest that circadian phase shifts of the core body temperature rhythm in response to a three-cycle stimulus occur within 24 h following the end of the 3-day light stimulus and that this poststimulus temperature rhythm accurately reflects the timing of the underlying circadian clock.

Buffer Optimization of Thermal Melt Assays of Plasmodium Proteins for Detection of Small-Molecule Ligands

PubMed Central

Crowther, Gregory J.; Napuli, Alberto J.; Thomas, Andrew P.; Chung, Diana J.; Kovzun, Kuzma V.; Leibly, David J.; Castaneda, Lisa J.; Bhandari, Janhavi; Damman, Christopher J.; Hui, Raymond; Hol, Wim G. J.; Buckner, Frederick S.; Verlinde, Christophe L. M. J.; Zhang, Zhongsheng; Fan, Erkang; Van Voorhis, Wesley C.

2010-01-01

In the last decade, thermal melt/thermal shift assays have become a common tool for identifying ligands and other factors that stabilize specific proteins. Increased stability is indicated by an increase in the protein's melting temperature (Tm). In optimizing the assays for subsequent screening of compound libraries, it is important to minimize the variability of Tm measurements so as to maximize the assay's ability to detect potential ligands. Here we present an investigation of Tm variability in recombinant proteins from Plasmodium parasites. Ligands of Plasmodium proteins are particularly interesting as potential starting points for drugs for malaria, and new drugs are urgently needed. A single standard buffer (100 mM HEPES, pH 7.5, 150 mM NaCl) permitted estimation of Tm for 58 of 61 Plasmodium proteins tested. However, with several proteins, Tm could not be measured with a consistency suitable for high-throughput screening unless alternative protein-specific buffers were employed. We conclude that buffer optimization to minimize variability in Tm measurements increases the success of thermal melt screens involving proteins for which a standard buffer is suboptimal. PMID:19470714

One Question, Multiple Answers: Biochemical and Biophysical Screening Methods Retrieve Deviating Fragment Hit Lists.

PubMed

Schiebel, Johannes; Radeva, Nedyalka; Köster, Helene; Metz, Alexander; Krotzky, Timo; Kuhnert, Maren; Diederich, Wibke E; Heine, Andreas; Neumann, Lars; Atmanene, Cedric; Roecklin, Dominique; Vivat-Hannah, Valérie; Renaud, Jean-Paul; Meinecke, Robert; Schlinck, Nina; Sitte, Astrid; Popp, Franziska; Zeeb, Markus; Klebe, Gerhard

2015-09-01

Fragment-based lead discovery is gaining momentum in drug development. Typically, a hierarchical cascade of several screening techniques is consulted to identify fragment hits which are then analyzed by crystallography. Because crystal structures with bound fragments are essential for the subsequent hit-to-lead-to-drug optimization, the screening process should distinguish reliably between binders and non-binders. We therefore investigated whether different screening methods would reveal similar collections of putative binders. First we used a biochemical assay to identify fragments that bind to endothiapepsin, a surrogate for disease-relevant aspartic proteases. In a comprehensive screening approach, we then evaluated our 361-entry library by using a reporter-displacement assay, saturation-transfer difference NMR, native mass spectrometry, thermophoresis, and a thermal shift assay. While the combined results of these screening methods retrieve 10 of the 11 crystal structures originally predicted by the biochemical assay, the mutual overlap of individual hit lists is surprisingly low, highlighting that each technique operates on different biophysical principles and conditions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Age-Related Shifts in the Density and Distribution of Genetic Marker Water Quality Indicators in Cow and Calf Feces (Journal)

EPA Science Inventory

Calves (≤ 226 kg body mass) make up about 16% of the current bovine population in the United States and can excrete high levels of human pathogens. We describe the density and distribution of genetic markers from 11 PCR- and real-time quantitative PCR-based assays including CF...

Human serum albumin binding assay based on displacement of a non selective fluorescent inhibitor.

PubMed

Thorarensen, Atli; Sarver, Ronald W; Tian, Fang; Ho, Andrea; Romero, Donna L; Marotti, Keith R

2007-08-15

In this paper, we describe a fluorescent antibacterial analog, 6, with utility as a competition probe to determine affinities of other antibacterial analogs for human serum albumin (HSA). Analog 6 bound to HSA with an affinity of 400+/-100 nM and the fluorescence was environmentally sensitive. With 370 nm excitation, environmental sensitivity was indicated by a quenching of the 530 nm emission when the probe bound to HSA. Displacement of dansylsarcosine from HSA by 6 indicated it competed with compounds that bound at site II (ibuprofen binding site) on HSA. Analog 6 also shifted the NMR peaks of an HSA bound oleic acid molecule that itself was affected by compounds that bound at site II. In addition to binding at site II, 6 interacted at site I (warfarin binding site) as indicated by displacement of dansylamide and the shifting of NMR peaks of an HSA bound oleic acid molecule affected by warfarin site binding. Additional evidence for multiple site interaction was discovered when a percentage of 6 could be displaced by either ibuprofen or phenylbutazone. A competition assay was established using 6 to determine relative affinities of other antibacterial inhibitors for HSA.

The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.

PubMed

Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D

2004-11-15

Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.

Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein.

PubMed

Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj

2011-10-01

The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.

Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein

PubMed Central

Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S

2011-01-01

The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncation of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T] [T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein. PMID:21918373

A fully-integrated aptamer-based affinity assay platform for monitoring astronaut health in space.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Xianbin; Durland, Ross H.; Hecht, Ariel H.

2010-07-01

Here we demonstrate the suitability of robust nucleic acid affinity reagents in an integrated point-of-care diagnostic platform for monitoring proteomic biomarkers indicative of astronaut health in spaceflight applications. A model thioaptamer targeting nuclear factor-kappa B (NF-{kappa}B) is evaluated in an on-chip electrophoretic gel-shift assay for human serum. Key steps of (i) mixing sample with the aptamer, (ii) buffer exchange, and (iii) preconcentration of sample were successfully integrated upstream of fluorescence-based detection. Challenges due to (i) nonspecific interactions with serum, and (ii) preconcentration at a nanoporous membrane are discussed and successfully resolved to yield a robust, rapid, and fully-integrated diagnostic system.

Simplified 2,4-dinitrophenylhydrazine spectrophotometric assay for quantification of carbonyls in oxidized proteins.

PubMed

Mesquita, Cristina S; Oliveira, Raquel; Bento, Fátima; Geraldo, Dulce; Rodrigues, João V; Marcos, João C

2014-08-01

This work proposes a modification of the 2,4-dinitrophenylhydrazine (DNPH) spectrophotometric assay commonly used to evaluate the concentration of carbonyl groups in oxidized proteins. In this approach NaOH is added to the protein solution after the addition of DNPH, shifting the maximum absorbance wavelength of the derivatized protein from 370 to 450nm. This reduces the interference of DNPH and allows the direct quantification in the sample solution without the need for the precipitation, washing, and resuspension steps that are carried out in the traditional DNPH method. The two methods were compared under various conditions and are statistically equivalent. Copyright © 2014 Elsevier Inc. All rights reserved.

Periplasmic binding protein-based detection of maltose using liposomes: a new class of biorecognition elements in competitive assays.

PubMed

Edwards, Katie A; Baeumner, Antje J

2013-03-05

A periplasmic binding protein (PBP) was investigated as a novel binding species in a similar manner to an antibody in a competitive enzyme linked immunosorbent assay (ELISA), resulting in a highly sensitive and specific assay utilizing liposome-based signal amplification. PBPs are located at high concentrations (10(-4) M) between the inner and outer membranes of gram negative bacteria and are involved in the uptake of solutes and chemotaxis of bacteria toward nutrient sources. Previous sensors relying on PBPs took advantage of the change in local environment or proximity of site-specific fluorophore labels resulting from the significant conformational shift of these proteins' two globular domains upon target binding. Here, rather than monitoring conformational shifts, we have instead utilized the maltose binding protein (MBP) in lieu of an antibody in an ELISA. To our knowledge, this is the first PBP-based sensor without the requirement for engineering site-specific modifications within the protein. MBP conjugated fluorescent dye-encapsulating liposomes served to provide recognition and signal amplification in a competitive assay for maltose using amylose magnetic beads in a microtiter plate-based format. The development of appropriate binding buffers and competitive surfaces are described, with general observations expected to extend to PBPs for other analytes. The resulting assay was specific for d-(+)-maltose versus other sugar analogs including d-(+)-raffinose, sucrose, d-trehalose, d-(+)-xylose, d-fructose, 1-thio-β-d-glucose sodium salt, d-(+)-galactose, sorbitol, glycerol, and dextrose. Cross-reactivity with d-lactose and d-(+)-glucose occurred only at concentrations >10(4)-fold greater than d-(+)-maltose. The limit of detection was 78 nM with a dynamic range covering over 3 orders of magnitude. Accurate detection of maltose as an active ingredient in a pharmaceutical preparation was demonstrated. This method offers a significant improvement over existing enzymatic detection approaches that cannot discriminate between maltose and glucose and over existing fluorescence resonance energy transfer (FRET)-based detection methods that are sensitivity limited. In addition, it opens up a new strategy for the development of biosensors to difficult analytes refractory to immunological detection.

Photon upconversion in homogeneous fluorescence-based bioanalytical assays.

PubMed

Soukka, Tero; Rantanen, Terhi; Kuningas, Katri

2008-01-01

Upconverting phosphors (UCPs) are very attractive reporters for fluorescence resonance energy transfer (FRET)-based bioanalytical assays. The large anti-Stokes shift and capability to convert near-infrared to visible light via sequential absorption of multiple photons enable complete elimination of autofluorescence, which commonly impairs the performance of fluorescence-based assays. UCPs are ideal donors for FRET, because their very narrow-banded emission allows measurement of the sensitized acceptor emission, in principle, without any crosstalk from the donor emission at a wavelength just tens of nanometers from the emission peak of the donor. In addition, acceptor dyes emitting at visible wavelengths are essentially not excited by near-infrared, which further emphasizes the unique potential of upconversion FRET (UC-FRET). These characteristics result in favorable assay performance using detection instrumentation based on epifluorometer configuration and laser diode excitation. Although UC-FRET is a recently emerged technology, it has already been applied in both immunoassays and nucleic acid hybridization assays. The technology is also compatible with optically difficult biological samples, such as whole blood. Significant advances in assay performance are expected using upconverting lanthanide-doped nanocrystals, which are currently under extensive research. UC-FRET, similarly to other fluorescence techniques based on resonance energy transfer, is strongly distance dependent and may have limited applicability, for example in sandwich-type assays for large biomolecules, such as viruses. In this article, we summarize the essentials of UC-FRET, describe its current applications, and outline the expectations for its future potential.

Lose-Shift Responding in Humans Is Promoted by Increased Cognitive Load

PubMed Central

Ivan, Victorita E.; Banks, Parker J.; Goodfellow, Kris; Gruber, Aaron J.

2018-01-01

The propensity of animals to shift choices immediately after unexpectedly poor reinforcement outcomes is a pervasive strategy across species and tasks. We report here on the memory supporting such lose-shift responding in humans, assessed using a binary choice task in which random responding is the optimal strategy. Participants exhibited little lose-shift responding when fully attending to the task, but this increased by 30%–40% in participants that performed with additional cognitive load that is known to tax executive systems. Lose-shift responding in the cognitively loaded adults persisted throughout the testing session, despite being a sub-optimal strategy, but was less likely as the time increased between reinforcement and the subsequent choice. Furthermore, children (5–9 years old) without load performed similarly to the cognitively loaded adults. This effect disappeared in older children aged 11–13 years old. These data provide evidence supporting our hypothesis that lose-shift responding is a default and reflexive strategy in the mammalian brain, likely mediated by a decaying memory trace, and is normally suppressed by executive systems. Reducing the efficacy of executive control by cognitive load (adults) or underdevelopment (children) increases its prevalence. It may therefore be an important component to consider when interpreting choice data, and may serve as an objective behavioral assay of executive function in humans that is easy to measure. PMID:29568264

Gel shift analysis of the empA promoter region in Vibrio anguillarum.

PubMed

Denkin, Steven M; Sekaric, Pedja; Nelson, David R

2004-10-29

The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG)-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20), nine salts solution + 200 microg/ml mucus (NSSM), 3M (marine minimal medium), or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. The data demonstrate that protein extracts of V. anguillarum NB10 cells contain a protein that binds to a 50 bp oligomer containing the empA promoter-lux box-like region. NB10 cells express empA during stationary phase in all growth conditions. The DNA binding protein is not present in M93Sm extracts. M93Sm cells express protease activity only when incubated at high cell density in fish gastrointestinal mucus. The gel shift observed with NB10 cells is not due to VanT binding. The data also suggest that the DNA binding protein is responsible for the less restrictive expression of empA in NB10 compared to M93Sm.

Direct detection of hyaluronidase in urine using cationic gold nanoparticles: a potential diagnostic test for bladder cancer.

PubMed

Nossier, Ahmed Ibrahim; Eissa, Sanaa; Ismail, Manal Fouad; Hamdy, Mohamed Ahmed; Azzazy, Hassan Mohamed El-Said

2014-04-15

Hyaluronidase (HAase) was reported as a urinary marker of bladder cancer. In this study, a simple colorimetric gold nanoparticle (AuNP) assay was developed for rapid and sensitive detection of urinary HAase activity. Charge interaction between polyanionic hyaluronic acid (HA) and cationic AuNPs stabilized with cetyl trimethyl ammonium bromide (CTAB) led to formation of gold aggregates and a red to blue color shift. HAase digests HA into small fragments preventing the aggregation of cationic AuNPs. The nonspecific aggregation of AuNPs in urine samples was overcome by pre-treatment of samples with the polycationic chitosan that was able to agglomerate all negatively charged interfering moieties before performing the assay. The developed AuNP assay was compared with zymography for qualitative detection of urinary HAase activity in 40 bladder carcinoma patients, 11 benign bladder lesions patients and 15 normal individuals, the assay sensitivity was 82.5% vs. 65% for zymography, while the specificity for both assays was 96.1%. The absorption ratio, A530/A620 of the reacted AuNP solution was used to quantify the HAase activity. The best cut off value was 93.5 μU/ng protein, at which the sensitivity was 90% and the specificity was 80.8%.The developed colorimetric AuNP HAase assay is simple, inexpensive, and can aid noninvasive diagnosis of bladder cancer. © 2013 Elsevier B.V. All rights reserved.

Identification of cis-elements for ethylene and circadian regulation of the Solanum melongena gene encoding cysteine proteinase.

PubMed

Rawat, Reetika; Xu, Zeng-Fu; Yao, Kwok-Ming; Chye, Mee-Len

2005-03-01

We have previously shown that the expression of SmCP which encodes Solanum melongena cysteine proteinase is ethylene-inducible and is under circadian control. To understand the regulation of SmCP, a 1.34-kb SmCP 5'-flanking region and its deletion derivatives were analyzed for cis-elements using GUS and luc fusions and by in vitro binding assays. Analysis of transgenic tobacco transformed with SmCP promoter-GUS constructs confirmed that the promoter region -415/+54 containing Ethylene Responsive Element ERE(-355/-348) conferred threefold ethylene-induction of GUS expression, while -827/+54 which also contains ERE(-683/-676), produced fivefold induction. Using gel mobility shift assays, we demonstrated that each ERE binds nuclear proteins from both ethephon-treated and untreated 5-week-old seedlings, suggesting that different transcriptions factors bind each ERE under varying physiological conditions. Binding was also observed in extracts from senescent, but not young, fruits. The variation in binding at the EREs in fruits and seedlings imply that organ-specific factors may participate in binding. Analysis of transgenic tobacco expressing various SmCP promoter-luc constructs containing wild-type or mutant Evening Elements (EEs) confirmed that both conserved EEs at -795/-787 and -785/-777 are important in circadian control. We confirmed the binding of total nuclear proteins to EEs in gel mobility shift assays and in DNase I footprinting. Our results suggest that multiple proteins bind the EEs which are conserved in plants other than Arabidopsis and that functional EEs and EREs are present in the 5'-flanking region of a gene encoding cysteine proteinase.

Prenatal exposure of mice to diethylstilbestrol disrupts T-cell differentiation by regulating Fas/Fas ligand expression through estrogen receptor element and nuclear factor-κB motifs.

PubMed

Singh, Narendra P; Singh, Udai P; Nagarkatti, Prakash S; Nagarkatti, Mitzi

2012-11-01

Prenatal exposure to diethylstilbestrol (DES) is known to cause altered immune functions and increased susceptibility to autoimmune disease in humans. In the current study, we investigated the effect of prenatal exposure to DES on thymocyte differentiation involving apoptotic pathways. Prenatal DES exposure caused thymic atrophy, apoptosis, and up-regulation of Fas and Fas ligand (FasL) expression in thymocytes. To examine the mechanism underlying DES-mediated regulation of Fas and FasL, we performed luciferase assays using T cells transfected with luciferase reporter constructs containing full-length Fas or FasL promoters. There was significant luciferase induction in the presence of Fas or FasL promoters after DES exposure. Further analysis demonstrated the presence of several cis-regulatory motifs on both Fas and FasL promoters. When DES-induced transcription factors were analyzed, estrogen receptor element (ERE), nuclear factor κB (NF-κB), nuclear factor of activated T cells (NF-AT), and activator protein-1 motifs on the Fas promoter, as well as ERE, NF-κB, and NF-AT motifs on the FasL promoter, showed binding affinity with the transcription factors. Electrophoretic mobility-shift assays were performed to verify the binding affinity of cis-regulatory motifs of Fas or FasL promoters with transcription factors. There was shift in mobility of probes (ERE or NF-κB2) of both Fas and FasL in the presence of nuclear proteins from DES-treated cells, and the shift was specific to DES because these probes failed to shift their mobility in the presence of nuclear proteins from vehicle-treated cells. Together, the current study demonstrates that prenatal exposure to DES triggers significant alterations in apoptotic molecules expressed on thymocytes, which may affect T-cell differentiation and cause long-term effects on the immune functions.

Prenatal Exposure of Mice to Diethylstilbestrol Disrupts T-Cell Differentiation by Regulating Fas/Fas Ligand Expression through Estrogen Receptor Element and Nuclear Factor-κB Motifs

PubMed Central

Singh, Narendra P.; Singh, Udai P.; Nagarkatti, Prakash S.

2012-01-01

Prenatal exposure to diethylstilbestrol (DES) is known to cause altered immune functions and increased susceptibility to autoimmune disease in humans. In the current study, we investigated the effect of prenatal exposure to DES on thymocyte differentiation involving apoptotic pathways. Prenatal DES exposure caused thymic atrophy, apoptosis, and up-regulation of Fas and Fas ligand (FasL) expression in thymocytes. To examine the mechanism underlying DES-mediated regulation of Fas and FasL, we performed luciferase assays using T cells transfected with luciferase reporter constructs containing full-length Fas or FasL promoters. There was significant luciferase induction in the presence of Fas or FasL promoters after DES exposure. Further analysis demonstrated the presence of several cis-regulatory motifs on both Fas and FasL promoters. When DES-induced transcription factors were analyzed, estrogen receptor element (ERE), nuclear factor κB (NF-κB), nuclear factor of activated T cells (NF-AT), and activator protein-1 motifs on the Fas promoter, as well as ERE, NF-κB, and NF-AT motifs on the FasL promoter, showed binding affinity with the transcription factors. Electrophoretic mobility-shift assays were performed to verify the binding affinity of cis-regulatory motifs of Fas or FasL promoters with transcription factors. There was shift in mobility of probes (ERE or NF-κB2) of both Fas and FasL in the presence of nuclear proteins from DES-treated cells, and the shift was specific to DES because these probes failed to shift their mobility in the presence of nuclear proteins from vehicle-treated cells. Together, the current study demonstrates that prenatal exposure to DES triggers significant alterations in apoptotic molecules expressed on thymocytes, which may affect T-cell differentiation and cause long-term effects on the immune functions. PMID:22888145

Epistatic interactions influence terrestrial–marine functional shifts in cetacean rhodopsin

PubMed Central

2017-01-01

Like many aquatic vertebrates, whales have blue-shifting spectral tuning substitutions in the dim-light visual pigment, rhodopsin, that are thought to increase photosensitivity in underwater environments. We have discovered that known spectral tuning substitutions also have surprising epistatic effects on another function of rhodopsin, the kinetic rates associated with light-activated intermediates. By using absorbance spectroscopy and fluorescence-based retinal release assays on heterologously expressed rhodopsin, we assessed both spectral and kinetic differences between cetaceans (killer whale) and terrestrial outgroups (hippo, bovine). Mutation experiments revealed that killer whale rhodopsin is unusually resilient to pleiotropic effects on retinal release from key blue-shifting substitutions (D83N and A292S), largely due to a surprisingly specific epistatic interaction between D83N and the background residue, S299. Ancestral sequence reconstruction indicated that S299 is an ancestral residue that predates the evolution of blue-shifting substitutions at the origins of Cetacea. Based on these results, we hypothesize that intramolecular epistasis helped to conserve rhodopsin's kinetic properties while enabling blue-shifting spectral tuning substitutions as cetaceans adapted to aquatic environments. Trade-offs between different aspects of molecular function are rarely considered in protein evolution, but in cetacean and other vertebrate rhodopsins, may underlie multiple evolutionary scenarios for the selection of specific amino acid substitutions. PMID:28250185

Emergence of Competitive Dominant Ammonia-Oxidizing Bacterial Populations in a Full-Scale Industrial Wastewater Treatment Plant

PubMed Central

Layton, Alice C.; Dionisi, Hebe; Kuo, H.-W.; Robinson, Kevin G.; Garrett, Victoria M.; Meyers, Arthur; Sayler, Gary S.

2005-01-01

Ammonia-oxidizing bacterial populations in an industrial wastewater treatment plant were investigated with amoA and 16S rRNA gene real-time PCR assays. Nitrosomonas nitrosa initially dominated, but over time RI-27-type ammonia oxidizers, also within the Nitrosomonas communis lineage, increased from below detection to codominance. This shift occurred even though nitrification remained constant. PMID:15691975

Science & Technology Review May 2006

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aufderheide III, M B

2006-04-03

This month's issue has the following articles: (1) Science and Technology Help the Nation Counter Terrorism--Commentary by Raymond J. Juzaitis; (2) Imagers Provide Eyes to See Gamma Rays--Gamma-ray imagers provide increased radiation detection capabilities and enhance the nation's arsenal for homeland security; (3) Protecting the Nation's Livestock--Foot-and-mouth disease could devastate America's livestock; a new assay provides a rapid means to detect it; (4) Measures for Measures--Laboratory physicists combine emissivity and reflectivity to achieve highly accurate temperature measurements of metal foils; and (5) Looping through the Lamb Shift--Livermore scientists measured a small perturbation in the spectra of highly ionized uranium--the firstmore » measurement of the two-loop Lamb shift in a bound state.« less

NRF2 Orchestrates the Metabolic Shift during Induced Pluripotent Stem Cell Reprogramming

PubMed Central

Hawkins, Kate E.; Joy, Shona; Delhove, Juliette M.K.M.; Kotiadis, Vassilios N.; Fernandez, Emilio; Fitzpatrick, Lorna M.; Whiteford, James R.; King, Peter J.; Bolanos, Juan P.; Duchen, Michael R.; Waddington, Simon N.; McKay, Tristan R.

2016-01-01

Summary The potential of induced pluripotent stem cells (iPSCs) in disease modeling and regenerative medicine is vast, but current methodologies remain inefficient. Understanding the cellular mechanisms underlying iPSC reprogramming, such as the metabolic shift from oxidative to glycolytic energy production, is key to improving its efficiency. We have developed a lentiviral reporter system to assay longitudinal changes in cell signaling and transcription factor activity in living cells throughout iPSC reprogramming of human dermal fibroblasts. We reveal early NF-κB, AP-1, and NRF2 transcription factor activation prior to a temporal peak in hypoxia inducible factor α (HIFα) activity. Mechanistically, we show that an early burst in oxidative phosphorylation and elevated reactive oxygen species generation mediates increased NRF2 activity, which in turn initiates the HIFα-mediated glycolytic shift and may modulate glucose redistribution to the pentose phosphate pathway. Critically, inhibition of NRF2 by KEAP1 overexpression compromises metabolic reprogramming and results in reduced efficiency of iPSC colony formation. PMID:26904936

Electrophoretic mobility shift scanning using an automated infrared DNA sequencer.

PubMed

Sano, M; Ohyama, A; Takase, K; Yamamoto, M; Machida, M

2001-11-01

Electrophoretic mobility shift assay (EMSA) is widely used in the study of sequence-specific DNA-binding proteins, including transcription factors and mismatch binding proteins. We have established a non-radioisotope-based protocol for EMSA that features an automated DNA sequencer with an infrared fluorescent dye (IRDye) detection unit. Our modification of the elec- trophoresis unit, which includes cooling the gel plates with a reduced well-to-read length, has made it possible to detect shifted bands within 1 h. Further, we have developed a rapid ligation-based method for generating IRDye-labeled probes with an approximately 60% cost reduction. This method has the advantages of real-time scanning, stability of labeled probes, and better safety associated with nonradioactive methods of detection. Analysis of a promoter from an industrially important filamentous fungus, Aspergillus oryzae, in a prototype experiment revealed that the method we describe has potential for use in systematic scanning and identification of the functionally important elements to which cellular factors bind in a sequence-specific manner.

tRNA Shifts the G-quadruplex-Hairpin Conformational Equilibrium in RNA towards the Hairpin Conformer.

PubMed

Rode, Ambadas B; Endoh, Tamaki; Sugimoto, Naoki

2016-11-07

Non-coding RNAs play important roles in cellular homeostasis and are involved in many human diseases including cancer. Intermolecular RNA-RNA interactions are the basis for the diverse functions of many non-coding RNAs. Herein, we show how the presence of tRNA influences the equilibrium between hairpin and G-quadruplex conformations in the 5' untranslated regions of oncogenes and model sequences. Kinetic and equilibrium analyses of the hairpin to G-quadruplex conformational transition of purified RNA as well as during co-transcriptional folding indicate that tRNA significantly shifts the equilibrium toward the hairpin conformer. The enhancement of relative translation efficiency in a reporter gene assay is shown to be due to the tRNA-mediated shift in hairpin-G-quadruplex equilibrium of oncogenic mRNAs. Our findings suggest that tRNA is a possible therapeutic target in diseases in which RNA conformational equilibria is dysregulated. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Shift Work and Cognitive Flexibility: Decomposing Task Performance.

PubMed

Cheng, Philip; Tallent, Gabriel; Bender, Thomas John; Tran, Kieulinh Michelle; Drake, Christopher L

2017-04-01

Deficits in cognitive functioning associated with shift work are particularly relevant to occupational performance; however, few studies have examined how cognitive functioning is associated with specific components of shift work. This observational study examined how circadian phase, nocturnal sleepiness, and daytime insomnia in a sample of shift workers ( N = 30) were associated with cognitive flexibility during the night shift. Cognitive flexibility was measured using a computerized task-switching paradigm, which produces 2 indexes of flexibility: switch cost and set inhibition. Switch cost represents the additional cognitive effort required in switching to a different task and can impact performance when multitasking is involved. Set inhibition is the efficiency in returning to previously completed tasks and represents the degree of cognitive perseveration, which can lead to reduced accuracy. Circadian phase was measured via melatonin assays, nocturnal sleepiness was assessed using the Multiple Sleep Latency Test, and daytime insomnia was assessed using the Insomnia Severity Index. Results indicated that those with an earlier circadian phase, insomnia, and sleepiness exhibited reduced cognitive flexibility; however, specific components of cognitive flexibility were differentially associated with circadian phase, insomnia, and sleepiness. Individuals with an earlier circadian phase (thus more misaligned to the night shift) exhibited larger switch costs, which was also associated with reduced task efficiency. Shift workers with more daytime insomnia demonstrated difficulties with cognitive inhibition, whereas nocturnal sleepiness was associated with difficulties in reactivating previous tasks. Deficits in set inhibition were also related to reduced accuracy and increased perseverative errors. Together, this study indicates that task performance deficits in shift work are complex and are variably impacted by different mechanisms. Future research may examine phenotypic differences in shift work and the associated consequences. Results also suggest that fatigue risk management strategies may benefit from increased scope and specificity in assessment of sleep, sleepiness, and circadian rhythms in shift workers.

Rational Methods for the Selection of Diverse Screening Compounds

PubMed Central

Huggins, David J.; Venkitaraman, Ashok R.; Spring, David R.

2016-01-01

Traditionally a pursuit of large pharmaceutical companies, high-throughput screening assays are becoming increasingly common within academic and government laboratories. This shift has been instrumental in enabling projects that have not been commercially viable, such as chemical probe discovery and screening against high risk targets. Once an assay has been prepared and validated, it must be fed with screening compounds. Crafting a successful collection of small molecules for screening poses a significant challenge. An optimized collection will minimize false positives whilst maximizing hit rates of compounds that are amenable to lead generation and optimization. Without due consideration of the relevant protein targets and the downstream screening assays, compound filtering and selection can fail to explore the great extent of chemical diversity and eschew valuable novelty. Herein, we discuss the different factors to be considered and methods that may be employed when assembling a structurally diverse compound screening collection. Rational methods for selecting diverse chemical libraries are essential for their effective use in high-throughput screens. PMID:21261294

Identification of eukaryotic UDP-galactopyranose mutase inhibitors using the ThermoFAD assay.

PubMed

Martín Del Campo, Julia S; Eckshtain-Levi, Meital; Sobrado, Pablo

2017-11-04

Aspergillus fumigatus is a human pathogen responsible for deadly infections in immune-compromised patients. A potential strategy for treating A. fumigatus infections is by targeting the biosynthesis of cell wall components, such as galactofuranase, which is absent in humans. Galactofuranose biosynthesis is initiated by the flavoenzyme UDP-galactopyranose mutase (UGM), which converts UDP-galactopyranose (UDP-Galp) to UDP-galactofuranose (UDP-Galf). UGM requires the reduced form of the flavin for activity, which is obtained by reacting with NADPH. We aimed to identify inhibitors of UGM by screening a kinase inhibitor library using ThermoFAD, a flavin fluorescence thermal shift assay. The screening assay identified flavopiridol as a compound that increased the melting temperature of A. fumigatus UGM. Further characterization showed that flavopiridol is a non-competitive inhibitor of UGM and docking studies suggest that it binds in the active site. This compound does not inhibit the prokaryotic UGM from Mycobacteria tuberculosis. Copyright © 2017 Elsevier Inc. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Danno, Hirosuke; Ishii, Kiyo-aki; Nakagawa, Yoshimi

To elucidate the physiological role of CREBH, the hepatic mRNA and protein levels of CREBH were estimated in various feeding states of wild and obesity mice. In the fast state, the expression of CREBH mRNA and nuclear protein were high and profoundly suppressed by refeeding in the wild-type mice. In ob/ob mice, the refeeding suppression was impaired. The diet studies suggested that CREBH expression was activated by fatty acids. CREBH mRNA levels in the mouse primary hepatocytes were elevated by addition of the palmitate, oleate and eicosapenonate. It was also induced by PPAR{alpha} agonist and repressed by PPAR{alpha} antagonist. Luciferasemore » reporter gene assays indicated that the CREBH promoter activity was induced by fatty acids and co-expression of PPAR{alpha}. Deletion studies identified the PPRE for PPAR{alpha} activation. Electrophoretic mobility shift assay and chromatin immunoprecipitation (ChIP) assay confirmed that PPAR{alpha} directly binds to the PPRE. Activation of CREBH at fasting through fatty acids and PPAR{alpha} suggest that CREBH is involved in nutritional regulation.« less

Safer Nanomaterials and Nanomanufacturing

DTIC Science & Technology

2013-02-01

groups focused on the tracking and effects of gold nanoparticles (AuNPs) within biological systems. Most of the research was conducted in Drosophila ...results, and we decided to shift our focus away from in vitro assays, towards studying the effect of AuNPs on adult Drosophila in vivo. In vivo...investigations of AuNP effects on adult Drosophila melanogaster In vivo effects of AuNPs on adult flies were tested for two routes of exposure

Review and Implementation of Technology for Solid Radioactive Waste Volume Reduction

DTIC Science & Technology

1999-10-15

were shifted to Project 1.1 for spent nuclear fuel cask development to accelerate that project. Those funds should be repaid to Project 1.3 in the... transported between the shipyards such as Nerpa, and other intermediate storage sites such as Gremikha and Andreeva Bay. At these sites the largest...waste source and allow pretreatment unit operations using commercially available technologies of contaminant assaying, cutting/shearing, sorting

Measurement of Nanomolar Dissociation Constants by Titration Calorimetry and Thermal Shift Assay – Radicicol Binding to Hsp90 and Ethoxzolamide Binding to CAII

PubMed Central

Zubrienė, Asta; Matulienė, Jurgita; Baranauskienė, Lina; Jachno, Jelena; Torresan, Jolanta; Michailovienė, Vilma; Cimmperman, Piotras; Matulis, Daumantas

2009-01-01

The analysis of tight protein-ligand binding reactions by isothermal titration calorimetry (ITC) and thermal shift assay (TSA) is presented. The binding of radicicol to the N-terminal domain of human heat shock protein 90 (Hsp90αN) and the binding of ethoxzolamide to human carbonic anhydrase (hCAII) were too strong to be measured accurately by direct ITC titration and therefore were measured by displacement ITC and by observing the temperature-denaturation transitions of ligand-free and ligand-bound protein. Stabilization of both proteins by their ligands was profound, increasing the melting temperature by more than 10 ºC, depending on ligand concentration. Analysis of the melting temperature dependence on the protein and ligand concentrations yielded dissociation constants equal to 1 nM and 2 nM for Hsp90αN-radicicol and hCAII-ethoxzolamide, respectively. The ligand-free and ligand-bound protein fractions melt separately, and two melting transitions are observed. This phenomenon is especially pronounced when the ligand concentration is equal to about half the protein concentration. The analysis compares ITC and TSA data, accounts for two transitions and yields the ligand binding constant and the parameters of protein stability, including the Gibbs free energy and the enthalpy of unfolding. PMID:19582223

Evaluating the antimicrobial, apoptotic, and cancer cell gene delivery properties of protein-capped gold nanoparticles synthesized from the edible mycorrhizal fungus Tricholoma crassum

NASA Astrophysics Data System (ADS)

Basu, Arpita; Ray, Sarmishtha; Chowdhury, Supriyo; Sarkar, Arnab; Mandal, Deba Prasad; Bhattacharjee, Shamee; Kundu, Surekha

2018-05-01

Biosynthesis of gold nanoparticles of distinct geometric shapes with highly functional protein coats without additional capping steps is rarely reported. This study describes green synthesis of protein-coated gold nanoparticles for the first time from the edible, mycorrhizal fungus Tricholoma crassum (Berk.) Sacc . The nanoparticles were of the size range 5-25 nm and of different shapes. Spectroscopic analysis showed red shift of the absorption maxima with longer reaction period during production and blue shift with increase in pH. These were characterized with spectroscopy, SEM, TEM, AFM, XRD, and DLS. The particle size could be altered by changing synthesis parameters. These had potent antimicrobial activity against bacteria, fungi, and multi-drug-resistant pathogenic bacteria. These also had inhibitory effect on the growth kinetics of bacteria and germination of fungal spores. These showed apoptotic properties on eukaryotic cells when tested with comet assays. Moreover, the particles are capped with a natural 40 kDa protein which was utilized as attachment sites for genes to be delivered into sarcoma cancer cells. The present work also attempted at optimizing safe dosage of these nanoparticles using hemolysis assays, for application in therapy. Large-scale production of the nanoparticles in fermentors and other possible applications of the particles have been discussed.

Crocetin shifts autophagic cell survival to death of breast cancer cells in chemotherapy.

PubMed

Zhang, Ailian; Li, Jincheng

2017-03-01

The chemotherapy with fluorouracil is not always effective, in which some breast cancer cells may survive the fluorouracil treatment through enhanced autophagy. Crocetin is the major constituent of saffron, a Chinese traditional herb, which has recently found to have multiple pharmacological effects, including anticancer. However, the effects of Crocetin on the outcome of fluorouracil therapy for breast cancer have not been studied. Here, we showed that fluorouracil treatment inhibited the growth of breast cancer cells, in either a Cell Counting Kit-8 assay or an MTT assay. Inhibition of autophagy further suppressed breast cancer cell growth, suggesting that the breast cancer cells increased autophagic cell survival during fluorouracil treatment. However, Crocetin significantly increased the suppressive effects of fluorouracil on breast cancer cell growth, without affecting either cell apoptosis or autophagy. Inhibition of autophagy at the presence of Crocetin partially abolished the suppressive effects on breast cancer cell growth, suggesting that Crocetin may increase autophagic cell death in fluorouracil-treated breast cancer cells. Furthermore, Crocetin decreased Beclin-1 levels but increased ATG1 levels in fluorouracil-treated breast cancer cells. Together, these data suggest that Crocetin may shift autophagic cell survival to autophagic cell death in fluorouracil-treated breast cancer cells, possibly through modulation of the expression of ATG1 and Beclin-1.

Redox states of Desulfovibrio vulgaris DsrC, a key protein in dissimilatory sulfite reduction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Venceslau, Sofia S.; Cort, John R.; Baker, Erin S.

2013-11-29

Highlights: •DsrC is known to interact with the dissimilatory sulfite reductase enzyme (DsrAB). •We show that, however, most cellular DsrC is not associated with DsrAB. •A gel-shift assay was developed that allows monitoring of the DsrC redox state. •The DsrC intramolecularly oxidized state could only be produced by arginine treatment. -- Abstract: Dissimilatory reduction of sulfite is carried out by the siroheme enzyme DsrAB, with the involvement of the protein DsrC, which has two conserved redox-active cysteines. DsrC was initially believed to be a third subunit of DsrAB. Here, we report a study of the distribution of DsrC in cellmore » extracts to show that, in the model sulfate reducer Desulfovibrio vulgaris, the majority of DsrC is not associated with DsrAB and is thus free to interact with other proteins. In addition, we developed a cysteine-labelling gel-shift assay to monitor the DsrC redox state and behaviour, and procedures to produce the different redox forms. The oxidized state of DsrC with an intramolecular disulfide bond, which is proposed to be a key metabolic intermediate, could be successfully produced for the first time by treatment with arginine.« less

Gel shift analysis of the empA promoter region in Vibrio anguillarum

PubMed Central

Denkin, Steven M; Sekaric, Pedja; Nelson, David R

2004-01-01

Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG)-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20), nine salts solution + 200 μg/ml mucus (NSSM), 3M (marine minimal medium), or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V. anguillarum NB10 cells contain a protein that binds to a 50 bp oligomer containing the empA promoter-lux box-like region. NB10 cells express empA during stationary phase in all growth conditions. The DNA binding protein is not present in M93Sm extracts. M93Sm cells express protease activity only when incubated at high cell density in fish gastrointestinal mucus. The gel shift observed with NB10 cells is not due to VanT binding. The data also suggest that the DNA binding protein is responsible for the less restrictive expression of empA in NB10 compared to M93Sm. PMID:15516264

Extreme sensitive metasensor for targeted biomarkers identification using colloidal nanoparticles-integrated plasmonic unit cells

PubMed Central

Ahmadivand, Arash; Gerislioglu, Burak; Tomitaka, Asahi; Manickam, Pandiaraj; Kaushik, Ajeet; Bhansali, Shekhar; Nair, Madhavan; Pala, Nezih

2018-01-01

Engineered terahertz (THz) plasmonic metamaterials have emerged as promising platforms for quick infection diagnosis, cost-effective and real-time pharmacology applications owing to their non-destructive and harmless interaction with biological tissues in both in vivo and in vitro assays. As a recent member of THz metamaterials family, toroidal metamaterials have been demonstrated to be supporting high-quality sharp resonance modes. Here we introduce a THz metasensor based on a plasmonic surface consisting of metamolecules that support ultra-narrow toroidal resonances excited by the incident radiation and demonstrate detection of an ultralow concertation targeted biomarker. The toroidal plasmonic metasurface was designed and optimized through extensive numerical studies and fabricated by standard microfabrication techniques. The surface then functionalized by immobilizing the antibody for virus-envelope proteins (ZIKV-EPs) for selective sensing. We sensed and quantified the ZIKV-EP in the assays by measuring the spectral shifts of the toroidal resonances while varying the concentration. In an improved protocol, we introduced gold nanoparticles (GNPs) decorated with the same antibodies onto the metamolecules and monitored the resonance shifts for the same concentrations. Our studies verified that the presence of GNPs enhances capturing of biomarker molecules in the surrounding medium of the metamaterial. By measuring the shift of the toroidal dipolar momentum (up to Δω~0.35 cm−1) for different concentrations of the biomarker proteins, we analyzed the sensitivity, repeatability, and limit of detection (LoD) of the proposed toroidal THz metasensor. The results show that up to 100-fold sensitivity enhancement can be obtained by utilizing plasmonic nanoparticles-integrated toroidal metamolecules in comparison to analogous devices. This approach allows for detection of low molecular-weight biomolecules (≈13 kDa) in diluted solutions using toroidal THz plasmonic unit cells. PMID:29552379

Extreme sensitive metasensor for targeted biomarkers identification using colloidal nanoparticles-integrated plasmonic unit cells.

PubMed

Ahmadivand, Arash; Gerislioglu, Burak; Tomitaka, Asahi; Manickam, Pandiaraj; Kaushik, Ajeet; Bhansali, Shekhar; Nair, Madhavan; Pala, Nezih

2018-02-01

Engineered terahertz (THz) plasmonic metamaterials have emerged as promising platforms for quick infection diagnosis, cost-effective and real-time pharmacology applications owing to their non-destructive and harmless interaction with biological tissues in both in vivo and in vitro assays. As a recent member of THz metamaterials family, toroidal metamaterials have been demonstrated to be supporting high-quality sharp resonance modes. Here we introduce a THz metasensor based on a plasmonic surface consisting of metamolecules that support ultra-narrow toroidal resonances excited by the incident radiation and demonstrate detection of an ultralow concertation targeted biomarker. The toroidal plasmonic metasurface was designed and optimized through extensive numerical studies and fabricated by standard microfabrication techniques. The surface then functionalized by immobilizing the antibody for virus-envelope proteins (ZIKV-EPs) for selective sensing. We sensed and quantified the ZIKV-EP in the assays by measuring the spectral shifts of the toroidal resonances while varying the concentration. In an improved protocol, we introduced gold nanoparticles (GNPs) decorated with the same antibodies onto the metamolecules and monitored the resonance shifts for the same concentrations. Our studies verified that the presence of GNPs enhances capturing of biomarker molecules in the surrounding medium of the metamaterial. By measuring the shift of the toroidal dipolar momentum (up to Δ ω ~0.35 cm -1 ) for different concentrations of the biomarker proteins, we analyzed the sensitivity, repeatability, and limit of detection (LoD) of the proposed toroidal THz metasensor. The results show that up to 100-fold sensitivity enhancement can be obtained by utilizing plasmonic nanoparticles-integrated toroidal metamolecules in comparison to analogous devices. This approach allows for detection of low molecular-weight biomolecules (≈13 kDa) in diluted solutions using toroidal THz plasmonic unit cells.

In Vitro Functional Characterization of GET73 as Possible Negative Allosteric Modulator of Metabotropic Glutamate Receptor 5.

PubMed

Beggiato, Sarah; Borelli, Andrea C; Tomasini, Maria C; Castelli, M Paola; Pintori, Nicholas; Cacciaglia, Roberto; Loche, Antonella; Ferraro, Luca

2018-01-01

The present study was aimed to further characterize the pharmacological profile of N-[4-(trifluoromethyl) benzyl]-4-methoxybutyramide (GET73), a putative negative allosteric modulator (NAM) of metabotropic glutamate subtype 5 receptor (mGluR5) under development as a novel medication for the treatment of alcohol dependence. This aim has been accomplished by means of a series of in vitro functional assays. These assays include the measure of several down-stream signaling [intracellular Ca ++ levels, inositol phosphate (IP) formation and CREB phosphorylation (pCREB)] which are generally affected by mGluR5 ligands. In particular, GET73 (0.1 nM-10 μM) was explored for its ability to displace the concentration-response curve of some mGluR5 agonists/probes (glutamate, L-quisqualate, CHPG) in different native preparations. GET73 produced a rightward shift of concentration-response curves of glutamate- and CHPG-induced intracellular Ca ++ levels in primary cultures of rat cortical astrocytes. The compound also induced a rightward shift of concentration response curve of glutamate- and L-quisqualate-induced increase in IP turnover in rat hippocampus slices, along with a reduction of CHPG (10 mM)-induced increase in IP formation. Moreover, GET73 produced a rightward shift of concentration-response curve of glutamate-, CHPG- and L-quisqualate-induced pCREB levels in rat cerebral cortex neurons. Although the engagement of other targets cannot be definitively ruled out, these data support the view that GET73 acts as an mGluR5 NAM and support the significance of further investigating the possible mechanism of action of the compound.

The Vibrio parahaemolyticus small RNA RyhB promotes production of the siderophore vibrioferrin by stabilizing the polycistronic mRNA.

PubMed

Tanabe, Tomotaka; Funahashi, Tatsuya; Nakao, Hiroshi; Maki, Jun; Yamamoto, Shigeo

2013-08-01

High-affinity iron acquisition in Vibrio parahaemolyticus is mediated by the cognate siderophore vibrioferrin. We have previously reported that the vibrioferrin biosynthesis operon (pvsOp) is regulated at the transcriptional level by the iron-responsive repressor Fur (T. Tanabe, T. Funahashi, H. Nakao, S. Miyoshi, S. Shinoda, and S. Yamamoto, J. Bacteriol. 185:6938-6949, 2003). In this study, we identified the Fur-regulated small RNA RyhB and the RNA chaperone Hfq protein as additional regulatory proteins of vibrioferrin biosynthesis. We found that vibrioferrin production was greatly impaired in both the ryhB and hfq deletion mutants, and a TargetRNA search (http://snowwhite.wellesley.edu/targetRNA/index2.html) revealed that the 5'-untranslated region of pvsOp mRNA (pvsOp 5'-UTR) contains a potential base-pairing region required for the formation of the RyhB-pvsOp 5'-UTR duplex. An electrophoresis mobility shift assay indicated that RyhB can directly bind to the pvsOp 5'-UTR with the aid of Hfq. Rifampin chase experiments indicated that the half-life of pvsOp mRNA in the ryhB and hfq mutants was approximately 3-fold shorter than that in the parental strain, suggesting that both RyhB and Hfq are engaged in the stabilization of pvsOp mRNA. Chrome azurol S assays followed by electrophoresis mobility shift assays and rifampin chase experiments carried out for mutant strains indicated that base pairing between RyhB and the pvsOp 5'-UTR results in an increase in the stability of pvsOp mRNA, thereby leading to the promotion of vibrioferrin production. It is unprecedented that RyhB confers increased stability on a polycistronic mRNA involved in siderophore biosynthesis as a direct target.

Claudin-1 has tumor suppressive activity and is a direct target of RUNX3 in gastric epithelial cells.

PubMed

Chang, Ti Ling; Ito, Kosei; Ko, Tun Kiat; Liu, Qiang; Salto-Tellez, Manuel; Yeoh, Khay Guan; Fukamachi, Hiroshi; Ito, Yoshiaki

2010-01-01

The transcription factor RUNX3 is a gastric tumor suppressor. Tumorigenic Runx3(-/-) gastric epithelial cells attach weakly to each other, compared with nontumorigenic Runx3(+/+) cells. We aimed to identify RUNX3 target genes that promote cell-cell contact to improve our understanding of RUNX3's role in suppressing gastric carcinogenesis. We compared gene expression profiles of Runx3(+/+) and Runx3(-/-) cells and observed down-regulation of genes associated with cell-cell adhesion in Runx3(-/-) cells. Reporter, mobility shift, and chromatin immunoprecipitation assays were used to examine the regulation of these genes by RUNX3. Tumorigenesis assays and immunohistological analyses of human gastric tumors were performed to confirm the role of the candidate genes in gastric tumor development. Mobility shift and chromatin immunoprecipitation assays revealed that the promoter activity of the gene that encodes the tight junction protein claudin-1 was up-regulated via the binding of RUNX3 to the RUNX consensus sites. The tumorigenicity of gastric epithelial cells from Runx3(-/-) mice was significantly reduced by restoration of claudin-1 expression, whereas knockdown of claudin-1 increased the tumorigenicity of human gastric cancer cells. Concomitant expression of RUNX3 and claudin-1 was observed in human normal gastric epithelium and cancers. The tight junction protein claudin-1 has gastric tumor suppressive activity and is a direct transcriptional target of RUNX3. Claudin-1 is down-regulated during the epithelial-mesenchymal transition; RUNX3 might therefore act as a tumor suppressor to antagonize the epithelial-mesenchymal transition. Copyright 2010 AGA Institute. Published by Elsevier Inc. All rights reserved.

The g.763G>C SNP of the bovine FASN gene affects its promoter activity via Sp-mediated regulation: implications for the bovine lactating mammary gland.

PubMed

Ordovás, Laura; Roy, Rosa; Pampín, Sandra; Zaragoza, Pilar; Osta, Rosario; Rodríguez-Rey, Jose Carlos; Rodellar, Clementina

2008-07-15

Fatty acid synthase (FASN) is an enzyme that catalyzes de novo synthesis of fatty acids in cells. The bovine FASN gene maps to BTA 19, where several quantitative trait loci for fat-related traits have been described. Our group recently reported the identification of a single nucleotide polymorphism (SNP), g.763G>C, in the bovine FASN 5' flanking region that was significantly associated with milk fat content in dairy cattle. The g.763G>C SNP was part of a GC-rich region that may constitute a cis element for members of the Sp transcription factor family. Thus the SNP could alter the transcription factor binding ability of the FASN promoter and consequently affect the promoter activity of the gene. However, the functional consequences of the SNP on FASN gene expression are unknown. The present study was therefore directed at elucidating the underlying molecular mechanism that could explain the association of the SNP with milk fat content. Three cellular lines (3T3L1, HepG2, and MCF-7) were used to test the promoter and the transcription factor binding activities by luciferase reporter assays and electrophoretic mobility shift assays, respectively. Band shift assays were also carried out with nuclear extracts from lactating mammary gland (LMG) to further investigate the role of the SNP in this tissue. Our results demonstrate that the SNP alters the bovine FASN promoter activity in vitro and the Sp1/Sp3 binding ability of the sequence. In bovine LMG, the specific binding of Sp3 may account for the association with milk fat content.

Mechanical properties of sheet metal components with local reinforcement produced by additive manufacturing

NASA Astrophysics Data System (ADS)

Ünsal, Ismail; Hama-Saleh, R.; Sviridov, Alexander; Bambach, Markus; Weisheit, A.; Schleifenbaum, J. H.

2018-05-01

New technological challenges like electro-mobility pose an increasing demand for cost-efficient processes for the production of product variants. This demand opens the possibility to combine established die-based manufacturing methods and innovative, dieless technologies like additive manufacturing [1, 2]. In this context, additive manufacturing technologies allow for the weight-efficient local reinforcement of parts before and after forming, enabling manufacturers to produce product variants from series parts [3]. Previous work by the authors shows that the optimal shape of the reinforcing structure can be determined using sizing optimization. Sheet metal parts can then be reinforced using laser metal deposition. The material used is a pearlite-reduced, micro-alloyed steel (ZE 630). The aim of this paper is to determine the effect of the additive manufacturing process on the material behavior and the mechanical properties of the base material and the resulting composite material. The parameters of the AM process are optimized to reach similar material properties in the base material and the build-up volume. A metallographic analysis of the parts is presented, where the additive layers, the base material and also the bonding between the additive layers and the base material are analyzed. The paper shows the feasibility of the approach and details the resulting mechanical properties and performance.

Novel red fluorescence protein based microplate assay for drug screening against dormant Mycobacterium tuberculosis by using paraffin.

PubMed

Yeware, Amar; Sarkar, Dhiman

2018-05-01

The hypoxia model of dormancy is widely used in drug screening programs to identify novel inhibitors against latent Mycobacterium tuberculosis disease. In earlier reported microplate assays, hypoxia was maintained by either sealing the microplate or shifting in an anaerobic chamber to develop dormant phenotype. In these assays, inhibitors were added during inoculation, which mainly represents the active stage inhibitors instead of the dormant ones. Herein, the culture was covered with paraffin to develop hypoxia condition and consequently providing the advantage of adding compounds at any stage during incubation of 96-well plate. The stable expression of the red fluorescent protein in the bacilli under both actively growing as well as dormant conditions also facilitate the reliable estimation of growth and inhibition kinetics of bacilli in medium. Furthermore, S/N ratio and Z' factor of this assay were found to be > 27 and 0.91-0.94 respectively, which confirm the robustness of the protocol. This newly developed drug-screening assay offers an easy, inexpensive, safe and high throughput-screening tool to search novel antitubercular inhibitors against both active and dormant bacilli. The red fluorescent H37Ra strain is a suitable surrogate for the more virulent H37Rv strain, and thus this effort will help in combating latent tuberculosis. Copyright © 2018 Elsevier Ltd. All rights reserved.

A novel cerium oxide nanoparticles-based colorimetric sensor using tetramethyl benzidine reagent for antioxidant activity assay.

PubMed

Ozdemir Olgun, F Ayca; Üzer, Ayşem; Ozturk, Birsen Demirata; Apak, Reşat

2018-05-15

Antioxidant activity (AOA) assays using nanotechnology are recently developed utilizing nanoparticles of transition metal oxides, especially nanoceria that can switch between trivalent and tetravalent oxidation states of cerium. Cerium oxide nanoparticles (CeO-NPs) may act as both an oxidant and an antioxidant, depending on the preparation method and particle size. A novel colorimetric sensor for AOA assay is proposed with the use of poly(acrylic acid) sodium salt (PAANa)-coated CeO-NPs. PAANa-coated CeO-NPs oxidized tetramethyl benzidine (TMB), a peroxidase substrate, in a slightly acidic solution at pH 4.0 to a blue charge-transfer complex. Antioxidants decreased the color intensity of the nanoceria suspension, and were indirectly determined by absorbance difference. Detection limits, linearity, additivity and precision were calculated, e.g., quercetin quantification with the proposed assay showed a detection limit of 8.25 × 10 -9 mol L -1 . The trolox equivalent antioxidant capacities of hydrophilic and lipophilic antioxidants were compatible with those of conventional antioxidant assays. Potential interferents such as glucose, citric acid, mannitol, sorbitol and benzoic acid did not adversely affect AOA determination. The developed sensor is more sensitive and selective than similar colorimetric sensors relying on the intrinsic color change of nanoceria. The measurement wavelength is sufficiently red-shifted, preventing possible interferences from plant pigments. Copyright © 2018 Elsevier B.V. All rights reserved.

The transcription factor CCAAT-binding factor CBF/NF-Y regulates the proximal promoter activity in the human alpha 1(XI) collagen gene (COL11A1).

PubMed

Matsuo, Noritaka; Yu-Hua, Wang; Sumiyoshi, Hideaki; Sakata-Takatani, Keiko; Nagato, Hitoshi; Sakai, Kumiko; Sakurai, Mami; Yoshioka, Hidekatsu

2003-08-29

We have characterized the proximal promoter region of the human COL11A1 gene. Transient transfection assays indicate that the segment from -199 to +1 is necessary for the activation of basal transcription. Electrophoretic mobility shift assays (EMSAs) demonstrated that the ATTGG sequence, within the -147 to -121 fragment, is critical to bind nuclear proteins in the proximal COL11A1 promoter. We demonstrated that the CCAAT binding factor (CBF/NF-Y) bound to this region using an interference assay with consensus oligonucleotides and a supershift assay with specific antibodies in an EMSA. In a chromatin immunoprecipitation assay and EMSA using DNA-affinity-purified proteins, CBF/NF-Y proteins directly bound this region in vitro and in vivo. We also showed that four tandem copies of the CBF/NF-Y-binding fragment produced higher transcriptional activity than one or two copies, whereas the absence of a CBF/NF-Y-binding fragment suppressed the COL11A1 promoter activity. Furthermore, overexpression of a dominant-negative CBF-B/NF-YA subunit significantly inhibited promoter activity in both transient and stable cells. These results indicate that the CBF/NF-Y proteins regulate the transcription of COL11A1 by directly binding to the ATTGG sequence in the proximal promoter region.

COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

PubMed Central

2016-01-01

Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

Methanol extract of Codium fragile inhibits tumor necrosis factor-α-induced matrix metalloproteinase-9 and invasiveness of MDA-MB-231 cells by suppressing nuclear factor-κB activation.

PubMed

Dilshara, Matharage Gayani; Jayasooriya, Rajapaksha Gedara Prasad Tharanga; Kang, Chang-Hee; Choi, Yung-Hyun; Kim, Gi-Young

2016-06-01

To evaluate whether the methanol extract of Codium fragile (MECF) regulates tumor necrosis factor-α (TNF-α)-induced invasion of human breast cancer MDA-MB-231 cells by suppressing matrix metalloproteinase-9 (MMP-9). Reverse transcription-polymerase chain reaction (RT-PCR) and western blot analysis were performed to analyze the expression of MMP-9 and nuclear factor-κB (NF-κB) subunits, p65 and p50, and IκB in MDA-MB-231 cells. 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay was used for cell viability. MMP-9 activity and invasion were measured by gelatin zymography and a matrigel invasion assay, respectively. NF-κB activity was measured by an electrophoretic mobility shift assay and luciferase activity. MECF had no effect on cell viability up to a concentration of 100 μg/mL in human breast cancer MDA-MB-231 cells regardless of the presence of TNF-α. MDA-MB-231 cells that were stimulated with TNF-α showed a marked increase of invasion compared to the untreated control, whereas pretreatment with MECF downregulated the TNF-α-induced invasion of MDA-MB-231 cells. Additionally, zymography, western blot analysis, and RT-PCR confirmed that MECF decreased TNF-α-induced MMP-9 expression and activity which is a key regulator for cancer invasion. According to an electrophoretic morbidity shift assay, pretreatment with MECF in MDA-MB-231 cells significantly decreased the TNF-α-induced DNA-binding activity of NF-κB, which is an important transcription factor for regulating cancer invasion-related genes such as MMP-9. Furthermore, treatment with MECF sustained the expression of p65 and p50 in response to TNF-α in the cytosolic compartment. The luciferase assay demonstrated that MECF attenuated TNF-α-induced NF-κB luciferase activity. MECF exhibited its anti-invasive capability by downregulating TNF-α-induced MMP-9 expression, resulting from the suppression of NF-κB activity in the human breast cancer cell line MDA-MB-231. Copyright © 2016 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.

EPA protects against muscle damage in the mdx mouse model of Duchenne muscular dystrophy by promoting a shift from the M1 to M2 macrophage phenotype.

PubMed

Carvalho, Samara Camaçari de; Apolinário, Leticia Montanholi; Matheus, Selma Maria Michelin; Santo Neto, Humberto; Marques, Maria Julia

2013-11-15

In dystrophic mdx mice and in Duchenne muscular dystrophy, inflammation contributes to myonecrosis. Previously, we demonstrated that eicosapentaenoic acid (EPA) decreased inflammation and necrosis in dystrophic muscle. In the present study, we examined the effects of EPA and the corticoid deflazacort (DFZ) as modulators of M1 (iNOS-expressing cells) and M2 (CD206-expressing cells) macrophages. Mdx mice (14 days old) received EPA or DFZ for 16 days. The diaphragm, biceps brachii and quadriceps muscles were studied. Immunofluorescence, immunoblotting and ELISA assays showed that EPA increased interleucin-10, reduced interferon-γ and was more effective than DFZ in promoting a shift from M1 to M2. © 2013.

Comparison of human immunodeficiency virus type 1 tropism profiles in clinical samples by the Trofile and MT-2 assays.

PubMed

Coakley, Eoin; Reeves, Jacqueline D; Huang, Wei; Mangas-Ruiz, Marga; Maurer, Irma; Harskamp, Agnes M; Gupta, Soumi; Lie, Yolanda; Petropoulos, Christos J; Schuitemaker, Hanneke; van 't Wout, Angélique B

2009-11-01

The recent availability of CCR5 antagonists as anti-human immunodeficiency virus (anti-HIV) therapeutics has highlighted the need to accurately identify CXCR4-using variants in patient samples when use of this new drug class is considered. The Trofile assay (Monogram Biosciences) has become the method that is the most widely used to define tropism in the clinic prior to the use of a CCR5 antagonist. By comparison, the MT-2 assay has been used since early in the HIV epidemic to define tropism in clinical specimens. Given that there are few data from direct comparisons of these two assays, we evaluated the performance of the plasma-based Trofile assay and the peripheral blood mononuclear cell (PBMC)-based MT-2 assay for the detection of CXCR4 use in defining the tropism of HIV isolates derived from clinical samples. The various samples used for this comparison were derived from participants of the Amsterdam Cohort Studies on HIV infection and AIDS who underwent consecutive MT-2 assay testing of their PBMCs at approximately 3-month intervals. This unique sample set was specifically selected because consecutive MT-2 assays had demonstrated a shift from negative to positive in PBMCs, reflecting the first emergence of CXCR4-using virus in PBMCs above the level of detection of the assay in these individuals. Trofile testing was performed with clonal HIV type 1 (HIV-1) variants (n = 21), MT-2 cell culture-derived cells (n = 20) and supernatants (n = 42), and plasma samples (n = 76). Among the clonal HIV-1 variants and MT-2 cell culture-derived samples, the results of the Trofile and MT-2 assays demonstrated a high degree of concordance (95% to 98%). Among consecutive plasma samples, detection of CXCR4-using virus was at or before the time of first detection by the MT-2 assay in 5/10 patients by the original Trofile assay and in 9/10 patients by the enhanced-sensitivity Trofile assay. Differences in the time to the first detection of CXCR4 use between the MT-2 assay (PBMCs) and the original Trofile assay (plasma) were greatly reduced by the enhanced-sensitivity Trofile assay, suggesting that sensitivity for the detection of minor CXCR4-using variants may be a more important determinant of discordant findings than compartmentalization. The similarities in performance of the enhanced-sensitivity Trofile and MT-2 assays suggest that either may be an appropriate methodology to define tropism in patient specimens.

Multi-platform metabolomics assays for human lung lavage fluids in an air pollution exposure study.

PubMed

Surowiec, Izabella; Karimpour, Masoumeh; Gouveia-Figueira, Sandra; Wu, Junfang; Unosson, Jon; Bosson, Jenny A; Blomberg, Anders; Pourazar, Jamshid; Sandström, Thomas; Behndig, Annelie F; Trygg, Johan; Nording, Malin L

2016-07-01

Metabolomics protocols are used to comprehensively characterize the metabolite content of biological samples by exploiting cutting-edge analytical platforms, such as gas chromatography (GC) or liquid chromatography (LC) coupled to mass spectrometry (MS) assays, as well as nuclear magnetic resonance (NMR) assays. We have developed novel sample preparation procedures combined with GC-MS, LC-MS, and NMR metabolomics profiling for analyzing bronchial wash (BW) and bronchoalveolar lavage (BAL) fluid from 15 healthy volunteers following exposure to biodiesel exhaust and filtered air. Our aim was to investigate the responsiveness of metabolite profiles in the human lung to air pollution exposure derived from combustion of biofuels, such as rapeseed methyl ester biodiesel, which are increasingly being promoted as alternatives to conventional fossil fuels. Our multi-platform approach enabled us to detect the greatest number of unique metabolites yet reported in BW and BAL fluid (82 in total). All of the metabolomics assays indicated that the metabolite profiles of the BW and BAL fluids differed appreciably, with 46 metabolites showing significantly different levels in the corresponding lung compartments. Furthermore, the GC-MS assay revealed an effect of biodiesel exhaust exposure on the levels of 1-monostearylglycerol, sucrose, inosine, nonanoic acid, and ethanolamine (in BAL) and pentadecanoic acid (in BW), whereas the LC-MS assay indicated a shift in the levels of niacinamide (in BAL). The NMR assay only identified lactic acid (in BW) as being responsive to biodiesel exhaust exposure. Our findings demonstrate that the proposed multi-platform approach is useful for wide metabolomics screening of BW and BAL fluids and can facilitate elucidation of metabolites responsive to biodiesel exhaust exposure. Graphical Abstract Graphical abstract illustrating the study workflow. NMR Nuclear Magnetic Resonance, LC-TOFMS Liquid chromatography-Time Of Flight Mass Spectrometry, GC Gas Chromatography-Mass spectrometry.

The Role ERG and CXCR4 in Prostate Cancer Progression

DTIC Science & Technology

2011-06-01

axis functions in PC progression to enhance invasion and metastasis. To address the regulation of CXCR4 expression, we identified several putative ERG...interaction between ERG factor and CXCR4 gene promoter and link these activities with TMPRSS2-ERG translocations and enhanced metastasis of tumor cells via...and increased VCaP nuclear extract protein in assay enhanced the intensity of bands (Figure 1D). Inclusion of anti-ERG antibodies super shifted

Genomic Instability and Breast Cancer

DTIC Science & Technology

2011-06-01

Survival Assay—Atotal of 1 103 cells were seeded onto a 60-mm dish in triplicate. Twenty-four hours after seeding, cells were irradiated by using a JL...ShepherdMark I-68A 137Cs- irradiator at indicated doses and incubated for 14 days. Result- ing colonies were fixed and stainedwithCoomassie Blue. Num...antibodies, cell culture, transfection and siRNAs, DNA substrates protein purification in insect cells, electrophoretic mobility shift assay and the ATPase

Mapping the transcription start points of the Staphylococcus aureus eap, emp, and vwb promoters reveals a conserved octanucleotide sequence that is essential for expression of these genes.

PubMed

Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan

2008-01-01

Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.

Comparison of Human Immunodeficiency Virus Type 1 Tropism Profiles in Clinical Samples by the Trofile and MT-2 Assays▿

PubMed Central

Coakley, Eoin; Reeves, Jacqueline D.; Huang, Wei; Mangas-Ruiz, Marga; Maurer, Irma; Harskamp, Agnes M.; Gupta, Soumi; Lie, Yolanda; Petropoulos, Christos J.; Schuitemaker, Hanneke; van 't Wout, Angélique B.

2009-01-01

The recent availability of CCR5 antagonists as anti-human immunodeficiency virus (anti-HIV) therapeutics has highlighted the need to accurately identify CXCR4-using variants in patient samples when use of this new drug class is considered. The Trofile assay (Monogram Biosciences) has become the method that is the most widely used to define tropism in the clinic prior to the use of a CCR5 antagonist. By comparison, the MT-2 assay has been used since early in the HIV epidemic to define tropism in clinical specimens. Given that there are few data from direct comparisons of these two assays, we evaluated the performance of the plasma-based Trofile assay and the peripheral blood mononuclear cell (PBMC)-based MT-2 assay for the detection of CXCR4 use in defining the tropism of HIV isolates derived from clinical samples. The various samples used for this comparison were derived from participants of the Amsterdam Cohort Studies on HIV infection and AIDS who underwent consecutive MT-2 assay testing of their PBMCs at approximately 3-month intervals. This unique sample set was specifically selected because consecutive MT-2 assays had demonstrated a shift from negative to positive in PBMCs, reflecting the first emergence of CXCR4-using virus in PBMCs above the level of detection of the assay in these individuals. Trofile testing was performed with clonal HIV type 1 (HIV-1) variants (n = 21), MT-2 cell culture-derived cells (n = 20) and supernatants (n = 42), and plasma samples (n = 76). Among the clonal HIV-1 variants and MT-2 cell culture-derived samples, the results of the Trofile and MT-2 assays demonstrated a high degree of concordance (95% to 98%). Among consecutive plasma samples, detection of CXCR4-using virus was at or before the time of first detection by the MT-2 assay in 5/10 patients by the original Trofile assay and in 9/10 patients by the enhanced-sensitivity Trofile assay. Differences in the time to the first detection of CXCR4 use between the MT-2 assay (PBMCs) and the original Trofile assay (plasma) were greatly reduced by the enhanced-sensitivity Trofile assay, suggesting that sensitivity for the detection of minor CXCR4-using variants may be a more important determinant of discordant findings than compartmentalization. The similarities in performance of the enhanced-sensitivity Trofile and MT-2 assays suggest that either may be an appropriate methodology to define tropism in patient specimens. PMID:19687240

The importance of pollen chemistry in evolutionary host shifts of bees

PubMed Central

Vanderplanck, Maryse; Vereecken, Nicolas J.; Grumiau, Laurent; Esposito, Fabiana; Lognay, Georges; Wattiez, Ruddy; Michez, Denis

2017-01-01

Although bee-plant associations are generally maintained through speciation processes, host shifts have occurred during evolution. Understanding shifts between both phylogenetically and morphologically unrelated plants (i.e., host-saltation) is especially important since they could have been key processes in the origin and radiation of bees. Probably far from being a random process, such host-saltation might be driven by hidden constraints associated with plant traits. We selected two clades of oligolectic bees (i.e., Colletes succinctus group and Melitta leporina group) foraging on co-flowering but unrelated host-plants to test this hypothesis. We analyzed floral scent, floral color and chemical composition of pollen from host and non-host plants of these two clades. We did not find evidence for host-plant evolution in the Melitta leporina group driven by one of the assayed floral traits. On the contrary, hosts of the C. succinctus group display similar primary nutritive content of pollen (i.e., amino acids and sterols) but not similar floral scent or color, suggesting that shared pollen chemistry probably mediates saltation in this clade. Our study revealed that constraints shaping floral associations are diverse and clearly depend on species life-history traits, but evidence suggests that pollen chemistry may act as a major floral filter and guide evolutionary host-shifts. PMID:28216663

Identification of RNAIII-binding proteins in Staphylococcus aureus using tethered RNAs and streptavidin aptamers based pull-down assay.

PubMed

Zhang, Xu; Zhu, Qing; Tian, Tian; Zhao, Changlong; Zang, Jianye; Xue, Ting; Sun, Baolin

2015-05-15

It has been widely recognized that small RNAs (sRNAs) play important roles in physiology and virulence control in bacteria. In Staphylococcus aureus, many sRNAs have been identified and some of them have been functionally studied. Since it is difficult to identify RNA-binding proteins (RBPs), very little has been known about the RBPs in S. aureus, especially those associated with sRNAs. Here we adopted a tRNA scaffold streptavidin aptamer based pull-down assay to identify RBPs in S. aureus. The tethered RNA was successfully captured by the streptavidin magnetic beads, and proteins binding to RNAIII were isolated and analyzed by mass spectrometry. We have identified 81 proteins, and expressed heterologously 9 of them in Escherichia coli. The binding ability of the recombinant proteins with RNAIII was further analyzed by electrophoresis mobility shift assay, and the result indicates that proteins CshA, RNase J2, Era, Hu, WalR, Pyk, and FtsZ can bind to RNAIII. This study suggests that some proteins can bind to RNA III in S. aureus, and may be involved in RNA III function. And tRSA based pull-down assay is an effective method to search for RBPs in bacteria, which should facilitate the identification and functional study of RBPs in diverse bacterial species.

How well can morphology assess cell death modality? A proteomics study

PubMed Central

Chernobrovkin, Alexey L; Zubarev, Roman A

2016-01-01

While the focus of attempts to classify cell death programs has finally shifted in 2010s from microscopy-based morphological characteristics to biochemical assays, more recent discoveries have put the underlying assumptions of many such assays under severe stress, mostly because of the limited specificity of the assays. On the other hand, proteomics can quantitatively measure the abundances of thousands of proteins in a single experiment. Thus proteomics could develop a modern alternative to both semiquantitative morphology assessment as well as single-molecule biochemical assays. Here we tested this hypothesis by analyzing the proteomes of cells dying after been treated with various chemical agents. The most striking finding is that, for a multivariate model based on the proteome changes in three cells lines, the regulation patterns of the 200–500 most abundant proteins typically attributed to household type more accurately reflect that of the proteins directly interacting with the drug than any other protein subset grouped by common function or biological process, including cell death. This is in broad agreement with the 'rigid cell death mechanics' model where drug action mechanism and morphological changes caused by it are bijectively linked. This finding, if confirmed, will open way for a broad use of proteomics in death modality assessment. PMID:27752363

Cellular and Biophysical Pipeline for the Screening of Peroxisome Proliferator-Activated Receptor Beta/Delta Agonists: Avoiding False Positives

PubMed Central

Batista, Fernanda Aparecida Heleno

2018-01-01

Peroxisome proliferator-activated receptor beta/delta (PPARß/δ) is considered a therapeutic target for metabolic disorders, cancer, and cardiovascular diseases. Here, we developed one pipeline for the screening of PPARß/δ agonists, which reduces the cost, time, and false-positive hits. The first step is an optimized 3-day long cellular transactivation assay based on reporter-gene technology, which is supported by automated liquid-handlers. This primary screening is followed by a confirmatory transactivation assay and by two biophysical validation methods (thermal shift assay (TSA) and (ANS) fluorescence quenching), which allow the calculation of the affinity constant, giving more information about the selected hits. All of the assays were validated using well-known commercial agonists providing trustworthy data. Furthermore, to validate and test this pipeline, we screened a natural extract library (560 extracts), and we found one plant extract that might be interesting for PPARß/δ modulation. In conclusion, our results suggested that we developed a cheaper and more robust pipeline that goes beyond the single activation screening, as it also evaluates PPARß/δ tertiary structure stabilization and the ligand affinity constant, selecting only molecules that directly bind to the receptor. Moreover, this approach might improve the effectiveness of the screening for agonists that target PPARß/δ for drug development.

Gelatin-modified gold nanoparticles for direct detection of urinary total gelatinase activity: Diagnostic value in bladder cancer.

PubMed

Nossier, Ahmed I; Mohammed, Ola S; Fakhr El-Deen, Rasha R; Zaghloul, Ashraf S; Eissa, Sanaa

2016-12-01

Matrix metalloproteinases (MMPs), in particularly gelatinases (MMP-2 and MMP-9) were reported as urinary markers of bladder cancer. In this work, we developed a simple colorimetric gold nanoparticle (AuNP) assay for rapid and sensitive detection of urinary total gelatinase activity based on the surface plasmon resonance (SPR) property of AuNPs. Gelatin-modified AuNPs were stably suspended in solution even upon addition of an aggregation inducer as 6-mercaptohexan-1-ol (6-MCH). Gelatinases digest gelatin capping. Subsequently, addition of 6-MCH leads to AuNPs aggregation with red to blue color shift. In a pilot study, results of the developed AuNP assay were consistent with zymography for qualitative detection of urinary total gelatinase activity. The sensitivity and specificity of both assays were 80% and 90.9% respectively. The absorption ratios, A 625 /A 530 of the reacted AuNP solutions were used to quantify the total gelatinase concentration. The best cut off value was 0.01895ng/μg protein, at which the sensitivity was 87.5% and the specificity was 86.4%. The developed AuNP assay is simple, low-cost and can aid non-invasive diagnosis of bladder cancer. Copyright © 2016 Elsevier B.V. All rights reserved.

Evaluation of genome damage in subjects occupationally exposed to possible carcinogens.

PubMed

Zeljezic, Davor; Mladinic, Marin; Kopjar, Nevenka; Radulovic, Azra Hursidic

2016-09-01

In occupational exposures, populations are simultaneously exposed to a mixture of chemicals. We aimed to evaluate DNA damage due to possible carcinogen exposure (phenylhydrazine, ethylene oxide, dichloromethane, and 1,2-dichloroethane) in lymphocytes of pharmaceutical industry workers from the same production line. Population comprised 16 subjects (9 females and 7 males) who were exposed to multiple chemicals for 8 months. Genome damage was assessed using alkaline comet assay, micronucleus assay, and comet assay coupled with fluorescent in situ hybridization (comet-FISH). After 8 months of exposure, the issue of irregular use of all available personal protective equipment (PPE) came into light. To decrease the risk of exposure, strict use of PPE was enforced. After 8 months of strict PPE use, micronuclei frequency and comet assay parameters in lymphocytes of pharmaceutical workers significantly decreased compared with prior period of irregular PPE use. Comet-FISH results indicated a significant shift in distribution of signals for the TP 53 gene toward a more frequent occurrence in the comet tail. Prolonged exposure to possible carcinogens may hinder DNA repair mechanisms and affect structural integrity of TP 53 Two indicators of loss of TP 53 gene integrity have risen, namely, TP 53 fragmentation rate in lymphocytes with persistently elevated primary damage and incidence of TP 53 deletions in undamaged lymphocytes. © The Author(s) 2015.

Alcohols which have been in contact with any plastics may interfere in radioimmunoassays of progesterone.

PubMed

Ocvirk, Rok; Bisson, Jennifer M; Murphy, Beverley E Pearson

2009-01-01

In recent years there has been increasing use of plastic rather than glass containers for many liquids, including wine. However we have found that residue from commercially obtained 'pure' ethanol dispensed in plastic bottles interferes in some biochemical assays. We have observed a volume-dependent decrease in maximally bound ligand in radioimmunoassays of progesterone. The resulting shift in the standard curve leads to an underestimation of the analyte concentrations and to altered estimation of cross reactivity by competing ligands. These effects became apparent in assays with high sensitivity (500 pg or less). All sources of ethanol obtainable in Quebec contained impurities. A similar effect was also produced by 'pure' methanol. The reduction in maximally bound ligand was amplified when the alcohol was aliquoted using plastic pipette tips. We conclude that alcohols which have had any contact with plastics are not safe to use in immunoassays of progesterone (or its metabolites as estimated according to cross-reactivity after HPLC) and may affect other assays. If the use of alcohol and plastic tips cannot be avoided, the amount of alcohol used should be reduced to 1% or less. This can be accomplished by preparing steroid standards in assay buffers containing albumin or gelatin, which enhance the solubility of steroids in aqueous media.

Arginine insertion and loss of N-linked glycosylation site in HIV-1 envelope V3 region confer CXCR4-tropism

PubMed Central

Tsuchiya, Kiyoto; Ode, Hirotaka; Hayashida, Tsunefusa; Kakizawa, Junko; Sato, Hironori; Oka, Shinichi; Gatanaga, Hiroyuki

2013-01-01

The third variable region (V3) of HIV-1 envelope glycoprotein gp120 plays a key role in determination of viral coreceptor usage (tropism). However, which combinations of mutations in V3 confer a tropism shift is still unclear. A unique pattern of mutations in antiretroviral therapy-naive HIV-1 patient was observed associated with the HIV-1 tropism shift CCR5 to CXCR4. The insertion of arginine at position 11 and the loss of the N-linked glycosylation site were indispensable for acquiring pure CXCR4-tropism, which were confirmed by cell-cell fusion assay and phenotype analysis of recombinant HIV-1 variants. The same pattern of mutations in V3 and the associated tropism shift were identified in two of 53 other patients (3.8%) with CD4+ cell count <200/mm3. The combination of arginine insertion and loss of N-linked glycosylation site usually confers CXCR4-tropism. Awareness of this rule will help to confirm the tropism prediction from V3 sequences by conventional rules. PMID:23925152

Coelenterazine-v ligated to Ca2+-triggered coelenterazine-binding protein is a stable and efficient substrate of the red-shifted mutant of Renilla muelleri luciferase.

PubMed

Stepanyuk, Galina A; Unch, James; Malikova, Natalia P; Markova, Svetlana V; Lee, John; Vysotski, Eugene S

2010-10-01

It has been shown that the coelenterazine analog, coelenterazine-v, is an efficient substrate for a reaction catalyzed by Renilla luciferase. The resulting bioluminescence emission maximum is shifted to a longer wavelength up to 40 nm, which allows the use of some "yellow" Renilla luciferase mutants for in vivo imaging. However, the utility of coelenterazine-v in small-animal imaging has been hampered by its instability in solution and in biological tissues. To overcome this drawback, we ligated coelenterazine-v to Ca(2+)-triggered coelenterazine-binding protein from Renilla muelleri, which apparently functions in the organism for stabilizing and protecting coelenterazine from oxidation. The coelenterazine-v bound within coelenterazine-binding protein has revealed a greater long-term stability at both 4 and 37 °C. In addition, the coelenterazine-binding protein ligated by coelenterazine-v yields twice the total light over free coelenterazine-v as a substrate for the red-shifted R. muelleri luciferase. These findings suggest the possibility for effective application of coelenterazine-v in various in vitro assays.

Affinity Pulldown of Biotinylated RNA for Detection of Protein-RNA Complexes.

PubMed

Panda, Amaresh C; Martindale, Jennifer L; Gorospe, Myriam

2016-12-20

RNA-binding proteins (RBPs) have recently emerged as crucial players in the regulation of gene expression. The interactions of RBPs with target mRNAs control the levels of gene products by altering different regulatory steps, including pre-mRNA splicing and maturation, nuclear mRNA export, and mRNA stability and translation (Glisovic et al. , 2008). There are several methodologies available today to identify RNAs bound to specific RBPs; some detect only recombinant molecules in vitro , others detect recombinant and endogenous molecules, while others detect only endogenous molecules. Examples include systematic evolution of ligands by exponential enrichment (SELEX), biotinylated RNA pulldown assay, RNA immunoprecipitation (RIP) assay, electrophoretic mobility shift assay (EMSA), RNA footprinting analysis, and various UV crosslinking and immunoprecipitation (CLIP) methods such as CLIP, PAR-CLIP, and iCLIP (Popova et al. , 2015). Here, we describe a simple and informative method to study and identify the RNA region of interaction between an RBP and its target transcript (Panda et al. , 2014 and 2016). Its reproducibility and ease of use make this protocol a fast and useful method to identify interactions between RBPs and specific RNAs.

Isolation and characterization of chromosome-gain and increase-in-ploidy mutants in yeast.

PubMed

Chan, C S; Botstein, D

1993-11-01

We have developed a colony papillation assay for monitoring the copy number of genetically marked chromosomes II and III in Saccharomyces cerevisiae. The unique feature of this assay is that it allows detection of a gain of the marked chromosomes even if there is a gain of the entire set of chromosomes (increase-in-ploidy). This assay was used to screen for chromosome-gain or increase-in-ploidy mutants. Five complementation groups have been defined for recessive mutations that confer an increase-in-ploidy (ipl) phenotype, which, in each case, cosegregates with a temperature-sensitive growth phenotype. Four new alleles of CDC31, which is required for spindle pole body duplication, were also recovered from this screen. Temperature-shift experiments with ipl1 cells show that they suffer severe nondisjunction at 37 degrees. Similar experiments with ipl2 cells show that they gain entire sets of chromosomes and become arrested as unbudded cells at 37 degrees. Molecular cloning and genetic mapping show that IPL1 is a newly identified gene, whereas IPL2 is allelic to BEM2, which is required for normal bud growth.

Association of Serum Concentration of Different Trace Elements with Biomarkers of Systemic Oxidant Status in Dairy Cattle.

PubMed

Abuelo, Angel; Hernandez, Joaquín; Alves-Nores, Víctor; Benedito, José L; Castillo, Cristina

2016-12-01

There has been some recent criticism about the reliability of the assays commonly used to measure oxidant status in cattle, because some recent publications suggested that the concentration of different trace elements influences the results of these assays. The aim of this study was to test the correlation in 502 bovine serum samples between the concentration of several trace elements (Br, Co, Cr, Cu, Fe, I, Mn, Mo, Ni, Se, Sr, V and Zn) and markers of oxidant status (reactive oxygen species (ROS) and total serum antioxidant capacity (SAC)). The Oxidative Stress index (OSi) was also calculated as ROS/SAC. Some significant correlations were found, although weak (|ρ| < 0.50). Therefore, the relationships observed might be attributed to the different pro- and antioxidant effect of the different elements rather than to the assays detecting these elements instead of the oxidised molecules or total antioxidant potential, respectively. The OSi was poorly correlated (|ρ| ≤ 0.36) with the concentration of the studied trace elements, and therefore, its use is recommended to assess shifts in the systemic redox balance.

The rat's not for turning: Dissociating the psychological components of cognitive inflexibility☆

PubMed Central

Nilsson, Simon R.O.; Alsiö, Johan; Somerville, Elizabeth M.; Clifton, Peter G.

2015-01-01

Executive function is commonly assessed by assays of cognitive flexibility such as reversal learning and attentional set-shifting. Disrupted performance in these assays, apparent in many neuropsychiatric disorders, is frequently interpreted as inability to overcome prior associations with reward. However, non-rewarded or irrelevant associations may be of considerable importance in both discrimination learning and cognitive flexibility. Non-rewarded associations can have greater influence on choice behaviour than rewarded associations in discrimination learning. Pathology-related deficits in cognitive flexibility can produce selective disruptions to both the processing of irrelevant associations and associations with reward. Genetic and pharmacological animal models demonstrate that modulation of reversal learning may result from alterations in either rewarded or non-rewarded associations. Successful performance in assays of cognitive flexibility can therefore depend on a combination of rewarded, non-rewarded, and irrelevant associations derived from previous learning, accounting for some inconsistencies observed in the literature. Taking this combination into account may increase the validity of animal models and may also reveal pathology-specific differences in problem solving and executive function. PMID:26112128

Sp1-mediated transcription regulation of TAF-Ialpha gene encoding a histone chaperone.

PubMed

Asaka, Masamitsu N; Murano, Kensaku; Nagata, Kyosuke

2008-11-28

TAF-I, one of histone chaperones, consists of two subtypes, TAF-Ialpha and TAF-Ibeta. The histone chaperone activity of TAF-I is regulated by dimer patterns of these subtypes. TAF-Ibeta is expressed ubiquitously, while the expression level of TAF-Ialpha with less activity than TAF-Ibeta differs among cell types. It is, therefore, assumed that the expression level of TAF-Ialpha in a cell is important for the TAF-I activity level. Here, we found that TAF-Ialpha and TAF-Ibeta genes are under the control of distinct promoters. Reporter assays and gel shift assays demonstrated that Sp1 binds to three regions in the TAF-Ialpha promoter and two or all mutaions of the three Sp1 binding regions reduced the TAF-Ialpha promoter activity. ChIP assays demonstrated that Sp1 binds to the TAF-Ialpha promoter in vivo. Furthermore, the expression level of TAF-Ialpha mRNA was reduced by knockdown of Sp1 using siRNA method. These studies indicated that the TAF-Ialpha promoter is under the control of Sp1.

Lactoferricin B Inhibits the Phosphorylation of the Two-Component System Response Regulators BasR and CreB*

PubMed Central

Ho, Yu-Hsuan; Sung, Tzu-Cheng; Chen, Chien-Sheng

2012-01-01

Natural antimicrobial peptides provide fundamental protection for multicellular organisms from microbes, such as Lactoferricin B (Lfcin B). Many studies have shown that Lfcin B penetrates the cell membrane and has intracellular activities. To elucidate the intracellular behavior of Lfcin B, we first used Escherichia coli K12 proteome chips to identify the intracellular targets of Lfcin B. The results showed that Lfcin B binds to two response regulators, BasR and CreB, of the two-component system. For further analysis, we conducted several in vitro and in vivo experiments and utilized bioinformatics methods. The electrophoretic mobility shift assays and kinase assays indicate that Lfcin B inhibits the phosphorylation of the response regulators (BasR and CreB) and their cognate sensor kinases (BasS and CreC). Antibacterial assays showed that Lfcin B reduced E. coli's tolerance to environmental stimuli, such as excessive ferric ions and minimal medium conditions. This is the first study to show that an antimicrobial peptide inhibits the growth of bacteria by influencing the phosphorylation of a two-component system directly. PMID:22138548

Lactoferricin B inhibits the phosphorylation of the two-component system response regulators BasR and CreB.

PubMed

Ho, Yu-Hsuan; Sung, Tzu-Cheng; Chen, Chien-Sheng

2012-04-01

Natural antimicrobial peptides provide fundamental protection for multicellular organisms from microbes, such as Lactoferricin B (Lfcin B). Many studies have shown that Lfcin B penetrates the cell membrane and has intracellular activities. To elucidate the intracellular behavior of Lfcin B, we first used Escherichia coli K12 proteome chips to identify the intracellular targets of Lfcin B. The results showed that Lfcin B binds to two response regulators, BasR and CreB, of the two-component system. For further analysis, we conducted several in vitro and in vivo experiments and utilized bioinformatics methods. The electrophoretic mobility shift assays and kinase assays indicate that Lfcin B inhibits the phosphorylation of the response regulators (BasR and CreB) and their cognate sensor kinases (BasS and CreC). Antibacterial assays showed that Lfcin B reduced E. coli's tolerance to environmental stimuli, such as excessive ferric ions and minimal medium conditions. This is the first study to show that an antimicrobial peptide inhibits the growth of bacteria by influencing the phosphorylation of a two-component system directly.

Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia

PubMed Central

Martin, Jaclyn; Carrillo, Yisel; Talley, Justin L.; Ochoa-Corona, Francisco M.

2018-01-01

Background The importance of tick and flea-borne rickettsia infections is increasingly recognized worldwide. While increased focus has shifted in recent years to the development of point-of-care diagnostics for various vector-borne diseases in humans and animals, little research effort has been devoted to their integration into vector surveillance and control programs, particularly in resource-challenged countries. One technology which may be helpful for large scale vector surveillance initiatives is loop-mediated isothermal amplification (LAMP). The aim of this study was to develop a LAMP assay to detect spotted fever group (SFG) rickettsia DNA from field-collected ticks and fleas and compare with published end-point PCR results. Methodology/Principal findings A Spotted Fever Group rickettsia-specific loop-mediated isothermal amplification (SFGR-LAMP) assay was developed using primers based on a region of the R. rickettsii 17kDa protein gene. The sensitivity, specificity, and reproducibility of the assay were evaluated. The assay was then compared with the results of end-point PCR assays for pooled tick and flea samples obtained from field-based surveillance studies. The sensitivity of the SFGR-LAMP assay was 0.00001 ng/μl (25μl volume) which was 10 times more sensitive than the 17kDa protein gene end-point PCR used as the reference method. The assay only recognized gDNA from SFG and transitional group (TRG) rickettsia species tested but did not detect gDNA from typhus group (TG) rickettsia species or closely or distantly related bacterial species. The SFGR-LAMP assay detected the same positives from a set of pooled tick and flea samples detected by end-point PCR in addition to two pooled flea samples not detected by end-point PCR. Conclusions/significance To our knowledge, this is the first study to develop a functional LAMP assay to initially screen for SFG and TRG rickettsia pathogens in field-collected ticks and fleas. With a high sensitivity and specificity, the results indicate the potential use as a field-based surveillance tool for tick and flea-borne rickettsial pathogens in resource-challenged countries. PMID:29390021

Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia.

PubMed

Noden, Bruce H; Martin, Jaclyn; Carrillo, Yisel; Talley, Justin L; Ochoa-Corona, Francisco M

2018-01-01

The importance of tick and flea-borne rickettsia infections is increasingly recognized worldwide. While increased focus has shifted in recent years to the development of point-of-care diagnostics for various vector-borne diseases in humans and animals, little research effort has been devoted to their integration into vector surveillance and control programs, particularly in resource-challenged countries. One technology which may be helpful for large scale vector surveillance initiatives is loop-mediated isothermal amplification (LAMP). The aim of this study was to develop a LAMP assay to detect spotted fever group (SFG) rickettsia DNA from field-collected ticks and fleas and compare with published end-point PCR results. A Spotted Fever Group rickettsia-specific loop-mediated isothermal amplification (SFGR-LAMP) assay was developed using primers based on a region of the R. rickettsii 17kDa protein gene. The sensitivity, specificity, and reproducibility of the assay were evaluated. The assay was then compared with the results of end-point PCR assays for pooled tick and flea samples obtained from field-based surveillance studies. The sensitivity of the SFGR-LAMP assay was 0.00001 ng/μl (25μl volume) which was 10 times more sensitive than the 17kDa protein gene end-point PCR used as the reference method. The assay only recognized gDNA from SFG and transitional group (TRG) rickettsia species tested but did not detect gDNA from typhus group (TG) rickettsia species or closely or distantly related bacterial species. The SFGR-LAMP assay detected the same positives from a set of pooled tick and flea samples detected by end-point PCR in addition to two pooled flea samples not detected by end-point PCR. To our knowledge, this is the first study to develop a functional LAMP assay to initially screen for SFG and TRG rickettsia pathogens in field-collected ticks and fleas. With a high sensitivity and specificity, the results indicate the potential use as a field-based surveillance tool for tick and flea-borne rickettsial pathogens in resource-challenged countries.

A Study of the Effects of High Power Pulsed 2450 MHz Microwaves, ELF modulated Microwaves, and ELF Fields on Human Lymphocytes and Selected Cell Lines

DTIC Science & Technology

1993-01-27

Considerable effect was expended in investigating shifts in intercellular calcium of one particular cell line, Jurket, using flow cytometry methods. No...culture. The following analysis were used to characterize the immortalized cell lines: flow cytometry , electron microscopy, two-dimensional protein gel...further characterized by flow cytometry , electron microscopy, two dimensional protein electrophoresis and nuclear run-off assay. Flow cytometric analysis of

Manufacturing of a novel double-function ssDNA aptamer for sensitive diagnosis and efficient neutralization of SEA.

PubMed

Sedighian, Hamid; Halabian, Raheleh; Amani, Jafar; Heiat, Mohammad; Taheri, Ramezan Ali; Imani Fooladi, Abbas Ali

2018-05-01

Staphylococcal enterotoxin A (SEA) is an enterotoxin produced mainly by Staphylococcus aureus. In recent years, it has become the most prevalent compound for staphylococcal food poisoning (SFP) around the world. In this study, we isolate new dual-function single-stranded DNA (ssDNA) aptamers by using some new methods, such as the Taguchi method, by focusing on the detection and neutralization of SEA enterotoxin in food and clinical samples. For the asymmetric polymerase chain reaction (PCR) optimization of each round of systematic evolution of ligands by exponential enrichment (SELEX), we use Taguchi L9 orthogonal arrays, and the aptamer mobility shift assay (AMSA) is used for initial evaluation of the protein-DNA interactions on the last SELEX round. In our investigation the dissociation constant (K D ) value and the limit of detection (LOD) of the candidate aptamer were found to be 8.5 ± 0.91 of nM and 5 ng/ml using surface plasmon resonance (SPR). In the current study, the Taguchi and mobility shift assay methods were innovatively harnessed to improve the selection process and evaluate the protein-aptamer interactions. To the best of our knowledge, this is the first report on employing these two methods in aptamer technology especially against bacterial toxin. Copyright © 2018 Elsevier Inc. All rights reserved.

Promoter mapping of the mouse Tcp-10bt gene in transgenic mice identifies essential male germ cell regulatory sequences.

PubMed

Ewulonu, U K; Snyder, L; Silver, L M; Schimenti, J C

1996-03-01

Transgenic mice were generated to localize essential promoter elements in the mouse testis-expressed Tcp-10 genes. These genes are expressed exclusively in male germ cells, and exhibit a diffuse range of transcriptional start sites, possibly due to the absence of a TATA box. A series of transgene constructs containing different amounts of 5' flanking DNA revealed that all sequences necessary for appropriate temporal and tissue-specific transcription of Tcp-10 reside between positions -1 to -973. All transgenic animals containing these sequences expressed a chimeric transgene at high levels, in a pattern that paralleled the endogenous genes. These experiments further defined a 227 bp fragment from -746 to -973 that was absolutely essential for expression. In a gel-shift assay, this 227-bp fragment bound nuclear protein from testis, but not other tissues, to yield two retarded bands. Sequence analysis of this fragment revealed a half-site for the AP-2 transcription factor recognition sequence. Gel shift assays using native or mutant oligonucleotides demonstrated that the putative AP-2 recognition sequence was essential for generating the retarded bands. Since the binding activity is testis-specific, but AP-2 expression is not exclusive to male germ cells, it is possible that transcription of Tcp-10 requires interaction between AP-2 and a germ cell-specific transcription factor.

Utilisation of Quartz Crystal Microbalance Sensors with Dissipation (QCM-D) for a Clauss Fibrinogen Assay in Comparison with Common Coagulation Reference Methods.

PubMed

Oberfrank, Stephanie; Drechsel, Hartmut; Sinn, Stefan; Northoff, Hinnak; Gehring, Frank K

2016-02-24

The determination of fibrinogen levels is one of the most important coagulation measurements in medicine. It plays a crucial part in diagnostic and therapeutic decisions, often associated with time-critical conditions. The commonly used measurement is the Clauss fibrinogen assay (CFA) where plasma is activated by thrombin reagent and which is conducted by mechanical/turbidimetric devices. As quartz crystal microbalance sensors with dissipation (QCM-D) based devices have a small footprint, can be operated easily and allow measurements independently from sample transportation time, laboratory location, availability and opening hours, they offer a great opportunity to complement laboratory CFA measurements. Therefore, the objective of the work was to (1) transfer the CFA to the QCM-D method; (2) develop an easy, time- and cost-effective procedure and (3) compare the results with references. Different sensor coatings (donor's own plasma; gold surface) and different QCM-D parameters (frequency signal shift; its calculated turning point; dissipation signal shift) were sampled. The results demonstrate the suitability for a QCM-D-based CFA in physiological fibrinogen ranges. Results were obtained in less than 1 min and in very good agreement with a standardized reference (Merlin coagulometer). The results provide a good basis for further investigation and pave the way to a possible application of QCM-D in clinical and non-clinical routine in the medical field.

Behavioral effects of Splenda, Equal and sucrose: clues from planarians on sweeteners

PubMed Central

Ouyang, Kevin; Nayak, Sunil; Lee, Young; Kim, Erin; Wu, Michael; Tallarida, Christopher S.; Rawls, Scott M.

2016-01-01

Sweetened diets share commonalities with drugs of abuse, but studies comparing behavioral effects of different sweeteners are lacking. Common table sugar produces rewarding and withdrawal effects in planarians. We postulated that Splenda and Equal would produce similar responses and used a tetrad of behavioral assays to test this hypothesis. Acute exposure to a relatively high concentration (10%) of each sweetener produced stereotyped responses (C-shapes) and reduced motility, with Equal producing greater motor effects than sucrose or Splenda. In experiments testing for anxiogenic-like effects, planarians withdrawn from Splenda (1, 3%) or sucrose (1, 3%), but not Equal, and placed into a petri dish with dark and light compartments spent more time in the dark compared to water controls. In place conditioning experiments, both Splenda (0.01%) and sucrose (0.01%) produced an environmental preference shift. Maltodextrin (0.1%), a principal ingredient of Splenda and Equal, produced a significant preference shift. In contrast, sucralose, an indigestible polysaccharide contained in Splenda and Equal, was ineffective. Our data reveal that Splenda produces sucrose-like rewarding and withdrawal effects in planarians that may be dependent on maltodextrin and dextrose. The ineffectiveness of Equal may be due to the presence of aspartame, which is too water insoluble to test in our planarian assay, or to its bitter aftertaste that could mask any rewarding effects produce by maltodextrin or dextrose. PMID:27845240

The change of nuclear LC3 distribution in acute myeloid leukemia cells.

PubMed

Guo, Wenjian; Jin, Jingrui; Pan, Jiajia; Yao, Rongxing; Li, Xia; Huang, Xin; Ma, Zhixing; Huang, Sujuan; Yan, Xiao; Jin, Jie; Dong, Aishu

2018-05-09

Making sure the change of nuclear LC3 distribution in the autophagy of acute myeloid leukemia (AML) cell and finding out the regulation mechanism may lead to a breakthrough for killing AML cells. Western blots were performed to assess the expression of autophagy proteins. Changes in the LC3 distribution were monitored by immunofluorescence assays together with western blots, and the expression levels of Sirt1, DOR, Beclin1, HMGB1, and AMPK mRNA were detected via fluorescent quantitative PCR. The effects of Sirt1 and DOR on cell proliferation and survival were analyzed by MTT, flow cytometry, and western blotting assays. We found that treating AML cells with Ara-c or Sorafenib resulted in autophagy enhancement, and when autophagy was enhanced, nuclear LC3 moved into the cytoplasm. Notably, when autophagy was inhibited by blocking the nuclear LC3 shift, the cytotoxicity of drugs was enhanced. Our results also identified Sirt1 and DOR as regulatory molecules for the observed nuclear LC3 shift, and these molecules further affected the expression of Beclin1, HMGB1, and AMPK. Our results suggest the distribution of nuclear LC3 can be a novel way for further studying death of AML cells,and the regulatory molecules may be new targets for treating AML. Copyright © 2018 Elsevier Inc. All rights reserved.

Quantification of mRNA expression by competitive PCR using non-homologous competitors containing a shifted restriction site

PubMed Central

Watzinger, Franz; Hörth, Elfriede; Lion, Thomas

2001-01-01

Despite the recent introduction of real-time PCR methods, competitive PCR techniques continue to play an important role in nucleic acid quantification because of the significantly lower cost of equipment and consumables. Here we describe a shifted restriction-site competitive PCR (SRS-cPCR) assay based on a modified type of competitor. The competitor fragments are designed to contain a recognition site for a restriction endonuclease that is also present in the target sequence to be quantified, but in a different position. Upon completion of the PCR, the amplicons are digested in the same tube with a single restriction enzyme, without the need to purify PCR products. The generated competitor- and target-specific restriction fragments display different sizes, and can be readily separated by electrophoresis and quantified by image analysis. Suboptimal digestion affects competitor- and target-derived amplicons to the same extent, thus eliminating the problem of incorrect quantification as a result of incomplete digestion of PCR products. We have established optimized conditions for a panel of 20 common restriction endonucleases permitting efficient digestion in PCR buffer. It is possible, therefore, to find a suitable restriction site for competitive PCR in virtually any sequence of interest. The assay presented is inexpensive, widely applicable, and permits reliable and accurate quantification of nucleic acid targets. PMID:11376164

Utilisation of Quartz Crystal Microbalance Sensors with Dissipation (QCM-D) for a Clauss Fibrinogen Assay in Comparison with Common Coagulation Reference Methods

PubMed Central

Oberfrank, Stephanie; Drechsel, Hartmut; Sinn, Stefan; Northoff, Hinnak; Gehring, Frank K.

2016-01-01

The determination of fibrinogen levels is one of the most important coagulation measurements in medicine. It plays a crucial part in diagnostic and therapeutic decisions, often associated with time-critical conditions. The commonly used measurement is the Clauss fibrinogen assay (CFA) where plasma is activated by thrombin reagent and which is conducted by mechanical/turbidimetric devices. As quartz crystal microbalance sensors with dissipation (QCM-D) based devices have a small footprint, can be operated easily and allow measurements independently from sample transportation time, laboratory location, availability and opening hours, they offer a great opportunity to complement laboratory CFA measurements. Therefore, the objective of the work was to (1) transfer the CFA to the QCM-D method; (2) develop an easy, time- and cost-effective procedure and (3) compare the results with references. Different sensor coatings (donor’s own plasma; gold surface) and different QCM-D parameters (frequency signal shift; its calculated turning point; dissipation signal shift) were sampled. The results demonstrate the suitability for a QCM-D-based CFA in physiological fibrinogen ranges. Results were obtained in less than 1 min and in very good agreement with a standardized reference (Merlin coagulometer). The results provide a good basis for further investigation and pave the way to a possible application of QCM-D in clinical and non-clinical routine in the medical field. PMID:26927107

Behavioral effects of Splenda, Equal and sucrose: Clues from planarians on sweeteners.

PubMed

Ouyang, Kevin; Nayak, Sunil; Lee, Young; Kim, Erin; Wu, Michael; Tallarida, Christopher S; Rawls, Scott M

2017-01-01

Sweetened diets share commonalities with drugs of abuse, but studies comparing behavioral effects of different sweeteners are lacking. Common table sugar produces rewarding and withdrawal effects in planarians. We postulated that Splenda and Equal would produce similar responses and used a tetrad of behavioral assays to test this hypothesis. Acute exposure to a relatively high concentration (10%) of each sweetener produced stereotyped responses (C-shapes) and reduced motility, with Equal producing greater motor effects than sucrose or Splenda. In experiments testing for anxiogenic-like effects, planarians withdrawn from Splenda (1, 3%) or sucrose (1, 3%), but not Equal, and placed into a petri dish with dark and light compartments spent more time in the dark compared to water controls. In place conditioning experiments, both Splenda (0.01%) and sucrose (0.01%) produced an environmental preference shift. Maltodextrin (0.1%), a principal ingredient of Splenda and Equal, produced a significant preference shift. In contrast, sucralose, an indigestible polysaccharide contained in Splenda and Equal, was ineffective. Our data reveal that Splenda produces sucrose-like rewarding and withdrawal effects in planarians that may be dependent on maltodextrin and dextrose. The ineffectiveness of Equal may be due to the presence of aspartame, which is too water insoluble to test in our planarian assay, or to its bitter aftertaste that could mask any rewarding effects produce by maltodextrin or dextrose. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Regulation of glycerolipid metabolism in Tetrahymena species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jones, C.R.

1988-01-01

A simplified extraction system was developed to study the in vivo incorporation of 1-{sup 14}C-acetate into the glycerolipids of Tetrahymena. Cells incubated in the presence of 1-{sup 14}C-sodium acetate were spotted onto pre-acidified TLC plate and extracted by developing the plates in ethanol, and thereafter developing with 90:10:1 (v:v:v) hexane-ether-acetic acid. The synthesis of glycerolipids in Tetrahymena thermophila and Tetrahymena furgasoni, was studied using the above assay system. The level of triacylglycerol was elevated at stationary phase, whereas phospholipid levels were depressed. A shift from phospholipid synthesis to triacylglycerol synthesis occurred when growth was inhibited in Tetrahymena thermophila. The signalmore » for this shift in Tetrahymena thermophila is apparently a decrease in protein synthesis due either to culture age, the presence of cycloheximide, or the removal of amino acid from the synthetic medium. In exponentially growing Tetrahymena thermophila cycloheximide stimulated the incorporation of 1-{sup 14}C-acetate into triacylglycerol and decreased the incorporation into phospholipid, while stopping the incorporation of 1-{sup 14}C-serine into TCA precipitable material from the cells. Similar alterations in glycerolipid synthesis were obtained when amino acids were deleted from the medium. An in vitro assay system was developed to measure the incorporation of 1-{sup 14}C-palmitic acid into triacylglycerol and phospholipid using conditions similar to those of the in vivo studies.« less

Clinical and economic impact of the introduction of a nucleic acid amplification assay for Clostridium difficile.

PubMed

Guinta, Margaret M; Bunnell, Kristen; Harrington, Amanda; Bleasdale, Susan; Danziger, Larry; Wenzler, Eric

2017-12-04

The clinical outcomes and cost implications of a diagnostic shift from an EIA- to PCR-based assay for Clostridium difficile infection (CDI) have not been completely described in the literature. The impact of the PCR-based assay on the incidence and duration of CDI therapy was compared to the EIA assay for patients with a negative CDI diagnostic result. Secondary clinical and economic outcomes were also evaluated. Independent predictors of receipt of antibiotic therapy were assessed via logistic regression. 141 EIA and 140 PCR patients were included. Significantly more patients were started or continued on anti-CDI antibiotic therapy after a known negative assay result in the EIA group (26 patients vs. 8 patients, P = 0.002). Duration of antibiotic therapy after a known negative result was significantly shorter in the PCR group (1 vs. 4 days, P = 0.029) and a 23% reduction in the number of tests obtained per patient was observed (1.41 ± 0.86 vs. 1.82 ± 1.35, P = 0.007). The over fourfold difference in per-test cost of the EIA assay ($8.33 vs. $42.86, P < 0.0001) was offset by the overall medication costs required for the increased treatment in the EIA group ($546.60 vs. $188.96, P = 0.191). Utilization of the EIA-based CDI assay was associated with increased odds of CDI treatment after a negative test (aOR 4.71, 95% CI 1.93-11.46, P = 0.001). The transition from an EIA to PCR-based assay for diagnosing CDI resulted in a significant decrease in the number of patients treated and the duration of treatment in response to a negative test result. This significant decrease in treatment resulted in decreased costs offsetting the utilization of a more expensive molecular test for patients with a negative CDI diagnostic result.

Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

NASA Astrophysics Data System (ADS)

Zhang, Z.; Birkedal, V.; Gothelf, K. V.

2016-05-01

The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection.

Quality Improvement to Demonstrate the Lack of Reliability of the Human Papillomavirus mRNA Assay to Identify Women With Latent Human Papillomavirus Infections.

PubMed

Cotton, Sarah; Brown, Robert E; Nugent, Elizabeth K; Robazetti, Sonia C; Berens, Pamela D; Smith, Judith A

2018-04-01

To assess the consistency between human papillomavirus (HPV) mRNA testing in women with a history of previous HPV infections diagnosed by HPV DNA assay and the potential effects on follow-up HPV screening. This was a quality improvement study that used data from a pathology laboratory software database reviewed from November 2014 to June 2016 to identify female patients aged 30 years or older with greater than one HPV-positive result, including one or more HPV mRNA assay results and one or more documented HPV DNA assay results for comparison. Previous correlative cytology and colposcopic histopathology were also documented. American College of Obstetricians and Gynecologists' cervical cancer screening guidelines were used to compare potential differences in follow-up recommendations. Four hundred twenty-five charts for female patients 30 years of age or older were identified with one or more prior high-risk HPV infections by DNA assay. There was a 69.3% difference in HPV mRNA results compared with previous HPV DNA-positive results. There was a potential change in follow-up for 71.7% of patients with one prior high-risk-HPV-positive result and 60.0% of patients with two or more prior high-risk HPV-positive results. There were 231 colposcopy reports evaluated in this study. Of these, 62 (26.8%) were abnormal colposcopy reports, including 45 low-grade squamous intraepithelial lesions, 15 high-grade squamous intraepithelial lesions, and two cancers. Twenty-five (40.3%) abnormal colposcopy findings were in patients with a history of at least than two prior HPV DNA-positive results and a report of currently being HPV-negative with the mRNA assay. The HPV mRNA assays are less sensitive for detection of latent HPV infections compared with HPV DNA assays. Based on these data and the potential change in follow-up care, the HPV mRNA assay should not be used for a primary screening tool for cervical cancer. Many pathology laboratories have shifted to using the HPV mRNA assay without clear discussion with gynecologists about the effects on patient follow-up. The type of HPV assay being used should be documented and any HPV mRNA result confirmed by HPV DNA assay.

Current Protocols in Protein Science

PubMed Central

Huynh, Kathy

2015-01-01

The purification of recombinant proteins for biochemical assays and structural studies is time-consuming and presents inherent difficulties that depend on the optimization of protein stability. The use of dyes to monitor thermal denaturation of proteins with sensitive fluorescence detection enables the rapid and inexpensive determination of protein stability using real-time PCR instruments. By screening a wide range of solution conditions and additives in 96-well format, the thermal shift assay easily identifies conditions that significantly enhance the stability of recombinant proteins. The same approach can be used as a low cost, initial screen to discover new protein:ligand interactions by capitalizing on increases in protein stability that typically occur upon ligand binding. This unit presents a methodological workflow for the small-scale, high-throughout thermal denaturation of recombinant proteins in the presence of SYPRO Orange dye. PMID:25640896

Rational design of gold nanoparticle toxicology assays: a question of exposure scenario, dose and experimental setup.

PubMed

Taylor, Ulrike; Rehbock, Christoph; Streich, Carmen; Rath, Detlef; Barcikowski, Stephan

2014-09-01

Many studies have evaluated the toxicity of gold nanoparticles, although reliable predictions based on these results are rare. In order to overcome this problem, this article highlights strategies to improve comparability and standardization of nanotoxicological studies. To this end, it is proposed that we should adapt the nanomaterial to the addressed exposure scenario, using ligand-free nanoparticle references in order to differentiate ligand effects from size effects. Furthermore, surface-weighted particle dosing referenced to the biologically relevant parameter (e.g., cell number or organ mass) is proposed as the gold standard. In addition, it is recommended that we should shift the focus of toxicological experiments from 'live-dead' assays to the assessment of cell function, as this strategy allows observation of bioresponses at lower doses that are more relevant for in vivo scenarios.

Reduced osteoblast activity in the mice lacking TR4 nuclear receptor leads to osteoporosis.

PubMed

Lin, Shin-Jen; Ho, Hsin-Chiu; Lee, Yi-Fen; Liu, Ning-Chun; Liu, Su; Li, Gonghui; Shyr, Chih-Rong; Chang, Chawnshang

2012-06-07

Early studies suggested that TR4 nuclear receptor might play important roles in the skeletal development, yet its detailed mechanism remains unclear. We generated TR4 knockout mice and compared skeletal development with their wild type littermates. Primary bone marrow cells were cultured and we assayed bone differentiation by alkaline phosphatase and alizarin red staining. Primary calvaria were cultured and osteoblastic marker genes were detected by quantitative PCR. Luciferase reporter assays, chromatin immunoprecipitation (ChIP) assays, and electrophoretic mobility shift assays (EMSA) were performed to demonstrate TR4 can directly regulate bone differentiation marker osteocalcin. We first found mice lacking TR4 might develop osteoporosis. We then found that osteoblast progenitor cells isolated from bone marrow of TR4 knockout mice displayed reduced osteoblast differentiation capacity and calcification. Osteoblast primary cultures from TR4 knockout mice calvaria also showed higher proliferation rates indicating lower osteoblast differentiation ability in mice after loss of TR4. Mechanism dissection found the expression of osteoblast markers genes, such as ALP, type I collagen alpha 1, osteocalcin, PTH, and PTHR was dramatically reduced in osteoblasts from TR4 knockout mice as compared to those from TR4 wild type mice. In vitro cell line studies with luciferase reporter assay, ChIP assay, and EMSA further demonstrated TR4 could bind directly to the promoter region of osteocalcin gene and induce its gene expression at the transcriptional level in a dose dependent manner. Together, these results demonstrate TR4 may function as a novel transcriptional factor to play pathophysiological roles in maintaining normal osteoblast activity during the bone development and remodeling, and disruption of TR4 function may result in multiple skeletal abnormalities.

Implementation and Operational Research: Programmatic Feasibility of Dried Blood Spots for the Virological Follow-up of Patients on Antiretroviral Treatment in Nord Kivu, Democratic Republic of the Congo

PubMed Central

Serrano, Laetitia; Muwonga, Jeremie; Kabuayi, Jean Pierre; Kambale, Alain; Mutaka, Fidèle; Fujiwara, Paula I.; Decosas, Josef; Peeters, Martine; Delaporte, Eric

2016-01-01

Background: As part of its policy to shift monitoring of antiretroviral therapy (ART) to primary health care (PHC) workers, the Ministry of Health of the Democratic Republic of Congo (DRC) tested the feasibility of using dried blood spots (DBS) for viral load (VL) quantification and genotypic drug resistance testing in off-site high-throughput laboratories. Methods: DBS samples from adults on ART were collected in 13 decentralized PHC facilities in the Nord-Kivu province and shipped during program quarterly supervision to a reference laboratory 2000 km away, where VL was quantified with a commercial assay (m2000rt, Abbott). A second DBS was sent to a World Health Organization (WHO)-accredited laboratory for repeat VL quantification on a subset of samples with a generic assay (Biocentric) and genotypic drug resistance testing when VL >1000 copies per milliliter. Findings: Constraints arose because of an interruption in national laboratory funding rather than to technical or logistic problems. All samples were assessed by both VL assays to allow ART adjustment. Median DBS turnaround time was 37 days (interquartile range: 9–59). Assays performed unequally with DBS, impacting clinical decisions, quality assurance, and overall cost-effectiveness. Based on m2000rt or generic assay, 31.3% of patients were on virological failure (VF) and 14.8% presented resistance mutations versus 50.3% and 15.4%, respectively. Conclusion: This study confirms that current technologies involving DBS make virological monitoring of ART possible at PHC level, including in challenging environments, provided organizational issues are addressed. Adequate core funding of HIV laboratories and adapted choice of VL assays require urgent attention to control resistance to ART as coverage expands. PMID:26413848

A G-quadruplex-selective luminescent iridium(III) complex and its application by long lifetime.

PubMed

Lin, Sheng; Lu, Lihua; Liu, Jin-Biao; Liu, Chenfu; Kang, Tian-Shu; Yang, Chao; Leung, Chung-Hang; Ma, Dik-Lung

2017-05-01

The G-quadruplex motif has been widely used for the construction of analytical detection platforms due to its rich structural polymorphism and flexibility. Luminescent assays are often limited due to the interference from endogenous fluorophores in biological samples. To address this challenge, a novel long lifetime iridium(III) complex 1 was synthesized and used to construct a G-quadruplex-based assay for detecting prostate specific antigen (PSA) in aqueous solution. PSA is a common biomarker in serum and used as a model for demonstration in this work. The PSA assay has achieved a detection limit of 40.8pg·mL -1 , and shows high selectivity towards PSA over other proteins. Additionally, the assay could function in diluted human serum by using time-resolved luminescent spectroscopy, with good linearity from 1 to 10ng·mL -1 of PSA, which is adequate to detect the PSA levels for physiological (<4ng·mL -1 ) and clinical (4-10ng·mL -1 ) applications. The assay was successfully constructed. As revealed from time-resolved method, the long lifetime property of iridium(III) complex 1 plays an important role in distinguishing phosphorescence signals from short-life auto-fluorescence of human serum. Luminescent transition metal complexes offer several advantages over other widely used organic fluorophores, such as long phosphorescence lifetime, large Stokes shift and modular syntheses. In addition, the assay could work effectively in diluted human serum using time-resolved luminescent spectroscopy, it therefore could be potentially developed to monitor PSA in biological samples. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio. Copyright © 2016 Elsevier B.V. All rights reserved.

Andrographolide Sensitizes Ras-Transformed Cells to Radiation in vitro and in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hung, Shih-Kai; Department of Radiation Oncology, Buddhist Dalin Tzu Chi General Hospital, Chiayi, Taiwan; Tzu Chi University School of Medicine, Hualian, Taiwan

2010-07-15

Purpose: Increasing the sensitivity of tumor cells to radiation is a major goal of radiotherapy. The present study investigated the radiosensitizing effects of andrographolide and examined the molecular mechanisms of andrographolide-mediated radiosensitization. Methods and Materials: An H-ras-transformed rat kidney epithelial (RK3E) cell line was used to measure the radiosensitizing effects of andrographolide in clonogenic assays, 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H tetrazolium bromide assays, and a xenograft tumor growth model. The mechanism of andrographolide-sensitized cell death was analyzed using annexin V staining, caspase 3 activity assays, and terminal transferase uridyl nick end labeling assays. The roles of nuclear factor kappa B (NF-{kappa}B) and Akt inmore » andrographolide-mediated sensitization were examined using reporter assays, electrophoretic mobility shift assays, and Western blotting. Results: Concurrent andrographolide treatment (10 {mu}M, 3 h) sensitized Ras-transformed cells to radiation in vitro (sensitizer enhancement ratio, 1.73). Andrographolide plus radiation (one dose of 300 mg/kg peritumor andrographolide and one dose of 6 Gy radiation) resulted in significant tumor growth delay (27 {+-} 2.5 days) compared with radiation alone (22 {+-} 1.5 days; p <.05). Radiation induced apoptotic markers (e.g., caspase-3, membrane reversion, DNA fragmentation), and andrographolide treatment did not promote radiation-induced apoptosis. However, the protein level of activated Akt was significantly reduced by andrographolide. NF-{kappa}B activity was elevated in irradiated Ras-transformed cells, and andrographolide treatment significantly reduced radiation-induced NF-{kappa}B activity. Conclusion: Andrographolide sensitized Ras-transformed cells to radiation both in vitro and in vivo. Andrographolide-mediated radiosensitization was associated with downregulation of Akt and NF-{kappa}B activity. These observations indicate that andrographolide is a novel radiosensitizing agent with potential application in cancer radiotherapy.« less

Pharmacological analysis of ecto-ATPase inhibition: evidence for combined enzyme inhibition and receptor antagonism in P2X-purinoceptor ligands.

PubMed

Crack, B E; Beukers, M W; McKechnie, K C; Ijzerman, A P; Leff, P

1994-12-01

1. Previous studies have shown that suramin and FPL 66301 are competitive antagonists at the P2X-purinoceptor in the rabbit ear artery. Those studies employed alpha,beta-methylene ATP, a poorly hydrolysable ATP analogue, as the agonist. In this study these compounds have been tested using ATP as the agonist. 2. Suramin, in the concentration range 30-1000 microM, potentiated the contractile effects of ATP, producing a 3-fold leftward shift of the ATP E/[A] curves. FPL 66301, in the concentration range 100-1000 microM, produced a significant but small (approximately 3-fold) rightward shift of the ATP curves. These results are in marked contrast with previous studies using alpha,beta-methylene ATP in which 30-fold rightward shifts were achieved using the same concentration ranges of suramin and FPL 66301. 3. Suramin and FPL 66301 were tested as ecto-ATPase inhibitors in a human blood cell assay. Suramin inhibited the enzyme with a pIC50 of 4.3, FPL 66301 with a pIC50 of 3.3. 4. The pharmacological data were analysed using a theoretical model describing the action of a compound with dual enzyme inhibitory and receptor antagonistic properties on the effects of an agonist susceptible to enzymatic degradation. The model was found to fit the data well using the known pKB estimates for suramin and FPL 66301 and similar relative (but not absolute) pK1 estimates to those obtained for the compounds in the enzyme assay. 5. From this analysis it was concluded that the limited shifts of ATP E/[A] curves produced by suramin and FPL 66301 were the result of 'self-cancellation' of the potentiating (enzyme inhibitory) and rightward-shifting (receptor antagonistic) properties.6. The analysis also indicated that the presence of ecto-ATPase activity in the rabbit ear artery preparation has a marked effect on the apparent potency of ATP. The experimental p[A50] was 3.4,whereas the 'true' value, that is the value which would be obtained in the absence of ecto-ATPase activity, was 6.0, some 400-fold higher.7 Two conclusions are drawn from this study. Firstly, caution must be exercised in the use of suramin and FPL 66301 as tools for receptor classification. Absence of overt antagonism by these compounds when metabolically unstable agonists are used could lead to erroneous claims for receptor subtypes.Secondly, the agonist potency order currently used to designate P2X- purinoceptors may require modification.

Necrosis and apoptosis pathways of cell death at photodynamic treatment in vitro as revealed by digital holographic microscopy

NASA Astrophysics Data System (ADS)

Semenova, I. V.; Belashov, A. V.; Belyaeva, T. N.; Kornilova, E. S.; Salova, A. V.; Zhikhoreva, A. A.; Vasyutinskii, O. S.

2018-02-01

Monitoring of variations in morphological characteristics of cultured HeLa cells after photodynamic treatment with Radachlorin photosensitizer is performed by means of digital holographic microscopy. The observed dose-dependent post-treatment variations of phase shift evidence threshold effect of photodynamic treatment and allow for distinguishing between necrotic or apoptotic pathways of cell death. Results obtained by holographic microscopy were confirmed by means of far-field optical microscopy and confocal fluorescence microscopy with commonly used test assays.

Role of Human DNA Polymerase and its Accessory Proteins in Breast Cancer.

DTIC Science & Technology

1999-09-01

by W estern blotting. Total mRNA was isolated from the Ac.in mRNA cells using RNA-STAT 60 (Tel- Test .t .... Inc) and subjected to Northern blotting...p53 expression on the activity of the POLDI promoter were tested using the 1.8 kb-luciferase POLD1 promoter construct in SAOS-2 cells which do not...activity. In preliminary studies using gel mobility shift assays we tested ds oligonucleotides corresponding to all five sites (P1-P5). The results

Glycinin-gum arabic complex formation: Turbidity measurement and charge neutralization analysis.

PubMed

Dong, Die; Hua, Yufei

2016-11-01

The interaction between glycinin and anionic polysaccharides has gained considerable attention recently because of its scientific impact on the stability of acid soymilk systems. In this study, the formation of glycinin/gum arabic complexes driven by electrostatic interactions was investigated. Turbidity titrations at different glycinin/gum arabic ratios were conducted and critical pH values (pH φ1 ) where insoluble complexes began forming were determined firstly. The corresponding pH φ1 values at glycinin/gum arabic ratios of 1:4, 1:2, 1:1, 2:1, 4:1 and 8:1 were 2.85, 3.25, 3.70, 4.40, 4.85 and 5.35, respectively. Afterwards, electromobilities for glycinin and gum arabic at the pH values between 4.1 and 2.6 were measured, and charge densities (ZN) for glycinin and gum arabic were calculated based on the soft particle analysis theory. Further analysis indicated that the product of glycinin/gum arabic ratio (ρ) and ZN ratio of glycinin/gum arabic was approximate 1 at any pH φ1 values. It was revealed that charge neutralization was achieved when glycinin/gum arabic insoluble complexes began forming. NaCl displayed multiple effects on glycinin/gum arabic complex formation according to turbidity and compositional analysis. The present study could provide basic guidance in acid soymilk designing. Copyright © 2016 Elsevier Ltd. All rights reserved.

Single exosome detection in serum using microtoroid optical resonators (Conference Presentation)

NASA Astrophysics Data System (ADS)

Su, Judith

2016-03-01

Recently exosomes have attracted interest due to their potential as cancer biomarkers. We report the real time, label-free sensing of single exosomes in serum using microtoroid optical resonators. We use this approach to assay the progression of tumors implanted in mice by specifically detecting low concentrations of tumor-derived exosomes. Our approach measures the adsorption of individual exosomes onto a functionalized silica microtoroid by tracking changes in the optical resonant frequency of the microtoroid. When exosomes land on the microtoroid, they perturb its refractive index in the evanescent field and thus shift its resonance frequency. Through digital frequency locking, we are able to rapidly track these shifts with accuracies of better than 10 attometers (one part in 10^11). Samples taken from tumor-implanted mice from later weeks generated larger frequency shifts than those from earlier weeks. Control samples taken from a mouse with no tumor generated no such increase in signal between subsequent weeks. Analysis of shifts from tumor-implanted mouse samples show a distribution of unitary steps, with the maximum step having a height of ~1.2 fm, corresponding to an exosome size of 44 ± 4.8 nm. This size range corresponds to that found by performing nanoparticle tracking analysis on the same samples. Our results demonstrate development towards a minimally-invasive tumor "biopsy" that eliminates the need to find and access a tumor.

Rapid Adjustment of Circadian Clocks to Simulated Travel to Time Zones across the Globe.

PubMed

Harrison, Elizabeth M; Gorman, Michael R

2015-12-01

Daily rhythms in mammalian physiology and behavior are generated by a central pacemaker located in the hypothalamic suprachiasmatic nuclei (SCN), the timing of which is set by light from the environment. When the ambient light-dark cycle is shifted, as occurs with travel across time zones, the SCN and its output rhythms must reset or re-entrain their phases to match the new schedule-a sluggish process requiring about 1 day per hour shift. Using a global assay of circadian resetting to 6 equidistant time-zone meridians, we document this characteristically slow and distance-dependent resetting of Syrian hamsters under typical laboratory lighting conditions, which mimic summer day lengths. The circadian pacemaker, however, is additionally entrainable with respect to its waveform (i.e., the shape of the 24-h oscillation) allowing for tracking of seasonally varying day lengths. We here demonstrate an unprecedented, light exposure-based acceleration in phase resetting following 2 manipulations of circadian waveform. Adaptation of circadian waveforms to long winter nights (8 h light, 16 h dark) doubled the shift response in the first 3 days after the shift. Moreover, a bifurcated waveform induced by exposure to a novel 24-h light-dark-light-dark cycle permitted nearly instant resetting to phase shifts from 4 to 12 h in magnitude, representing a 71% reduction in the mismatch between the activity rhythm and the new photocycle. Thus, a marked enhancement of phase shifting can be induced via nonpharmacological, noninvasive manipulation of the circadian pacemaker waveform in a model species for mammalian circadian rhythmicity. Given the evidence of conserved flexibility in the human pacemaker waveform, these findings raise the promise of flexible resetting applicable to circadian disruption in shift workers, frequent time-zone travelers, and any individual forced to adjust to challenging schedules. © 2015 The Author(s).

Impact of Work Task-Related Acute Occupational Smoke Exposures on Select Proinflammatory Immune Parameters in Wildland Firefighters.

PubMed

Adetona, Anna M; Adetona, Olorunfemi; Gogal, Robert M; Diaz-Sanchez, David; Rathbun, Stephen L; Naeher, Luke P

2017-07-01

A repeated measures study was used to assess the effect of work tasks on select proinflammatory biomarkers in firefighters working at prescribed burns. Ten firefighters and two volunteers were monitored for particulate matter and carbon monoxide on workdays, January to July 2015. Before and after workshift dried blood spots were analyzed for inflammatory mediators using the Meso Scale Discovery assay, while blood smears were used to assess leukocyte parameters. Firefighters lighting with drip-torches had higher cross-work-shift increases in interleukin-8, C-reactive protein, and serum amyloid A compared with holding, a task involving management of fire boundaries. A positive association between interleukin-8 and segmented-neutrophil was observed. Results from this study suggest that intermittent occupational diesel exposures contribute to cross-work-shift changes in host systemic innate inflammation as indicated by elevated interleukin-8 levels and peripheral blood segmented-neutrophils.

Chemically cued suppression of coral reef resilience: Where is the tipping point?

NASA Astrophysics Data System (ADS)

Brooker, Rohan M.; Hay, Mark E.; Dixson, Danielle L.

2016-12-01

Coral reefs worldwide are shifting from high-diversity, coral-dominated communities to low-diversity systems dominated by seaweeds. This shift can impact essential recovery processes such as larval recruitment and ecosystem resilience. Recent evidence suggests that chemical cues from certain corals attract, and from certain seaweeds suppress, recruitment of juvenile fishes, with loss of coral cover and increases in seaweed cover creating negative feedbacks that prevent reef recovery and sustain seaweed dominance. Unfortunately, the level of seaweed increase and coral decline that creates this chemically cued tipping point remains unknown, depriving managers of data-based targets to prevent damaging feedbacks. We conducted flume and field assays that suggest juvenile fishes sense and respond to cues produced by low levels of seaweed cover. However, the herbivore species we tested was more tolerant of degraded reef cues than non-herbivores, possibly providing some degree of resilience if these fishes recruit, consume macroalgae, and diminish negative cues.

Shifted Golgi targeting of glycosyltransferases and α-mannosidase IA from giantin to GM130-GRASP65 results in formation of high mannose N-glycans in aggressive prostate cancer cells.

PubMed

Bhat, Ganapati; Hothpet, Vishwanath-Reddy; Lin, Ming-Fong; Cheng, Pi-Wan

2017-11-01

There is a pressing need for biomarkers that can distinguish indolent from aggressive prostate cancer to prevent over-treatment of patients with indolent tumor. Golgi targeting of glycosyltransferases was characterized by confocal microscopy after knockdown of GM130, giantin, or both. N-glycans on a trans-Golgi enzyme β4galactosyltransferase-1 isolated by immunoprecipitation from androgen-sensitive and independent prostate cancer cells were determined by matrix-assisted laser desorption-time of flight-mass spectrometry. In situ proximity ligation assay was employed to determine co-localization of (a) α-mannosidase IA, an enzyme required for processing Man 8 GlcNAc 2 down to Man 5 GlcNAc 2 to enable synthesis of complex-type N-glycans, with giantin, GM130, and GRASP65, and (b) trans-Golgi glycosyltransferases with high mannose N-glycans terminated with α3-mannose. Defective giantin in androgen-independent prostate cancer cells results in a shift of Golgi targeting of glycosyltransferases and α-mannosidase IA from giantin to GM130-GRASP65. Consequently, trans-Golgi enzymes and cell surface glycoproteins acquire high mannose N-glycans, which are absent in cells with functional giantin. In situ proximity ligation assays of co-localization of α-mannosidase IA with GM130 and GRASP65, and trans-Golgi glycosyltransferases with high mannose N-glycans are negative in androgen-sensitive LNCaP C-33 cells but positive in androgen-independent LNCaP C-81 and DU145 cells, and LNCaP C-33 cells devoid of giantin. In situ proximity ligation assays of Golgi localization of α-mannosidase IA at giantin versus GM130-GRASP65 site, and absence or presence of N-glycans terminated with α3-mannose on trans-Golgi glycosyltransferases may be useful for distinguishing indolent from aggressive prostate cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.

The Vibrio parahaemolyticus Small RNA RyhB Promotes Production of the Siderophore Vibrioferrin by Stabilizing the Polycistronic mRNA

PubMed Central

Funahashi, Tatsuya; Nakao, Hiroshi; Maki, Jun; Yamamoto, Shigeo

2013-01-01

High-affinity iron acquisition in Vibrio parahaemolyticus is mediated by the cognate siderophore vibrioferrin. We have previously reported that the vibrioferrin biosynthesis operon (pvsOp) is regulated at the transcriptional level by the iron-responsive repressor Fur (T. Tanabe, T. Funahashi, H. Nakao, S. Miyoshi, S. Shinoda, and S. Yamamoto, J. Bacteriol. 185:6938–6949, 2003). In this study, we identified the Fur-regulated small RNA RyhB and the RNA chaperone Hfq protein as additional regulatory proteins of vibrioferrin biosynthesis. We found that vibrioferrin production was greatly impaired in both the ryhB and hfq deletion mutants, and a TargetRNA search (http://snowwhite.wellesley.edu/targetRNA/index2.html) revealed that the 5′-untranslated region of pvsOp mRNA (pvsOp 5′-UTR) contains a potential base-pairing region required for the formation of the RyhB-pvsOp 5′-UTR duplex. An electrophoresis mobility shift assay indicated that RyhB can directly bind to the pvsOp 5′-UTR with the aid of Hfq. Rifampin chase experiments indicated that the half-life of pvsOp mRNA in the ryhB and hfq mutants was approximately 3-fold shorter than that in the parental strain, suggesting that both RyhB and Hfq are engaged in the stabilization of pvsOp mRNA. Chrome azurol S assays followed by electrophoresis mobility shift assays and rifampin chase experiments carried out for mutant strains indicated that base pairing between RyhB and the pvsOp 5′-UTR results in an increase in the stability of pvsOp mRNA, thereby leading to the promotion of vibrioferrin production. It is unprecedented that RyhB confers increased stability on a polycistronic mRNA involved in siderophore biosynthesis as a direct target. PMID:23772063

Cell Density Affects the Detection of Chk1 Target Engagement by the Selective Inhibitor V158411.

PubMed

Geneste, Clara C; Massey, Andrew J

2018-02-01

Understanding drug target engagement and the relationship to downstream pharmacology is critical for drug discovery. Here we have evaluated target engagement of Chk1 by the small-molecule inhibitor V158411 using two different target engagement methods (autophosphorylation and cellular thermal shift assay [CETSA]). Target engagement measured by these methods was subsequently related to Chk1 inhibitor-dependent pharmacology. Inhibition of autophosphorylation was a robust method for measuring V158411 Chk1 target engagement. In comparison, while target engagement determined using CETSA appeared robust, the V158411 CETSA target engagement EC 50 values were 43- and 19-fold greater than the autophosphorylation IC 50 values. This difference was attributed to the higher cell density in the CETSA assay configuration. pChk1 (S296) IC 50 values determined using the CETSA assay conditions were 54- and 33-fold greater than those determined under standard conditions and were equivalent to the CETSA EC 50 values. Cellular conditions, especially cell density, influenced the target engagement of V158411 for Chk1. The effects of high cell density on apparent compound target engagement potency should be evaluated when using target engagement assays that necessitate high cell densities (such as the CETSA conditions used in this study). In such cases, the subsequent relation of these data to downstream pharmacological changes should therefore be interpreted with care.

Transcriptional regulation of human MUC4 gene: identification of a novel inhibitory element and its nuclear binding protein.

PubMed

Zhang, Jing-Jing; Zhu, Yi; Zhang, Xiong-Fei; Liang, Wen-Biao; Xie, Kun-Ling; Tao, Jin-Qiu; Peng, Yun-Peng; Xu, Ze-Kuan; Miao, Yi

2013-08-01

The human mucin 4 (MUC4) is aberrantly expressed in pancreatic adenocarcinoma and tumor cell lines, while remaining undetectable in normal pancreas, indicating its important role in pancreatic cancer development. Although its transcriptional regulation has been investigated in considerable detail, some important elements remain unknown. The aim of the present study was to demonstrate the existence of a novel inhibitory element in the MUC4 promoter and characterize some of its binding proteins. By luciferase reporter assay, we located the inhibitory element between nucleotides -2530 and -2521 in the MUC4 promoter using a series of deletion and mutant reporter constructs. Electrophoretic mobility shift assay (EMSA) with Bxpc-3 cell nuclear extracts revealed that one protein or protein complex bind to this element. The proteins binding to this element were purified and identified as Yin Yang 1 (YY1) by mass spectrometry. Supershift assay and chromatin immunoprecipitation (ChIP) assay confirmed that YY1 binds to this element in vitro and in vivo. Moreover, transient YY1 overexpression significantly inhibited MUC4 promoter activity and endogenous MUC4 protein expression. In conclusion, we reported here a novel inhibitory element in the human MUC4 promoter. This provides additional data on MUC4 gene regulation and indicates that YY1 may be a potential target for abnormal MUC4 expression.

REGULATION OF INFLAMMATORY TRANSCRIPTION FACTORS BY HEAT SHOCK PROTEIN 70 IN PRIMARY CULTURED ASTROCYTES EXPOSED TO OXYGEN–GLUCOSE DEPRIVATION

PubMed Central

KIM, J. Y.; YENARI, M. A.; LEE, J. E.

2018-01-01

Inflammation is an important event in ischemic injury. These immune responses begin with the expression of pro-inflammatory genes modulating transcription factors, such as nuclear factor-κB (NF-κB), activator protein-1 (AP-1), and signal transducers and activator of transcription-1 (STAT-1). The 70-kDa heat shock protein (Hsp70) can both induce and arrest inflammatory reactions and lead to improved neurological outcome in experimental brain injury and ischemia. Since Hsp70 are induced under heat stress, we investigated the link between Hsp70 neuroprotection and phosphorylation of inhibitor of κB (IκB), c-Jun N-terminal kinases (JNK) and p38 through co-immunoprecipitation and enzyme-linked immunosorbent assay (ELISA) assay. Transcription factors and pro-inflammatory genes were quantified by immunoblotting, electrophoretic-mobility shift assay and reverse transcription-polymerase chain reaction assays. The results showed that heat stress led to Hsp70 overexpression which rendered neuroprotection after ischemia-like injury. Overexpression Hsp70 also interrupts the phosphorylation of IκB, JNK and p38 and bluntsDNA binding of their transcription factors (NF-κB, AP-1 and STAT-1), effectively downregulating the expression of pro-inflammatory genes inheat-pretreatedastrocytes. Takentogether, these results suggest that overexpression of Hsp70 may protect against brain ischemia via an anti-inflammatory mechanism by interrupting the phosphorylation of upstream of transcription factors. PMID:25485480

Nuclear factor I-A represses expression of the cell adhesion molecule L1

PubMed Central

2009-01-01

Background The neural cell adhesion molecule L1 plays a crucial role in development and plasticity of the nervous system. Neural cells thus require precise control of L1 expression. Results We identified a full binding site for nuclear factor I (NFI) transcription factors in the regulatory region of the mouse L1 gene. Electrophoretic mobility shift assay (EMSA) showed binding of nuclear factor I-A (NFI-A) to this site. Moreover, for a brain-specific isoform of NFI-A (NFI-A bs), we confirmed the interaction in vivo using chromatin immunoprecipitation (ChIP). Reporter gene assays showed that in neuroblastoma cells, overexpression of NFI-A bs repressed L1 expression threefold. Conclusion Our findings suggest that NFI-A, in particular its brain-specific isoform, represses L1 gene expression, and might act as a second silencer of L1 in addition to the neural restrictive silencer factor (NRSF). PMID:20003413

Improving the photostability of bright monomeric orange and red fluorescent proteins.

PubMed

Shaner, Nathan C; Lin, Michael Z; McKeown, Michael R; Steinbach, Paul A; Hazelwood, Kristin L; Davidson, Michael W; Tsien, Roger Y

2008-06-01

All organic fluorophores undergo irreversible photobleaching during prolonged illumination. Although fluorescent proteins typically bleach at a substantially slower rate than many small-molecule dyes, in many cases the lack of sufficient photostability remains an important limiting factor for experiments requiring large numbers of images of single cells. Screening methods focusing solely on brightness or wavelength are highly effective in optimizing both properties, but the absence of selective pressure for photostability in such screens leads to unpredictable photobleaching behavior in the resulting fluorescent proteins. Here we describe an assay for screening libraries of fluorescent proteins for enhanced photostability. With this assay, we developed highly photostable variants of mOrange (a wavelength-shifted monomeric derivative of DsRed from Discosoma sp.) and TagRFP (a monomeric derivative of eqFP578 from Entacmaea quadricolor) that maintain most of the beneficial qualities of the original proteins and perform as reliably as Aequorea victoria GFP derivatives in fusion constructs.

Analysis of a cis-Acting Element Involved in Regulation by Estrogen of Human Angiotensinogen Gene Expression.

PubMed

Zhao, Yan-Yan; Sun, Kai-Lai; Ashok, Kumar

1998-01-01

The work was aimed to identify the estrogen responsive element in the human angiotensinogen gene. The nucleotide sequence between the transcription initiation site and TATA box in angiotensinogen gene promoter was found to be strongly homologous with the consensus estrogen responsive element. This sequence was confirmed as the estrogen responsive element (HAG ERE) by electrophoretic mobility shift assay. The recombinant expression vectors were constructed in which chloramphenicol acetyltransferase (CAT) reporter gene was driven by angiotensinogen core promoter with HAG ERE of by TK core promoter with multiplied HAG ERE, and were used in cotransfection with the human estrogen receptor expression vector into HepG(2) cells; CAT assays showed an increase of the CAT activity on 17beta-estradiol treatment in those transfectants. These results suggest that the human angiotensinogen gene is transcriptionally up-regulated by estrogen through the estrogen responsive element near TATA box of the promoter.

Identification of insulin as a novel retinoic acid receptor-related orphan receptor α target gene.

PubMed

Kuang, Jiangying; Hou, Xiaoming; Zhang, Jinlong; Chen, Yulong; Su, Zhiguang

2014-03-18

Insulin plays an important role in regulation of lipid and glucose metabolism. Retinoic acid receptor-related orphan receptor α (RORα) modulates physiopathological processes such as dyslipidemia and diabetes. In this study, we found overexpression of RORα in INS1 cells resulted in increased expression and secretion of insulin. Suppression of endogenous RORα caused a decrease of insulin expression. Luciferase and electrophoretic mobility shift assay (EMSA) assays demonstrated that RORα activated insulin transcription via direct binding to its promoter. RORα was also observed to regulate BETA2 expression, which is one of the insulin active transfactors. In vivo analyses showed that the insulin transcription is increased by the synthetic RORα agonist SR1078. These findings identify RORα as a transcriptional activator of insulin and suggest novel therapeutic opportunities for management of the disease. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Multicolor Fluorescence Detection for Droplet Microfluidics Using Optical Fibers

PubMed Central

Cole, Russell H.; Gartner, Zev J.; Abate, Adam R.

2016-01-01

Fluorescence assays are the most common readouts used in droplet microfluidics due to their bright signals and fast time response. Applications such as multiplex assays, enzyme evolution, and molecular biology enhanced cell sorting require the detection of two or more colors of fluorescence. Standard multicolor detection systems that couple free space lasers to epifluorescence microscopes are bulky, expensive, and difficult to maintain. In this paper, we describe a scheme to perform multicolor detection by exciting discrete regions of a microfluidic channel with lasers coupled to optical fibers. Emitted light is collected by an optical fiber coupled to a single photodetector. Because the excitation occurs at different spatial locations, the identity of emitted light can be encoded as a temporal shift, eliminating the need for more complicated light filtering schemes. The system has been used to detect droplet populations containing four unique combinations of dyes and to detect sub-nanomolar concentrations of fluorescein. PMID:27214249

The Human Splicing Factor ASF/SF2 can Specifically Recognize Pre-mRNA 5' Splice Sites

NASA Astrophysics Data System (ADS)

Zuo, Ping; Manley, James L.

1994-04-01

ASF/SF2 is a human protein previously shown to function in in vitro pre-mRNA splicing as an essential factor necessary for all splices and also as an alternative splicing factor, capable of switching selection of 5' splice sites. To begin to study the protein's mechanism of action, we have investigated the RNA binding properties of purified recombinant ASF/SF2. Using UV crosslinking and gel shift assays, we demonstrate that the RNA binding region of ASF/SF2 can interact with RNA in a sequence-specific manner, recognizing the 5' splice site in each of two different pre-mRNAs. Point mutations in the 5' splice site consensus can reduce binding by as much as a factor of 100, with the largest effects observed in competition assays. These findings support a model in which ASF/SF2 aids in the recognition of pre-mRNA 5' splice sites.

Investigation on the toxic potential of Tribulus terrestris in vitro.

PubMed

Abudayyak, M; Jannuzzi, A T; Özhan, G; Alpertunga, B

2015-04-01

Tribulus terrestris L. (Zygophyllaceae) has been commonly used to energize, vitalize, and improve sexual function and physical performance in men. This study investigates the potential cytotoxic and genotoxic, and endocrine disrupting activities of T. terrestris in vitro. The whole T. terrestris plant was extracted with water, methanol, and chloroform. The genotoxic potential of T. terrestris extracts at 3-2400 µg/mL was assessed by Comet assay in a rat kidney cell line (NRK-52E) and by Ames assay in Salmonella typhimurium TA98 and TA100 strains. Endocrine disrupting effects of the extracts at concentrations of 0.22-25 000 µg/mL were assessed by YES/YAS assay in Saccharomyces cerevisiae. Cytotoxic activity of the extracts was determined by the MTT test in NRK-52E cells. The different exposure times were used for four tests (3-48 h). The methanol extract of T. terrestris IC50 value was 160 µg/mL. The other extracts did not show cytotoxic effects. In the Comet and Ames genotoxicity assays, none of the extracts possessed genotoxic activities at concentrations of 0-2400 µg/mL. Only the water extract of T. terrestris induced frame shift mutations after metabolic activation. The water extract also showed estrogenic activity by YES/YAS assay in S. cerevisiae at concentrations ≥27 µg/mL (≥2.6-fold), while the other T. terrestris extracts had anti-estrogenic properties. Tribulus terrestris had estrogenic and genotoxic activities. The study was useful in determining its toxicological effects and the precautions regarding consumption.

A coupled photometric assay for characterization of S-adenosyl-l-homocysteine hydrolases in the physiological hydrolytic direction.

PubMed

Kailing, Lyn L; Bertinetti, Daniela; Herberg, Friedrich W; Pavlidis, Ioannis V

2017-10-25

S-Adenosyl-l-homocysteine hydrolases (SAHases) are important metabolic enzymes and their dysregulation is associated with some severe diseases. In vivo they catalyze the hydrolysis of S-adenosyl-l-homocysteine (SAH), the by-product of methylation reactions in various organisms. SAH is a potent inhibitor of methyltransferases, thus its removal from the equilibrium is an important requirement for methylation reactions. SAH hydrolysis is also the first step in the cellular regeneration process of the methyl donor S-adenosyl-l-methionine (SAM). However, in vitro the equilibrium lies towards the synthetic direction. To enable characterization of SAHases in the physiologically relevant direction, we have developed a coupled photometric assay that shifts the equilibrium towards hydrolysis by removing the product adenosine, using a high affinity adenosine kinase (AK). This converts adenosine to AMP and thereby forms equimolar amounts of ADP, which is phosphorylated by a pyruvate kinase (PK), in turn releasing pyruvate. The readout of the assay is the consumption of NADH during the lactate dehydrogenase (LDH) catalyzed reduction of pyruvate to lactic acid. The applicability of the assay is showcased for the determination of the kinetic constants of an SAHase from Bradyrhizobium elkanii (K M,SAH 41±5μM, v max,SAH 25±1μM/min with 0.13mg/mL enzyme). This assay is a valuable tool for in vitro characterization of SAHases with biotechnological potential, and for monitoring SAHase activity in diagnostics. Copyright © 2017 Elsevier B.V. All rights reserved.

Genomic sequencing and in vivo footprinting of an expression-specific DNase I-hypersensitive site of avian vitellogenin II promoter reveal a demethylation of a mCpG and a change in specific interactions of proteins with DNA.

PubMed Central

Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P

1988-01-01

Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118

Harnessing Raman spectroimmunoassay for detection of serological breast cancer markers (Conference Presentation)

NASA Astrophysics Data System (ADS)

Barman, Ishan; Li, Ming

2017-02-01

Two critical, unmet needs in breast cancer are the early detection of cancer metastasis and recurrence, and the sensitive assessment of temporal changes in tumor burden in response to therapy. The present research is directed towards developing a non-invasive, ultrasensitive and specific tool that provides a comprehensive real-time picture of the metastatic tumor burden and provides a radically new route to address these overarching challenges. As the continuing search for better diagnostic and prognostic clues has shifted away from a singular focus on primary tumor lesions, circulating and disseminated biomarkers have surfaced as attractive candidates due to the intrinsic advantages of a non-invasive, repeatable "liquid biopsy" procedure. However, a reproducible, facile blood-based test for diagnosis and follow-up of breast cancer has yet to be incorporated into a clinical laboratory assay due to the limitations of existing assays in terms of sensitivity, extensive sample processing requirements and, importantly, multiplexing capability. Here, by architecting nano-structured probes for detection of specific molecular species, we engineer a novel plasmon-enhanced Raman spectroscopic platform that offers a paradigmatic shift from the capabilities of today's diagnostic test platforms. Specifically, quantitative single-droplet serum tests reveal ultrasensitive and multiplexed detection of three key breast cancer biomarkers, cancer antigen 15-3 (CA15-3), CA27-29 and carcinoembryonic antigen (CEA), over several order of magnitude range of biomarker concentration and clear segmentation of the sera between normal and metastatic cancer levels.

Recurrent isolation of extremotolerant bacteria from the clean room where Phoenix spacecraft components were assembled.

PubMed

Ghosh, Sudeshna; Osman, Shariff; Vaishampayan, Parag; Venkateswaran, Kasthuri

2010-04-01

The microbial burden of the Phoenix spacecraft assembly environment was assessed in a systematic manner via several cultivation-based techniques and a suite of NASA-certified, cultivation-independent biomolecule-based detection assays. Extremotolerant bacteria that could potentially survive conditions experienced en route to Mars or on the planet's surface were isolated with a series of cultivation-based assays that promoted the growth of a variety of organisms, including spore formers, mesophilic heterotrophs, anaerobes, thermophiles, psychrophiles, alkaliphiles, and bacteria resistant to UVC radiation and hydrogen peroxide exposure. Samples were collected from the clean room where Phoenix was housed at three different time points, before (1P), during (2P), and after (3P) Phoenix's presence at the facility. There was a reduction in microbial burden of most bacterial groups, including spore formers, in samples 2P and 3P. Analysis of 262 isolates from the facility demonstrated that there was also a shift in predominant cultivable bacterial populations accompanied by a reduction in diversity during 2P and 3P. It is suggested that this shift was a result of increased cleaning when Phoenix was present in the assembly facility and that certain species, such as Acinetobacter johnsonii and Brevundimonas diminuta, may be better adapted to environmental conditions found during 2P and 3P. In addition, problematic bacteria resistant to multiple extreme conditions, such as Bacillus pumilus, were able to survive these periods of increased cleaning.

Threading the Needle: Small-Molecule Targeting of a Xenobiotic Receptor to Ablate Escherichia coli Polysaccharide Capsule Expression Without Altering Antibiotic Resistance.

PubMed

Arshad, Mehreen; Goller, Carlos C; Pilla, Danielle; Schoenen, Frank J; Seed, Patrick C

2016-04-15

Uropathogenic Escherichia coli (UPEC), a leading cause of urinary tract and invasive infections worldwide, is rapidly acquiring multidrug resistance, hastening the need for selective new anti-infective agents. Here we demonstrate the molecular target of DU011, our previously discovered potent, nontoxic, small-molecule inhibitor of UPEC polysaccharide capsule biogenesis and virulence. Real-time polymerase chain reaction analysis and a target-overexpression drug-suppressor screen were used to localize the putative inhibitor target. A thermal shift assay quantified interactions between the target protein and the inhibitor, and a novel DNase protection assay measured chemical inhibition of protein-DNA interactions. Virulence of a regulatory target mutant was assessed in a murine sepsis model. MprA, a MarR family transcriptional repressor, was identified as the putative target of the DU011 inhibitor. Thermal shift measurements indicated the formation of a stable DU011-MprA complex, and DU011 abrogated MprA binding to its DNA promoter site. Knockout of mprA had effects similar to that of DU011 treatment of wild-type bacteria: a loss of encapsulation and complete attenuation in a murine sepsis model, without any negative change in antibiotic resistance. MprA regulates UPEC polysaccharide encapsulation, is essential for UPEC virulence, and can be targeted without inducing antibiotic resistance. © The Author 2015. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Determination of DNA Binding Behavior of FoxA1 Constructs Using a Gold Nanoparticle-Based High Throughput Assay

NASA Astrophysics Data System (ADS)

Aung, Khin Moh Moh; Lim, Michelle Gek Liang; Hong, Shuzhen; Cheung, Edwin; Su, Xiaodi

Forkhead box protein 1 (FoxA1) is a member of the forkhead family of winged-helix transcription factors. It plays crucial roles in the development and differentiation of multiple organs and in the regulation of estrogen-stimulated genes. In this study, in order to determine the regions of FoxA1 necessary for efficient Deoxyribonucleic Acid (DNA) binding, we cloned, expressed and purified a series of FoxA1 constructs that contain either the DNA Binding Domain (DBD), the Transcription Activation Domain (TAD), or both. We determined the DNA binding behavior of these constructs using traditional electrophoretic mobility shift assay (EMSA) and a recently developed gold nanoparticles (AuNPs)-based fast screening method. We conclude that just the DBD region alone is not sufficient for protein-DNA binding activity. Amino acids flanking the upstream of the DBD region are required for maximal DNA binding activity. Through this study, we have also further validated the AuNPs assay for its generality and expanded the existing protocol for comparing the DNA binding behavior of multiple proteins of different charge properties and molecular weights.

Selection of homeotic proteins for binding to a human DNA replication origin.

PubMed

de Stanchina, E; Gabellini, D; Norio, P; Giacca, M; Peverali, F A; Riva, S; Falaschi, A; Biamonti, G

2000-06-09

We have previously shown that a cell cycle-dependent nucleoprotein complex assembles in vivo on a 74 bp sequence within the human DNA replication origin associated to the Lamin B2 gene. Here, we report the identification, using a one-hybrid screen in yeast, of three proteins interacting with the 74 bp sequence. All of them, namely HOXA13, HOXC10 and HOXC13, are orthologues of the Abdominal-B gene of Drosophila melanogaster and are members of the homeogene family of developmental regulators. We describe the complete open reading frame sequence of HOXC10 and HOXC13 along with the structure of the HoxC13 gene. The specificity of binding of these two proteins to the Lamin B2 origin is confirmed by both band-shift and in vitro footprinting assays. In addition, the ability of HOXC10 and HOXC13 to increase the activity of a promoter containing the 74 bp sequence, as assayed by CAT-assay experiments, demonstrates a direct interaction of these homeoproteins with the origin sequence in mammalian cells. We also show that HOXC10 expression is cell-type-dependent and positively correlates with cell proliferation. Copyright 2000 Academic Press.

Isolation and characterization of a bactericidal withanolide from Physalis virginiana.

PubMed

Gibson, Kathleen A; Reese, R Neil; Halaweish, Fathi T; Ren, Yulin

2012-01-01

Physalis virginiana (Virginia Groundcherry) is a member of the family Solenaceae. Several species of the Physalis genus have been used traditionally by American Indians as medicinal treatments. This study investigated the antibacterial activity of chemicals extracted from P. virginiana through antibacterial disc and cytotoxicity assays. Isolation and purification of an antimicrobial compound was achieved through flash chromatography and preparative HPLC. Finally, identification of chemical structure was determined from (1)H and (13)C NMR and MS. Disc assays showed that crude ethanol extracts were effective antibacterial agents against one gram-negative and seven gram-positive bacterial strains. Cytotoxicity assays indicated that it is less toxic than gentamicin controls. Isolation of the active component showed it to be a relatively polar compound. (1)H and (13)C NMR chemical shifts together with HRMS indicated a similar structure to withanolides previously identified from Physalis angulata. HRMS analysis showed a molecular mass of 472.2857 which corresponds to a molecular formula C(28)H(40)O(6). An antibacterial withanolide was isolated from P. virginiana using flash chromatography and HPLC separations. The chemical structure was determined by NMR and MS to be the withanolide physagulin V.

Heat shock factor 1 upregulates transcription of Epstein-Barr Virus nuclear antigen 1 by binding to a heat shock element within the BamHI-Q promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Feng-Wei; Wu, Xian-Rui; Liu, Wen-Ju

Epstein-Barr virus (EBV) nuclear antigen 1 (EBNA1) is essential for maintenance of the episome and establishment of latency. In this study, we observed that heat treatment effectively induced EBNA1 transcription in EBV-transformed B95-8 and human LCL cell lines. Although Cp is considered as the sole promoter used for the expression of EBNA1 transcripts in the lymphoblastoid cell lines, the RT-PCR results showed that the EBNA1 transcripts induced by heat treatment arise from Qp-initiated transcripts. Using bioinformatics, a high affinity and functional heat shock factor 1 (HSF1)-binding element within the - 17/+4 oligonucleotide of the Qp was found, and was determinedmore » by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. Moreover, heat shock and exogenous HSF1 expression induced Qp activity in reporter assays. Further, RNA interference-mediated HSF1 gene silencing attenuated heat-induced EBNA1 expression in B95-8 cells. These results provide evidence that EBNA1 is a new target for the transcription factor HSF1.« less

Isolation and Characterization of Chromosome-Gain and Increase-in-Ploidy Mutants in Yeast

PubMed Central

Chan, CSM.; Botstein, D.

1993-01-01

We have developed a colony papillation assay for monitoring the copy number of genetically marked chromosomes II and III in Saccharomyces cerevisiae. The unique feature of this assay is that it allows detection of a gain of the marked chromosomes even if there is a gain of the entire set of chromosomes (increase-in-ploidy). This assay was used to screen for chromosome-gain or increase-in-ploidy mutants. Five complementation groups have been defined for recessive mutations that confer an increase-in-ploidy (ipl) phenotype, which, in each case, cosegregates with a temperature-sensitive growth phenotype. Four new alleles of CDC31, which is required for spindle pole body duplication, were also recovered from this screen. Temperature-shift experiments with ipl1 cells show that they suffer severe nondisjunction at 37°. Similar experiments with ipl2 cells show that they gain entire sets of chromosomes and become arrested as unbudded cells at 37°. Molecular cloning and genetic mapping show that IPL1 is a newly identified gene, whereas IPL2 is allelic to BEM2, which is required for normal bud growth. PMID:8293973

Histone deacetylase inhibitors induce growth arrest and differentiation in uveal melanoma

PubMed Central

Landreville, Solange; Agapova, Olga A.; Matatall, Katie A.; Kneass, Zachary T.; Onken, Michael D.; Lee, Ryan S.; Bowcock, Anne M.; Harbour, J. William

2011-01-01

Purpose Metastasis is responsible for the death of most cancer patients, yet few therapeutic agents are available which specifically target the molecular events that lead to metastasis. We recently showed that inactivating mutations in the tumor suppressor gene BAP1 are closely associated with loss of melanocytic differentiation in uveal melanoma and metastasis (UM). The purpose of this study was to identify therapeutic agents that reverse the phenotypic effects of BAP1 loss in UM. Experimental Design In silico screens were performed to identify therapeutic compounds predicted to differentiate UM cells using Gene Set Enrichment Analysis and Connectivity Map databases. Valproic acid, trichostatin A, LBH-589 and suberoylanilide hydroxamic acid were evaluated for their effects on UM cells using morphologic evaluation, MTS viability assays, BrdU incorporation, flow cytometry, clonogenic assays, gene expression profiling, histone acetylation and ubiquitination assays, and a murine xenograft tumorigenicity model. Results HDAC inhibitors induced morphologic differentiation, cell cycle exit, and a shift to a differentiated, melanocytic gene expression profile in cultured UM cells. Valproic acid inhibited the growth of UM tumors in vivo. Conclusions These findings suggest that HDAC inhibitors may have therapeutic potential for inducing differentiation and prolonged dormancy of micrometastatic disease in UM. PMID:22038994

Unlabeled oligonucleotides as internal temperature controls for genotyping by amplicon melting.

PubMed

Seipp, Michael T; Durtschi, Jacob D; Liew, Michael A; Williams, Jamie; Damjanovich, Kristy; Pont-Kingdon, Genevieve; Lyon, Elaine; Voelkerding, Karl V; Wittwer, Carl T

2007-07-01

Amplicon melting is a closed-tube method for genotyping that does not require probes, real-time analysis, or allele-specific polymerase chain reaction. However, correct differentiation of homozygous mutant and wild-type samples by melting temperature (Tm) requires high-resolution melting and closely controlled reaction conditions. When three different DNA extraction methods were used to isolate DNA from whole blood, amplicon Tm differences of 0.03 to 0.39 degrees C attributable to the extractions were observed. To correct for solution chemistry differences between samples, complementary unlabeled oligonucleotides were included as internal temperature controls to shift and scale the temperature axis of derivative melting plots. This adjustment was applied to a duplex amplicon melting assay for the methylenetetrahydrofolate reductase variants 1298A>C and 677C>T. High- and low-temperature controls bracketing the amplicon melting region decreased the Tm SD within homozygous genotypes by 47 to 82%. The amplicon melting assay was 100% concordant to an adjacent hybridization probe (HybProbe) melting assay when temperature controls were included, whereas a 3% error rate was observed without temperature correction. In conclusion, internal temperature controls increase the accuracy of genotyping by high-resolution amplicon melting and should also improve results on lower resolution instruments.

Highly sensitive detection of caspase-3 activities via a nonconjugated gold nanoparticle-quantum dot pair mediated by an inner-filter effect.

PubMed

Li, Jingwen; Li, Xinming; Shi, Xiujuan; He, Xuewen; Wei, Wei; Ma, Nan; Chen, Hong

2013-10-09

We describe here a simple fluorometric assay for the highly sensitive detection of caspase-3 activities on the basis of the inner-filter effect of gold nanoparticles (AuNPs) on CdTe quantum dots (QDs). The method takes advantage of the high molar absorptivity of the plasmon band of gold nanoparticles as well as the large absorption band shift from 520 to 680 nm upon nanoparticle aggregation. When labeled with a peptide possessing the caspase-3 cleavage sequence (DEVD), the monodispersed Au-Ps (peptide-modified AuNPs) exhibited a tendency to aggregate when exposed to caspase-3, which induced the absorption band transition from 520 to 680 nm and turned on the fluorescence of the CdTe QDs for caspase-3 sensing. Under optimum conditions, a high sensitivity towards caspase-3 was achieved with a detection limit as low as 18 pM, which was much lower than the corresponding assays based on absorbance or other approaches. Overall, we demonstrated a facile and sensitive approach for caspase-3 detection, and we expected that this method could be potentially generalized to design more fluorescent assays for sensing other bioactive entities.

Isolation and characterization of a bactericidal withanolide from Physalis virginiana

PubMed Central

Gibson, Kathleen A.; Reese, R. Neil; Halaweish, Fathi T.; Ren, Yulin

2012-01-01

Background: Physalis virginiana (Virginia Groundcherry) is a member of the family Solenaceae. Several species of the Physalis genus have been used traditionally by American Indians as medicinal treatments. Materials and Methods: This study investigated the antibacterial activity of chemicals extracted from P. virginiana through antibacterial disc and cytotoxicity assays. Isolation and purification of an antimicrobial compound was achieved through flash chromatography and preparative HPLC. Finally, identification of chemical structure was determined from 1H and 13C NMR and MS. Results: Disc assays showed that crude ethanol extracts were effective antibacterial agents against one gram-negative and seven gram-positive bacterial strains. Cytotoxicity assays indicated that it is less toxic than gentamicin controls. Isolation of the active component showed it to be a relatively polar compound. 1H and 13C NMR chemical shifts together with HRMS indicated a similar structure to withanolides previously identified from Physalis angulata. HRMS analysis showed a molecular mass of 472.2857 which corresponds to a molecular formula C28H40O6. Conclusion: An antibacterial withanolide was isolated from P. virginiana using flash chromatography and HPLC separations. The chemical structure was determined by NMR and MS to be the withanolide physagulin V. PMID:22438659

A Novel Heat Shock Element (HSE) in Entamoeba histolytica that Regulates the Transcriptional Activation of the EhPgp5 Gene in the Presence of Emetine Drug.

PubMed

Nieto, Alma; Pérez Ishiwara, David G; Orozco, Esther; Sánchez Monroy, Virginia; Gómez García, Consuelo

2017-01-01

Transcriptional regulation of the multidrug resistance EhPgp5 gene in Entamoeba histolytica is induced by emetine stress. EhPgp5 overexpression alters the chloride-dependent currents that cause trophozoite swelling, diminishing induced programmed cell death (PCD) susceptibility. In contrast, antisense inhibition of P-glycoprotein (PGP) expression produces synchronous death of trophozoites and the enhancement of the biochemical and morphological characteristics of PCD induced by G418. Transcriptional gene regulation analysis identified a 59 bp region at position -170 to -111 bp promoter as putative emetine response elements (EREs). However, insights into transcription factors controlling EhPgp5 gene transcription are missing; to fill this knowledge gap, we used deletion studies and transient CAT activity assays. Our findings suggested an activating motif (-151 to -136 bp) that corresponds to a heat shock element (HSE). Gel-shift assays, UV-crosslinking, binding protein purification, and western blotting assays revealed proteins of 94, 66, 62, and 51 kDa binding to the EhPgp5 HSE that could be heat shock-like transcription factors that regulate the transcriptional activation of the EhPgp5 gene in the presence of emetine drug.

Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.

PubMed

Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef

2016-10-15

Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is found as the side chain of the rhamnogalacturonan type I complex in pectin, has remained partially studied. Here, we investigated the galactan utilization system consisting of the ganSPQAB operon and its regulator ganR This study improves our knowledge of the carbohydrate degradation systems of B. subtilis, especially the pectin degradation systems. Moreover, the galactan-degrading enzymes may be exploited for the production of galacto-oligosaccharides, which are used as prebiotic substances in the food industry. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Stem cells in prostate cancer initiation and progression

PubMed Central

Lawson, Devon A.; Witte, Owen N.

2007-01-01

Peter Nowell and David Hungerford’s discovery of the Philadelphia chromosome facilitated many critical studies that have led to a paradigm shift in our understanding of cancer as a disease of stem cells. This Review focuses on the application of these concepts to investigation of the role of stem cells in prostate cancer initiation and progression. Major strides in the development of in vitro and in vivo assays have enabled identification and characterization of prostate stem cells as well as functional evaluation of the tumorigenic effects of prostate cancer–related genetic alterations. PMID:17671638

Iron(II) supramolecular helicates interfere with the HIV-1 Tat-TAR RNA interaction critical for viral replication.

PubMed

Malina, Jaroslav; Hannon, Michael J; Brabec, Viktor

2016-07-12

The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat-TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates.

Effects of chronic intermittent ethanol exposure on orbitofrontal and medial prefrontal cortex-dependent behaviors in mice

PubMed Central

Badanich, Kimberly A.; Becker, Howard C.; Woodward, John J.

2011-01-01

In humans, stroke or trauma-induced damage to the orbitofrontal cortex (OFC) or medial prefrontal cortex (mPFC) results in impaired cognitive flexibility. Alcoholics also exhibit similar deficits in cognitive flexibility suggesting that the OFC and mPFC are susceptible to alcohol-induced dysfunction. The present experiments investigated this issue using an attention set-shifting assay in ethanol dependent adult male C57BL/6J mice. Ethanol dependence was induced by exposing mice to repeated cycles of chronic intermittent ethanol (CIE) vapor inhalation. Behavioral testing was conducted 72 hours or 10 days following CIE exposure to determine whether ethanol-induced changes in OFC-dependent (reversal learning) and mPFC-dependent (set-shifting) behaviors are long-lasting. During early ethanol abstinence (72 hrs), CIE mice showed reduced reversal learning performance as compared to controls. Reversal learning deficits were revealed as greater number of trials to criterion, more errors made and a greater difficulty in performing a reversal learning task relative to baseline performance. Furthermore, the magnitude of the impairment was greater during reversal of a simple discrimination rather than reversal of an intradimensional shift. Reversal learning deficits were no longer present when mice were tested 10 days after CIE exposure suggesting that ethanol-induced changes in OFC function can recover. Unexpectedly, performance on the set-shifting task was not impaired during abstinence from ethanol. These data suggest reversal learning, but not attention set-shifting, is transiently disrupted during short-term abstinence from CIE. Given that reversal learning requires an intact OFC, these findings support the idea that the OFC may be vulnerable to the cognitive impairing actions of ethanol. PMID:22122149

Using information from historical high-throughput screens to predict active compounds.

PubMed

Riniker, Sereina; Wang, Yuan; Jenkins, Jeremy L; Landrum, Gregory A

2014-07-28

Modern high-throughput screening (HTS) is a well-established approach for hit finding in drug discovery that is routinely employed in the pharmaceutical industry to screen more than a million compounds within a few weeks. However, as the industry shifts to more disease-relevant but more complex phenotypic screens, the focus has moved to piloting smaller but smarter chemically/biologically diverse subsets followed by an expansion around hit compounds. One standard method for doing this is to train a machine-learning (ML) model with the chemical fingerprints of the tested subset of molecules and then select the next compounds based on the predictions of this model. An alternative approach would be to take advantage of the wealth of bioactivity information contained in older (full-deck) screens using so-called HTS fingerprints, where each element of the fingerprint corresponds to the outcome of a particular assay, as input to machine-learning algorithms. We constructed HTS fingerprints using two collections of data: 93 in-house assays and 95 publicly available assays from PubChem. For each source, an additional set of 51 and 46 assays, respectively, was collected for testing. Three different ML methods, random forest (RF), logistic regression (LR), and naïve Bayes (NB), were investigated for both the HTS fingerprint and a chemical fingerprint, Morgan2. RF was found to be best suited for learning from HTS fingerprints yielding area under the receiver operating characteristic curve (AUC) values >0.8 for 78% of the internal assays and enrichment factors at 5% (EF(5%)) >10 for 55% of the assays. The RF(HTS-fp) generally outperformed the LR trained with Morgan2, which was the best ML method for the chemical fingerprint, for the majority of assays. In addition, HTS fingerprints were found to retrieve more diverse chemotypes. Combining the two models through heterogeneous classifier fusion led to a similar or better performance than the best individual model for all assays. Further validation using a pair of in-house assays and data from a confirmatory screen--including a prospective set of around 2000 compounds selected based on our approach--confirmed the good performance. Thus, the combination of machine-learning with HTS fingerprints and chemical fingerprints utilizes information from both domains and presents a very promising approach for hit expansion, leading to more hits. The source code used with the public data is provided.

The hURAT1 rs559946 polymorphism and the incidence of gout in Han Chinese men.

PubMed

Li, C; Yu, Q; Han, L; Wang, C; Chu, N; Liu, S

2014-01-01

Our previous study identified rs559946, a human urate transporter 1 (hURAT1) single nucleotide polymorphism (SNP), as being significantly associated with risk of primary hyperuricaemia (HUA) in a Han Chinese population. In the current study we aimed to identify the genetic effects of rs559946 on gout susceptibility in Han Chinese men. A total of 335 patients with gout and 376 healthy controls were recruited for a case-control association study. To examine the functional effect of rs559946, we performed luciferase reporter assays and an electrophoretic mobility shift assay (EMSA). rs559946 was found to be significantly associated with gout susceptibility (p = 0.004), with T-allele carriers showing a decreased risk of gout [odds ratio (OR) 0.70, 95% confidence interval (CI) 0.55-0.89]. Multiple linear regression analysis identified a significant association between rs559946 genotypes and tophi. Luciferase reporter assays show increased transcriptional activity of the hURAT1 promoter with the C allele of rs559946. EMSA detected binding of nuclear proteins to both the T and C alleles, although increased binding was observed with the T allele. Cold competition assays suggest that rs559946 may bind within a glucocorticoid receptor (GR) binding motif. Our study suggests that the rs559946 polymorphism is associated with increased HUA risk and may also contribute to gout development in Han Chinese men. The T to C substitution within rs559946 increased the transcriptional activity, and potentially increases gout susceptibility.

Open Science Meets Stem Cells: A New Drug Discovery Approach for Neurodegenerative Disorders

PubMed Central

Han, Chanshuai; Chaineau, Mathilde; Chen, Carol X.-Q.; Beitel, Lenore K.; Durcan, Thomas M.

2018-01-01

Neurodegenerative diseases are a challenge for drug discovery, as the biological mechanisms are complex and poorly understood, with a paucity of models that faithfully recapitulate these disorders. Recent advances in stem cell technology have provided a paradigm shift, providing researchers with tools to generate human induced pluripotent stem cells (iPSCs) from patient cells. With the potential to generate any human cell type, we can now generate human neurons and develop “first-of-their-kind” disease-relevant assays for small molecule screening. Now that the tools are in place, it is imperative that we accelerate discoveries from the bench to the clinic. Using traditional closed-door research systems raises barriers to discovery, by restricting access to cells, data and other research findings. Thus, a new strategy is required, and the Montreal Neurological Institute (MNI) and its partners are piloting an “Open Science” model. One signature initiative will be that the MNI biorepository will curate and disseminate patient samples in a more accessible manner through open transfer agreements. This feeds into the MNI open drug discovery platform, focused on developing industry-standard assays with iPSC-derived neurons. All cell lines, reagents and assay findings developed in this open fashion will be made available to academia and industry. By removing the obstacles many universities and companies face in distributing patient samples and assay results, our goal is to accelerate translational medical research and the development of new therapies for devastating neurodegenerative disorders. PMID:29467610

Open Science Meets Stem Cells: A New Drug Discovery Approach for Neurodegenerative Disorders.

PubMed

Han, Chanshuai; Chaineau, Mathilde; Chen, Carol X-Q; Beitel, Lenore K; Durcan, Thomas M

2018-01-01

Neurodegenerative diseases are a challenge for drug discovery, as the biological mechanisms are complex and poorly understood, with a paucity of models that faithfully recapitulate these disorders. Recent advances in stem cell technology have provided a paradigm shift, providing researchers with tools to generate human induced pluripotent stem cells (iPSCs) from patient cells. With the potential to generate any human cell type, we can now generate human neurons and develop "first-of-their-kind" disease-relevant assays for small molecule screening. Now that the tools are in place, it is imperative that we accelerate discoveries from the bench to the clinic. Using traditional closed-door research systems raises barriers to discovery, by restricting access to cells, data and other research findings. Thus, a new strategy is required, and the Montreal Neurological Institute (MNI) and its partners are piloting an "Open Science" model. One signature initiative will be that the MNI biorepository will curate and disseminate patient samples in a more accessible manner through open transfer agreements. This feeds into the MNI open drug discovery platform, focused on developing industry-standard assays with iPSC-derived neurons. All cell lines, reagents and assay findings developed in this open fashion will be made available to academia and industry. By removing the obstacles many universities and companies face in distributing patient samples and assay results, our goal is to accelerate translational medical research and the development of new therapies for devastating neurodegenerative disorders.

Transferability of antibody pairs from ELISA to fiber optic surface plasmon resonance for infliximab detection

NASA Astrophysics Data System (ADS)

Van Stappen, Thomas; Lu, Jiadi; Bloemen, Maarten; Geukens, Nick; Spasic, Dragana; Delport, Filip; Verbiest, Thierry; Lammertyn, Jeroen; Gils, Ann

2015-03-01

Tumor necrosis factor (TNF)-alpha is a pleiotropic cytokine up-regulated in inflammatory bowel disease, rheumatoid arthritis and psoriasis. The introduction of anti-TNF drugs such as infliximab has revolutionized the treatment of these diseases. Recently, therapeutic drug monitoring (TDM) of infliximab has been introduced in clinical decision making to increase cost-efficiency. Nowadays, TDM is performed using radio-immunoassays, homogeneous mobility shift assays or ELISA. Unfortunately, these assays do not allow for in situ treatment optimization, because of the required sample transportation to centralized laboratories and the subsequent assay execution time. In this perspective, we evaluated the potential of fiber optic-surface plasmon resonance (FO-SPR). To achieve this goal, a panel of 55 monoclonal anti-infliximab antibodies (MA-IFX) was developed and characterized in-house, leading to the identification of nine different clusters. Based on this high diversity, 22 antibody pairs were selected and tested for their reactivity towards IFX, using one MA-IFX as capture and one MA-IFX for detection, in a sandwich type ELISA and FO-SPR. This study showed that the reactivity towards IFX of each antibody pair in ELISA is highly similar to its reactivity on FO-SPR, indicating that antibody pairs are easily transferable between both platforms. Given the fact that FO-SPR shows the potential for miniaturization and fast assay time, it can be considered a highly promising platform for on-site infliximab monitoring.

A versatile assay for RNA-binding proteins in living cells

PubMed Central

Strein, Claudia; Alleaume, Anne-Marie; Rothbauer, Ulrich; Hentze, Matthias W.; Castello, Alfredo

2014-01-01

RNA-binding proteins (RBPs) control RNA fate from synthesis to decay. Since their cellular expression levels frequently do not reflect their in vivo activity, methods are needed to assess the steady state RNA-binding activity of RBPs as well as their responses to stimuli. While electrophoresis mobility shift assays (EMSA) have been used for such determinations, their results serve at best as proxies for the RBP activities in living cells. Here, we describe a quantitative dual fluorescence method to analyze protein–mRNA interactions in vivo. Known or candidate RBPs are fused to fluorescent proteins (eGFP, YFP), expressed in cells, cross-linked in vivo to RNA by ultraviolet light irradiation, and immunoprecipitated, after lysis, with a single chain antibody fragment directed against eGFP (GFP-binding protein, GBP). Polyadenylated RNA-binding activity of fusion proteins is assessed by hybridization with an oligo(DT) probe coupled with a red fluorophore. Since UV light is directly applied to living cells, the assay can be used to monitor dynamic changes in RNA-binding activities in response to biological or pharmacological stimuli. Notably, immunoprecipitation and hybridization can also be performed with commercially available GBP-coupled 96-well plates (GFP-multiTrap), allowing highly parallel RNA-binding measurements in a single experiment. Therefore, this method creates the possibility to conduct in vivo high-throughput RNA-binding assays. We believe that this fast and simple radioactivity-free method will find many useful applications in RNA biology. PMID:24664470

A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR

PubMed Central

Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven

2016-01-01

Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and efficient use of tailed primers. PMID:27723800

Chemical composition, antioxidant, antitumor, anticancer and cytotoxic effects of Psidium guajava leaf extracts.

PubMed

Ashraf, Aisha; Sarfraz, Raja Adil; Rashid, Muhammad Abid; Mahmood, Adeel; Shahid, Muhammad; Noor, Nadia

2016-10-01

Context Psidium guajava L. (Myrtaceae) leaves are used in traditional medicines for the treatment of cancer, inflammation and other ailments. Objective The current study explores scientific validation for this traditional medication. Materials and methods We used ferric-reducing antioxidant power (FRAP) and 2,2-diphenyl-1-picryl hydrazil (DPPH) assays to estimate antioxidant activity of P. guajava leaf extracts (methanol, hexane and chloroform). Antitumour and in vivo cytotoxic activities were determined using potato disc assay (PDA) and brine shrimp lethality assay, respectively. Three human carcinoma cell lines (KBM5, SCC4 and U266) were incubated with different doses (10-100 μg/mL) of extracts and the anticancer activity was estimated by MTT assay. NF-κB suppressing activity was determined using electrophoretic mobility shift assay (EMSA). Chemical composition of the three extracts was identified by GC-MS. Total phenolic and flavonoid contents were measured by colorimetric assays. Results and discussions The order of antioxidant activity of three extracts was methanol > chloroform > hexane. The IC50 values ranged from 22.73 to 51.65 μg/mL for KBM5; 22.82 to 70.25 μg/mL for SCC4 and 20.97 to 89.55 μg/mL for U266 cells. The hexane extract exhibited potent antitumour (IC50  value = 65.02 μg/mL) and cytotoxic (LC50  value = 32.18 μg/mL) activities. This extract also completely inhibited the TNF-α induced NF-κB activation in KBM5 cells. GC-MS results showed that pyrogallol, palmitic acid and vitamin E were the major components of methanol, chloroform and hexane extracts. We observed significant (p < 0.05) difference in total phenolic and flavonoid contents of different solvent extracts. Conclusion The present study demonstrates that P. guajava leaf extracts play a substantial role against cancer and down-modulate inflammatory nuclear factor kB.

Bee venom suppresses PMA-mediated MMP-9 gene activation via JNK/p38 and NF-kappaB-dependent mechanisms.

PubMed

Cho, Hyun-Ji; Jeong, Yun-Jeong; Park, Kwan-Kyu; Park, Yoon-Yub; Chung, Il-Kyung; Lee, Kwang-Gill; Yeo, Joo-Hong; Han, Sang-Mi; Bae, Young-Seuk; Chang, Young-Chae

2010-02-17

Bee venom has been used for the treatment of inflammatory diseases such as rheumatoid arthritis and for the relief of pain in traditional oriental medicine. The purpose of this study is to elucidate the effects of bee venom on MMP-9 expression and determine possible mechanisms by which bee venom relieves or prevents the expression of MMP-9 during invasion and metastasis of breast cancer cells. We examined the expression and activity of MMP-9 and possible signaling pathway affected in PMA-induced MCF-7 cells. Bee venom was obtained from the National Institute of Agricultural Science and Technology of Korea. Matrigel invasion assay, wound-healing assay, zymography assay, western blot assay, electrophoretic mobility shift assay and luciferase gene assay were used for assessment. Bee venom inhibited cell invasion and migration, and also suppressed MMP-9 activity and expression, processes related to tumor invasion and metastasis, in PMA-induced MCF-7 cells. Bee venom specifically suppressed the phosphorylation of p38/JNK and at the same time, suppressed the protein expression, DNA binding and promoter activity of NF-kappaB. The levels of phosphorylated ERK1/2 and c-Jun did not change. We also investigated MMP-9 inhibition by melittin, apamin and PLA(2), representative single component of bee venom. We confirmed that PMA-induced MMP-9 activity was significantly decreased by melittin, but not by apamin and phospholipase A(2). These data demonstrated that the expression of MMP-9 was abolished by melittin, the main component of bee venom. Bee venom inhibits PMA-induced MMP-9 expression and activity by inhibition of NF-kappaB via p38 MAPK and JNK signaling pathways in MCF-7 cells. These results indicate that bee venom can be a potential anti-metastatic and anti-invasive agent. This useful effect may lead to future clinical research on the anti-cancer properties of bee venom. Copyright 2009 Elsevier Ireland Ltd. All rights reserved.

CD30 serum levels and response to hymenoptera venom immunotherapy.

PubMed

Foschi, F G; Emiliani, F; Savini, S; Quercia, O; Stefanini, G F

2008-01-01

The glycoprotein CD30 is expressed and released by T lymphocytes that secrete type 2 helper cytokines of (T(H)2). These molecules play a role in the pathogenesis of allergic diseases. Venom immunotherapy has proven to be very effective in hymenoptera venom allergy through a shift in cytokine production from T(H)2-type cytokines to T(H)1-type cytokines. To evaluate the relationship between the soluble form of CD30 (sCD30) and venom immunotherapy in patients with hymenoptera venom allergy. sCD30 levels were assayed by enzyme-linked immunosorbent assay in the sera of 61 healthy controls and 14 patients with hymenoptera venom allergy who had undergone immunotherapy before treatment and 1,3, and 12 months after treatment started. Nine patients were allergic to Apis venom, 4 to Vespula venom, and 1 to Polistes venom. CD30 serum levels (median, interquartile range) were significantly higher in venom-allergic patients before treatment (33.6 U/mL; 14.8-61.6) than in controls (9.7 U/mL, 1.9-21.3) (P < .000). These levels decreased progressively during treatment in all patients except 2 (P < .000). At the third month of therapy, the levels reached statistical significance in comparison with baseline. This study shows that sCD30 levels are significantly higher in patients with hymenoptera venom allergy and indirectly confirms a preferential T(H)2-type cytokine production in these patients. sCD30 expression decreases during immunotherapy, thus confirming the immunomodulatory role of this treatment in promoting a shift to T(H)1-type cytokines.

The unique functional role of the C-HS hydrogen bond in the substrate specificity and enzyme catalysis of type 1 methionine aminopeptidase.

PubMed

Reddi, Ravikumar; Singarapu, Kiran Kumar; Pal, Debnath; Addlagatta, Anthony

2016-07-19

It is intriguing how nature attains recognition specificity between molecular interfaces where there is no apparent scope for classical hydrogen bonding or polar interactions. Methionine aminopeptidase (MetAP) is one such enzyme where this fascinating conundrum is at play. In this study, we demonstrate that a unique C-HS hydrogen bond exists between the enzyme methionine aminopeptidase (MetAP) and its N-terminal-methionine polypeptide substrate, which allows specific interaction between apparent apolar interfaces, imposing a strict substrate recognition specificity and efficient catalysis, a feature replicated in Type I MetAPs across all kingdoms of life. We evidence this evolutionarily conserved C-HS hydrogen bond through enzyme assays on wild-type and mutant MetAP proteins from Mycobacterium tuberculosis that show a drastic difference in catalytic efficiency. The X-ray crystallographic structure of the methionine bound protein revealed a conserved water bridge and short contacts involving the Met side-chain, a feature also observed in MetAPs from other organisms. Thermal shift assays showed a remarkable 3.3 °C increase in melting temperature for methionine bound protein compared to its norleucine homolog, where C-HS interaction is absent. The presence of C-HS hydrogen bonding was also corroborated by nuclear magnetic resonance spectroscopy through a change in chemical shift. Computational chemistry studies revealed the unique role of the electrostatic environment in facilitating the C-HS interaction. The significance of this atypical hydrogen bond is underscored by the fact that the function of MetAP is essential for any living cell.

Inhibition of Mycobacterium tuberculosis dihydrodipicolinate synthase by alpha-ketopimelic acid and its other structural analogues

PubMed Central

Shrivastava, Priyanka; Navratna, Vikas; Silla, Yumnam; Dewangan, Rikeshwer P.; Pramanik, Atreyi; Chaudhary, Sarika; Rayasam, GeethaVani; Kumar, Anuradha; Gopal, Balasubramanian; Ramachandran, Srinivasan

2016-01-01

The Mycobacterium tuberculosis dihydrodipicolinate synthase (Mtb-dapA) is an essential gene. Mtb-DapA catalyzes the aldol condensation between pyruvate and L-aspartate-beta-semialdehyde (ASA) to yield dihydrodipicolinate. In this work we tested the inhibitory effects of structural analogues of pyruvate on recombinant Mtb-DapA (Mtb-rDapA) using a coupled assay with recombinant dihydrodipicolinate reductase (Mtb-rDapB). Alpha-ketopimelic acid (α-KPA) showed maximum inhibition of 88% and IC50 of 21 μM in the presence of pyruvate (500 μM) and ASA (400 μM). Competition experiments with pyruvate and ASA revealed competition of α-KPA with pyruvate. Liquid chromatography-mass spectrometry (LC-MS) data with multiple reaction monitoring (MRM) showed that the relative abundance peak of final product, 2,3,4,5-tetrahydrodipicolinate, was decreased by 50%. Thermal shift assays showed 1 °C Tm shift of Mtb-rDapA upon binding α-KPA. The 2.4 Å crystal structure of Mtb-rDapA-α-KPA complex showed the interaction of critical residues at the active site with α-KPA. Molecular dynamics simulations over 500 ns of pyruvate docked to Mtb-DapA and of α-KPA-bound Mtb-rDapA revealed formation of hydrogen bonds with pyruvate throughout in contrast to α-KPA. Molecular descriptors analysis showed that ligands with polar surface area of 91.7 Å2 are likely inhibitors. In summary, α-hydroxypimelic acid and other analogues could be explored further as inhibitors of Mtb-DapA. PMID:27501775

A Novel Methodology for Bioenergetic Analysis of Plasmodium falciparum Reveals a Glucose-Regulated Metabolic Shift and Enables Mode of Action Analyses of Mitochondrial Inhibitors.

PubMed

Sakata-Kato, Tomoyo; Wirth, Dyann F

2016-12-09

Given that resistance to all drugs in clinical use has arisen, discovery of new antimalarial drug targets is eagerly anticipated. The Plasmodium mitochondrion has been considered a promising drug target largely based on its significant divergence from the host organelle as well as its involvement in ATP production and pyrimidine biosynthesis. However, the functions of Plasmodium mitochondrial protein complexes and associated metabolic pathways are not fully characterized. Here, we report the development of novel and robust bioenergetic assay protocols for Plasmodium falciparum asexual parasites utilizing a Seahorse Bioscience XFe24 Extracellular Flux Analyzer. These protocols allowed us to simultaneously assess the direct effects of metabolites and inhibitors on mitochondrial respiration and glycolytic activity in real-time with the readout of oxygen consumption rate and extracellular acidification rate. Using saponin-freed parasites at the schizont stage, we found that succinate, malate, glycerol-3-phosphate, and glutamate, but not pyruvate, were able to increase the oxygen consumption rate and that glycerol-3-phosphate dehydrogenase had the largest potential as an electron donor among tested mitochondrial dehydrogenases. Furthermore, we revealed the presence of a glucose-regulated metabolic shift between oxidative phosphorylation and glycolysis. We measured proton leak and reserve capacity and found bioenergetic evidence for oxidative phosphorylation in erythrocytic stage parasites but at a level much lower than that observed in mammalian cells. Lastly, we developed an assay platform for target identification and mode of action studies of mitochondria-targeting antimalarials. This study provides new insights into the bioenergetics and metabolomics of the Plasmodium mitochondria.

Fiber-optic Fourier transform infrared (FO-FTIR) spectroscopy for detecting endotoxin contamination in ophthalmic viscosurgical devices (OVDS) (Conference Presentation)

NASA Astrophysics Data System (ADS)

Hassan, Moinuddin; Ilev, Ilko

2016-03-01

Ophthalmic Viscosurgical Devices (OVDs) in clinical setting are a major health risk factor for potential endotoxin contamination in the eye, due to their extensive applications in cataract surgery for space creation, stabilization and protection of intraocular tissue and intraocular lens (IOL) during implantation. Endotoxin contamination of OVDs is implicated in toxic anterior syndrome (TASS), a severe complication of cataract surgery that leads to intraocular damage and even blindness. Current standard methods for endotoxin contamination detection utilize rabbit assay or Limulus amoebocyte lysate (LAL) assays. These endotoxin detection strategies are extremely difficult for gel-like type devices such as OVDs. To overcome the endotoxin detection limitations in OVDs, we have developed an alternative optical detection methodology for label-free and real-time sensing of bacterial endotoxin in OVDs, based on fiber-optic Fourier transform infrared (FO-FTIR) transmission spectrometry in the mid-IR spectral range from 2.5 micron to 12 micron. Endotoxin contaminated OVD test samples were prepared by serial dilutions of endotoxins on OVDs. The major results of this study revealed two salient spectral peak shifts (in the regions 2925 to 2890 cm^-1 and 1125 to 1100 cm^-1), which are associated with endotoxin in OVDs. In addition, FO-FTIR experimental results processed using a multivariate analysis confirmed the observed specific peak shifts associated with endotoxin contamination in OVDs. Thus, employing the FO-FTIR sensing methodology integrated with a multivariate analysis could potentially be used as an alternative endotoxin detection technique in OVD.

Characterization of the rat RALDH1 promoter. A functional CCAAT and octamer motif are critical for basal promoter activity.

PubMed

Guimond, Julie; Devost, Dominic; Brodeur, Helene; Mader, Sylvie; Bhat, Pangala V

2002-12-12

Retinal dehydrogenase type 1 (RALDH1) catalyzes the oxidation of retinal to retinoic acid (RA), a metabolite of vitamin A important for embryogenesis and tissue differentiation. Rat RALDH1 is expressed to high levels in developing kidney, and in stomach, intestine epithelia. To understand the mechanisms of the transcriptional regulation of rat RALDH1, we cloned a 1360-base pair (bp) 5'-flanking region of RALDH1 gene. Using luciferase reporter constructs transfected into HEK 293 and LLCPK (kidney-derived) cells, basal promoter activity was associated with sequences between -80 and +43. In this minimal promoter region, TATA and CCAAT cis-acting elements as well as SP1, AP1 and octamer (Oct)-binding sites were present. The CCAAT box and Oct-binding site, located between positions -72 and -68 and -56 and -49, respectively, were shown by deletion analysis and site-directed mutation to be critical for promoter activity. Nuclear extracts from kidney cells contain proteins specifically binding the Oct and CCAAT sequences, resulting in the formation of six complexes, while different patterns of complexes were observed with non-kidney cell extracts. Gel shift assays using either single or double mutations of the Oct and CCAAT sequences as well as super shift assays demonstrated single and double occupancy of these two sites by Oct-1 and CBF-A. In addition, unidentified proteins also bound the Oct motif specifically in the absence of CBF-A binding. These results demonstrate specific involvement of Oct and CCAAT-binding proteins in the regulation of RALDH1 gene.

Electric vehicle recycling 2020: Key component power electronics.

PubMed

Bulach, Winfried; Schüler, Doris; Sellin, Guido; Elwert, Tobias; Schmid, Dieter; Goldmann, Daniel; Buchert, Matthias; Kammer, Ulrich

2018-04-01

Electromobility will play a key role in order to reach the specified ambitious greenhouse gas reduction targets in the German transport sector of 42% between 1990 and 2030. Subsequently, a significant rise in the sale of electric vehicles (EVs) is to be anticipated in future. The amount of EVs to be recycled will rise correspondingly after a delay. This includes the recyclable power electronics modules which are incorporated in every EV as an important component for energy management. Current recycling methods using car shredders and subsequent post shredder technologies show high recycling rates for the bulk metals but are still associated with high losses of precious and strategic metals such as gold, silver, platinum, palladium and tantalum. For this reason, the project 'Electric vehicle recycling 2020 - key component power electronics' developed an optimised recycling route for recycling power electronics modules from EVs which is also practicable in series production and can be implemented using standardised technology. This 'WEEE recycling route' involves the disassembly of the power electronics from the vehicle and a subsequent recycling in an electronic end-of-life equipment recycling plant. The developed recycling process is economical under the current conditions and raw material prices, even though it involves considerably higher costs than recycling using the car shredder. The life cycle assessment shows basically good results, both for the traditional car shredder route and the developed WEEE recycling route: the latter provides additional benefits from some higher recovery rates and corresponding credits.

Low cost balancing unit design

NASA Astrophysics Data System (ADS)

Golembiovsky, Matej; Dedek, Jan; Slanina, Zdenek

2017-06-01

This article deals with the design of a low-cost balancing system which consist of battery balancing units, accumulator pack units and coordinator unit with interface for higher level of battery management system. This solution allows decentralized mode of operation and the aim of this work is implementation of controlling and diagnostic mechanism into an electric scooter project realized at Technical university of Ostrava. In todays world which now fully enjoys the prime of electromobility, off-grid battery systems and other, it is important to seek the optimal balance between functionality and the economy side of BMS that being electronics which deals with secondary cells of batery packs. There were numerous sophisticated, but not too practical BMS models in the past, such as centralized system or standalone balance modules of individual cells. This article aims at development of standalone balance modules which are able to communicate with the coordinator, adjust their parameters and ensure their cells safety in case of a communication failure. With the current worldwide cutting cost trend in mind, the emphasis was put on the lowest price possible for individual component. The article is divided into two major categories, the first one being desing of power electronics with emphasis on quality, safety (cooling) and also cost. The second part describes development of a communication interface with reliability and cost in mind. The article contains numerous graphs from practical measurements. The outcome of the work and its possible future is defined in the conclusion.

"Off-on" red-emitting fluorescent probes with large Stokes shifts for nitric oxide imaging in living cells.

PubMed

Chen, Jian-Bo; Zhang, Hui-Xian; Guo, Xiao-Feng; Wang, Hong; Zhang, Hua-Shan

2013-09-01

Fluorescent probes with larger Stokes shifts in the far-visible and near-infrared spectral region (600-900 nm) are more superior for cellular imaging and biological analysis due to avoiding light scattering interference, reducing autofluorescence from biological sample and encouraging deeper tissue penetration in vivo imaging. In this work, two bis-methoxyphenyl-BODIPY fluorescent probes for the detection of nitric oxide (NO) have been firstly synthesized. Under physiological conditions, these probes can react with NO to form the corresponding triazoles with 250- and 70-fold turn-on fluorescence emitting at 590 and 620 nm, respectively. Moreover, the triazole forms of these probes have large Stokes shifts of 38 nm, in contrast to 10 nm of existing BODIPY probes for NO. Excellent selectivity has been observed against other reactive oxygen/nitrogen species, ascorbic acid and biological matrix. After the evaluation of MTT assay, new fluorescent probes have been successfully applied to fluorescence imaging of NO released from RAW 264.7 macrophages by co-stimulation of lipopolysaccharide and interferon-γ. The experimental results indicate that our fluorescent probes can be powerful candidates for fluorescence imaging of NO due to the low background interference and high detection sensitivity.

Functional characterisation of Burkholderia pseudomallei biotin protein ligase: A toolkit for anti-melioidosis drug development.

PubMed

Bond, Thomas E H; Sorenson, Alanna E; Schaeffer, Patrick M

2017-06-01

Burkholderia pseudomallei (Bp) is the causative agent of melioidosis. The bacterium is responsible for 20% of community-acquired sepsis cases and 40% of sepsis-related mortalities in northeast Thailand, and is intrinsically resistant to aminoglycosides, macrolides, rifamycins, cephalosporins, and nonureidopenicillins. There is no vaccine and its diagnosis is problematic. Biotin protein ligase (BirA) which is essential for fatty acid synthesis has been proposed as a drug target in bacteria. Very few bacterial BirA have been characterized, and a better understanding of these enzymes is necessary to further assess their value as drug targets. BirA within the Burkholderia genus have not yet been investigated. We present for the first time the cloning, expression, purification and functional characterisation of the putative Bp BirA and orthologous B. thailandensis (Bt) biotin carboxyl carrier protein (BCCP) substrate. A GFP-tagged Bp BirA was produced and applied for the development of a high-throughput (HT) assay based on our differential scanning fluorimetry of GFP-tagged proteins (DSF-GTP) principle as well as an electrophoretic mobility shift assay. Our biochemical data in combination with the new HT DSF-GTP and biotinylation activity assay could facilitate future drug screening efforts against this drug-resistant organism. Copyright © 2017 Elsevier GmbH. All rights reserved.

Development of a Platform to Enable Fully Automated Cross-Titration Experiments.

PubMed

Cassaday, Jason; Finley, Michael; Squadroni, Brian; Jezequel-Sur, Sylvie; Rauch, Albert; Gajera, Bharti; Uebele, Victor; Hermes, Jeffrey; Zuck, Paul

2017-04-01

In the triage of hits from a high-throughput screening campaign or during the optimization of a lead compound, it is relatively routine to test compounds at multiple concentrations to determine potency and maximal effect. Additional follow-up experiments, such as agonist shift, can be quite valuable in ascertaining compound mechanism of action (MOA). However, these experiments require cross-titration of a test compound with the activating ligand of the receptor requiring 100-200 data points, severely limiting the number tested in MOA assays in a screening triage. We describe a process to enhance the throughput of such cross-titration experiments through the integration of Hewlett Packard's D300 digital dispenser onto one of our robotics platforms to enable on-the-fly cross-titration of compounds in a 1536-well plate format. The process handles all the compound management and data tracking, as well as the biological assay. The process relies heavily on in-house-built software and hardware, and uses our proprietary control software for the platform. Using this system, we were able to automate the cross-titration of compounds for both positive and negative allosteric modulators of two different G protein-coupled receptors (GPCRs) using two distinct assay detection formats, IP1 and Ca 2+ detection, on nearly 100 compounds for each target.

POZ domain transcription factor, FBI-1, represses transcription of ADH5/FDH by interacting with the zinc finger and interfering with DNA binding activity of Sp1.

PubMed

Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook

2002-07-26

The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.

Using Next Generation Sequencing for Multiplexed Trait-Linked Markers in Wheat

PubMed Central

Bernardo, Amy; Wang, Shan; St. Amand, Paul; Bai, Guihua

2015-01-01

With the advent of next generation sequencing (NGS) technologies, single nucleotide polymorphisms (SNPs) have become the major type of marker for genotyping in many crops. However, the availability of SNP markers for important traits of bread wheat ( Triticum aestivum L.) that can be effectively used in marker-assisted selection (MAS) is still limited and SNP assays for MAS are usually uniplex. A shift from uniplex to multiplex assays will allow the simultaneous analysis of multiple markers and increase MAS efficiency. We designed 33 locus-specific markers from SNP or indel-based marker sequences that linked to 20 different quantitative trait loci (QTL) or genes of agronomic importance in wheat and analyzed the amplicon sequences using an Ion Torrent Proton Sequencer and a custom allele detection pipeline to determine the genotypes of 24 selected germplasm accessions. Among the 33 markers, 27 were successfully multiplexed and 23 had 100% SNP call rates. Results from analysis of "kompetitive allele-specific PCR" (KASP) and sequence tagged site (STS) markers developed from the same loci fully verified the genotype calls of 23 markers. The NGS-based multiplexed assay developed in this study is suitable for rapid and high-throughput screening of SNPs and some indel-based markers in wheat. PMID:26625271

The bZIP transcription factor MdHY5 regulates anthocyanin accumulation and nitrate assimilation in apple.

PubMed

An, Jian-Ping; Qu, Feng-Jia; Yao, Ji-Fang; Wang, Xiao-Na; You, Chun-Xiang; Wang, Xiao-Fei; Hao, Yu-Jin

2017-01-01

The basic leucine zipper (bZIP) transcription factor HY5 plays a multifaceted role in plant growth and development. Here the apple MdHY5 gene was cloned based on its homology with Arabidopsis HY5 . Expression analysis demonstrated that MdHY5 transcription was induced by light and abscisic acid treatments. Electrophoretic mobility shift assays and transient expression assays subsequently showed that MdHY5 positively regulated both its own transcription and that of MdMYB10 by binding to E-box and G-box motifs, respectively. Furthermore, we obtained transgenic apple calli that overexpressed the MdHY5 gene, and apple calli coloration assays showed that MdHY5 promoted anthocyanin accumulation by regulating expression of the MdMYB10 gene and downstream anthocyanin biosynthesis genes. In addition, the transcript levels of a series of nitrate reductase genes and nitrate uptake genes in both wild-type and transgenic apple calli were detected. In association with increased nitrate reductase activities and nitrate contents, the results indicated that MdHY5 might be an important regulator in nutrient assimilation. Taken together, these results indicate that MdHY5 plays a vital role in anthocyanin accumulation and nitrate assimilation in apple.

Autoregulation and Virulence Control by the Toxin-Antitoxin System SavRS in Staphylococcus aureus

PubMed Central

Wen, Wen; Liu, Banghui; Xue, Lu; Zhu, Zhongliang; Niu, Liwen

2018-01-01

ABSTRACT Toxin-antitoxin (TA) systems play diverse physiological roles, such as plasmid maintenance, growth control, and persister cell formation, but their involvement in bacterial pathogenicity remains largely unknown. Here, we have identified a novel type II toxin-antitoxin system, SavRS, and revealed the molecular mechanisms of its autoregulation and virulence control in Staphylococcus aureus. Electrophoretic mobility shift assay and isothermal titration calorimetry data indicated that the antitoxin SavR acted as the primary repressor bound to its own promoter, while the toxin SavS formed a complex with SavR to enhance the ability to bind to the operator site. DNase I footprinting assay identified the SavRS-binding site containing a short and long palindrome in the promoter region. Further, mutation and DNase I footprinting assay demonstrated that the two palindromes were crucial for DNA binding and transcriptional repression. More interestingly, genetic deletion of the savRS system led to the increased hemolytic activity and pathogenicity in a mouse subcutaneous abscess model. We further identified two virulence genes, hla and efb, by real-time quantitative reverse transcription-PCR and demonstrated that SavR and SavRS could directly bind to their promoter regions to repress virulence gene expression. PMID:29440365

Unlabeled Oligonucleotides as Internal Temperature Controls for Genotyping by Amplicon Melting

PubMed Central

Seipp, Michael T.; Durtschi, Jacob D.; Liew, Michael A.; Williams, Jamie; Damjanovich, Kristy; Pont-Kingdon, Genevieve; Lyon, Elaine; Voelkerding, Karl V.; Wittwer, Carl T.

2007-01-01

Amplicon melting is a closed-tube method for genotyping that does not require probes, real-time analysis, or allele-specific polymerase chain reaction. However, correct differentiation of homozygous mutant and wild-type samples by melting temperature (Tm) requires high-resolution melting and closely controlled reaction conditions. When three different DNA extraction methods were used to isolate DNA from whole blood, amplicon Tm differences of 0.03 to 0.39°C attributable to the extractions were observed. To correct for solution chemistry differences between samples, complementary unlabeled oligonucleotides were included as internal temperature controls to shift and scale the temperature axis of derivative melting plots. This adjustment was applied to a duplex amplicon melting assay for the methylenetetrahydrofolate reductase variants 1298A>C and 677C>T. High- and low-temperature controls bracketing the amplicon melting region decreased the Tm SD within homozygous genotypes by 47 to 82%. The amplicon melting assay was 100% concordant to an adjacent hybridization probe (HybProbe) melting assay when temperature controls were included, whereas a 3% error rate was observed without temperature correction. In conclusion, internal temperature controls increase the accuracy of genotyping by high-resolution amplicon melting and should also improve results on lower resolution instruments. PMID:17591926

Mechanistic insights into the link between visfatin gene C-1535T polymorphism and coronary artery disease: an in vitro study.

PubMed

Wang, Yong-Sheng; Gao, Wei; Li, Hong-Fen; Wang, Ze-Mu; Zhu, Jun; Zhao, Huan; Yan, Jian-Jun; Jia, En-Zhi; Yang, Zhi-Jian; Wang, Lian-Sheng

2012-04-01

Visfatin, a pro-inflammatory cytokine predominantly released from leucocytes, is correlated with coronary artery disease (CAD). We have previously reported that the -1535C>T polymorphism (rs1330082), which located on the promoter region of visfatin, was associated with decreased risk of CAD. Here, we investigated the underlying mechanism by which this polymorphism affects the genetic susceptibility to CAD. The difference of the promoter activities between -1535T variant and -1535C allele was tested by luciferase reporter gene assay. The difference of transcription factor binding activities between T and C allele was evaluated by electrophoretic mobility shift assay. In reporter gene assay, we showed that the T variant had a significantly reduced transcriptional activity compared with the C allele. The T-variant significantly attenuated the promoter binding affinity to nuclear transcription factors and this effect became much obvious after treatment with TNF-α. Moreover, competition experiment revealed that the retarded complex formed by T-1535- or C-1535-probe binding to nuclear extracts was nearly completely inhibited by unlabeled activator protein-1 (AP-1) specific probe, indicating that AP-1 might be the target nuclear effector. Taken together, our data provided potential mechanistic link between the visfatin -1535C>T polymorphism and reduced CAD risk.

Clinical validation of the 50 gene AmpliSeq Cancer Panel V2 for use on a next generation sequencing platform using formalin fixed, paraffin embedded and fine needle aspiration tumour specimens.

PubMed

Rathi, Vivek; Wright, Gavin; Constantin, Diana; Chang, Siok; Pham, Huong; Jones, Kerryn; Palios, Atha; Mclachlan, Sue-Anne; Conron, Matthew; McKelvie, Penny; Williams, Richard

2017-01-01

The advent of massively parallel sequencing has caused a paradigm shift in the ways cancer is treated, as personalised therapy becomes a reality. More and more laboratories are looking to introduce next generation sequencing (NGS) as a tool for mutational analysis, as this technology has many advantages compared to conventional platforms like Sanger sequencing. In Australia all massively parallel sequencing platforms are still considered in-house in vitro diagnostic tools by the National Association of Testing Authorities (NATA) and a comprehensive analytical validation of all assays, and not just mere verification, is a strict requirement before accreditation can be granted for clinical testing on these platforms. Analytical validation of assays on NGS platforms can prove to be extremely challenging for pathology laboratories. Although there are many affordable and easily accessible NGS instruments available, there are no standardised guidelines as yet for clinical validation of NGS assays. We present an accreditation development procedure that was both comprehensive and applicable in a setting of hospital laboratory for NGS services. This approach may also be applied to other NGS applications in service laboratories. Copyright © 2016 Royal College of Pathologists of Australasia. Published by Elsevier B.V. All rights reserved.

A Novel Heat Shock Element (HSE) in Entamoeba histolytica that Regulates the Transcriptional Activation of the EhPgp5 Gene in the Presence of Emetine Drug

PubMed Central

Nieto, Alma; Pérez Ishiwara, David G.; Orozco, Esther; Sánchez Monroy, Virginia; Gómez García, Consuelo

2017-01-01

Transcriptional regulation of the multidrug resistance EhPgp5 gene in Entamoeba histolytica is induced by emetine stress. EhPgp5 overexpression alters the chloride-dependent currents that cause trophozoite swelling, diminishing induced programmed cell death (PCD) susceptibility. In contrast, antisense inhibition of P-glycoprotein (PGP) expression produces synchronous death of trophozoites and the enhancement of the biochemical and morphological characteristics of PCD induced by G418. Transcriptional gene regulation analysis identified a 59 bp region at position −170 to −111 bp promoter as putative emetine response elements (EREs). However, insights into transcription factors controlling EhPgp5 gene transcription are missing; to fill this knowledge gap, we used deletion studies and transient CAT activity assays. Our findings suggested an activating motif (−151 to −136 bp) that corresponds to a heat shock element (HSE). Gel-shift assays, UV-crosslinking, binding protein purification, and western blotting assays revealed proteins of 94, 66, 62, and 51 kDa binding to the EhPgp5 HSE that could be heat shock-like transcription factors that regulate the transcriptional activation of the EhPgp5 gene in the presence of emetine drug. PMID:29238701

Time-gated detection of protein-protein interactions with transcriptional readout

PubMed Central

Sanchez, Mateo I; Coukos, Robert; von Zastrow, Mark

2017-01-01

Transcriptional assays, such as yeast two-hybrid and TANGO, that convert transient protein-protein interactions (PPIs) into stable expression of transgenes are powerful tools for PPI discovery, screens, and analysis of cell populations. However, such assays often have high background and lose information about PPI dynamics. We have developed SPARK (Specific Protein Association tool giving transcriptional Readout with rapid Kinetics), in which proteolytic release of a membrane-tethered transcription factor (TF) requires both a PPI to deliver a protease proximal to its cleavage peptide and blue light to uncage the cleavage site. SPARK was used to detect 12 different PPIs in mammalian cells, with 5 min temporal resolution and signal ratios up to 37. By shifting the light window, we could reconstruct PPI time-courses. Combined with FACS, SPARK enabled 51 fold enrichment of PPI-positive over PPI-negative cells. Due to its high specificity and sensitivity, SPARK has the potential to advance PPI analysis and discovery. PMID:29189201

A new fractionation assay, based on the size of formaldehyde-crosslinked, mildly sheared chromatin, delineates the chromatin structure at promoter regions

PubMed Central

Ishihara, Satoru; Varma, Rajat; Schwartz, Ronald H.

2010-01-01

To explore the higher order structure of transcribable chromatin in vivo, its local configuration was assessed through the accessibility of the chromatin to crosslinking with formaldehyde. The application of crosslinked and mildly sheared chromatin to sedimentation velocity centrifugation followed by size-fractionation of the DNA enabled us to biochemically distinguish between chromatin with heavily versus sparsely crosslinkable structures. The separated fractions showed a good correlation with gene expression profiles. Genes with poor crosslinking around the promoter region were actively transcribed, while transcripts were hardly detected from genes with extensive crosslinking in their promoter regions. For the inducible gene, Il2, the distribution of the promoter shifted in the gradient following T-cell receptor stimulation, consistent with a change in structure at this locus during activation. The kinetics of this switch preceded the chromatin change observed in a DNase I accessibility assay. Thus, this new chromatin fractionation technique has revealed a change in chromatin structure that has not been previously characterized. PMID:20371521

In Situ Target Engagement Studies in Adherent Cells.

PubMed

Axelsson, Hanna; Almqvist, Helena; Otrocka, Magdalena; Vallin, Michaela; Lundqvist, Sara; Hansson, Pia; Karlsson, Ulla; Lundbäck, Thomas; Seashore-Ludlow, Brinton

2018-04-20

A prerequisite for successful drugs is effective binding of the desired target protein in the complex environment of a living system. Drug-target engagement has typically been difficult to monitor in physiologically relevant models, and with current methods, especially, while maintaining spatial information. One recent technique for quantifying drug-target engagement is the cellular thermal shift assay (CETSA), in which ligand-induced protein stabilization is measured after a heat challenge. Here, we describe a CETSA protocol in live A431 cells for p38α (MAPK14), where remaining soluble protein is detected in situ, using high-content imaging in 384-well, microtiter plates. We validate this assay concept using a number of known p38α inhibitors and further demonstrate the potential of this technology for chemical probe and drug discovery purposes by performing a small pilot screen for novel p38α binders. Importantly, this protocol creates a workflow that is amenable to adherent cells in their native state and yields spatially resolved target engagement information measurable at the single-cell level.

Serine/Threonine kinase dependent transcription from the polyhedrin promoter of SpltNPV-I

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mishra, Gourav; Gautam, Hemant K.; Das, Rakha H.

2007-07-06

Polyhedrin (polh) and p10 are the two hyper-expressed very late genes of nucleopolyhedroviruses. Alpha amanitin resistant transcription from Spodoptera litura nucleopolyhedrovirus (SpltNPV-I) polyhedrin promoter was observed with virus infected nuclear extract of NIV-HA-197 cells but not with that from uninfected nuclear extract. Anti-protein kinase-1 (pk1) antibody inhibited the transcription and the inhibition reversed on addition of pk1, however, pk1 mutant protein, K50M having no phosphorylation activity did not overcome the transcription inhibition. Chromatin immuno-precipitation assays with viral anti-pk1 antibody showed the interaction of pk1 with the polh while electrophoretic mobility shift assays indicated the strong binding affinity (K {sub d}more » {approx} 5.5 x 10{sup -11}) of purified pk1 with the polh promoter. These results suggested that the viral coded pk1 acts as a transcription factor in transcribing baculovirus very late genes.« less

Intersection of toxicogenomics and high throughput screening in the Tox21 program: an NIEHS perspective.

PubMed

Merrick, B Alex; Paules, Richard S; Tice, Raymond R

Humans are exposed to thousands of chemicals with inadequate toxicological data. Advances in computational toxicology, robotic high throughput screening (HTS), and genome-wide expression have been integrated into the Tox21 program to better predict the toxicological effects of chemicals. Tox21 is a collaboration among US government agencies initiated in 2008 that aims to shift chemical hazard assessment from traditional animal toxicology to target-specific, mechanism-based, biological observations using in vitro assays and lower organism models. HTS uses biocomputational methods for probing thousands of chemicals in in vitro assays for gene-pathway response patterns predictive of adverse human health outcomes. In 1999, NIEHS began exploring the application of toxicogenomics to toxicology and recent advances in NextGen sequencing should greatly enhance the biological content obtained from HTS platforms. We foresee an intersection of new technologies in toxicogenomics and HTS as an innovative development in Tox21. Tox21 goals, priorities, progress, and challenges will be reviewed.

GATA-1 directly regulates Nanog in mouse embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Wen-Zhong; Ai, Zhi-Ying; Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A&F University, Yangling 712100

2015-09-25

Nanog safeguards pluripotency in mouse embryonic stem cells (mESCs). Insight into the regulation of Nanog is important for a better understanding of the molecular mechanisms that control pluripotency of mESCs. In a silico analysis, we identify four GATA-1 putative binding sites in Nanog proximal promoter. The Nanog promoter activity can be significantly repressed by ectopic expression of GATA-1 evidenced by a promoter reporter assay. Mutation studies reveal that one of the four putative binding sites counts for GATA-1 repressing Nanog promoter activity. Direct binding of GATA-1 on Nanog proximal promoter is confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation.more » Our data provide new insights into the expanded regulatory circuitry that coordinates Nanog expression. - Highlights: • The Nanog proximal promoter conceives functional element for GATA-1. • GATA-1 occupies the Nanog proximal promoter in vitro and in vivo. • GATA-1 transcriptionally suppresses Nanog.« less

Molecular mechanism of Aurora A kinase autophosphorylation and its allosteric activation by TPX2

DOE PAGES

Zorba, Adelajda; Buosi, Vanessa; Kutter, Steffen; ...

2014-05-27

We elucidate the molecular mechanisms of two distinct activation strategies (autophosphorylation and TPX2-mediated activation) in human Aurora A kinase. Classic allosteric activation is in play where either activation loop phosphorylation or TPX2 binding to a conserved hydrophobic groove shifts the equilibrium far towards the active conformation. We resolve the controversy about the mechanism of autophosphorylation by demonstrating intermolecular autophosphorylation in a long-lived dimer by combining X-ray crystallography with functional assays. We then address the allosteric activation by TPX2 through activity assays and the crystal structure of a domain-swapped dimer of dephosphorylated Aurora A and TPX21−25. While autophosphorylation is the keymore » regulatory mechanism in the centrosomes in the early stages of mitosis, allosteric activation by TPX2 of dephosphorylated Aurora A could be at play in the spindle microtubules. The mechanistic insights into autophosphorylation and allosteric activation by TPX2 binding proposed here, may have implications for understanding regulation of other protein kinases.« less

Photometric and fluorometric continuous kinetic assay of acid phosphatases with new substrates possessing longwave absorption and emission maxima.

PubMed

Koller, E; Wolfbeis, O S

1984-11-15

A direct and continuous kinetic method for the photometric and fluorometric determination of various acid phosphatases is described. It is based on new coumarin-derived phosphates, which after enzymatic hydrolysis undergo dissociation to form intensely colored and strongly fluorescent phenolate anions. The latter have absorption maxima ranging from 385 to 505 nm, and fluorescence maxima between 470 and 595 nm. The new substrates were compared with respect to their rate of enzymatic hydrolysis, optimum pH, and detection limits of acid phosphatase from potato and wheat germ. Detection limits of 0.001 unit/ml were found by photometry, and as low as 0.00006 unit/ml by fluorometry. The principal advantages of the new substrates over existing ones are longwave absorptions and emissions, large Stokes shifts, and the low pKa values of the corresponding phenols, thus allowing a direct and continuous assay of acid phosphatase even in weakly acidic solutions.

The Zur regulon of Corynebacterium glutamicum ATCC 13032

PubMed Central

2010-01-01

Background Zinc is considered as an essential element for all living organisms, but it can be toxic at large concentrations. Bacteria therefore tightly regulate zinc metabolism. The Cg2502 protein of Corynebacterium glutamicum was a candidate to control zinc metabolism in this species, since it was classified as metalloregulator of the zinc uptake regulator (Zur) subgroup of the ferric uptake regulator (Fur) family of DNA-binding transcription regulators. Results The cg2502 (zur) gene was deleted in the chromosome of C. glutamicum ATCC 13032 by an allelic exchange procedure to generate the zur-deficient mutant C. glutamicum JS2502. Whole-genome DNA microarray hybridizations and real-time RT-PCR assays comparing the gene expression in C. glutamicum JS2502 with that of the wild-type strain detected 18 genes with enhanced expression in the zur mutant. The expression data were combined with results from cross-genome comparisons of shared regulatory sites, revealing the presence of candidate Zur-binding sites in the mapped promoter regions of five transcription units encoding components of potential zinc ABC-type transporters (cg0041-cg0042/cg0043; cg2911-cg2912-cg2913), a putative secreted protein (cg0040), a putative oxidoreductase (cg0795), and a putative P-loop GTPase of the COG0523 protein family (cg0794). Enhanced transcript levels of the respective genes in C. glutamicum JS2502 were verified by real-time RT-PCR, and complementation of the mutant with a wild-type zur gene reversed the effect of differential gene expression. The zinc-dependent expression of the putative cg0042 and cg2911 operons was detected in vivo with a gfp reporter system. Moreover, the zinc-dependent binding of purified Zur protein to double-stranded 40-mer oligonucleotides containing candidate Zur-binding sites was demonstrated in vitro by DNA band shift assays. Conclusion Whole-genome expression profiling and DNA band shift assays demonstrated that Zur directly represses in a zinc-dependent manner the expression of nine genes organized in five transcription units. Accordingly, the Zur (Cg2502) protein is the key transcription regulator for genes involved in zinc homeostasis in C. glutamicum. PMID:20055984

Synergistic antibacterial effect of apigenin with β-lactam antibiotics and modulation of bacterial resistance by a possible membrane effect against methicillin resistant Staphylococcus aureus.

PubMed

Akilandeswari, K; Ruckmani, K

2016-12-30

Methicillin-resistant Staphylococcus aureus (MRSA) infections are easily spread among infected patients, where resistance has dramatically increased resulted in serious health issues. Therefore, there is a need to develop alternative natural or combination drug therapies. Apigenin (AP) is a natural poly phenolic flavonoid has been found to possess many beneficial biological actions. The aim of this study was to investigate the anti-MRSA efficacy and synergistic effect of apigenin (AP) and in combination with ampicillin (AM) and ceftriaxone (CEF). The antibacterial activity of apigenin was assessed by the broth macro dilution, checkerboard micro dilution method and time-kill assay.  The mode of action was studied by outer and inner membrane permeabilisation assays, scanning electron microscopy and transmission electron microscopy. The minimum inhibitory concentration (MIC) of apigenin against gram positive and gram negative strain ranged from 32.5 to 62.5µg/ml. In checkerboard method apigenin markedly reduced the MIC of the antibiotics ampicillin 800 µg/ml shifted to 107 µg/ml (AM+AP) and ceftriaxone 58 µg/ml shifted to 2.6 µg/ml (CEF+AP) against MRSA. The synergistic activity of ampicillin and ceftriaxone plus apigenin combinations with FIC indices (CI) between 0.18-0.47. The modulation of methicillin-resistance by apigenin significantly enhanced the activities of ampicillin and ceftriaxone. The result of time-kill assays of the two drug combinations AM +AP and CEF+AP against MRSA showed significant inhibitory effect and reduced the colony count by approximately 99% after 8 h The results for outer membrane (OM) and inner membrane (IM) permeabilization showed that ampicillin and ceftriaxone in combination with apigenin damaged MRSA cytoplasmic membrane and caused subsequent leakage of intracellular constituents. Electron microscopy clearly showed that the above said combination also caused marked morphological damage of cell wall, cell shape and plasma membrane of this strain. From these results, it can be concluded that apigenin has the synergistic effect with ampicillin and ceftriaxone to reverse bacterial resistance against MRSA.

A minimalist biosensor: Quantitation of cyclic di-GMP using the conformational change of a riboswitch aptamer.

PubMed

Kellenberger, Colleen A; Sales-Lee, Jade; Pan, Yuchen; Gassaway, Madalee M; Herr, Amy E; Hammond, Ming C

2015-01-01

Cyclic di-GMP (c-di-GMP) is a second messenger that is important in regulating bacterial physiology and behavior, including motility and virulence. Many questions remain about the role and regulation of this signaling molecule, but current methods of detection are limited by either modest sensitivity or requirements for extensive sample purification. We have taken advantage of a natural, high affinity receptor of c-di-GMP, the Vc2 riboswitch aptamer, to develop a sensitive and rapid electrophoretic mobility shift assay (EMSA) for c-di-GMP quantitation that required minimal engineering of the RNA.

Fluorescence method for enzyme analysis which couples aromatic amines with aromatic aldehydes

DOEpatents

Smith, R.E.; Dolbeare, F.A.

1980-10-21

Analysis of proteinases is accomplished using conventional amino acid containing aromatic amine substrates. Aromatic amines such as 4-methoxy-2-naphthylamine (4M2NA), 2-naphthylamine, aminoisophthalic acid dimethyl ester, p-nitroaniline, 4-methoxy-1-aminofluorene and coumarin derivatives resulting from enzymatic hydrolysis of the substrate couples with aromatic aldehydes such as 5-nitrosalicylaldehyde (5-NSA), benzaldehyde and p-nitrobenzaldehyde to produce Schiff-base complexes which are water insoluble. Certain Schiff-base complexes produce a shift from blue to orange-red (visible) fluorescence. Such complexes are useful in the assay of enzymes. No Drawings

Fluorescence method for enzyme analysis which couples aromatic amines with aromatic aldehydes

DOEpatents

Smith, Robert E. [557 Escondido Cir., Livermore, CA 94550; Dolbeare, Frank A. [5178 Diane La., Livermore, CA 94550

1980-10-21

Analysis of proteinases is accomplished using conventional amino acid containing aromatic amine substrates. Aromatic amines such as 4-methoxy-2-naphthylamine (4M2NA), 2-naphthylamine, aminoisophthalic acid dimethyl ester, p-nitroaniline, 4-methoxy-1-aminofluorene and coumarin derivatives resulting from enzymatic hydrolysis of the substrate couples with aromatic aldehydes such as 5-nitrosalicylaldehyde (5-NSA), benzaldehyde and p-nitrobenzaldehyde to produce Schiff-base complexes which are water insoluble. Certain Schiff-base complexes produce a shift from blue to orange-red (visible) fluorescence. Such complexes are useful in the assay of enzymes.

Fluorescence method for enzyme analysis which couples aromatic amines with aromatic aldehydes

DOEpatents

Smith, Robert E.; Dolbeare, Frank A.

1979-01-01

Analysis of proteinases is accomplished using conventional amino acid containing aromatic amine substrates. Aromatic amines such as 4-methoxy-2-naphthylamine (4M2NA), 2-naphthylamine, aminoisophthalic acid dimethyl ester, p-nitroaniline, 5-methoxy-1-aminofluorene and coumarin derivatives resulting from enzymatic hydrolysis of the substrate couples with aromatic aldehydes such as 5-nitrosalicylaldehyde (5-NSA), benzaldehyde and p-nitrobenzaldehyde to produce Schiff-base complexes which are water insoluble. Certain Schiff-base complexes produce a shift from blue to orange-red (visible) fluorescence. Such complexes are useful in the assay of enzymes.

Iron(II) supramolecular helicates interfere with the HIV-1 Tat–TAR RNA interaction critical for viral replication

PubMed Central

Malina, Jaroslav; Hannon, Michael J.; Brabec, Viktor

2016-01-01

The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat–TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates. PMID:27405089

The Empower project - a new way of assessing and monitoring test comparability and stability.

PubMed

De Grande, Linde A C; Goossens, Kenneth; Van Uytfanghe, Katleen; Stöckl, Dietmar; Thienpont, Linda M

2015-07-01

Manufacturers and laboratories might benefit from using a modern integrated tool for quality management/assurance. The tool should not be confounded by commutability issues and focus on the intrinsic analytical quality and comparability of assays as performed in routine laboratories. In addition, it should enable monitoring of long-term stability of performance, with the possibility to quasi "real-time" remedial action. Therefore, we developed the "Empower" project. The project comprises four pillars: (i) master comparisons with panels of frozen single-donation samples, (ii) monitoring of patient percentiles and (iii) internal quality control data, and (iv) conceptual and statistical education about analytical quality. In the pillars described here (i and ii), state-of-the-art as well as biologically derived specifications are used. In the 2014 master comparisons survey, 125 laboratories forming 8 peer groups participated. It showed not only good intrinsic analytical quality of assays but also assay biases/non-comparability. Although laboratory performance was mostly satisfactory, sometimes huge between-laboratory differences were observed. In patient percentile monitoring, currently, 100 laboratories participate with 182 devices. Particularly, laboratories with a high daily throughput and low patient population variation show a stable moving median in time with good between-instrument concordance. Shifts/drifts due to lot changes are sometimes revealed. There is evidence that outpatient medians mirror the calibration set-points shown in the master comparisons. The Empower project gives manufacturers and laboratories a realistic view on assay quality/comparability as well as stability of performance and/or the reasons for increased variation. Therefore, it is a modern tool for quality management/assurance toward improved patient care.

Kaempferol acts through mitogen-activated protein kinases and protein kinase B/AKT to elicit protection in a model of neuroinflammation in BV2 microglial cells

PubMed Central

Park, SE; Sapkota, K; Kim, S; Kim, H; Kim, SJ

2011-01-01

BACKGROUND AND PURPOSE Kaempferol, a dietary flavonoid and phyto-oestrogen, is known to have anti-inflammatory properties. Microglial activation has been implicated in various neurodegenerative diseases. Anti-inflammatory effects of kaempferol and the underlying mechanisms were investigated by using LPS-stimulated microglial BV2 cells. EXPERIMENTAL APPROACH Cell viability was measured using MTT and neutral red assays. elisa, Western blot, immunocytochemistry and electrophoretic mobility-shift assay were used to analyse NO, PGE2, TNF-α and IL-1β production, inducible NOS (iNOS), COX-2 expression and the involvement of signalling pathways such as toll-like receptor-4 (TLR4), MAPK cascades, PKB (AKT) and NF-κB. Accumulation of reaction oxygen species (ROS) was measured by nitroblue tetrazolium and 2′7′-dichlorofluorescein diacetate assay. Matrix metalloproteinase activity was investigated by zymography and immunoblot assay. Phagocytotic activity was assessed by use of latex beads. KEY RESULTS Kaempferol significantly attenuated LPS-induced NO, PGE2, TNF-α, IL-1β and ROS production and phagocytosis in a concentration-dependent manner. Kaempferol suppressed the expression of iNOS, COX-2, MMP-3 and blocked the TLR4 activation. Moreover, kaempferol inhibited LPS-induced NF-κB activation and p38 MAPK, JNK and AKT phosphorylation. CONCLUSION AND IMPLICATIONS Kaempferol was able to reduce LPS-induced inflammatory mediators through the down-regulation of TLR4, NF-κB, p38 MAPK, JNK and AKT suggesting that kaempferol has therapeutic potential for the treatment of neuroinflammatory diseases. PMID:21449918

Label-free fluorescent detection of protein kinase activity based on the aggregation behavior of unmodified quantum dots.

PubMed

Xu, Xiahong; Liu, Xin; Nie, Zhou; Pan, Yuliang; Guo, Manli; Yao, Shouzhuo

2011-01-01

Herein, we present a novel label-free fluorescent assay for monitoring the activity and inhibition of protein kinases based on the aggregation behavior of unmodified CdTe quantum dots (QDs). In this assay, cationic substrate peptides induce the selective aggregation of unmodified QDs with anionic surface charge, whereas phosphorylated peptides do not. Phosphorylation by kinase alters the net charge of peptides and subsequently inhibits the aggregation of unmodified QDs, causing an enhanced fluorescence with a 45 nm blue-shift in emission and a yellow-to-green emission color change. Hence the fluorescence response allows this QD-based method to easily probe kinase activity by a spectrometer or even by the naked eye. The feasibility of the method has been demonstrated by sensitive measurement of the activity of cAMP-dependent protein kinase (PKA) with a low detection limit (0.47 mU μL(-1)). On the basis of the fluorescence response of QDs on the concentration of PKA inhibitor H-89, the IC(50) value, the half maximal inhibitory concentration, was estimated, which was in agreement with the literature value. Moreover, the system can be applicable to detect the Forskolin/3-isobutyl-1-methylxantine (IBMX)-stimulated activation of PKA in cell lysate. Unlike the existing QD-based enzyme activity assays in which the modification process of QDs is essential, this method relies on unmodified QDs without the requirement of peptide labeling and QDs' modification, presenting a promising candidate for cost-effective kinase activity and inhibitor screening assays.

The Activation of the Rat Insulin Gene II by BETA2 and PDX-1 in Rat Insulinoma Cells Is Repressed by Pax6

PubMed Central

Wolf, Gabriele; Hessabi, Behnam; Karkour, Anke; Henrion, Ulrike; Dahlhaus, Meike; Ostmann, Annett; Giese, Bernd; Fraunholz, Martin; Grabarczyk, Piotr; Jack, Robert; Walther, Reinhard

2010-01-01

The transcriptional transactivator Pax6 binds the pancreatic islet cell-specific enhancer sequence (PISCES) of the rat insulin I gene. However the human, mouse, and rat insulin gene II promoters do not contain a PISCES element. To analyze the role of Pax6 in those PISCES-less promoters, we investigated its influence on rat insulin gene II expression and included in our studies the main activators: pancreatic and duodenal homeobox protein-1 (PDX-1) and BETA2/E47. Luciferase assays, Northern blots, and RIA were used to study effects of Pax6 overexpression, gel shift and chromatin precipitation assays to study its binding to the DNA, and yeast two-hybrid assays and glutathione S transferase capture assays to investigate its interactions with PDX-1 and BETA2. Finally, glucose-dependent intracellular transport of Pax6 was demonstrated by fluorescence microscopy. Overexpression of Pax6 prevents activation of the rat insulin II gene by BETA2 and PDX-1 and hence suppresses insulin synthesis and secretion. In vitro, Pax6 binds to the A-boxes, thereby blocking binding of PDX-1, and at the same time, its paired domain interacts with BETA2. Fluorescence microscopy demonstrated that the nuclear-cytoplasmic localization of Pax6 and PDX-1 are oppositely regulated by glucose. From the results, it is suggested that at low concentrations of glucose, Pax6 is localized in the nucleus and prevents the activation of the insulin gene by occupying the PDX-1 binding site and by interacting with BETA2. PMID:20943817

Interleukin 2 transcription factors as molecular targets of cAMP inhibition: delayed inhibition kinetics and combinatorial transcription roles

PubMed Central

1994-01-01

Elevation of cAMP can cause gene-specific inhibition of interleukin 2 (IL-2) expression. To investigate the mechanism of this effect, we have combined electrophoretic mobility shift assays and in vivo genomic footprinting to assess both the availability of putative IL-2 transcription factors in forskolin-treated cells and the functional capacity of these factors to engage their sites in vivo. All observed effects of forskolin depended upon protein kinase A, for they were blocked by introduction of a dominant negative mutant subunit of protein kinase A. In the EL4.E1 cell line, we report specific inhibitory effects of cAMP elevation both on NF-kappa B/Rel family factors binding at -200 bp, and on a novel, biochemically distinct "TGGGC" factor binding at -225 bp with respect to the IL-2 transcriptional start site. Neither NF-AT nor AP-1 binding activities are detectably inhibited in gel mobility shift assays. Elevation of cAMP inhibits NF-kappa B activity with delayed kinetics in association with a delayed inhibition of IL-2 RNA accumulation. Activation of cells in the presence of forskolin prevents the maintenance of stable protein- DNA interactions in vivo, not only at the NF-kappa B and TGGGC sites of the IL-2 enhancer, but also at the NF-AT, AP-1, and other sites. This result, and similar results in cyclosporin A-treated cells, imply that individual IL-2 transcription factors cannot stably bind their target sequences in vivo without coengagement of all other distinct factors at neighboring sites. It is proposed that nonhierarchical, cooperative enhancement of binding is a structural basis of combinatorial transcription factor action at the IL-2 locus. PMID:8113685

Xylem specific activation of 5' upstream regulatory region of two NAC transcription factors (MusaVND6 and MusaVND7) in banana is regulated by SNBE-like sites.

PubMed

Negi, Sanjana; Tak, Himanshu; Ganapathi, T R

2018-01-01

Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5' upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop.

Two MCAT elements of the SM alpha-actin promoter function differentially in SM vs. non-SM cells.

PubMed

Swartz, E A; Johnson, A D; Owens, G K

1998-08-01

Transcriptional activity of the smooth muscle (SM) alpha-actin gene is differentially regulated in SM vs. non-SM cells. Contained within the rat SM alpha-actin promoter are two MCAT motifs, binding sites for transcription enhancer factor 1 (TEF-1) transcriptional factors implicated in the regulation of many muscle-specific genes. Transfections of SM alpha-actin promoter-CAT constructs containing wild-type or mutagenized MCAT elements were performed to evaluate their functional significance. Mutation of the MCAT elements resulted in increased transcriptional activity in SM cells, whereas these mutations either had no effect or decreased activity in L6 myotubes or endothelial cells. High-resolution gel shift assays resolved several complexes of different mobilities that were formed between MCAT oligonucleotides and nuclear extracts from the different cell types, although no single band was unique to SM. Western blot analysis of nuclear extracts with polyclonal antibodies to conserved domains of the TEF-1 gene family revealed multiple reactive bands, some that were similar and others that differed between SM and non-SM. Supershift assays with a polyclonal antibody to the TEF-related protein family demonstrated that TEF-1 or TEF-1-related proteins were contained in the shifted complexes. Results suggest that the MCAT elements may contribute to cell type-specific regulation of the SM alpha-actin gene. However, it remains to be determined whether the differential transcriptional activity of MCAT elements in SM vs. non-SM is due to differences in expression of TEF-1 or TEF-1-related proteins or to unique (cell type specific) combinatorial interactions of the MCAT elements with other cis-elements and trans-factors.

Shifted termination assay (STA) fragment analysis to detect BRAF V600 mutations in papillary thyroid carcinomas

PubMed Central

2013-01-01

Background BRAF mutation is an important diagnostic and prognostic marker in patients with papillary thyroid carcinoma (PTC). To be applicable in clinical laboratories with limited equipment, diverse testing methods are required to detect BRAF mutation. Methods A shifted termination assay (STA) fragment analysis was used to detect common V600 BRAF mutations in 159 PTCs with DNAs extracted from formalin-fixed paraffin-embedded tumor tissue. The results of STA fragment analysis were compared to those of direct sequencing. Serial dilutions of BRAF mutant cell line (SNU-790) were used to calculate limit of detection (LOD). Results BRAF mutations were detected in 119 (74.8%) PTCs by STA fragment analysis. In direct sequencing, BRAF mutations were observed in 118 (74.2%) cases. The results of STA fragment analysis had high correlation with those of direct sequencing (p < 0.00001, κ = 0.98). The LOD of STA fragment analysis and direct sequencing was 6% and 12.5%, respectively. In PTCs with pT3/T4 stages, BRAF mutation was observed in 83.8% of cases. In pT1/T2 carcinomas, BRAF mutation was detected in 65.9% and this difference was statistically significant (p = 0.007). Moreover, BRAF mutation was more frequent in PTCs with extrathyroidal invasion than tumors without extrathyroidal invasion (84.7% versus 62.2%, p = 0.001). To prepare and run the reactions, direct sequencing required 450 minutes while STA fragment analysis needed 290 minutes. Conclusions STA fragment analysis is a simple and sensitive method to detect BRAF V600 mutations in formalin-fixed paraffin-embedded clinical samples. Virtual Slides The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/5684057089135749 PMID:23883275

Transforming growth factor-beta 1 (TGF-beta1) promotes IL-2 mRNA expression through the up-regulation of NF-kappaB, AP-1 and NF-AT in EL4 cells.

PubMed

Han, S H; Yea, S S; Jeon, Y J; Yang, K H; Kaminski, N E

1998-12-01

Transforming growth factor beta1 (TGF-beta1) has been previously shown to modulate interleukin 2 (IL-2) secretion by activated T-cells. In the present studies, we determined that TGF-beta1 induced IL-2 mRNA expression in the murine T-cell line EL4, in the absence of other stimuli. IL-2 mRNA expression was significantly induced by TGF-beta1 (0.1-1 ng/ml) over a relatively narrow concentration range, which led to the induction of IL-2 secretion. Under identical condition, we examined the effect of TGF-beta1 on the activity of nuclear factor AT (NF-AT), nuclear factor kappaB (NF-kappaB), activator protein-1 (AP-1) and octamer, all of which contribute to the regulation of IL-2 gene expression. Electrophoretic mobility shift assays showed that TGF-beta1 markedly increased NF-AT, NF-kappaB and AP-1 binding to their respective cognate DNA binding sites, whereas octamer binding remained constant, as compared with untreated cells. Employing a reporter gene expression system with p(NF-kappaB)3-CAT, p(NF-AT)3-CAT and p(AP-1)3-CAT, TGF-beta1 treatment of transfected EL4 cells induced a dose-related increase in chloramphenicol acetyltransferase activity that correlated well with the DNA binding profile found in the electrophoretic mobility shift assay studies. These results show that TGF-beta1, in the absence of any additional stimuli, up-regulates the activity of key transcription factors involved in IL-2 gene expression, including NF-AT, NF-kappaB and AP-1, to help promote IL-2 mRNA expression by EL4 cells.

Promoter variant -204A > C of the cholesterol 7α-hydroxylase gene: association with response to plant sterols in humans and increased transcriptional activity in transfected HepG2 cells.

PubMed

De Castro-Orós, Isabel; Pampín, Sandra; Cofán, Montserrat; Mozas, Pilar; Pintó, Xavier; Salas-Salvadó, Jordi; Rodríguez-Rey, Jose C; Ros, Emilio; Civeira, Fernando; Pocoví, Miguel

2011-04-01

The bile acid pool influences intestinal cholesterol absorption because this process is strictly dependent on micellar solubilization, which is disrupted by plant sterols (PS). Plasma lipid variation relates to promoter variant -204A > C (rs3808607) of the CYP7A1 gene encoding for 7α-hydroxylase, an enzyme for bile acid synthesis. We hypothesized that this polymorphism would be associated with variability in lipid responses to PS. We investigated 67 subjects (31 AA and 36 AC + CC) with lipid responses to PS documented in two studies. To assess the functionality of the -204A > C variant, electrophoretic mobility gel shift assays were performed and luciferase reporter plasmids containing the promoter were transfected into HepG2 cells. Compared to AA-subjects, C-carriers showed significantly higher adjusted mean reductions in total cholesterol (0.14 versus 0.43 mmol/L, P = 0.042) and increases in lathosterol-to-cholesterol ratios (0.10 versus 0.75, P = 0.013). The C-construct caused a 78% promoter activity increase and gel-shift assays showed lower affinity for nuclear transcription factors, while in silico experiments predicted a binding site for inhibitory nuclear factors RXR-CAR. Results suggest that promoter -204A > C variant is associated with enhanced CYP7A1 activity. Increased intestinal bile acids and ensuing more efficient cholesterol absorption might explain why C-allele carriers show enhanced cholesterol lowering and increased feedback cholesterol synthesis to PS intervention. Copyright © 2010 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

Poly- and perfluoroalkyl substances in wastewater: Significance of unknown precursors, manufacturing shifts, and likely AFFF impacts.

PubMed

Houtz, Erika F; Sutton, Rebecca; Park, June-Soo; Sedlak, Margaret

2016-05-15

In late 2014, wastewater effluent samples were collected from eight treatment plants that discharge to San Francisco (SF) Bay in order to assess poly- and perfluoroalkyl substances (PFASs) currently released from municipal and industrial sources. In addition to direct measurement of twenty specific PFAS analytes, the total concentration of perfluoroalkyl acid (PFAA) precursors was also indirectly measured by adapting a previously developed oxidation assay. Effluent from six municipal treatment plants contained similar amounts of total PFASs, with highest median concentrations of PFHxA (24 ng/L), followed by PFOA (23 ng/L), PFBA (19 ng/L), and PFOS (15 ng/L). Compared to SF Bay municipal wastewater samples collected in 2009, the short chain perfluorinated carboxylates PFBA and PFHxA rose significantly in concentration. Effluent samples from two treatment plants contained much higher levels of PFASs: over two samplings, wastewater from one municipal plant contained an average of 420 ng/L PFOS and wastewater from an airport industrial treatment plant contained 560 ng/L PFOS, 390 ng/L 6:2 FtS, 570 ng/L PFPeA, and 500 ng/L PFHxA. The elevated levels observed in effluent samples from these two plants are likely related to aqueous film forming foam (AFFF) sources impacting their influent; PFASs attributable to both current use and discontinued AFFF formulations were observed. Indirectly measured PFAA precursor compounds accounted for 33%-63% of the total molar concentration of PFASs across all effluent samples and the PFAA precursors indicated by the oxidation assay were predominately short-chained. PFAS levels in SF Bay effluent samples reflect the manufacturing shifts towards shorter chained PFASs while also demonstrating significant impacts from localized usage of AFFF. Copyright © 2016 Elsevier Ltd. All rights reserved.

Xylem specific activation of 5’ upstream regulatory region of two NAC transcription factors (MusaVND6 and MusaVND7) in banana is regulated by SNBE-like sites

PubMed Central

2018-01-01

Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5’ upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop. PMID:29438404

Phosphorylation and calcium antagonistically tune myosin-binding protein C’s structure and function

PubMed Central

Previs, Michael J.; Mun, Ji Young; Michalek, Arthur J.; Previs, Samantha Beck; Gulick, James; Robbins, Jeffrey; Warshaw, David M.; Craig, Roger

2016-01-01

During each heartbeat, cardiac contractility results from calcium-activated sliding of actin thin filaments toward the centers of myosin thick filaments to shorten cellular length. Cardiac myosin-binding protein C (cMyBP-C) is a component of the thick filament that appears to tune these mechanochemical interactions by its N-terminal domains transiently interacting with actin and/or the myosin S2 domain, sensitizing thin filaments to calcium and governing maximal sliding velocity. Both functional mechanisms are potentially further tunable by phosphorylation of an intrinsically disordered, extensible region of cMyBP-C’s N terminus, the M-domain. Using atomic force spectroscopy, electron microscopy, and mutant protein expression, we demonstrate that phosphorylation reduced the M-domain’s extensibility and shifted the conformation of the N-terminal domain from an extended structure to a compact configuration. In combination with motility assay data, these structural effects of M-domain phosphorylation suggest a mechanism for diminishing the functional potency of individual cMyBP-C molecules. Interestingly, we found that calcium levels necessary to maximally activate the thin filament mitigated the structural effects of phosphorylation by increasing M-domain extensibility and shifting the phosphorylated N-terminal fragments back to the extended state, as if unphosphorylated. Functionally, the addition of calcium to the motility assays ablated the impact of phosphorylation on maximal sliding velocities, fully restoring cMyBP-C’s inhibitory capacity. We conclude that M-domain phosphorylation may have its greatest effect on tuning cMyBP-C’s calcium-sensitization of thin filaments at the low calcium levels between contractions. Importantly, calcium levels at the peak of contraction would allow cMyBP-C to remain a potent contractile modulator, regardless of cMyBP-C’s phosphorylation state. PMID:26908872

Night Shift Work and Levels of 6-Sulfatoxymelatonin and Cortisol in Men

PubMed Central

Mirick, Dana K.; Bhatti, Parveen; Chen, Chu; Nordt, Frank; Stanczyk, Frank Z.; Davis, Scott

2016-01-01

Background Nightshift work is associated with cancer among men, but the biological mechanism is unclear. We investigated whether male nightshift workers demonstrated changes in levels of melatonin and cortisol, potential biomarkers of cancer risk. Methods Urine was collected from 185 nightshift and 158 dayshift-working male healthcare providers, aged 22-55, throughout work and sleep periods and assayed for 6-sulfatoxymelatonin and cortisol. Morning serum was collected within 90 minutes of completing the night and assayed for cortisol. Results Nightshift workers had significantly lower 6-sulfatoxymelatonin levels during daytime sleep, nighttime work, and nighttime sleep on off-nights (57%, 62% and 40% lower, respectively), relative to the dayshift workers during nighttime sleep (p<0.0001); urinary cortisol in nightshift workers was 16% higher during daytime sleep and 13% lower during nighttime sleep on off-nights (p<0.05). Morning serum cortisol post-work and post-sleep in nightshift workers were 24% and 43% lower, respectively, than post-sleep levels among dayshift workers (p<0.0001). Within-subject comparisons among the nightshift workers revealed significantly lower melatonin levels and significantly higher urinary cortisol levels during daytime sleep and nighttime work, relative to nighttime sleep (p<0.01); morning serum cortisol levels post-work were lower than those post-sleep. Conclusions Nightshift workers have substantially lower 6-sulfatoxymelatonin during night work and daytime sleep, and levels remain low when nightshift workers sleep at night. Chronic reduction in melatonin among nightshift workers may be an important carcinogenic mechanism. Cortisol secretion patterns may be impacted by night shift work, which could affect cancer risk. Impact Shiftwork could be an important risk factor for many types of cancer. PMID:23563887

Microbial Extracellular Enzyme Activity and Community Assembly Processes Post Fire Disturbance Amanda Labrado, University of Texas at El Paso; Emily B. Graham, University of Colorado Boulder; Joseph E. Knelman, University of Colorado Boulder; Scott Ferrenberg, University of Colorado Boulder; Diana R. Nemergut, University of Colorado Boulder

NASA Astrophysics Data System (ADS)

Labrdo, A.; Knelman, J. E.; Graham, E. B.; Ferrenberg, S.; Nemergut, D. R.

2013-12-01

Microbes control major biogeochemical cycles and can directly impact the carbon, nitrogen, and phosphorus pools and fluxes of soils. However, many questions remain regarding when and where data on microbial community structure are necessary to accurately predict biogeochemical processes. In particular, it is unknown how shifts in microbial assembly processes may relate to changes in the relationship between community structure and ecosystem function. Here, we examine soil microbial community assembly processes and extracellular enzyme activity (EEA) at 4-weeks and 16-weeks after the Fourmile Canyon Fire in Boulder, CO in order to determine the effects of disturbance on community assembly and EEA. Microbial community structure was determined from 16S rRNA gene pyrosequencing, edaphic properties were determined using standard biogeochemical assays, and extracellular enzyme activity for β-1, 4-glucosidase (BG) and β-1, 4-N-acetylglucosaminidase (NAG) enzymes were determined using fluorimetric assays. Stepwise linear regressions were used to determine the effects of microbial community structure and edaphic factors on EEA. We determined that in 4-week post fire samples EEA was only correlated with microbial predictors. However, we observed a shift with 16-week samples in which EEA was significantly related to edaphic predictors. Null derivation analysis of community assembly revealed that communities in the 4-week samples were more neutrally assembled than communities in the 16-week samples. Together, these results support a conceptual model in which the relationship between edaphic factors and ecosystem processes is somewhat decoupled in more neutrally assembled communities, and data on microbial community structure is important to most accurately predict function.

Elucidating the impact of glucosylation on human serum albumin: A multi-technique approach.

PubMed

Neelofar, K M; Ahmad, Jamal; Arif, Zarina; Alam, Khursheed

2016-11-01

Early glycation products as well as advance glycation end products are involved in pathogenesis of diabetes. Most of studies carried out on AGEs and their possible role in assessing diabetes complications, whereas only a few were focused to highlight the role of Amadori products. In this study, an attempt has been made to investigate a structural and immunological characterizations of Amadori-albumin upon early glucosylation because albumin undergoes fast glycation under hyperglycaemic condition. Amadori-albumin formation was determined by NBT assay and Amadori adducts in glycated samples were confirmed by LC-MS. Structural alterations in Amadori-albumin were characterized by loss in fluorescence intensity, loss in secondary and tertiary structures, exposure of hydrophobic patches, shifting in Amide bands and increment in hydrodynamic radius. Further, presence to autoantibodies against Amadori-albumin in diabetes patients were confirmed by direct binding ELISA and inhibition ELISA. Immunological studies results showed that autoantibodies present in diabetic patients with and without chronic kidney disease (CKD) showed significant binding with Amadori-albumin in comparison to the native protein. Anti Amadori-albumin antibodies predominantly present in CKD patients compare to without CKD patients. Band shift assay results showed true interaction between Amadori-albumin and autoantibodies present in CKD patients. Glucosylation results showed structural alterations in Amadori-albumin and hence generation of neo-epitopes in HSA molecule. Such modifications rendering the protein highly immunogenic that may be recognized as foreign molecule by immune cells and induced autoantibodies in diabetic patients. These finding signify the role of Amadori-albumin in kidney dysfunction in diabetes and raised level of autoantibodies may be used as biomarker for progression of CKD. Copyright © 2016 Elsevier B.V. All rights reserved.

Nanobiophotonics for molecular imaging of cancer: Au- and Ag-based Epidermal Growth Factor receptor (EGFR) specific nanoprobes

NASA Astrophysics Data System (ADS)

Lucas, Leanne J.; Hewitt, Kevin C.

2012-03-01

Our aim is to create and validate a novel SERS-based nanoprobe for optical imaging of the epidermal growth factor receptor (EGFR). Gold and silver nanoparticles (Au/AgNPs) of various sizes were synthesized and coupled to epidermal growth factor (EGF) via a short ligand, α-lipoic acid (206 g/mol), which binds strongly to both Au and Ag nanoparticles via its disulfide end group. We used carbodiimide chemistry to couple EGF to α-lipoic acid. These nanoprobes were tested for binding affinity using Enzyme Linked ImmunoSorbent Assay (ELISA) and, in-vitro, using EGFRoverexpressing A431 cells. The nanoprobes show excellent EGFR-specific binding. Time of Flight Mass Spectrometry demonstrate the carbodiimide based linking of the carboxylic acid end-group of α-lipoic acid to one or more of the three (terminal, or 2 lysine) amine groups on EGF. ELISA confirms that the linked EGF is active by itself, and following conjugation with gold or silver nanoparticles. Compared with bare nanoparticles, UV-Vis spectroscopy of Ag-based nanoprobes exhibit significant plasmon red-shift, while there was no discernable shift for Au-based ones. Dark field microscopy shows abundant uptake by EGFR overexpressing A431 cells, and serves to further confirm the excellent binding affinity. Nanoprobe internalization and consequent aggregation is thought to be the basis of enhanced light scattering in the dark field images, supporting the notion that these nanoprobes should provide excellent SERS signals at all nanoprobe sizes. In summary, novel EGFR-specific nanoprobes have been synthesized and validated by standard assay and in cell culture for use as SERS optical imaging probes.

Molecular interferometric imaging study of molecular interactions

NASA Astrophysics Data System (ADS)

Zhao, Ming; Wang, Xuefeng; Nolte, David

2008-02-01

Molecular Interferometric Imaging (MI2) is a sensitive detection platform for direct optical detection of immobilized biomolecules. It is based on inline common-path interferometry combined with far-field optical imaging. The substrate is a simple thermal oxide on a silicon surface with a thickness at or near the quadrature condition that produces a π/2 phase shift between the normal-incident wave reflected from the top oxide surface and the bottom silicon surface. The presence of immobilized or bound biomolecules on the surface produces a relative phase shift that is converted to a far-field intensity shift and is imaged by a reflective microscope onto a CCD camera. Shearing interferometry is used to remove the spatial 1/f noise from the illumination to achieve shot-noise-limited detection of surface dipole density profiles. The lateral resolution of this technique is diffraction limited at 0.4 micron, and the best longitudinal resolution is 10 picometers. The minimum detectable mass at the metrology limit is 2 attogram, which is 8 antibody molecules of size 150 kDa. The corresponding scaling mass sensitivity is 5 fg/mm compared with 1 pg/mm for typical SPR sensitivity. We have applied MI2 to immunoassay applications, and real-time binding kinetics has been measured for antibody-antigen reactions. The simplicity of the substrate and optical read-out make MI2 a promising analytical assay tool for high-throughput screening and diagnostics.

Rational and random mutagenesis of firefly luciferase to identify an efficient emitter of red bioluminescence

NASA Astrophysics Data System (ADS)

Branchini, Bruce R.; Southworth, Tara L.; Khattak, Neelum F.; Murtiashaw, Martha H.; Fleet, Sarah E.

2004-06-01

Firefly luciferase, which emits yellow-green (557 nm) light, and the corresponding cDNA have been used successfully as a bioluminescence reporter of gene expression. One particularly exciting application is in the area of in vivo bioluminescence imaging. Our interest is in developing improved reagents by identifying Photinus pyralis luciferase mutants that efficiently emit red bioluminescence. In this way, the proven advantages of the P. pyralis protein can be combined with the potential advantages of a red-shifted emitter. Using site-directed mutagenesis techniques, we have identified many mutants emitting red bioluminescence. Unfortunately, these enzymes generally have significantly decreased bioluminescence activity. Interestingly, we discovered a mutation, Ile351Ala, that produced a moderate 16 nm red-shift, while maintaining excellent bioluminescence activity. We then undertook a random mutagenesis approach to identify luciferase mutants that emit further red-shifted bioluminescence with minimal loss of activity. Libraries of mutants were created using an error-prone PCR method and the Ile351Ala luciferase mutant as the template DNA. The libraries were screened by in vivo bacterial assays and the promising mutants were purified to enable accurate determination of bioluminescence emission spectra and total bioluminescence activity. We will report the characterization results, including the identification of the randomly altered amino acids, of several mutants that catalyze bioluminescence with emission maxima of approximately 600 nm.

An Alternative Thiol-Reactive Dye to Analyze Ligand Interactions with the Chemokine Receptor CXCR2 Using a New Thermal Shift Assay Format.

PubMed

Bergsdorf, Christian; Fiez-Vandal, Cédric; Sykes, David A; Bernet, Pascal; Aussenac, Sonia; Charlton, Steven J; Schopfer, Ulrich; Ottl, Johannes; Duckely, Myriam

2016-03-01

Integral membrane proteins (IMPs) play an important role in many cellular events and are involved in numerous pathological processes. Therefore, understanding the structure and function of IMPs is a crucial prerequisite to enable successful targeting of these proteins with low molecular weight (LMW) ligands early on in the discovery process. To optimize IMP purification/crystallization and to identify/characterize LMW ligand-target interactions, robust, reliable, high-throughput, and sensitive biophysical methods are needed. Here, we describe a differential scanning fluorimetry (DSF) screening method using the thiol-reactive BODIPY FL-cystine dye to monitor thermal unfolding of the G-protein-coupled receptor (GPCR), CXCR2. To validate this method, the seven-transmembrane protein CXCR2 was analyzed with a set of well-characterized antagonists. This study showed that the new DSF assay assessed reliably the stability of CXCR2 in a 384-well format. The analysis of 14 ligands with a potency range over 4 log units demonstrated the detection/characterization of LMW ligands binding to the membrane protein target. Furthermore, DSF results cross-validated with the label-free differential static light scattering (DSLS) thermal denaturation method. These results underline the potential of the BODIPY assay format as a general tool to investigate membrane proteins and their interaction partners. © 2015 Society for Laboratory Automation and Screening.

Microchip assays for screening monoclonal antibody product quality.

PubMed

Chen, Xiaoyu; Tang, Kaiyan; Lee, Maximilian; Flynn, Gregory C

2008-12-01

Microchip CE-SDS was evaluated as a high-throughput alternative to conventional CE-SDS for monitoring monoclonal antibody protein quality. A commercial instrument (LabChip) 90) was used to separate dodecyl sulfate coated proteins through a sieving polymer based on the proteins' sizes. Under reducing conditions, the microchip CE-SDS separation was similar to that of conventional CE-SDS, providing reasonable resolution of the non-glycosylated and the glycosylated heavy chains. The fluorescence detection on LabChip 90 using non-covalent fluorescent labeling method was about as sensitive as the 220 nm UV detection used in a conventional CE instrument. A simple glycan typing assay was developed for the reducing microchip CE-SDS format. Antibodies, either pure or in crude cell culture media are treated with Endoglycosidase H, which specifically cleaves the hybrid and high mannose type glycans. A heavy chain migration shift on reducing CE-SDS resulting from the loss of glycan is used to measure the level of high mannose/hybrid type glycans as a percentage of the total glycans. Microchip CE-SDS, under both non-reducing and reducing conditions, can be used in a variety of antibody product screening assays. The microchip analyses provide sufficient resolution and sensitivity for this purpose but on a time scale approximately 70 times faster (41 s versus 50 min per sample) than conventional CE separation under typical operational conditions.

Molecular interactions of ROOTLESS CONCERNING CROWN AND SEMINAL ROOTS, a LOB domain protein regulating shoot-borne root initiation in maize (Zea mays L.)

PubMed Central

Majer, Christine; Xu, Changzheng; Berendzen, Kenneth W.; Hochholdinger, Frank

2012-01-01

Rootless concerning crown and seminal roots (Rtcs) encodes a LATERAL ORGAN BOUNDARIES domain (LBD) protein that regulates shoot-borne root initiation in maize (Zea mays L.). GREEN FLUORESCENT PROTEIN (GFP)-fusions revealed RTCS localization in the nucleus while its paralogue RTCS-LIKE (RTCL) was detected in the nucleus and cytoplasm probably owing to an amino acid exchange in a nuclear localization signal. Moreover, enzyme-linked immunosorbent assay (ELISA) experiments demonstrated that RTCS primarily binds to LBD DNA motifs. RTCS binding to an LBD motif in the promoter of the auxin response factor (ARF) ZmArf34 and reciprocally, reciprocal ZmARF34 binding to an auxin responsive element motif in the promoter of Rtcs was shown by electrophoretic mobility shift assay experiments. In addition, comparative qRT-PCR of wild-type versus rtcs coleoptilar nodes suggested RTCS-dependent activation of ZmArf34 expression. Consistently, luciferase reporter assays illustrated the capacity of RTCS, RTCL and ZmARF34 to activate downstream gene expression. Finally, RTCL homo- and RTCS/RTCL hetero-interaction were demonstrated in yeast-two-hybrid and bimolecular fluorescence complementation experiments, suggesting a role of these complexes in downstream gene regulation. In summary, the data provide novel insights into the molecular interactions resulting in crown root initiation in maize. PMID:22527397

Structural insights into the recognition of the internal A-rich linker from OxyS sRNA by Escherichia coli Hfq

PubMed Central

Wang, Lijun; Wang, Weiwei; Li, Fudong; Zhang, Jiahai; Wu, Jihui; Gong, Qingguo; Shi, Yunyu

2015-01-01

Small RNA OxyS is induced during oxidative stress in Escherichia coli and it is an Hfq-dependent negative regulator of mRNA translation. OxyS represses the translation of fhlA and rpoS mRNA, which encode the transcriptional activator and σs subunit of RNA polymerase, respectively. However, little is known regarding how Hfq, an RNA chaperone, interacts with OxyS at the atomic level. Here, using fluorescence polarization and tryptophan fluorescence quenching assays, we verified that the A-rich linker region of OxyS sRNA binds Hfq at its distal side. We also report two crystal structures of Hfq in complex with A-rich RNA fragments from this linker region. Both of these RNA fragments bind to the distal side of Hfq and adopt a different conformation compared with those previously reported for the (A-R-N)n tripartite recognition motif. Furthermore, using fluorescence polarization, electrophoresis mobility shift assays and in vivo translation assays, we found that an Hfq mutant, N48A, increases the binding affinity of OxyS for Hfq in vitro but is defective in the negative regulation of fhlA translation in vivo, suggesting that the normal function of OxyS depends on the details of the interaction with Hfq that may be related to the rapid recycling of Hfq in the cell. PMID:25670676

HoloMonitor M4: holographic imaging cytometer for real-time kinetic label-free live-cell analysis of adherent cells

NASA Astrophysics Data System (ADS)

Sebesta, Mikael; Egelberg, Peter J.; Langberg, Anders; Lindskov, Jens-Henrik; Alm, Kersti; Janicke, Birgit

2016-03-01

Live-cell imaging enables studying dynamic cellular processes that cannot be visualized in fixed-cell assays. An increasing number of scientists in academia and the pharmaceutical industry are choosing live-cell analysis over or in addition to traditional fixed-cell assays. We have developed a time-lapse label-free imaging cytometer HoloMonitorM4. HoloMonitor M4 assists researchers to overcome inherent disadvantages of fluorescent analysis, specifically effects of chemical labels or genetic modifications which can alter cellular behavior. Additionally, label-free analysis is simple and eliminates the costs associated with staining procedures. The underlying technology principle is based on digital off-axis holography. While multiple alternatives exist for this type of analysis, we prioritized our developments to achieve the following: a) All-inclusive system - hardware and sophisticated cytometric analysis software; b) Ease of use enabling utilization of instrumentation by expert- and entrylevel researchers alike; c) Validated quantitative assay end-points tracked over time such as optical path length shift, optical volume and multiple derived imaging parameters; d) Reliable digital autofocus; e) Robust long-term operation in the incubator environment; f) High throughput and walk-away capability; and finally g) Data management suitable for single- and multi-user networks. We provide examples of HoloMonitor applications of label-free cell viability measurements and monitoring of cell cycle phase distribution.

Highly sensitive colorimetric detection of glucose in a serum based on DNA-embeded Au@Ag core-shell nanoparticles

NASA Astrophysics Data System (ADS)

Kang, Fei; Hou, Xiangshu; Xu, Kun

2015-10-01

Glucose is a key energy substance in diverse biology and closely related to the life activities of the organism. To develop a simple and sensitive method for glucose detection is extremely urgent but still remains a key challenge. Herein, we report a colorimetric glucose sensor in a homogeneous system based on DNA-embedded core-shell Au@Ag nanoparticles. In this assay, a glucose substrate was first catalytically oxidized by glucose oxidase to produce H2O2 which would further oxidize and gradually etch the outer silver shell of Au@Ag nanoparticles. Afterwards, the solution color changed from yellow to red and the surface plasmon resonance (SPR) band of Au@Ag nanoparticles declined and red-shifted from 430 to 516 nm. Compared with previous silver-based glucose colorimetric detection strategies, the distinctive SPR band change is superior to the color variation, which is critical to the high sensitivity of this assay. Benefiting from the outstanding optical property, robust stability and well-dispersion of the core-shell Au@AgNPs hybrid, this colorimetric assay obtained a detection limit of glucose as low as 10 nM, which is at least a 10-fold improvement over other AgNPs-based procedures. Moreover, this optical biosensor was successfully employed to the determination of glucose in fetal bovine serum.

Screening for lead compounds and herbal extracts with potential anti-influenza viral activity.

PubMed

Klaywong, Konrapob; Khutrakul, Gachagorn; Choowongkomon, Kiattawee; Lekcharoensuk, Chalermpol; Petcharat, Nantawan; Leckcharoensuk, Porntippa; Ramasoota, Pongrama

2014-01-01

Nonstructural protein 1 (NS1) of the highly pathogenic avian influenza virus (H5N1) contains a conserved RNA binding domain (RBD) that inhibits antiviral functions of host-innate immune response. Dimerization of NS1 forms a central groove and binds to double stranded (ds) RNA. This region might serve as a potential drug target. In this study, three dimensional structure model of NS1 RBD protein was constructed and virtual screening was performed to identify lead compounds that bound within and around the central groove. The virtual screening showed that 5 compounds bound within the central groove with binding energy ranging between -16.05 and -17.36 Kcal/mol. Two commercially available compounds, estradiol and veratridine, were selected for using in an in vitro screening assay. The results showed that neither of the compounds could inhibit the association between dsRNA and NS1 RBD protein. In addition, 34 herbal extracts were examined for their inhibitory effects. Five of them were able to inhibit association between NS1 RBD and dsRNA in electrophoresis mobility shift assay. Four herbs, Terminalia belirica, Salacia chinensis, Zingiber montanum and Peltophorum pterocarpum, could reduce > 50% of infectivity of H5N1 in a cell-based assay, and it is worth further studying their potential use as source of antiviral drugs.

High resolution clear native electrophoresis for in-gel functional assays and fluorescence studies of membrane protein complexes.

PubMed

Wittig, Ilka; Karas, Michael; Schägger, Hermann

2007-07-01

Clear native electrophoresis and blue native electrophoresis are microscale techniques for the isolation of membrane protein complexes. The Coomassie Blue G-250 dye, used in blue native electrophoresis, interferes with in-gel fluorescence detection and in-gel catalytic activity assays. This problem can be overcome by omitting the dye in clear native electrophoresis. However, clear native electrophoresis suffers from enhanced protein aggregation and broadening of protein bands during electrophoresis and therefore has been used rarely. To preserve the advantages of both electrophoresis techniques we substituted Coomassie dye in the cathode buffer of blue native electrophoresis by non-colored mixtures of anionic and neutral detergents. Like Coomassie dye, these mixed micelles imposed a charge shift on the membrane proteins to enhance their anodic migration and improved membrane protein solubility during electrophoresis. This improved clear native electrophoresis offers a high resolution of membrane protein complexes comparable to that of blue native electrophoresis. We demonstrate the superiority of high resolution clear native electrophoresis for in-gel catalytic activity assays of mitochondrial complexes I-V. We present the first in-gel histochemical staining protocol for respiratory complex III. Moreover we demonstrate the special advantages of high resolution clear native electrophoresis for in-gel detection of fluorescent labeled proteins labeled by reactive fluorescent dyes and tagged by fluorescent proteins. The advantages of high resolution clear native electrophoresis make this technique superior for functional proteomics analyses.

A Multiplexed High-Content Screening Approach Using the Chromobody Technology to Identify Cell Cycle Modulators in Living Cells.

PubMed

Schorpp, Kenji; Rothenaigner, Ina; Maier, Julia; Traenkle, Bjoern; Rothbauer, Ulrich; Hadian, Kamyar

2016-10-01

Many screening hits show relatively poor quality regarding later efficacy and safety. Therefore, small-molecule screening efforts shift toward high-content analysis providing more detailed information. Here, we describe a novel screening approach to identify cell cycle modulators with low toxicity by combining the Cell Cycle Chromobody (CCC) technology with the CytoTox-Glo (CTG) cytotoxicity assay. The CCC technology employs intracellularly functional single-domain antibodies coupled to a fluorescent protein (chromobodies) to visualize the cell cycle-dependent redistribution of the proliferating cell nuclear antigen (PCNA) in living cells. This image-based cell cycle analysis was combined with determination of dead-cell protease activity in cell culture supernatants by the CTG assay. We adopted this multiplex approach to high-throughput format and screened 960 Food and Drug Administration (FDA)-approved drugs. By this, we identified nontoxic compounds, which modulate different cell cycle stages, and validated selected hits in diverse cell lines stably expressing CCC. Additionally, we independently validated these hits by flow cytometry as the current state-of-the-art format for cell cycle analysis. This study demonstrates that CCC imaging is a versatile high-content screening approach to identify cell cycle modulators, which can be multiplexed with cytotoxicity assays for early elimination of toxic compounds during screening. © 2016 Society for Laboratory Automation and Screening.

Modulation of Nrf2/Keap1 system by Wasabi 6-methylthiohexyl isothiocyanate in ARE-mediated NQO1 expression.

PubMed

Korenori, Yoshimi; Tanigawa, Shunsuke; Kumamoto, Takuma; Qin, Si; Daikoku, Yosuke; Miyamori, Koji; Nagai, Masashi; Hou, De-Xing

2013-05-01

6-Methylthiohexyl isothiocyanate (6-MTITC), one of the major bioactive ingredients in Japanese Wasabi, has revealed cytoprotective and cancer chemopreventive effects. This study aims to clarify the molecular mechanisms how 6-MTITC modulates nuclear factor E2-related factor 2 (Nrf2)/Kelchlike ECH-associating protein 1 (Keap1) system in antioxidant-responsive element (ARE)-mediated nicotinamide adenine dinucleotide phosphate (NADP): quinone oxidoreductase 1 (NQO1) expression. HepG2 cells were treated with 6-MTITC with varying time and dose. NQO1, Nrf2, and Keap1 proteins were detected by Western blotting. ARE transactivation was detected by electrophilic mobility shift assay and reporter gene assay. Nuclear localization of Nrf2 was determined by immunocytochemistry assay. Ubiquitination of Nrf2 and Keap1 was detected using immunoprecipitation after treatment with MG132. Small interfering RNA was used to knockdown Nrf2 or Keap1. The results revealed that 6-MTITC modulated Nrf2/ARE pathway by stimulating Keap1 modification, and inhibiting Nrf2 ubiquitination and protein turnover. These actions finally increased nuclear Nrf2 accumulation and ARE-binding activity. Moreover, silencing Nrf2 markedly reduced ARE-driven activity induced by 6-MTITC. 6-MTITC modulated ARE-driven NQO1 expression by stabilizing Nrf2 with enhanced Keap1 modification and decreased Nrf2 degradation. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Prediction of cellular radiosensitivity from DNA damage induced by gamma-rays and carbon ion irradiation in canine tumor cells.

PubMed

Wada, Seiichi; Van Khoa, Tran; Kobayashi, Yasuhiko; Funayama, Tomoo; Ogihara, Kikumi; Ueno, Shunji; Ito, Nobuhiko

2005-11-01

Diseases of companion animals are shifting from infectious diseases to neoplasms (cancer), and since radiation therapy is one of the effective choices available for cancer treatment, the application of radiotherapy in veterinary medicine is likely to increase. However tumor tissues have different radiosensitivities, and therefore it is important to determine the intrinsic radiosensitivity of tumors in individual patients in advance of radiotherapy. We have studied the relationship between the surviving cell fraction measured by a clonogenic assay and DNA double strand breaks detected by a comet assay under neutral conditions in three canine tumor cell lines, after gamma-ray and carbon ion irradiation. In all the cell lines, cell death assessed by the clonogenic assay was much higher following irradiation with carbon ions than with gamma-rays. The initial and residual (4 hr) DNA damage due to gamma-ray and carbon ion irradiation were higher in a radiosensitive cell line than in a radioresistant cell line. The surviving cell fraction at 2 Gy (SF2) showed a tendency for correlation with both the initial and residual DNA damage. In particular, the residual damage per Gy was significantly correlated with SF2, regardless of the type of radiation. This indicates that cellular radiosensitivity can be predicted by detection of radiation-induced residual DNA damage.

AutA and AutR, Two Novel Global Transcriptional Regulators, Facilitate Avian Pathogenic Escherichia coli Infection.

PubMed

Zhuge, Xiangkai; Tang, Fang; Zhu, Hongfei; Mao, Xiang; Wang, Shaohui; Wu, Zongfu; Lu, Chengping; Dai, Jianjun; Fan, Hongjie

2016-04-26

Bacteria can change its lifestyle during inhabiting in host niches where they survive and replicate by rapidly altering gene expression pattern to accommodate the new environment. In this study, two novel regulators in avian pathogenic Escherichia coli (APEC) were identified and designated as AutA and AutR. RT-PCR and β-galactosidase assay results showed that AutA and AutR co-regulated the expression of adhesin UpaB in APEC strain DE205B. Electrophoretic mobility shift assay showed that AutA and AutR could directly bind the upaB promoter DNA. In vitro transcription assay indicated that AutA could activate the upaB transcription, while AutR inhibited the upaB transcription due to directly suppressing the activating effect of AutA on UpaB expression. Transcriptome analysis showed that AutA and AutR coherently affected the expression of hundreds of genes. Our study confirmed that AutA and AutR co-regulated the expression of DE205B K1 capsule and acid resistance systems in E. coli acid fitness island (AFI). Moreover, phenotypic heterogeneity in expression of K1 capsule and acid resistance systems in AFI during host-pathogen interaction was associated with the regulation of AutA and AutR. Collectively speaking, our studies presented that AutA and AutR are involved in APEC adaptive lifestyle change to facilitate its infection.

Molecular interactions of ROOTLESS CONCERNING CROWN AND SEMINAL ROOTS, a LOB domain protein regulating shoot-borne root initiation in maize (Zea mays L.).

PubMed

Majer, Christine; Xu, Changzheng; Berendzen, Kenneth W; Hochholdinger, Frank

2012-06-05

Rootless concerning crown and seminal roots (Rtcs) encodes a LATERAL ORGAN BOUNDARIES domain (LBD) protein that regulates shoot-borne root initiation in maize (Zea mays L.). GREEN FLUORESCENT PROTEIN (GFP)-fusions revealed RTCS localization in the nucleus while its paralogue RTCS-LIKE (RTCL) was detected in the nucleus and cytoplasm probably owing to an amino acid exchange in a nuclear localization signal. Moreover, enzyme-linked immunosorbent assay (ELISA) experiments demonstrated that RTCS primarily binds to LBD DNA motifs. RTCS binding to an LBD motif in the promoter of the auxin response factor (ARF) ZmArf34 and reciprocally, reciprocal ZmARF34 binding to an auxin responsive element motif in the promoter of Rtcs was shown by electrophoretic mobility shift assay experiments. In addition, comparative qRT-PCR of wild-type versus rtcs coleoptilar nodes suggested RTCS-dependent activation of ZmArf34 expression. Consistently, luciferase reporter assays illustrated the capacity of RTCS, RTCL and ZmARF34 to activate downstream gene expression. Finally, RTCL homo- and RTCS/RTCL hetero-interaction were demonstrated in yeast-two-hybrid and bimolecular fluorescence complementation experiments, suggesting a role of these complexes in downstream gene regulation. In summary, the data provide novel insights into the molecular interactions resulting in crown root initiation in maize.

Opposing effects of bile acids deoxycholic acid and ursodeoxycholic acid on signal transduction pathways in oesophageal cancer cells.

PubMed

Abdel-Latif, Mohamed M; Inoue, Hiroyasu; Reynolds, John V

2016-09-01

Ursodeoxycholic acid (UDCA) was reported to reduce bile acid toxicity, but the mechanisms underlying its cytoprotective effects are not fully understood. The aim of the present study was to examine the effects of UDCA on the modulation of deoxycholic acid (DCA)-induced signal transduction in oesophageal cancer cells. Nuclear factor-κB (NF-κB) and activator protein-1 (AP-1) activity was assessed using a gel shift assay. NF-κB activation and translocation was performed using an ELISA-based assay and immunofluorescence analysis. COX-2 expression was analysed by western blotting and COX-2 promoter activity was assessed by luciferase assay. DCA induced NF-κB and AP-1 DNA-binding activities in SKGT-4 and OE33 cells. UDCA pretreatment inhibited DCA-induced NF-κB and AP-1 activation and NF-κB translocation. This inhibitory effect was coupled with a blockade of IκB-α degradation and inhibition of phosphorylation of IKK-α/β and ERK1/2. Moreover, UDCA pretreatment inhibited COX-2 upregulation. Using transient transfection of the COX-2 promoter, UDCA pretreatment abrogated DCA-induced COX-2 promoter activation. In addition, UDCA protected oesophageal cells from the apoptotic effects of deoxycholate. Our findings indicate that UDCA inhibits DCA-induced signalling pathways in oesophageal cancer cells. These data indicate a possible mechanistic role for the chemopreventive actions of UDCA in oesophageal carcinogenesis.

Advances in the Diagnosis of Human Opisthorchiasis: Development of Opisthorchis viverrini Antigen Detection in Urine

PubMed Central

Duenngai, Kunyarat; Wangboon, Chompunoot; Sithithaworn, Jiraporn; Watwiengkam, Nattaya; Namwat, Nisana; Techasen, Anchalee; Loilome, Watcharin; Yongvanit, Puangrat; Loukas, Alex; Sithithaworn, Paiboon; Bethony, Jeffrey M.

2015-01-01

Background Many strategies to control opisthorchiasis have been employed in Thailand, but not in the other neighbouring countries. Specific control methods include mass drug administration (MDA) and health education to reduce raw fish consumption. These control efforts have greatly shifted the epidemiology of Opisthorchis viverrini (OV) infection over the last decade from presenting as densely concentrated "heavy" infections in single villages to widespread "light" OV infections distributed over wide geographical areas. Currently, the "gold standard" detection method for OV infection is formalin ethyl-acetate concentration technique (FECT), which has limited diagnostic sensitivity and diagnostic specificity for light OV infections, with OV eggs often confused with eggs of minute intestinal flukes (MIFs) in feces. In this study, we developed and evaluated the diagnostic performance of a monoclonal antibody-based enzyme-linked immunosorbent assay for the measurement of OV excretory-secretory (ES) antigens in urine (urine OV-ES assay) for the diagnosis of opisthorchiasis compared to the gold standard detection FECT method. Methodology We tested several methods for pre-treating urine samples prior to testing the diagnostic performance of the urine OV-ES assay. Using trichloroacetic acid (TCA) pre-treated urine, we compared detection and quantification of OV infection using the urine OV-ES assay versus FECT in OV-endemic areas in Northeastern Thailand. Receiver operating characteristic (ROC) curves were used to determine the diagnostic sensitivity and specificity of the urine OV-ES assay using TCA pre-treated urine, and to establish diagnostic positivity thresholds. The Positive Predictive Value as well as the likelihood of obtaining a positive test result (LR+) or a negative test result (LR-) were calculated for the established diagnostic positivity threshold. Diagnostic risks (Odds Ratios) were estimated using logistic regression. Results When urine samples were pre-treated with TCA prior to use in the urine OV-ES assay, the analytical sensitivity was significantly improved. Using TCA pre-treatment of urine, the urine OV-ES assay had a limit of detection (LoD) of 39 ng/ml compared to the LoD of 52 ng/mL reported for coprological antigen detection methods. Similarly, the urine OV-ES assay correlated significantly with intensity of OV infection as measured by FECT. The urine OV-ES assay was also able to detect 28 individuals as positive from the 63 (44.4%) individuals previously determined to be negative using FECT. The likelihood of a positive diagnosis of OV infection by urine OV-ES assay increased significantly with the intensity of OV infection as determined by FECT. With reference to FECT, the sensitivity and specificity of the urine OV-ES assay was 81% and 70%, respectively. Conclusion The detection of OV-infection by the urine OV-ES assay showed much greater diagnostic sensitivity and diagnostic specificity than the current "gold standard" FECT method for the detection and quantification of OV infection. Due to its ease-of-use, and noninvasive sample collection (urine), the urine OV-ES assay offers the potential to revolutionize the diagnosis of liver fluke infection and provide an effective tool for control and elimination of these tumorigenic parasites. PMID:26485024

Effects of irritant chemicals on Aedes aegypti resting behavior: is there a simple shift to untreated "safe sites"?

PubMed

Manda, Hortance; Arce, Luana M; Foggie, Tarra; Shah, Pankhil; Grieco, John P; Achee, Nicole L

2011-07-01

Previous studies have identified the behavioral responses of Aedes aegypti to irritant and repellent chemicals that can be exploited to reduce man-vector contact. Maximum efficacy of interventions based on irritant chemical actions will, however, require full knowledge of variables that influence vector resting behavior and how untreated "safe sites" contribute to overall impact. Using a laboratory box assay, resting patterns of two population strains of female Ae. aegypti (THAI and PERU) were evaluated against two material types (cotton and polyester) at various dark:light surface area coverage (SAC) ratio and contrast configuration (horizontal and vertical) under chemical-free and treated conditions. Chemicals evaluated were alphacypermethrin and DDT at varying concentrations. Under chemical-free conditions, dark material had significantly higher resting counts compared to light material at all SAC, and significantly increased when material was in horizontal configuration. Cotton elicited stronger response than polyester. Within the treatment assays, significantly higher resting counts were observed on chemical-treated dark material compared to untreated light fabric. However, compared to matched controls, significantly less resting observations were made on chemical-treated dark material overall. Most importantly, resting observations on untreated light material (or "safe sites") in the treatment assay did not significantly increase for many of the tests, even at 25% SAC. Knockdown rates were ≤5% for all assays. Significantly more observations of flying mosquitoes were made in test assays under chemical-treatment conditions as compared to controls. When preferred Ae. aegypti resting sites are treated with chemicals, even at reduced treatment coverage area, mosquitoes do not simply move to safe sites (untreated areas) following contact with the treated material. Instead, they become agitated, using increased flight as a proxy indicator. It is this contact irritant response that may elicit escape behavior from a treated space and is a focus of exploitation for reducing man-vector contact inside homes.

New Real-Time PCR Assays for Detection of Inducible and Acquired Clarithromycin Resistance in the Mycobacterium abscessus Group.

PubMed

Shallom, Shamira J; Moura, Natalia S; Olivier, Kenneth N; Sampaio, Elizabeth P; Holland, Steven M; Zelazny, Adrian M

2015-11-01

Members of the Mycobacterium abscessus group (MAG) cause lung, soft tissue, and disseminated infections. The oral macrolides clarithromycin and azithromycin are commonly used for treatment. MAG can display clarithromycin resistance through the inducible erm(41) gene or via acquired mutations in the rrl (23S rRNA) gene. Strains harboring a truncation or a T28C substitution in erm(41) lose the inducible resistance trait. Phenotypic detection of clarithromycin resistance requires extended incubation (14 days), highlighting the need for faster methods to detect resistance. Two real-time PCR-based assays were developed to assess inducible and acquired clarithromycin resistance and tested on a total of 90 clinical and reference strains. A SYBR green assay was designed to distinguish between a full-length and truncated erm(41) gene by temperature shift in melting curve analysis. Single nucleotide polymorphism (SNP) allele discrimination assays were developed to distinguish T or C at position 28 of erm(41) and 23S rRNA rrl gene mutations at position 2058 and/or 2059. Truncated and full-size erm(41) genes were detected in 21/90 and 69/90 strains, respectively, with 64/69 displaying T at nucleotide position 28 and 5/69 containing C at that position. Fifteen isolates showed rrl mutations conferring clarithromycin resistance, including A2058G (11 isolates), A2058C (3 isolates), and A2059G (1 isolate). Targeted sequencing and phenotypic assessment of resistance concurred with molecular assay results. Interestingly, we also noted cooccurring strains harboring an active erm(41), inactive erm(41), and/or acquired mutational resistance, as well as slowly growing MAG strains and also strains displaying an inducible resistance phenotype within 5 days, long before the recommended 14-day extended incubation. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

The Feynman-Y Statistic in Relation to Shift-Register Neutron Coincidence Counting: Precision and Dead Time

DOE Office of Scientific and Technical Information (OSTI.GOV)

Croft, Stephen; Santi, Peter A.; Henzlova, Daniela

The Feynman-Y statistic is a type of autocorrelation analysis. It is defined as the excess variance-to-mean ratio, Y = VMR - 1, of the number count distribution formed by sampling a pulse train using a series of non-overlapping gates. It is a measure of the degree of correlation present on the pulse train with Y = 0 for Poisson data. In the context of neutron coincidence counting we show that the same information can be obtained from the accidentals histogram acquired using the multiplicity shift-register method, which is currently the common autocorrelation technique applied in nuclear safeguards. In the casemore » of multiplicity shift register analysis however, overlapping gates, either triggered by the incoming pulse stream or by a periodic clock, are used. The overlap introduces additional covariance but does not alter the expectation values. In this paper we discuss, for a particular data set, the relative merit of the Feynman and shift-register methods in terms of both precision and dead time correction. Traditionally the Feynman approach is applied with a relatively long gate width compared to the dieaway time. The main reason for this is so that the gate utilization factor can be taken as unity rather than being treated as a system parameter to be determined at characterization/calibration. But because the random trigger interval gate utilization factor is slow to saturate this procedure requires a gate width many times the effective 1/e dieaway time. In the traditional approach this limits the number of gates that can be fitted into a given assay duration. We empirically show that much shorter gates, similar in width to those used in traditional shift register analysis can be used. Because the way in which the correlated information present on the pulse train is extracted is different for the moments based method of Feynman and the various shift register based approaches, the dead time losses are manifested differently for these two approaches. The resulting estimates for the dead time corrected first and second order reduced factorial moments should be independent of the method however and this allows the respective dead time formalism to be checked. We discuss how to make dead time corrections in both the shift register and the Feynman approaches.« less

A novel gamma-fitting statistical method for anti-drug antibody assays to establish assay cut points for data with non-normal distribution.

PubMed

Schlain, Brian; Amaravadi, Lakshmi; Donley, Jean; Wickramasekera, Ananda; Bennett, Donald; Subramanyam, Meena

2010-01-31

In recent years there has been growing recognition of the impact of anti-drug or anti-therapeutic antibodies (ADAs, ATAs) on the pharmacokinetic and pharmacodynamic behavior of the drug, which ultimately affects drug exposure and activity. These anti-drug antibodies can also impact safety of the therapeutic by inducing a range of reactions from hypersensitivity to neutralization of the activity of an endogenous protein. Assessments of immunogenicity, therefore, are critically dependent on the bioanalytical method used to test samples, in which a positive versus negative reactivity is determined by a statistically derived cut point based on the distribution of drug naïve samples. For non-normally distributed data, a novel gamma-fitting method for obtaining assay cut points is presented. Non-normal immunogenicity data distributions, which tend to be unimodal and positively skewed, can often be modeled by 3-parameter gamma fits. Under a gamma regime, gamma based cut points were found to be more accurate (closer to their targeted false positive rates) compared to normal or log-normal methods and more precise (smaller standard errors of cut point estimators) compared with the nonparametric percentile method. Under a gamma regime, normal theory based methods for estimating cut points targeting a 5% false positive rate were found in computer simulation experiments to have, on average, false positive rates ranging from 6.2 to 8.3% (or positive biases between +1.2 and +3.3%) with bias decreasing with the magnitude of the gamma shape parameter. The log-normal fits tended, on average, to underestimate false positive rates with negative biases as large a -2.3% with absolute bias decreasing with the shape parameter. These results were consistent with the well known fact that gamma distributions become less skewed and closer to a normal distribution as their shape parameters increase. Inflated false positive rates, especially in a screening assay, shifts the emphasis to confirm test results in a subsequent test (confirmatory assay). On the other hand, deflated false positive rates in the case of screening immunogenicity assays will not meet the minimum 5% false positive target as proposed in the immunogenicity assay guidance white papers. Copyright 2009 Elsevier B.V. All rights reserved.

Analytical methods to determine the comparative DNA binding studies of curcumin-Cu(II) complexes

NASA Astrophysics Data System (ADS)

Rajesh, Jegathalaprathaban; Rajasekaran, Marichamy; Rajagopal, Gurusamy; Athappan, Periakaruppan

2012-11-01

DNA interaction studies of two mononuclear [1:1(1); 1:2(2)] copper(II) complexes of curcumin have been studied. The interaction of these complexes with CT-DNA has been explored by physical methods to propose modes of DNA binding of the complexes. Absorption spectral titrations of complex 1 with CT-DNA shows a red-shift of 3 nm with the DNA binding affinity of Kb, 5.21 × 104 M-1 that are higher than that obtained for 2 (red-shift, 2 nm; Kb, 1.73 × 104 M-1) reveal that the binding occurs in grooves as a result of the interaction is via exterior phosphates. The CD spectra of these Cu(II) complexes show a red shift of 3-10 nm in the positive band with increase in intensities. This spectral change of induced CD due to the hydrophobic interaction of copper complexes with DNA is the characteristic of B to A conformational change. The EB displacement assay also reveals the same trend as observed in UV-Vis spectral titration. The addition of complexes 1 and 2 to the DNA bound ethidium bromide (EB) solutions causes an obvious reduction in emission intensities indicating that these complexes competitively bind to DNA with EB. The positive shift of both the Epc and E0' accompanied by reduction of peak currents in differential pulse voltammogram (DPV), upon adding different concentrations of DNA to the metal complexes, are obviously in favor of strong binding to DNA. The super coiled plasmid pUC18 DNA cleavage ability of Cu(II) complexes in the presence of reducing agent reveals the single strand DNA cleavage (ssDNA) is observed. The hydroxyl radical (HOrad ) and the singlet oxygen are believed to be the reactive species responsible for the cleavage.

Stimulated phase-shift acoustic nanodroplets enhance vancomycin efficacy against methicillin-resistant Staphylococcus aureus biofilms.

PubMed

Guo, Hao; Wang, Ziming; Du, Quanyin; Li, Pan; Wang, Zhigang; Wang, Aimin

2017-01-01

Bacterial biofilms on the surface of prostheses are becoming a rising concern in managing prosthetic joint infections. The inherent resistant features of biofilms render traditional antimicrobial therapy unproductive and revision surgery outcomes uncertain. This situation has prompted the exploration of novel antimicrobial strategies. The synergy of ultrasound microbubbles and vancomycin has been proposed as an efficient alternative for biofilm eradication. The purpose of this study was to evaluate the anti-biofilm effect of stimulated phase-shift acoustic nanodroplets (NDs) combined with vancomycin. We fabricated lipid phase-shift NDs with a core of liquid perfluoropentane. A new phase change mode for NDs incorporating an initial unfocused low-intensity pulsed ultrasound for 5 minutes and a subsequent incubation at 37°C into a 24-hour duration was developed. Methicillin-resistant Staphylococcus aureus (MRSA) biofilms were incubated with vancomycin and NDs under the hybrid stimulation. Biofilm morphology following treatment was determined using confocal laser scanning microscopy and scanning electron microscopy. Resazurin assay was used to quantify bactericidal efficacy against MRSA biofilm bacteria. NDs treated sequentially with ultrasound and heating at 37°C achieved gradual and substantial ND vaporization and cavitation in a successive process. NDs after stimulation were capable of generating stronger destruction on biofilm structure which was best characterized by residual circular arc margins and more dead bacteria. Furthermore, NDs combined with vancomycin contributed to significantly decreasing the metabolic activity of bacteria in MRSA biofilms ( P <0.05). Phase-shift acoustic NDs could exert a significant bactericidal effect against MRSA biofilms through a new stimulation mode. Acoustic NDs present advantages over microbubbles for biofilm damage. This anti-biofilm strategy could be used either alone or as an enhancer of traditional antibiotics in the control of prosthetic joint infections.

[Diagnostic and therapeutic approach of intraabdominal candidiasis].

PubMed

Montero, A; Gilsanz, F; Maseda, E

2016-09-01

Invasive fungal disease is associated to a high mortality rate on critical ill patients. In the last decades an important epidemiological shift has been described. Early diagnosis and treatment are related with a better prognosis. The key factors lie in a set of predictive scores that allow to identify patients that will benefit of early treatment, as well as using diagnosis techniques that are culture independent. New diagnosis approximations are being developed with promising results: in situ hybridisation using PNA-FISH probes, MALDI-TOF MS and rapid nucleic acids detection assays. The use of echinocandin is recommended as antifungal therapy on critical ill patients with candida peritonitis.

Functionalized xenon as a biosensor

PubMed Central

Spence, Megan M.; Rubin, Seth M.; Dimitrov, Ivan E.; Ruiz, E. Janette; Wemmer, David E.; Pines, Alexander; Yao, Shao Qin; Tian, Feng; Schultz, Peter G.

2001-01-01

The detection of biological molecules and their interactions is a significant component of modern biomedical research. In current biosensor technologies, simultaneous detection is limited to a small number of analytes by the spectral overlap of their signals. We have developed an NMR-based xenon biosensor that capitalizes on the enhanced signal-to-noise, spectral simplicity, and chemical-shift sensitivity of laser-polarized xenon to detect specific biomolecules at the level of tens of nanomoles. We present results using xenon “functionalized” by a biotin-modified supramolecular cage to detect biotin–avidin binding. This biosensor methodology can be extended to a multiplexing assay for multiple analytes. PMID:11535830

Isolation of a 5-Kilodalton Actin-Sequestering Peptide from Human Blood Platelets

NASA Astrophysics Data System (ADS)

Safer, Daniel; Golla, Rajasree; Nachmias, Vivianne T.

1990-04-01

Resting human platelets contain ≈0.3 mM unpolymerized actin. When freshly drawn and washed platelets are treated with saponin, 85-90% of the unpolymerized actin diffuses out. Analysis by polyacrylamide gel electrophoresis under nondenaturing conditions shows that the bulk of this unpolymerized actin migrates with a higher mobility than does pure G-actin, profilactin, or actin-gelsolin complex. When muscle G-actin is added to fresh or boiled saponin extract, the added muscle actin is shifted to the high-mobility form. The saponin extract contains an acidic peptide having a molecular mass in the range of 5 kDa, which has been purified to homogeneity by reverse-phase HPLC. This peptide also shifts muscle actin to the high-mobility form. Addition of either boiled saponin extract or the purified peptide to muscle G-actin also strongly and stoichiometrically inhibits salt-induced polymerization, as assayed by falling-ball viscometry and by sedimentation. We conclude that this peptide binds to the bulk of the unpolymerized actin in platelets and prevents it from polymerizing.

Statistical tests and identifiability conditions for pooling and analyzing multisite datasets

PubMed Central

Zhou, Hao Henry; Singh, Vikas; Johnson, Sterling C.; Wahba, Grace

2018-01-01

When sample sizes are small, the ability to identify weak (but scientifically interesting) associations between a set of predictors and a response may be enhanced by pooling existing datasets. However, variations in acquisition methods and the distribution of participants or observations between datasets, especially due to the distributional shifts in some predictors, may obfuscate real effects when datasets are combined. We present a rigorous statistical treatment of this problem and identify conditions where we can correct the distributional shift. We also provide an algorithm for the situation where the correction is identifiable. We analyze various properties of the framework for testing model fit, constructing confidence intervals, and evaluating consistency characteristics. Our technical development is motivated by Alzheimer’s disease (AD) studies, and we present empirical results showing that our framework enables harmonizing of protein biomarkers, even when the assays across sites differ. Our contribution may, in part, mitigate a bottleneck that researchers face in clinical research when pooling smaller sized datasets and may offer benefits when the subjects of interest are difficult to recruit or when resources prohibit large single-site studies. PMID:29386387

Habituation as an adaptive shift in response strategy mediated by neuropeptides

NASA Astrophysics Data System (ADS)

Ardiel, Evan L.; Yu, Alex J.; Giles, Andrew C.; Rankin, Catharine H.

2017-08-01

Habituation is a non-associative form of learning characterized by a decremented response to repeated stimulation. It is typically framed as a process of selective attention, allowing animals to ignore irrelevant stimuli in order to free up limited cognitive resources. However, habituation can also occur to threatening and toxic stimuli, suggesting that habituation may serve other functions. Here we took advantage of a high-throughput Caenorhabditis elegans learning assay to investigate habituation to noxious stimuli. Using real-time computer vision software for automated behavioral tracking and optogenetics for controlled activation of a polymodal nociceptor, ASH, we found that neuropeptides mediated habituation and performed an RNAi screen to identify candidate receptors. Through subsequent mutant analysis and cell-type-specific gene expression, we found that pigment-dispersing factor (PDF) neuropeptides function redundantly to promote habituation via PDFR-1-mediated cAMP signaling in both neurons and muscles. Behavioral analysis during learning acquisition suggests that response habituation and sensitization of locomotion are parts of a shifting behavioral strategy orchestrated by pigment dispersing factor signaling to promote dispersal away from repeated aversive stimuli.

Manufacture of pooled platelets in additive solution and storage in an ELX container after an overnight warm temperature hold of platelet-rich plasma.

PubMed

Alhumaidan, Hiba; Cheves, Tracey; Holme, Stein; Sweeney, Joseph D

2011-10-01

The processing of whole blood-derived platelet-rich plasma (PRP) to a platelet concentrate and platelet-poor plasma is currently performed within 8 hours to comply with the requirements to manufacture fresh frozen plasma. Maintaining PRP at room temperature for a longer period can have the advantage of shifting the completion of component manufacture onto day shifts. Pairs of ABO-identical prepooled platelets were manufactured by the PRP method, using the current approach with platelet storage in a CLX HP container (Pall Medical, Covina, CA) and plasma, or a novel approach with an 18- to a 24-hour room temperature hold of the PRP and the manufacture of pooled platelets in a glucose-containing additive solution (AS) and storage in a new ELX container (Pall Medical). Standard in vitro assays were performed on days 2, 5, and 7. The results showed that the AS platelets in ELX have in vitro characteristics that are equivalent or superior to those of the standard product.

Use of a 17-Gene Prognostic Assay in Contemporary Urologic Practice: Results of an Interim Analysis in an Observational Cohort.

PubMed

Eure, Gregg; Germany, Raymond; Given, Robert; Lu, Ruixiao; Shindel, Alan W; Rothney, Megan; Glowacki, Richard; Henderson, Jonathan; Richardson, Tim; Goldfischer, Evan; Febbo, Phillip G; Denes, Bela S

2017-09-01

To study the impact of genomic testing in shared decision making for men with clinically low-risk prostate cancer (PCa). Patients with clinically low-risk PCa were enrolled in a prospective, multi-institutional study of a validated 17-gene tissue-based reverse transcription polymerase chain reaction assay (Genomic Prostate Score [GPS]). In this paper we report on outcomes in the first 297 patients enrolled in the study with valid 17-gene assay results and decision-change data. The primary end points were shared decision on initial management and persistence on active surveillance (AS) at 1 year post diagnosis. AS utilization and persistence were compared with similar end points in a group of patients who did not have genomic testing (baseline cohort). Secondary end points included perceived utility of the assay and patient decisional conflict before and after testing. One-year results were available on 258 patients. Shift between initial recommendation and shared decision occurred in 23% of patients. Utilization of AS was higher in the GPS-tested cohort than in the untested baseline cohort (62% vs 40%). The proportion of men who selected and persisted on AS at 1 year was 55% and 34% in the GPS and baseline cohorts, respectively. Physicians reported that GPS was useful in 90% of cases. Mean decisional conflict scores declined in patients after GPS testing. Patients who received GPS testing were more likely to select and persist on AS for initial management compared with a matched baseline group. These data indicate that GPS help guide shared decisions in clinically low-risk PCa. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Utilizing direct skin feeding assays for development of vaccines that interrupt malaria transmission: A systematic review of methods and case study.

PubMed

Brickley, Elizabeth B; Coulibaly, Mamadou; Gabriel, Erin E; Healy, Sara A; Hume, Jen C C; Sagara, Issaka; Traore, Sekou F; Doumbo, Ogobara; Duffy, Patrick E

2016-11-21

Shifting the malaria priorities from a paradigm of control and elimination to a goal of global eradication calls for renewed attention to the interruption of malaria transmission. Sustained progress toward eradication will require both improved understanding of infectious reservoirs and efficient development of novel transmission-blocking interventions, such as rapidly acting and highly efficacious therapeutics and vaccines. Here, we review the direct skin feeding assay (DSF), which has been proposed as a valuable tool for measuring the in natura transmission of malaria parasites from human hosts to mosquito vectors across heterogeneous populations. To capture the methodological breadth of this assay's use, we first systematically review and qualitatively synthesize previously published investigations using DSFs to study malaria transmission in humans. Then, using a recent Phase 1 trial in Mali of the Pfs25H-EPA/Alhydrogel® vaccine candidate (NCT01867463) designed to interrupt Plasmodium falciparum transmission as a case study, we describe the potential opportunities and current limitations of utilizing the endpoints measured by DSF in making early clinical decisions for individually randomized transmission-interrupting intervention candidates. Using simulations based on the data collected in the clinical trial, we demonstrate that the capacity of the DSF to serve as an evaluative tool is limited by the statistical power constraints of the "effective sample size" (i.e. the number of subjects that are capable of transmitting at the time of feeding). Altogether, our findings suggest DSFs have great potential utility for assessing the public health impacts of emerging antimalarial tools, but additional research is needed to address issues of scalability and to establish correlation with community-wide clinical endpoints as well as complementary in vitro measures, such as standard membrane feeding assays. Published by Elsevier Ltd.

Retinoid X receptor and peroxisome proliferator-activated receptor activate an estrogen responsive gene independent of the estrogen receptor.

PubMed

Nuñez, S B; Medin, J A; Braissant, O; Kemp, L; Wahli, W; Ozato, K; Segars, J H

1997-03-14

Estrogen receptors regulate transcription of genes essential for sexual development and reproductive function. Since the retinoid X receptor (RXR) is able to modulate estrogen responsive genes and both 9-cis RA and fatty acids influenced development of estrogen responsive tumors, we hypothesized that estrogen responsive genes might be modulated by RXR and the fatty acid receptor (peroxisome proliferator-activated receptor, PPAR). To test this hypothesis, transfection assays in CV-1 cells were performed with an estrogen response element (ERE) coupled to a luciferase reporter construct. Addition of expression vectors for RXR and PPAR resulted in an 11-fold increase in luciferase activity in the presence of 9-cis RA. Furthermore, mobility shift assays demonstrated binding of RXR and PPAR to the vitellogenin A2-ERE and an ERE in the oxytocin promoter. Methylation interference assays demonstrated that specific guanine residues required for RXR/PPAR binding to the ERE were similar to residues required for ER binding. Moreover, RXR domain-deleted constructs in transfection assays showed that activation required RXR since an RXR delta AF-2 mutant completely abrogated reporter activity. Oligoprecipitation binding studies with biotinylated ERE and (35)S-labeled in vitro translated RXR constructs confirmed binding of delta AF-2 RXR mutant to the ERE in the presence of baculovirus-expressed PPAR. Finally, in situ hybridization confirmed RXR and PPAR mRNA expression in estrogen responsive tissues. Collectively, these data suggest that RXR and PPAR are present in reproductive tissues, are capable of activating estrogen responsive genes and suggest that the mechanism of activation may involve direct binding of the receptors to estrogen response elements.

Accurate, simple, and inexpensive assays to diagnose F8 gene inversion mutations in hemophilia A patients and carriers.

PubMed

Dutta, Debargh; Gunasekera, Devi; Ragni, Margaret V; Pratt, Kathleen P

2016-12-27

The most frequent mutations resulting in hemophilia A are an intron 22 or intron 1 gene inversion, which together cause ∼50% of severe hemophilia A cases. We report a simple and accurate RNA-based assay to detect these mutations in patients and heterozygous carriers. The assays do not require specialized equipment or expensive reagents; therefore, they may provide useful and economic protocols that could be standardized for central laboratory testing. RNA is purified from a blood sample, and reverse transcription nested polymerase chain reaction (RT-NPCR) reactions amplify DNA fragments with the F8 sequence spanning the exon 22 to 23 splice site (intron 22 inversion test) or the exon 1 to 2 splice site (intron 1 inversion test). These sequences will be amplified only from F8 RNA without an intron 22 or intron 1 inversion mutation, respectively. Additional RT-NPCR reactions are then carried out to amplify the inverted sequences extending from F8 exon 19 to the first in-frame stop codon within intron 22 or a chimeric transcript containing F8 exon 1 and the VBP1 gene. These latter 2 products are produced only by individuals with an intron 22 or intron 1 inversion mutation, respectively. The intron 22 inversion mutations may be further classified (eg, as type 1 or type 2, reflecting the specific homologous recombination sites) by the standard DNA-based "inverse-shifting" PCR assay if desired. Efficient Bcl I and T4 DNA ligase enzymes that cleave and ligate DNA in minutes were used, which is a substantial improvement over previous protocols that required overnight incubations. These protocols can accurately detect F8 inversion mutations via same-day testing of patient samples.

ERK inhibition enhances TSA-induced gastric cancer cell apoptosis via NF-κB-dependent and Notch-independent mechanism.

PubMed

Yao, Jun; Qian, Cui-Juan; Ye, Bei; Zhang, Xin; Liang, Yong

2012-09-04

To analyze the combined impact of the histone deacetylase inhibitor (HDACI) Trichostatin A (TSA) and the extracellular-signal-regulated kinase 1/2 (ERK1/2) inhibitor PD98059 on gastric cancer (GC) cell line SGC7901 growth. SGC7901 cells were treated with TSA, PD98059 or with a TSA-PD98059 combination. Effects of drug treatment on tumor cell proliferation, apoptosis, cell cycle progression, and cell signaling pathways were investigated by MTS assay, flow cytometry, Western blotting, chromatin immunoprecipitation (ChIP) assay, electrophoretic mobility shift assay (EMSA), and luciferase reporter assay, respectively. PD98059 enhanced TSA-induced cell growth arrest, apoptosis and activation of p21(WAF1/CIP1), but reversed TSA-induced activation of ERK1/2 and nuclear factor-κB (NF-κB). TSA alone up-regulated Notch1 and Hes1, and down-regulated Notch2, but PD98059 did not affect the trends of Notch1 and Notch2 induced by TSA. Particularly, PD98059 did potentiate the ability of TSA to down-regulate phospho-histone H3 protein, but increased levels of the acetylated forms of histone H3 bound to the p21(WAF1/CIP1) promoter, leading to enhanced expression of p21(WAF1/CIP1) in SGC7901 cells. PD98059 synergistically potentiates TSA-induced GC growth arrest and apoptosis by manipulating NF-κB and p21(WAF1/CIP1) independent of Notch. Therefore, concomitant administration of HDACIs and ERK1/2 inhibitors may be a promising treatment strategy for individuals with GC. Copyright © 2012 Elsevier Inc. All rights reserved.

The putative Agrobacterium transcriptional activator-like virulence protein VirD5 may target T-complex to prevent the degradation of coat proteins in the plant cell nucleus.

PubMed

Wang, Yafei; Peng, Wei; Zhou, Xu; Huang, Fei; Shao, Lingyun; Luo, Meizhong

2014-09-01

Agrobacterium exports at least five virulence proteins (VirE2, VirE3, VirF, VirD2, VirD5) into host cells and hijacks some host plant factors to facilitate its transformation process. Random DNA binding selection assays (RDSAs), electrophoretic mobility shift assays (EMSAs) and yeast one-hybrid systems were used to identify protein-bound DNA elements. Bimolecular fluorescence complementation, glutathione S-transferase pull-down and yeast two-hybrid assays were used to detect protein interactions. Protoplast transformation, coprecipitation, competitive binding and cell-free degradation assays were used to analyze the relationships among proteins. We found that Agrobacterium VirD5 exhibits transcriptional activation activity in yeast, is located in the plant cell nucleus, and forms homodimers. A specific VirD5-bound DNA element designated D5RE (VirD5 response element) was identified. VirD5 interacted directly with Arabidopsis VirE2 Interacting Protein 1 (AtVIP1). However, the ternary complex of VirD5-AtVIP1-VirE2 could be detected, whereas that of VirD5-AtVIP1-VBF (AtVIP1 Binding F-box protein) could not. We demonstrated that VirD5 competes with VBF for binding to AtVIP1 and stabilizes AtVIP1 and VirE2 in the cell-free degradation system. Our results indicated that VirD5 may act as both a transcriptional activator-like effector to regulate host gene expression and a protector preventing the coat proteins of the T-complex from being quickly degraded by the host's ubiquitin proteasome system (UPS). © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

Reporter enzyme inhibitor study to aid assembly of orthogonal reporter gene assays.

PubMed

Ho, Pei-i; Yue, Kimberley; Pandey, Pramod; Breault, Lyne; Harbinski, Fred; McBride, Aaron J; Webb, Brian; Narahari, Janaki; Karassina, Natasha; Wood, Keith V; Hill, Adam; Auld, Douglas S

2013-05-17

Reporter gene assays (RGAs) are commonly used to measure biological pathway modulation by small molecules. Understanding how such compounds interact with the reporter enzyme is critical to accurately interpret RGA results. To improve our understanding of reporter enzymes and to develop optimal RGA systems, we investigated eight reporter enzymes differing in brightness, emission spectrum, stability, and substrate requirements. These included common reporter enzymes such as firefly luciferase (Photinus pyralis), Renilla reniformis luciferase, and β-lactamase, as well as mutated forms of R. reniformis luciferase emitting either blue- or green-shifted luminescence, a red-light emitting form of Luciola cruciata firefly luciferase, a mutated form of Gaussia princeps luciferase, and a proprietary luciferase termed "NanoLuc" derived from the luminescent sea shrimp Oplophorus gracilirostris. To determine hit rates and structure-activity relationships, we screened a collection of 42,460 PubChem compounds at 10 μM using purified enzyme preparations. We then compared hit rates and chemotypes of actives for each enzyme. The hit rates ranged from <0.1% for β-lactamase to as high as 10% for mutated forms of Renilla luciferase. Related luciferases such as Renilla luciferase mutants showed high degrees of inhibitor overlap (40-70%), while unrelated luciferases such as firefly luciferases, Gaussia luciferase, and NanoLuc showed <10% overlap. Examination of representative inhibitors in cell-based assays revealed that inhibitor-based enzyme stabilization can lead to increases in bioluminescent signal for firefly luciferase, Renilla luciferase, and NanoLuc, with shorter half-life reporters showing increased activation responses. From this study we suggest strategies to improve the construction and interpretation of assays employing these reporter enzymes.

Straightforward hit identification approach in fragment-based discovery of bromodomain-containing protein 4 (BRD4) inhibitors.

PubMed

Borysko, Petro; Moroz, Yurii S; Vasylchenko, Oleksandr V; Hurmach, Vasyl V; Starodubtseva, Anastasia; Stefanishena, Natalia; Nesteruk, Kateryna; Zozulya, Sergey; Kondratov, Ivan S; Grygorenko, Oleksandr O

2018-05-09

A combination approach of a fragment screening and "SAR by catalog" was used for the discovery of bromodomain-containing protein 4 (BRD4) inhibitors. Initial screening of 3695-fragment library against bromodomain 1 of BRD4 using thermal shift assay (TSA), followed by initial hit validation, resulted in 73 fragment hits, which were used to construct a follow-up library selected from available screening collection. Additionally, analogs of inactive fragments, as well as a set of randomly selected compounds were also prepared (3 × 3200 compounds in total). Screening of the resulting sets using TSA, followed by re-testing at several concentrations, counter-screen, and TR-FRET assay resulted in 18 confirmed hits. Compounds derived from the initial fragment set showed better hit rate as compared to the other two sets. Finally, building dose-response curves revealed three compounds with IC 50  = 1.9-7.4 μM. For these compounds, binding sites and conformations in the BRD4 (4UYD) have been determined by docking. Copyright © 2018 Elsevier Ltd. All rights reserved.

Preparative two-step purification of recombinant H1.0 linker histone and its domains.

PubMed

Ivic, Nives; Bilokapic, Silvija; Halic, Mario

2017-01-01

H1 linker histones are small basic proteins that have a key role in the formation and maintenance of higher-order chromatin structures. Additionally, many examples have shown that linker histones play an important role in gene regulation, modulated by their various subtypes and posttranslational modifications. Obtaining high amounts of very pure linker histones, especially for efficient antibody production, remains a demanding and challenging procedure. Here we present an easy and fast method to purify human linker histone H1.0 overexpressed in Escherichia coli, as well as its domains: N-terminal/globular domain and C-terminal intrinsically disordered domain. This purification protocol relies on a simple affinity chromatography step followed by cation exchange due to the highly basic properties of histone proteins. Therefore, this protocol can also be applied to other linker histones. Highly pure proteins in amounts sufficient for most biochemical experiments can be obtained. The functional quality of purified H1.0 histone and its domains has been confirmed by pull-down, gel-mobility shift assays and the nuclear import assay.

Interactions between the nuclear matrix and an enhancer of the tryptophan oxygenase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaneoka, Hidenori; Miyake, Katsuhide, E-mail: miyake@nubio.nagoya-u.ac.jp; Iijima, Shinji

2009-10-02

The gene for tryptophan oxygenase (TO) is expressed in adult hepatocytes in a tissue- and differentiation-specific manner. The TO promoter has two glucocorticoid-responsive elements (GREs), and its expression is regulated by glucocorticoid hormone in the liver. We found a novel GRE in close proximity to a scaffold/matrix attachment region (S/MAR) that was located around -8.5 kb from the transcriptional start site of the TO gene by electrophoretic mobility shift and chromatin immunoprecipitation (ChIP) assays. A combination of nuclear fractionation and quantitative PCR analysis showed that the S/MAR was tethered to the nuclear matrix in both fetal and adult hepatocytes. ChIPmore » assay showed that, in adult hepatocytes, the S/MAR-GRE and the promoter proximal regions interacted with lamin and heterogeneous nuclear ribonucleoprotein U in a dexamethasone dependent manner, but this was not the case in fetal cells, suggesting that developmental stage-specific expression of the TO gene might rely on the binding of the enhancer (the -8.5 kb S/MAR-GRE) and the promoter to the inner nuclear matrix.« less

MicroRNA-92a is a circadian modulator of neuronal excitability in Drosophila

PubMed Central

Chen, Xiao; Rosbash, Michael

2017-01-01

Many biological and behavioural processes of animals are governed by an endogenous circadian clock, which is dependent on transcriptional regulation. Here we address post-transcriptional regulation and the role of miRNAs in Drosophila circadian rhythms. At least six miRNAs show cycling expression levels within the pigment dispersing factor (PDF) cell-pacemaker neurons; only mir-92a peaks during the night. In vivo calcium monitoring, dynamics of PDF projections, ArcLight, GCaMP6 imaging and sleep assays indicate that mir-92a suppresses neuronal excitability. In addition, mir-92a levels within PDF cells respond to light pulses and also affect the phase shift response. Translating ribosome affinity purification (TRAP) and in vitro luciferase reporter assay indicate that mir-92a suppresses expression of sirt2, which is homologous to human sir2 and sirt3. sirt2 RNAi also phenocopies mir-92a overexpression. These experiments indicate that sirt2 is a functional mir-92a target and that mir-92a modulates PDF neuronal excitability via suppressing SIRT2 levels in a rhythmic manner. PMID:28276426

G-Quadruplex Induction by the Hairpin Pyrrole-Imidazole Polyamide Dimer.

PubMed

Obata, Shunsuke; Asamitsu, Sefan; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2018-02-06

The G-quadruplex (G4) is one type of higher-order structure of nucleic acids and is thought to play important roles in various biological events such as regulation of transcription and inhibition of DNA replication. Pyrrole-imidazole polyamides (PIPs) are programmable small molecules that can sequence-specifically bind with high affinity to the minor groove of double-stranded DNA (dsDNA). Herein, we designed head-to-head hairpin PIP dimers and their target dsDNA in a model G4-forming sequence. Using an electrophoresis mobility shift assay and transcription arrest assay, we found that PIP dimers could induce the structural change to G4 DNA from dsDNA through the recognition by one PIP dimer molecule of two duplex-binding sites flanking both ends of the G4-forming sequence. This induction ability was dependent on linker length. This is the first study to induce G4 formation using PIPs, which are known to be dsDNA binders. The results reported here suggest that selective G4 induction in native sequences may be achieved with PIP dimers by applying the same design strategy.

Novel pyrrole derivatives bearing sulfonamide groups: Synthesis in vitro cytotoxicity evaluation, molecular docking and DFT study

NASA Astrophysics Data System (ADS)

Bavadi, Masoumeh; Niknam, Khodabakhsh; Shahraki, Omolbanin

2017-10-01

The synthesis of new derivatives of pyrrole substituted sulfonamide groups is described. The in vitro anticancer activity of these pyrroles was evaluated against MCF7, MOLT-4 and HL-60 cells using MTT assay. The target compounds showed inhibitory activity against tested cell lines. Among the compounds, compound 1a exhibited good cytotoxic activity. The potential of this analog to induce apoptosis was confirmed in a nuclear morphological assay by Hoechst 33258 staining in the PC-12 cells. Finally, molecular docking was performed to determine the probable binding mode of the designed pyrrole derivatives into the active site of FGFR1 protein. DFT calculations were carried out at the B3LYP levels of theory with 6-31+G (d,p) basis set for compound 1a. The point group (C1) of it was obtained based on the optimized structures; the calculation of the FT-IR vibrational frequencies, 1H NMR and 13C NMR chemical shifts of the compound were carried out and compared with those obtained experimentally.

The regulation of the SARK promoter activity by hormones and environmental signals.

PubMed

Delatorre, Carla A; Cohen, Yuval; Liu, Li; Peleg, Zvi; Blumwald, Eduardo

2012-09-01

The Senescence Associated Receptor Protein Kinase (P(SARK)) promoter, fused to isopentenyltransferase (IPT) gene has been shown to promote drought tolerance in crops. We dissected P(SARK) in order to understand the various elements associated with its activation and suppression. The activity of P(SARK) was higher in mature and early senescing leaves, and abiotic stress induced its activity in mature leaves. Bioinformatics analysis suggests the interactions of multiple cis-acting elements in the control of P(SARK) activity. In vitro gel shift assays and yeast one hybrid system revealed interactions of P(SARK) with transcription factors related to abscisic acid and cytokinin response. Deletion analysis of P(SARK), fused to GUS-reporter gene was used to identify specific regions regulating transcription under senescence or during drought stress. Effects of exogenous hormonal treatments were characterized in entire plants and in leaf disk assays, and regions responsive to various hormones were defined. Our results indicate a complex interaction of plant hormones and additional factors modulating P(SARK) activity under stress resulting in a transient induction of expression. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Design, development, and validation of a high-throughput drug-screening assay for targeting of human leukemia

PubMed Central

Karjalainen, Katja; Pasqualini, Renata; Cortes, Jorge E.; Kornblau, Steven M.; Lichtiger, Benjamin; O'Brien, Susan; Kantarjian, Hagop M.; Sidman, Richard L.; Arap, Wadih; Koivunen, Erkki

2015-01-01

Background We introduce an ex vivo methodology to perform drug library screening against human leukemia. Method Our strategy relies on human blood or bone marrow cultures under hypoxia; under these conditions, leukemia cells deplete oxygen faster than normal cells, causing a hemoglobin oxygenation shift. We demonstrate several advantages: (I) partial recapitulation of the leukemia microenvironment, (ii) use of native hemoglobin oxygenation as real-time sensor/reporter, (iii) cost-effectiveness, (iv) species-specificity, and (v) format that enables high-throughput screening. Results As a proof-of-concept, we screened a chemical library (size ∼20,000) against human leukemia cells. We identified 70 compounds (“hit” rate=0.35%; Z-factor=0.71) with activity; we examined 20 to find 18 true-positives (90%). Finally, we show that carbonohydraxonic diamide group-containing compounds are potent anti-leukemia agents that induce cell death in leukemia cells and patient-derived samples. Conclusions This unique functional assay can identify novel drug candidates as well as find future applications in personalized drug selection for leukemia patients. PMID:24496871

Evaluation of uranium transitions for isotopically-selective laser induced fluorescence with diode lasers (technical report for ST064)

NASA Astrophysics Data System (ADS)

Cannon, B. D.

1993-10-01

Isotopically-selective excitation of uranium atoms by diode lasers can be the basis for a portable instrument to perform uranium isotopic assays in the field. Such an instrument would improve the ability of on-site inspections to detect and deter nuclear proliferation. Published and unpublished spectroscopic data on atomic uranium were examined to identify candidate transitions for isotopically-selective laser excitation with diode lasers. Eleven candidate transitions were identified and evaluated for their potential usefulness for a portable uranium assay instrument. Eight of these transitions are suitable for laser induced fluorescence using different excitation and detection wavelengths, which will improve sensitivity and elemental selectivity. Data sheets on the 25 uranium transitions in the wavelength range 629 nm to 1,000 nm that originate in the ground or first excited states of neutral atomic uranium are included. Each data sheet provides the wavelength, upper and lower energy levels, angular momentum quantum numbers, U-235 isotope shift (relative to U-238, and high-resolution spectra of weapons-grade uranium (93% U-235 and 7% U-238).

The monomeric form of Neisseria DNA mimic protein DMP19 prevents DNA from binding to the histone-like HU protein

PubMed Central

Ko, Tzu-Ping; Liao, Yi-Ting; Hsu, Kai-Cheng

2017-01-01

DNA mimicry is a direct and effective strategy by which the mimic competes with DNA for the DNA binding sites on other proteins. Until now, only about a dozen proteins have been shown to function via this strategy, including the DNA mimic protein DMP19 from Neisseria meningitides. We have shown previously that DMP19 dimer prevents the operator DNA from binding to the transcription factor NHTF. Here, we provide new evidence that DMP19 monomer can also interact with the Neisseria nucleoid-associated protein HU. Using BS3 crosslinking, gel filtration and isothermal titration calorimetry assays, we found that DMP19 uses its monomeric form to interact with the Neisseria HU dimer. Crosslinking conjugated mass spectrometry was used to investigate the binding mode of DMP19 monomer and HU dimer. Finally, an electrophoretic mobility shift assay (EMSA) confirmed that the DNA binding affinity of HU is affected by DMP19. These results showed that DMP19 is bifunctional in the gene regulation of Neisseria through its variable oligomeric forms. PMID:29220372

Differential Transcription Factor Use by the KIR2DL4 Promoter Under Constitutive and IL-2/15-Treated Conditions

PubMed Central

Presnell, Steven R.; Zhang, Lei; Chlebowy, Corrin N.; Al-Attar, Ahmad; Lutz, Charles T.

2012-01-01

KIR2DL4 is unique among human KIR genes in expression, cellular localization, structure, and function, yet the transcription factors required for its expression have not been identified. Using mutagenesis, electrophoretic mobility shift assay, and co-transfection assays, we identified two redundant Runx binding sites in the 2DL4 promoter as essential for constitutive 2DL4 transcription, with contributions by a CRE site and initiator elements. IL-2-and IL-15-stimulated human NK cell lines increased 2DL4 promoter activity, which required functional Runx, CRE, and Ets sites. Chromatin immunoprecipitation experiments show that Runx3 and Ets1 bind the 2DL4 promoter in situ. 2DL4 promoter activity had similar transcription factor requirements in T cells. Runx, CRE, and Ets binding motifs are present in 2DL4 promoters from across primate species, but other postulated transcription factor binding sites are not preserved. Differences between 2DL4 and clonally-restricted KIR promoters suggest a model that explains the unique 2DL4 expression pattern in human NK cells. PMID:22467658

Identification and characterization of cell-specific enhancer elements for the mouse ETF/Tead2 gene.

PubMed

Tanoue, Y; Yasunami, M; Suzuki, K; Ohkubo, H

2001-12-21

We have identified and characterized by transient transfection assays the cell-specific 117-bp enhancer sequence in the first intron of the mouse ETF (Embryonic TEA domain-containing factor)/Tead2 gene required for transcriptional activation in ETF/Tead2 gene-expressing cells, such as P19 cells. The 117-bp enhancer contains one GC-rich sequence (5'-GGGGCGGGG-3'), termed the GC box, and two tandemly repeated GA-rich sequences (5'-GGGGGAGGGG-3'), termed the proximal and distal GA elements. Further analyses, including transfection studies and electrophoretic mobility shift assays using a series of deletion and mutation constructs, indicated that Sp1, a putative activator, may be required to predominate over its competition with another unknown putative repressor, termed the GA element-binding factor, for binding to both the GC box, which overlapped with the proximal GA element, and the distal GA element in the 117-bp sequence in order to achieve a full enhancer activity. We also discuss a possible mechanism underlying the cell-specific enhancer activity of the 117-bp sequence.

Wogonin suppresses TNF-{alpha}-induced MMP-9 expression by blocking the NF-{kappa}B activation via MAPK signaling pathways in human aortic smooth muscle cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Syng-Ook; Jeong, Yun-Jeong; Yu, Mi Hee

2006-12-08

Matrix metalloproteinase-9 (MMP-9) plays a major role in the pathogenesis of atherosclerosis and restenosis by regulating both migration and proliferation of vascular smooth muscle cells (VSMC) after an arterial injury. In this study, we examined the inhibitory effect of three major flavonoids in Scutellariae Radix, baicalin, baicalein, and wogonin, on TNF-{alpha}-induced MMP-9 expression in human aortic smooth muscle cells (HASMC). Wogonin, but not baicalin and baicalein, significantly and selectively suppressed TNF-{alpha}-induced MMP-9 expression in HASMC. Reporter gene, electrophoretic mobility shift, and Western blotting assays showed that wogonin inhibits MMP-9 gene transcriptional activity by blocking the activation of NF-{kappa}B via MAPKmore » signaling pathways. Moreover, the Matrigel migration assay showed that wogonin reduced TNF-{alpha}-induced HASMC migration. These results suggest that wogonin effectively suppresses TNF-{alpha}-induced HASMC migration through the selective inhibition of MMP-9 expression and represents a potential agent for the prevention of vascular disorders related to the migration of VSMC.« less

A functional polymorphism of the TNF-{alpha} gene that is associated with type 2 DM

DOE Office of Scientific and Technical Information (OSTI.GOV)

Susa, Shinji; Daimon, Makoto; Sakabe, Jun-Ichi

2008-05-09

To examine the association of the tumor necrosis factor-{alpha} (TNF-{alpha}) gene region with type 2 diabetes (DM), 11 single-nucleotide polymorphisms (SNPs) of the region were analyzed. The initial study using a sample set (148 cases vs. 227 controls) showed a significant association of the SNP IVS1G + 123A of the TNF-{alpha} gene with DM (p = 0.0056). Multiple logistic regression analysis using an enlarged sample set (225 vs. 716) revealed the significant association of the SNP with DM independently of any clinical traits examined (OR: 1.49, p = 0.014). The functional relevance of the SNP were examined by the electrophoreticmore » mobility shift assays using nuclear extracts from the U937 and NIH3T3 cells and luciferase assays in these cells with Simian virus 40 promoter- and TNF-{alpha} promoter-reporter gene constructs. The functional analyses showed that YY1 transcription factor bound allele-specifically to the SNP region and, the IVS1 + 123A allele had an increase in luciferase expression compared with the G allele.« less

Bisphenol A induces corticotropin-releasing hormone expression in the placental cells JEG-3.

PubMed

Huang, Hui; Tan, Wenjuan; Wang, C C; Leung, Lai K

2012-11-01

Bisphenol A is utilized to make polycarbonate plastics and is an environmental pollutant. Recent research has indicated that it is an endocrine disruptor and may interfere with reproduction. Placental corticotrophin-releasing hormone (CRH) is a peptide hormone which is involved in fetal development. Increased plasma CRH is associated with elevated risk of premature delivery. In the present study, we demonstrated that bisphenol A increased CRH mRNA expression in the placental JEG-3 cells at or above 25μM. Reporter gene assay also demonstrated that bisphenol A could induce CRH gene transactivity. Since cyclic AMP response element (CRE) is a major regulatory element located in CRH promoter, the sequence-specific binding activity was investigated by using electrophoretic mobility shift assay. Our data indicated that bisphenol A increased the CRE binding activity. Western analysis further illustrated that PKA could be the signal triggering the CRE binding and CRH gene transactivation. In summary, the present study demonstrated that bisphenol A could induce CRH expression in placental cells and the underlying signal transduction pathway was also described. Copyright © 2012 Elsevier Inc. All rights reserved.

The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Seongman; Chul Ahn, Byung; O'Callaghan, Dennis J.

2012-10-25

The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealedmore » that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.« less

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Redox Polypharmacology as an Emerging Strategy to Combat Malarial Parasites.

PubMed

Sidorov, Pavel; Desta, Israel; Chessé, Matthieu; Horvath, Dragos; Marcou, Gilles; Varnek, Alexandre; Davioud-Charvet, Elisabeth; Elhabiri, Mourad

2016-06-20

3-Benzylmenadiones are potent antimalarial agents that are thought to act through their 3-benzoylmenadione metabolites as redox cyclers of two essential targets: the NADPH-dependent glutathione reductases (GRs) of Plasmodium-parasitized erythrocytes and methemoglobin. Their physicochemical properties were characterized in a coupled assay using both targets and modeled with QSPR predictive tools built in house. The substitution pattern of the west/east aromatic parts that controls the oxidant character of the electrophore was highlighted and accurately predicted by QSPR models. The effects centered on the benz(o)yl chain, induced by drug bioactivation, markedly influenced the oxidant character of the reduced species through a large anodic shift of the redox potentials that correlated with the redox cycling of both targets in the coupled assay. Our approach demonstrates that the antimalarial activity of 3-benz(o)ylmenadiones results from a subtle interplay between bioactivation, fine-tuned redox properties, and interactions with crucial targets of P. falciparum. Plasmodione and its analogues give emphasis to redox polypharmacology, which constitutes an innovative approach to antimalarial therapy. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Multiplex detection of pathogen biomarkers in human blood, serum, and saliva using silicon photonic microring resonators

NASA Astrophysics Data System (ADS)

Estrada, I. A.; Burlingame, R. W.; Wang, A. P.; Chawla, K.; Grove, T.; Wang, J.; Southern, S. O.; Iqbal, M.; Gunn, L. C.; Gleeson, M. A.

2015-05-01

Genalyte has developed a multiplex silicon photonic chip diagnostics platform (MaverickTM) for rapid detection of up to 32 biological analytes from a drop of sample in just 10 to 20 minutes. The chips are manufactured with waveguides adjacent to ring resonators, and probed with a continuously variable wavelength laser. A shift in the resonant wavelength as mass binds above the ring resonators is measured and is directly proportional to the amount of bound macromolecules. We present here the ability to multiplex the detection of hemorrhagic fever antigens in whole blood, serum, and saliva in a 16 minute assay. Our proof of concept testing of a multiplex antigencapture chip has the ability to detect Zaire Ebola (ZEBOV) recombinant soluble glycoprotein (rsGP), Marburg virus (MARV) Angola recombinant glycoprotein (rGP) and dengue nonstructural protein I (NS1). In parallel, detection of 2 malaria antigens has proven successful, but has yet to be incorporated into multiplex with the others. Each assay performs with sensitivity ranging from 1.6 ng/ml to 39 ng/ml depending on the antigen detected, and with minimal cross-reactivity.

One or two serological assay testing strategy for diagnosis of HBV and HCV infection? The use of predictive modelling.

PubMed

Parry, John V; Easterbrook, Philippa; Sands, Anita R

2017-11-01

Initial serological testing for chronic hepatitis B virus (HBV) and hepatitis C virus (HCV) infection is conducted using either rapid diagnostic tests (RDT) or laboratory-based enzyme immunoassays (EIA)s for detection of hepatitis B surface antigen (HBsAg) or antibodies to HCV (anti-HCV), typically on serum or plasma specimens and, for certain RDTs, capillary whole blood. WHO recommends the use of standardized testing strategies - defined as a sequence of one or more assays to maximize testing accuracy while simplifying the testing process and ideally minimizing cost. Our objective was to examine the diagnostic outcomes of a one- versus two-assay serological testing strategy. These data were used to inform recommendations in the 2017 WHO Guidelines on hepatitis B and C testing. Few published studies have compared diagnostic outcomes for one-assay versus two-assay serological testing strategies for HBsAg and anti-HCV. Therefore, the principles of Bayesian statistics were used to conduct a modelling exercise to examine the outcomes of a one-assay versus two-assay testing strategy when applied to a hypothetical population of 10,000 individuals. The resulting model examined the diagnostic outcomes (true and false positive diagnoses; true and false negative diagnoses; positive and negative predictive values as a function of prevalence; and total tests required) for both one-assay and two-assay testing strategies. The performance characteristics assumed for assays used within the testing strategies were informed by WHO prequalification assessment findings and systematic reviews for diagnostic accuracy studies. Each of the presumptive testing strategies (one-assay or two-assay) was modelled at varying prevalences of HBsAg (10%, 2% and 0.4%) and of anti-HCV (40%, 10%, 2% and 0.4%), aimed at representing the range of testing populations typically encountered in WHO Member States. When the two-assay testing strategy was considered, the model assumed the independence of the two assays. Modeling demonstrated that applying a single assay (HBsAg or anti-HCV), even with high specificity (99%), may result in considerable numbers of false positive diagnoses and low positive predictive values (PPV), particularly in lower prevalence settings. Even at very low prevalences shifting to a two-assay testing strategy would result in a PPV approaching 1.0. When test sensitivity is high (>99%) false negative reactions are rare at all but the highest prevalences; but a two-test strategy might yield more false negative diagnoses. The order in which the tests are used has no impact on the overall accuracy of a two-assay strategy though it may impact the total number of tests needed to complete the diagnostic strategy, incurring added cost and complexity. HBsAg assays may have a low sensitivity (<90%), and result in large numbers of false negative diagnoses, particularly in high prevalence settings, which would be exacerbated in the two-assay testing strategy. In contrast, most anti-HCV assays have high sensitivity and lead to fewer false negative results, both in the one-assay and two-assay testing strategies. At prevalences ≤2% the number of tests needed using a second assay was nearly always small, at <300 per 10,000 individuals tested, making sustainability of a second assay uncertain in such a setting. A key public health objective of an effective testing strategy is to identify all individuals who would benefit from treatment. Therefore, a strategy that prioritizes a high NPV (minimal false negatives) may be acceptable even if the PPV is suboptimal (some false positives) as the implementation of such a public health programme must also take account of other factors such as costs, feasibility, impact on testing uptake and linkage to care, and consequences of a false-positive test. This rationale informed the development of the WHO Viral Hepatitis Testing Guidelines, with a conditional recommendation for a one-assay serological testing strategy in most testing settings and populations (≥0.4% prevalence in population tested). A one-test strategy results in few failures to diagnose infection and, although it is associated under most assumptions with a sub-optimal PPV, benefits include greater simplicity, easier implementation, lower costs and better feasibility, uptake and linkage to care. Furthermore, prior to antiviral therapy all those diagnosed either HBsAg or anti-HCV positive will require confirmation of viræmia, preventing unnecessary treatment of those who may be false positive on serology. For HBsAg, in low-prevalence settings (≤0.4%), a second recommendation was made to consider a two-assay testing strategy, using a confirmatory neutralization step or a second different HBsAg assay.

Cryptophane Nanoscale Assemblies Expand 129Xe NMR Biosensing.

PubMed

Zemerov, Serge D; Roose, Benjamin W; Greenberg, Mara L; Wang, Yanfei; Dmochowski, Ivan J

2018-06-19

Cryptophane-based biosensors are promising agents for the ultrasensitive detection of biomedically relevant targets via 129 Xe NMR. Dynamic light scattering revealed that cryptophanes form water-soluble aggregates tens to hundreds of nanometers in size. Acridine orange fluorescence quenching assays allowed quantitation of the aggregation state, with critical concentrations ranging from 200 nM to 600 nM, depending on the cryptophane species in solution. The addition of excess carbonic anhydrase (CA) protein target to a benzenesulfonamide-functionalized cryptophane biosensor (C8B) led to C8B disaggregation and produced the expected 1:1 C8B-CA complex. C8B showed higher affinity at 298 K for the cytoplasmic isozyme CAII than the extracellular CAXII isozyme, which is a biomarker of cancer. Using hyper-CEST NMR, we explored the role of stoichiometry in detecting these two isozymes. Under CA-saturating conditions, we observed that isozyme CAII produces a larger 129 Xe NMR chemical shift change (δ = 5.9 ppm, relative to free biosensor) than CAXII (δ = 2.7 ppm), which indicates the strong potential for isozyme-specific detection. However, stoichiometry-dependent chemical shift data indicated that biosensor disaggregation contributes to the observed 129 Xe NMR chemical shift change that is normally assigned to biosensor-target binding. Finally, we determined that monomeric cryptophane solutions improve hyper-CEST saturation contrast, which enables ultrasensitive detection of biosensor-protein complexes. These insights into cryptophane-solution behavior support further development of xenon biosensors, but will require reinterpretation of the data previously obtained for many water-soluble cryptophanes.

Depth investigation of rapid sand filters for drinking water production reveals strong stratification in nitrification biokinetic behavior.

PubMed

Tatari, K; Smets, B F; Albrechtsen, H-J

2016-09-15

The biokinetic behavior of NH4(+) removal was investigated at different depths of a rapid sand filter treating groundwater for drinking water preparation. Filter materials from the top, middle and bottom layers of a full-scale filter were exposed to various controlled NH4(+) loadings in a continuous-flow lab-scale assay. NH4(+) removal capacity, estimated from short term loading up-shifts, was at least 10 times higher in the top than in the middle and bottom filter layers, consistent with the stratification of Ammonium Oxidizing Bacteria (AOB). AOB density increased consistently with the NH4(+) removal rate, indicating their primarily role in nitrification under the imposed experimental conditions. The maximum AOB cell specific NH4(+) removal rate observed at the bottom was at least 3 times lower compared to the top and middle layers. Additionally, a significant up-shift capacity (4.6 and 3.5 times) was displayed from the top and middle layers, but not from the bottom layer at increased loading conditions. Hence, AOB with different physiological responses were active at the different depths. The biokinetic analysis predicted that despite the low NH4(+) removal capacity at the bottom layer, the entire filter is able to cope with a 4-fold instantaneous loading increase without compromising the effluent NH4(+). Ultimately, this filter up-shift capacity was limited by the density of AOB and their biokinetic behavior, both of which were strongly stratified. Copyright © 2016 Elsevier Ltd. All rights reserved.

Step-wise addition of disulfide bridge in firefly luciferase controls color shift through a flexible loop: a thermodynamic perspective.

PubMed

Nazari, Mahboobeh; Hosseinkhani, Saman; Hassani, Leila

2013-02-01

Multi-color bioluminescence is developed using the introduction of single/double disulfide bridges in firefly luciferase. The bioluminescence reaction, which uses luciferin, Mg(2+)-ATP and molecular oxygen to yield an electronically excited oxyluciferin, is carried out by the luciferase and emits visible light. The bioluminescence color of firefly luciferases is determined by the luciferase sequence and assay conditions. It has been proposed that the stability of a protein may increase through the introduction of a disulfide bridge that decreases the configurational entropy of unfolding. Single and double disulfide bridges are introduced into Photinus pyralis firefly luciferase to make separate mutant enzymes with a single/double bridge (C(81)-A(105)C, L(306)C-L(309)C, P(451)C-V(469)C; C(81)-A(105)C/P(451)C-V(469)C, and A(296)C-A(326)C/P(451)C-V(469)C). By introduction of disulfide bridges using site-directed mutagenesis in Photinus pyralis luciferase the color of emitted light was changed to red or kept in different extents. The bioluminescence color shift occurred with displacement of a critical loop in the luciferase structure without any change in green emitter mutants. Thermodynamic analysis revealed that among mutants, L(306)C-L(309)C shows a remarkable stability against urea denaturation and also a considerable increase in kinetic stability and a clear shift in bioluminescence spectra towards red.

Microbiota and Metatranscriptome Changes Accompanying the Onset of Gingivitis

PubMed Central

2018-01-01

ABSTRACT Over half of adults experience gingivitis, a mild yet treatable form of periodontal disease caused by the overgrowth of oral microbes. Left untreated, gingivitis can progress to a more severe and irreversible disease, most commonly chronic periodontitis. While periodontal diseases are associated with a shift in the oral microbiota composition, it remains unclear how this shift impacts microbiota function early in disease progression. Here, we analyzed the transition from health to gingivitis through both 16S v4-v5 rRNA amplicon and metatranscriptome sequencing of subgingival plaque samples from individuals undergoing an experimental gingivitis treatment. Beta-diversity analysis of 16S rRNA reveals that samples cluster based on disease severity and patient but not by oral hygiene status. Significant shifts in the abundance of several genera occurred during disease transition, suggesting a dysbiosis due to development of gingivitis. Comparing taxonomic abundance with transcriptomic activity revealed concordance of bacterial diversity composition between the two quantification assays in samples originating from both healthy and diseased teeth. Metatranscriptome sequencing analysis indicates that during the early stages of transition to gingivitis, a number of virulence-related transcripts were significantly differentially expressed in individual and across pooled patient samples. Upregulated genes include those involved in proteolytic and nucleolytic processes, while expression levels of those involved in surface structure assembly and other general virulence functions leading to colonization or adaptation within the host are more dynamic. These findings help characterize the transition from health to periodontal disease and identify genes associated with early disease. PMID:29666288

Denitrification potential under different fertilization regimes is closely coupled with changes in the denitrifying community in a black soil.

PubMed

Yin, Chang; Fan, Fenliang; Song, Alin; Cui, Peiyuan; Li, Tingqiang; Liang, Yongchao

2015-07-01

Preferable inorganic fertilization over the last decades has led to fertility degradation of black soil in Northeast China. However, how fertilization regimes impact denitrification and its related bacterial community in this soil type is still unclear. Here, taking advantage of a suit of molecular ecological tools in combination of assaying the potential denitrification (DP), we explored the variation of activity, community structure, and abundance of nirS and nirK denitrifiers under four different fertilization regimes, namely no fertilization control (N0M0), organic pig manure (N0M1), inorganic fertilization (N1M0), and combination of inorganic fertilizer and pig manure (N1M1). The results indicated that organic fertilization increased DP, but inorganic fertilization had no impacts. The increase of DP was mirrored by the shift of nirS denitrifiers' community structure but not by that of nirK denitrifiers'. Furthermore, the change of DP coincided with the variation of abundances of both denitrifiers. Shifts of community structure and abundance of nirS and nirK denitrifiers were correlated with the change of soil pH, total nitrogen (TN), organic matter (OM), C:P, total phosphorus (TP), and available phosphorus (Olsen P). Our results suggest that the change of DP under these four fertilization regimes was closely related to the shift of denitrifying bacteria communities resulting from the variation of properties in the black soil tested.

α -Actinin TvACTN3 of Trichomonas vaginalis is an RNA-binding protein that could participate in its posttranscriptional iron regulatory mechanism.

PubMed

Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

2014-01-01

Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system.

Left-right axis asymmetry determining human Cryptic gene is transcriptionally repressed by Snail.

PubMed

Gupta, Kartik; Pilli, Vijaya Satish Sekhar; Aradhyam, Gopala Krishna

2016-10-28

Establishment of the left-right axis is important for positioning organs asymmetrically in the developing vertebrate-embryo. A number of factors like maternally deposited molecules have emerged essential in initiating the specification of the axis; the downstream events, however, are regulated by signal-transduction and gene-expression changes identifying which remains a crucial challenge. The EGF-CFC family member Cryptic, that functions as a co-receptor for some TGF-beta ligands, is developmentally expressed in higher mammals and mutations in the gene cause loss or change in left-right axis asymmetry. Despite the strong phenotype, no transcriptional-regulator of this gene is known till date. Using promoter-analyses tools, we found strong evidence that the developmentally essential transcription factor Snail binds to the human Cryptic-promoter. We cloned the promoter-region of human Cryptic in a reporter gene and observed decreased Cryptic-promoter activation upon increasing Snail expression. Further, the expression of Cryptic is down-regulated upon exogenous Snail expression, validating the reporter assays and the previously identified role of Snail as a transcriptional repressor. Finally, we demonstrate using gel-shift assay that Snail in nuclear extract of PANC1 cells interacts with the promoter-construct bearing putative Snail binding sites and confirm this finding using chromatin immunoprecipitation assay. Snail represses the expression of human Cryptic and therefore, might affect the signaling via Nodal that has previously been demonstrated to specify the left-right axis using the EGF-CFC co-receptors.

On the mechanism of Cr (VI)-induced carcinogenesis: dose dependence of uptake and cellular responses.

PubMed

Liu, K; Husler, J; Ye, J; Leonard, S S; Cutler, D; Chen, F; Wang, S; Zhang, Z; Ding, M; Wang, L; Shi, X

2001-06-01

Cr (VI) compounds are widely used industrial chemicals and are recognized human carcinogens. The mechanisms of carcinogenesis associated with these compounds remain to be investigated. The present study focused on dose-dependence of Cr (VI)-induced uptake and cellular responses. The results show that Cr (VI) is able to enter the cells (human lung epithelial cell line A549) at low concentration (< 10 microM) and that the Cr (VI) uptake appears to be a combination of saturable transport and passive diffusion. Electron spin resonance (ESR) trapping measurements showed that upon stimulation with Cr (VI), A549 cells were able to generate reactive oxygen species (ROS). The amount of ROS generated depended on the Cr (VI) concentration. ROS generation involved NADPH-dependent flavoenzymes. Cr (VI) affected the following cellular parameters in a dose-dependent manner, (a) activation of nuclear transcription factors NF-kappaB, and p53, (b) DNA damage, (c) induction of cell apoptosis, and (d) inhibition of cell proliferation. The activation of transcription factors was assessed by electrophoretic mobility shift assay and western blot analysis, DNA damage by single cell gel electrophoresis assay, cell apoptosis by DNA fragmentation assay, and cell proliferation by a non-radioactive ELISA kit. At the concentration range used in the present study, no thresholds were found in all of these cell responses to Cr (VI). The results may guide further research to better understand and evaluate the risk of Cr (VI)-induced carcinogenesis at low levels of exposure.

Phasin Proteins Activate Aeromonas caviae Polyhydroxyalkanoate (PHA) Synthase but Not Ralstonia eutropha PHA Synthase

PubMed Central

Ushimaru, Kazunori; Motoda, Yoko; Numata, Keiji

2014-01-01

In this study, we performed in vitro and in vivo activity assays of polyhydroxyalkanoate (PHA) synthases (PhaCs) in the presence of phasin proteins (PhaPs), which revealed that PhaPs are activators of PhaC derived from Aeromonas caviae (PhaCAc). In in vitro assays, among the three PhaCs tested, PhaCAc was significantly activated when PhaPs were added at the beginning of polymerization (prepolymerization PhaCAc), whereas the prepolymerization PhaCRe (derived from Ralstonia eutropha) and PhaCDa (Delftia acidovorans) showed reduced activity with PhaPs. The PhaP-activated PhaCAc showed a slight shift of substrate preference toward 3-hydroxyhexanoyl-CoA (C6). PhaPAc also activated PhaCAc when it was added during polymerization (polymer-elongating PhaCAc), while this effect was not observed for PhaCRe. In an in vivo assay using Escherichia coli TOP10 as the host strain, the effect of PhaPAc expression on PHA synthesis by PhaCAc or PhaCRe was examined. As PhaPAc expression increased, PHA production was increased by up to 2.3-fold in the PhaCAc-expressing strain, whereas it was slightly increased in the PhaCRe-expressing strain. Taken together, this study provides evidence that PhaPs function as activators for PhaCAc both in vitro and in vivo but do not activate PhaCRe. This activating effect may be attributed to the new role of PhaPs in the polymerization reaction by PhaCAc. PMID:24584238

Chemical characterization and in vitro toxicity of diesel exhaust particulate matter generated under varying conditions

PubMed Central

Cox, David P.; Drury, Bertram E.; Gould, Timothy R.; Kavanagh, Terrance J.; Paulsen, Michael H.; Sheppard, Lianne; Simpson, Christopher D.; Stewart, James A.; Larson, Timothy V.; Kaufman, Joel D.

2014-01-01

Epidemiologic studies have linked diesel exhaust (DE) to cardiovascular and respiratory morbidity and mortality, as well as lung cancer. DE composition is known to vary with many factors, although it is unclear how this influences toxicity. We generated eight DE atmospheres by applying a 2×2×2 factorial design and altering three parameters in a controlled exposure facility: (1) engine load (27 vs 82 %), (2) particle aging (residence time ~5 s vs ~5 min prior to particle collection), and (3) oxidation (with or without ozonation during dilution). Selected exposure concentrations of both diesel exhaust particles (DEPs) and DE gases, DEP oxidative reactivity via DTT activity, and in vitro DEP toxicity in murine endothelial cells were measured for each DE atmosphere. Cell toxicity was assessed via measurement of cell proliferation (colony formation assay), cell viability (MTT assay), and wound healing (scratch assay). Differences in DE composition were observed as a function of engine load. The mean 1-nitropyrene concentration was 15 times higher and oxidative reactivity was two times higher for low engine load versus high load. There were no substantial differences in measured toxicity among the three DE exposure parameters. These results indicate that alteration of applied engine load shifts the composition and can modify the biological reactivity of DE. While engine conditions did not affect the selected in vitro toxicity measures, the change in oxidative reactivity suggests that toxicological studies with DE need to take into account engine conditions in characterizing biological effects. PMID:26539254

Quantitative Detection of Small Molecule/DNA Complexes Employing a Force-Based and Label-Free DNA-Microarray

PubMed Central

Ho, Dominik; Dose, Christian; Albrecht, Christian H.; Severin, Philip; Falter, Katja; Dervan, Peter B.; Gaub, Hermann E.

2009-01-01

Force-based ligand detection is a promising method to characterize molecular complexes label-free at physiological conditions. Because conventional implementations of this technique, e.g., based on atomic force microscopy or optical traps, are low-throughput and require extremely sensitive and sophisticated equipment, this approach has to date found only limited application. We present a low-cost, chip-based assay, which combines high-throughput force-based detection of dsDNA·ligand interactions with the ease of fluorescence detection. Within the comparative unbinding force assay, many duplicates of a target DNA duplex are probed against a defined reference DNA duplex each. The fractions of broken target and reference DNA duplexes are determined via fluorescence. With this assay, we investigated the DNA binding behavior of artificial pyrrole-imidazole polyamides. These small compounds can be programmed to target specific dsDNA sequences and distinguish between D- and L-DNA. We found that titration with polyamides specific for a binding motif, which is present in the target DNA duplex and not in the reference DNA duplex, reliably resulted in a shift toward larger fractions of broken reference bonds. From the concentration dependence nanomolar to picomolar dissociation constants of dsDNA·ligand complexes were determined, agreeing well with prior quantitative DNAase footprinting experiments. This finding corroborates that the forced unbinding of dsDNA in presence of a ligand is a nonequilibrium process that produces a snapshot of the equilibrium distribution between dsDNA and dsDNA·ligand complexes. PMID:19486688

Changes in the level and activation state of the plasma membrane H(+)-ATPase during aging of red beet slices.

PubMed

Papini, R; De Michelis, M I

1997-07-01

The effect of aging on the plasma membrane (PM) H(+)-ATPase of red beet (Beta vulgaris L.) parenchyma discs was analyzed in PM purified by aqueous two-phase partitioning. Aging increased both the activity in the amount of immunodetectable H(+)-ATPase in the PM. The activity assayed at slightly alkaline pH values increased earlier and more strongly than that assayed at acidic pH values, so that the pH curve of the enzyme from aged beet discs was shifted toward more alkaline values. Aging decreased the stimulation of the PM H(+)-ATPase activity by controlled trypsin treatments or by lysophosphatidylcholine. After trypsin treatment the pH dependence of H(+)-ATPase from dormant or aged beet discs became equal. These results indicate that aging not only increases the level of H(+)-ATPase in the PM, but also determines its activation, most likely by modifying the interaction between the autoinhibitory carboxyl-terminal domain and the catalytic site. When the PM H(+)-ATPase activity was assayed at a slightly alkaline pH, the tyrosine modifier N-acetylimidazole inhibited the H(+)-ATPase in the PM from dormant beet discs much less than in the PM from aged discs, suggesting that modification of a tyrosine residue may be involved in the activation of the PM H(+)-ATPase induced by aging. The results are discussed with regard to aging-induced development of transmembrane transport activities.

A de novo mosaic mutation of PHEX in a boy with hypophosphatemic rickets.

PubMed

Weng, Chen; Chen, Jiao; Sun, Li; Zhou, Zhong-Wei; Feng, Xue; Sun, Jun-Hui; Lu, Ling-Ping; Yu, Ping; Qi, Ming

2016-03-01

X-linked dominant hypophosphatemic rickets (XLHR), is characterized mainly by renal phosphate wasting with hypophosphatemia, short stature and abnormal bone mineralization. PHEX, located at Xp22.1-p22.2, is the gene causing XLHR. We aim to characterize the pathogenesis of a Chinese boy who is apparently 'heterozygous' in PHEX gene. Direct sequencing showed two peaks: one was a wild-type 'G' and the other was one base substitution to 'A', though the patient was a male. TA clone assay clearly showed each sequences and the ratios. The mutation effect was predicted via bioinformatics and validated by exon-trapping assay. Real-time PCR was applied to determine the copy number of PHEX. TA clone assay showed the frequency of normal (G) to mutant allele (A) as 19:13. Normal karyotype and real-time PCR results indicate the normal copy number of PHEX. This splice site mutation leads to 4 bp of exon 18 skipping out causing frame shift p.Gly590Glufs*28 that ends up with a loss of active site and Zn(2+)-binding site of PHEX, which probably interfere with renal phosphate reabsorption and bone mineralization. In conclusion, mutation at conserved splice acceptor site resulted in aberrant splicing, ending up with a damaged protein product. This novel mutation is de novo in mosaic pattern that may be induced during early postzygotic period. Taking mosaic somatic mutation of PHEX into consideration is strongly suggested in genetic counseling and etiology research for XLHR.

Sensitive detection of oversulfated chondroitin sulfate in heparin sodium or crude heparin with a colorimetric microplate based assay.

PubMed

Sommers, Cynthia D; Mans, Daniel J; Mecker, Laura C; Keire, David A

2011-05-01

In this work we describe a 96-well microplate assay for oversulfated chondroitin sulfate A (OSCS) in heparin, based on a water-soluble cationic polythiophene polymer (3-(2-(N-(N'-methylimidazole))ethoxy)-4-methylthiophene (LPTP)) and heparinase digestion of heparin. The assay takes advantage of several unique properties of heparin, OSCS, and LPTP, including OSCS inhibition of heparinase I and II activity, the molecular weight dependence of heparin-LPTP spectral shifts, and the distinct association of heparin fragments and OSCS to LPTP. These factors combine to enable detection of the presence of 0.003% w/w spiked OSCS in 10 μg of heparin sodium active pharmaceutical ingredient (API) using a plate reader and with visual detection to 0.1% levels. The same detection limit for OSCS was observed in the presence of 10% levels of dermatan sulfate (DS) or chondroitin sulfate A (CSA) impurities. In addition, we surveyed a selection of crude heparin samples received by the agency in 2008 and 2009 to determine average and extreme DS, CSA, and galactosamine weight percent levels. In the presence of these impurities and the variable heparin content in the crude heparin samples, spiked OSCS was reliably detected to the 0.1% w/w level using a plate reader. Finally, authentically OSCS contaminated heparin sodium API and crude samples were distinguished visually by color from control samples using the LPTP/heparinase test.

α-Actinin TvACTN3 of Trichomonas vaginalis Is an RNA-Binding Protein That Could Participate in Its Posttranscriptional Iron Regulatory Mechanism

PubMed Central

Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

2014-01-01

Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system. PMID:24719864

Monitoring the dynamics of syntrophic β-oxidizing bacteria during anaerobic degradation of oleic acid by quantitative PCR.

PubMed

Ziels, Ryan M; Beck, David A C; Martí, Magalí; Gough, Heidi L; Stensel, H David; Svensson, Bo H

2015-04-01

The ecophysiology of long-chain fatty acid-degrading syntrophic β-oxidizing bacteria has been poorly understood due to a lack of quantitative abundance data. Here, TaqMan quantitative PCR (qPCR) assays targeting the 16S rRNA gene of the known mesophilic syntrophic β-oxidizing bacterial genera Syntrophomonas and Syntrophus were developed and validated. Microbial community dynamics were followed using qPCR and Illumina-based high-throughput amplicon sequencing in triplicate methanogenic bioreactors subjected to five consecutive batch feedings of oleic acid. With repeated oleic acid feeding, the initial specific methane production rate significantly increased along with the relative abundances of Syntrophomonas and methanogenic archaea in the bioreactor communities. The novel qPCR assays showed that Syntrophomonas increased from 7 to 31% of the bacterial community 16S rRNA gene concentration, whereas that of Syntrophus decreased from 0.02 to less than 0.005%. High-throughput amplicon sequencing also revealed that Syntrophomonas became the dominant genus within the bioreactor microbiomes. These results suggest that increased specific mineralization rates of oleic acid were attributed to quantitative shifts within the microbial communities toward higher abundances of syntrophic β-oxidizing bacteria and methanogenic archaea. The novel qPCR assays targeting syntrophic β-oxidizing bacteria may thus serve as monitoring tools to indicate the fatty acid β-oxidization potential of anaerobic digester communities. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Base-driven sunlight oxidation of silver nanoprisms for label-free visual colorimetric detection of hexahydro-1,3,5-trinitro-1,3,5-triazine explosive.

PubMed

He, Yi; Wang, Li

2017-05-05

Here we report a label-free method for visual colorimetric detection of hexahydro-1,3,5-trinitro-1,3,5-triazine (HTT) explosive based on base-driven sunlight oxidation of silver nanoprisms (AgNPRs). Under natural sunlight illumination, the surface plasmon of AgNPRs is excited, which populates O 2 antibonding orbitals to generate negative-ion state (O 2 - ). The resultant O 2 - with a strong oxidation activity can etch AgNPRs to smaller nanodisks with the aid of NaOH aqueous solution, leading to a blue shift of the absorption peak and color change from blue to pink. However, when HTT is introduced, the resultant O 2 - will be consumed by the nitrite and formaldehyde that are produced from the alkaline hydrolysis of HTT. Under this condition, the etching of AgNPRs does not occur, and the detection solution remains blue. This assay can sensitively detect as low as 1nM HTT, a level which is three orders of magnitude lower than that of gold nanoparticle-based colorimetric assays (2.6μM), and shows linearity in the range of 0.003-3.3μM. The lowest detectable concentration with the naked eye is 0.1μM. Additionally, the present assay exhibits good selectivity, and can be applied in the detection of HTT in natural water and soil samples with recoveries ranging from 90% to 100%. Copyright © 2017 Elsevier B.V. All rights reserved.

Coordinated regulation of IFITM1, 2 and 3 genes by an IFN-responsive enhancer through long-range chromatin interactions.

PubMed

Li, Ping; Shi, Ming-Lei; Shen, Wen-Long; Zhang, Zhang; Xie, De-Jian; Zhang, Xiang-Yuan; He, Chao; Zhang, Yan; Zhao, Zhi-Hu

2017-08-01

Interferon-induced transmembrane protein (IFITM) 1, 2 and 3 genes encode a family of interferon (IFN)-induced transmembrane proteins that block entry of a broad spectrum of pathogens. However, the transcriptional regulation of these genes, especially whether there exist any enhancers and their roles during the IFN induction process remain elusive. Here, through public data mining, episomal luciferase reporter assay and in vivo CRISPR-Cas9 genome editing, we identified an IFN-responsive enhancer located 35kb upstream of IFITM3 gene promoter upregulating the IFN-induced expression of IFITM1, 2 and 3 genes. Chromatin immunoprecipitation (ChIP), electrophoretic mobility shift assay (EMSA) and luciferase reporter assay demonstrated that signal transducers and activators of transcription (STAT) 1 bound to the enhancer with the treatment of IFN and was indispensable for the enhancer activity. Furthermore, using chromosome conformation capture technique, we revealed that the IFITM1, 2 and 3 genes physically clustered together and constitutively looped to the distal enhancer through long-range interactions in both HEK293 and A549 cells, providing structural basis for coordinated regulation of IFITM1, 2 and 3 by the enhancer. Finally, we showed that in vivo truncation of the enhancer impaired IFN-induced resistance to influenza A virus (IAV) infection. These findings expand our understanding of the mechanisms underlying the transcriptional regulation of IFITM1, 2 and 3 expression and its ability to mediate IFN signaling. Copyright © 2017 Elsevier B.V. All rights reserved.

EBV induces persistent NF-κB activation and contributes to survival of EBV-positive neoplastic T- or NK-cells.

PubMed

Takada, Honami; Imadome, Ken-Ichi; Shibayama, Haruna; Yoshimori, Mayumi; Wang, Ludan; Saitoh, Yasunori; Uota, Shin; Yamaoka, Shoji; Koyama, Takatoshi; Shimizu, Norio; Yamamoto, Kouhei; Fujiwara, Shigeyoshi; Miura, Osamu; Arai, Ayako

2017-01-01

Epstein-Barr virus (EBV) has been detected in several T- and NK-cell neoplasms such as extranodal NK/T-cell lymphoma nasal type, aggressive NK-cell leukemia, EBV-positive peripheral T-cell lymphoma, systemic EBV-positive T-cell lymphoma of childhood, and chronic active EBV infection (CAEBV). However, how this virus contributes to lymphomagenesis in T or NK cells remains largely unknown. Here, we examined NF-κB activation in EBV-positive T or NK cell lines, SNT8, SNT15, SNT16, SNK6, and primary EBV-positive and clonally proliferating T/NK cells obtained from the peripheral blood of patients with CAEBV. Western blotting, electrophoretic mobility shift assays, and immunofluorescent staining revealed persistent NF-κB activation in EBV-infected cell lines and primary cells from patients. Furthermore, we investigated the role of EBV in infected T cells. We performed an in vitro infection assay using MOLT4 cells infected with EBV. The infection directly induced NF-κB activation, promoted survival, and inhibited etoposide-induced apoptosis in MOLT4 cells. The luciferase assay suggested that LMP1 mediated NF-κB activation in MOLT4 cells. IMD-0354, a specific inhibitor of NF-κB that suppresses NF-κB activation in cell lines, inhibited cell survival and induced apoptosis. These results indicate that EBV induces NF-κB-mediated survival signals in T and NK cells, and therefore, may contribute to the lymphomagenesis of these cells.

EBV induces persistent NF-κB activation and contributes to survival of EBV-positive neoplastic T- or NK-cells

PubMed Central

Shibayama, Haruna; Yoshimori, Mayumi; Wang, Ludan; Saitoh, Yasunori; Uota, Shin; Yamaoka, Shoji; Koyama, Takatoshi; Shimizu, Norio; Yamamoto, Kouhei; Fujiwara, Shigeyoshi; Miura, Osamu

2017-01-01

Epstein–Barr virus (EBV) has been detected in several T- and NK-cell neoplasms such as extranodal NK/T-cell lymphoma nasal type, aggressive NK-cell leukemia, EBV-positive peripheral T-cell lymphoma, systemic EBV-positive T-cell lymphoma of childhood, and chronic active EBV infection (CAEBV). However, how this virus contributes to lymphomagenesis in T or NK cells remains largely unknown. Here, we examined NF-κB activation in EBV-positive T or NK cell lines, SNT8, SNT15, SNT16, SNK6, and primary EBV-positive and clonally proliferating T/NK cells obtained from the peripheral blood of patients with CAEBV. Western blotting, electrophoretic mobility shift assays, and immunofluorescent staining revealed persistent NF-κB activation in EBV-infected cell lines and primary cells from patients. Furthermore, we investigated the role of EBV in infected T cells. We performed an in vitro infection assay using MOLT4 cells infected with EBV. The infection directly induced NF-κB activation, promoted survival, and inhibited etoposide-induced apoptosis in MOLT4 cells. The luciferase assay suggested that LMP1 mediated NF-κB activation in MOLT4 cells. IMD-0354, a specific inhibitor of NF-κB that suppresses NF-κB activation in cell lines, inhibited cell survival and induced apoptosis. These results indicate that EBV induces NF-κB-mediated survival signals in T and NK cells, and therefore, may contribute to the lymphomagenesis of these cells. PMID:28346502

FXR induces SOCS3 and suppresses hepatocellular carcinoma

PubMed Central

Zhang, Yan; Jiang, Peng; Huang, Gang; Chen, Shan; Lyu, Xilin; Zheng, Ping; Zhao, Xin; Zeng, Yijun; Wang, Shuguang; He, Fengtian

2015-01-01

Suppressor of cytokine signaling 3 (SOCS3) is regarded as a vital repressor in the liver carcinogenesis mainly by inhibiting signal transducer and activator of transcription 3 (STAT3) activity. Farnesoid X Receptor (FXR), highly expressed in liver, has an important role in protecting against hepatocellular carcinoma (HCC). However, it is unclear whether the tumor suppressive activity of FXR involves the regulation of SOCS3. In the present study, we found that activation of FXR by its specific agonist GW4064 in HCC cells inhibited cell growth, induced cell cycle arrest at G1 phase, elevated p21 expression and repressed STAT3 activity. The above anti-tumor effects of FXR were dramatically alleviated by knockdown of SOCS3 with siRNA. Reporter assay revealed that FXR activation enhanced the transcriptional activity of SOCS3 promoter. Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assay displayed that FXR directly bound to IR9 DNA motif within SOCS3 promoter region. The in vivo study in nude mice showed that treatment with FXR ligand GW4064 could decelerate the growth of HCC xenografts, up-regulate SOCS3 and p21 expression and inhibit STAT3 phosphorylation in the xenografts. These results suggest that induction of SOCS3 may be a novel mechanism by which FXR exerts its anti-HCC effects, and the FXR-SOCS3 signaling may serve as a new potential target for the prevention/treatment of HCC. PMID:26416445

Inflammatory bowel diseases phenotype, C. difficile and NOD2 genotype are associated with shifts in human ileum associated microbial composition.

PubMed

Li, Ellen; Hamm, Christina M; Gulati, Ajay S; Sartor, R Balfour; Chen, Hongyan; Wu, Xiao; Zhang, Tianyi; Rohlf, F James; Zhu, Wei; Gu, Chi; Robertson, Charles E; Pace, Norman R; Boedeker, Edgar C; Harpaz, Noam; Yuan, Jeffrey; Weinstock, George M; Sodergren, Erica; Frank, Daniel N

2012-01-01

We tested the hypothesis that Crohn's disease (CD)-related genetic polymorphisms involved in host innate immunity are associated with shifts in human ileum-associated microbial composition in a cross-sectional analysis of human ileal samples. Sanger sequencing of the bacterial 16S ribosomal RNA (rRNA) gene and 454 sequencing of 16S rRNA gene hypervariable regions (V1-V3 and V3-V5), were conducted on macroscopically disease-unaffected ileal biopsies collected from 52 ileal CD, 58 ulcerative colitis and 60 control patients without inflammatory bowel diseases (IBD) undergoing initial surgical resection. These subjects also were genotyped for the three major NOD2 risk alleles (Leu1007fs, R708W, G908R) and the ATG16L1 risk allele (T300A). The samples were linked to clinical metadata, including body mass index, smoking status and Clostridia difficile infection. The sequences were classified into seven phyla/subphyla categories using the Naïve Bayesian Classifier of the Ribosome Database Project. Centered log ratio transformation of six predominant categories was included as the dependent variable in the permutation based MANCOVA for the overall composition with stepwise variable selection. Polymerase chain reaction (PCR) assays were conducted to measure the relative frequencies of the Clostridium coccoides - Eubacterium rectales group and the Faecalibacterium prausnitzii spp. Empiric logit transformations of the relative frequencies of these two microbial groups were included in permutation-based ANCOVA. Regardless of sequencing method, IBD phenotype, Clostridia difficile and NOD2 genotype were selected as associated (FDR ≤ 0.05) with shifts in overall microbial composition. IBD phenotype and NOD2 genotype were also selected as associated with shifts in the relative frequency of the C. coccoides--E. rectales group. IBD phenotype, smoking and IBD medications were selected as associated with shifts in the relative frequency of F. prausnitzii spp. These results indicate that the effects of genetic and environmental factors on IBD are mediated at least in part by the enteric microbiota.

Inflammatory Bowel Diseases Phenotype, C. difficile and NOD2 Genotype Are Associated with Shifts in Human Ileum Associated Microbial Composition

PubMed Central

Li, Ellen; Hamm, Christina M.; Gulati, Ajay S.; Sartor, R. Balfour; Chen, Hongyan; Wu, Xiao; Zhang, Tianyi; Rohlf, F. James; Zhu, Wei; Gu, Chi; Robertson, Charles E.; Pace, Norman R.; Boedeker, Edgar C.; Harpaz, Noam; Yuan, Jeffrey; Weinstock, George M.; Sodergren, Erica; Frank, Daniel N.

2012-01-01

We tested the hypothesis that Crohn’s disease (CD)-related genetic polymorphisms involved in host innate immunity are associated with shifts in human ileum–associated microbial composition in a cross-sectional analysis of human ileal samples. Sanger sequencing of the bacterial 16S ribosomal RNA (rRNA) gene and 454 sequencing of 16S rRNA gene hypervariable regions (V1–V3 and V3–V5), were conducted on macroscopically disease-unaffected ileal biopsies collected from 52 ileal CD, 58 ulcerative colitis and 60 control patients without inflammatory bowel diseases (IBD) undergoing initial surgical resection. These subjects also were genotyped for the three major NOD2 risk alleles (Leu1007fs, R708W, G908R) and the ATG16L1 risk allele (T300A). The samples were linked to clinical metadata, including body mass index, smoking status and Clostridia difficile infection. The sequences were classified into seven phyla/subphyla categories using the Naïve Bayesian Classifier of the Ribosome Database Project. Centered log ratio transformation of six predominant categories was included as the dependent variable in the permutation based MANCOVA for the overall composition with stepwise variable selection. Polymerase chain reaction (PCR) assays were conducted to measure the relative frequencies of the Clostridium coccoides – Eubacterium rectales group and the Faecalibacterium prausnitzii spp. Empiric logit transformations of the relative frequencies of these two microbial groups were included in permutation-based ANCOVA. Regardless of sequencing method, IBD phenotype, Clostridia difficile and NOD2 genotype were selected as associated (FDR ≤0.05) with shifts in overall microbial composition. IBD phenotype and NOD2 genotype were also selected as associated with shifts in the relative frequency of the C. coccoides – E. rectales group. IBD phenotype, smoking and IBD medications were selected as associated with shifts in the relative frequency of F. prausnitzii spp. These results indicate that the effects of genetic and environmental factors on IBD are mediated at least in part by the enteric microbiota. PMID:22719818

Photonic ring resonance is a versatile platform for performing multiplex immunoassays in real time.

PubMed

Mudumba, Sasi; de Alba, Sophia; Romero, Randy; Cherwien, Carli; Wu, Alice; Wang, Jue; Gleeson, Martin A; Iqbal, Muzammil; Burlingame, Rufus W

2017-09-01

Photonic ring resonance is a property of light where in certain circumstances specific wavelengths are trapped in a ring resonator. Sensors based on silicon photonic ring resonators function by detecting the interaction between light circulating inside the sensor and matter deposited on the sensor surface. Binding of biological material results in a localized change in refractive index on the sensor surface, which affects the circulating optical field extending beyond the sensor boundary. That is, the resonant wavelength will change when the refractive index of the medium around the ring resonator changes. Ring resonators can be fabricated onto small silicon chips, allowing development of a miniature multiplex array of ring based biosensors. This paper describes the properties of such a system when responding to the refractive index changed in a simple and precise way by changing the ionic strength of the surrounding media, and in a more useful way by the binding of macromolecules to the surface above the resonators. Specifically, a capture immunoassay is described that measures the change of resonant wavelength as a patient serum sample with anti-SS-A autoantibodies is flowed over a chip spotted with SS-A antigen and amplified with anti-IgG. The technology has been miniaturized and etched into a 4×6mm silicon chip that can measure 32 different reactions in quadruplicate simultaneously. The variability between 128 rings on a chip as measured by 2M salt assays averaged 0.6% CV. The output of the assays is the average shift per cluster of 4 rings, and the assays averaged 0.5% CV between clusters. The variability between chips averaged 1.8%. Running the same array on multiple instruments showed that after some improvements to the wavelength referencing system, the upper boundary of variation was 3% between 13 different instruments. The immunoassay displayed about 2% higher variability than the salt assays. There are several outstanding features of this system. The amount of antigen used on the chip for each test is around 200 picograms, only a few microliters of sample is necessary, and the assays take <10min. Copyright © 2017 Genalyte Inc. Published by Elsevier B.V. All rights reserved.

Enzyme functional evolution through improved catalysis of ancestrally nonpreferred substrates

PubMed Central

Huang, Ruiqi; Hippauf, Frank; Rohrbeck, Diana; Haustein, Maria; Wenke, Katrin; Feike, Janie; Sorrelle, Noah; Piechulla, Birgit; Barkman, Todd J.

2012-01-01

In this study, we investigated the role for ancestral functional variation that may be selected upon to generate protein functional shifts using ancestral protein resurrection, statistical tests for positive selection, forward and reverse evolutionary genetics, and enzyme functional assays. Data are presented for three instances of protein functional change in the salicylic acid/benzoic acid/theobromine (SABATH) lineage of plant secondary metabolite-producing enzymes. In each case, we demonstrate that ancestral nonpreferred activities were improved upon in a daughter enzyme after gene duplication, and that these functional shifts were likely coincident with positive selection. Both forward and reverse mutagenesis studies validate the impact of one or a few sites toward increasing activity with ancestrally nonpreferred substrates. In one case, we document the occurrence of an evolutionary reversal of an active site residue that reversed enzyme properties. Furthermore, these studies show that functionally important amino acid replacements result in substrate discrimination as reflected in evolutionary changes in the specificity constant (kcat/KM) for competing substrates, even though adaptive substitutions may affect KM and kcat separately. In total, these results indicate that nonpreferred, or even latent, ancestral protein activities may be coopted at later times to become the primary or preferred protein activities. PMID:22315396

Enzyme functional evolution through improved catalysis of ancestrally nonpreferred substrates.

PubMed

Huang, Ruiqi; Hippauf, Frank; Rohrbeck, Diana; Haustein, Maria; Wenke, Katrin; Feike, Janie; Sorrelle, Noah; Piechulla, Birgit; Barkman, Todd J

2012-02-21

In this study, we investigated the role for ancestral functional variation that may be selected upon to generate protein functional shifts using ancestral protein resurrection, statistical tests for positive selection, forward and reverse evolutionary genetics, and enzyme functional assays. Data are presented for three instances of protein functional change in the salicylic acid/benzoic acid/theobromine (SABATH) lineage of plant secondary metabolite-producing enzymes. In each case, we demonstrate that ancestral nonpreferred activities were improved upon in a daughter enzyme after gene duplication, and that these functional shifts were likely coincident with positive selection. Both forward and reverse mutagenesis studies validate the impact of one or a few sites toward increasing activity with ancestrally nonpreferred substrates. In one case, we document the occurrence of an evolutionary reversal of an active site residue that reversed enzyme properties. Furthermore, these studies show that functionally important amino acid replacements result in substrate discrimination as reflected in evolutionary changes in the specificity constant (k(cat)/K(M)) for competing substrates, even though adaptive substitutions may affect K(M) and k(cat) separately. In total, these results indicate that nonpreferred, or even latent, ancestral protein activities may be coopted at later times to become the primary or preferred protein activities.

Modification of Kolmogorov-Smirnov test for DNA content data analysis through distribution alignment.

PubMed

Huang, Shuguang; Yeo, Adeline A; Li, Shuyu Dan

2007-10-01

The Kolmogorov-Smirnov (K-S) test is a statistical method often used for comparing two distributions. In high-throughput screening (HTS) studies, such distributions usually arise from the phenotype of independent cell populations. However, the K-S test has been criticized for being overly sensitive in applications, and it often detects a statistically significant difference that is not biologically meaningful. One major reason is that there is a common phenomenon in HTS studies that systematic drifting exists among the distributions due to reasons such as instrument variation, plate edge effect, accidental difference in sample handling, etc. In particular, in high-content cellular imaging experiments, the location shift could be dramatic since some compounds themselves are fluorescent. This oversensitivity of the K-S test is particularly overpowered in cellular assays where the sample sizes are very big (usually several thousands). In this paper, a modified K-S test is proposed to deal with the nonspecific location-shift problem in HTS studies. Specifically, we propose that the distributions are "normalized" by density curve alignment before the K-S test is conducted. In applications to simulation data and real experimental data, the results show that the proposed method has improved specificity.

Functional overload increases beta-MHC promoter activity in rodent fast muscle via the proximal MCAT (betae3) site.

PubMed

Giger, Julia M; Haddad, Fadia; Qin, Anqi X; Baldwin, Kenneth M

2002-03-01

Functional overload (OL) of the rat plantaris muscle by the removal of synergistic muscles induces a shift in the myosin heavy chain (MHC) isoform expression profile from the fast isoforms toward the slow type I, or, beta-MHC isoform. Different length rat beta-MHC promoters were linked to a firefly luciferase reporter gene and injected in control and OL plantaris muscles. Reporter activities of -3,500, -914, -408, and -215 bp promoters increased in response to 1 wk of OL. The smallest -171 bp promoter was not responsive to OL. Mutation analyses of putative regulatory elements within the -171 and -408 bp region were performed. The -408 bp promoters containing mutations of the betae1, distal muscle CAT (MCAT; betae2), CACC, or A/T-rich (GATA), were still responsive to OL. Only the proximal MCAT (betae3) mutation abolished the OL response. Gel mobility shift assays revealed a significantly higher level of complex formation of the betae3 probe with nuclear protein from OL plantaris compared with control plantaris. These results suggest that the betae3 site functions as a putative OL-responsive element in the rat beta-MHC gene promoter.

Archimedes' principle for characterisation of recombinant whole cell biocatalysts.

PubMed

Schmitt, Steven; Walser, Marcel; Rehmann, Michael; Oesterle, Sabine; Panke, Sven; Held, Martin

2018-02-14

The ability of whole cells to catalyse multistep reactions, often yielding synthetically demanding compounds later used by industrial biotech or pharma, makes them an indispensable tool of synthetic chemistry. The complex reaction network employed by cellular catalysts and the still only moderate predictive power of modelling approaches leaves this tool challenging to engineer. Frequently, large libraries of semi-rationally generated variants are sampled in high-throughput mode in order to then identify improved catalysts. We present a method for space- and time-efficient processing of very large libraries (10 7 ) of recombinant cellular catalysts, in which the phenotypic characterisation and the isolation of positive variants for the entire library is done within one minute in a single, highly parallelized operation. Specifically, product formation in nanolitre-sized cultivation vessels is sensed and translated into the formation of catalase as a reporter protein. Exposure to hydrogen peroxide leads to oxygen gas formation and thus to a density shift of the cultivation vessel. Exploiting Archimedes' principle, this density shift and the resulting upward buoyancy force can be used for batch-wise library sampling. We demonstrate the potential of the method for both, screening and selection protocols, and envision a wide applicability of the system for biosensor-based assays.

Pigment epithelium-derived factor stimulates skeletal muscle glycolytic activity through NADPH oxidase-dependent reactive oxygen species production.

PubMed

Carnagarin, Revathy; Carlessi, Rodrigo; Newsholme, Philip; Dharmarajan, Arun M; Dass, Crispin R

2016-09-01

Pigment epithelium-derived factor is a multifunctional serpin implicated in insulin resistance in metabolic disorders. Recent evidence suggests that exposure of peripheral tissues such as skeletal muscle to PEDF has profound metabolic consequences with predisposition towards chronic conditions such as obesity, type 2 diabetes, metabolic syndrome and polycystic ovarian syndrome. Chronic inflammation shifts muscle metabolism towards increased glycolysis and decreased oxidative metabolism. In the present study, we demonstrate a novel effect of PEDF on cellular metabolism in mouse cell line (C2C12) and human primary skeletal muscle cells. PEDF addition to skeletal muscle cells induced enhanced phospholipase A2 activity. This was accompanied with increased production of reactive oxygen species in a nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-dependent manner that triggered a shift towards a more glycolytic phenotype. Extracellular flux analysis and glucose consumption assays demonstrated that PEDF treatment resulted in enhanced glycolysis but did not change mitochondrial respiration. Our results demonstrate that skeletal muscle cells express a PEDF-inducible oxidant generating system that enhances glycolysis but is sensitive to antioxidants and NADPH oxidase inhibition. Copyright © 2016 Elsevier Ltd. All rights reserved.

Inter- and intramolecular epitope spreading in equine recurrent uveitis.

PubMed

Deeg, Cornelia A; Amann, Barbara; Raith, Albert J; Kaspers, Bernd

2006-02-01

To test the hypothesis that inter- and intramolecular spreading to S-antigen (S-Ag) and interphotoreceptor retinoid binding protein (IRBP)-derived epitopes occurs in a spontaneous model of recurrent uveitis in the horse. The immune response of eight horses with equine recurrent uveitis (ERU) was compared with that of five control horses with healthy eyes. Lymphocytes derived from peripheral blood (PBLs) were tested every 8 weeks for their reactivity against S-Ag and various S-Ag and IRBP-derived peptides for 12 to 39 months (median, 22 months). During uveitic episodes, additional blood samples were analyzed. Intermolecular epitope spreading was detectable in all ERU cases during the study. Intramolecular spreading occurred in seven (of eight) horses with ERU. Fourteen relapses were analyzed during the observation period. Ten uveitic episodes were accompanied by neoreactivity to S-Ag or IRBP-derived peptides during the relapse. Shifts in the immune response profile were also detectable without any clinical signs of inflammation. Eye-healthy control horses were negative at all time points in the in vitro proliferation assays. Inter- and intramolecular spreading was detectable in a spontaneous model of recurrent uveitis. The shifts in immunoreactivity could account for the remitting-relapsing character of the disease.

Statistical tests and identifiability conditions for pooling and analyzing multisite datasets.

PubMed

Zhou, Hao Henry; Singh, Vikas; Johnson, Sterling C; Wahba, Grace

2018-02-13

When sample sizes are small, the ability to identify weak (but scientifically interesting) associations between a set of predictors and a response may be enhanced by pooling existing datasets. However, variations in acquisition methods and the distribution of participants or observations between datasets, especially due to the distributional shifts in some predictors, may obfuscate real effects when datasets are combined. We present a rigorous statistical treatment of this problem and identify conditions where we can correct the distributional shift. We also provide an algorithm for the situation where the correction is identifiable. We analyze various properties of the framework for testing model fit, constructing confidence intervals, and evaluating consistency characteristics. Our technical development is motivated by Alzheimer's disease (AD) studies, and we present empirical results showing that our framework enables harmonizing of protein biomarkers, even when the assays across sites differ. Our contribution may, in part, mitigate a bottleneck that researchers face in clinical research when pooling smaller sized datasets and may offer benefits when the subjects of interest are difficult to recruit or when resources prohibit large single-site studies. Copyright © 2018 the Author(s). Published by PNAS.

A millennial-scale chronicle of evolutionary responses to cultural eutrophication in Daphnia.

PubMed

Frisch, Dagmar; Morton, Philip K; Chowdhury, Priyanka Roy; Culver, Billy W; Colbourne, John K; Weider, Lawrence J; Jeyasingh, Punidan D

2014-03-01

For an accurate assessment of the anthropogenic impacts on evolutionary change in natural populations, we need long-term environmental, genetic and phenotypic data that predate human disturbances. Analysis of c. 1600 years of history chronicled in the sediments of South Center Lake, Minnesota, USA, revealed major environmental changes beginning c. 120 years ago coinciding with the initiation of industrialised agriculture in the catchment area. Population genetic structure, analysed using DNA from dormant eggs of the keystone aquatic herbivore, Daphnia pulicaria, suggested no change for c. 1500 years prior to striking shifts associated with anthropogenic environmental alterations. Furthermore, phenotypic assays on the oldest resurrected metazoan genotypes (potentially as old as c. 700 years) indicate significant shifts in phosphorus utilisation rates compared to younger genotypes. Younger genotypes show steeper reaction norms with high growth under high phosphorus (P), and low growth under low P, while 'ancient' genotypes show flat reaction norms, yet higher growth efficiency under low P. Using this resurrection ecology approach, environmental, genetic and phenotypic data spanning pre- and post-industrialised agricultural eras clearly reveal the evolutionary consequences of anthropogenic environmental change. © 2014 John Wiley & Sons Ltd/CNRS.

BrWRKY65, a WRKY Transcription Factor, Is Involved in Regulating Three Leaf Senescence-Associated Genes in Chinese Flowering Cabbage.

PubMed

Fan, Zhong-Qi; Tan, Xiao-Li; Shan, Wei; Kuang, Jian-Fei; Lu, Wang-Jin; Chen, Jian-Ye

2017-06-08

Plant-specific WRKY transcription factors (TFs) have been implicated to function as regulators of leaf senescence, but their association with postharvest leaf senescence of economically important leafy vegetables, is poorly understood. In this work, the characterization of a Group IIe WRKY TF, BrWRKY65, from Chinese flowering cabbage ( Brassica rapa var. parachinensis) is reported. The expression of BrWRKY65 was up-regulated following leaf chlorophyll degradation and yellowing during postharvest senescence. Subcellular localization and transcriptional activation assays showed that BrWRKY65 was localized in the nucleus and exhibited trans-activation ability. Further electrophoretic mobility shift assay (EMSA) and transient expression analysis clearly revealed that BrWRKY65 directly bound to the W-box motifs in the promoters of three senescence-associated genes ( SAGs ) such as BrNYC1 and BrSGR1 associated with chlorophyll degradation, and BrDIN1 , and subsequently activated their expressions. These findings demonstrate that BrWRKY65 may be positively associated with postharvest leaf senescence, at least partially, by the direct activation of SAGs . Taken together, these findings provide new insights into the transcriptional regulatory mechanism of postharvest leaf senescence in Chinese flowering cabbage.

Cloning and functional analysis of 5'-upstream region of the Pokemon gene.

PubMed

Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang

2008-04-01

Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.

Toxicity evaluation of ZnO nanostructures on L929 fibroblast cell line using MTS assay

NASA Astrophysics Data System (ADS)

Bakhori, Siti Khadijah Mohd; Mahmud, Shahrom; Ann, Ling Chuo; Mohamed, Azman Seeni; Saifuddin, Siti Nazmin; Masudi, Sam'an Malik; Mohamad, Dasmawati

2015-04-01

ZnO has wide applications in medical and dentistry apart from being used as optoelectronic devices such as solar cells, photodetectors, sensors and light emitting diodes (LEDs). Therefore, the toxicity evaluation is important to know the toxicity level on normal cell line. The toxicity of two grades ZnO nanostructures, ZnO-4 and ZnO-8 have been carried out using cytotoxicity test of MTS assay on L929 rat fibroblast cell line. Prior to that, ZnO-4 and ZnO-8 were characterized for its morphology, structure and optical properties using FESEM, X-ray diffraction, and Photoluminescence respectively. The two groups revealed difference in morphology and exhibit slightly shifted of near band edge emission of Photoluminescence other than having a similar calculated crystallite size of nanostructures. The viability of cells after 72h were obtained and the statistical significance value was calculated using SPSS v20. The p value is more than 0.05 between untreated and treated cell with ZnO. This insignificant value of p>0.05 can be summarized as a non-toxic level of ZnO-4 and ZnO-8 on the L929 cell line.

Specific labeling of zinc finger proteins using noncanonical amino acids and copper-free click chemistry.

PubMed

Kim, Younghoon; Kim, Sung Hoon; Ferracane, Dean; Katzenellenbogen, John A; Schroeder, Charles M

2012-09-19

Zinc finger proteins (ZFPs) play a key role in transcriptional regulation and serve as invaluable tools for gene modification and genetic engineering. Development of efficient strategies for labeling metalloproteins such as ZFPs is essential for understanding and controlling biological processes. In this work, we engineered ZFPs containing cysteine-histidine (Cys2-His2) motifs by metabolic incorporation of the unnatural amino acid azidohomoalanine (AHA), followed by specific protein labeling via click chemistry. We show that cyclooctyne promoted [3 + 2] dipolar cycloaddition with azides, known as copper-free click chemistry, provides rapid and specific labeling of ZFPs at high yields as determined by mass spectrometry analysis. We observe that the DNA-binding activity of ZFPs labeled by conventional copper-mediated click chemistry was completely abolished, whereas ZFPs labeled by copper-free click chemistry retain their sequence-specific DNA-binding activity under native conditions, as determined by electrophoretic mobility shift assays, protein microarrays, and kinetic binding assays based on Förster resonance energy transfer (FRET). Our work provides a general framework to label metalloproteins such as ZFPs by metabolic incorporation of unnatural amino acids followed by copper-free click chemistry.

Flavonoid Regulation of HCN2 Channels*

PubMed Central

Carlson, Anne E.; Rosenbaum, Joel C.; Brelidze, Tinatin I.; Klevit, Rachel E.; Zagotta, William N.

2013-01-01

The hyperpolarization-activated cyclic nucleotide-modulated (HCN) channels are pacemaker channels whose currents contribute to rhythmic activity in the heart and brain. HCN channels open in response to hyperpolarizing voltages, and the binding of cAMP to their cyclic nucleotide-binding domain (CNBD) facilitates channel opening. Here, we report that, like cAMP, the flavonoid fisetin potentiates HCN2 channel gating. Fisetin sped HCN2 activation and shifted the conductance-voltage relationship to more depolarizing potentials with a half-maximal effective concentration (EC50) of 1.8 μm. When applied together, fisetin and cAMP regulated HCN2 gating in a nonadditive fashion. Fisetin did not potentiate HCN2 channels lacking their CNBD, and two independent fluorescence-based binding assays reported that fisetin bound to the purified CNBD. These data suggest that the CNBD mediates the fisetin potentiation of HCN2 channels. Moreover, binding assays suggest that fisetin and cAMP partially compete for binding to the CNBD. NMR experiments demonstrated that fisetin binds within the cAMP-binding pocket, interacting with some of the same residues as cAMP. Together, these data indicate that fisetin is a partial agonist for HCN2 channels. PMID:24085296

Specific Labeling of Zinc Finger Proteins using Non-canonical Amino Acids and Copper-free Click Chemistry

PubMed Central

Kim, Younghoon; Kim, Sung Hoon; Ferracane, Dean; Katzenellenbogen, John A.

2012-01-01

Zinc finger proteins (ZFPs) play a key role in transcriptional regulation and serve as invaluable tools for gene modification and genetic engineering. Development of efficient strategies for labeling metalloproteins such as ZFPs is essential for understanding and controlling biological processes. In this work, we engineered ZFPs containing cysteine-histidine (Cys2-His2) motifs by metabolic incorporation of the unnatural amino acid azidohomoalanine (AHA), followed by specific protein labeling via click chemistry. We show that cyclooctyne promoted [3 + 2] dipolar cycloaddition with azides, known as copper-free click chemistry, provides rapid and specific labeling of ZFPs at high yields as determined by mass spectrometry analysis. We observe that the DNA-binding activity of ZFPs labeled by conventional copper-mediated click chemistry was completely abolished, whereas ZFPs labeled by copper-free click chemistry retain their sequence-specific DNA-binding activity under native conditions, as determined by electrophoretic mobility shift assays, protein microarrays and kinetic binding assays based on Förster resonance energy transfer (FRET). Our work provides a general framework to label metalloproteins such as ZFPs by metabolic incorporation of unnatural amino acids followed by copper-free click chemistry. PMID:22871171

Determination of equilibrium dissociation constants for recombinant antibodies by high-throughput affinity electrophoresis.

PubMed

Pan, Yuchen; Sackmann, Eric K; Wypisniak, Karolina; Hornsby, Michael; Datwani, Sammy S; Herr, Amy E

2016-12-23

High-quality immunoreagents enhance the performance and reproducibility of immunoassays and, in turn, the quality of both biological and clinical measurements. High quality recombinant immunoreagents are generated using antibody-phage display. One metric of antibody quality - the binding affinity - is quantified through the dissociation constant (K D ) of each recombinant antibody and the target antigen. To characterize the K D of recombinant antibodies and target antigen, we introduce affinity electrophoretic mobility shift assays (EMSAs) in a high-throughput format suitable for small volume samples. A microfluidic card comprised of free-standing polyacrylamide gel (fsPAG) separation lanes supports 384 concurrent EMSAs in 30 s using a single power source. Sample is dispensed onto the microfluidic EMSA card by acoustic droplet ejection (ADE), which reduces EMSA variability compared to sample dispensing using manual or pin tools. The K D for each of a six-member fragment antigen-binding fragment library is reported using ~25-fold less sample mass and ~5-fold less time than conventional heterogeneous assays. Given the form factor and performance of this micro- and mesofluidic workflow, we have developed a sample-sparing, high-throughput, solution-phase alternative for biomolecular affinity characterization.

Determination of equilibrium dissociation constants for recombinant antibodies by high-throughput affinity electrophoresis

PubMed Central

Pan, Yuchen; Sackmann, Eric K.; Wypisniak, Karolina; Hornsby, Michael; Datwani, Sammy S.; Herr, Amy E.

2016-01-01

High-quality immunoreagents enhance the performance and reproducibility of immunoassays and, in turn, the quality of both biological and clinical measurements. High quality recombinant immunoreagents are generated using antibody-phage display. One metric of antibody quality – the binding affinity – is quantified through the dissociation constant (KD) of each recombinant antibody and the target antigen. To characterize the KD of recombinant antibodies and target antigen, we introduce affinity electrophoretic mobility shift assays (EMSAs) in a high-throughput format suitable for small volume samples. A microfluidic card comprised of free-standing polyacrylamide gel (fsPAG) separation lanes supports 384 concurrent EMSAs in 30 s using a single power source. Sample is dispensed onto the microfluidic EMSA card by acoustic droplet ejection (ADE), which reduces EMSA variability compared to sample dispensing using manual or pin tools. The KD for each of a six-member fragment antigen-binding fragment library is reported using ~25-fold less sample mass and ~5-fold less time than conventional heterogeneous assays. Given the form factor and performance of this micro- and mesofluidic workflow, we have developed a sample-sparing, high-throughput, solution-phase alternative for biomolecular affinity characterization. PMID:28008969

High affinity γPNA sandwich hybridization assay for rapid detection of short nucleic acid targets with single mismatch discrimination.

PubMed

Goldman, Johnathan M; Zhang, Li Ang; Manna, Arunava; Armitage, Bruce A; Ly, Danith H; Schneider, James W

2013-07-08

Hybridization analysis of short DNA and RNA targets presents many challenges for detection. The commonly employed sandwich hybridization approach cannot be implemented for these short targets due to insufficient probe-target binding strengths for unmodified DNA probes. Here, we present a method capable of rapid and stable sandwich hybridization detection for 22 nucleotide DNA and RNA targets. Stable hybridization is achieved using an n-alkylated, polyethylene glycol γ-carbon modified peptide nucleic acid (γPNA) amphiphile. The γPNA's exceptionally high affinity enables stable hybridization of a second DNA-based probe to the remaining bases of the short target. Upon hybridization of both probes, an electrophoretic mobility shift is measured via interaction of the n-alkane modification on the γPNA with capillary electrophoresis running buffer containing nonionic surfactant micelles. We find that sandwich hybridization of both probes is stable under multiple binding configurations and demonstrate single base mismatch discrimination. The binding strength of both probes is also stabilized via coaxial stacking on adjacent hybridization to targets. We conclude with a discussion on the implementation of the proposed sandwich hybridization assay as a high-throughput microRNA detection method.

Growth of fluorescence gold clusters using photo-chemically activated ligands

NASA Astrophysics Data System (ADS)

Mishra, Dinesh; Aldeek, Fadi; Michael, Serge; Palui, Goutam; Mattoussi, Hedi

2016-03-01

Ligands made of lipoic acid (LA) appended with a polyethylene glycol (PEG) chain have been used in the aqueous phase growth of luminescent gold clusters with distinct emission from yellow to near-IR, using two different routes. In the first route, the gold-ligand complex was chemically reduced using sodium borohydride in alkaline medium, which gave near- IR luminescent gold clusters with maximum emission around 745 nm. In the second method, LA-PEG ligand was photochemically modified to a mixture of thiols, oligomers and oxygenated species under UV-irradiation, which was then used as both reducing agent and stabilizing ligand. By adjusting the pH, temperature, and time of the reaction, we were able to obtain clusters with two distinct emission properties. Refluxing the gold-ligand complex in alkaline medium in the presence of excess ligand gave yellow emission within the first two hours and the emission shifted to red after overnight reaction. Mass spectrometry and chemical assay were used to understand the photo-chemical transformation of Lipoic Acid (LA). Mass spectroscopic studies showed the photo-irradiated product contains thiols, oligomers (dimers, trimers and tetramers) as well as oxygenated species. The amount of thiol formed under different conditions of irradiation was estimated using Ellman's assay.

Humanizing the zebrafish liver shifts drug metabolic profiles and improves pharmacokinetics of CYP3A4 substrates.

PubMed

Poon, Kar Lai; Wang, Xingang; Ng, Ashley S; Goh, Wei Huang; McGinnis, Claudia; Fowler, Stephen; Carney, Tom J; Wang, Haishan; Ingham, Phillip W

2017-03-01

Understanding and predicting whether new drug candidates will be safe in the clinic is a critical hurdle in pharmaceutical development, that relies in part on absorption, distribution, metabolism, excretion and toxicology studies in vivo. Zebrafish is a relatively new model system for drug metabolism and toxicity studies, offering whole organism screening coupled with small size and potential for high-throughput screening. Through toxicity and absorption analyses of a number of drugs, we find that zebrafish is generally predictive of drug toxicity, although assay outcomes are influenced by drug lipophilicity which alters drug uptake. In addition, liver microsome assays reveal specific differences in metabolism of compounds between human and zebrafish livers, likely resulting from the divergence of the cytochrome P450 superfamily between species. To reflect human metabolism more accurately, we generated a transgenic "humanized" zebrafish line that expresses the major human phase I detoxifying enzyme, CYP3A4, in the liver. Here, we show that this humanized line shows an elevated metabolism of CYP3A4-specific substrates compared to wild-type zebrafish. The generation of this first described humanized zebrafish liver suggests such approaches can enhance the accuracy of the zebrafish model for toxicity prediction.

Dissection of Arabidopsis NCED9 promoter regulatory regions reveals a role for ABA synthesized in embryos in the regulation of GA-dependent seed germination.

PubMed

Seo, Mitsunori; Kanno, Yuri; Frey, Anne; North, Helen M; Marion-Poll, Annie

2016-05-01

Nine-cis-epoxycarotenoid dioxygenase (NCED) catalyzes the key step of abscisic acid (ABA) biosynthesis. There are five genes encoding NCED in Arabidopsis, which differentially regulate ABA biosynthesis in a spatiotemporal manner in response to endogenous and environmental stimuli. Previous studies have shown that NCED9 is expressed in testa and embryos during seed development. In the present study, we have identified promoter regions required for the expression of NCED9 in testa and embryos, respectively. Electrophoretic mobility shift assays (EMSA) and yeast one-hybrid (Y1H) assays showed that several homeodomain-leucine zipper (HD-Zip) proteins, namely ATHBs, bound to the sequence required for expression of NCED9 in testa, suggesting that they redundantly regulate NCED9 expression. By expressing the NCED9 gene under the control of a deleted NCED9 promoter in an nced9 mutant expression was limited to embryos. Transformants were complemented for the paclobutrazol resistant germination phenotype of the mutant, suggesting that the ABA synthesis mediated by NCED9 in embryos plays an important role in the regulation of gibberellin (GA)-dependent seed germination. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Rce1, a novel transcriptional repressor, regulates cellulase gene expression by antagonizing the transactivator Xyr1 in Trichoderma reesei.

PubMed

Cao, Yanli; Zheng, Fanglin; Wang, Lei; Zhao, Guolei; Chen, Guanjun; Zhang, Weixin; Liu, Weifeng

2017-07-01

Cellulase gene expression in the model cellulolytic fungus Trichoderma reesei is supposed to be controlled by an intricate regulatory network involving multiple transcription factors. Here, we identified a novel transcriptional repressor of cellulase gene expression, Rce1. Disruption of the rce1 gene not only facilitated the induced expression of cellulase genes but also led to a significant delay in terminating the induction process. However, Rce1 did not participate in Cre1-mediated catabolite repression. Electrophoretic mobility shift (EMSA) and DNase I footprinting assays in combination with chromatin immunoprecipitation (ChIP) demonstrated that Rce1 could bind directly to a cbh1 (cellobiohydrolase 1-encoding) gene promoter region containing a cluster of Xyr1 binding sites. Furthermore, competitive binding assays revealed that Rce1 antagonized Xyr1 from binding to the cbh1 promoter. These results indicate that intricate interactions exist between a variety of transcription factors to ensure tight and energy-efficient regulation of cellulase gene expression in T. reesei. This study also provides important clues regarding increased cellulase production in T. reesei. © 2017 John Wiley & Sons Ltd.

Critical period for acoustic preference in mice

PubMed Central

Yang, Eun-Jin; Lin, Eric W.; Hensch, Takao K.

2012-01-01

Preference behaviors are often established during early life, but the underlying neural circuit mechanisms remain unknown. Adapting a unique nesting behavior assay, we confirmed a “critical period” for developing music preference in C57BL/6 mice. Early music exposure between postnatal days 15 and 24 reversed their innate bias for silent shelter, which typically could not be altered in adulthood. Instead, exposing adult mice treated acutely with valproic acid or carrying a targeted deletion of the Nogo receptor (NgR−/−) unmasked a strong plasticity of preference consistent with a reopening of the critical period as seen in other systems. Imaging of cFos expression revealed a prominent neuronal activation in response to the exposed music in the prelimbic and infralimbic medial prefrontal cortex only under conditions of open plasticity. Neither behavioral changes nor selective medial prefrontal cortex activation was observed in response to pure tone exposure, indicating a music-specific effect. Open-field center crossings were increased concomitant with shifts in music preference, suggesting a potential anxiolytic effect. Thus, music may offer both a unique window into the emotional state of mice and a potentially efficient assay for molecular “brakes” on critical period plasticity common to sensory and higher order brain areas. PMID:23045690

Critical period for acoustic preference in mice.

PubMed

Yang, Eun-Jin; Lin, Eric W; Hensch, Takao K

2012-10-16

Preference behaviors are often established during early life, but the underlying neural circuit mechanisms remain unknown. Adapting a unique nesting behavior assay, we confirmed a "critical period" for developing music preference in C57BL/6 mice. Early music exposure between postnatal days 15 and 24 reversed their innate bias for silent shelter, which typically could not be altered in adulthood. Instead, exposing adult mice treated acutely with valproic acid or carrying a targeted deletion of the Nogo receptor (NgR(-/-)) unmasked a strong plasticity of preference consistent with a reopening of the critical period as seen in other systems. Imaging of cFos expression revealed a prominent neuronal activation in response to the exposed music in the prelimbic and infralimbic medial prefrontal cortex only under conditions of open plasticity. Neither behavioral changes nor selective medial prefrontal cortex activation was observed in response to pure tone exposure, indicating a music-specific effect. Open-field center crossings were increased concomitant with shifts in music preference, suggesting a potential anxiolytic effect. Thus, music may offer both a unique window into the emotional state of mice and a potentially efficient assay for molecular "brakes" on critical period plasticity common to sensory and higher order brain areas.

The transcription of the human fructose-bisphosphate aldolase C gene is activated by nerve-growth-factor-induced B factor in human neuroblastoma cells.

PubMed Central

Buono, P; Conciliis, L D; Izzo, P; Salvatore, F

1997-01-01

A DNA region located at around -200 bp in the 5' flanking region (region D) of the human brain-type fructose-bisphosphate aldolase (aldolase C) gene has been analysed. We show by transient transfection assay and electrophoretic-mobility-shift assay (EMSA) that the binding of transcriptional activators to region D is much more efficient (80% versus 30%) in human neuroblastoma cells (SKNBE) than in the non-neuronal cell line A1251, which contains low levels of aldolase C mRNA. The sequence of region D, CAAGGTCA, is very similar to the AAAGGTCA motif present in the mouse steroid 21-hydroxylase gene; the latter motif binds nerve-growth-factor-induced B factor (NGFI-B), which is a member of the thyroid/steroid/retinoid nuclear receptor gene family. Competition experiments in EMSA and antibody-directed supershift experiments showed that NGFI-B is involved in the binding to region D of the human aldolase C gene. Furthermore, the regulation of the aldolase C gene (which is the second known target of NGFI-B) expression during development parallels that of NGFI-B. PMID:9173889

Involvement of the Global Crp Regulator in Cyclic AMP-Dependent Utilization of Aromatic Amino Acids by Pseudomonas putida

PubMed Central

Herrera, M. Carmen; Daddaoua, Abdelali; Fernández-Escamilla, Ana

2012-01-01

The phhAB operon encodes a phenylalanine hydroxylase involved in the conversion of l-phenylalanine into l-tyrosine in Pseudomonas putida. The phhAB promoter is transcribed by RNA polymerase sigma-70 and is unusual in that the specific regulator PhhR acts as an enhancer protein that binds to two distant upstream sites (−75 to −92 and −132 to −149). There is an integration host factor (IHF) binding site that overlaps the proximal PhhR box, and, consequently, IHF acts as an inhibitor of transcription. Use of l-phenylalanine is compromised in a crp-deficient background due to reduced expression from the phhAB promoter. Electrophoretic mobility shift assays and DNase I footprinting assays reveal that Crp binds at a site centered at −109 only in the presence of cyclic AMP (cAMP). We show, using circular permutation analysis, that the simultaneous binding of Crp/cAMP and PhhR bends DNA to bring positive regulators and RNA polymerase into close proximity. This nucleoprotein complex promotes transcription from phhA only in response to l-phenylalanine. PMID:22081386

The LacI family protein GlyR3 co-regulates the celC operon and manB in Clostridium thermocellum

DOE PAGES

Choi, Jinlyung; Klingeman, Dawn M.; Brown, Steven D.; ...

2017-06-24

In this paper, we demonstrate that the GlyR3 protein mediates the regulation of manB. We first identify putative GlyR3 binding sites within or just upstream of the coding regions of manB and celT. Using an electrophoretic mobility shift assay (EMSA), we determined that a higher concentration of GlyR3 is required to effectively bind to the putative manB site in comparison to the celC site. Neither the putative celT site nor random DNA significantly binds GlyR3. While laminaribiose interfered with GlyR3 binding to the celC binding site, binding to the manB site was unaffected. In the presence of laminaribiose, in vivomore » transcription of the celC–glyR3–licA gene cluster increases, while manB expression is repressed, compared to in the absence of laminaribiose, consistent with the results from the EMSA. An in vitro transcription assay demonstrated that GlyR3 and laminaribiose interactions were responsible for the observed patters of in vivo transcription.« less

Use of an Enzyme-Linked Lectinsorbent Assay To Monitor the Shift in Polysaccharide Composition in Bacterial Biofilms

PubMed Central

Leriche, V.; Sibille, P.; Carpentier, B.

2000-01-01

An enzyme-linked lectinsorbent assay (ELLA) was developed for quantification and characterization of extracellular polysaccharides produced by 1- and 4-day biofilms of 10 bacterial strains isolated from food industry premises. Peroxidase-labeled concanavalin A (ConA) and wheat germ agglutinin (WGA) were used, as they specifically bind to saccharide residues most frequently encountered in biofilms matrices: d-glucose or d-mannose for ConA and N-acetyl-d-glucosamine or N-acetylneuraminic acid for WGA. The ELLA applied to 1- and 4-day biofilms colonizing wells of microtiter plates was able to detect that for Stenotrophomonas maltophilia and to a lesser extent Staphylococcus sciuri, the increase in production of exopolysaccharides over time was not the same for sugars binding with ConA and those binding with WGA. Differences in extracellular polysaccharides produced were observed among strains belonging to the same species. These results demonstrate that ELLA is a useful tool not only for rapid characterization of biofilm extracellular polysaccharides but also, in studies of individual strains, for detection of changes over time in the proportion of the exopolysaccharidic component within the polymeric matrix. PMID:10788349

In Vitro Antiviral Activity of Circular Triple Helix Forming Oligonucleotide RNA towards Feline Infectious Peritonitis Virus Replication

PubMed Central

Choong, Oi Kuan; Tejo, Bimo Ario; Omar, Abdul Rahman

2014-01-01

Feline Infectious Peritonitis (FIP) is a severe fatal immune-augmented disease in cat population. It is caused by FIP virus (FIPV), a virulent mutant strain of Feline Enteric Coronavirus (FECV). Current treatments and prophylactics are not effective. The in vitro antiviral properties of five circular Triple-Helix Forming Oligonucleotide (TFO) RNAs (TFO1 to TFO5), which target the different regions of virulent feline coronavirus (FCoV) strain FIPV WSU 79-1146 genome, were tested in FIPV-infected Crandell-Rees Feline Kidney (CRFK) cells. RT-qPCR results showed that the circular TFO RNAs, except TFO2, inhibit FIPV replication, where the viral genome copy numbers decreased significantly by 5-fold log10 from 1014 in the virus-inoculated cells to 109 in the circular TFO RNAs-transfected cells. Furthermore, the binding of the circular TFO RNA with the targeted viral genome segment was also confirmed using electrophoretic mobility shift assay. The strength of binding kinetics between the TFO RNAs and their target regions was demonstrated by NanoITC assay. In conclusion, the circular TFOs have the potential to be further developed as antiviral agents against FIPV infection. PMID:24707494

Pip, a Novel Activator of Phenazine Biosynthesis in Pseudomonas chlororaphis PCL1391▿ †

PubMed Central

Girard, Geneviève; Barends, Sharief; Rigali, Sébastien; van Rij, E. Tjeerd; Lugtenberg, Ben J. J.; Bloemberg, Guido V.

2006-01-01

Secondary metabolites are important factors for interactions between bacteria and other organisms. Pseudomonas chlororaphis PCL1391 produces the antifungal secondary metabolite phenazine-1-carboxamide (PCN) that inhibits growth of Fusarium oxysporum f. sp. radius lycopersici the causative agent of tomato foot and root rot. Our previous work unraveled a cascade of genes regulating the PCN biosynthesis operon, phzABCDEFGH. Via a genetic screen, we identify in this study a novel TetR/AcrR regulator, named Pip (phenazine inducing protein), which is essential for PCN biosynthesis. A combination of a phenotypical characterization of a pip mutant, in trans complementation assays of various mutant strains, and electrophoretic mobility shift assays identified Pip as the fifth DNA-binding protein so far involved in regulation of PCN biosynthesis. In this regulatory pathway, Pip is positioned downstream of PsrA (Pseudomonas sigma factor regulator) and the stationary-phase sigma factor RpoS, while it is upstream of the quorum-sensing system PhzI/PhzR. These findings provide further evidence that the path leading to the expression of secondary metabolism gene clusters in Pseudomonas species is highly complex. PMID:16997957

Effects of porcine 25 kDa amelogenin and its proteolytic derivatives on bone sialoprotein expression.

PubMed

Nakayama, Y; Yang, L; Mezawa, M; Araki, S; Li, Z; Wang, Z; Sasaki, Y; Takai, H; Nakao, S; Fukae, M; Ogata, Y

2010-10-01

Amelogenins are hydrophobic proteins that are the major component of developing enamel. Enamel matrix derivative has been used for periodontal regeneration. Bone sialoprotein is an early phenotypic marker of osteoblast differentiation. In this study, we examined the ability of porcine amelogenins to regulate bone sialoprotein transcription. To determine the molecular basis of the transcriptional regulation of the bone sialoprotein gene by amelogenins, we conducted northern hybridization, transient transfection analyses and gel mobility shift assays using the osteoblast-like ROS 17/2.8 cells. Amelogenins (100 ng/mL) up-regulated bone sialoprotein mRNA at 3 h, with maximal mRNA expression occurring at 12 h (25 and 20 kDa) and 6 h (13 and 6 kDa). Amelogenins (100 ng/mL, 12 h) increased luciferase activities in pLUC3 (nucleotides -116 to +60), and 6 kDa amelogenin up-regulated pLUC4 (nucleotides -425 to +60) activity. The tyrosine kinase inhibitor inhibited amelogenin-induced luciferase activities, whereas the protein kinase A inhibitor abolished 25 kDa amelogenin-induced bone sialoprotein transcription. The effects of amelogenins were abrogated by 2-bp mutations in the fibroblast growth factor 2 response element (FRE). Gel-shift assays with radiolabeled FRE, homeodomain-protein binding site (HOX) and transforming growth factor-beta1 activation element (TAE) double-strand oligonucleotides revealed increased binding of nuclear proteins from amelogenin-stimulated ROS 17/2.8 cells at 3 h (25 and 13 kDa) and 6 h (20 and 6 kDa). These results demonstrate that porcine 25 kDa amelogenin and its proteolytic derivatives stimulate bone sialoprotein transcription by targeting FRE, HOX and TAE in the bone sialoprotein gene promoter, and that full-length amelogenin and amelogenin cleavage products are able to regulate bone sialoprotein transcription via different signaling pathways. (c) 2010 John Wiley & Sons A/S.

Opaque-2 is a transcriptional activator that recognizes a specific target site in 22-kD zein genes.

PubMed Central

Schmidt, R J; Ketudat, M; Aukerman, M J; Hoschek, G

1992-01-01

opaque-2 (o2) is a regulatory locus in maize that plays an essential role in controlling the expression of genes encoding the 22-kD zein proteins. Through DNase I footprinting and DNA binding analyses, we have identified the binding site for the O2 protein (O2) in the promoter of 22-kD zein genes. The sequence in the 22-kD zein gene promoter that is recognized by O2 is similar to the target site recognized by other "basic/leucine zipper" (bZIP) proteins in that it contains an ACGT core that is necessary for DNA binding. The site is located in the -300 region relative to the translation start and lies about 20 bp downstream of the highly conserved zein gene sequence motif known as the "prolamin box." Employing gel mobility shift assays, we used O2 antibodies and nuclear extracts from an o2 null mutant to demonstrate that the O2 protein in maize endosperm nuclei recognizes the target site in the zein gene promoter. Mobility shift assays using nuclear proteins from an o2 null mutant indicated that other endosperm proteins in addition to O2 can bind the O2 target site and that O2 may be associated with one of these proteins. We also demonstrated that in yeast cells the O2 protein can activate expression of a lacZ gene containing a multimer of the O2 target sequence as part of its promoter, thus confirming its role as a transcriptional activator. A computer-assisted search indicated that the O2 target site is not present in the promoters of zein genes other than those of the 22-kD class. These data suggest a likely explanation at the molecular level for the differential effect of o2 mutations on expression of certain members of the zein gene family. PMID:1392590

Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lake, April D.; Novak, Petr; Shipkova, Petia

2013-04-15

Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BAmore » profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids are observed in NASH. ► Hepatic bile acid synthesis shifts toward the alternative pathway in NASH.« less

Visualizing dopamine released from living cells using a nanoplasmonic probe

NASA Astrophysics Data System (ADS)

Qin, W. W.; Wang, S. P.; Li, J.; Peng, T. H.; Xu, Y.; Wang, K.; Shi, J. Y.; Fan, C. H.; Li, D.

2015-09-01

We report the development of an ultrasensitive nanoplasmonic probe for discriminative detection and imaging of dopamine released from living cells. The sensing mechanism is based on the dopamine-induced seeded-growth of Au nanoparticles (Au NPs) that leads to the shift of the plasmon band. This platform allows for the detection of dopamine with a detection limit down to 0.25 pM within 1 min. This nanoplasmonic assay is further applied to visualize the release of dopamine from living rat pheochromocytoma (PC12) cells under ATP-stimulation with dark-field microscopy (DFM). The DFM results together with real time fluorescence imaging of PC12 cells stained with the Fluo calcium indicator, suggested that ATP stimulated-release of dopamine is concomitant with the Ca2+ influx, and the influx of Ca2+ is through ATP-activated channels instead of the voltage-gated Ca2+ channel (VGC).We report the development of an ultrasensitive nanoplasmonic probe for discriminative detection and imaging of dopamine released from living cells. The sensing mechanism is based on the dopamine-induced seeded-growth of Au nanoparticles (Au NPs) that leads to the shift of the plasmon band. This platform allows for the detection of dopamine with a detection limit down to 0.25 pM within 1 min. This nanoplasmonic assay is further applied to visualize the release of dopamine from living rat pheochromocytoma (PC12) cells under ATP-stimulation with dark-field microscopy (DFM). The DFM results together with real time fluorescence imaging of PC12 cells stained with the Fluo calcium indicator, suggested that ATP stimulated-release of dopamine is concomitant with the Ca2+ influx, and the influx of Ca2+ is through ATP-activated channels instead of the voltage-gated Ca2+ channel (VGC). Electronic supplementary information (ESI) available: Fig. S1-S4 and Table S1. See DOI: 10.1039/c5nr04433b

High-mobility group (HMG) protein HMG-1 and TATA-binding protein-associated factor TAF(II)30 affect estrogen receptor-mediated transcriptional activation.

PubMed

Verrier, C S; Roodi, N; Yee, C J; Bailey, L R; Jensen, R A; Bustin, M; Parl, F F

1997-07-01

The estrogen receptor (ER) belongs to a family of ligand-inducible nuclear receptors that exert their effects by binding to cis-acting DNA elements in the regulatory region of target genes. The detailed mechanisms by which ER interacts with the estrogen response element (ERE) and affects transcription still remain to be elucidated. To study the ER-ERE interaction and transcription initiation, we employed purified recombinant ER expressed in both the baculovirus-Sf9 and his-tagged bacterial systems. The effect of high-mobility group (HMG) protein HMG-1 and purified recombinant TATA-binding protein-associated factor TAF(II)30 on ER-ERE binding and transcription initiation were assessed by electrophoretic mobility shift assay and in vitro transcription from an ERE-containing template (pERE2LovTATA), respectively. We find that purified, recombinant ER fails to bind to ERE in spite of high ligand-binding activity and electrophoretic and immunological properties identical to ER in MCF-7 breast cancer cells. HMG-1 interacts with ER and promotes ER-ERE binding in a concentration- and time-dependent manner. The effectiveness of HMG-1 to stimulate ER-ERE binding in the electrophoretic mobility shift assay depends on the sequence flanking the ERE consensus as well as the position of the latter in the oligonucleotide. We find that TAF(II)30 has no effect on ER-ERE binding either alone or in combination with ER and HMG-1. Although HMG-1 promotes ER-ERE binding, it fails to stimulate transcription initiation either in the presence or absence of hormone. In contrast, TAF(II)30, while not affecting ER-ERE binding, stimulates transcription initiation 20-fold in the presence of HMG-1. These results indicate that HMG-1 and TAF(II)30 act in sequence, the former acting to promote ER-ERE binding followed by the latter to stimulate transcription initiation.

Macroalgal herbivory on recovering versus degrading coral reefs

NASA Astrophysics Data System (ADS)

Chong-Seng, K. M.; Nash, K. L.; Bellwood, D. R.; Graham, N. A. J.

2014-06-01

Macroalgal-feeding fishes are considered to be a key functional group on coral reefs due to their role in preventing phase shifts from coral to macroalgal dominance, and potentially reversing the shift should it occur. However, assessments of macroalgal herbivory using bioassay experiments are primarily from systems with relatively high coral cover. This raises the question of whether continued functionality can be ensured in degraded systems. It is clearly important to determine whether the species that remove macroalgae on coral-dominated reefs will still be present and performing significant algal removal on macroalgal-dominated reefs. We compared the identity and effectiveness of macroalgal-feeding fishes on reefs in two conditions post-disturbance—those regenerating with high live coral cover (20-46 %) and those degrading with high macroalgal cover (57-82 %). Using filmed Sargassum bioassays, we found significantly different Sargassum biomass loss between the two conditions; mean assay weight loss due to herbivory was 27.9 ± 4.9 % on coral-dominated reefs and 2.2 ± 1.1 % on reefs with high macroalgal cover. However, once standardised for the availability of macroalgae on the reefs, the rates of removal were similar between the two reef conditions (4.8 ± 4.1 g m-2 h-1 on coral-dominated and 5.3 ± 2.1 g m-2 h-1 on macroalgal-dominated reefs). Interestingly, the Sargassum-assay consumer assemblages differed between reef conditions; nominally grazing herbivores, Siganus puelloides and Chlorurus sordidus, and the browser , Siganus sutor, dominated feeding on high coral cover reefs, whereas browsing herbivores, Naso elegans, Naso unicornis, and Leptoscarus vaigiensis, prevailed on macroalgal-dominated reefs. It appeared that macroalgal density in the surrounding habitat had a strong influence on the species driving the process of macroalgal removal. This suggests that although the function of macroalgal removal may continue, the species responsible may change with context, differing between systems that are regenerating versus degrading.

Endotoxin exposure and changes in short-term pulmonary function among sewage workers.

PubMed

Cyprowski, Marcin; Sobala, Wojciech; Buczyńska, Alina; Szadkowska-Stańczyk, Irena

2015-01-01

The inhaled endotoxin is considered as a causative factor in the process of acute bronchial obstruction, which can be measured by a decrease in forced expiratory volume in 1 s (FEV1). The aim of this study was to assess endotoxin exposure among sewage treatment plant workers (STPW) and its effect on across-shift changes in respiratory airflow. A group of 78 STPW from a large sewage treatment plant was studied. Inhalable dust for endotoxin assessment was collected using personal aerosol samplers. Endotoxin was assayed with the kinetic, chromogenic Limulus amebocyte lysate test. Across-shift spirometric measurements were performed on Mondays, after 2-days absence from work, with the use of portable spirometer. The forced vital capacity (FVC), and FEV1 parameters were analyzed. Multifactor regression modeling was performed to determine parameters significantly associated with endotoxin exposure. The concentration of inhalable dust and endotoxin ranged from 0.01-1.38 mg/m3 and 0.68-214 endotoxin units per cubic meter of air (EU/m3), respectively. Endotoxins were characterized with the skewed distribution (arithmetic mean (AM) = 38.8 EU/m3, geometric mean (GM) = 15.4 EU/m3, geometric standard deviation (GSD) = 4.21). Through the use of multifactor analysis, which excluded the main confounders (inhalable dust and smoking habit) it was found that, despite low levels of endotoxin, it had significant impact on the observed across-shift decline in FEV1 (p = 0.044). For this parameter, the regression slope was additionally calculated (r = -0.017, p = 0.071). Relatively low levels of endotoxin among sewage treatment plant workers may cause small, but significant across-shift declines in FEV1. The observed relationship was independent of organic dust concentrations and smoking habit. The respiratory protection should be provided for STPW. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.

Physiological Conjunction of Allelochemicals and Desert Plants

PubMed Central

Dudai, Nativ; Rachmilevitch, Shimon

2013-01-01

Plants exchange signals with other physical and biological entities in their habitat, a form of communication termed allelopathy. The underlying principles of allelopathy and secondary-metabolite production are still poorly understood, especially in desert plants. The coordination and role of secondary metabolites were examined as a cause of allelopathy in plants thriving under arid and semiarid soil conditions. Desert plant species, Origanum dayi, Artemisia sieberi and Artemisia judaica from two different sources (cultivar cuttings and wild seeds) were studied in their natural habitats. Growth rate, relative water content, osmotic potential, photochemical efficiency, volatile composition and vital factors of allelopathy were analyzed at regular intervals along four seasons with winter showing optimum soil water content and summer showing water deficit conditions. A comprehensive analysis of the volatile composition of the leaves, ambient air and soil in the biological niche of the plants under study was carried out to determine the effects of soil water conditions and sample plants on the surrounding flora. Significant morpho-physiological changes were observed across the seasons and along different soil water content. Metabolic analysis showed that water deficit was the key for driving selective metabolomic shifts. A. judaica showed the least metabolic shifts, while A. sieberi showed the highest shifts. All the species exhibited high allelopathic effects; A. judaica displayed relatively higher growth-inhibition effects, while O. dayi showed comparatively higher germination-inhibition effects in germination assays. The current study may help in understanding plant behavior, mechanisms underlying secondary-metabolite production in water deficit conditions and metabolite-physiological interrelationship with allelopathy in desert plants, and can help cull economic benefits from the produced volatiles. PMID:24339945

Aluminium-induced excessive ROS causes cellular damage and metabolic shifts in black gram Vigna mungo (L.) Hepper.

PubMed

Chowra, Umakanta; Yanase, Emiko; Koyama, Hiroyuki; Panda, Sanjib Kumar

2017-01-01

Aluminium-induced oxidative damage caused by excessive ROS production was evaluated in black gram pulse crop. Black gram plants were treated with different aluminium (Al 3+ ) concentrations (10, 50 and 100 μM with pH 4.7) and further the effects of Al 3+ were characterised by means of root growth inhibition, histochemical assay, ROS content analysis, protein carbonylation quantification and 1 H-NMR analysis. The results showed that aluminium induces excessive ROS production which leads to cellular damage, root injury, stunt root growth and other metabolic shifts. In black gram, Al 3+ induces cellular damage at the earliest stage of stress which was characterised from histochemical analysis. From this study, it was observed that prolonged stress can activate certain aluminium detoxification defence mechanism. Probably excessive ROS triggers such defence mechanism in black gram. Al 3+ can induce excessive ROS initially in the root region then transported to other parts of the plant. As much as the Al 3+ concentration increases, the rate of cellular injury and ROS production also increases. But after 72 h of stress, plants showed a lowered ROS level and cellular damage which indicates the upregulation of defensive mechanisms. Metabolic shift analysis also showed that the black gram plant under stress has less metabolic content after 24 h of treatment, but gradually, it was increased after 72 h of treatment. It was assumed that ROS played the most important role as a signalling molecule for aluminium stress in black gram.

Cis-Regulatory Changes Associated with a Recent Mating System Shift and Floral Adaptation in Capsella

PubMed Central

Steige, Kim A.; Reimegård, Johan; Koenig, Daniel; Scofield, Douglas G.; Slotte, Tanja

2015-01-01

The selfing syndrome constitutes a suite of floral and reproductive trait changes that have evolved repeatedly across many evolutionary lineages in response to the shift to selfing. Convergent evolution of the selfing syndrome suggests that these changes are adaptive, yet our understanding of the detailed molecular genetic basis of the selfing syndrome remains limited. Here, we investigate the role of cis-regulatory changes during the recent evolution of the selfing syndrome in Capsella rubella, which split from the outcrosser Capsella grandiflora less than 200 ka. We assess allele-specific expression (ASE) in leaves and flower buds at a total of 18,452 genes in three interspecific F1 C. grandiflora x C. rubella hybrids. Using a hierarchical Bayesian approach that accounts for technical variation using genomic reads, we find evidence for extensive cis-regulatory changes. On average, 44% of the assayed genes show evidence of ASE; however, only 6% show strong allelic expression biases. Flower buds, but not leaves, show an enrichment of cis-regulatory changes in genomic regions responsible for floral and reproductive trait divergence between C. rubella and C. grandiflora. We further detected an excess of heterozygous transposable element (TE) insertions near genes with ASE, and TE insertions targeted by uniquely mapping 24-nt small RNAs were associated with reduced expression of nearby genes. Our results suggest that cis-regulatory changes have been important during the recent adaptive floral evolution in Capsella and that differences in TE dynamics between selfing and outcrossing species could be important for rapid regulatory divergence in association with mating system shifts. PMID:26318184

Identification of a novel prophage-like gene cluster actively expressed in both virulent and avirulent strains of Leptospira interrogans serovar Lai.

PubMed

Qin, Jin-Hong; Zhang, Qing; Zhang, Zhi-Ming; Zhong, Yi; Yang, Yang; Hu, Bao-Yu; Zhao, Guo-Ping; Guo, Xiao-Kui

2008-06-01

DNA microarray analysis was used to compare the differential gene expression profiles between Leptospira interrogans serovar Lai type strain 56601 and its corresponding attenuated strain IPAV. A 22-kb genomic island covering a cluster of 34 genes (i.e., genes LA0186 to LA0219) was actively expressed in both strains but concomitantly upregulated in strain 56601 in contrast to that of IPAV. Reverse transcription-PCR assays proved that the gene cluster comprised five transcripts. Gene annotation of this cluster revealed characteristics of a putative prophage-like remnant with at least 8 of 34 sequences encoding prophage-like proteins, of which the LA0195 protein is probably a putative prophage CI-like regulator. The transcription initiation activities of putative promoter-regulatory sequences of transcripts I, II, and III, all proximal to the LA0195 gene, were further analyzed in the Escherichia coli promoter probe vector pKK232-8 by assaying the reporter chloramphenicol acetyltransferase (CAT) activities. The strong promoter activities of both transcripts I and II indicated by the E. coli CAT assay were well correlated with the in vitro sequence-specific binding of the recombinant LA0195 protein to the corresponding promoter probes detected by the electrophoresis mobility shift assay. On the other hand, the promoter activity of transcript III was very low in E. coli and failed to show active binding to the LA0195 protein in vitro. These results suggested that the LA0195 protein is likely involved in the transcription of transcripts I and II. However, the identical complete DNA sequences of this prophage remnant from these two strains strongly suggests that possible regulatory factors or signal transduction systems residing outside of this region within the genome may be responsible for the differential expression profiling in these two strains.

In vitro evaluation, in vivo quantification, and microbial diversity studies of nutritional strategies for reducing enteric methane production.

PubMed

Abdalla, Adibe Luiz; Louvandini, Helder; Sallam, Sobhy Mohamed Abdallah Hassan; Bueno, Ives Cláudio da Silva; Tsai, Siu Mui; Figueira, Antonio Vargas de Oliveira

2012-06-01

The main objective of the present work was to study nutritive strategies for lessening the CH(4) formation associated to ruminant tropical diets. In vitro gas production technique was used for evaluating the effect of tannin-rich plants, essential oils, and biodiesel co-products on CH(4) formation in three individual studies and a small chamber system to measure CH(4) released by sheep for in vivo studies was developed. Microbial rumen population diversity from in vitro assays was studied using qPCR. In vitro studies with tanniniferous plants, herbal plant essential oils derived from thyme, fennel, ginger, black seed, and Eucalyptus oil (EuO) added to the basal diet and cakes of oleaginous plants (cotton, palm, castor plant, turnip, and lupine), which were included in the basal diet to replace soybean meal, presented significant differences regarding fermentation gas production and CH(4) formation. In vivo assays were performed according to the results of the in vitro assays. Mimosa caesalpineaefolia, when supplemented to a basal diet (Tifton-85 hay Cynodon sp, corn grain, soybean meal, cotton seed meal, and mineral mixture) fed to adult Santa Ines sheep reduced enteric CH(4) emission but the supplementation of the basal diet with EuO did not affect (P > 0.05) methane released. Regarding the microbial studies of rumen population diversity using qPCR with DNA samples collected from the in vitro trials, the results showed shifts in microbial communities of the tannin-rich plants in relation to control plant. This research demonstrated that tannin-rich M. caesepineapholia, essential oil from eucalyptus, and biodiesel co-products either in vitro or in vivo assays showed potential to mitigate CH(4) emission in ruminants. The microbial community study suggested that the reduction in CH(4) production may be attributed to a decrease in fermentable substrate rather than to a direct effect on methanogenesis.

Aciculatin Inhibits Granulocyte Colony-Stimulating Factor Production by Human Interleukin 1β-Stimulated Fibroblast-Like Synoviocytes

PubMed Central

Shih, Kao-Shang; Wang, Jyh-Horng; Wu, Yi-Wen; Teng, Che-Ming; Chen, Chien-Chih; Yang, Chia-Ron

2012-01-01

The expression of granulocyte colony-stimulating factor (G-CSF), the major regulator of neutrophil maturation, by human fibroblast-like synoviocytes (FLS) can be stimulated by the inflammatory cytokine interleukin-1β (IL-1β). G-CSF is known to contribute to the pathologic processes of destructive arthritis, but the induction mechanism remains unknown. The aims of this study were to identify the signaling pathways involved in IL-1β-stimulated G-CSF production and to determine whether this process was inhibited by aciculatin (8-((2R,4S,5S,6R)-tetrahydro-4,5-dihydroxy-6-methyl-2H-pyran-2-yl)-5-hydroxy-2-(4-hydroxyphenyl)-7-methoxy-4H-chromen-4-one), the major bioactive component of Chrysopogon aciculatus. IL-1β-induced cytokine expression was evaluated by measuring mRNA and protein levels by RT-PCR, ELISA, and Milliplex® assay. Whether aciculatin inhibited IL-1β-stimulated G-CSF expression, and if so, how, were evaluated using western blot assay, an electrophoretic mobility shift assay, and a reporter gene assay. Neutrophil differentiation was determined by Wright-Giemsa staining and flow cytometry. Aciculatin markedly inhibited G-CSF expression induced by IL-1β (10 ng/mL) in a concentration-dependent manner (1–10 µM). In clarifying the mechanisms involved, aciculatin was found to inhibit the IL-1β-induced activation of the IκB kinase (IKK)/IκB/nuclear factor-κB (NF-κB) and mitogen-activated protein kinase (MAPK) pathways by suppressing the DNA binding activity of the transcription factors NF-κB and activator protein (AP)-1. Furthermore, aciculatin significantly inhibited the G-CSF-mediated phosphorylation of Janus kinase-signal transducer and activator of transcription (JAK-STAT) and Akt and neutrophil differentiation from precursor cells. Our results show that aciculatin inhibits IL-1β-stimulated G-CSF expression and the subsequent neutrophil differentiation, suggesting that it might have therapeutic potential for inflammatory arthritis. PMID:22860122

Monitoring of DNA breakage in embryonic stages of the African catfish Clarias gariepinus (Burchell, 1822) after exposure to lead nitrate using alkaline comet assay.

PubMed

Osman, Alaa G M; Mekkawy, Imam A; Verreth, Johan; Wuertz, Sven; Kloas, Werner; Kirschbaum, Frank

2008-12-01

Increasing lead contamination in Egyptian ecosystems and high lead concentrations in food items have raised concern for human health and stimulated studies on monitoring ecotoxicological impact of lead-caused genotoxicity. In this work, the alkaline comet assay was modified for monitoring DNA strand breakage in sensitive early life stages of the African catfish Clarias gariepinus. Following exposure to 100, 300, and 500 microg/L lead nitrate, DNA strand breakage was quantified in embryos at 30, 48, 96, 144, and 168 h post-fertilization (PFS). For quantitative analysis, four commonly used parameters (tail % DNA, %TDNA; head % DNA, %HDNA; tail length, TL; tail moment, TM) were analyzed in 96 nuclei (in triplicates) at each sampling point. The parameter %TDNA revealed highest resolution and lowest variation. A strong correlation between lead concentration, time of exposure, and DNA strand breakage was observed. Here, genotoxicity detected by comet assay preceded the manifested malformations assessed with conventional histology. Qualitative evaluation was carried out using five categories are as follows: undamaged (%TDNA < or = 10%), low damaged (10% < %TDNA < or = 25%), median damaged (25 < %TDNA < or = 50%), highly damaged (50 < %TDNA < or = 75%), and extremely damaged (%TDNA > 75%) nuclei confirming a dose and time-dependent shift towards increased frequencies of highly and extremely damaged nuclei. A protective capacity provided by a hardened chorion is a an interesting finding in this study as DNA damage in the prehatching stages 30 h-PFS and 48 h-PFS was low in all treatments (qualitative and quantitative analyses). These results clearly show that the comet assay is a sensitive tool for the detection of genotoxicity in vulnerable early life stages of the African catfish and is a method more sensitive than histological parameters for monitoring genotoxic effects. 2008 Wiley Periodicals, Inc.

Molecular Cloning, Functional Characterization, and Evolutionary Analysis of Vitamin D Receptors Isolated from Basal Vertebrates

PubMed Central

Kollitz, Erin M.; Zhang, Guozhu; Hawkins, Mary Beth; Whitfield, G. Kerr; Reif, David M.; Kullman, Seth W.

2015-01-01

The vertebrate genome is a result of two rapid and successive rounds of whole genome duplication, referred to as 1R and 2R. Furthermore, teleost fish have undergone a third whole genome duplication (3R) specific to their lineage, resulting in the retention of multiple gene paralogs. The more recent 3R event in teleosts provides a unique opportunity to gain insight into how genes evolve through specific evolutionary processes. In this study we compare molecular activities of vitamin D receptors (VDR) from basal species that diverged at key points in vertebrate evolution in order to infer derived and ancestral VDR functions of teleost paralogs. Species include the sea lamprey (Petromyzon marinus), a 1R jawless fish; the little skate (Leucoraja erinacea), a cartilaginous fish that diverged after the 2R event; and the Senegal bichir (Polypterus senegalus), a primitive 2R ray-finned fish. Saturation binding assays and gel mobility shift assays demonstrate high affinity ligand binding and classic DNA binding characteristics of VDR has been conserved across vertebrate evolution. Concentration response curves in transient transfection assays reveal EC50 values in the low nanomolar range, however maximum transactivational efficacy varies significantly between receptor orthologs. Protein-protein interactions were investigated using co-transfection, mammalian 2-hybrid assays, and mutations of coregulator activation domains. We then combined these results with our previous study of VDR paralogs from 3R teleosts into a bioinformatics analysis. Our results suggest that 1, 25D3 acts as a partial agonist in basal species. Furthermore, our bioinformatics analysis suggests that functional differences between VDR orthologs and paralogs are influenced by differential protein interactions with essential coregulator proteins. We speculate that we may be observing a change in the pharmacodynamics relationship between VDR and 1, 25D3 throughout vertebrate evolution that may have been driven by changes in protein-protein interactions between VDR and essential coregulators. PMID:25855982

FOXD3 inhibits SCN2A gene transcription in intractable epilepsy cell models.

PubMed

Xiang, Jun; Wen, Fang; Zhang, Lingyun; Zhou, Yu

2018-04-01

The expression of sodium voltage-gated channel alpha subunit 2 (SCN2A) is closely related to the development of epilepsy. This study investigated regulatory element of the SCN2A gene involved in epilepsy. An intractable epilepsy cell model was constructed using hippocampal primary neurons and the SH-SY5Y cell line. SCN2A protein and gene expression in cells as well as the level of lactic acid dehydrogenase (LDH) in the cell culture supernatants was detected. Potential regulatory factors of SCN2A and its upstream regulatory elements were identified using the dual-luciferase reporter assay. Finally, the role of the hypothetical transcription factor in epilepsy was examined by using its small interfering RNA (siRNA). Results found that levels of LDH and expression of the hypothetical transcription factor, Forkhead box D3 (FOXD3), was both increased in the model cells, whereas that of SCN2A was decreased. The results of dual-luciferase reporter assays revealed that an upstream region of SCN2A gene spanning from nucleotides -1617 to -1470 was a transcription factor binding region and a trans-acting factor role of FOXD3 was identified in the core region (GGCAAAATTAT). Then the FOXD3 binding site was further verified by the chromatin immunoprecipitation (ChIP) assay and electrophoretic mobility shift assay (EMSA). After SH-SY5Y cells were transfected with FOXD3 siRNA, the release of LDH into culture supernatants and the LDH expression levels in cells were significantly decreased. SCN2A expression in model cells was increased by knockdown of FOXD3. Therefore, this study demonstrated that FOXD3 is a trans-acting factor of SCN2A, and this mechanism may play a role in cell injury after epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.

Toll-like receptor 4 mediates inflammatory signaling by bacterial lipopolysaccharide in human hepatic stellate cells.

PubMed

Paik, Yong-Han; Schwabe, Robert F; Bataller, Ramón; Russo, Maria P; Jobin, Christian; Brenner, David A

2003-05-01

Bacterial lipopolysaccharide (LPS) stimulates Kupffer cells and participates in the pathogenesis of alcohol-induced liver injury. However, it is unknown whether LPS directly affects hepatic stellate cells (HSCs), the main fibrogenic cell type in the injured liver. This study characterizes LPS-induced signal transduction and proinflammatory gene expression in activated human HSCs. Culture-activated HSCs and HSCs isolated from patients with hepatitis C virus-induced cirrhosis express LPS-associated signaling molecules, including CD14, toll-like receptor (TLR) 4, and MD2. Stimulation of culture-activated HSCs with LPS results in a rapid and marked activation of NF-kappaB, as assessed by in vitro kinase assays for IkappaB kinase (IKK), IkappaBalpha steady-state levels, p65 nuclear translocation, NF-kappaB-dependent luciferase reporter gene assays, and electrophoretic mobility shift assays. Lipid A induces NF-kappaB activation in a similar manner. Both LPS- and lipid A-induced NF-kappaB activation is blocked by preincubation with either anti-TLR4 blocking antibody (HTA125) or Polymyxin B. Lipid A induces NF-kappaB activation in HSCs from TLR4-sufficient (C3H/OuJ) mice but not from TLR4-deficient (C3H/HeJ) mice. LPS also activates c-Jun N-terminal kinase (JNK), as assessed by in vitro kinase assays. LPS up-regulates IL-8 and MCP-1 gene expression and secretion. LPS-induced IL-8 secretion is completely inhibited by the IkappaB super repressor (Ad5IkappaB) and partially inhibited by a specific JNK inhibitor, SP600125. LPS also up-regulates cell surface expression of ICAM-1 and VCAM-1. In conclusion, human activated HSCs utilize components of TLR4 signal transduction cascade to stimulate NF-kappaB and JNK and up-regulate chemokines and adhesion molecules. Thus, HSCs are a potential mediator of LPS-induced liver injury.

Genotypic, Phenotypic and Clinical Validation of GeneXpert in Extra-Pulmonary and Pulmonary Tuberculosis in India

PubMed Central

Singh, Urvashi B.; Pandey, Pooja; Mehta, Girija; Bhatnagar, Anuj K.; Mohan, Anant; Goyal, Vinay; Ahuja, Vineet; Ramachandran, Ranjani; Sachdeva, Kuldeep S.; Samantaray, Jyotish C.

2016-01-01

Background Newer molecular diagnostics have brought paradigm shift in early diagnosis of tuberculosis [TB]. WHO recommended use of GeneXpert MTB/RIF [Xpert] for Extra-pulmonary [EP] TB; critics have since questioned its efficiency. Methods The present study was designed to assess the performance of GeneXpert in 761 extra-pulmonary and 384 pulmonary specimens from patients clinically suspected of TB and compare with Phenotypic, Genotypic and Composite reference standards [CRS]. Results Comparison of GeneXpert results to CRS, demonstrated sensitivity of 100% and 90.68%, specificity of 100% and 99.62% for pulmonary and extra-pulmonary samples. On comparison with culture, sensitivity for Rifampicin [Rif] resistance detection was 87.5% and 81.82% respectively, while specificity was 100% for both pulmonary and extra-pulmonary TB. On comparison to sequencing of rpoB gene [Rif resistance determining region, RRDR], sensitivity was respectively 93.33% and 90% while specificity was 100% in both pulmonary and extra-pulmonary TB. GeneXpert assay missed 533CCG mutation in one sputum and dual mutation [517 & 519] in one pus sample, detected by sequencing. Sequencing picked dual mutation [529, 530] in a sputum sample sensitive to Rif, demonstrating, not all RRDR mutations lead to resistance. Conclusions Current study reports observations in a patient care setting in a high burden region, from a large collection of pulmonary and extra-pulmonary samples and puts to rest questions regarding sensitivity, specificity, detection of infrequent mutations and mutations responsible for low-level Rif resistance by GeneXpert. Improvements in the assay could offer further improvement in sensitivity of detection in different patient samples; nevertheless it may be difficult to improve sensitivity of Rif resistance detection if only one gene is targeted. Assay specificity was high both for TB detection and Rif resistance detection. Despite a few misses, the assay offers major boost to early diagnosis of TB and MDR-TB, in difficult to diagnose pauci-bacillary TB. PMID:26894283

Molecular Characterization and Transcriptional Regulation Analysis of the Bovine PDHB Gene.

PubMed

Li, Anning; Zhang, Yaran; Zhao, Zhidong; Wang, Mingming; Zan, Linsen

2016-01-01

The pyruvate dehydrogenase beta subunit (PDHB) is a subunit of pyruvate dehydrogenase (E1), which catalyzes pyruvate into acetyl-CoA and provides a linkage between the tricarboxylic acid cycle (TCA) and the glycolysis pathway. Previous studies demonstrated PDHB to be positively related to the intramuscular fat (IMF) content. However, the transcriptional regulation of PDHB remains unclear. In our present study, the cDNA of bovine PDHB was cloned and the genomic structure was analyzed. The phylogenetic tree showed bovine PDHB to be closely related to goat and sheep, and least related to chicken. Spatial expression pattern analysis revealed the products of bovine PDHB to be widely expressed with the highest level in the fat of testis. To understand the transcriptional regulation of bovine PDHB, 1899 base pairs (bp) of the 5'-regulatory region was cloned. Sequence analysis neither found consensus TATA-box nor CCAAT-box in the 5'-flanking region of bovine PDHB. However, a CpG island was predicted from nucleotides -284 to +117. Serial deletion constructs of the 5'-flanking region, evaluated in dual-luciferase reporter assay, revealed the core promoter to be located 490bp upstream from the transcription initiation site (+1). Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation assay (ChIP) in combination with asite-directed mutation experiment indicated both myogenin (MYOG) and the CCAAT/enhancer-binding protein beta (C/EBPß) to be important transcription factors for bovine PDHB in skeletal muscle cells and adipocytes. Our results provide an important basis for further investigation of the bovine PDHB function and regulation in cattle.

Expression of Interferon Lambda 4 Is Associated with Reduced Proliferation and Increased Cell Death in Human Hepatic Cells

PubMed Central

Onabajo, Olusegun O.; Porter-Gill, Patricia; Paquin, Ashley; Rao, Nina; Liu, Luyang; Tang, Wei; Brand, Nathan

2015-01-01

Interferon lambda 4 (IFN-λ4) is a novel type-III interferon that can be generated only in individuals carrying a ΔG frame-shift allele of an exonic genetic variant (rs368234815-ΔG/TT). The rs368234815-ΔG allele is strongly associated with decreased clearance of hepatitis C virus (HCV) infection. Here, we further explored the biological function of IFN-λ4 expressed in human hepatic cells—a hepatoma cell line HepG2 and fresh primary human hepatocytes (PHHs). We performed live confocal imaging, cell death and proliferation assays, mRNA expression profiling, protein detection, and antibody blocking assays using transient and inducible stable in vitro systems. Not only did we observe significant intracellular retention of IFN-λ4 but also detected secreted IFN-λ4 in the culture media of expressing cells. Secreted IFN-λ4 induced strong activation of the interferon-stimulated genes (ISGs) in IFN-λ4-expressing and surrounding cells in transwell assays. Specifically, in PHHs, secreted IFN-λ4 induced expression of the CXCL10 transcript and a corresponding pro-inflammatory chemokine, IP-10. In IFN-λ4-expressing HepG2 cells, we also observed decreased proliferation and increased cell death. All IFN-λ4-induced phenotypes—activation of ISGs, decreased proliferation, and increased cell death—could be inhibited by an anti-IFN-λ4-specific antibody. Our study offers new insights into biology of IFN-λ4 and its possible role in HCV clearance. PMID:26134097

Discovery and structural optimization of 4-(4-(benzyloxy)phenyl)-3,4-dihydropyrimidin-2(1H)-ones as RORc inverse agonists.

PubMed

Wu, Xi-Shan; Wang, Rui; Xing, Yan-Li; Xue, Xiao-Qian; Zhang, Yan; Lu, Yong-Zhi; Song, Yu; Luo, Xiao-Yu; Wu, Chun; Zhou, Yu-Lai; Jiang, Jian-Qin; Xu, Yong

2016-11-01

Retinoic acid receptor-related orphan nuclear receptors (RORs) are orphan nuclear receptors that show constitutive activity in the absence of ligands. Among 3 subtypes of RORs, RORc is a promising therapeutic target for the treatment of Th17-mediated autoimmune diseases. Here, we report novel RORc inverse agonists discovered through structure-based drug design. Based on the structure of compound 8, a previously described agonist of RORa, a series of 4-(4-(benzyloxy)phenyl)-3,4-dihydropyrimidin-2(1H)-one derivatives were designed and synthesized. The interaction between the compounds and RORc was detected at molecular level using AlphaScreen assay. The compounds were further examined in 293T cells transfected with RORc and luciferase reporter gene. Thermal stability shift assay was used to evaluate the effects of the compounds on protein stability. A total of 27 derivatives were designed and synthesized. Among them, the compound 22b was identified as the most potent RORc inverse agonist. Its IC 50 values were 2.39 μmol/L in AlphaScreen assay, and 0.82 μmol/L in inhibition of the cell-based luciferase reporter activity. Furthermore, the compound 22b displayed a 120-fold selectivity for RORc over other nuclear receptors. Moreover, a molecular docking study showed that the structure-activity relationship was consistent with the binding mode of compound 22b in RORc. 4-(4-(Benzyloxy)phenyl)-3,4-dihydropyrimidin-2(1H)-one derivatives are promising candidates for the treatment of Th17-mediated autoimmune diseases, such as rheumatoid arthritis, psoriasis, and multiple sclerosis.

Mutation Analysis in Cultured Cells of Transgenic Rodents

PubMed Central

Zheng, Albert; Bates, Steven E.; Tommasi, Stella

2018-01-01

To comply with guiding principles for the ethical use of animals for experimental research, the field of mutation research has witnessed a shift of interest from large-scale in vivo animal experiments to small-sized in vitro studies. Mutation assays in cultured cells of transgenic rodents constitute, in many ways, viable alternatives to in vivo mutagenicity experiments in the corresponding animals. A variety of transgenic rodent cell culture models and mutation detection systems have been developed for mutagenicity testing of carcinogens. Of these, transgenic Big Blue® (Stratagene Corp., La Jolla, CA, USA, acquired by Agilent Technologies Inc., Santa Clara, CA, USA, BioReliance/Sigma-Aldrich Corp., Darmstadt, Germany) mouse embryonic fibroblasts and the λ Select cII Mutation Detection System have been used by many research groups to investigate the mutagenic effects of a wide range of chemical and/or physical carcinogens. Here, we review techniques and principles involved in preparation and culturing of Big Blue® mouse embryonic fibroblasts, treatment in vitro with chemical/physical agent(s) of interest, determination of the cII mutant frequency by the λ Select cII assay and establishment of the mutation spectrum by DNA sequencing. We describe various approaches for data analysis and interpretation of the results. Furthermore, we highlight representative studies in which the Big Blue® mouse cell culture model and the λ Select cII assay have been used for mutagenicity testing of diverse carcinogens. We delineate the advantages of this approach and discuss its limitations, while underscoring auxiliary methods, where applicable. PMID:29337872

Synthesis of a selective ratiometric fluorescent probe based on Naphthalimide and its application in human cytochrome P450 1A.

PubMed

Zhang, Xiuxuan; Zhou, Yan; Gu, Xiaofei; Cheng, Yu; Hong, Manxin; Yan, Liqiang; Ma, Fulong; Qi, Zhengjian

2018-08-15

Cytochrome P450s have brought considerable attention to researchers for their significant correlations with metabolic behaviors of procarcinogenic chemicals. To better understand the roles of CYP1A in biological and physiological systems, we developed a novel ratiometric fluorescence probe N-((2-hydroxyl ethoxy) ethyl)- 4-methoxy-1, 8-naphthalimide (NEMN) allowing for selectively and sensitively monitoring the target enzymes under physiological conditions and living cells. The probe was designed based on substrate predilection of CYP1A and its outstanding O-dealkylation capacity, and 1, 8-naphthalimide was chosen as fluorophore on account of its desirable photophysical properties. Absorption and emission spectra of the probe solution and reacted metabolism showed obvious red-shift with remarkable colour changes, which indicated that NEMN could be a promising ratiometric detector of CYP1A. Additionally, the selectivity assays displayed that NEMN only sensitive to CYP1A1 and CYP1A2 enzymes with scarce interference of other CYPs. Furthermore, the excellent linear relationships between the ratio of fluorescent intensities and incubation time and enzymes concentration signified time- and concentration- dependence of the probe, which were of desire benefit to quantify and monitor the CYP1A-involved biological behaviors in physiological conditions. The assay in real living samples (Human liver microsomes) further proved the analytical utility of the probe. Finally, the cytotoxicity assay and confocal fluorescence imaging demonstrated that this probe was of great promise for detecting the activity of endogenous CYP1A in human living cells. Copyright © 2018 Elsevier B.V. All rights reserved.

NFIL3 suppresses hypoxia-induced apoptotic cell death by targeting the insulin-like growth factor 2 receptor.

PubMed

Lin, Kuan-Ho; Kuo, Chia-Hua; Kuo, Wei-Wen; Ho, Tsung-Jung; Pai, Peiying; Chen, Wei-Kung; Pan, Lung-Fa; Wang, Chien-Cheng; Padma, V Vijaya; Huang, Chih-Yang

2015-06-01

The insulin-like growth factor-II/mannose 6-phosphate receptor (IGF2R) over-expression correlates with heart disease progression. The IGF2R is not only an IGF2 clearance receptor, but it also triggers signal transduction, resulting in cardiac hypertrophy, apoptosis and fibrosis. The present study investigated the nuclear factor IL-3 (NFIL3), a transcription factor of the basic leucine zipper superfamily, and its potential pro-survival effects in cardiomyocytes. NFIL3 might play a key role in heart development and act as a survival factor in the heart, but the regulatory mechanisms are still unclear. IGF2 and IGF2R protein expression were highly increased in rat hearts subjected to hemorrhagic shock. IGF2R protein expression was also up-regulated in H9c2 cells exposed to hypoxia. Over-expression of NFIL3 in H9c2 cardiomyoblast cells inhibited the induction of hypoxia-induced apoptosis and down-regulated IGF2R expression levels. Gel shift assay, double-stranded DNA pull-down assay and chromatin immune-precipitation analyses indicated that NFIL3 binds directly to the IGF2R promoter region. Using a luciferase assay, we further observed NFIL3 repress IGF2R gene promoter activity. Our results demonstrate that NFIL3 is an important negative transcription factor, which through binding to the promoter of IGF2R, suppresses the apoptosis induced by IGF2R signaling in H9c2 cardiomyoblast cells under hypoxic conditions. © 2015 Wiley Periodicals, Inc.

A high throughput colorimetric assay of β-1,3-D-glucans by Congo red dye.

PubMed

Semedo, Magda C; Karmali, Amin; Fonseca, Luís

2015-02-01

Mushroom strains contain complex nutritional biomolecules with a wide spectrum of therapeutic and prophylactic properties. Among these compounds, β-d-glucans play an important role in immuno-modulating and anti-tumor activities. The present work involves a novel colorimetric assay method for β-1,3-d-glucans with a triple helix tertiary structure by using Congo red. The specific interaction that occurs between Congo red and β-1,3-d-glucan was detected by bathochromic shift from 488 to 516 nm (>20 nm) in UV-Vis spectrophotometer. A micro- and high throughput method based on a 96-well microtiter plate was devised which presents several advantages over the published methods since it requires only 1.51 μg of polysaccharides in samples, greater sensitivity, speed, assay of many samples and very cheap. β-D-Glucans of several mushrooms (i.e., Coriolus versicolor, Ganoderma lucidum, Pleurotus ostreatus, Ganoderma carnosum, Hericium erinaceus, Lentinula edodes, Inonotus obliquus, Auricularia auricular, Polyporus umbellatus, Cordyseps sinensis, Agaricus blazei, Poria cocos) were isolated by using a sequence of several extractions with cold and boiling water, acidic and alkaline conditions and quantified by this microtiter plate method. FTIR spectroscopy was used to study the structural features of β-1,3-D-glucans in these mushroom samples as well as the specific interaction of these polysaccharides with Congo red. The effect of NaOH on triple helix conformation of β-1,3-D-glucans was investigated in several mushroom species. Copyright © 2014 Elsevier B.V. All rights reserved.

Molecular Characterization and Transcriptional Regulation Analysis of the Bovine PDHB Gene

PubMed Central

Li, Anning; Zhang, Yaran; Zhao, Zhidong; Wang, Mingming; Zan, Linsen

2016-01-01

The pyruvate dehydrogenase beta subunit (PDHB) is a subunit of pyruvate dehydrogenase (E1), which catalyzes pyruvate into acetyl-CoA and provides a linkage between the tricarboxylic acid cycle (TCA) and the glycolysis pathway. Previous studies demonstrated PDHB to be positively related to the intramuscular fat (IMF) content. However, the transcriptional regulation of PDHB remains unclear. In our present study, the cDNA of bovine PDHB was cloned and the genomic structure was analyzed. The phylogenetic tree showed bovine PDHB to be closely related to goat and sheep, and least related to chicken. Spatial expression pattern analysis revealed the products of bovine PDHB to be widely expressed with the highest level in the fat of testis. To understand the transcriptional regulation of bovine PDHB, 1899 base pairs (bp) of the 5’-regulatory region was cloned. Sequence analysis neither found consensus TATA-box nor CCAAT-box in the 5’-flanking region of bovine PDHB. However, a CpG island was predicted from nucleotides -284 to +117. Serial deletion constructs of the 5’-flanking region, evaluated in dual-luciferase reporter assay, revealed the core promoter to be located 490bp upstream from the transcription initiation site (+1). Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation assay (ChIP) in combination with asite-directed mutation experiment indicated both myogenin (MYOG) and the CCAAT/enhancer-binding protein beta (C/EBPß) to be important transcription factors for bovine PDHB in skeletal muscle cells and adipocytes. Our results provide an important basis for further investigation of the bovine PDHB function and regulation in cattle. PMID:27379520

Evidence of the neuron-restrictive silencer factor (NRSF) interaction with Sp3 and its synergic repression to the mu opioid receptor (MOR) gene

PubMed Central

Kim, Chun Sung; Choi, Hack Sun; Hwang, Cheol Kyu; Song, Kyu Young; Lee, Byung-Kwon; Law, Ping-Yee; Wei, Li-Na; Loh, Horace H.

2006-01-01

Previously, we reported that the neuron-restrictive silencer element (NRSE) of mu opioid receptor (MOR) functions as a critical regulator to repress the MOR transcription in specific neuronal cells, depending on neuron-restriction silence factor (NRSF) expression levels [C.S.Kim, C.K.Hwang, H.S.Choi, K.Y.Song, P.Y.Law, L.N.Wei and H.H.Loh (2004) J. Biol. Chem., 279, 46464–46473]. Herein, we identify a conserved GC sequence next to NRSE region in the mouse MOR gene. The inhibition of Sp family factors binding to this GC box by mithramycin A led to a significant increase in the endogenous MOR transcription. In the co-immunoprecipitation experiment, NRSF interacted with the full-length Sp3 factor, but not with Sp1 or two short Sp3 isoforms. The sequence specific and functional binding by Sp3 at this GC box was confirmed by in vitro gel-shift assays using either in vitro translated proteins or nuclear extract, and by in vivo chromatin immunoprecipitation assays. Transient transfection assays showed that Sp3-binding site of the MOR gene is a functionally synergic repressor element with NRSE in NS20Y cells, but not in the NRSF negative PC12 cells. The results suggest that the synergic interaction between NRSF and Sp3 is required to negatively regulate MOR gene transcription and that transcription of MOR gene would be governed by the context of available transcription factors rather than by a master regulator. PMID:17130167

Ferrocene and (arene)ruthenium(II) complexes of the natural anticancer naphthoquinone plumbagin with enhanced efficacy against resistant cancer cells and a genuine mode of action.

PubMed

Spoerlein-Guettler, Cornelia; Mahal, Katharina; Schobert, Rainer; Biersack, Bernhard

2014-09-01

A series of ferrocene and (arene)ruthenium(II) complexes attached to the naturally occurring anticancer naphthoquinones plumbagin and juglone was tested for efficacy against various cancer cell lines and for alterations in the mode of action. The plumbagin ferrocene and (p-cymene)Ru(II) conjugates 1c and 2a overcame the multi-drug drug resistance of KB-V1/Vbl cervix carcinoma cells and showed IC50 (72 h) values around 1 μM in growth inhibition assays using 3-(4,5-dimethyl-2-yl)-2,5-diphenyltetrazolium bromide (MTT). They were further investigated for their influence on the cell cycle of KB-V1/Vbl and HCT-116 colon carcinoma cells, on the generation of reactive oxygen species (ROS) by the latter cell line, for their substrate character for the P-glycoprotein drug eflux pump via the calcein-AM efflux assays, and for DNA affinity by the electrophoretic mobility shift assay (EMSA). The derivatives 1c and 2a increased the number of dead cancer cells (sub-G0/G1 fraction) in a dose- and time-dependent manner. ROS levels were significantly increased upon treatment with 1c and 2a. These compounds also showed a greater affinity to linear DNA than plumbagin. While plumbagin did not affect calcein-AM transport by P-glycoprotein the derivatives 1c and 2a exhibited a 50% or 80% inhibition of the P-glycoprotein-mediated calcein-AM efflux relative to the clinically established sensitizer verapamil. Copyright © 2014 Elsevier Inc. All rights reserved.

Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

PubMed

Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

2009-08-13

Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

Optimization of protein buffer cocktails using Thermofluor.

PubMed

Reinhard, Linda; Mayerhofer, Hubert; Geerlof, Arie; Mueller-Dieckmann, Jochen; Weiss, Manfred S

2013-02-01

The stability and homogeneity of a protein sample is strongly influenced by the composition of the buffer that the protein is in. A quick and easy approach to identify a buffer composition which increases the stability and possibly the conformational homogeneity of a protein sample is the fluorescence-based thermal-shift assay (Thermofluor). Here, a novel 96-condition screen for Thermofluor experiments is presented which consists of buffer and additive parts. The buffer screen comprises 23 different buffers and the additive screen includes small-molecule additives such as salts and nucleotide analogues. The utilization of small-molecule components which increase the thermal stability of a protein sample frequently results in a protein preparation of higher quality and quantity and ultimately also increases the chances of the protein crystallizing.

Redox states of Desulfovibrio vulgaris DsrC, a key protein in dissimilatory sulfite reduction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Venceslau, Sofia S.; Cort, John R.; Baker, Erin Shammel

2013-11-29

Dissimilatory reduction of sulfite is carried out by the siroheme enzyme DsrAB, with the involvement of the protein DsrC having two conserved cysteine residues. Here, we report a study of the distribution of DsrC in cell extracts, a cysteine-labelling gel-shift assay to monitor its redox state and behaviour, and procedures to produce the different redox forms. We show that, in the model sulfate reducer Desulfovibrio vulgaris, the majority of DsrC is not associated with DsrAB and is thus free to interact with other proteins. In addition, we successfully produced DsrC with an intramolecular disulfide bond (oxidized state) by treatment withmore » arginine.« less

Differential regulation of ParaHox genes by retinoic acid in the invertebrate chordate amphioxus (Branchiostoma floridae).

PubMed

Osborne, Peter W; Benoit, Gérard; Laudet, Vincent; Schubert, Michael; Ferrier, David E K

2009-03-01

The ParaHox cluster is the evolutionary sister to the Hox cluster. Like the Hox cluster, the ParaHox cluster displays spatial and temporal regulation of the component genes along the anterior/posterior axis in a manner that correlates with the gene positions within the cluster (a feature called collinearity). The ParaHox cluster is however a simpler system to study because it is composed of only three genes. We provide a detailed analysis of the amphioxus ParaHox cluster and, for the first time in a single species, examine the regulation of the cluster in response to a single developmental signalling molecule, retinoic acid (RA). Embryos treated with either RA or RA antagonist display altered ParaHox gene expression: AmphiGsx expression shifts in the neural tube, and the endodermal boundary between AmphiXlox and AmphiCdx shifts its anterior/posterior position. We identified several putative retinoic acid response elements and in vitro assays suggest some may participate in RA regulation of the ParaHox genes. By comparison to vertebrate ParaHox gene regulation we explore the evolutionary implications. This work highlights how insights into the regulation and evolution of more complex vertebrate arrangements can be obtained through studies of a simpler, unduplicated amphioxus gene cluster.

Behavioral evidence for fruit odor discrimination and sympatric host races of Rhagoletis pomonella flies in the Western United States.

PubMed

Linn, Charles E; Yee, Wee L; Sim, Sheina B; Cha, Dong H; Powell, Thomas H Q; Goughnour, Robert B; Feder, Jeffrey L

2012-11-01

The recent shift of Rhagoletis pomonella (Diptera: Tephritidae) from its native host downy hawthorn, Crataegus mollis, to introduced domesticated apple, Malus domestica, in the eastern United States is a model for sympatric host race formation. However, the fly is also present in the western United States, where it may have been introduced via infested apples within the last 60 years. In addition to apple, R. pomonella also infests two hawthorns in the West, one the native black hawthorn, C. douglasii, and the other the introduced English ornamental hawthorn, C. monogyna. Here, we test for behavioral evidence of host races in the western United States. through flight tunnel assays of western R. pomonella flies to host fruit volatile blends. We report that western apple, black hawthorn, and ornamental hawthorn flies showed significantly increased levels of upwind-directed flight to their respective natal compared to nonnatal fruit volatile blends, consistent with host race status. We discuss the implications of the behavioral results for the origin(s) of western R. pomonella, including the possibility that western apple flies were not introduced, but may represent a recent shift from local hawthorn fly populations. © 2012 The Author(s). Evolution© 2012 The Society for the Study of Evolution.

Solution structure of leptospiral LigA4 Big domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mei, Song; Zhang, Jiahai; Zhang, Xuecheng

Pathogenic Leptospiraspecies express immunoglobulin-like proteins which serve as adhesins to bind to the extracellular matrices of host cells. Leptospiral immunoglobulin-like protein A (LigA), a surface exposed protein containing tandem repeats of bacterial immunoglobulin-like (Big) domains, has been proved to be involved in the interaction of pathogenic Leptospira with mammalian host. In this study, the solution structure of the fourth Big domain of LigA (LigA4 Big domain) from Leptospira interrogans was solved by nuclear magnetic resonance (NMR). The structure of LigA4 Big domain displays a similar bacterial immunoglobulin-like fold compared with other Big domains, implying some common structural aspects of Bigmore » domain family. On the other hand, it displays some structural characteristics significantly different from classic Ig-like domain. Furthermore, Stains-all assay and NMR chemical shift perturbation revealed the Ca{sup 2+} binding property of LigA4 Big domain. - Highlights: • Determining the solution structure of a bacterial immunoglobulin-like domain from a surface protein of Leptospira. • The solution structure shows some structural characteristics significantly different from the classic Ig-like domains. • A potential Ca{sup 2+}-binding site was identified by strains-all and NMR chemical shift perturbation.« less

Genetic models in applied physiology: selected contribution: effects of spaceflight on immunity in the C57BL/6 mouse. I. Immune population distributions

NASA Technical Reports Server (NTRS)

Pecaut, Michael J.; Nelson, Gregory A.; Peters, Luanne L.; Kostenuik, Paul J.; Bateman, Ted A.; Morony, Sean; Stodieck, Louis S.; Lacey, David L.; Simske, Steven J.; Gridley, Daila S.

2003-01-01

There are several aspects of the spaceflight environment that may lead to changes in immunity: mission-related psychological stress, radiation, and changes in gravity. On December 5, 2001, the space shuttle Endeavor launched for a 12-day mission to examine these effects on C57BL/6 mice for the first time. On their return, assays were performed on the spleen, blood, and bone marrow. In response to flight, there were no significant differences in the general circulating leukocyte proportions. In contrast, there was an increase in splenic lymphocyte percentages, with a corresponding decrease in granulocytes. There was an overall shift in splenic lymphocytes away from T cells toward B cells, and a decrease in the CD4-to-CD8 ratios due to a decrease in T helpers. In contrast, there were proportional increases in bone marrow T cells, with decreases in B cells. Although the blast percentage and count were decreased in flight mice, the CD34(+) population was increased. The data were more consistent with a shift in bone marrow populations rather than a response to changes in the periphery. Many of the results are similar to those using other models. Clearly, spaceflight can influence immune parameters ranging from hematopoiesis to mature leukocyte mechanisms.

Real-time monitoring of metabolic function in liver-on-chip microdevices tracks the dynamics of mitochondrial dysfunction

PubMed Central

Bavli, Danny; Prill, Sebastian; Ezra, Elishai; Levy, Gahl; Cohen, Merav; Vinken, Mathieu; Vanfleteren, Jan; Jaeger, Magnus; Nahmias, Yaakov

2016-01-01

Microfluidic organ-on-a-chip technology aims to replace animal toxicity testing, but thus far has demonstrated few advantages over traditional methods. Mitochondrial dysfunction plays a critical role in the development of chemical and pharmaceutical toxicity, as well as pluripotency and disease processes. However, current methods to evaluate mitochondrial activity still rely on end-point assays, resulting in limited kinetic and prognostic information. Here, we present a liver-on-chip device capable of maintaining human tissue for over a month in vitro under physiological conditions. Mitochondrial respiration was monitored in real time using two-frequency phase modulation of tissue-embedded phosphorescent microprobes. A computer-controlled microfluidic switchboard allowed contiguous electrochemical measurements of glucose and lactate, providing real-time analysis of minute shifts from oxidative phosphorylation to anaerobic glycolysis, an early indication of mitochondrial stress. We quantify the dynamics of cellular adaptation to mitochondrial damage and the resulting redistribution of ATP production during rotenone-induced mitochondrial dysfunction and troglitazone (Rezulin)-induced mitochondrial stress. We show troglitazone shifts metabolic fluxes at concentrations previously regarded as safe, suggesting a mechanism for its observed idiosyncratic effect. Our microfluidic platform reveals the dynamics and strategies of cellular adaptation to mitochondrial damage, a unique advantage of organ-on-chip technology. PMID:27044092

Fragment Screening of Human Aquaporin 1

PubMed Central

To, Janet; Torres, Jaume

2016-01-01

Aquaporins (AQPs) are membrane proteins that enable water transport across cellular plasma membranes in response to osmotic gradients. Phenotypic analyses have revealed important physiological roles for AQPs, and the potential for AQP water channel modulators in various disease states has been proposed. For example, AQP1 is overexpressed in tumor microvessels, and this correlates with higher metastatic potential and aggressiveness of the malignancy. Chemical modulators would help in identifying the precise contribution of water channel activity in these disease states. These inhibitors would also be important therapeutically, e.g., in anti-cancer treatment. This perceived importance contrasts with the lack of success of high-throughput screens (HTS) to identify effective and specific inhibitors of aquaporins. In this paper, we have screened a library of 1500 “fragments”, i.e., smaller than molecules used in HTS, against human aquaporin (hAQP1) using a thermal shift assay and surface plasmon resonance. Although these fragments may not inhibit their protein target, they bound to and stabilized hAQP1 (sub mM binding affinities (KD), with an temperature of aggregation shift ΔTagg of +4 to +50 °C) in a concentration-dependent fashion. Chemically expanded versions of these fragments should follow the determination of their binding site on the aquaporin surface. PMID:27023529

Aptamer conjugated silver nanoparticles for the detection of interleukin 6

NASA Astrophysics Data System (ADS)

Locke, Andrea K.; Norwood, Nicole; Marks, Haley L.; Schechinger, Monika; Jackson, George W.; Graham, Duncan; Coté, Gerard L.

2016-03-01

The controlled assembly of plasmonic nanoparticles by a molecular binding event has emerged as a simple yet sensitive methodology for protein detection. Metallic nanoparticles (NPs) coated with functionalized aptamers can be utilized as biosensors by monitoring changes in particle optical properties, such as the LSPR shift and enhancement of the SERS spectra, in the presence of a target protein. Herein we test this method using two modified aptamers selected for the protein biomarker interleukin 6, an indicator of the dengue fever virus and other diseases including certain types of cancers, diabetes, and even arthritis. IL6 works by inducing an immunological response within the body that can be either anti-inflammatory or pro-inflammatory. The results show that the average hydrodynamic diameter of the NPs as measured by Dynamic Light Scattering was ~42 nm. After conjugation of the aptamers, the peak absorbance of the AgNPs shifted from 404 to 408 nm indicating a surface modification of the NPs due to the presence of the aptamer. Lastly, preliminary results were obtained showing an increase in SERS intensity occurs when the IL-6 protein was introduced to the conjugate solution but the assay will still need to be optimized in order for it to be able to monitor varying concentration changes within and across the desired range.

Single cardiac ventricular myosins are autonomous motors

PubMed Central

Wang, Yihua; Yuan, Chen-Ching; Kazmierczak, Katarzyna; Szczesna-Cordary, Danuta

2018-01-01

Myosin transduces ATP free energy into mechanical work in muscle. Cardiac muscle has dynamically wide-ranging power demands on the motor as the muscle changes modes in a heartbeat from relaxation, via auxotonic shortening, to isometric contraction. The cardiac power output modulation mechanism is explored in vitro by assessing single cardiac myosin step-size selection versus load. Transgenic mice express human ventricular essential light chain (ELC) in wild- type (WT), or hypertrophic cardiomyopathy-linked mutant forms, A57G or E143K, in a background of mouse α-cardiac myosin heavy chain. Ensemble motility and single myosin mechanical characteristics are consistent with an A57G that impairs ELC N-terminus actin binding and an E143K that impairs lever-arm stability, while both species down-shift average step-size with increasing load. Cardiac myosin in vivo down-shifts velocity/force ratio with increasing load by changed unitary step-size selections. Here, the loaded in vitro single myosin assay indicates quantitative complementarity with the in vivo mechanism. Both have two embedded regulatory transitions, one inhibiting ADP release and a second novel mechanism inhibiting actin detachment via strain on the actin-bound ELC N-terminus. Competing regulators filter unitary step-size selection to control force-velocity modulation without myosin integration into muscle. Cardiac myosin is muscle in a molecule. PMID:29669825

The Behavior-Physiology Nexus: Behavioral and Physiological Compensation Are Relied on to Different Extents between Seasons.

PubMed

Basson, Christine H; Clusella-Trullas, Susana

2015-01-01

Environmental variability occurring at different timescales can significantly reduce performance, resulting in evolutionary fitness costs. Shifts in thermoregulatory behavior, metabolism, and water loss via phenotypic plasticity can compensate for thermal variation, but the relative contribution of each mechanism and how they may influence each other are largely unknown. Here, we take an ecologically relevant experimental approach to dissect these potential responses at two temporal scales: weather transients and seasons. Using acclimation to cold, average, or warm conditions in summer and winter, we measure the direction and magnitude of plasticity of resting metabolic rate (RMR), water loss rate (WLR), and preferred body temperature (Tpref) in the lizard Cordylus oelofseni within and between seasons. In summer, lizards selected lower Tpref when acclimated to warm versus cold but had no plasticity of either RMR or WLR. By contrast, winter lizards showed partial compensation of RMR but no behavioral compensation. Between seasons, both behavioral and physiological shifts took place. By integrating ecological reality into laboratory assays, we demonstrate that behavioral and physiological responses of C. oelofseni can be contrasting, depending on the timescale investigated. Incorporating ecologically relevant scenarios and the plasticity of multiple traits is thus essential when attempting to forecast extinction risk to climate change.

Developmental plasticity in vision and behavior may help guppies overcome increased turbidity.

PubMed

Ehlman, Sean M; Sandkam, Benjamin A; Breden, Felix; Sih, Andrew

2015-12-01

Increasing turbidity in streams and rivers near human activity is cause for environmental concern, as the ability of aquatic organisms to use visual information declines. To investigate how some organisms might be able to developmentally compensate for increasing turbidity, we reared guppies (Poecilia reticulata) in either clear or turbid water. We assessed the effects of developmental treatments on adult behavior and aspects of the visual system by testing fish from both developmental treatments in turbid and clear water. We found a strong interactive effect of rearing and assay conditions: fish reared in clear water tended to decrease activity in turbid water, whereas fish reared in turbid water tended to increase activity in turbid water. Guppies from all treatments decreased activity when exposed to a predator. To measure plasticity in the visual system, we quantified treatment differences in opsin gene expression of individuals. We detected a shift from mid-wave-sensitive opsins to long wave-sensitive opsins for guppies reared in turbid water. Since long-wavelength sensitivity is important in motion detection, this shift likely allows guppies to salvage motion-detecting abilities when visual information is obscured in turbid water. Our results demonstrate the importance of developmental plasticity in responses of organisms to rapidly changing environments.

Role of Self-Association and Supersaturation in Oral Absorption of a Poorly Soluble Weakly Basic Drug.

PubMed

Narang, Ajit S; Badawy, Sherif; Ye, Qingmei; Patel, Dhaval; Vincent, Maria; Raghavan, Krishnaswamy; Huang, Yande; Yamniuk, Aaron; Vig, Balvinder; Crison, John; Derbin, George; Xu, Yan; Ramirez, Antonio; Galella, Michael; Rinaldi, Frank A

2015-08-01

Precipitation of weakly basic drugs in intestinal fluids can affect oral drug absorption. In this study, the implications of self-association of brivanib alaninate in acidic aqueous solution, leading to supersaturation at basic pH condition, on its solubility and oral absorption were investigated. Self-association of brivanib alaninate was investigated by proton NMR spectroscopy, surface tension measurement, dynamic light scattering, isothermal titration calorimetry, and molecular modeling. Drug solubility was determined in various pH media, and its tendency to supersaturate upon pH shift was investigated in buffered and biorelevant aqueous solutions. Pharmacokinetic modeling of human oral drug absorption was utilized for parameter sensitivity analyses of input variables. Brivanib alaninate exhibited continuous, and pH- and concentration-dependent self-association. This phenomenon resulted in positive deviation of drug solubility at acidic pH and the formation of a stable supersaturated drug solution in pH-shift assays. Consistent with the supersaturation phenomenon observed in vitro, oral absorption simulations necessitated invoking long precipitation time in the intestine to successfully predict in vivo data. Self-association of a weakly basic drug in acidic aqueous solution can increase its oral absorption by supersaturation and precipitation resistance at the intestinal pH. This consideration is important to the selection of parameters for oral absorption simulation.

Light availability affects stream biofilm bacterial community composition and function, but not diversity

PubMed Central

Wagner, Karoline; Besemer, Katharina; Burns, Nancy R.; Battin, Tom J.

2015-01-01

Summary Changes in riparian vegetation or water turbidity and browning in streams alter the local light regime with potential implications for stream biofilms and ecosystem functioning. We experimented with biofilms in microcosms grown under a gradient of light intensities (range: 5–152 μmole photons s−1 m−2) and combined 454‐pyrosequencing and enzymatic activity assays to evaluate the effects of light on biofilm structure and function. We observed a shift in bacterial community composition along the light gradient, whereas there was no apparent change in alpha diversity. Multifunctionality, based on extracellular enzymes, was highest under high light conditions and decoupled from bacterial diversity. Phenol oxidase activity, involved in the degradation of polyphenolic compounds, was twice as high on average under the lowest compared with the highest light condition. This suggests a shift in reliance of microbial heterotrophs on biofilm phototroph‐derived organic matter under high light availability to more complex organic matter under low light. Furthermore, extracellular enzyme activities correlated with nutrient cycling and community respiration, supporting the link between biofilm structure–function and biogeochemical fluxes in streams. Our findings demonstrate that changes in light availability are likely to have significant impacts on biofilm structure and function, potentially affecting stream ecosystem processes. PMID:26013911

Chelerythrine down regulates expression of VEGFA, BCL2 and KRAS by arresting G-Quadruplex structures at their promoter regions.

PubMed

Jana, Jagannath; Mondal, Soma; Bhattacharjee, Payel; Sengupta, Pallabi; Roychowdhury, Tanaya; Saha, Pranay; Kundu, Pallob; Chatterjee, Subhrangsu

2017-01-19

A putative anticancer plant alkaloid, Chelerythrine binds to G-quadruplexes at promoters of VEGFA, BCL2 and KRAS genes and down regulates their expression. The association of Chelerythrine to G-quadruplex at the promoters of these oncogenes were monitored using UV absorption spectroscopy, fluorescence anisotropy, circular dichroism spectroscopy, CD melting, isothermal titration calorimetry, molecular dynamics simulation and quantitative RT-PCR technique. The pronounced hypochromism accompanied by red shifts in UV absorption spectroscopy in conjunction with ethidium bromide displacement assay indicates end stacking mode of interaction of Chelerythrine with the corresponding G-quadruplex structures. An increase in fluorescence anisotropy and CD melting temperature of Chelerythrine-quadruplex complex revealed the formation of stable Chelerythrine-quadruplex complex. Isothermal titration calorimetry data confirmed that Chelerythrine-quadruplex complex formation is thermodynamically favourable. Results of quantative RT-PCR experiment in combination with luciferase assay showed that Chelerythrine treatment to MCF7 breast cancer cells effectively down regulated transcript level of all three genes, suggesting that Chelerythrine efficiently binds to in cellulo quadruplex motifs. MD simulation provides the molecular picture showing interaction between Chelerythrine and G-quadruplex. Binding of Chelerythrine with BCL2, VEGFA and KRAS genes involved in evasion, angiogenesis and self sufficiency of cancer cells provides a new insight for the development of future therapeutics against cancer.

Nanoplasmonic biochips for rapid label-free detection of imidacloprid pesticides with a smartphone.

PubMed

Lee, Kuang-Li; You, Meng-Lin; Tsai, Chia-Hsin; Lin, En-Hung; Hsieh, Shu-Yi; Ho, Ming-Hsun; Hsu, Ju-Chun; Wei, Pei-Kuen

2016-01-15

The widespread and intensive use of neonicotinoid insecticides induces negative cascading effects on ecosystems. It is desirable to develop a portable sensitive sensing platform for on-site screening of high-risk pesticides. We combined an indirect competitive immunoassay, highly sensitive surface plasmon resonance (SPR) biochip and a simple portable imaging setup for label-free detection of imidacloprid pesticides. The SPR biochip consists of several capped nanoslit arrays with different periods which form a spectral image on the chip. The qualitative and semiquantitative analyses of pesticides can be directly observed from the spot shift on the chip. The precise semiquantitative analyses can be further completed by using image processing in a smartphone. We demonstrate simultaneous detection of four different concentrations of imidacloprid pesticides. The visual detection limit is about 1ppb, which is well below the maximum residue concentration permitted by law (20ppb). Compared to the one-step strip assay, the proposed chip is capable of performing semiquantitative analyses and multiple detection. Compared to the enzyme-linked immunosorbent assay, our method is label-free and requires simple washing steps and short reaction time. In addition, the label-free chip has a comparable sensitivity but wider working range than those labeling techniques. Copyright © 2015 Elsevier B.V. All rights reserved.

Noninvasive evaluation of tissue-engineered cartilage with time-resolved laser-induced fluorescence spectroscopy.

PubMed

Kutsuna, Toshiharu; Sato, Masato; Ishihara, Miya; Furukawa, Katsuko S; Nagai, Toshihiro; Kikuchi, Makoto; Ushida, Takashi; Mochida, Joji

2010-06-01

Regenerative medicine requires noninvasive evaluation. Our objective is to investigate the application of time-resolved laser-induced fluorescence spectroscopy (TR-LIFS) using a nano-second-pulsed laser for evaluation of tissue-engineered cartilage (TEC). To prepare scaffold-free TEC, articular chondrocytes from 4-week-old Japanese white rabbits were harvested, and were inoculated at a high density in a mold. Cells were cultured for 5 weeks by rotating culture (RC) or static culture (SC). The RC group and SC group at each week (n = 5), as well as normal articular cartilage and purified collagen type II (as controls), were analyzed by TR-LIFS. The peak wavelength was compared with those of type II collagen immunostaining and type II collagen quantification by enzyme-linked immunosorbent assay and tensile testing. The fluorescence peak wavelength of the TEC analyzed by this method shifted significantly in the RC group at 3 weeks, and in the SC group at 5 weeks (p < 0.01). These results correlated with changes in type II collagen (enzyme-linked immunosorbent assay) and changes in Young's modulus on tensile testing. The results were also supported by immunohistologic findings (type II collagen staining). Our findings show that TR-LIFS is useful for evaluating TEC.

Hypoxia inducible factor-1 mediates the expression of the immune checkpoint HLA-G in glioma cells through hypoxia response element located in exon 2.

PubMed

Yaghi, Layale; Poras, Isabelle; Simoes, Renata T; Donadi, Eduardo A; Tost, Jörg; Daunay, Antoine; de Almeida, Bibiana Sgorla; Carosella, Edgardo D; Moreau, Philippe

2016-09-27

HLA-G is an immune checkpoint molecule with specific relevance in cancer immunotherapy. It was first identified in cytotrophoblasts, protecting the fetus from maternal rejection. HLA-G tissue expression is very restricted but induced in numerous malignant tumors such as glioblastoma, contributing to their immune escape. Hypoxia occurs during placenta and tumor development and was shown to activate HLA-G. We aimed to elucidate the mechanisms of HLA-G activation under conditions combining hypoxia-mimicking treatment and 5-aza-2'deoxycytidine, a DNA demethylating agent used in anti-cancer therapy which also induces HLA-G. Both treatments enhanced the amount of HLA-G mRNA and protein in HLA-G negative U251MG glioma cells. Electrophoretic Mobility Shift Assays and luciferase reporter gene assays revealed that HLA-G upregulation depends on Hypoxia Inducible Factor-1 (HIF-1) and a hypoxia responsive element (HRE) located in exon 2. A polymorphic HRE at -966 bp in the 5'UT region may modulate the magnitude of the response mediated by the exon 2 HRE. We suggest that therapeutic strategies should take into account that HLA-G expression in response to hypoxic tumor environment is dependent on HLA-G gene polymorphism and DNA methylation state at the HLA-G locus.

Human pluripotent stem cells on artificial microenvironments: a high content perspective

PubMed Central

Viswanathan, Priyalakshmi; Gaskell, Terri; Moens, Nathalie; Culley, Oliver J.; Hansen, Darrick; Gervasio, Mia K. R.; Yeap, Yee J.; Danovi, Davide

2014-01-01

Self-renewing stem cell populations are increasingly considered as resources for cell therapy and tools for drug discovery. Human pluripotent stem (hPS) cells in particular offer a virtually unlimited reservoir of homogeneous cells and can be differentiated toward diverse lineages. Many diseases show impairment in self-renewal or differentiation, abnormal lineage choice or other aberrant cell behavior in response to chemical or physical cues. To investigate these responses, there is a growing interest in the development of specific assays using hPS cells, artificial microenvironments and high content analysis. Several hurdles need to be overcome that can be grouped into three areas: (i) availability of robust, homogeneous, and consistent cell populations as a starting point; (ii) appropriate understanding and use of chemical and physical microenvironments; (iii) development of assays that dissect the complexity of cell populations in tissues while mirroring specific aspects of their behavior. Here we review recent progress in the culture of hPS cells and we detail the importance of the environment surrounding the cells with a focus on synthetic material and suitable high content analysis approaches. The technologies described, if properly combined, have the potential to create a paradigm shift in the way diseases are modeled and drug discovery is performed. PMID:25071572

Surface changes and polymyxin interactions with a resistant strain of Klebsiella pneumoniae.

PubMed

Velkov, Tony; Deris, Zakuan Z; Huang, Johnny X; Azad, Mohammad A K; Butler, Mark; Sivanesan, Sivashangarie; Kaminskas, Lisa M; Dong, Yao-Da; Boyd, Ben; Baker, Mark A; Cooper, Matthew A; Nation, Roger L; Li, Jian

2014-05-01

This study examines the interaction of polymyxin B and colistin with the surface and outer membrane components of a susceptible and resistant strain of Klebsiella pneumoniae. The interaction between polymyxins and bacterial membrane and isolated LPS from paired wild type and polymyxin-resistant strains of K. pneumoniae were examined with N-phenyl-1-naphthylamine (NPN) uptake, fluorometric binding and thermal shift assays, lysozyme and deoxycholate sensitivity assays, and by (1)H NMR. LPS from the polymyxin-resistant strain displayed a reduced binding affinity for polymyxins B and colistin in comparison with the wild type LPS. The outer membrane NPN permeability of the resistant strain was greater compared with the susceptible strain. Polymyxin exposure enhanced the permeability of the outer membrane of the wild type strain to lysozyme and deoxycholate, whereas polymyxin concentrations up to 32 mg/ml failed to permeabilize the outer membrane of the resistant strain. Zeta potential measurements revealed that mid-logarithmic phase wild type cells exhibited a greater negative charge than the mid-logarithmic phase-resistant cells. Taken together, our findings suggest that the resistant derivative of K. pneumoniae can block the electrostatically driven first stage of polymyxin action, which thereby renders the hydrophobically driven second tier of polymyxin action on the outer membrane inconsequential.

Interactions between the promoter and first intron are involved in transcriptional control of alpha 1(I) collagen gene expression.

PubMed Central

Bornstein, P; McKay, J; Liska, D J; Apone, S; Devarayalu, S

1988-01-01

The first intron of the human collagen alpha 1(I) gene contains several positively and negatively acting elements. We have studied the transcription of collagen-human growth hormone fusion genes, containing deletions and rearrangements of collagen intronic sequences, by transient transfection of chick tendon fibroblasts and NIH 3T3 cells. In chick tendon fibroblasts, but not in 3T3 cells, inversion of intronic sequences containing a previously studied 274-base-pair segment, A274, resulted in markedly reduced human growth hormone mRNA levels as determined by an RNase protection assay. This inhibitory effect was largely alleviated when deletions were introduced in the collagen promoter of plasmids containing negatively oriented intronic sequences. Evidence for interaction of the promoter with the intronic segment, A274, was obtained by gel mobility shift assays. We suggest that promoter-intron interactions, mediated by DNA-binding proteins, regulate collagen gene transcription. Inversion of intronic segments containing critical interactive elements might then lead to an altered geometry and reduced activity of a transcriptional complex in those cells with sufficiently high levels of appropriate transcription factors. We further suggest that the deleted promoter segment plays a key role in directing DNA interactions involved in transcriptional control. Images PMID:3211130

Functional Analysis of the Epidermal-Specific MYB Genes CAPRICE and WEREWOLF in Arabidopsis[W

PubMed Central

Tominaga, Rumi; Iwata, Mineko; Okada, Kiyotaka; Wada, Takuji

2007-01-01

Epidermis cell differentiation in Arabidopsis thaliana is a model system for understanding the developmental end state of plant cells. Two types of MYB transcription factors, R2R3-MYB and R3-MYB, are involved in cell fate determination. To examine the molecular basis of this process, we analyzed the functional relationship of the R2R3-type MYB gene WEREWOLF (WER) and the R3-type MYB gene CAPRICE (CPC). Chimeric constructs made from the R3 MYB regions of WER and CPC used in reciprocal complementation experiments showed that the CPC R3 region cannot functionally substitute for the WER R3 region in the differentiation of hairless cells. However, WER R3 can substantially substitute for CPC R3. There are no differences in yeast interaction assays of WER or WER chimera proteins with GLABRA3 (GL3) or ENHANCER OF GLABRA3 (EGL3). CPC and CPC chimera proteins also have similar activity in preventing GL3 WER and EGL3 WER interactions. Furthermore, we showed by gel mobility shift assays that WER chimera proteins do not bind to the GL2 promoter region. However, a CPC chimera protein, which harbors the WER R3 motif, still binds to the GL2 promoter region. PMID:17644729

Functional analysis of the epidermal-specific MYB genes CAPRICE and WEREWOLF in Arabidopsis.

PubMed

Tominaga, Rumi; Iwata, Mineko; Okada, Kiyotaka; Wada, Takuji

2007-07-01

Epidermis cell differentiation in Arabidopsis thaliana is a model system for understanding the developmental end state of plant cells. Two types of MYB transcription factors, R2R3-MYB and R3-MYB, are involved in cell fate determination. To examine the molecular basis of this process, we analyzed the functional relationship of the R2R3-type MYB gene WEREWOLF (WER) and the R3-type MYB gene CAPRICE (CPC). Chimeric constructs made from the R3 MYB regions of WER and CPC used in reciprocal complementation experiments showed that the CPC R3 region cannot functionally substitute for the WER R3 region in the differentiation of hairless cells. However, WER R3 can substantially substitute for CPC R3. There are no differences in yeast interaction assays of WER or WER chimera proteins with GLABRA3 (GL3) or ENHANCER OF GLABRA3 (EGL3). CPC and CPC chimera proteins also have similar activity in preventing GL3 WER and EGL3 WER interactions. Furthermore, we showed by gel mobility shift assays that WER chimera proteins do not bind to the GL2 promoter region. However, a CPC chimera protein, which harbors the WER R3 motif, still binds to the GL2 promoter region.

A common FADS2 promoter polymorphism increases promoter activity and facilitates binding of transcription factor ELK1

PubMed Central

Lattka, E.; Eggers, S.; Moeller, G.; Heim, K.; Weber, M.; Mehta, D.; Prokisch, H.; Illig, T.; Adamski, J.

2010-01-01

Fatty acid desaturases (FADS) play an important role in the formation of omega-6 and omega-3 highly unsaturated fatty acids (HUFAs). The composition of HUFAs in the human metabolome is important for membrane fluidity and for the modulation of essential physiological functions such as inflammation processes and brain development. Several recent studies reported significant associations of single nucleotide polymorphisms (SNPs) in the human FADS gene cluster with HUFA levels and composition. The presence of the minor allele correlated with a decrease of desaturase reaction products and an accumulation of substrates. We performed functional studies with two of the associated polymorphisms (rs3834458 and rs968567) and showed an influence of polymorphism rs968567 on FADS2 promoter activity by luciferase reporter gene assays. Electrophoretic mobility shift assays proved allele-dependent DNA-binding ability of at least two protein complexes to the region containing SNP rs968567. One of the proteins binding to this region in an allele-specific manner was shown to be the transcription factor ELK1 (a member of ETS domain transcription factor family). These results indicate that rs968567 influences FADS2 transcription and offer first insights into the modulation of complex regulation mechanisms of FADS2 gene transcription by SNPs. PMID:19546342

A common FADS2 promoter polymorphism increases promoter activity and facilitates binding of transcription factor ELK1.

PubMed

Lattka, E; Eggers, S; Moeller, G; Heim, K; Weber, M; Mehta, D; Prokisch, H; Illig, T; Adamski, J

2010-01-01

Fatty acid desaturases (FADS) play an important role in the formation of omega-6 and omega-3 highly unsaturated fatty acids (HUFAs). The composition of HUFAs in the human metabolome is important for membrane fluidity and for the modulation of essential physiological functions such as inflammation processes and brain development. Several recent studies reported significant associations of single nucleotide polymorphisms (SNPs) in the human FADS gene cluster with HUFA levels and composition. The presence of the minor allele correlated with a decrease of desaturase reaction products and an accumulation of substrates. We performed functional studies with two of the associated polymorphisms (rs3834458 and rs968567) and showed an influence of polymorphism rs968567 on FADS2 promoter activity by luciferase reporter gene assays. Electrophoretic mobility shift assays proved allele-dependent DNA-binding ability of at least two protein complexes to the region containing SNP rs968567. One of the proteins binding to this region in an allele-specific manner was shown to be the transcription factor ELK1 (a member of ETS domain transcription factor family). These results indicate that rs968567 influences FADS2 transcription and offer first insights into the modulation of complex regulation mechanisms of FADS2 gene transcription by SNPs.

Sol-Gel-Based Titania-Silica Thin Film Overlay for Long Period Fiber Grating-Based Biosensors.

PubMed

Chiavaioli, Francesco; Biswas, Palas; Trono, Cosimo; Jana, Sunirmal; Bandyopadhyay, Somnath; Basumallick, Nandini; Giannetti, Ambra; Tombelli, Sara; Bera, Susanta; Mallick, Aparajita; Baldini, Francesco

2015-12-15

An evanescent wave optical fiber biosensor based on titania-silica-coated long period grating (LPG) is presented. The chemical overlay, which increases the refractive index (RI) sensitivity of the sensor, consists of a sol-gel-based titania-silica thin film, deposited along the sensing portion of the fiber by means of the dip-coating technique. Changing both the sol viscosity and the withdrawal speed during the dip-coating made it possible to adjust the thickness of the film overlay, which is a crucial parameter for the sensor performance. After the functionalization of the fiber surface using a methacrylic acid/methacrylate copolymer, an antibody/antigen (IgG/anti-IgG) assay was carried out to assess the performance of sol-gel based titania-silica-coated LPGs as biosensors. The analyte concentration was determined from the wavelength shift at the end of the binding process and from the initial binding rate. This is the first time that a sol-gel based titania-silica-coated LPG is proposed as an effective and feasible label-free biosensor. The specificity of the sensor was validated by performing the same model assay after spiking anti-IgG into human serum. With this structured LPG, detection limits of the order of tens of micrograms per liter (10(-11) M) are attained.

Drug designs fulfilling the requirements of clinical trials aiming at personalizing medicine

PubMed Central

Mandrekar, Sumithra J.; Sargent, Daniel J.

2014-01-01

In the current era of stratified medicine and biomarker-driven therapies, the focus has shifted from predictions based on the traditional anatomic staging systems to guide the choice of treatment for an individual patient to an integrated approach using the genetic makeup of the tumor and the genotype of the patient. The clinical trial designs utilized in the developmental pathway for biomarkers and biomarker-directed therapies from discovery to clinical practice are rapidly evolving. While several issues need careful consideration, two critical issues that surround the validation of biomarkers are the choice of the clinical trial design (which is based on the strength of the preliminary evidence and marker prevalence), and biomarker assay related issues surrounding the marker assessment methods such as the reliability and reproducibility of the assay. In this review, we focus on trial designs aiming at personalized medicine in the context of early phase trials for initial marker validation, as well as in the context of larger definitive trials. Designs for biomarker validation are broadly classified as retrospective (i.e., using data from previously well-conducted randomized controlled trials (RCTs) versus prospective (enrichment, all-comers, hybrid or adaptive). We believe that the systematic evaluation and implementation of these design strategies are essential to accelerate the clinical validation of biomarker guided therapy. PMID:25414851

Cross-species extrapolation of toxicity information using the ...

EPA Pesticide Factsheets

In the United States, the Endocrine Disruptor Screening Program (EDSP) was established to identify chemicals that may lead to adverse effects via perturbation of the endocrine system (i.e., estrogen, androgen, and thyroid hormone systems). In the mid-1990s the EDSP adopted a two tiered approach for screening chemicals that applied standardized in vitro and in vivo toxicity tests. The Tier 1 screening assays were designed to identify substances that have the potential of interacting with the endocrine system and Tier 2 testing was developed to identify adverse effects caused by the chemical, with documentation of dose-response relationships. While this tiered approach was effective in identifying possible endocrine disrupting chemicals, the cost and time to screen a single chemical was significant. Therefore, in 2012 the EDSP proposed a transition to make greater use of computational approaches (in silico) and high-throughput screening (HTS; in vitro) assays to more rapidly and cost-efficiently screen chemicals for endocrine activity. This transition from resource intensive, primarily in vivo, screening methods to more pathway-based approaches aligns with the simultaneously occurring transformation in toxicity testing termed “Toxicity Testing in the 21st Century” which shifts the focus to the disturbance of the biological pathway predictive of the observable toxic effects. An example of such screening tools include the US Environmental Protection Agency’s

Amino acid substitutions affecting aspartic acid 605 and valine 606 decrease the interaction strength between the influenza virus RNA polymerase PB2 '627' domain and the viral nucleoprotein.

PubMed

Hsia, Ho-Pan; Yang, Yin-Hua; Szeto, Wun-Chung; Nilsson, Benjamin E; Lo, Chun-Yeung; Ng, Andy Ka-Leung; Fodor, Ervin; Shaw, Pang-Chui

2018-01-01

The influenza virus RNA genome is transcribed and replicated in the context of the viral ribonucleoprotein (vRNP) complex by the viral RNA polymerase. The nucleoprotein (NP) is the structural component of the vRNP providing a scaffold for the viral RNA. In the vRNP as well as during transcription and replication the viral polymerase interacts with NP but it is unclear which parts of the polymerase and NP mediate these interactions. Previously the C-terminal '627' domain (amino acids 538-693) of PB2 was shown to interact with NP. Here we report that a fragment encompassing amino acids 146-185 of NP is sufficient to mediate this interaction. Using NMR chemical shift perturbation assays we show that amino acid region 601 to 607 of the PB2 '627' domain interacts with this fragment of NP. Substitutions of these PB2 amino acids resulted in diminished RNP activity and surface plasmon resonance assays showed that amino acids D605 was essential for the interaction with NP and V606 may also play a partial role in the interaction. Collectively these results reveal a possible interaction surface between NP and the PB2 subunit of the RNA polymerase complex.

Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

PubMed Central

Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

1993-01-01

The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

Glucose Regulates the Expression of the Apolipoprotein A5 Gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fruchart, Jamila; Nowak, Maxime; Helleboid-Chapman, Audrey

2008-04-07

The apolipoprotein A5 gene (APOA5) is a key player in determining triglyceride concentrations in humans and mice. Since diabetes is often associated with hypertriglyceridemia, this study explores whether APOA5 gene expression is regulated by alteration in glucose homeostasis and the related pathways. D-glucose activates APOA5 gene expression in a time- and dose-dependent manner in hepatocytes, and the glycolytic pathway involved was determined using D-glucose analogs and metabolites. Together, transient transfections, electrophoretic mobility shift assays and chromatin immunoprecipitation assays show that this regulation occurs at the transcriptional level through an increase of USF1/2 binding to an E-box in the APOA5 promoter.more » We show that this phenomenon is not due to an increase of mRNA or protein expression levels of USF. Using protein phosphatases 1 and 2A inhibitor, we demonstrate that D-glucose regulates APOA5 gene via a dephosphorylation mechanism, thereby resulting in an enhanced USF1/2-promoter binding. Last, subsequent suppressions of USF1/2 and phosphatases mRNA through siRNA gene silencing abolished the regulation. We demonstrate that APOA5 gene is up regulated by D-glucose and USF through phosphatase activation. These findings may provide a new cross talk between glucose and lipid metabolism.« less

The Staphylococcus aureus AirSR Two-Component System Mediates Reactive Oxygen Species Resistance via Transcriptional Regulation of Staphyloxanthin Production.

PubMed

Hall, Jeffrey W; Yang, Junshu; Guo, Haiyong; Ji, Yinduo

2017-02-01

Staphylococcus aureus is an important opportunistic pathogen and is the etiological agent of many hospital- and community-acquired infections. The golden pigment, staphyloxanthin, of S. aureus colonies distinguishes it from other staphylococci and related Gram-positive cocci. Staphyloxanthin is the product of a series of biosynthetic steps that produce a unique membrane-embedded C 30 golden carotenoid and is an important antioxidant. We observed that a strain with an inducible airR overexpression cassette had noticeably increased staphyloxanthin production compared to the wild-type strain under aerobic culturing conditions. Further analysis revealed that depletion or overproduction of the AirR response regulator resulted in a corresponding decrease or increase in staphyloxanthin production and susceptibility to killing by hydrogen peroxide, respectively. Furthermore, the genetic elimination of staphyloxanthin during AirR overproduction abolished the protective phenotype of increased staphyloxanthin production in a whole-blood survival assay. Promoter reporter and gel shift assays determined that the AirR response regulator is a direct positive regulator of the staphyloxanthin-biosynthetic operon, crtOPQMN, but is epistatic to alternative sigma factor B. Taken together, these data indicate that AirSR positively regulates the staphyloxanthin-biosynthetic operon crtOPQMN, promoting survival of S. aureus in the presence of oxidants. Copyright © 2017 American Society for Microbiology.

Structural characterization of the RNA chaperone Hfq from the nitrogen-fixing bacterium Herbaspirillum seropedicae SmR1.

PubMed

Kadowaki, Marco Antonio Seiki; Iulek, Jorge; Barbosa, João Alexandre Ribeiro Gonçalves; Pedrosa, Fábio de Oliveira; de Souza, Emanuel Maltempi; Chubatsu, Leda Satie; Monteiro, Rose Adele; de Oliveira, Marco Aurélio Schüler; Steffens, Maria Berenice Reynaud

2012-02-01

The RNA chaperone Hfq is a homohexamer protein identified as an E. coli host factor involved in phage Qβ replication and it is an important posttranscriptional regulator of several types of RNA, affecting a plethora of bacterial functions. Although twenty Hfq crystal structures have already been reported in the Protein Data Bank (PDB), new insights into these protein structures can still be discussed. In this work, the structure of Hfq from the β-proteobacterium Herbaspirillum seropedicae, a diazotroph associated with economically important agricultural crops, was determined by X-ray crystallography and small-angle X-ray scattering (SAXS). Biochemical assays such as exclusion chromatography and RNA-binding by the electrophoretic shift assay (EMSA) confirmed that the purified protein is homogeneous and active. The crystal structure revealed a conserved Sm topology, composed of one N-terminal α-helix followed by five twisted β-strands, and a novel π-π stacking intra-subunit interaction of two histidine residues, absent in other Hfq proteins. Moreover, the calculated ab initio envelope based on small-angle X-ray scattering (SAXS) data agreed with the Hfq crystal structure, suggesting that the protein has the same folding structure in solution. Copyright © 2011 Elsevier B.V. All rights reserved.

Quantitative analysis of TALE-DNA interactions suggests polarity effects.

PubMed

Meckler, Joshua F; Bhakta, Mital S; Kim, Moon-Soo; Ovadia, Robert; Habrian, Chris H; Zykovich, Artem; Yu, Abigail; Lockwood, Sarah H; Morbitzer, Robert; Elsäesser, Janett; Lahaye, Thomas; Segal, David J; Baldwin, Enoch P

2013-04-01

Transcription activator-like effectors (TALEs) have revolutionized the field of genome engineering. We present here a systematic assessment of TALE DNA recognition, using quantitative electrophoretic mobility shift assays and reporter gene activation assays. Within TALE proteins, tandem 34-amino acid repeats recognize one base pair each and direct sequence-specific DNA binding through repeat variable di-residues (RVDs). We found that RVD choice can affect affinity by four orders of magnitude, with the relative RVD contribution in the order NG > HD ≈ NN > NI > NK. The NN repeat preferred the base G over A, whereas the NK repeat bound G with 10(3)-fold lower affinity. We compared AvrBs3, a naturally occurring TALE that recognizes its target using some atypical RVD-base combinations, with a designed TALE that precisely matches 'standard' RVDs with the target bases. This comparison revealed unexpected differences in sensitivity to substitutions of the invariant 5'-T. Another surprising observation was that base mismatches at the 5' end of the target site had more disruptive effects on affinity than those at the 3' end, particularly in designed TALEs. These results provide evidence that TALE-DNA recognition exhibits a hitherto un-described polarity effect, in which the N-terminal repeats contribute more to affinity than C-terminal ones.

Novel dual ligand co-functionalized fluorescent gold nanoclusters as a versatile probe for sensitive analysis of Hg(2+) and oxytetracycline.

PubMed

Xu, Shenghao; Li, Xiaolin; Mao, Yaning; Gao, Teng; Feng, Xiuying; Luo, Xiliang

2016-04-01

In this work, we present a direct one-step strategy for rapidly preparing dual ligand co-functionalized fluorescent Au nanoclusters (NCs) by using threonine (Thr) and 11-mercaptoundecanoic acid (MUA) as assorted reductants and capping agents in aqueous solution at room temperature. Fluorescence spectra, high-resolution transmission electron microscopy (HRTEM), X-ray photoelectron spectroscopy (XPS), dynamic light scattering (DLS), and infrared (IR) spectroscopy were performed to demonstrate the optical properties and chemical composition of the as-prepared AuNCs. They possess many attractive features such as near-infrared emission (λem = 606 nm), a large Stoke's shift (>300 nm), high colloidal stability (pH, temperature, salt, and time stability), and water dispersibility. Subsequently, the as-prepared AuNCs were used as a versatile probe for "turn off" sensing of Hg(2+) based on aggregation-induced fluorescence quenching and for "turn-on" sensing of oxytetracycline (OTC). This assay provided good linearity ranging from 37.5 to 3750 nM for Hg(2+) and from 0.375 to 12.5 μM for OTC, with detection limits of 8.6 nM and 0.15 μM, respectively. Moreover, the practical application of this assay was further validated by detecting OTC in human serum samples.

The red/white colony color assay in the yeast Saccharomyces cerevisiae: epistatic growth advantage of white ade8-18, ade2 cells over red ade2 cells.

PubMed

Ugolini, S; Bruschi, C V

1996-12-01

In the yeast Saccharomyces cerevisiae the ade2, and/or the ade1, mutation in the adenine biosynthetic pathway leads to the accumulation of a cell-limited red pigment, while epistatic mutations in the same pathway, i.e. ade8, preclude this phenomenon, resulting in normal white colonies. The shift in color from red to white (or vice versa) with a combination of appropriate wild-type and mutant alleles of the adenine-pathway genes has been widely utilized as a non-selective phenotype to visualise and quantify the occurrence of various genetic events such as recombination, conversion and aneuploidy. It has provided an invaluable tool for the study of gene dosage and plasmid stability. In competition experiments between disrupted ade2, ade8-18 transformants carrying either a functional or non-functional episomal ADE8 gene, we verified that white ade8 ade2 cells show a remarkable selective advantage over red ade2 cells, with important implications on the use of this assay for the monitoring of genetic events. The accumulation of the red pigment in ade2 cells is likely to be the cause for impaired growth in these cells.

High mobility group box (HMGB) proteins of Plasmodium falciparum: DNA binding proteins with pro-inflammatory activity.

PubMed

Kumar, Krishan; Singal, Ankita; Rizvi, M Moshahid A; Chauhan, Virander S

2008-06-01

High mobility group box chromosomal protein 1 (HMGB1), known as an abundant, non-histone architectural chromosomal protein, is highly conserved across different species. Homologues of HMGB1 were identified and cloned from malaria parasite, Plasmodium falciparum. Sequence analyses showed that the P. falciparum HMGB1 (PfHMGB1) exhibits 45, 23 and 18%, while PfHMGB2 shares 42, 21 and 17% homology with Saccharomyces cerevisiae, human and mouse HMG box proteins respectively. Parasite PfHMGB1and PfHMGB2 proteins contain one HMG Box domain similar to B-Box of mammalian HMGB1. Electrophoretic Mobility Shift Assay (EMSA) showed that recombinant PfHMGB1 and PfHMGB2 bind to DNA. Immunofluorescence Assay using specific antibodies revealed that these proteins are expressed abundantly in the ring stage nuclei. Significant levels of PfHMGB1 and PfHMGB2 were also present in the parasite cytosol at trophozoite and schizont stages. Both, PfHMGB1 and PfHMGB2 were found to be potent inducers of pro-inflammatory cytokines such as TNFalpha from mouse peritoneal macrophages as analyzed by both reverse transcription PCR and by ELISA. These results suggest that secreted PfHMGB1 and PfHMGB2 may be responsible for eliciting/ triggering host inflammatory immune responses associated with malaria infection.

Design, synthesis, and biological evaluation of polo-like kinase 1/eukaryotic elongation factor 2 kinase (PLK1/EEF2K) dual inhibitors for regulating breast cancer cells apoptosis and autophagy.

PubMed

Pan, Zhaoping; Chen, Yujuan; Liu, Jingyan; Jiang, Qinglin; Yang, Shengyong; Guo, Li; He, Gu

2018-01-20

Both PLK1 and EEF2K are serine⁄threonine kinases that play important roles in the proliferation and programmed cell death of various types of cancer. They are highly expressed in breast cancer tissues. Based on the multiple-complexes generated pharmacophore models of PLK1 and homology models of EEF2K, the integrated virtual screening is performed to discover novel PLK1/EEF2K dual inhibitors. The top ten hit compounds are selected and tested in vitro, and five of them display PLK1 and EEF2K inhibition in vitro. Based on the docking modes of the most potent hit compound, a series of derivatives are synthesized, characterized and biological assayed on the PLK1, EEF2K as well as breast cancer cell proliferation models. Compound 18i with satisfied inhibitory potency are shifted to molecular mechanism studies contained molecular dynamics simulations, cell cycles, apoptosis and autophagy assays. Our results suggested that these novel PLK1/EEF2K dual inhibitors can be used as lead compounds for further development breast cancer chemotherapy. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases

PubMed Central

Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik

2014-01-01

Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840

Chelerythrine down regulates expression of VEGFA, BCL2 and KRAS by arresting G-Quadruplex structures at their promoter regions

NASA Astrophysics Data System (ADS)

Jana, Jagannath; Mondal, Soma; Bhattacharjee, Payel; Sengupta, Pallabi; Roychowdhury, Tanaya; Saha, Pranay; Kundu, Pallob; Chatterjee, Subhrangsu

2017-01-01

A putative anticancer plant alkaloid, Chelerythrine binds to G-quadruplexes at promoters of VEGFA, BCL2 and KRAS genes and down regulates their expression. The association of Chelerythrine to G-quadruplex at the promoters of these oncogenes were monitored using UV absorption spectroscopy, fluorescence anisotropy, circular dichroism spectroscopy, CD melting, isothermal titration calorimetry, molecular dynamics simulation and quantitative RT-PCR technique. The pronounced hypochromism accompanied by red shifts in UV absorption spectroscopy in conjunction with ethidium bromide displacement assay indicates end stacking mode of interaction of Chelerythrine with the corresponding G-quadruplex structures. An increase in fluorescence anisotropy and CD melting temperature of Chelerythrine-quadruplex complex revealed the formation of stable Chelerythrine-quadruplex complex. Isothermal titration calorimetry data confirmed that Chelerythrine-quadruplex complex formation is thermodynamically favourable. Results of quantative RT-PCR experiment in combination with luciferase assay showed that Chelerythrine treatment to MCF7 breast cancer cells effectively down regulated transcript level of all three genes, suggesting that Chelerythrine efficiently binds to in cellulo quadruplex motifs. MD simulation provides the molecular picture showing interaction between Chelerythrine and G-quadruplex. Binding of Chelerythrine with BCL2, VEGFA and KRAS genes involved in evasion, angiogenesis and self sufficiency of cancer cells provides a new insight for the development of future therapeutics against cancer.

Molecular mechanism for sphingosine-induced Pseudomonas ceramidase expression through the transcriptional regulator SphR

PubMed Central

Okino, Nozomu; Ito, Makoto

2016-01-01

Pseudomonas aeruginosa, an opportunistic, but serious multidrug-resistant pathogen, secretes a ceramidase capable of cleaving the N-acyl linkage of ceramide to generate fatty acids and sphingosine. We previously reported that the secretion of P. aeruginosa ceramidase was induced by host-derived sphingolipids, through which phospholipase C-induced hemolysis was significantly enhanced. We herein investigated the gene(s) regulating sphingolipid-induced ceramidase expression and identified SphR, which encodes a putative AraC family transcriptional regulator. Disruption of the sphR gene in P. aeruginosa markedly decreased the sphingomyelin-induced secretion of ceramidase, reduced hemolytic activity, and resulted in the loss of sphingomyelin-induced ceramidase expression. A microarray analysis confirmed that sphingomyelin significantly induced ceramidase expression in P. aeruginosa. Furthermore, an electrophoretic mobility shift assay revealed that SphR specifically bound free sphingoid bases such as sphingosine, dihydrosphingosine, and phytosphingosine, but not sphingomyelin or ceramide. A β-galactosidase-assisted promoter assay showed that sphingosine activated ceramidase expression through SphR at a concentration of 100 nM. Collectively, these results demonstrated that sphingosine induces the secretion of ceramidase by promoting the mRNA expression of ceramidase through SphR, thereby enhancing hemolytic phospholipase C-induced cytotoxicity. These results facilitate understanding of the physiological role of bacterial ceramidase in host cells. PMID:27941831

Morphometric Characterization of Rat and Human Alveolar Macrophage Cell Models and their Response to Amiodarone using High Content Image Analysis.

PubMed

Hoffman, Ewelina; Patel, Aateka; Ball, Doug; Klapwijk, Jan; Millar, Val; Kumar, Abhinav; Martin, Abigail; Mahendran, Rhamiya; Dailey, Lea Ann; Forbes, Ben; Hutter, Victoria

2017-12-01

Progress to the clinic may be delayed or prevented when vacuolated or "foamy" alveolar macrophages are observed during non-clinical inhalation toxicology assessment. The first step in developing methods to study this response in vitro is to characterize macrophage cell lines and their response to drug exposures. Human (U937) and rat (NR8383) cell lines and primary rat alveolar macrophages obtained by bronchoalveolar lavage were characterized using high content fluorescence imaging analysis quantification of cell viability, morphometry, and phospholipid and neutral lipid accumulation. Cell health, morphology and lipid content were comparable (p < 0.05) for both cell lines and the primary macrophages in terms of vacuole number, size and lipid content. Responses to amiodarone, a known inducer of phospholipidosis, required analysis of shifts in cell population profiles (the proportion of cells with elevated vacuolation or lipid content) rather than average population data which was insensitive to the changes observed. A high content image analysis assay was developed and used to provide detailed morphological characterization of rat and human alveolar-like macrophages and their response to a phospholipidosis-inducing agent. This provides a basis for development of assays to predict or understand macrophage vacuolation following inhaled drug exposure.

Effects of herbivore exclusion and nutrient enrichment on coral reef macroalgae and cyanobacteria

NASA Astrophysics Data System (ADS)

Thacker, R.; Ginsburg, D.; Paul, V.

2001-05-01

Although phase shifts on coral reefs from coral-dominated to algal-dominated communities have been attributed to the effects of increased nutrient availability due to eutrophication and reduced herbivore abundance due to overfishing and disease, these factors have rarely been manipulated simultaneously. In addition, few studies have considered the effects of these factors on benthic, filamentous cyanobacteria (blue-green algae) as well as macroalgae. We used a combination of herbivore-exclusion cages and nutrient enrichment to manipulate herbivore abundance and nutrient availability, and measured the impacts of these treatments on macroalgal and cyanobacterial community structure. In the absence of cages, surface cover of the cyanobacterium Tolypothrix sp. decreased, while surface cover of the cyanobacteria Oscillatoria spp. increased. Cyanobacterial cover decreased in partial cages, and Tolypothrix sp. cover decreased further in full cages. Lower cyanobacterial cover and biomass were correlated with higher macroalgal cover and biomass. Dictyota bartayresiana dominated the partial cages, while Padina tenuis and Tolypiocladia glomerulata recruited into the full cages. Palatability assays demonstrated that herbivore-exclusion shifted macroalgal species composition from relatively unpalatable to relatively palatable species. Nutrient enrichment interacted with herbivore exclusion to increase the change in cover of D. bartayresiana in the uncaged and fully caged plots, but did not affect the final biomass of D. bartayresiana among treatments. Nutrient enrichment did not significantly affect the cover or biomass of any other taxa. These results stress the critical role of herbivory in determining coral reef community structure and suggest that the relative palatabilities of dominant algae, as well as algal growth responses to nutrient enrichment, will determine the potential for phase shifts to algal-dominated communities.

Staphylococcus aureus Shifts toward Commensalism in Response to Corynebacterium Species

PubMed Central

Ramsey, Matthew M.; Freire, Marcelo O.; Gabrilska, Rebecca A.; Rumbaugh, Kendra P.; Lemon, Katherine P.

2016-01-01

Staphylococcus aureus–human interactions result in a continuum of outcomes from commensalism to pathogenesis. S. aureus is a clinically important pathogen that asymptomatically colonizes ~25% of humans as a member of the nostril and skin microbiota, where it resides with other bacteria including commensal Corynebacterium species. Commensal Corynebacterium spp. are also positively correlated with S. aureus in chronic polymicrobial diabetic foot infections, distinct from acute monomicrobial S. aureus infections. Recent work by our lab and others indicates that microbe–microbe interactions between S. aureus and human skin/nasal commensals, including Corynebacterium species, affect S. aureus behavior and fitness. Thus, we hypothesized that S. aureus interactions with Corynebacterium spp. diminish S. aureus virulence. We tested this by assaying for changes in S. aureus gene expression during in vitro mono- versus coculture with Corynebacterium striatum, a common skin and nasal commensal. We observed a broad shift in S. aureus gene transcription during in vitro growth with C. striatum, including increased transcription of genes known to exhibit increased expression during human nasal colonization and decreased transcription of virulence genes. S. aureus uses several regulatory pathways to transition between commensal and pathogenic states. One of these, the quorum signal accessory gene regulator (agr) system, was strongly inhibited in response to Corynebacterium spp. Phenotypically, S. aureus exposed to C. striatum exhibited increased adhesion to epithelial cells, reflecting a commensal state, and decreased hemolysin activity, reflecting an attenuation of virulence. Consistent with this, S. aureus displayed diminished fitness in experimental in vivo coinfection with C. striatum when compared to monoinfection. These data support a model in which S. aureus shifts from virulence toward a commensal state when exposed to commensal Corynebacterium species. PMID:27582729

Identification of squid species by melting temperature shifts on fluorescence melting curve analysis (FMCA) using single dual-labeled probe

NASA Astrophysics Data System (ADS)

Koh, Eunjung; Song, Ha Jeong; Kwon, Na Young; Kim, Gi Won; Lee, Kwang Ho; Jo, Soyeon; Park, Sujin; Park, Jihyun; Park, Eun Kyeong; Hwang, Seung Yong

2017-06-01

Real time PCR is a standard method for identification of species. One of limitations of the qPCR is that there would be false-positive result due to mismatched hybridization between target sequence and probe depending on the annealing temperature in the PCR condition. As an alternative, fluorescence melting curve analysis (FMCA) could be applied for species identification. FMCA is based on a dual-labeled probe. Even with subtle difference of target sequence, there are visible melting temperature (Tm) shift. One of FMCA applications is distinguishing organisms distributed and consumed globally as popular food ingredients. Their prices are set by species or country of origin. However, counterfeiting or distributing them without any verification procedure are becoming social problems and threatening food safety. Besides distinguishing them in naked eye is very difficult and almost impossible in any processed form. Therefore, it is necessary to identify species in molecular level. In this research three species of squids which have 1-2 base pair differences each are selected as samples since they have the same issue. We designed a probe which perfectly matches with one species and the others mismatches 2 and 1 base pair respectively and labeled with fluorophore and quencher. In an experiment with a single probe, we successfully distinguished them by Tm shift depending on the difference of base pair. By combining FMCA and qPCR chip, smaller-scale assay with higher sensitivity and resolution could be possible, andc furthermore, enabling results analysis with smart phone would realize point-of-care testing (POCT).

Biochemical testing in a laboratory tent and semi-intensive care of Ebola patients on-site in a remote part of Guinea: a paradigm shift based on a bleach-sensitive point-of-care device.

PubMed

Irenge, Leonid M; Dindart, Jean-Michel; Gala, Jean-Luc

2017-10-26

During the West Africa Ebola virus disease (EVD) outbreak, a Belgian laboratory was deployed for supporting the Ebola treatment unit (ETU) of N'Zerekore, Guinea. Besides diagnosis of EVD and malaria, biochemical parameters were tested and used to guide supportive treatment of EVD. To preserve analytes stability, lithium-heparin blood samples were analyzed using the i-STAT® point-of-care testing (POCT) handheld device without the viral inactivation step. To mitigate the risk of Ebola virus transmission, assays were performed inside a portable glovebox with strict biosafety procedures. Providing the medical staff with real-time biochemical data modified their therapeutic attitude, shifting from empiric to a semi-intensive laboratory-guided treatment of hydro-electrolytic disturbances, metabolic acidosis and/or impaired kidney function. As illustrated with representative EVD cases (n=8), optimized supportive treatment with intravenous fluid therapy and electrolyte replacement often helped correct these abnormalities. However, the harsh operating conditions, especially the use of bleach decontamination inside the glovebox, caused several technical failures and the final breakdown of the POCT device. POCT availability resulted in a paradigm shift in laboratory practice and care delivery at the N'Zerekore ETU. We conclude that there is urgent need for novel well-designed and validated POCT devices usable by non-expert operators in high ambient temperature and limited space. These devices should withstand regular and thorough decontamination by the personnel working on-site with life-threatening pathogens and be compatible with high biosafety level procedures. Such specific users' requirements need a European validation and standardization process of proposed solutions led by the EU Standardization Committee (CEN).

Declines in plant palatability from polar to tropical latitudes depend on herbivore and plant identity.

PubMed

Demko, Alyssa M; Amsler, Charles D; Hay, Mark E; Long, Jeremy D; McClintock, James B; Paul, Valerie J; Sotka, Erik E

2017-09-01

Long-standing theory predicts that the intensity of consumer-prey interactions declines with increasing latitude, yet for plant-herbivore interactions, latitudinal changes in herbivory rates and plant palatability have received variable support. The topic is of growing interest given that lower-latitude species are moving poleward at an accelerating rate due to climate change, and predicting local interactions will depend partly on whether latitudinal gradients occur in these critical biotic interactions. Here, we assayed the palatability of 50 seaweeds collected from polar (Antarctica), temperate (northeastern Pacific; California), and tropical (central Pacific; Fiji) locations to two herbivores native to the tropical and subtropical Atlantic, the generalist crab Mithraculus sculptus and sea urchin Echinometra lucunter. Red seaweeds (Rhodophyta) of polar and temperate origin were more readily consumed by urchins than were tropical reds. The decline in palatability with decreasing latitude is explained by shifts in tissue organic content along with the quantity and quality of secondary metabolites, degree of calcification or both. We detected no latitudinal shift in palatability of red seaweeds to crabs, nor any latitudinal shifts in palatability of brown seaweeds (Phaeophyta) to either crabs or urchins. Our results suggest that evolutionary pressure from tropical herbivores favored red seaweeds with lower palatability, either through the production of greater levels of chemical defenses, calcification, or both. Moreover, our results tentatively suggest that the "tropicalization" of temperate habitats is facilitated by the migration of tropical herbivores into temperate areas dominated by weakly defended and more nutritious foods, and that the removal of these competing seaweeds may facilitate the invasion of better-defended tropical seaweeds. © 2017 by the Ecological Society of America.

A new blue-shifted luciferase from the Brazilian Amydetes fanestratus (Coleoptera: Lampyridae) firefly: molecular evolution and structural/functional properties.

PubMed

Viviani, Vadim R; Amaral, Danilo; Prado, Rogilene; Arnoldi, Frederico G C

2011-12-01

Firefly luciferases usually produce bioluminescence in the yellow-green region, with colors in the green and yellow-orange extremes of the spectrum being less common. Several firefly luciferases have already been cloned and sequenced, and site-directed mutagenesis studies have already identified important regions and residues for bioluminescence colors. However the structural determinants and mechanisms of bioluminescence colors turned out to be elusive, mainly when comparing luciferases with a high degree of divergence. Thus comparison of more similar luciferases producing colors in the two extremes of the spectrum could be revealing. The South-American fauna of fireflies remains largely unstudied, with some unique taxa that are not found anywhere else in the world and that produce a wide range of bioluminescence colors. Among them, fireflies of the genus Amydetes are especially interesting because its taxonomical status as an independent subfamily or as a tribe is not yet solved, and because they usually produce a continuous bright blue-shifted bioluminescence. In this work we cloned the cDNA for the luciferase of the Atlantic rain forest Amydetes fanestratus firefly, which is found near Sorocaba municipality (São Paulo, Brazil). Despite showing a higher degree of identity with the South-American Cratomorphus, the European Lampyris and the Asiatic Pyrocoelia, phylogenetical analysis of the luciferase sequence support the inclusion of Amydetes as an independent subfamily. Amydetes luciferase displays one of the most blue-shifted emission spectra (λ(max) = 538 nm) among beetle luciferases, with lower pH-sensitivity and higher affinity for ATP when compared to other luciferases, making this luciferase attractive for sensitive ATP and reporter assays.

Cross-shift changes in blood inflammatory markers occur in the absence of airway obstruction in workers exposed to grain dust.

PubMed

Borm, P J; Schins, R P; Derhaag, T J; Kant, I; Jorna, T H

1996-04-01

Grain dust is well known to cause both acute and chronic respiratory disorders, and endotoxins are considered key components in this. Since endotoxins are known to elicit proinflammatory mediators, we investigated cytokine (tumor necrosis factor [TNF], interleukin-6, interleukin-8) release and a number of proinflammatory and anti-inflammatory proteins (soluble TNF receptors, lipopolysaccharide (LPS) binding protein, bactericidal permeability increasing protein (BPI), C-reactive protein) in plasma of workers exposed to grain dust. In two surveys during 1 week, lung function was measured daily before and after the shift, using flow-volume curves and/or forced oscillation measurements. On Monday and Friday, blood samples (30 mL) were drawn and cytokine release was determined by enzyme-linked immunosorbent assay in supernatant of isolated monocytes or whole blood culture, either unstimulated or on the ex vivo stimulation with 3 ng/mL or 1,000 ng/mL endotoxin. Individual exposures were determined from stationary dust measurements at every workplace combined with personal task analysis during all shifts. In both surveys, no cross-week change in lung function parameters was observed. In the first survey (average exposure: 20.2 mg/m3), monocyte spontaneous TNF release was increased sevenfold cross week (p<0.001) and was significantly related both to individual dust exposure (r=0.62) of that week and the increase in soluble TNF receptor 75 kD (r=0.85). In the second survey, where average exposure was much lower (3.67 mg/m3), impedance parameters indicated a significant improvement of airway function, and cross-week changes in inflammatory markers were minimal. Therefore, we conclude that inflammatory events can be used to monitor adverse respiratory effects of moderate grain dust exposure.

Long non-coding RNA HOTAIR, a c-Myc activated driver of malignancy, negatively regulates miRNA-130a in gallbladder cancer

PubMed Central

2014-01-01

Background Protein coding genes account for only about 2% of the human genome, whereas the vast majority of transcripts are non-coding RNAs including long non-coding RNAs. A growing volume of literature has proposed that lncRNAs are important players in cancer. HOTAIR was previously shown to be an oncogene and negative prognostic factor in a variety of cancers. However, the factors that contribute to its upregulation and the interaction between HOTAIR and miRNAs are largely unknown. Methods A computational screen of HOTAIR promoter was conducted to search for transcription-factor-binding sites. HOTAIR promoter activities were examined by luciferase reporter assay. The function of the c-Myc binding site in the HOTAIR promoter region was tested by a promoter assay with nucleotide substitutions in the putative E-box. The association of c-Myc with the HOTAIR promoter in vivo was confirmed by chromatin immunoprecipitation assay and Electrophoretic mobility shift assay. A search for miRNAs with complementary base paring with HOTAIR was performed utilizing online software program. Gain and loss of function approaches were employed to investigate the expression changes of HOTAIR or miRNA-130a. The expression levels of HOTAIR, c-Myc and miRNA-130a were examined in 65 matched pairs of gallbladder cancer tissues. The effects of HOTAIR and miRNA-130a on gallbladder cancer cell invasion and proliferation was tested using in vitro cell invasion and flow cytometric assays. Results We demonstrate that HOTAIR is a direct target of c-Myc through interaction with putative c-Myc target response element (RE) in the upstream region of HOTAIR in gallbladder cancer cells. A positive correlation between c-Myc and HOTAIR mRNA levels was observed in gallbladder cancer tissues. We predicted that HOTAIR harbors a miRNA-130a binding site. Our data showed that this binding site is vital for the regulation of miRNA-130a by HOTAIR. Moreover, a negative correlation between HOTAIR and miRNA-130a was observed in gallbladder cancer tissues. Finally, we demonstrate that the oncogenic activity of HOTAIR is in part through its negative regulation of miRNA-130a. Conclusion Together, these results suggest that HOTAIR is a c-Myc-activated driver of malignancy, which acts in part through repression of miRNA-130a. PMID:24953832

Estrogenic and serotonergic butenolides from the leaves of Piper hispidum Swingle (Piperaceae)

PubMed Central

Michel, Joanna L; Chen, Yegao; Zhang, Hongjie; Huang, Yue; Krunic, Alecjev; Orjala, Jimmy; Veliz, Mario; Soni, Kapil K.; Soejarto, Djaja Doel; Caceres, Armando; Perez, Alice; Mahady, Gail B

2010-01-01

Ethnopharmacological relevance Our previous work has demonstrated that several plants in the Piperaceae family are commonly used by the Q’eqchi Maya of Livingston, Guatemala to treat amenorrhea, dysmenorrhea, and pain. Extracts of Piper hispidum Swingle (Piperaceae), bound to the estrogen (ER) and serotonin (5-HT7) receptors. Aim of the study To investigate the estrogenic and serotonergic activities of P. hispidum extracts in functionalized assays, identify the active chemical constituents in the leaf extract, and test these compounds as agonists or antagonists of ER and 5-HT7. Materials and methods The effects of the P. hispidum leaf extracts were investigated in estrogen reporter gene and endogenous gene assays in MCF-7 cells to determine if the extracts acted as an estrogen agonist or antagonist. In addition, the active compounds were isolated using ER- and 5-HT7 receptor bioassay-guided fractionation. The structures of the purified compounds were identified using high-resolution LC-MS and NMR spectroscopic methods. The ER- and 5-HT7-agonist effects of the purified chemical constituents were tested in a 2ERE-reporter gene assay in MCF-7 cells and in serotonin binding and functionalized assays. Results Three butenolides including one new compound (1) were isolated from the leaves of P. hispidum, and their structures were determined. Compound 1 bound to the serotonin receptor 5-HT7 with IC50 values of 16.1 and 8.3 μM, respectively, and using GTP shift assays, compound 1 was found to be a partial agonist of the 5-HT7 receptor. The P. hispidum leaf extracts, as well as compounds 2 and 3 enhanced the expression of estrogen responsive reporter and endogenous genes in MCF-7 cells, demonstrating estrogen agonist effects. Conclusions Extracts of P. hispidum act as agonists of the ER and 5-HT7 receptors. Compound 1, a new natural product, identified as 9, 10-methylenedioxy-5,6-Z-fadyenolide, was isolated as the 5-HT7 agonist. Compounds 2 and 3 are reported for the first time in P. hispidum, and identified as the estrogen agonists. No inhibition of CYP450 was observed for any of these compounds in concentrations up to 1 μM. These activities are consistent with the Q’eqchi traditional use of the plant for the treatment of disorders associated with the female reproductive cycle. PMID:20304039