Structures and Binding Energies of the Naphthalene Dimer in Its Ground and Excited States.

PubMed

Dubinets, N O; Safonov, A A; Bagaturyants, A A

2016-05-05

Possible structures of the naphthalene dimer corresponding to local energy minima in the ground and excited (excimer) electronic states are comprehensively investigated using DFT-D and TDDFT-D methods with a special accent on the excimer structures. The corresponding binding and electronic transition energies are calculated, and the nature of the electronic states in different structures is analyzed. Several parallel (stacked) and T-shaped structures were found in both the ground and excited (excimer) states in a rather narrow energy range. The T-shaped structure with the lowest energy in the excited state exhibits a marked charge transfer from the upright molecule to the base one.

Dynamics, magnetic properties, and electron binding energies of H2O2 in water.

PubMed

C Cabral, Benedito J

2017-06-21

Results for the magnetic properties and electron binding energies of H 2 O 2 in liquid water are presented. The adopted methodology relies on the combination of Born-Oppenheimer molecular dynamics and electronic structure calculations. The Keal-Tozer functional was applied for predicting magnetic shieldings and H 2 O 2 intramolecular spin-spin coupling constants. Electron binding energies were calculated with electron propagator theory. In water, H 2 O 2 is a better proton donor than proton acceptor, and the present results indicate that this feature is important for understanding magnetic properties in solution. In comparison with the gas-phase, H 2 O 2 atoms are deshielded in water. For oxygen atoms, the deshielding is mainly determined by structural/conformational changes. Hydrogen-bond interactions explain the deshielding of protons in water. The predicted chemical shift for the H 2 O 2 protons in water (δ∼11.8 ppm) is in good agreement with experimental information (δ=11.2 ppm). The two lowest electron binding energies of H 2 O 2 in water (10.7±0.5 and 11.2±0.5 eV) are in reasonable agreement with experiment. In keeping with data from photoelectron spectroscopy, an ∼1.6 eV red-shift of the two first ionisation energies relative to the gas-phase is observed in water. The strong dependence of magnetic properties on changes of the electronic density in the nuclei environment is illustrated by a correlation between the σ( 17 O) magnetic shielding constant and the energy gap between the [2a] lowest valence and [1a] core orbitals of H 2 O 2 .

Donor states in inverse opals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mahan, G. D.

We calculate the binding energy of an electron bound to a donor in a semiconductor inverse opal. Inverse opals have two kinds of cavities, which we call octahedral and tetrahedral, according to their group symmetry. We put the donor in the center of each of these two cavities and obtain the binding energy. The binding energies become very large when the inverse opal is made from templates with small spheres. For spheres less than 50 nm in diameter, the donor binding can increase to several times its unconfined value. Then electrons become tightly bound to the donor and are unlikelymore » to be thermally activated to the semiconductor conduction band. This conclusion suggests that inverse opals will be poor conductors.« less

Electrostatic Interactions in Aminoglycoside-RNA Complexes

PubMed Central

Kulik, Marta; Goral, Anna M.; Jasiński, Maciej; Dominiak, Paulina M.; Trylska, Joanna

2015-01-01

Electrostatic interactions often play key roles in the recognition of small molecules by nucleic acids. An example is aminoglycoside antibiotics, which by binding to ribosomal RNA (rRNA) affect bacterial protein synthesis. These antibiotics remain one of the few valid treatments against hospital-acquired infections by Gram-negative bacteria. It is necessary to understand the amplitude of electrostatic interactions between aminoglycosides and their rRNA targets to introduce aminoglycoside modifications that would enhance their binding or to design new scaffolds. Here, we calculated the electrostatic energy of interactions and its per-ring contributions between aminoglycosides and their primary rRNA binding site. We applied either the methodology based on the exact potential multipole moment (EPMM) or classical molecular mechanics force field single-point partial charges with Coulomb formula. For EPMM, we first reconstructed the aspherical electron density of 12 aminoglycoside-RNA complexes from the atomic parameters deposited in the University at Buffalo Databank. The University at Buffalo Databank concept assumes transferability of electron density between atoms in chemically equivalent vicinities and allows reconstruction of the electron densities from experimental structural data. From the electron density, we then calculated the electrostatic energy of interaction using EPMM. Finally, we compared the two approaches. The calculated electrostatic interaction energies between various aminoglycosides and their binding sites correlate with experimentally obtained binding free energies. Based on the calculated energetic contributions of water molecules mediating the interactions between the antibiotic and rRNA, we suggest possible modifications that could enhance aminoglycoside binding affinity. PMID:25650932

Mechanical work makes important contributions to surface chemistry at steps.

PubMed

Francis, M F; Curtin, W A

2015-02-13

The effect of mechanical strain on the binding energy of adsorbates to late transition metals is believed to be entirely controlled by electronic factors, with tensile stress inducing stronger binding. Here we show, via computation, that mechanical strain of late transition metals can modify binding at stepped surfaces opposite to well-established trends on flat surfaces. The mechanism driving the trend is mechanical, arising from the relaxation of stored mechanical energy. The mechanical energy change can be larger than, and of opposite sign than, the energy changes due to electronic effects and leads to a violation of trends predicted by the widely accepted electronic 'd-band' model. This trend has a direct impact on catalytic activity, which is demonstrated here for methanation, where biaxial tension is predicted to shift the activity of nickel significantly, reaching the peak of the volcano plot and comparable to cobalt and ruthenium.

Low energy electron catalyst: the electronic origin of catalytic strategies.

PubMed

Davis, Daly; Sajeev, Y

2016-10-12

Using a low energy electron (LEE) as a catalyst, the electronic origin of the catalytic strategies corresponding to substrate selectivity, reaction specificity and reaction rate enhancement is investigated for a reversible unimolecular elementary reaction. An electronic energy complementarity between the catalyst and the substrate molecule is the origin of substrate selectivity and reaction specificity. The electronic energy complementarity is induced by tuning the electronic energy of the catalyst. The energy complementarity maximizes the binding forces between the catalyst and the molecule. Consequently, a new electronically metastable high-energy reactant state and a corresponding new low barrier reaction path are resonantly created for a specific reaction of the substrate through the formation of a catalyst-substrate transient adduct. The LEE catalysis also reveals a fundamental structure-energy correspondence in the formation of the catalyst-substrate transient adduct. Since the energy complementarities corresponding to the substrate molecules of the forward and the backward steps of the reversible reactions are not the same due to their structural differences, the LEE catalyst exhibits a unique one-way catalytic strategy, i.e., the LEE catalyst favors the reversible reaction more effectively in one direction. A characteristic stronger binding of the catalyst to the transition state of the reaction than in the initial reactant state and the final product state is the molecular origin of barrier lowering.

Universal binding energy relations in metallic adhesion

NASA Technical Reports Server (NTRS)

Ferrante, J.; Smith, J. R.; Rose, J. H.

1981-01-01

Scaling relations which map metallic adhesive binding energy onto a single universal binding energy curve are discussed in relation to adhesion, friction, and wear in metals. The scaling involved normalizing the energy to the maximum binding energy and normalizing distances by a suitable combination of Thomas-Fermi screening lengths. The universal curve was found to be accurately represented by E*(A*)= -(1+beta A) exp (-Beta A*) where E* is the normalized binding energy, A* is the normalized separation, and beta is the normalized decay constant. The calculated cohesive energies of potassium, barium, copper, molybdenum, and samarium were also found to scale by similar relations, suggesting that the universal relation may be more general than for the simple free electron metals.

Interfacial disorder drives charge separation in molecular semiconductors

NASA Astrophysics Data System (ADS)

Willard, Adam

One of the fundamental microscopic processes in photocurrent generation is the dissociation of neutral photo-excitations (i.e., Frenkel excitons) into free charge carriers (i.e., electrons and holes). This process requires the physical separation of oppositely charged electrons and holes, which are held to together by an attractive electrostatic binding energy. In traditional inorganic-based photovoltaic (PV) materials, this binding energy is generally small and easily overcome, however, in organic-based PVs (OPVs) the exciton binding energy can significantly exceed thermal energies. The inability of bound charges to overcome this large binding energy has been implicated as a primary source of efficiency loss in OPVs. Here I present results from our recent efforts to explore the role of static molecular disorder in mediating this process. Using a simple lattice model of exciton dynamics we demonstrate that random spatial variations in the energetic landscape can mitigate the attractive Coulomb interaction between electrons and holes. We show that this effect manifests as a reduction in the free energy barrier for exciton dissociation that grows more pronounced with increasing disorder. By considering the competition between this thermodynamic effect and the disorder-induced slowing of dissociation kinetics we demonstrate that exciton dissociation yields are expected to depend non-monotonically on the degree of static disorder.

Neutron production during the interaction of monoenergetic electrons with a Tungsten foil in the radiotherapeutic energy range

NASA Astrophysics Data System (ADS)

Soto-Bernal, Tzinnia Gabriela; Baltazar-Raigosa, Antonio; Medina-Castro, Diego; Vega-Carrillo, Hector Rene

2017-10-01

The electron, photon, and neutron spectra produced during the interaction between monoenergetic electron beams (8, 10, 12, 15, and 18 MeV) and a 0.05 cm-thick tungsten scattering foil were estimated using Monte Carlo method. Incoming electrons is a pencil beam that after collide with the foil acquires a broader distribution peaked in the same direction of the incoming electrons. Electron spectra show the influence of the binding energy of electrons in the tungsten shells and the increase of the electron fluence. In the interaction between the electrons in the beam and the tungsten atoms in the foil, bremsstrahlung and characteristic photons are produced. These photons are also peaked in the same direction of the incoming beam, and the electron fluence increases as the energy of the electron beam raises. The electron and photon spectra have particles whose energy is larger than the binding energy of neutron in the nucleus. Thus neutron production was noticed for 10, 12, 15, and 18 MeV electron beam. The neutron fluence becomes larger as the energy of the electron beam increases, the neutron spectra are mainly evaporation neutrons for 10 and 12 MeV, and for 15 and 18 MeV knock-on neutrons are also produced. Neutrons are produced in the foil volume having a quasi-isotropic distribution.

Three-body Coulomb bound states

NASA Technical Reports Server (NTRS)

Bhatia, A. K.; Drachman, Richard J.

1987-01-01

The binding energies of three-particle systems containing two electrons and one positive particle of mass M are reexamined in an attempt to understand the approximate proportionality of the 1Se ground-state binding energies of the reduced masses, as pointed out by Botero and Green (1986). The contribution to the energy of the mass-polarization term is evaluated. No fundamental principle is involved, since the mass polarization merely decreases somewhat as the mass of the positive particle is reduced below the proton mass. In the case of the excited 3Pe state, this reduction is not sufficient to allow binding when M approaches the electron mass. Some properties of the recently observed negative muonium ion (e/-/ mu/+/ e/-/) are also computed.

Theoretical study on electronic structure of bathocuproine: Renormalization of the band gap in the crystalline state and the large exciton binding energy

NASA Astrophysics Data System (ADS)

Yanagisawa, Susumu; Hatada, Shin-No-Suke; Morikawa, Yoshitada

Bathocuproine (BCP) is a promising organic material of a hole blocking layer in organic light-emitting diodes or an electron buffer layer in organic photovoltaic cells. The nature of the unoccupied electronic states is a key characteristic of the material, which play vital roles in the electron transport. To elucidate the electronic properties of the molecular or crystalline BCP, we use the GW approximation for calculation of the fundamental gap, and the long-range corrected density functional theory for the molecular optical absorption. It is found that the band gap of the BCP single crystal is 4.39 eV, and it is in agreement with the recent low-energy inverse photoemission spectroscopy measurement. The polarization energy is estimated to be larger than 1 eV, demonstrating the large polarization effects induced by the electronic clouds surrounding the injected charge. The theoretical optical absorption energy is 3.68 eV, and the exciton binding energy is estimated to be 0.71 eV, implying the large binding in the eletron-hole pair distributed around the small part of the molecular region. This work was supported by the Grants-in-Aid for Young Scientists (B) (No. 26810009), and for Scientific Research on Innovative Areas ``3D Active-Site Science'' (No. 26105011) from Japan Society for the Promotion of Science.

Two Aromatic Rings Coupled a Sulfur-Containing Group to Favor Protein Electron Transfer by Instantaneous Formations of π∴S:π↔π:S∴π or π∴π:S↔π:π∴S Five-Electron Bindings

PubMed Central

Sun, Weichao; Ren, Haisheng; Tao, Ye; Xiao, Dong; Qin, Xin; Deng, Li; Shao, Mengyao; Gao, Jiali; Chen, Xiaohua

2015-01-01

The cooperative interactions among two aromatic rings with a S-containing group are described, which may participate in electron hole transport in proteins. Ab initio calculations reveal the possibility for the formations of the π∴S:π↔π:S∴π and π∴π:S↔π:π∴S five-electron bindings in the corresponding microsurrounding structures in proteins, both facilitating electron hole transport as efficient relay stations. The relay functionality of these two special structures comes from their low local ionization energies and proper binding energies, which varies with the different aromatic amino acids, S-containing residues, and the arrangements of the same aromatic rings according to the local microsurroundings in proteins. PMID:26120374

Binding energy of excitons formed from spatially separated electrons and holes in insulating quantum dots

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pokutnyi, S. I., E-mail: pokutnyi-sergey@inbox.ru; Kulchin, Yu. N.; Dzyuba, V. P.

It is found that the binding energy of the ground state of an exciton formed from an electron and a hole spatially separated from each other (the hole is moving within a quantum dot, and the electron is localized above the spherical (quantum dot)–(insulating matrix) interface) in a nanosystem containing insulating Al{sub 2}O{sub 3} quantum dots is substantially increased (by nearly two orders of magnitude) compared to the exciton binding energy in an Al{sub 2}O{sub 3} single crystal. It is established that, in the band gap of an Al{sub 2}O{sub 3} nanoparticle, a band of exciton states (formed from spatiallymore » separated electrons and holes) appears. It is shown that there exists the possibility of experimentally detecting the ground and excited exciton states in the band gap of Al{sub 2}O{sub 3} nanoparticles at room temperature from the absorption spectrum of the nanosystem.« less

A density functional theory study of the correlation between analyte basicity, ZnPc adsorption strength, and sensor response.

PubMed

Tran, N L; Bohrer, F I; Trogler, W C; Kummel, A C

2009-05-28

Density functional theory (DFT) simulations were used to determine the binding strength of 12 electron-donating analytes to the zinc metal center of a zinc phthalocyanine molecule (ZnPc monomer). The analyte binding strengths were compared to the analytes' enthalpies of complex formation with boron trifluoride (BF(3)), which is a direct measure of their electron donating ability or Lewis basicity. With the exception of the most basic analyte investigated, the ZnPc binding energies were found to correlate linearly with analyte basicities. Based on natural population analysis calculations, analyte complexation to the Zn metal of the ZnPc monomer resulted in limited charge transfer from the analyte to the ZnPc molecule, which increased with analyte-ZnPc binding energy. The experimental analyte sensitivities from chemiresistor ZnPc sensor data were proportional to an exponential of the binding energies from DFT calculations consistent with sensitivity being proportional to analyte coverage and binding strength. The good correlation observed suggests DFT is a reliable method for the prediction of chemiresistor metallophthalocyanine binding strengths and response sensitivities.

Inner reorganization limiting electron transfer controlled hydrogen bonding: intra- vs. intermolecular effects.

PubMed

Martínez-González, Eduardo; Frontana, Carlos

2014-05-07

In this work, experimental evidence of the influence of the electron transfer kinetics during electron transfer controlled hydrogen bonding between anion radicals of metronidazole and ornidazole, derivatives of 5-nitro-imidazole, and 1,3-diethylurea as the hydrogen bond donor, is presented. Analysis of the variations of voltammetric EpIcvs. log KB[DH], where KB is the binding constant, allowed us to determine the values of the binding constant and also the electron transfer rate k, confirmed by experiments obtained at different scan rates. Electronic structure calculations at the BHandHLYP/6-311++G(2d,2p) level for metronidazole, including the solvent effect by the Cramer/Truhlar model, suggested that the minimum energy conformer is stabilized by intramolecular hydrogen bonding. In this structure, the inner reorganization energy, λi,j, contributes significantly (0.5 eV) to the total reorganization energy of electron transfer, thus leading to a diminishment of the experimental k.

Assigning crystallographic electron densities with free energy calculations—The case of the fluoride channel Fluc

PubMed Central

2018-01-01

Approximately 90% of the structures in the Protein Data Bank (PDB) were obtained by X-ray crystallography or electron microscopy. Whereas the overall quality of structure is considered high, thanks to a wide range of tools for structure validation, uncertainties may arise from density maps of small molecules, such as organic ligands, ions or water, which are non-covalently bound to the biomolecules. Even with some experience and chemical intuition, the assignment of such disconnected electron densities is often far from obvious. In this study, we suggest the use of molecular dynamics (MD) simulations and free energy calculations, which are well-established computational methods, to aid in the assignment of ambiguous disconnected electron densities. Specifically, estimates of (i) relative binding affinities, for instance between an ion and water, (ii) absolute binding free energies, i.e., free energies for transferring a solute from bulk solvent to a binding site, and (iii) stability assessments during equilibrium simulations may reveal the most plausible assignments. We illustrate this strategy using the crystal structure of the fluoride specific channel (Fluc), which contains five disconnected electron densities previously interpreted as four fluoride and one sodium ion. The simulations support the assignment of the sodium ion. In contrast, calculations of relative and absolute binding free energies as well as stability assessments during free MD simulations suggest that four of the densities represent water molecules instead of fluoride. The assignment of water is compatible with the loss of these densities in the non-conductive F82I/F85I mutant of Fluc. We critically discuss the role of the ion force fields for the calculations presented here. Overall, these findings indicate that MD simulations and free energy calculations are helpful tools for modeling water and ions into crystallographic density maps. PMID:29771936

Metalloid Aluminum Clusters with Fluorine

DTIC Science & Technology

2016-12-01

molecular dynamics, binding energy , siesta code, density of states, projected density of states 15. NUMBER OF PAGES 69 16. PRICE CODE 17. SECURITY...high energy density compared to explosives, but typically release this energy slowly via diffusion-limited combustion. There is recent interest in using...examine the cluster binding energy and electronic structure. Partial fluorine substitution in a prototypical aluminum-cyclopentadienyl cluster results

Crown oxygen-doping graphene with embedded main-group metal atoms

NASA Astrophysics Data System (ADS)

Wu, Liyuan; Wang, Qian; Yang, Chuanghua; Quhe, Ruge; Guan, Pengfei; Lu, Pengfei

2018-02-01

Different main-group metal atoms embedded in crown oxygen-doping graphene (metal@OG) systems are studied by the density functional theory. The binding energies and electronic structures are calculated by using first-principles calculations. The binding energy of metal@OG system mainly depends on the electronegativity of the metal atom. The lower the value of the electronegativity, the larger the binding energy, indicating the more stable the system. The electronic structure of metal@OG arouses the emergence of bandgap and shift of Dirac point. It is shown that interaction between metal atom and crown oxygen-doping graphene leads to the graphene's stable n-doping, and the metal@OG systems are stable semiconducting materials, which can be used in technological applications.

Effective Mass Theory of 2D Excitons Revisited

NASA Astrophysics Data System (ADS)

Gonzalez, Joseph; Oleynik, Ivan

Two-dimensional (2D) semiconducting materials possess an exceptionally unique set of electronic and excitonic properties due to the combined effects of quantum and dielectric confinement. Reliable determination of exciton binding energies from both first-principles many-body perturbation theory (GW/BSE) and experiment is very challenging due to the enormous computational expense as well as the tremendous technical difficulties in experiment.. Very recently, effective mass theories of 2D excitons have been developed as an attractive alternative for inexpensive and accurate evaluation of the exciton binding energies. In this presentation, we evaluate two effective mass theory approaches by Velizhanin et al and Olsen et al in predicting exciton binding energies across a wide range of 2D materials. We specifically analyze the trends related to the varying screening lengths and exciton effective masses. We also extended the effective mass theory of 2D excitons to include effects of electron and hole mass anisotropies (mx ≠ my) , the latter showing a substantial influence on exciton binding energies. The recent predictions of exciton binding energies being independent of the exciton effective mass and a linear correlation with the band gap of a specific material are also critically reexamined.

Dispersion- and Exchange-Corrected Density Functional Theory for Sodium Ion Hydration.

PubMed

Soniat, Marielle; Rogers, David M; Rempe, Susan B

2015-07-14

A challenge in density functional theory is developing functionals that simultaneously describe intermolecular electron correlation and electron delocalization. Recent exchange-correlation functionals address those two issues by adding corrections important at long ranges: an atom-centered pairwise dispersion term to account for correlation and a modified long-range component of the electron exchange term to correct for delocalization. Here we investigate how those corrections influence the accuracy of binding free energy predictions for sodium-water clusters. We find that the dual-corrected ωB97X-D functional gives cluster binding energies closest to high-level ab initio methods (CCSD(T)). Binding energy decomposition shows that the ωB97X-D functional predicts the smallest ion-water (pairwise) interaction energy and larger multibody contributions for a four-water cluster than most other functionals - a trend consistent with CCSD(T) results. Also, ωB97X-D produces the smallest amounts of charge transfer and the least polarizable waters of the density functionals studied, which mimics the lower polarizability of CCSD. When compared with experimental binding free energies, however, the exchange-corrected CAM-B3LYP functional performs best (error <1 kcal/mol), possibly because of its parametrization to experimental formation enthalpies. For clusters containing more than four waters, "split-shell" coordination must be considered to obtain accurate free energies in comparison with experiment.

Generalized virial theorem for massless electrons in graphene and other Dirac materials

NASA Astrophysics Data System (ADS)

Sokolik, A. A.; Zabolotskiy, A. D.; Lozovik, Yu. E.

2016-05-01

The virial theorem for a system of interacting electrons in a crystal, which is described within the framework of the tight-binding model, is derived. We show that, in the particular case of interacting massless electrons in graphene and other Dirac materials, the conventional virial theorem is violated. Starting from the tight-binding model, we derive the generalized virial theorem for Dirac electron systems, which contains an additional term associated with a momentum cutoff at the bottom of the energy band. Additionally, we derive the generalized virial theorem within the Dirac model using the minimization of the variational energy. The obtained theorem is illustrated by many-body calculations of the ground-state energy of an electron gas in graphene carried out in Hartree-Fock and self-consistent random-phase approximations. Experimental verification of the theorem in the case of graphene is discussed.

Probing electronic binding potentials with attosecond photoelectron wavepackets

NASA Astrophysics Data System (ADS)

Kiesewetter, D.; Jones, R. R.; Camper, A.; Schoun, S. B.; Agostini, P.; Dimauro, L. F.

2018-01-01

The central goal of attosecond science is to visualize, understand and ultimately control electron dynamics in matter over the fastest relevant timescales. To date, numerous schemes have demonstrated exquisite temporal resolution, on the order of ten attoseconds, in measurements of the response of photo-excited electrons to time-delayed probes. However, attributing this response to specific dynamical mechanisms is difficult, requiring guidance from advanced calculations. Here we show that energy transfer between an oscillating field and low-energy attosecond photoelectron wavepackets directly provides coarse-grained information on the effective binding potential from which the electrons are liberated. We employ a dense extreme ultraviolet (XUV) harmonic comb to photoionize He, Ne and Ar atoms and record the electron spectra as a function of the phase of a mid-infrared dressing field. The amplitude and phase of the resulting interference modulations in the electron spectra reveal the average momentum and change in momentum of the electron wavepackets during the first quarter-period of the dressing field after their creation, reflecting the corresponding coarse characteristics of the binding potential.

The electronic and optical properties of quantum nano-structures

NASA Astrophysics Data System (ADS)

Ham, Heon

In semiconducting quantum nano-structures, the excitonic effects play an important role when we fabricate opto-electronic devices, such as lasers, diodes, detectors, etc. To gain a better understanding of the excitonic effects in quantum nano-structures, we investigated the exciton binding energy, oscillator strength, and linewidth in quantum nano-structures using both the infinite and finite well models. We investigated also the hydrogenic impurity binding energy and the photoionization cross section of the hydrogenic impurity in a spherical quantum dot. In our work, the variational approach is used in all calculations, because the Hamiltonian of the system is not separable, due to the different symmetries of the Coulomb and confining potentials. In the infinite well model of the semiconducting quantum nanostructures, the binding energy of the exciton increases with decreasing width of the potential barriers due to the increase in the effective strength of the Coulomb interaction between the electron and hole. In the finite well model, the exciton binding energy reaches a peak value, and the binding energy decreases with further decrease in the width of the potential barriers. The exciton linewidth in the infinite well model increases with decreasing wire radius, because the scattering rate of the exciton increases with decreasing wire radius. In the finite well model, the exciton linewidth in a cylindrical quantum wire reaches a peak value and the exciton linewidth decreases with further decrease in the wire radius, because the exciton is not well confined at very smaller wire radii. The binding energy of the hydrogenic impurity in a spherical quantum dot has also calculated using both the infinite and the finite well models. The binding energy of the hydrogenic impurity was calculated for on center and off center impurities in the spherical quantum dots. With decreasing radii of the dots, the binding energy of the hydrogenic impurity increases in the infinite well model. The binding energy of the hydrogenic impurity in the finite well model reaches a peak value and decreases with further decrease in the dot radii for both on center and off center impurities. We have calculated the photoionization cross section as a function of the radius and the frequency using both the infinite and finite well models. The photoionizaton cross section has a peak value at a frequency where the photon energy equals the difference between the final and initial state energies of the impurity. The behavior of the cross section with dot radius depends upon the location of the impurity and the polarization of the electromagnetic field.

Simple method for determining binding energies of fullerene and complex atomic negative ions

NASA Astrophysics Data System (ADS)

Felfli, Zineb; Msezane, Alfred

2017-04-01

A robust potential which embeds fully the vital core polarization interaction has been used in the Regge pole method to explore low-energy electron scattering from C60, Eu and Nb through the total cross sections (TCSs) calculations. From the characteristic dramatically sharp resonances in the TCSs manifesting negative ion formation in these systems, we extracted the binding energies for the C60, Euand Nbanions they are found to be in outstanding agreement with the measured electron affinities of C60, Eu and Nb. Common among these considered systems, including the standard atomic Au is the formation of their ground state negative ions at the second Ramsauer-Townsend (R-T) minima of their TCSs. Indeed, this is a signature of all the fullerenes and complex atoms considered thus far. Shape resonances, R-T minima and binding energies of the resultant anions are presented. This work was supported by U.S. DOE, Basic Energy Sciences, Office of Energy Research.

On the electron affinity of cytosine in bulk water and at hydrophobic aqueous interfaces.

PubMed

Vöhringer-Martinez, Esteban; Dörner, Ciro; Abel, Bernd

2014-10-01

In the past one possible mechanism of DNA damage in bulk water has been attributed to the presence of hydrated electrons in water. Recently, one important property of hydrated electrons, namely their binding energy, was reported to be smaller at hydrophobic interfaces than in bulk aqueous solution. This possibly opens up new reaction possibilities with different solutes such as the DNA at hydrophobic, aqueous interfaces. Here, we use QM/MM molecular dynamics simulation to study how the molecular environment at the vacuum-water interface and in the bulk alters the electron affinity of cytosine being a characteristic part of the DNA. The electron affinity at the interface is closer to the corresponding binding energy of the partially hydrated electron. The increased energy resonance makes the electron capture process more probable and suggests that hydrated electrons at hydrophobic interfaces may be more reactive than the fully hydrated ones. Additionally, we found that the relaxation of the anionic form after electron attachment also induces a proton transfer from the surrounding solvent that was confirmed by comparison with the experimental reduction potential.

Electrostatic redesign of the [myoglobin, cytochrome b5] interface to create a well-defined docked complex with rapid interprotein electron transfer.

PubMed

Xiong, Peng; Nocek, Judith M; Griffin, Amanda K K; Wang, Jingyun; Hoffman, Brian M

2009-05-27

Cyt b(5) is the electron-carrier "repair" protein that reduces met-Mb and met-Hb to their O(2)-carrying ferroheme forms. Studies of electron transfer (ET) between Mb and cyt b(5) revealed that they react on a "Dynamic Docking" (DD) energy landscape on which binding and reactivity are uncoupled: binding is weak and involves an ensemble of nearly isoenergetic configurations, only a few of which are reactive; those few contribute negligibly to binding. We set the task of redesigning the surface of Mb so that its reaction with cyt b(5) instead would occur on a conventional "simple docking" (SD) energy landscape, on which a complex exhibits a well-defined (set of) reactive binding configuration(s), with binding and reactivity thus no longer being decoupled. We prepared a myoglobin (Mb) triple mutant (D44K/D60K/E85K; Mb(+6)) substituted with Zn-deuteroporphyrin and monitored cytochrome b(5) (cyt b(5)) binding and electron transfer (ET) quenching of the (3)ZnMb(+6) triplet state. In contrast, to Mb(WT), the three charge reversals around the "front-face" heme edge of Mb(+6) have directed cyt b(5) to a surface area of Mb adjacent to its heme, created a well-defined, most-stable structure that supports good ET pathways, and apparently coupled binding and ET: both K(a) and k(et) are increased by the same factor of approximately 2 x 10(2), creating a complex that exhibits a large ET rate constant, k(et) = 10(6 1) s(-1), and is in slow exchange (k(off) < k(et)). In short, these mutations indeed appear to have created the sought-for conversion from DD to simple docking (SD) energy landscapes.

Energies of rare-earth ion states relative to host bands in optical materials from electron photoemission spectroscopy

NASA Astrophysics Data System (ADS)

Thiel, Charles Warren

There are a vast number of applications for rare-earth-activated materials and much of today's cutting-edge optical technology and emerging innovations are enabled by their unique properties. In many of these applications, interactions between the rare-earth ion and the host material's electronic states can enhance or inhibit performance and provide mechanisms for manipulating the optical properties. Continued advances in these technologies require knowledge of the relative energies of rare-earth and crystal band states so that properties of available materials may be fully understood and new materials may be logically developed. Conventional and resonant electron photoemission techniques were used to measure 4f electron and valence band binding energies in important optical materials, including YAG, YAlO3, and LiYF4. The photoemission spectra were theoretically modeled and analyzed to accurately determine relative energies. By combining these energies with ultraviolet spectroscopy, binding energies of excited 4fN-15d and 4fN+1 states were determined. While the 4fN ground-state energies vary considerably between different trivalent ions and lie near or below the top of the valence band in optical materials, the lowest 4f N-15d states have similar energies and are near the bottom of the conduction band. As an example for YAG, the Tb3+ 4f N ground state is in the band gap at 0.7 eV above the valence band while the Lu3+ ground state is 4.7 eV below the valence band maximum; however, the lowest 4fN-15d states are 2.2 eV below the conduction band for both ions. We found that a simple model accurately describes the binding energies of the 4fN, 4fN-1 5d, and 4fN+1 states. The model's success across the entire rare-earth series indicates that measurements on two different ions in a host are sufficient to predict the energies of all rare-earth ions in that host. This information provides new insight into electron transfer transitions, luminescence quenching, and valence stability. All of these results lead to a clearer picture for the host's effect on the rare-earth ion's electron binding energies and will motivate fundamental theoretical analysis and accelerate the development of new optical materials.

Cooper-pair size and binding energy for unconventional superconducting systems

NASA Astrophysics Data System (ADS)

Dinóla Neto, F.; Neto, Minos A.; Salmon, Octavio D. Rodriguez

2018-06-01

The main proposal of this paper is to analyze the size of the Cooper pairs composed by unbalanced mass fermions from different electronic bands along the BCS-BEC crossover and study the binding energy of the pairs. We are considering an interaction between fermions with different masses leading to an inter-band pairing. In addiction to the attractive interaction we have an hybridization term to couple both bands, which in general acts unfavorable for the pairing between the electrons. We get first order phase transitions as the hybridization breaks the Cooper pairs for the s-wave symmetry of the gap amplitude. The results show the dependence of the Cooper-pair size as a function of the hybridization for T = 0 . We also propose the structure of the binding energy of the inter-band system as a function of the two-bands quasi-particle energies.

Reducing exciton binding energy by increasing thin film permittivity: an effective approach to enhance exciton separation efficiency in organic solar cells.

PubMed

Leblebici, Sibel Y; Chen, Teresa L; Olalde-Velasco, Paul; Yang, Wanli; Ma, Biwu

2013-10-23

Photocurrent generation in organic solar cells requires that excitons, which are formed upon light absorption, dissociate into free carriers at the interface of electron acceptor and donor materials. The high exciton binding energy, arising from the low permittivity of organic semiconductor films, generally causes low exciton separation efficiency and subsequently low power conversion efficiency. We demonstrate here, for the first time, that the exciton binding energy in B,O-chelated azadipyrromethene (BO-ADPM) donor films is reduced by increasing the film permittivity by blending the BO-ADPM donor with a high dielectric constant small molecule, camphoric anhydride (CA). Various spectroscopic techniques, including impedance spectroscopy, photon absorption and emission spectroscopies, as well as X-ray spectroscopies, are applied to characterize the thin film electronic and photophysical properties. Planar heterojunction solar cells are fabricated with a BO-ADPM:CA film as the electron donor and C60 as the acceptor. With an increase in the dielectric constant of the donor film from ∼4.5 to ∼11, the exciton binding energy is reduced and the internal quantum efficiency of the photovoltaic cells improves across the entire spectrum, with an ∼30% improvement in the BO-ADPM photoactive region.

Effect of H2 binding on the nonadiabatic transition probability between singlet and triplet states of the [NiFe]-hydrogenase active site.

PubMed

Kaliakin, Danil S; Zaari, Ryan R; Varganov, Sergey A

2015-02-12

We investigate the effect of H2 binding on the spin-forbidden nonadiabatic transition probability between the lowest energy singlet and triplet electronic states of [NiFe]-hydrogenase active site model, using a velocity averaged Landau-Zener theory. Density functional and multireference perturbation theories were used to provide parameters for the Landau-Zener calculations. It was found that variation of the torsion angle between the terminal thiolate ligands around the Ni center induces an intersystem crossing between the lowest energy singlet and triplet electronic states in the bare active site and in the active site with bound H2. Potential energy curves between the singlet and triplet minima along the torsion angle and H2 binding energies to the two spin states were calculated. Upon H2 binding to the active site, there is a decrease in the torsion angle at the minimum energy crossing point between the singlet and triplet states. The probability of nonadiabatic transitions at temperatures between 270 and 370 K ranges from 35% to 32% for the active site with bound H2 and from 42% to 38% for the bare active site, thus indicating the importance of spin-forbidden nonadiabatic pathways for H2 binding on the [NiFe]-hydrogenase active site.

ETMB-RBF: discrimination of metal-binding sites in electron transporters based on RBF networks with PSSM profiles and significant amino acid pairs.

PubMed

Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng

2013-01-01

Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation-reduction reactions. In these oxidation-reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins.

ETMB-RBF: Discrimination of Metal-Binding Sites in Electron Transporters Based on RBF Networks with PSSM Profiles and Significant Amino Acid Pairs

PubMed Central

Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng

2013-01-01

Background Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation–reduction reactions. In these oxidation–reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. Methods We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. Results We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. Conclusions We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins. PMID:23405059

The Strength of Hydrogen Bonds between Fluoro-Organics and Alcohols, a Theoretical Study.

PubMed

Rosenberg, Robert E

2018-05-10

Fluorinated organic compounds are ubiquitous in the pharmaceutical and agricultural industries. To better discern the mode of action of these compounds, it is critical to understand the strengths of hydrogen bonds involving fluorine. There are only a few published examples of the strengths of these bonds. This study provides a high level ab initio study of inter- and intramolecular hydrogen bonds between RF and R'OH, where R and R' are aryl, vinyl, alkyl, and cycloalkyl. Intermolecular binding energies average near 5 kcal/mol, while intramolecular binding energies average about 3 kcal/mol. Inclusion of zero-point energies and applying a counterpoise correction lessen the difference. In both series, modest increases in binding energies are seen with increased acidity of R'OH and increased electron donation of R in RF. In the intramolecular compounds, binding energy increases with the rigidity of the F-(C) n -OH ring. Inclusion of free energy corrections at 298 K results in exoergic binding energies for the intramolecular compounds and endoergic binding energies for the intermolecular compounds. Parameters such as bond lengths, vibrational frequencies, and atomic populations are consistent with formation of a hydrogen bond and with slightly stronger binding in the intermolecular cases over the intramolecular cases. However, these parameters correlated poorly with binding energies.

Free energies of binding from large-scale first-principles quantum mechanical calculations: application to ligand hydration energies.

PubMed

Fox, Stephen J; Pittock, Chris; Tautermann, Christofer S; Fox, Thomas; Christ, Clara; Malcolm, N O J; Essex, Jonathan W; Skylaris, Chris-Kriton

2013-08-15

Schemes of increasing sophistication for obtaining free energies of binding have been developed over the years, where configurational sampling is used to include the all-important entropic contributions to the free energies. However, the quality of the results will also depend on the accuracy with which the intermolecular interactions are computed at each molecular configuration. In this context, the energy change associated with the rearrangement of electrons (electronic polarization and charge transfer) upon binding is a very important effect. Classical molecular mechanics force fields do not take this effect into account explicitly, and polarizable force fields and semiempirical quantum or hybrid quantum-classical (QM/MM) calculations are increasingly employed (at higher computational cost) to compute intermolecular interactions in free-energy schemes. In this work, we investigate the use of large-scale quantum mechanical calculations from first-principles as a way of fully taking into account electronic effects in free-energy calculations. We employ a one-step free-energy perturbation (FEP) scheme from a molecular mechanical (MM) potential to a quantum mechanical (QM) potential as a correction to thermodynamic integration calculations within the MM potential. We use this approach to calculate relative free energies of hydration of small aromatic molecules. Our quantum calculations are performed on multiple configurations from classical molecular dynamics simulations. The quantum energy of each configuration is obtained from density functional theory calculations with a near-complete psinc basis set on over 600 atoms using the ONETEP program.

Many-body effects and excitonic features in 2D biphenylene carbon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lüder, Johann, E-mail: johann.luder@physics.uu.se; Puglia, Carla; Eriksson, Olle

2016-01-14

The remarkable excitonic effects in low dimensional materials in connection to large binding energies of excitons are of great importance for research and technological applications such as in solar energy and quantum information processing as well as for fundamental investigations. In this study, the unique electronic and excitonic properties of the two dimensional carbon network biphenylene carbon were investigated with GW approach and the Bethe-Salpeter equation accounting for electron correlation effects and electron-hole interactions, respectively. Biphenylene carbon exhibits characteristic features including bright and dark excitons populating the optical gap of 0.52 eV and exciton binding energies of 530 meV asmore » well as a technologically relevant intrinsic band gap of 1.05 eV. Biphenylene carbon’s excitonic features, possibly tuned, suggest possible applications in the field of solar energy and quantum information technology in the future.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Yang; Tu, Xingchen; Wang, Hao

The electronic efficiency and binding energy of contacts formed between graphene electrodes and poly-aromatic hydrocarbon (PAH) anchoring groups have been investigated by the non-equilibrium Green’s function formalism combined with density functional theory. Our calculations show that PAH molecules always bind in the interior and at the edge of graphene in the AB stacking manner, and that the binding energy increases following the increase of the number of carbon and hydrogen atoms constituting the PAH molecule. When we move to analyzing the electronic transport properties of molecular junctions with a six-carbon alkyne chain as the central molecule, the electronic efficiency ofmore » the graphene-PAH contacts is found to depend on the energy gap between the highest occupied molecular orbital (HOMO) and the lowest unoccupied molecular orbital (LUMO) of the corresponding PAH anchoring group, rather than its size. To be specific, the smaller is the HOMO-LUMO gap of the PAH anchoring group, the higher is the electronic efficiency of the graphene-PAH contact. Although the HOMO-LUMO gap of a PAH molecule depends on its specific configuration, PAH molecules with similar atomic structures show a decreasing trend for their HOMO-LUMO gap as the number of fused benzene rings increases. Therefore, graphene-conjugated molecule-graphene junctions with high-binding and high-conducting graphene-PAH contacts can be realized by choosing appropriate PAH anchor groups with a large area and a small HOMO-LUMO gap.« less

Phylogenetic analysis of proteins associated in the four major energy metabolism systems: photosynthesis, aerobic respiration, denitrification, and sulfur respiration.

PubMed

Tomiki, Takeshi; Saitou, Naruya

2004-08-01

The four electron transfer energy metabolism systems, photosynthesis, aerobic respiration, denitrification, and sulfur respiration, are thought to be evolutionarily related because of the similarity of electron transfer patterns and the existence of some homologous proteins. How these systems have evolved is elusive. We therefore conducted a comprehensive homology search using PSI-BLAST, and phylogenetic analyses were conducted for the three homologous groups (groups 1-3) based on multiple alignments of domains defined in the Pfam database. There are five electron transfer types important for catalytic reaction in group 1, and many proteins bind molybdenum. Deletions of two domains led to loss of the function of binding molybdenum and ferredoxin, and these deletions seem to be critical for the electron transfer pattern changes in group 1. Two types of electron transfer were found in group 2, and all its member proteins bind siroheme and ferredoxin. Insertion of the pyridine nucleotide disulfide oxidoreductase domain seemed to be the critical point for the electron transfer pattern change in this group. The proteins belonging to group 3 are all flavin enzymes, and they bind flavin adenine dinucleotide (FAD) or flavin mononucleotide (FMN). Types of electron transfer in this group are divergent, but there are two common characteristics. NAD(P)H works as an electron donor or acceptor, and FAD or FMN transfers electrons from/to NAD(P)H. Electron transfer functions might be added to these common characteristics by the addition of functional domains through the evolution of group 3 proteins. Based on the phylogenetic analyses in this study and previous studies, we inferred the phylogeny of the energy metabolism systems as follows: photosynthesis (and possibly aerobic respiration) and the sulfur/nitrogen assimilation system first diverged, then the sulfur/nitrogen dissimilation system was produced from the latter system.

Full-potential KKR calculations for vacancies in Al : Screening effect and many-body interactions

NASA Astrophysics Data System (ADS)

Hoshino, T.; Asato, M.; Zeller, R.; Dederichs, P. H.

2004-09-01

We give ab initio calculations for vacancies in Al . The calculations are based on the generalized-gradient approximation in the density-functional theory and employ the all-electron full-potential Korringa-Kohn-Rostoker Green’s function method for point defects, which guarantees the correct embedding of the cluster of point defects in an otherwise perfect crystal. First, we confirm the recent calculated results of Carling [Phys. Rev. Lett. 85, 3862 (2000)], i.e., repulsion of the first-nearest-neighbor (1NN) divacancy in Al , and elucidate quantitatively the micromechanism of repulsion. Using the calculated results for vacancy formation energies and divacancy binding energies in Na , Mg , Al , and Si of face-centered-cubic, we show that the single vacancy in nearly free-electron systems becomes very stable with increasing free-electron density, due to the screening effect, and that the formation of divacancy destroys the stable electron distribution around the single vacancy, resulting in a repulsion of two vacancies on 1NN sites, so that the 1NN divacancy is unstable. Second, we show that the cluster expansion converges rapidly for the binding energies of vacancy agglomerates in Al . The binding energy of 13 vacancies consisting of a central vacancy and its 12 nearest neighbors, is reproduced within the error of 0.002eV per vacancy, if many-body interaction energies up to the four-body terms are taken into account in the cluster expansion, being compared with the average error (>0.1eV) of the glue models which are very often used to provide interatomic potentials for computer simulations. For the cluster expansion of the binding energies of impurities, we get the same convergence as that obtained for vacancies. Thus, the present cluster-expansion approach for the binding energies of agglomerates of vacancies and impurities in Al may provide accurate data to construct the interaction-parameter model for computer simulations which are strongly requested to study the dynamical process in the initial stage of the formation of the so-called Guinier-Preston zones of low-concentrated Al -based alloys such as Al1-cXc ( X=Cu , Zn ; c<0.05 ).

Density-functional tight-binding investigation of the structure, stability and material properties of nickel hydroxide nanotubes

NASA Astrophysics Data System (ADS)

Jahangiri, Soran; Mosey, Nicholas J.

2018-01-01

Nickel hydroxide is a material composed of two-dimensional layers that can be rolled up to form cylindrical nanotubes belonging to a class of inorganic metal hydroxide nanotubes that are candidates for applications in catalysis, energy storage, and microelectronics. The stabilities and other properties of this class of inorganic nanotubes have not yet been investigated in detail. The present study uses self-consistent-charge density-functional tight-binding calculations to examine the stabilities, mechanical properties, and electronic properties of nickel hydroxide nanotubes along with the energetics associated with the adsorption of water by these systems. The tight-binding model was parametrized for this system based on the results of first-principles calculations. The stabilities of the nanotubes were examined by calculating strain energies and performing molecular dynamics simulations. The results indicate that single-walled nickel hydroxide nanotubes are stable at room temperature, which is consistent with experimental investigations. The nanotubes possess size-dependent mechanical properties that are similar in magnitude to those of other inorganic nanotubes. The electronic properties of the nanotubes were also found to be size-dependent and small nickel oxyhydroxide nanotubes are predicted to be semiconductors. Despite this size-dependence, both the mechanical and electronic properties were found to be almost independent of the helical structure of the nanotubes. The calculations also show that water molecules have higher adsorption energies when binding to the interior of the nickel hydroxide nanotubes when compared to adsorption in nanotubes formed from other two-dimensional materials such as graphene. The increased adsorption energy is due to the hydrophilic nature of nickel hydroxide. Due to the broad applications of nickel hydroxide, the nanotubes investigated here are also expected to be used in catalysis, electronics, and clean energy production.

Calculation of positron binding energies using the generalized any particle propagator theory

DOE Office of Scientific and Technical Information (OSTI.GOV)

Romero, Jonathan; Charry, Jorge A.; Flores-Moreno, Roberto

2014-09-21

We recently extended the electron propagator theory to any type of quantum species based in the framework of the Any-Particle Molecular Orbital (APMO) approach [J. Romero, E. Posada, R. Flores-Moreno, and A. Reyes, J. Chem. Phys. 137, 074105 (2012)]. The generalized any particle molecular orbital propagator theory (APMO/PT) was implemented in its quasiparticle second order version in the LOWDIN code and was applied to calculate nuclear quantum effects in electron binding energies and proton binding energies in molecular systems [M. Díaz-Tinoco, J. Romero, J. V. Ortiz, A. Reyes, and R. Flores-Moreno, J. Chem. Phys. 138, 194108 (2013)]. In this work,more » we present the derivation of third order quasiparticle APMO/PT methods and we apply them to calculate positron binding energies (PBEs) of atoms and molecules. We calculated the PBEs of anions and some diatomic molecules using the second order, third order, and renormalized third order quasiparticle APMO/PT approaches and compared our results with those previously calculated employing configuration interaction (CI), explicitly correlated and quantum Montecarlo methodologies. We found that renormalized APMO/PT methods can achieve accuracies of ∼0.35 eV for anionic systems, compared to Full-CI results, and provide a quantitative description of positron binding to anionic and highly polar species. Third order APMO/PT approaches display considerable potential to study positron binding to large molecules because of the fifth power scaling with respect to the number of basis sets. In this regard, we present additional PBE calculations of some small polar organic molecules, amino acids and DNA nucleobases. We complement our numerical assessment with formal and numerical analyses of the treatment of electron-positron correlation within the quasiparticle propagator approach.« less

Photoelectron imaging spectroscopy of niobium mononitride anion NbN{sup −}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berkdemir, Cuneyt; Department of Physics, Faculty of Science, Erciyes University, Kayseri 38039; Gunaratne, K. Don Dasitha

2016-07-21

In this gas-phase photoelectron spectroscopy study, we present the electron binding energy spectrum and photoelectron angular distributions of NbN{sup −} by the velocity-map imaging technique. The electron binding energy of NbN{sup −} is measured to be 1.42 ± 0.02 eV from the X band maximum which defines the 0-0 transition between ground states of anion and neutral. Theoretical binding energies which are the vertical and adiabatic detachment energies are computed by density functional theory to compare them with experiment. The ground state of NbN{sup −} is assigned to the {sup 2}Δ{sub 3/2} state and then the electronic transitions originating frommore » this state into X{sup 3}Δ{sub Ω} (Ω = 1-3), a{sup 1}Δ{sub 2}, A{sup 3}Σ{sub 1}{sup −}, and b{sup 1}Σ{sub 0}{sup +} states of NbN are reported to interpret the spectral features. As a prospective study for catalytic materials, spectral features of NbN{sup −} are compared with those of isovalent ZrO{sup −} and Pd{sup −}.« less

The Self-Association of Graphane Is Driven by London Dispersion and Enhanced Orbital Interactions.

PubMed

Wang, Changwei; Mo, Yirong; Wagner, J Philipp; Schreiner, Peter R; Jemmis, Eluvathingal D; Danovich, David; Shaik, Sason

2015-04-14

We investigated the nature of the cohesive energy between graphane sheets via multiple CH···HC interactions, using density functional theory (DFT) including dispersion correction (Grimme's D3 approach) computations of [n]graphane σ dimers (n = 6-73). For comparison, we also evaluated the binding between graphene sheets that display prototypical π/π interactions. The results were analyzed using the block-localized wave function (BLW) method, which is a variant of ab initio valence bond (VB) theory. BLW interprets the intermolecular interactions in terms of frozen interaction energy (ΔE(F)) composed of electrostatic and Pauli repulsion interactions, polarization (ΔE(pol)), charge-transfer interaction (ΔE(CT)), and dispersion effects (ΔE(disp)). The BLW analysis reveals that the cohesive energy between graphane sheets is dominated by two stabilizing effects, namely intermolecular London dispersion and two-way charge transfer energy due to the σ(CH) → σ*(HC) interactions. The shift of the electron density around the nonpolar covalent C-H bonds involved in the intermolecular interaction decreases the C-H bond lengths uniformly by 0.001 Å. The ΔE(CT) term, which accounts for ∼15% of the total binding energy, results in the accumulation of electron density in the interface area between two layers. This accumulated electron density thus acts as an electronic "glue" for the graphane layers and constitutes an important driving force in the self-association and stability of graphane under ambient conditions. Similarly, the "double faced adhesive tape" style of charge transfer interactions was also observed among graphene sheets in which it accounts for ∼18% of the total binding energy. The binding energy between graphane sheets is additive and can be expressed as a sum of CH···HC interactions, or as a function of the number of C-H bonds.

Variational calculation of ground-state energy of iron atoms and condensed matter in strong magnetic fields. [at neutron star surfaces

NASA Technical Reports Server (NTRS)

Flowers, E. G.; Ruderman, M. A.; Lee, J.-F.; Sutherland, P. G.; Hillebrandt, W.; Mueller, E.

1977-01-01

Variational calculations of the binding energies of iron atoms and condensed matter in strong magnetic fields (greater than 10 to the 12th gauss). These calculations include the electron exchange energy. The cohesive energy of the condensed matter, which is the difference between these two binding energies, is of interest in pulsar theories and in the description of the surfaces of neutron stars. It is found that the cohesive energy ranges from 2.6 keV to 8.0 keV.

Theoretical study of metal noble-gas positive ions

NASA Technical Reports Server (NTRS)

Bauschlicher, Charles W., Jr.; Partridge, Harry; Langhoff, Stephen R.

1989-01-01

Theoretical calculations have been performed to determine the spectroscopic constant for the ground and selected low-lying electronic states of the transition-metal noble-gas ions Var(+), FeAr(+), CoAr(+), CuHe(+), CuAr(+), and CuKr(+). Analogous calculations have been performed for the ground states of the alkali noble-gas ions LiAr(+), LiKr(+), NaAr(+), and KAr(+) and the alkaline-earth noble-gas ion MgAr(+) to contrast the difference in binding energies between the simple and transition-metal noble-gas ions. The binding energies increase with increasing polarizability of the noble-gas ions, as expected for a charge-induced dipole bonding mechanism. It is found that the spectroscopic constants of the X 1Sigma(+) states of the alkali noble-gas ions are well described at the self-consistent field level. In contrast, the binding energies of the transition-metal noble-gas ions are substantially increased by electron correlation.

Complexes of dipolar excitons in layered quasi-two-dimensional nanostructures

NASA Astrophysics Data System (ADS)

Bondarev, Igor V.; Vladimirova, Maria R.

2018-04-01

We discuss neutral and charged complexes (biexcitons and trions) formed by indirect excitons in layered quasi-two-dimensional semiconductor heterostructures. Indirect excitons—long-lived neutral Coulomb-bound pairs of electrons and holes of different layers—have been known for semiconductor coupled quantum wells and have recently been reported for van der Waals heterostructures such as double bilayer graphene and transition-metal dichalcogenides. Using the configuration space approach, we derive the analytical expressions for the trion and biexciton binding energies as a function of interlayer distance. The method captures essential kinematics of complex formation to reveal significant binding energies, up to a few tens of meV for typical interlayer distances ˜3 -5 Å , with the trion binding energy always being greater than that of the biexciton. Our results can contribute to the understanding of more complex many-body phenomena such as exciton Bose-Einstein condensation and Wigner-like electron-hole crystallization in layered semiconductor heterostructures.

Assessment of strontium oxide functionalized graphene nanoflakes for enhanced photocatalytic activity: A density functional theory approach

NASA Astrophysics Data System (ADS)

Divya, A.; Mathavan, T.; Asath, R. Mohamed; Archana, J.; Hayakawa, Y.; Benial, A. Milton Franklin

2016-05-01

A series of strontium oxide functionalized graphene nanoflakes were designed and their optoelectronic properties were studied for enhanced photocatalytic activity. The efficiency of designed molecules was studied using various parameters such as HOMO-LUMO energy gap, light harvesting efficiency and exciton binding energy. The computed results show that by increasing the degree of functionalization of strontium oxide leads to lowering the band gap of hydrogen terminated graphene nanoflakes. Furthermore, the study explores the role of strontium oxide functionalization in Frontier Molecular Orbitals, ionization potential, electron affinity, exciton binding energy and light harvesting efficiency of designed molecules. The infrared and Raman spectra were simulated for pure and SrO functionalized graphene nanoflakes. The electron rich and electron deficient regions which are favorable for electrophilic and nucleophilic attacks respectively were analyzed using molecular electrostatic potential surface analysis.

An (e, 2e+ ion) study of electron-impact ionization and fragmentation of tetrafluoromethane at low energies

NASA Astrophysics Data System (ADS)

Hossen, Khokon; Ren, Xueguang; Wang, Enliang; Kumar, S. V. K.; Dorn, Alexander

2018-03-01

We study ionization and fragmentation of tetrafluoromethane (CF4) molecule induced by electron impact at low energies ( E 0 = 38 and 67 eV). We use a reaction microscope combined with a pulsed photoemission electron beam for our experimental investigation. The momentum vectors of the two outgoing electrons (energies E 1, E 2) and one fragment ion are detected in triple coincidence (e, 2e+ ion). After dissociation, the fragment products observed are CF3 +, CF2 +, CF+, F+ and C+. For CF3 + and CF2 + channels, we measure the ionized orbitals binding energies, the kinetic energy (KE) of the charged fragments and the two-dimensional (2D) correlation map between binding energy (BE) and KE of the fragments. From the BE and KE spectra, we conclude which molecular orbitals contribute to particular fragmentation channels of CF4. We also measure the total ionization cross section for the formation of CF3 + and CF2 + ions as function of projectile energy. We compare our results with earlier experiments and calculations for electron-impact and photoionization. The major contribution to CF3 + formation originates from ionization of the 4t2 orbital while CF2 + is mainly formed after 3t2 orbital ionization. We also observe a weak contribution of the (4a1)-1 state for the channel CF3 +.

Determination of the binding energies of the np Rydberg states of H{sub 2}, HD, and D{sub 2} from high-resolution spectroscopic data by multichannel quantum-defect theory

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sprecher, Daniel; Merkt, Frédéric, E-mail: frederic.merkt@phys.chem.ethz.ch; Jungen, Christian

2014-03-14

Multichannel quantum-defect theory (MQDT) is used to calculate the electron binding energies of np Rydberg states of H{sub 2}, HD, and D{sub 2} around n = 60 at an accuracy of better than 0.5 MHz. The theory includes the effects of rovibronic channel interactions and the hyperfine structure, and has been extended to the calculation of the asymmetric hyperfine structure of Rydberg states of a heteronuclear diatomic molecule (HD). Starting values for the eigenquantum-defect parameters of MQDT were extracted from ab initio potential-energy functions for the low-lying p Rydberg states of molecular hydrogen and subsequently refined in a global weighted fitmore » to available experimental data on the singlet and triplet Rydberg states of H{sub 2} and D{sub 2}. The electron binding energies of high-np Rydberg states derived in this work represent important quantities for future determinations of the adiabatic ionization energies of H{sub 2}, HD, and D{sub 2} at sub-MHz accuracy.« less

Signatures of van der Waals binding: A coupling-constant scaling analysis

NASA Astrophysics Data System (ADS)

Jiao, Yang; Schröder, Elsebeth; Hyldgaard, Per

2018-02-01

The van der Waals (vdW) density functional (vdW-DF) method [Rep. Prog. Phys. 78, 066501 (2015), 10.1088/0034-4885/78/6/066501] describes dispersion or vdW binding by tracking the effects of an electrodynamic coupling among pairs of electrons and their associated exchange-correlation holes. This is done in a nonlocal-correlation energy term Ecnl, which permits density functional theory calculation in the Kohn-Sham scheme. However, to map the nature of vdW forces in a fully interacting materials system, it is necessary to also account for associated kinetic-correlation energy effects. Here, we present a coupling-constant scaling analysis, which permits us to compute the kinetic-correlation energy Tcnl that is specific to the vdW-DF account of nonlocal correlations. We thus provide a more complete spatially resolved analysis of the electrodynamical-coupling nature of nonlocal-correlation binding, including vdW attraction, in both covalently and noncovalently bonded systems. We find that kinetic-correlation energy effects play a significant role in the account of vdW or dispersion interactions among molecules. Furthermore, our mapping shows that the total nonlocal-correlation binding is concentrated to pockets in the sparse electron distribution located between the material fragments.

Electronic structure of antibiotic erythromycin

NASA Astrophysics Data System (ADS)

Novak, Igor; Kovač, Branka

2015-03-01

The electronic structure of erythromycin A (ERYMA) molecule has been studied by UV photoelectron spectroscopy and assigned (in the low ionization energy region only) by empirical arguments. The two orbitals with highest energy (lowest ionization energy) are localized on the nitrogen of the desosamine sugar functional group and on the ester group of macrolide (lactone) ring. We discuss how these orbital energies can help to rationalize the known mode of binding of ERYMA to their biological receptors.

Time-dependent density-functional tight-binding method with the third-order expansion of electron density

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishimoto, Yoshio, E-mail: nishimoto.yoshio@fukui.kyoto-u.ac.jp

2015-09-07

We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of themore » third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.« less

Time-dependent density-functional tight-binding method with the third-order expansion of electron density.

PubMed

Nishimoto, Yoshio

2015-09-07

We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of the third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.

Electronic structure and mechanical properties of plasma nitrided ferrous alloys

NASA Astrophysics Data System (ADS)

Portolan, E.; Baumvol, I. J. R.; Figueroa, C. A.

2009-04-01

The electronic structures of the near-surface regions of two different nitrided steels (AISI 316 and 4140) were investigated using X-ray photoelectron spectroscopy. Photoelectron groups from all main chemical elements involved were addressed for steel samples with implanted-N concentrations in the range 16-32 at.%. As the implanted-N concentrations were increased, rather contrasting behaviors were observed for the two kinds of steel. The N1s photoelectrons had spectral shifts toward lower (nitrided AISI 316) or higher (nitrided AISI 4140) binding energies, whereas the Fe2p 3/2 photoelectron spectrum remains at a constant binding energy (nitrided AISI 316) or shifts toward higher binding energies (AISI 4140). These trends are discussed in terms of the metallic nitride formation and the overlapping of atomic orbitals. For nitrided AISI 316, a semi-classical approach of charge transfer between Cr and N is used to explain the experimental facts (formation of CrN), while for nitrided AISI 4140 we propose that the interaction between orbitals 4s from Fe and 2p from N promotes electrons to the conduction band increasing the electrical attraction of the N1s and Fe2p electrons in core shells (formation of FeN x). The increase in hardness of the steel upon N implantation is attributed to the localization of electrons in specific bonds, which diminishes the metallic bond character.

Universal binding energy relations in metallic adhesion

NASA Technical Reports Server (NTRS)

Ferrante, J.; Smith, J. R.; Rose, J. J.

1984-01-01

Rose, Smith, and Ferrante have discovered scaling relations which map the adhesive binding energy calculated by Ferrante and Smith onto a single universal binding energy curve. These binding energies are calculated for all combinations of Al(111), Zn(0001), Mg(0001), and Na(110) in contact. The scaling involves normalizing the energy by the maximum binding energy and normalizing distances by a suitable combination of Thomas-Fermi screening lengths. Rose et al. have also found that the calculated cohesive energies of K, Ba, Cu, Mo, and Sm scale by similar simple relations, suggesting the universal relation may be more general than for the simple free electron metals for which it was derived. In addition, the scaling length was defined more generally in order to relate it to measurable physical properties. Further this universality can be extended to chemisorption. A simple and yet quite accurate prediction of a zero temperature equation of state (volume as a function of pressure for metals and alloys) is presented. Thermal expansion coefficients and melting temperatures are predicted by simple, analytic expressions, and results compare favorably with experiment for a broad range of metals.

Electronic structure evolution of fullerene on CH 3NH 3PbI 3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Chenggong; Wang, Congcong; Liu, Xiaoliang

2015-03-19

The thickness dependence of fullerene on CH 3NH 3PbI 3 perovskitefilm surface has been investigated by using ultraviolet photoemission spectroscopy (UPS), X-ray photoemission spectroscopy(XPS), and inverse photoemission spectroscopy (IPES). The lowest unoccupied molecular orbital and highest occupied molecular orbital (HOMO) can be observed directly with IPES and UPS. It is observed that the HOMO level in fullerene shifts to lower binding energy. The XPS results show a strong initial shift of core levels to lower binding energy in the perovskite, which indicates that electrons transfer from the perovskitefilm to fullerene molecules. Further deposition of fullerene forms C 60 solid, accompaniedmore » by the reduction of the electron transfer. As a result, the strongest electron transfer happened at 1/4 monolayer of fullerene.« less

Electronic structure evolution of fullerene on CH{sub 3}NH{sub 3}PbI{sub 3}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Chenggong; Wang, Congcong; Kauppi, John

2015-03-16

The thickness dependence of fullerene on CH{sub 3}NH{sub 3}PbI{sub 3} perovskite film surface has been investigated by using ultraviolet photoemission spectroscopy (UPS), X-ray photoemission spectroscopy (XPS), and inverse photoemission spectroscopy (IPES). The lowest unoccupied molecular orbital and highest occupied molecular orbital (HOMO) can be observed directly with IPES and UPS. It is observed that the HOMO level in fullerene shifts to lower binding energy. The XPS results show a strong initial shift of core levels to lower binding energy in the perovskite, which indicates that electrons transfer from the perovskite film to fullerene molecules. Further deposition of fullerene forms C{submore » 60} solid, accompanied by the reduction of the electron transfer. The strongest electron transfer happened at 1/4 monolayer of fullerene.« less

Ultrafast Structural Dynamics in Combustion Relevant Model Systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weber, Peter M.

2014-03-31

The research project explored the time resolved structural dynamics of important model reaction system using an array of novel methods that were developed specifically for this purpose. They include time resolved electron diffraction, time resolved relativistic electron diffraction, and time resolved Rydberg fingerprint spectroscopy. Toward the end of the funding period, we also developed time-resolved x-ray diffraction, which uses ultrafast x-ray pulses at LCLS. Those experiments are just now blossoming, as the funding period expired. In the following, the time resolved Rydberg Fingerprint Spectroscopy is discussed in some detail, as it has been a very productive method. The binding energymore » of an electron in a Rydberg state, that is, the energy difference between the Rydberg level and the ground state of the molecular ion, has been found to be a uniquely powerful tool to characterize the molecular structure. To rationalize the structure sensitivity we invoke a picture from electron diffraction: when it passes the molecular ion core, the Rydberg electron experiences a phase shift compared to an electron in a hydrogen atom. This phase shift requires an adjustment of the binding energy of the electron, which is measurable. As in electron diffraction, the phase shift depends on the molecular, geometrical structure, so that a measurement of the electron binding energy can be interpreted as a measurement of the molecule’s structure. Building on this insight, we have developed a structurally sensitive spectroscopy: the molecule is first elevated to the Rydberg state, and the binding energy is then measured using photoelectron spectroscopy. The molecule’s structure is read out as the binding energy spectrum. Since the photoionization can be done with ultrafast laser pulses, the technique is inherently capable of a time resolution in the femtosecond regime. For the purpose of identifying the structures of molecules during chemical reactions, and for the analysis of molecular species in the hot environments of combustion processes, there are several features that make the Rydberg ionization spectroscopy uniquely useful. First, the Rydberg electron’s orbit is quite large and covers the entire molecule for most molecular structures of combustion interest. Secondly, the ionization does not change vibrational quantum numbers, so that even complicated and large molecules can be observed with fairly well resolved spectra. In fact, the spectroscopy is blind to vibrational excitation of the molecule. This has the interesting consequence for the study of chemical dynamics, where the molecules are invariably very energetic, that the molecular structures are observed unobstructed by the vibrational congestion that dominates other spectroscopies. This implies also that, as a tool to probe the time-dependent structural dynamics of chemically interesting molecules, Rydberg spectroscopy may well be better suited than electron or x-ray diffraction. With recent progress in calculating Rydberg binding energy spectra, we are approaching the point where the method can be evolved into a structure determination method. To implement the Rydberg ionization spectroscopy we use a molecular beam based, time-resolved pump-probe multi-photon ionization/photoelectron scheme in which a first laser pulse excites the molecule to a Rydberg state, and a probe pulse ionizes the molecule. A time-of-flight detector measures the kinetic energy spectrum of the photoelectrons. The photoelectron spectrum directly provides the binding energy of the electron, and thereby reveals the molecule’s time-dependent structural fingerprint. Only the duration of the laser pulses limits the time resolution. With a new laser system, we have now reached time resolutions better than 100 fs, although very deep UV wavelengths (down to 190 nm) have slightly longer instrument functions. The structural dynamics of molecules in Rydberg-excited states is obtained by delaying the probe ionization photon from the pump photon; the structural dynamics of molecules in their ground state or excited valence states is measured by inducing the dynamics using a near UV laser pulse, and employing a multi-photon ionization scheme via the Rydberg states as a probe process. Thus, the technique is capable of measuring the reaction dynamics in any electronic state of neutral molecules.« less

Quantum mechanics/molecular mechanics modeling of photoelectron spectra: the carbon 1s core-electron binding energies of ethanol-water solutions.

PubMed

Löytynoja, T; Niskanen, J; Jänkälä, K; Vahtras, O; Rinkevicius, Z; Ågren, H

2014-11-20

Using ethanol-water solutions as illustration, we demonstrate the capability of the hybrid quantum mechanics/molecular mechanics (QM/MM) paradigm to simulate core photoelectron spectroscopy: the binding energies and the chemical shifts. An integrated approach with QM/MM binding energy calculations coupled to preceding molecular dynamics sampling is adopted to generate binding energies averaged over the solute-solvent configurations available at a particular temperature and pressure and thus allowing for a statistical assessment with confidence levels for the final binding energies. The results are analyzed in terms of the contributions in the molecular mechanics model-electrostatic, polarization, and van der Waals-with atom or bond granulation of the corresponding MM charge and polarizability force-fields. The role of extramolecular charge transfer screening of the core-hole and explicit hydrogen bonding is studied by extending the QM core to cover the first solvation shell. The results are compared to those obtained from pure electrostatic and polarizable continuum models. Particularly, the dependence of the carbon 1s binding energies with respect to the ethanol concentration is studied. Our results indicate that QM/MM can be used as an all-encompassing model to study photoelectron binding energies and chemical shifts in solvent environments.

Insights on the Cuprate High Energy Anomaly Observed in ARPES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moritz, Brian

2011-08-16

Recently, angle-resolved photoemission spectroscopy has been used to highlight an anomalously large band renormalization at high binding energies in cuprate superconductors: the high energy 'waterfall' or high energy anomaly (HEA). The anomaly is present for both hole- and electron-doped cuprates as well as the half-filled parent insulators with different energy scales arising on either side of the phase diagram. While photoemission matrix elements clearly play a role in changing the aesthetic appearance of the band dispersion, i.e. creating a 'waterfall'-like appearance, they provide an inadequate description for the physics that underlies the strong band renormalization giving rise to the HEA.more » Model calculations of the single-band Hubbard Hamiltonian showcase the role played by correlations in the formation of the HEA and uncover significant differences in the HEA energy scale for hole- and electron-doped cuprates. In addition, this approach properly captures the transfer of spectral weight accompanying doping in a correlated material and provides a unifying description of the HEA across both sides of the cuprate phase diagram. We find that the anomaly demarcates a transition, or cross-over, from a quasiparticle band at low binding energies near the Fermi level to valence bands at higher binding energy, assumed to be of strong oxygen character.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ren, Xueguang, E-mail: xue.g.ren@ptb.de; Pflüger, Thomas; Weyland, Marvin

The ionization and fragmentation of methane induced by low-energy (E{sub 0} = 66 eV) electron-impact is investigated using a reaction microscope. The momentum vectors of all three charged final state particles, two outgoing electrons, and one fragment ion, are detected in coincidence. Compared to the earlier study [Xu et al., J. Chem. Phys. 138, 134307 (2013)], considerable improvements to the instrumental mass and energy resolutions have been achieved. The fragment products CH{sub 4}{sup +}, CH{sub 3}{sup +}, CH{sub 2}{sup +}, CH{sup +}, and C{sup +} are clearly resolved. The binding energy resolution of ΔE = 2.0 eV is a factormore » of three better than in the earlier measurements. The fragmentation channels are investigated by measuring the ion kinetic energy distributions and the binding energy spectra. While being mostly in consistence with existing photoionization studies the results show differences including missing fragmentation channels and previously unseen channels.« less

Properties of 83mKr conversion electrons and their use in the KATRIN experiment

NASA Astrophysics Data System (ADS)

Vénos, D.; Sentkerestiová, J.; Dragoun, O.; Slezák, M.; Ryšavý, M.; Špalek, A.

2018-02-01

The gaseous 83mKr will be used as a source of monoenergetic conversion electrons for systematic studies and calibration of the energy scale in the KArlsruhe TRItium Neutrino experiment (KATRIN). Using all existing experimental data the adopted values of the electron binding energies for free krypton were established and the basic conversion electron properties in 83mKr decay were compiled. Modes of the measurements with gaseous 83mKr were suggested for KATRIN.

Basis sets for the calculation of core-electron binding energies

NASA Astrophysics Data System (ADS)

Hanson-Heine, Magnus W. D.; George, Michael W.; Besley, Nicholas A.

2018-05-01

Core-electron binding energies (CEBEs) computed within a Δ self-consistent field approach require large basis sets to achieve convergence with respect to the basis set limit. It is shown that supplementing a basis set with basis functions from the corresponding basis set for the element with the next highest nuclear charge (Z + 1) provides basis sets that give CEBEs close to the basis set limit. This simple procedure provides relatively small basis sets that are well suited for calculations where the description of a core-ionised state is important, such as time-dependent density functional theory calculations of X-ray emission spectroscopy.

Effective homogeneity of the exchange-correlation and non-interacting kinetic energy functionals under density scaling.

PubMed

Borgoo, Alex; Teale, Andrew M; Tozer, David J

2012-01-21

Correlated electron densities, experimental ionisation potentials, and experimental electron affinities are used to investigate the homogeneity of the exchange-correlation and non-interacting kinetic energy functionals of Kohn-Sham density functional theory under density scaling. Results are presented for atoms and small molecules, paying attention to the influence of the integer discontinuity and the choice of the electron affinity. For the exchange-correlation functional, effective homogeneities are highly system-dependent on either side of the integer discontinuity. By contrast, the average homogeneity-associated with the potential that averages over the discontinuity-is generally close to 4/3 when the discontinuity is computed using positive affinities for systems that do bind an excess electron and negative affinities for those that do not. The proximity to 4/3 becomes increasingly pronounced with increasing atomic number. Evaluating the discontinuity using a zero affinity in systems that do not bind an excess electron instead leads to effective homogeneities on the electron abundant side that are close to 4/3. For the non-interacting kinetic energy functional, the effective homogeneities are less system-dependent and the effect of the integer discontinuity is less pronounced. Average values are uniformly below 5/3. The study provides information that may aid the development of improved exchange-correlation and non-interacting kinetic energy functionals. © 2012 American Institute of Physics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beard, Matthew C; Chen, Xihan; Lu, Haipeng

The exciton binding energy in methylammonium lead iodide (MAPbI3) is about 10 meV, around 1/3 of the available thermal energy (kBT ~ 26 meV) at room temperature. Thus, exciton populations are not stable at room temperature at moderate photoexcited carrier densities. However, excitonic resonances dominate the absorption onset. Furthermore, these resonances determine the transient absorbance and transient reflectance spectra. The exciton binding energy is a reflection of the Coulomb interaction energy between photoexcited electrons and holes. As such, it serves as a marker for the strength of electron/hole interactions and impacts a variety of phenomena, such as, absorption, radiative recombination,more » and Auger recombination. In this Perspective, we discuss the role of excitons and excitonic resonances in the optical properties of lead-halide perovskite semiconductors. Finally, we discuss how the strong light-matter interactions induce an optical stark effect splitting the doubly spin degenerate ground exciton states and are easily observed at room temperature.« less

Electron binding energy of uranium-ligand and uranyl-ligand anions

NASA Astrophysics Data System (ADS)

Wang, Lei; Horowitz, Steven; Marston, Brad

2012-02-01

Electron binding energies of the early actinide element uranium in gas-phase anion complexes are calculated by relativistic density functional theory (DFT) with two different exchange-correlation functions (RPBE and B3LYP) and also in the Hartree-Fock (HF) approximationootnotetextADF2010.02, SCM.com. Scalar and spin-orbit calculations are performed, and the calculated energies are compared to available experimental measurements and shown to disagree by energies of order 1 eV. Strong correlations that are poorly treated in DFT and HF can be included by a hybrid approach in which a generalized Anderson impurity model is numerically diagonalized. Reduction-oxidation (redox) potentials of aqueous actinide ions show improved agreement with measured values in the hybrid approachootnotetextS. E. Horowitz and J. B. Marston, J. Chem. Phys 134 064510 (2011).. We test whether or not similar improvements are found in the gas-phase.

Theoretical analysis of the time-resolved binary (e, 2e) binding energy spectra on three-body photodissociation of acetone at 195 nm

NASA Astrophysics Data System (ADS)

Yamazaki, M.; Nakayama, S.; Zhu, C. Y.; Takahashi, M.

2017-11-01

We report on theoretical progress in time-resolved (e, 2e) electron momentum spectroscopy of photodissociation dynamics of the deuterated acetone molecule at 195 nm. We have examined the predicted minimum energy reaction path to investigate whether associated (e, 2e) calculations meet the experimental results. A noticeable difference between the experiment and calculations has been found at around binding energy of 10 eV, suggesting that the observed difference may originate, at least partly, in ever-unconsidered non-minimum energy paths.

Tight-binding model of the photosystem II reaction center: application to two-dimensional electronic spectroscopy

NASA Astrophysics Data System (ADS)

Gelzinis, Andrius; Valkunas, Leonas; Fuller, Franklin D.; Ogilvie, Jennifer P.; Mukamel, Shaul; Abramavicius, Darius

2013-07-01

We propose an optimized tight-binding electron-hole model of the photosystem II (PSII) reaction center (RC). Our model incorporates two charge separation pathways and spatial correlations of both static disorder and fast fluctuations of energy levels. It captures the main experimental features observed in time-resolved two-dimensional (2D) optical spectra at 77 K: peak pattern, lineshapes and time traces. Analysis of 2D spectra kinetics reveals that specific regions of the 2D spectra of the PSII RC are sensitive to the charge transfer states. We find that the energy disorder of two peripheral chlorophylls is four times larger than the other RC pigments.

Conductance of three-terminal molecular bridge based on tight-binding theory

NASA Astrophysics Data System (ADS)

Wang, Li-Guang; Li, Yong; Yu, Ding-Wen; Katsunori, Tagami; Masaru, Tsukada

2005-05-01

The quantum transmission characteristic of three-benzene ring nano-molecular bridge is investigated theoretically by using Green's function approach based on tight-binding theory with only a π orbital per carbon atom at the site. The transmission probabilities that electrons transport through the molecular bridge from one terminal to the other two terminals are obtained. The electronic current distributions inside the molecular bridge are calculated and shown in graphical analogy by the current density method based on Fisher-Lee formula at the energy points E = ±0.42, ±1.06 and ±1.5, respectively, where the transmission spectra appear peaks. We find that the transmission spectra are related to the incident electronic energy and the molecular levels strongly and the current distributions agree well with Kirchhoff quantum current momentum conservation law.

Examining the structural evolution of bicarbonate–water clusters: insights from photoelectron spectroscopy, basin-hopping structural search, and comparison with available IR spectral studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wen, Hui; Hou, Gao-Lei; Liu, Yi-Rong

2016-05-31

Bicarbonate serves a crucial biochemical role in the physiological pH buffering system and also has important atmospheric implications. In the current study, HCO 3 $-$(H 2O) n (n = 0-13) clusters were successfully produced via electrospray ionization of corresponding bulk salt solution, and were characterized by combining negative ion photoelectron spectroscopy and theoretical calculations. The photoelectron spectra reveal that the electron binding energy monotonically increases with the cluster size up to n = 10 and remains largely the same after n > 10. The photo-detaching feature of the solute HCO3$-$itself, which dominates in the small clusters, diminishes with increase ofmore » water coverage. Based on the charge distribution and molecular orbital analyses, the universal high electron binding energy tail that dominates in the larger clusters can be attributed to ionization of water. Thus, the transition of ionization from solute to solvent at the size larger than n=10 has been observed. Extensive theoretical structural search based on the Basin-Hopping unbiased method was carried out, and a plethora of low energy isomers have been obtained for each medium and large size. By comparing the simulated photoelectron spectra and calculated electron binding energies with the experiments, as well as by comparing the simulated infrared spectra with previously reported IR spectra, the probable global minima and the structural evolutionary routes are presented. The nature of bicarbonate-water interactions are mainly electrostatic as implied by the electron localization function (ELF) analysis.« less

On the nature of the {SO2-4}/{Ag(111) } and {SO2-4}/{Au(111) } surface bonding

NASA Astrophysics Data System (ADS)

Patrito, E. M.; Olivera, P. Paredes; Sellers, Harrell

1997-05-01

The nature of sulfate-Ag(111) and sulfate-Au(111) surface bonding has been investigated at the SCF + MP2 level of theory. Convergence of binding energy with cluster size is investigated and, unlike neutral adsorbates, large clusters are required in order to obtain reliable binding energies. In the most stable adsorption mode, sulfate binds to the surface via three oxygen atoms (C 3v symmetry) with a binding energy of 159.3 kcal/mol on Ag(111) and 143.9 kcal/mol on Au(111). The geometry of adsorbed sulfate was optimized at the SCF level. While the bond length between sulfur and the oxygens coordinated to the surface increases, the sulfur-uncoordinated oxygen bond length decreases. This weakening and strengthening of the bonds, respectively, is consistent with bond order conservation in adsorbates on metal surfaces. Although a charge transfer of 0.4 electrons towards the metal is observed, the adsorbate remains very much sulfate-like. The molecular orbital analysis indicates that there is also some charge back-donation towards unoccupied orbitals of sulfate. This results in an increased electron density around sulfur as revealed in the electron density difference maps. Analysis of the Laplacian of the charge density of free sulfate provides a suitable framework to understand the nature of the different charge transfer processes and allows us to establish some similarities with the CO- and SO 2-metal bondings.

Hartree-Fock implementation using a Laguerre-based wave function for the ground state and correlation energies of two-electron atoms.

PubMed

King, Andrew W; Baskerville, Adam L; Cox, Hazel

2018-03-13

An implementation of the Hartree-Fock (HF) method using a Laguerre-based wave function is described and used to accurately study the ground state of two-electron atoms in the fixed nucleus approximation, and by comparison with fully correlated (FC) energies, used to determine accurate electron correlation energies. A variational parameter A is included in the wave function and is shown to rapidly increase the convergence of the energy. The one-electron integrals are solved by series solution and an analytical form is found for the two-electron integrals. This methodology is used to produce accurate wave functions, energies and expectation values for the helium isoelectronic sequence, including at low nuclear charge just prior to electron detachment. Additionally, the critical nuclear charge for binding two electrons within the HF approach is calculated and determined to be Z HF C =1.031 177 528.This article is part of the theme issue 'Modern theoretical chemistry'. © 2018 The Author(s).

Impact of Many-Body Effects on Landau Levels in Graphene

NASA Astrophysics Data System (ADS)

Sonntag, J.; Reichardt, S.; Wirtz, L.; Beschoten, B.; Katsnelson, M. I.; Libisch, F.; Stampfer, C.

2018-05-01

We present magneto-Raman spectroscopy measurements on suspended graphene to investigate the charge carrier density-dependent electron-electron interaction in the presence of Landau levels. Utilizing gate-tunable magnetophonon resonances, we extract the charge carrier density dependence of the Landau level transition energies and the associated effective Fermi velocity vF. In contrast to the logarithmic divergence of vF at zero magnetic field, we find a piecewise linear scaling of vF as a function of the charge carrier density, due to a magnetic-field-induced suppression of the long-range Coulomb interaction. We quantitatively confirm our experimental findings by performing tight-binding calculations on the level of the Hartree-Fock approximation, which also allow us to estimate an excitonic binding energy of ≈6 meV contained in the experimentally extracted Landau level transitions energies.

The Role of Glycine Residues 140 and 141 of Subunit B in the Functional Ubiquinone Binding Site of the Na+-pumping NADH:quinone Oxidoreductase from Vibrio cholerae*

PubMed Central

Juárez, Oscar; Neehaul, Yashvin; Turk, Erin; Chahboun, Najat; DeMicco, Jessica M.; Hellwig, Petra; Barquera, Blanca

2012-01-01

The Na+-pumping NADH:quinone oxidoreductase (Na+-NQR) is the main entrance for electrons into the respiratory chain of many marine and pathogenic bacteria. The enzyme accepts electrons from NADH and donates them to ubiquinone, and the free energy released by this redox reaction is used to create an electrochemical gradient of sodium across the cell membrane. Here we report the role of glycine 140 and glycine 141 of the NqrB subunit in the functional binding of ubiquinone. Mutations at these residues altered the affinity of the enzyme for ubiquinol. Moreover, mutations in residue NqrB-G140 almost completely abolished the electron transfer to ubiquinone. Thus, NqrB-G140 and -G141 are critical for the binding and reaction of Na+-NQR with its electron acceptor, ubiquinone. PMID:22645140

Benchmark CCSD(T) and DFT study of binding energies in Be7 - 12: in search of reliable DFT functional for beryllium clusters

NASA Astrophysics Data System (ADS)

Labanc, Daniel; Šulka, Martin; Pitoňák, Michal; Černušák, Ivan; Urban, Miroslav; Neogrády, Pavel

2018-05-01

We present a computational study of the stability of small homonuclear beryllium clusters Be7 - 12 in singlet electronic states. Our predictions are based on highly correlated CCSD(T) coupled cluster calculations. Basis set convergence towards the complete basis set limit as well as the role of the 1s core electron correlation are carefully examined. Our CCSD(T) data for binding energies of Be7 - 12 clusters serve as a benchmark for performance assessment of several density functional theory (DFT) methods frequently used in beryllium cluster chemistry. We observe that, from Be10 clusters on, the deviation from CCSD(T) benchmarks is stable with respect to size, and fluctuating within 0.02 eV error bar for most examined functionals. This opens up the possibility of scaling the DFT binding energies for large Be clusters using CCSD(T) benchmark values for smaller clusters. We also tried to find analogies between the performance of DFT functionals for Be clusters and for the valence-isoelectronic Mg clusters investigated recently in Truhlar's group. We conclude that it is difficult to find DFT functionals that perform reasonably well for both beryllium and magnesium clusters. Out of 12 functionals examined, only the M06-2X functional gives reasonably accurate and balanced binding energies for both Be and Mg clusters.

The effects of the electric and intense laser field on the binding energies of donor impurity states (1s and 2p±) and optical absorption between the related states in an asymmetric parabolic quantum well

NASA Astrophysics Data System (ADS)

Kasapoglu, E.; Sakiroglu, S.; Sökmen, I.; Restrepo, R. L.; Mora-Ramos, M. E.; Duque, C. A.

2016-10-01

We have calculated the effects of electric and intense laser fields on the binding energies of the ground and some excited states of conduction electrons coupled to shallow donor impurities as well as the total optical absorption coefficient for transitions between 1s and 2p± electron-impurity states in a asymmetric parabolic GaAs/Ga1-x AlxAs quantum well. The binding energies were obtained using the effective-mass approximation within a variational scheme. Total absorption coefficient (linear and nonlinear absorption coefficient) for the transitions between any two impurity states were calculated from first- and third-order dielectric susceptibilities derived within a perturbation expansion for the density matrix formalism. Our results show that the effects of the electric field, intense laser field, and the impurity location on the binding energy of 1s-impurity state are more pronounced compared with other impurity states. If the well center is changed to be Lc<0 (Lc>0), the effective well width decreases (increases), and thus we can obtain the red or blue shift in the resonant peak position of the absorption coefficient by changing the intensities of the electric and non-resonant intense laser field as well as dimensions of the well and impurity positions.

Effect of Fermi surface nesting on resonant spin excitations in Ba{<_1-x}K{<_x}Fe{<_2}As{<_2}.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Castellan, J.-P.; Rosenkranz, S.; Goremychkin, E.A.

2011-01-01

We report inelastic neutron scattering measurements of the resonant spin excitations in Ba{sub 1-x}K{sub x}Fe{sub 2}As{sub 2} over a broad range of electron band filling. The fall in the superconducting transition temperature with hole doping coincides with the magnetic excitations splitting into two incommensurate peaks because of the growing mismatch in the hole and electron Fermi surface volumes, as confirmed by a tight-binding model with s{sub {+-}}-symmetry pairing. The reduction in Fermi surface nesting is accompanied by a collapse of the resonance binding energy and its spectral weight, caused by the weakening of electron-electron correlations.

On the validity of the basis set superposition error and complete basis set limit extrapolations for the binding energy of the formic acid dimer

NASA Astrophysics Data System (ADS)

Miliordos, Evangelos; Xantheas, Sotiris S.

2015-03-01

We report the variation of the binding energy of the Formic Acid Dimer with the size of the basis set at the Coupled Cluster with iterative Singles, Doubles and perturbatively connected Triple replacements [CCSD(T)] level of theory, estimate the Complete Basis Set (CBS) limit, and examine the validity of the Basis Set Superposition Error (BSSE)-correction for this quantity that was previously challenged by Kalescky, Kraka, and Cremer (KKC) [J. Chem. Phys. 140, 084315 (2014)]. Our results indicate that the BSSE correction, including terms that account for the substantial geometry change of the monomers due to the formation of two strong hydrogen bonds in the dimer, is indeed valid for obtaining accurate estimates for the binding energy of this system as it exhibits the expected decrease with increasing basis set size. We attribute the discrepancy between our current results and those of KKC to their use of a valence basis set in conjunction with the correlation of all electrons (i.e., including the 1s of C and O). We further show that the use of a core-valence set in conjunction with all electron correlation converges faster to the CBS limit as the BSSE correction is less than half than the valence electron/valence basis set case. The uncorrected and BSSE-corrected binding energies were found to produce the same (within 0.1 kcal/mol) CBS limits. We obtain CCSD(T)/CBS best estimates for De = - 16.1 ± 0.1 kcal/mol and for D0 = - 14.3 ± 0.1 kcal/mol, the later in excellent agreement with the experimental value of -14.22 ± 0.12 kcal/mol.

Ultrafast Dynamics of 1,3-Cyclohexadiene in Highly Excited States

DOE PAGES

Bühler, Christine C.; Minitti, Michael P.; Deb, Sanghamitra; ...

2011-01-01

The ultrafast dynamics of 1,3-cyclohexadiene has been investigated via structurally sensitive Rydberg electron binding energies and shown to differ upon excitation to the 1B state and the 3p Rydberg state. Excitation of the molecule with 4.63 eV photons into the ultrashort-lived 1B state yields the well-known ring opening to 1,3,5-hexatriene, while a 5.99 eV photon lifts the molecule directly into the 3p-Rydberg state. Excitation to 3p does not induce ring opening. In both experiments, time-dependent shifts of the Rydberg electron binding energy reflect the structural dynamics of the molecular core. Structural distortions associated with 3p-excitation cause a dynamical shift in the -more » and -binding energies by 10 and 26 meV/ps, respectively, whereas after excitation into 1B, more severe structural transformations along the ring-opening coordinate produce shifts at a rate of 40 to 60 meV/ps. The experiment validates photoionization-photoelectron spectroscopy via Rydberg states as a powerful technique to observe structural dynamics of polyatomic molecules.« less

First Principles Electronic Structure of Mn doped GaAs, GaP, and GaN Semiconductors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schulthess, Thomas C; Temmerman, Walter M; Szotek, Zdzislawa

We present first-principles electronic structure calculations of Mn doped III-V semiconductors based on the local spin-density approximation (LSDA) as well as the self-interaction corrected local spin density method (SIC-LSD). We find that it is crucial to use a self-interaction free approach to properly describe the electronic ground state. The SIC-LSD calculations predict the proper electronic ground state configuration for Mn in GaAs, GaP, and GaN. Excellent quantitative agreement with experiment is found for magnetic moment and p-d exchange in (GaMn)As. These results allow us to validate commonly used models for magnetic semiconductors. Furthermore, we discuss the delicate problem of extractingmore » binding energies of localized levels from density functional theory calculations. We propose three approaches to take into account final state effects to estimate the binding energies of the Mn-d levels in GaAs. We find good agreement between computed values and estimates from photoemisison experiments.« less

Pressure-induced increase of exciton-LO-phonon coupling in a ZnCdSe/ZnSe quantum well

NASA Astrophysics Data System (ADS)

Guo, Z. Z.; Liang, X. X.; Ban, S. L.

2003-07-01

The possibility of pressure-induced increase of exciton-LO-phonon coupling in ZnCdSe/ZnSe quantum wells is studied. The ground state binding energies of the heavy hole excitons are calculated using a variational method with consideration of the electron-phonon interaction and the pressure dependence of the parameters. The results show that for quantum wells with intermediate well width, the exciton binding energy and the LO-phonon energy may coincide in the course of pressure increasing, resulting in the increase of exciton-LO-phonon coupling. It is also found that among the pressure-dependent parameters, the influence of the lattice constant is the most important one. The changes of both the effective masses and the dielectric constants have obvious effects on the exciton binding energy, but their influences are counterbalanced.

Positronium ions and molecules

NASA Technical Reports Server (NTRS)

Ho, Y. K.

1990-01-01

Recent theoretical studies on positronium ions and molecules are discussed. A positronium ion is a three particle system consisting of two electrons in singlet spin state, and a positron. Recent studies include calculations of its binding energy, positron annihilation rate, and investigations of its doubly excited resonant states. A positronium molecule is a four body system consisting of two positrons and two electrons in an overall singlet spin state. The recent calculations of its binding energy against the dissociation into two positronium atoms, and studies of auto-detaching states in positronium molecules are discussed. These auto-dissociating states, which are believed to be part of the Rydberg series as a result of a positron attaching to a negatively charged positronium ion, Ps-, would appear as resonances in Ps-Ps scattering.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morris, J.R.; Lu, Z.; Ring, D.M.

We have examined a variety of structures for the {l_brace}510{r_brace} symmetric tilt boundary in Si and Ge, using tight-binding and first-principles calculations. These calculations show that the observed structure in Si is the lowest-energy structure, despite the fact that it is more complicated than what is necessary to preserve fourfold coordination. Contrary to calculations using a Tersoff potential, first-principles calculations show that the energy depends strongly upon the structure. A recently developed tight-binding model for Si produces results in very good agreement with the first-principles calculations. Electronic density of states calculations based upon this model show no evidence of midgapmore » states and little evidence of electronic states localized to the grain boundary. {copyright} {ital 1998} {ital The American Physical Society}« less

Renormalization of myoglobin–ligand binding energetics by quantum many-body effects

PubMed Central

Weber, Cédric; Cole, Daniel J.; O’Regan, David D.; Payne, Mike C.

2014-01-01

We carry out a first-principles atomistic study of the electronic mechanisms of ligand binding and discrimination in the myoglobin protein. Electronic correlation effects are taken into account using one of the most advanced methods currently available, namely a linear-scaling density functional theory (DFT) approach wherein the treatment of localized iron 3d electrons is further refined using dynamical mean-field theory. This combination of methods explicitly accounts for dynamical and multireference quantum physics, such as valence and spin fluctuations, of the 3d electrons, while treating a significant proportion of the protein (more than 1,000 atoms) with DFT. The computed electronic structure of the myoglobin complexes and the nature of the Fe–O2 bonding are validated against experimental spectroscopic observables. We elucidate and solve a long-standing problem related to the quantum-mechanical description of the respiration process, namely that DFT calculations predict a strong imbalance between O2 and CO binding, favoring the latter to an unphysically large extent. We show that the explicit inclusion of the many-body effects induced by the Hund’s coupling mechanism results in the correct prediction of similar binding energies for oxy- and carbonmonoxymyoglobin. PMID:24717844

Photoelectron spectroscopy of aqueous solutions: Streaming potentials of NaX (X = Cl, Br, and I) solutions and electron binding energies of liquid water and X{sup −}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kurahashi, Naoya; Horio, Takuya; Suzuki, Toshinori, E-mail: suzuki@kuchem.kyoto-u.ac.jp

2014-05-07

The streaming potentials of liquid beams of aqueous NaCl, NaBr, and NaI solutions are measured using soft X-ray, He(I), and laser multiphoton ionization photoelectron spectroscopy. Gaseous molecules are ionized in the vicinity of liquid beams and the photoelectron energy shifts are measured as a function of the distance between the ionization point and the liquid beam. The streaming potentials change their polarity with concentration of electrolytes, from which the singular points of concentration eliminating the streaming potentials are determined. The streaming currents measured in air also vanish at these concentrations. The electron binding energies of liquid water and I{sup −},more » Br{sup −}, and Cl{sup −} anions are revisited and determined more accurately than in previous studies.« less

Study of behaviors of aluminum overlayers deposited on uranium via AES, EELS, and XPS

NASA Astrophysics Data System (ADS)

Liu, Kezhao; Luo, Lizhu; Zhou, Wei; Yang, Jiangrong; Xiao, Hong; Hong, Zhanglian; Yang, Hui

2013-04-01

Aluminum overlayers on uranium were prepared by sputtering at room temperature in an ultra-high vacuum chamber. The growth mode of aluminum overlayers and behaviors of the Al/U interface reaction were studied in situ by auger electron spectroscopy, electron energy loss spectroscopy, and X-ray photoelectron spectroscopy. The results suggested that the interdiffusion took place at the Al/U interface during the initial stage of deposition. The U4f spectra of the Al/U interface showed strong correlation satellites at binding energies of 380.4 and 392.7 eV and plasma loss features at 404.2 eV, respectively. The interactions between aluminum and uranium yielded the intermetallic compound of UAlx, inducing the shift to a low binding energy for Al2p peaks. The results indicated that aluminum overlayers were formed on the uranium by sputtering in an island growth mode.

Morphology variation, composition alteration and microstructure changes in ion-irradiated 1060 aluminum alloy

NASA Astrophysics Data System (ADS)

Wan, Hao; Si, Naichao; Wang, Quan; Zhao, Zhenjiang

2018-02-01

Morphology variation, composition alteration and microstructure changes in 1060 aluminum irradiated with 50 keV helium ions were characterized by field emission scanning electron microscopy (FESEM) equipped with x-ray elemental scanning, 3D measuring laser microscope and transmission electron microscope (TEM). The results show that, helium ions irradiation induced surface damage and Si-rich aggregates in the surfaces of irradiated samples. Increasing the dose of irradiation, more damages and Si-rich aggregates would be produced. Besides, defects such as dislocations, dislocation loops and dislocation walls were the primary defects in the ion implanted layer. The forming of surface damages were related with preferentially sputtering of Al component. While irradiation-enhanced diffusion and irradiation-induced segregation resulted in the aggregation of impurity atoms. And the aggregation ability of impurity atoms were discussed based on the atomic radius, displacement energy, lattice binding energy and surface binding energy.

The structural, electronic and optical properties of Au-ZnO interface structure from the first-principles calculation

NASA Astrophysics Data System (ADS)

Huo, Jin-Rong; Li, Lu; Cheng, Hai-Xia; Wang, Xiao-Xu; Zhang, Guo-Hua; Qian, Ping

2018-03-01

The interface structure, electronic and optical properties of Au-ZnO are studied using the first-principles calculation based on density functional theory (DFT). Given the interfacial distance, bonding configurations and terminated surface, we built the optimal interface structure and calculated the electronic and optical properties of the interface. The total density of states, partial electronic density of states, electric charge density and atomic populations (Mulliken) are also displayed. The results show that the electrons converge at O atoms at the interface, leading to a stronger binding of interfaces and thereby affecting the optical properties of interface structures. In addition, we present the binding energies of different interface structures. When the interface structure of Au-ZnO gets changed, furthermore, varying optical properties are exhibited.

Adhesion of a bimetallic interface. Ph.D. Thesis - Case Western Reserve Univ.; [for Al, Mg, and Zn

NASA Technical Reports Server (NTRS)

Ferrante, J.

1978-01-01

The Hohenberg-Kohn and Kohn-Sham formalisms are used to examine binding (binding energy as a function of separation) for combinations of the simple metals Al(111), Zn(0001), Mg(0001), and Na(110) in contact. Similar metal contacts between Al, Zn, Mg, and Na are examined self-consistently in an ab initio calculation using the Kohn-Sham formalism. Crystallinity is included using the Aschroft pseudopotential via first order perturbation theory for the electron-ion interaction; and the ion-ion interaction is included exactly via a lattice sum. Binding energy was determined both in the local-density approximation and including gradient corrections to the exchange and correlation energy. Binding was found in all cases. In dissimilar metal contacts, interfacial bonding was greater than that in the weaker material predicting the possibility of metallic transfer. The nonzero position of the energy minimum in like metal contacts is explained in terms of consistency between the Ashcroft pseudopotential and the bulk charge density. Good agreement with experimental surface energies is obtained in the self-consistent calculation when nonlocal terms are included.

On the Rutherford-Santilli neutron model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burande, Chandrakant S.

2015-03-10

In 1920 H. Rutherford conjectured that the first particle synthesized in stars is neutron from a proton and an electron after which all known matter is progressively synthesized. However, Pauli objected Rutherford’s version of neutron synthesis because inability to represent spin 1/2 of the neutron. Using this objection E. Fermi proposed emission of massless particle, called “neutrino”. However, Santilli has dismissed the neutrino hypothesis following certain ambiguities such as positive binding energy required in synthesis of neutron. He found that celebrated Schrödinger’s equation of quantum physics is not suitable for obtaining positive binding energy for bound state at the dimensionmore » of 10{sup −13}cm. In order to remove these shortcomings, Santilli has developed isomathematics and then hadronic mechanics, which allowed the time invariant representation of Hamiltonian and non-Hamiltonian interactions as needed for the neutron synthesis (see for example: References cited at [1]).Thus the anomalies pertaining to the binding energy, the spin and the magnetic moment got resolved. He successfully calculated missing positive binding energy via isonormalization of the mass for electron when totally immersed within the hyper-dense medium inside the proton. Considering Rutherford’s compression of the isoelectron within the proton in the singlet coupling, he also identified the spin 1/2 for neutron and calculated the magnetic moment of the neutron. In order to verify his logical concept, he repeated the Don Carlo Borghi experiment of synthesis of the neutron from proton and electrons and verified that the said setup indeed produces neutron-type particles called “neutroids” which latter is absorbed by the activated detector substances that produces known nuclear reactions. He dismissed the neutrino hypothesis and replaced it with a longitudinal impulse originating from the ether as a universal substratum, named, “etherino”. He pointed out that all the physical quantities missing in the neutron synthesis, such as energy and spin, are delivered by said impulse.« less

Developing a Novel Hydrogen Sponge with Ideal Binding Energy and High Surface Area for Practical Hydrogen Storage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chung, T. C. Mike

This Phase I (5 quarters) research project was to examine the validity of a new class of boron-containing polymer (B-polymer) frameworks, serving as the adsorbents for the practical onboard H2 storage applications. Three B-polymer frameworks were synthesized and investigated, which include B-poly(butyenylstyrene) (B-PBS) framework (A), B-poly(phenyldiacetyene) (B-PPDA) framework (B), and B-poly(phenyltriacetylene) (B-PPTA) framework (C). They are 2-D polymer structures with the repeating cyclic units that spontaneously form open morphology and the B-doped (p-type) π-electrons delocalized surfaces. The ideal B-polymer framework shall exhibit open micropores (pore size in the range of 1-1.5nm) with high surface area (>3000 m 2/g), and themore » B-dopants in the conjugated framework shall provide high surface energy for interacting with H 2 molecules (an ideal H 2 binding energy in the range of 15-25 kJ/mol). The pore size distribution and H2 binding energy were investigated at both Penn State and NREL laboratories. So far, the experimental results show the successful synthesis of B-polymer frameworks with the relatively well-defined planar (2-D) structures. The intrinsically formed porous morphology exhibits a broad pore size distribution (in the range of 0.5-10 nm) with specific surface area (~1000 m 2/g). The miss-alignment between 2-D layers may block some micropore channels and limit gas diffusion throughout the entire matrix. In addition, the 2-D planar conjugated structure may also allow free π-electrons delocalization throughout the framework, which significantly reduces the acidity of B-moieties (electron-deficiency).The resulting 2-D B-polymer frameworks only exhibit a small increase of H 2 binding energy in the range of 8-9 KJ/mole (quite constant over the whole sorption range).« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kolmann, Stephen J.; D'Arcy, Jordan H.; Jordan, Meredith J. T., E-mail: m.jordan@chem.usyd.edu.au

Quantum and anharmonic effects are investigated in H{sub 2}-Li{sup +}-benzene, a model for hydrogen adsorption in metal-organic frameworks and carbon-based materials. Three- and 8-dimensional quantum diffusion Monte Carlo (QDMC) and rigid-body diffusion Monte Carlo (RBDMC) simulations are performed on potential energy surfaces interpolated from electronic structure calculations at the M05-2X/6-31+G(d,p) and M05-2X/6-311+G(2df,p) levels of theory using a three-dimensional spline or a modified Shepard interpolation. These calculations investigate the intermolecular interactions in this system, with three- and 8-dimensional 0 K H{sub 2} binding enthalpy estimates, ΔH{sub bind} (0 K), being 16.5 kJ mol{sup −1} and 12.4 kJ mol{sup −1}, respectively: 0.1 and 0.6more » kJ mol{sup −1} higher than harmonic values. Zero-point energy effects are 35% of the value of ΔH{sub bind} (0 K) at M05-2X/6-311+G(2df,p) and cannot be neglected; uncorrected electronic binding energies overestimate ΔH{sub bind} (0 K) by at least 6 kJ mol{sup −1}. Harmonic intermolecular binding enthalpies can be corrected by treating the H{sub 2} “helicopter” and “ferris wheel” rotations as free and hindered rotations, respectively. These simple corrections yield results within 2% of the 8-dimensional anharmonic calculations. Nuclear ground state probability density histograms obtained from the QDMC and RBDMC simulations indicate the H{sub 2} molecule is delocalized above the Li{sup +}-benzene system at 0 K.« less

Density functional study of the electronic structure of dye-functionalized fullerenes and their model donor-acceptor complexes containing P3HT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baruah, Tunna; Garnica, Amanda; Paggen, Marina

2016-04-14

We study the electronic structure of C{sub 60} fullerenes functionalized with a thiophene-diketo-pyrrolopyrrole-thiophene based chromophore using density functional theory combined with large polarized basis sets. As the attached chromophore has electron donor character, the functionalization of the fullerene leads to a donor-acceptor (DA) system. We examine in detail the effect of the linker and the addition site on the electronic structure of the functionalized fullerenes. We further study the electronic structure of these DA complexes with a focus on the charge transfer excitations. Finally, we examine the interface of the functionalized fullerenes with the widely used poly(3-hexylthiophene-2,5-diyl) (P3HT) donor. Ourmore » results show that all functionalized fullerenes with an exception of the C{sub 60}-pyrrolidine [6,6], where the pyrrolidine is attached at a [6,6] site, have larger electron affinities relative to the pristine C{sub 60} fullerene. We also estimate the quasi-particle gap, lowest charge transfer excitation energy, and the exciton binding energies of the functionalized fullerene-P3MT model systems. Results show that the exciton binding energies in these model complexes are slightly smaller compared to a similarly prepared phenyl-C{sub 61}-butyric acid methyl ester (PCBM)-P3MT complex.« less

Excitonic Effects in Methylammonium Lead Halide Perovskites.

PubMed

Chen, Xihan; Lu, Haipeng; Yang, Ye; Beard, Matthew C

2018-05-17

The exciton binding energy in methylammonium lead iodide (MAPbI 3 ) is about 10 meV, around 1/3 of the available thermal energy ( k B T ∼ 26 meV) at room temperature. Thus, exciton populations are not stable at room temperature at moderate photoexcited carrier densities. However, excitonic resonances dominate the absorption onset. Furthermore, these resonances determine the transient absorbance and transient reflectance spectra. The exciton binding energy is a reflection of the Coulomb interaction energy between photoexcited electrons and holes. As such, it serves as a marker for the strength of electron/hole interactions and impacts a variety of phenomena, such as, absorption, radiative recombination, and Auger recombination. In this Perspective, we discuss the role of excitons and excitonic resonances in the optical properties of lead-halide perovskite semiconductors. Finally, we discuss how the strong light-matter interactions induce an optical stark effect splitting the doubly spin degenerate ground exciton states and are easily observed at room temperature.

Two- and three-body interatomic dispersion energy contributions to binding in molecules and solids

NASA Astrophysics Data System (ADS)

Anatole von Lilienfeld, O.; Tkatchenko, Alexandre

2010-06-01

We present numerical estimates of the leading two- and three-body dispersion energy terms in van der Waals interactions for a broad variety of molecules and solids. The calculations are based on London and Axilrod-Teller-Muto expressions where the required interatomic dispersion energy coefficients, C6 and C9, are computed "on the fly" from the electron density. Inter- and intramolecular energy contributions are obtained using the Tang-Toennies (TT) damping function for short interatomic distances. The TT range parameters are equally extracted on the fly from the electron density using their linear relationship to van der Waals radii. This relationship is empiricially determined for all the combinations of He-Xe rare gas dimers, as well as for the He and Ar trimers. The investigated systems include the S22 database of noncovalent interactions, Ar, benzene and ice crystals, bilayer graphene, C60 dimer, a peptide (Ala10), an intercalated drug-DNA model [ellipticine-d(CG)2], 42 DNA base pairs, a protein (DHFR, 2616 atoms), double stranded DNA (1905 atoms), and 12 molecular crystal polymorphs from crystal structure prediction blind test studies. The two- and three-body interatomic dispersion energies are found to contribute significantly to binding and cohesive energies, for bilayer graphene the latter reaches 50% of experimentally derived binding energy. These results suggest that interatomic three-body dispersion potentials should be accounted for in atomistic simulations when modeling bulky molecules or condensed phase systems.

Two and three-body interatomic dispersion energy contributions to binding in molecules and solids.

DOE Office of Scientific and Technical Information (OSTI.GOV)

von Lilienfeld-Toal, Otto Anatole; Tkatchenko, Alexandre

We present numerical estimates of the leading two- and three-body dispersion energy terms in van der Waals interactions for a broad variety of molecules and solids. The calculations are based on London and Axilrod-Teller-Muto expressions where the required interatomic dispersion energy coefficients, C{sub 6} and C{sub 9}, are computed 'on the fly' from the electron density. Inter- and intramolecular energy contributions are obtained using the Tang-Toennies (TT) damping function for short interatomic distances. The TT range parameters are equally extracted on the fly from the electron density using their linear relationship to van der Waals radii. This relationship is empiriciallymore » determined for all the combinations of He-Xe rare gas dimers, as well as for the He and Ar trimers. The investigated systems include the S22 database of noncovalent interactions, Ar, benzene and ice crystals, bilayer graphene, C{sub 60} dimer, a peptide (Ala{sub 10}), an intercalated drug-DNA model [ellipticine-d(CG){sub 2}], 42 DNA base pairs, a protein (DHFR, 2616 atoms), double stranded DNA (1905 atoms), and 12 molecular crystal polymorphs from crystal structure prediction blind test studies. The two- and three-body interatomic dispersion energies are found to contribute significantly to binding and cohesive energies, for bilayer graphene the latter reaches 50% of experimentally derived binding energy. These results suggest that interatomic three-body dispersion potentials should be accounted for in atomistic simulations when modeling bulky molecules or condensed phase systems.« less

Quasiparticle Energies and Band Gaps in Graphene Nanoribbons

NASA Astrophysics Data System (ADS)

Yang, Li; Park, Cheol-Hwan; Son, Young-Woo; Cohen, Marvin L.; Louie, Steven G.

2007-11-01

We present calculations of the quasiparticle energies and band gaps of graphene nanoribbons (GNRs) carried out using a first-principles many-electron Green’s function approach within the GW approximation. Because of the quasi-one-dimensional nature of a GNR, electron-electron interaction effects due to the enhanced screened Coulomb interaction and confinement geometry greatly influence the quasiparticle band gap. Compared with previous tight-binding and density functional theory studies, our calculated quasiparticle band gaps show significant self-energy corrections for both armchair and zigzag GNRs, in the range of 0.5 3.0 eV for ribbons of width 2.4 0.4 nm. The quasiparticle band gaps found here suggest that use of GNRs for electronic device components in ambient conditions may be viable.

A DFT study for the structural and electronic properties of Zn m Se n nanoclusters

NASA Astrophysics Data System (ADS)

Yadav, Phool Singh; Pandey, Dheeraj Kumar

2012-09-01

An ab initio study has been performed for the stability, structural and electronic properties of 19 small zinc selenide Zn m Se n ( m + n = 2-4) nanoclusters. Out of these nanoclusters, one nanocluster is found to be unstable due to its imaginary vibrational frequency. A B3LYP-DFT/6-311G(3df) method is used in the optimization of the geometries of the nanoclusters. We have calculated the zero point energy (ZPE), which is ignored by the other workers. The binding energies (BE), HOMO-LUMO gaps and bond lengths have been obtained for all the optimized nanoclusters. For the same value of ` m' and ` n', we designate the most stable structure the one, which has maximum final binding energy (FBE) per atom. The adiabatic and vertical ionization potentials (IP) and electron affinities (EA), dipole moments and charge on atoms have been investigated for the most stable nanoclusters. For the same value of ` m' and ` n', the nanocluster containing maximum number of Se atoms is found to be most stable.

Lanthanide and transition metal complexes of bioactive coumarins: molecular modeling and spectroscopic studies.

PubMed

Georgieva, I; Mihaylov, Tz; Trendafilova, N

2014-06-01

The present paper summarizes theoretical and spectroscopic investigations on a series of active coumarins and their lanthanide and transition metal complexes with application in medicine and pharmacy. Molecular modeling as well as IR, Raman, NMR and electronic spectral simulations at different levels of theory were performed to obtain important molecular descriptors: total energy, formation energy, binding energy, stability, conformations, structural parameters, electron density distribution, molecular electrostatic potential, Fukui functions, atomic charges, and reactive indexes. The computations are performed both in gas phase and in solution with consideration of the solvent effect on the molecular structural and energetic parameters. The investigations have shown that the advanced computational methods are reliable for prediction of the metal-coumarin binding mode, electron density distribution, thermodynamic properties as well as the strength and nature of the metal-coumarin interaction (not experimentally accessible) and correctly interpret the experimental spectroscopic data. Known results from biological tests for cytotoxic, antimicrobial, anti-fungal, spasmolytic and anti-HIV activities on the studied metal complexes are reported and discussed. Copyright © 2014 Elsevier Inc. All rights reserved.

Effect of Li Adsorption on the Electronic and Hydrogen Storage Properties of Acenes: A Dispersion-Corrected TAO-DFT Study

PubMed Central

Seenithurai, Sonai; Chai, Jeng-Da

2016-01-01

Due to the presence of strong static correlation effects and noncovalent interactions, accurate prediction of the electronic and hydrogen storage properties of Li-adsorbed acenes with n linearly fused benzene rings (n = 3–8) has been very challenging for conventional electronic structure methods. To meet the challenge, we study these properties using our recently developed thermally-assisted-occupation density functional theory (TAO-DFT) with dispersion corrections. In contrast to pure acenes, the binding energies of H2 molecules on Li-adsorbed acenes are in the ideal binding energy range (about 20 to 40 kJ/mol per H2). Besides, the H2 gravimetric storage capacities of Li-adsorbed acenes are in the range of 9.9 to 10.7 wt%, satisfying the United States Department of Energy (USDOE) ultimate target of 7.5 wt%. On the basis of our results, Li-adsorbed acenes can be high-capacity hydrogen storage materials for reversible hydrogen uptake and release at ambient conditions. PMID:27609626

Excitation and characterization of image potential state electrons on quasi-free-standing graphene

NASA Astrophysics Data System (ADS)

Lin, Yi; Li, Yunzhe; Sadowski, Jerzy T.; Jin, Wencan; Dadap, Jerry I.; Hybertsen, Mark S.; Osgood, Richard M.

2018-04-01

We investigate the band structure of image potential states in quasi-free-standing graphene (QFG) monolayer islands using angle-resolved two-photon-photoemission spectroscopy. Direct probing by low-energy electron diffraction shows that QFG is formed following oxygen intercalation into the graphene-Ir(111) interface. Despite the apparent decoupling of the monolayer graphene from the Ir substrate, we find that the binding energy of the n =1 image potential state on these QFG islands increases by 0.17 eV, as compared to the original Gr/Ir(111) interface. We use calculations based on density-functional theory to construct an empirical, one-dimensional potential that quantitatively reproduces the image potential state binding energy and links the changes in the interface structure to the shift in energy. Specifically, two factors contribute comparably to this energy shift: a deeper potential well arising from the presence of intercalated oxygen adatoms and a wider potential well associated with the increase in the graphene-Ir distance. While image potential states have not been observed previously on QFG by photoemission, our paper now demonstrates that they may be strongly excited in a well-defined QFG system produced by oxygen intercalation. This opens an opportunity for studying the surface electron dynamics in QFG systems, beyond those found in typical nonintercalated graphene-on-substrate systems.

Electrons trapped in the wake of a negative muon

NASA Astrophysics Data System (ADS)

Rivacoba, A.; Echenique, P. M.

1987-08-01

Electron binding energies in the wake of a swift negative ion such as a muon or an antiproton have been evaluated. The velocity distributions of electrons emerging from the solid at the ionic velocities are also estimated. These calculations could be of guidance to the experimental project of Yamazaki and co-workers directed to elucidate the nature of convoy electrons emerging from solids after the passage of swift ions.

An environment-dependent semi-empirical tight binding model suitable for electron transport in bulk metals, metal alloys, metallic interfaces, and metallic nanostructures. I. Model and validation

NASA Astrophysics Data System (ADS)

Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy; Klimeck, Gerhard

2014-03-01

Semi-empirical Tight Binding (TB) is known to be a scalable and accurate atomistic representation for electron transport for realistically extended nano-scaled semiconductor devices that might contain millions of atoms. In this paper, an environment-aware and transferable TB model suitable for electronic structure and transport simulations in technologically relevant metals, metallic alloys, metal nanostructures, and metallic interface systems are described. Part I of this paper describes the development and validation of the new TB model. The new model incorporates intra-atomic diagonal and off-diagonal elements for implicit self-consistency and greater transferability across bonding environments. The dependence of the on-site energies on strain has been obtained by appealing to the Moments Theorem that links closed electron paths in the system to energy moments of angular momentum resolved local density of states obtained ab initio. The model matches self-consistent density functional theory electronic structure results for bulk face centered cubic metals with and without strain, metallic alloys, metallic interfaces, and metallic nanostructures with high accuracy and can be used in predictive electronic structure and transport problems in metallic systems at realistically extended length scales.

On the applicability of one- and many-electron quantum chemistry models for hydrated electron clusters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Turi, László, E-mail: turi@chem.elte.hu

2016-04-21

We evaluate the applicability of a hierarchy of quantum models in characterizing the binding energy of excess electrons to water clusters. In particular, we calculate the vertical detachment energy of an excess electron from water cluster anions with methods that include one-electron pseudopotential calculations, density functional theory (DFT) based calculations, and ab initio quantum chemistry using MP2 and eom-EA-CCSD levels of theory. The examined clusters range from the smallest cluster size (n = 2) up to nearly nanosize clusters with n = 1000 molecules. The examined cluster configurations are extracted from mixed quantum-classical molecular dynamics trajectories of cluster anions withmore » n = 1000 water molecules using two different one-electron pseudopotenial models. We find that while MP2 calculations with large diffuse basis set provide a reasonable description for the hydrated electron system, DFT methods should be used with precaution and only after careful benchmarking. Strictly tested one-electron psudopotentials can still be considered as reasonable alternatives to DFT methods, especially in large systems. The results of quantum chemistry calculations performed on configurations, that represent possible excess electron binding motifs in the clusters, appear to be consistent with the results using a cavity structure preferring one-electron pseudopotential for the hydrated electron, while they are in sharp disagreement with the structural predictions of a non-cavity model.« less

On the applicability of one- and many-electron quantum chemistry models for hydrated electron clusters

NASA Astrophysics Data System (ADS)

Turi, László

2016-04-01

We evaluate the applicability of a hierarchy of quantum models in characterizing the binding energy of excess electrons to water clusters. In particular, we calculate the vertical detachment energy of an excess electron from water cluster anions with methods that include one-electron pseudopotential calculations, density functional theory (DFT) based calculations, and ab initio quantum chemistry using MP2 and eom-EA-CCSD levels of theory. The examined clusters range from the smallest cluster size (n = 2) up to nearly nanosize clusters with n = 1000 molecules. The examined cluster configurations are extracted from mixed quantum-classical molecular dynamics trajectories of cluster anions with n = 1000 water molecules using two different one-electron pseudopotenial models. We find that while MP2 calculations with large diffuse basis set provide a reasonable description for the hydrated electron system, DFT methods should be used with precaution and only after careful benchmarking. Strictly tested one-electron psudopotentials can still be considered as reasonable alternatives to DFT methods, especially in large systems. The results of quantum chemistry calculations performed on configurations, that represent possible excess electron binding motifs in the clusters, appear to be consistent with the results using a cavity structure preferring one-electron pseudopotential for the hydrated electron, while they are in sharp disagreement with the structural predictions of a non-cavity model.

Rethinking chemisorption: New insights into the factors controlling the binding energy

NASA Astrophysics Data System (ADS)

Alcantara Ortigoza, Marisol; Stolbov, Sergey

2015-03-01

Chemisorption of atomic and molecular species on a substrate induces electronic charge redistribution upon which substrate nuclei respond by adjusting their positions. This lattice distortion has been linked to the binding energy EB of the adsorbed species and attached to the so-called surface relaxation energy, Erx. We have found, however, that for transition metals the energy associated with the mere charge redistribution Eelec is much larger than Erx and thus both contributions must be considered [1]. In this work, we quantify the electronic and structural perturbation energy EP brought by various adsorbates on surfaces to understand anomalous adsorbate binding energies, i.e., those in which EP strongly influences the magnitude of EB. For example, for O adsorption on Au(111), while Erx is only 0.25 eV, the overall perturbation energy EP affecting EB(O) is ~ 1 eV [1]. This indicates that EP cannot be ignored but also that local bonds may not be as weak as portrayed by EB, even though EB is significantly reduced. We expose cases in which EP is really dominated by the lattice distortion energy, as well as a rationale for its trends as a function of the substrate and adsorbate. We discuss the implications of the fact that EB is not always predominately controlled by the bond-strength on heterogeneous catalysis, as well as the applications of the same fact. M. Alcántara Ortigoza and S. Stolbov; ``The Perturbation Energy: The missing key to understand gold `nobleness.' '' Submitted in October 2014 This work was supported the NSF under Grant CBET-1249134.

Systematic spatial and stoichiometric screening towards understanding the surface of ultrasmall oxygenated silicon nanocrystal

NASA Astrophysics Data System (ADS)

Niaz, Shanawer; Zdetsis, Aristides D.; Koukaras, Emmanuel N.; Gülseren, Oǧuz; Sadiq, Imran

2016-11-01

In most of the realistic ab initio and model calculations which have appeared on the emission of light from silicon nanocrystals, the role of surface oxygen has been usually ignored, underestimated or completely ruled out. We investigate theoretically, by density functional theory (DFT/B3LYP) possible modes of oxygen bonding in hydrogen terminated silicon quantum dots using as a representative case of the Si29 nanocrystal. We have considered Bridge-bonded oxygen (BBO), Doubly-bonded oxygen (DBO), hydroxyl (OH) and Mix of these oxidizing agents. Due to stoichiometry, all comparisons performed are unbiased with respect to composition whereas spatial distribution of oxygen species pointed out drastic change in electronic and cohesive characteristics of nanocrytals. From an overall perspective of this study, it is shown that bridge bonded oxygenated Si nanocrystals accompanied by Mix have higher binding energies and large electronic gap compared to nanocrystals with doubly bonded oxygen atoms. In addition, it is observed that the presence of OH along with BBO, DBO and mixed configurations further lowers electronic gaps and binding energies but trends in same fashion. It is also demonstrated that within same composition, oxidizing constituent, along with their spatial distribution substantially alters binding energy, highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) gap (up to 1.48 eV) and localization of frontier orbitals.

Investigation of electronic transport through a ladder-like graphene nanoribbon including random distributed impurities

NASA Astrophysics Data System (ADS)

Esmaili, Esmat; Mardaani, Mohammad; Rabani, Hassan

2018-01-01

The electronic transport of a ladder-like graphene nanoribbon which the on-site or hopping energies of a small part of it can be random is modeled by using the Green's function technique within the nearest neighbor tight-binding approach. We employ a unitary transformation in order to convert the Hamiltonian of the nanoribbon to the Hamiltonian of a tight-binding ladder-like network. In this case, the disturbed part of the system includes the second neighbor hopping interactions. While, the converted Hamiltonian of each ideal part is equivalent to the Hamiltonian of two periodic on-site chains. Therefore, we can insert the self-energies of the alternative on-site tight-binding chains to the inverse of the Green's function matrix of the ladder-like part. In this viewpoint, the conductance is constructed from two trans and cis contributions. The results show that increasing the disorder strength causes the increase and decrease of the conductance of the trans and cis contributions, respectively.

Pnicogen bonds between X═PH3 (X = O, S, NH, CH2) and phosphorus and nitrogen bases.

PubMed

Alkorta, Ibon; Sánchez-Sanz, Goar; Elguero, José; Del Bene, Janet E

2014-02-27

Ab initio MP2/aug'-cc-pVTZ calculations have been carried out to investigate the pnicogen bonded complexes formed between the acids O═PH3, S═PH3, HN═PH3, and H2C═PH3 and the bases NH3, NCH, N2, PH3, and PCH. All nitrogen and phosphorus bases form complexes in which the bases are lone pair electron donors. The binding energies of complexes involving the stronger bases NH3, NCH, and PH3 differentiate among the acids, but the binding energies of complexes with the weaker bases do not. These complexes are stabilized by charge transfer from the lone pair orbital of N or P to the σ*P═A orbital of X═PH3, where A is the atom of X directly bonded to P. PCH also forms complexes with the X═PH3 acids as a π electron donor to the σ*P═A orbital. The binding energies and the charge-transfer energies of the π complexes are greater than those of the complexes in which PCH is a lone pair donor. Whether the positive charge on P increases, decreases, or remains the same upon complex formation, the chemical shieldings of (31)P decrease in the complexes relative to the corresponding monomers. (1p)J(P-N) and (1p)J(P-P) values correlate best with the corresponding P-N and P-P distances as a function of the nature of the base. (1)J(P-A) values do not correlate with P-A distances. Rather, the absolute values of (1)J(P-O), (1)J(P-S), and (1)J(P-N) decrease upon complexation. Decreasing (1)J(P-A) values correlate linearly with increasing complex binding energies. In contrast, (1)J(P-C) values increase upon complexation and correlate linearly with increasing binding energies.

Temperature and hydrostatic pressure effects on single dopant states in hollow cylindrical core-shell quantum dot

NASA Astrophysics Data System (ADS)

El-Yadri, M.; Aghoutane, N.; El Aouami, A.; Feddi, E.; Dujardin, F.; Duque, C. A.

2018-05-01

This work reports on theoretical investigation of the temperature and hydrostatic pressure effects on the confined donor impurity in a AlGaAs-GaAs hollow cylindrical core-shell quantum dot. The charges are assumed to be completely confined to the interior of the shell with approximately rigid walls. Within the framework of the effective-mass approximation and by using a variational approach, we have computed the donor binding energies as a function of the shell size in order to study the behavior of the electron-impurity attraction for a very small thickness under the influence of both temperature and hydrostatic pressure. Our results show that the temperature and hydrostatic pressure have a significant influence on the impurity binding energy for large shell quantum dots. It will be shown that the binding energy is more pronounced with increasing pressure and decreasing temperature for any impurity position and quantum dot size. The photoionization cross section is also analyzed by considering only the in-plane incident radiation polarization. Its behavior is investigated as a function of photon energy for different values of pressure and temperature. The opposite effects caused by temperature and hydrostatic pressure reveal a big practical interest and offer an alternative way to tuning of correlated electron-impurity transitions in optoelectronic devices.

Quantum mechanics capacitance molecular mechanics modeling of core-electron binding energies of methanol and methyl nitrite on Ag(111) surface.

PubMed

Löytynoja, T; Li, X; Jänkälä, K; Rinkevicius, Z; Ågren, H

2016-07-14

We study a newly devised quantum mechanics capacitance molecular mechanics (QMCMM) method for the calculation of core-electron binding energies in the case of molecules adsorbed on metal surfaces. This yet untested methodology is applied to systems with monolayer of methanol/methyl nitrite on an Ag(111) surface at 100 K temperature. It was found out that the studied C, N, and O 1s core-hole energies converge very slowly as a function of the radius of the metallic cluster, which was ascribed to build up of positive charge on the edge of the Ag slab. Further analysis revealed that an extrapolation process can be used to obtain binding energies that deviated less than 0.5 eV against experiments, except in the case of methanol O 1s where the difference was as large as 1.8 eV. Additional QM-cluster calculations suggest that the latter error can be connected to the lack of charge transfer over the QM-CMM boundary. Thus, the results indicate that the QMCMM and QM-cluster methods can complement each other in a holistic picture of molecule-adsorbate core-ionization studies, where all types of intermolecular interactions are considered.

Quantum mechanics capacitance molecular mechanics modeling of core-electron binding energies of methanol and methyl nitrite on Ag(111) surface

NASA Astrophysics Data System (ADS)

Löytynoja, T.; Li, X.; Jänkälä, K.; Rinkevicius, Z.; Ågren, H.

2016-07-01

We study a newly devised quantum mechanics capacitance molecular mechanics (QMCMM) method for the calculation of core-electron binding energies in the case of molecules adsorbed on metal surfaces. This yet untested methodology is applied to systems with monolayer of methanol/methyl nitrite on an Ag(111) surface at 100 K temperature. It was found out that the studied C, N, and O 1s core-hole energies converge very slowly as a function of the radius of the metallic cluster, which was ascribed to build up of positive charge on the edge of the Ag slab. Further analysis revealed that an extrapolation process can be used to obtain binding energies that deviated less than 0.5 eV against experiments, except in the case of methanol O 1s where the difference was as large as 1.8 eV. Additional QM-cluster calculations suggest that the latter error can be connected to the lack of charge transfer over the QM-CMM boundary. Thus, the results indicate that the QMCMM and QM-cluster methods can complement each other in a holistic picture of molecule-adsorbate core-ionization studies, where all types of intermolecular interactions are considered.

Methods for neutralizing anthrax or anthrax spores

DOEpatents

Sloan, Mark A; Vivekandanda, Jeevalatha; Holwitt, Eric A; Kiel, Johnathan L

2013-02-26

The present invention concerns methods, compositions and apparatus for neutralizing bioagents, wherein bioagents comprise biowarfare agents, biohazardous agents, biological agents and/or infectious agents. The methods comprise exposing the bioagent to an organic semiconductor and exposing the bioagent and organic semiconductor to a source of energy. Although any source of energy is contemplated, in some embodiments the energy comprises visible light, ultraviolet, infrared, radiofrequency, microwave, laser radiation, pulsed corona discharge or electron beam radiation. Exemplary organic semiconductors include DAT and DALM. In certain embodiments, the organic semiconductor may be attached to one or more binding moieties, such as an antibody, antibody fragment, or nucleic acid ligand. Preferably, the binding moiety has a binding affinity for one or more bioagents to be neutralized. Other embodiments concern an apparatus comprising an organic semiconductor and an energy source. In preferred embodiments, the methods, compositions and apparatus are used for neutralizing anthrax spores.

Exciton Scattering approach for conjugated macromolecules: from electronic spectra to electron-phonon coupling

NASA Astrophysics Data System (ADS)

Tretiak, Sergei

2014-03-01

The exciton scattering (ES) technique is a multiscale approach developed for efficient calculations of excited-state electronic structure and optical spectra in low-dimensional conjugated macromolecules. Within the ES method, the electronic excitations in the molecular structure are attributed to standing waves representing quantum quasi-particles (excitons), which reside on the graph. The exciton propagation on the linear segments is characterized by the exciton dispersion, whereas the exciton scattering on the branching centers is determined by the energy-dependent scattering matrices. Using these ES energetic parameters, the excitation energies are then found by solving a set of generalized ``particle in a box'' problems on the graph that represents the molecule. All parameters can be extracted from quantum-chemical computations of small molecular fragments and tabulated in the ES library for further applications. Subsequently, spectroscopic modeling for any macrostructure within considered molecular family could be performed with negligible numerical effort. The exciton scattering properties of molecular vertices can be further described by tight-binding or equivalently lattice models. The on-site energies and hopping constants are obtained from the exciton dispersion and scattering matrices. Such tight-binding model approach is particularly useful to describe the exciton-phonon coupling, energetic disorder and incoherent energy transfer in large branched conjugated molecules. Overall the ES applications accurately reproduce the optical spectra compared to the reference quantum chemistry results, and make possible to predict spectra of complex macromolecules, where conventional electronic structure calculations are unfeasible.

Charge-transfer excitons at organic semiconductor surfaces and interfaces.

PubMed

Zhu, X-Y; Yang, Q; Muntwiler, M

2009-11-17

When a material of low dielectric constant is excited electronically from the absorption of a photon, the Coulomb attraction between the excited electron and the hole gives rise to an atomic H-like quasi-particle called an exciton. The bound electron-hole pair also forms across a material interface, such as the donor/acceptor interface in an organic heterojunction solar cell; the result is a charge-transfer (CT) exciton. On the basis of typical dielectric constants of organic semiconductors and the sizes of conjugated molecules, one can estimate that the binding energy of a CT exciton across a donor/acceptor interface is 1 order of magnitude greater than k(B)T at room temperature (k(B) is the Boltzmann constant and T is the temperature). How can the electron-hole pair escape this Coulomb trap in a successful photovoltaic device? To answer this question, we use a crystalline pentacene thin film as a model system and the ubiquitous image band on the surface as the electron acceptor. We observe, in time-resolved two-photon photoemission, a series of CT excitons with binding energies < or = 0.5 eV below the image band minimum. These CT excitons are essential solutions to the atomic H-like Schrodinger equation with cylindrical symmetry. They are characterized by principal and angular momentum quantum numbers. The binding energy of the lowest lying CT exciton with 1s character is more than 1 order of magnitude higher than k(B)T at room temperature. The CT(1s) exciton is essentially the so-called exciplex and has a very low probability of dissociation. We conclude that hot CT exciton states must be involved in charge separation in organic heterojunction solar cells because (1) in comparison to CT(1s), hot CT excitons are more weakly bound by the Coulomb potential and more easily dissociated, (2) density-of-states of these hot excitons increase with energy in the Coulomb potential, and (3) electronic coupling from a donor exciton to a hot CT exciton across the D/A interface can be higher than that to CT(1s) as expected from energy resonance arguments. We suggest a design principle in organic heterojunction solar cells: there must be strong electronic coupling between molecular excitons in the donor and hot CT excitons across the D/A interface.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sahu, Sivabrata, E-mail: siva1987@iopb.res.in; Parashar, S. K. S., E-mail: sksparashar@yahoo.com; Rout, G. C., E-mail: gcr@iopb.res.in

We address here a tight-binding theoretical model calculation for AA-stacked bi-layer graphene taking into account of a biased potential between two layers to study the density of states and the band dispersion within the total Brillouin zone. We have calculated the electronic Green’s function for electron operator corresponding to A and B sub lattices by Zubarev’s Green’s function technique from which the electronic density of states and the electron band energy dispersion are calculated. The numerically computed density of states and band energy dispersions are investigated by tuning the biased potential to exhibit the band gap by varying the differentmore » physical parameters.« less

The use of analytical surface tools in the fundamental study of wear. [atomic nature of wear

NASA Technical Reports Server (NTRS)

Buckley, D. H.

1977-01-01

Various techniques and surface tools available for the study of the atomic nature of the wear of materials are reviewed These include chemical etching, x-ray diffraction, electron diffraction, scanning electron microscopy, low-energy electron diffraction, Auger emission spectroscopy analysis, electron spectroscopy for chemical analysis, field ion microscopy, and the atom probe. Properties of the surface and wear surface regions which affect wear, such as surface energy, crystal structure, crystallographic orientation, mode of dislocation behavior, and cohesive binding, are discussed. A number of mechanisms involved in the generation of wear particles are identified with the aid of the aforementioned tools.

Low-temperature binding of NO adsorbed on MIL-100(Al)-A case study for the application of high resolution pulsed EPR methods and DFT calculations.

PubMed

Mendt, Matthias; Barth, Benjamin; Hartmann, Martin; Pöppl, Andreas

2017-12-14

The low-temperature binding of nitric oxide (NO) in the metal-organic framework MIL-100(Al) has been investigated by pulsed electron nuclear double resonance and hyperfine sublevel correlation spectroscopy. Three NO adsorption species have been identified. Among them, one species has been verified experimentally to bind directly to an 27 Al atom and all its relevant 14 N and 27 Al hyperfine interaction parameters have been determined spectroscopically. Those parameters fit well to the calculated ones of a theoretical cluster model, which was derived by density functional theory (DFT) in the present work and describes the low temperature binding of NO to the regular coordinatively unsaturated Al 3+ site of the MIL-100(Al) structure. As a result, the Lewis acidity of that site has been characterized using the NO molecule as an electron paramagnetic resonance active probe. The DFT derived wave function analysis revealed a bent end-on coordination of the NO molecule adsorbed at that site which is almost purely ionic and has a weak binding energy. The calculated flat potential energy surface of this species indicates the ability of the NO molecule to freely rotate at intermediate temperatures while it is still binding to the Al 3+ site. For the other two NO adsorption species, no structural models could be derived, but one of them is indicated to be adsorbed at the organic part of the metal-organic framework. Hyperfine interactions with protons, weakly coupled to the observed NO adsorption species, have also been measured by pulsed electron paramagnetic resonance and found to be consistent with their attribution to protons of the MIL-100(Al) benzenetricarboxylate ligand molecules.

X-ray data booklet. Revision

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vaughan, D.

A compilation of data is presented. Included are properties of the elements, electron binding energies, characteristic x-ray energies, fluorescence yields for K and L shells, Auger energies, energy levels for hydrogen-, helium-, and neonlike ions, scattering factors and mass absorption coefficients, and transmission bands of selected filters. Also included are selected reprints on scattering processes, x-ray sources, optics, x-ray detectors, and synchrotron radiation facilities. (WRF)

Cisplatin Radiosensitization of DNA Irradiated with 2-20 eV Electrons: Role of Transient Anions.

PubMed

Bao, Qianhong; Chen, Yunfeng; Zheng, Yi; Sanche, Léon

2014-06-20

Platinum chemotherapeutic agents, such as cisplatin ( cis -diamminedichloroplatinum(II)), can act as radiosensitizers when bound covalently to nuclear DNA in cancer cells. This radiosensitization is largely due to an increase in DNA damage induced by low-energy secondary electrons, produced in large quantities by high-energy radiation. We report the yields of single- and double-strand breaks (SSB and DSB) and interduplex cross-links (CL) induced by electrons of 1.6-19.6 eV (i.e., the yield functions) incident on 5 monolayer (ML) films of cisplatin-DNA complexes. These yield functions are compared with those previously recorded with 5 ML films of unmodified plasmid DNA. Binding of five cisplatin molecules to plasmid DNA (3197 base pairs) enhances SSB, DSB, and CL by factors varying, from 1.2 to 2.8, 1.4 to 3.5, and 1.2 to 2.7, respectively, depending on electron energy. All yield functions exhibit structures around 5 and 10 eV that can be attributed to enhancement of bond scission, via the initial formation of core-excited resonances associated with π → π * transitions of the bases. This increase in damage is interpreted as arising from a modification of the parameters of the corresponding transient anions already present in nonmodified DNA, particularly those influencing molecular dissociation. Two additional resonances, specific to cisplatin-modified DNA, are formed at 13.6 and 17.6 eV in the yield function of SSB. Furthermore, cisplatin binding causes the induction of DSB by electrons of 1.6-3.6 eV, i.e., in an energy region where a DSB cannot be produced by a single electron in pure DNA. Breaking two bonds with a subexcitation-energy electron is tentatively explained by a charge delocalization mechanism, where a single electron occupies simultaneously two σ * bonds linking the Pt atom to guanine bases on opposite strands.

Cisplatin Radiosensitization of DNA Irradiated with 2–20 eV Electrons: Role of Transient Anions

PubMed Central

Bao, Qianhong; Chen, Yunfeng; Zheng, Yi; Sanche, Léon

2015-01-01

Platinum chemotherapeutic agents, such as cisplatin (cis-diamminedichloroplatinum(II)), can act as radiosensitizers when bound covalently to nuclear DNA in cancer cells. This radiosensitization is largely due to an increase in DNA damage induced by low-energy secondary electrons, produced in large quantities by high-energy radiation. We report the yields of single- and double-strand breaks (SSB and DSB) and interduplex cross-links (CL) induced by electrons of 1.6–19.6 eV (i.e., the yield functions) incident on 5 monolayer (ML) films of cisplatin–DNA complexes. These yield functions are compared with those previously recorded with 5 ML films of unmodified plasmid DNA. Binding of five cisplatin molecules to plasmid DNA (3197 base pairs) enhances SSB, DSB, and CL by factors varying, from 1.2 to 2.8, 1.4 to 3.5, and 1.2 to 2.7, respectively, depending on electron energy. All yield functions exhibit structures around 5 and 10 eV that can be attributed to enhancement of bond scission, via the initial formation of core-excited resonances associated with π → π* transitions of the bases. This increase in damage is interpreted as arising from a modification of the parameters of the corresponding transient anions already present in nonmodified DNA, particularly those influencing molecular dissociation. Two additional resonances, specific to cisplatin-modified DNA, are formed at 13.6 and 17.6 eV in the yield function of SSB. Furthermore, cisplatin binding causes the induction of DSB by electrons of 1.6–3.6 eV, i.e., in an energy region where a DSB cannot be produced by a single electron in pure DNA. Breaking two bonds with a subexcitation-energy electron is tentatively explained by a charge delocalization mechanism, where a single electron occupies simultaneously two σ* bonds linking the Pt atom to guanine bases on opposite strands. PMID:26793285

Adsorption of formaldehyde on graphene and graphyne

NASA Astrophysics Data System (ADS)

Majidi, R.; Karami, A. R.

2014-05-01

The adsorption of formaldehyde on graphene and graphyne was investigated to search high sensitivity sensors for detection of formaldehyde. We have used density functional theory to study the effect of formaldehyde on the electronic properties of graphene and graphyne. It is found that formaldehyde is physisorbed on the graphene and graphyne with small binding energy, large binding distance, and small charge transfer. The calculations also indicate that formaldehyde adsorption modifies the electronic properties of semimetallic graphene, α-graphyne, and β-graphyne and semiconducting γ-graphyne. The graphene and graphyne show semiconducting property in the presence of formaldehyde. The effect of formaldehyde on the electronic properties of graphene and graphyne suggests the potential application of these carbon nanomaterials for formaldehyde detection.

Imaging of the outer valence orbitals of CO by electron momentum spectroscopy — Comparison with high level MRSD-CI and DFT calculations

NASA Astrophysics Data System (ADS)

Fan, X. W.; Chen, X. J.; Zhou, S. J.; Zheng, Y.; Brion, C. E.; Frey, R.; Davidson, E. R.

1997-09-01

A newly constructed energy dispersive multichannel electron momentum spectrometer has been used to image the electron density of the outer valence orbitals of CO with high precision. Binding energy spectra are obtained at a coincidence energy resolution of 1.2 eV fwhm. The measured electron density profiles in momentum space for the outer valence orbitals of CO are compared with cross sections calculated using SCF wavefunctions with basis sets of varying complexity up to near-Hartree-Fock limit in quality. The effects of correlation and electronic relaxation on the calculated momentum profiles are investigated using large MRSD-CI calculations of the full ion-neutral overlap distributions, as well as large basis set DFT calculations with local and non-local (gradient corrected) functionals.

Interaction of fluorescent sensor with superparamagnetic iron oxide nanoparticles.

PubMed

Karunakaran, Chockalingam; Jayabharathi, Jayaraman; Sathishkumar, Ramalingam; Jayamoorthy, Karunamoorthy

2013-06-01

To sense superparamagnetic iron oxides (Fe2O3 and Fe3O4) nanocrystals a sensitive bioactive phenanthroimidazole based fluorescent molecule, 2-(4-fluorophenyl)-1-phenyl-1H-phenanthro [9,10-d] imidazole has been designed and synthesized. Electronic spectral studies show that phenanthroimidazole is bound to the surface of iron oxide semiconductors. Fluorescent enhancement has been explained on the basis of photo-induced electron transfer (PET) mechanism and apparent binding constants have been deduced. Binding of phenanthroimidazole with iron oxide nanoparticles lowers the HOMO and LUMO energy levels of phenanthroimidazole molecule. Chemical affinity between the nitrogen atom of the phenanthroimidazole and Fe(2+) and Fe(3+) ions on the surface of the nano-oxide may result in strong binding of the phenanthroimidazole derivative with the nanoparticles. The electron injection from the photoexcited phenanthroimidazole to the iron oxides conduction band explains the enhanced fluorescence. Copyright © 2013 Elsevier B.V. All rights reserved.

X-ray spectroscopy of high-/Z highly charged ions with the Tokyo EBIT

NASA Astrophysics Data System (ADS)

Nakamura, Nobuyuki; Kato, Daiji; Ohtani, Shunsuke

2003-05-01

We have been using the Tokyo electron beam ion trap to investigate the relativistic and the quantum electrodynamical effects on the atomic structure of few electron heavy ions. In this paper, we present 1s binding energy measurement for hydrogen-like rhodium which was performed as one of such systematic studies. It has been obtained by measuring the X-ray transition energy for radiative recombination into the 1s vacancy of bare rhodium and subtracting the electron beam energy from it. For further investigation, a bent crystal spectrometer for hard X-rays is being developed. The design of the new spectrometer and the preliminary result with it are also presented.

Ultralong-range Rydberg Molecules: Investigation of a Novel Binding Mechanism

NASA Astrophysics Data System (ADS)

Butscher, Björn; Bendkowsky, Vera; Nipper, Johannes; Balewski, Jonathan; Shaffer, James P.; Löw, Robert; Pfau, Tilman

2010-03-01

For highly excited Rydberg atoms, the scattering of the Rydberg electron from a nearby polarizable ground state atom can generate an attractive mean-field potential which is able to bind the ground state atom to the Rydberg atom within the Rydberg electron wave function at binding energies ranging from a few MHz to hundreds of MHz[1]. We present spectroscopic data on the observation of various bound states including the vibrational ground and excited states of rubidium dimers Rb(5S)-Rb(nS) as well as those of trimer states. Furthermore, we show calculations that reproduce the observed binding energies remarkably well and reveal that some of the excited states are purely bound by quantum reflection at a shape resonance for p-wave scattering [2]. To further characterize the coherent excitation of the molecular states, we performed echo experiments. [0pt] [1] V. Bendkowsky, B. Butscher, J. Nipper, J. P. Shaffer, R. Löw, T. Pfau, Nature 458, 1005 (2009); [2] V. Bendkowsky, B. Butscher, J. Nipper, J. Balewski, J. P. Shaffer, R. Löw, T. Pfau, W. Li, J. Stanojevic, T. Pohl,and J. M. Rost, arXiv:0912.4058 (2009)

Molecular dynamics simulations of apocupredoxins: insights into the formation and stabilization of copper sites under entatic control.

PubMed

Abriata, Luciano A; Vila, Alejandro J; Dal Peraro, Matteo

2014-06-01

Cupredoxins perform copper-mediated long-range electron transfer (ET) in biological systems. Their copper-binding sites have evolved to force copper ions into ET-competent systems with decreased reorganization energy, increased reduction potential, and a distinct electronic structure compared with those of non-ET-competent copper complexes. The entatic or rack-induced state hypothesis explains these special properties in terms of the strain that the protein matrix exerts on the metal ions. This idea is supported by X-ray structures of apocupredoxins displaying "closed" arrangements of the copper ligands like those observed in the holoproteins; however, it implies completely buried copper-binding atoms, conflicting with the notion that they must be exposed for copper loading. On the other hand, a recent work based on NMR showed that the copper-binding regions of apocupredoxins are flexible in solution. We have explored five cupredoxins in their "closed" apo forms through molecular dynamics simulations. We observed that prearranged ligand conformations are not stable as the X-ray data suggest, although they do form part of the dynamic landscape of the apoproteins. This translates into variable flexibility of the copper-binding regions within a rigid fold, accompanied by fluctuations of the hydrogen bonds around the copper ligands. Major conformations with solvent-exposed copper-binding atoms could allow initial binding of the copper ions. An eventual subsequent incursion to the closed state would result in binding of the remaining ligands, trapping the closed conformation thanks to the additional binding energy and the fastening of noncovalent interactions that make up the rack.

A comparative study about electronic structures at rubrene/Ag and Ag/rubrene interfaces

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sinha, Sumona, E-mail: sumona.net.09@gmail.com; Mukherjee, M.

The contact between the electrode and the organic semiconductor is one of the most crucial factors in determining the organic device performance. The development and production technology of different organic devices require the understanding of different types of metal/organic semiconducting thin film interfaces. Comparisons about the electronic structures at Rubrene/Ag and Ag/Rubrene interfaces have been studied using photoemission spectroscopy. The Ag on rubrene interfaces is found to show more interesting and complex natures than its counterpart. The vacuum level (VL) was shifted about 0.51 eV from push back effect for deposition of 5 Å rubrene onto Ag film whereas themore » electronic features of silver was only suppressed and no energy shift was resulted. While the deposition of 5 Å Ag onto rubrene film leads to the diffusion of the Ag atoms, as a cluster with quantum size effect, inside the film. Angle dependent XPS measurement indicates that diffused metal clusters were present at entire probed depth of the film. Moreover these clusters dope the uppermost surface of the rubrene film which consequences a shift of the electronic states of thick organic film towards higher binding energy. The VL was found to shift about 0.31 eV toward higher binding energy whereas the shift was around 0.21 eV for the electronic states of rubrene layer.« less

Electronic, Magnetic and Optical Properties of 2D Metal Nanolayers: A DFT Study

NASA Astrophysics Data System (ADS)

Bhuyan, Prabal Dev; Gupta, Sanjeev K.; Singh, Deobrat; Sonvane, Yogesh; Gajjar, P. N.

2018-03-01

In the recent work, we have investigated the structural, electronic, magnetic and optical properties of graphene-like hexagonal monolayers and multilayers (up to five layers) of 3d-transition metals Fe, Co and Ni based on spin-polarized density functional theory. Here, we have taken two types of pattern namely AA-stacking and AB-stacking for the calculations. The binding energy calculations show that the AA-type configuration is energetically more stable. The calculated binding energies of Fe, Co and Ni-bilayer monolayer are - 3.24, - 2.53 and - 1.94 eV, respectively. The electronic band structures show metallic behavior for all the systems and each configurations of Fe, Co and Ni-atoms. While, the quantum ballistic conductances of these metallic systems are found to be higher for pentalayer than other layered systems. The density of states confirms the ferromagnetic behavior of monolayers and multilayers of Fe and Co having negative spin polarizations. We have also calculated frequency dependent complex dielectric function, electronic energy loss spectrum and reflectance spectrum of monolayer to pentalayer metallic systems. The ferromagnetic material shows different permittivity tensor (ɛ), which is due to high spin magnetic moment for n-layered Fe and Co two-dimensional (2D) nanolayers. The theoretical investigation suggests that the electronic, magnetic and optical properties of 3d-transition metal nanolayers offers great promise for their use in spintronics nanodevices and magneto-optical nanodevices applications.

Introducing various ligands into superhalogen anions reduces their electronic stabilities

NASA Astrophysics Data System (ADS)

Smuczyńska, Sylwia; Skurski, Piotr

2008-02-01

The vertical electron detachment energies (VDE) of six NaX2- anions (where X = F, Cl, Br) were calculated at the OVGF level with the 6-311++G(3df) basis sets. In all the cases studied the VDE exceeds the electron affinity of chlorine atom and thus those species were classified as superhalogen anions. The largest vertical binding energy was found for the NaF2- system (6.644 eV). The strong VDE dependence on the ligand type, ligand-central atom distance, and the character of the highest occupied molecular orbital (HOMO) was observed and discussed.

Determination of layer-dependent exciton binding energies in few-layer black phosphorus

PubMed Central

Zhang, Guowei; Chaves, Andrey; Huang, Shenyang; Wang, Fanjie; Xing, Qiaoxia; Low, Tony; Yan, Hugen

2018-01-01

The attraction between electrons and holes in semiconductors forms excitons, which largely determine the optical properties of the hosting material, and hence the device performance, especially for low-dimensional systems. Mono- and few-layer black phosphorus (BP) are emerging two-dimensional (2D) semiconductors. Despite its fundamental importance and technological interest, experimental investigation of exciton physics has been rather limited. We report the first systematic measurement of exciton binding energies in ultrahigh-quality few-layer BP by infrared absorption spectroscopy, with layer (L) thickness ranging from 2 to 6 layers. Our experiments allow us to determine the exciton binding energy, decreasing from 213 meV (2L) to 106 meV (6L). The scaling behavior with layer numbers can be well described by an analytical model, which takes into account the nonlocal screening effect. Extrapolation to free-standing monolayer yields a large binding energy of ~800 meV. Our study provides insights into 2D excitons and their crossover from 2D to 3D, and demonstrates that few-layer BP is a promising high-quality optoelectronic material for potential infrared applications. PMID:29556530

Renormalized coupled cluster approaches in the cluster-in-molecule framework: predicting vertical electron binding energies of the anionic water clusters (H2O)(n)(-).

PubMed

Xu, Peng; Gordon, Mark S

2014-09-04

Anionic water clusters are generally considered to be extremely challenging to model using fragmentation approaches due to the diffuse nature of the excess electron distribution. The local correlation coupled cluster (CC) framework cluster-in-molecule (CIM) approach combined with the completely renormalized CR-CC(2,3) method [abbreviated CIM/CR-CC(2,3)] is shown to be a viable alternative for computing the vertical electron binding energies (VEBE). CIM/CR-CC(2,3) with the threshold parameter ζ set to 0.001, as a trade-off between accuracy and computational cost, demonstrates the reliability of predicting the VEBE, with an average percentage error of ∼15% compared to the full ab initio calculation at the same level of theory. The errors are predominantly from the electron correlation energy. The CIM/CR-CC(2,3) approach provides the ease of a black-box type calculation with few threshold parameters to manipulate. The cluster sizes that can be studied by high-level ab initio methods are significantly increased in comparison with full CC calculations. Therefore, the VEBE computed by the CIM/CR-CC(2,3) method can be used as benchmarks for testing model potential approaches in small-to-intermediate-sized water clusters.

Binding and Energetics of Electron Transfer between an Artificial Four-Helix Mn-Protein and Reaction Centers from Rhodobacter sphaeroides.

PubMed

Espiritu, Eduardo; Olson, Tien L; Williams, JoAnn C; Allen, James P

2017-12-12

The ability of an artificial four-helix bundle Mn-protein, P1, to bind and transfer an electron to photosynthetic reaction centers from the purple bacterium Rhodobacter sphaeroides was characterized using optical spectroscopy. Upon illumination of reaction centers, an electron is transferred from P, the bacteriochlorophyll dimer, to Q A , the primary electron acceptor. The P1 Mn-protein can bind to the reaction center and reduce the oxidized bacteriochlorophyll dimer, P + , with a dissociation constant of 1.2 μM at pH 9.4, comparable to the binding constant of c-type cytochromes. Amino acid substitutions of surface residues on the Mn-protein resulted in increases in the dissociation constant to 8.3 μM. The extent of reduction of P + by the P1 Mn-protein was dependent on the P/P + midpoint potential and the pH. Analysis of the free energy difference yielded a midpoint potential of approximately 635 mV at pH 9.4 for the Mn cofactor of the P1 Mn-protein, a value similar to those found for other Mn cofactors in proteins. The linear dependence of -56 mV/pH is consistent with one proton being released upon Mn oxidation, allowing the complex to maintain overall charge neutrality. These outcomes demonstrate the feasibility of designing four-helix bundles and other artificial metalloproteins to bind and transfer electrons to bacterial reaction centers and establish the usefulness of this system as a platform for designing sites to bind novel metal cofactors capable of performing complex oxidation-reduction reactions.

X-Ray Data Booklet

Science.gov Websites

X-RAY DATA BOOKLET Center for X-ray Optics and Advanced Light Source Lawrence Berkeley National Laboratory Introduction X-Ray Properties of Elements Electron Binding Energies X-Ray Energy Emission Energies Table of X-Ray Properties Synchrotron Radiation Characteristics of Synchrotron Radiation History of X

Binding together bonds

NASA Astrophysics Data System (ADS)

Rideout, Ken

2011-03-01

Many years ago when I was in high school, I asked my AP® Chemistry teacher, "Why is there a negative sign in front of the 13.6 eV in the table of electron energies? What does it mean to have negative energy?" She told me it had something to do with potential energy and not to worry about it. Well, I am still worrying about it.

Charge transfer excitons and image potential states on organic semiconductor surfaces

NASA Astrophysics Data System (ADS)

Yang, Qingxin; Muntwiler, Matthias; Zhu, X.-Y.

2009-09-01

We report two types of excited electronic states on organic semiconductor surfaces: image potential states (IPS) and charge transfer excitons (CTE). In the former, an excited electron is localized in the surface-normal direction by the image potential and delocalized in the surface plane. In the latter, the electron is localized in all directions by both the image potential and the Coulomb potential from a photogenerated hole on an organic molecule. We use crystalline pentacene and tetracene surfaces as model systems, and time- and angle-resolved two-photon photoemission spectroscopy to probe the energetics and dynamics of both the IPS and the CTE states. On either pentacene or tetracene surfaces, we observe delocalized image bands and a series of CT excitons with binding energies <0.5eV below the image-band minimum. The binding energies of these CT excitons agree well with solutions to the atomic-H-like Schrödinger equation based on the image potential and the electron-hole Coulomb potential. We hypothesize that the formation of CT excitons should be general to the surfaces of organic semiconductors where the relatively narrow valance-band width facilitates the localization of the hole and the low dielectric constant ensures strong electron-hole attraction.

Photoionization cross section and binding energy of single dopant in hollow cylindrical core/shell quantum dot

NASA Astrophysics Data System (ADS)

Feddi, E.; El-Yadri, M.; Dujardin, F.; Restrepo, R. L.; Duque, C. A.

2017-02-01

In this study, we have investigated the confined donor impurity in a hollow cylindrical-shell quantum dot. The charges are assumed to be completely confined to the interior of the shell with rigid walls. Within the framework of the effective-mass approximation and by using a simple variational approach, we have computed the donor binding energy as a function of the shell sizes in order to study the behavior of the electron-impurity attraction for a very small thickness. Our results show that the binding energy of a donor impurity placed at the center of cylindrical core/shell dots depends strongly on the shell size. The binding energy increases when the shell-wideness becomes smaller and shows the same behavior as in a simple cylindrical quantum dot. A special case has been studied, which corresponds to the ratio between the inner and outer radii near to one (a/b → 1) for which our model gives a non-significant behavior of the impurity binding energy. This fact implies the existence of a critical value (a/b) for which the binding energy of the donor impurity tends to the limit value of 4 effective Rydbergs as in a 2D quantum well. We also analyse the photoionization cross section considering only the in-plane incident radiation polarization. We determine its behavior as a function of photon energy, shell size, and donor position. The measurement of photoionization in such systems would be of great interest to understand the optical properties of carriers in quantum dots.

Carbohydrate–Aromatic Interactions in Proteins

PubMed Central

2015-01-01

Protein–carbohydrate interactions play pivotal roles in health and disease. However, defining and manipulating these interactions has been hindered by an incomplete understanding of the underlying fundamental forces. To elucidate common and discriminating features in carbohydrate recognition, we have analyzed quantitatively X-ray crystal structures of proteins with noncovalently bound carbohydrates. Within the carbohydrate-binding pockets, aliphatic hydrophobic residues are disfavored, whereas aromatic side chains are enriched. The greatest preference is for tryptophan with an increased prevalence of 9-fold. Variations in the spatial orientation of amino acids around different monosaccharides indicate specific carbohydrate C–H bonds interact preferentially with aromatic residues. These preferences are consistent with the electronic properties of both the carbohydrate C–H bonds and the aromatic residues. Those carbohydrates that present patches of electropositive saccharide C–H bonds engage more often in CH−π interactions involving electron-rich aromatic partners. These electronic effects are also manifested when carbohydrate–aromatic interactions are monitored in solution: NMR analysis indicates that indole favorably binds to electron-poor C–H bonds of model carbohydrates, and a clear linear free energy relationships with substituted indoles supports the importance of complementary electronic effects in driving protein–carbohydrate interactions. Together, our data indicate that electrostatic and electronic complementarity between carbohydrates and aromatic residues play key roles in driving protein–carbohydrate complexation. Moreover, these weak noncovalent interactions influence which saccharide residues bind to proteins, and how they are positioned within carbohydrate-binding sites. PMID:26561965

Carbohydrate-Aromatic Interactions in Proteins.

PubMed

Hudson, Kieran L; Bartlett, Gail J; Diehl, Roger C; Agirre, Jon; Gallagher, Timothy; Kiessling, Laura L; Woolfson, Derek N

2015-12-09

Protein-carbohydrate interactions play pivotal roles in health and disease. However, defining and manipulating these interactions has been hindered by an incomplete understanding of the underlying fundamental forces. To elucidate common and discriminating features in carbohydrate recognition, we have analyzed quantitatively X-ray crystal structures of proteins with noncovalently bound carbohydrates. Within the carbohydrate-binding pockets, aliphatic hydrophobic residues are disfavored, whereas aromatic side chains are enriched. The greatest preference is for tryptophan with an increased prevalence of 9-fold. Variations in the spatial orientation of amino acids around different monosaccharides indicate specific carbohydrate C-H bonds interact preferentially with aromatic residues. These preferences are consistent with the electronic properties of both the carbohydrate C-H bonds and the aromatic residues. Those carbohydrates that present patches of electropositive saccharide C-H bonds engage more often in CH-π interactions involving electron-rich aromatic partners. These electronic effects are also manifested when carbohydrate-aromatic interactions are monitored in solution: NMR analysis indicates that indole favorably binds to electron-poor C-H bonds of model carbohydrates, and a clear linear free energy relationships with substituted indoles supports the importance of complementary electronic effects in driving protein-carbohydrate interactions. Together, our data indicate that electrostatic and electronic complementarity between carbohydrates and aromatic residues play key roles in driving protein-carbohydrate complexation. Moreover, these weak noncovalent interactions influence which saccharide residues bind to proteins, and how they are positioned within carbohydrate-binding sites.

Magneto-electronic properties of graphene nanoribbons in the spatially modulated electric field

NASA Astrophysics Data System (ADS)

Chen, S. C.; Wang, T. S.; Lee, C. H.; Lin, M. F.

2008-09-01

The Peierls tight-binding model with the nearest-neighbor interactions is used to calculate the magneto-electronic structure of graphene nanoribbons under a spatially modulated electric field along the y-axis. A uniform perpendicular magnetic field could make energy dispersions change into the quasi-Landau levels. Such levels are composed of the dispersionless and parabolic energy bands. A spatially modulated electric field would further induce a lot of oscillating parabolic bands with several band-edge states. It drastically modifies energy dispersions, alters subband spacings, destroys symmetry of energy spectrum about k=0, and changes features of band-edge states (number and energy). The above-mentioned magneto-electronic structures are directly reflected in density of states (DOS). The modulation effect changes shape, number, positions, and intensities of peaks in DOS. The predicted result could be tested by the optical measurements.

Isoelectronic bound-exciton photoluminescence in strained beryllium-doped Si0.92Ge0.08 epilayers and Si0.92Ge0.08/Si superlattices at ambient and elevated hydrostatic pressure

NASA Astrophysics Data System (ADS)

Kim, Sangsig; Chang, Ganlin; Herman, Irving P.; Bevk, Joze; Moore, Karen L.; Hall, Dennis G.

1997-03-01

Photoluminescence (PL) from a beryllium-doped Si0.92Ge0.08 epilayer and three different beryllium-doped Si0.92Ge0.08/Si superlattices (SL's) commensurately grown on Si(100) substrates is examined at 9 K at ambient pressure and, for the epilayer and one SL, as a function of hydrostatic pressure. In each structure, excitons bind to the isoelectronic Be pairs in the strained Si0.92Ge0.08 layers. The zero-phonon PL peaks of the epilayer and the in situ doped 50-Å Si0.92Ge0.08/100-Å Si SL shift linearly with pressure toward lower energy at the rate of 0.68+/-0.03 and 0.97+/-0.03 meV/kbar, respectively, which are near the 0.77-meV/kbar value for Si:Be. The PL energies at ambient and elevated pressure are analyzed by accounting for strain, quantum confinement, and exciton binding. A modified Hopfield-Thomas-Lynch model is used to model exciton binding to the Be pairs. This model, in which potential wells bind electrons to a site (that then trap holes), predicts a distribution of electron binding energies when an inhomogeneous distribution of potential-well depths is used. This accounts for the large PL linewidth and the decrease of linewidth with increasing pressure, among other observations. In SL's, the exciton binding energy is shown to depend on the width of the wells as well as the spatial distribution of Be dopants in the superlattice. Also, at and above 58 kbar a very unusual peak is observed in one of the SL's, which is associated with a free-exciton peak in Si, that shifts very fast with pressure (-6.02+/-0.03 meV/kbar).

Electronic structure of BaO/W cathode surfaces

NASA Technical Reports Server (NTRS)

Muller, Wolfgang

1989-01-01

The local electronic structure of the emissive layer of barium dispenser thermionic cathodes is investigated theoretically using the relativistic scattered-wave approach. The interaction of Ba and O with W, Os, and W-Os alloy surfaces is studied with atomic clusters modeling different absorption environments representative of B- and M-type cathodes. Ba is found to be strongly oxidized, while O and the metal substrate are in a reduced chemical state. The presence of O enhances the surface dipole and Ba binding energy relative to Ba on W. Model results for W-Os alloy substrates show only relatively small changes in Ba and O for identical geometries, but very large charge redistributions inside the substrate, which are attributed to the electronegativity difference between Os and W. If Os is present in the surface layer, the charge transfer from Ba to the substrate and the Ba binding energy increase relative to W. Explanations are offered for the improved electron emission from alloy surfaces and the different emission enhancement for different alloy substrates.

The adsorption of methyl iodide on uranium and uranium dioxide: Surface characterization using X-ray photoelectron spectroscopy (XPS) and Auger electron spectroscopy (AES)

NASA Astrophysics Data System (ADS)

Dillard, J. G.; Moers, H.; Klewe-Nebenius, H.; Kirch, G.; Pfennig, G.; Ache, H. J.

1984-09-01

The adsorption of methyl iodide on uranium and on uranium dioxide has been studied at 25 °C. Surfaces of the substrates were characterized before and after adsorption by X-ray photoelectron spectroscopy (XPS) and Auger electron spectroscopy (AES). The XPS binding energy results indicate that CH 3I adsorption on uranium yields a carbide-type carbon, UC, and uranium iodide, UI 3. On uranium dioxide the carbon electron binding energy measurements are consistent with the formation of a hydrocarbon, —CH 3-type moiety. The interpretation of XPS and AES spectral features for CH 3I adsorption on uranium suggest that a complex dissociative adsorption reaction takes place. Adsorption of CH 3I on UO 2 occurs via a dissociative process. Saturation coverage occurs on uranium at approximately two langmuir (1 L = 10 -6 Torr s) exposure whereas saturation coverage on uranium dioxide is found at about five langmuir.

Simultaneous observation of free and defect-bound excitons in CH3NH3PbI3 using four-wave mixing spectroscopy

NASA Astrophysics Data System (ADS)

March, Samuel A.; Clegg, Charlotte; Riley, Drew B.; Webber, Daniel; Hill, Ian G.; Hall, Kimberley C.

2016-12-01

Solar cells incorporating organic-inorganic perovskite, which may be fabricated using low-cost solution-based processing, have witnessed a dramatic rise in efficiencies yet their fundamental photophysical properties are not well understood. The exciton binding energy, central to the charge collection process, has been the subject of considerable controversy due to subtleties in extracting it from conventional linear spectroscopy techniques due to strong broadening tied to disorder. Here we report the simultaneous observation of free and defect-bound excitons in CH3NH3PbI3 films using four-wave mixing (FWM) spectroscopy. Due to the high sensitivity of FWM to excitons, tied to their longer coherence decay times than unbound electron- hole pairs, we show that the exciton resonance energies can be directly observed from the nonlinear optical spectra. Our results indicate low-temperature binding energies of 13 meV (29 meV) for the free (defect-bound) exciton, with the 16 meV localization energy for excitons attributed to binding to point defects. Our findings shed light on the wide range of binding energies (2-55 meV) reported in recent years.

Photoelectron spectroscopy and electronic structure of ScO{sub n}{sup {minus}}(n = 1--4) and YO{sub n}{sup {minus}}(n = 1--5): Strong electron correlation effects in ScO{sup {minus}} and YO{sup {minus}}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, H.; Wang, L.S.

A photoelectron spectroscopic study of ScO{sub n}{sup {minus}} (n = 1--4) and YO{sub n}{sup {minus}} (n = 1--5) was carried out at three photon energies: 532, 355, and 266 nm. Vibrationally resolved photoelectron spectra were obtained for ScO{sup {minus}} and YO{sup {minus}}. The electron affinities of both ScO and YO were measured to be identical (1.35 eV) within the experimental accuracy ({+-}0.02 eV). Three low-lying excited states were observed for the monoxides, {Alpha}{prime}{sup 2}{Delta}, {Alpha}{sup 2}{Pi}, and {Beta}{sup 2}{Sigma}{sup +}. The latter two excited states resulted from two-electron detachment, suggesting unusually strong electron correlation (configuration interaction) effects in the groundmore » state of the anions. The excitation energies of the low-lying states were also found to be similar for the two monoxides except that YO has a smaller vibrational frequency and larger spin-orbit splitting. The {Alpha}{prime}{sup 2}{Delta} states of both ScO and YO show very strong photon energy-dependent detachment cross sections. Four similar photoelectron features were observed for the dioxides with those of YO{sub 2}{sup {minus}} having lower binding energies. A second isomer due to an O{sub 2} complex was also observed for Sc and Y. Broad and featureless spectra were observed for the higher oxides. At least two isomers were present for the higher oxides, one with low and one with high binding energies.« less

Physical origins of weak H 2 binding on carbon nanostructures: Insight from ab initio studies of chemically functionalized graphene nanoribbons

DOE PAGES

Ulman, Kanchan; Bhaumik, Debarati; Wood, Brandon C.; ...

2014-05-05

Here, we have performed ab initio density functional theory calculations, incorporating London dispersion corrections, to study the absorption of molecular hydrogen on zigzag graphene nanoribbons whose edges have been functionalized by OH, NH 2, COOH, NO 2, or H 2PO 3. We find that hydrogen molecules always preferentially bind at or near the functionalized edge, and display induced dipole moments. Binding is generally enhanced by the presence of polar functional groups. Furthermore, the largest gains are observed for groups with oxygen lone pairs that can facilitate local charge reorganization, with the biggest single enhancement in adsorption energy found for “strongmore » functionalization” by H 2PO 3 (115 meV/H 2 versus 52 meV/H 2 on bare graphene). We show that for binding on the “outer edge” near the functional group, the presence of the group can introduce appreciable contributions from Debye interactions and higher-order multipole electrostatic terms, in addition to the dominant London dispersion interactions. For those functional groups that contain the OH moiety, the adsorption energy is linearly proportional to the number of lone pairs on oxygen atoms. Mixed functionalization with two different functional groups on a graphene edge can also have a synergistic effect, particularly when electron-donating and electron-withdrawing groups are combined. For binding on the “inner edge” somewhat farther from the functional group, most of the binding again arises from London interactions; however, there is also significant charge redistribution in the π manifold, which directly reflects the electron donating or withdrawing capacity of the functional group. These results offer insight into the specific origins of weak binding of gas molecules on graphene, and suggest that edge functionalization could perhaps be used in combination with other strategies to increase the uptake of hydrogen in graphene. They also have relevance for the storage of hydrogen in porous carbon materials, such as activated carbons.« less

Multiple mobility edges in a 1D Aubry chain with Hubbard interaction in presence of electric field: Controlled electron transport

NASA Astrophysics Data System (ADS)

Saha, Srilekha; Maiti, Santanu K.; Karmakar, S. N.

2016-09-01

Electronic behavior of a 1D Aubry chain with Hubbard interaction is critically analyzed in presence of electric field. Multiple energy bands are generated as a result of Hubbard correlation and Aubry potential, and, within these bands localized states are developed under the application of electric field. Within a tight-binding framework we compute electronic transmission probability and average density of states using Green's function approach where the interaction parameter is treated under Hartree-Fock mean field scheme. From our analysis we find that selective transmission can be obtained by tuning injecting electron energy, and thus, the present model can be utilized as a controlled switching device.

H2O Nucleation Around Noble Metal Cations

NASA Astrophysics Data System (ADS)

Calaminici, Patrizia; Oropeza Alfaro, Pavel; Juarez Flores, Martin; Köster, Andreas; Beltran, Marcela; Ulises Reveles, J.; Khanna, Shiv N.

2008-03-01

First principle electronic structure calculations have been carried out to investigate the ground state geometry, electronic structure and binding energy of noble metal cations (H2O)n^+ clusters containing up to 10 H2O molecules. The calculations are performed with the density functional theory code deMon2k [1]. Due to the very flat potential energy surface of these systems special care to the numerical stability of energy and gradient calculation must be taken.Comparison of the results obtained with Cu^+, Ag^+ and Au^+ will be shown. This investigation provides insight into the structural arrangement of the water molecules around these metals and a microscopic understanding of the observed incremental binding energy in the case of the gold cation based on collision induced dissociation experiments. [1] A.M. Köster, P. Calaminici, M.E. Casida, R. Flores-Moreno, G. Geudtner, A. Goursot, T. Heine, A. Ipatov, F. Janetzko, J. Martin del Campo, S. Patchkovski, J.U. Reveles, A. Vela and D.R. Salahub, deMon2k, The deMon Developers, Cinvestav, 2006

Time of flight spectrometer for background-free positron annihilation induced Auger electron spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mukherjee, S.; Shastry, K.; Anto, C. V.

2016-03-15

We describe a novel spectrometer designed for positron annihilation induced Auger electron spectroscopy employing a time-of-flight spectrometer. The spectrometer’s new configuration enables us to implant monoenergetic positrons with kinetic energies as low as 1.5 eV on the sample while simultaneously allowing for the detection of electrons emitted from the sample surface at kinetic energies ranging from ∼500 eV to 0 eV. The spectrometer’s unique characteristics made it possible to perform (a) first experiments demonstrating the direct transition of a positron from an unbound scattering state to a bound surface state and (b) the first experiments demonstrating that Auger electron spectramore » can be obtained down to 0 eV without the beam induced secondary electron background obscuring the low energy part of the spectra. Data are presented which show alternative means of estimating positron surface state binding energy and background-free Auger spectra.« less

ProbeZT: Simulation of transport coefficients of molecular electronic junctions under environmental effects using Büttiker's probes

NASA Astrophysics Data System (ADS)

Korol, Roman; Kilgour, Michael; Segal, Dvira

2018-03-01

We present our in-house quantum transport package, ProbeZT. This program provides linear response coefficients: electrical and electronic thermal conductances, as well as the thermopower of molecular junctions in which electrons interact with the surrounding thermal environment. Calculations are performed based on the Büttiker probe method, which introduces decoherence, energy exchange and dissipation effects phenomenologically using virtual electrode terminals called probes. The program can realize different types of probes, each introducing various environmental effects, including elastic and inelastic scattering of electrons. The molecular system is described by an arbitrary tight-binding Hamiltonian, allowing the study of different geometries beyond simple one-dimensional wires. Applications of the program to study the thermoelectric performance of molecular junctions are illustrated. The program also has a built-in functionality to simulate electron transport in double-stranded DNA molecules based on a tight-binding (ladder) description of the junction.

Supramolecular complex of a fused zinc phthalocyanine-zinc porphyrin dyad assembled by two imidazole-C60 units: ultrafast photoevents.

PubMed

Follana-Berná, Jorge; Seetharaman, Sairaman; Martín-Gomis, Luis; Charalambidis, Georgios; Trapali, Adelais; Karr, Paul A; Coutsolelos, Athanassios G; Fernández-Lázaro, Fernando; D'Souza, Francis; Sastre-Santos, Ángela

2018-03-14

A new zinc phthalocyanine-zinc porphyrin dyad (ZnPc-ZnP) fused through a pyrazine ring has been synthesized as a receptor for imidazole-substituted C 60 (C 60 Im) electron acceptor. Self-assembly via metal-ligand axial coordination and the pertinent association constants in solution were determined by 1 H-NMR, UV-Vis and fluorescence titration experiments at room temperature. The designed host was able to bind up to two C 60 Im electron acceptor guest molecules to yield C 60 Im:ZnPc-ZnP:ImC 60 donor-acceptor supramolecular complex. The spectral data showed that the two binding sites behave independently with binding constants similar in magnitude. Steady-state fluorescence studies were indicative of an efficient singlet-singlet energy transfer from zinc porphyrin to zinc phthalocyanine within the fused dyad. Accordingly, the transient absorption studies covering a wide timescale of femto-to-milli seconds revealed ultrafast energy transfer from 1 ZnP* to ZnPc (k EnT ∼ 10 12 s -1 ) in the fused dyad. Further, a photo induced electron transfer was observed in the supramolecularly assembled C 60 Im:ZnPc-ZnP:ImC 60 donor-acceptor complex leading to charge separated states, which persisted for about 200 ns.

Measurement of Exciton Binding Energy of Monolayer WS2

NASA Astrophysics Data System (ADS)

Chen, Xi; Zhu, Bairen; Cui, Xiaodong

Excitonic effects are prominent in monolayer crystal of transition metal dichalcogenides (TMDCs) because of spatial confinement and reduced Coulomb screening. Here we use linear differential transmission spectroscopy and two-photon photoluminescence excitation spectroscopy (TP-PLE) to measure the exciton binding energy of monolayer WS2. Peaks for excitonic absorptions of the direct gap located at K valley of the Brillouin zone and transitions from multiple points near Γ point of the Brillouin zone, as well as trion side band are shown in the linear absorption spectra of WS2. But there is no gap between distinct excitons and the continuum of the interband transitions. Strong electron-phonon scattering, overlap of excitons around Γ point and the transfer of the oscillator strength from interband continuum to exciton states make it difficult to resolve the electronic interband transition edge even down to 10K. The gap between excited states of the band-edge exciton and the single-particle band is probed by TP-PLE measurements. And the energy difference between 1s exciton and the single-particle gap gives the exciton binding energy of monolayer WS2 to be about 0.71eV. The work is supported by Area of excellency (AoE/P-04/08), CRF of Hong Kong Research Grant Council (HKU9/CRF/13G) and SRT on New Materials of The University of Hong Kong.

Energy transfer between two vacuum-gapped metal plates: Coulomb fluctuations and electron tunneling

NASA Astrophysics Data System (ADS)

Zhang, Zu-Quan; Lü, Jing-Tao; Wang, Jian-Sheng

2018-05-01

Recent experimental measurements for near-field radiative heat transfer between two bodies have been able to approach the gap distance within 2 nm , where the contributions of Coulomb fluctuation and electron tunneling are comparable. Using the nonequilibrium Green's function method in the G0W0 approximation, based on a tight-binding model, we obtain for the energy current a Caroli formula from the Meir-Wingreen formula in the local equilibrium approximation. Also, the Caroli formula is consistent with the evanescent part of the heat transfer from the theory of fluctuational electrodynamics. We go beyond the local equilibrium approximation to study the energy transfer in the crossover region from electron tunneling to Coulomb fluctuation based on a numerical calculation.

Wobbled electronic properties of lithium clusters: Deterministic approach through first principles

NASA Astrophysics Data System (ADS)

Kushwaha, Anoop Kumar; Nayak, Saroj Kumar

2018-03-01

The innate tendency to form dendritic growth promoted through cluster formation leading to the failure of a Li-ion battery system have drawn significant attention of the researchers towards the effective destabilization of the cluster growth through selective implementation of electrolytic media such as acetonitrile (MeCN). In the present work, using first principles density functional theory and continuum dielectric model, we have investigated the origin of oscillatory nature of binding energy per atom of Lin (n ≤ 8) under the influence of MeCN. In the gas phase, we found that static mean polarizability is strongly correlated with binding energy and shows oscillatory nature with cluster size due to the open shell of Lin cluster. However, in acetonitrile medium, the binding energy has been correlated with electrostatic Lin -MeCN interaction and it has been found that both of them possess wobbled behavior characterized by the cluster size.

Perfect transmission at oblique incidence by trigonal warping in graphene P-N junctions

NASA Astrophysics Data System (ADS)

Zhang, Shu-Hui; Yang, Wen

2018-01-01

We develop an analytical mode-matching technique for the tight-binding model to describe electron transport across graphene P-N junctions. This method shares the simplicity of the conventional mode-matching technique for the low-energy continuum model and the accuracy of the tight-binding model over a wide range of energies. It further reveals an interesting phenomenon on a sharp P-N junction: the disappearance of the well-known Klein tunneling (i.e., perfect transmission) at normal incidence and the appearance of perfect transmission at oblique incidence due to trigonal warping at energies beyond the linear Dirac regime. We show that this phenomenon arises from the conservation of a generalized pseudospin in the tight-binding model. We expect this effect to be experimentally observable in graphene and other Dirac fermions systems, such as the surface of three-dimensional topological insulators.

Approximations to complete basis set-extrapolated, highly correlated non-covalent interaction energies.

PubMed

Mackie, Iain D; DiLabio, Gino A

2011-10-07

The first-principles calculation of non-covalent (particularly dispersion) interactions between molecules is a considerable challenge. In this work we studied the binding energies for ten small non-covalently bonded dimers with several combinations of correlation methods (MP2, coupled-cluster single double, coupled-cluster single double (triple) (CCSD(T))), correlation-consistent basis sets (aug-cc-pVXZ, X = D, T, Q), two-point complete basis set energy extrapolations, and counterpoise corrections. For this work, complete basis set results were estimated from averaged counterpoise and non-counterpoise-corrected CCSD(T) binding energies obtained from extrapolations with aug-cc-pVQZ and aug-cc-pVTZ basis sets. It is demonstrated that, in almost all cases, binding energies converge more rapidly to the basis set limit by averaging the counterpoise and non-counterpoise corrected values than by using either counterpoise or non-counterpoise methods alone. Examination of the effect of basis set size and electron correlation shows that the triples contribution to the CCSD(T) binding energies is fairly constant with the basis set size, with a slight underestimation with CCSD(T)∕aug-cc-pVDZ compared to the value at the (estimated) complete basis set limit, and that contributions to the binding energies obtained by MP2 generally overestimate the analogous CCSD(T) contributions. Taking these factors together, we conclude that the binding energies for non-covalently bonded systems can be accurately determined using a composite method that combines CCSD(T)∕aug-cc-pVDZ with energy corrections obtained using basis set extrapolated MP2 (utilizing aug-cc-pVQZ and aug-cc-pVTZ basis sets), if all of the components are obtained by averaging the counterpoise and non-counterpoise energies. With such an approach, binding energies for the set of ten dimers are predicted with a mean absolute deviation of 0.02 kcal/mol, a maximum absolute deviation of 0.05 kcal/mol, and a mean percent absolute deviation of only 1.7%, relative to the (estimated) complete basis set CCSD(T) results. Use of this composite approach to an additional set of eight dimers gave binding energies to within 1% of previously published high-level data. It is also shown that binding within parallel and parallel-crossed conformations of naphthalene dimer is predicted by the composite approach to be 9% greater than that previously reported in the literature. The ability of some recently developed dispersion-corrected density-functional theory methods to predict the binding energies of the set of ten small dimers was also examined. © 2011 American Institute of Physics

Ultralow energy calibration of LUX detector using Xe 127 electron capture

DOE PAGES

Akerib, D. S.; Alsum, S.; Araújo, H. M.; ...

2017-12-01

We report an absolute calibration of the ionization yields(more » $$\\textit{Q$$_y$})$ and fluctuations for electronic recoil events in liquid xenon at discrete energies between 186 eV and 33.2 keV. The average electric field applied across the liquid xenon target is 180 V/cm. The data are obtained using low energy $$^{127}$$Xe electron capture decay events from the 95.0-day first run from LUX (WS2013) in search of Weakly Interacting Massive Particles (WIMPs). The sequence of gamma-ray and X-ray cascades associated with $$^{127}$$I de-excitations produces clearly identified 2-vertex events in the LUX detector. We observe the K- (binding energy, 33.2 keV), L- (5.2 keV), M- (1.1 keV), and N- (186 eV) shell cascade events and verify that the relative ratio of observed events for each shell agrees with calculations. The N-shell cascade analysis includes single extracted electron (SE) events and represents the lowest-energy electronic recoil $$\\textit{in situ}$$ measurements that have been explored in liquid xenon.« less

Ultralow energy calibration of LUX detector using Xe 127 electron capture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akerib, D. S.; Alsum, S.; Araújo, H. M.

We report an absolute calibration of the ionization yields (Q y) and fluctuations for electronic recoil events in liquid xenon at discrete energies between 186 eV and 33.2 keV. The average electric field applied across the liquid xenon target is 180 V/cm. The data are obtained using low energy 127Xe electron capture decay events from the 95.0-day first run from LUX (WS2013) in search of weakly interacting massive particles. The sequence of gamma-ray and x-ray cascades associated with 127I deexcitations produces clearly identified two-vertex events in the LUX detector. We observe the K-(binding energy, 33.2 keV), L-(5.2 keV), M-(1.1 keV),more » and N-(186 eV) shell cascade events and verify that the relative ratio of observed events for each shell agrees with calculations. In conclusion, the N-shell cascade analysis includes single extracted electron (SE) events and represents the lowest-energy electronic recoil in situ measurements that have been explored in liquid xenon.« less

Ultralow energy calibration of LUX detector using Xe 127 electron capture

NASA Astrophysics Data System (ADS)

Akerib, D. S.; Alsum, S.; Araújo, H. M.; Bai, X.; Bailey, A. J.; Balajthy, J.; Beltrame, P.; Bernard, E. P.; Bernstein, A.; Biesiadzinski, T. P.; Boulton, E. M.; Brás, P.; Byram, D.; Cahn, S. B.; Carmona-Benitez, M. C.; Chan, C.; Currie, A.; Cutter, J. E.; Davison, T. J. R.; Dobi, A.; Druszkiewicz, E.; Edwards, B. N.; Fallon, S. R.; Fan, A.; Fiorucci, S.; Gaitskell, R. J.; Genovesi, J.; Ghag, C.; Gilchriese, M. G. D.; Hall, C. R.; Hanhardt, M.; Haselschwardt, S. J.; Hertel, S. A.; Hogan, D. P.; Horn, M.; Huang, D. Q.; Ignarra, C. M.; Jacobsen, R. G.; Ji, W.; Kamdin, K.; Kazkaz, K.; Khaitan, D.; Knoche, R.; Larsen, N. A.; Lenardo, B. G.; Lesko, K. T.; Lindote, A.; Lopes, M. I.; Manalaysay, A.; Mannino, R. L.; Marzioni, M. F.; McKinsey, D. N.; Mei, D.-M.; Mock, J.; Moongweluwan, M.; Morad, J. A.; Murphy, A. St. J.; Nehrkorn, C.; Nelson, H. N.; Neves, F.; O'Sullivan, K.; Oliver-Mallory, K. C.; Palladino, K. J.; Pease, E. K.; Rhyne, C.; Shaw, S.; Shutt, T. A.; Silva, C.; Solmaz, M.; Solovov, V. N.; Sorensen, P.; Sumner, T. J.; Szydagis, M.; Taylor, D. J.; Taylor, W. C.; Tennyson, B. P.; Terman, P. A.; Tiedt, D. R.; To, W. H.; Tripathi, M.; Tvrznikova, L.; Uvarov, S.; Velan, V.; Verbus, J. R.; Webb, R. C.; White, J. T.; Whitis, T. J.; Witherell, M. S.; Wolfs, F. L. H.; Xu, J.; Yazdani, K.; Young, S. K.; Zhang, C.

2017-12-01

We report an absolute calibration of the ionization yields (Qy ) and fluctuations for electronic recoil events in liquid xenon at discrete energies between 186 eV and 33.2 keV. The average electric field applied across the liquid xenon target is 180 V /cm . The data are obtained using low energy Xe 127 electron capture decay events from the 95.0-day first run from LUX (WS2013) in search of weakly interacting massive particles. The sequence of gamma-ray and x-ray cascades associated with I 127 deexcitations produces clearly identified two-vertex events in the LUX detector. We observe the K-(binding energy, 33.2 keV), L-(5.2 keV), M-(1.1 keV), and N-(186 eV) shell cascade events and verify that the relative ratio of observed events for each shell agrees with calculations. The N-shell cascade analysis includes single extracted electron (SE) events and represents the lowest-energy electronic recoil in situ measurements that have been explored in liquid xenon.

Ultralow energy calibration of LUX detector using Xe 127 electron capture

DOE PAGES

Akerib, D. S.; Alsum, S.; Araújo, H. M.; ...

2017-12-28

We report an absolute calibration of the ionization yields (Q y) and fluctuations for electronic recoil events in liquid xenon at discrete energies between 186 eV and 33.2 keV. The average electric field applied across the liquid xenon target is 180 V/cm. The data are obtained using low energy 127Xe electron capture decay events from the 95.0-day first run from LUX (WS2013) in search of weakly interacting massive particles. The sequence of gamma-ray and x-ray cascades associated with 127I deexcitations produces clearly identified two-vertex events in the LUX detector. We observe the K-(binding energy, 33.2 keV), L-(5.2 keV), M-(1.1 keV),more » and N-(186 eV) shell cascade events and verify that the relative ratio of observed events for each shell agrees with calculations. In conclusion, the N-shell cascade analysis includes single extracted electron (SE) events and represents the lowest-energy electronic recoil in situ measurements that have been explored in liquid xenon.« less

Calculation of protein-ligand binding affinities.

PubMed

Gilson, Michael K; Zhou, Huan-Xiang

2007-01-01

Accurate methods of computing the affinity of a small molecule with a protein are needed to speed the discovery of new medications and biological probes. This paper reviews physics-based models of binding, beginning with a summary of the changes in potential energy, solvation energy, and configurational entropy that influence affinity, and a theoretical overview to frame the discussion of specific computational approaches. Important advances are reported in modeling protein-ligand energetics, such as the incorporation of electronic polarization and the use of quantum mechanical methods. Recent calculations suggest that changes in configurational entropy strongly oppose binding and must be included if accurate affinities are to be obtained. The linear interaction energy (LIE) and molecular mechanics Poisson-Boltzmann surface area (MM-PBSA) methods are analyzed, as are free energy pathway methods, which show promise and may be ready for more extensive testing. Ultimately, major improvements in modeling accuracy will likely require advances on multiple fronts, as well as continued validation against experiment.

Combined quantum mechanics/molecular mechanics (QM/MM) simulations for protein-ligand complexes: free energies of binding of water molecules in influenza neuraminidase.

PubMed

Woods, Christopher J; Shaw, Katherine E; Mulholland, Adrian J

2015-01-22

The applicability of combined quantum mechanics/molecular mechanics (QM/MM) methods for the calculation of absolute binding free energies of conserved water molecules in protein/ligand complexes is demonstrated. Here, we apply QM/MM Monte Carlo simulations to investigate binding of water molecules to influenza neuraminidase. We investigate five different complexes, including those with the drugs oseltamivir and peramivir. We investigate water molecules in two different environments, one more hydrophobic and one hydrophilic. We calculate the free-energy change for perturbation of a QM to MM representation of the bound water molecule. The calculations are performed at the BLYP/aVDZ (QM) and TIP4P (MM) levels of theory, which we have previously demonstrated to be consistent with one another for QM/MM modeling. The results show that the QM to MM perturbation is significant in both environments (greater than 1 kcal mol(-1)) and larger in the more hydrophilic site. Comparison with the same perturbation in bulk water shows that this makes a contribution to binding. The results quantify how electronic polarization differences in different environments affect binding affinity and also demonstrate that extensive, converged QM/MM free-energy simulations, with good levels of QM theory, are now practical for protein/ligand complexes.

Distribution of localized states from fine analysis of electron spin resonance spectra of organic semiconductors: Physical meaning and methodology

NASA Astrophysics Data System (ADS)

Mishchenko, Andrey S.; Matsui, Hiroyuki; Hasegawa, Tatsuo

2012-02-01

We develop an analytical method for the processing of electron spin resonance (ESR) spectra. The goal is to obtain the distributions of trapped carriers over both their degree of localization and their binding energy in semiconductor crystals or films composed of regularly aligned organic molecules [Phys. Rev. Lett.PRLTAO0031-900710.1103/PhysRevLett.104.056602 104, 056602 (2010)]. Our method has two steps. We first carry out a fine analysis of the shape of the ESR spectra due to the trapped carriers; this reveals the distribution of the trap density of the states over the degree of localization. This analysis is based on the reasonable assumption that the linewidth of the trapped carriers is predetermined by their degree of localization because of the hyperfine mechanism. We then transform the distribution over the degree of localization into a distribution over the binding energies. The transformation uses the relationships between the binding energies and the localization parameters of the trapped carriers. The particular relation for the system under study is obtained by the Holstein model for trapped polarons using a diagrammatic Monte Carlo analysis. We illustrate the application of the method to pentacene organic thin-film transistors.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sedlacek, J. A.; Kim, E.; Rittenhouse, S. T.

We investigate the (0001) surface of single crystal quartz with a submonolayer of Rb adsorbates. Using Rydberg atom electromagnetically induced transparency, we investigate the electric elds resulting from Rb adsorbed on the quartz surface, and measure the activation energy of the Rb adsorbates. We show that the Rb induces a negative electron affnity (NEA) on the quartz surface. The NEA surface allows for low energy electrons to bind to the surface and cancel the electric eld from the Rb adsorbates. Our results have implications for integrating Rydberg atoms into hybrid quantum systems and the fundamental study of atom-surface interactions, asmore » well as applications for electrons bound to a 2D surface.« less

Angle and frequency dependence of self-energy from spin fluctuation mediated d-wave pairing for high temperature superconductors.

PubMed

Hong, Seung Hwan; Choi, Han-Yong

2013-09-11

We investigated the characteristics of spin fluctuation mediated superconductivity employing the Eliashberg formalism. The effective interaction between electrons was modeled in terms of the spin susceptibility measured by inelastic neutron scattering experiments on single crystal La(2-x)Sr(x)CuO4 superconductors. The diagonal self-energy and off-diagonal self-energy were calculated by solving the coupled Eliashberg equation self-consistently for the chosen spin susceptibility and tight-binding dispersion of electrons. The full momentum and frequency dependence of the self-energy is presented for optimally doped, overdoped, and underdoped LSCO cuprates in a superconductive state. These results may be compared with the experimentally deduced self-energy from ARPES experiments.

Formation, stability and dissociation dynamics of {{\\rm{N}}}_{2}{}^{{\\rm{n}}+} cations (n = 1 - 2) in 3.5 keV e - -N2 collisions studied using the energy resolved electron-ion coincidence technique

NASA Astrophysics Data System (ADS)

Kumar, S.; Prajapati, S.; Singh, B.; Singh, B. K.; Shanker, R.

2018-04-01

Coincidences between energy selected electrons and ions produced in the decay of a core hole ionized (excited) state in a free nitrogen molecule have been measured at three specified energies of emitted electrons to reveal the individual pathways produced in 3.5 keV electron-induced fragmentation processes. From these measurements, it has been possible to show, for the first time, that in addition to the normal Auger decay, the resonant Auger excitation channels also share their appreciable contributions in producing singly charged parent ions in an electron-induced collision system. The correlations between ion fragmentation products and electronic structures with a hole configuration in singly-, doubly- and possibly in triply charged molecular electronic states populated in the electronic decay of the initial core hole have been studied and discussed. KER values obtained from our experiments are found to be consistent with the previous results of photo absorption experiments for fragmentation channel {{{{N}}}2}2+ → N+ + N+ however, N2+ fragment ions are found to arise mainly from the fragmentation channel {{{{N}}}2}2+ → N2+ + N and to possess relatively low kinetic energies in the considered region of binding energies.

Ni doping effect on the electronic and sensing properties of 2D SnO2

NASA Astrophysics Data System (ADS)

Patel, Anjali; Roondhe, Basant; Jha, Prafulla K.

2018-05-01

In the present work using state of art first principles calculations under the frame work of density functional theory the effect of Nickel (Ni) doping on electronic as well as sensing properties of most stable two dimensional (2D) T-SnO2 phase towards ethanol (C2H5OH) has been observed. It has been found that Ni atom when dope on T-SnO2 causes prominent decrement in the band gap from 2.26 eV to 1.48 eV and improves the sensing phenomena of pristine T-SnO2 towards C2H5OH by increasing the binding energy from -0.18eV to -0.93eV. The comparative analysis of binding energy shows that Ni improves the binding of C2H5OH by 5.16 times the values for pristine T-SnO2. The doping of Ni into 2D T-SnO2 reduces the band gap through lowering of the conduction band minimum, thereby increasing the electron affinity which increases the sensing performance of T-SnO2. The variation in the electronic properties after and before the exposure of ethanol reinforced to use Ni:SnO2 nano structure for sensing applications. The results indicate that the Ni doped T-SnO2 can be utilized in improved optoelectronic as well as sensor devices in the future.

Assessing Carbon-Based Anodes for Lithium-Ion Batteries: A Universal Description of Charge-Transfer Binding

DOE PAGES

Liu, Yuanyue; Wang, Y. Morris; Yakobson, Boris I.; ...

2014-07-11

Many key performance characteristics of carbon-based lithium-ion battery anodes are largely determined by the strength of binding between lithium (Li) and sp 2 carbon (C), which can vary significantly with subtle changes in substrate structure, chemistry, and morphology. We use density functional theory calculations to investigate the interactions of Li with a wide variety of sp 2 C substrates, including pristine, defective, and strained graphene, planar C clusters, nanotubes, C edges, and multilayer stacks. In almost all cases, we find a universal linear relation between the Li-C binding energy and the work required to fill previously unoccupied electronic states withinmore » the substrate. This suggests that Li capacity is predominantly determined by two key factors—namely, intrinsic quantum capacitance limitations and the absolute placement of the Fermi level. This simple descriptor allows for straightforward prediction of the Li-C binding energy and related battery characteristics in candidate C materials based solely on the substrate electronic structure. It further suggests specific guidelines for designing more effective C-based anodes. Furthermore, this method should be broadly applicable to charge-transfer adsorption on planar substrates, and provides a phenomenological connection to established principles in supercapacitor and catalyst design.« less

Dissociation kinetics of excited ions: PEPICO measurements of Os3(CO)12 - The 7-35 eV single ionization binding energy region.

PubMed

Schalk, Oliver; Josefsson, Ida; Geng, Ting; Richter, Robert; Sa'adeh, Hanan; Thomas, Richard D; Mucke, Melanie

2018-02-28

In this article, we study the photoinduced dissociation pathways of a metallocarbonyl, Os 3 (CO) 12 , in particular the consecutive loss of CO groups. To do so, we performed photoelectron-photoion coincidence (PEPICO) measurements in the single ionization binding energy region from 7 to 35 eV using 45-eV photons. Zero-energy ion appearance energies for the dissociation steps were extracted by modeling the PEPICO data using the statistical adiabatic channel model. Upon ionization to the excited ionic states above 13 eV binding energy, non-statistical behavior was observed and assigned to prompt CO loss. Double ionization was found to be dominated by the knockout process with an onset of 20.9 ± 0.4 eV. The oscillator strength is significantly larger for energies above 26.6 ± 0.4 eV, corresponding to one electron being ejected from the Os 3 center and one from the CO ligands. The cross section for double ionization was found to increase linearly up to 35 eV ionization energy, at which 40% of the generated ions are doubly charged.

The Successive OH Binding Energies of Sc(OH)n+ for n=1-3

NASA Technical Reports Server (NTRS)

Bauschlicher, Charles W., Jr.; Partridge, Harry; Arnold, James O. (Technical Monitor)

1996-01-01

The geometries of Sc(OH)n+, for n = 1-3, have been optimized using density functional theory, in conjunction with the B3LYP hybrid functional. The zero-point energies are computed at the same level of theory. The successive OH bond energies have been computed at the CCSD(T) level for ScOH+ and Sc(OH)2+. The computed result for ScOD+ is in excellent agreement with the recent experiment of Armentrout and co-workers. There is a dramatic drop for the third OH, because Sc+ has only two valence electrons and therefore the bonding changes when the third OH is added. The difference between the B3LYP and CCSD(T) OH binding energies for the first two OH groups is discussed.

The tight binding model study of the role of anisotropic AFM spin ordering in the charge ordered CMR manganites

NASA Astrophysics Data System (ADS)

Kar, J. K.; Panda, Saswati; Rout, G. C.

2017-05-01

We propose here a tight binding model study of the interplay between charge and spin orderings in the CMR manganites taking anisotropic effect due to electron hoppings and spin exchanges. The Hamiltonian consists of the kinetic energies of eg and t2g electrons of manganese ion. It further includes double exchange and Heisenberg interactions. The charge density wave interaction (CDW) describes an extra mechanism for the insulating character of the system. The CDW gap and spin parameters are calculated using Zubarev's Green's function technique and computed self-consistently. The results are reported in this communication.

Hydrogen incorporation into BN fullerene-like nanostructures: A first-principles study

NASA Astrophysics Data System (ADS)

Ganji, M. D.; Abbaszadeh, B.; Ahaz, B.

2011-10-01

We performed density functional theory calculations to investigate the possibility of formation of endohedrally H@(BN) n-fullerene ( n: 24, 36, 60) and H@C 60 complexes for potential applications in solid-state quantum-computers. Spin-polarized approach within the generalized gradient approximation with the Perdew-Burke-Ernzerhof functional was used for the total energies and structural relaxation calculations. The calculated binding energies show that H atom being incorporated into B 60N 60 nanocage can form most stable complexes while the B 24N 24 and C 60 nanocages might form unstable complex with positive binding energy. We have also examined the penetration of an H atom into the respective nanocages and the calculated barrier energies indicate that the H atom prefers to penetrate into the B 24N 24 and B 60N 60 nanocages with barrier energy of about 0.47 eV (10.84 kcal/mol). Furthermore the binding characteristic is rationalized by analyzing the electronic structures. Our findings reveal that the B 60N 60 nanocage has fascinating potential application in future solid-state quantum-computers.

First-principles study of structure, electronic properties and stability of tungsten adsorption on TiC(111) surface with disordered vacancies

NASA Astrophysics Data System (ADS)

Ilyasov, Victor V.; Pham, Khang D.; Zhdanova, Tatiana P.; Phuc, Huynh V.; Hieu, Nguyen N.; Nguyen, Chuong V.

2017-12-01

In this paper, we systematically investigate the atomic structure, electronic and thermodynamic properties of adsorbed W atoms on the polar Ti-terminated TixCy (111) surface with different configurations of adsorptions using first principle calculations. The bond length, adsorption energy, and formation energy for different reconstructions of the atomic structure of the W/TixCy (111) systems were established. The effect of the tungsten coverage on the electronic structure and the adsorption mechanism of tungsten atom on the TixCy (111) are also investigated. We also suggest the possible mechanisms of W nucleation on the TixCy (111) surface. The effective charges on W atoms and nearest-neighbor atoms in the examined reconstructions were identified. Additionally, we have established the charge transfer from titanium atom to tungsten and carbon atoms which determine by the reconstruction of the local atomic and electronic structures. Our calculations showed that the charge transfer correlates with the electronegativity of tungsten and nearest-neighbor atoms. We also determined the effective charge per atom of titanium, carbon atoms, and neighboring adsorbed tungsten atom in different binding configurations. We found that, with reduction of the lattice symmetry associated with titanium and carbon vacancies, the adsorption energy increases by 1.2 times in the binding site A of W/TixCy systems.

Intense conductivity suppression by edge defects in zigzag MoS2 and WSe2 nanoribbons: a density functional based tight-binding study.

PubMed

Silva, F W N; Costa, A L M T; Liu, Lei; Barros, E B

2016-11-04

The effects of edge vacancies on the electron transport properties of zigzag MoS2/WSe2 nanoribbons are studied using a density functional theory (DFT)-based tight-binding model with a sp(3)d(5) basis set for the electronic structure calculation and applying the Landauer-Büttiker approach for the electronic transport. Our results show that the presence of a single edge vacancy, with a missing MoS2/WSe2 triplet, is enough to suppress the conductance of the system by almost one half for most energies around the Fermi level. Furthermore, the presence of other single defects along the same edge has little effect on the overall conductance, indicating that the conductance of that particular edge has been strongly suppressed by the first defect. The presence of another defect on the opposite edge further suppresses the quantum conductance, independently of the relative position between the two defects in opposite edges. The introduction of other defects cause the suppression to be energy dependent, leading to conductance peaks which depend on the geometry of the edges. The strong conductance dependence on the presence of edge defects is corroborated by DFT calculations using SIESTA, which show that the electronic bands near the Fermi energy are strongly localized at the edge.

Extended Fenske-Hall LCAO MO Calculations for Mixed Methylene Dihalides

NASA Astrophysics Data System (ADS)

Ziemann, Hartmut; Paulun, Manfred

1988-10-01

The electronic structure of mixed methylene dihalides CH2XY (X, Y = F, Cl, Br. I) has been studied using extended Fenske-Hall LCAO MO method. The comparison with available photoelec­tron spectra confirmes previous assignments of all bands with binding energies <100 eV. The electronic structure changes occurring upon varying the halogen substituents are discussed.

Ab-initio study of structural, electronic, and transport properties of zigzag GaP nanotubes.

PubMed

Srivastava, Anurag; Jain, Sumit Kumar; Khare, Purnima Swarup

2014-03-01

Stability and electronic properties of zigzag (3 ≤ n ≤ 16) gallium phosphide nanotubes (GaP NTs) have been analyzed by employing a systematic ab-intio approach based on density functional theory using generalized gradient approximation with revised Perdew Burke Ernzerhoff type parameterization. Diameter dependence of bond length, buckling, binding energy, and band gap has been investigated and the analysis shows that the bond length and buckling decreases with increasing diameter of the tube, highest binding energy of (16, 0) confirms this as the most stable amongst all the NTs taken into consideration. The present GaP NTs shows direct band gap and it increases with diameter of the tubes. Using a two probe model for (4, 0) NT the I-V relationship shows an exponential increase in current on applying bias voltage beyond 1.73 volt.

X-ray photoelectron spectrometry and binding energies of Be 1s and O 1s core levels in clinobarylite, BaBe{sub 2}Si{sub 2}O{sub 7}, from Khibiny massif, Kola peninsula

DOE Office of Scientific and Technical Information (OSTI.GOV)

Atuchin, V.V.; Kesler, V.G.; Sapozhnikov, V.K.

2008-09-15

The electronic structure of BaBe{sub 2}Si{sub 2}O{sub 7}, clinobarylite, has been investigated by means of X-ray photoelectron spectroscopy (XPS). The valence band of the crystal is mainly formed by Ba 5p, Ba 3s and O 2s states. At higher binding energies the emission lines related to the Si 2p, Be 1s, Si 2s, O 1s and numerous Ba-related states were analyzed in the photoemission spectrum. The Si KLL Auger line has been measured under excitation by the bremsstrahlung X-rays from the Al anode. Chemical bonding effects for Be 1s core level have been considered by comparison with electronic parameters measuredmore » for other beryllium containing oxides.« less

Theoretical study of structure, bonding, and electronic behavior of novel sandwich compounds M₃(C6R6)₂ (M = Ni, Pd, Pt; R = H, F).

PubMed

Zhou, Ke

2012-10-01

The correlations between the structural and electronic properties of the monolayer clusters M₃ (where M = Ni, Pd, Pt) and the sandwich complexes M₃(C₆R₆)₂ (where M = Ni, Pd, Pt; R = H, F) were studied by performing quantum-chemical calculations. All of the sandwich complexes are strongly donating and backdonating metal-ligand bonding structures. The influence of the ligand as well as significant variations in the M-C, M-M, and C-C bond lengths and binding energies were examined to obtain a qualitative and quantitative picture of the intramolecular interactions in C₆R₆-M₃. Our theoretical investigations show that the binding energies of these sandwich complexes gradually decrease from Ni to Pt as well as from H to F, which can be explained via the frontier orbitals of the clusters M₃ and C₆R₆.

Effect of charging on silicene with alkali metal atom adsorption

NASA Astrophysics Data System (ADS)

Li, Manman; Li, Zhongyao; Gong, Shi-Jing

2018-02-01

Based on first-principles calculations, we studied the effects of charging on the structure, binding energy and electronic properties of silicene with alkali metal (AM) atom (Li, Na or K) adsorption. In AMSi2, electron doping enlarges the lattice constant of silicene, while the influence of hole doping is non-monotonic. In AMSi8, the lattice constant increases/decreases almost linearly with the increase in electron/hole doping. In addition, the AM-Si vertical distance can be greatly enlarged by excessive hole doping in both AMSi2 and AMSi8 systems. When the hole doping is as large as  +e per unit cell, both AMSi2 and AMSi8 can be transformed from metal to semiconductor. However, the binding energy would be negative in the AM+ Si2 semiconductor. It suggests AM+ Si2 is unstable in this case. In addition, the electron doping and the AM-Si vertical distance would greatly influence the band gap of silicene in LiSi8 and NaSi8, while the band gap in KSi8 is relatively stable. Therefore, KSi8 may be a more practicable material in nanotechnology.

Effects of Low-Energy Excitations on Spectral Properties at Higher Binding Energy: The Metal-Insulator Transition of VO2

NASA Astrophysics Data System (ADS)

Gatti, Matteo; Panaccione, Giancarlo; Reining, Lucia

2015-03-01

The effects of electron interaction on spectral properties can be understood in terms of coupling between excitations. In transition-metal oxides, the spectral function close to the Fermi level and low-energy excitations between d states have attracted particular attention. In this work we focus on photoemission spectra of vanadium dioxide over a wide (10 eV) range of binding energies. We show that there are clear signatures of the metal-insulator transition over the whole range due to a cross coupling of the delocalized s and p states with low-energy excitations between the localized d states. This coupling can be understood by advanced calculations based on many-body perturbation theory in the G W approximation. We also advocate the fact that tuning the photon energy up to the hard-x-ray range can help to distinguish fingerprints of correlation from pure band-structure effects.

Electronic structure and optical properties of triangular GaAs/AlGaAs quantum dots: Exciton and impurity states

NASA Astrophysics Data System (ADS)

Tiutiunnyk, A.; Akimov, V.; Tulupenko, V.; Mora-Ramos, M. E.; Kasapoglu, E.; Ungan, F.; Sökmen, I.; Morales, A. L.; Duque, C. A.

2016-03-01

Electronic structure and optical properties in equilateral triangular GaAs/Al0.3Ga0.7As quantum dots are studied extensively. The effects of donor and acceptor impurity atoms positioned in the orthocenter of the triangle, as well as of the external DC electric field are taken into account. Binding energies of the impurity, exciton energies, interband photoluminescence peak positions as well as linear and non-linear optical properties in THz range caused by transitions between excitonic states are calculated and discussed.

Unusual structures of MgF5- superhalogen anion

NASA Astrophysics Data System (ADS)

Anusiewicz, Iwona; Skurski, Piotr

2007-05-01

The vertical electron detachment energies (VDE) of three MgF5- anions were calculated at the outer valence Green function level with the 6-311 + G(3df) basis sets. This species was found to form unusual geometrical structures each of which corresponds to an anionic state exhibiting superhalogen nature. The global minimum structure was described as a system in which two central magnesium atoms are linked via symmetrical triangle formed by three fluorine atoms. Extremely large electron binding energies of these anions (exceeding 8.5 eV in all cases) were predicted and discussed.

Electronic Chemical Potentials of Porous Metal–Organic Frameworks

PubMed Central

2014-01-01

The binding energy of an electron in a material is a fundamental characteristic, which determines a wealth of important chemical and physical properties. For metal–organic frameworks this quantity is hitherto unknown. We present a general approach for determining the vacuum level of porous metal–organic frameworks and apply it to obtain the first ionization energy for six prototype materials including zeolitic, covalent, and ionic frameworks. This approach for valence band alignment can explain observations relating to the electrochemical, optical, and electrical properties of porous frameworks. PMID:24447027

Screening of excitons in single, suspended carbon nanotubes.

PubMed

Walsh, Andrew G; Vamivakas, A Nickolas; Yin, Yan; Cronin, Stephen B; Unlü, M Selim; Goldberg, Bennett B; Swan, Anna K

2007-06-01

Resonant Raman spectroscopy of single carbon nanotubes suspended across trenches displays red-shifts of up to 30 meV of the electronic transition energies as a function of the surrounding dielectric environment. We develop a simple scaling relationship between the exciton binding energy and the external dielectric function and thus quantify the effect of screening. Our results imply that the underlying particle interaction energies change by hundreds of meV.

Low potential manganese ions as efficient electron donors in native anoxygenic bacteria.

PubMed

Deshmukh, Sasmit S; Protheroe, Charles; Ivanescu, Matei-Alexandru; Lag, Sarah; Kálmán, László

2018-04-01

Systematic control over molecular driving forces is essential for understanding the natural electron transfer processes as well as for improving the efficiency of the artificial mimics of energy converting enzymes. Oxygen producing photosynthesis uniquely employs manganese ions as rapid electron donors. Introducing this attribute to anoxygenic photosynthesis may identify evolutionary intermediates and provide insights to the energetics of biological water oxidation. This work presents effective environmental methods that substantially and simultaneously tune the redox potentials of manganese ions and the cofactors of a photosynthetic enzyme from native anoxygenic bacteria without the necessity of genetic modification or synthesis. A spontaneous coordination with bis-tris propane lowered the redox potential of the manganese (II) to manganese (III) transition to an unusually low value (~400 mV) at pH 9.4 and allowed its binding to the bacterial reaction center. Binding to a novel buried binding site elevated the redox potential of the primary electron donor, a dimer of bacteriochlorophylls, by up to 92 mV also at pH 9.4 and facilitated the electron transfer that is able to compete with the wasteful charge recombination. These events impaired the function of the natural electron donor and made BTP-coordinated manganese a viable model for an evolutionary alternative. Copyright © 2018 Elsevier B.V. All rights reserved.

Excitation and characterization of image potential state electrons on quasi-free-standing graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Yi; Li, Yunzhe; Sadowski, Jerzy T.

We investigate the band structure of image potential states in quasi-free-standing graphene (QFG) monolayer islands using angle-resolved two-photon-photoemission spectroscopy. Direct probing by low-energy electron diffraction shows that QFG is formed following oxygen intercalation into the graphene-Ir(111) interface. Despite the apparent decoupling of the monolayer graphene from the Ir substrate, we find that the binding energy of the n = 1 image potential state on these QFG islands increases by 0.17 eV, as compared to the original Gr/Ir(111) interface. We use calculations based on density-functional theory to construct an empirical, one-dimensional potential that quantitatively reproduces the image potential state binding energymore » and links the changes in the interface structure to the shift in energy. Specifically, two factors contribute comparably to this energy shift: a deeper potential well arising from the presence of intercalated oxygen adatoms and a wider potential well associated with the increase in the graphene-Ir distance. While image potential states have not been observed previously on QFG by photoemission, our paper now demonstrates that they may be strongly excited in a well-defined QFG system produced by oxygen intercalation. Finally, this opens an opportunity for studying the surface electron dynamics in QFG systems, beyond those found in typical nonintercalated graphene-on-substrate systems.« less

Excitation and characterization of image potential state electrons on quasi-free-standing graphene

DOE PAGES

Lin, Yi; Li, Yunzhe; Sadowski, Jerzy T.; ...

2018-04-09

We investigate the band structure of image potential states in quasi-free-standing graphene (QFG) monolayer islands using angle-resolved two-photon-photoemission spectroscopy. Direct probing by low-energy electron diffraction shows that QFG is formed following oxygen intercalation into the graphene-Ir(111) interface. Despite the apparent decoupling of the monolayer graphene from the Ir substrate, we find that the binding energy of the n = 1 image potential state on these QFG islands increases by 0.17 eV, as compared to the original Gr/Ir(111) interface. We use calculations based on density-functional theory to construct an empirical, one-dimensional potential that quantitatively reproduces the image potential state binding energymore » and links the changes in the interface structure to the shift in energy. Specifically, two factors contribute comparably to this energy shift: a deeper potential well arising from the presence of intercalated oxygen adatoms and a wider potential well associated with the increase in the graphene-Ir distance. While image potential states have not been observed previously on QFG by photoemission, our paper now demonstrates that they may be strongly excited in a well-defined QFG system produced by oxygen intercalation. Finally, this opens an opportunity for studying the surface electron dynamics in QFG systems, beyond those found in typical nonintercalated graphene-on-substrate systems.« less

Donor states in a semimagnetic Cd1 -xinMnxin Te /Cd1 -xoutMnxout Te Double Quantum Well

NASA Astrophysics Data System (ADS)

Kalpana, Panneer Selvam; Nithiananthi, Perumal; Jayakumar, Kalyanasundaram

2017-02-01

The theoretical investigation has been carried out on the binding energy of donor associated with the electrons confined in a Cd1 -xinMnxin Te /Cd1 -xoutMnxout Te Double Quantum Well (DQW) as a function of central barrier width for various well dimensions and impurity locations in the barrier and the well. The magnetic field can act as a tool to continuously change the interwell coupling inside this DQW systems and its effect on donor binding has also been studied. Moreover, the polaronic corrections, which is due to the strong exchange interaction between the magnetic moment of Mn2+ ion and the spin of the confined carrier, to the binding energy of the hydrogenic donor impurity has also been estimated with and without the application of magnetic field. The binding energy of the donor impurity is determined by solving the Schrodinger equation variationally in the effective mass approximation and the effect due to Bound Magnetic Polaron (BMP) is included using mean field theory with the modified Brillouin function. The results are reported and discussed.

Structural and Thermal Disorder of Solution-Processed CH3NH3PbBr3 Hybrid Perovskite Thin Films.

PubMed

Wolf, Christoph; Kim, Joo-Sung; Lee, Tae-Woo

2017-03-29

We extracted the electronic disorder energy of the organic-inorganic lead-halide hybrid perovskite CH 3 NH 3 PbBr 3 from temperature-dependent absorption data. We showed that the disorder at room temperature is ∼30 meV and is due to strong electron-phonon coupling with the longitudinal-optical mode of energy 16 meV. This mode can be attributed to longitudinal-optical phonons of the inorganic PbBr 6 frame; this conclusion highlights the polaronic nature of electronic excitations in CH 3 NH 3 PbBr 3 . We showed that structural disorder is of the same impact as thermal disorder. A temperature-dependence of the exciton binding energy was observed close to the orthorhombic-to-tetragonal phase-transition temperature.

Structure, electronic and magnetic properties of Mn{sub n} (n=2-8) clusters: A DFT investigation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, Vipin; Roy, Debesh R., E-mail: drr@ashd.svnit.ac.in

2016-05-06

A detail studyon the stability, electronic and magnetic properties of Mn{sub n} (n=2-8) cluster series is performed under the utilization ofdensity functional theory (DFT). The binding energy (B.E.), HOMO-LUMO energy gap (HLG), chemical hardness (η), ionization potential (I.P.), electron affinity (E.A)and electronegativity (χ) of these clusters are predicted. We have also studied the magnetic moments associated with the stable cluster isomers. The lowest energy structures for each cluster sizes aredetermined with a systematic search imposing all possible initial magnetic configuration on the cluster. All the calculations are carried out using a popular GGA functional PBE as proposed by Pardew, Burkemore » and Ernzerhof and implemented in the VASP program.« less

An ab initio study on BeX 3- superhalogen anions (X = F, Cl, Br)

NASA Astrophysics Data System (ADS)

Anusiewicz, Iwona; Skurski, Piotr

2002-06-01

The vertical electron detachment energies (VDE) of 10 BeX 3- (X = F, Cl, Br) anions were calculated at the outer valence Green function (OVGF) level with the 6-311++G(3df) basis sets. The largest vertical electron binding energy was found for BeF 3- system (7.63 eV). All negatively charged species possess the vertical electron detachment energies that are larger than 5.5 eV and thus may be termed superhalogen anions. The strong dependence of the VDE of the BeX 3- species on the ligand-central atom (Be-X) distance and on the partial atomic charge localized on Be was observed and discussed, as well as the other factors that may influence the electronic stability of such anions. In addition, the usefulness of the various theoretical treatments for estimating the VDEs of superhalogen anions was tested and analyzed.

DFTBaby: A software package for non-adiabatic molecular dynamics simulations based on long-range corrected tight-binding TD-DFT(B)

NASA Astrophysics Data System (ADS)

Humeniuk, Alexander; Mitrić, Roland

2017-12-01

A software package, called DFTBaby, is published, which provides the electronic structure needed for running non-adiabatic molecular dynamics simulations at the level of tight-binding DFT. A long-range correction is incorporated to avoid spurious charge transfer states. Excited state energies, their analytic gradients and scalar non-adiabatic couplings are computed using tight-binding TD-DFT. These quantities are fed into a molecular dynamics code, which integrates Newton's equations of motion for the nuclei together with the electronic Schrödinger equation. Non-adiabatic effects are included by surface hopping. As an example, the program is applied to the optimization of excited states and non-adiabatic dynamics of polyfluorene. The python and Fortran source code is available at http://www.dftbaby.chemie.uni-wuerzburg.de.

Quasi-bound states in strained graphene

NASA Astrophysics Data System (ADS)

Bahamon, Dario; Qi, Zenan; Park, Harold; Pareira, Vitor; Campbell, David

In this work, we explore the possibility of manipulating electronic states in graphene nanostructures by mechanical means. Specifically, we use molecular dynamics and tight-binding models to access the electronic and transport properties of strained graphene nanobubbles and graphene kirigami. We establish that low energy electrons can be confined in the arms of the kirigami and within the nanobubbles; under different load conditions the coupling between confined states and continuous states is modified creating different conductance line-shapes.

Electronic structure of gadolinium complexes in ZnO in the GW approximation

NASA Astrophysics Data System (ADS)

Rosa, A. L.; Frauenheim, Th.

2018-04-01

The role of intrinsic defects has been investigated to determine binding energies and the electronic structure of Gd complexes in ZnO. We use density-functional theory and the GW method to show that the presence of vacancies and interstitials affect the electronic structure of Gd doped ZnO. However, the strong localization of the Gd-f and d states suggest that carrier mediated ferromagnetism in this material may be difficult to achieve.

Electronic Structure of Lithium Tetraborate

DTIC Science & Technology

2010-06-01

binding energies of -56.5+0.4 and -53.7+0.5 eV. Resonance features were observed along the [001] direction and were attributed to a Coster- Kronig ...could be theoretically explained as an Auger electron [12] or Coster- Kronig process [13] of a Li 1s electron photoexcitation to an unoccupied 2p...Coster Kronig , which requires only one Li atom. Such a Coster Kronig mechanism is pictorially displayed below in Figure 7.9. 128 Figure 7.9

Direct Observation of Electron-Phonon Coupling and Slow Vibrational Relaxation in Organic-Inorganic Hybrid Perovskites.

PubMed

Straus, Daniel B; Hurtado Parra, Sebastian; Iotov, Natasha; Gebhardt, Julian; Rappe, Andrew M; Subotnik, Joseph E; Kikkawa, James M; Kagan, Cherie R

2016-10-05

Quantum and dielectric confinement effects in 2D hybrid perovskites create excitons with a binding energy exceeding 150 meV. We exploit the large exciton binding energy to study exciton and carrier dynamics as well as electron-phonon coupling in hybrid perovskites using absorption and photoluminescence (PL) spectroscopies. At temperatures below 75 K, we resolve splitting of the excitonic absorption and PL into multiple regularly-spaced resonances every 40-46 meV, consistent with electron-phonon coupling to phonons located on the organic cation. We also resolve resonances with a 14 meV spacing, in accord with coupling to phonons with mixed organic and inorganic character, and these assignments are supported by density-functional theory calculations. Hot exciton PL and time-resolved PL measurements show that vibrational relaxation occurs on a picosecond timescale competitive with that for PL. At temperatures above 75 K, excitonic absorption and PL exhibit homogeneous broadening. While absorption remains homogeneous, PL becomes inhomogeneous below 75K, which we speculate is caused by the formation and subsequent dynamics of a polaronic exciton.

Electronic structure of Mo1-x Re x alloys studied through resonant photoemission spectroscopy

NASA Astrophysics Data System (ADS)

Sundar, Shyam; Banik, Soma; Sharath Chandra, L. S.; Chattopadhyay, M. K.; Ganguli, Tapas; Lodha, G. S.; Pandey, Sudhir K.; Phase, D. M.; Roy, S. B.

2016-08-01

We studied the electronic structure of Mo-rich Mo1-x Re x alloys (0≤slant x≤slant 0.4 ) using valence band photoemission spectroscopy in the photon energy range 23-70 eV and density of states calculations. Comparison of the photoemission spectra with the density of states calculations suggests that, with respect to the Fermi level E F, the d states lie mostly in the binding energy range 0 to  -6 eV, whereas s states lie in the binding energy range  -4 to  -10 eV. We observed two resonances in the photoemission spectra of each sample, one at about 35 eV photon energy and the other at about 45 eV photon energy. Our analysis suggests that the resonance at 35 eV photon energy is related to the Mo 4p-5s transition and the resonance at 45 eV photon energy is related to the contribution from both the Mo 4p-4d transition (threshold: 42 eV) and the Re 5p-5d transition (threshold: 46 eV). In the constant initial state plot, the resonance at 35 eV incident photon energy for binding energy features in the range E F (BE  =  0) to  -5 eV becomes progressively less prominent with increasing Re concentration x and vanishes for x  >  0.2. The difference plots obtained by subtracting the valence band photoemission spectrum of Mo from that of Mo1-x Re x alloys, measured at 47 eV photon energy, reveal that the Re d-like states appear near E F when Re is alloyed with Mo. These results indicate that interband s-d interaction, which is weak in Mo, increases with increasing x and influences the nature of the superconductivity in alloys with higher x.

Electron-phonon coupling and superconductivity in the (4/3)-monolayer of Pb on Si(111): Role of spin-orbit interaction

NASA Astrophysics Data System (ADS)

Sklyadneva, I. Yu.; Heid, R.; Bohnen, K.-P.; Echenique, P. M.; Chulkov, E. V.

2018-05-01

The effect of spin-orbit coupling on the electron-phonon interaction in a (4/3)-monolayer of Pb on Si(111) is investigated within the density-functional theory and linear-response approach in the mixed-basis pseudopotential representation. We show that the spin-orbit interaction produces a large weakening of the electron-phonon coupling strength, which appears to be strongly overestimated in the scalar relativistic calculations. The effect of spin-orbit interaction is largely determined by the induced modification of Pb electronic bands and a stiffening of the low-energy part of phonon spectrum, which favor a weakening of the electron-phonon coupling strength. The state-dependent strength of the electron-phonon interaction in occupied Pb electronic bands varies depending on binding energy rather than electronic momentum. It is markedly larger than the value averaged over electron momentum because substrate electronic bands make a small contribution to the phonon-mediated scattering and agrees well with the experimental data.

VhuD Facilitates Electron Flow from H2 or Formate to Heterodisulfide Reductase in Methanococcus maripaludis

PubMed Central

Costa, Kyle C.; Lie, Thomas J.; Xia, Qin

2013-01-01

Flavin-based electron bifurcation has recently been characterized as an essential energy conservation mechanism that is utilized by hydrogenotrophic methanogenic Archaea to generate low-potential electrons in an ATP-independent manner. Electron bifurcation likely takes place at the flavin associated with the α subunit of heterodisulfide reductase (HdrA). In Methanococcus maripaludis the electrons for this reaction come from either formate or H2 via formate dehydrogenase (Fdh) or Hdr-associated hydrogenase (Vhu). However, how these enzymes bind to HdrA to deliver electrons is unknown. Here, we present evidence that the δ subunit of hydrogenase (VhuD) is central to the interaction of both enzymes with HdrA. When M. maripaludis is grown under conditions where both Fdh and Vhu are expressed, these enzymes compete for binding to VhuD, which in turn binds to HdrA. Under these conditions, both enzymes are fully functional and are bound to VhuD in substoichiometric quantities. We also show that Fdh copurifies specifically with VhuD in the absence of other hydrogenase subunits. Surprisingly, in the absence of Vhu, growth on hydrogen still occurs; we show that this involves F420-reducing hydrogenase. The data presented here represent an initial characterization of specific protein interactions centered on Hdr in a hydrogenotrophic methanogen that utilizes multiple electron donors for growth. PMID:24039260

Energy spectrum and electrical conductivity of graphene with a nitrogen impurity

NASA Astrophysics Data System (ADS)

Repetskii, S. P.; Vyshivanaya, I. G.; Skotnikov, V. A.; Yatsenyuk, A. A.

2015-04-01

The electronic structure of graphene with a nitrogen impurity has been studied based on the model of tight binding using exchange-correlation potentials in the density-functional theory. Wave functions of 2 s and 2 p states of neutral noninteracting carbon atoms have been chosen as the basis. When studying the matrix elements of the Hamiltonian, the first three coordination shells have been taken into account. It has been established that the hybridization of electron-energy bands leads to the splitting of the electron energy spectrum near the Fermi level. Due to the overlap of the energy bands, the arising gap behaves as a quasi-gap, in which the density of the electron levels is much lower than in the rest of the spectrum. It has been established that the conductivity of graphene decreases with increasing nitrogen concentration. Since the increase in the nitrogen concentration leads to an increase in the density of states at the Fermi level, the decrease in the conductivity is due to a sharper decrease in the time of relaxation of the electron sates.

Element specificity of ortho-positronium annihilation for alkali-metal loaded SiO2 glasses.

PubMed

Sato, K; Hatta, T

2015-03-07

Momentum distributions associated with ortho-positronium (o-Ps) pick-off annihilation photon are often influenced by light elements, as, e.g., carbon, oxygen, and fluorine. This phenomenon, so-called element specificity of o-Ps pick-off annihilation, has been utilized for studying the elemental environment around the open spaces. To gain an insight into the element specificity of o-Ps pick-off annihilation, the chemical shift of oxygen 1s binding energy and the momentum distributions associated with o-Ps pick-off annihilation were systematically investigated for alkali-metal loaded SiO2 glasses by means of X-ray photoelectron spectroscopy and positron-age-momentum correlation spectroscopy, respectively. Alkali metals introduced into the open spaces surrounded by oxygen atoms cause charge transfer from alkali metals to oxygen atoms, leading to the lower chemical shift for the oxygen 1s binding energy. The momentum distribution of o-Ps localized into the open spaces is found to be closely correlated with the oxygen 1s chemical shift. This correlation with the deepest 1s energy level evidences that the element specificity of o-Ps originates from pick-off annihilation with orbital electrons, i.e., dominantly with oxygen 2p valence electrons and s electrons with lower probability.

Quantum confined stark effect on the binding energy of exciton in type II quantum heterostructure

NASA Astrophysics Data System (ADS)

Suseel, Rahul K.; Mathew, Vincent

2018-05-01

In this work, we have investigated the effect of external electric field on the strongly confined excitonic properties of CdTe/CdSe/CdTe/CdSe type-II quantum dot heterostructures. Within the effective mass approximation, we solved the Poisson-Schrodinger equations of the exciton in nanostructure using relaxation method in a self-consistent iterative manner. We changed both the external electric field and core radius of the quantum dot, to study the behavior of binding energy of exciton. Our studies show that the external electric field destroys the positional flipped state of exciton by modifying the confining potentials of electron and hole.

First-principles study of Ti intercalation between graphene and Au surface

NASA Astrophysics Data System (ADS)

Kaneko, T.; Imamura, H.

2011-06-01

We investigate the effects of Ti intercalation between graphene and Au surface on binding energy and charge doping by using the first-principles calculations. We show that the largest binding energy is realized by the intercalation of single mono-layer of Ti. We also show that electronic structure is very sensitive to the arrangement of metal atoms at the interface. If the composition of the interface layer is Ti0.33Au0.67 and the Ti is located at the top site, the Fermi level lies closely at the Dirac point, i.e., the Dirac cone of the ideal free-standing graphene is recovered.

Direct versus indirect many-body methods for calculating vertical electron affinities: applications to F -, OH - , NH 2-, CN -, Cl -, SH - and PH 2-

NASA Astrophysics Data System (ADS)

Ortiz, J. V.

1987-05-01

Electron propagator theory (EPT) is applied to calculating vertical ionization energies of the anions F -, Cl -, OH -,SH -, NH 2-, PH 2- and CN -. Third-order and outer valence approximation (OVA) quasiparticle calculations are compared with ΔMBPT(4) (MBPT, many-body perturbation theory) results using the same basis sets. Agreement with experiment is satisfactory for EPT calculations except for F - and OH -, while the ΔMBPT treatments fail for CN -. EPT(OVA) estimates are reliable when the discrepancy between second- and third-order results is small. Computational aspects are discussed, showing relative merits of direct and indirect methods for evaluating electron binding energies.

Electronic structure and optical properties of metal doped tetraphenylporphyrins

NASA Astrophysics Data System (ADS)

Shah, Esha V.; Roy, Debesh R.

2018-05-01

A density functional scrutiny on the structure, electronic and optical properties of metal doped tetraphenylporphyrins MTPP (M=Fe, Co, Ni) is performed. The structural stability of the molecules is evaluated based on the electronic parameters like HOMO-LUMO gap (HLG), chemical hardness (η) and binding energy of the central metal atom to the molecular frame etc. The computed UltraViolet-Visible (UV-Vis) optical absorption spectra for all the compounds are also compared. The molecular structures reported are the lowest energy configurations. The entire calculations are carried out with a widely reliable functional, viz. B3LYP with a popular basis set which includes a scaler relativistic effect, viz. LANL2DZ.

Effects of excitation frequency on high-order terahertz sideband generation in semiconductors

NASA Astrophysics Data System (ADS)

Xie, Xiao-Tao; Zhu, Bang-Fen; Liu, Ren-Bao

2013-10-01

We theoretically investigate the effects of the excitation frequency on the plateau of high-order terahertz sideband generation (HSG) in semiconductors driven by intense terahertz (THz) fields. We find that the plateau of the sideband spectrum strongly depends on the detuning between the near-infrared laser field and the band gap. We use the quantum trajectory theory (three-step model) to understand the HSG. In the three-step model, an electron-hole pair is first excited by a weak laser, then driven by the strong THz field, and finally recombined to emit a photon with energy gain. When the laser is tuned below the band gap (negative detuning), the electron-hole generation is a virtual process that requires quantum tunneling to occur. When the energy gained by the electron-hole pair from the THz field is less than 3.17 times the ponderomotive energy (Up), the electron and the hole can be driven to the same position and recombined without quantum tunneling, so that the HSG will have large probability amplitude. This leads to a plateau feature of the HSG spectrum with a high-frequency cutoff at about 3.17Up above the band gap. Such a plateau feature is similar to the case of high-order harmonics generation in atoms where electrons have to overcome the binding energy to escape the atomic core. A particularly interesting excitation condition in HSG is that the laser can be tuned above the band gap (positive detuning), corresponding to the unphysical ‘negative’ binding energy in atoms for high-order harmonic generation. Now the electron-hole pair is generated by real excitation, but the recombination process can be real or virtual depending on the energy gained from the THz field, which determines the plateau feature in HSG. Both the numerical calculation and the quantum trajectory analysis reveal that for positive detuning, the HSG plateau cutoff depends on the frequency of the excitation laser. In particular, when the laser is tuned more than 3.17Up above the band gap, the HSG spectrum presents no plateau feature but instead sharp peaks near the band edge and near the excitation frequency.

Lattice distortion and electron charge redistribution induced by defects in graphene

DOE PAGES

Zhang, Wei; Lu, Wen -Cai; Zhang, Hong -Xing; ...

2016-09-14

Lattice distortion and electronic charge localization induced by vacancy and embedded-atom defects in graphene were studied by tight-binding (TB) calculations using the recently developed three-center TB potential model. We showed that the formation energies of the defects are strongly correlated with the number of dangling bonds and number of embedded atoms, as well as the magnitude of the graphene lattice distortion induced by the defects. Lastly, we also showed that the defects introduce localized electronic states in the graphene which would affect the electron transport properties of graphene.

Covalent bonds are created by the drive of electron waves to lower their kinetic energy through expansion

PubMed Central

Schmidt, Michael W.; Ivanic, Joseph; Ruedenberg, Klaus

2014-01-01

An analysis based on the variation principle shows that in the molecules H2+, H2, B2, C2, N2, O2, F2, covalent bonding is driven by the attenuation of the kinetic energy that results from the delocalization of the electronic wave function. For molecular geometries around the equilibrium distance, two features of the wave function contribute to this delocalization: (i) Superposition of atomic orbitals extends the electronic wave function from one atom to two or more atoms; (ii) intra-atomic contraction of the atomic orbitals further increases the inter-atomic delocalization. The inter-atomic kinetic energy lowering that (perhaps counter-intuitively) is a consequence of the intra-atomic contractions drives these contractions (which per se would increase the energy). Since the contractions necessarily encompass both, the intra-atomic kinetic and potential energy changes (which add to a positive total), the fact that the intra-atomic potential energy change renders the total potential binding energy negative does not alter the fact that it is the kinetic delocalization energy that drives the bond formation. PMID:24880263

Covalent bonds are created by the drive of electron waves to lower their kinetic energy through expansion.

PubMed

Schmidt, Michael W; Ivanic, Joseph; Ruedenberg, Klaus

2014-05-28

An analysis based on the variation principle shows that in the molecules H2 (+), H2, B2, C2, N2, O2, F2, covalent bonding is driven by the attenuation of the kinetic energy that results from the delocalization of the electronic wave function. For molecular geometries around the equilibrium distance, two features of the wave function contribute to this delocalization: (i) Superposition of atomic orbitals extends the electronic wave function from one atom to two or more atoms; (ii) intra-atomic contraction of the atomic orbitals further increases the inter-atomic delocalization. The inter-atomic kinetic energy lowering that (perhaps counter-intuitively) is a consequence of the intra-atomic contractions drives these contractions (which per se would increase the energy). Since the contractions necessarily encompass both, the intra-atomic kinetic and potential energy changes (which add to a positive total), the fact that the intra-atomic potential energy change renders the total potential binding energy negative does not alter the fact that it is the kinetic delocalization energy that drives the bond formation.

Binding Energy of Quantum Bound States in X-shaped Nanowire Intersection

DTIC Science & Technology

2014-01-01

α0)〉 = 3~2 mb2 ( 2α0 + 2 11 ) = 6~2 mb2 ( α0 + 1 11 ) = 1.058 ~2 ma2 ∆2 (111) The threshold energy is found to be Et = π2~2 2mw2 (112) Since the...energy (Eb) of the electron taking the threshold energy as zero level is given by Eb = −Emin = −1.058 ~2 ma2 ∆2 = −4.232 ~ 2 mw2 cos2(θ1 − θ2

Can HN[double bond, length as m-dash]NH, FN[double bond, length as m-dash]NH, or HN[double bond, length as m-dash]CHOH bridge the σ-hole and the lone pair at P in binary complexes with H2XP, for X = F, Cl, NC, OH, CN, CCH, CH3, and H?

PubMed

Del Bene, Janet E; Alkorta, Ibon; Elguero, José

2015-11-11

Ab initio MP2/aug'-cc-pVTZ calculations have been carried out to investigate the properties of complexes formed between H2XP, for X = F, Cl, NC, OH, CN, CCH, CH3, and H, and the possible bridging molecules HN[double bond, length as m-dash]NH, FN[double bond, length as m-dash]NH, and HN[double bond, length as m-dash]CHOH. H2XP:HNNH and H2XP:FNNH complexes are stabilized by PN pnicogen bonds, except for H2(CH3)P:FNNH and H3P:FNNH which are stabilized by N-HP hydrogen bonds. H2XP:HNCHOH complexes are stabilized by PN pnicogen bonds and nonlinear O-HP hydrogen bonds. For a fixed H2XP molecule, binding energies decrease in the order HNCHOH > HNNH > FNNH, except for the binding energies of H2(CH3)P and H3P with HNNH and FNNH. Binding energies of complexes with HNCHOH and HNNH increase as the P-N1 distance decreases, but binding energies of complexes with FNNH show little dependence on this distance. The large binding energies of H2XP:HNCHOH complexes arise from a cooperative effect involving electron-pair acceptance by P to form a pnicogen bond, and electron-pair donation by P to form a hydrogen bond. The dominant charge-transfer interaction in these complexes involves electron-pair donation by N across the pnicogen bond, except for complexes in which X is one of the more electropositive substituents, CCH, CH3, and H. For these, lone-pair donation by P across the hydrogen bond dominates. AIM and NBO data for these complexes are consistent with their bonding characteristics, showing molecular graphs with bond critical points and charge-transfer interactions associated with hydrogen and pnicogen bonds. EOM-CCSD spin-spin coupling constants (1p)J(P-N) across the pnicogen bond for each series of complexes correlate with the P-N distance. In contrast, (2h)J(O-P) values for complexes H2XP:HNCHOH do not correlate with the O-P distance, a consequence of the nonlinearity of these hydrogen bonds.

A Mixed QM/MM Scoring Function to Predict Protein-Ligand Binding Affinity

PubMed Central

Hayik, Seth A.; Dunbrack, Roland; Merz, Kenneth M.

2010-01-01

Computational methods for predicting protein-ligand binding free energy continue to be popular as a potential cost-cutting method in the drug discovery process. However, accurate predictions are often difficult to make as estimates must be made for certain electronic and entropic terms in conventional force field based scoring functions. Mixed quantum mechanics/molecular mechanics (QM/MM) methods allow electronic effects for a small region of the protein to be calculated, treating the remaining atoms as a fixed charge background for the active site. Such a semi-empirical QM/MM scoring function has been implemented in AMBER using DivCon and tested on a set of 23 metalloprotein-ligand complexes, where QM/MM methods provide a particular advantage in the modeling of the metal ion. The binding affinity of this set of proteins can be calculated with an R2 of 0.64 and a standard deviation of 1.88 kcal/mol without fitting and 0.71 and a standard deviation of 1.69 kcal/mol with fitted weighting of the individual scoring terms. In this study we explore using various methods to calculate terms in the binding free energy equation, including entropy estimates and minimization standards. From these studies we found that using the rotational bond estimate to ligand entropy results in a reasonable R2 of 0.63 without fitting. We also found that using the ESCF energy of the proteins without minimization resulted in an R2 of 0.57, when using the rotatable bond entropy estimate. PMID:21221417

Physical origins of weak H{sub 2} binding on carbon nanostructures: Insight from ab initio studies of chemically functionalized graphene nanoribbons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ulman, Kanchan; Bhaumik, Debarati; Wood, Brandon C.

2014-05-07

We have performed ab initio density functional theory calculations, incorporating London dispersion corrections, to study the absorption of molecular hydrogen on zigzag graphene nanoribbons whose edges have been functionalized by OH, NH{sub 2}, COOH, NO{sub 2}, or H{sub 2}PO{sub 3}. We find that hydrogen molecules always preferentially bind at or near the functionalized edge, and display induced dipole moments. Binding is generally enhanced by the presence of polar functional groups. The largest gains are observed for groups with oxygen lone pairs that can facilitate local charge reorganization, with the biggest single enhancement in adsorption energy found for “strong functionalization” bymore » H{sub 2}PO{sub 3} (115 meV/H{sub 2} versus 52 meV/H{sub 2} on bare graphene). We show that for binding on the “outer edge” near the functional group, the presence of the group can introduce appreciable contributions from Debye interactions and higher-order multipole electrostatic terms, in addition to the dominant London dispersion interactions. For those functional groups that contain the OH moiety, the adsorption energy is linearly proportional to the number of lone pairs on oxygen atoms. Mixed functionalization with two different functional groups on a graphene edge can also have a synergistic effect, particularly when electron-donating and electron-withdrawing groups are combined. For binding on the “inner edge” somewhat farther from the functional group, most of the binding again arises from London interactions; however, there is also significant charge redistribution in the π manifold, which directly reflects the electron donating or withdrawing capacity of the functional group. Our results offer insight into the specific origins of weak binding of gas molecules on graphene, and suggest that edge functionalization could perhaps be used in combination with other strategies to increase the uptake of hydrogen in graphene. They also have relevance for the storage of hydrogen in porous carbon materials, such as activated carbons.« less

-X Mixing in T- and V-Shaped Quantum Wires

NASA Astrophysics Data System (ADS)

di Carlo, A.; Pescetelli, S.; Kavokin, A.; Vladimirova, M.; Lugli, P.

1997-11-01

We have applied both tight-binding (TB) and multivalley envelope function (MEF) techniques to calculate the electronic states in T- and V-shaped realistic quantum wires taking into account -X mixing in the conduction band. Strong reduction of the electron quantization energy due to the off-resonant -X mixing has been found in all types of quantum wires. This effect appears to be tied to the localization of the electron wave function and to its overlap with atomic layers next to interfaces.

Binding mechanisms of DNA/RNA nucleobases adsorbed on graphene under charging: first-principles van der Waals study

NASA Astrophysics Data System (ADS)

Gürel, Hikmet Hakan; Salmankurt, Bahadır

2017-06-01

Graphene is a 2D material that has attracted much attention due to its outstanding properties. Because of its high surface area and unique chemical and physical properties, graphene is a good candidate for biological applications. For this reason, a deep understanding of the mechanism of interaction of graphene with biomolecules is required. In this study, theoretical investigation of van der Waals effects has been conducted using density functional theory. Here we show that the order of the binding energies of five nucleobases with graphene is G  >  A  >  T  >  C  >   U. This trend is in good agreement with most of the theoretical and experimental data. Also, the effects of charging on the electronic and structural properties of the graphene-nucleubase systems are studied for the first time. We show that the binding energy can be changed by adding or removing an electron from the system. The results presented in this work provide fundamental insights into the quantum interactions of DNA with carbon-based nanostructures and will be useful for developments in biotechnology and nanotechnology.

Van der Waals Epitaxy of GaSe/Graphene Heterostructure: Electronic and Interfacial Properties.

PubMed

Ben Aziza, Zeineb; Henck, Hugo; Pierucci, Debora; Silly, Mathieu G; Lhuillier, Emmanuel; Patriarche, Gilles; Sirotti, Fausto; Eddrief, Mahmoud; Ouerghi, Abdelkarim

2016-10-07

Stacking two-dimensional materials in so-called van der Waals (vdW) heterostructures, like the combination of GaSe and graphene, provides the ability to obtain hybrid systems which are suitable to design optoelectronic devices. Here, we report the structural and electronic properties of the direct growth of multilayered GaSe by Molecular beam Epitaxy (MBE) on graphene. Reflection high-energy electron diffraction (RHEED) images exhibited sharp streaky features indicative of high quality GaSe layer produced via a vdW epitaxy. Micro-Raman spectroscopy showed that, after the vdW hetero-interface formation, the Raman signature of pristine graphene is preserved. However, the GaSe film tuned the charge density of graphene layer by shifting the Dirac point by about 80 meV toward lower binding energies, attesting an electron transfer from graphene to GaSe. Angle-resolved photoemission spectroscopy (ARPES) measurements showed that the maximum of the valence band of few layers of GaSe are located at the Γ point at a binding energy of about -0.73 eV relatively to the Fermi level (p-type doping). From the ARPES measurements, a hole effective mass defined along the ΓM direction and equal to about m*/m0 = -1.1 was determined. By coupling the ARPES data with high resolution X-ray photoemission spectroscopy (HR-XPS) measurements, the Schottky interface barrier height was estimated to be 1.2 eV. These findings allow deeper understanding of the interlayer interactions and the electronic structure of GaSe/graphene vdW heterostructure.

Interlayer coupling and electronic structure of misfit-layered bismuth-based cobaltites

NASA Astrophysics Data System (ADS)

Takakura, Sho-ichi; Yamamoto, Isamu; Tanaka, Eishi; Azuma, Junpei; Maki, Makoto

2017-05-01

The [Bi2M2O4] pCoO2 materials (M =Ca , Sr, and Ba) were studied to clarify the effect of the lattice incommensurability on electronic properties using angle-resolved photoemission spectroscopy and transmission electron microscopy (TEM). Results show that the insulating behavior is characterized by a spectral weight for binding energies higher than 2.0 eV. Moreover, the spectral shape is modified as a function of the incident photon energy, demonstrating a close relationship between the electrical properties and interlayer coupling. TEM results show that the effect of the lattice mismatch differs for different misfit parameters p . We therefore conclude that the carrier concentration and the chemical environment at the misfit interface, which depend on the degree of incommensurability, mutually determine the electronic properties of the system.

Optical properties of alkali halide crystals from all-electron hybrid TD-DFT calculations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Webster, R., E-mail: ross.webster07@imperial.ac.uk; Harrison, N. M.; Bernasconi, L.

2015-06-07

We present a study of the electronic and optical properties of a series of alkali halide crystals AX, with A = Li, Na, K, Rb and X = F, Cl, Br based on a recent implementation of hybrid-exchange time-dependent density functional theory (TD-DFT) (TD-B3LYP) in the all-electron Gaussian basis set code CRYSTAL. We examine, in particular, the impact of basis set size and quality on the prediction of the optical gap and exciton binding energy. The formation of bound excitons by photoexcitation is observed in all the studied systems and this is shown to be correlated to specific features ofmore » the Hartree-Fock exchange component of the TD-DFT response kernel. All computed optical gaps and exciton binding energies are however markedly below estimated experimental and, where available, 2-particle Green’s function (GW-Bethe-Salpeter equation, GW-BSE) values. We attribute this reduced exciton binding to the incorrect asymptotics of the B3LYP exchange correlation ground state functional and of the TD-B3LYP response kernel, which lead to a large underestimation of the Coulomb interaction between the excited electron and hole wavefunctions. Considering LiF as an example, we correlate the asymptotic behaviour of the TD-B3LYP kernel to the fraction of Fock exchange admixed in the ground state functional c{sub HF} and show that there exists one value of c{sub HF} (∼0.32) that reproduces at least semi-quantitatively the optical gap of this material.« less

Direct Measurement of the Nanomechanical Stability of a Redox Protein Active Site and Its Dependence upon Metal Binding.

PubMed

Giannotti, Marina I; Cabeza de Vaca, Israel; Artés, Juan M; Sanz, Fausto; Guallar, Victor; Gorostiza, Pau

2015-09-10

The structural basis of the low reorganization energy of cupredoxins has long been debated. These proteins reconcile a conformationally heterogeneous and exposed metal-chelating site with the highly rigid copper center required for efficient electron transfer. Here we combine single-molecule mechanical unfolding experiments with statistical analysis and computer simulations to show that the metal-binding region of apo-azurin is mechanically flexible and that high mechanical stability is imparted by copper binding. The unfolding pathway of the metal site depends on the pulling residue and suggests that partial unfolding of the metal-binding site could be facilitated by the physical interaction with certain regions of the redox protein.

Two-electron states of a group-V donor in silicon from atomistic full configuration interactions

NASA Astrophysics Data System (ADS)

Tankasala, Archana; Salfi, Joseph; Bocquel, Juanita; Voisin, Benoit; Usman, Muhammad; Klimeck, Gerhard; Simmons, Michelle Y.; Hollenberg, Lloyd C. L.; Rogge, Sven; Rahman, Rajib

2018-05-01

Two-electron states bound to donors in silicon are important for both two-qubit gates and spin readout. We present a full configuration interaction technique in the atomistic tight-binding basis to capture multielectron exchange and correlation effects taking into account the full band structure of silicon and the atomic-scale granularity of a nanoscale device. Excited s -like states of A1 symmetry are found to strongly influence the charging energy of a negative donor center. We apply the technique on subsurface dopants subjected to gate electric fields and show that bound triplet states appear in the spectrum as a result of decreased charging energy. The exchange energy, obtained for the two-electron states in various confinement regimes, may enable engineering electrical control of spins in donor-dot hybrid qubits.

Adsorption of alcohols on a two-dimensional SiO2 single crystal - Alcohol adsorption on silicatene

NASA Astrophysics Data System (ADS)

Nayakasinghe, M. T.; Sivapragasam, N.; Burghaus, U.

2017-12-01

The adsorption kinetics of alcohols (methanol, ethanol, 1-propanol, 1-butanol, 1-pentanol) was studied on monoatomic, two-dimensional SiO2 single crystals (silicatene) using thermal desorption spectroscopy (TDS). Silicatene was grown on Mo(1 1 2) at ultra-high vacuum. In contrast to Mo, the alcohols physisorb molecularly on the hydrophobic SiO2/Mo surface. Zero coverage binding energies vary from 46.5 to 65.5 kJ/mol and increase with molecular size. Silicatene was characterized by Auger electron spectroscopy (AES), low energy electron diffraction (LEED), and water TDS.

Ramifications of codoping SrI2:Eu with isovalent and aliovalent impurities

NASA Astrophysics Data System (ADS)

Feng, Qingguo; Biswas, Koushik

2016-12-01

Eu2+ doped SrI2 is an important scintillator having applications in the field of radiation detection. Codoping techniques are often useful to improve the electronic response of such insulators. Using first-principles based approach, we report on the properties of SrI2:Eu and the influence of codoping with aliovalent (Na, Cs) and isovalent (Mg, Ca, Ba, and Sn) impurities. These codopants do not preferably bind with Eu and are expected to remain as isolated impurities in the SrI2 host. As isolated defects they display amphoteric behavior having, in most cases, significant ionization energies of the donor and acceptor levels. Furthermore, the acceptor states of Na, Cs, and Mg can bind with I-vacancy forming charge compensated donor-acceptor pairs. Such pairs may also bind additional holes or electrons similar to the isolated defects. Lack of deep-to-shallow behavior upon codoping and its ramifications will be discussed.

Electronic delocalization in discotic liquid crystals: a joint experimental and theoretical study.

PubMed

Crispin, Xavier; Cornil, Jérôme; Friedlein, Rainer; Okudaira, Koji Kamiya; Lemaur, Vincent; Crispin, Annica; Kestemont, Gaël; Lehmann, Matthias; Fahlman, Mats; Lazzaroni, Roberto; Geerts, Yves; Wendin, Göran; Ueno, Nobuo; Brédas, Jean-Luc; Salaneck, William R

2004-09-29

Discotic liquid crystals emerge as very attractive materials for organic-based (opto)electronics as they allow efficient charge and energy transport along self-organized molecular columns. Here, angle-resolved photoelectron spectroscopy (ARUPS) is used to investigate the electronic structure and supramolecular organization of the discotic molecule, hexakis(hexylthio)diquinoxalino[2,3-a:2',3'-c]phenazine, deposited on graphite. The ARUPS data reveal significant changes in the electronic properties when going from disordered to columnar phases, the main feature being a decrease in ionization potential by 1.8 eV following the appearance of new electronic states at low binding energy. This evolution is rationalized by quantum-chemical calculations performed on model stacks containing from two to six molecules, which illustrate the formation of a quasi-band structure with Bloch-like orbitals delocalized over several molecules in the column. The ARUPS data also point to an energy dispersion of the upper pi-bands in the columns by some 1.1 eV, therefore highlighting the strongly delocalized nature of the pi-electrons along the discotic stacks.

Extended Lagrangian formulation of charge-constrained tight-binding molecular dynamics.

PubMed

Cawkwell, M J; Coe, J D; Yadav, S K; Liu, X-Y; Niklasson, A M N

2015-06-09

The extended Lagrangian Born-Oppenheimer molecular dynamics formalism [Niklasson, Phys. Rev. Lett., 2008, 100, 123004] has been applied to a tight-binding model under the constraint of local charge neutrality to yield microcanonical trajectories with both precise, long-term energy conservation and a reduced number of self-consistent field optimizations at each time step. The extended Lagrangian molecular dynamics formalism restores time reversal symmetry in the propagation of the electronic degrees of freedom, and it enables the efficient and accurate self-consistent optimization of the chemical potential and atomwise potential energy shifts in the on-site elements of the tight-binding Hamiltonian that are required when enforcing local charge neutrality. These capabilities are illustrated with microcanonical molecular dynamics simulations of a small metallic cluster using an sd-valent tight-binding model for titanium. The effects of weak dissipation on the propagation of the auxiliary degrees of freedom for the chemical potential and on-site Hamiltonian matrix elements that is used to counteract the accumulation of numerical noise during trajectories was also investigated.

Decreasing the electronic confinement in layered perovskites through intercalation.

PubMed

Smith, Matthew D; Pedesseau, Laurent; Kepenekian, Mikaël; Smith, Ian C; Katan, Claudine; Even, Jacky; Karunadasa, Hemamala I

2017-03-01

We show that post-synthetic small-molecule intercalation can significantly reduce the electronic confinement of 2D hybrid perovskites. Using a combined experimental and theoretical approach, we explain structural, optical, and electronic effects of intercalating highly polarizable molecules in layered perovskites designed to stabilize the intercalants. Polarizable molecules in the organic layers substantially alter the optical and electronic properties of the inorganic layers. By calculating the spatially resolved dielectric profiles of the organic and inorganic layers within the hybrid structure, we show that the intercalants afford organic layers that are more polarizable than the inorganic layers. This strategy reduces the confinement of excitons generated in the inorganic layers and affords the lowest exciton binding energy for an n = 1 perovskite of which we are aware. We also demonstrate a method for computationally evaluating the exciton's binding energy by solving the Bethe-Salpeter equation for the exciton, which includes an ab initio determination of the material's dielectric profile across organic and inorganic layers. This new semi-empirical method goes beyond the imprecise phenomenological approximation of abrupt dielectric-constant changes at the organic-inorganic interfaces. This work shows that incorporation of polarizable molecules in the organic layers, through intercalation or covalent attachment, is a viable strategy for tuning 2D perovskites towards mimicking the reduced electronic confinement and isotropic light absorption of 3D perovskites while maintaining the greater synthetic tunability of the layered architecture.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dhaka, R. S.; Barman, S. R.

Ne 1s core-level photoelectron spectra from Ne nanobubbles implanted in aluminum exhibit two peaks whose binding energies and relative intensities change with implantation energy, isochronal annealing, and sputtering. These changes in the core-level spectra are manifestations of the nanometer size of the bubbles since the screening of the photohole by the Al conduction electrons depends on the bubble size. Existence of a bimodal depth and size distribution of Ne nanobubbles is demonstrated in this work: smaller bubbles of about 4 A in radius are formed close to the Al(111) surface while the larger sized bubbles of 20 A in radiusmore » exist deeper below in the beneath subsurface region. A general relation between the radius of the rare-gas bubbles and their core-level binding energies is established.« less

Excess electrons in methanol clusters: Beyond the one-electron picture

NASA Astrophysics Data System (ADS)

Pohl, Gábor; Mones, Letif; Turi, László

2016-10-01

We performed a series of comparative quantum chemical calculations on various size negatively charged methanol clusters, ("separators=" CH 3 OH ) n - . The clusters are examined in their optimized geometries (n = 2-4), and in geometries taken from mixed quantum-classical molecular dynamics simulations at finite temperature (n = 2-128). These latter structures model potential electron binding sites in methanol clusters and in bulk methanol. In particular, we compute the vertical detachment energy (VDE) of an excess electron from increasing size methanol cluster anions using quantum chemical computations at various levels of theory including a one-electron pseudopotential model, several density functional theory (DFT) based methods, MP2 and coupled-cluster CCSD(T) calculations. The results suggest that at least four methanol molecules are needed to bind an excess electron on a hydrogen bonded methanol chain in a dipole bound state. Larger methanol clusters are able to form stronger interactions with an excess electron. The two simulated excess electron binding motifs in methanol clusters, interior and surface states, correlate well with distinct, experimentally found VDE tendencies with size. Interior states in a solvent cavity are stabilized significantly stronger than electron states on cluster surfaces. Although we find that all the examined quantum chemistry methods more or less overestimate the strength of the experimental excess electron stabilization, MP2, LC-BLYP, and BHandHLYP methods with diffuse basis sets provide a significantly better estimate of the VDE than traditional DFT methods (BLYP, B3LYP, X3LYP, PBE0). A comparison to the better performing many electron methods indicates that the examined one-electron pseudopotential can be reasonably used in simulations for systems of larger size.

Excess electrons in methanol clusters: Beyond the one-electron picture.

PubMed

Pohl, Gábor; Mones, Letif; Turi, László

2016-10-28

We performed a series of comparative quantum chemical calculations on various size negatively charged methanol clusters, CH 3 OH n - . The clusters are examined in their optimized geometries (n = 2-4), and in geometries taken from mixed quantum-classical molecular dynamics simulations at finite temperature (n = 2-128). These latter structures model potential electron binding sites in methanol clusters and in bulk methanol. In particular, we compute the vertical detachment energy (VDE) of an excess electron from increasing size methanol cluster anions using quantum chemical computations at various levels of theory including a one-electron pseudopotential model, several density functional theory (DFT) based methods, MP2 and coupled-cluster CCSD(T) calculations. The results suggest that at least four methanol molecules are needed to bind an excess electron on a hydrogen bonded methanol chain in a dipole bound state. Larger methanol clusters are able to form stronger interactions with an excess electron. The two simulated excess electron binding motifs in methanol clusters, interior and surface states, correlate well with distinct, experimentally found VDE tendencies with size. Interior states in a solvent cavity are stabilized significantly stronger than electron states on cluster surfaces. Although we find that all the examined quantum chemistry methods more or less overestimate the strength of the experimental excess electron stabilization, MP2, LC-BLYP, and BHandHLYP methods with diffuse basis sets provide a significantly better estimate of the VDE than traditional DFT methods (BLYP, B3LYP, X3LYP, PBE0). A comparison to the better performing many electron methods indicates that the examined one-electron pseudopotential can be reasonably used in simulations for systems of larger size.

Empirical optimization of DFT  +  U and HSE for the band structure of ZnO.

PubMed

Bashyal, Keshab; Pyles, Christopher K; Afroosheh, Sajjad; Lamichhane, Aneer; Zayak, Alexey T

2018-02-14

ZnO is a well-known wide band gap semiconductor with promising potential for applications in optoelectronics, transparent electronics, and spintronics. Computational simulations based on the density functional theory (DFT) play an important role in the research of ZnO, but the standard functionals, like Perdew-Burke-Erzenhof, result in largely underestimated values of the band gap and the binding energies of the Zn 3d electrons. Methods like DFT  +  U and hybrid functionals are meant to remedy the weaknesses of plain DFT. However, both methods are not parameter-free. Direct comparison with experimental data is the best way to optimize the computational parameters. X-ray photoemission spectroscopy (XPS) is commonly considered as a benchmark for the computed electronic densities of states. In this work, both DFT  +  U and HSE methods were parametrized to fit almost exactly the binding energies of electrons in ZnO obtained by XPS. The optimized parameterizations of DFT  +  U and HSE lead to significantly worse results in reproducing the ion-clamped static dielectric tensor, compared to standard high-level calculations, including GW, which in turn yield a perfect match for the dielectric tensor. The failure of our XPS-based optimization reveals the fact that XPS does not report the ground state electronic structure for ZnO and should not be used for benchmarking ground state electronic structure calculations.

Empirical optimization of DFT  +  U and HSE for the band structure of ZnO

NASA Astrophysics Data System (ADS)

Bashyal, Keshab; Pyles, Christopher K.; Afroosheh, Sajjad; Lamichhane, Aneer; Zayak, Alexey T.

2018-02-01

ZnO is a well-known wide band gap semiconductor with promising potential for applications in optoelectronics, transparent electronics, and spintronics. Computational simulations based on the density functional theory (DFT) play an important role in the research of ZnO, but the standard functionals, like Perdew-Burke-Erzenhof, result in largely underestimated values of the band gap and the binding energies of the Zn3d electrons. Methods like DFT  +  U and hybrid functionals are meant to remedy the weaknesses of plain DFT. However, both methods are not parameter-free. Direct comparison with experimental data is the best way to optimize the computational parameters. X-ray photoemission spectroscopy (XPS) is commonly considered as a benchmark for the computed electronic densities of states. In this work, both DFT  +  U and HSE methods were parametrized to fit almost exactly the binding energies of electrons in ZnO obtained by XPS. The optimized parameterizations of DFT  +  U and HSE lead to significantly worse results in reproducing the ion-clamped static dielectric tensor, compared to standard high-level calculations, including GW, which in turn yield a perfect match for the dielectric tensor. The failure of our XPS-based optimization reveals the fact that XPS does not report the ground state electronic structure for ZnO and should not be used for benchmarking ground state electronic structure calculations.

Correlation between morphology, electron band structure, and resistivity of Pb atomic chains on the Si(5 5 3)-Au surface

NASA Astrophysics Data System (ADS)

Jałochowski, M.; Kwapiński, T.; Łukasik, P.; Nita, P.; Kopciuszyński, M.

2016-07-01

Structural and electron transport properties of multiple Pb atomic chains fabricated on the Si(5 5 3)-Au surface are investigated using scanning tunneling spectroscopy, reflection high electron energy diffraction, angular resolved photoemission electron spectroscopy and in situ electrical resistance. The study shows that Pb atomic chains growth modulates the electron band structure of pristine Si(5 5 3)-Au surface and hence changes its sheet resistivity. Strong correlation between chains morphology, electron band structure and electron transport properties is found. To explain experimental findings a theoretical tight-binding model of multiple atomic chains interacting on effective substrate is proposed.

A dipole-bound dianion

NASA Astrophysics Data System (ADS)

Skurski, Piotr; Simons, Jack

2000-04-01

The possibility of binding two electrons by the dipole potential of a molecule was examined earlier by us using model potentials. That study suggested that large dipole moments μ=qR and large charge separation distances R (or equivalently large charges q) would be required to achieve binding two electrons. For example, even with a charge q=1.5 a.u. which might be achieved using di- or tri-valent cations, a dipole moment exceeding 15.922 D is needed. The presence of inner-shell electrons even further increases the value of μ that is required because the dipole-bound electrons' orbital must be orthogonal to and excluded from such inner shells. In the present work, we discuss our efforts to find a real molecule that can actually bind two electrons to a single dipole site. Numerical results are presented for the mono- and dianions of a double 5-member carbon ring system substituted with a Ca atom and three superhalogen -PF5 groups. The dianion of this molecule is found to be geometrically stable and to have a vertical electron detachment energy of ca. 0.8 eV. Its two excess electrons occupy the same fully symmetric a1 molecular orbital localized at the electropositive Ca end of the neutral system as is routinely observed in dipole-bound monoanions. Although our final candidate is chemically unusual, it is hoped that our predictions about it will encourage others to search for more synthetically tractable alternatives.

Binding energies from diffusion Monte Carlo for the MB-pol H{sub 2}O and D{sub 2}O dimer: A comparison to experimental values

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mallory, Joel D.; Mandelshtam, Vladimir A.

2015-10-14

The diffusion Monte Carlo (DMC) method is applied to compute the ground state energies of the water monomer and dimer and their D{sub 2}O isotopomers using MB-pol; the most recent and most accurate ab inito-based potential energy surface (PES). MB-pol has already demonstrated excellent agreement with high level electronic structure data, as well as agreement with some experimental, spectroscopic, and thermodynamic data. Here, the DMC binding energies of (H{sub 2}O){sub 2} and (D{sub 2}O){sub 2} agree with the corresponding values obtained from velocity map imaging within, respectively, 0.01 and 0.02 kcal/mol. This work adds two more valuable data points thatmore » highlight the accuracy of the MB-pol PES.« less

Hydrogen molecules and chains in a superstrong magnetic field

NASA Technical Reports Server (NTRS)

Lai, Dong; Salpeter, Edwin E.; Shapiro, Stuart L.

1992-01-01

The electronic structures of hydrogen polymolecules H(n) (n = 2,3,4,...) is studied in a superstrong magnetic field (B greater than about 10 exp 12 G) typically found on the surface of a neutron star. Simple analytical scaling relations for several limiting cases (e.g., large n, high B field) are derived. The binding energies of H(n) molecules are numerically calculated for various magnetic-field strengths. For a given magnetic-field strength, the binding energy per atom in the H(n) molecules is found to approach a constant value as n increases. For typical field strengths of interest, energy saturation is essentially achieved once n exceeds 3 to 4. Also considered is the structure of negative H ions in a high magnetic field. For B about 10 exp 12 G, the dissociation energy of an atom in a hydrogen chain and the ionization potential of H(-) are smaller than the ionization potential of neutral atomic hydrogen.

Binding energy and photoionization cross-section of hydrogen-like donor impurity in strongly oblate ellipsoidal quantum dot

NASA Astrophysics Data System (ADS)

Hayrapetyan, D. B.; Ohanyan, G. L.; Baghdasaryan, D. A.; Sarkisyan, H. A.; Baskoutas, S.; Kazaryan, E. M.

2018-01-01

Hydrogen-like donor impurity states in strongly oblate ellipsoidal quantum dot have been studied. The hydrogen-like donor impurity states are investigated within the framework of variational method. The trial wave function constructed on the base of wave functions of the system without impurity. The dependence of the energy and binding energy for the ground and first excited states on the geometrical parameters of the ellipsoidal quantum dot and on the impurity position have been calculated. The behavior of the oscillator strength for different angles of incident light and geometrical parameters have been revealed. Photoionization cross-section of the electron transitions from the impurity ground state to the size-quantized ground and first excited states have been studied. The effects of impurity position and the geometrical parameters of the ellipsoidal quantum dot on the photoionization cross section dependence on the photon energy have been considered.

10 CFR 600.10 - Form and content of applications.

Code of Federal Regulations, 2010 CFR

2010-01-01

... Energy Technology Center, Attn: Unsolicited Proposal Manager, Post Office Box 10940, Pittsburgh, PA...: (1) A facesheet containing basic identifying information. The facesheet shall be the Standard Form... electronically, by an official authorized to bind the applicant; or (2) Omits any information or documentation...

Strong interaction between electrons and collective excitations in the multiband superconductor MgB 2

DOE PAGES

Mou, Daixiang; Jiang, Rui; Taufour, Valentin; ...

2015-04-08

We use a tunable laser angle-resolved photoemission spectroscopy to study the electronic properties of the prototypical multiband BCS superconductor MgB 2. Our data reveal a strong renormalization of the dispersion (kink) at ~65meV, which is caused by the coupling of electrons to the E 2g phonon mode. In contrast to cuprates, the 65 meV kink in MgB 2 does not change significantly across T c. More interestingly, we observe strong coupling to a second, lower energy collective mode at a binding energy of 10 meV. As a result, this excitation vanishes above T c and is likely a signature ofmore » the elusive Leggett mode.« less

Coulomb engineering of the bandgap and excitons in two-dimensional materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Raja, Archana; Chaves, Andrey; Yu, Jaeeun

Here, the ability to control the size of the electronic bandgap is an integral part of solid-state technology. Atomically thin two-dimensional crystals offer a new approach for tuning the energies of the electronic states based on the unusual strength of the Coulomb interaction in these materials and its environmental sensitivity. Here, we show that by engineering the surrounding dielectric environment, one can tune the electronic bandgap and the exciton binding energy in monolayers of WS 2 and WSe 2 by hundreds of meV. We exploit this behaviour to present an in-plane dielectric heterostructure with a spatially dependent bandgap, as anmore » initial step towards the creation of diverse lateral junctions with nanoscale resolution.« less

Coulomb engineering of the bandgap and excitons in two-dimensional materials

DOE PAGES

Raja, Archana; Chaves, Andrey; Yu, Jaeeun; ...

2017-05-04

Here, the ability to control the size of the electronic bandgap is an integral part of solid-state technology. Atomically thin two-dimensional crystals offer a new approach for tuning the energies of the electronic states based on the unusual strength of the Coulomb interaction in these materials and its environmental sensitivity. Here, we show that by engineering the surrounding dielectric environment, one can tune the electronic bandgap and the exciton binding energy in monolayers of WS 2 and WSe 2 by hundreds of meV. We exploit this behaviour to present an in-plane dielectric heterostructure with a spatially dependent bandgap, as anmore » initial step towards the creation of diverse lateral junctions with nanoscale resolution.« less

Binding matter with antimatter: the covalent positron bond.

PubMed

Charry, Jorge Alfonso; Varella, Marcio T Do N; Reyes, Andrés

2018-05-16

We report sufficient theoretical evidence of the energy stability of the e⁺H₂²⁻ molecule, formed by two H⁻ anions and one positron. Analysis of the electronic and positronic densities of the latter compound undoubtedly points out the formation of a positronic covalent bond between the otherwise repelling hydride anions. The lower limit for the bonding energy of the e⁺H₂²⁻ molecule is 74 kJ/mol (0.77 eV), accounting for the zero-point vibrational correction. The formation of a non electronic covalent bond is fundamentally distinct from positron attachment to stable molecules, as the latter process is characterized by a positron affinity, analogous to the electron affinity. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Coulomb engineering of the bandgap and excitons in two-dimensional materials

PubMed Central

Raja, Archana; Chaves, Andrey; Yu, Jaeeun; Arefe, Ghidewon; Hill, Heather M.; Rigosi, Albert F.; Berkelbach, Timothy C.; Nagler, Philipp; Schüller, Christian; Korn, Tobias; Nuckolls, Colin; Hone, James; Brus, Louis E.; Heinz, Tony F.; Reichman, David R.; Chernikov, Alexey

2017-01-01

The ability to control the size of the electronic bandgap is an integral part of solid-state technology. Atomically thin two-dimensional crystals offer a new approach for tuning the energies of the electronic states based on the unusual strength of the Coulomb interaction in these materials and its environmental sensitivity. Here, we show that by engineering the surrounding dielectric environment, one can tune the electronic bandgap and the exciton binding energy in monolayers of WS2 and WSe2 by hundreds of meV. We exploit this behaviour to present an in-plane dielectric heterostructure with a spatially dependent bandgap, as an initial step towards the creation of diverse lateral junctions with nanoscale resolution. PMID:28469178

Stable biexcitons in two-dimensional metal-halide perovskites with strong dynamic lattice disorder

NASA Astrophysics Data System (ADS)

Thouin, Félix; Neutzner, Stefanie; Cortecchia, Daniele; Dragomir, Vlad Alexandru; Soci, Cesare; Salim, Teddy; Lam, Yeng Ming; Leonelli, Richard; Petrozza, Annamaria; Kandada, Ajay Ram Srimath; Silva, Carlos

2018-03-01

With strongly bound and stable excitons at room temperature, single-layer, two-dimensional organic-inorganic hybrid perovskites are viable semiconductors for light-emitting quantum optoelectronics applications. In such a technological context, it is imperative to comprehensively explore all the factors—chemical, electronic, and structural—that govern strong multiexciton correlations. Here, by means of two-dimensional coherent spectroscopy, we examine excitonic many-body effects in pure, single-layer (PEA) 2PbI4 (PEA = phenylethylammonium). We determine the binding energy of biexcitons—correlated two-electron, two-hole quasiparticles—to be 44 ±5 meV at room temperature. The extraordinarily high values are similar to those reported in other strongly excitonic two-dimensional materials such as transition-metal dichalcogenides. Importantly, we show that this binding energy increases by ˜25 % upon cooling to 5 K. Our work highlights the importance of multiexciton correlations in this class of technologically promising, solution-processable materials, in spite of the strong effects of lattice fluctuations and dynamic disorder.

Weak interactions and cooperativity effects on disiloxane: a look at the building block of silicones

NASA Astrophysics Data System (ADS)

Martín-Fernández, Carlos; Montero-Campillo, M. Merced; Alkorta, Ibon; Elguero, José

2018-06-01

The behaviour of disiloxane 1 towards a set of Lewis acids (LA) and Lewis bases (LB) forming complexes through its oxygen and silicon atoms, respectively, was studied at the MP2/aug‧-cc-pVTZ level of theory, exploring a wide variety of non-covalent interactions. Disiloxane is a moderate electron acceptor and a good electron donor, exhibiting in the latter case binding energies up to almost -100 kJ/mol with BeCl2. Cooperativity effects were also analysed by looking at ternary 1:LA:LB complexes. Shorter intermolecular distances than in the corresponding binary complexes and a negative contribution of the three-body term to the binding energy indicate that the non-covalent interactions allowed by disiloxane through its acid and basic centres cooperate between them to reinforce both donor-acceptor pairs. These effects are particularly strong in complexes involving beryllium and triel bonds, but are also relevant for complexes containing hydrogen bonds.

Electronic Structure Calculations of Ammonia Adsorption on Graphene and Graphene Oxide with Epoxide and Hydroxyl Groups

NASA Astrophysics Data System (ADS)

Nancy Anna Anasthasiya, A.; Khaneja, Mamta; Jeyaprakash, B. G.

2017-10-01

Ammonia adsorption on graphene (G) and graphene oxide (GO) was investigated through density functional theory calculations. In the GO system, the obtained binding energy, band gap, charge transfer and electronic structure revealed that the epoxide (GO-O) and hydroxyl groups (GO-OH) in GO enhance the NH3 adsorption, which leads to the chemisorption of NH3 on GO. The dissociation of NH3 to NH2 and formation of OH was also observed when the O and H atoms were separated at 0.985 Å, 1.019 Å, 1.035 Å, and 1.044 Å for various GO systems. The maximum charge transfer value was found to be 0.054 |e| with the binding energy of 1.143 eV for GO with a single epoxide (GO-1O) group. The charge transfer from NH3 to G or GO and the bond formation in this study agree with the reported experimental results.

Mutations of Electrons as Constituents of Hadrons

NASA Astrophysics Data System (ADS)

Driscoll, R. B.

1997-04-01

Conjecture (C) 1: Coulomb-charged constituents of electron (e) are attracted to its barycentre by lepto-strong force F=K/r^2+f; f is stably perturbative for r < the "radius" of e. An exterior magnetic field (MF) with gradient (G) secularly perturbs the eccentricities but not the energies of the constituents' orbits, changing the spin (s) and magnetic moment (μ) of e. (C) 2: F coheres two or more e's dynamically with r approximately equal to the "radius" of e. The resulting MF and G at each e oscillate. Stable values of s and μ result for each e which differs from the atomic values. Binding energies change the masses of the e's. A hadron results. (C) 3: An e similarly may bind to a proton to form a Rutherford- Santilli neutron. The proton is negligibly mutated.(References: H. Dehmelt, Science 247, 539 (1990); T.E. Phipps, Jr., Heretical Verities (Classic Non-fiction Library, Urbana, 1986); R.M. Santilli, Hadronic Mechanics (Ukrainian Academy of Sciences, Kiev, 1995 and 1996), 3 volumes.)

Actinide electronic structure and atomic forces

NASA Astrophysics Data System (ADS)

Albers, R. C.; Rudin, Sven P.; Trinkle, Dallas R.; Jones, M. D.

2000-07-01

We have developed a new method[1] of fitting tight-binding parameterizations based on functional forms developed at the Naval Research Laboratory.[2] We have applied these methods to actinide metals and report our success using them (see below). The fitting procedure uses first-principles local-density-approximation (LDA) linear augmented plane-wave (LAPW) band structure techniques[3] to first calculate an electronic-structure band structure and total energy for fcc, bcc, and simple cubic crystal structures for the actinide of interest. The tight-binding parameterization is then chosen to fit the detailed energy eigenvalues of the bands along symmetry directions, and the symmetry of the parameterization is constrained to agree with the correct symmetry of the LDA band structure at each eigenvalue and k-vector that is fit to. By fitting to a range of different volumes and the three different crystal structures, we find that the resulting parameterization is robust and appears to accurately calculate other crystal structures and properties of interest.

Observation of a shape resonance of the positronium negative ion

PubMed Central

Michishio, Koji; Kanai, Tsuneto; Kuma, Susumu; Azuma, Toshiyuki; Wada, Ken; Mochizuki, Izumi; Hyodo, Toshio; Yagishita, Akira; Nagashima, Yasuyuki

2016-01-01

When an electron binds to its anti-matter counterpart, the positron, it forms the exotic atom positronium (Ps). Ps can further bind to another electron to form the positronium negative ion, Ps− (e−e+e−). Since its constituents are solely point-like particles with the same mass, this system provides an excellent testing ground for the three-body problem in quantum mechanics. While theoretical works on its energy level and dynamics have been performed extensively, experimental investigations of its characteristics have been hampered by the weak ion yield and short annihilation lifetime. Here we report on the laser spectroscopy study of Ps−, using a source of efficiently produced ions, generated from the bombardment of slow positrons onto a Na-coated W surface. A strong shape resonance of 1Po symmetry has been observed near the Ps (n=2) formation threshold. The resonance energy and width measured are in good agreement with the result of three-body calculations. PMID:26983496

Pectin-like carbohydrates in the green alga Micrasterias characterized by cytochemical analysis and energy filtering TEM.

PubMed

Eder, M; Lütz-Meindl, U

2008-08-01

Pectins are the major matrix polysaccharides of plant cell walls and are important for controlling growth, wall porosity and regulation of the ionic environment in plant cells. Pectic epitopes recognized by the monoclonal antibodies JIM5, JIM7 and 2F4 could be localized in the primary wall during development of the green alga Micrasterias. As the degree of pectin esterification determines the calcium-binding capacity and thus the physical properties of the cell wall, chemical and enzymatic in situ de-esterification was performed. This resulted in displacement of epitopes recognized by JIM5, JIM7 and 2F4, respectively, in changes in the intensity of the antibody labelling as visualized in CLSM. In addition, calcium-binding capacities of cell walls and components of the secretory apparatus were determined in transmission electron microscopy by electron energy loss spectroscopy and electron spectroscopic imaging. These analyses revealed that pectic polysaccharides are transported to the cell wall in a de-esterified form. At the primary wall, pectins get methyl-esterified at the inner side, thus allowing flexibility of the wall. At the outer side of the wall they become again de-esterified and bind high amounts of calcium which leads to cell wall stiffening. Mucilage vesicles possess the highest calcium-binding capacity of all structures observed in Micrasterias, indicating that the pectic polysaccharides of mucilage are secreted in a de-esterified, compact form. When mucilage is excreted through the cell wall, it loses its ability to bind calcium. The esterification of pectins involved is obviously required for swelling of mucilage by water uptake, which generates the motive force for orientation of this unicellular organism in respect to light. Incubation of Micrasterias in pectin methylesterase (PME), which de-esterifies pectic polymers in higher plants, resulted in growth inhibition, cell shape malformation and primary wall thickening. A PME-like enzyme could be found in Micrasterias by PME activity assays.

A theoretical investigation on bio-transformation of third generation anti-cancer drug Heptaplatin and its interaction with DNA purine bases

NASA Astrophysics Data System (ADS)

Reddy B., Venkata P.; Mukherjee, Subhajit; Mitra, Ishani; Moi, Sankar Ch.

2017-12-01

Heptaplatin is an approved platinum based cytostatic drug for the treatment of gastric cancers. The hydrolytic bio-transformation of Heptaplatin and the platination processes of guanine (G) and adenine (A) with resulting mono and di-aquated species of Heptaplatin have been investigated using density functional theory (DFT) combined with the conductor like dielectric continuum model (CPCM) approach, to spotlight the drug activation energy profiles and their binding mechanisms. The stationary points on the potential energy surfaces were fully optimized and characterized. The mono-functional binding of Heptaplatin, guanine as target over adenine due to electronic factors and more favorable hydrogen-bonds pattern.

Analysis of oxygen binding-energy variations for BaO on W

NASA Astrophysics Data System (ADS)

Haas, G. A.; Shih, A.; Mueller, D.; Thomas, R. E.

Interatomic Auger analyses have been made of different forms of BaO layers on W substrates. Variations in Auger spectroscopy energies of the Ba4dBa5pO2p interatomic Auger transition were found to be largely governed by the O2p binding energy of the BaO adsorbate. This was illustrated by comparing results of the Auger data values with values derived from O2p binding energies using ultraviolet photoelectron spectroscopy. Very good agreement was observed not only for the W<100> substrate but also for the W<110> substrate which showed two oxygen-induced electronics state. Variations in binding energy were noted for different states of BaO lattice formation and for different amounts of oxidation, ranging from the transition of Ba to BaO and continuing to the BaO 2 stoichiometry and beyond. Effects were also reported for adsorbate alignment and thermal activation (i.e., reduction) of the oxidized state. An empirical relationship was found suggesting that the more tightly bound the O2p states of the BaO adsorbate were, the lower its work function would be. This link between binding energy and work function was observed to be valid not only for cases of poisoning by oxidation, but held as well during reactivation by the subsequent reduction of the oxide. In addition, this relationship also appeared to predict the low work function obtained through the introduction of substances such as Sc to the BaO-W system. Possible qualitative reasons which might contribute to this are discussed in terms of enhanced dipole effects and shifts in band structure.

High-order above-threshold dissociation of molecules

NASA Astrophysics Data System (ADS)

Lu, Peifen; Wang, Junping; Li, Hui; Lin, Kang; Gong, Xiaochun; Song, Qiying; Ji, Qinying; Zhang, Wenbin; Ma, Junyang; Li, Hanxiao; Zeng, Heping; He, Feng; Wu, Jian

2018-03-01

Electrons bound to atoms or molecules can simultaneously absorb multiple photons via the above-threshold ionization featured with discrete peaks in the photoelectron spectrum on account of the quantized nature of the light energy. Analogously, the above-threshold dissociation of molecules has been proposed to address the multiple-photon energy deposition in the nuclei of molecules. In this case, nuclear energy spectra consisting of photon-energy spaced peaks exceeding the binding energy of the molecular bond are predicted. Although the observation of such phenomena is difficult, this scenario is nevertheless logical and is based on the fundamental laws. Here, we report conclusive experimental observation of high-order above-threshold dissociation of H2 in strong laser fields where the tunneling-ionized electron transfers the absorbed multiphoton energy, which is above the ionization threshold to the nuclei via the field-driven inelastic rescattering. Our results provide an unambiguous evidence that the electron and nuclei of a molecule as a whole absorb multiple photons, and thus above-threshold ionization and above-threshold dissociation must appear simultaneously, which is the cornerstone of the nowadays strong-field molecular physics.

Automated docking of ligands to an artificial active site: augmenting crystallographic analysis with computer modeling

NASA Astrophysics Data System (ADS)

Rosenfeld, Robin J.; Goodsell, David S.; Musah, Rabi A.; Morris, Garrett M.; Goodin, David B.; Olson, Arthur J.

2003-08-01

The W191G cavity of cytochrome c peroxidase is useful as a model system for introducing small molecule oxidation in an artificially created cavity. A set of small, cyclic, organic cations was previously shown to bind in the buried, solvent-filled pocket created by the W191G mutation. We docked these ligands and a set of non-binders in the W191G cavity using AutoDock 3.0. For the ligands, we compared docking predictions with experimentally determined binding energies and X-ray crystal structure complexes. For the ligands, predicted binding energies differed from measured values by ± 0.8 kcal/mol. For most ligands, the docking simulation clearly predicted a single binding mode that matched the crystallographic binding mode within 1.0 Å RMSD. For 2 ligands, where the docking procedure yielded an ambiguous result, solutions matching the crystallographic result could be obtained by including an additional crystallographically observed water molecule in the protein model. For the remaining 2 ligands, docking indicated multiple binding modes, consistent with the original electron density, suggesting disordered binding of these ligands. Visual inspection of the atomic affinity grid maps used in docking calculations revealed two patches of high affinity for hydrogen bond donating groups. Multiple solutions are predicted as these two sites compete for polar hydrogens in the ligand during the docking simulation. Ligands could be distinguished, to some extent, from non-binders using a combination of two trends: predicted binding energy and level of clustering. In summary, AutoDock 3.0 appears to be useful in predicting key structural and energetic features of ligand binding in the W191G cavity.

Theoretical studies of electronically excited states

DOE Office of Scientific and Technical Information (OSTI.GOV)

Besley, Nicholas A.

2014-10-06

Time-dependent density functional theory is the most widely used quantum chemical method for studying molecules in electronically excited states. However, excited states can also be computed within Kohn-Sham density functional theory by exploiting methods that converge the self-consistent field equations to give excited state solutions. The usefulness of single reference self-consistent field based approaches for studying excited states is demonstrated by considering the calculation of several types of spectroscopy including the infrared spectroscopy of molecules in an electronically excited state, the rovibrational spectrum of the NO-Ar complex, core electron binding energies and the emission spectroscopy of BODIPY in water.

X-ray Photoelectron Spectroscopy of Pyridinium-Based Ionic Liquids: Comparison to Imidazolium- and Pyrrolidinium-Based Analogues.

PubMed

Men, Shuang; Mitchell, Daniel S; Lovelock, Kevin R J; Licence, Peter

2015-07-20

We investigate eight 1-alkylpyridinium-based ionic liquids of the form [Cn Py][A] by using X-ray photoelectron spectroscopy (XPS). The electronic environment of each element of the ionic liquids is analyzed. In particular, a reliable fitting model is developed for the C 1s region that applies to each of the ionic liquids. This model allows the accurate charge correction of binding energies and the determination of reliable and reproducible binding energies for each ionic liquid. Shake-up/off phenomena are determinedfor both C 1s and N 1s spectra. The electronic interaction between cations and anions is investigated for both simple ionic liquids and an example of an ionic-liquid mixture; the effect of the anion on the electronic environment of the cation is also explored. Throughout the study, a detailed comparison is made between [C8 Py][A] and analogues including 1-octyl-1-methylpyrrolidinium- ([C8 C1 Pyrr][A]), and 1-octyl-3-methylimidazolium- ([C8 C1 Im][A]) based samples, where X is common to all ionic liquids. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

X‐ray Photoelectron Spectroscopy of Pyridinium‐Based Ionic Liquids: Comparison to Imidazolium‐ and Pyrrolidinium‐Based Analogues

PubMed Central

Mitchell, Daniel S.; Lovelock, Kevin R. J.

2015-01-01

Abstract We investigate eight 1‐alkylpyridinium‐based ionic liquids of the form [CnPy][A] by using X‐ray photoelectron spectroscopy (XPS). The electronic environment of each element of the ionic liquids is analyzed. In particular, a reliable fitting model is developed for the C 1s region that applies to each of the ionic liquids. This model allows the accurate charge correction of binding energies and the determination of reliable and reproducible binding energies for each ionic liquid. Shake‐up/off phenomena are determinedfor both C 1s and N 1s spectra. The electronic interaction between cations and anions is investigated for both simple ionic liquids and an example of an ionic‐liquid mixture; the effect of the anion on the electronic environment of the cation is also explored. Throughout the study, a detailed comparison is made between [C8Py][A] and analogues including 1‐octyl‐1‐methylpyrrolidinium‐ ([C8C1Pyrr][A]), and 1‐octyl‐3‐methylimidazolium‐ ([C8C1Im][A]) based samples, where X is common to all ionic liquids. PMID:25952131

Organization of chlorophyll biosynthesis and insertion of chlorophyll into the chlorophyll-binding proteins in chloroplasts.

PubMed

Wang, Peng; Grimm, Bernhard

2015-12-01

Oxygenic photosynthesis requires chlorophyll (Chl) for the absorption of light energy, and charge separation in the reaction center of photosystem I and II, to feed electrons into the photosynthetic electron transfer chain. Chl is bound to different Chl-binding proteins assembled in the core complexes of the two photosystems and their peripheral light-harvesting antenna complexes. The structure of the photosynthetic protein complexes has been elucidated, but mechanisms of their biogenesis are in most instances unknown. These processes involve not only the assembly of interacting proteins, but also the functional integration of pigments and other cofactors. As a precondition for the association of Chl with the Chl-binding proteins in both photosystems, the synthesis of the apoproteins is synchronized with Chl biosynthesis. This review aims to summarize the present knowledge on the posttranslational organization of Chl biosynthesis and current attempts to envision the proceedings of the successive synthesis and integration of Chl into Chl-binding proteins in the thylakoid membrane. Potential auxiliary factors, contributing to the control and organization of Chl biosynthesis and the association of Chl with the Chl-binding proteins during their integration into photosynthetic complexes, are discussed in this review.

A spin transition mechanism for cooperative adsorption in metal-organic frameworks

NASA Astrophysics Data System (ADS)

Reed, Douglas A.; Keitz, Benjamin K.; Oktawiec, Julia; Mason, Jarad A.; Runčevski, Tomče; Xiao, Dianne J.; Darago, Lucy E.; Crocellà, Valentina; Bordiga, Silvia; Long, Jeffrey R.

2017-10-01

Cooperative binding, whereby an initial binding event facilitates the uptake of additional substrate molecules, is common in biological systems such as haemoglobin. It was recently shown that porous solids that exhibit cooperative binding have substantial energetic benefits over traditional adsorbents, but few guidelines currently exist for the design of such materials. In principle, metal-organic frameworks that contain coordinatively unsaturated metal centres could act as both selective and cooperative adsorbents if guest binding at one site were to trigger an electronic transformation that subsequently altered the binding properties at neighbouring metal sites. Here we illustrate this concept through the selective adsorption of carbon monoxide (CO) in a series of metal-organic frameworks featuring coordinatively unsaturated iron(II) sites. Functioning via a mechanism by which neighbouring iron(II) sites undergo a spin-state transition above a threshold CO pressure, these materials exhibit large CO separation capacities with only small changes in temperature. The very low regeneration energies that result may enable more efficient Fischer-Tropsch conversions and extraction of CO from industrial waste feeds, which currently underutilize this versatile carbon synthon. The electronic basis for the cooperative adsorption demonstrated here could provide a general strategy for designing efficient and selective adsorbents suitable for various separations.

FIRST PRINCIPLES STUDY ON ELECTRONIC AND OPTICAL PROPERTIES OF Al-DOPED γ-Ge3N4

NASA Astrophysics Data System (ADS)

Ding, Y. C.; Xiang, A. P.; Zhu, X. H.; Luo, J.; Hu, X. F.

2012-12-01

First principles study of the structural, electronic and optical properties of Al-doped γ-Ge3N4 with different concentration has been reported using the pseudo-potential plane wave method within the generalized gradient approximation (GGA). The binding energy and the formation energy suggest that Aluminum (Al) impurities prefer to substitute Ge at octahedral sites. Different doping concentrations are considered and the corresponding density of states (DOS) are analyzed. Calculated DOS indicates that there are holes in the top of the valance band after doping, meaning a p-type doping. We study the complex dielectric function, the absorption coefficient, and the electron energy loss spectra. It is demonstrated that for the low Al concentration, the material exhibits the dielectric behavior and for the high Al concentration, the material has possibilities to exhibit some metallic behavior. The γ-Ge3N4 doped with Al has a much higher static dielectric constant than undoped γ-Ge3N4, implying its potential applications in electronics and optics.

Substituent Effects in the Benzene Dimer are Due to Direct Interactions of the Substituents with the Unsubstituted Benzene

PubMed Central

Wheeler, Steven E.; Houk, K. N.

2009-01-01

The prevailing views of substituent effects in the sandwich configuration of the benzene dimer are flawed. For example, in the polar/π model of Cozzi and co-workers (J. Am. Chem. Soc. 1992, 114, 5729), electron-withdrawing substituents enhance binding in the benzene dimer by withdrawing electron density from the π-cloud of the substituted ring, reducing the repulsive electrostatic interaction with the non-substituted benzene. Conversely, electron-donating substituents donate excess electrons into the π-system and diminish the π-stacking interaction. We present computed interaction energies for the sandwich configuration of the benzene dimer and 24 substituted dimers, as well as sandwich complexes of substituted benzenes with perfluorobenzene. While the computed interaction energies correlate well with σm values for the substituents, interaction energies for related model systems demonstrate that this trend is independent of the substituted ring. Instead, the observed trends are consistent with direct electrostatic and dispersive interactions of the substituents with the unsubstituted ring. PMID:18652453

QM/QM approach to model energy disorder in amorphous organic semiconductors.

PubMed

Friederich, Pascal; Meded, Velimir; Symalla, Franz; Elstner, Marcus; Wenzel, Wolfgang

2015-02-10

It is an outstanding challenge to model the electronic properties of organic amorphous materials utilized in organic electronics. Computation of the charge carrier mobility is a challenging problem as it requires integration of morphological and electronic degrees of freedom in a coherent methodology and depends strongly on the distribution of polaron energies in the system. Here we represent a QM/QM model to compute the polaron energies combining density functional methods for molecules in the vicinity of the polaron with computationally efficient density functional based tight binding methods in the rest of the environment. For seven widely used amorphous organic semiconductor materials, we show that the calculations are accelerated up to 1 order of magnitude without any loss in accuracy. Considering that the quantum chemical step is the efficiency bottleneck of a workflow to model the carrier mobility, these results are an important step toward accurate and efficient disordered organic semiconductors simulations, a prerequisite for accelerated materials screening and consequent component optimization in the organic electronics industry.

Polarizable atomistic calculation of site energy disorder in amorphous Alq3.

PubMed

Nagata, Yuki

2010-02-01

A polarizable molecular dynamics simulation and calculation scheme for site energy disorder is presented in amorphous tris(8-hydroxyquinolinato)aluminum (Alq(3)) by means of the charge response kernel (CRK) method. The CRK fit to the electrostatic potential and the tight-binding approximation are introduced, which enables modeling of the polarizable electrostatic interaction for a large molecule systematically from an ab initio calculation. The site energy disorder for electron and hole transfers is calculated in amorphous Alq(3) and the effect of the polarization on the site energy disorder is discussed.

Analytical RISM-MP2 free energy gradient method: Application to the Schlenk equilibrium of Grignard reagent

NASA Astrophysics Data System (ADS)

Mori, Toshifumi; Kato, Shigeki

2007-03-01

We present a method to evaluate the analytical gradient of reference interaction site model Møller-Plesset second order free energy with respect to solute nuclear coordinates. It is applied to calculate the geometries and energies in the equilibria of the Grignard reagent (CH 3MgCl) in dimethylether solvent. The Mg-Mg and Mg-Cl distances as well as the binding energies of solvents are largely affected by the dynamical electron correlation. The solvent effect on the Schlenk equilibrium is examined.

Photoelectron spectroscopy of nitromethane anion clusters

NASA Astrophysics Data System (ADS)

Pruitt, Carrie Jo M.; Albury, Rachael M.; Goebbert, Daniel J.

2016-08-01

Nitromethane anion and nitromethane dimer, trimer, and hydrated cluster anions were studied by photoelectron spectroscopy. Vertical detachment energies, estimated electron affinities, and solvation energies were obtained from the photoelectron spectra. Cluster structures were investigated using theoretical calculations. Predicted detachment energies agreed with experiment. Calculations show water binds to nitromethane anion through two hydrogen bonds. The dimer has a non-linear structure with a single ionic Csbnd H⋯O hydrogen bond. The trimer has two different solvent interactions, but both involve the weak Csbnd H⋯O hydrogen bond.

The cluster Ir4 and its interaction with a hydrogen impurity. A density functional study.

PubMed

Bussai, Chuenchit; Krüger, Sven; Vayssilov, Georgi N; Rösch, Notker

2005-07-07

To contribute to the understanding of how iridium particles act as catalysts for hydrogenation and dehydrogenation of hydrocarbons, we have determined structures and binding energies of various isomers of Ir(4) as well as HIr(4) on the basis of relativistic density functional theory. The most stable isomer of Ir(4) showed a square planar structure with eight unpaired electrons. The tetrahedral structure, experimentally suggested for supported species, was calculated 49 kJ mol(-1) less stable. Hydrogen coordinates preferentially to a single Ir center of the planar cluster with a binding energy of up to 88 kJ mol(-1) with respect to the atom in the H(2) molecule. Terminal interaction of hydrogen with an Ir(4) tetrahedron causes the cluster to open to a butterfly structure. We calculated terminal binding of hydrogen at different Ir(4) isomers to be more stable than bridge coordination, at variance with earlier studies.

The role of van der Waals interaction in the tilted binding of amine molecules to the Au(111) surface

NASA Astrophysics Data System (ADS)

Le, Duy; Aminpour, Maral; Kiejna, Adam; Rahman, Talat S.

2012-06-01

We present the results of ab initio electronic structure calculations for the adsorption characteristics of three amine molecules on Au(111), which show that the inclusion of van der Waals interactions between the isolated molecule and the surface leads in general to good agreement with experimental data on the binding energies. Each molecule, however, adsorbs with a small tilt angle (between -5 and 9°). For the specific case of 1,4-diaminobenzene (BDA) our calculations reproduce the larger tilt angle (close to 24°) measured by photoemission experiments, when intermolecular (van der Waals) interactions (for about 8% coverage) are included. These results point not only to the important contribution of van der Waals interactions to molecule-surface binding energy, but also that of intermolecular interactions, often considered secondary to that between the molecule and the surface, in determining the adsorption geometry and pattern formation.

Structural basis for energy transduction by respiratory alternative complex III.

PubMed

Sousa, Joana S; Calisto, Filipa; Langer, Julian D; Mills, Deryck J; Refojo, Patrícia N; Teixeira, Miguel; Kühlbrandt, Werner; Vonck, Janet; Pereira, Manuela M

2018-04-30

Electron transfer in respiratory chains generates the electrochemical potential that serves as energy source for the cell. Prokaryotes can use a wide range of electron donors and acceptors and may have alternative complexes performing the same catalytic reactions as the mitochondrial complexes. This is the case for the alternative complex III (ACIII), a quinol:cytochrome c/HiPIP oxidoreductase. In order to understand the catalytic mechanism of this respiratory enzyme, we determined the structure of ACIII from Rhodothermus marinus at 3.9 Å resolution by single-particle cryo-electron microscopy. ACIII presents a so-far unique structure, for which we establish the arrangement of the cofactors (four iron-sulfur clusters and six c-type hemes) and propose the location of the quinol-binding site and the presence of two putative proton pathways in the membrane. Altogether, this structure provides insights into a mechanism for energy transduction and introduces ACIII as a redox-driven proton pump.

Direct Observation of Electron-Phonon Coupling and Slow Vibrational Relaxation in Organic-Inorganic Hybrid Perovskites

NASA Astrophysics Data System (ADS)

Hurtado Parra, Sebastian; Straus, Daniel; Iotov, Natasha; Fichera, Bryan; Gebhardt, Julian; Rappe, Andrew; Subotnik, Joseph; Kikkawa, James; Kagan, Cherie

Quantum and dielectric confinement effects in Ruddlesden-Popper 2D hybrid perovskites create excitons with a binding energy exceeding 150 meV. We exploit the large exciton binding energy to study exciton and carrier dynamics as well as electron-phonon coupling (EPC) in hybrid perovskites using absorption and photoluminescence (PL) spectroscopies. At temperatures <75 K, we resolve splitting of the excitonic absorption and PL into multiple regularly spaced resonances every 40-46 meV, consistent with EPC to phonons located on the organic cation. We also resolve resonances with a 14 meV spacing, in accord with coupling to phonons with mixed organic and inorganic character. These assignments are supported by density-functional theory calculations. Hot exciton PL and time-resolved PL measurements show that vibrational relaxation occurs on a picosecond time scale competitive with that for PL. At temperatures >75 K, excitonic absorption and PL exhibit homogeneous broadening. While absorption remains homogeneous, PL becomes inhomogeneous at temperatures <75K, which we speculate is caused by the formation and subsequent dynamics of a polaronic exciton. This work is supported by the U.S. Department of Energy, Office of Basic Energy Sciences Grant DE-SC0002158 and the National Science Foundation Graduate Research Fellowship Grant DGE-1321851.

Novel Automatic Electrochemical-mechanical Polishing (ECMP) of Metals for Scanning Electron Microscopy (Postprint)

DTIC Science & Technology

2010-03-23

Micron 41 (2010) 615–621 619 Fig. 4 . XPS binding energy (eV) versus sputtering time (s) results for the Ti 2p peaks for the titanium samples: (a...improved the IQ values. 4 . Conclusions The electrochemical–mechanical polishing system (ECMP) removed material from titanium and nickel alloys at a...March 2014 4 . TITLE AND SUBTITLE NOVEL AUTOMATIC ELECTROCHEMICAL-MECHANICAL POLISHING (ECMP) OF METALS FOR SCANNING ELECTRON MICROSCOPY

Communication: Charge-population based dispersion interactions for molecules and materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stöhr, Martin; Department Chemie, Technische Universität München, Lichtenbergstr. 4, D-85748 Garching; Michelitsch, Georg S.

2016-04-21

We introduce a system-independent method to derive effective atomic C{sub 6} coefficients and polarizabilities in molecules and materials purely from charge population analysis. This enables the use of dispersion-correction schemes in electronic structure calculations without recourse to electron-density partitioning schemes and expands their applicability to semi-empirical methods and tight-binding Hamiltonians. We show that the accuracy of our method is en par with established electron-density partitioning based approaches in describing intermolecular C{sub 6} coefficients as well as dispersion energies of weakly bound molecular dimers, organic crystals, and supramolecular complexes. We showcase the utility of our approach by incorporation of the recentlymore » developed many-body dispersion method [Tkatchenko et al., Phys. Rev. Lett. 108, 236402 (2012)] into the semi-empirical density functional tight-binding method and propose the latter as a viable technique to study hybrid organic-inorganic interfaces.« less

Evaluation of a novel electronic eigenvalue (EEVA) molecular descriptor for QSAR/QSPR studies: validation using a benchmark steroid data set.

PubMed

Tuppurainen, Kari; Viisas, Marja; Laatikainen, Reino; Peräkylä, Mikael

2002-01-01

A novel electronic eigenvalue (EEVA) descriptor of molecular structure for use in the derivation of predictive QSAR/QSPR models is described. Like other spectroscopic QSAR/QSPR descriptors, EEVA is also invariant as to the alignment of the structures concerned. Its performance was tested with respect to the CBG (corticosteroid binding globulin) affinity of 31 benchmark steroids. It appeared that the electronic structure of the steroids, i.e., the "spectra" derived from molecular orbital energies, is directly related to the CBG binding affinities. The predictive ability of EEVA is compared to other QSAR approaches, and its performance is discussed in the context of the Hammett equation. The good performance of EEVA is an indication of the essential quantum mechanical nature of QSAR. The EEVA method is a supplement to conventional 3D QSAR methods, which employ fields or surface properties derived from Coulombic and van der Waals interactions.

Targeted conjugation of breast anticancer drug tamoxifen and its metabolites with synthetic polymers.

PubMed

Sanyakamdhorn, S; Agudelo, D; Bekale, L; Tajmir-Riahi, H A

2016-09-01

Conjugation of antitumor drug tamoxifen and its metabolites, 4-hydroxytamxifen and ednoxifen with synthetic polymers poly(ethylene glycol) (PEG), methoxypoly (ethylene glycol) polyamidoamine (mPEG-PAMAM-G3) and polyamidoamine (PAMAM-G4) dendrimers was studied in aqueous solution at pH 7.4. Multiple spectroscopic methods, transmission electron microscopy (TEM) and molecular modeling were used to characterize the drug binding process to synthetic polymers. Structural analysis showed that drug-polymer binding occurs via both H-bonding and hydrophobic contacts. The order of binding is PAMAM-G4>mPEG-PAMAM-G3>PEG-6000 with 4-hydroxttamoxifen forming more stable conjugate than tamoxifen and endoxifen. Transmission electron microscopy showed significant changes in carrier morphology with major changes in the shape of the polymer aggregate as drug encapsulation occurred. Modeling also showed that drug is located in the surface and in the internal cavities of PAMAM with the free binding energy of -3.79 for tamoxifen, -3.70 for 4-hydroxytamoxifen and -3.69kcal/mol for endoxifen, indicating of spontaneous drug-polymer interaction at room temperature. Copyright © 2016 Elsevier B.V. All rights reserved.

A framework for stochastic simulations and visualization of biological electron-transfer dynamics

NASA Astrophysics Data System (ADS)

Nakano, C. Masato; Byun, Hye Suk; Ma, Heng; Wei, Tao; El-Naggar, Mohamed Y.

2015-08-01

Electron transfer (ET) dictates a wide variety of energy-conversion processes in biological systems. Visualizing ET dynamics could provide key insight into understanding and possibly controlling these processes. We present a computational framework named VizBET to visualize biological ET dynamics, using an outer-membrane Mtr-Omc cytochrome complex in Shewanella oneidensis MR-1 as an example. Starting from X-ray crystal structures of the constituent cytochromes, molecular dynamics simulations are combined with homology modeling, protein docking, and binding free energy computations to sample the configuration of the complex as well as the change of the free energy associated with ET. This information, along with quantum-mechanical calculations of the electronic coupling, provides inputs to kinetic Monte Carlo (KMC) simulations of ET dynamics in a network of heme groups within the complex. Visualization of the KMC simulation results has been implemented as a plugin to the Visual Molecular Dynamics (VMD) software. VizBET has been used to reveal the nature of ET dynamics associated with novel nonequilibrium phase transitions in a candidate configuration of the Mtr-Omc complex due to electron-electron interactions.

Electronic conductance of a poly(p-phenylene)-like nanowire in the presence of thermal atomic vibrations

NASA Astrophysics Data System (ADS)

Shariati, Ashrafalsadat; Rabani, Hassan; Mardaani, Mohammad

2017-10-01

We present a theoretical method based on Green’s function technique and tight-binding approach as well as harmonic approximation in order to calculate the coherent electronic conductance of an extended poly(p-phenylene) oligomer in the presence of thermal atomic vibrations. We study two proposed mass-spring models for atomic vibrations: one, including rigid benzene rings connected to each other by vibrating bonds; and in another, the bonds along the oligomer vibrate even in the benzene rings. The electron-phonon (e-ph) interaction influences the electron hopping energies linearly with respect to atomic displacements. The model shows that the conductance spectra exhibit some new energy gaps in the presence of e-ph interaction even at zero temperature. The conductance is more affected by e-ph interaction when the atomic vibrations are supposed to be present in the benzene rings. At the edges of the band energy and central gap, the phonon-assisted phenomena can be observed. Generally, the increasing e-ph interaction strength as well as temperature destroys the electronic conductance especially in the resonance region.

Electronic transport in smectic liquid crystals

NASA Astrophysics Data System (ADS)

Shiyanovskaya, I.; Singer, K. D.; Twieg, R. J.; Sukhomlinova, L.; Gettwert, V.

2002-04-01

Time-of-flight measurements of transient photoconductivity have revealed bipolar electronic transport in phenylnaphthalene and biphenyl liquid crystals (LC), which exhibit several smectic mesophases. In the phenylnaphthalene LC, the hole mobility is significantly higher than the electron mobility and exhibits different temperature and phase behavior. Electron mobility in the range ~10-5 cm2/V s is temperature activated and remains continuous at the phase transitions. However, hole mobility is nearly temperature independent within the smectic phases, but is very sensitive to smectic order, 10-3 cm2/V s in the smectic-B (Sm-B) and 10-4 cm2/V s in the smectic-A (Sm-A) mesophases. The different behavior for holes and electron transport is due to differing transport mechanisms. The electron mobility is apparently controlled by rate-limiting multiple shallow trapping by impurities, but hole mobility is not. To explain the lack of temperature dependence for hole mobility within the smectic phases we consider two possible polaron transport mechanisms. The first mechanism is based on the hopping of Holstein small polarons in the nonadiabatic limit. The polaron binding energy and transfer integral values, obtained from the model fit, turned out to be sensitive to the molecular order in smectic mesophases. A second possible scenario for temperature-independent hole mobility involves the competion between two different polaron mechanisms involving so-called nearly small molecular polarons and small lattice polarons. Although the extracted transfer integrals and binding energies are reasonable and consistent with the model assumptions, the limited temperature range of the various phases makes it difficult to distinguish between any of the models. In the biphenyl LCs both electron and hole mobilities exhibit temperature activated behavior in the range of 10-5 cm2/V s without sensitivity to the molecular order. The dominating transport mechanism is considered as multiple trapping in the impurity sites. Temperature-activated mobility was treated within the disorder formalism, and activation energy and width of density of states have been calculated.

Negative Ion Photoelectron Spectroscopy Reveals Remarkable Noninnocence of Ligands in Nickel Bis(dithiolene) Complexes [Ni(dddt) 2 ] - and [Ni(edo) 2 ] -

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Xing; Hou, Gao-Lei; Wang, Xuefeng

2016-04-21

[Ni(dddt) 2] – (dddt = 5,6-dihydro-1,4-dithiine-2,3-dithiolate) and [Ni(edo) 2] – (edo = 5,6-dihydro-1,4-dioxine-2,3-dithiolate) are two donor-type nickel bis(dithiolene) complexes, with the tendency of donating low binding energy electrons. These two structurally similar complexes differ only with respect to the outer atoms in the ligand framework where the former has four S atoms while the latter has four O atoms. Herein, we report a negative ion photoelectron spectroscopy (NIPES) study on these two complexes to probe electronic structures of the anions and their corresponding neutrals. The NIPE spectra exhibit the adiabatic electron detachment energy (ADE) or, equivalently, the electron affinity (EA)more » of the neutral [Ni(L) 2] 0 to be relatively low for this type complexes, 2.780 and 2.375 eV for L = dddt and edo, respectively. The 0.4 eV difference in ADEs shows significant substitution effect for sulfur in dddt by oxygen in edo, i.e., noninnocence of the ligands, which has decreased the electronic stability of [Ni(edo) 2] – by lowering its electron binding energy by ~0.4 eV. The observed substitution effect on gas-phase EA values correlates well with the measured redox potentials for [Ni(dddt) 2] –/0 and [Ni(edo) 2] –/0 in solutions. The singlet-triplet splitting (ΔE ST) of [Ni(dddt) 2] 0 and [Ni(edo) 2] 0 is also determined from the spectra to be 0.57 and 0.53 eV, respectively. Accompanying DFT calculations and molecular orbital (MO) composition analyses show significant ligand contributions to the redox MOs and allow the components of the orbitals involved in each electronic transition and spectral assignments to be identified.« less

Adsorption of magnetic transition metals on borophene: an ab initio study

NASA Astrophysics Data System (ADS)

Tomar, Shalini; Rastogi, Priyank; Bhadoria, Bhagirath Singh; Bhowmick, Somnath; Chauhan, Yogesh Singh; Agarwal, Amit

2018-03-01

We explore the doping strategy for adsorbing different metallic 3d transition-metal atoms (Fe, Co and Ni) on two different polymorphs of borophene monolayer: 2-Pmmn and 8-Pmmn borophene. Both have energy dispersion, with 2-Pmmn borophene being metallic in nature, and 8-Pmmn borophene being semi-metallic with a tilted Dirac cone like dispersion. Using density functional theory based calculations, we find the most suitable adsorption site for each adatom, and calculate the binding energy, binding energy per atom, charge transfer, density of states and magnetic moment of the resulting borophene-adatom system. We show that Ni is the most effective for electron doping for both the polymorphs. Additionally Fe is the most suitable to magnetically dope 8-Pmmn borophene, while Co is the best for magnetically doping 2-Pmmn borophene.

Development of many-body polarizable force fields for Li-battery components: 1. Ether, alkane, and carbonate-based solvents.

PubMed

Borodin, Oleg; Smith, Grant D

2006-03-30

Classical many-body polarizable force fields were developed for n-alkanes, perflouroalkanes, polyethers, ketones, and linear and cyclic carbonates on the basis of quantum chemistry dimer energies of model compounds and empirical thermodynamic liquid-state properties. The dependence of the electron correlation contribution to the dimer binding energy on basis-set size and level of theory was investigated as a function of molecular separation for a number of alkane, ether, and ketone dimers. Molecular dynamics (MD) simulations of the force fields accurately predicted structural, dynamic, and transport properties of liquids and unentangled polymer melts. On average, gas-phase dimer binding energies predicted with the force field were between those from MP2/aug-cc-pvDz and MP2/aug-cc-pvTz quantum chemistry calculations.

Platinum Monolayer Shell on Non-Noble Metal Core Electrocatalysts for the Hydrogen Oxidation Reaction

NASA Astrophysics Data System (ADS)

Teeluck, Krishani Malini

According to the United States Environmental Protection Agency, as of 2015, transportation accounted for 32% of the carbon dioxide emissions in the United States (and all carbon dioxide emissions in the U.S. accounted for 82.2% of all greenhouse gases from human activity). A hydrogen fuel cell is a device that efficiently produces electrical energy directly from a chemical reaction, with zero carbon emissions, and therefore holds great promise in alleviating our dependence on harmful use of energy sources. Due to their clean emissions and high efficiencies, there has been focus on the hydrogen fuel cell for vehicle applications using proton exchange membrane and alkaline fuel cells. Although the proton exchange membrane fuel cell is currently being used in vehicles, their high cost limits their feasibility in the market. This has inspired the development of the alkaline fuel cell whose efficiency and simplicity suggest the possibility of manufacturing high power fuel cell vehicles at a low cost, since the electrocatalysts in the alkaline fuel cell can be made from non-noble metals. Although the hydrogen oxidation reaction is one of the fastest electrochemical reactions in acidic media, it is two orders of magnitude slower in alkaline media, which hinders the overall efficiency of the alkaline fuel cell. Pure platinum is currently the best catalyst for the hydrogen oxidation reaction, but platinum’s high cost and rarity yields economic issues, rendering the technology futile if it cannot be commercialized. Furthermore, platinum’s hydrogen binding energy is slightly stronger than the optimal hydrogen binding energy. As the hydrogen oxidation reaction happens only on the surface of the catalyst, there is no need for platinum content beyond the exterior. Since tungsten and nickel are cheap, as well as abundant, they are ideal elements to replace the core of the catalyst with, while leaving a platinum shell surrounding this core. The activity of the hydrogen oxidation reaction when using a platinum monolayer shell on a nickel tungsten core electrocatalyst is explored, and it was found that the novel catalyst created here exhibits kinetics that rival pure platinum, but at less than half the platinum content, suggesting that nickel and tungsten modify the electronic properties of platinum in a way that enhances its activity for the hydrogen oxidation reaction. Furthermore, the hydrogen binding energy of this novel electrocatalyst was found to be weaker than the optimal binding energy (rather than stronger, as seen in pure platinum), indicating the possibility of modifying the electronic properties of platinum for a more optimal hydrogen binding energy.

Doping Induced Structural Stability and Electronic Properties of GaN Nanotubes

PubMed Central

Khan, Mohammad Irfan; Tyagi, Neha; Swaroop Khare, Purnima

2014-01-01

The present paper discusses the effect of manganese doping on the structural stability and electronic band gap of chiral (2, 1), armchair (3, 3), and zigzag ((6, 0) and (10, 0)) single walled GaN nanotube by using density functional theory based Atomistix Toolkit (ATK) Virtual NanoLab (VNL). The structural stability has been analyzed in terms of minimum ground state total energy, binding, and formation energy. As an effect of Mn doping (1–4 atoms), all the GaN nanotubes taken into consideration show semiconducting to metallic transition first and after certain level of Mn doping changes its trend. PMID:24707225

Energy-resolved collision-induced dissociation studies of 1,10-phenanthroline complexes of the late first-row divalent transition metal cations: determination of the third sequential binding energies.

PubMed

Nose, Holliness; Chen, Yu; Rodgers, M T

2013-05-23

The third sequential binding energies of the late first-row divalent transition metal cations to 1,10-phenanthroline (Phen) are determined by energy-resolved collision-induced dissociation (CID) techniques using a guided ion beam tandem mass spectrometer. Five late first-row transition metal cations in their +2 oxidation states are examined including: Fe(2+), Co(2+), Ni(2+), Cu(2+), and Zn(2+). The kinetic energy dependent CID cross sections for loss of an intact Phen ligand from the M(2+)(Phen)3 complexes are modeled to obtain 0 and 298 K bond dissociation energies (BDEs) after accounting for the effects of the internal energy of the complexes, multiple ion-neutral collisions, and unimolecular decay rates. Electronic structure theory calculations at the B3LYP, BHandHLYP, and M06 levels of theory are employed to determine the structures and theoretical estimates for the first, second, and third sequential BDEs of the M(2+)(Phen)x complexes. B3LYP was found to deliver results that are most consistent with the measured values. Periodic trends in the binding of these complexes are examined and compared to the analogous complexes to the late first-row monovalent transition metal cations, Co(+), Ni(+), Cu(+), and Zn(+), previously investigated.

Strontium and barium in aqueous solution and a potassium channel binding site

NASA Astrophysics Data System (ADS)

Chaudhari, Mangesh I.; Rempe, Susan B.

2018-06-01

Ion hydration structure and free energy establish criteria for understanding selective ion binding in potassium (K+) ion channels and may be significant to understanding blocking mechanisms as well. Recently, we investigated the hydration properties of Ba2+, the most potent blocker of K+ channels among the simple metal ions. Here, we use a similar method of combining ab initio molecular dynamics simulations, statistical mechanical theory, and electronic structure calculations to probe the fundamental hydration properties of Sr2+, which does not block bacterial K+ channels. The radial distribution of water around Sr2+ suggests a stable 8-fold geometry in the local hydration environment, similar to Ba2+. While the predicted hydration free energy of -331.8 kcal/mol is comparable with the experimental result of -334 kcal/mol, the value is significantly more favorable than the -305 kcal/mol hydration free energy of Ba2+. When placed in the innermost K+ channel blocking site, the solvation free energies and lowest energy structures of both Sr2+ and Ba2+ are nearly unchanged compared with their respective hydration properties. This result suggests that the block is not attributable to ion trapping due to +2 charge, and differences in blocking behavior arise due to free energies associated with the exchange of water ligands for channel ligands instead of free energies of transfer from water to the binding site.

Plastoquinol diffusion in linear photosynthetic electron transport

PubMed Central

Mitchell, Rowan; Spillmann, Andreas; Haehnel, Wolfgang

1990-01-01

The diffusion of plastoquinol and its binding to the cytochrome bf complex, which occurs during linear photosynthetic electron transport and is analogous to reaction sequences found in most energy-converting membranes, has been studied in intact thylakoid membranes. The flash-induced electron transfer between the laterally separated photosystems II and photosystems I was measured by following the sigmoidal reduction kinetics of P-700+ after previous oxidation of the intersystem electron carriers. The amount of flash-induced plastoquinol produced at photosystem II was (a) reduced by inhibition with dichlorophenyl-dimethylurea and (b) increased by giving a second saturating flash. These signals were simulated by a new model which combines a deterministic simulation of reaction kinetics with a Monte Carlo approach to the diffusion of plastoquinol, taking into account the known structural features of the thylakoid membrane. The plastoquinol molecules were assumed to be oxidized by either a diffusion-limited or a nondiffusion-limited step in a collisional mechanism or after binding to the cytochrome bf complex. The model was able to account for the experimental observations with a nondiffusion-limited collisional mechanism or with a binding mechanism, giving minimum values for the diffusion coefficient of plastoquinol of 2 × 10-8 cm2s-1 and 3 × 10-7 cm2s-1, respectively. PMID:19431770

Dissipative time-dependent quantum transport theory.

PubMed

Zhang, Yu; Yam, Chi Yung; Chen, GuanHua

2013-04-28

A dissipative time-dependent quantum transport theory is developed to treat the transient current through molecular or nanoscopic devices in presence of electron-phonon interaction. The dissipation via phonon is taken into account by introducing a self-energy for the electron-phonon coupling in addition to the self-energy caused by the electrodes. Based on this, a numerical method is proposed. For practical implementation, the lowest order expansion is employed for the weak electron-phonon coupling case and the wide-band limit approximation is adopted for device and electrodes coupling. The corresponding hierarchical equation of motion is derived, which leads to an efficient and accurate time-dependent treatment of inelastic effect on transport for the weak electron-phonon interaction. The resulting method is applied to a one-level model system and a gold wire described by tight-binding model to demonstrate its validity and the importance of electron-phonon interaction for the quantum transport. As it is based on the effective single-electron model, the method can be readily extended to time-dependent density functional theory.

Insights into the binding behavior of native and non-native cytochromes to photosystem I from Thermosynechococcus elongatus.

PubMed

Kölsch, Adrian; Hejazi, Mahdi; Stieger, Kai R; Feifel, Sven C; Kern, Jan F; Müh, Frank; Lisdat, Fred; Lokstein, Heiko; Zouni, Athina

2018-06-08

The binding of photosystem I (PS I) from Thermosynechococcus elongatus to the native cytochrome (cyt) c 6 and cyt c from horse heart (cyt c HH ) was analyzed by oxygen consumption measurements, isothermal titration calorimetry (ITC), and rigid body docking combined with electrostatic computations of binding energies. Although PS I has a higher affinity for cyt c HH than for cyt c 6 , the influence of ionic strength and pH on binding is different in the two cases. ITC and theoretical computations revealed the existence of unspecific binding sites for cyt c HH besides one specific binding site close to P 700 Binding to PS I was found to be the same for reduced and oxidized cyt c HH Based on this information, suitable conditions for cocrystallization of cyt c HH with PS I were found, resulting in crystals with a PS I:cyt c HH ratio of 1:1. A crystal structure at 3.4-Å resolution was obtained, but cyt c HH cannot be identified in the electron density map because of unspecific binding sites and/or high flexibility at the specific binding site. Modeling the binding of cyt c 6 to PS I revealed a specific binding site where the distance and orientation of cyt c 6 relative to P 700 are comparable with cyt c 2 from purple bacteria relative to P 870 This work provides new insights into the binding modes of different cytochromes to PS I, thus facilitating steps toward solving the PS I-cyt c costructure and a more detailed understanding of natural electron transport processes.

High-resolution photoluminescence spectroscopy of Sn-doped ZnO single crystals

DOE PAGES

Kumar, E. Senthil; Mohammadbeigi, F.; Boatner, Lynn A.; ...

2016-01-01

Here, Group IV donors in ZnO are poorly understood, despite evidence that they are effective n-dopants. We present high-resolution photoluminescence spectroscopy studies of unintentionally doped and Sn doped ZnO single crystals grown by the chemical vapor transport method. Doped samples showed greatly increased emission from the I10 bound exciton transition which was recently proven to be related to the incorporation of Sn impurities based on radio-isotope studies. PL linewidths are exceptionally sharp for these samples, enabling clear identification of several donor species. Temperature dependent PL measurements of the I10 line emission energy and intensity dependence reveal a behavior similar tomore » other shallow donors in ZnO. Ionized donor bound exciton and two electron satellite transitions of the I10 transition are unambiguously identified and yield a donor binding energy of 71 meV. In contrast to recent reports of Ge-related donors in ZnO, the spectroscopic binding energy for the Sn-related donor bound exciton follows a linear relationship with donor binding energy (Haynes rule), confirming the shallow nature of this defect center, which we attribute to a SnZn double donor compensated by an unknown single acceptor.« less

Identification of the Catalytic Ubiquinone-binding Site of Vibrio cholerae Sodium-dependent NADH Dehydrogenase

PubMed Central

Tuz, Karina; Li, Chen; Fang, Xuan; Raba, Daniel A.; Liang, Pingdong; Minh, David D. L.; Juárez, Oscar

2017-01-01

The sodium-dependent NADH dehydrogenase (Na+-NQR) is a key component of the respiratory chain of diverse prokaryotic species, including pathogenic bacteria. Na+-NQR uses the energy released by electron transfer between NADH and ubiquinone (UQ) to pump sodium, producing a gradient that sustains many essential homeostatic processes as well as virulence factor secretion and the elimination of drugs. The location of the UQ binding site has been controversial, with two main hypotheses that suggest that this site could be located in the cytosolic subunit A or in the membrane-bound subunit B. In this work, we performed alanine scanning mutagenesis of aromatic residues located in transmembrane helices II, IV, and V of subunit B, near glycine residues 140 and 141. These two critical glycine residues form part of the structures that regulate the site's accessibility. Our results indicate that the elimination of phenylalanine residue 211 or 213 abolishes the UQ-dependent activity, produces a leak of electrons to oxygen, and completely blocks the binding of UQ and the inhibitor HQNO. Molecular docking calculations predict that UQ interacts with phenylalanine 211 and pinpoints the location of the binding site in the interface of subunits B and D. The mutagenesis and structural analysis allow us to propose a novel UQ-binding motif, which is completely different compared with the sites of other respiratory photosynthetic complexes. These results are essential to understanding the electron transfer pathways and mechanism of Na+-NQR catalysis. PMID:28053088

Energetic basis for the molecular-scale organization of bone.

PubMed

Tao, Jinhui; Battle, Keith C; Pan, Haihua; Salter, E Alan; Chien, Yung-Ching; Wierzbicki, Andrzej; De Yoreo, James J

2015-01-13

The remarkable properties of bone derive from a highly organized arrangement of coaligned nanometer-scale apatite platelets within a fibrillar collagen matrix. The origin of this arrangement is poorly understood and the crystal structures of hydroxyapatite (HAP) and the nonmineralized collagen fibrils alone do not provide an explanation. Moreover, little is known about collagen-apatite interaction energies, which should strongly influence both the molecular-scale organization and the resulting mechanical properties of the composite. We investigated collagen-mineral interactions by combining dynamic force spectroscopy (DFS) measurements of binding energies with molecular dynamics (MD) simulations of binding and atomic force microscopy (AFM) observations of collagen adsorption on single crystals of calcium phosphate for four mineral phases of potential importance in bone formation. In all cases, we observe a strong preferential orientation of collagen binding, but comparison between the observed orientations and transmission electron microscopy (TEM) analyses of native tissues shows that only calcium-deficient apatite (CDAP) provides an interface with collagen that is consistent with both. MD simulations predict preferred collagen orientations that agree with observations, and results from both MD and DFS reveal large values for the binding energy due to multiple binding sites. These findings reconcile apparent contradictions inherent in a hydroxyapatite or carbonated apatite (CAP) model of bone mineral and provide an energetic rationale for the molecular-scale organization of bone.

Models of charge pair generation in organic solar cells.

PubMed

Few, Sheridan; Frost, Jarvist M; Nelson, Jenny

2015-01-28

Efficient charge pair generation is observed in many organic photovoltaic (OPV) heterojunctions, despite nominal electron-hole binding energies which greatly exceed the average thermal energy. Empirically, the efficiency of this process appears to be related to the choice of donor and acceptor materials, the resulting sequence of excited state energy levels and the structure of the interface. In order to establish a suitable physical model for the process, a range of different theoretical studies have addressed the nature and energies of the interfacial states, the energetic profile close to the heterojunction and the dynamics of excited state transitions. In this paper, we review recent developments underpinning the theory of charge pair generation and phenomena, focussing on electronic structure calculations, electrostatic models and approaches to excited state dynamics. We discuss the remaining challenges in achieving a predictive approach to charge generation efficiency.

Electron correlation contribution to the physisorption of CO on MgF2(110).

PubMed

Hammerschmidt, Lukas; Müller, Carsten; Paulus, Beate

2012-03-28

We have performed CCSD(T), MP2, and DF-LMP2 calculations of the interaction energy of CO on the MgF(2)(110) surface by applying the method of increments and an embedded cluster model. In addition, we performed periodic HF, B3LYP, and DF-LMP2 calculations and compare them to the cluster results. The incremental CCSD(T) calculations predict an interaction energy of E(int) = -0.37 eV with a C-down orientation of CO above a Mg(2+) ion at the surface with a basis set of VTZ quality. We find that electron correlation constitutes about 50% of the binding energy and a detailed evaluation of the increments shows that the largest contribution to the correlation energy originates from the CO interaction with the closest F ions on the second layer.

Geometrical, electronic, and magnetic properties of CunFe (n=1-12) clusters: A density functional study

NASA Astrophysics Data System (ADS)

Ling, Wang; Dong, Die; Shi-Jian, Wang; Zheng-Quan, Zhao

2015-01-01

The geometrical, electronic, and magnetic properties of small CunFe (n=1-12) clusters have been investigated by using density functional method B3LYP and LanL2DZ basis set. The structural search reveals that Fe atoms in low-energy CunFe isomers tend to occupy the position with the maximum coordination number. The ground state CunFe clusters possess planar structure for n=2-5 and three-dimensional (3D) structure for n=6-12. The electronic properties of CunFe clusters are analyzed through the averaged binding energy, the second-order energy difference and HOMO-LUMO energy gap. It is found that the magic numbers of stability are 1, 3, 7 and 9 for the ground state CunFe clusters. The energy gap of Fe-encapsulated cage clusters is smaller than that of other configurations. The Cu5Fe and Cu7Fe clusters have a very large energy gap (>2.4 eV). The vertical ionization potential (VIP), electron affinity (EA) and photoelectron spectra are also calculated and simulated theoretically for all the ground-state clusters. The magnetic moment analyses for the ground-state CunFe clusters show that Fe atom can enhance the magnetic moment of the host cluster and carries most of the total magnetic moment.

Spectra of electrons emitted as a result of the sticking and annihilation of low energy positrons to the surfaces of graphene and highly oriented pyrolytic graphite (HOPG)

NASA Astrophysics Data System (ADS)

Chrysler, M.; Chirayath, V.; McDonald, A.; Lim, Z.; Shastry, K.; Gladen, R.; Fairchild, A.; Koymen, A.; Weiss, A.

Positron annihilation induced Auger electron spectroscopy (PAES) was used to study the positron induced low energy electron spectra from HOPG and a sample composed of 6-8 layers of graphene grown on polycrystalline copper. A low energy (~2eV) beam of positrons was used to implant positrons into a surface localized state on the graphene and HOPG samples. Measurements of the energy spectra of the positron induced electrons obtained using a TOF spectrometer indicate the presence of an annihilation induced KLL C Auger peak (at ~263 eV) along with a narrow low energy secondary peak due to an Auger mediated positron sticking (AMPS) process. A broad spectral feature was also observed below ~15 eV which we believe may be due to a VVV C Auger transition not previously observed. The energy dependence of the integrated intensity of the AMPS peak was measured for a series of incident positron kinetic energies ranging from ~1.5 eV up to 11 eV from which the binding energy of the surface localized positron state on graphene and HOPG was estimated. The implication of our results regarding the applicability of AMPS and PAES to the study of graphene surfaces and interfaces will be discussed. This work was supported by NSF Grant No. DMR 1508719 and DMR 1338130.

High-potential perfluorinated phthalocyanine-fullerene dyads for generation of high-energy charge-separated states: formation and photoinduced electron-transfer studies.

PubMed

Das, Sushanta K; Mahler, Andrew; Wilson, Angela K; D'Souza, Francis

2014-08-25

High oxidation potential perfluorinated zinc phthalocyanines (ZnF(n)Pcs) are synthesised and their spectroscopic, redox, and light-induced electron-transfer properties investigated systematically by forming donor-acceptor dyads through metal-ligand axial coordination of fullerene (C60) derivatives. Absorption and fluorescence spectral studies reveal efficient binding of the pyridine- (Py) and phenylimidazole-functionalised fullerene (C60Im) derivatives to the zinc centre of the F(n)Pcs. The determined binding constants, K, in o-dichlorobenzene for the 1:1 complexes are in the order of 10(4) to 10(5) M(-1); nearly an order of magnitude higher than that observed for the dyad formed from zinc phthalocyanine (ZnPc) lacking fluorine substituents. The geometry and electronic structure of the dyads are determined by using the B3LYP/6-31G* method. The HOMO and LUMO levels are located on the Pc and C60 entities, respectively; this suggests the formation of ZnF(n)Pc(.+)-C60Im(.-) and ZnF(n)Pc(.+)-C60Py(.-) (n=0, 8 or 16) intra-supramolecular charge-separated states during electron transfer. Electrochemical studies on the ZnPc-C60 dyads enable accurate determination of their oxidation and reduction potentials and the energy of the charge-separated states. The energy of the charge-separated state for dyads composed of ZnF(n)Pc is higher than that of normal ZnPc-C60 dyads and reveals their significance in harvesting higher amounts of light energy. Evidence for charge separation in the dyads is secured from femtosecond transient absorption studies in nonpolar toluene. Kinetic evaluation of the cation and anion radical ion peaks reveals ultrafast charge separation and charge recombination in dyads composed of perfluorinated phthalocyanine and fullerene; this implies their significance in solar-energy harvesting and optoelectronic device building applications. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ren, Xueguang, E-mail: xue.g.ren@ptb.de; Pflüger, Thomas; Weyland, Marvin

We study the low-energy (E{sub 0} = 26 eV) electron-impact induced ionization and fragmentation of tetrahydrofuran using a reaction microscope. All three final-state charged particles, i.e., two outgoing electrons and one fragment ion, are detected in triple coincidence such that the momentum vectors and, consequently, the kinetic energies for charged reaction products are determined. The ionic fragments are clearly identified in the experiment with a mass resolution of 1 amu. The fragmentation pathways of tetrahydrofuran are investigated by measuring the ion kinetic energy spectra and the binding energy spectra where an energy resolution of 1.5 eV has been achieved usingmore » the recently developed photoemission electron source. Here, we will discuss the fragmentation reactions for the cations C{sub 4}H{sub 8}O{sup +}, C{sub 4}H{sub 7}O{sup +}, C{sub 2}H{sub 3}O{sup +}, C{sub 3}H{sub 6}{sup +}, C{sub 3}H{sub 5}{sup +}, C{sub 3}H{sub 3}{sup +}, CH{sub 3}O{sup +}, CHO{sup +}, and C{sub 2}H{sub 3}{sup +}.« less

Evidence for a positron bound state on the surface of a topological insulator

NASA Astrophysics Data System (ADS)

Shastry, K.; Weiss, A. H.; Barbiellini, B.; Assaf, B. A.; Lim, Z. H.; Joglekar, P. V.; Heiman, D.

2015-06-01

We describe experiments aimed at probing the sticking of positrons to the surfaces of topological insulators using the Positron Annihilation induced Auger Electron Spectrometer (PAES). A magnetically guided beam was used to deposit positrons at the surface of Bi2Te2Se sample at energy of ∼2eV. Peaks observed in the energy spectra and intensities of electrons emitted as a result of positron annihilation showed peaks at energies corresponding to Auger peaks in Bi, Teand Se providing clear evidence of Auger emission associated with the annihilation of positrons in a surface bound state. Theoretical estimates of the binding energy of this state are compared with estimates obtained by measuring the incident beam energy threshold for secondary electron emission and the temperature dependence positronium(Ps) emission. The experiments provide strong evidence for the existence of a positron bound state at the surface of Bi2Te2Se and indicate the practicality of using positron annihilation to selectively probe the critically important top most layer of topological insulator system.

The in Silico Insight into Carbon Nanotube and Nucleic Acid Bases Interaction.

PubMed

Karimi, Ali Asghar; Ghalandari, Behafarid; Tabatabaie, Seyed Saleh; Farhadi, Mohammad

2016-05-01

To explore practical applications of carbon nanotubes (CNTs) in biomedical fields the properties of their interaction with biomolecules must be revealed. Recent years, the interaction of CNTs with biomolecules is a subject of research interest for practical applications so that previous research explored that CNTs have complementary structure properties with single strand DNA (ssDNA). Hence, the quantum mechanics (QM) method based on ab initio was used for this purpose. Therefore values of binding energy, charge distribution, electronic energy and other physical properties of interaction were studied for interaction of nucleic acid bases and SCNT. In this study, the interaction between nucleic acid bases and a (4, 4) single-walled carbon nanotube (SCNT) were investigated through calculations within quantum mechanics (QM) method at theoretical level of Hartree-Fock (HF) method using 6-31G basis set. Hence, the physical properties such as electronic energy, total dipole moment, charge distributions and binding energy of nucleic acid bases interaction with SCNT were investigated based on HF method. It has been found that the guanine base adsorption is bound stronger to the outer surface of nanotube in comparison to the other bases, consistent with the recent theoretical studies. In the other words, the results explored that guanine interaction with SCNT has optimum level of electronic energy so that their interaction is stable. Also, the calculations illustrated that SCNT interact to nucleic acid bases by noncovalent interaction because of charge distribution an electrostatic area is created in place of interaction. Consequently, small diameter SCNT interaction with nucleic acid bases is noncovalent. Also, the results revealed that small diameter SCNT interaction especially SCNT (4, 4) with nucleic acid bases can be useful in practical application area of biomedical fields such detection and drug delivery.

Barrier-free proton transfer in the valence anion of 2'-deoxyadenosine-5'-monophosphate. II. A computational study.

PubMed

Kobyłecka, Monika; Gu, Jiande; Rak, Janusz; Leszczynski, Jerzy

2008-01-28

The propensity of four representative conformations of 2(')-deoxyadenosine-5(')-monophosphate (5(')-dAMPH) to bind an excess electron has been studied at the B3LYP6-31++G(d,p) level. While isolated canonical adenine does not support stable valence anions in the gas phase, all considered neutral conformations of 5(')-dAMPH form adiabatically stable anions. The type of an anionic 5(')-dAMPH state, i.e., the valence, dipole bound, or mixed (valence/dipole bound), depends on the internal hydrogen bond(s) pattern exhibited by a particular tautomer. The most stable anion results from an electron attachment to the neutral syn-south conformer. The formation of this anion is associated with a barrier-free proton transfer triggered by electron attachment and the internal rotation around the C4(')-C5(') bond. The adiabatic electron affinity of the a_south-syn anion is 1.19 eV, while its vertical detachment energy is 1.89 eV. Our results are compared with the photoelectron spectrum (PES) of 5(')-dAMPH(-) measured recently by Stokes et al., [J. Chem. Phys. 128, 044314 (2008)]. The computational VDE obtained for the most stable anionic structure matches well with the experimental electron binding energy region of maximum intensity. A further understanding of DNA damage might require experimental and computational studies on the systems in which purine nucleotides are engaged in hydrogen bonding.

Barrier-free proton transfer in the valence anion of 2'-deoxyadenosine-5'-monophosphate. II. A computational study

NASA Astrophysics Data System (ADS)

Kobyłecka, Monika; Gu, Jiande; Rak, Janusz; Leszczynski, Jerzy

2008-01-01

The propensity of four representative conformations of 2'-deoxyadenosine-5'-monophosphate (5'-dAMPH) to bind an excess electron has been studied at the B3LYP /6-31++G(d,p) level. While isolated canonical adenine does not support stable valence anions in the gas phase, all considered neutral conformations of 5'-dAMPH form adiabatically stable anions. The type of an anionic 5'-dAMPH state, i.e., the valence, dipole bound, or mixed (valence/dipole bound), depends on the internal hydrogen bond(s) pattern exhibited by a particular tautomer. The most stable anion results from an electron attachment to the neutral syn-south conformer. The formation of this anion is associated with a barrier-free proton transfer triggered by electron attachment and the internal rotation around the C4'-C5' bond. The adiabatic electron affinity of the a&barbelow;south-syn anion is 1.19eV, while its vertical detachment energy is 1.89eV. Our results are compared with the photoelectron spectrum (PES) of 5'-dAMPH- measured recently by Stokes et al., [J. Chem. Phys. 128, 044314 (2008)]. The computational VDE obtained for the most stable anionic structure matches well with the experimental electron binding energy region of maximum intensity. A further understanding of DNA damage might require experimental and computational studies on the systems in which purine nucleotides are engaged in hydrogen bonding.

Study of positron annihilation with core electrons at the clean and oxygen covered Ag(001) surface

NASA Astrophysics Data System (ADS)

Joglekar, P.; Shastry, K.; Olenga, A.; Fazleev, N. G.; Weiss, A. H.

2013-03-01

In this paper we present measurements of the energy spectrum of electrons emitted as a result of Positron Annihilation Induce Auger Electron Emission from a clean and oxygen covered Ag (100) surface using a series of incident beam energies ranging from 20 eV down to 2 eV. A peak was observed at ~ 40 eV corresponding to the N23VV Auger transition in agreement with previous PAES studies. Experimental results were investigated theoretically by calculations of positron states and annihilation probabilities of surface-trapped positrons with relevant core electrons at the clean and oxygen covered Ag(100) surface. An ab-initio investigation of stability and associated electronic properties of different adsorption phases of oxygen on Ag(100) has been performed on the basis of density functional theory and using DMOl3 code. The computed positron binding energy, positron surface state wave function, and positron annihilation probabilities of surface trapped positrons with relevant core electrons demonstrate their sensitivity to oxygen coverage, elemental content, atomic structure of the topmost layers of surfaces, and charge transfer effects. Theoretical results are compared with experimental data. This work was supported in part by the National Science Foundation Grant # DMR-0907679.

An anomalous interlayer exciton in MoS2

NASA Astrophysics Data System (ADS)

Azhikodan, Dilna; Nautiyal, Tashi; Shallcross, Sam; Sharma, Sangeeta

2016-11-01

The few layer transition metal dichalcogenides are two dimensional materials that have an intrinsic gap of the order of ≈2 eV. The reduced screening in two dimensions implies a rich excitonic physics and, as a consequence, many potential applications in the field of opto-electronics. Here we report that a layer perpendicular electric field, by which the gap size in these materials can be efficiently controlled, generates an anomalous inter-layer exciton whose binding energy is independent of the gap size. We show this originates from the rich gap control and screening physics of TMDCs in a bilayer geometry: gating the bilayer acts on one hand to increase intra-layer screening by reducing the gap and, on the other hand, to decrease the inter-layer screening by field induced charge depletion. This constancy of binding energy is both a striking exception to the universal reduction in binding energy with gap size that all materials are believed to follow, as well as evidence of a degree of control over inter-layer excitons not found in their well studied intra-layer counterparts.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pogosov, Walter V.; Institute for Theoretical and Applied Electrodynamics, Russian Academy of Sciences, Izhorskaya 13, 125412 Moscow; Combescot, Monique

While the one-Cooper-pair problem is now a textbook exercise, the energy of two pairs of electrons with opposite spins and zero total momentum has not been derived yet, the exact handling of Pauli blocking between bound pairs being not that easy for N=2 already. The two-Cooper-pair problem however is quite enlightening to understand the very peculiar role played by the Pauli exclusion principle in superconductivity. Pauli blocking is known to drive the change from 1 to N pairs but no precise description of this continuous change has been given so far. Using Richardson's procedure, we here prove that Pauli blockingmore » increases the free part of the two-pair ground-state energy but decreases the binding part when compared to two isolated pairs--the excitation gap to break a pair however increasing from one to two pairs. When extrapolated to the dense BCS regime, the decrease in the pair binding while the gap increases strongly indicates that at odd with common belief, the average pair binding energy cannot be on the order of the gap.« less

Ab initio investigation of the ground and low-lying states of the diatomic fluorides TiF, VF, CrF, and MnF

NASA Astrophysics Data System (ADS)

Koukounas, Constantine; Kardahakis, Stavros; Mavridis, Aristides

2004-06-01

The electronic structure of the ground and low-lying states of the diatomic fluorides TiF, VF, CrF, and MnF was examined by multireference and coupled cluster methods in conjunction with extended basis sets. For a total of 34 states we report binding energies, spectroscopic constants, dipole moments, separation energies, and charge distributions. In addition, for all states we have constructed full potential curves. The suggested ground state binding energies of TiF(X 4Φ), VF(X 5Π), CrF(X 6Σ+), and MnF(X 7Σ+) are 135, 130, 110, and 108 kcal/mol, respectively, with first excited states A 4Σ-, A 5Δ, A 6Π, and a 5Σ+ about 2, 3, 23, and 19 kcal/mol higher. In essence all our numerical findings are in harmony with experimental results. For all molecules and states studied it is clear that the in situ metal atom (M) shows highly ionic character, therefore the binding is described realistically by M+F-.

Ab initio investigation of the ground and low-lying states of the diatomic fluorides TiF, VF, CrF, and MnF.

PubMed

Koukounas, Constantine; Kardahakis, Stavros; Mavridis, Aristides

2004-06-22

The electronic structure of the ground and low-lying states of the diatomic fluorides TiF, VF, CrF, and MnF was examined by multireference and coupled cluster methods in conjunction with extended basis sets. For a total of 34 states we report binding energies, spectroscopic constants, dipole moments, separation energies, and charge distributions. In addition, for all states we have constructed full potential curves. The suggested ground state binding energies of TiF(X (4)Phi), VF(X (5)Pi), CrF(X (6)Sigma(+)), and MnF(X (7)Sigma(+)) are 135, 130, 110, and 108 kcal/mol, respectively, with first excited states A (4)Sigma(-), A (5)Delta, A (6)Pi, and a (5)Sigma(+) about 2, 3, 23, and 19 kcal/mol higher. In essence all our numerical findings are in harmony with experimental results. For all molecules and states studied it is clear that the in situ metal atom (M) shows highly ionic character, therefore the binding is described realistically by M(+)F(-). (c) 2004 American Institute of Physics.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eilert, Andre; Cavalca, Filippo; Roberts, F. Sloan

Copper electrocatalysts derived from an oxide have shown extraordinary electrochemical properties for the carbon dioxide reduction reaction (CO 2RR). Using in situ ambient pressure X-ray photoelectron spectroscopy and quasi in situ electron energy-loss spectroscopy in a transmission electron microscope, we show that there is a substantial amount of residual oxygen in nanostructured, oxide-derived copper electrocatalysts but no residual copper oxide. On the basis of these findings in combination with density functional theory simulations, we propose that residual subsurface oxygen changes the electronic structure of the catalyst and creates sites with higher carbon monoxide binding energy. If such sites are stablemore » under the strongly reducing conditions found in CO 2RR, these findings would explain the high efficiencies of oxide-derived copper in reducing carbon dioxide to multicarbon compounds such as ethylene.« less

An ab initio study on MgX 3- and CaX 3- superhalogen anions (X=F, Cl, Br)

NASA Astrophysics Data System (ADS)

Anusiewicz, Iwona; Sobczyk, Monika; Dąbkowska, Iwona; Skurski, Piotr

2003-06-01

The vertical electron detachment energies (VDEs) of twenty MX 3- (M=Mg, Ca; X=F, Cl, Br) anions were calculated at the OVGF level with the 6-311++G(3df) basis sets. The largest vertical electron binding energy was found for MgF 3- system (8.793 eV). All negatively charged species possess the VDEs that are larger than 5.9 eV and thus may be termed superhalogen anions. The strong dependence of the VDE of the MX 3- species on the ligand-central atom (M-X) distance and on the partial atomic charge localized on Mg or Ca was observed and discussed, as well as the other factors that may influence the electronic stability of such anions.

Importance of conduction electron correlation in a Kondo lattice, Ce₂CoSi₃.

PubMed

Patil, Swapnil; Pandey, Sudhir K; Medicherla, V R R; Singh, R S; Bindu, R; Sampathkumaran, E V; Maiti, Kalobaran

2010-06-30

Kondo systems are usually described by the interaction of the correlation induced local moments with the highly itinerant conduction electrons. Here, we study the role of electron correlations among conduction electrons in the electronic structure of a Kondo lattice compound, Ce₂CoSi₃, using high resolution photoemission spectroscopy and ab initio band structure calculations, where Co 3d electrons contribute in the conduction band. High energy resolution employed in the measurements helped to reveal the signatures of Ce 4f states derived Kondo resonance features at the Fermi level and the dominance of Co 3d contributions at higher binding energies in the conduction band. The lineshape of the experimental Co 3d band is found to be significantly different from that obtained from the band structure calculations within the local density approximations, LDA. Consideration of electron-electron Coulomb repulsion, U, among Co 3d electrons within the LDA + U method leads to a better representation of experimental results. The signature of an electron correlation induced satellite feature is also observed in the Co 2p core level spectrum. These results clearly demonstrate the importance of the electron correlation among conduction electrons in deriving the microscopic description of such Kondo systems.

Energy and angular distributions of electron emission from diatomic molecules by bare ion impact

NASA Astrophysics Data System (ADS)

Mondal, A.; Mandal, C. R.; Purkait, M.

2015-06-01

The three-Coulomb wave model has been used extensively to study the energy and angular distributions of double-differential cross sections (DDCS) of electron emissions from hydrogen and nitrogen molecules by bare ion impact at intermediate and high energies. In the present model, we have expressed the molecular triple differential cross section in terms of the corresponding atomic triple differential cross section multiplied by the occupation number and the average Rayleigh interference factor, which accounts for the two-center interference effect. Here we have used an active electron approximation of the molecule as a whole in the initial channel. To account for the effect of passive electrons, we have constructed a model potential that satisfies the initial conditions and the corresponding wavefunction has been calculated from the model Hamiltonian of the active electron in the target. In the final channel, we have used a hydrogenic model with an effective nuclear charge that is calculated from its binding energy. In this model, the correlated motion of the particles in the exit channel of the reaction is considered by an adequate product of three-Coulomb functions. The emitted electron, the incident projectile ion and the residual ion are considered to be in same plane. The obtained results are compared with other recent theoretical and experimental findings. There is an overall agreement of the calculations with the experimental data for electron emission cross sections.

Designed Proteins as Optimized Oxygen Carriers for Artificial Blood

DTIC Science & Technology

2013-02-01

to the lower energy for electron transfer when coupled to a proton transfer from water (3). Thus we set out to compare the rate of solvent...binding affinities and reduction potentials are the sole result of differences in internal electric fields in these proteins wrought by the surface...serving as the source of potential energy for the hexa- to penta-coordinate conformational change, and one in which the b-position glutamates from

Electronic structure of a laterally graded ZrO2-TiO2 film on Si(100) prepared by metal-organic chemical vapor deposition in ultrahigh vacuum

NASA Astrophysics Data System (ADS)

Richter, J. H.; Karlsson, P. G.; Sandell, A.

2008-05-01

A TiO2-ZrO2 film with laterally graded stoichiometry has been prepared by metal-organic chemical vapor deposition in ultrahigh vacuum. The film was characterized in situ using synchrotron radiation photoelectron spectroscopy (PES) and x-ray absorption spectroscopy. PES depth profiling clearly shows that Ti ions segregate toward the surface region when mixed with ZrO2. The binding energy of the ZrO2 electronic levels is constant with respect to the local vacuum level. The binding energy of the TiO2 electronic levels is aligned to the Fermi level down to a Ti /Zr ratio of about 0.5. At a Ti /Zr ratio between 0.1 and 0.5, the TiO2 related electronic levels become aligned to the local vacuum level. The addition of small amounts of TiO2 to ZrO2 results in a ZrO2 band alignment relative to the Fermi level that is less asymmetric than for pure ZrO2. The band edge positions shift by -0.6eV for a Ti /Zr ratio of 0.03. This is explained in terms of an increase in the work function when adding TiO2, an effect that becomes emphasized by Ti surface segregation.

orbital selective correlation reduce in collapse tetragonal phase of CaFe2(As0.935P0.065)2 and electronic structure reconstruction studied by angel resolved photoemission spectroscopy

NASA Astrophysics Data System (ADS)

Zeng, Lingkun

We performed an angle-resolved photoemission spectroscopy (ARPES) study of the CaFe2(As0.935P0.065)2 in the collapse tetragonal(CT) phase and uncollapse tetragonal(UCT) phase. We find in the CT phase the electronic correlation dramatically reduces respective to UCT phase. Meanwhile, the reduction of correlation in CT phase show an orbital selective effect: correlation in dxy reduces the most, and then dxz/yz, while the one in dz2-r2 almost keeps the same. In CT phase, almost all bands sink downwards to higher binding energy, leading to the hole like bands around Brillouin zone(BZ) center sink below EF compared with UCT phase. However, the electron pocket around Brillouin Zone(BZ) corner(M) in UCT phase, forms a hole pocket around BZ center(Z point) in CT phase. Moreover, the dxy exhibits larger movement down to higher binding energy, resulting in farther away from dyz/xz and closer to dxy.We propose the electron filling ,namely high spin state in UCT phase to low spin state in CT phase(due to competing between crystal structure field and Hund's coupling), other than the Fermi surface nesting might be responsible for the absent of magnetic ordering.

Norbornane: An investigation into its valence electronic structure using electron momentum spectroscopy, and density functional and Green's function theories

NASA Astrophysics Data System (ADS)

Knippenberg, S.; Nixon, K. L.; Brunger, M. J.; Maddern, T.; Campbell, L.; Trout, N.; Wang, F.; Newell, W. R.; Deleuze, M. S.; Francois, J.-P.; Winkler, D. A.

2004-12-01

We report on the results of an exhaustive study of the valence electronic structure of norbornane (C7H12), up to binding energies of 29 eV. Experimental electron momentum spectroscopy and theoretical Green's function and density functional theory approaches were all utilized in this investigation. A stringent comparison between the electron momentum spectroscopy and theoretical orbital momentum distributions found that, among all the tested models, the combination of the Becke-Perdew functional and a polarized valence basis set of triple-ζ quality provides the best representation of the electron momentum distributions for all of the 20 valence orbitals of norbornane. This experimentally validated quantum chemistry model was then used to extract some chemically important properties of norbornane. When these calculated properties are compared to corresponding results from other independent measurements, generally good agreement is found. Green's function calculations with the aid of the third-order algebraic diagrammatic construction scheme indicate that the orbital picture of ionization breaks down at binding energies larger than 22.5 eV. Despite this complication, they enable insights within 0.2 eV accuracy into the available ultraviolet photoemission and newly presented (e,2e) ionization spectra, except for the band associated with the 1a2-1 one-hole state, which is probably subject to rather significant vibronic coupling effects, and a band at ˜25 eV characterized by a momentum distribution of "s-type" symmetry, which Green's function calculations fail to reproduce. We note the vicinity of the vertical double ionization threshold at ˜26 eV.

Theoretical analysis of the electronic properties of the sex pheromone and its analogue derivatives in the female processionary moth Thaumetopoea pytiocampa.

PubMed

Chamorro, Ester R; Sequeira, Alfredo F; Zalazar, M Fernanda; Peruchena, Nélida M

2008-09-15

In the present work, the distribution of the electronic charge density of the natural sex pheromone, the (Z)-13-hexadecen-11-ynyl acetate, in the female processionary moth, Thaumetopoea pytiocampa, and its nine analogue derivatives was studied within the framework of the Density Functional Theory and the Atoms in Molecules (AIM) Theory at B3LYP/6-31G *//B3LYP/6-31++G * * level. Additionally, molecular electrostatic potential (MEP) maps of the previously mentioned compounds were computed and compared. Furthermore, the substitution of hydrogen atoms from the methyl group in the acetate group by electron withdrawing substituents (i.e., halogen atoms) as well as the replacement effect of hydrogen by electron donor substituents (+I effect) as methyl group, were explored. The key feature of the topological distribution of the charge density in analogue compounds, such as the variations of the topological properties encountered in the region formed by neighbouring atoms from the substitution site were presented and discussed. Using topological parameters, such as electronic charge density, Laplacian, kinetic energy density, and potential energy density evaluated at bond critical points (BCP), we provide here a detailed analysis of the nature of the chemical bonding of these molecules. In addition, the atomic properties (population, charge, energy, volume, and dipole moment) were determined on selected atoms. These properties were analyzed at the substitution site (with respect to the natural sex pheromone) and related to the biological activity and to the possible binding site with the pheromone binding protein, (PBP). Moreover, the Laplacian function of the electronic density was used to locate electrophilic regions susceptible to be attacked (by deficient electron atoms or donor hydrogen). Our results indicate that the change in the atomic properties, such as electronic population and atomic volume, are sensitive indicators of the loss of the biological activity in the analogues studied here. The crucial interaction between the acetate group of the natural sex pheromone and the PBP is most likely to be a hydrogen bonding and the substitution of hydrogen atoms by electronegative atoms in the pheromone molecule reduces the hydrogen acceptor capacity. This situation is mirrored by the diminish of the electronic population on carbon and oxygen atoms at the carbonylic group in the halo-acetate group. Additionally, the modified acetate group (with electronegative atoms) shows new charge concentration critical points or regions of concentration of charge density in which an electrophilic attack can also occur. Finally, the use of the topological analysis based in the charge density distribution and its Laplacian function, in conjunction with MEP maps provides valuable information about the steric volume and electronic requirement of the sex pheromone for binding to the PBP.

Structure and binding energy of the H2S dimer at the CCSD(T) complete basis set limit.

PubMed

Lemke, Kono H

2017-06-21

This study presents results for the binding energy and geometry of the H 2 S dimer which have been computed using Møller-Plesset perturbation theory (MP2, MP4) and coupled cluster (CCSD, CCSD(T)) calculations with basis sets up to aug-cc-pV5Z. Estimates of D e , E ZPE , D o , and dimer geometry have been obtained at each level of theory by taking advantage of the systematic convergence behavior toward the complete basis set (CBS) limit. The CBS limit binding energy values of D e are 1.91 (MP2), 1.75 (MP4), 1.41 (CCSD), and 1.69 kcal/mol (CCSD[T]). The most accurate values for the equilibrium S-S distance r SS (without counterpoise correction) are 4.080 (MP2/aug-cc-pV5Z), 4.131 (MP4/aug-cc-pVQZ), 4.225 (CCSD/aug-cc-pVQZ), and 4.146 Å (CCSD(T)/aug-cc-pVQZ). This study also evaluates the effect of counterpoise correction on the H 2 S dimer geometry and binding energy. As regards the structure of (H 2 S) 2 , MPn, CCSD, and CCSD(T) level values of r SS , obtained by performing geometry optimizations on the counterpoise-corrected potential energy surface, converge systematically to CBS limit values of 4.099 (MP2), 4.146 (MP4), 4.233 (CCSD), and 4.167 Å (CCSD(T)). The corresponding CBS limit values of the equilibrium binding energy D e are 1.88 (MP2), 1.76 (MP4), 1.41 (CCSD), and 1.69 kcal/mol (CCSD(T)), the latter in excellent agreement with the measured binding energy value of 1.68 ± 0.02 kcal/mol reported by Ciaffoni et al. [Appl. Phys. B 92, 627 (2008)]. Combining CBS electronic binding energies D e with E ZPE predicted by CCSD(T) vibrational second-order perturbation theory calculations yields D o = 1.08 kcal/mol, which is around 0.6 kcal/mol smaller than the measured value of 1.7 ± 0.3 kcal/mol. Overall, the results presented here demonstrate that the application of high level calculations, in particular CCSD(T), in combination with augmented correlation consistent basis sets provides valuable insight into the structure and energetics of the hydrogen sulfide dimer.

Structure and binding energy of the H2S dimer at the CCSD(T) complete basis set limit

NASA Astrophysics Data System (ADS)

Lemke, Kono H.

2017-06-01

This study presents results for the binding energy and geometry of the H2S dimer which have been computed using Møller-Plesset perturbation theory (MP2, MP4) and coupled cluster (CCSD, CCSD(T)) calculations with basis sets up to aug-cc-pV5Z. Estimates of De, EZPE, Do, and dimer geometry have been obtained at each level of theory by taking advantage of the systematic convergence behavior toward the complete basis set (CBS) limit. The CBS limit binding energy values of De are 1.91 (MP2), 1.75 (MP4), 1.41 (CCSD), and 1.69 kcal/mol (CCSD[T]). The most accurate values for the equilibrium S-S distance rSS (without counterpoise correction) are 4.080 (MP2/aug-cc-pV5Z), 4.131 (MP4/aug-cc-pVQZ), 4.225 (CCSD/aug-cc-pVQZ), and 4.146 Å (CCSD(T)/aug-cc-pVQZ). This study also evaluates the effect of counterpoise correction on the H2S dimer geometry and binding energy. As regards the structure of (H2S)2, MPn, CCSD, and CCSD(T) level values of rSS, obtained by performing geometry optimizations on the counterpoise-corrected potential energy surface, converge systematically to CBS limit values of 4.099 (MP2), 4.146 (MP4), 4.233 (CCSD), and 4.167 Å (CCSD(T)). The corresponding CBS limit values of the equilibrium binding energy De are 1.88 (MP2), 1.76 (MP4), 1.41 (CCSD), and 1.69 kcal/mol (CCSD(T)), the latter in excellent agreement with the measured binding energy value of 1.68 ± 0.02 kcal/mol reported by Ciaffoni et al. [Appl. Phys. B 92, 627 (2008)]. Combining CBS electronic binding energies De with EZPE predicted by CCSD(T) vibrational second-order perturbation theory calculations yields Do = 1.08 kcal/mol, which is around 0.6 kcal/mol smaller than the measured value of 1.7 ± 0.3 kcal/mol. Overall, the results presented here demonstrate that the application of high level calculations, in particular CCSD(T), in combination with augmented correlation consistent basis sets provides valuable insight into the structure and energetics of the hydrogen sulfide dimer.

Structural and electronic properties of CdSe/ZnS and ZnS/CdSe core/shell nanowires via first principles study

NASA Astrophysics Data System (ADS)

Rehman, Shafiq Ur; Li, H. M.; Ding, Z. J.

2018-05-01

First principles calculations have been performed to predict the structural stability and electronic structures of hydrogen passivated wurtzite CdSe/ZnS and ZnS/CdSe core/shell nanowires (CSNWs) in the [0001] direction. The calculated binding energy shows that ZnS/CdSe CSNWs are more stable than CdSe/ZnS CSNWs and the stability of ZnS/CdSe CSNWs increases with increasing the thickness of ZnS shell. The modulated electronic band gap demonstrates an increase when the size of both CSNWs is reduced, as a result of the quantum confinement effect. The core-to-shell chemical composition of atoms shows that a strong composition effect also exists in these CSNWs, which in turn affects their electronic properties. Our simulated results show that the photoemission spectra of the CSNWs can be significantly improved by tuning the energy gap of CSNWs.

Analyte chemisorption and sensing on n- and p-channel copper phthalocyanine thin-film transistors.

PubMed

Yang, Richard D; Park, Jeongwon; Colesniuc, Corneliu N; Schuller, Ivan K; Royer, James E; Trogler, William C; Kummel, Andrew C

2009-04-28

Chemical sensing properties of phthalocyanine thin-film transistors have been investigated using nearly identical n- and p-channel devices. P-type copper phthalocyanine (CuPc) has been modified with fluorine groups to convert the charge carriers from holes to electrons. The sensor responses to the tight binding analyte dimethyl methylphosphonate (DMMP) and weak binding analyte methanol (MeOH) were compared in air and N(2). The results suggest that the sensor response involves counterdoping of pre-adsorbed oxygen (O(2)). A linear dependence of chemical response to DMMP concentration was observed in both n- and p- type devices. For DMMP, there is a factor of 2.5 difference in the chemical sensitivity between n- and p-channel CuPc thin-film transistors, even though it has similar binding strength to n- and p-type CuPc molecules as indicated by the desorption times. The effect is attributed to the difference in the analyte perturbation of electron and hole trap energies in n- and p-type materials.

B 36N 36 fullerene-like nanocages: A novel material for drug delivery

NASA Astrophysics Data System (ADS)

Ganji, M. D.; Yazdani, H.; Mirnejad, A.

2010-07-01

We study interaction between B 36N 36 fullerene-like nanocage and glycine amino acid from the first- principles. Binding energy is calculated and glycine binding to the pure C 60 fullerene is compared. We also analyze the electronic structure and charge Mulliken population for the energetically most favorable complexes. Our results indicate that glycine can form stable bindings with B 36N 36 nanocage via their carbonyl oxygen (O) active site while, the C 60 fullerene might be unable to form stable bindings to glycine amino acid via their active sites, which is consistence with recent experimental and theoretical investigations. Thus, we arrive at the prediction that the B 36N 36 nanocage can be implemented as a novel material for drug delivery applications.

Proton-bound dimers of nitrogen heterocyclic molecules: Substituent effects on the structures and binding energies of homodimers of diazine, triazine, and fluoropyridine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Attah, Isaac K.; Platt, Sean P.; Meot-Ner, Michael

2014-03-21

The bonding energies of proton-bound homodimers BH{sup +}B were measured by ion mobility equilibrium studies and calculated at the DFT B3LYP/6-311++G{sup **} level, for a series of nitrogen heterocyclic molecules (B) with electron-withdrawing in-ring N and on-ring F substituents. The binding energies (ΔH°{sub dissoc}) of the proton-bound dimers (BH{sup +}B) vary significantly, from 29.7 to 18.1 kcal/mol, decreasing linearly with decreasing the proton affinity of the monomer (B). This trend differs significantly from the constant binding energies of most homodimers of other organic nitrogen and oxygen bases. The experimentally measured ΔH°{sub dissoc} for (1,3-diazine){sub 2}H{sup +}, i.e., (pyrimidine){sub 2}H{sup +}more » and (3-F-pyridine){sub 2}H{sup +} are 22.7 and 23.0 kcal/mol, respectively. The measured ΔH°{sub dissoc} for the pyrimidine{sup ·+}(3-F-pyridine) radical cation dimer (19.2 kcal/mol) is signifcantly lower than that of the proton-bound homodimers of pyrimidine and 3-F-pyridine, reflecting the stronger interaction in the ionic H-bond of the protonated dimers. The calculated binding energies for (1,2-diazine){sub 2}H{sup +}, (pyridine){sub 2}H{sup +}, (2-F-pyridine){sub 2}H{sup +}, (3-F-pyridine){sub 2}H{sup +}, (2,6-di-F-pyridine){sub 2}H{sup +}, (4-F-pyridine){sub 2}H{sup +}, (1,3-diazine){sub 2}H{sup +}, (1,4-diazine){sub 2}H{sup +}, (1,3,5-triazine){sub 2}H{sup +}, and (pentafluoropyridine){sub 2}H{sup +} are 29.7, 24.9, 24.8, 23.3, 23.2, 23.0, 22.4, 21.9, 19.3, and 18.1 kcal/mol, respectively. The electron-withdrawing substituents form internal dipoles whose electrostatic interactions contribute to both the decreased proton affinities of (B) and the decreased binding energies of the protonated dimers BH{sup +}B. The bonding energies also vary with rotation about the hydrogen bond, and they decrease in rotamers where the internal dipoles of the components are aligned efficiently for inter-ring repulsion. For compounds substituted at the 3 or 4 (meta or para) positions, the lowest energy rotamers are T-shaped with the planes of the two rings rotated by 90° about the hydrogen bond, while the planar rotamers are weakened by repulsion between the ortho hydrogen atoms of the two rings. Conversely, in ortho-substituted (1,2-diazine){sub 2}H{sup +} and (2-F-pyridine){sub 2}H{sup +}, attractive interactions between the ortho (C–H) hydrogen atoms of one ring and the electronegative ortho atoms (N or F) of the other ring are stabilizing, and increase the protonated dimer binding energies by up to 4 kcal/mol. In all of the dimers, rotation about the hydrogen bond can involve a 2–4 kcal/mol barrier due to the relative energies of the rotamers.« less

Tight-binding approximations to time-dependent density functional theory — A fast approach for the calculation of electronically excited states

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rüger, Robert, E-mail: rueger@scm.com; Department of Theoretical Chemistry, Vrije Universiteit Amsterdam, De Boelelaan 1083, 1081 HV Amsterdam; Wilhelm-Ostwald-Institut für Physikalische und Theoretische Chemie, Linnéstr. 2, 04103 Leipzig

2016-05-14

We propose a new method of calculating electronically excited states that combines a density functional theory based ground state calculation with a linear response treatment that employs approximations used in the time-dependent density functional based tight binding (TD-DFTB) approach. The new method termed time-dependent density functional theory TD-DFT+TB does not rely on the DFTB parametrization and is therefore applicable to systems involving all combinations of elements. We show that the new method yields UV/Vis absorption spectra that are in excellent agreement with computationally much more expensive TD-DFT calculations. Errors in vertical excitation energies are reduced by a factor of twomore » compared to TD-DFTB.« less

Field emission energy distributions of hydrogen and deuterium on the /100/ and /110/ planes of tungsten.

NASA Technical Reports Server (NTRS)

Plummer, E. W.; Bell, A. E.

1972-01-01

Total energy distributions of field emitted electrons from the tungsten (110) and (100) planes as a function of coverage by hydrogen and deuterium have been recorded utilizing a spherical deflection energy analyzer. The elastic tunneling resonance spectrum gives a plot of the 'local density of states' in the adsorbate. The inelastic tunneling spectrum reveals those discrete excitation energies available in the adsorbate-substrate complex. These spectroscopic data have been used to infer the chemical nature of the binding states which have been observed in the flash desorption spectrum of hydrogen from tungsten.

Ground state of excitonic molecules by the Green's-function Monte Carlo method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, M.A.; Vashishta, P.; Kalia, R.K.

1983-12-26

The ground-state energy of excitonic molecules is evaluated as a function of the ratio of electron and hole masses, sigma, with use of the Green's-function Monte Carlo method. For all sigma, the Green's-function Monte Carlo energies are significantly lower than the variational estimates and in favorable agreement with experiments. In excitonic rydbergs, the binding energy of the positronium molecule (sigma = 1) is predicted to be -0.06 and for sigma<<1, the Green's-function Monte Carlo energies agree with the ''exact'' limiting behavior, E = -2.346+0.764sigma.

High-order above-threshold dissociation of molecules.

PubMed

Lu, Peifen; Wang, Junping; Li, Hui; Lin, Kang; Gong, Xiaochun; Song, Qiying; Ji, Qinying; Zhang, Wenbin; Ma, Junyang; Li, Hanxiao; Zeng, Heping; He, Feng; Wu, Jian

2018-02-27

Electrons bound to atoms or molecules can simultaneously absorb multiple photons via the above-threshold ionization featured with discrete peaks in the photoelectron spectrum on account of the quantized nature of the light energy. Analogously, the above-threshold dissociation of molecules has been proposed to address the multiple-photon energy deposition in the nuclei of molecules. In this case, nuclear energy spectra consisting of photon-energy spaced peaks exceeding the binding energy of the molecular bond are predicted. Although the observation of such phenomena is difficult, this scenario is nevertheless logical and is based on the fundamental laws. Here, we report conclusive experimental observation of high-order above-threshold dissociation of H 2 in strong laser fields where the tunneling-ionized electron transfers the absorbed multiphoton energy, which is above the ionization threshold to the nuclei via the field-driven inelastic rescattering. Our results provide an unambiguous evidence that the electron and nuclei of a molecule as a whole absorb multiple photons, and thus above-threshold ionization and above-threshold dissociation must appear simultaneously, which is the cornerstone of the nowadays strong-field molecular physics. Copyright © 2018 the Author(s). Published by PNAS.

Temperature and doping dependence of the high-energy kink in cuprates.

PubMed

Zemljic, M M; Prelovsek, P; Tohyama, T

2008-01-25

It is shown that spectral functions within the extended t-J model, evaluated using the finite-temperature diagonalization of small clusters, exhibit the high-energy kink in single-particle dispersion consistent with recent angle-resolved photoemission results on hole-doped cuprates. The kink and waterfall-like features persist up to large doping and to temperatures beyond J; hence, the origin can be generally attributed to strong correlations and incoherent hole propagation at large binding energies. In contrast, our analysis predicts that electron-doped cuprates do not exhibit these phenomena in photoemission.

The Minimum Binding Energy and Size of Doubly Muonic D3 Molecule

NASA Astrophysics Data System (ADS)

Eskandari, M. R.; Faghihi, F.; Mahdavi, M.

The minimum energy and size of doubly muonic D3 molecule, which two of the electrons are replaced by the much heavier muons, are calculated by the well-known variational method. The calculations show that the system possesses two minimum positions, one at typically muonic distance and the second at the atomic distance. It is shown that at the muonic distance, the effective charge, zeff is 2.9. We assumed a symmetric planar vibrational model between two minima and an oscillation potential energy is approximated in this region.

Spectroscopic characterization of the ethyl radical-water complex.

PubMed

Lin, Chen; Finney, Brian A; Laufer, Allan H; Anglada, Josep M; Francisco, Joseph S

2016-10-14

An ab initio investigation has been employed to determine the structural and spectroscopic parameters, such as rotational constants, vibrational frequencies, vertical excitation energies, and the stability of the ethyl-water complex. The ethyl-water complex has a binding energy of 1.15 kcal⋅mol -1 . The interaction takes place between the hydrogen of water and the unpaired electron of the radical. This interaction is found to produce a red shift in the OH stretching bands of water of ca. 84 cm -1 , and a shift of all UV absorption bands to higher energies.

A hierarchical coarse-grained (all-atom to all residue) approach to peptides (P1, P2) binding with a graphene sheet

NASA Astrophysics Data System (ADS)

Pandey, Ras; Kuang, Zhifeng; Farmer, Barry; Kim, Sang; Naik, Rajesh

2012-02-01

Recently, Kim et al. [1] have found that peptides P1: HSSYWYAFNNKT and P2: EPLQLKM bind selectively to graphene surfaces and edges respectively which are critical in modulating both the mechanical as well as electronic transport properties of graphene. Such distinctions in binding sites (edge versus surface) observed in electron micrographs were verified by computer simulation by an all-atomic model that captures the pi-pi bonding. We propose a hierarchical approach that involves input from the all-atom Molecular Dynamics (MD) study (with atomistic detail) into a coarse-grained Monte Carlo simulation to extend this study further to a larger scale. The binding energy of a free amino acid with the graphene sheet from all-atom simulation is used in the interaction parameter for the coarse-grained approach. Peptide chain executes its stochastic motion with the Metropolis algorithm. We investigate a number of local and global physical quantities and find that peptide P1 is likely to bind more strongly to graphene sheet than P2 and that it is anchored by three residues ^4Y^5W^6Y. [1] S.N. Kim et al J. Am. Chem. Soc. 133, 14480 (2011).

Ultrafast terahertz snapshots of excitonic Rydberg states and electronic coherence in an organometal halide perovskite

DOE PAGES

Luo, Liang; Men, Long; Liu, Zhaoyu; ...

2017-06-01

How photoexcitations evolve into Coulomb-bound electron and hole pairs, called excitons, and unbound charge carriers is a key cross-cutting issue in photovoltaics and optoelectronics. Until now, the initial quantum dynamics following photoexcitation remains elusive in the hybrid perovskite system. Furthermore we reveal excitonic Rydberg states with distinct formation pathways by observing the multiple resonant, internal quantum transitions using ultrafast terahertz quasi-particle transport. Nonequilibrium emergent states evolve with a complex co-existence of excitons, carriers and phonons, where a delayed buildup of excitons under on- and off-resonant pumping conditions allows us to distinguish between the loss of electronic coherence and hot statemore » cooling processes. The nearly ~1 ps dephasing time, efficient electron scattering with discrete terahertz phonons and intermediate binding energy of ~13.5 meV in perovskites are distinct from conventional photovoltaic semiconductors. In addition to providing implications for coherent energy conversion, these are potentially relevant to the development of light-harvesting and electron-transport devices.« less

Ultrafast terahertz snapshots of excitonic Rydberg states and electronic coherence in an organometal halide perovskite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luo, Liang; Men, Long; Liu, Zhaoyu

How photoexcitations evolve into Coulomb-bound electron and hole pairs, called excitons, and unbound charge carriers is a key cross-cutting issue in photovoltaics and optoelectronics. Until now, the initial quantum dynamics following photoexcitation remains elusive in the hybrid perovskite system. Furthermore we reveal excitonic Rydberg states with distinct formation pathways by observing the multiple resonant, internal quantum transitions using ultrafast terahertz quasi-particle transport. Nonequilibrium emergent states evolve with a complex co-existence of excitons, carriers and phonons, where a delayed buildup of excitons under on- and off-resonant pumping conditions allows us to distinguish between the loss of electronic coherence and hot statemore » cooling processes. The nearly ~1 ps dephasing time, efficient electron scattering with discrete terahertz phonons and intermediate binding energy of ~13.5 meV in perovskites are distinct from conventional photovoltaic semiconductors. In addition to providing implications for coherent energy conversion, these are potentially relevant to the development of light-harvesting and electron-transport devices.« less

Electronic and magnetic properties of MoSe2 armchair nanoribbons controlled by the different edge structures

NASA Astrophysics Data System (ADS)

Zhang, Hui; Zhao, Xu; Gao, Yonghui; Wang, Haiyang; Wang, Tianxing; Wei, Shuyi

2018-03-01

Tow-dimensional materials obviously have potential applications in next-generation nanodevices because of their extraordinary physical and chemical properties and the demands of the market. Using first-principle calculation based on density functional theory, we explore electronic and magnetic properties of the different nanoribbons with various edge structures, namely, with hydrogenation or not. In addition, we also calculate the binding energy to analyze the stability of the nanoribbon. Our calculations tell us that the passivated nanoribbons have the positive binding energies, which indicates the passivated nanoribbons are relative stable and hydrogenation can improve the stability of the bare nanoribbons due to the reduction of the dangling bonds. Among of them, full hydrogenation has the highest stability. We find all the nanoribbons with full and without hydrogenation are nonmagnetic semiconductors. It is worth mentioning that hydrogenation can induce the bare nanoribbons to transform gradually from indirect band gap semiconductor to direct band gap semiconductor, even to half-metal. In addition, the magnetic moment of the bare nanoribbon change bit by bit as the rate of hydrogenation increases. When the edge atoms are fully hydrogenated, the magnetic moment return to zero. What's more, our research results still confirm that electronic and magnetic properties of the nanorribons without and with different edge passivation are mainly contributed by the atoms at the edges. These studies about MoSe2 nanoribbons will shed light on the further development of the relevant nanodevices in versatile applications, such as spintronics and energy harvesting.

Scintillation properties and electronic structure of the intrinsic and extrinsic mixed elpasolites Cs 2 Na RBr 3I 3 ( R = La, Y)

DOE PAGES

Wei, Hua; Du, Mao -Hua; Stand, Luis; ...

2016-02-19

Scintillators attract wide research interest for their distinct applications in radiation detection. Elpasolite halides are among the most promising scintillators due to their high structural symmetry and good scintillation performance. A better understanding of their underlying scintillation mechanism opens up possibilities in scintillator development. In this work, we employ a variety of experimental techniques to study the two mixed-anion elpasolites Cs 2Na RBr 3I 3 ( R = La, Y). The emission of intrinsic Cs 2Na RBr 3I 3 with a light yield ranging from 20 000 to 40 000 ph / MeV is dominant by self-trapped exciton emission. Partialmore » substitution of R with Ce introduces a competing emission, the Ce 3+ 5d-to-4f radiative transition. Ab initio calculations are performed to investigate the electronic structures as well as the binding energies of polarons in Cs 2Na RBr 6. The calculated large self-trapped exciton binding energies are consistent with the observed high light yield due to self-trapped exciton (STE) emission. The unique electronic structure of halide elpasolites as calculated enhances the STE stability and the STE emission. The highly tunable scintillation properties of mixed-anion elpasolites underscore the role of their complex scintillation mechanism. Furthermore, our study provides guidance for the design of elpasolite scintillators with exceptional energy resolution and light yield desirable for applications.« less

Dioxygen Binding in the Active Site of Histone Demethylase JMJD2A and the Role of the Protein Environment.

PubMed

Cortopassi, Wilian A; Simion, Robert; Honsby, Charles E; França, Tanos C C; Paton, Robert S

2015-12-21

JMJD2A catalyses the demethylation of di- and trimethylated lysine residues in histone tails and is a target for the development of new anticancer medicines. Mechanistic details of demethylation are yet to be elucidated and are important for the understanding of epigenetic processes. We have evaluated the initial step of histone demethylation by JMJD2A and demonstrate the dramatic effect of the protein environment upon oxygen binding using quantum mechanics/molecular mechanics (QM/MM) calculations. The changes in electronic structure have been studied for possible spin states and different conformations of O2 , using a combination of quantum and classical simulations. O2 binding to this histone demethylase is computed to occur preferentially as an end-on superoxo radical bound to a high-spin ferric centre, yielding an overall quintet ground state. The favourability of binding is strongly influenced by the surrounding protein: we have quantified this effect using an energy decomposition scheme into electrostatic and dispersion contributions. His182 and the methylated lysine assist while Glu184 and the oxoglutarate cofactor are deleterious for O2 binding. Charge separation in the superoxo-intermediate benefits from the electrostatic stabilization provided by the surrounding residues, stabilizing the binding process significantly. This work demonstrates the importance of the extended protein environment in oxygen binding, and the role of energy decomposition in understanding the physical origin of binding/recognition. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Energy harvesting of non-emissive triplet excitons in tetracene by emissive PbS nanocrystals

NASA Astrophysics Data System (ADS)

Thompson, Nicholas J.; Wilson, Mark W. B.; Congreve, Daniel N.; Brown, Patrick R.; Scherer, Jennifer M.; Bischof, Thomas S.; Wu, Mengfei; Geva, Nadav; Welborn, Matthew; Voorhis, Troy Van; Bulović, Vladimir; Bawendi, Moungi G.; Baldo, Marc A.

2014-11-01

Triplet excitons are ubiquitous in organic optoelectronics, but they are often an undesirable energy sink because they are spin-forbidden from emitting light and their high binding energy hinders the generation of free electron-hole pairs. Harvesting their energy is consequently an important technological challenge. Here, we demonstrate direct excitonic energy transfer from ‘dark’ triplets in the organic semiconductor tetracene to colloidal PbS nanocrystals, thereby successfully harnessing molecular triplet excitons in the near infrared. Steady-state excitation spectra, supported by transient photoluminescence studies, demonstrate that the transfer efficiency is at least (90 ± 13)%. The mechanism is a Dexter hopping process consisting of the simultaneous exchange of two electrons. Triplet exciton transfer to nanocrystals is expected to be broadly applicable in solar and near-infrared light-emitting applications, where effective molecular phosphors are lacking at present. In particular, this route to ‘brighten’ low-energy molecular triplet excitons may permit singlet exciton fission sensitization of conventional silicon solar cells.

Effect on magnetic properties of germanium encapsulated C60 fullerene

NASA Astrophysics Data System (ADS)

Umran, Nibras Mossa; Kumar, Ranjan

2013-02-01

Structural and electronic properties of Gen(n = 1-4) doped C60 fullerene are investigated with ab initio density functional theory calculations by using an efficient computer code, known as SIESTA. The pseudopotentials are constructed using a Trouiller-Martins scheme, to describe the interaction of valence electrons with the atomic cores. In endohedral doped embedding of more germanium atoms complexes we have seen that complexes are stable and thereafter cage break down. We have also investigated that binding energy, electronic affinity increases and magnetic moment oscillating behavior as the number of semiconductor atoms in C60 fullerene goes on increasing.

Electronic instability and change of crystalline phase in compounds of the V3Si type at low temperature

NASA Technical Reports Server (NTRS)

Labbe, J.; Friedel, J.

1978-01-01

In V3Si, the V atoms form an array of dense linear chains; a tight-binding approximation in one dimension was used to describe the d electrons. The electronic energy calculated by this method was reduced when the lattice is deformed. This lead to a band type of the Jahn Teller effect, which may explain the cubic to tetragonal transition which was observed at low temperatures. The theory can be extended to other superconductors of the V3X type when X=Ga, Ge, Sn, etcetera, or NB3SN.

Electronic properties of long DNA nanowires in dry and wet conditions

NASA Astrophysics Data System (ADS)

Mousavi, Hamze; Khodadadi, Jabbar; Grabowski, Marek

2015-11-01

The electronic behavior of the long disordered DNA nanowires in both dry and wet conditions is investigated through the band structure and density of states of a tight-binding Hamiltonian model for π-electrons of the backbone, using Green's functions approach. For a chosen set of parameters in the dry case, semiconducting behavior is reproduced. It is also shown that for sufficiently long strands, the order of the base pairs has no noticeable effect on the energy band-gap. Moreover, this semiconducting duplex shows metallic tendencies when interacting with the environment of polar molecules.

Polaronic effects on the off-center donor impurity in AlAs/GaAs/SiO2 spherical core/shell quantum dots

NASA Astrophysics Data System (ADS)

El Haouari, M.; Feddi, E.; Dujardin, F.; Restrepo, R. L.; Mora-Ramos, M. E.; Duque, C. A.

2017-11-01

The ground state of a conduction electron coupled to an off-center impurity donor in a AlAS/GaAs spherical core/shell quantum dot is investigated theoretically. The image-charge effect and the influence of the electron-polar-LO-phonon interaction are considered. The electron-impurity binding energy is calculated via a variational procedure and is reported both as a function of the shell width and of the radial position of the donor atom. The polaronic effects on this quantity are particularly discussed.

Theoretical Analysis of Photoelectron Spectra of Pure and Mixed Metal Clusters: Disentangling Size, Structure, and Composition Effects

DOE PAGES

Acioli, Paulo H.; Jellinek, Julius

2017-07-14

A theoretical/computational description and analysis of the spectra of electron binding energies of Al 12 -, Al 13 - and Al 12Ni- clusters, which differ in size and/or composition by a single atom yet possess strikingly different measured photoelectron spectra, is presented. It is shown that the measured spectra can not only be reproduced computationally with quantitative fidelity – this is achieved through a combination of state-of-the-art density functional theory with a highly accurate scheme for conversion of the Kohn-Sham eigenenergies into electron binding energies – but also explained in terms of the effects of size, structure/symmetry and composition. Furthermore,more » a new methodology is developed and applied that provides for disentanglement and differential assignment of the separate roles played by size, structure/symmetry and composition in defining the observed differences in the measured spectra. The methodology is general and applicable to any finite system, homogeneous or heterogeneous. Finally, we project that in combination with advances in synthesis techniques this methodology will become an indispensable computation-based aid in the design of controlled synthesis protocols for manufacture of nanosystems and nanodevices with precisely desired electronic and other characteristics.« less

Asymmetry induces Q-band split in the electronic excitations of magnesium porphyrin

NASA Astrophysics Data System (ADS)

Jiang, Xiankai; Gao, Yi; Lal, Ratnesh; Hu, Jun; Song, Bo

2018-07-01

The electronic excitations of magnesium porphyrin (MgP), a molecular model for understanding the physics in light harvesting by biological systems, have been studied extensively. However, the theoretical underpinning of experimental measurements is still lacking, especially about the sub-bands in absorption spectrum. Here we propose that an asymmetry of MgP based on the uneven charge distribution of pyrrole rings and the linear structure of sp hybridised orbitals in Mg can largely influence the electronic excitations. Upon a very weak asymmetry of Mg-pyrrole bindings in MgP being introduced through the uneven distribution of charge, three different excitations are observed in the Q-band region of the experimental spectrum. Additionally, the predicted B-band excitations are highly correlated (10-2 eV level) with experimental measurements. In contrast, without this asymmetry, there are only two degenerate excitations in the Q-band region, and low agreement (10-1 eV level) of the B-band excitations with the experiment. The key physics of the unexpected and observable asymmetry in MgP is the ability of Mg to form sp hybridised orbitals on the third shell upon Mg binding to the nitrogen of pyrrole ring. Our findings provide new insight for high-energy efficiency of natural as well as artificial light-harvesting system for energy challenge.

Theoretical Analysis of Photoelectron Spectra of Pure and Mixed Metal Clusters: Disentangling Size, Structure, and Composition Effects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Acioli, Paulo H.; Jellinek, Julius

A theoretical/computational description and analysis of the spectra of electron binding energies of Al 12 -, Al 13 - and Al 12Ni- clusters, which differ in size and/or composition by a single atom yet possess strikingly different measured photoelectron spectra, is presented. It is shown that the measured spectra can not only be reproduced computationally with quantitative fidelity – this is achieved through a combination of state-of-the-art density functional theory with a highly accurate scheme for conversion of the Kohn-Sham eigenenergies into electron binding energies – but also explained in terms of the effects of size, structure/symmetry and composition. Furthermore,more » a new methodology is developed and applied that provides for disentanglement and differential assignment of the separate roles played by size, structure/symmetry and composition in defining the observed differences in the measured spectra. The methodology is general and applicable to any finite system, homogeneous or heterogeneous. Finally, we project that in combination with advances in synthesis techniques this methodology will become an indispensable computation-based aid in the design of controlled synthesis protocols for manufacture of nanosystems and nanodevices with precisely desired electronic and other characteristics.« less

In situ observation of electron beam-induced phase transformation of CaCO3 to CaO via ELNES at low electron beam energies.

PubMed

Golla-Schindler, Ute; Benner, Gerd; Orchowski, Alexander; Kaiser, Ute

2014-06-01

It is demonstrated that energy-filtered transmission electron microscope enables following of in situ changes of the Ca-L2,3 edge which can originate from variations in both local symmetry and bond lengths. Low accelerating voltages of 20 and 40 kV slow down radiation damage effects and enable study of the start and finish of phase transformations. We observed electron beam-induced phase transformation of single crystalline calcite (CaCO3) to polycrystalline calcium oxide (CaO) which occurs in different stages. The coordination of Ca in calcite is close to an octahedral one streched along the <111> direction. Changes during phase transformation to an octahedral coordination of Ca in CaO go along with a bond length increase by 5 pm, where oxygen is preserved as a binding partner. Electron loss near-edge structure of the Ca-L2,3 edge show four separated peaks, which all shift toward lower energies during phase transformation at the same time the energy level splitting increases. We suggest that these changes can be mainly addressed to the change of the bond length on the order of picometers. An important pre-condition for such studies is stability of the energy drift in the range of meV over at least 1 h, which is achieved with the sub-Ångström low-voltage transmission electron microscope I prototype microscope.

Bandstructure modulation for Si-h and Si-g nanotubes in a transverse electric field: Tight binding approach

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2013-11-01

We have investigated the electronic properties of SiNTs, under the external electric field, using Tight Binding (TB) approximation. It was found that the energy levels, energy gaps, and density of states (DOS) strongly depend on the electric field strength. The large electric strength leads to coupling the neighbor subbands and induce destruction of subband degeneracy, increase of low-energy states, and strong modulation of energy gap which these effects reflect in the DOS spectrum. It has been shown that, the band gap reduction of Si g-NTs is linearly proportional to the electric field strength. The band gap variation for Si h-NTs increases first and later decreases (Metallic) or first remains constant and then decreases (semiconductor). Also we show that the larger diameter tubes are more sensitive to the field strength than smaller ones. The semiconducting metallic transition or vice versa can be achieved through an increasing of applied fields. Number and position of peaks in DOS spectrum are dependent on electric field strength.

Probing Long-Range Neutrino-Mediated Forces with Atomic and Nuclear Spectroscopy.

PubMed

Stadnik, Yevgeny V

2018-06-01

The exchange of a pair of low-mass neutrinos between electrons, protons, and neutrons produces a "long-range" 1/r^{5} potential, which can be sought for in phenomena originating on the atomic and subatomic length scales. We calculate the effects of neutrino-pair exchange on transition and binding energies in atoms and nuclei. In the case of atomic s-wave states, there is a large enhancement of the induced energy shifts due to the lack of a centrifugal barrier and the highly singular nature of the neutrino-mediated potential. We derive limits on neutrino-mediated forces from measurements of the deuteron binding energy and transition energies in positronium, muonium, hydrogen, and deuterium, as well as isotope-shift measurements in calcium ions. Our limits improve on existing constraints on neutrino-mediated forces from experiments that search for new macroscopic forces by 18 orders of magnitude. Future spectroscopy experiments have the potential to probe long-range forces mediated by the exchange of pairs of standard-model neutrinos and other weakly charged particles.

Probing Long-Range Neutrino-Mediated Forces with Atomic and Nuclear Spectroscopy

NASA Astrophysics Data System (ADS)

Stadnik, Yevgeny V.

2018-06-01

The exchange of a pair of low-mass neutrinos between electrons, protons, and neutrons produces a "long-range" 1 /r5 potential, which can be sought for in phenomena originating on the atomic and subatomic length scales. We calculate the effects of neutrino-pair exchange on transition and binding energies in atoms and nuclei. In the case of atomic s -wave states, there is a large enhancement of the induced energy shifts due to the lack of a centrifugal barrier and the highly singular nature of the neutrino-mediated potential. We derive limits on neutrino-mediated forces from measurements of the deuteron binding energy and transition energies in positronium, muonium, hydrogen, and deuterium, as well as isotope-shift measurements in calcium ions. Our limits improve on existing constraints on neutrino-mediated forces from experiments that search for new macroscopic forces by 18 orders of magnitude. Future spectroscopy experiments have the potential to probe long-range forces mediated by the exchange of pairs of standard-model neutrinos and other weakly charged particles.

A density functional theory study on the structural and electronic properties of PbxSbySez (x + y + z = 2, 3) clusters

NASA Astrophysics Data System (ADS)

Peköz, Rengi˙n; Erkoç, Şaki˙r

2018-01-01

The structural and electronic properties of neutral ternary PbxSbySez clusters (x + y + z = 2, 3) in their ground states have been explored by means of density functional theory calculations. The geometric structures and binding energies are systematically explored and for the most stable configurations of each cluster type vibrational frequencies, charges on atoms, energy difference between highest occupied and lowest unoccupied molecular orbitals, and the possible dissociations channels have been analyzed. Depending on being binary or ternary cluster and composition, the most energetic structures have singlet, doublet or triplet ground states, and trimers prefer to form isosceles, equilateral or scalene triangle structure.

Structural, stability, and vibrational properties of BinPm clusters

NASA Astrophysics Data System (ADS)

Shen, Wanting; Han, Lihong; Liang, Dan; Zhang, Chunfang; Ruge, Quhe; Wang, Shumin; Lu, Pengfei

2018-04-01

An in-depth investigation is performed on stability mechanisms, electronic and optical properties of III-V semiconductor vapor phases clusters. First principles electronic structure calculations of CAM-B3LYP are performed on neutral BinPm (n + m ≤ 14) clusters. The geometrical evolution of all stable structures remains amorphous as the clusters size increases. Binding energies (BEs), energy gains and highest occupied molecular orbital and lowest unoccupied molecular orbital (HOMO-LUMO) gaps confirm that all four-atom structures of BinPm clusters have more stable optical properties. Orbitals composition and vibrational spectra of stable clusters are analyzed. Our calculations will contribute to the study of diluted bismuth alloys and compounds.

Quasi-particle energies and optical excitations of hydrogenated and fluorinated germanene.

PubMed

Shu, Huabing; Li, Yunhai; Wang, Shudong; Wang, Jinlan

2015-02-14

Using density functional theory, the G0W0 method and Bethe-Salpeter equation calculations, we systematically explore the structural, electronic and optical properties of hydrogenated and fluorinated germanene. The hydrogenated/fluorinated germanene tends to form chair and zigzag-line configurations and its electronic and optical properties show close geometry dependence. The chair hydrogenated/fluorinated and zigzag-line fluorinated germanene are direct band-gap semiconductors, while the zigzag-line hydrogenated germanene owns an indirect band-gap. Moreover, the quasi-particle corrections are significant and strong excitonic effects with large exciton binding energies are observed. Moreover, the zigzag-line hydrogenated/fluorinated germanene shows highly anisotropic optical responses, which may be used as a good optical linear polarizer.

Theoretical study of structure, bonding, and electronic behavior of novel sandwich complexes Os3(C6H6) n ( n = 1, 2)

NASA Astrophysics Data System (ADS)

Zhou, K.; Zhao, C. B.; Huang, W. D.

2017-11-01

The correlations between structural and electronic properties of the monolayer cluster Os3 and sandwich complexes of Os3(C6H6) n ( n = 1, 2) were studied with density functional theory. Every Os adopts η2 fashion to coordinate with C6H6 in Os3(C6H6), while every Os adopts η2 and η1 fashion to coordinate with below and above C6H6 rings in Os3(C6H6)2. η2 fashion is σ donation and π back bond, and η1 fashion belong to σ bond. The first binding energy between Os3 and below C6H6 ring is-114.23 kJ/mol, which is weaker than the second binding energy with-174.16 kJ/mol between Os3(C6H6) and above C6H6 ring. The reason is that the change of spin multiplicity is different, which leads the symmetry of Os3(C6H6)2 to be broken.

First-Principles Study of Electronic Structure and Hydrogen Adsorption of 3d Transition Metal Exposed Paddle Wheel Frameworks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bak, J. H.; Le, V. D.; Kang, J.

2012-04-05

Open-site paddle wheels, comprised of two transition metals bridged with four carboxylate ions, have been widely used for constructing metal-organic frameworks with large surface area and high binding energy sites. Using first-principles density functional theory calculations, we have investigated atomic and electronic structures of various 3d transition metal paddle wheels before and after metal exposure and their hydrogen adsorption properties at open metal sites. Notably, the hydrogen adsorption is impeded by covalent metal-metal bonds in early transition metal paddle wheels from Sc to Cr and by the strong ferromagnetic coupling of diatomic Mn and Fe in the paddle wheel configurations.more » A significantly enhanced H{sub 2} adsorption is predicted in the nonmagnetic Co{sub 2} and Zn{sub 2} paddle wheel with the binding energy of {approx}0.2 eV per H{sub 2}. We also propose the use of two-dimensional Co{sub 2} and Zn{sub 2} paddle wheel frameworks that could have strongly adsorbed dihydrogen up to 1.35 wt % for noncryogenic hydrogen storage applications.« less

Prediction of cyclin-dependent kinase 2 inhibitor potency using the fragment molecular orbital method

PubMed Central

2011-01-01

Background The reliable and robust estimation of ligand binding affinity continues to be a challenge in drug design. Many current methods rely on molecular mechanics (MM) calculations which do not fully explain complex molecular interactions. Full quantum mechanical (QM) computation of the electronic state of protein-ligand complexes has recently become possible by the latest advances in the development of linear-scaling QM methods such as the ab initio fragment molecular orbital (FMO) method. This approximate molecular orbital method is sufficiently fast that it can be incorporated into the development cycle during structure-based drug design for the reliable estimation of ligand binding affinity. Additionally, the FMO method can be combined with approximations for entropy and solvation to make it applicable for binding affinity prediction for a broad range of target and chemotypes. Results We applied this method to examine the binding affinity for a series of published cyclin-dependent kinase 2 (CDK2) inhibitors. We calculated the binding affinity for 28 CDK2 inhibitors using the ab initio FMO method based on a number of X-ray crystal structures. The sum of the pair interaction energies (PIE) was calculated and used to explain the gas-phase enthalpic contribution to binding. The correlation of the ligand potencies to the protein-ligand interaction energies gained from FMO was examined and was seen to give a good correlation which outperformed three MM force field based scoring functions used to appoximate the free energy of binding. Although the FMO calculation allows for the enthalpic component of binding interactions to be understood at the quantum level, as it is an in vacuo single point calculation, the entropic component and solvation terms are neglected. For this reason a more accurate and predictive estimate for binding free energy was desired. Therefore, additional terms used to describe the protein-ligand interactions were then calculated to improve the correlation of the FMO derived values to experimental free energies of binding. These terms were used to account for the polar and non-polar solvation of the molecule estimated by the Poisson-Boltzmann equation and the solvent accessible surface area (SASA), respectively, as well as a correction term for ligand entropy. A quantitative structure-activity relationship (QSAR) model obtained by Partial Least Squares projection to latent structures (PLS) analysis of the ligand potencies and the calculated terms showed a strong correlation (r2 = 0.939, q2 = 0.896) for the 14 molecule test set which had a Pearson rank order correlation of 0.97. A training set of a further 14 molecules was well predicted (r2 = 0.842), and could be used to obtain meaningful estimations of the binding free energy. Conclusions Our results show that binding energies calculated with the FMO method correlate well with published data. Analysis of the terms used to derive the FMO energies adds greater understanding to the binding interactions than can be gained by MM methods. Combining this information with additional terms and creating a scaled model to describe the data results in more accurate predictions of ligand potencies than the absolute values obtained by FMO alone. PMID:21219630

Study of effects of size and Ga mole content of In1-xGax As / GaAs quantum ring on excitonic properties using the variational calculation

NASA Astrophysics Data System (ADS)

Ben Mansour, Afef; Kehili, Mohamed Souhail; Melliti, Adnen; Maaref, Mohamed Ali

2017-10-01

This work aims to calculate the energy spectrum of semiconductor In1-xGax As / GaAs Quantum Ring (QR) using a three-dimensional model. The latter is modeled by a truncated torus residing on a thin In1-xWLGaxWL As wetting layer (WL). The main novelty of this work is to calculate electron and hole ground state energy using a variational method. The lattice-mismatch strain effect and the charge carrier confinement profile were considered in the calculation. For electron, the energy dependence of the effective mass was taken into account in solving the Schrödinger equation using the single band effective mass approximation. Moreover, variational estimate of the excitonic binding energy and the oscillator strength as a function of the QR radial width and Ga mole content were reported.

Influence of Γ-X band mixing on the excited donor in a parabolic quantum well

NASA Astrophysics Data System (ADS)

Raghuvaran, T.; Shanthi, R. Vijaya; D'Reuben, A. Merwyn Jasper; Nithiananthi, P.

2013-06-01

Equally spaced energy levels of Parabolic Quantum Well are perturbed due to the application of hydrostatic pressure. It will modify the electronic and optical behavior of high Potential devices. The variation of excited state donor binding energy due to Γ-X band mixing at critical cross over pressures in a Parabolic GaAs/AlxGa1-x As quantum well has been investigated in the effective mass approximation using variational method.

Theoretical studies of the electronic spectrum of tellurium monosulfide.

PubMed

Chattopadhyaya, Surya; Nath, Abhijit; Das, Kalyan Kumar

2013-08-01

Ab initio based multireference singles and doubles configuration interaction (MRDCI) study including spin-orbit coupling is carried out to explore the electronic structure and spectroscopic properties of tellurium monosulfide (TeS) molecule by employing relativistic effective core potentials (RECP) and suitable Gaussian basis sets of the constituent atoms. Potential energy curves correlating with the lowest and second dissociation limit are constructed and spectroscopic constants (T(e), r(e), and ω(e)) of several low-lying bound Λ-S electronic states up to 3.68 eV of energy are computed. The binding energies and electric dipole moments (μ(e)) of the ground and the low-lying excited Λ-S states are also computed. The effects of the spin-orbit coupling on the electronic spectrum of the species are studied in details and compared with the available data. The transition probabilities of some dipole-allowed and spin-forbidden transitions are computed and radiative lifetimes of some excited states at lowest vibrational level are estimated from the transition probability data. Copyright © 2013 Elsevier B.V. All rights reserved.

Development and Application of Explicitly Correlated Wave Function Based Methods for the Investigation of Optical Properties of Semiconductor Nanomaterials

NASA Astrophysics Data System (ADS)

Elward, Jennifer Mary

Semiconductor nanoparticles, or quantum dots (QDs), are well known to have very unique optical and electronic properties. These properties can be controlled and tailored as a function of several influential factors, including but not limited to the particle size and shape, effect of composition and heterojunction as well as the effect of ligand on the particle surface. This customizable nature leads to extensive experimental and theoretical research on the capabilities of these quantum dots for many application purposes. However, in order to be able to understand and thus further the development of these materials, one must first understand the fundamental interaction within these nanoparticles. In this thesis, I have developed a theoretical method which is called electron-hole explicitly correlated Hartee-Fock (eh-XCHF). It is a variational method for solving the electron-hole Schrodinger equation and has been used in this work to study electron-hole interaction in semiconductor quantum dots. The method was benchmarked with respect to a parabolic quantum dot system, and ground state energy and electron-hole recombination probability were computed. Both of these properties were found to be in good agreement with expected results. Upon successful benchmarking, I have applied the eh-XCHF method to study optical properties of several quantum dot systems including the effect of dot size on exciton binding energy and recombination probability in a CdSe quantum dot, the effect of shape on a CdSe quantum dot, the effect of heterojunction on a CdSe/ZnS quantum dot and the effect of quantum dot-biomolecule interaction within a CdSe-firefly Luciferase protein conjugate system. As metrics for assessing the effect of these influencers on the electron-hole interaction, the exciton binding energy, electron-hole recombination probability and the average electron-hole separation distance have been computed. These excitonic properties have been found to be strongly infuenced by the changing composition of the particle. It has also been found through this work that the explicitly correlated method performs very well when computing these properties as it provides a feasible computational route to compare to both experimental and other theoretical results.

The measured and calculated affinity of methyl and methoxy substituted benzoquinones for the QA site of bacterial reaction centers

PubMed Central

Zheng, Zhong; Dutton, P. Leslie; Gunner, M. R.

2010-01-01

Quinones play important roles in mitochondrial and photosynthetic energy conversion acting as intramembrane, mobile electron and proton carriers between catalytic sites in various electron transfer proteins. They display different affinity, selectivity, functionality and exchange dynamics in different binding sites. The computational analysis of quinone binding sheds light on the requirements for quinone affinity and specificity. The affinities of ten oxidized, neutral benzoquinones (BQs) were measured for the high affinity QA site in the detergent solubilized Rhodobacter sphaeroides bacterial photosynthetic reaction center. Multi-Conformation Continuum Electrostatics (MCCE) was then used to calculate their relative binding free energies by Grand Canonical Monte Carlo sampling with a rigid protein backbone, flexible ligand and side chain positions and protonation states. Van der Waals and torsion energies, Poisson-Boltzmann continuum electrostatics and accessible surface area dependent ligand-solvent interactions are considered. An initial, single cycle of GROMACS backbone optimization improves the match with experiment as do coupled ligand and side chain motions. The calculations match experiment with an RMSD of 2.29 and a slope of 1.28. The affinities are dominated by favorable protein-ligand van der Waals rather than electrostatic interactions. Each quinone appears in a closely clustered set of positions. Methyl and methoxy groups move into the same positions as found for the native quinone. Difficulties putting methyls into methoxy sites are observed. Calculations using an SAS dependent implicit van der Waals interaction smoothed out small clashes, providing a better match to experiment with a RMSD of 0.77 and a slope of 0.97. PMID:20607696

Quantum effects and anharmonicity in the H2-Li+-benzene complex: A model for hydrogen storage materials

NASA Astrophysics Data System (ADS)

Kolmann, Stephen J.; D'Arcy, Jordan H.; Jordan, Meredith J. T.

2013-12-01

Quantum and anharmonic effects are investigated in H2-Li+-benzene, a model for hydrogen adsorption in metal-organic frameworks and carbon-based materials. Three- and 8-dimensional quantum diffusion Monte Carlo (QDMC) and rigid-body diffusion Monte Carlo (RBDMC) simulations are performed on potential energy surfaces interpolated from electronic structure calculations at the M05-2X/6-31+G(d,p) and M05-2X/6-311+G(2df,p) levels of theory using a three-dimensional spline or a modified Shepard interpolation. These calculations investigate the intermolecular interactions in this system, with three- and 8-dimensional 0 K H2 binding enthalpy estimates, ΔHbind (0 K), being 16.5 kJ mol-1 and 12.4 kJ mol-1, respectively: 0.1 and 0.6 kJ mol-1 higher than harmonic values. Zero-point energy effects are 35% of the value of ΔHbind (0 K) at M05-2X/6-311+G(2df,p) and cannot be neglected; uncorrected electronic binding energies overestimate ΔHbind (0 K) by at least 6 kJ mol-1. Harmonic intermolecular binding enthalpies can be corrected by treating the H2 "helicopter" and "ferris wheel" rotations as free and hindered rotations, respectively. These simple corrections yield results within 2% of the 8-dimensional anharmonic calculations. Nuclear ground state probability density histograms obtained from the QDMC and RBDMC simulations indicate the H2 molecule is delocalized above the Li+-benzene system at 0 K.

Relative binding affinities of monolignols to horseradish peroxidase

DOE PAGES

Sangha, Amandeep K.; Petridis, Loukas; Cheng, Xiaolin; ...

2016-07-22

Monolignol binding to the peroxidase active site is the first step in lignin polymerization in plant cell walls. Using molecular dynamics, docking, and free energy perturbation calculations, we investigate the binding of monolignols to horseradish peroxidase C. Our results suggest that p-coumaryl alcohol has the strongest binding affinity followed by sinapyl and coniferyl alcohol. Stacking interactions between the monolignol aromatic rings and nearby phenylalanine residues play an important role in determining the calculated relative binding affinities. p-Coumaryl and coniferyl alcohols bind in a pose productive for reaction in which a direct H-bond is formed between the phenolic –OH group andmore » a water molecule (W2) that may facilitate proton transfer during oxidation. In contrast, in the case of sinapyl alcohol there is no such direct interaction, the phenolic –OH group instead interacting with Pro139. Furthermore, since proton and electron transfer is the rate-limiting step in monolignol oxidation by peroxidase, the binding pose (and thus the formation of near attack conformation) appears to play a more important role than the overall binding affinity in determining the oxidation rate.« less

Relaxation Process of Photoexcited meso-Naphthylporphyrins while Interacting with DNA and Singlet Oxygen Generation.

PubMed

Hirakawa, Kazutaka; Taguchi, Makoto; Okazaki, Shigetoshi

2015-10-15

Electron donor-connecting cationic porphyrins meso-(1-naphthyl)-tris(N-methyl-p-pyridinio)porphyrin (1-NapTMPyP) and meso-(2-naphthyl)-tris(N-methyl-p-pyridinio)porphyrin (2-NapTMPyP) were designed and synthesized. DFT calculations speculate that the photoexcited states of 1- and 2-NapTMPyPs can be deactivated via intramolecular electron transfer from the naphthyl moiety to the porphyrin moiety. However, the quenching effect through the intramolecular electron transfer is insufficient, possibly due to the orthogonal position of the electron donor and the porphyrin ring and the relatively small driving force: Gibbs energies are 0.11 and 0.07 eV for 1- and 2-NapTMPyPs, respectively. It was speculated that more than 0.3 eV of the driving force is required to realize effective electron transfer in similar electron-donor connecting porphyrin systems. These porphyrins aggregated around the DNA strand, accelerating the deactivation of their excited singlet state and decreasing their photosensitized singlet oxygen-generating activities. In the presence of a sufficiently large concentration of DNA, these porphyrins can bind to a DNA strand stably, leading to an increased fluorescence quantum yield and lifetime. Singlet oxygen generation was also suppressed by the aggregation of porphyrins around DNA. Although the quantum yield of singlet oxygen generation was recovered in the presence of sufficient DNA, the singlet oxygen generated by DNA-binding porphyrins was significantly smaller than that without DNA. These results suggest that DNA-binding drugs limit the generation of photosensitized singlet oxygen by quenching the DNA strand.

Probing ionization potential, electron affinity and self-energy effect on the spectral shape and exciton binding energy of quantum liquid water with self-consistent many-body perturbation theory and the Bethe-Salpeter equation.

PubMed

Ziaei, Vafa; Bredow, Thomas

2018-05-31

An accurate theoretical prediction of ionization potential (IP) and electron affinity (EA) is key in understanding complex photochemical processes in aqueous environments. There have been numerous efforts in literature to accurately predict IP and EA of liquid water, however with often conflicting results depending on the level of theory and the underlying water structures. In a recent study based on hybrid-non-self-consistent many-body perturbation theory (MBPT) Gaiduk et al (2018 Nat. Commun. 9 247) predicted an IP of 10.2 eV and EA of 0.2 eV, resulting in an electronic band gap (i.e. electronic gap (IP-EA) as measured by photoelectron spectroscopy) of about 10 eV, redefining the widely cited experimental gap of 8.7 eV in literature. In the present work, we show that GW self-consistency and an implicit vertex correction in MBPT considerably affect recently reported EA values by Gaiduk et al (2018 Nat. Commun. 9 247) by about 1 eV. Furthermore, the choice of pseudo-potential is critical for an accurate determination of the absolute band positions. Consequently, the self-consistent GW approach with an implicit vertex correction based on projector augmented wave (PAW) method on top of quantum water structures predicts an IP of 10.2, an EA of 1.1, a fundamental gap of 9.1 eV and an exciton binding (Eb) energy of 0.9 eV for the first absorption band of liquid water via the Bethe-Salpeter equation (BSE). Only within such a self-consistent approach a simultanously accurate prediction of IP, EA, Eg, Eb is possible.

Probing ionization potential, electron affinity and self-energy effect on the spectral shape and exciton binding energy of quantum liquid water with self-consistent many-body perturbation theory and the Bethe–Salpeter equation

NASA Astrophysics Data System (ADS)

Ziaei, Vafa; Bredow, Thomas

2018-05-01

An accurate theoretical prediction of ionization potential (IP) and electron affinity (EA) is key in understanding complex photochemical processes in aqueous environments. There have been numerous efforts in literature to accurately predict IP and EA of liquid water, however with often conflicting results depending on the level of theory and the underlying water structures. In a recent study based on hybrid-non-self-consistent many-body perturbation theory (MBPT) Gaiduk et al (2018 Nat. Commun. 9 247) predicted an IP of 10.2 eV and EA of 0.2 eV, resulting in an electronic band gap (i.e. electronic gap (IP-EA) as measured by photoelectron spectroscopy) of about 10 eV, redefining the widely cited experimental gap of 8.7 eV in literature. In the present work, we show that GW self-consistency and an implicit vertex correction in MBPT considerably affect recently reported EA values by Gaiduk et al (2018 Nat. Commun. 9 247) by about 1 eV. Furthermore, the choice of pseudo-potential is critical for an accurate determination of the absolute band positions. Consequently, the self-consistent GW approach with an implicit vertex correction based on projector augmented wave (PAW) method on top of quantum water structures predicts an IP of 10.2, an EA of 1.1, a fundamental gap of 9.1 eV and an exciton binding (Eb) energy of 0.9 eV for the first absorption band of liquid water via the Bethe–Salpeter equation (BSE). Only within such a self-consistent approach a simultanously accurate prediction of IP, EA, Eg, Eb is possible.

Experimental binding energies for the metal complexes [Mg(CH3OH)n](2+), [Ca(CH3OH)n](2+), and [Sr(CH3OH)n](2+) for n in the range 4-20.

PubMed

Bruzzi, E; Stace, A J

2014-10-09

A supersonic source of clusters has been used to prepare neutral complexes of methanol in association with an alkaline earth metal atom. From these complexes the following metal-containing dications have been generated through electron ionization: [Mg(CH3OH)n](2+), [Ca(CH3OH)n](2+), and [Sr(CH3OH)n](2+), and for n in the range 4-20, kinetic energy release measurements following the evaporation of a single molecule have been undertaken using a high resolution mass spectrometer. Using finite heat bath theory, these data have been transformed into binding energies for individual methanol molecules attached to each of the three cluster systems. In the larger complexes (n > 6) the results exhibit a consistent trend, whereby the experimental binding energy data for all three metal ions are similar, suggesting that the magnitude of the charge rather than charge density influences the strength of the interaction. From a comparison with data recorded previously for (CH3OH)nH(+) it is found that the 2+ charge on a metal ion has an effect on the binding energy of molecules in complexes containing up to 20 solvent molecules. The results recorded for [Ca(CH3OH)n](2+) show evidence of a very marked transition between n = 6 and 7, which is thought to coincide with the completion of a primary solvation shell and the onset of molecules starting to occupy a second and most probably a third shell.

Attaching Be or Mg to BH3 results in the formation of BeBH3 and MgBH3 molecules capable of forming stable anions

NASA Astrophysics Data System (ADS)

Anusiewicz, Iwona; Skurski, Piotr

2018-04-01

Stability of BeBH3 and MgBH3 molecules and their (BeBH3)- and (MgBH3)- anions is investigated on the basis of correlated ab initio calculations. The electronic and thermodynamic stability of all species is confirmed by estimating the excess electron binding energies of the anions and by evaluating the Gibbs free energies for various fragmentation paths. The bonding effects in BeBH3 and MgBH3 have been identified as the result of alkaline earth metal ns2 lone-pair donation to the empty 2p boron orbital. Adiabatic and vertical electronic stabilities of the (BeBH3)- and (MgBH3)- anions were found to span 1.114-1.301 and 0.675-0.744 eV range, respectively.

Subsurface Oxygen in Oxide-Derived Copper Electrocatalysts for Carbon Dioxide Reduction

DOE PAGES

Eilert, Andre; Cavalca, Filippo; Roberts, F. Sloan; ...

2016-12-16

Copper electrocatalysts derived from an oxide have shown extraordinary electrochemical properties for the carbon dioxide reduction reaction (CO 2RR). Using in situ ambient pressure X-ray photoelectron spectroscopy and quasi in situ electron energy-loss spectroscopy in a transmission electron microscope, we show that there is a substantial amount of residual oxygen in nanostructured, oxide-derived copper electrocatalysts but no residual copper oxide. On the basis of these findings in combination with density functional theory simulations, we propose that residual subsurface oxygen changes the electronic structure of the catalyst and creates sites with higher carbon monoxide binding energy. If such sites are stablemore » under the strongly reducing conditions found in CO 2RR, these findings would explain the high efficiencies of oxide-derived copper in reducing carbon dioxide to multicarbon compounds such as ethylene.« less

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Perspectives from ab-initio and tight-binding: Applications to transition metal compounds and superlattices

NASA Astrophysics Data System (ADS)

Venkataraman, Vijay Shankar

The experimental and theoretical study of transition metal compounds have occupied condensed matter physicists for the best part of the last century. The rich variety of physical behaviour exhibited by these compounds owes its origin to the subtle balance of the energy scales at play for the d orbitals. In this thesis, we study three different systems comprised of transition metal atoms from the third, the fourth, and the fifth group of the periodic table using a combination of ab-initio density functional theory (DFT) computations and effective tight-binding models for the electronic properties. We first consider the electronic properties of artificially fabricated perovskite superlattices of the form [(SrIrO3)m / SrTiO3] with integer m denoting the number of layers of SrIrO3. After discussing the results of experiments undertaken by our collaborators, we present the results of our DFT calculations and build tight-binding models for the m = 1 and m = 2 superlattices. The active ingredient is found to be the 5d orbitals with significant spin-orbit coupling. We then study the energies of magnetic ground states within DFT and compare and contrast our results with those obtained for the bulk Ruddlesden-Popper iridates. Together with experimental measurements, our results suggest that these superlattices are an exciting venue to probe the magnetism and metal-insulator transitions that occur from the intricate balance of the spin-orbit coupling and electron interactions, as has been reported for their bulk counterparts. Next, we consider alpha-RuCl3, a honeycomb lattice compound. We first show using DFT calculations in conjunction with experiments performed by our collaborators, how spin-orbit coupling in the 4d orbitals of Ru is essential to understand the insulating state realized in this compound. Then, in the latter half of the chapter, we study the magnetic ground states of a two-dimensional analogue of alpha-RuCl3 in weak and strong-coupling regimes obtained from a tight-binding model for the 4d orbitals. We further compare these results with energies obtained from DFT calculations. We obtain a zig-zag magnetic ground state for this compound, in all the three approaches. Within DFT, we find that correlations enhance the spin-orbit coupling in this compound and that the anisotropic Kitaev interactions between the spins are dominant in a strong-coupling model. Then, we move on to study the electronic band structures of the higher manganese silicides, which are good thermoelectric materials. Using results from DFT calculations on Mn4Si7 and structural arguments, we construct an effective tight-binding model for the first three members of this series - Mn4Si7, Mn11Si19, and Mn15Si26.

Band bending at the heterointerface of GaAs/InAs core/shell nanowires monitored by synchrotron X-ray photoelectron spectroscopy

NASA Astrophysics Data System (ADS)

Khanbabaee, B.; Bussone, G.; Knutsson, J. V.; Geijselaers, I.; Pryor, C. E.; Rieger, T.; Demarina, N.; Grützmacher, D.; Lepsa, M. I.; Timm, R.; Pietsch, U.

2016-10-01

Unique electronic properties of semiconductor heterostructured nanowires make them useful for future nano-electronic devices. Here, we present a study of the band bending effect at the heterointerface of GaAs/InAs core/shell nanowires by means of synchrotron based X-ray photoelectron spectroscopy. Different Ga, In, and As core-levels of the nanowire constituents have been monitored prior to and after cleaning from native oxides. The cleaning process mainly affected the As-oxides and was accompanied by an energy shift of the core-level spectra towards lower binding energy, suggesting that the As-oxides turn the nanowire surfaces to n-type. After cleaning, both As and Ga core-levels revealed an energy shift of about -0.3 eV for core/shell compared to core reference nanowires. With respect to depth dependence and in agreement with calculated strain distribution and electron quantum confinement, the observed energy shift is interpreted by band bending of core-levels at the heterointerface between the GaAs nanowire core and the InAs shell.

HITRAP: A Facility for Experiments with Trapped Highly Charged Ions

NASA Astrophysics Data System (ADS)

Quint, W.; Dilling, J.; Djekic, S.; Häffner, H.; Hermanspahn, N.; Kluge, H.-J.; Marx, G.; Moore, R.; Rodriguez, D.; Schönfelder, J.; Sikler, G.; Valenzuela, T.; Verdú, J.; Weber, C.; Werth, G.

2001-01-01

HITRAP is a planned ion trap facility for capturing and cooling of highly charged ions produced at GSI in the heavy-ion complex of the UNILAC-SIS accelerators and the ESR storage ring. In this facility heavy highly charged ions up to uranium will be available as bare nuclei, hydrogen-like ions or few-electron systems at low temperatures. The trap for receiving and studying these ions is designed for operation at extremely high vacuum by cooling to cryogenic temperatures. The stored highly charged ions can be investigated in the trap itself or can be extracted from the trap at energies up to about 10 keV/q. The proposed physics experiments are collision studies with highly charged ions at well-defined low energies (eV/u), high-accuracy measurements to determine the g-factor of the electron bound in a hydrogen-like heavy ion and the atomic binding energies of few-electron systems, laser spectroscopy of HFS transitions and X-ray spectroscopy.

Scattering of an electronic wave packet by a one-dimensional electron-phonon-coupled structure

NASA Astrophysics Data System (ADS)

Brockt, C.; Jeckelmann, E.

2017-02-01

We investigate the scattering of an electron by phonons in a small structure between two one-dimensional tight-binding leads. This model mimics the quantum electron transport through atomic wires or molecular junctions coupled to metallic leads. The electron-phonon-coupled structure is represented by the Holstein model. We observe permanent energy transfer from the electron to the phonon system (dissipation), transient self-trapping of the electron in the electron-phonon-coupled structure (due to polaron formation and multiple reflections at the structure edges), and transmission resonances that depend strongly on the strength of the electron-phonon coupling and the adiabaticity ratio. A recently developed TEBD algorithm, optimized for bosonic degrees of freedom, is used to simulate the quantum dynamics of a wave packet launched against the electron-phonon-coupled structure. Exact results are calculated for a single electron-phonon site using scattering theory and analytical approximations are obtained for limiting cases.

Atomistic model for excitons: Capturing Strongly Bound Excitons in Monolayer Transition-Metal Dichalcogenides

NASA Astrophysics Data System (ADS)

Tseng, Frank; Simsek, Ergun; Gunlycke, Daniel

2015-03-01

Monolayer transition-metal dichalcogenides form a direct bandgap predicted in the visible regime making them attractive host materials for various electronic and optoelectronic applications. Due to a weak dielectric screening in these materials, strongly bound electron-hole pairs or excitons have binding energies up to at least several hundred meV's. While the conventional wisdom is to think of excitons as hydrogen-like quasi-particles, we show that the hydrogen model breaks down for these experimentally observed strongly bound, room-temperature excitons. To capture these non-hydrogen-like photo-excitations, we introduce an atomistic model for excitons that predicts both bright excitons and dark excitons, and their broken degeneracy in these two-dimensional materials. For strongly bound exciton states, the lattice potential significantly distorts the envelope wave functions, which affects predicted exciton peak energies. The combination of large binding energies and non-degeneracy of exciton states in monolayer transition metal dichalogendies may furthermore be exploited in room temperature applications where prolonged exciton lifetimes are necessary. This work has been funded by the Office of Naval Research (ONR), directly and through the Naval Research Laboratory (NRL). F.T and E.S acknowledge support from NRL through the NRC Research Associateship Program and ONR Summer Faculty Program, respectively.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wei, Hua; Du, Mao -Hua; Stand, Luis

Scintillators attract wide research interest for their distinct applications in radiation detection. Elpasolite halides are among the most promising scintillators due to their high structural symmetry and good scintillation performance. A better understanding of their underlying scintillation mechanism opens up possibilities in scintillator development. In this work, we employ a variety of experimental techniques to study the two mixed-anion elpasolites Cs 2Na RBr 3I 3 ( R = La, Y). The emission of intrinsic Cs 2Na RBr 3I 3 with a light yield ranging from 20 000 to 40 000 ph / MeV is dominant by self-trapped exciton emission. Partialmore » substitution of R with Ce introduces a competing emission, the Ce 3+ 5d-to-4f radiative transition. Ab initio calculations are performed to investigate the electronic structures as well as the binding energies of polarons in Cs 2Na RBr 6. The calculated large self-trapped exciton binding energies are consistent with the observed high light yield due to self-trapped exciton (STE) emission. The unique electronic structure of halide elpasolites as calculated enhances the STE stability and the STE emission. The highly tunable scintillation properties of mixed-anion elpasolites underscore the role of their complex scintillation mechanism. Furthermore, our study provides guidance for the design of elpasolite scintillators with exceptional energy resolution and light yield desirable for applications.« less

Non-collinear magnetism with analytic Bond-Order Potentials

NASA Astrophysics Data System (ADS)

Ford, Michael E.; Pettifor, D. G.; Drautz, Ralf

2015-03-01

The theory of analytic Bond-Order Potentials as applied to non-collinear magnetic structures of transition metals is extended to take into account explicit rotations of Hamiltonian and local moment matrix elements between locally and globally defined spin-coordinate systems. Expressions for the gradients of the energy with respect to the Hamiltonian matrix elements, the interatomic forces and the magnetic torques are derived. The method is applied to simulations of the rotation of magnetic moments in α iron, as well as α and β manganese, based on d-valent orthogonal tight-binding parametrizations of the electronic structure. A new weighted-average terminator is introduced to improve the convergence of the Bond-Order Potential energies and torques with respect to tight-binding reference values, although the general behavior is qualitatively correct for low-moment expansions.

Atomistic Tight-Binding Theory Applied to Structural and Optical Properties of Silicon Nanodisks

NASA Astrophysics Data System (ADS)

Sukkabot, Worasak

2018-05-01

The use of ultrathin crystalline silicon (c-Si) wafers in solar cells necessitates a highly effective light absorber to compensate for poor light absorption. One route to overcoming this problem is to use a periodic array of Si nanodisks on ultrathin c-Si. In the present manuscript, we numerically investigate the effects of the geometrical parameters of the Si nanodisks, including disk diameter (D) and length (L), on the structural and optical properties, using atomistic tight-binding theory. These computations confirm that the electronic structure and optical properties are sensitive to the structural parameters. As the disk diameter and length increase, the single-electron energies decrease, and the single-hole energies increase. These calculations also reveal that, because of the quantum confinement effect, the optical band gaps gradually decrease independently of the increasing disk diameter and length. The optical spectra can be tuned across the visible region by varying the disk diameter and length, which is a useful feature for optimizing light absorption in solar cell applications. As the disk diameter and length increased, the optical intensities also increased; however, the atomistic electron-hole interactions and ground electron-hole wave function overlap progressively decreased. The ground electron-hole wave function overlap, Stokes shift, and fine structure splitting decreased as the disk diameter and length were increased. Thus, Si nanodisks with a large diameter and length might be a suitable candidate source of entangled photons. The Si nanodisks in this study also show promise for applications to solar cells based on ultrathin c-Si wafers.

Modeling electron transfer in photosystem I.

PubMed

Makita, Hiroki; Hastings, Gary

2016-06-01

Nanosecond to millisecond time-resolved absorption spectroscopy has been used to study electron transfer processes in photosystem I particles from Synechocystis sp. PCC 6803 with eight different quinones incorporated into the A1 binding site, at both 298 and 77K. A detailed kinetic model was constructed and solved within the context of Marcus electron transfer theory, and it was found that all of the data could be well described only if the in situ midpoint potentials of the quinones fell in a tightly defined range. For photosystem I with phylloquinone incorporated into the A1 binding site all of the time-resolved optical data is best modeled when the in situ midpoint potential of phylloquinone on the A/B branch is -635/-690 mV, respectively. With the midpoint potential of the F(X) iron sulfur cluster set at -680 mV, this indicates that forward electron transfer from A(1)(-) to F(X) is slightly endergonic/exergonic on the A/B branch, respectively. Additionally, for forward electron transfer from A(1)(-) to F(X), on both the A and B branches the reorganization energy is close to 0.7 eV. Reorganization energies of 0.4 or 1.0 eV are not possible. For the eight different quinones incorporated, the same kinetic model was used, allowing us to establish in situ redox potentials for all of the incorporated quinones on both branches. A linear correlation was found between the in situ and in vitro midpoint potentials of the quinones on both branches. Copyright © 2016 Elsevier B.V. All rights reserved.

Probing inter- and intrachain Zhang-Rice excitons in Li 2 CuO 2 and determining their binding energy

DOE PAGES

Monney, Claude; Bisogni, Valentina; Zhou, Ke-Jin; ...

2016-10-10

Cuprate materials, such as those hosting high-temperature superconductivity, represent a famous class of materials where the correlations between the strongly entangled charges and spins produce complex phase diagrams. Several years ago, the Zhang-Rice singlet was proposed as a natural quasiparticle in hole-doped cuprates. The occurrence and binding energy of this quasiparticle, consisting of a pair of bound holes with antiparallel spins on the same CuO 4 plaquette, depends on the local electronic interactions, which are fundamental quantities for understanding the physics of the cuprates. Here, we employ state-of-the-art resonant inelastic x-ray scattering (RIXS) to probe the correlated physics of themore » CuO 4 plaquettes in the quasi-one-dimensional chain cuprate Li 2CuO 2. By tuning the incoming photon energy to the O K edge, we populate bound states related to the Zhang-Rice quasiparticles in the RIXS process. Both intra- and interchain Zhang-Rice singlets are observed and their occurrence is shown to depend on the nearest-neighbor spin-spin correlations, which are readily probed in this experiment. Finally, we also extract the binding energy of the Zhang-Rice singlet and identify the Zhang-Rice triplet excitation in the RIXS spectra.« less

Insights into geometries, stabilities, electronic structures, reactivity descriptors, and magnetic properties of bimetallic Nim Cun-m (m = 1, 2; n = 3-13) clusters: Comparison with pure copper clusters.

PubMed

Singh, Raman K; Iwasa, Takeshi; Taketsugu, Tetsuya

2018-05-25

A long-range corrected density functional theory (LC-DFT) was applied to study the geometric structures, relative stabilities, electronic structures, reactivity descriptors and magnetic properties of the bimetallic NiCu n -1 and Ni 2 Cu n -2 (n = 3-13) clusters, obtained by doping one or two Ni atoms to the lowest energy structures of Cu n , followed by geometry optimizations. The optimized geometries revealed that the lowest energy structures of the NiCu n -1 and Ni 2 Cu n -2 clusters favor the Ni atom(s) situated at the most highly coordinated position of the host copper clusters. The averaged binding energy, the fragmentation energies and the second-order energy differences signified that the Ni doped clusters can continue to gain an energy during the growth process. The electronic structures revealed that the highest occupied molecular orbital and the lowest unoccupied molecular orbital energies of the LC-DFT are reliable and can be used to predict the vertical ionization potential and the vertical electron affinity of the systems. The reactivity descriptors such as the chemical potential, chemical hardness and electrophilic power, and the reactivity principle such as the minimum polarizability principle are operative for characterizing and rationalizing the electronic structures of these clusters. Moreover, doping of Ni atoms into the copper clusters carry most of the total spin magnetic moment. © 2018 Wiley Periodicals, Inc. © 2018 Wiley Periodicals, Inc.

First Principle Calculation : Investigation on interaction of Pt/Graphene as Catalyst

NASA Astrophysics Data System (ADS)

Anugrah Putri Namari, Nuning; Suprijadi

2017-07-01

The increasing in energy needs and the lack of non-renewable energy sources becomes a challenge for the human being to be able to use renewable energy sources. One of the devices to process renewable energy is Polymer Electrolyte Membrane Fuel Cell (PEMFC) . PEMFC use hydrogen and Oxygen as an energy sources . The most important reaction in fuel cell is Oxidation and reduction process. Therefore, a catalyst is needed to help the OR process. Study of catalyst shows that the most effective fuel cell for now is Platinum. Many fuel cell have use platinum as the catalyst. However, Platinum is a rare and expensive element. Therefore, to reduce the cost of fuel cell fabrication, we need to increase the activity of platinum. In this research, we use graphene as a support material. Then, we will study about the interaction of platinum on graphene and analyze its morphological change and electronic properties.The research conduct using Density Functional Theory (DFT). The calculation result shows that Pt/graphene can break H2 into H+ and the binding between Pt cluster is stronger than binding with the substrate.

First principles study of edge carboxylated graphene quantum dots

NASA Astrophysics Data System (ADS)

Abdelsalam, Hazem; Elhaes, Hanan; Ibrahim, Medhat A.

2018-05-01

The structure stability and electronic properties of edge carboxylated hexagonal and triangular graphene quantum dots are investigated using density functional theory. The calculated binding energies show that the hexagonal clusters with armchair edges have the highest stability among all the quantum dots. The binding energy of carboxylated graphene quantum dots increases by increasing the number of carboxyl groups. Our study shows that the total dipole moment significantly increases by adding COOH with the highest value observed in triangular clusters. The edge states in triangular graphene quantum dots with zigzag edges produce completely different energy spectrum from other dots: (a) the energy gap in triangular zigzag is very small as compared to other clusters and (b) the highest occupied molecular orbital is localized at the edges which is in contrast to other clusters where it is distributed over the cluster surface. The enhanced reactivity and the controllable energy gap by shape and edge termination make graphene quantum dots ideal for various nanodevice applications such as sensors. The infrared spectra are presented to confirm the stability of the quantum dots.

Polaron Stabilization by Cooperative Lattice Distortion and Cation Rotations in Hybrid Perovskite Materials

DOE PAGES

Neukirch, Amanda J.; Nie, Wanyi; Blancon, Jean-Christophe; ...

2016-05-25

Solution-processed organometallic perovskites have rapidly developed into a top candidate for the active layer of photovoltaic devices. In spite of the remarkable progress associated with perovskite materials, many questions about the fundamental photophysical processes taking place in these devices, remain open. High on the list of unexplained phenomena are very modest mobilities despite low charge carrier effective masses. Moreover, experiments elucidate unique degradation of photocurrent affecting stable operation of perovskite solar cells. These puzzles suggest that, while ionic hybrid perovskite devices may have efficiencies on par with conventional Si and GaAs devices, they exhibit more complicated charge transport phenomena. Wemore » report the results from an in-depth computational study of small polaron formation, electronic structure, charge density, and reorganization energies using both periodic boundary conditions and isolated structures. Using the hybrid density functional theory, we found that volumetric strain in a CsPbI 3 cluster creates a polaron with binding energy of around 300 and 900 meV for holes and electrons, respectively. In the MAPbI 3 (MA = CH 3NH 3) cluster, both volumetric strain and MA reorientation effects lead to larger binding energies at around 600 and 1300 meV for holes and electrons, respectively. Such large reorganization energies suggest appearance of small polarons in organometallic perovskite materials. Furthermore, the fact that both volumetric lattice strain and MA molecular rotational degrees of freedom can cooperate to create and stabilize polarons indicates that in order to mitigate this problem, formamidinium (FA = HC(NH 2) 2) and cesium (Cs) based crystals and alloys, are potentially better materials for solar cell and other optoelectronic applications.« less

Role of electron transfer in Ce{sup 3+} sensitized Yb{sup 3+} luminescence in borate glass

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sontakke, Atul D., E-mail: sontakke.atul.55a@st.kyoto-u.ac.jp; Katayama, Yumiko; Zhuang, Yixi

2015-01-07

In a Ce{sup 3+}-Yb{sup 3+} system, two mechanisms are proposed so far namely, the quantum cutting mechanism and the electron transfer mechanism explaining Yb{sup 3+} infrared luminescence under Ce{sup 3+} excitation. Among them, the quantum cutting mechanism, where one Ce{sup 3+} photon (ultraviolet/blue) gives rise to two Yb{sup 3+} photons (near infrared) is widely sought for because of its huge potential in enhancing the solar cell efficiency. In present study on Ce{sup 3+}-Yb{sup 3+} codoped borate glasses, Ce{sup 3+} sensitized Yb{sup 3+} luminescence at ∼1 μm have been observed on Ce{sup 3+} 5d state excitation. However, the intensity of sensitized Yb{supmore » 3+} luminescence is found to be very weak compared to the strong quenching occurred in Ce{sup 3+} luminescence in Yb{sup 3+} codoped glasses. Moreover, the absolute luminescence quantum yield also showed a decreasing trend with Yb{sup 3+} codoping in the glasses. The overall behavior of the luminescence properties and the quantum yield is strongly contradicting with the quantum cutting phenomenon. The results are attributed to the energetically favorable electron transfer interactions followed by Ce{sup 3+}-Yb{sup 3+} ⇌ Ce{sup 4+}-Yb{sup 2+} inter-valence charge transfer and successfully explained using the absolute electron binding energies of dopant ions in the studied borate glass. Finally, an attempt has been presented to generalize the electron transfer mechanism among opposite oxidation/reduction property dopant ions using the vacuum referred electron binding energy (VRBE) scheme for lanthanide series.« less

Ab initio study of structural, electronic, optical, and vibrational properties of Zn x S y ( x + y = 2 to 5) nanoclusters

NASA Astrophysics Data System (ADS)

Yadav, P. S.; Pandey, D. K.; Agrawal, S.; Agrawal, B. K.

2010-03-01

An ab initio study of the stability, structural, electronic. and optical properties has been performed for 46 zinc sulfide nanoclusters Zn x S y ( x + y = n = 2 to 5). Five out of them are seen to be unstable as their vibrational frequencies are found to be imaginary. A B3LYP-DFT/6-311G(3df) method is employed to optimize the geometries and a TDDFT method is used for the study of the optical properties. The binding energies (BE), HOMO-LUMO gaps and the bond lengths have been obtained for all the clusters. For the ZnS2, ZnS3, and ZnS4 nanoclusters, our stable structures are seen to be different from those obtained earlier by using the effective core potentials. We have also considered the zero point energy (ZPE) corrections ignored by the earlier workers. For a fixed value of n, we designate the most stable structure the one, which has maximum final binding energy per atom. The adiabatic and vertical ionization potentials (IP) and electron affinities (EA), charges on the atoms, dipole moments, optical properties, vibrational frequencies, infrared intensities, relative infrared intensities, and Raman scattering activities have been investigated for the most stable structures. The nanoclusters containing large number of S atoms for each n is found to be most stable. The HOMO-LUMO gap decreases from n = 2-3 and then increases above n = 3. The IP and EA both fluctuate with the cluster size n. The optical absorption is quite weak in visible region but strong in the ultraviolet region in most of the nanoclusters except a few. The optical absorption spectrum or electron energy loss spectrum (EELS) is unique for every nanocluster and may be used to characterize a specific nanocluster. The growth of most stable nanoclusters may be possible in the experiments.

High resolution spectroscopy of the 12Lambda B hypernucleus produced by the (e,e'K+) reaction.

PubMed

Miyoshi, T; Sarsour, M; Yuan, L; Zhu, X; Ahmidouch, A; Ambrozewicz, P; Androic, D; Angelescu, T; Asaturyan, R; Avery, S; Baker, O K; Bertovic, I; Breuer, H; Carlini, R; Cha, J; Chrien, R; Christy, M; Cole, L; Danagoulian, S; Dehnhard, D; Elaasar, M; Empl, A; Ent, R; Fenker, H; Fujii, Y; Furic, M; Gan, L; Garrow, K; Gasparian, A; Gueye, P; Harvey, M; Hashimoto, O; Hinton, W; Hu, B; Hungerford, E; Jackson, C; Johnston, K; Juengst, H; Keppel, C; Lan, K; Liang, Y; Likhachev, V P; Liu, J H; Mack, D; Margaryan, A; Markowitz, P; Martoff, J; Mkrtchyan, H; Nakamura, S N; Petkovic, T; Reinhold, J; Roche, J; Sato, Y; Sawafta, R; Simicevic, N; Smith, G; Stepanyan, S; Tadevosyan, V; Takahashi, T; Tanida, K; Tang, L; Ukai, M; Uzzle, A; Vulcan, W; Wells, S; Wood, S; Xu, G; Yamaguchi, H; Yan, C

2003-06-13

High-energy, cw electron beams at new accelerator facilities allow electromagnetic production and precision study of hypernuclear structure, and we report here on the first experiment demonstrating the potential of the (e,e'K+) reaction for hypernuclear spectroscopy. This experiment is also the first to take advantage of the enhanced virtual photon flux available when electrons are scattered at approximately zero degrees. The observed energy resolution was found to be approximately 900 keV for the (12)(Lambda)B spectrum, and is substantially better than any previous hypernuclear experiment using magnetic spectrometers. The positions of the major excitations are found to be in agreement with a theoretical prediction and with a previous binding energy measurement, but additional structure is also observed in the core excited region, underlining the future promise of this technique.

Theoretical study of the influence of the electric field on the electronic properties of armchair boron nitride nanoribbon

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2014-11-01

We have investigated the electronic properties of A-BNNRs in the external electric field using third nearest neighbor tight binding approximation including edge effects. We found that the dependence of on-site energy to the external electric field for edge atoms and center part atoms is different. By comparing the band structure in the different fields, several differences are clearly seen such as modification of energy dispersions, creation of additional band edge states and band gap reduction. By increasing the electric field the band gap reduces linearly until reaches zero and BNNRs with larger width are more sensitive than small ones. All changes in the band structure are directly reflected in the DOS spectrum. The numbers and the energies of the DOS peaks are dependent on the electric field strength.

Suzuki segregation in a binary Cu-Si alloy.

PubMed

Mendis, Budhika G; Jones, Ian P; Smallman, Raymond E

2004-01-01

Suzuki segregation to stacking faults and coherent twin boundaries has been investigated in a Cu-7.15 at.% Si alloy, heat-treated at temperatures of 275, 400 and 550 degrees C, using field-emission gun transmission electron microscopy. Silicon enrichment was observed at the stacking fault plane and decreased monotonically with increasing annealing temperature. This increase in the concentration of solute at the fault is due to the stacking fault energy being lowered at higher values of the electron-to-atom ratio of the alloy. From a McLean isotherm, the binding energy for segregation was calculated to be -0.021 +/- 0.019 eV atom(-1). Hardly any segregation was observed to coherent twin boundaries in the same alloy. This is because a twin has a lower interfacial energy than a stacking fault, so that the driving force for segregation is diminished.

Electronic Properties of SiNTs Under External Electric and Magnetic Fields Using the Tight-Binding Method

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2014-02-01

We investigated the electronic properties of silicon nanotubes (SiNTs) under external transverse electric fields and axial magnetic fields using the tight-binding approximation. It was found that, after switching on the electric and magnetic fields, band modifications such as distortion of degeneracy, change in energy dispersion and subband spacing, and bandgap size reduction occur. The bandgap of silicon gear-like nanotubes (Si g-NTs) decreases linearly with increasing electric field strength, but the bandgap for silicon hexagonal nanotubes (Si h-NTs) first increases and then decreases (metallic) or first remains constant and then decreases (semiconducting). Our results show that the bandgap of Si h-NTs is very sensitive to both electric and magnetic fields, unlike Si g-NTs, which are more sensitive to electric than magnetic fields.

The stark effect on the spectrum energy of tritium in first excited state with relativistic condition

NASA Astrophysics Data System (ADS)

Prastowo, S. H. B.; Supriadi, B.; Bahri, S.; Ridlo, Z. R.

2018-04-01

This research discussed about the correction of Stark Effect on Tritium atoms in the first excited state with relativistic conditions. The approach used to solve this Stark Effect correction was the perturbation theory which was from time independent degenerate perturbation theory to second-order correction. The Stark Effect on the excited state made the spectrum energy polarization of Tritium which was included in the isotope of hydrogen with an electron moving around the nucleus with high velocity. Hence, the relativistic correction affected the spectrum energy shift. Tritium was a radioactive material having half-time 12,3 years and relatively safe. The Tritium application was a material for the manufacture of nuclear battery. The most effective external electric field that should give to Tritium was 108 V/mith the total correction energy that was 0,97398557 × 10-21 Joule. Therefore, its effect reduced the binding energy between electron and nucleus, and increased the power of Tritium Betavoltaics Battery.

Complex absorbing potential based Lorentzian fitting scheme and time dependent quantum transport.

PubMed

Xie, Hang; Kwok, Yanho; Jiang, Feng; Zheng, Xiao; Chen, GuanHua

2014-10-28

Based on the complex absorbing potential (CAP) method, a Lorentzian expansion scheme is developed to express the self-energy. The CAP-based Lorentzian expansion of self-energy is employed to solve efficiently the Liouville-von Neumann equation of one-electron density matrix. The resulting method is applicable for both tight-binding and first-principles models and is used to simulate the transient currents through graphene nanoribbons and a benzene molecule sandwiched between two carbon-atom chains.

An experimental investigation of fractionation by sputter deposition. [application to solar wind irradiation of lunar soil

NASA Technical Reports Server (NTRS)

Paruso, D. M.; Cassidy, W. A.; Hapke, B. W.

1978-01-01

Artificial glass targets composed of elements varying widely in atomic weight were irradiated at an angle of incidence of 45 deg by 2-keV hydrogen ions at a current density of .33 mA/sq cm, and sputtered atoms were caught on a molybdenum film. Analyses of the sputter-deposited films and unsputtered target glasses were carried out by electron microprobe. The backward-sputtered component was found to be enriched in elements of low atomic weight, while the forward-sputtered component was enriched in heavy atoms. These results indicate that at the lunar surface lighter elements and isotopes would tend to be ejected in backward directions, escaping directly through the openings which admit bombarding ions without first striking an adjacent grain surface; heavy elements and isotopes would be forward-sputtered deeper into the soil and be preferentially retained, contributing to the reported enrichments of heavy elements and isotopes. Additional results show that the binding energy of an element in its oxide form influences the sticking coefficient of a sputtered atom; elements of low binding energy are likely to desorb, while elements of high binding energy tend to stick to the first bounce surface.

The stability of vacancy clusters and their effect on helium behaviors in 3C-SiC

NASA Astrophysics Data System (ADS)

Sun, Jingjing; Li, B. S.; You, Yu-Wei; Hou, Jie; Xu, Yichun; Liu, C. S.; Fang, Q. F.; Wang, Z. G.

2018-05-01

We have carried out systematical ab initio calculations to study the stability of vacancy clusters and their effect on helium behaviors in 3C-SiC. It is found that the formation energies of vacancy clusters containing only carbon vacancies are the lowest although the vacancies are not closest to each other, while the binding energies of vacancy clusters composed of both silicon and carbon vacancies in the closest neighbors to each other are the highest. Vacancy clusters can provide with free space for helium atoms to aggregate, while interstitial sites are not favorable for helium atoms to accumulate. The binding energies of vacancy clusters with helium atoms increase almost linearly with the ratio of helium to vacancy, n/m. The binding strength of vacancy cluster having the participation of the silicon vacancy with helium is relatively stronger than that without silicon vacancy. The vacancy clusters with more vacancies can trap helium atoms more tightly. With the presence of vacancy clusters in the material, the diffusivity of helium will be significantly reduced. Moreover, the three-dimension electron density is calculated to analyze the interplay of vacancy clusters with helium.

Environmental Screening Effects in 2D Materials: Renormalization of the Bandgap, Electronic Structure, and Optical Spectra of Few-Layer Black Phosphorus.

PubMed

Qiu, Diana Y; da Jornada, Felipe H; Louie, Steven G

2017-08-09

Few-layer black phosphorus has recently emerged as a promising 2D semiconductor, notable for its widely tunable bandgap, highly anisotropic properties, and theoretically predicted large exciton binding energies. To avoid degradation, it has become common practice to encapsulate black phosphorus devices. It is generally assumed that this encapsulation does not qualitatively affect their optical properties. Here, we show that the contrary is true. We have performed ab initio GW and GW plus Bethe-Salpeter equation (GW-BSE) calculations to determine the quasiparticle (QP) band structure and optical spectrum of one-layer (1L) through four-layer (4L) black phosphorus, with and without encapsulation between hexagonal boron nitride and sapphire. We show that black phosphorus is exceptionally sensitive to environmental screening. Encapsulation reduces the exciton binding energy in 1L by as much as 70% and completely eliminates the presence of a bound exciton in the 4L structure. The reduction in the exciton binding energies is offset by a similarly large renormalization of the QP bandgap so that the optical gap remains nearly unchanged, but the nature of the excited states and the qualitative features of the absorption spectrum change dramatically.

Calculating the X-Ray Fluorescence from the Planet Mercury Due to High-Energy Electrons

NASA Technical Reports Server (NTRS)

Burbine, T. H.; Trombka, J. I.; Bergstrom, P. M., Jr.; Christon, S. P.

2005-01-01

The least-studied terrestrial planet is Mercury due to its proximity to the Sun, which makes telescopic observations and spacecraft encounters difficult. Our lack of knowledge about Mercury should change in the near future due to the recent launching of MESSENGER, a Mercury orbiter. Another mission (BepiColombo) is currently being planned. The x-ray spectrometer on MESSENGER (and planned for BepiColombo) can characterize the elemental composition of a planetary surface by measuring emitted fluorescent x-rays. If electrons are ejected from an atom s inner shell by interaction with energetic particles such as photons, electrons, or ions, electrons from an outer shell can transfer to the inner shell. Characteristic x-rays are then emitted with energies that are the difference between the binding energy of the ion in its excited state and that of the ion in its ground state. Because each element has a unique set of energy levels, each element emits x-rays at a unique set of energies. Electrons and ions usually do not have the needed flux at high energies to cause significant x-ray fluorescence on most planetary bodies. This is not the case for Mercury where high-energy particles were detected during the Mariner 10 flybys. Mercury has an intrinsic magnetic field that deflects the solar wind, resulting in a bow shock in the solar wind and a magnetospheric cavity. Electrons and ions accelerated in the magnetosphere tend to follow its magnetic field lines and can impact the surface on Mercury s dark side Modeling has been done to determine if x-ray fluorescence resulting from the impact of high-energy electrons accelerated in Mercury's magnetosphere can be detected by MESSENGER. Our goal is to understand how much bulk chemical information can be obtained from x-ray fluorescence measurements on the dark side of Mercury.

Molecular models of alginic acid: Interactions with calcium ions and calcite surfaces

NASA Astrophysics Data System (ADS)

Perry, Thomas D.; Cygan, Randall T.; Mitchell, Ralph

2006-07-01

Cation binding by polysaccharides is observed in many environments and is important for predictive environmental modeling, and numerous industrial and food technology applications. The complexities of these cation-organic interactions are well suited for predictive molecular modeling and the analysis of conformation and configuration of polysaccharides and their influence on cation binding. In this study, alginic acid was chosen as a model polymer system and representative disaccharide and polysaccharide subunits were developed. Molecular dynamics simulation of the torsion angles of the ether linkage between various monomeric subunits identified local and global energy minima for selected disaccharides. The simulations indicate stable disaccharide configurations and a common global energy minimum for all disaccharide models at Φ = 274 ± 7°, Ψ = 227 ± 5°, where Φ and Ψ are the torsion angles about the ether linkage. The ability of disaccharide subunits to bind calcium ions and to associate with the (101¯4) surface of calcite was also investigated. Molecular models of disaccharide interactions with calcite provide binding energy differences for conformations that are related to the proximity and residence densities of the electron-donating moieties with calcium ions on the calcite surface, which are controlled, in part, by the torsion of the ether linkage between monosaccharide units. Dynamically optimized configurations for polymer alginate models with calcium ions were also derived.

Statins in therapy: understanding their hydrophilicity, lipophilicity, binding to 3-hydroxy-3-methylglutaryl-CoA reductase, ability to cross the blood brain barrier and metabolic stability based on electrostatic molecular orbital studies.

PubMed

Fong, Clifford W

2014-10-06

The atomic electrostatic potentials calculated by the CHELPG method have been shown to be sensitive indicators of the gas phase and solution properties of the statins. Solvation free energies in water, n-octanol and n-octane have been determined using the SMD solvent model. The percentage hydrophilicity and hydrophobicity (or lipophilicity) of the statins in solution have been determined using (a) the differences in solvation free energies between n-octanol and n-octane as a measure of hydrophilicity, and the solvation energy in octane as a measure of hydrophobicity (b) the sum of the atomic electrostatic charges on the hydrogen bonding and polar bonding nuclei of the common pharmacophore combined with a solvent measure of hydrophobicity, and (c) using the buried surface areas after statin binding to HMGCR to calculate the hydrophobicity of the bound statins. The data suggests that clinical definitions of statins as either "hydrophilic" or "lipophilic" based on experimental partition coefficients are misleading. An estimate of the binding energy between rosuvastatin and HMGCR has been made using: (a) a coulombic electrostatic interaction model, (b) the calculated desolvation and resolvation of the statin in water, and (c) the first shell transfer solvation energy as a proxy for the restructuring of the water molecules immediately adjacent to the active binding site of HMGCR prior to binding. Desolvation and resolvation of the statins before and after binding to HMGCR are major determinants of the energetics of the binding process. An analysis of the amphiphilic nature of lovastatin anion, acid and lactone and fluvastatin anion and their abilities to cross the blood brain barrier has indicated that this process may be dominated by desolvation and resolvation effects, rather than the statin molecular size or statin-lipid interactions within the bilayer. The ionization energy and electron affinity of the statins are sensitive physical indicators of the ease that the various statins can undergo endogenous oxidative metabolism. The absolute chemical hardness is also an indicator of the stability of the statins, and may be a useful indicator for drug design. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Elucidating the role of surface passivating ligand structural parameters in hole wave function delocalization in semiconductor cluster molecules.

PubMed

Teunis, Meghan B; Nagaraju, Mulpuri; Dutta, Poulami; Pu, Jingzhi; Muhoberac, Barry B; Sardar, Rajesh; Agarwal, Mangilal

2017-09-28

This article describes the mechanisms underlying electronic interactions between surface passivating ligands and (CdSe) 34 semiconductor cluster molecules (SCMs) that facilitate band-gap engineering through the delocalization of hole wave functions without altering their inorganic core. We show here both experimentally and through density functional theory calculations that the expansion of the hole wave function beyond the SCM boundary into the ligand monolayer depends not only on the pre-binding energetic alignment of interfacial orbitals between the SCM and surface passivating ligands but is also strongly influenced by definable ligand structural parameters such as the extent of their π-conjugation [π-delocalization energy; pyrene (Py), anthracene (Anth), naphthalene (Naph), and phenyl (Ph)], binding mode [dithiocarbamate (DTC, -NH-CS 2 - ), carboxylate (-COO - ), and amine (-NH 2 )], and binding head group [-SH, -SeH, and -TeH]. We observe an unprecedentedly large ∼650 meV red-shift in the lowest energy optical absorption band of (CdSe) 34 SCMs upon passivating their surface with Py-DTC ligands and the trend is found to be Ph- < Naph- < Anth- < Py-DTC. This shift is reversible upon removal of Py-DTC by triethylphosphine gold(i) chloride treatment at room temperature. Furthermore, we performed temperature-dependent (80-300 K) photoluminescence lifetime measurements, which show longer lifetime at lower temperature, suggesting a strong influence of hole wave function delocalization rather than carrier trapping and/or phonon-mediated relaxation. Taken together, knowledge of how ligands electronically interact with the SCM surface is crucial to semiconductor nanomaterial research in general because it allows the tuning of electronic properties of nanomaterials for better charge separation and enhanced charge transfer, which in turn will increase optoelectronic device and photocatalytic efficiencies.

The structure, energetics, and nature of the chemical bonding of phenylthiol adsorbed on the Au(111) surface: implications for density-functional calculations of molecular-electronic conduction.

PubMed

Bilić, Ante; Reimers, Jeffrey R; Hush, Noel S

2005-03-01

The adsorption of phenylthiol on the Au(111) surface is modeled using Perdew and Wang density-functional calculations. Both direct molecular physisorption and dissociative chemisorption via S-H bond cleavage are considered as well as dimerization to form disulfides. For the major observed product, the chemisorbed thiol, an extensive potential-energy surface is produced as a function of both the azimuthal orientation of the adsorbate and the linear translation of the adsorbate through the key fcc, hcp, bridge, and top binding sites. Key structures are characterized, the lowest-energy one being a broad minimum of tilted orientation ranging from the bridge structure halfway towards the fcc one. The vertically oriented threefold binding sites, often assumed to dominate molecular electronics measurements, are identified as transition states at low coverage but become favored in dense monolayers. A similar surface is also produced for chemisorption of phenylthiol on Ag(111); this displays significant qualitative differences, consistent with the qualitatively different observed structures for thiol chemisorption on Ag and Au. Full contours of the minimum potential energy as a function of sulfur translation over the crystal face are described, from which the barrier to diffusion is deduced to be 5.8 kcal mol(-1), indicating that the potential-energy surface has low corrugation. The calculated bond lengths, adsorbate charge and spin density, and the density of electronic states all indicate that, at all sulfur locations, the adsorbate can be regarded as a thiyl species that forms a net single covalent bond to the surface of strength 31 kcal mol(-1). No detectable thiolate character is predicted, however, contrary to experimental results for alkyl thiols that indicate up to 20%-30% thiolate involvement. This effect is attributed to the asymptotic-potential error of all modern density functionals that becomes manifest through a 3-4 eV error in the lineup of the adsorbate and substrate bands. Significant implications are described for density-functional calculations of through-molecule electron transport in molecular electronics.

Energetics of a Li Atom adsorbed on B/N doped graphene with monovacancy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rani, Babita, E-mail: babitabaghla15@gmail.com; Department of Physics, Punjabi University, Patiala 147002; Jindal, V.K.

We use density functional theory (DFT) to study the adsorption properties and diffusion of Li atom across B/N-pyridinic graphene. Regardless of the dopant type, B atoms of B-pyridinic graphene lose electron density. On the other hand, N atoms (p-type dopants) have tendency to gain electron density in N-pyridinic graphene. Higher chemical reactivity and electronic conductivity of B/N-pyridinic graphene are responsible for stronger binding of Li with the substrates as compared to pristine graphene. The binding energy of Li with B/N-pyridinic graphene exceeds the cohesive energy of bulk Li, making it energetically unfavourable for Li to form clusters on these substrates.more » Li atom gets better adsorbed on N-pyridinic graphene due to an additional p-p hybridization of the orbitals while Li on B-pyridinic prefers the ionic bonding. Also, significant distortion of N-pyridinic graphene upon Li adsorption is a consequence of the change in bonding mechanism between Li atom and the substrate. Our results show that bonding character and hence binding energies between Li and graphene can be tuned with the help of B/N doping of monovacancy defects. Further, the sites for most stable adsorption are different for the two types of doped and defective graphene, leading to greater Li uptake capacity of B-pyridinic graphene near the defect. In addition, B-pyridinic graphene offering lower diffusion barrier, ensures better Li kinetics. Thus, B-pyridinic graphene presents itself as a better anode material for LIBs as compared to N-pyridinic graphene. - Graphical abstract: Adsorption and diffusion of Li atom across the B/N doped monovacancy graphene is studied using ab-initio DFT calculations. Our results show that bonding mechanism and binding of Li with graphene can be tuned with the help of N/B doping of defects. Also, B-pyridinic graphene presents itself as a better anode material for lithium ion batteries as compared to N-pyridinic graphene. Display Omitted - Highlights: • Density functional theory (DFT) calculations are employed to study the effect of B/N doping of monovacancy graphene on the adsorption and diffusion of Li atom across the sheet using VASP. • Higher chemical reactivity and electronic conductivity of B/N-pyridinic graphene (p-type semiconductors) as compared to pristine graphene lead to stronger binding of Li. It also exceeds the cohesive energy of bulk Li. Thus, uniform distribution of Li atoms is possible on both substrates. • Li gets adsorbed stably at centre of defect in N-pyridinic graphene. B-pyridinic graphene has stable adsorption of Li at hollow site of hexagon, neighboring the defect, having only one boron atom. It leads to maximum Li uptake capacity of B-pyridinic graphene. • Li gets better adsorbed on N-pyridinic graphene due to an additional p-p hybridization of the orbitals. This change in bonding mechanism causes significant distortion of the substrate. On the other hand, Li on B-pyridinic graphene shows ionic bonding character. • B-pyridinic graphene offers lower energy barrier for Li to diffuse across the substrate in comparison to N-pyridinic graphene. Thus, B-pyridinic graphene presents itself as a better anode material for lithium ion batteries due to optimal Li adsorption and better diffusion kinetics.« less

High Resolution Λ Hypernuclear Spectroscopy with Electron Beams

NASA Astrophysics Data System (ADS)

Gogami, T.; Achenbach, P.; Ahmidouch, A.; Albayrak, I.; Androic, D.; Asaturyan, A.; Asaturyan, R.; Ates, O.; Baturin, P.; Badui, R.; Boeglin, W.; Bono, J.; Brash, E.; Carter, P.; Chen, C.; Chiba, A.; Christy, E.; Danagoulian, S.; De Leo, R.; Doi, D.; Elaasar, M.; Ent, R.; Fujii, Y.; Fujita, M.; Furic, M.; Gabrielyan, M.; Gan, L.; Garibaldi, F.; Gaskell, D.; Gasparian, A.; Hashimoto, O.; Horn, T.; Hu, B.; Hungerford, Ed. V.; Jones, M.; Kanda, H.; Kaneta, M.; Kato, S.; Kawai, M.; Kawama, D.; Khanal, H.; Kohl, M.; Liyanage, A.; Luo, W.; Maeda, K.; Margaryan, A.; Markowitz, P.; Maruta, T.; Matsumura, A.; Maxwell, V.; Mkrtchyan, A.; Mkrtchyan, H.; Nagao, S.; Nakamura, S. N.; Narayan, A.; Neville, C.; Niculescu, G.; Niculescu, M. I.; Nunez, A.; Nuruzzaman; Okayasu, Y.; Petkovic, T.; Pochodzalla, J.; Qiu, X.; Reinhold, J.; Rodriguez, V. M.; Samanta, C.; Sawatzky, B.; Seva, T.; Shichijo, A.; Tadevosyan, V.; Tang, L.; Taniya, N.; Tsukada, K.; Veilleux, M.; Vulcan, W.; Wesselmann, F. R.; Wood, S. A.; Yamamoto, T.; Ya, L.; Ye, Z.; Yokota, K.; Yuan, L.; Zhamkochyan, S.; Zhu, L.

JLab E05-115 which is an experiment for Λ hypernuclear spectroscopy with electron beams was carried out at Jefferson Lab (JLab) in 2009. In the experiment, Λ 7He, Λ 9Li, Λ 10Be, Λ 12B and Λ 52V were measured by new magnetic spectrometer systems (SPL+HES+HKS) which were necessary for spectroscopy with high energy resolution of sub-MeV (FWHM). This is the first attempt to measure a Λ hypernucleus with up to medium-heavy mass region by the (e,e' K + ) reaction, overcoming high rate and high multiplicity conditions due to electromagnetic background particles. An overview of the hypernuclear experiments at JLab Hall-C and preliminary binding energy spectrum of Λ 10Be are shown.

Isotope effect on electron-phonon interaction in the multiband superconductor MgB 2

DOE PAGES

Mou, Daixiang; Manni, Soham; Taufour, Valentin; ...

2016-04-07

We investigate the effect of isotope substitution on the electron-phonon interaction in the multiband superconductor MgB 2 using tunable laser-based angle-resolved photoemission spectroscopy. The kink structure around 70 meV in the σ band, which is caused by electron coupling to the E 2g phonon mode, is shifted to higher binding energy by ~3.5 meV in Mg 10B 2 and the shift is not affected by superconducting transition. Furthermore, these results serve as the benchmark for investigations of isotope effects in known, unconventional superconductors and newly discovered superconductors where the origin of pairing is unknown.

Highly Charged Rydberg Ions from the Coulomb Explosion of Clusters

NASA Astrophysics Data System (ADS)

Komar, D.; Kazak, L.; Almassarani, M.; Meiwes-Broer, K.-H.; Tiggesbäumker, J.

2018-03-01

Ion emission from a nanoplasma produced in the interaction of intense optical laser pulses with argon clusters is studied resolving simultaneously charge states and recoil energies. By applying appropriate static electric fields we observe that a significant fraction of the ions Arq + (q =1 - 7 ) has electrons with binding energies lower than 150 meV; i.e., nRyd≥15 levels are populated. Charge state changes observed on a μ s time scale can be attributed to electron emission due to autoionizing Rydberg states, indicating that high-ℓ Rydberg levels are populated as well. The experiments support theoretical predictions that a significant fraction of delocalized electrons, which are bound with hundreds of eV to the nanoplasma after the laser exposure, fill up meV bound ion states in the adiabatic expansion. We expect the process to be relevant for the long-term evolution of expanding laser-induced dense plasmas in general.

Analysis of the Structures and Properties of (GaSb)n (n = 4-9) Clusters through Density Functional Theory.

PubMed

Lu, Qi Liang; Luo, Qi Quan; Huang, Shou Guo; Li, Yi De; Wan, Jian Guo

2016-07-07

An optimization strategy combining global semiempirical quantum mechanical search with all-electron density functional theory was adopted to determine the lowest energy structure of (GaSb)n clusters up to n = 9. The growth pattern of the clusters differed from those of previously reported group III-V binary clusters. A cagelike configuration was found for cluster sizes n ≤ 7. The structure of (GaSb)6 deviated from that of other III-V clusters. Competition existed between core-shell and hollow cage structures of (GaSb)7. Novel noncagelike structures were energetically preferred over the cages for the (GaSb)8 and (GaSb)9 clusters. Electronic properties, such as vertical ionization potential, adiabatic electron affinities, HOMO-LUMO gaps, and average on-site charges on Ga or Sb atoms, as well as binding energies, were computed.

Competitive Energy and Electron Transfer in β-Functionalized Free-Base Porphyrin-Zinc Porphyrin Dimer Axially Coordinated to C60 : Synthesis, Supramolecular Formation and Excited-State Processes.

PubMed

Hu, Yi; Thomas, Michael B; Jinadasa, R G Waruna; Wang, Hong; D'Souza, Francis

2017-09-18

Simultaneous occurrence of energy and electron transfer events involving different acceptor sites in a newly assembled supramolecular triad comprised of covalently linked free-base porphyrin-zinc porphyrin dyad, H 2 P-ZnP axially coordinated to electron acceptor fullerene, has been successfully demonstrated. The dyad was connected through the β-pyrrole positions of the porphyrin macrocycle instead of the traditionally used meso-positions for better electronic communication. Interestingly, the β-pyrrole functionalization modulated the optical properties to such an extent that it was possible to almost exclusively excite the zinc porphyrin entity in the supramolecular triad. The measured binding constant for the complex with 1:1 molecular stoichiometry was in the order of 10 4  m -1 revealing moderately stable complex formation. An energy level diagram constructed using optical, electrochemical and computational results suggested that both the anticipated energy and electron events are thermodynamically feasible in the triad. Consequently, it was possible to demonstrate occurrence of excited state energy transfer to the covalently linked H 2 P, and electron transfer to the coordinated ImC 60 from studies involving steady-state and time-resolved emission, and femto- and nanosecond transient absorption studies. The estimated energy transfer was around 67 % in the dyad with a rate constant of 1.1×10 9  s -1 . In the supramolecular triad, the charge separated state was rather long-lived although it was difficult to arrive the exact lifetime of charge separated state from nanosecond transient spectral studies due to overlap of strong triplet excited signals of porphyrin in the monitoring wavelength window. Nevertheless, simultaneous occurrence of energy and electron transfer in the appropriately positioned energy and electron acceptor entities in a supramolecular triad was possible to demonstrate in the present study, a step forward to unraveling the complex photochemical events occurring in natural photosynthesis and its implications in building light energy harvesting devices. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Structural, electronic and vibrational properties of small GaxNy (x+y = 2 5) nanoclusters: a B3LYP-DFT study

NASA Astrophysics Data System (ADS)

Yadav, P. S.; Yadav, R. K.; Agrawal, B. K.

2007-02-01

An ab initio study of the stability, structural and electronic properties has been made for 49 gallium nitride nanoclusters, GaxNy (x+y = 2-5). Among the various configurations corresponding to a fixed x+y = n value, the configuration possessing the maximum value of binding energy (BE) is named as the most stable structure. The vibrational and optical properties have been investigated only for the most stable structures. A B3LYP-DFT/6-311G(3df) method has been employed to optimize the geometries of the nanoclusters fully. The binding energies (BEs), highest-occupied and lowest-unoccupied molecular orbital (HOMO-LUMO) gaps and the bond lengths have been obtained for all the clusters. We have considered the zero-point energy (ZPE) corrections ignored by the earlier workers. The adiabatic and vertical ionization potentials (IPs) and electron affinities (EAs), charge on atoms, dipole moments, vibrational frequencies, infrared intensities (IR Int.), relative infrared intensities (Rel. IR Int.) and Raman scattering activities have been investigated for the most stable structures. The configurations containing the N atoms in majority are seen to be the most stable structures. The strong N-N bond has an important role in stabilizing the clusters. For clusters containing one Ga atom and all the others as N atoms, the BE increases monotonically with the number of the N atoms. The HOMO-LUMO gap and IP fluctuate with the cluster size n, having larger values for the clusters containing odd number of N atoms. On the other hand, the EA decreases with the cluster size up to n = 3, and shows slow fluctuations thereafter for the larger clusters. In general, the adiabatic IP (EA) is smaller (greater) than the vertical IP (EA) because of the lower energies of the most stable ground state of the cationic (anionic) clusters. The optical absorption spectrum or electron energy loss spectrum (EELS) is unique for every cluster, and may be used to characterize a specific cluster. All the predicted physical quantities are in good agreement with the experimental data wherever available. The growth of these most stable structures should be possible in experiments.

Adsorbate-induced shifts of electronic surface states: Cs on the (100) faces of tungsten, molybdenum, and tantalum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Soukiassian, P.; Riwan, R.; Lecante, J.

1985-04-15

The adsorption of cesium on the (100) faces of W, Mo, and Ta for coverages between 0 and 1 monolayer is studied by angle-resolved ultraviolet photoemission spectroscopy with use of synchro- tron radiation, by electron-energy-loss spectroscopy, and by low-energy electron diffraction. With increasing cesiation, the W(100) surface state at Gamma-bar located 0.3 eV below the Fermi level is shifted by up to 1.0 eV to larger binding energies while remaining sharp and intense. A similar behavior is observed on Ta(100), whereas on Mo(100) the shift of 0.9 eV of this surface state is accompanied by a pronounced attenuation of itsmore » intensity. These experimental shifts are shown to be in excellent agreement with all-electron local-density-functional results obtained with the full-potential linearized augmented-plane-wave method for Cs monolayers on the W(100) and Mo(100) surfaces. Based on these ab initio results, the electronic origin of the shifts is understood by the formation of strongly polarized covalent bonds between the d-like surface states and the Cs 6s--derived valence states. It is argued that even at high Cs coverages, the main electron-energy-loss peaks, which are observed between 1 and 2 eV, could be interpreted as Cs 6s..-->..6p--like interband transitions rather than as surface-plasmon peaks.« less

Isomer depletion as experimental evidence of nuclear excitation by electron capture

NASA Astrophysics Data System (ADS)

Chiara, C. J.; Carroll, J. J.; Carpenter, M. P.; Greene, J. P.; Hartley, D. J.; Janssens, R. V. F.; Lane, G. J.; Marsh, J. C.; Matters, D. A.; Polasik, M.; Rzadkiewicz, J.; Seweryniak, D.; Zhu, S.; Bottoni, S.; Hayes, A. B.; Karamian, S. A.

2018-02-01

The atomic nucleus and its electrons are often thought of as independent systems that are held together in the atom by their mutual attraction. Their interaction, however, leads to other important effects, such as providing an additional decay mode for excited nuclear states, whereby the nucleus releases energy by ejecting an atomic electron instead of by emitting a γ-ray. This ‘internal conversion’ has been known for about a hundred years and can be used to study nuclei and their interaction with their electrons. In the inverse process—nuclear excitation by electron capture (NEEC)—a free electron is captured into an atomic vacancy and can excite the nucleus to a higher-energy state, provided that the kinetic energy of the free electron plus the magnitude of its binding energy once captured matches the nuclear energy difference between the two states. NEEC was predicted in 1976 and has not hitherto been observed. Here we report evidence of NEEC in molybdenum-93 and determine the probability and cross-section for the process in a beam-based experimental scenario. Our results provide a standard for the assessment of theoretical models relevant to NEEC, which predict cross-sections that span many orders of magnitude. The greatest practical effect of the NEEC process may be on the survival of nuclei in stellar environments, in which it could excite isomers (that is, long-lived nuclear states) to shorter-lived states. Such excitations may reduce the abundance of the isotope after its production. This is an example of ‘isomer depletion’, which has been investigated previously through other reactions, but is used here to obtain evidence for NEEC.

Structural evolution study of 1-2 nm gold clusters

NASA Astrophysics Data System (ADS)

Beltrán, M. R.; Suárez Raspopov, R.; González, G.

2011-12-01

We have explored lowest energy minima structures of gold atom clusters both, charged and neutral (Aun^{ν}νn with n = 20, 28, 34, 38, 55, 75, 101, 146, 147, 192, 212 atoms and ν = 0, ±1). The structures have been obtained from first principles generalized gradient approximation, density functional theory (DFT) calculations based on norm-conserving pseudopotentials and numerical atomic basis sets. We have found two new disordered or defective isomers lower in energy than their ordered counterparts for n = 101, 147. The purpose of this work is to systematically study the difference between the electronic properties of the two lowest ordered and disordered isomers for each size. Our results agree with previous first principle calculations and with some recent experimental results (Au20 and Au101). For each case we report total energies, binding energies, ionization potentials, electron affinities, density of states, highest occupied molecular orbital-lowest unoccupied molecular orbital (HOMO-LUMO) gaps, Housdorff chirality measure index and their simulated image in a high resolution transmission electron microscopy (HRTEM). The calculated properties of the two low lying (ordered and disordered) isomers show clear differences as to be singled out in a suitable experimental setting. An extensive discussion on the evolution with size of the cohesive energy, the ionization potentials, the electron affinities, the HOMO-LUMO gaps and their index of chirality to determine the crossover between them is given.

Nuclear polarization study: new frontiers for tests of QED in heavy highly charged ions.

PubMed

Volotka, Andrey V; Plunien, Günter

2014-07-11

A systematic investigation of the nuclear polarization effects in one- and few-electron heavy ions is presented. The nuclear polarization corrections in the zeroth and first orders in 1/Z are evaluated to the binding energies, the hyperfine splitting, and the bound-electron g factor. It is shown that the nuclear polarization contributions can be substantially canceled simultaneously with the rigid nuclear corrections. This allows for new prospects for probing the QED effects in a strong electromagnetic field and the determination of fundamental constants.

DFTB Parameters for the Periodic Table: Part 1, Electronic Structure.

PubMed

Wahiduzzaman, Mohammad; Oliveira, Augusto F; Philipsen, Pier; Zhechkov, Lyuben; van Lenthe, Erik; Witek, Henryk A; Heine, Thomas

2013-09-10

A parametrization scheme for the electronic part of the density-functional based tight-binding (DFTB) method that covers the periodic table is presented. A semiautomatic parametrization scheme has been developed that uses Kohn-Sham energies and band structure curvatures of real and fictitious homoatomic crystal structures as reference data. A confinement potential is used to tighten the Kohn-Sham orbitals, which includes two free parameters that are used to optimize the performance of the method. The method is tested on more than 100 systems and shows excellent overall performance.

Single d-metal atoms on F(s) and F(s+) defects of MgO(001): a theoretical study across the periodic table.

PubMed

Neyman, Konstantin M; Inntam, Chan; Matveev, Alexei V; Nasluzov, Vladimir A; Rösch, Notker

2005-08-24

Single d-metal atoms on oxygen defects F(s) and F(s+) of the MgO(001) surface were studied theoretically. We employed an accurate density functional method combined with cluster models, embedded in an elastic polarizable environment, and we applied two gradient-corrected exchange-correlation functionals. In this way, we quantified how 17 metal atoms from groups 6-11 of the periodic table (Cu, Ag, Au; Ni, Pd, Pt; Co, Rh, Ir; Fe, Ru, Os; Mn, Re; and Cr, Mo, W) interact with terrace sites of MgO. We found bonding with F(s) and F(s+) defects to be in general stronger than that with O2- sites, except for Mn-, Re-, and Fe/F(s) complexes. In M/F(s) systems, electron density is accumulated on the metal center in a notable fashion. The binding energy on both kinds of O defects increases from 3d- to 4d- to 5d-atoms of a given group, at variance with the binding energy trend established earlier for the M/O2- complexes, 4d < 3d < 5d. Regarding the evolution of the binding energy along a period, group 7 atoms are slightly destabilized compared to their group 6 congeners in both the F(s) and F(s+) complexes; for later transition elements, the binding energy increases gradually up to group 10 and finally decreases again in group 11, most strongly on the F(s) site. This trend is governed by the negative charge on the adsorbed atoms. We discuss implications for an experimental detection of metal atoms on oxide supports based on computed core-level energies.

Effects of hydrostatic pressure on the donor impurity in a cylindrical quantum dot with Morse confining potential

NASA Astrophysics Data System (ADS)

Hayrapetyan, David B.; Kotanjyan, Tigran V.; Tevosyan, Hovhannes Kh.; Kazaryan, Eduard M.

2016-12-01

The effects of hydrostatic pressure and size quantization on the binding energies of a hydrogen-like donor impurity in cylindrical GaAs quantum dot (QD) with Morse confining potential are studied using the variational method and effective-mass approximation. In the cylindrical QD, the effect of hydrostatic pressure on the binding energy of electron has been investigated and it has been found that the application of the hydrostatic pressure leads to the blue shift. The dependence of the absorption edge on geometrical parameters of cylindrical QD is obtained. Selection rules are revealed for transitions between levels with different quantum numbers. It is shown that for the radial quantum number, transitions are allowed between the levels with the same quantum numbers, and any transitions between different levels are allowed for the principal quantum number.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jain, Richa Naja, E-mail: ltprichanaja@gmail.com; Chakraborty, Brahmananda; Ramaniah, Lavanya M.

The electronic structure and hydrogen storage capability of Yttrium-doped BNNTs has been theoretically investigated using first principles density functional theory (DFT). Yttrium atom prefers the hollow site in the center of the hexagonal ring with a binding energy of 0.8048eV. Decorating by Y makes the system half-metallic and magnetic with a magnetic moment of 1.0µ{sub B}. Y decorated Boron-Nitride (8,0) nanotube can adsorb up to five hydrogen molecules whose average binding energy is computed as 0.5044eV. All the hydrogen molecules are adsorbed with an average desorption temperature of 644.708 K. Taking that the Y atoms can be placed only in alternatemore » hexagons, the implied wt% comes out to be 5.31%, a relatively acceptable value for hydrogen storage materials. Thus, this system can serve as potential hydrogen storage medium.« less

Excitonic effects and related properties in semiconductor nanostructures: roles of size and dimensionality

NASA Astrophysics Data System (ADS)

Wu, Shudong; Cheng, Liwen; Wang, Qiang

2017-08-01

The size- and dimensionality-dependence of excitonic effects and related properties in semiconductor nanostructures are theoretically studied in detail within the effective-mass approximation. When nanostructure sizes become smaller than the bulk exciton Bohr radius, excitonic effects are significantly enhanced with reducing size or dimensionality. This is as a result of quantum confinement in more directions leading to larger exciton binding energies and normalized exciton oscillator strengths. These excitonic effects originate from electron-hole Coulombic interactions, which strongly enhance the oscillator strength between the electron and hole. It is also established that the universal scaling of exciton binding energy versus the inverse of the exciton Bohr radius follows a linear scaling law. Herein, we propose a stretched exponential law for the size scaling of optical gap, which is in good agreement with the calculated data. Due to differences in the confinement dimensionality, the radiative lifetime of low-dimensional excitons becomes shorter than that of bulk excitons. The size dependence of the exciton radiative lifetimes is in good agreement with available experimental data. This strongly enhanced electron-hole exchange interaction is expected in low-dimensional structures due to enriched excitonic effects. The main difference in nanostructures compared to the bulk can be interpreted in terms of the enhanced excitonic effects induced by exciton localization. The enhanced excitonic effects are expected to be of importance in developing stable and high-efficiency nanoscale excitonic optoelectronic devices.

Enhanced Charge Carrier Transport and Device Performance Through Dual-Cesium Doping in Mixed-Cation Perovskite Solar Cells with Near Unity Free Carrier Ratios.

PubMed

Ye, Tao; Petrović, Miloš; Peng, Shengjie; Yoong, Jeremy Lee Kong; Vijila, Chellappan; Ramakrishna, Seeram

2017-01-25

PbI 2 -enriched mixed perovskite film [FA 0.81 MA 0.15 Pb(I 0.836 Br 0.15 ) 3 ] has been widely studied due to its great potential in perovskite solar cell (PSC) applications. Herein, a FA 0.81 MA 0.15 Pb(I 0.836 Br 0.15 ) 3 film has been fabricated with the temperature-dependent optical absorption spectra utilized to determine its exciton binding energy. A ∼13 meV exciton binding energy is estimated, and a near-unity fraction of free carriers out of the total photoexcitons has been obtained in the solar cell operating regime at equilibrium state. PSCs are fabricated with this mixed perovskite film, but a significant electron transport barrier at the TiO 2 -perovskite interface limited their performance. Cs 2 CO 3 and CsI are then utilized as functional enhancers with which to substantially balance the electron and hole transport and increase the carriers (both electrons and holes) mobilities in PSCs, resulting in much-improved solar-cell performance. The modified PSCs exhibit reproducible power conversion efficiency (PCE) values with little hysteresis effect in the J-V curves, achieving PCEs up to 19.5% for the Cs 2 CO 3 -modified PSC and 20.6% when subsequently further doped with CsI.

Investigating the Weak to Evaluate the Strong: An Experimental Determination of the Electron Binding Energy of Carborane Anions and the Gas phase Acidity of Carborane Acids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meyer, Matthew M; Wang, Xue B; Reed, Christopher A

2009-12-23

Five CHB 11X 6Y 5 - carborane anions from the series X = Br, Cl, I and Y = H, Cl, CH 3 were generated by electrospray ionization, and their reactivity with a series of Brønsted acids and electron transfer reagents were examined in the gas phase. The undecachlorocarborane acid, H(CHB 11Cl 11), was found to be far more acidic than the former record holder, (1-C 4F 9SO 2) 2NH (i.e., ΔH° acid = 241 ± 29 vs 291.1 ± 2.2 kcal mol -1) and bridges the gas-phase acidity and basicity scales for the first time. Its conjugate base, CHBmore » 11Cl 11 -, was found by photoelectron spectroscopy to have a remarkably large electron binding energy (6.35 ± 0.02 eV) but the value for the (1-C 4F 9SO 2) 2N - anion is even larger (6.5 ± 0.1 eV). Consequently, it is the weak H-(CHB 11Cl 11) BDE (70.0 kcal mol -1, G3(MP2)) compared to the strong BDE of (1-C 4F 9SO 2) 2N-H (127.4 ± 3.2 kcal mol -1) that accounts for the greater acidity of carborane acids.« less

Allosteric Signaling Is Bidirectional in an Outer-Membrane Transport Protein.

PubMed

Sikora, Arthur; Joseph, Benesh; Matson, Morgan; Staley, Jacob R; Cafiso, David S

2016-11-01

In BtuB, the Escherichia coli TonB-dependent transporter for vitamin B 12 , substrate binding to the extracellular surface unfolds a conserved energy coupling motif termed the Ton box into the periplasm. This transmembrane signaling event facilitates an interaction between BtuB and the inner-membrane protein TonB. In this study, continuous-wave and pulse electron paramagnetic resonance in a native outer-membrane preparation demonstrate that signaling also occurs from the periplasmic to the extracellular surface in BtuB. The binding of a TonB fragment to the periplasmic interface alters the configuration of the second extracellular loop and partially dissociates a spin-labeled substrate analog. Moreover, mutants in the periplasmic Ton box that are transport-defective alter the binding site for vitamin B 12 in BtuB. This work demonstrates that the Ton box and the extracellular substrate binding site are allosterically coupled in BtuB, and that TonB binding may initiate a partial round of transport. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Nature of Interlayer Binding and Stacking of sp–sp 2 Hybridized Carbon Layers: A Quantum Monte Carlo Study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shin, Hyeondeok; Kim, Jeongnim; Lee, Hoonkyung

α-graphyne is a two-dimensional sheet of sp-sp2 hybridized carbon atoms in a honeycomb lattice. While the geometrical structure is similar to that of graphene, the hybridized triple bonds give rise to electronic structure that is different from that of graphene. Similar to graphene, α-graphyne can be stacked in bilayers with two stable configurations, but the different stackings have very different electronic structures: one is predicted to have gapless parabolic bands and the other a tunable bandgap which is attractive for applications. In order to realize applications, it is crucial to understand which stacking is more stable. This is difficult tomore » model, as the stability is a result of weak interlayer van der Waals interactions which are not well captured by density functional theory (DFT). We have used quantum Monte Carlo simulations that accurately include van der Waals interactions to calculate the interlayer binding energy of bilayer graphyne and to determine its most stable stacking mode. Our results show that inter-layer bindings of sp- and sp2-bonded carbon networks are significantly underestimated in a Kohn-Sham DFT approach, even with an exchange-correlation potential corrected to include, in some approximation, van der Waals interactions. Finally, our quantum Monte Carlo calculations reveal that the interlayer binding energy difference between the two stacking modes is only 0.9(4) eV/atom. From this we conclude that the two stable stacking modes of bilayer α-graphyne are almost degenerate with each other, and both will occur with about the same probability at room temperature unless there is a synthesis path that prefers one stacking over the other.« less

Nature of Interlayer Binding and Stacking of sp–sp 2 Hybridized Carbon Layers: A Quantum Monte Carlo Study

DOE PAGES

Shin, Hyeondeok; Kim, Jeongnim; Lee, Hoonkyung; ...

2017-10-25

α-graphyne is a two-dimensional sheet of sp-sp2 hybridized carbon atoms in a honeycomb lattice. While the geometrical structure is similar to that of graphene, the hybridized triple bonds give rise to electronic structure that is different from that of graphene. Similar to graphene, α-graphyne can be stacked in bilayers with two stable configurations, but the different stackings have very different electronic structures: one is predicted to have gapless parabolic bands and the other a tunable bandgap which is attractive for applications. In order to realize applications, it is crucial to understand which stacking is more stable. This is difficult tomore » model, as the stability is a result of weak interlayer van der Waals interactions which are not well captured by density functional theory (DFT). We have used quantum Monte Carlo simulations that accurately include van der Waals interactions to calculate the interlayer binding energy of bilayer graphyne and to determine its most stable stacking mode. Our results show that inter-layer bindings of sp- and sp2-bonded carbon networks are significantly underestimated in a Kohn-Sham DFT approach, even with an exchange-correlation potential corrected to include, in some approximation, van der Waals interactions. Finally, our quantum Monte Carlo calculations reveal that the interlayer binding energy difference between the two stacking modes is only 0.9(4) eV/atom. From this we conclude that the two stable stacking modes of bilayer α-graphyne are almost degenerate with each other, and both will occur with about the same probability at room temperature unless there is a synthesis path that prefers one stacking over the other.« less

Quantum mechanical/molecular mechanical and docking study of the novel analogues based on hybridization of common pharmacophores as potential anti-breast cancer agents

PubMed Central

Asadi, Parvin; Khodarahmi, Ghadamali; Farrokhpour, Hossein; Hassanzadeh, Farshid; Saghaei, Lotfollah

2017-01-01

In an attempt to identify some new potential leads as anti-breast cancer agents, novel hybrid compounds were designed by molecular hybridization approach. These derivatives were structurally derived from hybrid benzofuran–imidazole and quinazolinone derivatives, which had shown good cytotoxicity against the breast cancer cell line (MCF-7). Since aromatase enzyme (CYP19) is highly expressed in the MCF-7 cell line, the binding of these novel hybrid compounds to aromatase was investigated using the docking method. In this study, due to the positive charge on the imidazole ring of the designed ligands and also, the presence of heme iron in the active site of the enzyme, it was decided to optimize the ligand inside the protein to obtain more realistic atomic charges for it. Quantum mechanical/molecular mechanical (QM/MM) method was used to obtain more accurate atomic charges of ligand for docking calculations by considering the polarization effects of CYP19 on ligands. It was observed that the refitted charge improved the binding energy of the docked compounds. Also, the results showed that these novel hybrid compounds were adopted properly within the aromatase binding site, thereby suggesting that they could be potential inhibitors of aromatase. The main binding modes in these complexes were through hydrophobic and H bond interactions showing agreement with the basic physicochemical features of known anti aromatase compounds. Finally, the complex structures obtained from the docking study were used for single point QM/MM calculations to obtain more accurate electronic interaction energy, considering the electronic polarization of the ligand by its protein environment. PMID:28626481

Design of graphene nanoparticle undergoing axial compression: quantum study

NASA Astrophysics Data System (ADS)

Glukhova, O. E.; Kirillova, I. V.; Saliy, I. N.; Kolesnikova, A. S.; Slepchenkov, M. M.

2011-03-01

We report the results of quantum mechanical investigations of the atomic structure and deformations of graphene nanoparticle undergoing axial compression. We applied the tight-binding (TB) method. Our transferable tightbinding potential correctly reproduced tight-binding changes in the electronic configuration as a function of the local bonding geometry around each carbon atom. The tight-binding method applied provided the consideration and calculation of the rehybridization between σ- and π-orbitals. To research nanoribbons using tight-binding potential our own program was used. We adapted TB method to be able to run the algorithm on a parallel computing machine (computer cluster). To simulate axial compression of graphene nanoparticles the atoms on the ends were fixed on the plates. The plates were moved towards each other to decrease the length at some percent. Plane atomic network undergoing axial compression became wave-like. The amplitude of wave and its period were not constant and changed along axis. This is a phase transition. The strain energy collapse occurs at the value of axial compression 0.03-0.04. The strain energy increased up to the quantity compression 0.03, then collapsed sharply and decreased. So according to our theoretical investigation, the elasticity of graphene nanoparticles is more than the elasticity of nanotubes the same width and length. The curvature of the atomic network because of compression will decrease the reactivity of graphene nanoparticles. We have calculated the atomic structure and electronic structure of the compression graphene nanopaticle at each step of strain of axial compression. We have come to the conclusion that the wave-like graphenes adsorbing protein and nucleic acid are the effective nanosensors and bionanosensors.

Imaging the Formation of High-Energy Dispersion Anomalies in the Actinide UCoGa5

NASA Astrophysics Data System (ADS)

Das, Tanmoy; Durakiewicz, Tomasz; Zhu, Jian-Xin; Joyce, John J.; Sarrao, John L.; Graf, Matthias J.

2012-10-01

We use angle-resolved photoemission spectroscopy to image the emergence of substantial dispersion and spectral-weight anomalies in the electronic renormalization of the actinide compound UCoGa5 that was presumed to belong to a conventional Fermi-liquid family. Kinks or abrupt breaks in the slope of the quasiparticle dispersion are detected both at low (approximately 130 meV) and high (approximately 1 eV) binding energies below the Fermi energy, ruling out any significant contribution of phonons. We perform numerical calculations to demonstrate that the anomalies are adequately described by coupling between itinerant fermions and spin fluctuations arising from the particle-hole continuum of the spin-orbit-split 5f states of uranium. These anomalies resemble the “waterfall” phenomenon of the high-temperature copper-oxide superconductors, suggesting that spin fluctuations are a generic route toward multiform electronic phases in correlated materials as different as high-temperature superconductors and actinides.

Chemical bonding in aqueous hexacyano cobaltate from photon- and electron-detection perspectives

PubMed Central

Lalithambika, Sreeju Sreekantan Nair; Atak, Kaan; Seidel, Robert; Neubauer, Antje; Brandenburg, Tim; Xiao, Jie; Winter, Bernd; Aziz, Emad F.

2017-01-01

The electronic structure of the [Co(CN)6]3− complex dissolved in water is studied using X-ray spectroscopy techniques. By combining electron and photon detection methods from the solutions ionized or excited by soft X-rays we experimentally identify chemical bonding between the metal center and the CN ligand. Non-resonant photoelectron spectroscopy provides solute electron binding energies, and nitrogen 1 s and cobalt 2p resonant core-level photoelectron spectroscopy identifies overlap between metal and ligand orbitals. By probing resonances we are able to qualitatively determine the ligand versus metal character of the respective occupied and non-occupied orbitals, purely by experiment. For the same excitations we also detect the emitted X-rays, yielding the complementary resonant inelastic X-ray scattering spectra. For a quantitative interpretation of the spectra, we perform theoretical electronic-structure calculations. The latter provide both orbital energies and orbital character which are found to be in good agreement with experimental energies and with experimentally inferred orbital mixing. We also report calculated X-ray absorption spectra, which in conjunction with our orbital-structure analysis, enables us to quantify various bonding interactions with a particular focus on the water-solvent – ligand interaction and the strength of π-backbonding between metal and ligand. PMID:28098216

Intrinsic Resolution of Molecular Electronic Wave Functions and Energies in Terms of Quasi-atoms and Their Interactions.

PubMed

West, Aaron C; Schmidt, Michael W; Gordon, Mark S; Ruedenberg, Klaus

2017-02-09

A general intrinsic energy resolution has been formulated for strongly correlated wave functions in the full molecular valence space and its subspaces. The information regarding the quasi-atomic organization of the molecular electronic structure is extracted from the molecular wave function without introducing any additional postulated model state wave functions. To this end, the molecular wave function is expressed in terms of quasi-atomic molecular orbitals, which maximize the overlap between subspaces of the molecular orbital space and the free-atom orbital spaces. As a result, the molecular wave function becomes the superposition of a wave function representing the juxtaposed nonbonded quasi-atoms and a wave function describing the interatomic electron migrations that create bonds through electron sharing. The juxtaposed nonbonded quasi-atoms are shown to consist of entangled quasi-atomic states from different atoms. The binding energy is resolved as a sum of contributions that are due to quasi-atom formation, quasiclassical electrostatic interactions, and interatomic interferences caused by electron sharing. The contributions are further resolved according to orbital interactions. The various transformations that generate the analysis are determined by criteria that are independent of the working orbital basis used for calculating the molecular wave function. The theoretical formulation of the resolution is quantitatively validated by an application to the C 2 molecule.

Partially ionized hydrogen plasma in strong magnetic fields.

PubMed

Potekhin, A Y; Chabrier, G; Shibanov, Y A

1999-08-01

We study the thermodynamic properties of a partially ionized hydrogen plasma in strong magnetic fields, B approximately 10(12)-10(13) G, typical of neutron stars. The properties of the plasma depend significantly on the quantum-mechanical sizes and binding energies of the atoms, which are strongly modified by thermal motion across the field. We use new fitting formulas for the atomic binding energies and sizes, based on accurate numerical calculations and valid for any state of motion of the atom. In particular, we take into account decentered atomic states, neglected in previous studies of thermodynamics of magnetized plasmas. We also employ analytic fits for the thermodynamic functions of nonideal fully ionized electron-ion Coulomb plasmas. This enables us to construct an analytic model of the free energy. An ionization equilibrium equation is derived, taking into account the strong magnetic field effects and the nonideality effects. This equation is solved by an iteration technique. Ionization degrees, occupancies, and the equation of state are calculated.

Electronic and Structural Parameters of Phosphorus-Oxygen Bonds in Inorganic Phosphate Crystals

NASA Astrophysics Data System (ADS)

Atuchin, V. V.; Kesler, V. G.; Pervukhina, N. V.

Wide set of experimental results on binding energy of photoelectrons emitted from P 2p, P 2s, and O 1s core levels has been observed for inorganic phosphate crystals and the parameters were compared using energy differences Δ(O 1s - P 2p) and Δ (O 1s - P 2s) as most robust characteristics. Linear dependence of the binding energy difference on mean chemical bond length L(P-O) between phosphorus and oxygen atoms has been found. The functions are of the forms: Δ (O 1s - P 2p) (eV) = 375.54 + 0.146 · L(P-O) (pm) and Δ (O 1s - P 2s) (eV) = 320.77 + 0.129 · L(P-O) (pm). The dependencies are general for inorganic phosphates and may be used in quantitative component analysis of X-ray photoemission spectra of complex oxide compounds including functional groups with different coordination of P and O atoms.

Observation of the spin-polarized surface state in a noncentrosymmetric superconductor BiPd

DOE Office of Scientific and Technical Information (OSTI.GOV)

Neupane, Madhab; Alidoust, Nasser; Hosen, M. Mofazzel

Recently, noncentrosymmetric superconductor BiPd has attracted considerable research interest due to the possibility of hosting topological superconductivity. Here in this paper we report a systematic high-resolution angle-resolved photoemission spectroscopy (ARPES) and spin-resolved ARPES study of the normal state electronic and spin properties of BiPd. Our experimental results show the presence of a surface state at higher-binding energy with the location of Dirac point at around 700 meV below the Fermi level. The detailed photon energy, temperature-dependent and spin-resolved ARPES measurements complemented by our first-principles calculations demonstrate the existence of the spin-polarized surface states at high-binding energy. The absence of suchmore » spin-polarized surface states near the Fermi level negates the possibility of a topological superconducting behaviour on the surface. Our direct experimental observation of spin-polarized surface states in BiPd provides critical information that will guide the future search for topological superconductivity in noncentrosymmetric materials.« less

Observation of the spin-polarized surface state in a noncentrosymmetric superconductor BiPd

DOE PAGES

Neupane, Madhab; Alidoust, Nasser; Hosen, M. Mofazzel; ...

2016-11-07

Recently, noncentrosymmetric superconductor BiPd has attracted considerable research interest due to the possibility of hosting topological superconductivity. Here in this paper we report a systematic high-resolution angle-resolved photoemission spectroscopy (ARPES) and spin-resolved ARPES study of the normal state electronic and spin properties of BiPd. Our experimental results show the presence of a surface state at higher-binding energy with the location of Dirac point at around 700 meV below the Fermi level. The detailed photon energy, temperature-dependent and spin-resolved ARPES measurements complemented by our first-principles calculations demonstrate the existence of the spin-polarized surface states at high-binding energy. The absence of suchmore » spin-polarized surface states near the Fermi level negates the possibility of a topological superconducting behaviour on the surface. Our direct experimental observation of spin-polarized surface states in BiPd provides critical information that will guide the future search for topological superconductivity in noncentrosymmetric materials.« less

Hydrogen atom addition to the surface of graphene nanoflakes: A density functional theory study

NASA Astrophysics Data System (ADS)

Tachikawa, Hiroto

2017-02-01

Polycyclic aromatic hydrocarbons (PAHs) provide a 2-dimensional (2D) reaction surface in 3-dimensional (3D) interstellar space and have been utilized as a model of graphene surfaces. In the present study, the reaction of PAHs with atomic hydrogen was investigated by means of density functional theory (DFT) to systematically elucidate the binding nature of atomic hydrogen to graphene nanoflakes. PAHs with n = 4-37 were chosen, where n indicates the number of benzene rings. Activation energies of hydrogen addition to the graphene surface were calculated to be 5.2-7.0 kcal/mol at the CAM-B3LYP/6-311G(d,p) level, which is almost constant for all PAHs. The binding energies of hydrogen atom were slightly dependent on the size (n): 14.8-28.5 kcal/mol. The absorption spectra showed that a long tail is generated at the low-energy region after hydrogen addition to the graphene surface. The electronic states of hydrogenated graphenes were discussed on the basis of theoretical results.

Study on immobilization of yeast alcohol dehydrogenase on nanocrystalline Ni-Co ferrites as magnetic support.

PubMed

Shakir, Mohammad; Nasir, Zeba; Khan, Mohd Shoeb; Lutfullah; Alam, Md Fazle; Younus, Hina; Al-Resayes, Saud Ibrahim

2015-01-01

The covalent binding of yeast alcohol dehydrogenase (YADH) enzyme complex in a series of magnetic crystalline Ni-Co nanoferrites, synthesized via sol-gel auto combustion technique was investigated. The structural analysis, morphology and magnetic properties of Ni-Co nanoferrites were determined by X-ray diffraction (XRD), scanning electron microscopy (SEM), energy dispersive X-ray spectroscopy (EDS), vibrating-sample magnetometer (VSM), high resolution transmission electron microscopy (HRTEM) and Fourier transform infrared spectroscopy (FTIR). The comparative analysis of the HRTEM micrographs of bare magnetic nanoferrite particles and particles immobilized with enzyme revealed an uniform distribution of the particles in both the cases without undergoing change in the size which was found to be in the range 20-30 nm. The binding of YADH to Ni-Co nanoferrites and the possible binding mechanism have been suggested by comparing the FTIR results. The binding properties of the immobilized YADH enzyme were also studied by kinetic parameters, optimum operational pH, temperature, thermal stability and reusability. The immobilized YADH exhibits enhanced thermal stability as compared to the free enzyme over a wide range of temperature and pH, and showed good durability after recovery by magnetic separation for repeated use. Copyright © 2014 Elsevier B.V. All rights reserved.

Binding in pair potentials of liquid simple metals from nonlocality in electronic kinetic energy

NASA Technical Reports Server (NTRS)

Perrot, F.; March, N. H.

1990-01-01

The paper presents an explicit expression for the pair potential in liquid simple metals from low-order density-gradient theory when the superposition of single-center displaced charges is employed. Numerical results are presented for the gradient expansion pair interaction in liquid Na and Be. The low-order density-gradient equation for the pair potential is presented.

Cl-doping of Te-rich CdTe: Complex formation, self-compensation and self-purification from first principles

NASA Astrophysics Data System (ADS)

Lindström, A.; Klintenberg, M.; Sanyal, B.; Mirbt, S.

2015-08-01

The coexistence in Te-rich CdTe of substitutional Cl-dopants, ClTe, which act as donors, and Cd vacancies, VC d - 1 , which act as electron traps, was studied from first principles utilising the HSE06 hybrid functional. We find ClTe to preferably bind to VC d - 1 and to form an acceptor complex, (ClTe-VCd)-1. The complex has a (0,-1) charge transfer level close to the valence band and shows no trap state (deep level) in the band gap. During the complex formation, the defect state of VCd-1 is annihilated and leaves the Cl-doped CdTe bandgap without any trap states (self-purification). We calculate Cl-doped CdTe to be semi-insulating with a Fermi energy close to midgap. We calculate the formation energy of the complex to be sufficiently low to allow for spontanous defect formation upon Cl-doping (self-compensation). In addition, we quantitatively analyse the geometries, DOS, binding energies and formation energies of the (ClTe-VCd) complexes.

Development of a Multicenter Density Functional Tight Binding Model for Plutonium Surface Hydriding.

PubMed

Goldman, Nir; Aradi, Bálint; Lindsey, Rebecca K; Fried, Laurence E

2018-05-08

We detail the creation of a multicenter density functional tight binding (DFTB) model for hydrogen on δ-plutonium, using a framework of new Slater-Koster interaction parameters and a repulsive energy based on the Chebyshev Interaction Model for Efficient Simulation (ChIMES), where two- and three-center atomic interactions are represented by linear combinations of Chebyshev polynomials. We find that our DFTB/ChIMES model yields a total electron density of states for bulk δ-Pu that compares well to that from Density Functional Theory, as well as to a grid of energy calculations representing approximate H 2 dissociation paths on the δ-Pu (100) surface. We then perform molecular dynamics simulations and minimum energy pathway calculations to determine the energetics of surface dissociation and subsurface diffusion on the (100) and (111) surfaces. Our approach allows for the efficient creation of multicenter repulsive energies with a relatively small investment in initial DFT calculations. Our efforts are particularly pertinent to studies that rely on quantum calculations for interpretation and validation, such as experimental determination of chemical reactivity both on surfaces and in condensed phases.

Absorption spectrum and ultrafast response of monolayer and bilayer transition-metal dichalcogenides

NASA Astrophysics Data System (ADS)

Turkowski, Volodymyr; Ramirez-Torres, Alfredo; Rahman, Talat S.

2015-03-01

We apply a combined time-dependent density functional theory and many-body theory approach to examine the absorption spectrum and nonequilibrium response of monolayer and bilayer MoS2, MoSe2, WS2 and WSe2 systems. In particular, we evaluate the possibility of existence of bound states - excitons and trions in the undoped systems. In a previous work we have already demonstrated that the binding energies of these states in the monolayer systems are large which makes them available for room temperature applications. We analyze the possibility of ultrafast electron-hole separation in bilayer systems through inter-layer hole transfer, and show that such a possibility exists, in agreement with experimental observations. For doped systems we consider the possibility of Mahan excitonic states in monolayers and show that the binding energy for these states is of the order of 10 meV. We perform a detailed analysis of the relaxation of doped monolayers excited by ultrafast laser pulse by taking into account electron-phonon scattering effects, and demonstrate that ultrafast (10-100fs) processes, including luminescence, may be relevant for these materials. Work supported in part by DOE Grant No. DOE-DE-FG02-07ER46354.

Boron doping effect on the interface interaction and mechanical properties of graphene reinforced copper matrix composite

NASA Astrophysics Data System (ADS)

Fang, Bingcheng; Li, Jiajun; Zhao, Naiqin; Shi, Chunsheng; Ma, Liying; He, Chunnian; He, Fang; Liu, Enzuo

2017-12-01

In order to explore an efficient way of modifying graphene to improve the Cu/graphene interfacial bonding and remain the excellent mechanical and physical properties of graphene, the interaction between Cu and the pristine, atomic oxygen functionalized and boron- or nitrogen-doped graphene with and without defects was systematically investigated by density functional theory calculation. The electronic structure analysis revealed that the chemically active oxygen can enhance the binding energy Eb of Cu with graphene by forming strong covalent bonds, supporting the experimental study suggesting an vital role of intermediate oxygen in the improvement of the mechanical properties of graphene/Cu composites. Due to the strong hybridization between Cu-3d electron states and the 2p states of both boron and carbon atoms, the boron-doping effect is comparable to or even better than the chemical bridging role of oxygen in the reduced graphene oxide reinforced Cu matrix composite. Furthermore, we evidenced an enhancement of mechanical properties including bulk modulus, shear modulus and Young modulus of graphene/Cu composite after boron doping, which closely relates to the increased interfacial binding energy between boron-doped graphene and Cu surfaces.

Simulation of electron-proton coupling with a Monte Carlo method: application to cytochrome c3 using continuum electrostatics.

PubMed Central

Baptista, A M; Martel, P J; Soares, C M

1999-01-01

A new method is presented for simulating the simultaneous binding equilibrium of electrons and protons on protein molecules, which makes it possible to study the full equilibrium thermodynamics of redox and protonation processes, including electron-proton coupling. The simulations using this method reflect directly the pH and electrostatic potential of the environment, thus providing a much closer and realistic connection with experimental parameters than do usual methods. By ignoring the full binding equilibrium, calculations usually overlook the twofold effect that binding fluctuations have on the behavior of redox proteins: first, they affect the energy of the system by creating partially occupied sites; second, they affect its entropy by introducing an additional empty/occupied site disorder (here named occupational entropy). The proposed method is applied to cytochrome c3 of Desulfovibrio vulgaris Hildenborough to study its redox properties and electron-proton coupling (redox-Bohr effect), using a continuum electrostatic method based on the linear Poisson-Boltzmann equation. Unlike previous studies using other methods, the full reduction order of the four hemes at physiological pH is successfully predicted. The sites more strongly involved in the redox-Bohr effect are identified by analysis of their titration curves/surfaces and the shifts of their midpoint redox potentials and pKa values. Site-site couplings are analyzed using statistical correlations, a method much more realistic than the usual analysis based on direct interactions. The site found to be more strongly involved in the redox-Bohr effect is propionate D of heme I, in agreement with previous studies; other likely candidates are His67, the N-terminus, and propionate D of heme IV. Even though the present study is limited to equilibrium conditions, the possible role of binding fluctuations in the concerted transfer of protons and electrons under nonequilibrium conditions is also discussed. The occupational entropy contributions to midpoint redox potentials and pKa values are computed and shown to be significant. PMID:10354425

Electronic states of aryl radical functionalized graphenes: Density functional theory study

NASA Astrophysics Data System (ADS)

Tachikawa, Hiroto; Kawabata, Hiroshi

2016-06-01

Functionalized graphenes are known as a high-performance molecular device. In the present study, the structures and electronic states of the aryl radical functionalized graphene have been investigated by the density functional theory (DFT) method to elucidate the effects of functionalization on the electronic states of graphene (GR). Also, the mechanism of aryl radical reaction with GR was investigated. The benzene, biphenyl, p-terphenyl, and p-quaterphenyl radicals [denoted by (Bz) n (n = 1-4), where n means numbers of benzene rings in aryl radical] were examined as aryl radicals. The DFT calculation of GR-(Bz) n (n = 1-4) showed that the aryl radical binds to the carbon atom of GR, and a C-C single bond was formed. The binding energies of aryl radicals to GR were calculated to be ca. 6.0 kcal mol-1 at the CAM-B3LYP/6-311G(d,p) level. It was found that the activation barrier exists in the aryl radical addition: the barrier heights were calculated to be 10.0 kcal mol-1. The electronic states of GR-(Bz) n were examined on the basis of theoretical results.

Electronic Structure of C60/Zinc Phthalocyanine/V₂O₅ Interfaces Studied Using Photoemission Spectroscopy for Organic Photovoltaic Applications.

PubMed

Lim, Chang Jin; Park, Min Gyu; Kim, Min Su; Han, Jeong Hwa; Cho, Soohaeng; Cho, Mann-Ho; Yi, Yeonjin; Lee, Hyunbok; Cho, Sang Wan

2018-02-18

The interfacial electronic structures of a bilayer of fullerene (C 60 ) and zinc phthalocyanine (ZnPc) grown on vanadium pentoxide (V₂O₅) thin films deposited using radio frequency sputtering under various conditions were studied using X-ray and ultraviolet photoelectron spectroscopy. The energy difference between the highest occupied molecular orbital (HOMO) level of the ZnPc layer and the lowest unoccupied molecular orbital (LUMO) level of the C 60 layer was determined and compared with that grown on an indium tin oxide (ITO) substrate. The energy difference of a heterojunction on all V₂O₅ was found to be 1.3~1.4 eV, while that on ITO was 1.1 eV. This difference could be due to the higher binding energy of the HOMO of ZnPc on V₂O₅ than that on ITO regardless of work functions of the substrates. We also determined the complete energy level diagrams of C 60 /ZnPc on V₂O₅ and ITO.

Direct Density Functional Energy Minimization using an Tetrahedral Finite Element Grid

NASA Astrophysics Data System (ADS)

Vaught, A.; Schmidt, K. E.; Chizmeshya, A. V. G.

1998-03-01

We describe an O(N) (N proportional to volume) technique for solving electronic structure problems using the finite element method (FEM). A real--space tetrahedral grid is used as a basis to represent the electronic density, of a free or periodic system and Poisson's equation is solved as a boundary value problem. Nuclear cusps are treated using a local grid consisting of radial elements. These features facilitate the implementation of complicated energy functionals and permit a direct (constrained) energy minimization with respect to the density. We demonstrate the usefulness of the scheme by calculating the binding trends and polarizabilities of a number of atoms and molecules using a number of recently proposed non--local, orbital--free kinetic energy functionals^1,2. Scaling behavior, computational efficiency and the generalization to band--structure will also be discussed. indent 0 pt øbeylines øbeyspaces skip 0 pt ^1 P. Garcia-Gonzalez, J.E. Alvarellos and E. Chacon, Phys. Rev. B 54, 1897 (1996). ^2 A. J. Thakkar, Phys.Rev.B 46, 6920 (1992).

Atomistic tight-binding theory of excitonic splitting energies in CdX(X = Se, S and Te)/ZnS core/shell nanocrystals

NASA Astrophysics Data System (ADS)

Sukkabot, Worasak; Pinsook, Udomsilp

2017-01-01

Using the atomistic tight-binding theory (TB) and a configuration interaction description (CI), we numerically compute the excitonic splitting of CdX(X = Se, S and Te)/ZnS core/shell nanocrystals with the objective to explain how types of the core materials and growth shell thickness can provide the detailed manipulation of the dark-dark (DD), dark-bright (DB) and bright-bright (BB) excitonic splitting, beneficial for the active application of quantum information. To analyze the splitting of the excitonic states, the optical band gaps, ground-state wave function overlaps and atomistic electron-hole interactions tend to be numerically demonstrated. Based on the atomistic computations, the single-particle and excitonic gaps are mainly reduced with the increasing ZnS shell thickness owing to the quantum confinement. In the range of the higher to lower energies, the order of the single-particle gaps is CdSe/ZnS, CdS/ZnS and CdTe/ZnS core/shell nanocrystals, while one of the excitonic gaps is CdS/ZnS, CdSe/ZnS and CdTe/ZnS core/shell nanocrystals because of the atomistic electron-hole interaction. The strongest electron-hole interactions are mainly observed in CdSe/ZnS core/shell nanocrystals. In addition, the computational results underline that the energies of the dark-dark (DD), dark-bright (DB) and bright-bright (BB) excitonic splitting are generally reduced with the increasing ZnS growth shell thickness as described by the trend of the electron-hole exchange interaction. The high-to-low splitting of the excitonic states is demonstrated in CdSe/ZnS, CdTe/ZnS and CdS/ZnS core/shell nanocrystals because of the fashion in the electron-hole exchange interaction and overlaps of the electron-hole wave functions. As the resulting calculations, it is expected that CdS/ZnS core/shell nanocrystals are the best candidates to be the source of entangled photons. Finally, the comprehensive information on the excitonic splitting can enable the use of suitable core/shell nanocrystals for the entangled photons in the application of quantum information.

Binding interactions of halogenated bisphenol A with mouse PPARα: In vitro investigation and molecular dynamics simulation.

PubMed

Zhang, Jie; Li, Tiezhu; Wang, Tuoyi; Guan, Tianzhu; Yu, Hansong; Li, Zhuolin; Wang, Yongzhi; Wang, Yongjun; Zhang, Tiehua

2018-02-01

The binding of bisphenol A (BPA) and its halogenated derivatives (halogenated BPAs) to mouse peroxisome proliferator-activated receptor α ligand binding domain (mPPARα-LBD) was examined by a combination of in vitro investigation and in silico simulation. Fluorescence polarization (FP) assay showed that halogenated BPAs could bind to mPPARα-LBD* as the affinity ligands. The calculated electrostatic potential (ESP) illustrated the different charge distributions of halogenated BPAs with altered halogenation patterns. As electron-attracting substituents, halogens decrease the positive electrostatic potential and thereby have a significant influence on the electrostatic interactions of halogenated BPAs with mPPARα-LBD*. The docking results elucidated that hydrophobic and hydrogen-bonding interactions may also contribute to stabilize the binding of the halogenated BPAs to their receptor molecule. Comparison of the calculated binding energies with the experimentally determined affinities yielded a good correlation (R 2 =0.6659) that could provide a rational basis for designing environmentally benign chemicals with reduced toxicities. This work can potentially be used for preliminary screening of halogenated BPAs. Copyright © 2017 Elsevier B.V. All rights reserved.

Heterolytic Cleavage of H2 by Bifunctional Manganese(I) Complexes: Impact of Ligand Dynamics, Electrophilicity, and Base Positioning

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hulley, Elliott B.; Helm, Monte L.; Bullock, R. Morris

2014-12-01

We report the synthesis, characterization, and reactivity with H2 of a series of MnI complexes of the type [(P-P)Mn(L2)CO]+ (L2 = dppm, bppm, or (CO)2; P-P = PPhNMePPh or PPh2 NBn2 ) that bear pendant amine ligands designed to function as proton relays. The pendant amine was found to function as a hemilabile ligand; its binding strength is strongly affected by the ancillary ligand environment around Mn. Tuning the electrophilicity of the Mn center leads to systems capable of reversible heterolytic cleavage of the H-H bond. The strength of pendant amine binding can be balanced to protect the Mn centermore » while still leading to facile reactivity with H2. Neutral amine-bearing MnIH species were found to react with one-electron oxidants and, after proton and electron transfer reactions, regenerate MnI cationic species. The reactivity presented herein indicate that the Mn complexes we have developed are a promising platform for Mn-based H2 oxidation electrocatalyst development. The research was supported as part of the Center for Molecular Electrocatalysis, an Energy Frontier Research Center funded by the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences. Pacific Northwest National Laboratory is operated by Battelle for DOE.« less

Photo-illuminated diamond as a solid-state source of solvated electrons in water for nitrogen reduction.

PubMed

Zhu, Di; Zhang, Linghong; Ruther, Rose E; Hamers, Robert J

2013-09-01

The photocatalytic reduction of N₂ to NH₃ is typically hampered by poor binding of N₂ to catalytic materials and by the very high energy of the intermediates involved in this reaction. Solvated electrons directly introduced into the reactant solution can provide an alternative pathway to overcome such limitations. Here we demonstrate that illuminated hydrogen-terminated diamond yields facile electron emission into water, thus inducing reduction of N₂ to NH₃ at ambient temperature and pressure. Transient absorption measurements at 632 nm reveal the presence of solvated electrons adjacent to the diamond after photoexcitation. Experiments using inexpensive synthetic diamond samples and diamond powder show that photocatalytic activity is strongly dependent on the surface termination and correlates with the production of solvated electrons. The use of diamond to eject electrons into a reactant liquid represents a new paradigm for photocatalytic reduction, bringing electrons directly to reactants without requiring molecular adsorption to the surface.

Lattice vibrational contribution to equation of state for tetrahedral compounds

NASA Astrophysics Data System (ADS)

Kagaya, H.-Matsuo; Kotoku, H.; Soma, T.

1989-02-01

The lattice vibrational contributions to the Helmholtz free energy and the thermal pressure of tetrahedral compounds such as GaP, InP, ZnS, ZnSe, ZnTe and CdTe are investigated from the electronic theory of solids in the dynamical treatment based on our presented binding force. The temperature dependence of Helmholtz free energy and thermal pressure from lattice vibrational term are quantitatively obtained, and vibrational contributions to free energy are small compared with the static crystal energy. The influence of the thermal pressure is important to the equation of state in high temperatures, and the reformulation of the volume scale for the pressure-volume relation is given by considering the thermal pressure.

The effect of driven electron-phonon coupling on the electronic conductance of a polar nanowire

NASA Astrophysics Data System (ADS)

Mardaani, Mohammad; Rabani, Hassan; Esmaili, Esmat; Shariati, Ashrafalsadat

2015-08-01

A semi-classical model is proposed to explore the effect of electron-phonon coupling on the coherent electronic transport of a polar chain which is confined between two rigid leads in the presence of an external electric field. To this end, we construct the model by means of Green's function technique within the nearest neighbor tight-binding and harmonic approximations. For a time-periodic electric field, the atomic displacements from the equilibrium positions are obtained precisely. The result is then used to compute the electronic transport properties of the chain within the Peierls-type model. The numerical results indicate that the conductance of the system shows interesting behavior in some special frequencies. For each special frequency, there is an electronic quasi-state in which the scattering of electrons by vibrating atoms reaches maximum. The system electronic conductance decreases dramatically at the strong electron-phonon couplings and low electron energies. In the presence of damping forces, the electron-phonon interaction has a less significant effect on the conductance.

Quantum chemical approaches in structure-based virtual screening and lead optimization

NASA Astrophysics Data System (ADS)

Cavasotto, Claudio N.; Adler, Natalia S.; Aucar, Maria G.

2018-05-01

Today computational chemistry is a consolidated tool in drug lead discovery endeavors. Due to methodological developments and to the enormous advance in computer hardware, methods based on quantum mechanics (QM) have gained great attention in the last 10 years, and calculations on biomacromolecules are becoming increasingly explored, aiming to provide better accuracy in the description of protein-ligand interactions and the prediction of binding affinities. In principle, the QM formulation includes all contributions to the energy, accounting for terms usually missing in molecular mechanics force-fields, such as electronic polarization effects, metal coordination, and covalent binding; moreover, QM methods are systematically improvable, and provide a greater degree of transferability. In this mini-review we present recent applications of explicit QM-based methods in small-molecule docking and scoring, and in the calculation of binding free-energy in protein-ligand systems. Although the routine use of QM-based approaches in an industrial drug lead discovery setting remains a formidable challenging task, it is likely they will increasingly become active players within the drug discovery pipeline.

Electron-Hole Condensation in Semiconductors: Electrons and holes condense into freely moving liquid metallic droplets, a plasma phase with novel properties.

PubMed

Jeffries, C D

1975-09-19

In Ge and Si, and also in Ge-Si alloys (74), there is extensive evidence for the stable binding of electrons and holes into a cold plasma of constant density, which undergoes a phase separation. Liquid metallic drops 1 to 300 microm in size are formed, with lifetimes ranging from 0.1 to 600 microsec. For Ge a surprising amount is known: the phase diagram, the surface energy, the work function, the decay kinetics. Much less is known for Si. There is good agreement between theoretical and experimental values of the liquid density, the critical density, the critical temperature, and the binding energy. The stability of the liquid phase is strikingly dependent on band structure. The multivalley structure and mass anisotropy of Si, Ge, and Ge-Si, together with their indirect band gap, are no doubt responsible for the observed stability in these crystals. In the similar semiconductor gallium phosphide, drops have not yet been observed, most likely because the high impurity content traps the excitons. In gallium arsenide the existence of drops is controversial (75). Undoubtedly drops will be found to exist in other semiconductors, perhaps at even higher temperatures. This is an exciting field for the experimentalist; new phenomena are being rapidly discovered, usually before they are predicted. For the theorist, the electron-hole drop is of high intrinsic interest. It represents the first example of a quantum liquid of constant density in a periodic crystal lattice. A number of challenging experimental and theoretical problems remain.

Single or functionalized fullerenes interacting with heme group

DOE Office of Scientific and Technical Information (OSTI.GOV)

Costa, Wallison Chaves; Diniz, Eduardo Moraes, E-mail: eduardo.diniz@ufma.br

The heme group is responsible for iron transportation through the bloodstream, where iron participates in redox reactions, electron transfer, gases detection etc. The efficiency of such processes can be reduced if the whole heme molecule or even the iron is somehow altered from its original oxidation state, which can be caused by interactions with nanoparticles as fullerenes. To verify how such particles alter the geometry and electronic structure of heme molecule, here we report first principles calculations based on density functional theory of heme group interacting with single C{sub 60} fullerene or with C{sub 60} functionalized with small functional groupsmore » (−CH{sub 3}, −COOH, −NH{sub 2}, −OH). The calculations shown that the system heme + nanoparticle has a different spin state in comparison with heme group if the fullerene is functionalized. Also a functional group can provide a stronger binding between nanoparticle and heme molecule or inhibit the chemical bonding in comparison with single fullerene results. In addition heme molecule loses electrons to the nanoparticles and some systems exhibited a geometry distortion in heme group, depending on the binding energy. Furthermore, one find that such nanoparticles induce a formation of spin up states in heme group. Moreover, there exist modifications in density of states near the Fermi energy. Although of such changes in heme electronic structure and geometry, the iron atom remains in the heme group with the same oxidation state, so that processes that involve the iron might not be affected, only those that depend on the whole heme molecule.« less

Core–shell interaction and its impact on the optical absorption of pure and doped core-shell CdSe/ZnSe nanoclusters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Xinqin; Cui, Yingqi; Zeng, Qun

The structural, electronic, and optical properties of core-shell nanoclusters, (CdSe){sub x}@(CdSe){sub y} and their Zn-substituted complexes of x = 2–4 and y = 16–28, were studied with density functional theory calculations. The substitution was applied in the cores, the shells, and/or the whole clusters. All these clusters are characterized by their core-shell structures in which the core-shell interaction was found different from those in core or in shell, as reflected by their bondlengths, volumes, and binding energies. Moreover, the core and shell combine together to compose a new cluster with electronic and optical properties different from those of separated individuals,more » as reflected by their HOMO-LUMO gaps and optical absorptions. With the substitution of Cd by Zn, the structural, electronic, and optical properties of clusters change regularly. The binding energy increases with Zn content, attributed to the strong Zn–Se bonding. For the same core/shell, the structure with a CdSe shell/core has a narrower gap than that with a ZnSe shell/core. The optical absorption spectra also change accordingly with Zn substitution. The peaks blueshift with increasing Zn concentration, accompanying with shape variations in case large number of Cd atoms are substituted. Our calculations reveal the core-shell interaction and its influence on the electronic and optical properties of the core-shell clusters, suggesting a composition–structure–property relationship for the design of core-shell CdSe and ZnSe nanoclusters.« less

Strain-mediated electronic properties of pristine and Mn-doped GaN monolayers

NASA Astrophysics Data System (ADS)

Sharma, Venus; Srivastava, Sunita

2018-04-01

Graphene-like two-dimensional (2D) monolayer structures GaN has gained enormous amount of interest due to high thermal stability and inherent energy band gap for practical applications. First principles calculations are performed to investigate the electronic structure and strain-mediated electronic properties of pristine and Mn-doped GaN monolayer. Binding energy of Mn dopant at various adsorption site is found to be nearly same indicating these sites to be equally favorable for adsorption of foreign atom. Depending on the adsorption site, GaN monolayer can act as p-type or n-type magnetic semiconductor. The tensile strength of both pristine and doped GaN monolayer (∼24 GPa) at ultimate tensile strain of 34% is comparable with the tensile strength of graphene. The in-plane biaxial strain modulate the energy band gap of both pristine and doped-monolayer from direct to indirect gap semiconductor and finally retendered theme into metal at critical value of applied strain. These characteristics make GaN monolayer to be potential candidate for the future applications in tunable optoelectronics.

CuPc/Au(1 1 0): Determination of the azimuthal alignment by a combination of angle-resolved photoemission and density functional theory

PubMed Central

Lüftner, Daniel; Milko, Matus; Huppmann, Sophia; Scholz, Markus; Ngyuen, Nam; Wießner, Michael; Schöll, Achim; Reinert, Friedrich; Puschnig, Peter

2014-01-01

Here we report on a combined experimental and theoretical study on the structural and electronic properties of a monolayer of Copper-Phthalocyanine (CuPc) on the Au(1 1 0) surface. Low-energy electron diffraction reveals a commensurate overlayer unit cell containing one adsorbate species. The azimuthal alignment of the CuPc molecule is revealed by comparing experimental constant binding energy (kxky)-maps using angle-resolved photoelectron spectroscopy with theoretical momentum maps of the free molecule's highest occupied molecular orbital (HOMO). This structural information is confirmed by total energy calculations within the framework of van-der-Waals corrected density functional theory. The electronic structure is further analyzed by computing the molecule-projected density of states, using both a semi-local and a hybrid exchange-correlation functional. In agreement with experiment, the HOMO is located about 1.2 eV below the Fermi-level, while there is no significant charge transfer into the molecule and the CuPc LUMO remains unoccupied on the Au(1 1 0) surface. PMID:25284953

Self-Consistent Optimization of Excited States within Density-Functional Tight-Binding.

PubMed

Kowalczyk, Tim; Le, Khoa; Irle, Stephan

2016-01-12

We present an implementation of energies and gradients for the ΔDFTB method, an analogue of Δ-self-consistent-field density functional theory (ΔSCF) within density-functional tight-binding, for the lowest singlet excited state of closed-shell molecules. Benchmarks of ΔDFTB excitation energies, optimized geometries, Stokes shifts, and vibrational frequencies reveal that ΔDFTB provides a qualitatively correct description of changes in molecular geometries and vibrational frequencies due to excited-state relaxation. The accuracy of ΔDFTB Stokes shifts is comparable to that of ΔSCF-DFT, and ΔDFTB performs similarly to ΔSCF with the PBE functional for vertical excitation energies of larger chromophores where the need for efficient excited-state methods is most urgent. We provide some justification for the use of an excited-state reference density in the DFTB expansion of the electronic energy and demonstrate that ΔDFTB preserves many of the properties of its parent ΔSCF approach. This implementation fills an important gap in the extended framework of DFTB, where access to excited states has been limited to the time-dependent linear-response approach, and affords access to rapid exploration of a valuable class of excited-state potential energy surfaces.

Hydrogen bonding in microsolvation: photoelectron imaging and theoretical studies on Au(x)(-)-(H2O)(n) and Au(x)(-)-(CH3OH)(n) (x = 1, 2; n = 1, 2) complexes.

PubMed

Wu, Xia; Tan, Kai; Tang, Zichao; Lu, Xin

2014-03-14

We have combined photoelectron velocity-map imaging (VMI) spectroscopy and theoretical calculations to elucidate the geometry and energy properties of Aux(-)(Solv)n clusters with x = 1, 2; n = 1, 2; and Solv = H2O and CH3OH. Besides the blue-shifted vertical electron detachment energies (VDEs) of the complexes Au1,2(-)(Solv)n with the increase of the solvation number (n), we independently probed two distinct Au(-)(CH3OH)2 isomers, which combined with MP2/aug-cc-pVTZ(pp) calculations represent a competition between O···H-O hydrogen bonds (HBs) and Au···H-O nonconventional hydrogen bonds (NHBs). Complementary calculations provide the total binding energies of the low-energy isomers. Moreover, the relationship between the total binding energies and total VDEshift is discussed. We found that the Au1,2(-) anions exhibit halide-analogous behavior in microsolvation. These findings also demonstrate that photoelectron velocity map imaging spectroscopy with the aid of the ab initio calculations is an effective tool for investigating weak-interaction complexes.

Probing the structural and electronic properties of cationic rubidium-gold clusters: [AunRb]+ (n = 1-10)

NASA Astrophysics Data System (ADS)

Zhao, Ya-Ru; Zhang, Hai-Rong; Qian, Yu; Duan, Xu-Chao; Hu, Yan-Fei

2016-03-01

Density functional theory has been applied to study the geometric structures, relative stabilities, and electronic properties of cationic [AunRb]+ and Aun + 1+ (n = 1-10) clusters. For the lowest energy structures of [AunRb]+ clusters, the planar to three-dimensional transformation is found to occur at cluster size n = 4 and the Rb atoms prefer being located at the most highly coordinated position. The trends of the averaged atomic binding energies, fragmentation energies, second-order difference of energies, and energy gaps show pronounced even-odd alternations. It indicated that the clusters containing odd number of atoms maintain greater stability than the clusters in the vicinity. In particular, the [Au6Rb]+ clusters are the most stable isomer for [AunRb]+ clusters in the region of n = 1-10. The charges in [AunRb]+ clusters transfer from the Rb atoms to Aun host. Density of states revealed that the Au-5d, Au-5p, and Rb-4p orbitals hardly participated in bonding. In addition, it is found that the most favourable channel of the [AunRb]+ clusters is Rb+ cation ejection. The electronic localisation function (ELF) analysis of the [AunRb]+ clusters shown that strong interactions are not revealed in this study.

Nonlinear properties of gated graphene in a strong electromagnetic field

DOE Office of Scientific and Technical Information (OSTI.GOV)

Avetisyan, A. A., E-mail: artakav@ysu.am; Djotyan, A. P., E-mail: adjotyan@ysu.am; Moulopoulos, K., E-mail: cos@ucy.ac.cy

We develop a microscopic theory of a strong electromagnetic field interaction with gated bilayer graphene. Quantum kinetic equations for density matrix are obtained using a tight binding approach within second quantized Hamiltonian in an intense laser field. We show that adiabatically changing the gate potentials with time may produce (at resonant photon energy) a full inversion of the electron population with high density between valence and conduction bands. In the linear regime, excitonic absorption of an electromagnetic radiation in a graphene monolayer with opened energy gap is also studied.

Enhanced nitrogen diffusion induced by atomic attrition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ochoa, E.A.; Figueroa, C.A.; Czerwiec, T.

2006-06-19

The nitrogen diffusion in steel is enhanced by previous atomic attrition with low energy xenon ions. The noble gas bombardment generates nanoscale texture surfaces and stress in the material. The atomic attrition increases nitrogen diffusion at lower temperatures than the ones normally used in standard processes. The stress causes binding energy shifts of the Xe 3d{sub 5/2} electron core level. The heavy ion bombardment control of the texture and stress of the material surfaces may be applied to several plasma processes where diffusing species are involved.

Decipher the mechanisms of protein conformational changes induced by nucleotide binding through free-energy landscape analysis: ATP binding to Hsp70.

PubMed

Nicolaï, Adrien; Delarue, Patrice; Senet, Patrick

2013-01-01

ATP regulates the function of many proteins in the cell by transducing its binding and hydrolysis energies into protein conformational changes by mechanisms which are challenging to identify at the atomic scale. Based on molecular dynamics (MD) simulations, a method is proposed to analyze the structural changes induced by ATP binding to a protein by computing the effective free-energy landscape (FEL) of a subset of its coordinates along its amino-acid sequence. The method is applied to characterize the mechanism by which the binding of ATP to the nucleotide-binding domain (NBD) of Hsp70 propagates a signal to its substrate-binding domain (SBD). Unbiased MD simulations were performed for Hsp70-DnaK chaperone in nucleotide-free, ADP-bound and ATP-bound states. The simulations revealed that the SBD does not interact with the NBD for DnaK in its nucleotide-free and ADP-bound states whereas the docking of the SBD was found in the ATP-bound state. The docked state induced by ATP binding found in MD is an intermediate state between the initial nucleotide-free and final ATP-bound states of Hsp70. The analysis of the FEL projected along the amino-acid sequence permitted to identify a subset of 27 protein internal coordinates corresponding to a network of 91 key residues involved in the conformational change induced by ATP binding. Among the 91 residues, 26 are identified for the first time, whereas the others were shown relevant for the allosteric communication of Hsp70 s in several experiments and bioinformatics analysis. The FEL analysis revealed also the origin of the ATP-induced structural modifications of the SBD recently measured by Electron Paramagnetic Resonance. The pathway between the nucleotide-free and the intermediate state of DnaK was extracted by applying principal component analysis to the subset of internal coordinates describing the transition. The methodology proposed is general and could be applied to analyze allosteric communication in other proteins.

Decipher the Mechanisms of Protein Conformational Changes Induced by Nucleotide Binding through Free-Energy Landscape Analysis: ATP Binding to Hsp70

PubMed Central

Nicolaï, Adrien; Delarue, Patrice; Senet, Patrick

2013-01-01

ATP regulates the function of many proteins in the cell by transducing its binding and hydrolysis energies into protein conformational changes by mechanisms which are challenging to identify at the atomic scale. Based on molecular dynamics (MD) simulations, a method is proposed to analyze the structural changes induced by ATP binding to a protein by computing the effective free-energy landscape (FEL) of a subset of its coordinates along its amino-acid sequence. The method is applied to characterize the mechanism by which the binding of ATP to the nucleotide-binding domain (NBD) of Hsp70 propagates a signal to its substrate-binding domain (SBD). Unbiased MD simulations were performed for Hsp70-DnaK chaperone in nucleotide-free, ADP-bound and ATP-bound states. The simulations revealed that the SBD does not interact with the NBD for DnaK in its nucleotide-free and ADP-bound states whereas the docking of the SBD was found in the ATP-bound state. The docked state induced by ATP binding found in MD is an intermediate state between the initial nucleotide-free and final ATP-bound states of Hsp70. The analysis of the FEL projected along the amino-acid sequence permitted to identify a subset of 27 protein internal coordinates corresponding to a network of 91 key residues involved in the conformational change induced by ATP binding. Among the 91 residues, 26 are identified for the first time, whereas the others were shown relevant for the allosteric communication of Hsp70 s in several experiments and bioinformatics analysis. The FEL analysis revealed also the origin of the ATP-induced structural modifications of the SBD recently measured by Electron Paramagnetic Resonance. The pathway between the nucleotide-free and the intermediate state of DnaK was extracted by applying principal component analysis to the subset of internal coordinates describing the transition. The methodology proposed is general and could be applied to analyze allosteric communication in other proteins. PMID:24348227

Insights into the Structural Changes Occurring upon Photoconversion in the Orange Carotenoid Protein from Broadband Two-Dimensional Electronic Spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Re, Eleonora; Schlau-Cohen, Gabriela S.; Leverenz, Ryan L.

Carotenoids play an essential role in photoprotection, interacting with other pigments to safely dissipate excess absorbed energy as heat. In cyanobacteria, the short time scale photoprotective mechanisms involve the photoactive orange carotenoid protein (OCP), which binds a single carbonyl carotenoid. Blue-green light induces the photoswitching of OCP from its ground state form (OCPO) to a metastable photoproduct (OCPR). OCPR can bind to the phycobilisome antenna and induce fluorescence quenching. The photoswitching is accompanied by structural and functional changes at the level of the protein and of the bound carotenoid. In this study, we use broadband two-dimensional electronic spectroscopy to lookmore » at the differences in excited state dynamics of the carotenoid in the two forms of OCP. Our results provide insight into the origin of the pronounced vibrational lineshape and oscillatory dynamics observed in linear absorption and 2D electronic spectroscopy of OCPO and the large inhomogeneous broadening in OCPR, with consequences for the chemical function of the two forms.« less

Photoelectron Spectroscopy of the Doubly-Charged Anions [MIVO(mnt)2]2- (M=Mo, W; mnt=S2C2(CN)22-): Access to the Ground and Excited States of the [MvO(mnt)2]-Anion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Waters, Tom; Wang, Xue B.; Yang, Xin

2004-04-21

Photodetachment photoelectron spectroscopy was used to investigate the electronic structure of the doubly charged complexes [MIVO(mnt)2]2- (M=Mo, W;mnt=1,2 dicyanoethenedithiolato). These dianions are stable in the gas phase and are minimal models for the active sites of the dimethyl sulfoxide reductase family of molybdenum enzymes and of related tungsten enzymes. Adiabatic and vertical electron binding energies for both species were measured, providing detailed information about molecular orbital energy levels of the parent dianions as well as the ground and excited states of the product anions [MvO(mnt)2]. Density functional theory calculations were used to assist assignment of the detachment features.

Modeling Biophysical and Biological Properties From the Characteristics of the Molecular Electron Density, Electron Localization and Delocalization Matrices, and the Electrostatic Potential

PubMed Central

Matta*, Chérif F

2014-01-01

The electron density and the electrostatic potential are fundamentally related to the molecular hamiltonian, and hence are the ultimate source of all properties in the ground- and excited-states. The advantages of using molecular descriptors derived from these fundamental scalar fields, both accessible from theory and from experiment, in the formulation of quantitative structure-to-activity and structure-to-property relationships, collectively abbreviated as QSAR, are discussed. A few such descriptors encode for a wide variety of properties including, for example, electronic transition energies, pKa's, rates of ester hydrolysis, NMR chemical shifts, DNA dimers binding energies, π-stacking energies, toxicological indices, cytotoxicities, hepatotoxicities, carcinogenicities, partial molar volumes, partition coefficients (log P), hydrogen bond donor capacities, enzyme–substrate complementarities, bioisosterism, and regularities in the genetic code. Electronic fingerprinting from the topological analysis of the electron density is shown to be comparable and possibly superior to Hammett constants and can be used in conjunction with traditional bulk and liposolubility descriptors to accurately predict biological activities. A new class of descriptors obtained from the quantum theory of atoms in molecules' (QTAIM) localization and delocalization indices and bond properties, cast in matrix format, is shown to quantify transferability and molecular similarity meaningfully. Properties such as “interacting quantum atoms (IQA)” energies which are expressible into an interaction matrix of two body terms (and diagonal one body “self” terms, as IQA energies) can be used in the same manner. The proposed QSAR-type studies based on similarity distances derived from such matrix representatives of molecular structure necessitate extensive investigation before their utility is unequivocally established. © 2014 The Author and the Journal of Computational Chemistry Published by Wiley Periodicals, Inc. PMID:24777743

Density functional theory based study of molecular interactions, recognition, engineering, and quantum transport in π molecular systems.

PubMed

Cho, Yeonchoo; Cho, Woo Jong; Youn, Il Seung; Lee, Geunsik; Singh, N Jiten; Kim, Kwang S

2014-11-18

CONSPECTUS: In chemical and biological systems, various interactions that govern the chemical and physical properties of molecules, assembling phenomena, and electronic transport properties compete and control the microscopic structure of materials. The well-controlled manipulation of each component can allow researchers to design receptors or sensors, new molecular architectures, structures with novel morphology, and functional molecules or devices. In this Account, we describe the structures and electronic and spintronic properties of π-molecular systems that are important for controlling the architecture of a variety of carbon-based systems. Although DFT is an important tool for describing molecular interactions, the inability of DFT to accurately represent dispersion interactions has made it difficult to properly describe π-interactions. However, the recently developed dispersion corrections for DFT have allowed us to include these dispersion interactions cost-effectively. We have investigated noncovalent interactions of various π-systems including aromatic-π, aliphatic-π, and non-π systems based on dispersion-corrected DFT (DFT-D). In addition, we have addressed the validity of DFT-D compared with the complete basis set (CBS) limit values of coupled cluster theory with single, double, and perturbative triple excitations [CCSD(T)] and Møller-Plesset second order perturbation theory (MP2). The DFT-D methods are still unable to predict the correct ordering in binding energies within the benzene dimer and the cyclohexane dimer. Nevertheless, the overall DFT-D predicted binding energies are in reasonable agreement with the CCSD(T) results. In most cases, results using the B97-D3 method closely reproduce the CCSD(T) results with the optimized energy-fitting parameters. On the other hand, vdW-DF2 and PBE0-TS methods estimate the dispersion energies from the calculated electron density. In these approximations, the interaction energies around the equilibrium point are reasonably close to the CCSD(T) results but sometimes slightly deviate from them because interaction energies were not particularly optimized with parameters. Nevertheless, because the electron cloud deforms when neighboring atoms/ions induce an electric field, both vdW-DF2 and PBE0-TS seem to properly reproduce the resulting change of dispersion interaction. Thus, improvements are needed in both vdW-DF2 and PBE0-TS to better describe the interaction energies, while the B97-D3 method could benefit from the incorporation of polarization-driven energy changes that show highly anisotropic behavior. Although the current DFT-D methods need further improvement, DFT-D is very useful for computer-aided molecular design. We have used these newly developed DFT-D methods to calculate the interactions between graphene and DNA nucleobases. Using DFT-D, we describe the design of molecular receptors of π-systems, graphene based electronic devices, metalloporphyrin half-metal based spintronic devices as graphene nanoribbon (GNR) analogs, and graphene based molecular electronic devices for DNA sequencing. DFT-D has also helped us understand quantum phenomena in materials and devices of π-systems including graphene.

Electronic Structures, Bonding Configurations, and Band-Gap-Opening Properties of Graphene Binding with Low-Concentration Fluorine

DOE PAGES

Duan, Yuhua; Stinespring, Charter D.; Chorpening, Benjamin

2015-06-18

To better understand the effects of low-level fluorine in graphene-based sensors, first-principles density functional theory (DFT) with van der Waals dispersion interactions has been employed to investigate the structure and impact of fluorine defects on the electrical properties of single-layer graphene films. The results show that both graphite-2H and graphene have zero band gaps. When fluorine bonds to a carbon atom, the carbon atom is pulled slightly above the graphene plane, creating what is referred to as a CF defect. The lowest-binding energy state is found to correspond to two CF defects on nearest neighbor sites, with one fluorine abovemore » the carbon plane and the other below the plane. Overall this has the effect of buckling the graphene. The results further show that the addition of fluorine to graphene leads to the formation of an energy band (BF) near the Fermi level, contributed mainly from the 2p orbitals of fluorine with a small contribution from the porbitals of the carbon. Among the 11 binding configurations studied, our results show that only in two cases does the BF serve as a conduction band and open a band gap of 0.37 eV and 0.24 eV respectively. The binding energy decreases with decreasing fluorine concentration due to the interaction between neighboring fluorine atoms. The obtained results are useful for sensor development and nanoelectronics.« less

Communication: electronic band gaps of semiconducting zig-zag carbon nanotubes from many-body perturbation theory calculations.

PubMed

Umari, P; Petrenko, O; Taioli, S; De Souza, M M

2012-05-14

Electronic band gaps for optically allowed transitions are calculated for a series of semiconducting single-walled zig-zag carbon nanotubes of increasing diameter within the many-body perturbation theory GW method. The dependence of the evaluated gaps with respect to tube diameters is then compared with those found from previous experimental data for optical gaps combined with theoretical estimations of exciton binding energies. We find that our GW gaps confirm the behavior inferred from experiment. The relationship between the electronic gap and the diameter extrapolated from the GW values is also in excellent agreement with a direct measurement recently performed through scanning tunneling spectroscopy.

Field-induced structural control of COx molecules adsorbed on graphene

NASA Astrophysics Data System (ADS)

Matsubara, Manaho; Okada, Susumu

2018-05-01

Using the density functional theory combined with both the van der Waals correction and the effective screening medium method, we investigate the energetics and electronic structures of CO and CO2 molecules adsorbed on graphene surfaces in the field-effect-transistor structure with respect to the external electric field by the excess electrons/holes. The binding energies of CO and CO2 molecules to graphene monotonically increase with increasing hole and electron concentrations. The increase occurs regardless of the molecular conformations to graphene and the counter electrode, indicating that the carrier injection substantially enhances the molecular adsorption on graphene. Injected carriers also modulate the stable molecular conformation, which is metastable in the absence of an electric field.

Energetics and electronic structures of chemically decorated C60 chains

NASA Astrophysics Data System (ADS)

Furutani, Sho; Okada, Susumu

2018-06-01

We studied the energetics and electronic structures of one-dimensional molecular chains of [6,6]-phenyl-C61-butyric acid methyl ester (PCBM) using the density functional theory (DFT). Our DFT calculations show that the binding energies of PCBM range from 90 to 300 meV, depending on not only the intermolecular spacing but also the intermolecular arrangements owing to the interaction between functional groups and C60. The electronic structure of PCBM chains are also sensitive to the mutual arrangements of PCBM in their chain structure. The calculated effective masses of the conduction band range from 0.58 to 634.97m e, giving rise to anisotropic transport properties in their condensed phase.

Structural, electronic and photocatalytic properties of atomic defective BiI3 monolayers

NASA Astrophysics Data System (ADS)

Yan, Huang; Ziyu, Hu; Xu, Gong; Xiaohong, Shao

2018-01-01

The structural, electronic and photocatalytic properties of five vacancy-containing 2D BiI3 monolayers are investigated by the first-principle calculations. The electronic structures show that the five structures are stable and have comparable binding energies to that of the pristine BiI3 monolayer, and the defects can tune the band gaps. Optical spectra indicate that the five structures retain high absorption capacity for visible light. The spin-orbit coupling (SOC) effect is found to play an important role in the band edge of defective structures, and the VBi and VBi-I3 defective BiI3 monolayers can make absolute band edges straddle water redox potentials more easily.

Electrostatics of electron-hole interactions in van der Waals heterostructures

NASA Astrophysics Data System (ADS)

Cavalcante, L. S. R.; Chaves, A.; Van Duppen, B.; Peeters, F. M.; Reichman, D. R.

2018-03-01

The role of dielectric screening of electron-hole interaction in van der Waals heterostructures is theoretically investigated. A comparison between models available in the literature for describing these interactions is made and the limitations of these approaches are discussed. A simple numerical solution of Poisson's equation for a stack of dielectric slabs based on a transfer matrix method is developed, enabling the calculation of the electron-hole interaction potential at very low computational cost and with reasonable accuracy. Using different potential models, direct and indirect exciton binding energies in these systems are calculated within Wannier-Mott theory, and a comparison of theoretical results with recent experiments on excitons in two-dimensional materials is discussed.

The Binding Mode Prediction and Similar Ligand Potency in the Active Site of Vitamin D Receptor with QM/MM Interaction, MESP, and MD Simulation.

PubMed

Selvaraman, Nagamani; Selvam, Saravana Kumar; Muthusamy, Karthikeyan

2016-08-01

Non-secosteroidal ligands are well-known vitamin D receptor (VDR) agonists. In this study, we described a combined QM/MM to define the protein-ligand interaction energy a strong positive correlation in both QM-MM interaction energy and binding free energy against the biological activity. The molecular dynamics simulation study was performed, and specific interactions were extensively studied. The molecular docking results and surface analysis shed light on steric and electrostatic complementarities of these non-secosteroidal ligands to VDR. Finally, the drug likeness properties were also calculated and found within the acceptable range. The results show that bulky group substitutions in side chain decrease the VDR activity, whereas a small substitution increased it. Functional analyses of H393A and H301A mutations substantiate their roles in the VDR agonistic and antagonistic activities. Apart from the His393 and His301, two other amino acids in the hinge region viz. Ser233 and Arg270 acted as an electron donor/acceptor specific to the agonist in the distinct ligand potency. The results from this study disclose the binding mechanism of VDR agonists and structural modifications required to improve the selectivity. © 2016 John Wiley & Sons A/S.

Photochemical and DFT studies on DNA-binding ability and antibacterial activity of lanthanum(III)-phenanthroline complex

NASA Astrophysics Data System (ADS)

Niroomand, Sona; Khorasani-Motlagh, Mozhgan; Noroozifar, Meissam; Jahani, Shohreh; Moodi, Asieh

2017-02-01

The binding of the lanthanum(III) complex containing 1,10-phenanthroline (phen), [La(phen)3Cl3·OH2], to DNA is investigated by absorption and emission methods. This complex shows absorption decreasing in a charge transfer band, and fluorescence decrement when it binds to DNA. Electronic absorption spectroscopy (UV-Vis), fluorescence spectra, iodide quenching experiments, salt effect and viscosity measurements, ethidium bromide (EB) competition test, circular dichroism (CD) spectra as well as variable temperature experiments indicate that the La(III) complex binds to fish salmon (FS) DNA, presumably via groove binding mode. The binding constants (Kb) of the La(III) complex with DNA is (2.55 ± 0.02) × 106 M-1. Furthermore, the binding site size, n, the Stern-Volmer constant KSV and thermodynamic parameters; enthalpy change (ΔH0) and entropy change (ΔS0) and Gibb's free energy (ΔG0), are calculated according to relevant fluorescent data and the Van't Hoff equation. The La(III) complex has been screened for its antibacterial activities by the disc diffusion method. Also, in order to supplement the experimental findings, DFT computation and NBO analysis are carried out.

Electronic properties and optical absorption of a phosphorene quantum dot

NASA Astrophysics Data System (ADS)

Liang, F. X.; Ren, Y. H.; Zhang, X. D.; Jiang, Z. T.

2018-03-01

Using the tight-binding Hamiltonian approach, we theoretically study the electronic and optical properties of a triangular phosphorene quantum dot (PQD) including one normal zigzag edge and two skewed armchair edges (ZAA-PQD). It is shown that the energy spectrum can be classified into the filled band (FB), the zero-energy band (ZB), and the unfilled band (UB). Numerical calculations of the FB, ZB, and UB probability distributions show that the FB and the UB correspond to the bulk states, while the ZB corresponds to the edge states, which appear on all of the three edges of the ZAA-PQD sharply different from the other PQDs. We also find that the strains and the electric fields can affect the energy levels inhomogeneously. Then the optical properties of the ZAA-PQD are investigated. There appear some strong low-energy optical absorption peaks indicating its sensitive low-energy optical response that is absent in other PQDs. Moreover, the strains and the electric fields can make inhomogeneous influences on the optical spectrum of the ZAA-PQD. This work may provide a useful reference for designing the electrical, mechanical, and optical PQD devices.

Lewis Acid-Base Chemistry of 7-Azaisoindigo-Based Organic Semiconductors.

PubMed

Randell, Nicholas M; Fransishyn, Kyle M; Kelly, Timothy L

2017-07-26

Low-band-gap organic semiconductors are important in a variety of organic electronics applications, such as organic photovoltaic devices, photodetectors, and field effect transistors. Building on our previous work, which introduced 7-azaisoindigo as an electron-deficient building block for the synthesis of donor-acceptor organic semiconductors, we demonstrate how Lewis acids can be used to further tune the energies of the frontier molecular orbitals. Coordination of a Lewis acid to the pyridinic nitrogen of 7-azaisoindigo greatly diminishes the electron density in the azaisoindigo π-system, resulting in a substantial reduction in the lowest unoccupied molecular orbital (LUMO) energy. This results in a smaller highest occupied molecular orbital-LUMO gap and shifts the lowest-energy electronic transition well into the near-infrared region. Both H + and BF 3 are shown to coordinate to azaisoindigo and affect the energy of the S 0 → S 1 transition. A combination of time-dependent density functional theory and UV/vis and 1 H NMR spectroscopic titrations reveal that when two azaisoindigo groups are present and high concentrations of acid are used, both pyridinic nitrogens bind Lewis acids. Importantly, we demonstrate that this acid-base chemistry can be carried out at the solid-vapor interface by exposing thin films of aza-substituted organic semiconductors to vapor-phase BF 3 ·Et 2 O. This suggests the possibility of using the BF 3 -bound 7-azaisoindigo-based semiconductors as n-type materials in various organic electronic applications.

Annealing induced atomic rearrangements on (Ga,In) (N,As) probed by hard X-ray photoelectron spectroscopy and X-ray absorption fine structure.

PubMed

Ishikawa, Fumitaro; Higashi, Kotaro; Fuyuno, Satoshi; Morifuji, Masato; Kondow, Masahiko; Trampert, Achim

2018-04-13

We study the effects of annealing on (Ga 0.64 ,In 0.36 ) (N 0.045 ,As 0.955 ) using hard X-ray photoelectron spectroscopy and X-ray absorption fine structure measurements. We observed surface oxidation and termination of the N-As bond defects caused by the annealing process. Specifically, we observed a characteristic chemical shift towards lower binding energies in the photoelectron spectra related to In. This phenomenon appears to be caused by the atomic arrangement, which produces increased In-N bond configurations within the matrix, as indicated by the X-ray absorption fine structure measurements. The reduction in the binding energies of group-III In, which occurs concomitantly with the atomic rearrangements of the matrix, causes the differences in the electronic properties of the system before and after annealing.

Strong π-π interaction of porphyrins on (6,5) carbon nanotubes with full surface coverage: Ab-initio calculations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Orellana, Walter, E-mail: worellana@unab.cl

2014-07-14

The stability, electronic, and optical properties of (6,5) single-walled carbon nanotubes (CNTs) functionalized with free-base tetraphenylporphyrin (TPP) molecules through π-stacking interactions are studied by ab-initio calculations. The stability and optical response of the CNT-TPP compounds for increasing CNT-surface coverage are investigated. Our results show that four TPP molecules forming a ring around the CNT is the most stable configuration, showing strong binding energies of about 2.5 eV/TPP. However, this binding energy can increase even more after additional molecules assemble side by side along the CNT, favoring the formation of a full single layer of TPP, as experimentally suggested. The strong π-πmore » attractive forces induce molecular distortions that move the TPP higher-occupied molecular orbital levels inside the CNT bandgap, changing the optical response of the TPP molecules stacked on the CNT.« less

Unveiling Stability Criteria of DNA-Carbon Nanotubes Constructs by Scanning Tunneling Microscopy and Computational Modeling

DOE PAGES

Kilina, Svetlana; Yarotski, Dzmitry A.; Talin, A. Alec; ...

2011-01-01

We present a combined approach that relies on computational simulations and scanning tunneling microscopy (STM) measurements to reveal morphological properties and stability criteria of carbon nanotube-DNA (CNT-DNA) constructs. Application of STM allows direct observation of very stable CNT-DNA hybrid structures with the well-defined DNA wrapping angle of 63.4 ° and a coiling period of 3.3 nm. Using force field simulations, we determine how the DNA-CNT binding energy depends on the sequence and binding geometry of a single strand DNA. This dependence allows us to quantitatively characterize the stability of a hybrid structure with an optimal π-stacking between DNA nucleotides and themore » tube surface and better interpret STM data. Our simulations clearly demonstrate the existence of a very stable DNA binding geometry for (6,5) CNT as evidenced by the presence of a well-defined minimum in the binding energy as a function of an angle between DNA strand and the nanotube chiral vector. This novel approach demonstrates the feasibility of CNT-DNA geometry studies with subnanometer resolution and paves the way towards complete characterization of the structural and electronic properties of drug-delivering systems based on DNA-CNT hybrids as a function of DNA sequence and a nanotube chirality.« less

Surface Charge-Transfer Doping of Graphene Nanoflakes Containing Double-Vacancy (5-8-5) and Stone-Wales (55-77) Defects through Molecular Adsorption.

PubMed

Shakourian-Fard, Mehdi; Jamshidi, Zahra; Kamath, Ganesh

2016-10-18

The adsorption of six electron donor-acceptor (D/A) organic molecules on various sizes of graphene nanoflakes (GNFs) containing two common defects, double-vacancy (5-8-5) and Stone-Wales (55-77), are investigated by means of ab initio DFT [M06-2X(-D3)/cc-pVDZ]. Different D/A molecules adsorb on a defect graphene (DG) surface with binding energies (ΔE b ) of about -12 to -28 kcal mol -1 . The ΔE b values for adsorption of molecules on the Stone-Wales GNF surface are higher than those on the double vacancy GNF surface. Moreover, binding energies increase by about 10 % with an increase in surface size. The nature of cooperative weak interactions is analyzed based on quantum theory of atoms in molecules, noncovalent interactions plot, and natural bond order analyses, and the dominant interaction is compared for different molecules. Electron density population analysis is used to explain the n- and p-type character of defect graphene nanoflakes (DGNFs) and also the change in electronic properties and reactivity parameters of DGNFs upon adsorption of different molecules and with increasing DGNF size. Results indicate that the HOMO-LUMO energy gap (E g ) of DGNFs decreases upon adsorption of molecules. However, by increasing the size of DGNFs, the E g and chemical hardness of all complexes decrease and the electrophilicity index increases. Furthermore, the values of the chemical potential of acceptor-DGNF complexes decrease with increasing size, whereas those of donor-DGNF complexes increase. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Investigation of energy deposited by femtosecond electron transfer in collisions using hydrated ion nanocalorimetry.

PubMed

Holm, Anne I S; Donald, William A; Hvelplund, Preben; Larsen, Mikkel K; Nielsen, Steen Brøndsted; Williams, Evan R

2008-10-30

Ion nanocalorimetry is used to investigate the internal energy deposited into M (2+)(H 2O) n , M = Mg ( n = 3-11) and Ca ( n = 3-33), upon 100 keV collisions with a Cs or Ne atom target gas. Dissociation occurs by loss of water molecules from the precursor (charge retention) or by capture of an electron to form a reduced precursor (charge reduction) that can dissociate either by loss of a H atom accompanied by water molecule loss or by exclusively loss of water molecules. Formation of bare CaOH (+) and Ca (+) by these two respective dissociation pathways occurs for clusters with n up to 33 and 17, respectively. From the threshold dissociation energies for the loss of water molecules from the reduced clusters, obtained from binding energies calculated using a discrete implementation of the Thomson liquid drop model and from quantum chemistry, estimates of the internal energy deposition can be obtained. These values can be used to establish a lower limit to the maximum and average energy deposition. Not taking into account effects of a kinetic shift, over 16 eV can be deposited into Ca (2+)(H 2O) 33, the minimum energy necessary to form bare CaOH (+) from the reduced precursor. The electron capture efficiency is at least a factor of 40 greater for collisions of Ca (2+)(H 2O) 9 with Cs than with Ne, reflecting the lower ionization energy of Cs (3.9 eV) compared to Ne (21.6 eV). The branching ratio of the two electron capture dissociation pathways differs significantly for these two target gases, but the distributions of water molecules lost from the reduced precursors are similar. These results suggest that the ionization energy of the target gas has a large effect on the electron capture efficiency, but relatively little effect on the internal energy deposited into the ion. However, the different branching ratios suggest that different electronic excited states may be accessed in the reduced precursor upon collisions with these two different target gases.

π-Stacking, C-H/π, and halogen bonding interactions in bromobenzene and mixed bromobenzene-benzene clusters.

PubMed

Reid, Scott A; Nyambo, Silver; Muzangwa, Lloyd; Uhler, Brandon

2013-12-19

Noncovalent interactions play an important role in many chemical and biochemical processes. Building upon our recent study of the homoclusters of chlorobenzene, where π-π stacking and CH/π interactions were identified as the most important binding motifs, in this work we present a study of bromobenzene (PhBr) and mixed bromobenzene-benzene clusters. Electronic spectra in the region of the PhBr monomer S0-S1 (ππ*) transition were obtained using resonant two-photon ionization (R2PI) methods combined with time-of-flight mass analysis. As previously found for related systems, the PhBr cluster spectra show a broad feature whose center is red-shifted from the monomer absorption, and electronic structure calculations indicate the presence of multiple isomers and Franck-Condon activity in low-frequency intermolecular modes. Calculations at the M06-2X/aug-cc-pVDZ level find in total eight minimum energy structures for the PhBr dimer: four π-stacked structures differing in the relative orientation of the Br atoms (denoted D1-D4), one T-shaped structure (D5), and three halogen bonded structures (D6-D8). The calculated binding energies of these complexes, corrected for basis set superposition error (BSSE) and zero-point energy (ZPE), are in the range of -6 to -24 kJ/mol. Time-dependent density functional theory (TDDFT) calculations predict that these isomers absorb over a range that is roughly consistent with the breadth of the experimental spectrum. To examine the influence of dipole-dipole interaction, R2PI spectra were also obtained for the mixed PhBr···benzene dimer, where the spectral congestion is reduced and clear vibrational structure is observed. This structure is well-simulated by Franck-Condon calculations that incorporate the lowest frequency intermolecular modes. Calculations find four minimum energy structures for the mixed dimer and predict that the binding energy of the global minimum is reduced by ~30% relative to the global minimum PhBr dimer structure.

Urban Biomining: Biological Extraction of Metals and Materials from Electronics Waste Using a Synthetic Biology Approach

NASA Astrophysics Data System (ADS)

Urbina-Navarrete, J.; Rothschild, L.

2016-12-01

End-of-life electronics waste (e-waste) containing toxic and valuable materials is a rapidly progressing human health and environmental issue. Using synthetic biology tools, we have developed a recycling method for e-waste. Our innovation is to use a recombinant version of a naturally-occurring silica-degrading enzyme to depolymerize the silica in metal- and glass- containing e-waste components, and subsequently, to use engineered bacterial surfaces to bind and separate metals from a solution. The bacteria with bound metals can then be used as "bio-ink" to print new circuits using a novel plasma jet electronics printing technology. Here, we present the results from our initial studies that focus on the specificity of metal-binding motifs for a cognate metal. The candidate motifs that show high affinity and specificity will be engineered into bacterial surfaces for downstream applications in biologically-mediated metal recycling. Since the chemistry and role of Cu in metalloproteins is relatively well-characterized, we are using Cu as a proxy to elucidate metal and biological ligand interactions with various metals in e-waste. We assess the binding parameters of 3 representative classes of Cu-binding motifs using isothermal titration calorimetry; 1) natural motifs found in metalloproteins, 2) consensus motifs, and 3) rationally designed peptides that are predicted, in silico, to bind Cu. Our results indicate that naturally-occurring motifs have relative high affinity and specificity for Cu (association constant for Cu Ka 104 M-1, Zn Ka 103 M-1) when competing ions are present in the aqueous milieu. However, motifs developed through rational design by applying quantum mechanical methods that take into account complexation energies of the elemental binding partners and molecular geometry of the cognate metal, not only show high affinity for the cognate metal (Cu Ka 106 M-1), but they show specificity and discrimination against other metal ions that would be competitors for the same binding sites. This is an initial proof-of-concept study that focuses on Cu-binding; however the overall objective of this research is to have peptides that selectively bind many metals from e-waste and this would allow for the separation of the metals from a solution, at ambient temperatures and under non-toxic conditions.

Structural and electronic parameters of ferroelectric KWOF

NASA Astrophysics Data System (ADS)

Atuchin, V. V.; Gavrilova, T. A.; Kesler, V. G.; Molokeev, M. S.; Aleksandrov, K. S.

2010-11-01

The low-temperature ferroelectric G2 polymorph of K 3WO 3F 3 oxyfluoride is formed by chemical synthesis. The electronic parameters of G2-K 3WO 3F 3 have been measured by X-ray photoelectron spectroscopy under excitation with Al Kα radiation (1486.6 eV). Detailed spectra have been recorded for all element core levels and Auger lines. The chemical bonding effects in the WO 3F 3 and WO 6 octahedrons are considered by using the binding energy difference ΔBE(O-W)=BE(O 1s)-BE(W 4f).

Temperature-induced band shift in bulk γ-InSe by angle-resolved photoemission spectroscopy

NASA Astrophysics Data System (ADS)

Xu, Huanfeng; Wang, Wei; Zhao, Yafei; Zhang, Xiaoqian; Feng, Yue; Tu, Jian; Gu, Chenyi; Sun, Yizhe; Liu, Chang; Nie, Yuefeng; Edmond Turcu, Ion C.; Xu, Yongbing; He, Liang

2018-05-01

Indium selenide (InSe) has recently become popular research topics because of its unique layered crystal structure, direct band gap and high electron mobilities. In this work, we have acquired the electronic structure of bulk γ-InSe at various temperatures using angle-resolved photoemission spectroscopy (ARPES). We have also found that as the temperature decreases, the valence bands of γ-InSe exhibit a monotonic shift to lower binding energies. This band shift is attributed to the change of lattice parameters and has been validated by variable temperature X-ray diffraction measurements and theoretical calculations.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miliordos, Evangelos; Aprà, Edoardo; Xantheas, Sotiris S.

We establish a new estimate for the binding energy between two benzene molecules in the parallel-displaced (PD) conformation by systematically converging (i) the intra- and intermolecular geometry at the minimum, (ii) the expansion of the orbital basis set, and (iii) the level of electron correlation. The calculations were performed at the second-order Møller–Plesset perturbation (MP2) and the coupled cluster including singles, doubles, and a perturbative estimate of triples replacement [CCSD(T)] levels of electronic structure theory. At both levels of theory, by including results corrected for basis set superposition error (BSSE), we have estimated the complete basis set (CBS) limit bymore » employing the family of Dunning’s correlation-consistent polarized valence basis sets. The largest MP2 calculation was performed with the cc-pV6Z basis set (2772 basis functions), whereas the largest CCSD(T) calculation was with the cc-pV5Z basis set (1752 basis functions). The cluster geometries were optimized with basis sets up to quadruple-ζ quality, observing that both its intra- and intermolecular parts have practically converged with the triple-ζ quality sets. The use of converged geometries was found to play an important role for obtaining accurate estimates for the CBS limits. Our results demonstrate that the binding energies with the families of the plain (cc-pVnZ) and augmented (aug-cc-pVnZ) sets converge [within <0.01 kcal/mol for MP2 and <0.15 kcal/mol for CCSD(T)] to the same CBS limit. In addition, the average of the uncorrected and BSSE-corrected binding energies was found to converge to the same CBS limit much faster than either of the two constituents (uncorrected or BSSE-corrected binding energies). Due to the fact that the family of augmented basis sets (especially for the larger sets) causes serious linear dependency problems, the plain basis sets (for which no linear dependencies were found) are deemed as a more efficient and straightforward path for obtaining an accurate CBS limit. We considered extrapolations of the uncorrected (ΔE) and BSSE-corrected (ΔE cp) binding energies, their average value (ΔE ave), as well as the average of the latter over the plain and augmented sets (Δ~E ave) with the cardinal number of the basis set n. Our best estimate of the CCSD(T)/CBS limit for the π–π binding energy in the PD benzene dimer is D e = -2.65 ± 0.02 kcal/mol. The best CCSD(T)/cc-pV5Z calculated value is -2.62 kcal/mol, just 0.03 kcal/mol away from the CBS limit. For comparison, the MP2/CBS limit estimate is -5.00 ± 0.01 kcal/mol, demonstrating a 90% overbinding with respect to CCSD(T). Finally, the spin-component-scaled (SCS) MP2 variant was found to closely reproduce the CCSD(T) results for each basis set, while scaled opposite spin (SOS) MP2 yielded results that are too low when compared to CCSD(T).« less

DNA as a Target for Anticancer Phen-Imidazole Pd(II) Complexes.

PubMed

Heydari, Maryam; Moghadam, Mahboube Eslami; Tarlani, AliAkbar; Farhangian, Hossein

2017-05-01

Imidazole ring is a known structure in many natural or synthetic drug molecules and its metal complexes can interact with DNA and do the cleavage. Hence, to study the influence of the structure and size of the ligand on biological behavior of metal complexes, two water-soluble Pd(II) complexes of phen and FIP ligands (where phen is 1,10-phenanthroline and FIP is 2-(Furan-2-yl)-1H-Imidazo[4,5-f][1, 10]phenanthroline) with the formula of [Pd(phen)(FIP)](NO 3 ) 2 and [Pd(FIP) 2 ]Cl 2 , that were activated against chronic myelogenous leukemia cell line, K562, were selected. Also, the interaction of these anticancer Pd(II) complexes with highly polymerized calf thymus DNA was extensively studied by means of electronic absorption, fluorescence, and circular dichroism in Tris-buffer. The results showed that the binding was positive cooperation and [Pd(phen)(FIP)](NO 3 ) 2 (K f  = 127 M -1 G = 1.2) exhibited higher binding constant and number of binding sites than [Pd(FIP) 2 ]Cl 2 (K f  = 13 M -1 G = 1.03) upon binding to DNA. The fluorescence data indicates that quenching effect for [Pd(phen)(FIP)](NO 3 ) 2 (K SV  = 58 mM -1 ) was higher than [Pd(FIP) 2 ]Cl 2 (K SV  = 12 mM -1 ). Also, [Pd(FIP) 2 ]Cl 2 interacts with ethidium bromide-DNA, as non-competitive inhibition, and can bind to DNA via groove binding and [Pd(phen)(FIP)](NO 3 ) 2 can intercalate in DNA. These results were confirmed by circular dichroism spectra. Docking data revealed that longer complexes have higher interaction energy and bind to DNA via groove binding. Graphical Abstract Two anticancer Pd(II) complexes of imidazole derivative have been synthesized and interacted with calf thymus DNA. Modes of binding have been studied by electronic absorption, fluorescence, and CD measurements. [Pd(FIP) 2 ]Cl 2 can bind to DNA via groove binding while intercalation mode of binding is observed for [Pd(phen)(FIP)](NO 3 ) 2 .

Electronic and optical properties of hexathiapentacene in the gas and crystal phases

NASA Astrophysics Data System (ADS)

Cardia, R.; Malloci, G.; Rignanese, G.-M.; Blase, X.; Molteni, E.; Cappellini, G.

2016-06-01

Using density functional theory (DFT) and its time-dependent (TD) extension, the electronic and optical properties of the hexathiapentacene (HTP) molecule, a derivative of pentacene (PNT) obtained by symmetric substitution of the six central H atoms with S atoms, are investigated for its gas and solid phases. For the molecular structure, all-electron calculations are performed using a Gaussian localized orbital basis set in conjunction with the Becke three-parameter Lee-Yang-Parr (B3LYP) hybrid exchange-correlation functional. Electron affinities, ionization energies, quasiparticle energy gaps, optical absorption spectra, and exciton binding energies are calculated and compared with the corresponding results for PNT, as well as with the available experimental data. The DFT and TDDFT results are also validated by performing many-body perturbation theory calculations within the G W and Bethe-Salpeter equation formalisms. The functionalization with S atoms induces an increase of both ionization energies and electron affinities, a sizable reduction of the fundamental electronic gap, and a redshift of the optical absorption onset. Notably, the intensity of the first absorption peak of HTP falling in the visible region is found to be nearly tripled with respect to the pure PNT molecule. For the crystal structures, pseudopotential calculations are adopted using a plane-wave basis set together with the Perdew-Burke-Ernzerhof exchange-correlation functional empirically corrected in order to take dispersive interactions into account. The electronic excitations are also obtained within a perturbative B3LYP scheme. A comparative analysis is carried out between the ground-state and excited-state properties of crystalline HTP and PNT linking to the findings obtained for the isolated molecules.

Structural, electronic and vibrational properties of GexCy (x+y=2-5) nanoclusters: A B3LYP-DFT study

NASA Astrophysics Data System (ADS)

Goswami, Sohini; Saha, Sushmita; Yadav, R. K.

2015-11-01

An ab-initio study of the stability, structural and electronic properties has been made for 84 germanium carbide nanoclusters, GexCy (x+y=2-5). The configuration possessing the maximum value of final binding energy (FBE), among the various configurations corresponding to a fixed x+y=n value, is named as the most stable structure. The vibrational and optical properties have been investigated only for the most stable structures. A B3LYP-DFT/6-311G(3df) method has been employed to optimize fully the geometries of the nanoclusters. The binding energies (BE), highest-occupied and lowest-unoccupied molecular orbital (HOMO-LUMO) gaps have been obtained for all the clusters and the bond lengths have been reported for the most stable clusters. We have considered the zero point energy (ZPE) corrections. The adiabatic and vertical ionization potentials (IPs) and electron affinities (EAs), charge on atoms, dipole moments, vibrational frequencies, infrared intensities (IR Int.), relative infrared intensities (Rel. IR Int.) and Raman scattering activities have also been investigated for the most stable structures. The configurations containing the carbon atoms in majority are seen to be the most stable structures. The strong C-C bond has important role in stabilizing the clusters. For the clusters containing one germanium atom and all the other as carbon atoms, the BE increases monotonically with the number of the carbon atoms. The HOMO-LUMO gap, IPs and EAs fluctuates with increase in the number of atoms. The nanoclusters containing even number of carbon atoms have large HOMO-LUMO gaps and IPs, whereas the nanoclusters containing even number of carbon atoms have small EAs. In general, the adiabatic IP (EA) is smaller (greater) than the vertical IP (EA). The optical absorption spectrum or electron energy loss spectrum (EELS) is unique for every cluster, and may be used to characterize a specific cluster. All the predicted physical quantities are in good agreement with the experimental data wherever available. The growth of these most stable structures should be possible in the experiments.

Protocols Utilizing Constant pH Molecular Dynamics to Compute pH-Dependent Binding Free Energies

PubMed Central

2015-01-01

In protein–ligand binding, the electrostatic environments of the two binding partners may vary significantly in bound and unbound states, which may lead to protonation changes upon binding. In cases where ligand binding results in a net uptake or release of protons, the free energy of binding is pH-dependent. Nevertheless, conventional free energy calculations and molecular docking protocols typically do not rigorously account for changes in protonation that may occur upon ligand binding. To address these shortcomings, we present a simple methodology based on Wyman’s binding polynomial formalism to account for the pH dependence of binding free energies and demonstrate its use on cucurbit[7]uril (CB[7]) host–guest systems. Using constant pH molecular dynamics and a reference binding free energy that is taken either from experiment or from thermodynamic integration computations, the pH-dependent binding free energy is determined. This computational protocol accurately captures the large pKa shifts observed experimentally upon CB[7]:guest association and reproduces experimental binding free energies at different levels of pH. We show that incorrect assignment of fixed protonation states in free energy computations can give errors of >2 kcal/mol in these host–guest systems. Use of the methods presented here avoids such errors, thus suggesting their utility in computing proton-linked binding free energies for protein–ligand complexes. PMID:25134690

Ultra-fast computation of electronic spectra for large systems by tight-binding based simplified Tamm-Dancoff approximation (sTDA-xTB)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grimme, Stefan, E-mail: grimme@thch.uni-bonn.de; Bannwarth, Christoph

2016-08-07

The computational bottleneck of the extremely fast simplified Tamm-Dancoff approximated (sTDA) time-dependent density functional theory procedure [S. Grimme, J. Chem. Phys. 138, 244104 (2013)] for the computation of electronic spectra for large systems is the determination of the ground state Kohn-Sham orbitals and eigenvalues. This limits such treatments to single structures with a few hundred atoms and hence, e.g., sampling along molecular dynamics trajectories for flexible systems or the calculation of chromophore aggregates is often not possible. The aim of this work is to solve this problem by a specifically designed semi-empirical tight binding (TB) procedure similar to the wellmore » established self-consistent-charge density functional TB scheme. The new special purpose method provides orbitals and orbital energies of hybrid density functional character for a subsequent and basically unmodified sTDA procedure. Compared to many previous semi-empirical excited state methods, an advantage of the ansatz is that a general eigenvalue problem in a non-orthogonal, extended atomic orbital basis is solved and therefore correct occupied/virtual orbital energy splittings as well as Rydberg levels are obtained. A key idea for the success of the new model is that the determination of atomic charges (describing an effective electron-electron interaction) and the one-particle spectrum is decoupled and treated by two differently parametrized Hamiltonians/basis sets. The three-diagonalization-step composite procedure can routinely compute broad range electronic spectra (0-8 eV) within minutes of computation time for systems composed of 500-1000 atoms with an accuracy typical of standard time-dependent density functional theory (0.3-0.5 eV average error). An easily extendable parametrization based on coupled-cluster and density functional computed reference data for the elements H–Zn including transition metals is described. The accuracy of the method termed sTDA-xTB is first benchmarked for vertical excitation energies of open- and closed-shell systems in comparison to other semi-empirical methods and applied to exemplary problems in electronic spectroscopy. As side products of the development, a robust and efficient valence electron TB method for the accurate determination of atomic charges as well as a more accurate calculation scheme of dipole rotatory strengths within the Tamm-Dancoff approximation is proposed.« less