Sample records for electron molecule scattering

  1. Electron scattering by molecules. II - Experimental methods and data

    NASA Technical Reports Server (NTRS)

    Trajmar, S.; Chutjian, A.; Register, D. F.

    1983-01-01

    Experimental techniques for measuring electron-molecule collision cross sections are briefly summarized. A survey of the available experimental cross section data is presented. The emphasis here is on elastic scattering, rotational, vibrational and electronic excitations, total electron scattering, and momentum transfer in the few eV to few hundred eV impact energy range. Reference is made to works concerned with high energy electron scattering, innershell and multi-electron excitations, conicidence methods and electron scattering in laser fields.

  2. Electron-molecule scattering in a strong laser field: Two-center interference effects

    NASA Astrophysics Data System (ADS)

    Dakić, J.; Habibović, D.; Čerkić, A.; Busuladžić, M.; Milošević, D. B.

    2017-10-01

    Laser-assisted scattering of electrons on diatomic molecules is considered using the S -matrix theory within the second Born approximation. The first term of the expansion in powers of the scattering potential corresponds to the direct or single laser-assisted scattering of electrons on molecular targets, while the second term of this expansion corresponds to the laser-assisted rescattering or double scattering. The rescattered electrons may have considerably higher energies in the final state than those that scattered only once. For multicenter polyatomic molecules scattering and rescattering may happen at any center and in any order. All these cases contribute to the scattering amplitude and the interference of different contributions leads to an increase or a decrease of the differential cross section in particular electron energy regions. For diatomic molecules there are two such contributions for single scattering and four contributions for double scattering. Analyzing the spectra of the scattered electrons, we find two interesting effects. For certain molecular orientations, the plateaus in the electron energy spectrum, characteristic of laser-assisted electron-atom scattering, are replaced by a sequence of gradually declining maxima, caused by the two-center interference effects. The second effect is the appearance of symmetric U -shaped structures in the angle-resolved energy spectra, which are described very well by the analytical formulas we provide.

  3. The interaction of low-energy electrons with fructose molecules

    NASA Astrophysics Data System (ADS)

    Chernyshova, I. V.; Kontrosh, E. E.; Markush, P. P.; Shpenik, O. B.

    2017-11-01

    Using a hypocycloidal electronic spectrometer, the interactions of low energy electrons (0-8.50 eV) with fructose molecules, namely, electron scattering and dissociative attachment, are studied. The results of these studies showed that the fragmentation of fructose molecules occurs effectively even at an electron energy close to zero. In the total electron-scattering cross section by molecules, resonance features (at energies 3.10 and 5.00 eV) were first observed near the formation thresholds of light ion fragments OH- and H-. The correlation of the features observed in the cross sections of electron scattering and dissociative attachment is analyzed.

  4. Ionic scattering factors of atoms that compose biological molecules

    PubMed Central

    Matsuoka, Rei; Yamashita, Yoshiki; Yamane, Tsutomu; Kidera, Akinori; Maki-Yonekura, Saori

    2018-01-01

    Ionic scattering factors of atoms that compose biological molecules have been computed by the multi-configuration Dirac–Fock method. These ions are chemically unstable and their scattering factors had not been reported except for O−. Yet these factors are required for the estimation of partial charges in protein molecules and nucleic acids. The electron scattering factors of these ions are particularly important as the electron scattering curves vary considerably between neutral and charged atoms in the spatial-resolution range explored in structural biology. The calculated X-ray and electron scattering factors have then been parameterized for the major scattering curve models used in X-ray and electron protein crystallography and single-particle cryo-EM. The X-ray and electron scattering factors and the fitting parameters are presented for future reference. PMID:29755750

  5. Complete solution of electronic excitation and ionization in electron-hydrogen molecule scattering

    DOE PAGES

    Zammit, Mark C.; Savage, Jeremy S.; Fursa, Dmitry V.; ...

    2016-06-08

    The convergent close-coupling method has been used to solve the electron-hydrogen molecule scattering problem in the fixed-nuclei approximation. Excellent agreement with experiment is found for the grand total, elastic, electronic-excitation, and total ionization cross sections from the very low to the very high energies. This shows that for the electronic degrees of freedom the method provides a complete treatment of electron scattering on molecules as it does for atoms.

  6. A method to obtain static potential for electron-molecule scattering

    NASA Astrophysics Data System (ADS)

    Srivastava, Rajesh; Das, Tapasi; Stauffer, Allan

    2014-05-01

    Electron scattering from molecules is complicated by the fact that molecules are a multi-centered target with the nuclei of the constituent atoms being a center of charge. One of the most important parts of a scattering calculation is to obtain the static potential which represents the interaction of the incident electron with the unperturbed charge distribution of the molecule. A common way to represent the charge distribution of molecules is with Gaussian orbitals centered on the various nuclei. We have derived a way to calculate spherically-averaged molecular static potentials using this form of molecular wave function which is mostly analytic. This method has been applied to elastic electron scattering from water molecules and we obtained differential cross sections which are compared with previous experimental and theoretical results. The method can be extended to more complex molecules. One of us (RS) is thankful to IAEA, Vienna, Austria and DAE-BRNS, Mumbai, India for financial support.

  7. Electron- and positron-molecule scattering: development of the molecular convergent close-coupling method

    NASA Astrophysics Data System (ADS)

    Zammit, Mark C.; Fursa, Dmitry V.; Savage, Jeremy S.; Bray, Igor

    2017-06-01

    Starting from first principles, this tutorial describes the development of the adiabatic-nuclei convergent close-coupling (CCC) method and its application to electron and (single-centre) positron scattering from diatomic molecules. We give full details of the single-centre expansion CCC method, namely the formulation of the molecular target structure; solving the momentum-space coupled-channel Lippmann-Schwinger equation; deriving adiabatic-nuclei cross sections and calculating V-matrix elements. Selected results are presented for electron and positron scattering from molecular hydrogen H2 and electron scattering from the vibrationally excited molecular hydrogen ion {{{H}}}2+ and its isotopologues (D2 +, {{{T}}}2+, HD+, HT+ and TD+). Convergence in both the close-coupling (target state) and projectile partial-wave expansions of fixed-nuclei electron- and positron-molecule scattering calculations is demonstrated over a broad energy-range and discussed in detail. In general, the CCC results are in good agreement with experiments.

  8. Nanowire electron scattering spectroscopy

    NASA Technical Reports Server (NTRS)

    Hunt, Brian D. (Inventor); Bronikowski, Michael (Inventor); Wong, Eric W. (Inventor); von Allmen, Paul (Inventor); Oyafuso, Fabiano A. (Inventor)

    2009-01-01

    Methods and devices for spectroscopic identification of molecules using nanoscale wires are disclosed. According to one of the methods, nanoscale wires are provided, electrons are injected into the nanoscale wire; and inelastic electron scattering is measured via excitation of low-lying vibrational energy levels of molecules bound to the nanoscale wire.

  9. Electron-impact excitation of the low-lying electronic states of HCN

    NASA Technical Reports Server (NTRS)

    Chutjian, A.; Tanaka, H.; Srivastava, S. K.; Wicke, B. G.

    1977-01-01

    The first study of the low-energy electron-impact excitation of low-lying electronic transitions in the HCN molecule is reported. Measurements were made at incident electron energies of 11.6 and 21.6 eV in the energy-loss range of 3-10 eV, and at scattering angles of 20-130 deg. Inelastic scattering spectra were placed on the absolute cross-section scale by determining first the ratio of inelastic-to-elastic scattering cross sections, and then separately measuring the absolute elastic scattering cross section. Several new electronic transitions are observed which are intrinsically overlapped in the molecule itself. Assignments of these electronic transitions are suggested. These assignments are based on present spectroscopic and cross-sections measurements, high-energy electron scattering spectra, optical absorption spectra, and ab initio molecular orbital calculations.

  10. Two-potential approach for electron-molecular collisions at intermediate and high energies - Application to e-N2 scatterings

    NASA Technical Reports Server (NTRS)

    Choi, B. H.; Poe, R. T.; Sun, J. C.; Shan, Y.

    1979-01-01

    A general theoretical approach is proposed for the calculation of elastic, vibrational, and rotational transitions for electron-molecule scattering at intermediate and high-electron-impact energies. In this formulation, contributions to the scattering process come from the incoherent sum of two dominant potentials: a short-range shielded nuclear Coulomb potential from individual atomic centers, and a permanent/induced long-range potential. Application to e-N2 scattering from 50-500 eV incident electron energies has yielded good agreement with absolutely calibrated experiments. Comparisons with other theoretical approaches are made. The physical picture as well as the general features of electron-molecule scattering process are discussed within the framework of the two-potential approach.

  11. UKRmol: a low-energy electron- and positron-molecule scattering suite

    NASA Astrophysics Data System (ADS)

    Carr, J. M.; Galiatsatos, P. G.; Gorfinkiel, J. D.; Harvey, A. G.; Lysaght, M. A.; Madden, D.; Mašín, Z.; Plummer, M.; Tennyson, J.; Varambhia, H. N.

    2012-03-01

    We describe the UK computational implementation of the R-matrix method for the treatment of electron and positron scattering from molecules. Recent developments in the UKRmol suite are detailed together with the collision processes it is enabling us to treat.

  12. Electron and positron scattering from CF 3I molecules below 600 eV: a comparison with CF 3H

    NASA Astrophysics Data System (ADS)

    Kawada, Michihito K.; Sueoka, Osamu; Kimura, Mineo

    2000-11-01

    The total cross-sections (TCSs) for electron and positron scattering from CF 3I molecules have been studied experimentally. A theoretical analysis based on the continuum multiple-scattering (CMS) method has been performed to understand the origin of resonances and the elastic cross-sections. The present TCS for electron scattering is found to be larger by about 20% than that of T. Underwood-Lemons, D.C. Winkler, J.A. Tossel, J.H. Moore [J. Chem. Phys. 100 (1994) 9117] although the general shape agrees well in the entire energy studied. The difference in the cross-sections for CF 3I and CF 3H is explained by the sizes and the dipole moments of these molecules.

  13. Electron– and positron–molecule scattering: development of the molecular convergent close-coupling method

    DOE PAGES

    Zammit, Mark C.; Fursa, Dmitry V.; Savage, Jeremy S.; ...

    2017-05-22

    Starting from first principles, this tutorial describes the development of the adiabatic-nuclei convergent close-coupling (CCC) method and its application to electron and (single-centre) positron scattering from diatomic molecules. In this paper, we give full details of the single-centre expansion CCC method, namely the formulation of the molecular target structure; solving the momentum-space coupled-channel Lippmann-Schwinger equation; deriving adiabatic-nuclei cross sections and calculatingmore » $V$-matrix elements. Selected results are presented for electron and positron scattering from molecular hydrogen H$$_2$$ and electron scattering from the vibrationally excited molecular hydrogen ion H$$_2^+$$ and its isotopologues (D$$_2^+$$, T$$_2^+$$, HD$^+$, HT$^+$ and TD$^+$). Finally, convergence in both the close-coupling (target state) and projectile partial-wave expansions of fixed-nuclei electron- and positron-molecule scattering calculations is demonstrated over a broad energy-range and discussed in detail. In general the CCC results are in good agreement with experiments.« less

  14. Born Hartree Bethe approximation in the theory of inelastic electron molecule scattering

    NASA Astrophysics Data System (ADS)

    Kretinin, I. Yu; Krisilov, A. V.; Zon, B. A.

    2008-11-01

    We propose a new approximation in the theory of inelastic electron atom and electron molecule scattering. Taking into account the completeness property of atomic and molecular wavefunctions, considered in the Hartree approximation, and using Bethe's parametrization for electronic excitations during inelastic collisions via the mean excitation energy, we show that the calculation of the inelastic total integral cross-sections (TICS), in the framework of the first Born approximation, involves only the ground-state wavefunction. The final analytical formula obtained for the TICS, i.e. for the sum of elastic and inelastic ones, contains no adjusting parameters. Calculated TICS for electron scattering by light atoms and molecules (He, Ne, and H2) are in good agreement within the experimental data; results show asymptotic coincidence for heavier ones (Ar, Kr, Xe and N2).

  15. Nanowire Electron Scattering Spectroscopy

    NASA Technical Reports Server (NTRS)

    Hunt, Brian; Bronikowsky, Michael; Wong, Eric; VonAllmen, Paul; Oyafuso, Fablano

    2009-01-01

    Nanowire electron scattering spectroscopy (NESS) has been proposed as the basis of a class of ultra-small, ultralow-power sensors that could be used to detect and identify chemical compounds present in extremely small quantities. State-of-the-art nanowire chemical sensors have already been demonstrated to be capable of detecting a variety of compounds in femtomolar quantities. However, to date, chemically specific sensing of molecules using these sensors has required the use of chemically functionalized nanowires with receptors tailored to individual molecules of interest. While potentially effective, this functionalization requires labor-intensive treatment of many nanowires to sense a broad spectrum of molecules. In contrast, NESS would eliminate the need for chemical functionalization of nanowires and would enable the use of the same sensor to detect and identify multiple compounds. NESS is analogous to Raman spectroscopy, the main difference being that in NESS, one would utilize inelastic scattering of electrons instead of photons to determine molecular vibrational energy levels. More specifically, in NESS, one would exploit inelastic scattering of electrons by low-lying vibrational quantum states of molecules attached to a nanowire or nanotube.

  16. The vibrational excitation of hot molecules by low energy electron impact

    NASA Astrophysics Data System (ADS)

    Kato, H.; Ohkawa, M.; Hoshino, M.; Campbell, L.; Brunger, M. J.; Tanaka, H.

    2010-01-01

    We report vibrational excitation functions and angular distributions for electron scattering from the ground vibrational quantum (000), the bending vibrational quantum (010) and the unresolved first bending overtone (020) and symmetric stretch (100) modes of the ground-electronic state in hot (750 K) carbon dioxide (CO2) molecules. The excitation function measurements were carried out at incident electron energies in the range of 1-9 eV, and at the electron scattering angles of 30°, 60°, 90° and 120°.

  17. Positronium collisions with molecular nitrogen

    NASA Astrophysics Data System (ADS)

    Wilde, R. S.; Fabrikant, I. I.

    2018-05-01

    For many atomic and molecular targets positronium (Ps) scattering looks very similar to electron scattering if total scattering cross sections are plotted as functions of the projectile velocity. Recently this similarity was observed for the resonant scattering by the N2 molecule. For correct treatment of Ps-molecule scattering incorporation of the exchange interaction and short-range correlations is of paramount importance. In the present work we have used a free-electron-gas model to describe these interactions in collisions of Ps with the N2 molecule. The results agree reasonably well with the experiment, but the position of the resonance is somewhat shifted towards lower energies, probably due to the fixed-nuclei approximation employed in the calculations. The partial-wave analysis of the resonant peak shows that its composition is more complex than in the case of e -N2 scattering.

  18. LETTER TO THE EDITOR: Differential electron scattering from the (010) excited vibrational mode of N2O

    NASA Astrophysics Data System (ADS)

    Akther, P.; Johnstone, W. M.; El-Zein, A. A. A.; Campbell, L.; Teubner, P. J. O.; Brunger, M. J.; Newell, W. R.

    2002-11-01

    In this letter we report differential superelastic, elastic and inelastic electron scattering measurements from nitrous oxide (N2O) in its (010)* excited vibrational quantum. The incident electron energy was 2.5 eV and the scattered electron angular range was 10°- 40°. Unlike our previous results (1999 J. Phys. B: At. Mol. Opt. Phys. 32 5779) with the isoelectronic molecule carbon dioxide (CO2), where the elastic differential cross sections (DCSs) for scattering from the (010)* mode were 2.3 times larger than those for elastic scattering from the ground (000) state, in N2O the corresponding (010)* elastic cross sections are usually only a fraction of those for the ground state. To the best of our knowledge, the present data are the first DCSs which have been reported in the literature for electron scattering from an excited vibrational level of the N2O molecule.

  19. Theory of raman scattering from molecules adsorbed at semiconductor surfaces

    NASA Astrophysics Data System (ADS)

    Ueba, H.

    1983-09-01

    A theory is presented to calculate the Raman polarizability of an adsorbed molecule at a semiconductor surface, where the electronic excitation in the molecular site interacts with excitons (elementary excitations in the semiconductor) through non-radiative energy transfer between them, in an intermediate state in the Raman scattering process. The Raman polarizability thus calculated is found to exhibit a peak at the energy corresponding to a resonant excitation of excitons, thereby suggesting the possibility of surface enhanced Raman scattering on semiconductor surfaces. The mechanism studied here can also give an explanation of a recent observation of the Raman excitation profiles of p-NDMA and p-DMAAB adsorbed on ZnO or TiO 2, where those profiles were best described by assuming a resonant intermediate state of the exciton transition in the semiconductors. It is also demonstrated that in addition to vibrational Raman scattering, excitonic Raman scattering of adsorbed molecules will occur in the coupled molecule-semiconductor system, where the molecular returns to its ground electronic state by leaving an exciton in the semiconductor. A spectrum of the excitonic Raman scattering is expected to appear in the background of the vibrational Raman band and to be characterized by the electronic structure of excitons. A desirable experiment is suggested for an examination of the theory.

  20. Low energy electron-molecule scattering using the R-matrix method

    NASA Astrophysics Data System (ADS)

    Gorfinkiel, Jimena

    2014-10-01

    The study of electron-molecule collisions continues to attract significant interest stimulated, in no small part, by the need for collisional data to model a number of physical environments and applied processes (e.g. the modelling of focused electron beam induced deposition and the description of the interaction of radiation with biological matter). This need for electron scattering data (cross sections but also information on the temporary negative ions, TNI, that can be formed) has motivated the renewed development of theoretical methodology and their computational implementation. I will present the latest developments in the study of low energy electron scattering from molecules and molecular clusters using the R-matrix method. Recent calculations on electron collisions with biologically relevant molecules have shed light on the formation of core-excited TNI these larger targets. The picture that emerges is much more complex than previously thought. I will discuss some examples as well as current and future developments of the methodology and software in order to provide more accurate collisional data (in particular cross sections) for bigger targets. In collaboration with Zdenek Masin, The Open University. This work was partially supported by EPSRC.

  1. Huygens-Fresnel picture for electron-molecule elastic scattering★

    NASA Astrophysics Data System (ADS)

    Baltenkov, Arkadiy S.; Msezane, Alfred Z.

    2017-11-01

    The elastic scattering cross sections for a slow electron by C2 and H2 molecules have been calculated within the framework of the non-overlapping atomic potential model. For the amplitudes of the multiple electron scattering by a target the wave function of the molecular continuum is represented as a combination of a plane wave and two spherical waves generated by the centers of atomic spheres. This wave function obeys the Huygens-Fresnel principle according to which the electron wave scattering by a system of two centers is accompanied by generation of two spherical waves; their interaction creates a diffraction pattern far from the target. Each of the Huygens waves, in turn, is a superposition of the partial spherical waves with different orbital angular momenta l and their projections m. The amplitudes of these partial waves are defined by the corresponding phases of electron elastic scattering by an isolated atomic potential. In numerical calculations the s- and p-phase shifts are taken into account. So the number of interfering electron waves is equal to eight: two of which are the s-type waves and the remaining six waves are of the p-type with different m values. The calculation of the scattering amplitudes in closed form (rather than in the form of S-matrix expansion) is reduced to solving a system of eight inhomogeneous algebraic equations. The differential and total cross sections of electron scattering by fixed-in-space molecules and randomly oriented ones have been calculated as well. We conclude by discussing the special features of the S-matrix method for the case of arbitrary non-spherical potentials. Contribution to the Topical Issue "Low energy positron and electron interactions", edited by James Sullivan, Ron White, Michael Bromley, Ilya Fabrikant, and David Cassidy.

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zammit, Mark C.; Fursa, Dmitry V.; Savage, Jeremy S.

    Starting from first principles, this tutorial describes the development of the adiabatic-nuclei convergent close-coupling (CCC) method and its application to electron and (single-centre) positron scattering from diatomic molecules. In this paper, we give full details of the single-centre expansion CCC method, namely the formulation of the molecular target structure; solving the momentum-space coupled-channel Lippmann-Schwinger equation; deriving adiabatic-nuclei cross sections and calculatingmore » $V$-matrix elements. Selected results are presented for electron and positron scattering from molecular hydrogen H$$_2$$ and electron scattering from the vibrationally excited molecular hydrogen ion H$$_2^+$$ and its isotopologues (D$$_2^+$$, T$$_2^+$$, HD$^+$, HT$^+$ and TD$^+$). Finally, convergence in both the close-coupling (target state) and projectile partial-wave expansions of fixed-nuclei electron- and positron-molecule scattering calculations is demonstrated over a broad energy-range and discussed in detail. In general the CCC results are in good agreement with experiments.« less

  3. Scaled plane-wave Born cross sections for atoms and molecules

    NASA Astrophysics Data System (ADS)

    Tanaka, H.; Brunger, M. J.; Campbell, L.; Kato, H.; Hoshino, M.; Rau, A. R. P.

    2016-04-01

    Integral cross sections for optically allowed electronic-state excitations of atoms and molecules by electron impact, by applying scaled plane-wave Born models, are reviewed. Over 40 years ago, Inokuti presented an influential review of charged-particle scattering, based on the theory pioneered by Bethe forty years earlier, which emphasized the importance of reliable cross-section data from low eV energies to high keV energies that are needed in many areas of radiation science with applications to astronomy, plasmas, and medicine. Yet, with a couple of possible exceptions, most computational methods in electron-atom scattering do not, in general, overlap each other's validity range in the region from threshold up to 300 eV and, in particular, in the intermediate region from 30 to 300 eV. This is even more so for electron-molecule scattering. In fact this entire energy range is of great importance and, to bridge the gap between the two regions of low and high energy, scaled plane-wave Born models were developed to provide reliable, comprehensive, and absolute integral cross sections, first for ionization by Kim and Rudd and then extended to optically allowed electronic-state excitation by Kim. These and other scaling models in a broad, general application to electron scattering from atoms and molecules, their theoretical basis, and their results for cross sections along with comparison to experimental measurements are reviewed. Where possible, these data are also compared to results from other computational approaches.

  4. SRS in the single molecule limit (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Potma, Eric O.; Crampton, Kevin T.; Fast, Alexander; Apkarian, Vartkess A.

    2017-02-01

    We present combined surface-enhanced stimulated Raman scattering (SE-SRS) and surface-enhanced coherent anti-Stokes Raman scattering (SE-CARS) measurements on individual plasmonic antennas dressed with bipyridyl-ethylene molecules. By carefully optimizing the conditions for performing SE-SRS experiments, we have obtained stable and reproducible molecular surface-enhanced SRS spectra from single nano-antennas. Using surface-enhanced Raman scattering (SERS) and transmission electron microscopy of the same antennas, we confirm that the observed SE-SRS signals originate from only one or a few molecules. We highlight the physics of surface enhancement in the context of coherent Raman scattering and derive sensitivity parameters under the relevant conditions. The implications of single molecule SRS measurements are discussed.

  5. Solid harmonic wavelet scattering for predictions of molecule properties

    NASA Astrophysics Data System (ADS)

    Eickenberg, Michael; Exarchakis, Georgios; Hirn, Matthew; Mallat, Stéphane; Thiry, Louis

    2018-06-01

    We present a machine learning algorithm for the prediction of molecule properties inspired by ideas from density functional theory (DFT). Using Gaussian-type orbital functions, we create surrogate electronic densities of the molecule from which we compute invariant "solid harmonic scattering coefficients" that account for different types of interactions at different scales. Multilinear regressions of various physical properties of molecules are computed from these invariant coefficients. Numerical experiments show that these regressions have near state-of-the-art performance, even with relatively few training examples. Predictions over small sets of scattering coefficients can reach a DFT precision while being interpretable.

  6. Cold Rydberg molecules

    NASA Astrophysics Data System (ADS)

    Raithel, Georg

    2017-04-01

    Cold atomic systems have opened new frontiers in atomic and molecular physics, including several types of Rydberg molecules. Three types will be reviewed. Long-range Rydberg-ground molecules, first predicted in and observed in, are formed via low-energy electron scattering of the Rydberg electron from a ground-state atom within the Rydberg atom's volume. The binding mostly arises from S- and P-wave triplet scattering. We use a Fermi model that includes S-wave and P-wave singlet and triplet scattering, the fine structure coupling of the Rydberg atom and the hyperfine structure coupling of the 5S1/2 atom (in rubidium). The hyperfine structure gives rise to mixed singlet-triplet potentials for both low-L and high-L Rydberg molecules. A classification into Hund's cases will be discussed. The talk further includes results on adiabatic potentials and adiabatic states of Rydberg-Rydberg molecules in Rb and Cs. These molecules, which have even larger bonding length than Rydberg-ground molecules, are formed via electrostatic multipole interactions. The leading interaction of neutral Rydberg-Rydberg molecules is dipole-dipole, while for ionic Rydberg molecules it is dipole-monopole. Higher-order terms are discussed. FUNDING: NSF (PHY-1506093), NNSF of China (61475123).

  7. The FEM-R-Matrix Approach: Use of Mixed Finite Element and Gaussian Basis Sets for Electron Molecule Collisions

    NASA Technical Reports Server (NTRS)

    Thuemmel, Helmar T.; Huo, Winifred M.; Langhoff, Stephen R. (Technical Monitor)

    1995-01-01

    For the calculation of electron molecule collision cross sections R-matrix methods automatically take advantage of the division of configuration space into an inner region (I) bounded by radius tau b, where the scattered electron is within the molecular charge cloud and the system is described by an correlated Configuration Interaction (CI) treatment in close analogy to bound state calculations, and an outer region (II) where the scattered electron moves in the long-range multipole potential of the target and efficient analytic methods can be used for solving the asymptotic Schroedinger equation plus boundary conditions.

  8. Plasmon Mapping in Metallic Nanostructures and its Application to Single Molecule Surface Enhanced Raman Scattering: Imaging Electromagnetic Hot-Spots and Analyte Location

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Camden, Jon P.

    2013-07-12

    A major component of this proposal is to elucidate the connection between optical and electron excitation of plasmon modes in metallic nanostructures. These accomplishments are reported: developed a routine protocol for obtaining spatially resolved, low energy EELS spectra, and resonance Rayleigh scattering spectra from the same nanostructures; correlated optical scattering spectra and plasmon maps obtained using STEM/EELS; and imaged electromagnetic hot spots responsible for single-molecule surface-enhanced Raman scattering (SMSERS).

  9. State-to-state time-of-flight measurements of NO scattering from Au(111): direct observation of translation-to-vibration coupling in electronically nonadiabatic energy transfer.

    PubMed

    Golibrzuch, Kai; Shirhatti, Pranav R; Altschäffel, Jan; Rahinov, Igor; Auerbach, Daniel J; Wodtke, Alec M; Bartels, Christof

    2013-09-12

    Translational motion is believed to be a spectator degree of freedom in electronically nonadiabatic vibrational energy transfer between molecules and metal surfaces, but the experimental evidence available to support this view is limited. In this work, we have experimentally determined the translational inelasticity in collisions of NO molecules with a single-crystal Au(111) surface-a system with strong electronic nonadiabaticity. State-to-state molecular beam surface scattering was combined with an IR-UV double resonance scheme to obtain high-resolution time-of-flight data. The measurements include vibrationally elastic collisions (v = 3→3, 2→2) as well as collisions where one or two quanta of molecular vibration are excited (2→3, 2→4) or de-excited (2→1, 3→2, 3→1). In addition, we have carried out comprehensive measurements of the effects of rotational excitation on the translational energy of the scattered molecules. We find that under all conditions of this work, the NO molecules lose a large fraction (∼0.45) of their incidence translational energy to the surface. Those molecules that undergo vibrational excitation (relaxation) during the collision recoil slightly slower (faster) than vibrationally elastically scattered molecules. The amount of translational energy change depends on the surface temperature. The translation-to-rotation coupling, which is well-known for v = 0→0 collisions, is found to be significantly weaker for vibrationally inelastic than elastic channels. Our results clearly show that the spectator view of the translational motion in electronically nonadiabatic vibrational energy transfer between NO and Au(111) is only approximately correct.

  10. The electron-spin--nuclear-spin interaction studied by polarized neutron scattering.

    PubMed

    Stuhrmann, Heinrich B

    2007-11-01

    Dynamic nuclear spin polarization (DNP) is mediated by the dipolar interaction of paramagnetic centres with nuclear spins. This process is most likely to occur near paramagnetic centres at an angle close to 45 degrees with respect to the direction of the external magnetic field. The resulting distribution of polarized nuclear spins leads to an anisotropy of the polarized neutron scattering pattern, even with randomly oriented radical molecules. The corresponding cross section of polarized coherent neutron scattering in terms of a multipole expansion is derived for radical molecules in solution. An application using data of time-resolved polarized neutron scattering from an organic chromium(V) molecule is tested.

  11. Cold Rydberg molecules

    NASA Astrophysics Data System (ADS)

    Raithel, Georg; Zhao, Jianming

    2017-04-01

    Cold atomic systems have opened new frontiers at the interface of atomic and molecular physics. These include research on novel types of Rydberg molecules. Three types of molecules will be reviewed. Long-range, homonuclear Rydberg molecules, first predicted in [1] and observed in [2], are formed via low-energy electron scattering of the Rydberg electron from a ground-state atom within the Rydberg atom's volume. The binding mostly arises from S- and P-wave triplet scattering. We use a Fermi model that includes S-wave and P-wave singlet and triplet scattering, the fine structure coupling of the Rydberg atom and the hyperfine structure coupling of the 5S1/2 atom (in rubidium [3]). The hyperfine structure gives rise to mixed singlet-triplet potentials for both low-L and high-L Rydberg molecules [3]. A classification into Hund's cases [3, 4, 5] will be discussed. The talk further includes results on adiabatic potentials and adiabatic states of Rydberg-Rydberg molecules in Rb and Cs. These molecules, which have even larger bonding length than Rydberg-ground molecules, are formed via electrostatic multipole interactions. The leading interaction term of neutral Rydberg-Rydberg molecules is between two dipoles, while for ionic Rydberg molecules it is between a dipole and a monopole. NSF (PHY-1506093), NNSF of China (61475123).

  12. Advances in positron and electron scattering*

    NASA Astrophysics Data System (ADS)

    Limão-Vieira, Paulo; García, Gustavo; Krishnakumar, E.; Petrović, Zoran; Sullivan, James; Tanuma, Hajime

    2016-10-01

    The topical issue on Advances in Positron and Electron Scattering" combines contributions from POSMOL 2015 together with others devoted to celebrate the unprecedented scientific careers of our loyal colleagues and trusted friends Steve Buckman (Australian National University, Australia) and Michael Allan (University of Fribourg, Switzerland) on the occasion of their retirements. POSMOL 2015, the XVIII International Workshop on Low-Energy Positron and Positronium Physics and the XIX International Symposium on Electron-Molecule Collisions and Swarms, was held at Universidade NOVA de Lisboa, Lisboa, Portugal, from 17-20 July 2015. The international workshop and symposium allowed to achieve a very privileged forum of sharing and developing our scientific expertise on current aspects of positron, positronium and antiproton interactions with electrons, atoms, molecules and solid surfaces, and related topics, as well as electron interactions with molecules in both gaseous and condensed phases. Particular topics include studies of electron interactions with biomolecules, electron induced surface chemistry and the study of plasma processes. Recent developments in the study of swarms are also fully addressed.

  13. Electron scattering by highly polar molecules. III - CsCl

    NASA Technical Reports Server (NTRS)

    Vuskovic, L.; Srivastava, S. K.

    1981-01-01

    Utilizing a crossed electron-beam-molecular-beam scattering geometry, relative values of differential electron scattering cross sections for cesium chloride at 5 and 20 eV electron impact energies and at scattering angles between 10 and 120 deg have been measured. These relative cross sections have been normalized to the cross section at 15 deg scattering angle calculated by the hybrid S-matrix technique. In the angular range between 0 and 10 deg and between 120 and 180 deg extrapolations have been made to obtain integral and momentum transfer cross sections. An energy-loss spectrum is also presented which gives various spectral features lying between the 4 and 10 eV regions in CsCl.

  14. Positronium collisions with atoms and molecules

    NASA Astrophysics Data System (ADS)

    Fabrikant, I. I.; Gribakin, G. F.; Wilde, R. S.

    2017-11-01

    We review recent theoretical efforts to explain observed similarities between electron-atom and positronium(Ps)-atom scattering which also extends to molecular targets. In the range of the projectile velocities above the threshold for Ps ionization (break-up) this similarity can be explained in terms of quasi-free electron scattering and impulse approximation. However, for lower Ps velocities more sophisticated methods should be developed. Our calculations of Ps scattering by heavy noble-gas atoms agree well with experiments at Ps velocities above the Ps ionization threshold. However, in contrast to electron scattering cross sections, at lower velocities they exhibit maxima whereas the experimental cross sections tend to decrease toward lower velocities indicating the same similarity with electron scattering cross section observed above the threshold. Our preliminary results for Ps-N2 scattering confirm experimental observation of a resonance similar to the ∏ g resonance in electron-N2 scattering.

  15. Electron transport property of tetrathiafulvalene molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mondal, Rajkumar; Bhattacharya, Barnali; Deb, Jyotirmoy

    2016-05-23

    We have investigated electron transport behavior of tetrathiafulvalene molecule connected with zigzag graphene nanoribbon (zGNR) using density functional theory combined with non-equilibrium Green’s function method. We have reported the transmission coefficient of the scattering region at different bias voltage to explain the nature of the current.

  16. Theoretical Calculations for Electron Impact Ionization of Atoms and Molecules

    NASA Astrophysics Data System (ADS)

    Amami, Sadek Mohamed Fituri

    In the last twenty years, significant progress has been made for the theoretical treatment of electron impact ionization (e,2e) of atoms and molecules and, for some cases, very nice agreement between experiment and theory has been achieved. In particular, excellent agreement between theory and experiment and theory has been achieved for ionization of hydrogen and helium. However, agreement between experiment and theory is not nearly as good for ionization of larger atoms and molecules. In the first part of this dissertation, different theoretical approaches will be employed to study the triply differential cross section (TDCS) for low and intermediate energy electron-impact ionization of Neon and Argon for different orbital states. There is a very recent interest in studying ionization of Laser aligned atoms in order to get a better understanding about electron impact ionization of molecules. In the next part of this dissertation, results will be presented for electron-impact ionization of three laser aligned atoms, Mg, Ca, and Na. The comparison between the theory and experiment showed that our three body distorted wave (3DW) model gave excellent agreement with experiment in the scattering plane but very poor agreement perpendicular to the scattering plane. An explanation for this poor agreement out of the scattering plane has been provided by comparing our theoretical results with those of the time depended close coupling (TDCC) model and this explanation is also provided in this dissertation. Recently, significant attention has been directed towards obtaining a better under-standing of electron-impact ionization of molecules which are significantly more challenging than atoms. In the last part of this dissertation, results will be presented for electron-impact ionization of three different molecules (N2 , H2O, and CH4) which have been studied comprehensively using different theoretical approximations for different types of geometries. The published papers in section two contain a detailed analysis and discussion for each of these topics.

  17. Absolute cross section measurements for the scattering of low- and intermediate-energy electrons from PF3. I. Elastic scattering

    NASA Astrophysics Data System (ADS)

    Hishiyama, N.; Hoshino, M.; Blanco, F.; García, G.; Tanaka, H.

    2017-12-01

    We report absolute elastic differential cross sections (DCSs) for electron collisions with phosphorus trifluoride, PF3, molecules (e- + PF3) in the impact energy range of 2.0-200 eV and over a scattering angle range of 10°-150°. Measured angular distributions of scattered electron intensities were normalized by reference to the elastic DCSs of He. Corresponding integral and momentum-transfer cross sections were derived by extrapolating the angular range from 0° to 180° with the help of a modified phase-shift analysis. In addition, due to the large dipole moment of the considered molecule, the dipole-Born correction for the forward scattering angles has also been applied. As a part of this study, independent atom model calculations in combination with screening corrected additivity rule were also performed for elastic and inelastic (electronic excitation plus ionization) scattering using a complex optical potential method. Rotational excitation cross sections have been estimated with a dipole-Born approximation procedure. Vibrational excitations are not considered in this calculation. Theoretical data, at the differential and integral levels, were found to reasonably agree with the present experimental results. Furthermore, we explore the systematics of the elastic DCSs for the four-atomic trifluoride molecules of XF3 (X = B, N, and P) and central P-atom in PF3, showing that, owing to the comparatively small effect of the F-atoms, the present angular distributions of elastic DCSs are essentially dominated by the characteristic of the central P-atom at lower impact energies. Finally, these quantitative results for e- - PF3 collisions were compiled together with the previous data available in the literature in order to obtain a cross section dataset for modeling purposes. To comprehensively describe such a considerable amount of data, we proceed by first discussing, in this paper, the vibrationally elastic scattering processes whereas vibrational and electronic excitation shall be the subject of our following paper devoted to inelastic collisions.

  18. Overset grid implementation of the complex Kohn variational method for electron-polyatomic molecule scattering

    NASA Astrophysics Data System (ADS)

    McCurdy, C. William; Lucchese, Robert L.; Greenman, Loren

    2017-04-01

    The complex Kohn variational method, which represents the continuum wave function in each channel using a combination of Gaussians and Bessel or Coulomb functions, has been successful in numerous applications to electron-polyatomic molecule scattering and molecular photoionization. The hybrid basis representation limits it to relatively low energies (< 50 eV) , requires an approximation to exchange matrix elements involving continuum functions, and hampers its coupling to modern electronic structure codes for the description of correlated target states. We describe a successful implementation of the method using completely adaptive overset grids to describe continuum functions, in which spherical subgrids are placed on every atomic center to complement a spherical master grid that describes the behavior at large distances. An accurate method for applying the free-particle Green's function on the grid eliminates the need to operate explicitly with the kinetic energy, enabling a rapidly convergent Arnoldi algorithm for solving linear equations on the grid, and no approximations to exchange operators are made. Results for electron scattering from several polyatomic molecules will be presented. Army Research Office, MURI, WN911NF-14-1-0383 and U. S. DOE DE-SC0012198 (at Texas A&M).

  19. On the role of electronic friction for dissociative adsorption and scattering of hydrogen molecules at a Ru(0001) surface.

    PubMed

    Füchsel, Gernot; Schimka, Selina; Saalfrank, Peter

    2013-09-12

    The role of electronic friction and, more generally, of nonadiabatic effects during dynamical processes at the gas/metal surface interface is still a matter of discussion. In particular, it is not clear if electronic nonadiabaticity has an effect under "mild" conditions, when molecules in low rovibrational states interact with a metal surface. In this paper, we investigate the role of electronic friction on the dissociative sticking and (inelastic) scattering of vibrationally and rotationally cold H2 molecules at a Ru(0001) surface theoretically. For this purpose, classical molecular dynamics with electronic friction (MDEF) calculations are performed and compared to MD simulations without friction. The two H atoms move on a six-dimensional potential energy surface generated from gradient-corrected density functional theory (DFT), that is, all molecular degrees of freedom are accounted for. Electronic friction is included via atomic friction coefficients obtained from an embedded atom, free electron gas (FEG) model, with embedding densities taken from gradient-corrected DFT. We find that within this model, dissociative sticking probabilities as a function of impact kinetic energies and impact angles are hardly affected by nonadiabatic effects. If one accounts for a possibly enhanced electronic friction near the dissociation barrier, on the other hand, reduced sticking probabilities are observed, in particular, at high impact energies. Further, there is always an influence on inelastic scattering, in particular, as far as the translational and internal energy distribution of the reflected molecules is concerned. Additionally, our results shed light on the role played by the velocity distribution of the incident molecular beam for adsorption probabilities, where, in particular, at higher impact energies, large effects are found.

  20. Exact Time-Dependent Exchange-Correlation Potential in Electron Scattering Processes

    NASA Astrophysics Data System (ADS)

    Suzuki, Yasumitsu; Lacombe, Lionel; Watanabe, Kazuyuki; Maitra, Neepa T.

    2017-12-01

    We identify peak and valley structures in the exact exchange-correlation potential of time-dependent density functional theory that are crucial for time-resolved electron scattering in a model one-dimensional system. These structures are completely missed by adiabatic approximations that, consequently, significantly underestimate the scattering probability. A recently proposed nonadiabatic approximation is shown to correctly capture the approach of the electron to the target when the initial Kohn-Sham state is chosen judiciously, and it is more accurate than standard adiabatic functionals but ultimately fails to accurately capture reflection. These results may explain the underestimation of scattering probabilities in some recent studies on molecules and surfaces.

  1. Total cross sections for electron scattering by 1-propanol at impact energies in the range 40-500 eV

    NASA Astrophysics Data System (ADS)

    da Silva, D. G. M.; Gomes, M.; Ghosh, S.; Silva, I. F. L.; Pires, W. A. D.; Jones, D. B.; Blanco, F.; Garcia, G.; Buckman, S. J.; Brunger, M. J.; Lopes, M. C. A.

    2017-11-01

    Absolute total cross section (TCS) measurements for electron scattering from 1-propanol molecules are reported for impact energies from 40 to 500 eV. These measurements were obtained using a new apparatus developed at Juiz de Fora Federal University—Brazil, which is based on the measurement of the attenuation of a collimated electron beam through a gas cell containing the molecules to be studied at a given pressure. Besides these experimental measurements, we have also calculated TCS using the Independent-Atom Model with Screening Corrected Additivity Rule and Interference (IAM-SCAR+I) approach with the level of agreement between them being typically found to be very good.

  2. Electron scattering on molecules: search for semi-empirical indications

    NASA Astrophysics Data System (ADS)

    Fedus, Kamil; Karwasz, Grzegorz P.

    2017-06-01

    Reliable cross-sections for electron-molecule collisions are urgently needed for numerical modeling of various processes important from technological point of view. Unfortunately, a significant progress in theory and experiment over the last decade is not usually accompanied by the convergence of cross-sections measured at different laboratories and calculated with different methods. Moreover the most advanced contemporary theories involve such large basis sets and complicated equations that they are not easily applied to each specific molecule for which data are needed. For these reasons the search for semi-empirical indications in angular and energy dependencies of scattering cross-section becomes important. In this paper we make a brief review of the applicability of the Born-dipole approximation for elastic, rotational, vibrational and ionization processes that can occur during electron-molecule collisions. We take into account the most recent experimental findings as the reference points. Contribution to the Topical Issue "Atomic and Molecular Data and Their Applications", edited by Gordon W.F. Drake, Jung-Sik Yoon, Daiji Kato, and Grzegorz Karwasz.

  3. Electron scattering effects at physisorbed hydrogen molecules on break-junction electrodes and nanowires formation in hydrogen environment

    NASA Astrophysics Data System (ADS)

    van der Maas, M.; Vasnyov, S.; Hendriksen, B. L. M.; Shklyarevskii, O. I.; Speller, S.

    2012-06-01

    Physisorption of hydrogen molecules on the surface of gold and other coinage metals has been studied using distance tunneling spectroscopy. We have observed that the distance dependence of the tunnel current (resistance) displays a strong N-shaped deviation from exponential behavior. Such deviations are difficult to explain within the Tersoff-Hamann approximation. We suggest the scattering of tunneling electrons by H2 molecules as an origin for the observed effect. We have found that this phenomenon is also common for strongly adsorbed organic molecules with a single anchoring group. Pulling Au, Cu and Pt nanowires at 22 K in hydrogen environment shows that the break-junction electrodes are still connected through hydrogen-metal monoatomic chains down to very low conductance values of 10-4-10-6 G0.

  4. Change in resonance parameters of a linear molecule as it bends: Evidence in electron-impact vibrational transitions of hot COS and CO2 molecules*

    NASA Astrophysics Data System (ADS)

    Hoshino, Masamitsu; Ishijima, Yohei; Kato, Hidetoshi; Mogi, Daisuke; Takahashi, Yoshinao; Fukae, Katsuya; Limão-Vieira, Paulo; Tanaka, Hiroshi; Shimamura, Isao

    2016-04-01

    Inelastic and superelastic electron-impact vibrational excitation functions of hot carbonyl sulphide COS (and hot CO2) are measured for electron energies from 0.5 to 3.0 eV (1.5 to 6.0 eV) and at a scattering angle of 90°. Based on the vibrational populations and the principle of detailed balance, these excitation functions are decomposed into contributions from state-to-state vibrational transitions involving up to the second bending overtone (030) in the electronically ground state. Both the 2Π resonance for COS around 1.2 eV and the 2Πu resonance for CO2 around 3.8 eV are shifted to lower energies as the initial vibrational state is excited in the bending mode. The width of the resonance hump for COS changes only little as the molecule bends, whereas that of the overall boomerang resonance for CO2 becomes narrower. The angular distribution of the electrons resonantly scattered by hot COS and hot CO2 is also measured. The different shapes depending on the vibrational transitions and gas temperatures are discussed in terms of the symmetry of the vibrational wave functions. Contribution to the Topical Issue "Advances in Positron and Electron Scattering", edited by Paulo Limao-Vieira, Gustavo Garcia, E. Krishnakumar, James Sullivan, Hajime Tanuma and Zoran Petrovic.

  5. Electron-Molecule Col1isions: Quantitative Approaches, and the Legacy of Aaron Temkin

    NASA Technical Reports Server (NTRS)

    Schneider, B.I.

    2007-01-01

    This article, on electron-molecule collisions, is dedicated to the legacy of my good friend and sometime collaborator, Aaron Temkin on his retirement from the NASA-Goddard Space Flight Center after many years of work at the highest intellectual level in the theoretical treatment of electron-atom and electron-molecule scattering. Aaron's contributions to the manner in which we think about electron-molecule collisions is clear to all of us who have worked in this field. I doubt that the great progress that has occurred in the computational treatment of such complex collision problems could have happened without these contributions. For a brief historical account, see the discussion of Temkin's contribution to electron-molecule scattering in the first article of this volume by Dr. A. K. Bhatia. In this article, I will concentrate on the application of the so called, non-adiabatic R-matrix theory, to vibrational excitation and dissociative attachment, although I will also present some results applying the Linear Algebraic and Kohn-Variational methods to vibrational excitation. As a starting point for almost all computationally effective approaches to electron-molecule collisions, is the fixed nuclei approximation. That is, one recognizes, just as one does with molecular bound states, that there is a separation of electronic(fast) and nuclear(s1ow) degrees of freedom. This separation makes it possible to "freeze" the nuclei in space, calculate the collision parameters for the frozen molecule and then, somehow to add back the vibrations and rotations. The manner in which this is done, depends on the details of the collision problem. It is the work of Aaron and a number of other researchers that has provided the guidance necessary to resolve these issues.

  6. Polarization effects in the elastic scattering of low-energy electrons by XH{sub 4} (X=C, Si, Ge, Sn, Pb)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bettega, M.H.F.; Varella, M.T.N. do; Lima, M.A.P.

    2003-07-01

    We report integral and differential cross sections for elastic scattering of electrons by XH{sub 4} (X=C, Si, Ge, Sn, Pb) molecules for energies between 3 and 10 eV. We use the Schwinger multichannel method with pseudopotentials [Bettega et al., Phys. Rev. A 47, 1111 (1993)] at the static-exchange and static-exchange plus polarization approximations. We compare our results with available theoretical and experimental results and find very good agreement. In particular, our results show Ramsauer-Towsend minima for all XH{sub 4} molecules.

  7. Exciton Scattering approach for conjugated macromolecules: from electronic spectra to electron-phonon coupling

    NASA Astrophysics Data System (ADS)

    Tretiak, Sergei

    2014-03-01

    The exciton scattering (ES) technique is a multiscale approach developed for efficient calculations of excited-state electronic structure and optical spectra in low-dimensional conjugated macromolecules. Within the ES method, the electronic excitations in the molecular structure are attributed to standing waves representing quantum quasi-particles (excitons), which reside on the graph. The exciton propagation on the linear segments is characterized by the exciton dispersion, whereas the exciton scattering on the branching centers is determined by the energy-dependent scattering matrices. Using these ES energetic parameters, the excitation energies are then found by solving a set of generalized ``particle in a box'' problems on the graph that represents the molecule. All parameters can be extracted from quantum-chemical computations of small molecular fragments and tabulated in the ES library for further applications. Subsequently, spectroscopic modeling for any macrostructure within considered molecular family could be performed with negligible numerical effort. The exciton scattering properties of molecular vertices can be further described by tight-binding or equivalently lattice models. The on-site energies and hopping constants are obtained from the exciton dispersion and scattering matrices. Such tight-binding model approach is particularly useful to describe the exciton-phonon coupling, energetic disorder and incoherent energy transfer in large branched conjugated molecules. Overall the ES applications accurately reproduce the optical spectra compared to the reference quantum chemistry results, and make possible to predict spectra of complex macromolecules, where conventional electronic structure calculations are unfeasible.

  8. Electron and positron interaction with pyrimidine: A theoretical investigation

    NASA Astrophysics Data System (ADS)

    Sinha, Nidhi; Antony, Bobby

    2018-03-01

    Pyrimidine (C4H4N2) is considered as the building block of nucleobases, viz., cytosine, thymine and uracil. They provide a blueprint for probing the scattering of radiation by DNA and RNA bases. In this article, we report the elastic and total scattering cross-sections for electron and positron scattering from the pyrimidine molecule, employing a spherical complex optical potential (SCOP) formalism for an extensive energy range of 10 eV to 5 keV. In the case of positron scattering, the original SCOP formalism is modified to adequately solve the positron-target dynamics. Moreover, a reasonable agreement is observed between the present results and other available datasets, for both electron and positron scattering. The cross-sections for electron and positron impact scattering by pyrimidine are necessary input data for codes that seek to simulate radiation damage, and hence are useful to model biomolecular systems.

  9. Quantum Tunneling of Water in Beryl. A New State of the Water Molecule

    DOE PAGES

    Kolesnikov, Alexander I.; Reiter, George F.; Choudhury, Narayani; ...

    2016-04-22

    When using neutron scattering and ab initio simulations, we document the discovery of a new “quantum tunneling state” of the water molecule confined in 5 Å channels in the mineral beryl, characterized by extended proton and electron delocalization. We observed a number of peaks in the inelastic neutron scattering spectra that were uniquely assigned to water quantum tunneling. Additionally, the water proton momentum distribution was measured with deep inelastic neutron scattering, which directly revealed coherent delocalization of the protons in the ground state.

  10. Quantum Tunneling of Water in Beryl. A New State of the Water Molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kolesnikov, Alexander I.; Reiter, George F.; Choudhury, Narayani

    When using neutron scattering and ab initio simulations, we document the discovery of a new “quantum tunneling state” of the water molecule confined in 5 Å channels in the mineral beryl, characterized by extended proton and electron delocalization. We observed a number of peaks in the inelastic neutron scattering spectra that were uniquely assigned to water quantum tunneling. Additionally, the water proton momentum distribution was measured with deep inelastic neutron scattering, which directly revealed coherent delocalization of the protons in the ground state.

  11. Electron scattering by highly polar molecules. II - LiF

    NASA Technical Reports Server (NTRS)

    Vuskovic, L.; Srivastavas, S. K.; Trajmar, S.

    1978-01-01

    The crossed electron-beam - molecular-beam scattering technique has been used to measure relative values of differential 'elastic' scattering cross sections at electron impact energies of 5.4 and 20 eV for the angular range from 20 to 130 deg. The absolute values of these cross sections have been obtained by normalization to the classical perturbation theory of Dickinson (1977) at a scattering angle of 40 deg. These differential cross sections have then been used to calculate the integral and momentum-transfer cross sections. An energy-loss spectrum at 100 eV electron impact energy and 15 deg scattering angle has also been obtained. Two weak features at the energy losses of 6.74 and 8.82 eV appear. Their energy positions are compared with the recent calculations of Kahn et al. (1974).

  12. Herbert P. Broida Prize Talk: A single Rydberg electron in a Bose-Einstein condensate: from two to few to many-body physics

    NASA Astrophysics Data System (ADS)

    Pfau, Tilman

    2017-04-01

    Modern quantum scattering theory was developed in the context of Rydberg spectroscopy in 1934 by Enrico Fermi. He showed that for slow electrons the scattering from polarizable atoms via a 1/r4 potential is purely s-wave and can be described by a Fermi pseudopotential and a scattering length. To study this interaction Rydberg electrons are well suited as they are slow and trapped by the charged nucleus. In a high pressure discharge Amaldi and Segre, observed a line shift proportional to the scattering length. At ultracold temperatures one can ask the opposite question: What does a Rydberg electron do to the neutral atom sitting in the electronic orbit? We found that one, two or many ground state atoms can be trapped in the mean-field potential created by the Rydberg electron, leading to so called ultra-long range Rydberg molecules. I will explain this novel molecular binding mechanism and the properties of these exotic molecules. At higher Rydberg states the spatial extent of the Rydberg electron orbit is increasing. For principal quantum numbers n in the range of 100-200 up to several ten thousand ultracold ground state atoms can be located inside one Rydberg atom, When we excite a single Rydberg electron in a Bose-Einstein Condensate, the orbital size of which becomes comparable to the size of the BEC we observe the coupling between the electron and phonons in the BEC.

  13. Inclusion of exact exchange in the noniterative partial-differential-equation method of electron-molecule scattering - Application to e-N2

    NASA Technical Reports Server (NTRS)

    Weatherford, C. A.; Onda, K.; Temkin, A.

    1985-01-01

    The noniterative partial-differential-equation (PDE) approach to electron-molecule scattering of Onda and Temkin (1983) is modified to account for the effects of exchange explicitly. The exchange equation is reduced to a set of inhomogeneous equations containing no integral terms and solved noniteratively in a difference form; a method for propagating the solution to large values of r is described; the changes in the polarization potential of the original PDE method required by the inclusion of exact static exchange are indicated; and the results of computations for e-N2 scattering in the fixed-nuclei approximation are presented in tables and graphs and compared with previous calculations and experimental data. Better agreement is obtained using the modified PDE method.

  14. Vibrational excitation functions for inelastic and superelastic electron scattering from the ground-electronic state in hot CO2

    NASA Astrophysics Data System (ADS)

    Kato, H.; Kawahara, H.; Hoshino, M.; Tanaka, H.; Campbell, L.; Brunger, M. J.

    2008-11-01

    We report inelastic and superelastic excitation function measurements for electron scattering from the ground vibrational quantum (0 0 0), the bending vibrational quantum (0 1 0) and the unresolved first bending overtone (0 2 0) and symmetric stretch (1 0 0) modes of the ground-electronic state in hot (700 K) carbon dioxide ( CO) molecules. The incident electron energy range of these measurements was 1-9 eV, with the relevant excitation functions being measured at the respective electron scattering angles of 30°, 60°, 90° and 120°. Where possible comparison is made to the often quite limited earlier data, with satisfactory agreement typically being found to within the cited experimental errors.

  15. Molecular Electronic Devices Based On Electrooptical Behavior Of Heme-Like Molecules

    NASA Astrophysics Data System (ADS)

    Simic-Glavaski, B.

    1986-02-01

    This paper discusses application of the electrically modulated and unusually strong Raman emitted light produced by an adsorbed monolayer of phthalocyanine molecules on silver electrode or silver bromide substrates and on neural membranes. The analysis of electronic energy levels in semiconducting silver bromide and the adsorbed phthalocyanine molecules suggests a lasing mechanism as a possible origin of the high enhancement factor in surface enhanced Raman scattering. Electrically modulated Raman scattering may be used as a carrier of information which is drawn fran the fast intramolecular electron transfer aN,the multiplicity of quantum wells in phthalocyanine molecules. Fast switching times on the order of 10-13 seconds have been measured at room temperature. Multilevel and multioutput optical signals have also been obtained fran such an electrically modulated adsorbed monolayer of phthalocyanine molecules which can be precisely addressed and interrogated. This may be of practical use to develop Nlecular electronic devices with high density memory and fast parallel processing systems with a typical 1020 gate Hz/cm2 capacity at room temperature for use in optical computers. The paper also discusses the electrooptical modulation of Raman signals obtained from adsorbed bio-compatible phthalocyanine molecules on nerve membranes. This optical probe of neural systems can be used in studies of complex information processing in neural nets and provides a possible method for interfacing natural and man-made information processing devices.

  16. Accuracy of Hartree-Fock wave functions for electron-H/sub 2/ scattering calculations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Feldt, A.N.

    1988-05-01

    Recent papers on electron-N/sub 2/ scattering by Rumble, Stevens, and Truhlar (J. Phys. B 17, 3151 (1984)) and Weatherford, Brown, and Temkin (Phys. Rev. A 35, 4561 (1987)) have suggested that Hartree-Fock (HF) wave functions may not be accurate for calculating potentials for use in studying electron-molecule collisions. A comparison of results for electron-H/sub 2/ scattering using both correlated and HF wave functions is presented. It is found that for both elastic and inelastic collisions and for all energies considered (up to 10 eV) the HF wave functions yield results in excellent agreement with those obtained from the more accuratemore » wave functions.« less

  17. Elastic electron scattering from the DNA bases cytosine and thymine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Colyer, C. J.; Bellm, S. M.; Lohmann, B.

    2011-10-15

    Cross-section data for electron scattering from biologically relevant molecules are important for the modeling of energy deposition in living tissue. Relative elastic differential cross sections have been measured for cytosine and thymine using the crossed-beam method. These measurements have been performed for six discrete electron energies between 60 and 500 eV and for detection angles between 15 deg. and 130 deg. Calculations have been performed via the screen-corrected additivity rule method and are in good agreement with the present experiment.

  18. Laser-induced free-free transitions in elastic electron scattering from CO2

    NASA Astrophysics Data System (ADS)

    Musa, Mohamed; MacDonald, Amy; Tidswell, Lisa; Holmes, Jim; St. Francis Xavier Laser Scattering Lab Team

    2011-03-01

    This report presents measurements of laser-induced free-free transitions of electrons scattered from CO2 molecules in the ground electronic state at incident electron energies of 3.8 and 5.8 eV under pulsed CO2 laser field. The differential cross section of free-free transitions involving absorption and emission of up to two photons were measured at various scattering angles with the polarization of the laser either parallel with or perpendicular to the the momentum change vector of the scattered electrons. The results of the parallel geometry are found to be in qualitative agreement with the predictions of the Kroll-Watson approximation within the experimental uncertainty whereas those of the perpendicular geometry show marked discrepancy with the Kroll-Watson predictions. This work was supported by the Natural Sciences and Engineering Research Council of Canada and the St. Francis Xavier University Council for Research.

  19. Cross sections for electron scattering from furan molecules: Measurements and calculations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Szmytkowski, Czeslaw; Mozejko, Pawel; Ptasinska-Denga, Elzbieta

    Electron-scattering cross sections have been determined for the furan (C{sub 4}H{sub 4}O) molecule, both experimentally and theoretically. An absolute total cross section (TCS) has been measured over energies from 0.6 to 400 eV using a linear electron-transmission method. The TCS energy function is dominated with a very broad enhancement, between 1.2 and 9 eV; on the low-energy side, some resonant structures are visible. Integral elastic (ECS) and ionization (ICS) cross sections have been also calculated up to 4 keV in the additivity rule approximation and the binary-encounter-Bethe approach, respectively. Their sum, ECS+ICS, is in a very good agreement with themore » measured TCS above 70 eV.« less

  20. Exchange and correlation in positronium-molecule scattering

    NASA Astrophysics Data System (ADS)

    Fabrikant, I. I.; Wilde, R. S.

    2018-05-01

    Exchange and correlations play a particularly important role in positronium (Ps) collisions with atoms and molecules, since the static potential for Ps interaction with a neutral system is zero. Theoretical description of both effects is a very challenging task. In the present work we use the free-electron-gas model to describe exchange and correlations in Ps collisions with molecules similar to the approach widely used in the theory of electron-molecule collisions. The results for exchange and correlation energies are presented as functions of the Fermi momentum of the electron gas and the Ps incident energy. Using the Thomas-Fermi model, these functions can be converted into exchange and correlation potentials for Ps interaction with molecules as functions of the distance between the projectile and the target.

  1. A study of surface enhanced Raman scattering for furfural adsorbed on silver surface

    NASA Astrophysics Data System (ADS)

    Jia, Ting-jian; Li, Peng-wei; Shang, Zhi-guo; Zhang, Ling; He, Ting-chao; Mo, Yu-jun

    2008-02-01

    The normal Raman spectrum (NRS) and the surface enhanced Raman scattering (SERS) spectrum of furfural in silver colloid were recorded and analyzed in this paper. The assignment of these bands to furfural molecules was performed by density functional theory (DFT) calculation. The data of the SERS by comparing with the one of NRS show that furfural molecules are adsorbed on the silver surface via the nonbonding electrons of the carbonyl oxygen.

  2. Imaging photoelectron circular dichroism of chiral molecules by femtosecond multiphoton coincidence detection.

    PubMed

    Lehmann, C Stefan; Ram, N Bhargava; Powis, Ivan; Janssen, Maurice H M

    2013-12-21

    Here, we provide a detailed account of novel experiments employing electron-ion coincidence imaging to discriminate chiral molecules. The full three-dimensional angular scattering distribution of electrons is measured after photoexcitation with either left or right circular polarized light. The experiment is performed using a simplified photoelectron-photoion coincidence imaging setup employing only a single particle imaging detector. Results are reported applying this technique to enantiomers of the chiral molecule camphor after three-photon ionization by circularly polarized femtosecond laser pulses at 400 nm and 380 nm. The electron-ion coincidence imaging provides the photoelectron spectrum of mass-selected ions that are observed in the time-of-flight mass spectra. The coincident photoelectron spectra of the parent camphor ion and the various fragment ions are the same, so it can be concluded that fragmentation of camphor happens after ionization. We discuss the forward-backward asymmetry in the photoelectron angular distribution which is expressed in Legendre polynomials with moments up to order six. Furthermore, we present a method, similar to one-photon electron circular dichroism, to quantify the strength of the chiral electron asymmetry in a single parameter. The circular dichroism in the photoelectron angular distribution of camphor is measured to be 8% at 400 nm. The electron circular dichroism using femtosecond multiphoton excitation is of opposite sign and about 60% larger than the electron dichroism observed before in near-threshold one-photon ionization with synchrotron excitation. We interpret our multiphoton ionization as being resonant at the two-photon level with the 3s and 3p Rydberg states of camphor. Theoretical calculations are presented that model the photoelectron angular distribution from a prealigned camphor molecule using density functional theory and continuum multiple scattering X alpha photoelectron scattering calculations. Qualitative agreement is observed between the experimental results and the theoretical calculations of the Legendre moments representing the angular distribution for the two enantiomers. The electron-ion coincidence technique using multiphoton ionization opens new directions in table-top analytical mass-spectrometric applications of mixtures of chiral molecules.

  3. Imaging photoelectron circular dichroism of chiral molecules by femtosecond multiphoton coincidence detection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lehmann, C. Stefan; Ram, N. Bhargava; Janssen, Maurice H. M., E-mail: m.h.m.janssen@vu.nl

    2013-12-21

    Here, we provide a detailed account of novel experiments employing electron-ion coincidence imaging to discriminate chiral molecules. The full three-dimensional angular scattering distribution of electrons is measured after photoexcitation with either left or right circular polarized light. The experiment is performed using a simplified photoelectron-photoion coincidence imaging setup employing only a single particle imaging detector. Results are reported applying this technique to enantiomers of the chiral molecule camphor after three-photon ionization by circularly polarized femtosecond laser pulses at 400 nm and 380 nm. The electron-ion coincidence imaging provides the photoelectron spectrum of mass-selected ions that are observed in the time-of-flightmore » mass spectra. The coincident photoelectron spectra of the parent camphor ion and the various fragment ions are the same, so it can be concluded that fragmentation of camphor happens after ionization. We discuss the forward-backward asymmetry in the photoelectron angular distribution which is expressed in Legendre polynomials with moments up to order six. Furthermore, we present a method, similar to one-photon electron circular dichroism, to quantify the strength of the chiral electron asymmetry in a single parameter. The circular dichroism in the photoelectron angular distribution of camphor is measured to be 8% at 400 nm. The electron circular dichroism using femtosecond multiphoton excitation is of opposite sign and about 60% larger than the electron dichroism observed before in near-threshold one-photon ionization with synchrotron excitation. We interpret our multiphoton ionization as being resonant at the two-photon level with the 3s and 3p Rydberg states of camphor. Theoretical calculations are presented that model the photoelectron angular distribution from a prealigned camphor molecule using density functional theory and continuum multiple scattering X alpha photoelectron scattering calculations. Qualitative agreement is observed between the experimental results and the theoretical calculations of the Legendre moments representing the angular distribution for the two enantiomers. The electron-ion coincidence technique using multiphoton ionization opens new directions in table-top analytical mass-spectrometric applications of mixtures of chiral molecules.« less

  4. Total cross sections of electron scattering by molecules NF3, PF3, N(CH3)3, P(CH3)3, NH(CH3)2, PH(CH3)2, NH2CH3 and PH2CH3 at 30-5000 eV

    NASA Astrophysics Data System (ADS)

    Shi, D. H.; Sun, J. F.; Zhu, Z. L.; Liu, Y. F.

    2010-04-01

    Total cross sections of electron scattering by eight molecules NF3, PF3, N(CH3)3, P(CH3)3, NH(CH3)2, PH(CH3)2, NH2CH3 and PH2CH3, which have some structural similarities, are calculated at the Hartree-Fork level by the modified additivity rule approach [D.H. Shi, J.F. Sun, Z.L. Zhu, H. Ma, Y.F. Liu, Eur. Phys. J. D 45, 253 (2007); D.H. Shi, J.F. Sun, Y.F. Liu, Z.L. Zhu, X.D. Yang, Chin. Opt. Lett. 4, 192 (2006)]. The modified additivity rule approach takes into considerations that the contributions of the geometric shielding effect vary as the energy of incident electrons, the dimension of target molecule, the number of electrons in the molecule and the number of atoms constituting the molecule. The present investigations cover the impact energy range from 30 to 5000 eV. The quantitative total cross sections are compared with those obtained by experiments and other theories. Excellent agreement is observed even at energies of several tens of eV. It shows that the modified additivity rule approach is applicable to carry out the total cross section calculations of electron scattering by these molecules at intermediate and high energies, in particular over the energy range above 80 eV or so. It proves that the microscopic molecular properties, such as the geometrical size of the target and the number of atoms constituting the molecule, are of crucial importance in the TCS calculations. The new results for PH(CH3)2 and PH2CH3 are also presented at energies from 30 to 5000 eV, although no experimental and theoretical data are available for comparison. In the present calculations, the atoms are still represented by the spherical complex optical potential, which is composed of static, exchange, polarization and absorption terms.

  5. Molecular electronics: some views on transport junctions and beyond.

    PubMed

    Joachim, Christian; Ratner, Mark A

    2005-06-21

    The field of molecular electronics comprises a fundamental set of issues concerning the electronic response of molecules as parts of a mesoscopic structure and a technology-facing area of science. We will overview some important aspects of these subfields. The most advanced ideas in the field involve the use of molecules as individual logic or memory units and are broadly based on using the quantum state space of the molecule. Current work in molecular electronics usually addresses molecular junction transport, where the molecule acts as a barrier for incoming electrons: This is the fundamental Landauer idea of "conduction as scattering" generalized to molecular junction structures. Another point of view in terms of superexchange as a guiding mechanism for coherent electron transfer through the molecular bridge is discussed. Molecules generally exhibit relatively strong vibronic coupling. The last section of this overview focuses on vibronic effects, including inelastic electron tunneling spectroscopy, hysteresis in junction charge transport, and negative differential resistance in molecular transport junctions.

  6. On the widths of Stokes lines in Raman scattering from molecules adsorbed at metal surfaces and in molecular conduction junctions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gao, Yi, E-mail: yig057@ucsd.edu; Galperin, Michael, E-mail: migalperin@ucsd.edu; Nitzan, Abraham, E-mail: nitzan@post.tau.ac.il

    Within a generic model we analyze the Stokes linewidth in surface enhanced Raman scattering (SERS) from molecules embedded as bridges in molecular junctions. We identify four main contributions to the off-resonant Stokes signal and show that under zero voltage bias (a situation pertaining also to standard SERS experiments) and at low bias junctions only one of these contributions is pronounced. The linewidth of this component is determined by the molecular vibrational relaxation rate, which is dominated by interactions with the essentially bosonic thermal environment when the relevant molecular electronic energy is far from the metal(s) Fermi energy(ies). It increases whenmore » the molecular electronic level is close to the metal Fermi level so that an additional vibrational relaxation channel due to electron-hole (eh) exciton in the molecule opens. Other contributions to the Raman signal, of considerably broader linewidths, can become important at larger junction bias.« less

  7. Monitoring nonadiabatic avoided crossing dynamics in molecules by ultrafast X-ray diffraction

    DOE PAGES

    Kowalewski, Markus; Bennett, Kochise; Mukamel, Shaul

    2017-05-26

    We examine time-resolved X-ray diffraction from molecules in the gas phase which undergo nonadiabatic avoided-crossing dynamics involving strongly coupled electrons and nuclei. Several contributions to the signal are identified, representing (in decreasing strength) elastic scattering, contributions of the electronic coherences created by nonadiabatic couplings in the avoided crossing regime, and inelastic scattering. The former probes the charge density and delivers direct information on the evolving molecular geometry. The latter two contributions are weaker and carry spatial information through the transition charge densities (off-diagonal elements of the charge-density operator). Furthermore, simulations are presented for the nonadiabatic harpooning process in the excitedmore » state of sodium fluoride.« less

  8. The boomerang effect in electron-hydrogen molecule scattering as determined by time-dependent calculations

    NASA Astrophysics Data System (ADS)

    Ben-Asher, Anael; Moiseyev, Nimrod

    2017-05-01

    The appearance of oscillations in the energy-dependent cross sections of the vibrational excitation ν =0 →ν ≥3 of the hydrogen molecule in its electronic ground state as predicted by Mündel, Berman, and Domcke [Phys. Rev. A 32, 181 (1985)] was confirmed in the electron scattering experiments by Allan [J. Phys. B: At. Mol. Phys. 18, L451 (1985)]. These unusual structures were obtained in spite of the extremely short lifetime of H2- in its ro-vibrational states. Based on the standard (Hermitian) time-independent scattering calculations, Horáček et al. [Phys. Rev. A 73, 022701 (2006)] associated these oscillations with the boomerang effect. Here, we show the boomerang effect as developed in time, based on our time-dependent nuclear wavepacket (WP) calculations. The nuclear WP dynamics of H2- is determined using the non-Hermitian quantum mechanics (NH-QM) which enables the use of the Born-Oppenheimer approximation with complex potential energy surfaces. This NH-QM approach, which enables us the association of the nuclear WP dynamics as obtained from the complex potential energy curve of H2- with the evolution of cross section in time, can enlighten the dynamics in other scattering experiments.

  9. The boomerang effect in electron-hydrogen molecule scattering as determined by time-dependent calculations.

    PubMed

    Ben-Asher, Anael; Moiseyev, Nimrod

    2017-05-28

    The appearance of oscillations in the energy-dependent cross sections of the vibrational excitation ν=0→ν≥3 of the hydrogen molecule in its electronic ground state as predicted by Mündel, Berman, and Domcke [Phys. Rev. A 32, 181 (1985)] was confirmed in the electron scattering experiments by Allan [J. Phys. B: At. Mol. Phys. 18, L451 (1985)]. These unusual structures were obtained in spite of the extremely short lifetime of H 2 - in its ro-vibrational states. Based on the standard (Hermitian) time-independent scattering calculations, Horáček et al. [Phys. Rev. A 73, 022701 (2006)] associated these oscillations with the boomerang effect. Here, we show the boomerang effect as developed in time, based on our time-dependent nuclear wavepacket (WP) calculations. The nuclear WP dynamics of H 2 - is determined using the non-Hermitian quantum mechanics (NH-QM) which enables the use of the Born-Oppenheimer approximation with complex potential energy surfaces. This NH-QM approach, which enables us the association of the nuclear WP dynamics as obtained from the complex potential energy curve of H 2 - with the evolution of cross section in time, can enlighten the dynamics in other scattering experiments.

  10. Triple Differential Cross Sections for single ionization of the Ethane molecule

    NASA Astrophysics Data System (ADS)

    Ali, Esam; Nixon, Kate; Ning, Chuangang; Murray, Andrew; Madison, Don

    2015-09-01

    We report experimental and theoretical results for electron-impact (e,2e) ionization of the Ethane molecule (C2H6) in the coplanar scattering geometry for four different ejected electron energies Ea = 5,10,15, and 20 eV respectively, and for each ejected electron energy, the projectile scattering angle is fixed at 10°. We will show that the TDCS is very sensitive for the case of two heavy nuclei surrounded by lighter H nuclei. On the theoretical side, we have used the M3DW coupled with the Orientation Averaged Molecular Orbital (OAMO) approximation and proper average (PA) over all orientations. These approximations show good agreement with experimental data for the binary peaks. However, for the recoil peak region, experiment finds a noticeable peak while theory predicts no peak. No recoil peak suggests no (or very weak) nuclear scattering, so we have investigated the importance of nuclear scattering by moving the nuclei closer to the center of mass. This work is supported by the US National Science Foundation under Grant No. PHY-1068237 and XSEDE resources provided by the Texas Advanced Computing Center (Grant No. TG-MCA07S029).

  11. Molecular t-matrices for Low-Energy Electron Diffraction (TMOL v1.1)

    NASA Astrophysics Data System (ADS)

    Blanco-Rey, Maria; de Andres, Pedro; Held, Georg; King, David A.

    2004-08-01

    We describe a FORTRAN-90 program that computes scattering t-matrices for a molecule. These can be used in a Low-Energy Electron Diffraction program to solve the molecular structural problem very efficiently. The intramolecular multiple scattering is computed within a Dyson-like approach, using free space Green propagators in a basis of spherical waves. The advantage of this approach is related to exploiting the chemical identity of the molecule, and to the simplicity to translate and rotate these t-matrices without performing a new multiple-scattering calculation for each configuration. FORTRAN-90 routines for rotating the resulting t-matrices using Wigner matrices are also provided. Program summaryTitle of program: TMOL Catalogue number: ADUF Program summary URL:http://cpc.cs.qub.ac.uk/summaries/ADUF Program obtainable from: CPC Program Library, Queen's University of Belfast, N. Ireland. Computers: Alpha ev6-21264 (700 MHz) and Pentium-IV. Operating systems: Digital UNIX V5.0 and Linux (Red Hat 8.0). Programming language: FORTRAN-90/95 (Compaq True64 compiler, and Intel Fortran Compiler 7.0 for Linux). High-speed storage required for the test run: minimum 64 Mbytes, it can grow to more depending on the system considered. Disk storage required: None. No. of bits in a word: 64 and 32. No. of lines in distributed program, including test data etc.: 5404 No. of bytes in distributed program, including test data etc.: 59 856 Distribution format: tar.gz Nature of problem: We describe the FORTRAN-90 program TMOL (v1.1) for the computation of non-diagonal scattering t-matrices for molecules or any other poly-atomic sub-unit of surface structures. These matrices can be used in an standard Low-Energy Electron Diffraction program, such as LEED90 or CLEED. Method of solution: A general non-diagonal t-matrix is assumed for the atoms or more general scatterers forming the molecule. The molecular t-matrix is solved adding the possible intramolecular multiple scattering events using Green's propagator formalism. The resulting t-matrix is referred to the mass centre of the molecule and can be easily translated with these propagators and rotated applying Wigner matrices. Typical running time: Calculating the t-matrix for a single energy takes a few seconds. Time depends on the maximum angular momentum quantum number, lmax, and the number of scatterers in the molecule, N. Running time scales as lmax6 and N3. References: [1] S. Andersson, J.B. Pendry, J. Phys. C: Solid St. Phys. 13 (1980) 3547. [2] A. Gonis, W.H. Butler, Multiple Scattering in Solids, Springer-Verlag, Berlin/New York, 2000.

  12. Structure of IgG and IgY molecules in ribosome-antibody complexes as studied by electron microscopy.

    PubMed

    Noll, F; Lutsch, G; Bielka, H

    1982-03-01

    The overall shape and dimensions of IgG (rabbit) and IgY (chicken) antibodies against ribosomal proteins have been studied in electron micrographs of ribosome-antibody complexes. The antibodies appear as Y-shaped molecules with an angle of about 90 degrees between their Fab arms. The length of one Fab arm amounts to about 10 nm. No differences between the IgG and IgY molecules could be detected electron microscopically. The data obtained on the shape of IgG and IgY correlate with those of earlier electron microscopic studies while the determined size of the Fab arms is in the range found by scattering methods.

  13. Angular correlations of photons from solution diffraction at a free-electron laser encode molecular structure

    DOE PAGES

    Mendez, Derek; Watkins, Herschel; Qiao, Shenglan; ...

    2016-09-26

    During X-ray exposure of a molecular solution, photons scattered from the same molecule are correlated. If molecular motion is insignificant during exposure, then differences in momentum transfer between correlated photons are direct measurements of the molecular structure. In conventional small- and wide-angle solution scattering, photon correlations are ignored. This report presents advances in a new biomolecular structural analysis technique, correlated X-ray scattering (CXS), which uses angular intensity correlations to recover hidden structural details from molecules in solution. Due to its intense rapid pulses, an X-ray free electron laser (XFEL) is an excellent tool for CXS experiments. A protocol is outlinedmore » for analysis of a CXS data set comprising a total of half a million X-ray exposures of solutions of small gold nanoparticles recorded at the Spring-8 Ångström Compact XFEL facility (SACLA). From the scattered intensities and their correlations, two populations of nanoparticle domains within the solution are distinguished: small twinned, and large probably non-twinned domains. Finally, it is shown analytically how, in a solution measurement, twinning information is only accessible via intensity correlations, demonstrating how CXS reveals atomic-level information from a disordered solution of like molecules.« less

  14. Effect of the third π ∗ resonance on the angular distributions for electron-pyrimidine scattering

    NASA Astrophysics Data System (ADS)

    Mašín, Zdeněk; Gorfinkiel, Jimena D.

    2016-07-01

    We present a detailed analysis of the effect of the well known third π∗ resonance on the angular behaviour of the elastic cross section in electron scattering from pyrimidine. This resonance, occurring approximately at 4.7 eV, is of mixed shape and core-excited character. Experimental and theoretical results show the presence of a peak/dip behaviour in this energy range, that is absent for other resonances. Our investigations show that the cause of the peak/dip is an interference of background p-wave to p-wave scattering amplitudes with the amplitudes for resonant scattering. The equivalent resonance in pyrazine shows the same behaviour and the effect is therefore likely to appear in other benzene-like molecules. Contribution to the Topical Issue "Advances in Positron and Electron Scattering", edited by Paulo Limao-Vieira, Gustavo Garcia, E. Krishnakumar, James Sullivan, Hajime Tanuma and Zoran Petrovic.

  15. SU-E-T-489: Quantum versus Classical Trajectory Monte Carlo Simulations of Low Energy Electron Transport.

    PubMed

    Thomson, R; Kawrakow, I

    2012-06-01

    Widely-used classical trajectory Monte Carlo simulations of low energy electron transport neglect the quantum nature of electrons; however, at sub-1 keV energies quantum effects have the potential to become significant. This work compares quantum and classical simulations within a simplified model of electron transport in water. Electron transport is modeled in water droplets using quantum mechanical (QM) and classical trajectory Monte Carlo (MC) methods. Water droplets are modeled as collections of point scatterers representing water molecules from which electrons may be isotropically scattered. The role of inelastic scattering is investigated by introducing absorption. QM calculations involve numerically solving a system of coupled equations for the electron wavefield incident on each scatterer. A minimum distance between scatterers is introduced to approximate structured water. The average QM water droplet incoherent cross section is compared with the MC cross section; a relative error (RE) on the MC results is computed. RE varies with electron energy, average and minimum distances between scatterers, and scattering amplitude. The mean free path is generally the relevant length scale for estimating RE. The introduction of a minimum distance between scatterers increases RE substantially (factors of 5 to 10), suggesting that the structure of water must be modeled for accurate simulations. Inelastic scattering does not improve agreement between QM and MC simulations: for the same magnitude of elastic scattering, the introduction of inelastic scattering increases RE. Droplet cross sections are sensitive to droplet size and shape; considerable variations in RE are observed with changing droplet size and shape. At sub-1 keV energies, quantum effects may become non-negligible for electron transport in condensed media. Electron transport is strongly affected by the structure of the medium. Inelastic scatter does not improve agreement between QM and MC simulations of low energy electron transport in condensed media. © 2012 American Association of Physicists in Medicine.

  16. Electron Dynamics in the Core-Excited CS2 Molecule Revealed through Resonant Inelastic X-Ray Scattering Spectroscopy

    NASA Astrophysics Data System (ADS)

    Marchenko, T.; Carniato, S.; Journel, L.; Guillemin, R.; Kawerk, E.; Žitnik, M.; Kavčič, M.; Bučar, K.; Bohinc, R.; Petric, M.; Vaz da Cruz, V.; Gel'mukhanov, F.; Simon, M.

    2015-07-01

    We present an experimental and theoretical study of resonant inelastic x-ray scattering (RIXS) in the carbon disulphide CS2 molecule near the sulfur K-absorption edge. We observe a strong evolution of the RIXS spectral profile with the excitation energy tuned below the lowest unoccupied molecular orbital (LUMO) absorption resonance. The reason for this is twofold. Reducing the photon energy in the vicinity of the LUMO absorption resonance leads to a relative suppression of the LUMO contribution with respect to the emission signal from the higher unoccupied molecular orbitals, which results in the modulation of the total RIXS profile. At even larger negative photon-energy detuning from the resonance, the excitation-energy dependence of the RIXS profile is dominated by the onset of electron dynamics triggered by a coherent excitation of multiple electronic states. Furthermore, our study demonstrates that in the hard x-ray regime, localization of the S 1s core hole occurs in CS2 during the RIXS process because of the orientational dephasing of interference between the waves scattering on the two sulfur atoms. Core-hole localization leads to violation of the symmetry selection rules for the electron transitions observed in the spectra.

  17. Ionizing Collisions of Electrons with Radical Species OH, H2 O2 and HO2; Theoretical Calculations

    NASA Astrophysics Data System (ADS)

    Joshipura, K. N.; Pandya, S. H.; Vaishnav, B. G.; Patel, U. R.

    2016-05-01

    In this paper we present our calculated total ionization cross sections (TICS) of electron impact on radical targets OH, H2 O2 and HO2 at energies from threshold to 2000 eV. Reactive species such as these pose difficulties in measurements of electron scattering cross sections. No measured data have been reported in this regard except an isolated TICS measurement on OH radical, and hence the present work on the title radicals hold significance. These radical species are present in an environment in which water molecules undergo dissociation (neutral or ionic) in interactions with photons or electrons. The embedding environments could be quite diverse, ranging from our atmosphere to membranes of living cells. Ionization of OH, H2 O2 or HO2 can give rise to further chemistry in the relevant bulk medium. Therefore, it is appropriate and meaningful to examine electron impact ionization of these radicals in comparison with that of water molecules, for which accurate da are available. For the OH target single-centre scattering calculations are performed by starting with a 4-term complex potential, that describes simultaneous elastic plus inelastic scattering. TICS are obtained from the total inelastic cross sections in the complex scattering potential - ionization contribution formalism , a well established method. For H2 O2 and HO2 targets, we employ the additivity rule with overlap or screening corrections. Detailed results will be presented in the Conference.

  18. Total electron scattering cross section from pyridine molecules in the energy range 10-1000 eV

    NASA Astrophysics Data System (ADS)

    Dubuis, A. Traoré; Costa, F.; da Silva, F. Ferreira; Limão-Vieira, P.; Oller, J. C.; Blanco, F.; García, G.

    2018-05-01

    We report on experimental total electron scattering cross-section (TCS) from pyridine (C5H5N) for incident electron energies between 10 and 1000 eV, with experimental uncertainties within 5-10%, as measured with a double electrostatic analyser apparatus. The experimental results are compared with our theoretical calculations performed within the independent atom model complemented with a screening corrected additivity rule (IAM-SCAR) procedure which has been updated by including interference effects. A good level of agreement is found between both data sources within the experimental uncertainties. The present TCS results for electron impact energy under study contribute, together with other scattering data available in the literature, to achieve a consistent set of cross section data for modelling purposes.

  19. Magnetically confined electron beam system for high resolution electron transmission-beam experiments

    NASA Astrophysics Data System (ADS)

    Lozano, A. I.; Oller, J. C.; Krupa, K.; Ferreira da Silva, F.; Limão-Vieira, P.; Blanco, F.; Muñoz, A.; Colmenares, R.; García, G.

    2018-06-01

    A novel experimental setup has been implemented to provide accurate electron scattering cross sections from molecules at low and intermediate impact energies (1-300 eV) by measuring the attenuation of a magnetically confined linear electron beam from a molecular target. High-resolution electron energy is achieved through confinement in a magnetic gas trap where electrons are cooled by successive collisions with N2. Additionally, we developed and present a method to correct systematic errors arising from energy and angular resolution limitations. The accuracy of the entire measurement procedure is validated by comparing the N2 total scattering cross section in the considered energy range with benchmark values available in the literature.

  20. Variational treatment of electron-polyatomic-molecule scattering calculations using adaptive overset grids

    NASA Astrophysics Data System (ADS)

    Greenman, Loren; Lucchese, Robert R.; McCurdy, C. William

    2017-11-01

    The complex Kohn variational method for electron-polyatomic-molecule scattering is formulated using an overset-grid representation of the scattering wave function. The overset grid consists of a central grid and multiple dense atom-centered subgrids that allow the simultaneous spherical expansions of the wave function about multiple centers. Scattering boundary conditions are enforced by using a basis formed by the repeated application of the free-particle Green's function and potential Ĝ0+V ̂ on the overset grid in a Born-Arnoldi solution of the working equations. The theory is shown to be equivalent to a specific Padé approximant to the T matrix and has rapid convergence properties, in both the number of numerical basis functions employed and the number of partial waves employed in the spherical expansions. The method is demonstrated in calculations on methane and CF4 in the static-exchange approximation and compared in detail with calculations performed with the numerical Schwinger variational approach based on single-center expansions. An efficient procedure for operating with the free-particle Green's function and exchange operators (to which no approximation is made) is also described.

  1. Quantum State-Resolved Collision Dynamics of Nitric Oxide at Ionic Liquid and Molten Metal Surfaces

    NASA Astrophysics Data System (ADS)

    Zutz, Amelia Marie

    Detailed molecular scale interactions at the gas-liquid interface are explored with quantum state-to-state resolved scattering of a jet-cooled beam of NO(2pi1/2; N = 0) from ionic liquid and molten metal surfaces. The scattered distributions are probed via laser-induced fluorescence methods, which yield rotational and spin-orbit state populations that elucidate the dynamics of energy transfer at the gas-liquid interface. These collision dynamics are explored as a function of incident collision energy, surface temperature, scattering angle, and liquid identity, all of which are found to substantially affect the degree of rotational, electronic and vibrational excitation of NO via collisions at the liquid surface. Rotational distributions observed reveal two distinct scattering pathways, (i) molecules that trap, thermalize and eventually desorb from the surface (trapping-desorption, TD), and (ii) those that undergo prompt recoil (impulsive scattering, IS) prior to complete equilibration with the liquid surface. Thermally desorbing NO molecules are found to have rotational temperatures close to, but slightly cooler than the surface temperature, indicative of rotational dependent sticking probabilities on liquid surfaces. Nitric oxide is a radical with multiple low-lying electronic states that serves as an ideal candidate for exploring nonadiabatic state-changing collision dynamics at the gas-liquid interface, which induce significant excitation from ground (2pi1/2) to excited (2pi 3/2) spin-orbit states. Molecular beam scattering of supersonically cooled NO from hot molten metals (Ga and Au, Ts = 300 - 1400 K) is also explored, which provide preliminary evidence for vibrational excitation of NO mediated by thermally populated electron-hole pairs in the hot, conducting liquid metals. The results highlight the presence of electronically nonadiabatic effects and build toward a more complete characterization of energy transfer dynamics at gas-liquid interfaces.

  2. Electron impact ionization of plasma important SiClX (X = 1-4) molecules: theoretical cross sections

    NASA Astrophysics Data System (ADS)

    Kothari, Harshit N.; Pandya, Siddharth H.; Joshipura, K. N.

    2011-06-01

    Electron impact ionization of SiClX (X = 1-4) molecules is less studied but an important process for understanding and modelling the interactions of silicon-chlorine plasmas with different materials. The SiCl3 radical is a major chloro-silicon species involved in the CVD (chemical vapour deposition) of silicon films from SiCl4/Ar microwave plasmas. We report in this paper the total ionization cross sections for electron collisions on these silicon compounds at incident energies from the ionization threshold to 2000 eV. We employ the 'complex scattering potential-ionization contribution' method and identify the relative importance of various channels, with ionization included in the cumulative inelastic scattering. New results are also presented on these exotic molecular targets. This work is significant in view of the paucity of theoretical studies on the radicals SiClX (X = 1-3) and on SiCl4.

  3. 3D nanostar dimers with a sub-10-nm gap for single-/few-molecule surface-enhanced raman scattering.

    PubMed

    Chirumamilla, Manohar; Toma, Andrea; Gopalakrishnan, Anisha; Das, Gobind; Zaccaria, Remo Proietti; Krahne, Roman; Rondanina, Eliana; Leoncini, Marco; Liberale, Carlo; De Angelis, Francesco; Di Fabrizio, Enzo

    2014-04-16

    Plasmonic nanostar-dimers, decoupled from the substrate, have been fabricated by combining electron-beam lithography and reactive-ion etching techniques. The 3D architecture, the sharp tips of the nanostars and the sub-10 nm gap size promote the formation of giant electric-field in highly localized hot-spots. The single/few molecule detection capability of the 3D nanostar-dimers has been demonstrated by Surface-Enhanced Raman Scattering. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Ab initio R-matrix calculations of e+-molecule scattering

    NASA Technical Reports Server (NTRS)

    Danby, Grahame; Tennyson, Jonathan

    1990-01-01

    The adaptation of the molecular R-matrix method, originally developed for electron-molecule collision studies, to positron scattering is discussed. Ab initio R-matrix calculations are presented for collisions of low energy positrons with a number of diatomic systems including H2, HF and N2. Differential elastic cross sections for positron-H2 show a minimum at about 45 deg for collision energies between 0.3 and 0.5 Ryd. The calculations predict a bound state of positronHF. Calculations on inelastic processes in N2 and O2 are also discussed.

  5. Nanoantioxidant-driven plasmon enhanced proton-coupled electron transfer

    NASA Astrophysics Data System (ADS)

    Sotiriou, Georgios A.; Blattmann, Christoph O.; Deligiannakis, Yiannis

    2015-12-01

    Proton-coupled electron transfer (PCET) reactions involve the transfer of a proton and an electron and play an important role in a number of chemical and biological processes. Here, we describe a novel phenomenon, plasmon-enhanced PCET, which is manifested using SiO2-coated Ag nanoparticles functionalized with gallic acid (GA), a natural antioxidant molecule that can perform PCET. These GA-functionalized nanoparticles show enhanced plasmonic response at near-IR wavelengths, due to particle agglomeration caused by the GA molecules. Near-IR laser irradiation induces strong local hot-spots on the SiO2-coated Ag nanoparticles, as evidenced by surface enhanced Raman scattering (SERS). This leads to plasmon energy transfer to the grafted GA molecules that lowers the GA-OH bond dissociation enthalpy by at least 2 kcal mol-1 and therefore facilitates PCET. The nanoparticle-driven plasmon-enhancement of PCET brings together the so far unrelated research domains of nanoplasmonics and electron/proton translocation with significant impact on applications based on interfacial electron/proton transfer.Proton-coupled electron transfer (PCET) reactions involve the transfer of a proton and an electron and play an important role in a number of chemical and biological processes. Here, we describe a novel phenomenon, plasmon-enhanced PCET, which is manifested using SiO2-coated Ag nanoparticles functionalized with gallic acid (GA), a natural antioxidant molecule that can perform PCET. These GA-functionalized nanoparticles show enhanced plasmonic response at near-IR wavelengths, due to particle agglomeration caused by the GA molecules. Near-IR laser irradiation induces strong local hot-spots on the SiO2-coated Ag nanoparticles, as evidenced by surface enhanced Raman scattering (SERS). This leads to plasmon energy transfer to the grafted GA molecules that lowers the GA-OH bond dissociation enthalpy by at least 2 kcal mol-1 and therefore facilitates PCET. The nanoparticle-driven plasmon-enhancement of PCET brings together the so far unrelated research domains of nanoplasmonics and electron/proton translocation with significant impact on applications based on interfacial electron/proton transfer. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr04942c

  6. Recent measurements concerning uranium hexafluoride-electron collision processes

    NASA Technical Reports Server (NTRS)

    Trajmar, S.; Chutjian, A.; Srivastava, S.; Williams, W.; Cartwright, D. C.

    1976-01-01

    Scattering of electrons by UF6 molecules was studied at impact energies ranging from 5 to 100 eV and momentum transfer, elastic and inelastic scattering cross sections were determined. The measurements also yielded spectroscopic information which made possible to extend the optical absorption cross sections from 2000 angstroms to 435 angstroms. It was found that UF6 is a very strong absorber in the vacuum UV region. No transitions were found to lie below the onset of the optically detected 3.0 eV feature.

  7. Imaging ultrafast dynamics of molecules with laser-induced electron diffraction.

    PubMed

    Lin, C D; Xu, Junliang

    2012-10-14

    We introduce a laser-induced electron diffraction method (LIED) for imaging ultrafast dynamics of small molecules with femtosecond mid-infrared lasers. When molecules are placed in an intense laser field, both low- and high-energy photoelectrons are generated. According to quantitative rescattering (QRS) theory, high-energy electrons are produced by a rescattering process where electrons born at the early phase of the laser pulse are driven back to rescatter with the parent ion. From the high-energy electron momentum spectra, field-free elastic electron-ion scattering differential cross sections (DCS), or diffraction images, can be extracted. With mid-infrared lasers as the driving pulses, it is further shown that the DCS can be used to extract atomic positions in a molecule with sub-angstrom spatial resolution, in close analogy to the standard electron diffraction method. Since infrared lasers with pulse duration of a few to several tens of femtoseconds are already available, LIED can be used for imaging dynamics of molecules with sub-angstrom spatial and a few-femtosecond temporal resolution. The first experiment with LIED has shown that the bond length of oxygen molecules shortens by 0.1 Å in five femtoseconds after single ionization. The principle behind LIED and its future outlook as a tool for dynamic imaging of molecules are presented.

  8. Plasmonics and SERS activity of post-transition metal nanoparticles

    NASA Astrophysics Data System (ADS)

    Bezerra, A. G.; Machado, T. N.; Woiski, T. D.; Turchetti, D. A.; Lenz, J. A.; Akcelrud, L.; Schreiner, W. H.

    2018-05-01

    Nanoparticles of the post-transition metals, In, Sn, Pb, and Bi, and of the metalloid Sb were produced by laser ablation synthesis in solution (LASiS) and tested for localized surface plasmon resonances (LSPR) and surface-enhanced Raman scattering (SERS). The nanoparticles were characterized by UV-Vis optical absorption, dynamic light scattering (DLS), and transmission electron microscopy (TEM). Several organic and biological molecules were tested, and SERS activity was demonstrated for all tested nanoparticles and molecules. The Raman enhancement factor for each nanoparticle class and molecule was experimentally determined. The search for new plasmonic nanostructures is important mainly for life sciences-related applications and this study expands the range of SERS active systems.

  9. Free–free experiments: the search for dressed atom effects

    NASA Astrophysics Data System (ADS)

    Martin, N. L. S.; Weaver, C. M.; Kim, B. N.; deHarak, B. A.

    2018-07-01

    Experiments on free–free electron scattering, specifically the absorption or emission of 1.17 eV photons from a Nd:YAG laser field by an unbound electron when it is scattered by an atom or molecule, are reviewed. For large scattering angles such experiments are well described by a simple analytical theory that is independent of the properties of the target. At small scattering angles this theory breaks down for targets with a high dipole polarizability α, and an additional term needs to be incorporated in the scattering amplitude. This term is proportional to the dipole polarizability, and hence introduces the properties of the target into the free–free cross section—i.e., the laser field ‘dresses’ the atom. A progress report is given of free–free experiments designed to look for such ‘dressed atom’ effects during the electron-impact excitation of argon in the presence of a laser field; the lowest excited states of argon have α ≈ 300 atomic units.

  10. Dissociative Electron Attachment in the condensed phase: sample morphology and bio-molecules

    NASA Astrophysics Data System (ADS)

    Bass, A. D.

    2001-10-01

    Recent electron impact experiments on condensed plasmid DNA have shown low energy electrons to be remarkably effective in causing damage and reveal that electron-scattering phenomena, such as transient anion formation and their decay via dissociative electron attachment, play a central role in this process. Such experiments may prompt a revision of our understanding of the mutagenic effects of radiation and have significant implications for both radiotherapy and radio-protection. These results can be better understood by investigating electron scattering with the various functional constituents of DNA in condensed environments. Recent work, to be presented here, has focused on electron attachment processes in condensed DNA bases and sugar-like analogues of the DNA backbone, as evidenced by the desorption of fragment anions. Despite this progress, a complete understanding of these processes requires parallel study of simpler `model' systems, which allow the characteristic condensed-phase phenomena modulating electron-scattering to be identified. Factors affecting anion formation and DEA can been classed as either intrinsic (affecting the properties of the resonance) or extrinsic (modifying the energy of electrons before attachment and/or the reactions of fragments, post-dissociation). In this talk we will present new results in which the extrinsic factors of porosity and phase of a sample are probed via the desorption of anionic fragments from either the pure film or from probe molecules condensed upon its surface. We show that anion desorption and hence our ability to observe DEA process, is highly sensitive to sample morphology and phase, a property which can be exploited to study the morphology of the film itself.

  11. ELSEPA—Dirac partial-wave calculation of elastic scattering of electrons and positrons by atoms, positive ions and molecules

    NASA Astrophysics Data System (ADS)

    Salvat, Francesc; Jablonski, Aleksander; Powell, Cedric J.

    2005-01-01

    The FORTRAN 77 code system ELSEPA for the calculation of elastic scattering of electrons and positrons by atoms, positive ions and molecules is presented. These codes perform relativistic (Dirac) partial-wave calculations for scattering by a local central interaction potential V(r). For atoms and ions, the static-field approximation is adopted, with the potential set equal to the electrostatic interaction energy between the projectile and the target, plus an approximate local exchange interaction when the projectile is an electron. For projectiles with kinetic energies up to 10 keV, the potential may optionally include a semiempirical correlation-polarization potential to describe the effect of the target charge polarizability. Also, for projectiles with energies less than 1 MeV, an imaginary absorptive potential can be introduced to account for the depletion of the projectile wave function caused by open inelastic channels. Molecular cross sections are calculated by means of a single-scattering independent-atom approximation in which the electron density of a bound atom is approximated by that of the free neutral atom. Elastic scattering by individual atoms in solids is described by means of a muffin-tin model potential. Partial-wave calculations are feasible on modest personal computers for energies up to about 5 MeV. The ELSEPA code also implements approximate factorization methods that allow the fast calculation of elastic cross sections for much higher energies. The interaction model adopted in the calculations is defined by the user by combining the different options offered by the code. The nuclear charge distribution can be selected among four analytical models (point nucleus, uniformly charged sphere, Fermi's distribution and Helm's uniform-uniform distribution). The atomic electron density is handled in numerical form. The distribution package includes data files with electronic densities of neutral atoms of the elements hydrogen to lawrencium ( Z=1-103) obtained from multiconfiguration Dirac-Fock self-consistent calculations. For comparison purposes, three simple analytical approximations to the electron density of neutral atoms (corresponding to the Thomas-Fermi, the Thomas-Fermi-Dirac and the Dirac-Hartree-Fock-Slater models) are also included. For calculations of elastic scattering by ions, the electron density should be provided by the user. The exchange potential for electron scattering can be selected among three different analytical approximations (Thomas-Fermi, Furness-McCarthy, Riley-Truhlar). The offered options for the correlation-polarization potential are based on the empirical Buckingham potential. The imaginary absorption potential is calculated from the local-density approximation proposed by Salvat [Phys. Rev. A 68 (2003) 012708]. Program summaryTitle of program:ELSEPA Catalogue identifier: ADUS Program summary URL:http://cpc.cs.qub.ac.uk/cpc/summaries/ADUS Program obtainable from: CPC Program Library, Queen's University of Belfast, N. Ireland License provisions: none Computer for which the program is designed and others in which it is operable: Any computer with a FORTRAN 77 compiler Operating systems under which the program has been tested: Windows XP, Windows 2000, Debian GNU/Linux 3.0r0 (sarge) Compilers:Compaq Visual Fortran v6.5 (Windows); GNU FORTRAN, g77 (Windows and Linux) Programming language used: FORTRAN 77 No. of bits in a word: 32 Memory required to execute with typical data: 0.6 Mb No. of lines in distributed program, including test data, etc.:135 489 No. of bytes in distributed program, including test data, etc.: 1 280 006 Distribution format: tar.gz Keywords: Dirac partial-wave analysis, electron elastic scattering, positron elastic scattering, differential cross sections, momentum transfer cross sections, transport cross sections, scattering amplitudes, spin polarization, scattering by complex potentials, high-energy atomic screening functions Nature of the physical problem: The code calculates differential cross sections, total cross sections and transport cross sections for single elastic scattering of electrons and positrons by neutral atoms, positive ions and randomly oriented molecules. For projectiles with kinetic energies less than about 5 MeV, the programs can also compute scattering amplitudes and spin polarization functions. Method of solution: The effective interaction between the projectile and a target atom is represented by a local central potential that can optionally include an imaginary (absorptive) part to account approximately for the coupling with inelastic channels. For projectiles with kinetic energy less that about 5 MeV, the code performs a conventional relativistic Dirac partial-wave analysis. For higher kinetic energies, where the convergence of the partial-wave series is too slow, approximate factorization methods are used. Restrictions on the complexity of the program: The calculations are based on the static-field approximation. The optional correlation-polarization and inelastic absorption corrections are obtained from approximate, semiempirical models. Calculations for molecules are based on a single-scattering independent-atom approximation. To ensure accuracy of the results for scattering by ions, the electron density of the ion must be supplied by the user. Typical running time: on a 2.8 GHz Pentium 4, the calculation of elastic scattering by atoms and ions takes between a few seconds and about two minutes, depending on the atomic number of the target, the adopted potential model and the kinetic energy of the projectile. Unusual features of the program: The program calculates elastic cross sections for electrons and positrons with kinetic energies in a wide range, from a few tens of eV up to about 1 GeV. Calculations can be performed for neutral atoms of all elements, from hydrogen to lawrencium ( Z=1-103), ions and simple molecules. Commercial products are identified to specify the calculational procedures. Such identification does not imply recommendation or endorsement by the National Institute of Standards and Technology, the University of Barcelona or the Polish Academy of Sciences, nor does it imply that the products are necessarily the best available for the purpose.

  12. Evidence for Nuclear Tensor Polarization of Deuterium Molecules in Storage Cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    van den Brand, J.; Bulten, H.; Zhou, Z.

    1997-02-01

    Deuterium molecules were obtained by recombination, on a copper surface, of deuterium atoms prepared in specific hyperfine states. The molecules were stored for about 5ms in an open-ended cylindrical cell, placed in a 23mT magnetic field, and their tensor polarization was measured by elastic scattering of 704MeV electrons. The results of the measurements are consistent with the deuterium molecules retaining the tensor polarization of the initial atoms. {copyright} {ital 1997} {ital The American Physical Society}

  13. Electron-induced hydrogen loss in uracil in a water cluster environment

    NASA Astrophysics Data System (ADS)

    Smyth, M.; Kohanoff, J.; Fabrikant, I. I.

    2014-05-01

    Low-energy electron-impact hydrogen loss due to dissociative electron attachment (DEA) to the uracil and thymine molecules in a water cluster environment is investigated theoretically. Only the A'-resonance contribution, describing the near-threshold behavior of DEA, is incorporated. Calculations are based on the nonlocal complex potential theory and the multiple scattering theory, and are performed for a model target with basic properties of uracil and thymine, surrounded by five water molecules. The DEA cross section is strongly enhanced when the attaching molecule is embedded in a water cluster. This growth is due to two effects: the increase of the resonance lifetime and the negative shift in the resonance position due to interaction of the intermediate negative ion with the surrounding water molecules. A similar effect was earlier found in DEA to chlorofluorocarbons.

  14. Unified description of H-atom-induced chemicurrents and inelastic scattering.

    PubMed

    Kandratsenka, Alexander; Jiang, Hongyan; Dorenkamp, Yvonne; Janke, Svenja M; Kammler, Marvin; Wodtke, Alec M; Bünermann, Oliver

    2018-01-23

    The Born-Oppenheimer approximation (BOA) provides the foundation for virtually all computational studies of chemical binding and reactivity, and it is the justification for the widely used "balls and springs" picture of molecules. The BOA assumes that nuclei effectively stand still on the timescale of electronic motion, due to their large masses relative to electrons. This implies electrons never change their energy quantum state. When molecules react, atoms must move, meaning that electrons may become excited in violation of the BOA. Such electronic excitation is clearly seen for: ( i ) Schottky diodes where H adsorption at Ag surfaces produces electrical "chemicurrent;" ( ii ) Au-based metal-insulator-metal (MIM) devices, where chemicurrents arise from H-H surface recombination; and ( iii ) Inelastic energy transfer, where H collisions with Au surfaces show H-atom translation excites the metal's electrons. As part of this work, we report isotopically selective hydrogen/deuterium (H/D) translational inelasticity measurements in collisions with Ag and Au. Together, these experiments provide an opportunity to test new theories that simultaneously describe both nuclear and electronic motion, a standing challenge to the field. Here, we show results of a recently developed first-principles theory that quantitatively explains both inelastic scattering experiments that probe nuclear motion and chemicurrent experiments that probe electronic excitation. The theory explains the magnitude of chemicurrents on Ag Schottky diodes and resolves an apparent paradox--chemicurrents exhibit a much larger isotope effect than does H/D inelastic scattering. It also explains why, unlike Ag-based Schottky diodes, Au-based MIM devices are insensitive to H adsorption.

  15. Ion-momentum imaging of dissociative attachment of electrons to molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Slaughter, D. S.; Belkacem, A.; McCurdy, C. W.

    Here, we present an overview of experiments and theory relevant to dissociative electron attachment studied by momentum imaging. We describe several key examples of characteristic transient anion dynamics in the form of small polyatomic electron-molecule systems. In each of these examples the so-called axial recoil approximation is found to break down due to correlation of the electronic and nuclear degrees of freedom of the transient anion. Guided by anion fragment momentum measurements and predictions of the electron scattering attachment probability in the molecular frame, we demonstrate that accurate predictions of the dissociation dynamics can be achieved without a detailed investigationmore » of the surface topology of the relevant electronic states or the fragment trajectories on those surfaces.« less

  16. Ion-momentum imaging of dissociative attachment of electrons to molecules

    DOE PAGES

    Slaughter, D. S.; Belkacem, A.; McCurdy, C. W.; ...

    2016-10-24

    Here, we present an overview of experiments and theory relevant to dissociative electron attachment studied by momentum imaging. We describe several key examples of characteristic transient anion dynamics in the form of small polyatomic electron-molecule systems. In each of these examples the so-called axial recoil approximation is found to break down due to correlation of the electronic and nuclear degrees of freedom of the transient anion. Guided by anion fragment momentum measurements and predictions of the electron scattering attachment probability in the molecular frame, we demonstrate that accurate predictions of the dissociation dynamics can be achieved without a detailed investigationmore » of the surface topology of the relevant electronic states or the fragment trajectories on those surfaces.« less

  17. A liquid diffraction analysis of sarcoplasmic reticulum. I. Compositional variation.

    PubMed Central

    Brady, G W; Fein, D B; Harder, M E; Spehr, R; Meissner, G

    1981-01-01

    Intensities of x-ray scattering from a series of fragmented rabbit muscle sarcoplasmic reticulum (SR) samples have been measured over the range x = 0.05 to s = 0.25. By varying the relative concentrations of lipid and protein (chiefly the Mg++-dependent, Ca++- stimulated ATPase) in the membranes of this series, and by employing methods of analysis appropriate to the scattering from binary liquid mixtures, we have identified the separable contributions of protein and lipid, and the protein-lipid interaction contributions to the total scattering profiles. The shape of the protein term is consistent with scattering from a cylindrical ATPase particle 142 A in length and 35 A in diameter. These data imply that the dominant ATPase species is monomeric. The protein-lipid interaction term has been analyzed by a novel treatment based on a determination of the pair correlation function between the electrons of the protein molecule with the electrons of the lipid bilayer in terms of the asymmetry of the transbilayer disposition of the protein. Applied to our results, the analysis indicates a fully asymmetric disposition of ATPase, in which one end of the molecule is contiguous with either the lumenal or cytoplasmic surface of the bilayer. PMID:6111360

  18. Single Molecule Spectroelectrochemistry of Interfacial Charge Transfer Dynamics In Hybrid Organic Solar Cell

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pan, Shanlin

    2014-11-16

    Our research under support of this DOE grant is focused on applied and fundamental aspects of model organic solar cell systems. Major accomplishments are: 1) we developed a spectroelectorchemistry technique of single molecule single nanoparticle method to study charge transfer between conjugated polymers and semiconductor at the single molecule level. The fluorescence of individual fluorescent polymers at semiconductor surfaces was shown to exhibit blinking behavior compared to molecules on glass substrates. Single molecule fluorescence excitation anisotropy measurements showed the conformation of the polymer molecules did not differ appreciably between glass and semiconductor substrates. The similarities in molecular conformation suggest thatmore » the observed differences in blinking activity are due to charge transfer between fluorescent polymer and semiconductor, which provides additional pathways between states of high and low fluorescence quantum efficiency. Similar spectroelectrochemistry work has been done for small organic dyes for understand their charge transfer dynamics on various substrates and electrochemical environments; 2) We developed a method of transferring semiconductor nanoparticles (NPs) and graphene oxide (GO) nanosheets into organic solvent for a potential electron acceptor in bulk heterojunction organic solar cells which employed polymer semiconductor as the electron donor. Electron transfer from the polymer semiconductor to semiconductor and GO in solutions and thin films was established through fluorescence spectroscopy and electroluminescence measurements. Solar cells containing these materials were constructed and evaluated using transient absorption spectroscopy and dynamic fluorescence techniques to understand the charge carrier generation and recombination events; 3) We invented a spectroelectorchemistry technique using light scattering and electroluminescence for rapid size determination and studying electrochemistry of single NPs in an electrochemical cell. For example, we are able to use this technique to track electroluminescence of single Au NPs, and the electrodeposition of individual Ag NPs in-situ. These metallic NPs are useful to enhance light harvesting in organic photovoltaic systems. The scattering at the surface of an indium tin oxide (ITO) working electrode was measured during a potential sweep. Utilizing Mie scattering theory and high resolution scanning electron microscopy (SEM), the scattering data were used to calculate current-potential curves depicting the electrodeposition of individual Ag NPs. The oxidation of individual presynthesized and electrodeposited Ag NPs was also investigated using fluorescence and DFS microscopies. Our work has produced 1 US provisional patent, 15 published manuscripts, 1 submitted and two additional in-writing manuscripts. 5 graduate students, 1 postdoctoral student, 1 visiting professor, and two undergraduate students have received research training in the area of electrochemistry and optical spectroscopy under support of this award.« less

  19. Electron scattering measurements from molecules of technological relevance

    NASA Astrophysics Data System (ADS)

    Jones, Darryl

    2014-10-01

    Biomass represents a significant opportunity to provide renewable and sustainable biofuels. Non-thermal atmospheric pressure plasmas provide an opportunity to efficiently breakdown the naturally-resilient biomass into its useful subunits. Free electrons produced in the plasma may assist in this process by inducing fragmentation though dissociative excitation, ionization or attachment processes. To assist in understanding and refining this process, we have performed electron energy loss experiments from phenol (C6H5OH), a key structural building block of biomass. This enables a quantitative assessment of the excited electronic states of phenol. Differential cross sections for the electron-driven excitation of phenol have also been obtained for incident electron energies in the 20--250 eV range and over 3--90° scattering angles. DBJ acknowledges financial support provided by an Australian Research Council DECRA.

  20. Setting up a Rayleigh Scattering Based Flow Measuring System in a Large Nozzle Testing Facility

    NASA Technical Reports Server (NTRS)

    Panda, Jayanta; Gomez, Carlos R.

    2002-01-01

    A molecular Rayleigh scattering based air density measurement system has been built in a large nozzle testing facility at NASA Glenn Research Center. The technique depends on the light scattering by gas molecules present in air; no artificial seeding is required. Light from a single mode, continuous wave laser was transmitted to the nozzle facility by optical fiber, and light scattered by gas molecules, at various points along the laser beam, is collected and measured by photon-counting electronics. By placing the laser beam and collection optics on synchronized traversing units, the point measurement technique is made effective for surveying density variation over a cross-section of the nozzle plume. Various difficulties associated with dust particles, stray light, high noise level and vibration are discussed. Finally, a limited amount of data from an underexpanded jet are presented and compared with expected variations to validate the technique.

  1. Spin-interaction effects for ultralong-range Rydberg molecules in a magnetic field

    NASA Astrophysics Data System (ADS)

    Hummel, Frederic; Fey, Christian; Schmelcher, Peter

    2018-04-01

    We investigate the fine and spin structure of ultralong-range Rydberg molecules exposed to a homogeneous magnetic field. Each molecule consists of a 87Rb Rydberg atom the outer electron of which interacts via spin-dependent s - and p -wave scattering with a polarizable 87Rb ground-state atom. Our model includes also the hyperfine structure of the ground-state atom as well as spin-orbit couplings of the Rydberg and ground-state atom. We focus on d -Rydberg states and principal quantum numbers n in the vicinity of 40. The electronic structure and vibrational states are determined in the framework of the Born-Oppenheimer approximation for varying field strengths ranging from a few up to hundred Gauss. The results show that the interplay between the scattering interactions and the spin couplings gives rise to a large variety of molecular states in different spin configurations as well as in different spatial arrangements that can be tuned by the magnetic field. This includes relatively regularly shaped energy surfaces in a regime where the Zeeman splitting is large compared to the scattering interaction but small compared to the Rydberg fine structure, as well as more complex structures for both weaker and stronger fields. We quantify the impact of spin couplings by comparing the extended theory to a spin-independent model.

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schaefer, Tim; Institut für Physikalische Chemie, Universität zu Köln, 50939 Köln; Schwab, Tobias

    A random scattering approach to enhance light extraction in white top-emitting organic light-emitting diodes (OLEDs) is reported. Through solution processing from fluorinated solvents, a nano-particle scattering layer (NPSL) can be deposited directly on top of small molecule OLEDs without affecting their electrical performance. The scattering length for light inside the NPSL is determined from transmission measurements and found to be in agreement with Mie scattering theory. Furthermore, the dependence of the light outcoupling enhancement on electron transport layer thickness is studied. Depending on the electron transport layer thickness, the NPSL enhances the external quantum efficiency of the investigated white OLEDsmore » by between 1.5 and 2.3-fold. For a device structure that has been optimized prior to application of the NPSL, the maximum external quantum efficiency is improved from 4.7% to 7.4% (1.6-fold improvement). In addition, the scattering layer strongly reduces the undesired shift in emission color with viewing angle.« less

  3. Importance of projectile-target interactions in the triple differential cross sections for Low energy (e,2e) ionization of aligned H2

    NASA Astrophysics Data System (ADS)

    Ali, Esam; Madison, Don; Ren, X.; Dorn, A.; Ning, Chuangang

    2014-10-01

    Experimental and theoretical Triple Differential Cross Sections (TDCS) are presented for electron impact ionization-excitation of the 2 sσg state of H2 in the perpendicular plane. The excited 2 sσg state immediately dissociates and the alignment of the molecule is determined by detecting one of the fragments. Results are presented for three different alignments in the xy-plane (scattering plane is xz)-alignment along y-axis, x-axis, and 45° between the x- and y-axes for incident electron energies of 4, 10, and 25 eV and different scattered electron angles of 20° and 30° in the perpendicular plane. Theoretical M4DW (molecular 4-body distorted wave) results are compared to experimental data, and overall we found reasonably good agreement between experiment and theory. The Results show that (e,2e) cross sections for excitation-ionization depend strongly on the orientation of the H2 molecule.

  4. Positronium ions and molecules

    NASA Technical Reports Server (NTRS)

    Ho, Y. K.

    1990-01-01

    Recent theoretical studies on positronium ions and molecules are discussed. A positronium ion is a three particle system consisting of two electrons in singlet spin state, and a positron. Recent studies include calculations of its binding energy, positron annihilation rate, and investigations of its doubly excited resonant states. A positronium molecule is a four body system consisting of two positrons and two electrons in an overall singlet spin state. The recent calculations of its binding energy against the dissociation into two positronium atoms, and studies of auto-detaching states in positronium molecules are discussed. These auto-dissociating states, which are believed to be part of the Rydberg series as a result of a positron attaching to a negatively charged positronium ion, Ps-, would appear as resonances in Ps-Ps scattering.

  5. Density functional theory study on Herzberg-Teller contribution in Raman scattering from 4-aminothiophenol-metal complex and metal-4-aminothiophenol-metal junction

    NASA Astrophysics Data System (ADS)

    Liu, Shasha; Zhao, Xiuming; Li, Yuanzuo; Zhao, Xiaohong; Chen, Maodu

    2009-06-01

    Density functional theory (DFT) and time-dependent DFT calculations have been performed to investigate the Raman scattering spectra of metal-molecule complex and metal-molecule-metal junction architectures interconnected with 4-aminothiophenol (PATP) molecule. The simulated profiles of normal Raman scattering (NRS) spectra for the two complexes (Ag2-PATP and PATP-Au2) and the two junctions (Ag2-PATP-Au2 and Au2-PATP-Ag2) are similar to each other, but exhibit obviously different Raman intensities. Due to the lager static polarizabilities of the two junctions, which directly influence the ground state chemical enhancement in NRS spectra, the calculated normal Raman intensities of them are stronger than those of two complexes by the factor of 102. We calculate preresonance Raman scattering (RRS) spectra with incident light at 1064 nm, which is much lower than the S1 electronic transition energy of complexes and junctions. Ag2-PATP-Au2 and Au2-PATP-Ag2 junctions yield higher Raman intensities than those of Ag2-PATP and PATP-Au2 complexes, especially for b2 modes. This effect is mainly attributed to charge transfer (CT) between the metal gap and the PAPT molecule which results in the occurrence of CT resonance enhancement. The calculated pre-RRS spectra strongly depend on the electronic transition state produced by new structures. With excitation at 514.5 nm, the calculated pre-RRS spectra of two complexes and two junctions are stronger than those of with excitation at 1064 nm. A charge difference densities methodology has been used to visually describe chemical enhancement mechanism of RRS spectrum. This methodology aims at visualizing intermolecular CT which provides direct evidence of the Herzberg-Teller mechanism.

  6. Analysis of multiple scattering contributions in electron-impact ionization of molecular hydrogen

    NASA Astrophysics Data System (ADS)

    Ren, Xueguang; Hossen, Khokon; Wang, Enliang; Pindzola, M. S.; Dorn, Alexander; Colgan, James

    2017-10-01

    We report a combined experimental and theoretical study on the low-energy (E 0 = 31.5 eV) electron-impact ionization of molecular hydrogen (H2). Triple differential cross sections are measured for a range of fixed emission angles of one outgoing electron between {θ }1=-70^\\circ and -130° covering the full 4π solid angle of the second electron. The energy sharing of the outgoing electrons varies from symmetric ({E}1={E}2=8 eV) to highly asymmetric (E 1 = 1 eV and E 2 = 15 eV). In addition to the binary and recoil lobes, a structure is observed perpendicular to the incoming beam direction which is due to multiple scattering of the projectile inside the molecular potential. The absolutely normalized experimental cross sections are compared with results from the time-dependent close-coupling (TDCC) calculations. Molecular alignment dependent TDCC results demonstrate that these structures are only present if the molecule axis is lying in the scattering plane.

  7. Photon scattering cross sections of H2 and He measured with synchrotron radiation

    NASA Technical Reports Server (NTRS)

    Ice, G. E.

    1977-01-01

    Total (elastic + inelastic) differential photon scattering cross sections have been measured for H2 gas and He, using an X-ray beam. Absolute measured cross sections agree with theory within the probable errors. Relative cross sections (normalized to theory at large S) agree to better than one percent with theoretical values calculated from wave functions that include the effect of electron-electron Coulomb correlation, but the data deviate significantly from theoretical independent-particle (e.g., Hartree-Fock) results. The ratios of measured absolute He cross sections to those of H2, at any given S, also agree to better than one percent with theoretical He-to-H2 cross-section ratios computed from correlated wave functions. It appears that photon scattering constitutes a very promising tool for probing electron correlation in light atoms and molecules.

  8. Site-Selection in Single-Molecule Junction for Highly Reproducible Molecular Electronics.

    PubMed

    Kaneko, Satoshi; Murai, Daigo; Marqués-González, Santiago; Nakamura, Hisao; Komoto, Yuki; Fujii, Shintaro; Nishino, Tomoaki; Ikeda, Katsuyoshi; Tsukagoshi, Kazuhito; Kiguchi, Manabu

    2016-02-03

    Adsorption sites of molecules critically determine the electric/photonic properties and the stability of heterogeneous molecule-metal interfaces. Then, selectivity of adsorption site is essential for development of the fields including organic electronics, catalysis, and biology. However, due to current technical limitations, site-selectivity, i.e., precise determination of the molecular adsorption site, remains a major challenge because of difficulty in precise selection of meaningful one among the sites. We have succeeded the single site-selection at a single-molecule junction by performing newly developed hybrid technique: simultaneous characterization of surface enhanced Raman scattering (SERS) and current-voltage (I-V) measurements. The I-V response of 1,4-benzenedithiol junctions reveals the existence of three metastable states arising from different adsorption sites. Notably, correlated SERS measurements show selectivity toward one of the adsorption sites: "bridge sites". This site-selectivity represents an essential step toward the reliable integration of individual molecules on metallic surfaces. Furthermore, the hybrid spectro-electric technique reveals the dependence of the SERS intensity on the strength of the molecule-metal interaction, showing the interdependence between the optical and electronic properties in single-molecule junctions.

  9. High Resolution UV Emission Spectroscopy of Molecules Excited by Electron Impact

    NASA Technical Reports Server (NTRS)

    James, G. K.; Ajello, J. M.; Beegle, L.; Ciocca, M.; Dziczek, D.; Kanik, I.; Noren, C.; Jonin, C.; Hansen, D.

    1999-01-01

    Photodissociation via discrete line absorption into predissociating Rydberg and valence states is the dominant destruction mechanism of CO and other molecules in the interstellar medium and molecular clouds. Accurate values for the rovibronic oscillator strengths of these transitions and predissociation yields of the excited states are required for input into the photochemical models that attempt to reproduce observed abundances. We report here on our latest experimental results of the electron collisional properties of CO and N2 obtained using the 3-meter high resolution single-scattering spectroscopic facility at JPL.

  10. Nonlinear X-Ray and Auger Spectroscopy at X-Ray Free-Electron Laser Sources

    NASA Astrophysics Data System (ADS)

    Rohringer, Nina

    2015-05-01

    X-ray free-electron lasers (XFELs) open the pathway to transfer non-linear spectroscopic techniques to the x-ray domain. A promising all x-ray pump probe technique is based on coherent stimulated electronic x-ray Raman scattering, which was recently demonstrated in atomic neon. By tuning the XFEL pulse to core-excited resonances, a few seed photons in the spectral tail of the XFEL pulse drive an avalanche of resonant inelastic x-ray scattering events, resulting in exponential amplification of the scattering signal by of 6-7 orders of magnitude. Analysis of the line profile of the emitted radiation permits to demonstrate the cross over from amplified spontaneous emission to coherent stimulated resonance scattering. In combination with statistical covariance mapping, a high-resolution spectrum of the resonant inelastic scattering process can be obtained, opening the path to coherent stimulated x-ray Raman spectroscopy. An extension of these ideas to molecules and a realistic feasibility study of stimulated electronic x-ray Raman scattering in CO will be presented. Challenges to realizing stimulated electronic x-ray Raman scattering at present-day XFEL sources will be discussed, corroborated by results of a recent experiment at the LCLS XFEL. Due to the small gain cross section in molecular targets, other nonlinear spectroscopic techniques such as nonlinear Auger spectroscopy could become a powerful alternative. Theory predictions of a novel pump probe technique based on resonant nonlinear Auger spectroscopic will be discussed and the method will be compared to stimulated x-ray Raman spectroscopy.

  11. On macromolecular refinement at subatomic resolution with interatomic scatterers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Afonine, Pavel V., E-mail: pafonine@lbl.gov; Grosse-Kunstleve, Ralf W.; Adams, Paul D.

    2007-11-01

    Modelling deformation electron density using interatomic scatters is simpler than multipolar methods, produces comparable results at subatomic resolution and can easily be applied to macromolecules. A study of the accurate electron-density distribution in molecular crystals at subatomic resolution (better than ∼1.0 Å) requires more detailed models than those based on independent spherical atoms. A tool that is conventionally used in small-molecule crystallography is the multipolar model. Even at upper resolution limits of 0.8–1.0 Å, the number of experimental data is insufficient for full multipolar model refinement. As an alternative, a simpler model composed of conventional independent spherical atoms augmented bymore » additional scatterers to model bonding effects has been proposed. Refinement of these mixed models for several benchmark data sets gave results that were comparable in quality with the results of multipolar refinement and superior to those for conventional models. Applications to several data sets of both small molecules and macromolecules are shown. These refinements were performed using the general-purpose macromolecular refinement module phenix.refine of the PHENIX package.« less

  12. Progress in Computational Electron-Molecule Collisions

    NASA Astrophysics Data System (ADS)

    Rescigno, Tn

    1997-10-01

    The past few years have witnessed tremendous progress in the development of sophisticated ab initio methods for treating collisions of slow electrons with isolated small molecules. Researchers in this area have benefited greatly from advances in computer technology; indeed, the advent of parallel computers has made it possible to carry out calculations at a level of sophistication inconceivable a decade ago. But bigger and faster computers are only part of the picture. Even with today's computers, the practical need to study electron collisions with the kinds of complex molecules and fragments encountered in real-world plasma processing environments is taxing present methods beyond their current capabilities. Since extrapolation of existing methods to handle increasingly larger targets will ultimately fail as it would require computational resources beyond any imagined, continued progress must also be linked to new theoretical developments. Some of the techniques recently introduced to address these problems will be discussed and illustrated with examples of electron-molecule collision calculations we have carried out on some fairly complex target gases encountered in processing plasmas. Electron-molecule scattering continues to pose many formidable theoretical and computational challenges. I will touch on some of the outstanding open questions.

  13. Second order Møller-Plesset and coupled cluster singles and doubles methods with complex basis functions for resonances in electron-molecule scattering

    DOE PAGES

    White, Alec F.; Epifanovsky, Evgeny; McCurdy, C. William; ...

    2017-06-21

    The method of complex basis functions is applied to molecular resonances at correlated levels of theory. Møller-Plesset perturbation theory at second order and equation-of-motion electron attachment coupled-cluster singles and doubles (EOM-EA-CCSD) methods based on a non-Hermitian self-consistent-field reference are used to compute accurate Siegert energies for shape resonances in small molecules including N 2 - , CO - , CO 2 - , and CH 2 O - . Analytic continuation of complex θ-trajectories is used to compute Siegert energies, and the θ-trajectories of energy differences are found to yield more consistent results than those of total energies.more » Furthermore, the ability of such methods to accurately compute complex potential energy surfaces is investigated, and the possibility of using EOM-EA-CCSD for Feshbach resonances is explored in the context of e-helium scattering.« less

  14. Second order Møller-Plesset and coupled cluster singles and doubles methods with complex basis functions for resonances in electron-molecule scattering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    White, Alec F.; Epifanovsky, Evgeny; McCurdy, C. William

    The method of complex basis functions is applied to molecular resonances at correlated levels of theory. Møller-Plesset perturbation theory at second order and equation-of-motion electron attachment coupled-cluster singles and doubles (EOM-EA-CCSD) methods based on a non-Hermitian self-consistent-field reference are used to compute accurate Siegert energies for shape resonances in small molecules including N 2 - , CO - , CO 2 - , and CH 2 O - . Analytic continuation of complex θ-trajectories is used to compute Siegert energies, and the θ-trajectories of energy differences are found to yield more consistent results than those of total energies.more » Furthermore, the ability of such methods to accurately compute complex potential energy surfaces is investigated, and the possibility of using EOM-EA-CCSD for Feshbach resonances is explored in the context of e-helium scattering.« less

  15. Quantum crystallography: A perspective.

    PubMed

    Massa, Lou; Matta, Chérif F

    2018-06-30

    Extraction of the complete quantum mechanics from X-ray scattering data is the ultimate goal of quantum crystallography. This article delivers a perspective for that possibility. It is desirable to have a method for the conversion of X-ray diffraction data into an electron density that reflects the antisymmetry of an N-electron wave function. A formalism for this was developed early on for the determination of a constrained idempotent one-body density matrix. The formalism ensures pure-state N-representability in the single determinant sense. Applications to crystals show that quantum mechanical density matrices of large molecules can be extracted from X-ray scattering data by implementing a fragmentation method termed the kernel energy method (KEM). It is shown how KEM can be used within the context of quantum crystallography to derive quantum mechanical properties of biological molecules (with low data-to-parameters ratio). © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  16. Observation of pendular butterfly Rydberg molecules

    PubMed Central

    Niederprüm, Thomas; Thomas, Oliver; Eichert, Tanita; Lippe, Carsten; Pérez-Ríos, Jesús; Greene, Chris H.; Ott, Herwig

    2016-01-01

    Engineering molecules with a tunable bond length and defined quantum states lies at the heart of quantum chemistry. The unconventional binding mechanism of Rydberg molecules makes them a promising candidate to implement such tunable molecules. A very peculiar type of Rydberg molecules are the so-called butterfly molecules, which are bound by a shape resonance in the electron–perturber scattering. Here we report the observation of these exotic molecules and employ their exceptional properties to engineer their bond length, vibrational state, angular momentum and orientation in a small electric field. Combining the variable bond length with their giant dipole moment of several hundred Debye, we observe counter-intuitive molecules which locate the average electron position beyond the internuclear distance. PMID:27703143

  17. A model calculation of coherence effects in the elastic backscattering of very low energy electrons (1-20 eV) from amorphous ice.

    PubMed

    Liljequist, David

    2012-01-01

    Backscattering of very low energy electrons in thin layers of amorphous ice is known to provide experimental data for the elastic and inelastic cross sections and indicates values to be expected in liquid water. The extraction of cross sections was based on a transport analysis consistent with Monte Carlo simulation of electron trajectories. However, at electron energies below 20 eV, quantum coherence effects may be important and trajectory-based methods may be in significant error. This possibility is here investigated by calculating quantum multiple elastic scattering of electrons in a simple model of a very small, thin foil of amorphous ice. The average quantum multiple elastic scattering of electrons is calculated for a large number of simulated foils, using a point-scatterer model for the water molecule and taking inelastic absorption into account. The calculation is compared with a corresponding trajectory simulation. The difference between average quantum scattering and trajectory simulation at energies below about 20 eV is large, in particular in the forward scattering direction, and is found to be almost entirely due to coherence effects associated with the short-range order in the amorphous ice. For electrons backscattered at the experimental detection angle (45° relative to the surface normal) the difference is however small except at electron energies below about 10 eV. Although coherence effects are in general found to be strong, the mean free path values derived by trajectory-based analysis may actually be in fair agreement with the result of an analysis based on quantum scattering, at least for electron energies larger than about 10 eV.

  18. A method to investigate the electron scattering characteristics of ultrathin metallic films by in situ electrical resistance measurements.

    PubMed

    Trindade, I G; Fermento, R; Leitão, D; Sousa, J B

    2009-07-01

    In this article, a method to measure the electrical resistivity/conductivity of metallic thin films during layer growth on specific underlayers is described. The in situ monitoring of an underlayer electrical resistance, its change upon the incoming of new material atoms/molecules, and the growth of a new layer are presented. The method is easy to implement and allows obtaining in situ experimental curves of electrical resistivity dependence upon film thickness with a subatomic resolution, providing insight in film growth microstructure characteristics, specular/diffuse electron scattering surfaces, and optimum film thicknesses.

  19. Nanoantenna harmonic sensor: theoretical analysis of contactless detection of molecules with light

    NASA Astrophysics Data System (ADS)

    Farhat, Mohamed; Cheng, Mark M. C.; Le, Khai Q.; Chen, Pai-Yen

    2015-10-01

    The nonlinear harmonic sensor is a popular wireless sensor and radiofrequency identification (RFID) technique, which allows high-performance sensing in a severe interference/clutter background by transmitting a radio wave and detecting its modulated higher-order harmonics. Here we introduce the concept and design of optical harmonic tags based on nonlinear nanoantennas that can contactlessly detect electronic (e.g. electron affinity) and optical (e.g. relative permittivity) characteristics of molecules. By using a dual-resonance gold-molecule-silver nanodipole antenna within the quantum mechanical realm, the spectral form of the second-harmonic scattering can sensitively reveal the physical properties of molecules, paving a new route towards optical molecular sensors and optical identification (OPID) of biological, genetic, and medical events for the ‘Internet of Nano-Things’.

  20. Nanoantenna harmonic sensor: theoretical analysis of contactless detection of molecules with light.

    PubMed

    Farhat, Mohamed; Cheng, Mark M C; Le, Khai Q; Chen, Pai-Yen

    2015-10-16

    The nonlinear harmonic sensor is a popular wireless sensor and radiofrequency identification (RFID) technique, which allows high-performance sensing in a severe interference/clutter background by transmitting a radio wave and detecting its modulated higher-order harmonics. Here we introduce the concept and design of optical harmonic tags based on nonlinear nanoantennas that can contactlessly detect electronic (e.g. electron affinity) and optical (e.g. relative permittivity) characteristics of molecules. By using a dual-resonance gold-molecule-silver nanodipole antenna within the quantum mechanical realm, the spectral form of the second-harmonic scattering can sensitively reveal the physical properties of molecules, paving a new route towards optical molecular sensors and optical identification (OPID) of biological, genetic, and medical events for the 'Internet of Nano-Things'.

  1. Phthalocyanine adsorption to graphene on Ir(111): Evidence for decoupling from vibrational spectroscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Endlich, M., E-mail: michael.endlich@tu-ilmenau.de; Gozdzik, S.; Néel, N.

    2014-11-14

    Phthalocyanine molecules have been adsorbed to Ir(111) and to graphene on Ir(111). From a comparison of scanning tunneling microscopy images of individual molecules adsorbed to the different surfaces alone it is difficult to discern potential differences in the molecular adsorption geometry. In contrast, vibrational spectroscopy using inelastic electron scattering unequivocally hints at strong molecule deformations on Ir(111) and at a planar adsorption geometry on graphene. The spectroscopic evidence for the different adsorption configurations is supported by density functional calculations.

  2. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  3. Excitation of lowest electronic states of the uracil molecule by slow electrons

    NASA Astrophysics Data System (ADS)

    Chernyshova, I. V.; Kontros, J. E.; Markush, P. P.; Shpenik, O. B.

    2012-07-01

    The excitation of lowest electronic states of the uracil molecule in the gas phase has been studied by electron energy loss spectroscopy. Along with excitation of lowest singlet states, excitation of two lowest triplet states at 3.75 and 4.76 eV (±0.05 eV) and vibrational excitation of the molecule in two resonant ranges (1-2 and 3-4 eV) have been observed for the first time. The peak of the excitation band related to the lowest singlet state (5.50 eV) is found to be blueshifted by 0.4 eV in comparison with the optical absorption spectroscopy data. The threshold excitation spectra have been measured for the first time, with detection of electrons inelastically scattered by an angle of 180°. These spectra exhibit clear separation of the 5.50-eV-wide band into two bands, which are due to the excitation of the triplet 13 A″ and singlet 11 A' states.

  4. Electron-induced scattering dynamics of Boron, Aluminium and Gallium trihalides in the intermediate energy domain

    NASA Astrophysics Data System (ADS)

    Verma, Pankaj; Alam, Mohammad Jane; Ahmad, Shabbir; Antony, Bobby

    2018-05-01

    This article is focused on the calculation of electron-induced ionisation and total scattering cross sections by Boron, Aluminium and Gallium trihalide molecules in the intermediate energy domain. The computational formalism, spherical complex optical potential has been employed for the study of these two scattering cross sections. The ionisation cross section has been derived from the inelastic cross section using a semi-empirical method called complex scattering potential-ionisation contribution (CSP-ic) method. We have also calculated the ionisation cross section using the BEB theory with Hartree-Fock and density functional theory (DFT- ωB97XD) orbitals so that a comparison can be made with the cross sections predicted by CSP-ic method. For this theoretical study, we have also calculated polarisability and bond length of some targets which were not found in literature using DFT/B3LYP in Gaussian 09 software.

  5. Photoelectron diffraction from single oriented molecules: Towards ultrafast structure determination of molecules using x-ray free-electron lasers

    NASA Astrophysics Data System (ADS)

    Kazama, Misato; Fujikawa, Takashi; Kishimoto, Naoki; Mizuno, Tomoya; Adachi, Jun-ichi; Yagishita, Akira

    2013-06-01

    We provide a molecular structure determination method, based on multiple-scattering x-ray photoelectron diffraction (XPD) calculations. This method is applied to our XPD data on several molecules having different equilibrium geometries. Then it is confirmed that, by our method, bond lengths and bond angles can be determined with a resolution of less than 0.1 Å and 10∘, respectively. Differently from any other scenario of ultrafast structure determination, we measure the two- or three-dimensional XPD of aligned or oriented molecules in the energy range from 100 to 200 eV with a 4π detection velocity map imaging spectrometer. Thanks to the intense and ultrashort pulse properties of x-ray free-electron lasers, our approach exhibits the most probable method for obtaining ultrafast real-time structural information on small to medium-sized molecules consisting of light elements, i.e., a “molecular movie.”

  6. Triple differential cross section measurements for the outer valence molecular orbitals (1t2) of a methane molecule at 250 eV electron impact

    NASA Astrophysics Data System (ADS)

    Işık, N.; Doğan, M.; Bahçeli, S.

    2016-03-01

    In this study, detailed experimental research of triple differential cross section (TDCS) measurements is performed to investigate single ionization dynamics for the 1t2 orbital of methane molecule by 250 eV electron impact. In our experiments, the outgoing electrons are simultaneously measured in coincidence in a coplanar asymmetric geometry with the scattering angles of 10° and 20°. Therefore, TDCS measurements are performed for two different values of momentum transfer (K ≈ 0.9 au and 1.5 au). A detailed analysis of the dependence of the TDCS versus the momentum transfer is reported here.

  7. The Schwinger Variational Method

    NASA Technical Reports Server (NTRS)

    Huo, Winifred M.

    1995-01-01

    Variational methods have proven invaluable in theoretical physics and chemistry, both for bound state problems and for the study of collision phenomena. The application of the Schwinger variational (SV) method to e-molecule collisions and molecular photoionization has been reviewed previously. The present chapter discusses the implementation of the SV method as applied to e-molecule collisions. Since this is not a review of cross section data, cross sections are presented only to server as illustrative examples. In the SV method, the correct boundary condition is automatically incorporated through the use of Green's function. Thus SV calculations can employ basis functions with arbitrary boundary conditions. The iterative Schwinger method has been used extensively to study molecular photoionization. For e-molecule collisions, it is used at the static exchange level to study elastic scattering and coupled with the distorted wave approximation to study electronically inelastic scattering.

  8. Resonant inelastic x-ray scattering and photoemission measurement of O2: Direct evidence for dependence of Rydberg-valence mixing on vibrational states in O 1s → Rydberg states

    NASA Astrophysics Data System (ADS)

    Gejo, T.; Oura, M.; Tokushima, T.; Horikawa, Y.; Arai, H.; Shin, S.; Kimberg, V.; Kosugi, N.

    2017-07-01

    High-resolution resonant inelastic x-ray scattering (RIXS) and low-energy photoemission spectra of oxygen molecules have been measured for investigating the electronic structure of Rydberg states in the O 1s → σ* energy region. The electronic characteristics of each Rydberg state have been successfully observed, and new assignments are made for several states. The RIXS spectra clearly show that vibrational excitation is very sensitive to the electronic characteristics because of Rydberg-valence mixing and vibronic coupling in O2. This observation constitutes direct experimental evidence that the Rydberg-valence mixing characteristic depends on the vibrational excitation near the avoided crossing of potential surfaces. We also measured the photoemission spectra of metastable oxygen atoms (O*) from O2 excited to 1s → Rydberg states. The broadening of the 4p Rydberg states of O* has been found with isotropic behavior, implying that excited oxygen molecules undergo dissociation with a lifetime of the order of 10 fs in 1s → Rydberg states.

  9. Graphene-based textured surface by pulsed laser deposition as a robust platform for surface enhanced Raman scattering applications

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tite, T.; Donnet, C.; Loir, A.-S.

    We have developed a surface enhanced Raman scattering (SERS)-active substrate based on gold nanoparticles-decorated few-layer (fl) graphene grown by pulsed laser deposition. Diamond-Like Carbon film has been converted to fl-graphene after thermal annealing at low temperature. The formation of fl-graphene was confirmed by Raman spectroscopy, and surface morphology was highlighted by scanning electron microscopy. We found that textured fl-graphene film with nanoscale roughness was highly beneficial for SERS detection. Rhodamine 6G and p-aminothiophenol proposed as test molecules were detected with high sensitivity. The detection at low concentration of deltamethrin, an active molecule of a commercial pesticide was further demonstrated.

  10. Stochastic stimulated electronic x-ray Raman spectroscopy

    PubMed Central

    Kimberg, Victor; Rohringer, Nina

    2016-01-01

    Resonant inelastic x-ray scattering (RIXS) is a well-established tool for studying electronic, nuclear, and collective dynamics of excited atoms, molecules, and solids. An extension of this powerful method to a time-resolved probe technique at x-ray free electron lasers (XFELs) to ultimately unravel ultrafast chemical and structural changes on a femtosecond time scale is often challenging, due to the small signal rate in conventional implementations at XFELs that rely on the usage of a monochromator setup to select a small frequency band of the broadband, spectrally incoherent XFEL radiation. Here, we suggest an alternative approach, based on stochastic spectroscopy, which uses the full bandwidth of the incoming XFEL pulses. Our proposed method is relying on stimulated resonant inelastic x-ray scattering, where in addition to a pump pulse that resonantly excites the system a probe pulse on a specific electronic inelastic transition is provided, which serves as a seed in the stimulated scattering process. The limited spectral coherence of the XFEL radiation defines the energy resolution in this process and stimulated RIXS spectra of high resolution can be obtained by covariance analysis of the transmitted spectra. We present a detailed feasibility study and predict signal strengths for realistic XFEL parameters for the CO molecule resonantly pumped at the O1s→π* transition. Our theoretical model describes the evolution of the spectral and temporal characteristics of the transmitted x-ray radiation, by solving the equation of motion for the electronic and vibrational degrees of freedom of the system self consistently with the propagation by Maxwell equations. PMID:26958585

  11. Total electron count variability and stratospheric ozone effects on solar backscatter and LWIR emissions

    DTIC Science & Technology

    2017-03-10

    electromagnetic radiation that propagates through a planetary atmosphere. These codes vary in the extent of their scope, incorporated models, and derived...emissive properties of the atmosphere. The propagation of electromagnetic radiation is affected by the scattering and absorption by both air molecules...Mie theory is the collection of the Mie solutions and methods to Maxwell’s Equations, which 35 describe how electromagnetic waves are scattered by

  12. Generation of Gigawatt Circularly Polarized Attosecond-Pulse Pairs

    NASA Astrophysics Data System (ADS)

    Hu, K.; Wu, H.-C.

    2017-12-01

    A novel scheme for generating a pair of gigawatt attosecond pulses by coherent Thomson scattering from relativistic electron sheets is proposed. With a circularly polarized relativistic laser pulse, the scattered x-ray signal can have a saddlelike temporal profile, where the lower electromagnetic frequencies are found mostly in the center region of this saddlelike profile. By filtering out the latter, we can obtain two few-attosecond pulses separated by a subfemtosecond interval, which is tunable by controlling the energy of the sheet electrons. Such a pulse pair can be useful for an attosecond pump probe at an unprecedented time resolution and for ultrafast chiral studies in molecules and materials.

  13. Crossed-beam experiment for the scattering of low- and intermediate-energy electrons from BF{sub 3}: A comparative study with XF{sub 3} (X = C, N, and CH) molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoshino, M., E-mail: masami-h@sophia.ac.jp; Suga, A.; Kato, H.

    2015-07-14

    Absolute differential cross sections (DCSs) for electron interaction with BF{sub 3} molecules have been measured in the impact energy range of 1.5–200 eV and recorded over a scattering angle range of 15°–150°. These angular distributions have been normalized by reference to the elastic DCSs of the He atom and integrated by employing a modified phase shift analysis procedure to generate integral cross sections (ICSs) and momentum transfer cross sections (MTCSs). The calculations of DCSs and ICSs have been carried out using an independent atom model under the screening corrected additivity rule (IAM-SCAR). The present elastic DCSs have been found tomore » agree well with the results of IAM-SCAR calculation above 20 eV, and also with a recent Schwinger multichannel calculation below 30 eV. Furthermore, in the comparison with the XF{sub 3} (X = B, C, N, and CH) molecules, the elastic DCSs reveal a similar angular distribution which are approximately equal in magnitude from 30 to 200 eV. This feature suggests that the elastic scattering is dominated virtually by the 3-outer fluorine atoms surrounding the XF{sub 3} molecules. The vibrational DCSs have also been obtained in the energy range of 1.5–15 eV and vibrational analysis based on the angular correlation theory has been carried out to explain the nature of the shape resonances. Limited experiments on vibrational inelastic scattering confirmed the existence of a shape resonance with a peak at 3.8 eV, which is also observed in the vibrational ICS. Finally, the estimated elastic ICSs, MTCSs, as well as total cross sections are compared with the previous cross section data available.« less

  14. Anisotropy enhanced X-ray scattering from solvated transition metal complexes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Biasin, Elisa; van Driel, Tim B.; Levi, Gianluca

    Time-resolved X-ray scattering patterns from photoexcited molecules in solution are in many cases anisotropic at the ultrafast time scales accessible at X-ray free-electron lasers (XFELs). This anisotropy arises from the interaction of a linearly polarized UV–Vis pump laser pulse with the sample, which induces anisotropic structural changes that can be captured by femtosecond X-ray pulses. In this work, a method for quantitative analysis of the anisotropic scattering signal arising from an ensemble of molecules is described, and it is demonstrated how its use can enhance the structural sensitivity of the time-resolved X-ray scattering experiment. This method is applied on time-resolvedmore » X-ray scattering patterns measured upon photoexcitation of a solvated di-platinum complex at an XFEL, and the key parameters involved are explored. Here it is shown that a combined analysis of the anisotropic and isotropic difference scattering signals in this experiment allows a more precise determination of the main photoinduced structural change in the solute,i.e.the change in Pt—Pt bond length, and yields more information on the excitation channels than the analysis of the isotropic scattering only. Finally, it is discussed how the anisotropic transient response of the solvent can enable the determination of key experimental parameters such as the instrument response function.« less

  15. Anisotropy enhanced X-ray scattering from solvated transition metal complexes

    DOE PAGES

    Biasin, Elisa; van Driel, Tim B.; Levi, Gianluca; ...

    2018-02-13

    Time-resolved X-ray scattering patterns from photoexcited molecules in solution are in many cases anisotropic at the ultrafast time scales accessible at X-ray free-electron lasers (XFELs). This anisotropy arises from the interaction of a linearly polarized UV–Vis pump laser pulse with the sample, which induces anisotropic structural changes that can be captured by femtosecond X-ray pulses. In this work, a method for quantitative analysis of the anisotropic scattering signal arising from an ensemble of molecules is described, and it is demonstrated how its use can enhance the structural sensitivity of the time-resolved X-ray scattering experiment. This method is applied on time-resolvedmore » X-ray scattering patterns measured upon photoexcitation of a solvated di-platinum complex at an XFEL, and the key parameters involved are explored. Here it is shown that a combined analysis of the anisotropic and isotropic difference scattering signals in this experiment allows a more precise determination of the main photoinduced structural change in the solute,i.e.the change in Pt—Pt bond length, and yields more information on the excitation channels than the analysis of the isotropic scattering only. Finally, it is discussed how the anisotropic transient response of the solvent can enable the determination of key experimental parameters such as the instrument response function.« less

  16. Electron Collisions in our Atmosphere — How the Microscopic Drives the Macroscopic

    NASA Astrophysics Data System (ADS)

    Buckman, S. J.; Brunger, M. J.; Campbell, L.; Jelisavcic, M.; Petrovic, Z. Lj.

    2005-05-01

    Recent measurements of low energy, absolute electron scattering cross sections for vibrational excitation of NO have been used to update the cross set used for modeling atmospheric auroral processes. These new cross sections, which highlight the role that intermediate negative ions (resonances) play at energies below 5 eV in mediating vibrational excitation, also indicate that electron-driven processes play an important role in the infrared (˜5 um) auroral emissions from the NO molecule.

  17. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    NASA Astrophysics Data System (ADS)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  18. Gate-controlled current and inelastic electron tunneling spectrum of benzene: a self-consistent study.

    PubMed

    Liang, Y Y; Chen, H; Mizuseki, H; Kawazoe, Y

    2011-04-14

    We use density functional theory based nonequilibrium Green's function to self-consistently study the current through the 1,4-benzenedithiol (BDT). The elastic and inelastic tunneling properties through this Au-BDT-Au molecular junction are simulated, respectively. For the elastic tunneling case, it is found that the current through the tilted molecule can be modulated effectively by the external gate field, which is perpendicular to the phenyl ring. The gate voltage amplification comes from the modulation of the interaction between the electrodes and the molecules in the junctions. For the inelastic case, the electron tunneling scattered by the molecular vibrational modes is considered within the self-consistent Born approximation scheme, and the inelastic electron tunneling spectrum is calculated.

  19. Differential cross sections for electron impact excitation of the Herzberg pseudocontinuum of molecular oxygen

    NASA Astrophysics Data System (ADS)

    Green, M. A.; Maddern, T.; Brunger, M. J.; Campbell, L.; Cartwright, D. C.; Newell, W. R.; Teubner, P. J. O.

    2002-09-01

    We report differential cross sections (DCSs) for electron impact excitation of the sum (c1Σ u- + A'3 Δ u + A3 Σ u+) of the three states that constitute the Herzberg pseudocontinuum in O2. These DCSs were measured at seven incident electron energies in the range 9-20 eV and over the scattered electron angular range 10-90°. We note that this represents a far more detailed study than has hitherto previously been reported. In their review on electron-diatomic molecule scattering systems, Brunger and Buckman (Brunger M J and Buckman S J 2002 Phys. Rep. 357 215) clearly identified gaps in our knowledge for electron impact excitation of the Herzberg electronic states. The present study rectifies this situation and, additionally, seeks to stimulate theoreticians to extend their existing integral cross section calculations, for the c1 Σ u-, A'3 Δ u and A3 Σ u+ states, to the DCS-level.

  20. Quantum Detection and Invisibility in Coherent Nanostructures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fransson, J.

    2010-04-28

    We address quantum invisibility in the context of electronics in nanoscale quantum structures. In analogy with metamaterials, we use the freedom of design that quantum corrals provide and show that quantum mechanical objects can be hidden inside the corral, with respect to inelastic electron scattering spectroscopy in combination with scanning tunneling microscopy, and we propose a design strategy. A simple illustration of the invisibility is given in terms of an elliptic quantum corral containing a molecule, with a local vibrational mode, at one of the foci. Our work has implications to quantum information technology and presents new tools for nonlocalmore » quantum detection and distinguishing between different molecules.« less

  1. Quantum interference in multi-branched molecules: The exact transfer matrix solutions.

    PubMed

    Jiang, Yu

    2017-12-07

    We present a transfer matrix formalism for studying quantum interference in a single molecule electronic system with internal branched structures. Based on the Schrödinger equation with the Bethe ansatz and employing Kirchhoff's rule for quantum wires, we derive a general closed-form expression for the transmission and reflection amplitudes of a two-port quantum network. We show that the transport through a molecule with complex internal structures can be reduced to that of a single two-port scattering unit, which contains all the information of the original composite molecule. Our method allows for the calculation of the transmission coefficient for various types of individual molecular modules giving rise to different resonant transport behaviors such as the Breit-Wigner, Fano, and Mach-Zehnder resonances. As an illustration, we first re-derive the transmittance of the Aharonov-Bohm ring, and then we apply our formulation to N identical parity-time (PT)-symmetric potentials, connected in series as well as in parallel. It is shown that the spectral singularities and PT-symmetric transitions of single scattering cells may be observed in coupled systems. Such transitions may occur at the same or distinct values of the critical parameters, depending on the connection modes under which the scattering objects are coupled.

  2. Three-dimensional structure determination protocol for noncrystalline biomolecules using x-ray free-electron laser diffraction imaging.

    PubMed

    Oroguchi, Tomotaka; Nakasako, Masayoshi

    2013-02-01

    Coherent and intense x-ray pulses generated by x-ray free-electron laser (XFEL) sources are paving the way for structural determination of noncrystalline biomolecules. However, due to the small scattering cross section of electrons for x rays, the available incident x-ray intensity of XFEL sources, which is currently in the range of 10(12)-10(13) photons/μm(2)/pulse, is lower than that necessary to perform single-molecule diffraction experiments for noncrystalline biomolecules even with the molecular masses of megadalton and submicrometer dimensions. Here, we propose an experimental protocol and analysis method for visualizing the structure of those biomolecules by the combined application of coherent x-ray diffraction imaging and three-dimensional reconstruction methods. To compensate the small scattering cross section of biomolecules, in our protocol, a thin vitreous ice plate containing several hundred biomolecules/μm(2) is used as sample, a setup similar to that utilized by single-molecule cryoelectron microscopy. The scattering cross section of such an ice plate is far larger than that of a single particle. The images of biomolecules contained within irradiated areas are then retrieved from each diffraction pattern, and finally provide the three-dimensional electron density model. A realistic atomic simulation using large-scale computations proposed that the three-dimensional structure determination of the 50S ribosomal subunit embedded in a vitreous ice plate is possible at a resolution of 0.8 nm when an x-ray beam of 10(16) photons/500×500 nm(2)/pulse is available.

  3. HREELS to identify electronic structures of organic thin films.

    PubMed

    Oeter, D; Ziegler, C; Göpel, W

    1995-10-01

    The electronic structure of alpha-oligothiophene (alphanT) thin films has been investigated for increasing chain lengths of n= 4-8 thiophene units with high resolution electron energy loss spectroscopy (HREELS) in the specular reflection geometry at a primary energy of 15 eV. The great advantage of this technique in contrast to UV/VIS absorption spectroscopy results from the fact, that the impact scattering mechanism of HREELS makes it possible to also detect optically forbidden electronic transitions. On the other hand, the electrons used as probes in HREELS have a wavelength which is two orders of magnitudes smaller if compared to those of photons used in UV/VIS absorption spectroscopy. Therefore individual molecules are excited by HREELS independent from each other and hence the excitation of collective excitons is not possible. As a result, information about the orientation of the molecules cannot be achieved with HREELS, which, however, is possible in polarization-dependent UV/VIS spectroscopy.

  4. Tables of the coefficients A

    NASA Technical Reports Server (NTRS)

    Chandra, N.

    1974-01-01

    Numerical coefficients required to express the angular distribution for the rotationally elastic or inelastic scattering of electrons from a diatomic molecule were tabulated for the case of nitrogen and in the energy range from 0.20 eV to 10.0 eV. Five different rotational states are considered.

  5. Photoionization and pseudopotentials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Costa, Romarly F. da; Lima, Marco A.P.; Ferreira, Luiz G.

    2003-05-01

    Transferability of norm-conserving pseudopotentials to low-energy electron-molecule scattering processes has been very successful [Bettega et al., Phys. Rev. A 47, 1111 (1993)]. In this paper we discuss the possibility of using effective potentials in calculations of valence electrons photoionization cross sections. Through atomic targets, we illustrate that pseudopotentials can be optimized to give cross sections in good agreement with all-electron calculations. The present work represents a first step towards more elaborate computer programs for photoionization of molecular targets containing heavy atoms.

  6. Cross sections for electron scattering by carbon disulfide in the low- and intermediate-energy range

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brescansin, L. M.; Iga, I.; Lee, M.-T.

    2010-01-15

    In this work, we report a theoretical study on e{sup -}-CS{sub 2} collisions in the low- and intermediate-energy ranges. Elastic differential, integral, and momentum-transfer cross sections, as well as grand total (elastic + inelastic) and absorption cross sections, are reported in the 1-1000 eV range. A recently proposed complex optical potential composed of static, exchange, and correlation-polarization plus absorption contributions is used to describe the electron-molecule interaction. The Schwinger variational iterative method combined with the distorted-wave approximation is applied to calculate the scattering amplitudes. The comparison between our calculated results and the existing experimental and/or theoretical results is encouraging.

  7. Surface-enhanced Raman scattering on single-wall carbon nanotubes.

    PubMed

    Kneipp, Katrin; Kneipp, Harald; Dresselhaus, Mildred S; Lefrant, Serge

    2004-11-15

    Exploiting the effect of surface-enhanced Raman scattering (SERS), the Raman signal of single-wall carbon nanotubes (SWNTs) can be enhanced by up to 14 orders of magnitude when the tubes are in contact with silver or gold nanostructures and Raman scattering takes place predominantly in the enhanced local optical fields of the nanostructures. Such a level of enhancement offers exciting opportunities for ultrasensitive Raman studies on SWNTs and allows resonant and non-resonant Raman experiments to be done on single SWNTs at relatively high signal levels. Since the optical fields are highly localized within so-called "hot spots" on fractal silver colloidal clusters, lateral confinement of the Raman scattering can be as small as 5 nm, allowing spectroscopic selection of a single nanotube from a larger population. Moreover, since SWNTs are very stable "artificial molecules" with a high aspect ratio and a strong electron-phonon coupling, they are unique "test molecules" for investigating the SERS effect itself and for probing the "electromagnetic field contribution" and "charge transfer contribution" to the effect. SERS is also a powerful tool for monitoring the "chemical" interaction between the nanotube and the metal nanostructure.

  8. Low-Energy Electron Scattering by Sugarcane Lignocellulosic Biomass Molecules

    NASA Astrophysics Data System (ADS)

    Oliveira, Eliane; Sanchez, Sergio; Bettega, Marcio; Lima, Marco; Varella, Marcio

    2012-06-01

    The use of second generation (SG) bioethanol instead of fossil fuels could be a good strategy to reduce greenhouse gas emissions. However, the efficient production of SG bioethanol has being a challenge to researchers around the world. The main barrier one must overcome is the pretreatment, a very important step in SG bioethanol aimed at breaking down the biomass and facilitates the extraction of sugars from the biomass. Plasma-based treatment, which can generate reactive species, could be an interesting possibility since involves low-cost atmospheric-pressure plasma. In order to offer theoretical support to this technique, the interaction of low-energy electrons from the plasma with biomass is investigated. This study was motived by several works developed by Sanche et al., in which they understood that DNA damage arises from dissociative electron attachment, a mechanism in which electrons are resonantly trapped by DNA subunits. We will present elastic cross sections for low-energy electron scattering by sugarcane biomass molecules, obtained with the Schwinger multichannel method. Our calculations indicate the formation of π* shape resonances in the lignin subunits, while a series of broad and overlapping σ* resonances are found in cellulose and hemicellulose subunits. The presence of π* and σ* resonances could give rise to direct and indirect dissociation pathways in biomass. Then, theoretical resonance energies can be useful to guide the plasma-based pretreatment to break down specific linkages of interest in biomass.

  9. Transmission effects in unfolding electronic-vibrational electron-molecule energy-loss spectra

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang Shiyang; Khakoo, Murtadha A.; Johnson, Paul V.

    2006-03-15

    The results of an investigation concerning the sensitivity of conventional unfolding methods applied to electronic-vibrational electron-energy-loss spectra to the transmission efficiency of electron spectrometers are presented. This investigation was made in an effort to understand differences in the differential cross sections for excitation of low-lying electronic states determined experimentally by various groups using electronic-vibrational energy-loss spectra of N{sub 2}. In these experiments, very similar spectral unfolding methods were used, which relied on similar Franck-Condon factors. However, the overall analyses of the electron scattering spectra (by the individual groups) resulted in large differences among the differential cross sections determined from thesemore » energy-loss spectra. The transmission response of the experimental apparatus to different-energy scattered electrons has often been discussed as a key factor that caused these disagreements. The present investigation shows in contrast that the effect of transmission is smaller than that required to independently explain such differences, implying that other systematic effects are responsible for the existing differences between measurements.« less

  10. Resonant stimulation of Raman scattering from single-crystal thiophene/phenylene co-oligomers

    NASA Astrophysics Data System (ADS)

    Yanagi, Hisao; Marutani, Yusuke; Matsuoka, Naoki; Hiramatsu, Toru; Ishizumi, Atsushi; Sasaki, Fumio; Hotta, Shu

    2013-12-01

    Amplified Raman scattering was observed from single crystals of thiophene/phenylene co-oligomers (TPCOs). Under ns-pulsed excitation, the TPCO crystals exhibited amplified spontaneous emission (ASE) at resonant absorption wavelengths. With increasing excitation wavelength to the 0-0 absorption edge, the stimulated resonant Raman peaks appeared both in the 0-1 and 0-2 ASE band regions. When the excitation wavelength coincided with the 0-1 ASE band energy, the Raman peaks selectively appeared in the 0-2 ASE band. Such unusual enhancement of the 0-2 Raman scattering was ascribed to resonant stimulation via vibronic coupling with electronic transitions in the uniaxially oriented TPCO molecules.

  11. Ab initio structure determination from prion nanocrystals at atomic resolution by MicroED

    PubMed Central

    Sawaya, Michael R.; Rodriguez, Jose; Cascio, Duilio; Collazo, Michael J.; Shi, Dan; Reyes, Francis E.; Gonen, Tamir; Eisenberg, David S.

    2016-01-01

    Electrons, because of their strong interaction with matter, produce high-resolution diffraction patterns from tiny 3D crystals only a few hundred nanometers thick in a frozen-hydrated state. This discovery offers the prospect of facile structure determination of complex biological macromolecules, which cannot be coaxed to form crystals large enough for conventional crystallography or cannot easily be produced in sufficient quantities. Two potential obstacles stand in the way. The first is a phenomenon known as dynamical scattering, in which multiple scattering events scramble the recorded electron diffraction intensities so that they are no longer informative of the crystallized molecule. The second obstacle is the lack of a proven means of de novo phase determination, as is required if the molecule crystallized is insufficiently similar to one that has been previously determined. We show with four structures of the amyloid core of the Sup35 prion protein that, if the diffraction resolution is high enough, sufficiently accurate phases can be obtained by direct methods with the cryo-EM method microelectron diffraction (MicroED), just as in X-ray diffraction. The success of these four experiments dispels the concern that dynamical scattering is an obstacle to ab initio phasing by MicroED and suggests that structures of novel macromolecules can also be determined by direct methods. PMID:27647903

  12. Excitation laser energy dependence of surface-enhanced fluorescence showing plasmon-induced ultrafast electronic dynamics in dye molecules

    NASA Astrophysics Data System (ADS)

    Itoh, Tamitake; Yamamoto, Yuko S.; Tamaru, Hiroharu; Biju, Vasudevanpillai; Murase, Norio; Ozaki, Yukihiro

    2013-06-01

    We find unique properties accompanying surface-enhanced fluorescence (SEF) from dye molecules adsorbed on Ag nanoparticle aggregates, which generate surface-enhanced Raman scattering. The properties are observed in excitation laser energy dependence of SEF after excluding plasmonic spectral modulation in SEF. The unique properties are large blue shifts of fluorescence spectra, deviation of ratios between anti-Stokes SEF intensity and Stokes from those of normal fluorescence, super-broadening of Stokes spectra, and returning to original fluorescence by lower energy excitation. We elucidate that these properties are induced by electromagnetic enhancement of radiative decay rates exceeding the vibrational relaxation rates within an electronic excited state, which suggests that molecular electronic dynamics in strong plasmonic fields can be largely deviated from that in free space.

  13. Electronic levels and charge distribution near the interface of nickel

    NASA Technical Reports Server (NTRS)

    Waber, J. T.

    1982-01-01

    The energy levels in clusters of nickel atoms were investigated by means of a series of cluster calculations using both the multiple scattering and computational techniques (designated SSO) which avoids the muffin-tin approximation. The point group symmetry of the cluster has significant effect on the energy of levels nominally not occupied. This influences the electron transfer process during chemisorption. The SSO technique permits the approaching atom or molecule plus a small number of nickel atoms to be treated as a cluster. Specifically, molecular levels become more negative in the O atom, as well as in a CO molecule, as the metal atoms are approached. Thus, electron transfer from the nickel and bond formation is facilitated. This result is of importance in understanding chemisorption and catalytic processes.

  14. Ultrafast chemical interface scattering as an additional decay channel for nascent nonthermal electrons in small metal nanoparticles.

    PubMed

    Bauer, Christophe; Abid, Jean-Pierre; Fermin, David; Girault, Hubert H

    2004-05-15

    The use of 4.2 nm gold nanoparticles wrapped in an adsorbates shell and embedded in a TiO2 metal oxide matrix gives the opportunity to investigate ultrafast electron-electron scattering dynamics in combination with electronic surface phenomena via the surface plasmon lifetimes. These gold nanoparticles (NPs) exhibit a large nonclassical broadening of the surface plasmon band, which is attributed to a chemical interface damping. The acceleration of the loss of surface plasmon phase coherence indicates that the energy and the momentum of the collective electrons can be dissipated into electronic affinity levels of adsorbates. As a result of the preparation process, gold NPs are wrapped in a shell of sulfate compounds that gives rise to a large density of interfacial molecules confined between Au and TiO2, as revealed by Fourier-transform-infrared spectroscopy. A detailed analysis of the transient absorption spectra obtained by broadband femtosecond transient absorption spectroscopy allows separating electron-electron and electron-phonon interaction. Internal thermalization times (electron-electron scattering) are determined by probing the decay of nascent nonthermal electrons (NNEs) and the build-up of the Fermi-Dirac electron distribution, giving time constants of 540 to 760 fs at 0.42 and 0.34 eV from the Fermi level, respectively. Comparison with literature data reveals that lifetimes of NNEs measured for these small gold NPs are more than four times longer than for silver NPs with similar sizes. The surprisingly long internal thermalization time is attributed to an additional decay mechanism (besides the classical e-e scattering) for the energy loss of NNEs, identified as the ultrafast chemical interface scattering process. NNEs experience an inelastic resonant scattering process into unoccupied electronic states of adsorbates, that directly act as an efficient heat bath, via the excitation of molecular vibrational modes. The two-temperature model is no longer valid for this system because of (i) the temporal overlap between the internal and external thermalization process is very important; (ii) a part of the photonic energy is directly transferred toward the adsorbates (not among "cold" conduction band electrons). These findings have important consequence for femtochemistry on metal surfaces since they show that reactions can be initiated by nascent nonthermal electrons (as photoexcited, out of a Fermi-Dirac distribution) besides of the hot electron gas.

  15. Studies of electron-molecule collisions - Applications to e-H2O

    NASA Technical Reports Server (NTRS)

    Brescansin, L. M.; Lima, M. A. P.; Gibson, T. L.; Mckoy, V.; Huo, W. M.

    1986-01-01

    Elastic differential and momentum transfer cross sections for the elastic scattering of electrons by H2O are reported for collision energies from 2 to 20 eV. These fixed-nuclei static-exchange cross sections were obtained using the Schwinger variational approach. In these studies the exchange potential is directly evaluated and not approximated by local models. The calculated differential cross sections, obtained with a basis set expansion of the scattering wave function, agree well with available experimental data at intermediate and larger angles. As used here, the results cannot adequately describe the divergent cross sections at small angles. An interesting feature of the calculated cross sections, particularly at 15 and 20 eV, is their significant backward peaking. This peaking occurs in the experimentally inaccessible region beyond a scattering angle of 120 deg. The implication of this feature for the determination of momentum transfer cross sections is described.

  16. Inclusion of electron correlation for the target wave function in low- to intermediate-energy e-N2 scattering

    NASA Technical Reports Server (NTRS)

    Weatherford, C. A.; Brown, F. B.; Temkin, A.

    1987-01-01

    In a recent calculation, an exact exchange method was developed for use in the partial-differential-equation approach to electron-molecule scattering and was applied to e-N2 scattering in the fixed-nuclei approximation with an adiabatic polarization potential at low energies (0-10 eV). Integrated elastic cross sections were calculated and found to be lower than experiment at energies both below and above the Pi(g) resonance. It was speculated at that time that improved experimental agreement could be obtained if a correlated target representation were used in place of the uncorrelated one. The present paper implements this suggestion and demonstrates the improved agreement. These calculations are also extended to higher energies (0-30 eV) so asd to include the Sigma(u) resonance. Some discrepancies among the experiments and between experiment and the various calculations at very low energy are noted.

  17. Total cross section of furfural by electron impact: Experiment and theory.

    PubMed

    Traoré Dubuis, A; Verkhovtsev, A; Ellis-Gibbings, L; Krupa, K; Blanco, F; Jones, D B; Brunger, M J; García, G

    2017-08-07

    We present experimental total cross sections for electron scattering from furfural in the energy range from 10 to 1000 eV, as measured using a double electrostatic analyzer gas cell electron transmission experiment. These results are compared to theoretical data for furfural, as well as to experimental and theoretical values for the structurally similar molecules furan and tetrahydrofuran. The measured total cross section is in agreement with the theoretical results obtained by means of the independent-atom model with screening corrected additivity rule including interference method. In the region of higher electron energies, from 500 eV to 10 keV, the total electron scattering cross section is also estimated using a semi-empirical model based on the number of electrons and dipole polarizabilities of the molecular targets. Together with the recently measured differential and integral cross sections, and the furfural energy-loss spectra, the present total cross section data nearly complete the data set that is required for numerical simulation of low-energy electron processes in furfural, covering the range of projectile energies from a few electron volts up to 10 keV.

  18. Total cross section of furfural by electron impact: Experiment and theory

    NASA Astrophysics Data System (ADS)

    Traoré Dubuis, A.; Verkhovtsev, A.; Ellis-Gibbings, L.; Krupa, K.; Blanco, F.; Jones, D. B.; Brunger, M. J.; García, G.

    2017-08-01

    We present experimental total cross sections for electron scattering from furfural in the energy range from 10 to 1000 eV, as measured using a double electrostatic analyzer gas cell electron transmission experiment. These results are compared to theoretical data for furfural, as well as to experimental and theoretical values for the structurally similar molecules furan and tetrahydrofuran. The measured total cross section is in agreement with the theoretical results obtained by means of the independent-atom model with screening corrected additivity rule including interference method. In the region of higher electron energies, from 500 eV to 10 keV, the total electron scattering cross section is also estimated using a semi-empirical model based on the number of electrons and dipole polarizabilities of the molecular targets. Together with the recently measured differential and integral cross sections, and the furfural energy-loss spectra, the present total cross section data nearly complete the data set that is required for numerical simulation of low-energy electron processes in furfural, covering the range of projectile energies from a few electron volts up to 10 keV.

  19. Electron impact ionisation cross section for organoplatinum compounds

    NASA Astrophysics Data System (ADS)

    Mahato, Dibyendu; Naghma, Rahla; Alam, Mohammad Jane; Ahmad, Shabbir; Antony, Bobby

    2016-11-01

    This article reports electron impact ionisation cross sections for platinum-based drugs viz., cisplatin (H6N2Cl2Pt), carboplatin (C6H12N2O4Pt), oxaliplatin (C8H14N2O4Pt), nedaplatin (C2H8N2O3Pt) and satraplatin (C10H22ClN2O4Pt) complexes used in the cancer chemotherapy. The multi-scattering centre spherical complex optical potential formalism is used to obtain the inelastic cross section for these large molecules upon electron impact. The ionisation cross section is derived from the inelastic cross section employing complex scattering potential-ionisation contribution method. Comparison is made with previous results, where ever available and overall a reasonable agreement is observed. This is the first attempt to report total ionisation cross sections for nedaplatin and satraplatin complexes.

  20. On the Relative "Transparency" of Gas-phase Coronene Molecules to Low-energy Electrons: Effects on the Interstellar Medium

    NASA Astrophysics Data System (ADS)

    Carelli, F.; Gianturco, F. A.

    2011-12-01

    Free, gas-phase polycyclic aromatic hydrocarbons (PAHs) are understood to play an important role in the interstellar medium (ISM), as they are thought to significantly contribute to both diffused and unidentified infrared interstellar bands. They are also considered fundamental blocks of the interstellar dust, whose nature has important implications for a plethora of physical and chemical nanoscopic processes within the ISM. Since free electrons represent a versatile alternative way to transport energy in the interstellar space, in this paper we compute from quantum scattering methods the angular redistributions of free electrons by gas-phase coronene molecules, the latter of which are believed to be one of the most representative PAHs, in order to assess their role in describing the efficiency of electron deflection by this molecule. The associated rates can provide useful information about the coupling mechanism between external radio-frequency fields and complex molecular plasmas containing neutral and ionized PAHs. They can also yield information on the possible presence of such species in the dust phase of the medium.

  1. Holography and coherent diffraction with low-energy electrons: A route towards structural biology at the single molecule level.

    PubMed

    Latychevskaia, Tatiana; Longchamp, Jean-Nicolas; Escher, Conrad; Fink, Hans-Werner

    2015-12-01

    The current state of the art in structural biology is led by NMR, X-ray crystallography and TEM investigations. These powerful tools however all rely on averaging over a large ensemble of molecules. Here, we present an alternative concept aiming at structural analysis at the single molecule level. We show that by combining electron holography and coherent diffraction imaging estimations concerning the phase of the scattered wave become needless as the phase information is extracted from the data directly and unambiguously. Performed with low-energy electrons the resolution of this lens-less microscope is just limited by the De Broglie wavelength of the electron wave and the numerical aperture, given by detector geometry. In imaging freestanding graphene, a resolution of 2Å has been achieved revealing the 660.000 unit cells of the graphene sheet from a single data set. Once applied to individual biomolecules the method shall ultimately allow for non-destructive imaging and imports the potential to distinguish between different conformations of proteins with atomic resolution. Copyright © 2015. Published by Elsevier B.V.

  2. Ab initio molecular dynamics calculations on scattering of hyperthermal H atoms from Cu(111) and Au(111).

    PubMed

    Kroes, Geert-Jan; Pavanello, Michele; Blanco-Rey, María; Alducin, Maite; Auerbach, Daniel J

    2014-08-07

    Energy loss from the translational motion of an atom or molecule impinging on a metal surface to the surface may determine whether the incident particle can trap on the surface, and whether it has enough energy left to react with another molecule present at the surface. Although this is relevant to heterogeneous catalysis, the relative extent to which energy loss of hot atoms takes place to phonons or electron-hole pair (ehp) excitation, and its dependence on the system's parameters, remain largely unknown. We address these questions for two systems that present an extreme case of the mass ratio of the incident atom to the surface atom, i.e., H + Cu(111) and H + Au(111), by presenting adiabatic ab initio molecular dynamics (AIMD) predictions of the energy loss and angular distributions for an incidence energy of 5 eV. The results are compared to the results of AIMDEFp calculations modeling energy loss to ehp excitation using an electronic friction ("EF") model applied to the AIMD trajectories, so that the energy loss to the electrons is calculated "post" ("p") the computation of the AIMD trajectory. The AIMD calculations predict average energy losses of 0.38 eV for Cu(111) and 0.13-0.14 eV for Au(111) for H-atoms that scatter from these surfaces without penetrating the surface. These energies closely correspond with energy losses predicted with Baule models, which is suggestive of structure scattering. The predicted adiabatic integral energy loss spectra (integrated over all final scattering angles) all display a lowest energy peak at an energy corresponding to approximately 80% of the average adiabatic energy loss for non-penetrative scattering. In the adiabatic limit, this suggests a way of determining the approximate average energy loss of non-penetratively scattered H-atoms from the integral energy loss spectrum of all scattered H-atoms. The AIMDEFp calculations predict that in each case the lowest energy loss peak should show additional energy loss in the range 0.2-0.3 eV due to ehp excitation, which should be possible to observe. The average non-adiabatic energy losses for non-penetrative scattering exceed the adiabatic losses to phonons by 0.9-1.0 eV. This suggests that for scattering of hyperthermal H-atoms from coinage metals the dominant energy dissipation channel should be to ehp excitation. These predictions can be tested by experiments that combine techniques for generating H-atom beams that are well resolved in translational energy and for detecting the scattered atoms with high energy-resolution.

  3. Combining nanofluidics and plasmonics for single molecule detection

    NASA Astrophysics Data System (ADS)

    West, Melanie M.

    Single molecule detection is limited by the small scattering cross-section of molecules which leads to weak optical signals that can be obscured by background noise. The combination of plasmonics and nanofluidics in an integrated nano-device has the potential to provide the signal enhancement necessary for the detection of single molecules. The purpose of this investigation was to optimize the fabrication of an optofluidic device that integrates a nanochannel with a plasmonic bowtie antenna. The fluidic structure of the device was fabricated using UV-nanoimprint lithography, and the gold plasmonic antennas were fabricated using a shadow evaporation and lift-off process. The effect of electron beam lithography doses on the resolution of antenna-nanochannel configurations was studied to minimize antenna gap size while maintaining the integrity of the imprinted features. The smallest antenna gap size that was achieved was 46 nm. The antennas were characterized using dark field spectroscopy to find the resonance shift, which indicated the appropriate range for optical signal enhancement. The dark field scattering results showed antennas with a broad and well-defined resonance shift that ranged from 650--800 nm. The Raman scattering results showed the highest enhancement factor (EF = 2) for antennas with an "inverted configuration," which involved having the triangles of the antenna facing back-to-back rather than the more conventional tip-to-tip bowtie arrangement.

  4. Scattering of positrons and electrons by alkali atoms

    NASA Technical Reports Server (NTRS)

    Stein, T. S.; Kauppila, W. E.; Kwan, C. K.; Lukaszew, R. A.; Parikh, S. P.; Wan, Y. J.; Zhou, S.; Dababneh, M. S.

    1990-01-01

    Absolute total scattering cross sections (Q sub T's) were measured for positrons and electrons colliding with sodium, potassium, and rubidium in the 1 to 102 eV range, using the same apparatus and experimental approach (a beam transmission technique) for both projectiles. The present results for positron-sodium and -rubidium collisions represent the first Q sub T measurements reported for these collision systems. Features which distinguish the present comparisons between positron- and electron-alkali atom Q sub T's from those for other atoms and molecules (room-temperature gases) which have been used as targets for positrons and electrons are the proximity of the corresponding positron- and electron-alkali atom Q sub T's over the entire energy range of overlap, with an indication of a merging or near-merging of the corresponding positron and electron Q sub T's near (and above) the relatively low energy of about 40 eV, and a general tendency for the positron-alkali atom Q sub T's to be higher than the corresponding electron values as the projectile energy is decreased below about 40 eV.

  5. Prospects of high-resolution resonant X-ray inelastic scattering studies on solid materials, liquids and gases at diffraction-limited storage rings.

    PubMed

    Schmitt, Thorsten; de Groot, Frank M F; Rubensson, Jan Erik

    2014-09-01

    The spectroscopic technique of resonant inelastic X-ray scattering (RIXS) will particularly profit from immensely improved brilliance of diffraction-limited storage rings (DLSRs). In RIXS one measures the intensities of excitations as a function of energy and momentum transfer. DLSRs will allow for pushing the achievable energy resolution, signal intensity and the sampled spot size to new limits. With RIXS one nowadays probes a broad range of electronic systems reaching from simple molecules to complex materials displaying phenomena like peculiar magnetism, two-dimensional electron gases, superconductivity, photovoltaic energy conversion and heterogeneous catalysis. In this article the types of improved RIXS studies that will become possible with X-ray beams from DLSRs are envisioned.

  6. Measurement of inelastic cross sections for low-energy electron scattering from DNA bases.

    PubMed

    Michaud, Marc; Bazin, Marc; Sanche, Léon

    2012-01-01

    To determine experimentally the absolute cross sections (CS) to deposit various amount of energies into DNA bases by low-energy electron (LEE) impact. Electron energy loss (EEL) spectra of DNA bases were recorded for different LEE impact energies on the molecules deposited at very low coverage on an inert argon (Ar) substrate. Following their normalisation to the effective incident electron current and molecular surface number density, the EEL spectra were then fitted with multiple Gaussian functions in order to delimit the various excitation energy regions. The CS to excite a molecule into its various excitation modes were finally obtained from computing the area under the corresponding Gaussians. The EEL spectra and absolute CS for the electronic excitations of pyrimidine and the DNA bases thymine, adenine, and cytosine by electron impacts below 18 eV were reported for the molecules deposited at about monolayer coverage on a solid Ar substrate. The CS for electronic excitations of DNA bases by LEE impact were found to lie within the 10(216) to 10(218) cm(2) range. The large value of the total ionisation CS indicated that ionisation of DNA bases by LEE is an important dissipative process via which ionising radiation degrades and is absorbed in DNA.

  7. Measurement of inelastic cross sections for low-energy electron scattering from DNA bases

    PubMed Central

    Michaud, Marc; Bazin, Marc.; Sanche, Léon

    2013-01-01

    Purpose Determine experimentally the absolute cross sections (CS) to deposit various amount of energies into DNA bases by low-energy electron (LEE) impact. Materials and methods Electron energy loss (EEL) spectra of DNA bases are recorded for different LEE impact energies on the molecules deposited at very low coverage on an inert argon (Ar) substrate. Following their normalisation to the effective incident electron current and molecular surface number density, the EEL spectra are then fitted with multiple Gaussian functions in order to delimit the various excitation energy regions. The CS to excite a molecule into its various excitation modes are finally obtained from computing the area under the corresponding Gaussians. Results The EEL spectra and absolute CS for the electronic excitations of pyrimidine and the DNA bases thymine, adenine, and cytosine by electron impacts below 18 eV are reported for the molecules deposited at about monolayer coverage on a solid Ar substrate. Conclusions The CS for electronic excitations of DNA bases by LEE impact are found to lie within the 10−16 – 10−18 cm2 range. The large value of the total ionisation CS indicates that ionisation of DNA bases by LEE is an important dissipative process via which ionising radiation degrades and is absorbed in DNA. PMID:21615242

  8. Plasmonic Manipulation of Light for Sensing and Photovoltaic Applications

    NASA Astrophysics Data System (ADS)

    Sobhani Khakestar, Heidar

    Plasmonics is a successful new field of science and technology that exploits the exclusive optical properties of metallic nanostructures to manipulate and concentrate light at nano-meter length scales. When light hits the surface of gold or silver nanoparticles it can excite collective oscillations of the conduction electrons called surface plasmons. This surface plasmon undergoes two damping processes; it can decay into photon and reemit the plasmon energy as scattered energy or decay into electron-hole pair with the excitation energy equal to the energy of the plasmon resonance, known as absorption. This high energy electron subsequently undergoes into the carrier multiplication and eventually scatters into the electrons with lower energy. We used Finite-Difference Time-Domain (FDTD) and Finite-Element Method (Comsol) to design nanoscale structures to act as nanoantenna for light harvesting and consequently manipulating radiative and absorption properties of them for Sensing and Photovoltaic applications. To manipulate near and far field we designed our structures in a way that the bright and dark plasmon modes overlap and couple to each other. This process is called Fano resonance and introduces a transparency window in the far-field spectra. At the same time it increases the near-field enhancement. We applied the changes in near-field and far-field to SERS (Surface Enhanced Raman Spectroscopy) and LSPR (Localized Surface plasmon Resonance) shift for sensing purposes. We modeled Fano resonances with classical harmonic oscillator and reproduced the same feature with a simple equation of motion. We used this model to replicate scattering spectra from different geometries and explain the cathodoluminescence results obtained from nanoscale gold clusters structure. All of these nanoantenna optical properties and applications are due to the reemission ability of the plasmon energy to the vacuum and confining optical field, but the plasmon energy can decay into a high energy carrier rather than radiation. Photons coupled into metallic nanoantenna excite resonant plasmons, which can decay into energetic, hot electrons injected over a potential barrier at the nanoantenna-semiconductor interface, resulting in a photocurrent. We design a device which the range of its potential applications is extremely diverse. As silicon based detector capable of detecting sub-band gap photons, this device could be used in photovoltaic devices to harvest solar energy. Plasmon generated hot electrons can be used in photocatalytic dissociation of H2 molecules at the room temperature as well. The hot electrons in their higher energy states can populate the antibonding orbital of H2 molecules adsorbed on the metal surface and thus trigger the H2 molecule dissociation. The goal is to demonstrate the high efficiency of metallic photocatalytic systems by detecting the formation of HD molecules from the individual dissociation of two isotopes, H2 and D2. At the end we introduce lightning rod effect in metallic nanostructures and investigated the relation between the geometry properties of micrometer rod antennas and the electromagnetic field enhancement induced due to the lightning rod effect. At long wavelength, metals behave like perfect equipotential conductors and all the field enhancement results from the drop of potentials across the junctions between individual nanoparticles. This phenomenon is called lightning rod effect. By designing proper geometry we were able to utilize this effect to obtain enough electromagnetic enhancements in MIR region of spectrum to observe SEIRA signals from few hemoglobin molecules. Our simulation shows that the field enhancement obtained from this antenna does not depend sensitively on wavelength which is another advantage for SEIRA spectroscopy. We offered an analytical model to explore the coupling between the hemoglobin molecules and the Efield. We used this model to study the location effect of the molecule on the reflection signal. This technique allows us to detect the vibrational mode of molecules such as Hemoglobin in the real time and study their changes when the molecules are exposed to different environmental circumstances.

  9. Application and development of the Schwinger multichannel scattering theory and the partial differential equation theory of electron-molecule scattering

    NASA Technical Reports Server (NTRS)

    Weatherford, Charles A.

    1993-01-01

    One version of the multichannel theory for electron-target scattering based on the Schwinger variational principle, the SMC method, requires the introduction of a projection parameter. The role of the projection parameter a is investigated and it is shown that the principal-value operator in the SMC equation is Hermitian regardless of the value of a as long as it is real and nonzero. In a basis that is properly orthonormalizable, the matrix representation of this operator is also Hermitian. The use of such basis is consistent with the Schwinger variational principle because the Lippmann-Schwinger equation automatically builds in the correct boundary conditions. Otherwise, an auxiliary condition needs to be introduced, and Takatsuka and McKoy's original value of a is one of the three possible ways to achieve Hermiticity. In all cases but one, a can be uncoupled from the Hermiticity condition and becomes a free parameter. An equation for a based on the variational stability of the scattering amplitude is derived; its solution has an interesting property that the scattering amplitude from a converged SMC calculation is independent of the choice of a even though the SMC operator itself is a-dependent. This property provides a sensitive test of the convergence of the calculation. For a static-exchange calculation, the convergence requirement only depends on the completeness of the one-electron basis, but for a general multichannel case, the a-invariance in the scattering amplitude requires both the one-electron basis and the N plus 1-electron basis to be complete. The role of a in the SMC equation and the convergence property are illustrated using two examples: e-CO elastic scattering in the static-exchange approximation, and a two-state treatment of the e-H2 Chi(sup 1)Sigma(sub g)(+) yields b(sup 3)Sigma(sub u)(+) excitation.

  10. Generation of bright attosecond x-ray pulse trains via Thomson scattering from laser-plasma accelerators.

    PubMed

    Luo, W; Yu, T P; Chen, M; Song, Y M; Zhu, Z C; Ma, Y Y; Zhuo, H B

    2014-12-29

    Generation of attosecond x-ray pulse attracts more and more attention within the advanced light source user community due to its potentially wide applications. Here we propose an all-optical scheme to generate bright, attosecond hard x-ray pulse trains by Thomson backscattering of similarly structured electron beams produced in a vacuum channel by a tightly focused laser pulse. Design parameters for a proof-of-concept experiment are presented and demonstrated by using a particle-in-cell code and a four-dimensional laser-Compton scattering simulation code to model both the laser-based electron acceleration and Thomson scattering processes. Trains of 200 attosecond duration hard x-ray pulses holding stable longitudinal spacing with photon energies approaching 50 keV and maximum achievable peak brightness up to 1020 photons/s/mm2/mrad2/0.1%BW for each micro-bunch are observed. The suggested physical scheme for attosecond x-ray pulse trains generation may directly access the fastest time scales relevant to electron dynamics in atoms, molecules and materials.

  11. A time-of-flight spectrometer for measuring inelastic to elastic differential cross-section ratios for electron-gas scattering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    LeClair, L.R.; Trajmar, S.; Khakoo, M.A.

    1996-05-01

    We describe a crossed electron beam-atomic beam apparatus which utilizes a pulsed electron gun and field free drift tube to obtain time-of-flight (TOF) spectra of electrons scattered from atoms and molecules. This apparatus was constructed for the purpose of obtaining inelastic-to-elastic differential cross-section (DCS) ratios in the energy range extending from threshold to several eV above the threshold of the inelastic channel. The TOF approach eliminates the need for complicated calibration procedures required when using conventional electrostatic electron energy-loss spectroscopy (EELS) at these low energies. The characteristics of the apparatus will be given, along with representative TOF spectra from carbonmore » monoxide. From those spectra we obtained DCS ratios at 90{degree} scattering angle for excitation of the {ital a}{sup 3}{Pi} state of CO, in the impact energy range of 6{endash}15 eV. These ratios were measured with uncertainties as small as {plus_minus}4{percent}, which represents a substantial improvement over previous measurements in this energy range. This demonstrates the feasibility of using the TOF technique to measure DCS ratios which in turn can serve as secondary standards to normalize other inelastic DCSs obtained from measurements with EELS. {copyright} {ital 1996 American Institute of Physics.}« less

  12. Persistent three- and four-atom orbital molecules in the spinel Al V2O4

    NASA Astrophysics Data System (ADS)

    Browne, Alexander J.; Kimber, Simon A. J.; Attfield, J. Paul

    2017-10-01

    Electronic instabilities in transition-metal compounds may lead to ground states containing orbital molecules when direct metal-metal orbital interactions occur. The spinel Al V2O4 was reported to contain V717 + orbital heptamers that emerge below a 700 K charge ordering transition. Our x-ray total scattering analysis of Al V2O4 between 300 and 1100 K reveals a very different picture as the postulated heptamers are found to be pairs of spin-singlet V39 + trimers and V48 + tetramers, and these orbital molecules persist to at least 1100 K in a disordered high-temperature cubic phase.

  13. Angle-resolved molecular beam scattering of NO at the gas-liquid interface.

    PubMed

    Zutz, Amelia; Nesbitt, David J

    2017-08-07

    This study presents first results on angle-resolved, inelastic collision dynamics of thermal and hyperthermal molecular beams of NO at gas-liquid interfaces. Specifically, a collimated incident beam of supersonically cooled NO ( 2 Π 1/2 , J = 0.5) is directed toward a series of low vapor pressure liquid surfaces ([bmim][Tf 2 N], squalane, and PFPE) at θ inc = 45(1)°, with the scattered molecules detected with quantum state resolution over a series of final angles (θ s = -60°, -30°, 0°, 30°, 45°, and 60°) via spatially filtered laser induced fluorescence. At low collision energies [E inc = 2.7(9) kcal/mol], the angle-resolved quantum state distributions reveal (i) cos(θ s ) probabilities for the scattered NO and (ii) electronic/rotational temperatures independent of final angle (θ s ), in support of a simple physical picture of angle independent sticking coefficients and all incident NO thermally accommodating on the surface. However, the observed electronic/rotational temperatures for NO scattering reveal cooling below the surface temperature (T elec < T rot < T S ) for all three liquids, indicating a significant dependence of the sticking coefficient on NO internal quantum state. Angle-resolved scattering at high collision energies [E inc = 20(2) kcal/mol] has also been explored, for which the NO scattering populations reveal angle-dependent dynamical branching between thermal desorption and impulsive scattering (IS) pathways that depend strongly on θ s . Characterization of the data in terms of the final angle, rotational state, spin-orbit electronic state, collision energy, and liquid permit new correlations to be revealed and investigated in detail. For example, the IS rotational distributions reveal an enhanced propensity for higher J/spin-orbit excited states scattered into near specular angles and thus hotter rotational/electronic distributions measured in the forward scattering direction. Even more surprisingly, the average NO scattering angle (⟨θ s ⟩) exhibits a remarkably strong correlation with final angular momentum, N, which implies a linear scaling between net forward scattering propensity and torque delivered to the NO projectile by the gas-liquid interface.

  14. Angle-resolved molecular beam scattering of NO at the gas-liquid interface

    NASA Astrophysics Data System (ADS)

    Zutz, Amelia; Nesbitt, David J.

    2017-08-01

    This study presents first results on angle-resolved, inelastic collision dynamics of thermal and hyperthermal molecular beams of NO at gas-liquid interfaces. Specifically, a collimated incident beam of supersonically cooled NO (2 Π 1/2, J = 0.5) is directed toward a series of low vapor pressure liquid surfaces ([bmim][Tf2N], squalane, and PFPE) at θinc = 45(1)°, with the scattered molecules detected with quantum state resolution over a series of final angles (θs = -60°, -30°, 0°, 30°, 45°, and 60°) via spatially filtered laser induced fluorescence. At low collision energies [Einc = 2.7(9) kcal/mol], the angle-resolved quantum state distributions reveal (i) cos(θs) probabilities for the scattered NO and (ii) electronic/rotational temperatures independent of final angle (θs), in support of a simple physical picture of angle independent sticking coefficients and all incident NO thermally accommodating on the surface. However, the observed electronic/rotational temperatures for NO scattering reveal cooling below the surface temperature (Telec < Trot < TS) for all three liquids, indicating a significant dependence of the sticking coefficient on NO internal quantum state. Angle-resolved scattering at high collision energies [Einc = 20(2) kcal/mol] has also been explored, for which the NO scattering populations reveal angle-dependent dynamical branching between thermal desorption and impulsive scattering (IS) pathways that depend strongly on θs. Characterization of the data in terms of the final angle, rotational state, spin-orbit electronic state, collision energy, and liquid permit new correlations to be revealed and investigated in detail. For example, the IS rotational distributions reveal an enhanced propensity for higher J/spin-orbit excited states scattered into near specular angles and thus hotter rotational/electronic distributions measured in the forward scattering direction. Even more surprisingly, the average NO scattering angle (⟨θs⟩) exhibits a remarkably strong correlation with final angular momentum, N, which implies a linear scaling between net forward scattering propensity and torque delivered to the NO projectile by the gas-liquid interface.

  15. Internal twisting motion dependent conductance of an aperiodic DNA molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

    The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

  16. Mode Specific Electronic Friction in Dissociative Chemisorption on Metal Surfaces: H2 on Ag(111)

    NASA Astrophysics Data System (ADS)

    Maurer, Reinhard J.; Jiang, Bin; Guo, Hua; Tully, John C.

    2017-06-01

    Electronic friction and the ensuing nonadiabatic energy loss play an important role in chemical reaction dynamics at metal surfaces. Using molecular dynamics with electronic friction evaluated on the fly from density functional theory, we find strong mode dependence and a dominance of nonadiabatic energy loss along the bond stretch coordinate for scattering and dissociative chemisorption of H2 on the Ag(111) surface. Exemplary trajectories with varying initial conditions indicate that this mode specificity translates into modulated energy loss during a dissociative chemisorption event. Despite minor nonadiabatic energy loss of about 5%, the directionality of friction forces induces dynamical steering that affects individual reaction outcomes, specifically for low-incidence energies and vibrationally excited molecules. Mode-specific friction induces enhanced loss of rovibrational rather than translational energy and will be most visible in its effect on final energy distributions in molecular scattering experiments.

  17. Study of electron impact inelastic scattering of chlorine molecule (Cl2)

    NASA Astrophysics Data System (ADS)

    Yadav, Hitesh; Vinodkumar, Minaxi; Limbachiya, Chetan; Vinodkumar, P. C.

    2018-02-01

    A theoretical study is carried out for electron interactions with the chlorine molecule (Cl2) for incident energies ranging from 0.01 to 5000 eV. This wide range of energy has allowed us to investigate a variety of processes and report data on symmetric excitation energies, dissociative electron attachment (DEA), total excitation cross sections, and ionization cross section (Q ion) along with total inelastic cross sections (Q inel). The present study is important since Cl2 is a prominent gas for plasma etching and its anionic atoms are important in the etching of semiconductor wafers. In order to compute the total inelastic cross sections, we have employed the ab initio R-matrix method (0.01 to 15 eV) together with the spherical complex optical potential method (∼15 to 5000 eV). The R-matrix calculations are performed using a close coupling method, and we have used DEA estimator via Quantemol-N to calculate the DEA fragmentation and cross sections. The present study finds overall good agreement with the available experimental data. Total excitation and inelastic cross sections of e-{{{Cl}}}2 scattering for a wide energy range (0.01 to 5 keV) are reported for the first time, to the best of our knowledge.

  18. Quantum coherence and temperature dependence of the anomalous state of nanoconfined water in carbon nanotubes

    DOE PAGES

    Reiter, George F.; Deb, Aniruddha; Sakurai, Y.; ...

    2016-10-17

    X-ray Compton scattering measurements of the electron momentum distribution in water confined in both single-walled and double-walled carbon nanotubes (SWNT and DWNT), as a function of temperature and confinement size are presented here together with earlier measurements of the proton momentum distribution in the same systems using neutron Compton scattering. These studies provide a coherent picture of an anomalous state of water that exists because of nanoconfinement. This state cannot be described by the weakly interacting molecule picture. It has unique transport properties for both protons and water molecules. In conclusion, we suggest that knowledge of the excitation spectrum ofmore » this state is needed to understand the enhanced flow of water in cylinders with diameters on the order of 20 Å.« less

  19. Calcium phosphate nanoparticles as versatile carrier for small and large molecules across cell membranes

    NASA Astrophysics Data System (ADS)

    Sokolova, Viktoriya; Rotan, Olga; Klesing, Jan; Nalbant, Perihan; Buer, Jan; Knuschke, Torben; Westendorf, Astrid M.; Epple, Matthias

    2012-06-01

    The successful transport of molecules across the cell membrane is a key point in biology and medicine. In most cases, molecules alone cannot penetrate the cell membrane, therefore an efficient carrier is needed. Calcium phosphate nanoparticles (diameter: 100-250 nm, depending on the functionalization) were loaded with fluorescent oligonucleotides, peptide, proteins, antibodies, polymers or porphyrins and characterized by dynamic light scattering, nanoparticle tracking analysis and scanning electron microscopy. Any excess of molecules was removed by ultracentrifugation, and the dissolved molecules at the same concentration were used as control. The uptake of such fluorescence-labeled nanoparticles into HeLa cells was monitored by fluorescence microscopy and confocal laser scanning microscopy. Calcium phosphate nanoparticles were able to transport all molecules across the cell membrane, whereas the dissolved molecules alone were taken up only to a very small extent or even not at all.

  20. Ab initio structure determination from prion nanocrystals at atomic resolution by MicroED

    DOE PAGES

    Sawaya, Michael R.; Rodriguez, Jose; Cascio, Duilio; ...

    2016-09-19

    Electrons, because of their strong interaction with matter, produce high-resolution diffraction patterns from tiny 3D crystals only a few hundred nanometers thick in a frozen-hydrated state. This discovery offers the prospect of facile structure determination of complex biological macromolecules, which cannot be coaxed to form crystals large enough for conventional crystallography or cannot easily be produced in sufficient quantities. Two potential obstacles stand in the way. The first is a phenomenon known as dynamical scattering, in which multiple scattering events scramble the recorded electron diffraction intensities so that they are no longer informative of the crystallized molecule. The second obstaclemore » is the lack of a proven means of de novo phase determination, as is required if the molecule crystallized is insufficiently similar to one that has been previously determined.We showwith four structures of the amyloid core of the Sup35 prion protein that, if the diffraction resolution is high enough, sufficiently accurate phases can be obtained by direct methods with the cryo-EM method microelectron diffraction (MicroED), just as in X-ray diffraction. The success of these four experiments dispels the concern that dynamical scattering is an obstacle to ab initio phasing by MicroED and suggests that structures of novel macromolecules can also be determined by direct methods.« less

  1. Ab initio structure determination from prion nanocrystals at atomic resolution by MicroED

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sawaya, Michael R.; Rodriguez, Jose; Cascio, Duilio

    Electrons, because of their strong interaction with matter, produce high-resolution diffraction patterns from tiny 3D crystals only a few hundred nanometers thick in a frozen-hydrated state. This discovery offers the prospect of facile structure determination of complex biological macromolecules, which cannot be coaxed to form crystals large enough for conventional crystallography or cannot easily be produced in sufficient quantities. Two potential obstacles stand in the way. The first is a phenomenon known as dynamical scattering, in which multiple scattering events scramble the recorded electron diffraction intensities so that they are no longer informative of the crystallized molecule. The second obstaclemore » is the lack of a proven means of de novo phase determination, as is required if the molecule crystallized is insufficiently similar to one that has been previously determined.We showwith four structures of the amyloid core of the Sup35 prion protein that, if the diffraction resolution is high enough, sufficiently accurate phases can be obtained by direct methods with the cryo-EM method microelectron diffraction (MicroED), just as in X-ray diffraction. The success of these four experiments dispels the concern that dynamical scattering is an obstacle to ab initio phasing by MicroED and suggests that structures of novel macromolecules can also be determined by direct methods.« less

  2. Inelastic ponderomotive scattering of electrons at a high-intensity optical travelling wave in vacuum

    NASA Astrophysics Data System (ADS)

    Kozák, M.; Eckstein, T.; Schönenberger, N.; Hommelhoff, P.

    2018-02-01

    In the early days of quantum mechanics Kapitza and Dirac predicted that matter waves would scatter off the optical intensity grating formed by two counter-propagating light waves. This interaction, driven by the ponderomotive potential of the optical standing wave, was both studied theoretically and demonstrated experimentally for atoms and electrons. In the original version of the experiment, only the transverse momentum of particles was varied, but their energy and longitudinal momentum remained unchanged after the interaction. Here, we report on the generalization of the Kapitza-Dirac effect. We demonstrate that the energy of sub-relativistic electrons is strongly modulated on the few-femtosecond timescale via the interaction with a travelling wave created in vacuum by two colliding laser pulses at different frequencies. This effect extends the possibilities of temporal control of freely propagating particles with coherent light and can serve the attosecond ballistic bunching of electrons, or for the acceleration of neutral atoms or molecules by light.

  3. Single molecule dynamics at a mechanically controllable break junction in solution at room temperature.

    PubMed

    Konishi, Tatsuya; Kiguchi, Manabu; Takase, Mai; Nagasawa, Fumika; Nabika, Hideki; Ikeda, Katsuyoshi; Uosaki, Kohei; Ueno, Kosei; Misawa, Hiroaki; Murakoshi, Kei

    2013-01-23

    The in situ observation of geometrical and electronic structural dynamics of a single molecule junction is critically important in order to further progress in molecular electronics. Observations of single molecular junctions are difficult, however, because of sensitivity limits. Here, we report surface-enhanced Raman scattering (SERS) of a single 4,4'-bipyridine molecule under conditions of in situ current flow in a nanogap, by using nano-fabricated, mechanically controllable break junction (MCBJ) electrodes. When adsorbed at room temperature on metal nanoelectrodes in solution to form a single molecule junction, statistical analysis showed that nontotally symmetric b(1) and b(2) modes of 4,4'-bipyridine were strongly enhanced relative to observations of the same modes in solid or aqueous solutions. Significant changes in SERS intensity, energy (wavenumber), and selectivity of Raman vibrational bands that are coincident with current fluctuations provide information on distinct states of electronic and geometrical structure of the single molecule junction, even under large thermal fluctuations occurring at room temperature. We observed the dynamics of 4,4'-bipyridine motion between vertical and tilting configurations in the Au nanogap via b(1) and b(2) mode switching. A slight increase in the tilting angle of the molecule was also observed by noting the increase in the energies of Raman modes and the decrease in conductance of the molecular junction.

  4. DNA origami based Au–Ag-core–shell nanoparticle dimers with single-molecule SERS sensitivity† †Electronic supplementary information (ESI) available: Additional information about materials and methods, designs of DNA origami templates, height profiles, additional SERS spectra, assignment of DNA bands, SEM images, additional AFM images, FDTD simulations, additional reference spectra for Cy3 and detailed description of EF estimation, simulated absorption and scattering spectra. See DOI: 10.1039/c5nr08674d Click here for additional data file.

    PubMed Central

    Prinz, J.; Heck, C.; Ellerik, L.; Merk, V.

    2016-01-01

    DNA origami nanostructures are a versatile tool to arrange metal nanostructures and other chemical entities with nanometer precision. In this way gold nanoparticle dimers with defined distance can be constructed, which can be exploited as novel substrates for surface enhanced Raman scattering (SERS). We have optimized the size, composition and arrangement of Au/Ag nanoparticles to create intense SERS hot spots, with Raman enhancement up to 1010, which is sufficient to detect single molecules by Raman scattering. This is demonstrated using single dye molecules (TAMRA and Cy3) placed into the center of the nanoparticle dimers. In conjunction with the DNA origami nanostructures novel SERS substrates are created, which can in the future be applied to the SERS analysis of more complex biomolecular targets, whose position and conformation within the SERS hot spot can be precisely controlled. PMID:26892770

  5. LASER APPLICATIONS AND OTHER TOPICS IN QUANTUM ELECTRONICS: On gamma-ray spectra of metal nuclei in a metal-carbon cluster

    NASA Astrophysics Data System (ADS)

    Rivlin, Lev A.

    2007-07-01

    The resonance absorption and emission gamma-ray spectra are constructed for nuclear transitions in metals in large metal-carbon clusters. The possibilities of observing gamma lines with the natural linewidth in an isolated molecule and the suppression of the excess line broadening in an ensemble of molecules are estimated. The possibility of the appearance of the hidden population inversion of nuclear states and the quantum amplification of the type of coherent stimulated scattering is also analysed.

  6. Rotational-vibrational coupling in the theory of electron-molecule scattering

    NASA Technical Reports Server (NTRS)

    Temkin, A.; Sullivan, E. C.

    1974-01-01

    The adiabatic-nuclei approximation of vibrational-rotational excitation of homonuclear diatomic molecules can be simply augmented to describe the vibrational-rotational coupling by including the dependence of the vibrational wave function on j. Appropriate formulas are given, and the theory, is applied to e-H2 excitation, whereby it is shown that deviations from the simple Born-Oppenheimer approximation measured by Wong and Schultz can be explained. More important, it can be seen that the inclusion of the j-dependent centrifugal term is essential for transitions involving high-rotational quantum numbers.

  7. Proceeding of the 18th Intl. Workshop on Inelastic Ion-Surface Collisions (IISC-18)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reinhold, Carlos O; Krstic, Predrag S; Meyer, Fred W

    2011-01-01

    The main topics of this proceedings were: (1) Energy loss of particles at surfaces; (2) Scattering of atoms, ions, molecules and clusters; (3) Charge exchange between particles and surfaces; (4) Ion induced desorption, electronic and kinetic sputtering; (5) Defect formation, surface modification and nanostructuring; (6) Electron, photon and secondary ion emission due to particle impact on surfaces; (7) Sputtering, fragmentation, cluster and ion formation in SIMS and SNMS; (8) Cluster/molecular and highly charged ion beams; and (9) Laser induced desorption.

  8. Raman scattering mediated by neighboring molecules

    NASA Astrophysics Data System (ADS)

    Williams, Mathew D.; Bradshaw, David S.; Andrews, David L.

    2016-05-01

    Raman scattering is most commonly associated with a change in vibrational state within individual molecules, the corresponding frequency shift in the scattered light affording a key way of identifying material structures. In theories where both matter and light are treated quantum mechanically, the fundamental scattering process is represented as the concurrent annihilation of a photon from one radiation mode and creation of another in a different mode. Developing this quantum electrodynamical formulation, the focus of the present work is on the spectroscopic consequences of electrodynamic coupling between neighboring molecules or other kinds of optical center. To encompass these nanoscale interactions, through which the molecular states evolve under the dual influence of the input light and local fields, this work identifies and determines two major mechanisms for each of which different selection rules apply. The constituent optical centers are considered to be chemically different and held in a fixed orientation with respect to each other, either as two components of a larger molecule or a molecular assembly that can undergo free rotation in a fluid medium or as parts of a larger, solid material. The two centers are considered to be separated beyond wavefunction overlap but close enough together to fall within an optical near-field limit, which leads to high inverse power dependences on their local separation. In this investigation, individual centers undergo a Stokes transition, whilst each neighbor of a different species remains in its original electronic and vibrational state. Analogous principles are applicable for the anti-Stokes case. The analysis concludes by considering the experimental consequences of applying this spectroscopic interpretation to fluid media; explicitly, the selection rules and the impact of pressure on the radiant intensity of this process.

  9. Strong Overtones Modes in Inelastic Electron Tunneling Spectroscopy with Cross-Conjugated Molecules: A Prediction from Theory

    PubMed Central

    2013-01-01

    Cross-conjugated molecules are known to exhibit destructive quantum interference, a property that has recently received considerable attention in single-molecule electronics. Destructive quantum interference can be understood as an antiresonance in the elastic transmission near the Fermi energy and leading to suppressed levels of elastic current. In most theoretical studies, only the elastic contributions to the current are taken into account. In this paper, we study the inelastic contributions to the current in cross-conjugated molecules and find that while the inelastic contribution to the current is larger than for molecules without interference, the overall behavior of the molecule is still dominated by the quantum interference feature. Second, an ongoing challenge for single molecule electronics is understanding and controlling the local geometry at the molecule-surface interface. With this in mind, we investigate a spectroscopic method capable of providing insight into these junctions for cross-conjugated molecules: inelastic electron tunneling spectroscopy (IETS). IETS has the advantage that the molecule interface is probed directly by the tunneling current. Previously, it has been thought that overtones are not observable in IETS. Here, overtones are predicted to be strong and, in some cases, the dominant spectroscopic features. We study the origin of the overtones and find that the interference features in these molecules are the key ingredient. The interference feature is a property of the transmission channels of the π system only, and consequently, in the vicinity of the interference feature, the transmission channels of the σ system and the π system become equally transmissive. This allows for scattering between the different transmission channels, which serves as a pathway to bypass the interference feature. A simple model calculation is able to reproduce the results obtained from atomistic calculations, and we use this to interpret these findings. PMID:24067128

  10. Prospects of high-resolution resonant X-ray inelastic scattering studies on solid materials, liquids and gases at diffraction-limited storage rings

    PubMed Central

    Schmitt, Thorsten; de Groot, Frank M. F.; Rubensson, Jan-Erik

    2014-01-01

    The spectroscopic technique of resonant inelastic X-ray scattering (RIXS) will particularly profit from immensely improved brilliance of diffraction-limited storage rings (DLSRs). In RIXS one measures the intensities of excitations as a function of energy and momentum transfer. DLSRs will allow for pushing the achievable energy resolution, signal intensity and the sampled spot size to new limits. With RIXS one nowadays probes a broad range of electronic systems reaching from simple molecules to complex materials displaying phenomena like peculiar magnetism, two-dimensional electron gases, superconductivity, photovoltaic energy conversion and heterogeneous catalysis. In this article the types of improved RIXS studies that will become possible with X-ray beams from DLSRs are envisioned. PMID:25177995

  11. Elastic scattering of low-energy electrons by nitromethane

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lopes, A. R.; D'A Sanchez, S.; Bettega, M. H. F.

    2011-06-15

    In this work, we present integral, differential, and momentum transfer cross sections for elastic scattering of low-energy electrons by nitromethane, for energies up to 10 eV. We calculated the cross sections using the Schwinger multichannel method with pseudopotentials, in the static-exchange and in the static-exchange plus polarization approximations. The computed integral cross sections show a {pi}* shape resonance at 0.70 eV in the static-exchange-polarization approximation, which is in reasonable agreement with experimental data. We also found a {sigma}* shape resonance at 4.8 eV in the static-exchange-polarization approximation, which has not been previously characterized by the experiment. We also discuss howmore » these resonances may play a role in the dissociation process of this molecule.« less

  12. Resonant inelastic x-ray scattering probes the electron-phonon coupling in the spin liquid κ -(BEDT-TTF)2Cu2(CN) 3

    NASA Astrophysics Data System (ADS)

    Ilakovac, V.; Carniato, S.; Foury-Leylekian, P.; Tomić, S.; Pouget, J.-P.; Lazić, P.; Joly, Y.; Miyagawa, K.; Kanoda, K.; Nicolaou, A.

    2017-11-01

    Resonant inelastic x-ray scattering at the N K edge reveals clearly resolved harmonics of the anion plane vibrations in the κ -(BEDT-TTF) 2Cu2 (CN) 3 spin-liquid insulator. Tuning the incoming light energy at the K edge of two distinct N sites permits us to excite different sets of phonon modes. The cyanide (CN) stretching mode is selected at the edge of the ordered N sites which are more strongly connected to the bis(ethylenedithio)tetrathiafulvalene (BEDT-TTF) molecules, while positionally disordered N sites show multimode excitation. Combining measurements with calculations on an anion plane cluster permits us to estimate the site-dependent electron-phonon coupling of the modes related to nitrogen excitation.

  13. Enhanced Raman Scattering on In-plane Anisotropic Layered Materials

    DOE PAGES

    Liang, Liangbo; Meunier, Vincent; Sumpter, Bobby G.; ...

    2015-11-19

    Surface-enhanced Raman scattering (SERS) on two-dimensional (2D) layered materials has provided a unique platform to study the chemical mechanism (CM) of the enhancement due to its natural separation from electromagnetic enhancement. The CM stems from the basic charge interactions between the substrate and molecules. Despite the extensive studies of the energy alignment between 2D materials and molecules, an understanding of how the electronic properties of the substrate are explicitly involved in the charge interaction is still unclear. Lately, a new group of 2D layered materials with anisotropic structure, including orthorhombic black phosphorus (BP) and triclinic rhenium disulphide (ReS2), has attractedmore » great interest due to their unique anisotropic electrical and optical properties. Herein, we report a unique anisotropic Raman enhancement on few-layered BP and ReS2 using copper phthalocyanine (CuPc) molecules as a Raman probe, which is absent on isotropic graphene and h-BN. According to detailed Raman tensor analysis and density functional theory calculations, anisotropic charge interactions due to the anisotropic carrier mobilities of the 2D materials are responsible for the angular dependence of the Raman enhancement. Our findings not only provide new insights into the CM process in SERS, but also open up new avenues for the exploration and application of the electronic properties of anisotropic 2D layered materials.« less

  14. DNA origami based Au-Ag-core-shell nanoparticle dimers with single-molecule SERS sensitivity

    NASA Astrophysics Data System (ADS)

    Prinz, J.; Heck, C.; Ellerik, L.; Merk, V.; Bald, I.

    2016-03-01

    DNA origami nanostructures are a versatile tool to arrange metal nanostructures and other chemical entities with nanometer precision. In this way gold nanoparticle dimers with defined distance can be constructed, which can be exploited as novel substrates for surface enhanced Raman scattering (SERS). We have optimized the size, composition and arrangement of Au/Ag nanoparticles to create intense SERS hot spots, with Raman enhancement up to 1010, which is sufficient to detect single molecules by Raman scattering. This is demonstrated using single dye molecules (TAMRA and Cy3) placed into the center of the nanoparticle dimers. In conjunction with the DNA origami nanostructures novel SERS substrates are created, which can in the future be applied to the SERS analysis of more complex biomolecular targets, whose position and conformation within the SERS hot spot can be precisely controlled.DNA origami nanostructures are a versatile tool to arrange metal nanostructures and other chemical entities with nanometer precision. In this way gold nanoparticle dimers with defined distance can be constructed, which can be exploited as novel substrates for surface enhanced Raman scattering (SERS). We have optimized the size, composition and arrangement of Au/Ag nanoparticles to create intense SERS hot spots, with Raman enhancement up to 1010, which is sufficient to detect single molecules by Raman scattering. This is demonstrated using single dye molecules (TAMRA and Cy3) placed into the center of the nanoparticle dimers. In conjunction with the DNA origami nanostructures novel SERS substrates are created, which can in the future be applied to the SERS analysis of more complex biomolecular targets, whose position and conformation within the SERS hot spot can be precisely controlled. Electronic supplementary information (ESI) available: Additional information about materials and methods, designs of DNA origami templates, height profiles, additional SERS spectra, assignment of DNA bands, SEM images, additional AFM images, FDTD simulations, additional reference spectra for Cy3 and detailed description of EF estimation, simulated absorption and scattering spectra. See DOI: 10.1039/c5nr08674d

  15. Piezoelectric scattering limited mobility of hybrid organic-inorganic perovskites CH3NH3PbI3

    PubMed Central

    Lu, Ying-Bo; Kong, Xianghua; Chen, Xiaobin; Cooke, David G.; Guo, Hong

    2017-01-01

    Carrier mobility is one of the most important parameters for semiconducting materials and their use in optoelectronic devices. Here we report a systematic first principles analysis of the acoustic phonon scattering mechanism that limits the mobility of CH3NH3PbI3 (MAPbI3) perovskites. Due to the unique hybrid organic-inorganic structure, the mechanical, electronic and transport properties are dominated by the same factor, i.e. the weak interatomic bond and the easy rotation of methylammonium (MA) molecules under strain. Both factors make MAPbI3 soft. Rotation of MA molecule induces a transverse shift between Pb and I atoms, resulting in a very low deformation potential and a strong piezoelectricity in MAPbI3. Hence the carrier mobility of pristine MAPbI3 is limited by the piezoelectric scattering, which is consistent to the form of its temperature dependence. Our calculations suggest that in the pristine limit, a high mobility of about several thousand cm2 V−1 S−1 is expected for MAPbI3. PMID:28150743

  16. A spherical electron cloud hopping model for studying product branching ratios of dissociative recombination.

    PubMed

    Yu, Hua-Gen

    2008-05-21

    A spherical electron cloud hopping (SECH) model is proposed to study the product branching ratios of dissociative recombination (DR) of polyatomic systems. In this model, the fast electron-captured process is treated as an instantaneous hopping of a cloud of uniform spherical fractional point charges onto a target M+q ion (or molecule). The sum of point charges (-1) simulates the incident electron. The sphere radius is determined by a critical distance (Rc eM) between the incoming electron (e-) and the target, at which the potential energy of the e(-)-M+q system is equal to that of the electron-captured molecule M+q(-1) in a symmetry-allowed electronic state with the same structure as M(+q). During the hopping procedure, the excess energies of electron association reaction are dispersed in the kinetic energies of M+q(-1) atoms to conserve total energy. The kinetic energies are adjusted by linearly adding atomic momenta in the direction of driving forces induced by the scattering electron. The nuclear dynamics of the resultant M+q(-1) molecule are studied by using a direct ab initio dynamics method on the adiabatic potential energy surface of M+q(-1), or together with extra adiabatic surface(s) of M+q(-1). For the latter case, the "fewest switches" surface hopping algorithm of Tully was adapted to deal with the nonadiabaticity in trajectory propagations. The SECH model has been applied to study the DR of both CH+ and H3O+(H2O)2. The theoretical results are consistent with the experiment. It was found that water molecules play an important role in determining the product branching ratios of the molecular cluster ion.

  17. Ab initio studies of electronic transport through amine-Au-linked junctions of photoactive molecules

    NASA Astrophysics Data System (ADS)

    Strubbe, David A.; Quek, Su Ying; Venkataraman, Latha; Choi, Hyoung Joon; Neaton, J. B.; Louie, Steven G.

    2008-03-01

    Molecules linked to Au electrodes via amine groups have been shown to result in reproducible molecular conductance values for a wide range of single-molecule junctions [1,2]. Recent calculations have shown that these linkages result in a junction conductance relatively insensitive to atomic structure [3]. Here we exploit these well-defined linkages to study the effect of isomerization on conductance for the photoactive molecule 4,4'-diaminoazobenzene. We use a first-principles scattering-state method based on density-functional theory to explore structure and transport properties of the cis and trans isomers of the molecule, and we discuss implications for experiment. [1] L Venkataraman et al., Nature 442, 904-907 (2006); [2] L Venkataraman et al., Nano Lett. 6, 458-462 (2006); [3] SY Quek et al., Nano Lett. 7, 3477-3482 (2007).

  18. Ab initio molecular dynamics calculations on scattering of hyperthermal H atoms from Cu(111) and Au(111)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kroes, Geert-Jan, E-mail: g.j.kroes@chem.leidenuniv.nl; Pavanello, Michele; Blanco-Rey, María

    2014-08-07

    Energy loss from the translational motion of an atom or molecule impinging on a metal surface to the surface may determine whether the incident particle can trap on the surface, and whether it has enough energy left to react with another molecule present at the surface. Although this is relevant to heterogeneous catalysis, the relative extent to which energy loss of hot atoms takes place to phonons or electron-hole pair (ehp) excitation, and its dependence on the system's parameters, remain largely unknown. We address these questions for two systems that present an extreme case of the mass ratio of themore » incident atom to the surface atom, i.e., H + Cu(111) and H + Au(111), by presenting adiabatic ab initio molecular dynamics (AIMD) predictions of the energy loss and angular distributions for an incidence energy of 5 eV. The results are compared to the results of AIMDEFp calculations modeling energy loss to ehp excitation using an electronic friction (“EF”) model applied to the AIMD trajectories, so that the energy loss to the electrons is calculated “post” (“p”) the computation of the AIMD trajectory. The AIMD calculations predict average energy losses of 0.38 eV for Cu(111) and 0.13-0.14 eV for Au(111) for H-atoms that scatter from these surfaces without penetrating the surface. These energies closely correspond with energy losses predicted with Baule models, which is suggestive of structure scattering. The predicted adiabatic integral energy loss spectra (integrated over all final scattering angles) all display a lowest energy peak at an energy corresponding to approximately 80% of the average adiabatic energy loss for non-penetrative scattering. In the adiabatic limit, this suggests a way of determining the approximate average energy loss of non-penetratively scattered H-atoms from the integral energy loss spectrum of all scattered H-atoms. The AIMDEFp calculations predict that in each case the lowest energy loss peak should show additional energy loss in the range 0.2-0.3 eV due to ehp excitation, which should be possible to observe. The average non-adiabatic energy losses for non-penetrative scattering exceed the adiabatic losses to phonons by 0.9-1.0 eV. This suggests that for scattering of hyperthermal H-atoms from coinage metals the dominant energy dissipation channel should be to ehp excitation. These predictions can be tested by experiments that combine techniques for generating H-atom beams that are well resolved in translational energy and for detecting the scattered atoms with high energy-resolution.« less

  19. Cross sections for elastic scattering of electrons by CF3Cl, CF2Cl2, and CFCl3

    NASA Astrophysics Data System (ADS)

    Hoshino, M.; Horie, M.; Kato, H.; Blanco, F.; García, G.; Limão-Vieira, P.; Sullivan, J. P.; Brunger, M. J.; Tanaka, H.

    2013-06-01

    Differential, integral, and momentum transfer cross sections have been determined for the elastic scattering of electrons from the molecules CF3Cl, CF2Cl2, and CFCl3.With the help of a crossed electron beam-molecular beam apparatus using the relative flow technique, the ratios of the elastic differential cross sections (DCSs) of CF3Cl, CF2Cl2, and CFCl3 to those of He were measured in the energy region from 1.5 to 100 eV and at scattering angles in the range 15° to 130°. From those ratios, the absolute DCSs were determined by utilizing the known DCS of He. For CF3Cl and CF2Cl2, at the common energies of measurement, we find generally good agreement with the results from the independent experiments of Mann and Linder [J. Phys. B 25, 1621 (1992), 10.1088/0953-4075/25/7/030; Mann and Linder J. Phys. B 25, 1633 (1992), 10.1088/0953-4075/25/7/031]. In addition, as a result of progressively substituting a Cl-atom, undulations in the angular distributions have been found to vary in a largely systematic manner in going from CF4 to CF3Cl to CF2Cl2 to CFCl3 and to CCl4. These observed features suggest that the elastic scattering process is, in an independently additive manner, dominated by the atomic-Cl atoms of the molecules. The present independent atom method calculation typically supports the experimental evidence, within the screened additivity rule formulation, for each species and for energies greater than about 10-20 eV. Integral elastic and momentum transfer cross sections were also derived from the measured DCSs, and are compared to the other available theoretical and experimental results. The elastic integral cross sections are also evaluated as a part of their contribution to the total cross section.

  20. The use of neutron scattering to determine the functional structure of glycoside hydrolase.

    PubMed

    Nakamura, Akihiko; Ishida, Takuya; Samejima, Masahiro; Igarashi, Kiyohiko

    2016-10-01

    Neutron diffraction provides different information from X-ray diffraction, because neutrons are scattered by atomic nuclei, whereas X-rays are scattered by electrons. One of the key advantages of neutron crystallography is the ability to visualize hydrogen and deuterium atoms, making it possible to observe the protonation state of amino acid residues, hydrogen bonds, networks of water molecules and proton relay pathways in enzymes. But, because of technical difficulties, less than 100 enzyme structures have been evaluated by neutron crystallography to date. In this review, we discuss the advantages and disadvantages of neutron crystallography as a tool to investigate the functional structure of glycoside hydrolases, with some examples. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. UV Resonant Raman Spectrometer with Multi-Line Laser Excitation

    NASA Technical Reports Server (NTRS)

    Lambert, James L.; Kohel, James M.; Kirby, James P.; Morookian, John Michael; Pelletier, Michael J.

    2013-01-01

    A Raman spectrometer employs two or more UV (ultraviolet) laser wavel engths to generate UV resonant Raman (UVRR) spectra in organic sampl es. Resonant Raman scattering results when the laser excitation is n ear an electronic transition of a molecule, and the enhancement of R aman signals can be several orders of magnitude. In addition, the Ra man cross-section is inversely proportional to the fourth power of t he wavelength, so the UV Raman emission is increased by another fact or of 16, or greater, over visible Raman emissions. The Raman-scatter ed light is collected using a high-resolution broadband spectrograph . Further suppression of the Rayleigh-scattered laser light is provi ded by custom UV notch filters.

  2. On macromolecular refinement at subatomic resolution withinteratomic scatterers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Afonine, Pavel V.; Grosse-Kunstleve, Ralf W.; Adams, Paul D.

    2007-11-09

    A study of the accurate electron density distribution in molecular crystals at subatomic resolution, better than {approx} 1.0 {angstrom}, requires more detailed models than those based on independent spherical atoms. A tool conventionally used in small-molecule crystallography is the multipolar model. Even at upper resolution limits of 0.8-1.0 {angstrom}, the number of experimental data is insufficient for the full multipolar model refinement. As an alternative, a simpler model composed of conventional independent spherical atoms augmented by additional scatterers to model bonding effects has been proposed. Refinement of these mixed models for several benchmark datasets gave results comparable in quality withmore » results of multipolar refinement and superior of those for conventional models. Applications to several datasets of both small- and macro-molecules are shown. These refinements were performed using the general-purpose macromolecular refinement module phenix.refine of the PHENIX package.« less

  3. On macromolecular refinement at subatomic resolution with interatomic scatterers

    PubMed Central

    Afonine, Pavel V.; Grosse-Kunstleve, Ralf W.; Adams, Paul D.; Lunin, Vladimir Y.; Urzhumtsev, Alexandre

    2007-01-01

    A study of the accurate electron-density distribution in molecular crystals at subatomic resolution (better than ∼1.0 Å) requires more detailed models than those based on independent spherical atoms. A tool that is conventionally used in small-molecule crystallography is the multipolar model. Even at upper resolution limits of 0.8–1.0 Å, the number of experimental data is insufficient for full multipolar model refinement. As an alternative, a simpler model composed of conventional independent spherical atoms augmented by additional scatterers to model bonding effects has been proposed. Refinement of these mixed models for several benchmark data sets gave results that were comparable in quality with the results of multipolar refinement and superior to those for conventional models. Applications to several data sets of both small molecules and macromolecules are shown. These refinements were performed using the general-purpose macromolecular refinement module phenix.refine of the PHENIX package. PMID:18007035

  4. On macromolecular refinement at subatomic resolution with interatomic scatterers.

    PubMed

    Afonine, Pavel V; Grosse-Kunstleve, Ralf W; Adams, Paul D; Lunin, Vladimir Y; Urzhumtsev, Alexandre

    2007-11-01

    A study of the accurate electron-density distribution in molecular crystals at subatomic resolution (better than approximately 1.0 A) requires more detailed models than those based on independent spherical atoms. A tool that is conventionally used in small-molecule crystallography is the multipolar model. Even at upper resolution limits of 0.8-1.0 A, the number of experimental data is insufficient for full multipolar model refinement. As an alternative, a simpler model composed of conventional independent spherical atoms augmented by additional scatterers to model bonding effects has been proposed. Refinement of these mixed models for several benchmark data sets gave results that were comparable in quality with the results of multipolar refinement and superior to those for conventional models. Applications to several data sets of both small molecules and macromolecules are shown. These refinements were performed using the general-purpose macromolecular refinement module phenix.refine of the PHENIX package.

  5. Inelastic scattering in metal- H2 -metal junctions

    NASA Astrophysics Data System (ADS)

    Kristensen, I. S.; Paulsson, M.; Thygesen, K. S.; Jacobsen, K. W.

    2009-06-01

    We present first-principles calculations of the dI/dV characteristics of an H2 molecule sandwiched between Au and Pt electrodes in the presence of electron-phonon interactions. The conductance is found to decrease by a few percentages at threshold voltages corresponding to the excitation energy of longitudinal vibrations of the H2 molecule. In the case of Pt electrodes, the transverse vibrations can mediate transport through otherwise nontransmitting Ptd channels leading to an increase in the differential conductance even though the hydrogen junction is characterized predominately by a single almost fully open transport channel. In the case of Au, the transverse modes do not affect the dI/dV because the Aud states are too far below the Fermi level. A simple explanation of the first-principles results is given using scattering theory. Finally, we compare and discuss our results in relation to experimental data.

  6. Atomic and Molecular Physics

    NASA Technical Reports Server (NTRS)

    Bhatia, Anand K.

    2005-01-01

    A symposium on atomic and molecular physics was held on November 18, 2005 at Goddard Space Flight Center. There were a number of talks through the day on various topics such as threshold law of ionization, scattering of electrons from atoms and molecules, muonic physics, positron physics, Rydberg states etc. The conference was attended by a number of physicists from all over the world.

  7. Spotting the differences in two-dimensional materials - the Raman scattering perspective.

    PubMed

    Zhang, Shishu; Zhang, Na; Zhao, Yan; Cheng, Ting; Li, Xiaobo; Feng, Rui; Xu, Hua; Liu, Zhirong; Zhang, Jin; Tong, Lianming

    2018-05-08

    Two-dimensional (2D) layered materials have attracted tremendous attention and led to a prosperous development in both fundamental investigation and device applications in various fields, such as nanoelectronics, flexible devices, sustainable energy and catalysts. The precise characterization of the structure and properties of 2D materials is in urgent need. Raman scattering spectroscopy is one of the most popular characterization tools that is convenient, rapid and non-invasive. It provides information on both the lattice structure from the frequency of phonon modes and the electronic band structure through the intensity due to electronic resonance Raman scattering. Although a few morphological characterization tools can image 2D materials with atomic resolution, Raman scattering measurements are more tolerant to the conditions of sample preparation such as the substrate and less technically demanding, and have been one of the routine tools for the characterization of 2D materials. In this review, we focus on the characterization of 2D materials using Raman scattering spectroscopy, in particular, the revealing of differences from primitive 2D materials, such as defects, doping effects, van der Waals heterostructures and the interaction with molecules. The characteristic Raman features of such differences and the corresponding interpretation will be discussed. We hope that this review will be useful for wide research communities of materials, physics, chemistry and engineering.

  8. Electron collisions with α-D-glucose and β-D-glucose monomers

    NASA Astrophysics Data System (ADS)

    da Costa, Romarly F.; Bettega, Márcio H. F.; Varella, Márcio T. do N.; Lima, Marco A. P.

    2010-03-01

    The development of new alternative routes for production of second generation ethanol from sugarcane biomass poses a challenge to the scientific community. Current research in this field addresses the use of a plasma-based pretreatment of the lignocellulosic raw material. With the aim to provide a theoretical background for this experimental technique we investigate the role of low-energy electrons from the plasma in the rupture of the matrix of cellulosic chains. In this paper, we report calculated cross sections for elastic scattering of low-energy electrons by the α- and β-D-glucose monomers. The calculations employed the Schwinger multichannel method with pseudopotentials and were carried out at the static-exchange and static-exchange plus polarization levels of approximation. Through the comparison of the results obtained with inclusion of polarization effects we discuss the influence of the different conformations of the hydroxyl group linked to the anomeric carbon on the resonance spectra of these molecules. Resonant structures appearing at different energies for α- and β-glucose at the low-energy regime of impact energies can be understood as a fingerprint of an "isomeric effect" and suggest that distinct fragmentation mechanisms proceeding via σ∗ shape resonances may become operative depending on the glucose anomer under consideration. For energies above 15 eV the integral elastic cross sections are very similar for both monomers. Differential cross sections for the glucopyranose anomers considered in this work are typically dominated by a strong forward scattering due to the molecules' large electric dipole moments and, for energies close to the resonances' positions, they display particular features at the intermediate angular region, notably a pronounced f-wave scattering pattern, that are probably associated with the presence of those structures.

  9. Contemplating Transport Characteristics by Augmenting the Length of Molecule

    NASA Astrophysics Data System (ADS)

    Kaur, Milanpreet; Sawhney, Ravinder Singh; Engles, Derick

    2013-11-01

    In this paper, we contemplated the transport characteristics of a single molecular device junction by augmenting the length of the molecule in the scattering region. The molecules considered here belongs to class of alkanedithiols (CnH2n+2S2). Specifically, we used a tight binding semi-empirical model to compute the transport characteristics of butanedithiol, pentanedithiol, hexanedithiol and heptanedithiol connected to semi-infinite gold electrodes through thiol anchoring elements. The exploration of transport properties of considered alkanes was completed for different bias voltages within the sphere of Keldysh's Non Equilibrium Green's Function (NEGF) and Extended Hückel Theory (EHT), for studying the self-consistent steady-state solution, analyzing the out-of-equilibrium electron distribution, and the behavior of the self-consistent potential. We perceived that the current and conductance retrenches with aggravation with the increase in length of the molecule with exhibition of single electron tunneling. We observed that the coupling regime shifts from strong coupling to weak for higher order alkanedithiols and the transmission is function of evenness or oddness of the carbon atoms forming an alkane.

  10. On the production of Gamma rays and Relativistic Runaway Electron Avalanches from Martian dust storms

    NASA Astrophysics Data System (ADS)

    Arabshahi, S.; Majid, W.; Dwyer, J. R.; Rassoul, H.

    2016-12-01

    In Earth's atmosphere, runaway electrons are routinely produced from large electric fields such as occurs inside thunderclouds. Electrons run away when the average rate of energy loss in a medium is less than the average rate of energy gains from an electric field. These electrons can then produce more energetic electrons, and subsequently an avalanche of energetic electrons, through electron-electron Møller scattering with air atoms and molecules. The process is called a Relativistic Runaway Electron Avalanche (RREA). RREA also produces large flux of X-rays and gamma rays (e.g. Terrestrial Gamma Ray Flashes) through bremsstrahlung scattering. Theoretical modeling of electric fields inside dust devils [Farrel et al. 2006], and possible observation of large electrostatic discharges from Mars [Ruf et al. 2009] suggest that the electric fields could get close to the breakdown values for Mars' atmosphere, i.e. 25 kV/m. Using detailed Monte Carlo simulations, we have shown that for such electric fields it is possible to have a RREA-like mechanism also at work inside the Martian dust storms, capable of producing a large flux of gamma-ray photons. We have also shown that the resulting gamma ray photons could be detected using instruments either on the surface of Mars or on orbiting satellites.

  11. Microgravity

    NASA Image and Video Library

    2001-06-06

    X-rays diffracted from a well-ordered protein crystal create sharp patterns of scattered light on film. A computer can use these patterns to generate a model of a protein molecule. To analyze the selected crystal, an X-ray crystallographer shines X-rays through the crystal. Unlike a single dental X-ray, which produces a shadow image of a tooth, these X-rays have to be taken many times from different angles to produce a pattern from the scattered light, a map of the intensity of the X-rays after they diffract through the crystal. The X-rays bounce off the electron clouds that form the outer structure of each atom. A flawed crystal will yield a blurry pattern; a well-ordered protein crystal yields a series of sharp diffraction patterns. From these patterns, researchers build an electron density map. With powerful computers and a lot of calculations, scientists can use the electron density patterns to determine the structure of the protein and make a computer-generated model of the structure. The models let researchers improve their understanding of how the protein functions. They also allow scientists to look for receptor sites and active areas that control a protein's function and role in the progress of diseases. From there, pharmaceutical researchers can design molecules that fit the active site, much like a key and lock, so that the protein is locked without affecting the rest of the body. This is called structure-based drug design.

  12. Creation of Rydberg Polarons in a Bose Gas

    NASA Astrophysics Data System (ADS)

    Camargo, F.; Schmidt, R.; Whalen, J. D.; Ding, R.; Woehl, G.; Yoshida, S.; Burgdörfer, J.; Dunning, F. B.; Sadeghpour, H. R.; Demler, E.; Killian, T. C.

    2018-02-01

    We report spectroscopic observation of Rydberg polarons in an atomic Bose gas. Polarons are created by excitation of Rydberg atoms as impurities in a strontium Bose-Einstein condensate. They are distinguished from previously studied polarons by macroscopic occupation of bound molecular states that arise from scattering of the weakly bound Rydberg electron from ground-state atoms. The absence of a p -wave resonance in the low-energy electron-atom scattering in Sr introduces a universal behavior in the Rydberg spectral line shape and in scaling of the spectral width (narrowing) with the Rydberg principal quantum number, n . Spectral features are described with a functional determinant approach (FDA) that solves an extended Fröhlich Hamiltonian for a mobile impurity in a Bose gas. Excited states of polyatomic Rydberg molecules (trimers, tetrameters, and pentamers) are experimentally resolved and accurately reproduced with a FDA.

  13. Ultrasensitive molecular sensor using N-doped graphene through enhanced Raman scattering

    PubMed Central

    Feng, Simin; dos Santos, Maria Cristina; Carvalho, Bruno R.; Lv, Ruitao; Li, Qing; Fujisawa, Kazunori; Elías, Ana Laura; Lei, Yu; Perea-López, Nestor; Endo, Morinobu; Pan, Minghu; Pimenta, Marcos A.; Terrones, Mauricio

    2016-01-01

    As a novel and efficient surface analysis technique, graphene-enhanced Raman scattering (GERS) has attracted increasing research attention in recent years. In particular, chemically doped graphene exhibits improved GERS effects when compared with pristine graphene for certain dyes, and it can be used to efficiently detect trace amounts of molecules. However, the GERS mechanism remains an open question. We present a comprehensive study on the GERS effect of pristine graphene and nitrogen-doped graphene. By controlling nitrogen doping, the Fermi level (EF) of graphene shifts, and if this shift aligns with the lowest unoccupied molecular orbital (LUMO) of a molecule, charge transfer is enhanced, thus significantly amplifying the molecule’s vibrational Raman modes. We confirmed these findings using different organic fluorescent molecules: rhodamine B, crystal violet, and methylene blue. The Raman signals from these dye molecules can be detected even for concentrations as low as 10−11 M, thus providing outstanding molecular sensing capabilities. To explain our results, these nitrogen-doped graphene-molecule systems were modeled using dispersion-corrected density functional theory. Furthermore, we demonstrated that it is possible to determine the gaps between the highest occupied and the lowest unoccupied molecular orbitals (HOMO-LUMO) of different molecules when different laser excitations are used. Our simulated Raman spectra of the molecules also suggest that the measured Raman shifts come from the dyes that have an extra electron. This work demonstrates that nitrogen-doped graphene has enormous potential as a substrate when detecting low concentrations of molecules and could also allow for an effective identification of their HOMO-LUMO gaps. PMID:27532043

  14. Imaging electronic motions by ultrafast electron diffraction

    NASA Astrophysics Data System (ADS)

    Shao, Hua-Chieh; Starace, Anthony F.

    2017-08-01

    Recently ultrafast electron diffraction and microscopy have reached unprecedented temporal resolution, and transient structures with atomic precision have been observed in various reactions. It is anticipated that these extraordinary advances will soon allow direct observation of electronic motions during chemical reactions. We therefore performed a series of theoretical investigations and simulations to investigate the imaging of electronic motions in atoms and molecules by ultrafast electron diffraction. Three prototypical electronic motions were considered for hydrogen atoms. For the case of a breathing mode, the electron density expands and contracts periodically, and we show that the time-resolved scattering intensities reflect such changes of the charge radius. For the case of a wiggling mode, the electron oscillates from one side of the nucleus to the other, and we show that the diffraction images exhibit asymmetric angular distributions. The last case is a hybrid mode that involves both breathing and wiggling motions. Owing to the demonstrated ability of ultrafast electrons to image these motions, we have proposed to image a coherent population transfer in lithium atoms using currently available femtosecond electron pulses. A frequency-swept laser pulse adiabatically drives the valence electron of a lithium atom from the 2s to 2p orbitals, and a time-delayed electron pulse maps such motion. Our simulations show that the diffraction images reflect this motion both in the scattering intensities and the angular distributions.

  15. Electron Scattering Studies of Gas Phase Molecular Structure at High Temperature

    NASA Astrophysics Data System (ADS)

    Mawhorter, Richard J., Jr.

    A high precision counting electron diffraction study of the structure of gaseous sulfur dioxide as a function of temperature from 300(DEGREES) to 1000(DEGREES)K is presented. The results agree well with current theory, and yield insight into the effects of anharmonicity on molecular structure. Another aspect of molecular structure is the molecular charge density distribution. The difference (DELTA)(sigma) is between the electron scattering cross sections for the actual molecule and independent atom model (IAM) are a sensitive measure of the change in this distribution due to bond formation. These difference cross sections have been calculated using ab initio methods, and the results for a wide range of simple polyatomic molecules are presented. Such calculations are routinely done for a single, fixed molecular geometry, an approach which neglects the effects of the vibrational motion of real molecules. The effect of vibrational averaging is studied in detail for the three normal vibrational modes of H(,2)O in the ground state. The effects are small, lending credence to the practice of comparing cross sections calculated at a fixed geometry with inherently averaged experimental data. The efficacy of the standard formula used to account for vibrational averaging in the IAM is also examined. Finally, the nature of the ionic bond is probed with an experimental study of the structure of alkali chlorides, NaCl, KCl, RbCl, and CsCl, in the gas phase. Temperatures from 840-960(DEGREES)K were required to achieve the necessary vapor pressures of approximately 0.01 torr. A planar rhombic structure for the dimer molecule is confirmed, with a fairly uniform decrease of the chlorine-alkali-chlorine angle as the alkalis increase in size. The experiment also yields information on the amount of dimer present in the vapor, and these results are compared with thermodynamic values.

  16. Nonequilibrium Chemical Effects in Single-Molecule SERS Revealed by Ab Initio Molecular Dynamics Simulations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fischer, Sean A.; Aprà, Edoardo; Govind, Niranjan

    2017-02-03

    Recent developments in nanophotonics have paved the way for achieving significant advances in the realm of single molecule chemical detection, imaging, and dynamics. In particular, surface-enhanced Raman scattering (SERS) is a powerful analytical technique that is now routinely used to identify the chemical identity of single molecules. Understanding how nanoscale physical and chemical processes affect single molecule SERS spectra and selection rules is a challenging task, and is still actively debated. Herein, we explore underappreciated chemical phenomena in ultrasensitive SERS. We observe a fluctuating excited electronic state manifold, governed by the conformational dynamics of a molecule (4,4’-dimercaptostilbene, DMS) interacting withmore » a metallic cluster (Ag20). This affects our simulated single molecule SERS spectra; the time trajectories of a molecule interacting with its unique local environment dictates the relative intensities of the observable Raman-active vibrational states. Ab initio molecular dynamics of a model Ag20-DMS system are used to illustrate both concepts in light of recent experimental results.« less

  17. Large magnetoresistance in Fe3O4/molecule nanoparticles

    NASA Astrophysics Data System (ADS)

    Wang, S.; Yue, F. J.; Lin, L.; Shi, Y. J.; Wu, D.

    2010-08-01

    In this work, we successfully fabricate Fe3O4 nanoparticles self-assembled with molecules to explore a new approach of studying the molecular spintronics. Fourier transform infrared spectroscopy measurements indicate that one monolayer molecules chemically bonds to the Fe3O4 nanoparticles and the physically absorbed molecules do not exist in the samples. The magnetoresistance (MR) of molecule fully coated ~10 nm size nanoparticles is up to 7.3% at room temperature and 17.5% at 115 K under a field of 5.8 kOe. And the MR ratio is more than two times larger than that of pure Fe3O4 nanoparticles. This enhanced MR is likely arising from weak spin scattering while carriers transport through the molecules. Moreover, a very large low field magnetoresistance is also observed with ~500nm ferromagnetic Fe3O4 nanoparticles coated with acetic acid molecules. Those features open a door for the development of future spin-based molecular electronics.

  18. On the structure and dynamics of the hydrated sulfite ion in aqueous solution--an ab initio QMCF MD simulation and large angle X-ray scattering study.

    PubMed

    Eklund, Lars; Hofer, Thomas S; Pribil, Andreas B; Rode, Bernd M; Persson, Ingmar

    2012-05-07

    Theoretical ab initio quantum mechanical charge field molecular dynamics (QMCF MD) formalism has been applied in conjunction to experimental large angle X-ray scattering to study the structure and dynamics of the hydrated sulfite ion in aqueous solution. The results show that there is a considerable effect of the lone electron-pair on sulfur concerning structure and dynamics in comparison with the sulfate ion with higher oxidation number and symmetry of the hydration shell. The S-O bond distance in the hydrated sulfite ion has been determined to 1.53(1) Å by both methods. The hydrogen bonds between the three water molecules bound to each sulfite oxygen are only slightly stronger than those in bulk water. The sulfite ion can therefore be regarded as a weak structure maker. The water exchange rate is somewhat slower for the sulfite ion than for the sulfate ion, τ(0.5) = 3.2 and 2.6 ps, respectively. An even more striking observation in the angular radial distribution (ARD) functions is that the for sulfite ion the water exchange takes place in close vicinity of the lone electron-pair directed at its sides, while in principle no water exchange did take place of the water molecules hydrogen bound to sulfite oxygens during the simulation time. This is also confirmed when detailed pathway analysis is conducted. The simulation showed that the water molecules hydrogen bound to the sulfite oxygens can move inside the hydration shell to the area outside the lone electron-pair and there be exchanged. On the other hand, for the hydrated sulfate ion in aqueous solution one can clearly see from the ARD that the distribution of exchange events is symmetrical around the entire hydration sphere.

  19. Theory of low-energy electron-molecule collision physics in the coupled-channel method and application to e-CO/sub 2/ scattering. [0. 01 to 10 eV, potentials, partial waves

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morrison, M.A.

    1976-08-01

    A theory of electron-molecule scattering based on the fixed-nuclei approximation in a body-fixed reference frame is formulated and applied to e-CO/sub 2/ collisions in the energy range from 0.07 to 10.0 eV. The procedure used is a single-center coupled-channel method which incorporates a highly accurate static interaction potential, an approximate local exchange potential, and an induced polarization potential. Coupled equations are solved by a modification of the integral equations algorithm; several partial waves are required in the region of space near the nuclei, and a transformation procedure is developed to handle the consequent numerical problems. The potential energy is convergedmore » by separating electronic and nuclear contributions in a Legendre-polynomial expansion and including a large number of the latter. Formulas are derived for total elastic, differential, momentum transfer, and rotational excitation cross sections. The Born and asymptotic decoupling approximations are derived and discussed in the context of comparison with the coupled-channel cross sections. Both are found to be unsatisfactory in the energy range under consideration. An extensive discussion of the technical aspects of calculations for electron collisions with highly nonspherical targets is presented, including detailed convergence studies and a discussion of various numerical difficulties. The application to e-CO/sub 2/ scattering produces converged results in good agreement with observed cross sections. Various aspects of the physics of this collision are discussed, including the 3.8 eV shape resonance, which is found to possess both p and f character, and the anomalously large low-energy momentum transfer cross sections, which are found to be due to ..sigma../sub g/ symmetry. Comparison with static and static-exchange approximations are made.« less

  20. The quantum dynamics of electronically nonadiabatic chemical reactions

    NASA Technical Reports Server (NTRS)

    Truhlar, Donald G.

    1993-01-01

    Considerable progress was achieved on the quantum mechanical treatment of electronically nonadiabatic collisions involving energy transfer and chemical reaction in the collision of an electronically excited atom with a molecule. In the first step, a new diabatic representation for the coupled potential energy surfaces was created. A two-state diabatic representation was developed which was designed to realistically reproduce the two lowest adiabatic states of the valence bond model and also to have the following three desirable features: (1) it is more economical to evaluate; (2) it is more portable; and (3) all spline fits are replaced by analytic functions. The new representation consists of a set of two coupled diabatic potential energy surfaces plus a coupling surface. It is suitable for dynamics calculations on both the electronic quenching and reaction processes in collisions of Na(3p2p) with H2. The new two-state representation was obtained by a three-step process from a modified eight-state diatomics-in-molecules (DIM) representation of Blais. The second step required the development of new dynamical methods. A formalism was developed for treating reactions with very general basis functions including electronically excited states. Our formalism is based on the generalized Newton, scattered wave, and outgoing wave variational principles that were used previously for reactive collisions on a single potential energy surface, and it incorporates three new features: (1) the basis functions include electronic degrees of freedom, as required to treat reactions involving electronic excitation and two or more coupled potential energy surfaces; (2) the primitive electronic basis is assumed to be diabatic, and it is not assumed that it diagonalizes the electronic Hamiltonian even asymptotically; and (3) contracted basis functions for vibrational-rotational-orbital degrees of freedom are included in a very general way, similar to previous prescriptions for locally adiabatic functions in various quantum scattering algorithms.

  1. Isotope effect in heavy/light water suspensions of optically active gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Kutsenko, V. Y.; Artykulnyi, O. P.; Petrenko, V. I.; Avdeev, M. V.; Marchenko, O. A.; Bulavin, L. A.; Snegir, S. V.

    2018-04-01

    Aqueous suspensions of optically active gold nanoparticles coated with trisodium citrate were synthesized in light (H2O) water and mixture of light and heavy (H2O/D2O) water using the modified Turkevich protocol. The objective of the paper was to verify sensitivity of neutron scattering methods (in particular, neutron reflectometry) to the potential isotope H/D substitution in the stabilizing organic shell around particles in colloidal solutions. First, the isotope effect was studied with respect to the changes in the structural properties of metal particles (size, shape, crystalline morphology) in solutions by electron microscopy including high-resolution transmission electron microscopy from dried systems. The structural factors determining the variation in the adsorption spectra in addition to the change in the optical properties of surrounding medium were discussed. Then, neutron reflectometry was applied to the layered nanoparticles anchored on a silicon wafer via 3-aminopropyltriethoxysilane molecules to reveal the presence of deuterated water molecules in the shell presumably formed by citrate molecules around the metallic core.

  2. Electron impact ionization in plasma technologies; studies on atomic boron and BN molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Joshi, Foram M., E-mail: foram29@gmail.com; Joshipura, K. N., E-mail: knjoshipura22@gmail.com; Chaudhari, Asha S., E-mail: ashaschaudhari@gmail.com

    2016-05-06

    Electron impact ionization plays important role in plasma technologies. Relevant cross sections on atomic boron are required to understand the erosion processes in fusion experiments. Boronization of plasma exposed surfaces of tokomaks has proved to be an effective way to produce very pure fusion plasmas. This paper reports comprehensive theoretical investigations on electron scattering with atomic Boron and Boron Nitride in solid phases. Presently we determine total ionization cross-section Q{sub ion} and the summed-electronic excitation cross section ΣQ{sub exc} in a standard quantum mechanical formalism called SCOP and CSP-ic methods. Our calculated cross sections are examined as functions of incidentmore » electron energy along with available comparisons.« less

  3. Operational properties of fluctuation X-ray scattering data

    DOE PAGES

    Malmerberg, Erik; Kerfeld, Cheryl A.; Zwart, Petrus H.

    2015-03-20

    X-ray scattering images collected on timescales shorter than rotation diffusion times using a (partially) coherent beam result in a significant increase in information content in the scattered data. These measurements, named fluctuation X-ray scattering (FXS), are typically performed on an X-ray free-electron laser (XFEL) and can provide fundamental insights into the structure of biological molecules, engineered nanoparticles or energy-related mesoscopic materials beyond what can be obtained with standard X-ray scattering techniques. In order to understand, use and validate experimental FXS data, the availability of basic data characteristics and operational properties is essential, but has been absent up to this point.more » In this communication, an intuitive view of the nature of FXS data and their properties is provided, the effect of FXS data on the derived structural models is highlighted, and generalizations of the Guinier and Porod laws that can ultimately be used to plan experiments and assess the quality of experimental data are presented.« less

  4. Theoretical modeling of electronic transport in molecular devices

    NASA Astrophysics Data System (ADS)

    Piccinin, Simone

    In this thesis a novel approach for simulating electronic transport in nanoscale structures is introduced. We consider an open quantum system (the electrons of structure) accelerated by an external electromotive force and dissipating energy through inelastic scattering with a heat bath (phonons) acting on the electrons. This method can be regarded as a quantum-mechanical extension of the semi-classical Boltzmann transport equation. We use periodic boundary conditions and employ Density Functional Theory to recast the many-particle problem in an effective single-particle mean-field problem. By explicitly treating the dissipation in the electrodes, the behavior of the potential is an outcome of our method, at variance with the scattering approaches based on the Landauer formalism. We study the self-consistent steady-state solution, analyzing the out-of-equilibrium electron distribution, the electrical characteristics, the behavior of the self-consistent potential and the density of states of the system. We apply the method to the study of electronic transport in several molecular devices, consisting of small organic molecules or atomic wires sandwiched between gold surfaces. For gold wires we recover the experimental evidence that transport in short wires is ballistic, independent of the length of the wire and with conductance of one quantum. In benzene-1,4-dithiol we find that the delocalization of the frontier orbitals of the molecule is responsible for the high value of conductance and that, by inserting methylene groups to decouple the sulfur atoms from the carbon ring, the current is reduced, in agreement with the experimental measurements. We study the effect a geometrical distortion in a molecular device, namely the relative rotation of the carbon rings in a biphenyl-4,4'-dithiol molecule. We find that the reduced coupling between pi orbitals of the rings induced by the rotation leads to a reduction of the conductance and that this behavior is captured by a simple two level model. Finally the transport properties of alkanethiol monolayers are analyzed by means of the local density of states at the Fermi energy: we find an exponential dependence of the current on the length of the chain, in quantitative agreement with the corresponding experiments.

  5. Neutron Nucleic Acid Crystallography.

    PubMed

    Chatake, Toshiyuki

    2016-01-01

    The hydration shells surrounding nucleic acids and hydrogen-bonding networks involving water molecules and nucleic acids are essential interactions for the structural stability and function of nucleic acids. Water molecules in the hydration shells influence various conformations of DNA and RNA by specific hydrogen-bonding networks, which often contribute to the chemical reactivity and molecular recognition of nucleic acids. However, X-ray crystallography could not provide a complete description of structural information with respect to hydrogen bonds. Indeed, X-ray crystallography is a powerful tool for determining the locations of water molecules, i.e., the location of the oxygen atom of H2O; however, it is very difficult to determine the orientation of the water molecules, i.e., the orientation of the two hydrogen atoms of H2O, because X-ray scattering from the hydrogen atom is very small.Neutron crystallography is a specialized tool for determining the positions of hydrogen atoms. Neutrons are not diffracted by electrons, but are diffracted by atomic nuclei; accordingly, neutron scattering lengths of hydrogen and its isotopes are comparable to those of non-hydrogen atoms. Therefore, neutron crystallography can determine both of the locations and orientations of water molecules. This chapter describes the current status of neutron nucleic acid crystallographic research as well as the basic principles of neutron diffraction experiments performed on nucleic acid crystals: materials, crystallization, diffraction experiments, and structure determination.

  6. Molecular three-body Brauner-Briggs-Klar theory for ion-impact ionization of molecules

    NASA Astrophysics Data System (ADS)

    Ghanbari-Adivi, E.

    2016-12-01

    Molecular three-body Brauner-Briggs-Klar (M3BBK) theory is developed to study the single ionization of diatomic molecules by ion impact. The orientation-averaged molecular orbital (OAMO) approximation is used to reduce the required computer time without sacrificing the performance of the method. The post-collision interaction (PCI) between the scattered projectile and the ejected electron is included. The theory is applied to collision of protons with hydrogen molecules. Results are obtained for two different kinematical regimes: i) fast collisions and low emission energies, and ii) not so fast collisions and higher emission energies. For both considered regimes, experimental fully differential cross-sections as well as different theoretical calculations are available for comparison. These comparisons are carried out and discussed.

  7. Modeling inelastic phonon scattering in atomic- and molecular-wire junctions

    NASA Astrophysics Data System (ADS)

    Paulsson, Magnus; Frederiksen, Thomas; Brandbyge, Mads

    2005-11-01

    Computationally inexpensive approximations describing electron-phonon scattering in molecular-scale conductors are derived from the nonequilibrium Green’s function method. The accuracy is demonstrated with a first-principles calculation on an atomic gold wire. Quantitative agreement between the full nonequilibrium Green’s function calculation and the newly derived expressions is obtained while simplifying the computational burden by several orders of magnitude. In addition, analytical models provide intuitive understanding of the conductance including nonequilibrium heating and provide a convenient way of parameterizing the physics. This is exemplified by fitting the expressions to the experimentally observed conductances through both an atomic gold wire and a hydrogen molecule.

  8. Porous Silicon Covered with Silver Nanoparticles as Surface-Enhanced Raman Scattering (SERS) Substrate for Ultra-Low Concentration Detection.

    PubMed

    Kosović, Marin; Balarin, Maja; Ivanda, Mile; Đerek, Vedran; Marciuš, Marijan; Ristić, Mira; Gamulin, Ozren

    2015-12-01

    Microporous and macro-mesoporous silicon templates for surface-enhanced Raman scattering (SERS) substrates were produced by anodization of low doped p-type silicon wafers. By immersion plating in AgNO3, the templates were covered with silver metallic film consisting of different silver nanostructures. Scanning electron microscopy (SEM) micrographs of these SERS substrates showed diverse morphology with significant difference in an average size and size distribution of silver nanoparticles. Ultraviolet-visible-near-infrared (UV-Vis-NIR) reflection spectroscopy showed plasmonic absorption at 398 and 469 nm, which is in accordance with the SEM findings. The activity of the SERS substrates was tested using rhodamine 6G (R6G) dye molecules and 514.5 nm laser excitation. Contrary to the microporous silicon template, the SERS substrate prepared from macro-mesoporous silicon template showed significantly broader size distribution of irregular silver nanoparticles as well as localized surface plasmon resonance closer to excitation laser wavelength. Such silver morphology has high SERS sensitivity that enables ultralow concentration detection of R6G dye molecules up to 10(-15) M. To our knowledge, this is the lowest concentration detected of R6G dye molecules on porous silicon-based SERS substrates, which might even indicate possible single molecule detection.

  9. Comparison of incoherent scatter radar observations of SIMPLEX electron density depletion with SAMI2 and SAMI3 model results

    NASA Astrophysics Data System (ADS)

    Bhatt, A.; Huba, J. D.; Bernhardt, P. A.; Erickson, P. J.

    2010-12-01

    The Space Shuttle's Orbital Maneuvering System (OMS) engines have been used for active ionospheric modification experiments employing ground based ionospheric radars as diagnostic tools. These experiments initiated by the Naval Research Laboratory in 1995 have been scheduled as the Shuttle Ionospheric Modification with Pulsed Localized Exhaust or SIMPLEX through the US Dept. of Defense's Space Test Program. During 2009, two SIMPLEX experiments with the shuttles STS-119 and STS-128 were viewed by the Millstone Hill 440 MHz radar in Westford, MA operated by the MIT Haystack Observatory. The objectives of these experiments were to observe local ion-acoustic turbulence and the ionospheric density irregularities created by the exhaust injection across the magnetic field that present a Bragg scattering target for the radar. The exhaust also creates a depletion in the background electron density at F-region altitudes that persists for a relatively long time and is readily detected by an incoherent scatter radar. The OMS engine burns release 10 kg/s of H2O, CO2, H2, and N2 molecules that charge exchange with ambient O+ ions at the F region heights, producing molecular ions and the electron density depletion due to the recombination with the ambient electrons. 2009 was a year of deep solar minimum that saw the background electron density values 19% lower than were expected during a solar minimum. (Emmert et al., GRL, 2010). We believe that the long recovery time from density depletion in SIMPLEX experiments of 2009 may have a root in the unique nature of the deep solar minimum. The density whole production and recovery will be modeled using NRL SAMI2 and SAMI3 model and the results will be discussed along with the observations using the incoherent scatter radar.

  10. Exciton scattering approach for optical spectra calculations in branched conjugated macromolecules

    NASA Astrophysics Data System (ADS)

    Li, Hao; Wu, Chao; Malinin, Sergey V.; Tretiak, Sergei; Chernyak, Vladimir Y.

    2016-12-01

    The exciton scattering (ES) technique is a multiscale approach based on the concept of a particle in a box and developed for efficient calculations of excited-state electronic structure and optical spectra in low-dimensional conjugated macromolecules. Within the ES method, electronic excitations in molecular structure are attributed to standing waves representing quantum quasi-particles (excitons), which reside on the graph whose edges and nodes stand for the molecular linear segments and vertices, respectively. Exciton propagation on the linear segments is characterized by the exciton dispersion, whereas exciton scattering at the branching centers is determined by the energy-dependent scattering matrices. Using these ES energetic parameters, the excitation energies are then found by solving a set of generalized "particle in a box" problems on the graph that represents the molecule. Similarly, unique energy-dependent ES dipolar parameters permit calculations of the corresponding oscillator strengths, thus, completing optical spectra modeling. Both the energetic and dipolar parameters can be extracted from quantum-chemical computations in small molecular fragments and tabulated in the ES library for further applications. Subsequently, spectroscopic modeling for any macrostructure within a considered molecular family could be performed with negligible numerical effort. We demonstrate the ES method application to molecular families of branched conjugated phenylacetylenes and ladder poly-para-phenylenes, as well as structures with electron donor and acceptor chemical substituents. Time-dependent density functional theory (TD-DFT) is used as a reference model for electronic structure. The ES calculations accurately reproduce the optical spectra compared to the reference quantum chemistry results, and make possible to predict spectra of complex macromolecules, where conventional electronic structure calculations are unfeasible.

  11. Molecular Orientation in Dry and Hydrated Cellulose Fibers: A Coherent Anti-Stokes Raman Scattering Microscopy Study

    PubMed Central

    Zimmerley, Maxwell; Younger, Rebecca; Valenton, Tiffany; Oertel, David C.; Ward, Jimmie L.; Potma, Eric O.

    2012-01-01

    Coherent anti-Stokes Raman scattering (CARS) microscopy is combined with spontaneous Raman scattering microspectroscopy and second harmonic generation (SHG) microscopy to interrogate the molecular alignment in dry and hydrated cellulose fibers. Two types of cellulose were investigated: natural cellulose I in cotton fibers and regenerated cellulose II in rayon fibers. On the basis of the orientation of the methylene symmetric stretching vibration, the molecular alignment of cellulose microfibrils is found to be conserved on the micrometer scale. Whereas the molecular orientation in cotton shows modest variability along the fiber, the alignment of the cellulose units in rayon is highly consistent throughout the fiber. The ordered alignment is retained upon fiber hydration. Upon hydration of the cellulose fibers, an anisotropic electronic contribution is observed, which indicates an ordered incorporation of water molecules into the fiber structure. The third-order and second-order electronic polarizability of cellulose I are directed along the axis of the polyglucan chain. No second-order optical response is observed in cellulose II, supporting the antiparallel arrangement of the polyglucan chains in regenerated cellulose. PMID:20684644

  12. Efficient surface enhanced Raman scattering on confeito-like gold nanoparticle-adsorbed self-assembled monolayers.

    PubMed

    Chang, Chia-Chi; Imae, Toyoko; Chen, Liang-Yih; Ujihara, Masaki

    2015-12-28

    Confeito-like gold nanoparticles (AuNPs; average diameter = 80 nm) exhibiting a plasmon absorption band at 590 nm were adsorbed through immersion-adsorption on two self-assembled monolayers (SAMs) of 3-aminopropyltriethoxysilane (APTES-SAM) and polystyrene spheres coated with amine-terminated poly(amido amine) dendrimers (DEN/PS-SAM). The surface enhanced Raman scattering (SERS) effect on the SAM substrates was examined using the molecules of a probe dye, rhodamine 6G (R6G). The Raman scattering was strongly intensified on both substrates, but the enhancement factor (>10,000) of the AuNP/DEN/PS-SAM hierarchy substrate was 5-10 times higher than that of the AuNP/APTES-SAM substrate. This strong enhancement is attributed to the large surface area of the substrate and the presence of hot spots. Furthermore, analyzing the R6G concentration dependence of SERS suggested that the enhancement mechanism effectively excited the R6G molecules in the first layer on the hot spots and invoked the strong SERS effect. These results indicate that the SERS activity of confeito-like AuNPs on SAM substrates has high potential in molecular electronic devices and ultrasensitive analyses.

  13. Infinite-order sudden approximation for collisions involving molecules in Pi electronic states: a new derivation and calculations of rotationally inelastic cross sections for NO(x superscript 2 Pi) + He and Ar

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Corey, G.C.; Alexander, M.H.

    1986-11-15

    A new derivation is presented of the infinite order sudden (IOS) approximation for rotationally inelastic collisions of a diatomic molecule in a Pi electronic state with a closed shell atom. This derivation clearly demonstrates the connection between the two sudden S functions for scattering off the adiabatic potential surface of A' and A symmetry, which would arise from an ab initio calculation on an atom + Pi-state molecule system, and the S matrix elements in diabatic basis, which are required in the quantum treatment of the collision dynamics. Coupled states and IOS calculations were carried out for collisions of NImore » X 2 Pi with helium and argon, based on a electron gas potential surface at total energies of 63, 150, and 300 meV. The IOS approximation is not reliable for collisions of NO with Ar, even at the highest collision energy considered here. However, for collisions with He at 150 and 300 meV, the IOS approximation is nearly quantitative for transitions both within and between the Omega = 1/2 and Omega = 3/2 manifolds.« less

  14. Photoassociation of cold (RbCs)2 tetramers in the ground electronic state

    NASA Astrophysics Data System (ADS)

    Gacesa, Marko; Côté, Robin

    2017-04-01

    We theoretically investigate prospects for photoassociative formation of cold (RbCs)2 tetramers from a pair of ultracold RbCs molecules. The long-range region of the potential energy surface (PES) of the lowest electronic state of (RbCs)2 can be affected by orienting both RbCs molecules by an external electric field. In fact, we find a long-range barrier that supports long-range shelf states for relative angles between the dimers' internuclear axes smaller than about 20°. We show that these shelf states can be populated by spontaneous decay from the first excited electronic state which can be efficiently populated by photoassociation from the scattering continuum at ultracold temperatures. The vibrationally excited ground-state tetramer molecules formed this way have sufficiently long lifetimes to allow experimental detection. Moreover, for the relative angles between the dimers close to 20°, the proposed approach may result in production of deeply bound tetramers. Partially supported by the NASA Postdoctoral Program at the NASA Ames Research Center, administered by USRA and the MURI US Army Research Office Grant No. W911NF-14-1-0378 (MG), and by the PIF program of the National Science Foundation Grant No. PHY-141556.

  15. Collision dynamics of H+ + N2 at low energies based on time-dependent density-functional theory

    NASA Astrophysics Data System (ADS)

    Yu, W.; Zhang, Y.; Zhang, F. S.; Hutton, R.; Zou, Y.; Gao, C.-Z.; Wei, B.

    2018-02-01

    Using time-dependent density-functional theory at the level of local density approximation augmented by a self-interaction correction and coupled non-adiabatically to molecular dynamics, we study, from a theoretical perspective, scattering dynamics of the proton in collisions with the N2 molecule at 30 eV. Nine different collision configurations are employed to analyze the proton energy loss spectra, electron depletion, scattering angles and self-interaction effects. Our results agree qualitatively with the experimental data and previous theoretical calculations. The discrepancies are ascribed to the limitation of the theoretical models in use. We find that self-interaction effects can significantly influence the electron capture and the excited diatomic vibrational motion, which is in consistent with other calculations. In addition, it is found that the molecular structure can be readily retrieved from the proton energy loss spectra due to a significant momentum transfer in head-on collisions.

  16. Role of electronic correlations in photoionization of NO2 in the vicinity of the 2A1/2B2 conical intersection.

    PubMed

    Brambila, Danilo S; Harvey, Alex G; Houfek, Karel; Mašín, Zdeněk; Smirnova, Olga

    2017-08-02

    We present the first ab initio multi-channel photoionization calculations for NO 2 in the vicinity of the 2 A 1 / 2 B 2 conical intersection, for a range of nuclear geometries, using our newly developed set of tools based on the ab initio multichannel R-matrix method. Electronic correlation is included in both the neutral and the scattering states of the molecule via configuration interaction. Configuration mixing is especially important around conical intersections and avoided crossings, both pertinent for NO 2 , and manifests itself via significant variations in photoelectron angular distributions. The method allows for a balanced and accurate description of the photoionization/photorecombination for a number of different ionic channels in a wide range of photoelectron energies up to 100 eV. Proper account of electron correlations is crucial for interpreting time-resolved signals in photoelectron spectroscopy and high harmonic generation (HHG) from polyatomic molecules.

  17. Geometric phase effects in ultracold hydrogen exchange reactions

    NASA Astrophysics Data System (ADS)

    Naduvalath, Balakrishnan; Croft, James F. E.; Hazra, Jisha; Kendrick, Brian K.

    2017-04-01

    Electronically non-adiabatic effects play an important role in many chemical reactions. The geometric phase, also known as the Berry's phase, arises from the adiabatic transport of the electronic wave function around a conical intersection between two electronic potential energy surfaces. It is shown that in ultracold collisions of H and D atoms with vibrationally excited HD, inclusion of the geometric phase leads to constructive and destructive interferences between non-reactive and exchange components of the wave function. This results in strong enhancement or suppression of reactivity depending on the final rovibrational levels of the scattered HD molecules. The effect is illustrated for non-rotating and rotationally excited HD molecules in the v = 4 vibrational level for which the H+HD and D+HD reactions occur through a barrierless path. This work was supported in part by NSF Grant PHY-1505557 (N.B.), ARO MURI Grant No. W911NF-12-1-0476 (N.B.), and DOE LDRD Grant No. 20170221ER (B.K.).

  18. An R-matrix study of electron induced processes in BF3 plasma

    NASA Astrophysics Data System (ADS)

    Gupta, Dhanoj; Chakrabarti, Kalyan; Yoon, Jung-Sik; Song, Mi-Young

    2017-12-01

    An R-matrix formalism is used to study electron collision with the BF3 molecule using Quantemol-N, a computational system for electron molecule collisions which uses the molecular R-matrix method. Several target models are tested for BF3 in its equilibrium geometry, and the results are presented for the best model. Scattering calculations are then performed to yield resonance parameters, elastic, differential, excitation, and momentum transfer cross sections. The results for all the cross sections are compared with the experimental and theoretical data, and a good agreement is obtained. The resonances have been detected at 3.79 and 13.58 eV, with the ionization threshold being 15.7 eV. We have also estimated the absolute dissociative electron attachment (DEA) cross section for the F- ion production from BF3, which is a maiden attempt. The peak of the DEA is at around 13.5 eV, which is well supported by the resonance detected at 13.58 eV. The cross sections reported here find a variety of applications in the plasma technology.

  19. Excitation of vibrational quanta in furfural by intermediate-energy electrons

    NASA Astrophysics Data System (ADS)

    Jones, D. B.; Neves, R. F. C.; Lopes, M. C. A.; da Costa, R. F.; Varella, M. T. do N.; Bettega, M. H. F.; Lima, M. A. P.; García, G.; Blanco, F.; Brunger, M. J.

    2015-12-01

    We report cross sections for electron-impact excitation of vibrational quanta in furfural, at intermediate incident electron energies (20, 30, and 40 eV). The present differential cross sections are measured over the scattered electron angular range 10°-90°, with corresponding integral cross sections subsequently being determined. Furfural is a viable plant-derived alternative to petrochemicals, being produced via low-temperature plasma treatment of biomass. Current yields, however, need to be significantly improved, possibly through modelling, with the present cross sections being an important component of such simulations. To the best of our knowledge, there are no other cross sections for vibrational excitation of furfural available in the literature, so the present data are valuable for this important molecule.

  20. Inelastic Tunneling Spectroscopy of Alkanethiol Molecules: High-Resolution Spectroscopy and Theoretical Simulations

    NASA Astrophysics Data System (ADS)

    Okabayashi, Norio; Paulsson, Magnus; Ueba, Hiromu; Konda, Youhei; Komeda, Tadahiro

    2010-02-01

    We investigate inelastic electron tunneling spectroscopy (IETS) for alkanethiol self-assembled monolayers (SAM) with a scanning tunneling microscope and compare it to first-principles calculations. Using a combination of partial deuteration of the molecule and high-resolution measurements, we identify and differentiate between methyl (CH3) and methylene (CH2) groups and their symmetric and asymmetric C-H stretch modes. The calculations agree quantitatively with the measured IETS in producing the weight of the symmetric and asymmetric C-H stretch modes while the methylene stretch mode is largely underestimated. We further show that inelastic intermolecular scattering is important in the SAM by plotting the theoretical current densities.

  1. Low Energy Positron Scattering, Transport, and Applications

    NASA Astrophysics Data System (ADS)

    Buckman, Stephen

    2017-04-01

    Relatively intense, high energy-resolution beams of low-energy positrons are now available through the use of buffer-gas (Surko) traps. These have led to measurements of interaction cross sections for a broad range of atoms and molecules, including molecules of biological interest. The increased energy resolution, and experimental techniques developed for scattering in strong magnetic fields has also enabled highly accurate measurements of discrete excitation processes such as electronic and vibrational excitation, positronium formation and ionization in a range of atomic and molecular species. This talk will review some of these measurements and discuss their application in new and sophisticated models of positron transport which aim, for example, to provide a better understanding of the atomic and molecular processes which occur when positrons are emitted in the body during a Positron Emission Tomography scan. This work is part of a broad collaboration between the ANU (James Sullivan, Joshua Machacek), Flinders University (Michael Brunger), James Cook University (Ronald White and co-workers) CSIC Madrid (Gustavo Garcia) and the Institute of Physics, Belgrade (Zoran Petrovic and colleagues).

  2. Exploring the limits of the self-consistent Born approximation for inelastic electronic transport

    NASA Astrophysics Data System (ADS)

    Lee, William; Jean, Nicola; Sanvito, Stefano

    2009-02-01

    The nonequilibrium Green’s function formalism is today the standard computational method for describing elastic transport in molecular devices. This can be extended to include inelastic scattering by the so-called self-consistent Born approximation (SCBA), where the interaction of the electrons with the vibrations of the molecule is assumed to be weak and it is treated perturbatively. The validity of such assumption and therefore of the SCBA is difficult to establish with certainty. In this work we explore the limitations of the SCBA by using a simple tight-binding model with the electron-phonon coupling strength α chosen as a free parameter. As model devices we consider Au monatomic chains and a H2 molecule sandwiched between Pt electrodes. In both cases, our self-consistent calculations demonstrate a breakdown of the SCBA for large α and we identify a weak and a strong-coupling regime. For weak coupling our SCBA results compare closely with those obtained with exact scattering theory. However in the strong-coupling regime large deviations are found. In particular we demonstrate that there is a critical coupling strength, characteristic of the materials system, beyond which multiple self-consistent solutions can be found depending on the initial conditions in the simulation. These are entirely due to the large contribution of the Hartree self-energy and completely disappear when this is neglected. We attribute this feature to the breakdown of the perturbative expansion leading to the SCBA.

  3. X-ray crystallography

    NASA Technical Reports Server (NTRS)

    2001-01-01

    X-rays diffracted from a well-ordered protein crystal create sharp patterns of scattered light on film. A computer can use these patterns to generate a model of a protein molecule. To analyze the selected crystal, an X-ray crystallographer shines X-rays through the crystal. Unlike a single dental X-ray, which produces a shadow image of a tooth, these X-rays have to be taken many times from different angles to produce a pattern from the scattered light, a map of the intensity of the X-rays after they diffract through the crystal. The X-rays bounce off the electron clouds that form the outer structure of each atom. A flawed crystal will yield a blurry pattern; a well-ordered protein crystal yields a series of sharp diffraction patterns. From these patterns, researchers build an electron density map. With powerful computers and a lot of calculations, scientists can use the electron density patterns to determine the structure of the protein and make a computer-generated model of the structure. The models let researchers improve their understanding of how the protein functions. They also allow scientists to look for receptor sites and active areas that control a protein's function and role in the progress of diseases. From there, pharmaceutical researchers can design molecules that fit the active site, much like a key and lock, so that the protein is locked without affecting the rest of the body. This is called structure-based drug design.

  4. Rotationally inelastic scattering of ND3 with H2 as a probe of the intermolecular potential energy surface

    NASA Astrophysics Data System (ADS)

    Tkáč, Ondřej; Saha, Ashim K.; Loreau, Jérôme; Ma, Qianli; Dagdigian, Paul J.; Parker, David H.; van der Avoird, Ad; Orr-Ewing, Andrew J.

    2015-12-01

    Differential cross sections (DCSs) are reported for rotationally inelastic scattering of ND3 with H2, measured using a crossed molecular beam apparatus with velocity map imaging (VMI). ND3 molecules were quantum-state selected in the ground electronic and vibrational levels and, optionally, in the j±k = 11- rotation-inversion level prior to collisions. Inelastic scattering of state-selected ND3 with H2 was measured at the mean collision energy of 580 cm-1 by resonance-enhanced multiphoton ionisation spectroscopy and VMI of ND3 in selected single final j'±k' levels. Comparison of experimental DCSs with close-coupling quantum-mechanical scattering calculations serves as a test of a recently reported ab initio potential energy surface. Calculated integral cross sections reveal the propensities for scattering into various final j'±k' levels of ND3 and differences between scattering by ortho and para H2. Integral and differential cross sections are also computed at a mean collision energy of 430 cm-1 and compared to our recent results for inelastic scattering of state-selected ND3 with He.

  5. APPLICATION OF THE CLASSICAL SELFCORRELATION FUNCTION TO DETERMINE THE SLOW NEUTRON SCATTERING CROSS-SECTION OF FREE MOLECULES

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Parlinski, K.

    1962-06-01

    A classical selfcorrelation function is found for an atom in the molecule by considering the translation of the free molecule, its rotation and oscillation. The Krieger-Nelkin formula for the differential cross section of incoherent neutron scattering by molecules is derived from the correlation. (auth)

  6. Space Shuttle Exhaust Modifications of the Mid-Latitude Ionospheric Plasma As Diagnosed By Ground Based Radar

    NASA Astrophysics Data System (ADS)

    Lind, F. D.; Erickson, P. J.; Bhatt, A.; Bernhardt, P. A.

    2009-12-01

    The Space Shuttle's Orbital Maneuvering System (OMS) engines have been used since the early days of the STS program for active ionospheric modification experiments designed to be viewed by ground based ionospheric radar systems. In 1995, the Naval Research Laboratory initiated the Shuttle Ionospheric Modification with Pulsed Localized Exhaust (SIMPLEX) Program using dedicated Space Shuttle OMS burns scheduled through the US Department of Defense's Space Test Program. SIMPLEX objectives include generation of localized ion-acoustic turbulence and the formation of ionospheric density irregularities for injections perpendicular to the local magnetic field, creating structures which can scatter incident UHF radar signals. We discuss radar observations made during several recent SIMPLEX mid-latitude experiments conducted over the Millstone Hill incoherent scatter radar system in Westford, Massachusetts. OMS engine firings release 10 kg/s of CO2, H2, H2O, and N2 molecules which charge exchange with ambient O+ ions in the F region, producing molecular ions and long lived electron density depletions as recombination occurs with ambient electrons. Depending on the magnetic field angle, the high velocity of the injected reactive exhaust molecules relative to the background ionosphere can create longitudinal propagating ion acoustic waves with amplitudes well above normal thermal levels and stimulate a wide variety of plasma instability processes. These effects produce high radar cross section targets readily visible to the Millstone Hill system, a high power large aperture radar designed to measure very weak scatter from the quiescent background ionosphere. We will survey the plasma instability parameter space explored to date and discuss plans for future SIMPLEX observations.

  7. Differential cross sections for electron-impact excitation of the electronic states of pyrimidine

    NASA Astrophysics Data System (ADS)

    Brunger, Michael; Jones, Darryl; Bellm, Susan

    2012-06-01

    Pyrimidine (C4N2H4) is an important molecule, as it forms the basis of larger biomolecules, such as the DNA bases thymine, cytosine and uracil. There is a pressing demand for low-energy electron scattering data from such biological analogs in order to model radiation induced damage [1]. We therefore present the first measurements for absolute differential cross section data for low-energy electron-impact excitation of the electronic states of pyrimidine. The present measurements were performed using a crossed-beam apparatus [2] for incident electron energies ranging between 15 to 50eV while covering a 10 to 90^o angular range. Here the absolute scale has been determined through a normalisation to the recently measured elastic scattering differential cross section data for pyrimidine [3]. [1] F. Ferreira da Silva, D. Almeida, G. Martins, A. R. Milosavljevic, B. P. Marinkovic, S. V. Hoffmann, N. J. Mason, Y. Nunes, G. Garcia and P. Limao-Vieira, Phys Chem Chem Phys 12, 6717 (2010). [2] M. J. Brunger and P. J. O. Teubner, Phys Rev A 41, 1413 (1990). [3] P. Palihawadana, J. Sullivan, M. Brunger, C. Winstead, V. McKoy, G. Garcia, F. Blanco and S. Buckman, Phys Rev A 84, 062702 (2011).

  8. Accurate optimization of amino acid form factors for computing small-angle X-ray scattering intensity of atomistic protein structures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tong, Dudu; Yang, Sichun; Lu, Lanyuan

    2016-06-20

    Structure modellingviasmall-angle X-ray scattering (SAXS) data generally requires intensive computations of scattering intensity from any given biomolecular structure, where the accurate evaluation of SAXS profiles using coarse-grained (CG) methods is vital to improve computational efficiency. To date, most CG SAXS computing methods have been based on a single-bead-per-residue approximation but have neglected structural correlations between amino acids. To improve the accuracy of scattering calculations, accurate CG form factors of amino acids are now derived using a rigorous optimization strategy, termed electron-density matching (EDM), to best fit electron-density distributions of protein structures. This EDM method is compared with and tested againstmore » other CG SAXS computing methods, and the resulting CG SAXS profiles from EDM agree better with all-atom theoretical SAXS data. By including the protein hydration shell represented by explicit CG water molecules and the correction of protein excluded volume, the developed CG form factors also reproduce the selected experimental SAXS profiles with very small deviations. Taken together, these EDM-derived CG form factors present an accurate and efficient computational approach for SAXS computing, especially when higher molecular details (represented by theqrange of the SAXS data) become necessary for effective structure modelling.« less

  9. Strong interaction between dye molecule and electromagnetic field localized around 1 Nm3 at gaps of nanoparticle dimers by plasmon resonance

    NASA Astrophysics Data System (ADS)

    Itoh, Tamitake; Yamamoto, Yuko S.

    2017-11-01

    Electronic transition rates of a molecule located at a crevasse or a gap of a plasmonic nanoparticle (NP) dimer are largely enhanced up to the factor of around 106 due to electromagnetic (EM) coupling between plasmonic and molecular electronic resonances. The coupling rate is determined by mode density of the EM fields at the crevasse and the oscillator strength of the local electronic resonance of a molecule. The enhancement by EM coupling at a gap of plasmonic NP dimer enables us single molecule (SM) Raman spectroscopy. Recently, this type of research has entered a new regime wherein EM enhancement effects cannot be treated by conventional theorems, namely EM mechanism. Thus, such theorems used for the EM enhancement effect should be re-examined. We here firstly summarize EM mechanism by using surface-enhanced Raman scattering (SERS), which is common in EM enhancement phenomena. Secondly, we focus on recent two our studies on probing SM fluctuation by SERS within the spatial resolution of sub-nanometer scales. Finally, we discuss the necessity of re-examining the EM mechanism with respect to two-fold breakdowns of the weak coupling assumption: the breakdown of Kasha's rule induced by the ultra-fast plasmonic de-excitation and the breakdown of the weak coupling by EM coupling rates exceeding both the plasmonic and molecular excitonic dephasing rates.

  10. Application of 3A molecular sieve layer in dye-sensitized solar cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yan, Yuan; Wang, Jinzhong, E-mail: jinzhong-wang@hit.edu.cn, E-mail: qingjiang.yu@hit.edu.cn; Yu, Qingjiang, E-mail: jinzhong-wang@hit.edu.cn, E-mail: qingjiang.yu@hit.edu.cn

    2014-08-25

    3A molecular sieve layer was used as dehydration and electronic-insulation layer on the TiO{sub 2} electrode of dye-sensitized solar cells. This layer diminished the effect of water in electrolyte efficiently and enhanced the performance of cells. The conversion efficiency increased from 9.58% to 10.2%. The good moisture resistance of cells was attributed to the three-dimensional interconnecting structure of 3A molecular sieve with strong adsorption of water molecule. While the performance enhancement benefited from the suppression of the charge recombination of electronic-insulation layer and scattering effect of large particles.

  11. X-ray lasers for structural and dynamic biology

    NASA Astrophysics Data System (ADS)

    Spence, J. C. H.; Weierstall, U.; Chapman, H. N.

    2012-10-01

    Research opportunities and techniques are reviewed for the application of hard x-ray pulsed free-electron lasers (XFEL) to structural biology. These include the imaging of protein nanocrystals, single particles such as viruses, pump-probe experiments for time-resolved nanocrystallography, and snapshot wide-angle x-ray scattering (WAXS) from molecules in solution. The use of femtosecond exposure times, rather than freezing of samples, as a means of minimizing radiation damage is shown to open up new opportunities for the molecular imaging of biochemical reactions at room temperature in solution. This is possible using a ‘diffract-and-destroy’ mode in which the incident pulse terminates before radiation damage begins. Methods for delivering hundreds of hydrated bioparticles per second (in random orientations) to a pulsed x-ray beam are described. New data analysis approaches are outlined for the correlated fluctuations in fast WAXS, for protein nanocrystals just a few molecules on a side, and for the continuous x-ray scattering from a single virus. Methods for determining the orientation of a molecule from its diffraction pattern are reviewed. Methods for the preparation of protein nanocrystals are also reviewed. New opportunities for solving the phase problem for XFEL data are outlined. A summary of the latest results is given, which now extend to atomic resolution for nanocrystals. Possibilities for time-resolved chemistry using fast WAXS (solution scattering) from mixtures is reviewed, toward the general goal of making molecular movies of biochemical processes.

  12. Electron radiography

    DOEpatents

    Merrill, Frank E.; Morris, Christopher

    2005-05-17

    A system capable of performing radiography using a beam of electrons. Diffuser means receive a beam of electrons and diffuse the electrons before they enter first matching quadrupoles where the diffused electrons are focused prior to the diffused electrons entering an object. First imaging quadrupoles receive the focused diffused electrons after the focused diffused electrons have been scattered by the object for focusing the scattered electrons. Collimator means receive the scattered electrons and remove scattered electrons that have scattered to large angles. Second imaging quadrupoles receive the collimated scattered electrons and refocus the collimated scattered electrons and map the focused collimated scattered electrons to transverse locations on an image plane representative of the electrons' positions in the object.

  13. Elastic scattering and vibrational excitation for electron impact on para-benzoquinone

    NASA Astrophysics Data System (ADS)

    Jones, D. B.; Blanco, F.; García, G.; da Costa, R. F.; Kossoski, F.; Varella, M. T. do N.; Bettega, M. H. F.; Lima, M. A. P.; White, R. D.; Brunger, M. J.

    2017-12-01

    We report on theoretical elastic and experimental vibrational-excitation differential cross sections (DCSs) for electron scattering from para-benzoquinone (C6H4O2), in the intermediate energy range 15-50 eV. The calculations were conducted with two different theoretical methodologies, the Schwinger multichannel method with pseudopotentials (SMCPP) and the independent atom method with screening corrected additivity rule (IAM-SCAR) that also now incorporates a further interference (I) term. The SMCPP with N energetically open electronic states (Nopen) at the static-exchange-plus-polarisation (Nopench-SEP) level was used to calculate the scattering amplitudes using a channel coupling scheme that ranges from 1ch-SE up to the 89ch-SEP level of approximation. We found that in going from the 38ch-SEP to the 89ch-SEP, at all energies considered here, the elastic DCSs did not change significantly in terms of both their shapes and magnitudes. This is a good indication that our SMCPP 89ch-SEP elastic DCSs are converged with respect to the multichannel coupling effect for the investigated intermediate energies. While agreement between our IAM-SCAR+I and SMCPP 89ch-SEP computations improves as the incident electron energy increases from 15 eV, overall the level of accord is only marginal. This is particularly true at middle scattering angles, suggesting that our SCAR and interference corrections are failing somewhat for this molecule below 50 eV. We also report experimental DCS results, using a crossed-beam apparatus, for excitation of some of the unresolved ("hybrid") vibrational quanta (bands I-III) of para-benzoquinone. Those data were derived from electron energy loss spectra that were measured over a scattered electron angular range of 10°-90° and put on an absolute scale using our elastic SMCPP 89ch-SEP DCS results. The energy resolution of our measurements was ˜80 meV, which is why, at least in part, the observed vibrational features were only partially resolved. To the best of our knowledge, there are no other experimental or theoretical vibrational excitation results against which we might compare the present measurements.

  14. Absolute vibrational excitation cross sections for 1-18 eV electron scattering from condensed dimethyl phosphate (DMP)

    NASA Astrophysics Data System (ADS)

    Lemelin, V.; Bass, A. D.; Wagner, J. R.; Sanche, L.

    2017-12-01

    Absolute cross sections (CSs) for vibrational excitation by 1-18 eV electrons incident on condensed dimethyl phosphate (DMP) were measured with a high-resolution electron energy loss (EEL) spectrometer. Absolute CSs were extracted from EEL spectra of DMP condensed on multilayer film of Ar held at about 20 K under ultra-high vacuum (˜1 × 10-11 Torr). Structures observed in the energy dependence of the CSs around 2, 4, 7, and 12 eV were compared with previous results of gas- and solid-phase experiments and with theoretical studies on dimethyl phosphate and related molecules. These structures were attributed to the formation of shape resonances.

  15. Observation of two-center interference effects for electron impact ionization of N2

    NASA Astrophysics Data System (ADS)

    Chaluvadi, Hari; Nur Ozer, Zehra; Dogan, Mevlut; Ning, Chuangang; Colgan, James; Madison, Don

    2015-08-01

    In 1966, Cohen and Fano (1966 Phys. Rev. 150 30) suggested that one should be able to observe the equivalent of Young’s double slit interference if the double slits were replaced by a diatomic molecule. This suggestion inspired many experimental and theoretical studies searching for double slit interference effects both for photon and particle ionization of diatomic molecules. These effects turned out to be so small for particle ionization that this work proceeded slowly and evidence for interference effects were only found by looking at cross section ratios. Most of the early particle work concentrated on double differential cross sections for heavy particle scattering and the first evidence for two-center interference for electron-impact triple differential cross section (TDCS) did not appear until 2006 for ionization of H2. Subsequent work has now firmly established that two-center interference effects can be seen in the TDCS for electron-impact ionization of H2. However, in spite of several experimental and theoretical studies, similar effects have not been found for electron-impact ionization of N2. Here we report the first evidence for two-center interference for electron-impact ionization of N2.

  16. The polarization anisotropy of vibrational quantum beats in resonant pump-probe experiments: Diagrammatic calculations for square symmetric molecules.

    PubMed

    Farrow, Darcie A; Smith, Eric R; Qian, Wei; Jonas, David M

    2008-11-07

    By analogy to the Raman depolarization ratio, vibrational quantum beats in pump-probe experiments depend on the relative pump and probe laser beam polarizations in a way that reflects vibrational symmetry. The polarization signatures differ from those in spontaneous Raman scattering because the order of field-matter interactions is different. Since pump-probe experiments are sensitive to vibrations on excited electronic states, the polarization anisotropy of vibrational quantum beats can also reflect electronic relaxation processes. Diagrammatic treatments, which expand use of the symmetry of the two-photon tensor to treat signal pathways with vibrational and vibronic coherences, are applied to find the polarization anisotropy of vibrational and vibronic quantum beats in pump-probe experiments for different stages of electronic relaxation in square symmetric molecules. Asymmetric vibrational quantum beats can be distinguished from asymmetric vibronic quantum beats by a pi phase jump near the center of the electronic spectrum and their disappearance in the impulsive limit. Beyond identification of vibrational symmetry, the vibrational quantum beat anisotropy can be used to determine if components of a doubly degenerate electronic state are unrelaxed, dephased, population exchanged, or completely equilibrated.

  17. Rydberg Molecules for Ion-Atom Scattering in the Ultracold Regime

    NASA Astrophysics Data System (ADS)

    Schmid, T.; Veit, C.; Zuber, N.; Löw, R.; Pfau, T.; Tarana, M.; Tomza, M.

    2018-04-01

    We propose a novel experimental method to extend the investigation of ion-atom collisions from the so far studied cold, essentially classical regime to the ultracold, quantum regime. The key aspect of this method is the use of Rydberg molecules to initialize the ultracold ion-atom scattering event. We exemplify the proposed method with the lithium ion-atom system, for which we present simulations of how the initial Rydberg molecule wave function, freed by photoionization, evolves in the presence of the ion-atom scattering potential. We predict bounds for the ion-atom scattering length from ab initio calculations of the interaction potential. We demonstrate that, in the predicted bounds, the scattering length can be experimentally determined from the velocity of the scattered wave packet in the case of 6Li+ = 6Li and from the molecular ion fraction in the case of 7Li+ - 7Li. The proposed method to utilize Rydberg molecules for ultracold ion-atom scattering, here particularized for the lithium ion-atom system, is readily applicable to other ion-atom systems as well.

  18. Rydberg Molecules for Ion-Atom Scattering in the Ultracold Regime.

    PubMed

    Schmid, T; Veit, C; Zuber, N; Löw, R; Pfau, T; Tarana, M; Tomza, M

    2018-04-13

    We propose a novel experimental method to extend the investigation of ion-atom collisions from the so far studied cold, essentially classical regime to the ultracold, quantum regime. The key aspect of this method is the use of Rydberg molecules to initialize the ultracold ion-atom scattering event. We exemplify the proposed method with the lithium ion-atom system, for which we present simulations of how the initial Rydberg molecule wave function, freed by photoionization, evolves in the presence of the ion-atom scattering potential. We predict bounds for the ion-atom scattering length from ab initio calculations of the interaction potential. We demonstrate that, in the predicted bounds, the scattering length can be experimentally determined from the velocity of the scattered wave packet in the case of ^{6}Li^{+}-^{6}Li and from the molecular ion fraction in the case of ^{7}Li^{+}-^{7}Li. The proposed method to utilize Rydberg molecules for ultracold ion-atom scattering, here particularized for the lithium ion-atom system, is readily applicable to other ion-atom systems as well.

  19. Computational challenges in atomic, molecular and optical physics.

    PubMed

    Taylor, Kenneth T

    2002-06-15

    Six challenges are discussed. These are the laser-driven helium atom; the laser-driven hydrogen molecule and hydrogen molecular ion; electron scattering (with ionization) from one-electron atoms; the vibrational and rotational structure of molecules such as H(3)(+) and water at their dissociation limits; laser-heated clusters; and quantum degeneracy and Bose-Einstein condensation. The first four concern fundamental few-body systems where use of high-performance computing (HPC) is currently making possible accurate modelling from first principles. This leads to reliable predictions and support for laboratory experiment as well as true understanding of the dynamics. Important aspects of these challenges addressable only via a terascale facility are set out. Such a facility makes the last two challenges in the above list meaningfully accessible for the first time, and the scientific interest together with the prospective role for HPC in these is emphasized.

  20. Ultrasensitive ROS-Responsive Coassemblies of Tellurium-Containing Molecules and Phospholipids.

    PubMed

    Wang, Lu; Fan, Fuqiang; Cao, Wei; Xu, Huaping

    2015-07-29

    Reactive oxygen species (ROS) play crucial roles in cell signaling and redox homeostasis and are strongly related to metabolic activities. The increase of the ROS concentration in organisms can result in several diseases, such as cardiovascular diseases and cancer. The concentration of ROS in biologically relevant conditions is typically as low as around tens of micromolars to 100 μM H2O2, which makes it necessary to develop ultrasensitive ROS-responsive systems. A general approach is reported here to fabricate an ultrasensitive ROS-responsive system via coassembly between tellurium-containing molecules and phospholipids, combining the ROS-responsiveness of tellurium and the biocompatibility of phospholipids. By using dynamic light scattering, transmission electron microscopy, scanning electron microscopy, and NMR spectra, coassembly behaviors and the responsiveness of the coassemblies have been investigated. These coassemblies can respond to 100 μM H2O2, which is a biologically relevant ROS concentration, and demonstrate reversible redox properties.

  1. Relative importance of multiple scattering by air molecules and aerosols in forming the atmospheric path radiance in the visible and near-infrared parts of the spectrum.

    PubMed

    Antoine, D; Morel, A

    1998-04-20

    Single and multiple scattering by molecules or by atmospheric aerosols only (homogeneous scattering), and heterogeneous scattering by aerosols and molecules, are recorded in Monte Carlo simulations. It is shown that heterogeneous scattering (1) always contributes significantly to the path reflectance (rho(path)), (2) is realized at the expense of homogeneous scattering, (3) decreases when aerosols are absorbing, and (4) introduces deviations in the spectral dependencies of reflectances compared with the Rayleigh exponent and the aerosol angstrom exponent. The ratio of rho(path) to the Rayleigh reflectance for an aerosol-free atmosphere is linearly related to the aerosol optical thickness. This result provides a basis for a new scheme for atmospheric correction of remotely sensed ocean color observations.

  2. Local Intensity Enhancements in Spherical Microcavities: Implications for Photonic Chemical and Biological Sensors

    NASA Technical Reports Server (NTRS)

    Fuller, Kirk A.

    2005-01-01

    In this report, we summarize recent findings regarding the use spherical microcavities in the amplification of light that is inelastically scattered by either fluorescent or Raman-active molecules. This discussion will focus on Raman scattering, with the understanding that analogous processes apply to fluorescence. Raman spectra can be generated through the use of a very strong light source that stimulates inelastic light scattering by molecules, with the scattering occurring at wavelengths shifted from that of the source and being most prominent at shifts associated with the molecules natural vibrational frequencies. The Raman signal can be greatly enhanced by exposing a molecule to the intense electric fields that arise near surfaces (typically of gold or silver) exhibiting nanoscale roughness. This is known as surface-enhanced Raman scattering (SERS). SERS typically produces gain factors of 103 - 106, but under special conditions, factors of 1010 - 1014 have been achieved.

  3. Polarized Continuum Radiation from Stellar Atmospheres

    NASA Astrophysics Data System (ADS)

    Harrington, J. Patrick

    2015-10-01

    Continuum scattering by free electrons can be significant in early type stars, while in late type stars Rayleigh scattering by hydrogen atoms or molecules may be important. Computer programs used to construct models of stellar atmospheres generally treat the scattering of the continuum radiation as isotropic and unpolarized, but this scattering has a dipole angular dependence and will produce polarization. We review an accurate method for evaluating the polarization and limb darkening of the radiation from model stellar atmospheres. We use this method to obtain results for: (i) Late type stars, based on the MARCS code models (Gustafsson et al. 2008), and (ii) Early type stars, based on the NLTE code TLUSTY (Lanz and Hubeny 2003). These results are tabulated at http://www.astro.umd.edu/~jph/Stellar_Polarization.html. While the net polarization vanishes for an unresolved spherical star, this symmetry is broken by rapid rotation or by the masking of part of the star by a binary companion or during the transit of an exoplanet. We give some numerical results for these last cases.

  4. Single-Molecule Chemistry with Surface- and Tip-Enhanced Raman Spectroscopy.

    PubMed

    Zrimsek, Alyssa B; Chiang, Naihao; Mattei, Michael; Zaleski, Stephanie; McAnally, Michael O; Chapman, Craig T; Henry, Anne-Isabelle; Schatz, George C; Van Duyne, Richard P

    2017-06-14

    Single-molecule (SM) surface-enhanced Raman spectroscopy (SERS) and tip-enhanced Raman spectroscopy (TERS) have emerged as analytical techniques for characterizing molecular systems in nanoscale environments. SERS and TERS use plasmonically enhanced Raman scattering to characterize the chemical information on single molecules. Additionally, TERS can image single molecules with subnanometer spatial resolution. In this review, we cover the development and history of SERS and TERS, including the concept of SERS hot spots and the plasmonic nanostructures necessary for SM detection, the past and current methodologies for verifying SMSERS, and investigations into understanding the signal heterogeneities observed with SMSERS. Moving on to TERS, we cover tip fabrication and the physical origins of the subnanometer spatial resolution. Then, we highlight recent advances of SMSERS and TERS in fields such as electrochemistry, catalysis, and SM electronics, which all benefit from the vibrational characterization of single molecules. SMSERS and TERS provide new insights on molecular behavior that would otherwise be obscured in an ensemble-averaged measurement.

  5. Modelling fragmentations of aminoacids after resonant electron attachment: quantum evidence of possible direct -OH detachment

    NASA Astrophysics Data System (ADS)

    Panosetti, C.; Baccarelli, I.; Sebastianelli, F.; Gianturco, F. A.

    2010-10-01

    We investigate some aspects of the radiation damage mechanisms in biomolecules, focusing on the modelling of resonant fragmentation caused by the attachment of low-energy electrons (LEEs) initially ejected by biological tissues when exposed to ionizing radiation. Scattering equations are formulated within a symmetry-adapted, single-center expansion of both continuum and bound electrons, and the interaction forces are obtained from a combination of ab initio calculations and a nonempirical model of exchange and correlation effects developped in our group. We present total elastic scattering cross-sections and resonance features obtained for the equilibrium geometries of glycine, alanine, proline and valine. Our results at those geometries of the target molecules are briefly shown to qualitatively explain some of the fragmentation patterns obtained in experiments. We further carry out a one-dimensional (1D) modeling for the dynamics of intramolecular energy transfers mediated by the vibrational activation of selected bonds: our calculations indicate that resonant electron attachment to glycine can trigger direct, dissociative evolution of the complex into (Gly-OH)- and -OH losses, while they also find that the same process does not occur via a direct, 1D dissociative path in the larger aminoacids of the present study.

  6. Electronic excitation cross section in positron scattering by H2 molecules using distorted-wave method

    NASA Astrophysics Data System (ADS)

    Weiss, Luciara I.; Pinho, Adriane S. F.; Michelin, Sergio E.; Fujimoto, Milton M.

    2018-02-01

    In this work we have applied for the first time the distorted-wave approximation (DWA) combined with Schwinger Variational Iterative Method (SVIM) to describe electronic excitation of H2 molecules by positron collisions. The integral (ICS) and differential (DCS) excitation cross sections for X 1 Σ g + → B 1 Σ u + transition of H2 molecule, in the range from near threshold up to 45 eV of positron energies, were reported in static (ST) and static-correlation-polarization (STPOL) levels. Our two-state ICS in DWA-ST level have quantitative agreement with experimental measurement at energies from threshold up to 18 eV and the inclusion of polarization effects increases the cross sections. Comparison with 2-state close-coupling approximation (CCA), 2-state Schwinger Multichannel (SMC), 5-state SMC and 1013-state from Convergent Close-Coupling (CCC) methods are done and is encouraging. The relative steeper drop above 22 eV in experimental ICS was not observed by any theoretical calculations indicating that new measurements would be interesting for this transition in this energy range.

  7. Surface-enhanced Raman scattering active gold nanoparticle/nanohole arrays fabricated through electron beam lithography

    NASA Astrophysics Data System (ADS)

    Wu, Tsunghsueh; Lin, Yang-Wei

    2018-03-01

    Effective surface-enhanced Raman scattering (SERS)-active substrates from gold nanoparticle and gold nanohole arrays were successfully fabricated through electron beam lithography with precise computer-aided control of the unit size and intergap distance. Their SERS performance was evaluated using 4-mercaptobenzoic acid (4-MBA). These gold arrays yielded strong SERS signals under 785 nm laser excitation. The enhancement factors for 4-MBA molecules on the prepared gold nanoparticle and nanohole arrays maxed at 1.08 × 107 and 8.61 × 106, respectively. The observed increase in SERS enhancement was attributed to the localized surface plasmon resonance (LSPR) wavelength shifting toward the near-infrared regime when the gold nanohole diameter increased, in agreement with the theoretical prediction in this study. The contribution of LSPR to the Raman enhancement from nanohole arrays deposited on fluorine-doped tin oxide glass was elucidated by comparing SERS and transmission spectra. This simple fabrication procedure, which entails employing electron beam lithography and the controllability of the intergap distance, suggests highly promising uses of nanohole arrays as functional components in sensing and photonic devices.

  8. Time-Dependent Wave Packet Dynamics Calculations of Cross Sections for Ultracold Scattering of Molecules

    NASA Astrophysics Data System (ADS)

    Huang, Jiayu; Liu, Shu; Zhang, Dong H.; Krems, Roman V.

    2018-04-01

    Because the de Broglie wavelength of ultracold molecules is very large, the cross sections for collisions of molecules at ultracold temperatures are always computed by the time-independent quantum scattering approach. Here, we report the first accurate time-dependent wave packet dynamics calculation for reactive scattering of ultracold molecules. Wave packet dynamics calculations can be applied to molecular systems with more dimensions and provide real-time information on the process of bond rearrangement and/or energy exchange in molecular collisions. Our work thus makes possible the extension of rigorous quantum calculations of ultracold reaction properties to polyatomic molecules and adds a new powerful tool for the study of ultracold chemistry.

  9. Time-Dependent Wave Packet Dynamics Calculations of Cross Sections for Ultracold Scattering of Molecules.

    PubMed

    Huang, Jiayu; Liu, Shu; Zhang, Dong H; Krems, Roman V

    2018-04-06

    Because the de Broglie wavelength of ultracold molecules is very large, the cross sections for collisions of molecules at ultracold temperatures are always computed by the time-independent quantum scattering approach. Here, we report the first accurate time-dependent wave packet dynamics calculation for reactive scattering of ultracold molecules. Wave packet dynamics calculations can be applied to molecular systems with more dimensions and provide real-time information on the process of bond rearrangement and/or energy exchange in molecular collisions. Our work thus makes possible the extension of rigorous quantum calculations of ultracold reaction properties to polyatomic molecules and adds a new powerful tool for the study of ultracold chemistry.

  10. Computational Study of Nonadiabatic Effects in Atom-Molecule Reactive Scattering.

    DTIC Science & Technology

    1982-11-15

    a similar interpretation to those in Fig. 4-a, with the rotational effects most evident in the reactant tube (due to the mixing of the two open rotor ...AD-A125 135 COMPUTATIONAL STUDY OF NONRDIABATIC EFFECTS IN 1/2 ATOM-MOLECULE REACTIVE SCATTERING(U) CHEMICAL DYNAMICS CORP COLUMBUS OH B C GARRETT...COMPUTATIONAL STUDY OF NONADIABATIC EFFECTS [ Z IN ATOM-MOLECULE REACTIVE SCATTERING C:) TO AIR FORCE OFFICE OF SCIENTIFIC RESEARCHk CONTRACT NO. F49620-81

  11. Electron induced dissociation in condensed-phase nitromethane I: desorption of ionic fragments.

    PubMed

    Bazin, Marc; Ptasińska, Sylwia; Bass, Andrew D; Sanche, Léon

    2009-03-14

    Low energy electron induced dissociation of condensed nitromethane was investigated by measuring the electron stimulated desorption of anions and cations from multilayer films of CH(3)NO(2) and CD(3)NO(2), using a recently constructed, high sensitivity time of flight mass spectrometer. The desorbed yields were measured as a function of incident electron energy in the range between 1 to 20 eV and as function of coverage on Pt and Xe substrates. In anion desorption experiments, the following ions were observed: H(-) (D(-)), O(-), OH(-) (OD(-)), CN(-), NCO(-), NO(2)(-), CHNO(2)(-) (CDNO(2)(-)), CH(2)NO(2)(-) (CD(2)NO(2)(-)). Resonant structure seen in all anion yield functions, is attributed to dissociative electron attachment (DEA), though certain anion signals [e.g., OH(-) (OD(-)) and CH(2)NO(2)(-) (CD(2)NO(2)(-))] are likely the result of reactive scattering by O(-) ions. The dominant desorbed cation signals are CD(3)(+) and NO(+), and the appearance potentials of these species were measured to be 12.2 and 11.5 eV, respectively. The present measurements provide information on how the electron-induced dissociation processes of this proto-typical explosive molecule are modulated by the condensed environment and on how initial dissociation events occurring on a particular molecule, may induce further dissociation.

  12. Electron- and proton-induced ionization of pyrimidine

    DOE PAGES

    Champion, Christophe; Quinto, Michele; Weck, Philippe F

    2015-03-27

    This present work describes a quantum-mechanically based model of the electron- and proton-induced ionization of isolated pyrimidine molecules. The impact energies range from the target ionization threshold up to ~1 keV for electrons and from 10 keV up to 10 MeV for protons. The cross-section calculations are performed within the 1st Born approximation in which the ejected electron is described by a Coulomb wave whereas the incident and the scattered projectiles are both described by plane waves. The pyrimidine target is described using the Gaussian 09 software package. Furthermore, our theoretical predictions obtained are in good agreement with experimental absolutemore » total cross sections, while large discrepancies are observed between existing semi-empirical models and the present calculations.« less

  13. Electron impact ionization of cycloalkanes, aldehydes, and ketones

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gupta, Dhanoj; Antony, Bobby, E-mail: bka.ism@gmail.com

    The theoretical calculations of electron impact total ionization cross section for cycloalkane, aldehyde, and ketone group molecules are undertaken from ionization threshold to 2 keV. The present calculations are based on the spherical complex optical potential formalism and complex scattering potential ionization contribution method. The results of most of the targets studied compare fairly well with the recent measurements, wherever available and the cross sections for many targets are predicted for the first time. The correlation between the peak of ionization cross sections with number of target electrons and target parameters is also reported. It was found that the crossmore » sections at their maximum depend linearly with the number of target electrons and with other target parameters, confirming the consistency of the values reported here.« less

  14. Influence of the Renner-Teller Coupling in CO+H Collision Dynamics

    NASA Astrophysics Data System (ADS)

    Ndengue, Steve Alexandre; Dawes, Richard

    2017-06-01

    Carbon monoxide is after molecular hydrogen the second most abundant molecule in the universe and an important molecule for processes occurring in the atmosphere, hydrocarbon combustion and the interstellar medium. The rate coefficients of CO in collision with dominant species like H, H_2, He, etc are necessary to understand the CO emission spectrum or to model combustion chemistry processes. The inelastic scattering of CO with H has been intensively studied theoretically in the past decades,^1 mostly using the so-called WKS PES^6 developed by Werner et al. or recently a modified version by Song et al.^2 Though the spectroscopic agreement of the WKS surface with experiment is quite good, so far the studies of scattering dynamics have neglected coupling to an electronic excited state. We present new results on a set of HCO surfaces of the ground and the excited Renner-Teller coupled electronic states^3 with the principal objective of studying the influence of the Renner-Teller coupling on the inelastic scattering of CO+H. Our calculations done using the MCTDH^4 algorithm in the 0-2 eV energy range allow evaluation of the contribution of the Renner-Teller coupling on the rovibrationally inelastic scattering and discuss the relevance and reliability of the calculations. References:} 1. N. Balakrishnan, M. Yan and A. Dalgarno, Astrophys. J. 568, 443 (2002); B.C. Shepler et al, Astron. & Astroph. 475, L15 (2007); L. Song et al, J. Chem. Phys. 142, 204303 (2015); K.M. Walker et al, Astroph. J. 811, 27 (2015). 2. L. Song et al, Astrophys. J. 813, 96 (2015). 3. H.-M. Keller et al, J. Chem. Phys. 105, 4983 (1996). 4. S. Ndengue, R. Dawes and H. Guo, J. Chem. Phys. 144, 244301 (2016). 5. M.H. Beck et al., Phys. Rep. 324, 1 (2000).

  15. Analysis of improvement in performance and design parameters for enhancing resolution in an atmospheric scanning electron microscope.

    PubMed

    Yoon, Yeo Hun; Kim, Seung Jae; Kim, Dong Hwan

    2015-12-01

    The scanning electron microscope is used in various fields to go beyond diffraction limits of the optical microscope. However, the electron pathway should be conducted in a vacuum so as not to scatter electrons. The pretreatment of the sample is needed for use in the vacuum. To directly observe large and fully hydrophilic samples without pretreatment, the atmospheric scanning electron microscope (ASEM) is needed. We developed an electron filter unit and an electron detector unit for implementation of the ASEM. The key of the electron filter unit is that electrons are transmitted while air molecules remain untransmitted through the unit. The electron detector unit collected the backscattered electrons. We conducted experiments using the selected materials with Havar foil, carbon film and SiN film. © The Author 2015. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. Spectroscopic Studies of Abiotic and Biological Nanomaterials: Silver Nanoparticles, Rhodamine 6G Adsorbed on Graphene, and c-Type Cytochromes and Type IV Pili in Geobacter sulfurreducens

    NASA Astrophysics Data System (ADS)

    Thrall, Elizabeth S.

    This thesis describes spectroscopic studies of three different systems: silver nanoparticles, the dye molecule rhodamine 6G adsorbed on graphene, and the type IV pili and c-type cytochromes produced by the dissimilatory metal-reducing bacterium Geobacter sulfurreducens. Although these systems are quite different in some ways, they can all be considered examples of nanomaterials. A nanomaterial is generally defined as having at least one dimension below 100 nm in size. Silver nanoparticles, with sub-100 nm size in all dimensions, are examples of zero-dimensional nanomaterials. Graphene, a single atomic layer of carbon atoms, is the paradigmatic two-dimensional nanomaterial. And although bacterial cells are on the order of 1 μm in size, the type IV pili and multiheme c-type cytochromes produced by G. sulfurreducens can be considered to be one- and zero-dimensional nanomaterials respectively. A further connection between these systems is their strong interaction with visible light, allowing us to study them using similar spectroscopic tools. The first chapter of this thesis describes research on the plasmon-mediated photochemistry of silver nanoparticles. Silver nanoparticles support coherent electron oscillations, known as localized surface plasmons, at resonance frequencies that depend on the particle size and shape and the local dielectric environment. Nanoparticle absorption and scattering cross-sections are maximized at surface plasmon resonance frequencies, and the electromagnetic field is amplified near the particle surface. Plasmonic effects can enhance the photochemistry of silver particles alone or in conjunction with semiconductors according to several mechanisms. We study the photooxidation of citrate by silver nanoparticles in a photoelectrochemical cell, focusing on the wavelength-dependence of the reaction rate and the role of the semiconductor substrate. We find that the citrate photooxidation rate does not track the plasmon resonance of the silver nanoparticles but instead rises monotonically with photon energy. These results are discussed in terms of plasmonic enhancement mechanisms and a theoretical model describing hot carrier photochemistry. The second chapter explores the electronic absorption and resonance Raman scattering of the dye molecule rhodamine 6G (R6G) adsorbed on graphene. Graphene has been shown to quench the fluorescence of adsorbed molecules and quantum dots, and some previous studies have reported that the Raman scattering from molecules adsorbed on graphene is enhanced. We show that reflective contrast spectroscopy can be used to obtain the electronic absorption spectrum of R6G adsorbed on graphene, allowing us to estimate the surface concentration of the dye molecule. From these results we are able to calculate the absolute Raman scattering cross-section for R6G adsorbed on bilayer graphene. We find that there is no evidence of enhancement but instead that the cross-section is reduced by more than three-fold from its value in solution. We further show that a model incorporating electromagnetic interference effects can reproduce the observed dependence of the R6G Raman intensity on the number of graphene layers. The third and final chapter describes the preliminary results from studies of the dissimilatory metal-reducing bacterium Geobacter sulfurreducens . This anaerobic bacterium couples the oxidation of organic carbon sources to the reduction of iron oxides and other extracellular electron acceptors, a type of anaerobic respiration that necessitates an electron transport chain that can move electrons from the interior of the cell to the extracellular environment. The electron transport chain in G. sulfurreducens has not been completely characterized and two competing mechanisms for the charge transport have been proposed. The first holds that G. sulfurreducens produces type IV pili, protein filaments several nanometers in width, with intrinsic metallic-like conductivity. According to this mechanism, the conductive pili mediate electron transport to extracellular acceptors. The second proposed mechanism is that charge transport proceeds by electron hopping between the heme groups in the many c-type cytochromes produced by G. sulfurreducens. In this picture, the observed conductivity of the pili is due to hopping through associated cytochrome proteins. Our aim is to explore these alternative mechanisms for electron transport in G. sulfurreducens through electrical and optical studies. We report the work we have done thus far to culture and characterize G. sulfurreducens , and we show that preliminary micro-Raman studies of G. sulfurreducens cells confirm that we can detect the spectroscopic signature of c-type cytochrome proteins. Future directions for this ongoing work are briefly discussed.

  17. Scattering-Type Surface-Plasmon-Resonance Biosensors

    NASA Technical Reports Server (NTRS)

    Wang, Yu; Pain, Bedabrata; Cunningham, Thomas; Seshadri, Suresh

    2005-01-01

    Biosensors of a proposed type would exploit scattering of light by surface plasmon resonance (SPR). Related prior biosensors exploit absorption of light by SPR. Relative to the prior SPR biosensors, the proposed SPR biosensors would offer greater sensitivity in some cases, enough sensitivity to detect bioparticles having dimensions as small as nanometers. A surface plasmon wave can be described as a light-induced collective oscillation in electron density at the interface between a metal and a dielectric. At SPR, most incident photons are either absorbed or scattered at the metal/dielectric interface and, consequently, reflected light is greatly attenuated. The resonance wavelength and angle of incidence depend upon the permittivities of the metal and dielectric. An SPR sensor of the type most widely used heretofore includes a gold film coated with a ligand a substance that binds analyte molecules. The gold film is thin enough to support evanescent-wave coupling through its thickness. The change in the effective index of refraction at the surface, and thus the change in the SPR response, increases with the number of bound analyte molecules. The device is illuminated at a fixed wavelength, and the intensity of light reflected from the gold surface opposite the ligand-coated surface is measured as a function of the angle of incidence. From these measurements, the angle of minimum reflection intensity is determined

  18. Polymer-coated surface enhanced Raman scattering (SERS) gold nanoparticles for multiplexed labeling of chronic lymphocytic leukemia cells

    NASA Astrophysics Data System (ADS)

    MacLaughlin, Christina M.; Parker, Edward P. K.; Walker, Gilbert C.; Wang, Chen

    2012-01-01

    The ease and flexibility of functionalization and inherent light scattering properties of plasmonic nanoparticles make them suitable contrast agents for measurement of cell surface markers. Immunophenotyping of lymphoproliferative disorders is traditionally undertaken using fluorescence detection methods which have a number of limitations. Herein, surface-enhanced Raman scattering (SERS) gold nanoparticles conjugated to monoclonal antibodies are used for the selective targeting of CD molecules on the surface of chronic lymphocytic leukemia (CLL) cells. Raman-active reporters were physisorbed on to the surface of 60 nm spherical Au nanoparticles, the particles were coated with 5kDa polyethylene glycol (PEG) including functionalities for conjugation to monoclonal IgG1 antibodies. A novel method for quantifying the number of antibodies bound to SERS probes on an individual basis as opposed to obtaining averages from solution was demonstrated using metal dots in transmission electron microscopy (TEM). The specificity of the interaction between SERS probes and surface CD molecules of CLL cells was assessed using Raman spectroscopy and dark field microscopy. An in-depth study of SERS probe targeting to B lymphocyte marker CD20 was undertaken, and proof-of-concept targeting using different SERS nanoparticle dyes specific for cell surface CD19, CD45 and CD5 demonstrated using SERS spectroscopy.

  19. Surface-Enhanced Raman and Surface-Enhanced Hyper-Raman Scattering of Thiol-Functionalized Carotene

    PubMed Central

    2016-01-01

    A thiol-modified carotene, 7′-apo-7′-(4-mercaptomethylphenyl)-β-carotene, was used to obtain nonresonant surface-enhanced Raman scattering (SERS) spectra of carotene at an excitation wavelength of 1064 nm, which were compared with resonant SERS spectra at an excitation wavelength of 532 nm. These spectra and surface-enhanced hyper-Raman scattering (SEHRS) spectra of the functionalized carotene were compared with the spectra of nonmodified β-carotene. Using SERS, normal Raman, and SEHRS spectra, all obtained for the resonant case, the interaction of the carotene molecules with silver nanoparticles, as well as the influence of the resonance enhancement and the SERS enhancement on the spectra, were investigated. The interaction with the silver surface occurs for both functionalized and nonfunctionalized β-carotene, but only the stronger functionalization-induced interaction enables the acquisition of nonresonant SERS spectra of β-carotene at low concentrations. The resonant SEHRS and SERS spectra are very similar. Nevertheless, the SEHRS spectra contain additional bands of infrared-active modes of carotene. Increased contributions from bands that experience low resonance enhancement point to a strong interaction between silver nanoparticles and electronic levels of the molecules, thereby giving rise to a decrease in the resonance enhancement in SERS and SEHRS. PMID:28077983

  20. A New Scaling Law of Resonance in Total Scattering Cross Section in Gases

    NASA Astrophysics Data System (ADS)

    Raju, Gorur Govinda

    2009-10-01

    Electrical discharges in gases continue to be an active area of research because of industrial applications such as power systems, environmental clean up, laser technology, semiconductor fabrication etc. A fundamental knowledge of electron-gas neutral interaction is indispensable and, the total scattering cross section is one of the quantities that have been measured extensively. The energy dependence of the total cross sections shows peaks or resonance processes that are operative in the collision process. These peaks and the energies at which they occur are shown to satisfy a broad relationship involving the polarizability and the dipole moment of the target particle. Data on 62 target particles belonging to the following species are analyzed. (Eq 1) Rare gas atoms (Eq 2) Di-atomic molecules with combinations of polar, non-polar, attaching, and non-attaching properties Poly-atomic molecules with combinations of polar, non-polar, attaching, and non-attaching properties. Methods of improving the newly identified scaling law and possible application have been identified. 1 INTRODUCTION: Data on electron-neutral interactions are one of the most fundamental in the study of gaseous electronics and an immense literature, both experimental and theoretical, has become available since about the year 1920. [1-5]. In view of the central role which these data play in all facets of gas discharges and plasma science, it is felt that a critical review of available data is timely, mainly for the community of high voltage engineers and industries connected with plasma science in general. The electron-neutral interaction, often referred to as scattering in the scientific literature, is quantified by using the quantity called the total scattering cross section (QT, m^2). In the literature on cross section, total cross section and total scattering cross section are terms used synonymously and we follow the same practice. A definition may be found in reference [1]. This paper concerns scaling of total cross section of gases at resonance energy and the electron energy at which resonance occurs. The meaning of resonance is briefly explained in the following section. Here, we use the term scaling to relate the two quantities mentioned, namely, the resonance energy and the total cross section at that energy. Consistent with the definition of scaling, if the law proposed holds, one of the two quantities mentioned above may be calculated if the other is known. Such a method is very useful in gas discharge modeling and calculation of breakdown voltages, as more fully explained in the later section of the paper. 2 DESCRIPTION OF RESONANCE: A brief description of resonance phenomena in several types of target particles, viz., atomic, poly atomic, polar, non-polar phenomena are presented. 3 PREVIOUS SCALING LAWS: A common representation of a given characteristic with as few adjustable parameters as possible is generally known as the scaling law. The Paschen curve for breakdown voltage is such a familiar scaling law. With reference to cross sections several attempts have been made to obtain a scaling law, with varying degree of success. If the cross section-energy curve is qualitatively similar without having sharp peaks and oscillations, moderately successful scaling laws may be devised. For example, the ionization cross section- energy curves for most gases follow a general pattern. Several published scaling laws are discussed. 4 A NEW SCALING LAW AND DISCUSSION: In this work the author has compiled the resonance details for more than 60 gasest hat include the range from simple atoms to complex molecules that are polyatomic, dipolar, electron-attaching and isomers. The target particles exhibit a number of distinct features, as far as their total cross section variation with electron energy is concerned as already explained.

  1. Single Molecule Raman Spectroscopy Under High Pressure

    NASA Astrophysics Data System (ADS)

    Fu, Yuanxi; Dlott, Dana

    2014-06-01

    Pressure effects on surface-enhanced Raman scattering spectra of Rhdoamine 6G adsorbed on silver nanoparticle surfaces was studied using a confocal Raman microscope. Colloidal silver nanoparticles were treated with Rhodamine 6G (R6G) and its isotopically substituted partner, R6G-d4. Mixed isotopomers let us identify single-molecule spectra, since multiple-molecule spectra would show vibrational transitions from both species. The nanoparticles were embedded into a poly vinyl alcohol film, and loaded into a diamond anvil cell for the high-pressure Raman scattering measurement. Argon was the pressure medium. Ambient pressure Raman scattering spectra showed few single-molecule spectra. At moderately high pressure ( 1GPa), a surprising effect was observed. The number of sites with observable spectra decreased dramatically, and most of the spectra that could be observed were due to single molecules. The effects of high pressure suppressed the multiple-molecule Raman sites, leaving only the single-molecule sites to be observed.

  2. Velocity and Temperature Measurement in Supersonic Free Jets Using Spectrally Resolved Rayleigh Scattering

    NASA Technical Reports Server (NTRS)

    Panda, J.; Seasholtz, R. G.

    2004-01-01

    The flow fields of unheated, supersonic free jets from convergent and convergent-divergent nozzles operating at M = 0.99, 1.4, and 1.6 were measured using spectrally resolved Rayleigh scattering technique. The axial component of velocity and temperature data as well as density data obtained from a previous experiment are presented in a systematic way with the goal of producing a database useful for validating computational fluid dynamics codes. The Rayleigh scattering process from air molecules provides a fundamental means of measuring flow properties in a non-intrusive, particle free manner. In the spectrally resolved application, laser light scattered by the air molecules is collected and analyzed using a Fabry-Perot interferometer (FPI). The difference between the incident laser frequency and the peak of the Rayleigh spectrum provides a measure of gas velocity. The temperature is measured from the spectral broadening caused by the random thermal motion and density is measured from the total light intensity. The present point measurement technique uses a CW laser, a scanning FPI and photon counting electronics. The 1 mm long probe volume is moved from point to point to survey the flow fields. Additional arrangements were made to remove particles from the main as well as the entrained flow and to isolate FPI from the high sound and vibration levels produced by the supersonic jets. In general, velocity is measured within +/- 10 m/s accuracy and temperature within +/- 10 K accuracy.

  3. Ion mobilities in diatomic gases: measurement versus prediction with non-specular scattering models.

    PubMed

    Larriba, Carlos; Hogan, Christopher J

    2013-05-16

    Ion/electrical mobility measurements of nanoparticles and polyatomic ions are typically linked to particle/ion physical properties through either application of the Stokes-Millikan relationship or comparison to mobilities predicted from polyatomic models, which assume that gas molecules scatter specularly and elastically from rigid structural models. However, there is a discrepancy between these approaches; when specular, elastic scattering models (i.e., elastic-hard-sphere scattering, EHSS) are applied to polyatomic models of nanometer-scale ions with finite-sized impinging gas molecules, predictions are in substantial disagreement with the Stokes-Millikan equation. To rectify this discrepancy, we developed and tested a new approach for mobility calculations using polyatomic models in which non-specular (diffuse) and inelastic gas-molecule scattering is considered. Two distinct semiempirical models of gas-molecule scattering from particle surfaces were considered. In the first, which has been traditionally invoked in the study of aerosol nanoparticles, 91% of collisions are diffuse and thermally accommodating, and 9% are specular and elastic. In the second, all collisions are considered to be diffuse and accommodating, but the average speed of the gas molecules reemitted from a particle surface is 8% lower than the mean thermal speed at the particle temperature. Both scattering models attempt to mimic exchange between translational, vibrational, and rotational modes of energy during collision, as would be expected during collision between a nonmonoatomic gas molecule and a nonfrozen particle surface. The mobility calculation procedure was applied considering both hard-sphere potentials between gas molecules and the atoms within a particle and the long-range ion-induced dipole (polarization) potential. Predictions were compared to previous measurements in air near room temperature of multiply charged poly(ethylene glycol) (PEG) ions, which range in morphology from compact to highly linear, and singly charged tetraalkylammonium cations. It was found that both non-specular, inelastic scattering rules lead to excellent agreement between predictions and experimental mobility measurements (within 5% of each other) and that polarization potentials must be considered to make correct predictions for high-mobility particles/ions. Conversely, traditional specular, elastic scattering models were found to substantially overestimate the mobilities of both types of ions.

  4. Chapter 5 Multiple, Localized, and Delocalized/Conjugated Bonds in the Orbital Communication Theory of Molecular Systems

    NASA Astrophysics Data System (ADS)

    Nalewajski, Roman F.

    Information theory (IT) probe of the molecular electronic structure, within the communication theory of chemical bonds (CTCB), uses the standard entropy/information descriptors of the Shannon theory of communication to characterize a scattering of the electronic probabilities and their information content throughout the system chemical bonds generated by the occupied molecular orbitals (MO). These "communications" between the basis-set orbitals are determined by the two-orbital conditional probabilities: one- and two-electron in character. They define the molecular information system, in which the electron-allocation "signals" are transmitted between various orbital "inputs" and "outputs". It is argued, using the quantum mechanical superposition principle, that the one-electron conditional probabilities are proportional to the squares of corresponding elements of the charge and bond-order (CBO) matrix of the standard LCAO MO theory. Therefore, the probability of the interorbital connections in the molecular communication system is directly related to Wiberg's quadratic covalency indices of chemical bonds. The conditional-entropy (communication "noise") and mutual-information (information capacity) descriptors of these molecular channels generate the IT-covalent and IT-ionic bond components, respectively. The former reflects the electron delocalization (indeterminacy) due to the orbital mixing, throughout all chemical bonds in the system under consideration. The latter characterizes the localization (determinacy) in the probability scattering in the molecule. These two IT indices, respectively, indicate a fraction of the input information lost in the channel output, due to the communication noise, and its surviving part, due to deterministic elements in probability scattering in the molecular network. Together, these two components generate the system overall bond index. By a straightforward output reduction (condensation) of the molecular channel, the IT indices of molecular fragments, for example, localized bonds, functional groups, and forward and back donations accompanying the bond formation, and so on, can be extracted. The flow of information in such molecular communication networks is investigated in several prototype molecules. These illustrative (model) applications of the orbital communication theory of chemical bonds (CTCB) deal with several classical issues in the electronic structure theory: atom hybridization/promotion, single and multiple chemical bonds, bond conjugation, and so on. The localized bonds in hydrides and delocalized [pi]-bonds in simple hydrocarbons, as well as the multiple bonds in CO and CO2, are diagnosed using the entropy/information descriptors of CTCB. The atom promotion in hydrides and bond conjugation in [pi]-electron systems are investigated in more detail. A major drawback of the previous two-electron approach to molecular channels, namely, two weak bond differentiation in aromatic systems, has been shown to be remedied in the one-electron approach.

  5. Optical characteristics and parameters of gas-discharge plasma in a mixture of mercury dibromide vapor with argon

    NASA Astrophysics Data System (ADS)

    Malinina, A. A.; Malinin, A. N.

    2015-03-01

    Results are presented from studies of the optical characteristics and parameters of the plasma of a dielectric barrier discharge in a mixture of mercury dibromide vapor with argon—the working medium of an exciplex gas-discharge emitter. It is established that the partial pressures of mercury dibromide vapor and argon at which the average and pulsed emission intensities in the blue—green spectral region (λmax = 502 nm) reach their maximum values are 0.6 and 114.4 kPa, respectively. The electron energy distribution function, the transport characteristics, the specific power spent on the processes involving electrons, the electron density and temperature, and the rate constants for the processes of elastic and inelastic electron scattering from the molecules and atoms of the working mixture are determined by numerical simulation, and their dependences on the reduced electric field strength are analyzed. The rate constant of the process leading to the formation of exciplex mercury monobromide molecules for a reduced electric field of E/ N = 20 Td, at which the maximum emission intensity in the blue—green spectral region was observed in this experiment, is found to be 8.1 × 10-15 m3/s.

  6. Electron collisions with F2CO molecules

    NASA Astrophysics Data System (ADS)

    Freitas, Thiago Corrêa; Barbosa, Alessandra Souza; Bettega, Márcio Henrique Franco

    2017-07-01

    In this paper we present elastic differential, integral, and momentum-transfer cross sections for electron collisions with carbonyl fluoride (F2CO ) molecules for the incident electron's energy from 0.5 eV to 20 eV. The Schwinger multichannel method with pseudopotentials was employed to obtain the cross sections in the static-exchange and static-exchange plus polarization approximations. The present results were compared with the available data in the literature, in particular, with the results of Kaur, Mason, and Antony [Phys. Rev. A 92, 052702 (2015), 10.1103/PhysRevA.92.052702] for the differential, total, and momentum-transfer cross sections. We have found a π* shape resonance centered at 2.6 eV in the B1 symmetry and other resonance, in the B2 symmetry, located at around 9.7 eV. A systematic study of the inclusion of polarization effects was performed in order to have a well balanced description of this negative-ion transient state. The effects of the long-range electric dipole potential were included by the Born closure scheme. Electronic structure calculations were also performed to help in the interpretation of the scattering results, and associate the transient states to the unoccupied orbitals.

  7. Narrow Gap, High Mobility, and Stable Pi Conjugated Polymers

    DTIC Science & Technology

    2012-09-20

    wide-angle X-ray scattering (2D-WAXS) of P5.1 (extruded at 210oC). This trend is reflected in conventional bulk- heterojunction OPV devices as shown...Additives in Molecular Bulk Heterojunction Solar Cells Using a bithiophene capped, isoindigo core, DAD molecule as the donor phase, and PCBM as the...PCE values of 3.7% as illustrated in Figure 11. Figure 11. Combining interface control using MoOx as an electron transport material and PDMS

  8. Pulsating aurora from electron scattering by chorus waves

    NASA Astrophysics Data System (ADS)

    Kasahara, S.; Miyoshi, Y.; Yokota, S.; Mitani, T.; Kasahara, Y.; Matsuda, S.; Kumamoto, A.; Matsuoka, A.; Kazama, Y.; Frey, H. U.; Angelopoulos, V.; Kurita, S.; Keika, K.; Seki, K.; Shinohara, I.

    2018-02-01

    Auroral substorms, dynamic phenomena that occur in the upper atmosphere at night, are caused by global reconfiguration of the magnetosphere, which releases stored solar wind energy. These storms are characterized by auroral brightening from dusk to midnight, followed by violent motions of distinct auroral arcs that suddenly break up, and the subsequent emergence of diffuse, pulsating auroral patches at dawn. Pulsating aurorae, which are quasiperiodic, blinking patches of light tens to hundreds of kilometres across, appear at altitudes of about 100 kilometres in the high-latitude regions of both hemispheres, and multiple patches often cover the entire sky. This auroral pulsation, with periods of several to tens of seconds, is generated by the intermittent precipitation of energetic electrons (several to tens of kiloelectronvolts) arriving from the magnetosphere and colliding with the atoms and molecules of the upper atmosphere. A possible cause of this precipitation is the interaction between magnetospheric electrons and electromagnetic waves called whistler-mode chorus waves. However, no direct observational evidence of this interaction has been obtained so far. Here we report that energetic electrons are scattered by chorus waves, resulting in their precipitation. Our observations were made in March 2017 with a magnetospheric spacecraft equipped with a high-angular-resolution electron sensor and electromagnetic field instruments. The measured quasiperiodic precipitating electron flux was sufficiently intense to generate a pulsating aurora, which was indeed simultaneously observed by a ground auroral imager.

  9. Curcumin Inhibits Tau Aggregation and Disintegrates Preformed Tau Filaments in vitro.

    PubMed

    Rane, Jitendra Subhash; Bhaumik, Prasenjit; Panda, Dulal

    2017-01-01

    The pathological aggregation of tau is a common feature of most of the neuronal disorders including frontotemporal dementia, Parkinson's disease, and Alzheimer's disease. The inhibition of tau aggregation is considered to be one of the important strategies for treating these neurodegenerative diseases. Curcumin, a natural polyphenolic molecule, has been reported to have neuroprotective ability. In this work, curcumin was found to bind to adult tau and fetal tau with a dissociation constant of 3.3±0.4 and 8±1 μM, respectively. Molecular docking studies indicated a putative binding site of curcumin in the microtubule-binding region of tau. Using several complementary techniques, including dynamic light scattering, thioflavin S fluorescence, 90° light scattering, electron microscopy, and atomic force microscopy, curcumin was found to inhibit the aggregation of tau. The dynamic light scattering analysis and atomic force microscopic images revealed that curcumin inhibits the oligomerization of tau. Curcumin also disintegrated preformed tau oligomers. Using Far-UV circular dichroism, curcumin was found to inhibit the β-sheets formation in tau indicating that curcumin inhibits an initial step of tau aggregation. In addition, curcumin inhibited tau fibril formation. Furthermore, the effect of curcumin on the preformed tau filaments was analyzed by atomic force microscopy, transmission electron microscopy, and 90° light scattering. Curcumin treatment disintegrated preformed tau filaments. The results indicated that curcumin inhibited the oligomerization of tau and could disaggregate tau filaments.

  10. Surface-enhanced Raman scattering from silver nanostructures with different morphologies

    NASA Astrophysics Data System (ADS)

    Zhang, W. C.; Wu, X. L.; Kan, C. X.; Pan, F. M.; Chen, H. T.; Zhu, J.; Chu, Paul K.

    2010-07-01

    Scanning electron microscopy and X-ray diffraction reveal that four different types of crystalline silver nanostructures including nanoparticles, nanowires, nanocubes, and bipyramids are synthesized by a solvothermal method by reducing silver nitrate with ethylene glycol using poly(vinylpyrrolidone) as an adsorption agent and adding different quantities of sodium chloride to the solution. These nanostructures which exhibit different surface plasma resonance properties in the ultraviolet-visible region are shown to be good surface-enhanced Raman scattering (SERS) substrates using rhodamine 6G molecules. Our results demonstrate that the silver nanocubes, bipyramids with sharp corners and edges, and aggregated silver nanoparticles possess better SERS properties than the silver nanowires, indicating that they can serve as high-sensitivity substrates in SERS-based measurements.

  11. The influence of polarity of additive molecules on micelle structures of polystyrene-block-poly(4-vinylpyridine) in the fabrication of nano-porous templates.

    PubMed

    Chua, Kee Sze; Koh, Ai Peng; Lam, Yeng Ming

    2010-11-01

    Block copolymers are useful for in situ synthesis of nanoparticles as well as producing nanoporous templates. As such, the effects of precursors on the block copolymer micelle structure is important. In this study, we investigate the effects of polarity of molecules introduced into block copolymer micelle cores on the micelle structure. The molecular dipole moment of the additive molecules has been evaluated and their effects on the block copolymer micelles investigated using light scattering spectroscopy, small-angle X-ray scattering, transmission electron microscopy and atomic force microscopy. The molecule with the largest dipole moment resulted in spherical structures with a polydispersity of less than 0.06 in a fully translational diffusion system. Surprisingly, the less polar additive molecules produced elongated micelles and the aspect ratio increases with decreasing polarity. The change in structure from spherical to elongated structure was attributed to P4VP chain extension, where compounds with polarity most similar to P4VP induce the most chain extension. The second virial coefficients of the solutions with elongated micelles are lower than that for spherical micelle systems by up to one order in magnitude, indicating a strong tendency for micelles to coalesce. On rinsing the spin-cast films, pores were obtained from spherical micelles and ridges from elongated micelles, suggesting a viable alternative for morphology modification using mild conditions where external annealing treatments to the film are not preferred. The knowledge of polarity effects of additive molecules on micelle structure has wider implications for supramolecular block copolymer systems where, depending on the application requirements, changes to the shape of the micelle structure can be induced or avoided. Copyright 2010 Elsevier Inc. All rights reserved.

  12. Analysis of electron beam induced deposition (EBID) of residual hydrocarbons in electron microscopy

    NASA Astrophysics Data System (ADS)

    Rykaczewski, Konrad; White, William B.; Fedorov, Andrei G.

    2007-03-01

    In this work we have developed a comprehensive dynamic model of electron beam induced deposition (EBID) of residual hydrocarbon coupling mass transport, electron transport and scattering, and species decomposition to predict the deposition of carbon nanopillars. The simulations predict the local species and electron density distributions, as well as the three-demensional morphology and the growth rate of the deposit. Since the process occurs in a high vacuum environment, surface diffusion is considered as the primary transport mode of surface-adsorbed hydrocarbon precursor. The governing surface transport equation (STE) of the adsorbed species is derived and solved numerically. The transport, scattering, and absorption of primary electron as well as secondary electron generation are treated using the Monte Carlo method. Low energy secondary electrons are the major contributors to hydrocarbon decomposition due to their energy range matching peak dissociation reaction cross section energies for precursor molecules. The deposit and substrate are treated as a continuous entity allowing the simulation of the growth of a realistically sized deposit rather than a large number of cells representing each individual atom as in previously published simulations [Mitsuishi et al., Ultramicroscopy 103, 17 (2005); Silvis-Cividjian, Ph.D. thesis, University of Delft, 2002]. Such formulation allows for simple coupling of the STE with the dynamic growth of the nanopillar. Three different growth regimes occurring in EBID are identified using scaling analysis, and simulations are used to describe the deposit morphology and precursor surface concentration specific for each growth regime.

  13. Low-energy electron scattering from water molecules: A study of angular distributions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gianturco, F.A.; Scialla, S.

    1987-12-01

    We report quantal calculations of elastic differential and momentum transfercross sections for the scattering of electrons by H/sub 2/O at low and intermediatecollision energies, i.e., from 2 to 20 eV. The fixed-nuclei approximation (FNA) was employed and a single-center expanded (SCE) wave function was used to represent the molecular target. The well-known divergence in the forward direction was corrected via Born closure formulas (see the text) and a parameter-free model, previously tested for methane targets, was used to describe exchange and polarization effects. The present results can be used to adequately describe angular distributions even at very small angles andmore » can be extended beyond the largest angles that have been experimentally measured. The behavior of momentum-transfer cross sections as a function of energy, and the comparison of our results with other static-exchange (SE) calculations, which use an entirely different approach, are presented and discussed.« less

  14. Gold/silver coated nanoporous ceramic membranes: a new substrate for SERS studies

    NASA Astrophysics Data System (ADS)

    Kassu, A.; Robinson, P.; Sharma, A.; Ruffin, P. B.; Brantley, C.; Edwards, E.

    2010-08-01

    Surface Enhanced Raman Scattering (SERS) is a recently discovered powerful technique which has demonstrated sensitivity and selectivity for detecting single molecules of certain chemical species. This is due to an enhancement of Raman scattered light by factors as large as 1015. Gold and Silver-coated substrates fabricated by electron-beam lithography on Silicon are widely used in SERS technique. In this paper, we report the use of nanoporous ceramic membranes for SERS studies. Nanoporous membranes are widely used as a separation membrane in medical devices, fuel cells and other studies. Three different pore diameter sizes of commercially available nanoporous ceramic membranes: 35 nm, 55nm and 80nm are used in the study. To make the membranes SERS active, they are coated with gold/silver using sputtering techniques. We have seen that the membranes coated with gold layer remain unaffected even when immersed in water for several days. The results show that gold coated nanoporous membranes have sensitivity comparable to substrates fabricated by electron-beam lithography on Silicon substrates.

  15. Theoretical and experimental study on electron interactions with chlorobenzene: Shape resonances and differential cross sections

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Barbosa, Alessandra Souza; Laboratório de Colisões Atómicas e Moleculares, CEFITEC, Departamento de Física, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica; Varella, Márcio T. do N.

    2016-08-28

    In this work, we report theoretical and experimental cross sections for elastic scattering of electrons by chlorobenzene (ClB). The theoretical integral and differential cross sections (DCSs) were obtained with the Schwinger multichannel method implemented with pseudopotentials (SMCPP) and the independent atom method with screening corrected additivity rule (IAM-SCAR). The calculations with the SMCPP method were done in the static-exchange (SE) approximation, for energies above 12 eV, and in the static-exchange plus polarization approximation, for energies up to 12 eV. The calculations with the IAM-SCAR method covered energies up to 500 eV. The experimental differential cross sections were obtained in themore » high resolution electron energy loss spectrometer VG-SEELS 400, in Lisbon, for electron energies from 8.0 eV to 50 eV and angular range from 7{sup ∘} to 110{sup ∘}. From the present theoretical integral cross section (ICS) we discuss the low-energy shape-resonances present in chlorobenzene and compare our computed resonance spectra with available electron transmission spectroscopy data present in the literature. Since there is no other work in the literature reporting differential cross sections for this molecule, we compare our theoretical and experimental DCSs with experimental data available for the parent molecule benzene.« less

  16. Theory of lasing in a multiple-scattering medium

    NASA Astrophysics Data System (ADS)

    John, Sajeev; Pang, Gendi

    1996-10-01

    In several recent experiments, isotropic lasing action was observed in paints that contain rhodamine 640 dye molecules in methanol solution as gain media and titania particles as optical scatterers. These so-called paint-on laser systems are extraordinary because they are highly disordered systems. The microscopic mechanism for laser activity and the coherence properties of light emission in this multiple-light-scattering medium have not yet been elucidated. In this paper we derive the emission intensity properties of a model dye system with excited singlet and triplet electronic energy levels, which is immersed in a multiple-scattering medium with transport mean free path l*. Using physically reasonable estimates for the absorption and emission cross section for the singlet and triplet manifolds, and the singlet-triplet intersystem crossing rate, we solve the nonlinear laser rate equations for the dye molecules. This leads to a diffusion equation for the light intensity in the medium with a nonlinear intensity-dependent gain coefficient. Using this model we are able to account for nearly all of the experimentally observed properties of laser paint reported so far when l*>>λ0, the emission wavelength. This includes the dependence of the peak intensity of amplified emission on the mean free path l*, the dye concentration ρ, and the pump intensity characteristics. Our model recaptures the collapse of the emission linewidth at a specific threshold pump intensity and describes how this threshold intensity varies with l*. In addition, our model predicts a dramatic increase in the peak intensity and a further lowering of the lasing threshold for the strong scattering limit l*-->λ0. This suggests a striking enhancement of the characteristics of laser paint near the photon localization threshold in a disordered medium.

  17. ProbeZT: Simulation of transport coefficients of molecular electronic junctions under environmental effects using Büttiker's probes

    NASA Astrophysics Data System (ADS)

    Korol, Roman; Kilgour, Michael; Segal, Dvira

    2018-03-01

    We present our in-house quantum transport package, ProbeZT. This program provides linear response coefficients: electrical and electronic thermal conductances, as well as the thermopower of molecular junctions in which electrons interact with the surrounding thermal environment. Calculations are performed based on the Büttiker probe method, which introduces decoherence, energy exchange and dissipation effects phenomenologically using virtual electrode terminals called probes. The program can realize different types of probes, each introducing various environmental effects, including elastic and inelastic scattering of electrons. The molecular system is described by an arbitrary tight-binding Hamiltonian, allowing the study of different geometries beyond simple one-dimensional wires. Applications of the program to study the thermoelectric performance of molecular junctions are illustrated. The program also has a built-in functionality to simulate electron transport in double-stranded DNA molecules based on a tight-binding (ladder) description of the junction.

  18. The electron-furfural scattering dynamics for 63 energetically open electronic states

    NASA Astrophysics Data System (ADS)

    da Costa, Romarly F.; do N. Varella, Márcio T.; Bettega, Márcio H. F.; Neves, Rafael F. C.; Lopes, Maria Cristina A.; Blanco, Francisco; García, Gustavo; Jones, Darryl B.; Brunger, Michael J.; Lima, Marco A. P.

    2016-03-01

    We report on integral-, momentum transfer- and differential cross sections for elastic and electronically inelastic electron collisions with furfural (C5H4O2). The calculations were performed with two different theoretical methodologies, the Schwinger multichannel method with pseudopotentials (SMCPP) and the independent atom method with screening corrected additivity rule (IAM-SCAR) that now incorporates a further interference (I) term. The SMCPP with N energetically open electronic states (Nopen) at either the static-exchange (Nopen ch-SE) or the static-exchange-plus-polarisation (Nopen ch-SEP) approximation was employed to calculate the scattering amplitudes at impact energies lying between 5 eV and 50 eV, using a channel coupling scheme that ranges from the 1ch-SEP up to the 63ch-SE level of approximation depending on the energy considered. For elastic scattering, we found very good overall agreement at higher energies among our SMCPP cross sections, our IAM-SCAR+I cross sections and the experimental data for furan (a molecule that differs from furfural only by the substitution of a hydrogen atom in furan with an aldehyde functional group). This is a good indication that our elastic cross sections are converged with respect to the multichannel coupling effect for most of the investigated intermediate energies. However, although the present application represents the most sophisticated calculation performed with the SMCPP method thus far, the inelastic cross sections, even for the low lying energy states, are still not completely converged for intermediate and higher energies. We discuss possible reasons leading to this discrepancy and point out what further steps need to be undertaken in order to improve the agreement between the calculated and measured cross sections.

  19. The electron-furfural scattering dynamics for 63 energetically open electronic states

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Costa, Romarly F. da; Centro de Ciências Naturais e Humanas, Universidade Federal do ABC, Santo André, São Paulo 09210-580; Varella, Márcio T. do N

    We report on integral-, momentum transfer- and differential cross sections for elastic and electronically inelastic electron collisions with furfural (C{sub 5}H{sub 4}O{sub 2}). The calculations were performed with two different theoretical methodologies, the Schwinger multichannel method with pseudopotentials (SMCPP) and the independent atom method with screening corrected additivity rule (IAM-SCAR) that now incorporates a further interference (I) term. The SMCPP with N energetically open electronic states (N{sub open}) at either the static-exchange (N{sub open} ch-SE) or the static-exchange-plus-polarisation (N{sub open} ch-SEP) approximation was employed to calculate the scattering amplitudes at impact energies lying between 5 eV and 50 eV, using a channelmore » coupling scheme that ranges from the 1ch-SEP up to the 63ch-SE level of approximation depending on the energy considered. For elastic scattering, we found very good overall agreement at higher energies among our SMCPP cross sections, our IAM-SCAR+I cross sections and the experimental data for furan (a molecule that differs from furfural only by the substitution of a hydrogen atom in furan with an aldehyde functional group). This is a good indication that our elastic cross sections are converged with respect to the multichannel coupling effect for most of the investigated intermediate energies. However, although the present application represents the most sophisticated calculation performed with the SMCPP method thus far, the inelastic cross sections, even for the low lying energy states, are still not completely converged for intermediate and higher energies. We discuss possible reasons leading to this discrepancy and point out what further steps need to be undertaken in order to improve the agreement between the calculated and measured cross sections.« less

  20. An advanced molecule-surface scattering instrument for study of vibrational energy transfer in gas-solid collisions.

    PubMed

    Ran, Qin; Matsiev, Daniel; Wodtke, Alec M; Auerbach, Daniel J

    2007-10-01

    We describe an advanced and highly sensitive instrument for quantum state-resolved molecule-surface energy transfer studies under ultrahigh vacuum (UHV) conditions. The apparatus includes a beam source chamber, two differential pumping chambers, and a UHV chamber for surface preparation, surface characterization, and molecular beam scattering. Pulsed and collimated supersonic molecular beams are generated by expanding target molecule mixtures through a home-built pulsed nozzle, and excited quantum state-selected molecules were prepared via tunable, narrow-band laser overtone pumping. Detection systems have been designed to measure specific vibrational-rotational state, time-of-flight, angular and velocity distributions of molecular beams coming to and scattered off the surface. Facilities are provided to clean and characterize the surface under UHV conditions. Initial experiments on the scattering of HCl(v = 0) from Au(111) show many advantages of this new instrument for fundamental studies of the energy transfer at the gas-surface interface.

  1. Optical Feshbach resonances and ground-state-molecule production in the RbHg system

    NASA Astrophysics Data System (ADS)

    Borkowski, Mateusz; Muñoz Rodriguez, Rodolfo; Kosicki, Maciej B.; Ciuryło, Roman; Żuchowski, Piotr S.

    2017-12-01

    We present the prospects for photoassociation, optical control of interspecies scattering lengths, and, finally, the production of ultracold absolute ground-state molecules in the Rb+Hg system. We use the state-of-the-art ab initio methods for the calculations of ground- [CCSD(T)] and excited-state (EOM-CCSD) potential curves. The RbHg system, thanks to the wide range of stable Hg bosonic isotopes, offers possibilities for mass tuning of ground-state interactions. The optical lengths describing the strengths of optical Feshbach resonances near the Rb transitions are favorable even at large laser detunings. Ground-state RbHg molecules can be produced with efficiencies ranging from about 20% for deeply bound to at least 50% for weakly bound states close to the dissociation limit. Finally, electronic transitions with favorable Franck-Condon factors can be found for the purposes of a STIRAP transfer of the weakly bound RbHg molecules to the absolute ground state using commercially available lasers.

  2. Hyperthermal (1-100 eV) nitrogen ion scattering damage to D-ribose and 2-deoxy-D-ribose films.

    PubMed

    Deng, Zongwu; Bald, Ilko; Illenberger, Eugen; Huels, Michael A

    2007-10-14

    Highly charged heavy ion traversal of a biological medium can produce energetic secondary fragment ions. These fragment ions can in turn cause collisional and reactive scattering damage to DNA. Here we report hyperthermal (1-100 eV) scattering of one such fragment ion (N(+)) from biologically relevant sugar molecules D-ribose and 2-deoxy-D-ribose condensed on polycrystalline Pt substrate. The results indicate that N(+) ion scattering at kinetic energies down to 10 eV induces effective decomposition of both sugar molecules and leads to the desorption of abundant cation and anion fragments. Use of isotope-labeled molecules (5-(13)C D-ribose and 1-D D-ribose) partly reveals some site specificity of the fragment origin. Several scattering reactions are also observed. Both ionic and neutral nitrogen atoms abstract carbon from the molecules to form CN(-) anion at energies down to approximately 5 eV. N(+) ions also abstract hydrogen from hydroxyl groups of the molecules to form NH(-) and NH(2) (-) anions. A fraction of OO(-) fragments abstract hydrogen to form OH(-). The formation of H(3)O(+) ions also involves hydrogen abstraction as well as intramolecular proton transfer. These findings suggest a variety of severe damaging pathways to DNA molecules which occur on the picosecond time scale following heavy ion irradiation of a cell, and prior to the late diffusion-limited homogeneous chemical processes.

  3. A general method for controlling and resolving rotational orientation of molecules in molecule-surface collisions

    PubMed Central

    Godsi, Oded; Corem, Gefen; Alkoby, Yosef; Cantin, Joshua T.; Krems, Roman V.; Somers, Mark F.; Meyer, Jörg; Kroes, Geert-Jan; Maniv, Tsofar; Alexandrowicz, Gil

    2017-01-01

    The outcome of molecule–surface collisions can be modified by pre-aligning the molecule; however, experiments accomplishing this are rare because of the difficulty of preparing molecules in aligned quantum states. Here we present a general solution to this problem based on magnetic manipulation of the rotational magnetic moment of the incident molecule. We apply the technique to the scattering of H2 from flat and stepped copper surfaces. We demonstrate control of the molecule's initial quantum state, allowing a direct comparison of differences in the stereodynamic scattering from the two surfaces. Our results show that a stepped surface exhibits a much larger dependence of the corrugation of the interaction on the alignment of the molecule than the low-index surface. We also demonstrate an extension of the technique that transforms the set-up into an interferometer, which is sensitive to molecular quantum states both before and after the scattering event. PMID:28480890

  4. Rayleigh Scattering.

    ERIC Educational Resources Information Center

    Young, Andrew T.

    1982-01-01

    The correct usage of such terminology as "Rayleigh scattering,""Rayleigh lines,""Raman lines," and "Tyndall scattering" is resolved during an historical excursion through the physics of light-scattering by gas molecules. (Author/JN)

  5. Thon rings from amorphous ice and implications of beam-induced Brownian motion in single particle electron cryo-microscopy.

    PubMed

    McMullan, G; Vinothkumar, K R; Henderson, R

    2015-11-01

    We have recorded dose-fractionated electron cryo-microscope images of thin films of pure flash-frozen amorphous ice and pre-irradiated amorphous carbon on a Falcon II direct electron detector using 300 keV electrons. We observe Thon rings [1] in both the power spectrum of the summed frames and the sum of power spectra from the individual frames. The Thon rings from amorphous carbon images are always more visible in the power spectrum of the summed frames whereas those of amorphous ice are more visible in the sum of power spectra from the individual frames. This difference indicates that while pre-irradiated carbon behaves like a solid during the exposure, amorphous ice behaves like a fluid with the individual water molecules undergoing beam-induced motion. Using the measured variation in the power spectra amplitude with number of electrons per image we deduce that water molecules are randomly displaced by a mean squared distance of ∼1.1 Å(2) for every incident 300 keV e(-)/Å(2). The induced motion leads to an optimal exposure with 300 keV electrons of 4.0 e(-)/Å(2) per image with which to observe Thon rings centred around the strong 3.7 Å scattering peak from amorphous ice. The beam-induced movement of the water molecules generates pseudo-Brownian motion of embedded macromolecules. The resulting blurring of single particle images contributes an additional term, on top of that from radiation damage, to the minimum achievable B-factor for macromolecular structure determination. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Electron collisions with the HCOOH···(H2O)n complexes (n = 1, 2) in liquid phase: the influence of microsolvation on the π* resonance of formic acid.

    PubMed

    Freitas, T C; Coutinho, K; Varella, M T do N; Lima, M A P; Canuto, S; Bettega, M H F

    2013-05-07

    We report momentum transfer cross sections for elastic collisions of low-energy electrons with the HCOOH···(H2O)n complexes, with n = 1, 2, in liquid phase. The scattering cross sections were computed using the Schwinger multichannel method with pseudopotentials in the static-exchange and static-exchange plus polarization approximations, for energies ranging from 0.5 eV to 6 eV. We considered ten different structures of HCOOH···H2O and six structures of HCOOH···(H2O)2 which were generated using classical Monte Carlo simulations of formic acid in aqueous solution at normal conditions of temperature and pressure. The aim of this work is to investigate the influence of microsolvation on the π* shape resonance of formic acid. Previous theoretical and experimental studies reported a π* shape resonance for HCOOH at around 1.9 eV. This resonance can be either more stable or less stable in comparison to the isolated molecule depending on the complex structure and the water role played in the hydrogen bond interaction. This behavior is explained in terms of (i) the polarization of the formic acid molecule due to the water molecules and (ii) the net charge of the solute. The proton donor or acceptor character of the water molecules in the hydrogen bond is important for understanding the stabilization versus destabilization of the π* resonances in the complexes. Our results indicate that the surrounding water molecules may affect the lifetime of the π* resonance and hence the processes driven by this anion state, such as the dissociative electron attachment.

  7. Mixed Quantum/Classical Theory for Molecule-Molecule Inelastic Scattering: Derivations of Equations and Application to N2 + H2 System.

    PubMed

    Semenov, Alexander; Babikov, Dmitri

    2015-12-17

    The mixed quantum classical theory, MQCT, for inelastic scattering of two molecules is developed, in which the internal (rotational, vibrational) motion of both collision partners is treated with quantum mechanics, and the molecule-molecule scattering (translational motion) is described by classical trajectories. The resultant MQCT formalism includes a system of coupled differential equations for quantum probability amplitudes, and the classical equations of motion in the mean-field potential. Numerical tests of this theory are carried out for several most important rotational state-to-state transitions in the N2 + H2 system, in a broad range of collision energies. Besides scattering resonances (at low collision energies) excellent agreement with full-quantum results is obtained, including the excitation thresholds, the maxima of cross sections, and even some smaller features, such as slight oscillations of energy dependencies. Most importantly, at higher energies the results of MQCT are nearly identical to the full quantum results, which makes this approach a good alternative to the full-quantum calculations that become computationally expensive at higher collision energies and for heavier collision partners. Extensions of this theory to include vibrational transitions or general asymmetric-top rotor (polyatomic) molecules are relatively straightforward.

  8. C 1 s ionization in C sub 2 H sub 2 studied by asymmetric ( e ,2 e ) experiments

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Avaldi, L.; Camilloni, R.; Stefani, G.

    1990-01-01

    The dynamics of core ionization by electron impact is investigated through the measurement of the triply differential cross section of the C {sigma}1{ital s} orbital in the molecule C{sub 2}H{sub 2}. The ({ital e},2{ital e}) experiments have been performed under asymmetric conditions and at small scattering angles, with a scattered electron energy of 1500 eV and low energies of the ejected electrons (9.6 and 41.0 eV). The measured angular distributions are characterized by large-size recoil lobes, breaking of the symmetry around the momentum-transfer direction, and unusual deviations of the maxima of the recoil peaks towards smaller deflection angles. In themore » ({ital e},2{ital e}) energy spectrum a shift is observed in the position of the C {sigma}1{ital s} peak with respect to the expected value as measured by x-ray photoelectron spectroscopy. The amplitude of the shift amounts to 0.46{plus minus}0.23 eV at 9.6 eV excess energy, and it is too large to be explained only in terms of postcollision interactions.« less

  9. One-dimensional self-confinement promotes polymorph selection in large-area organic semiconductor thin films.

    PubMed

    Giri, Gaurav; Li, Ruipeng; Smilgies, Detlef-M; Li, Er Qiang; Diao, Ying; Lenn, Kristina M; Chiu, Melanie; Lin, Debora W; Allen, Ranulfo; Reinspach, Julia; Mannsfeld, Stefan C B; Thoroddsen, Sigurdur T; Clancy, Paulette; Bao, Zhenan; Amassian, Aram

    2014-04-16

    A crystal's structure has significant impact on its resulting biological, physical, optical and electronic properties. In organic electronics, 6,13(bis-triisopropylsilylethynyl)pentacene (TIPS-pentacene), a small-molecule organic semiconductor, adopts metastable polymorphs possessing significantly faster charge transport than the equilibrium crystal when deposited using the solution-shearing method. Here, we use a combination of high-speed polarized optical microscopy, in situ microbeam grazing incidence wide-angle X-ray-scattering and molecular simulations to understand the mechanism behind formation of metastable TIPS-pentacene polymorphs. We observe that thin-film crystallization occurs first at the air-solution interface, and nanoscale vertical spatial confinement of the solution results in formation of metastable polymorphs, a one-dimensional and large-area analogy to crystallization of polymorphs in nanoporous matrices. We demonstrate that metastable polymorphism can be tuned with unprecedented control and produced over large areas by either varying physical confinement conditions or by tuning energetic conditions during crystallization through use of solvent molecules of various sizes.

  10. Low-lying π∗ resonances associated with cyano groups: A CAP/SAC-CI study

    NASA Astrophysics Data System (ADS)

    Ehara, Masahiro; Kanazawa, Yuki; Sommerfeld, Thomas

    2017-01-01

    The complex absorbing potential (CAP)/symmetry-adapted cluster-configuration interaction (SAC-CI) method is applied to low-lying π∗ resonance states of molecules containing one or two cyano (CN) groups. Benchmark calculations are carried out comparing the non-variational and approximate variational approach of SAC-CI and studying the selection threshold of operators. Experimental resonance positions from electron transmission spectroscopy (ETS) are reproduced provided the anticipated deviations due to vibronic effects are taken into account. Moreover, the calculated positions and widths agree well with those obtained in previous electron scattering calculations for HCN, CH3CN and their isonitriles. Based on our results, we suggest a reassignment of the experimental ETS of fumaronitrile and malononitrile. Our present results demonstrate again that the CAP/SAC-CI method reliably predicts low-lying π∗ resonances, and regarding the total numbers of molecules and resonances investigated, it is fair to say that it is presently the most extensively used high-level method in the temporary anion field.

  11. Absorption effects in electron-sulfur-dioxide collisions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Machado, L. E.; Sugohara, R. T.; Santos, A. S. dos

    2011-09-15

    A joint experimental-theoretical study on electron-SO{sub 2} collisions in the low and intermediate energy range is reported. More specifically, experimental elastic differential, integral, and momentum transfer cross sections in absolute scale are measured in the 100-1000 eV energy range using the relative-flow technique. Calculated elastic differential, integral, and momentum transfer cross sections as well as grand-total and total absorption cross sections are also presented in the 1-1000 eV energy range. A complex optical potential is used to represent the electron-molecule interaction dynamics, whereas the Schwinger variational iterative method combined with the distorted-wave approximation is used to solve the scattering equations.more » Comparison of the present results is made with the theoretical and experimental results available in the literature.« less

  12. Attosecond control of electrons emitted from a nanoscale metal tip.

    PubMed

    Krüger, Michael; Schenk, Markus; Hommelhoff, Peter

    2011-07-06

    Attosecond science is based on steering electrons with the electric field of well controlled femtosecond laser pulses. It has led to the generation of extreme-ultraviolet pulses with a duration of less than 100 attoseconds (ref. 3; 1 as = 10(-18) s), to the measurement of intramolecular dynamics (by diffraction of an electron taken from the molecule under scrutiny) and to ultrafast electron holography. All these effects have been observed with atoms or molecules in the gas phase. Electrons liberated from solids by few-cycle laser pulses are also predicted to show a strong light-phase sensitivity, but only very small effects have been observed. Here we report that the spectra of electrons undergoing photoemission from a nanometre-scale tungsten tip show a dependence on the carrier-envelope phase of the laser, with a current modulation of up to 100 per cent. Depending on the carrier-envelope phase, electrons are emitted either from a single sub-500-attosecond interval of the 6-femtosecond laser pulse, or from two such intervals; the latter case leads to spectral interference. We also show that coherent elastic re-scattering of liberated electrons takes place at the metal surface. Owing to field enhancement at the tip, a simple laser oscillator reaches the peak electric field strengths required for attosecond experiments at 100-megahertz repetition rates, rendering complex amplified laser systems dispensable. Practically, this work represents a simple, extremely sensitive carrier-envelope phase sensor, which could be shrunk in volume to about one cubic centimetre. Our results indicate that the attosecond techniques developed with (and for) atoms and molecules can also be used with solids. In particular, we foresee subfemtosecond, subnanometre probing of collective electron dynamics (such as plasmon polaritons) in solid-state systems ranging in scale from mesoscopic solids to clusters and to single protruding atoms. ©2011 Macmillan Publishers Limited. All rights reserved

  13. HF-enhanced 4278-Å airglow: evidence of accelerated ionosphere electrons?

    NASA Astrophysics Data System (ADS)

    Fallen, C. T.; Watkins, B. J.

    2013-12-01

    We report calculations from a one-dimensional physics-based self-consistent ionosphere model (SCIM) demonstrating that HF-heating of F-region electrons can produce 4278-Å airglow enhancements comparable in magnitude to those reported during ionosphere HF modification experiments at the High-frequency Active Auroral Research Program (HAARP) observatory in Alaska. These artificial 'blue-line' emissions, also observed at the EISCAT ionosphere heating facility in Norway, have been attributed to arise solely from additional production of N2+ ions through impact ionization of N2 molecules by HF-accelerated electrons. Each N2+ ion produced by impact ionization or photoionization has a probability of being created in the N2+(1N) excited state, resulting in a blue-line emission from the allowed transition to its ground state. The ionization potential of N2 exceeds 18 eV, so enhanced impact ionization of N2 implies that significant electron acceleration processes occur in the HF-modified ionosphere. Further, because of the fast N2+ emission time, measurements of 4278-Å intensity during ionosphere HF modification experiments at HAARP have also been used to estimate artificial ionization rates. To the best of our knowledge, all observations of HF-enhanced blue-line emissions have been made during twilight conditions when resonant scattering of sunlight by N2+ ions is a significant source of 4278-Å airglow. Our model calculations show that F-region electron heating by powerful O-mode HF waves transmitted from HAARP is sufficient to increase N2+ ion densities above the shadow height through temperature-enhanced ambipolar diffusion and temperature-suppressed ion recombination. Resonant scattering from the modified sunlit region can cause a 10-20 R increase in 4278-Å airglow intensity, comparable in magnitude to artificial emissions measured during ionosphere HF-modification experiments. This thermally-induced artificial 4278-Å aurora occurs independently of any artificial aurora maintained by HF-accelerated (non-thermal) electrons. The numerical results presented here do not necessarily rule out the presence of HF-accelerated electrons with energies exceeding 18 eV. However, vertical or field-aligned airglow intensity measurements made during twilight conditions do not provide definitive evidence of energetic HF-accelerated electrons. Consequently, artificial blue-line airglow measurements should not be used to estimate N2+ ionization rates without also accounting for temperature-dependent chemistry and diffusion. Future experiments that make simultaneous measurements of N2+ ion airglow emissions from both the first negative bands and the Meinel bands can potentially resolve the relative contributions of accelerated electron and resonant scattering mechanisms. Airglow emission rates from these bands are expected to be in strict proportion when the emissions result from electron impact ionization of N2 molecules. Side-view altitude-resolved 4278-Å airglow measurements may also indicate the presence of energetic HF-accelerated electrons if the blue-line emissions are determined to occur below the shadow height.

  14. Quantum treatment of the capture of an atom by a fast nucleus incident on a molecule

    NASA Astrophysics Data System (ADS)

    Shakeshaft, Robin; Spruch, Larry

    1980-04-01

    The classical double-scattering model of Thomas for the capture of electrons from atoms by fast ions yields a cross section σ which dominates over the single scattering contribution for sufficiently fast ions. The magnitude of the classical double-scattering σ differs, however, from its quantum-mechanical (second-Born) analog by an order of magnitude. Further, a "fast ion" means an ion of some MeV, and at those energies the cross sections are very low. On the other hand, as noted by Bates, Cook, and Smith, the double-scattering cross section for the capture of atoms from molecules by fast ions dominates over the single-scattering contribution for incident ions of very much lower energy; roughly, one must have the velocity of the incident projectile much larger than a characteristic internal velocity of the particles in the target. It follows that we are in the asymptotic domain not at about 10 MeV but at about 100 eV. For the reaction H+ + CH4-->H+2 + CH3 with incident proton energies of 70 to 150 eV, the peak in the angular distribution as determined experimentally is at almost precisely the value predicted by the classical model, but the theoretical total cross section is about 30 times too large. Using a quantum version of the classical model, which involves the same kinematics and therefore preserves the agreement with the angular distribution, we obtain somewhat better agreement with the experimental total cross section, by a factor of about 5. (To obtain very good agreement, one may have to perform a really accurate calculation of large-angle elastic scattering of protons and H atoms by CH3, and take into account interference effects.) In the center-of-mass frame, for sufficiently high incident energy, the first of the two scatterings involves the scattering of H+ by H through an angle of very close to 90°, and it follows that the nuclei of the emergent H+2 ion will almost all be in the singlet state. We have also calculated the cross section for the reaction D+ + CH4-->(HD)+ + CH3.

  15. Molecular near-field antenna effect in resonance hyper-Raman scattering: Intermolecular vibronic intensity borrowing of solvent from solute through dipole-dipole and dipole-quadrupole interactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shimada, Rintaro; Hamaguchi, Hiro-o, E-mail: hhama@nctu.edu.tw

    2014-05-28

    We quantitatively interpret the recently discovered intriguing phenomenon related to resonance Hyper-Raman (HR) scattering. In resonance HR spectra of all-trans-β-carotene (β-carotene) in solution, vibrations of proximate solvent molecules are observed concomitantly with the solute β-carotene HR bands. It has been shown that these solvent bands are subject to marked intensity enhancements by more than 5 orders of magnitude under the presence of β-carotene. We have called this phenomenon the molecular-near field effect. Resonance HR spectra of β-carotene in benzene, deuterated benzene, cyclohexane, and deuterated cyclohexane have been measured precisely for a quantitative analysis of this effect. The assignments of themore » observed peaks are made by referring to the infrared, Raman, and HR spectra of neat solvents. It has been revealed that infrared active and some Raman active vibrations are active in the HR molecular near-field effect. The observed spectra in the form of difference spectra (between benzene/deuterated benzene and cyclohexane/deuterated cyclohexane) are quantitatively analyzed on the basis of the extended vibronic theory of resonance HR scattering. The theory incorporates the coupling of excited electronic states of β-carotene with the vibrations of a proximate solvent molecule through solute–solvent dipole–dipole and dipole–quadrupole interactions. It is shown that the infrared active modes arise from the dipole–dipole interaction, whereas Raman active modes from the dipole–quadrupole interaction. It is also shown that vibrations that give strongly polarized Raman bands are weak in the HR molecular near-field effect. The observed solvent HR spectra are simulated with the help of quantum chemical calculations for various orientations and distances of a solvent molecule with respect to the solute. The observed spectra are best simulated with random orientations of the solvent molecule at an intermolecular distance of 10 Å.« less

  16. The effect of nonlocal dielectric response on the surface-enhanced Raman and fluorescence spectra of molecular systems.

    PubMed

    Wei, Yong; Pei, Huan; Li, Li; Zhu, Yanying

    2018-05-04

    We present a theoretical study on the influence of the nonlocal dielectric response on surface-enhanced resonant Raman scattering (SERRS) and fluorescence (SEF) spectra of a model molecule confined in the center of a Ag nanoparticle (NP) dimer. In the simulations, the nonlocal dielectric response caused by the electron-hole pair generation in Ag NPs was computed with the d-parameter theory, and the scattering spectra of a model molecule representing the commonly used fluorescent dye rhodamine 6G (R6G) were obtained by density-matrix calculations. The influence of the separation between Ag NP dimers on the damping rate and scattering spectra with and without the nonlocal response were systematically analyzed. The results show that the nonlocal dielectric response is very sensitive to the gap distance of the NP dimers, and it undergoes much faster decay with the increase of the separation than the radiative and energy transfer rates. The Raman and fluorescence peaks as simulated with the nonlocal dielectric response are relative weaker than that without the nonlocal effect for smaller NP separations because the extra decay rates of the nonlocal effect could reduce both the population of the excited state and the interband coherence between the ground and excited states. Our result also indicates that the nonlocal effect is more prominent on the SEF process than the SERRS process.

  17. Radiative transfer in an atmosphere-ocean system.

    PubMed

    Plass, G N; Kattawar, G W

    1969-02-01

    The radiation field for an atmosphere-ocean system is calculated by a Monte Carlo method. In the atmosphere, both Rayleigh scattering by the molecules and Mie scattering by the aerosols and water droplets, when present, as well as molecular and aerosol absorption are included in the model. Similarly, in the ocean, both Rayleigh scattering by the water molecules and Mie scattering by the hydrosols as well as absorption by the water molecules and hydrosols are considered. Separate scattering functions are calculated from the Mie theory for the water droplets in clouds, the aerosols, and the hydrosols with an appropriate and different size distribution in each case. The photon path is followed accurately in three dimensions with new scattering angles determined from the appropriate scattering function including the strong forward scattering peak. Both the reflected and refracted rays, as well as the rays that undergo total internal reflection, are followed at the ocean surface, which is assumed smooth. The ocean floor is represented by a Lambert surface. The radiance and flux are given for two wavelengths, three solar angles, shallow and deep oceans, various albedos of ocean floor, various depths in atmosphere and ocean, and with and without clouds in the atmosphere.

  18. Molecular Rayleigh Scattering Diagnostic for Measurement of High Frequency Temperature Fluctuations

    NASA Technical Reports Server (NTRS)

    Mielke, Amy F.; Elam, Kristie A.

    2005-01-01

    A novel technique for measurement of high frequency temperature fluctuations in unseeded gas flows using molecular Rayleigh scattering is investigated. The spectrum of laser light scattered from molecules in a gas flow is resolved using a Fabry-Perot interferometer. The width of the spectral peak is broadened by thermal motion of the molecules and hence is related to gas temperature. The interference fringe pattern containing spectral information is divided into four concentric regions using a series of mirrors angled with respect to one another. Light from each of these regions is directed towards photomultiplier tubes and sampled at 10 kHz using photon counting electronics. Monitoring the relative change in intensity within each region allows measurement of gas temperature. Independently monitoring the total scattered intensity provides a measure of gas density. This technique also has the potential to simultaneously measure a single component of flow velocity by monitoring the spectral peak location. Measurements of gas temperature and density are demonstrated using a low speed heated air jet surrounded by an unheated air co-flow. Mean values of temperature and density are shown for radial scans across the jet flow at a fixed axial distance from the jet exit plane. Power spectra of temperature and density fluctuations at several locations in the jet are also shown. The instantaneous measurements have fairly high uncertainty; however, long data records provide highly accurate statistically quantities, which include power spectra. Mean temperatures are compared with thermocouple measurements as well as the temperatures derived from independent density measurements. The accuracy for mean temperature measurements was +/- 7 K.

  19. Profiling of back-scattered electrons in opposed magnetic field of a Twin Electron Beam Gun

    NASA Astrophysics Data System (ADS)

    Sethi, S.; Gupta, Anchal; Dileep Kumar, V.; Mukherjee, Jaya; Gantayet, L. M.

    2012-11-01

    Electron gun is extensively used in material processing, physical vapour deposition and atomic vapour based laser processes. In these processes where the electron beam is incident on the substrate, a significant fraction of electron beam gets back-scattered from the target surface. The trajectory of this back scattered electron beam depends on the magnetic field in the vicinity. The fraction of back-scattered depends on the atomic number of the target metal and can be as high as ~40% of the incident beam current. These back-scattered electrons can cause undesired hot spots and also affect the overall process. Hence, the study of the trajectory of these back-scattered electrons is important. This paper provides the details of experimentally mapped back-scattered electrons of a 2×20kW Twin Electron Beam Gun (TEBG) in opposed magnetic field i.e. with these guns placed at 180° to each other.

  20. Evidence for a quantum dipole liquid state in an organic quasi–two-dimensional material

    NASA Astrophysics Data System (ADS)

    Hassan, Nora; Cunningham, Streit; Mourigal, Martin; Zhilyaeva, Elena I.; Torunova, Svetlana A.; Lyubovskaya, Rimma N.; Schlueter, John A.; Drichko, Natalia

    2018-06-01

    Mott insulators are commonly pictured with electrons localized on lattice sites, with their low-energy degrees of freedom involving spins only. Here, we observe emergent charge degrees of freedom in a molecule-based Mott insulator κ-(BEDT-TTF)2Hg(SCN)2Br, resulting in a quantum dipole liquid state. Electrons localized on molecular dimer lattice sites form electric dipoles that do not order at low temperatures and fluctuate with frequency detected experimentally in our Raman spectroscopy experiments. The heat capacity and Raman scattering response are consistent with a scenario in which the composite spin and electric dipole degrees of freedom remain fluctuating down to the lowest measured temperatures.

  1. Photoconductivity study of acid on Zinc phthalocyanine pyridine thin films

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Singh, Sukhwinder, E-mail: ss7667@gmail.com; Saini, G. S. S.; Tripathi, S. K.

    2016-05-06

    The Metal Phthalocyanine (MPc) have attracted much interest because of chemical and high thermal stability. Molecules forming a crystal of MPc are held together by weak attractive Vander Waals forces. Organic semiconductors have π conjugate bonds which allow electrons to move via π-electron cloud overlaps. Conduction mechanisms for organic semiconductor are mainly through tunneling; hopping between localized states, mobility gaps, and phonon assisted hopping. The photo conductivity of thin films of these complexes changes when exposed to oxidizing and reducing gases. Arrhenius plot is used to find the thermal activation energy in the intrinsic region and impurity scattering region. Arrheniusmore » plotsare used to find the thermal activation energy.« less

  2. Hybrid theory and calculation of e-N2 scattering. [quantum mechanics - nuclei (nuclear physics)

    NASA Technical Reports Server (NTRS)

    Chandra, N.; Temkin, A.

    1975-01-01

    A theory of electron-molecule scattering was developed which was a synthesis of close coupling and adiabatic-nuclei theories. The theory is shown to be a close coupling theory with respect to vibrational degrees of freedom but is a adiabatic-nuclei theory with respect to rotation. It can be applied to any number of partial waves required, and the remaining ones can be calculated purely in one or the other approximation. A theoretical criterion based on fixed-nuclei calculations and not on experiment can be given as to which partial waves and energy domains require the various approximations. The theory allows all cross sections (i.e., pure rotational, vibrational, simultaneous vibration-rotation, differential and total) to be calculated. Explicit formulae for all the cross sections are presented.

  3. Multimodal Nonlinear Optical Microscopy

    PubMed Central

    Yue, Shuhua; Slipchenko, Mikhail N.; Cheng, Ji-Xin

    2013-01-01

    Because each nonlinear optical (NLO) imaging modality is sensitive to specific molecules or structures, multimodal NLO imaging capitalizes the potential of NLO microscopy for studies of complex biological tissues. The coupling of multiphoton fluorescence, second harmonic generation, and coherent anti-Stokes Raman scattering (CARS) has allowed investigation of a broad range of biological questions concerning lipid metabolism, cancer development, cardiovascular disease, and skin biology. Moreover, recent research shows the great potential of using CARS microscope as a platform to develop more advanced NLO modalities such as electronic-resonance-enhanced four-wave mixing, stimulated Raman scattering, and pump-probe microscopy. This article reviews the various approaches developed for realization of multimodal NLO imaging as well as developments of new NLO modalities on a CARS microscope. Applications to various aspects of biological and biomedical research are discussed. PMID:24353747

  4. Breaking Symmetry in Time-Dependent Electronic Structure Theory to Describe Spectroscopic Properties of Non-Collinear and Chiral Molecules

    NASA Astrophysics Data System (ADS)

    Goings, Joshua James

    Time-dependent electronic structure theory has the power to predict and probe the ways electron dynamics leads to useful phenomena and spectroscopic data. Here we report several advances and extensions of broken-symmetry time-dependent electronic structure theory in order to capture the flexibility required to describe non-equilibrium spin dynamics, as well as electron dynamics for chiroptical properties and vibrational effects. In the first half, we begin by discussing the generalization of self-consistent field methods to the so-called two-component structure in order to capture non-collinear spin states. This means that individual electrons are allowed to take a superposition of spin-1/2 projection states, instead of being constrained to either spin-up or spin-down. The system is no longer a spin eigenfunction, and is known a a spin-symmetry broken wave function. This flexibility to break spin symmetry may lead to variational instabilities in the approximate wave function, and we discuss how these may be overcome. With a stable non-collinear wave function in hand, we then discuss how to obtain electronic excited states from the non-collinear reference, along with associated challenges in their physical interpretation. Finally, we extend the two-component methods to relativistic Hamiltonians, which is the proper setting for describing spin-orbit driven phenomena. We describe the first implementation of the explicit time propagation of relativistic two-component methods and how this may be used to capture spin-forbidden states in electronic absorption spectra. In the second half, we describe the extension of explicitly time-propagated wave functions to the simulation of chiroptical properties, namely circular dichroism (CD) spectra of chiral molecules. Natural circular dichroism, that is, CD in the absence of magnetic fields, originates in the broken parity symmetry of chiral molecules. This proves to be an efficient method for computing circular dichroism spectra for high density-of-states chiral molecules. Next, we explore the impact of allowing nuclear motion on electronic absorption spectra within the context of mixed quantum-classical dynamics. We show that nuclear motion modulates the electronic response, and this gives rise to infrared absorption as well as Raman scattering phenomena in the computed dynamic polarizability. Finally, we explore the accuracy of several perturbative approximations to the equation-of-motion coupled-cluster methods for the efficient and accurate prediction of electronic absorption spectra.

  5. Theory of the reaction dynamics of small molecules on metal surfaces

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jackson, Bret

    The objective of this project has been to develop realistic theoretical models for gas-surface interactions, with a focus on processes important in heterogeneous catalysis. The dissociative chemisorption of a molecule on a metal is a key step in many catalyzed reactions, and is often the rate-limiting step. We have explored the dissociative chemisorption of H 2, H 2O and CH 4 on a variety of metal surfaces. Most recently, our extensive studies of methane dissociation on Ni and Pt surfaces have fully elucidated its dependence on translational energy, vibrational state and surface temperature, providing the first accurate comparisons with experimentalmore » data. We have explored Eley-Rideal and hot atom reactions of H atoms with H- and C-covered metal surfaces. H atom interactions with graphite have also been explored, including both sticking and Eley-Rideal recombination processes. Again, our methods made it possible to explain several experiments studying these reactions. The sticking of atoms on metal surfaces has also been studied. To help elucidate the experiments that study these processes, we examine how the reaction dynamics depend upon the nature of the molecule-metal interaction, as well as experimental variables such as substrate temperature, beam energy, angle of impact, and the internal states of the molecules. Electronic structure methods based on Density Functional Theory are used to compute each molecule-metal potential energy surface. Both time-dependent quantum scattering techniques and quasi-classical methods are used to examine the reaction or scattering dynamics. Much of our effort has been directed towards developing improved quantum methods that can accurately describe reactions, as well as include the effects of substrate temperature (lattice vibration).« less

  6. Comparative analysis of characteristic electron energy loss spectra and inelastic scattering cross-section spectra of Fe

    NASA Astrophysics Data System (ADS)

    Parshin, A. S.; Igumenov, A. Yu.; Mikhlin, Yu. L.; Pchelyakov, O. P.; Zhigalov, V. S.

    2016-05-01

    The inelastic electron scattering cross section spectra of Fe have been calculated based on experimental spectra of characteristic reflection electron energy loss as dependences of the product of the inelastic mean free path by the differential inelastic electron scattering cross section on the electron energy loss. It has been shown that the inelastic electron scattering cross-section spectra have certain advantages over the electron energy loss spectra in the analysis of the interaction of electrons with substance. The peaks of energy loss in the spectra of characteristic electron energy loss and inelastic electron scattering cross sections have been determined from the integral and differential spectra. It has been shown that the energy of the bulk plasmon is practically independent of the energy of primary electrons in the characteristic electron energy loss spectra and monotonically increases with increasing energy of primary electrons in the inelastic electron scattering cross-section spectra. The variation in the maximum energy of the inelastic electron scattering cross-section spectra is caused by the redistribution of intensities over the peaks of losses due to various excitations. The inelastic electron scattering cross-section spectra have been analyzed using the decomposition of the spectra into peaks of the energy loss. This method has been used for the quantitative estimation of the contributions from different energy loss processes to the inelastic electron scattering cross-section spectra of Fe and for the determination of the nature of the energy loss peaks.

  7. Isomer and Fluorination Effects among Fluorine Substituted Hydrocarbon C3/C4 Molecules in Electron Impact Ionization

    NASA Astrophysics Data System (ADS)

    Patel, U. R.; Joshipura, K. N.

    2015-05-01

    Electron collision processes are very important in both man-made and natural plasmas, for determining the energy balances and transport properties of electrons. Electron -molecule scattering leading to ionization represents one of the most fundamental processes in collision physics. In the gas phase, the total efficiency of the process is described by the absolute total electron impact ionization cross section. Carbon based materials are some of the widely used materials for a divertor plate and magnetically confined fusion devices. In the ``ITER,'' it is very important for steady state operation to have an estimate of the lifetime of carbon plasma facing components. Apart from fusion plasma relevance, the present theoretical study is very important in modeling and controlling other electron assisted processes in many areas. Hydrocarbons play an important role for plasma diagnostics as impurities in the Tokamak fusion divertor, as seed gases for the production of radicals and ions in low temperature plasma processing. Fluorine substituted hydrocarbons (perfluorocarbons) are important as reactants in plasma assisted fabrication processes. In the present work, we have calculated total ionization cross sections Qion for C3/C4 Hydrocarbon isomers by electron impact, and comparisons are made mutually to observe isomer effect. Comparisons are also made by substituting H atom by F atom and revealing fluorination effect. The present calculations are quite significant owing to the lack of experimental data, with just an isolated previous theoretical work in some cases.

  8. Exploring the chemical enhancement for surface-enhanced Raman scattering with Au bowtie nanoantennas

    PubMed Central

    Fromm, David P.; Kinkhabwala, Anika; Schuck, P. James; Moerner, W. E.; Sundaramurthy, Arvind; Kino, Gordon S.

    2006-01-01

    Single metallic bowtie nanoantennas provide a controllable environment for surface-enhanced Raman scattering (SERS) of adsorbed molecules. Bowties have experimentally measured electromagnetic enhancements, enabling estimation of chemical enhancement for both the bulk and the few-molecule regime. Strong fluctuations of selected Raman lines imply that a small number of p-mercaptoaniline molecules on a single bowtie show chemical enhancement >107, much larger than previously believed, likely due to charge transfer between the Au surface and the molecule. This chemical sensitivity of SERS has significant implications for ultra-sensitive detection of single molecules. PMID:16483189

  9. X-ray and Neutron Scattering Study of the Formation of Core–Shell-Type Polyoxometalates

    DOE PAGES

    Yin, Panchao; Wu, Bin; Mamontov, Eugene; ...

    2016-02-05

    A typical type of core-shell polyoxometalates can be obtained through the Keggin-type polyoxometalate-templated growth of a layer of spherical shell structure of {Mo 72Fe 30}. Small angle X-ray scattering is used to study the structural features and stability of the core-shell structures in aqueous solutions. Time-resolved small angle X-ray scattering is applied to monitor the synthetic reactions and a three-stage formation mechanism is proposed to describe the synthesis of the core-shell polyoxometalates based on the monitoring results. Quasi-elastic and inelastic neutron scattering are used to probe the dynamics of water molecules in the core-shell structures and two different types ofmore » water molecules, the confined and structured water, are observed. These water molecules play an important role in bridging core and shell structures and stabilizing the cluster structures. A typical type of core shell polyoxometalates can be obtained through the Keggin-type polyoxometalate-templated growth of a layer of spherical shell structure of {Mo 72Fe 30}. Small-angle X-ray scattering is used to study the structural features and stability of the core shell structures in aqueous solutions. Time-resolved small-angle X-ray scattering is applied to monitor the synthetic reactions, and a three-stage formation mechanism is proposed to describe the synthesis of the core shell polyoxometalates based on the monitoring results. New protocols have been developed by fitting the X-ray data with custom physical models, which provide more convincing, objective, and completed data interpretation. Quasi-elastic and inelastic neutron scattering are used to probe the dynamics of water molecules in the core shell structures, and two different types of water molecules, the confined and structured water, are observed. These water molecules play an important role in bridging core and shell structures and stabilizing the cluster structures.« less

  10. Through a Window, Brightly: A Review of Selected Nanofabricated Thin-Film Platforms for Spectroscopy, Imaging, and Detection.

    PubMed

    Dwyer, Jason R; Harb, Maher

    2017-09-01

    We present a review of the use of selected nanofabricated thin films to deliver a host of capabilities and insights spanning bioanalytical and biophysical chemistry, materials science, and fundamental molecular-level research. We discuss approaches where thin films have been vital, enabling experimental studies using a variety of optical spectroscopies across the visible and infrared spectral range, electron microscopies, and related techniques such as electron energy loss spectroscopy, X-ray photoelectron spectroscopy, and single molecule sensing. We anchor this broad discussion by highlighting two particularly exciting exemplars: a thin-walled nanofluidic sample cell concept that has advanced the discovery horizons of ultrafast spectroscopy and of electron microscopy investigations of in-liquid samples; and a unique class of thin-film-based nanofluidic devices, designed around a nanopore, with expansive prospects for single molecule sensing. Free-standing, low-stress silicon nitride membranes are a canonical structural element for these applications, and we elucidate the fabrication and resulting features-including mechanical stability, optical properties, X-ray and electron scattering properties, and chemical nature-of this material in this format. We also outline design and performance principles and include a discussion of underlying material preparations and properties suitable for understanding the use of alternative thin-film materials such as graphene.

  11. Optical characteristics and parameters of gas-discharge plasma in a mixture of mercury dibromide vapor with neon

    NASA Astrophysics Data System (ADS)

    Malinina, A. A.; Malinin, A. N.

    2013-12-01

    Results are presented from studies of the optical characteristics and parameters of plasma of a dielectric barrier discharge in a mixture of mercury dibromide vapor with neon—the working medium of a non-coaxial exciplex gas-discharge emitter. The electron energy distribution function, the transport characteristics, the specific power losses for electron processes, the electron density and temperature, and the rate constants for the processes of elastic and inelastic electron scattering by the working mixture components are determined as functions of the reduced electric field. The rate constant of the process leading to the formation of exciplex mercury monobromide molecules is found to be 1.6 × 10-14 m3/s for a reduced electric field of E/ N = 15 Td, at which the maximum emission intensity in the blue-green spectral region (λmax = 502 nm) was observed in this experiment.

  12. Electron- and proton-induced ionization of pyrimidine

    NASA Astrophysics Data System (ADS)

    Champion, Christophe; Quinto, Michele A.; Weck, Philippe F.

    2015-05-01

    The present work describes a quantum-mechanically based model of the electron- and proton-induced ionization of isolated pyrimidine molecules. The impact energies range from the target ionization threshold up to ~1 keV for electrons and from 10 keV up to 10 MeV for protons. The cross-section calculations are performed within the 1st Born approximation in which the ejected electron is described by a Coulomb wave whereas the incident and the scattered projectiles are both described by plane waves. The pyrimidine target is described using the Gaussian 09 software package. The theoretical predictions obtained are in good agreement with experimental absolute total cross sections, while large discrepancies are observed between existing semi-empirical models and the present calculations. Contribution to the Topical Issue "COST Action Nano-IBCT: Nano-scale Processes Behind Ion-Beam Cancer Therapy", edited by Andrey Solov'yov, Nigel Mason, Gustavo García, Eugene Surdutovich.

  13. Selectivity in the inelastic rotational scattering of D2 and HD molecules from graphite: Similarities and differences respect to the H2 case

    NASA Astrophysics Data System (ADS)

    Rutigliano, Maria; Pirani, Fernando

    2018-03-01

    The inelastic scattering of D2 and HD molecules impinging on a graphite surface in well-defined initial roto-vibrational states has been studied by using the computational setup recently developed to characterize important selectivities in the molecular dynamics occurring at the gas-surface interface. In order to make an immediate comparison of determined elastic and inelastic scattering probabilities, we considered for D2 and HD molecules the same initial states, as well as the same collision energy range, previously selected for the investigation of H2 behaviour. The analysis of the back-scattered molecules shows that, while low-lying initial vibrational states are preserved, the medium-high initial ones give rise to final states covering the complete ladder of vibrational levels, although with different probability for the various cases investigated. Moreover, propensities in the formation of the final rotational states are found to depend strongly on the initial ones, on the collision energy, and on the isotopologue species.

  14. Identifying the Tunneling Site in Strong-Field Ionization of H_{2}^{+}.

    PubMed

    Liu, Kunlong; Barth, Ingo

    2017-12-15

    The tunneling site of the electron in a molecule exposed to a strong laser field determines the initial position of the ionizing electron and, as a result, has a large impact on the subsequent ultrafast electron dynamics on the polyatomic Coulomb potential. Here, the tunneling site of the electron of H_{2}^{+} ionized by a strong circularly polarized (CP) laser pulse is studied by numerically solving the time-dependent Schrödinger equation. We show that the electron removed from the down-field site is directly driven away by the CP field and the lateral photoelectron momentum distribution (LPMD) exhibits a Gaussian-like distribution, whereas the corresponding LPMD of the electron removed from the up-field site differs from the Gaussian shape due to the Coulomb focusing and scattering by the down-field core. Our current study presents the direct evidence clarifying a long-standing controversy over the tunneling site in H_{2}^{+} and raises the important role of the tunneling site in strong-field molecular ionization.

  15. Ultrafast Surface-Enhanced Raman Probing of the Role of Hot Electrons in Plasmon-Driven Chemistry.

    PubMed

    Brandt, Nathaniel C; Keller, Emily L; Frontiera, Renee R

    2016-08-18

    Hot electrons generated through plasmonic excitations in metal nanostructures show great promise for efficiently driving chemical reactions with light. However, the lifetime, yield, and mechanism of action of plasmon-generated hot electrons involved in a given photocatalytic process are not well understood. Here, we develop ultrafast surface-enhanced Raman scattering (SERS) as a direct probe of plasmon-molecule interactions in the plasmon-catalyzed dimerization of 4-nitrobenzenethiol to p,p'-dimercaptoazobenzene. Ultrafast SERS probing of these molecular reporters in plasmonic hot spots reveals transient Fano resonances, which we attribute to near-field coupling of Stokes-shifted photons to hot electron-driven metal photoluminescence. Surprisingly, we find that hot spots that yield more photoluminescence are much more likely to drive the reaction, which indirectly proves that plasmon-generated hot electrons induce the photochemistry. These ultrafast SERS results provide insight into the relative reactivity of different plasmonic hot spot environments and quantify the ultrafast lifetime of hot electrons involved in plasmon-driven chemistry.

  16. Local vibrations in disordered solids studied via single-molecule spectroscopy: Comparison with neutron, nuclear, Raman scattering, and photon echo data

    NASA Astrophysics Data System (ADS)

    Vainer, Yu. G.; Naumov, A. V.; Kador, L.

    2008-06-01

    The energy spectrum of low-frequency vibrational modes (LFMs) in three disordered organic solids—amorphous polyisobutylene (PIB), toluene and deuterated toluene glasses, weakly doped with fluorescent chromophore molecules of tetra-tert-butylterrylene (TBT) has been measured via single-molecule (SM) spectroscopy. Analysis of the individual temperature dependences of linewidths of single TBT molecules allowed us to determine the values of the vibrational mode frequencies and the SM-LFM coupling constants for vibrations in the local environment of the molecules. The measured LFM spectra were compared with the “Boson peak” as measured in pure PIB by inelastic neutron scattering, in pure toluene glass by low-frequency Raman scattering, in doped toluene glass by nuclear inelastic scattering, and with photon echo data. The comparative analysis revealed close agreement between the spectra of the local vibrations as measured in the present study and the literature data of the Boson peak in PIB and toluene. The analysis has also the important result that weak doping of the disordered matrices with nonpolar probe molecules whose chemical composition is similar to that of the matrix molecules does not influence the observed vibrational dynamics markedly. The experimental data displaying temporal stability on the time scale of a few hours of vibrational excitation parameters in local surroundings was obtained for the first time both for polymer and molecular glass.

  17. Role of electron-electron interference in ultrafast time-resolved imaging of electronic wavepackets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dixit, Gopal; Santra, Robin; Department of Physics, University of Hamburg, D-20355 Hamburg

    2013-04-07

    Ultrafast time-resolved x-ray scattering is an emerging approach to image the dynamical evolution of the electronic charge distribution during complex chemical and biological processes in real-space and real-time. Recently, the differences between semiclassical and quantum-electrodynamical (QED) theory of light-matter interaction for scattering of ultrashort x-ray pulses from the electronic wavepacket were formally demonstrated and visually illustrated by scattering patterns calculated for an electronic wavepacket in atomic hydrogen [G. Dixit, O. Vendrell, and R. Santra, Proc. Natl. Acad. Sci. U.S.A. 109, 11636 (2012)]. In this work, we present a detailed analysis of time-resolved x-ray scattering from a sample containing a mixturemore » of non-stationary and stationary electrons within both the theories. In a many-electron system, the role of scattering interference between a non-stationary and several stationary electrons to the total scattering signal is investigated. In general, QED and semiclassical theory provide different results for the contribution from the scattering interference, which depends on the energy resolution of the detector and the x-ray pulse duration. The present findings are demonstrated by means of a numerical example of x-ray time-resolved imaging for an electronic wavepacket in helium. It is shown that the time-dependent scattering interference vanishes within semiclassical theory and the corresponding patterns are dominated by the scattering contribution from the time-independent interference, whereas the time-dependent scattering interference contribution do not vanish in the QED theory and the patterns are dominated by the scattering contribution from the non-stationary electron scattering.« less

  18. Role of electron-electron interference in ultrafast time-resolved imaging of electronic wavepackets

    NASA Astrophysics Data System (ADS)

    Dixit, Gopal; Santra, Robin

    2013-04-01

    Ultrafast time-resolved x-ray scattering is an emerging approach to image the dynamical evolution of the electronic charge distribution during complex chemical and biological processes in real-space and real-time. Recently, the differences between semiclassical and quantum-electrodynamical (QED) theory of light-matter interaction for scattering of ultrashort x-ray pulses from the electronic wavepacket were formally demonstrated and visually illustrated by scattering patterns calculated for an electronic wavepacket in atomic hydrogen [G. Dixit, O. Vendrell, and R. Santra, Proc. Natl. Acad. Sci. U.S.A. 109, 11636 (2012)], 10.1073/pnas.1202226109. In this work, we present a detailed analysis of time-resolved x-ray scattering from a sample containing a mixture of non-stationary and stationary electrons within both the theories. In a many-electron system, the role of scattering interference between a non-stationary and several stationary electrons to the total scattering signal is investigated. In general, QED and semiclassical theory provide different results for the contribution from the scattering interference, which depends on the energy resolution of the detector and the x-ray pulse duration. The present findings are demonstrated by means of a numerical example of x-ray time-resolved imaging for an electronic wavepacket in helium. It is shown that the time-dependent scattering interference vanishes within semiclassical theory and the corresponding patterns are dominated by the scattering contribution from the time-independent interference, whereas the time-dependent scattering interference contribution do not vanish in the QED theory and the patterns are dominated by the scattering contribution from the non-stationary electron scattering.

  19. Role of electron-electron interference in ultrafast time-resolved imaging of electronic wavepackets.

    PubMed

    Dixit, Gopal; Santra, Robin

    2013-04-07

    Ultrafast time-resolved x-ray scattering is an emerging approach to image the dynamical evolution of the electronic charge distribution during complex chemical and biological processes in real-space and real-time. Recently, the differences between semiclassical and quantum-electrodynamical (QED) theory of light-matter interaction for scattering of ultrashort x-ray pulses from the electronic wavepacket were formally demonstrated and visually illustrated by scattering patterns calculated for an electronic wavepacket in atomic hydrogen [G. Dixit, O. Vendrell, and R. Santra, Proc. Natl. Acad. Sci. U.S.A. 109, 11636 (2012)]. In this work, we present a detailed analysis of time-resolved x-ray scattering from a sample containing a mixture of non-stationary and stationary electrons within both the theories. In a many-electron system, the role of scattering interference between a non-stationary and several stationary electrons to the total scattering signal is investigated. In general, QED and semiclassical theory provide different results for the contribution from the scattering interference, which depends on the energy resolution of the detector and the x-ray pulse duration. The present findings are demonstrated by means of a numerical example of x-ray time-resolved imaging for an electronic wavepacket in helium. It is shown that the time-dependent scattering interference vanishes within semiclassical theory and the corresponding patterns are dominated by the scattering contribution from the time-independent interference, whereas the time-dependent scattering interference contribution do not vanish in the QED theory and the patterns are dominated by the scattering contribution from the non-stationary electron scattering.

  20. Vibronic coupling simulations for linear and nonlinear optical processes: Simulation results

    NASA Astrophysics Data System (ADS)

    Silverstein, Daniel W.; Jensen, Lasse

    2012-02-01

    A vibronic coupling model based on time-dependent wavepacket approach is applied to simulate linear optical processes, such as one-photon absorbance and resonance Raman scattering, and nonlinear optical processes, such as two-photon absorbance and resonance hyper-Raman scattering, on a series of small molecules. Simulations employing both the long-range corrected approach in density functional theory and coupled cluster are compared and also examined based on available experimental data. Although many of the small molecules are prone to anharmonicity in their potential energy surfaces, the harmonic approach performs adequately. A detailed discussion of the non-Condon effects is illustrated by the molecules presented in this work. Linear and nonlinear Raman scattering simulations allow for the quantification of interference between the Franck-Condon and Herzberg-Teller terms for different molecules.

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mikheev, Evgeny; Himmetoglu, Burak; Kajdos, Adam P.

    We analyze and compare the temperature dependence of the electron mobility of two- and three-dimensional electron liquids in SrTiO{sub 3}. The contributions of electron-electron scattering must be taken into account to accurately describe the mobility in both cases. For uniformly doped, three-dimensional electron liquids, the room temperature mobility crosses over from longitudinal optical (LO) phonon-scattering-limited to electron-electron-scattering-limited as a function of carrier density. In high-density, two-dimensional electron liquids, LO phonon scattering is completely screened and the mobility is dominated by electron-electron scattering up to room temperature. The possible origins of the observed behavior and the consequences for approaches to improvemore » the mobility are discussed.« less

  2. Non-adiabatic effects in elementary reaction processes at metal surfaces

    NASA Astrophysics Data System (ADS)

    Alducin, M.; Díez Muiño, R.; Juaristi, J. I.

    2017-12-01

    Great success has been achieved in the modeling of gas-surface elementary processes by the use of the Born-Oppenheimer approximation. However, in metal surfaces low energy electronic excitations are generated even by thermal and hyperthermal molecules due to the absence of band gaps in the electronic structure. This shows the importance of performing dynamical simulations that incorporate non-adiabatic effects to analyze in which way they affect most common gas-surface reactions. Here we review recent theoretical developments in this problem and their application to the study of the effect of electronic excitations in the adsorption and relaxation of atoms and molecules in metal surfaces, in scattering processes, and also in recombinative processes between impinging atoms and adsorbates at the surface. All these studies serve us to establish what properties of the gas-surface interaction favor the excitation of low-energy electron-hole pairs. A general observation is that the nature of these excitations usually requires long lasting interactions at the surface in order to observe deviations from the adiabatic behaviour. We also provide the basis of the local density friction approximation (LDFA) that have been used in all these studies, and show how it has been employed to perform ab initio molecular dynamics with electronic friction (AIMDEF). As a final remark, we will shortly review on recent applications of the LDFA to successfully simulate desorption processes induced by intense femtosecond laser pulses.

  3. (e, 2e) simple ionization of {{\\rm{H}}}_{3}^{+} by fast electron impact: use of triangular three-center continuum and bound state wave functions

    NASA Astrophysics Data System (ADS)

    Obeid, S.; Chuluunbaatar, O.; Joulakian, B. B.

    2017-07-01

    The variation of the multiply differential cross section of the (e, 2e) simple ionization of {{{H}}}3+, with the incident and ejection energy values, as well as the directions of the ejected and scattered electrons, is studied. The calculations have been performed in the frame of the perturbative first Born procedure, which has required the development of equilateral triangular three center bound and continuum state wave functions. The results explore the optimal conditions and the particularities of the triangular targets, such as the appearance of interference patterns in the variation of the four fold differential cross section (FDCS) with the scattering angle for a fixed orientation of the molecule. The comparison between the results obtained by two H3 + ground wave functions, with and without a correlation term r 12, shows that the effect of correlation on the magnitude of the triple differential cross section is not large, but it produces some modification in the structure of the FDCS.

  4. Tailored Rh surface facilitates, enhancement of Raman scattering in trimetallic AuPt core/Rh shell composites: Experimental and theoretical evidences

    NASA Astrophysics Data System (ADS)

    Loganathan, B.; Chandraboss, V. L.; Senthilvelan, S.; Karthikeyan, B.

    2016-01-01

    We present a detailed analysis of surface-enhanced Raman scattering of 7-azaindole and L-cysteine adsorbed on a tailored Rh surface by using experimental and density functional theoretical (DFT) calculations. DFT with the B3LYP/Lanl2DZ basis set was used for the optimization of the ground state geometries and simulation of the surface-enhanced Raman spectrum of probe molecules adsorbed on Rh6 cluster. 7-azaindole and L-cysteine adsorption at the shell interface was ascertained from first-principles. In addition, characterization of synthesized trimetallic AuPt core/Rh shell colloidal nanocomposites has been analyzed by UV-visible spectroscopy, high-resolution transmission and scanning electron microscopy, selected area electron diffraction pattern analysis, energy-dispersive X-ray spectroscopy, atomic force, confocal Raman microscopy, FT-Raman and surface-enhanced Raman spectroscopic analysis. This analysis serves as the first step in gaining an accurate understanding of specific interactions at the interface of organic and biomolecules and to gain knowledge on the surface composition of trimetallic Au/Pt/Rh colloidal nanocomposites.

  5. Surface-enhanced Raman scattering from finite arrays of gold nano-patches

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vincenti, M. A.; Ceglia, D. de; US Army-Charles M. Bowden Research Laboratory, 35898 Redstone Arsenal, Huntsville, Alabama

    We experimentally investigate the surface-enhanced Raman scattering (SERS) response of a 2D-periodic array of square gold nano-patches, functionalized by means of a conjugated, rigid thiol. We measure a Raman signal enhancement up to 200 times more intense compared to other plasmon-based nanostructures functionalized with the same molecule, and show that the enhancement is not strictly correlated to the presence of plasmonic resonances. The agreement between experimental and theoretical results reveals the importance of a full-wave analysis based on the inclusion of the actual scattering cross section of the molecule. The proposed numerical approach may serve not only as a toolmore » to predict the enhancement of Raman signal scattered from strongly resonant nanostructure but also as an effective instrument to engineer SERS platforms that target specific molecules.« less

  6. SPECIAL ISSUE DEVOTED TO THE 80TH BIRTHDAY OF S.A. AKHMANOV: Transient coherent anti-Stokes Raman scattering spectroscopy as a tool for measuring the diffusion coefficient and size of gas molecules

    NASA Astrophysics Data System (ADS)

    Nikitin, Sergei Yu

    2009-07-01

    Formulas are derived for evaluating the diffusion coefficient and size of gas molecules from transient coherent anti-Stokes Raman scattering measurements. Numerical estimates are presented for hydrogen.

  7. Inelastic neutron scattering spectrum of cyclotrimethylenetrinitramine: a comparison with solid-state electronic structure calculations.

    PubMed

    Ciezak, Jennifer A; Trevino, S F

    2006-04-20

    Solid-state geometry optimizations and corresponding normal-mode analysis of the widely used energetic material cyclotrimethylenetrinitramine (RDX) were performed using density functional theory with both the generalized gradient approximation (BLYP and BP functionals) and the local density approximation (PWC and VWN functionals). The structural results were found to be in good agreement with experimental neutron diffraction data and previously reported calculations based on the isolated-molecule approximation. The vibrational inelastic neutron scattering (INS) spectrum of polycrystalline RDX was measured and compared with simulated INS constructed from the solid-state calculations. The vibrational frequencies calculated from the solid-state methods had average deviations of 10 cm(-1) or less, whereas previously published frequencies based on an isolated-molecule approximation had deviations of 65 cm(-1) or less, illustrating the importance of including crystalline forces. On the basis of the calculations and analysis, it was possible to assign the normal modes and symmetries, which agree well with previous assignments. Four possible "doorway modes" were found in the energy range defined by the lattice modes, which were all found to contain fundamental contributions from rotation of the nitro groups.

  8. Gradual collapse of nuclear wave functions regulated by frequency tuned X-ray scattering.

    PubMed

    Ignatova, Nina; Cruz, Vinícius V; Couto, Rafael C; Ertan, Emelie; Zimin, Andrey; Guimarães, Freddy F; Polyutov, Sergey; Ågren, Hans; Kimberg, Victor; Odelius, Michael; Gel'mukhanov, Faris

    2017-03-07

    As is well established, the symmetry breaking by isotope substitution in the water molecule results in localisation of the vibrations along one of the two bonds in the ground state. In this study we find that this localisation may be broken in excited electronic states. Contrary to the ground state, the stretching vibrations of HDO are delocalised in the bound core-excited state in spite of the mass difference between hydrogen and deuterium. The reason for this effect can be traced to the narrow "canyon-like" shape of the potential of the state along the symmetric stretching mode, which dominates over the localisation mass-difference effect. In contrast, the localisation of nuclear motion to one of the HDO bonds is preserved in the dissociative core-excited state . The dynamics of the delocalisation of nuclear motion in these core-excited states is studied using resonant inelastic X-ray scattering of the vibrationally excited HDO molecule. The results shed light on the process of a wave function collapse. After core-excitation into the state of HDO the initial wave packet collapses gradually, rather than instantaneously, to a single vibrational eigenstate.

  9. Spectral properties of the association nanoparticle system of ciprofloxacin-phloxine and its application to fluorescence analysis.

    PubMed

    Zou, Jieming; Jiang, Zhiliang; Wang, Lisheng; Li, Tingsheng; Liu, Qinye

    2004-06-01

    There is a fluorescence peak at 570 nm, and a maximum absorption peak at 560 nm for phloxine (PHLO) in a pH 7 water solution. Under these conditions, the ciprofloxacin cation (CPFX+) and PHLO- combine into hydrophobic CPFX-PHLO association molecule by means of static gravitation. There are stronger van der Waals forces and hydrophobic forces among the CPFX-PHLO molecules. Thus, they aggregate automatically to the (CPFX-PHLO)n association nanoparticle in red-violet color. That was characterized by scan electron microscopy (SEM), hyperfiltration and dialysis tests. In 0.04 M HCl, the red-violet nanoparticles exhibited a Rayleigh scattering peak at 470 nm, a resonance scattering peak at 580 nm, a maximum absorption wavelength at 565 nm, and a fluorescence peak at 450 nm. The fluorescence analytical conditions of CPFX have been considered. The CPFX concentration in the range of 1.0 x 10(-6)-4.0 x 10(-5) M is linear to the fluorescence intensity, F450nm. The detection limit was achieved at 4.0 x 10(-7) M CPFX. The CPFX in real samples was determined with satisfactory results.

  10. Hyperthermal (1-100 eV) nitrogen ion scattering damage to D-ribose and 2-deoxy-D-ribose films

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Deng Zongwu; Bald, Ilko; Illenberger, Eugen

    2007-10-14

    Highly charged heavy ion traversal of a biological medium can produce energetic secondary fragment ions. These fragment ions can in turn cause collisional and reactive scattering damage to DNA. Here we report hyperthermal (1-100 eV) scattering of one such fragment ion (N{sup +}) from biologically relevant sugar molecules D-ribose and 2-deoxy-D-ribose condensed on polycrystalline Pt substrate. The results indicate that N{sup +} ion scattering at kinetic energies down to 10 eV induces effective decomposition of both sugar molecules and leads to the desorption of abundant cation and anion fragments. Use of isotope-labeled molecules (5-{sup 13}C D-ribose and 1-D D-ribose) partlymore » reveals some site specificity of the fragment origin. Several scattering reactions are also observed. Both ionic and neutral nitrogen atoms abstract carbon from the molecules to form CN{sup -} anion at energies down to {approx}5 eV. N{sup +} ions also abstract hydrogen from hydroxyl groups of the molecules to form NH{sup -} and NH{sub 2}{sup -} anions. A fraction of O/O{sup -} fragments abstract hydrogen to form OH{sup -}. The formation of H{sub 3}O{sup +} ions also involves hydrogen abstraction as well as intramolecular proton transfer. These findings suggest a variety of severe damaging pathways to DNA molecules which occur on the picosecond time scale following heavy ion irradiation of a cell, and prior to the late diffusion-limited homogeneous chemical processes.« less

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Richard, P.

    The study of inelastic collision phenomena with highly charged projectile ions and the interpretation of spectral features resulting from these collisions remain as the major focal points in the atomic physics research at the J.R. Macdonald Laboratory, Kansas State University, Manhattan, Kansas. The title of the research project, ``Atomic Physics with Highly Charged Ions,`` speaks to these points. The experimental work in the past few years has divided into collisions at high velocity using the primary beams from the tandem and LINAC accelerators and collisions at low velocity using the CRYEBIS facility. Theoretical calculations have been performed to accurately describemore » inelastic scattering processes of the one-electron and many-electron type, and to accurately predict atomic transition energies and intensities for x rays and Auger electrons. Brief research summaries are given for the following: (1) electron production in ion-atom collisions; (2) role of electron-electron interactions in two-electron processes; (3) multi-electron processes; (4) collisions with excited, aligned, Rydberg targets; (5) ion-ion collisions; (6) ion-molecule collisions; (7) ion-atom collision theory; and (8) ion-surface interactions.« less

  12. Performance of the rebuilt SUERC single-stage accelerator mass spectrometer

    NASA Astrophysics Data System (ADS)

    Shanks, Richard P.; Ascough, Philippa L.; Dougans, Andrew; Gallacher, Paul; Gulliver, Pauline; Rood, Dylan H.; Xu, Sheng; Freeman, Stewart P. H. T.

    2015-10-01

    The SUERC bipolar single-stage accelerator mass spectrometer (SSAMS) has been dismantled and rebuilt to accommodate an additional rotatable pre-accelerator electrostatic spherical analyser (ESA) and a second ion source injector. This is for the attachment of an experimental positive-ion electron cyclotron resonance (ECR) ion source in addition to a Cs-sputter source. The ESA significantly suppresses oxygen interference to radiocarbon detection, and remaining measurement interference is now thought to be from 13C injected as 13CH molecule scattering off the plates of a second original pre-detector ESA.

  13. Atomic and molecular data for spacecraft re-entry plasmas

    NASA Astrophysics Data System (ADS)

    Celiberto, R.; Armenise, I.; Cacciatore, M.; Capitelli, M.; Esposito, F.; Gamallo, P.; Janev, R. K.; Laganà, A.; Laporta, V.; Laricchiuta, A.; Lombardi, A.; Rutigliano, M.; Sayós, R.; Tennyson, J.; Wadehra, J. M.

    2016-06-01

    The modeling of atmospheric gas, interacting with the space vehicles in re-entry conditions in planetary exploration missions, requires a large set of scattering data for all those elementary processes occurring in the system. A fundamental aspect of re-entry problems is represented by the strong non-equilibrium conditions met in the atmospheric plasma close to the surface of the thermal shield, where numerous interconnected relaxation processes determine the evolution of the gaseous system towards equilibrium conditions. A central role is played by the vibrational exchanges of energy, so that collisional processes involving vibrationally excited molecules assume a particular importance. In the present paper, theoretical calculations of complete sets of vibrationally state-resolved cross sections and rate coefficients are reviewed, focusing on the relevant classes of collisional processes: resonant and non-resonant electron-impact excitation of molecules, atom-diatom and molecule-molecule collisions as well as gas-surface interaction. In particular, collisional processes involving atomic and molecular species, relevant to Earth (N2, O2, NO), Mars (CO2, CO, N2) and Jupiter (H2, He) atmospheres are considered.

  14. Theory of attosecond delays in molecular photoionization.

    PubMed

    Baykusheva, Denitsa; Wörner, Hans Jakob

    2017-03-28

    We present a theoretical formalism for the calculation of attosecond delays in molecular photoionization. It is shown how delays relevant to one-photon-ionization, also known as Eisenbud-Wigner-Smith delays, can be obtained from the complex dipole matrix elements provided by molecular quantum scattering theory. These results are used to derive formulae for the delays measured by two-photon attosecond interferometry based on an attosecond pulse train and a dressing femtosecond infrared pulse. These effective delays are first expressed in the molecular frame where maximal information about the molecular photoionization dynamics is available. The effects of averaging over the emission direction of the electron and the molecular orientation are introduced analytically. We illustrate this general formalism for the case of two polyatomic molecules. N 2 O serves as an example of a polar linear molecule characterized by complex photoionization dynamics resulting from the presence of molecular shape resonances. H 2 O illustrates the case of a non-linear molecule with comparably simple photoionization dynamics resulting from a flat continuum. Our theory establishes the foundation for interpreting measurements of the photoionization dynamics of all molecules by attosecond metrology.

  15. m-Cresol purple functionalized surface enhanced Raman scattering paper chips for highly sensitive detection of pH in the neutral pH range.

    PubMed

    Zou, Xinxin; Wang, Yunqing; Liu, Wanhui; Chen, Lingxin

    2017-06-26

    Herein, a pH sensitive paper SERS chip was prepared by selecting m-cresol purple, a molecule with halochromic properties in the neutral pH range as a Raman reporter. The adsorbed m-cresol purple underwent a reversible change in its electronic configuration from a non-resonant species to a resonant species, which resulted in a significant Raman signal intensity variation due to the transformation of the sensing mode from SERS to surface-enhanced resonance Raman scattering (SERRS). The chips have a sensitive pH range of 6.0 to 8.0 and exhibited good performance for the detection of natural water samples with detection precision of approximately 0.03 pH units, suggesting great potential for environmental pH monitoring applications.

  16. Surface enhanced Raman scattering, antibacterial and antifungal active triangular gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Smitha, S. L.; Gopchandran, K. G.

    2013-02-01

    Shape controlled syntheses of gold nanoparticles have attracted a great deal of attention as their optical, electronic, magnetic and biological properties are strongly dependent on the size and shape of the particles. Here is a report on the surface enhanced Raman scattering (SERS) activity of Cinnamomum zeylanicum leaf broth reduced gold nanoparticles consisting of triangular and spherical like particles, using 2-aminothiophenol (2-ATP) and crystal violet (CV) as probe molecules. Nanoparticles prepared with a minimum leaf broth concentration, having a greater number of triangular like particles exhibit a SERS activity of the order of 107. The synthesized nanoparticles exhibit efficient antibacterial activity against the tested gram negative bacterium Escherichia coli and gram positive bacterium Staphylococcus aureus. Investigations on the antifungal activity of the synthesized nanoparticles against Aspergillus niger and Fusarium oxysporum positive is also discussed.

  17. Structural Ordering of Semiconducting Polymers and Small-Molecules for Organic Electronics

    NASA Astrophysics Data System (ADS)

    O'Hara, Kathryn Allison

    Semiconducting polymers and small-molecules can be readily incorporated into electronic devices such as organic photovoltaics (OPVs), thermoelectrics (OTEs), organic light emitting diodes (OLEDs), and organic thin film transistors (OTFTs). Organic materials offer the advantage of being processable from solution to form flexible and lightweight thin films. The molecular design, processing, and resulting thin film morphology of semiconducting polymers drastically affect the optical and electronic properties. Charge transport within films of semiconducting polymers relies on the nanoscale organization to ensure electronic coupling through overlap of molecular orbitals and to provide continuous transport pathways. While the angstrom-scale packing details can be studied using X-ray scattering methods, an understanding of the mesoscale, or the length scale over which smaller ordered regions connect, is much harder to achieve. Grain boundaries play an important role in semiconducting polymer thin films where the average grain size is much smaller than the total distance which charges must traverse in order to reach the electrodes in a device. The majority of semiconducting polymers adopt a lamellar packing structure in which the conjugated backbones align in parallel pi-stacks separated by the alkyl side-chains. Only two directions of transport are possible--along the conjugated backbone and in the pi-stacking direction. Currently, the discussion of transport between crystallites is centered around the idea of tie-chains, or "bridging" polymer chains connecting two ordered regions. However, as molecular structures become increasingly complex with the development of new donor-acceptor copolymers, additional forms of connectivity between ordered domains should be considered. High resolution transmission electron microscopy (HRTEM) is a powerful tool for directly imaging the crystalline grain boundaries in polymer and small-molecule thin films. Recently, structures comparable to quadrites were discovered in the semiconducting polymer, PSBTBT, where the angle of chain overlap could be predicted by the geometry of the backbone and alkyl side-chains. Such structures are hypothesized to improve the electronic connectivity and enable 3D transport. Now, it has been determined that another semiconducting polymer, PBDTTPD, forms cross-chain structures in thin films. PBDTTPD is a low band-gap donor-acceptor copolymer used in high efficiency OPVs. The effect of the alkyl side-chains on intercrystallite order is determined by examining three different derivatives of the PBDTTPD polymer with HRTEM. Additionally, the expansion and contraction of films during thermal annealing and slow cooling is monitored through in-situ grazing incidence wide-angle X-ray scattering (GIWAXS) measurements. Results show that minor variations in side-chain structure drive both crystallite orientation and the formation of crossed structures. Overall, these studies suggest design principles to continue to advance the field of organic electronics.

  18. Chemical waste disposal in space by plasma discharge

    NASA Technical Reports Server (NTRS)

    Baird, James K.

    1991-01-01

    An inductively coupled plasma discharge apparatus operating at 13.56 MHz and with electrical power up to 2.5 kW was constructed. The efficiency of this device to destroy various gases expected to be carried aboard the Space Station was tested. By expressing the efficiency of the device in terms of G-value (the number of molecules decomposed per 100 eV of energy absorbed), the results are compared with known efficiencies of ionizing radiation to destroy these same gases. In the case of ammonia, it was found that in the inductively coupled device, the destruction efficiency, G(-NH3) varied from 6.0 to 32.0 molecules/100 eV, depending on conditions. It was also found that capacitatively coupled discharges were less efficient in destroying NH2 than the inductively coupled discharge. In the case NH2 destruction, it was found that the G(-NH3) was a qualitative guide to the efficiencies of plasmas. The plasma device was also used to destroy nitrous oxide and methane. It is shown how the G-value for the destruction of any gas can be computed theoretically from a knowledge of the electron velocity distribution, the various electron molecule scattering cross sections, and the rate constants for the reactions of secondary species.

  19. Observation of correlated excitations in bimolecular collisions

    NASA Astrophysics Data System (ADS)

    Gao, Zhi; Karman, Tijs; Vogels, Sjoerd N.; Besemer, Matthieu; van der Avoird, Ad; Groenenboom, Gerrit C.; van de Meerakker, Sebastiaan Y. T.

    2018-02-01

    Although collisions between atoms and molecules are largely understood, collisions between two molecules have proven much harder to study. In both experiment and theory, our ability to determine quantum-state-resolved bimolecular cross-sections lags behind their atom-molecule counterparts by decades. For many bimolecular systems, even rules of thumb—much less intuitive understanding—of scattering cross sections are lacking. Here, we report the measurement of state-to-state differential cross sections on the collision of state-selected and velocity-controlled nitric oxide (NO) radicals and oxygen (O2) molecules. Using velocity map imaging of the scattered NO radicals, the full product-pair correlations of rotational excitation that occurs in both collision partners from individual encounters are revealed. The correlated cross sections show surprisingly good agreement with quantum scattering calculations using ab initio NO-O2 potential energy surfaces. The observations show that the well-known energy-gap law that governs atom-molecule collisions does not generally apply to bimolecular excitation processes, and reveal a propensity rule for the vector correlation of product angular momenta.

  20. Phase properties of elastic waves in systems constituted of adsorbed diatomic molecules on the (001) surface of a simple cubic crystal

    NASA Astrophysics Data System (ADS)

    Deymier, P. A.; Runge, K.

    2018-03-01

    A Green's function-based numerical method is developed to calculate the phase of scattered elastic waves in a harmonic model of diatomic molecules adsorbed on the (001) surface of a simple cubic crystal. The phase properties of scattered waves depend on the configuration of the molecules. The configurations of adsorbed molecules on the crystal surface such as parallel chain-like arrays coupled via kinks are used to demonstrate not only linear but also non-linear dependency of the phase on the number of kinks along the chains. Non-linear behavior arises for scattered waves with frequencies in the vicinity of a diatomic molecule resonance. In the non-linear regime, the variation in phase with the number of kinks is formulated mathematically as unitary matrix operations leading to an analogy between phase-based elastic unitary operations and quantum gates. The advantage of elastic based unitary operations is that they are easily realizable physically and measurable.

  1. Report on the 18th International Conference on X-ray and Inner-Shell Processes (X99).

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gemmell, D. S.; Physics

    2000-01-01

    The 18th conference of the series served as a forum for discussing fundamental issues in the field of x-ray and inner-shell processes and their application in various disciplines of science and technology. Special emphasis was given to the opportunities offered by modern synchrotron x-ray sources. The program included plenary talks, progress reports and poster presentations relating to new developments in the field of x-ray and inner-shell processes. The range of topics included: X-ray interactions with atoms, molecules, clusters, surfaces and solids; Decay processes for inner-shell vacancies; X-ray absorption and emission spectroscopy - Photoionization processes; Phenomena associated with highly charged ionsmore » and collisions with energetic particles; Electron-spin and -momentum spectroscopy; X-ray scattering and spectroscopy in the study of magnetic systems; Applications in materials science, biology, geosciences, and other disciplines; Elastic and inelastic x-ray scattering processes in atoms and molecules; Threshold phenomena (post-collision interaction, resonant Raman processes, etc.); Nuclear absorption and scattering of x-rays; 'Fourth-generation' x-ray sources; Processes exploiting the polarization and coherence properties of x-ray beams; Developments in experimental techniques (x-ray optics, temporal techniques, detectors); Microscopy, spectromicroscopy, and various imaging techniques; Non-linear processes and x-ray lasers; Ionization and excitation induced by charged particles and by x-rays; and Exotic atoms (including 'hollow' atoms and atoms that contain 'exotic' particles).« less

  2. Effective and absolute cross sections for low-energy (1-30 eV) electron interactions with condensed biomolecules

    NASA Astrophysics Data System (ADS)

    Zheng, Yi; Sanche, Léon

    2018-06-01

    Ionizing radiation is intensively used for therapeutic [e.g., radiotherapy, brachytherapy, and targeted radionuclide therapy (TRT)], as well as for diagnostic medical imaging purposes. In these applications, the radiation dose given to the patient should be known and controlled. In conventional cancer treatments, absorbed dose calculations rely essentially on scattering cross sections (CSs) of the primary high-energy radiation. In more sophisticated treatments, such as combined radio- and chemo-therapy, a description of the details of energy deposits at the micro- and nano-scopic level is preferred to relate dose to radiobiological effectiveness or to evaluate doses at the biomolecular level, when radiopharmaceuticals emitting short-range radiation are delivered to critical molecular components of cancer cells (e.g., TRT). These highly radiotoxic compounds emit large densities of low-energy electrons (LEEs). More generally, LEE (0-30 eV) are emitted in large numbers by any type of high-energy radiation; i.e., about 30 000 per MeV of deposited primary energy. Thus, to optimize the effectiveness of several types of radiation treatments, the energy deposited by LEEs must be known at the level of the cell, nucleus, chromosome, or DNA. Such local doses can be evaluated by Monte Carlo (MC) calculations, which account event-by-event, for the slowing down of all generations of particles. In particular, these codes require as input parameters absolute LEE CSs for elastic scattering, energy losses, and direct damage to vital cellular molecules, particularly DNA, the main target of radiation therapy. In the last decade, such CSs have emerged in the literature. Furthermore, a method was developed to transform relative yields of damages into absolute CSs by measuring specific parameters in the experiments. In this review article, we first present a general description of dose calculations in biological media via MC simulation and give an overview of the CSs available from theoretical calculations and gas-phase experiments. The properties of LEE scattering in the gas-phase are then compared to those in the condensed phase. The remaining portion of the article is devoted to condensed-phase CSs. We provide absolute LEE scattering CSs for electronic, vibrational, and phonon excitation of biomolecules as well as for dissociative electron attachment, electron intra- and inter-molecular stabilization, and bond dissociation, including strand breaks and degradation product formation. The biomolecules are O2, CO2, H2O, DNA bases, sugar and phosphate unit analogs, oligonucleotides, plasmid DNA, and the amino acid tryptophan. CSs for strand breaks in radiosensitizing and chemotherapeutic molecules bond or not to a short DNA strand are also listed. The principle of each experimental technique and mathematical methods utilized to generate all condensed-phase CSs are briefly explained. The mechanisms responsible for the magnitudes of the CSs are discussed.

  3. Research to Operations Transition of an Auroral Specification and Forecast Model

    NASA Astrophysics Data System (ADS)

    Jones, J.; Sanders, S.; Davis, B.; Hedrick, C.; Mitchell, E. J.; Cox, J. M.

    Aurorae are generally caused by collisions of high-energy precipitating electrons and neutral molecules in Earth’s polar atmosphere. The electrons, originating in Earth’s magnetosphere, collide with oxygen and nitrogen molecules driving them to an excited state. As the molecules return to their normal state, a photon is released resulting in the aurora. Aurora can become troublesome for operations of UHF and L-Band radars since these radio frequencies can be scattered by these abundant free electrons and excited molecules. The presence of aurorae under some conditions can lead to radar clutter or false targets. It is important to know the state of the aurora and when radar clutter is likely. For this reason, models of the aurora have been developed and used in an operational center for many decades. Recently, a data-driven auroral precipitation model was integrated into the DoD operational center for space weather. The auroral precipitation model is data-driven in a sense that solar wind observations from the Lagrangian point L1 are used to drive a statistical model of Earth’s aurorae to provide nowcasts and short-duration forecasts of auroral activity. The project began with a laboratory-grade prototype and an algorithm theoretical basis document, then through a tailored Agile development process, deployed operational-grade code to a DoD operational center. The Agile development process promotes adaptive planning, evolutionary development, early delivery, continuous improvement, regular collaboration with the customer, and encourages rapid and flexible response to customer-driven changes. The result was an operational capability that met customer expectations for reliability, security, and scientific accuracy. Details of the model and the process of operational integration are discussed as well as lessons learned to improve performance on future projects.

  4. Electron Scattering by biomass molecular fragments

    NASA Astrophysics Data System (ADS)

    Lima, Marco

    2015-09-01

    The replacement of fossil fuels by biofuels from renewable sources may not be a definite answer for greenhouse gas emissions problems, but it is a good step towards a sustainable energy strategy. Few per cent of ethanol is being mixed to gasoline in many countries and in some of them, like Brazil, a very aggressive program has been developed, using, in large scale, flex fuel engines that can run with any mixture of gasoline and ethanol, including 100% ethanol. Important points are how to produce ethanol in a sustainable way and with which technology? Biomass is a good candidate to enhance the first generation (produced from Corn in USA and from sugarcane in Brazil) production towards the so-called second-generation ethanol, since it has cellulose and hemicellulose as source of sugars. In order to liberate these sugars for fermentation, it is important to learn how to separate the main components. Chemical routes (acid treatment) and biological routes (enzymatic hydrolysis) are combined and used for these purposes. Atmospheric plasmas can be useful for attacking the biomass in a controlled manner and low energy electrons may have an important role in the process. Recently, we have been studying the interaction of electrons with lignin subunits (phenol, guaiacol, p-coumaryl alcohol), cellulose components, β-D-glucose and cellobiose (β(1-4) linked glucose dimer) and hemicellulose components [2] (β-D-xylose). We also obtained results for the amylose subunits α-D-glucose and maltose (α(1-4) linked glucose dimer). Altogether, the resonance spectra of lignin, cellulose and hemicellulose components establish a physical-chemical basis for electron-induced biomass pretreatment that could be applied to biofuel production. In order to describe a more realistic system (where molecules are ``wet''), we have obtained the shape resonance spectra of phenol-water clusters, as obtained previously from elastic electron scattering calculations. Our results, obtained in a simple model (phenol in the presence of one and two water molecules), indicate that the well-known indirect mechanism for hydrogen elimination in the gas phase is significantly impacted on by microsolvation, due to the competition between vibronic couplings on the solute and solvent molecules. This fact suggested how relevant the solvation effects could be for the electron-driven damage of biomolecules and the biomass delignification. We have also discussed microsolvation signatures in the differential cross sections that could help to identify the solvated complexes and access the composition of gaseous admixtures of these species. In a collaboration project involving Australia (within the Brazilian Science Without Borders program), Portugal, Spain and Brazil, we have focused on obtaining theoretical and experimental electronic excitation cross sections of phenol and furfural for 10-50 eV electron impact energies. Convergence on electronic multichannel coupling stands as the biggest challenge to obtain agreement between theory and experiments. In my presentation, I will discuss the current status of this project.

  5. Kinetics of Electrons from Plasma Discharge in a Latent Track Region Induced by Swift Heavy ION Irradiation

    NASA Astrophysics Data System (ADS)

    Minárik, Stanislav

    2015-08-01

    While passing swift heavy ion through a material structure, it produces a region of radiation affected material which is known as a "latent track". Scattering motions of electrons interacting with a swift heavy ion are dominant in the latent track region. These phenomena include the electron impurity and phonon scattering processes modified by the interaction with the ion projectile as well as the Coulomb scattering between two electrons. In this paper, we provide detailed derivation of a 3D Boltzmann scattering equation for the description of the relative scattering motion of such electrons. Phase-space distribution function for this non-equilibrioum system of scattering electrons can be found by the solution of mentioned equation.

  6. Spacecraft self-contamination due to back-scattering of outgas products

    NASA Technical Reports Server (NTRS)

    Robertson, S. J.

    1976-01-01

    The back-scattering of outgas contamination near an orbiting spacecraft due to intermolecular collisions was analyzed. Analytical tools were developed for making reasonably accurate quantitative estimates of the outgas contamination return flux, given a knowledge of the pertinent spacecraft and orbit conditions. Two basic collision mechanisms were considered: (1) collisions involving only outgas molecules (self-scattering) and (2) collisions between outgas molecules and molecules in the ambient atmosphere (ambient-scattering). For simplicity, the geometry was idealized to a uniformly outgassing sphere and to a disk oriented normal to the freestream. The method of solution involved an integration of an approximation of the Boltzmann kinetic equation known as the BGK (or Krook) model equation. Results were obtained in the form of simple equations relating outgas return flux to spacecraft and orbit parameters. Results were compared with previous analyses based on more simplistic models of the collision processes.

  7. Electron Resonance Decay into a Biological Function: Decrease in Viability of E. coli Transformed by Plasmid DNA Irradiated with 0.5-18 eV Electrons.

    PubMed

    Kouass Sahbani, S; Cloutier, P; Bass, A D; Hunting, D J; Sanche, L

    2015-10-01

    Transient negative ions (TNIs) are ubiquitous in electron-molecule scattering at low electron impact energies (0-20 eV) and are particularly effective in damaging large biomolecules. Because ionizing radiation generates mostly 0-20 eV electrons, TNIs are expected to play important roles in cell mutagenesis and death during radiotherapeutic cancer treatment, although this hypothesis has never been directly verified. Here, we measure the efficiency of transforming E. coli bacteria by inserting into the cells, pGEM-3ZfL(-) plasmid DNA that confers resistance to the antibiotic ampicillin. Before transformation, plasmids are irradiated with electrons of specific energies between 0.5 and 18 eV. The loss of transformation efficiency plotted as a function of irradiation energy reveals TNIs at 5.5 and 9.5 eV, corresponding to similar states observed in the yields of DNA double strand breaks. We show that TNIs are detectable in the electron-energy dependence of a biological process and can decrease cell viability.

  8. Study of water diffusion on single-supported bilayer lipid membranes by quasielastic neutron scattering

    NASA Astrophysics Data System (ADS)

    Bai, M.; Miskowiec, A.; Hansen, F. Y.; Taub, H.; Jenkins, T.; Tyagi, M.; Diallo, S. O.; Mamontov, E.; Herwig, K. W.; Wang, S.-K.

    2012-05-01

    High-energy-resolution quasielastic neutron scattering has been used to elucidate the diffusion of water molecules in proximity to single bilayer lipid membranes supported on a silicon substrate. By varying sample temperature, level of hydration, and deuteration, we identify three different types of diffusive water motion: bulk-like, confined, and bound. The motion of bulk-like and confined water molecules is fast compared to those bound to the lipid head groups (7-10 H2O molecules per lipid), which move on the same nanosecond time scale as H atoms within the lipid molecules.

  9. Toroidal nanotraps for cold polar molecules

    DOE PAGES

    Salhi, Marouane; Passian, Ali; Siopsis, George

    2015-09-14

    Electronic excitations in metallic nanoparticles in the optical regime that have been of great importance in surface-enhanced spectroscopy and emerging applications of molecular plasmonics, due to control and confinement of electromagnetic energy, may also be of potential to control the motion of nanoparticles and molecules. Here, we propose a concept for trapping polarizable particles and molecules using toroidal metallic nanoparticles. Specifically, gold nanorings are investigated for their scattering properties and field distribution to computationally show that the response of these optically resonant particles to incident photons permit the formation of a nanoscale trap when proper aspect ratio, photon wavelength, andmore » polarization are considered. However, interestingly the resonant plasmonic response of the nanoring is shown to be detrimental to the trap formation. The results are in good agreement with analytic calculations in the quasistatic limit within the first-order perturbation of the scalar electric potential. The possibility of extending the single nanoring trapping properties to two-dimensional arrays of nanorings is suggested by obtaining the field distribution of nanoring dimers and trimers.« less

  10. Nano-hybrid carboxymethyl-hexanoyl chitosan modified with (3-aminopropyl)triethoxysilane for camptothecin delivery.

    PubMed

    Hsiao, Meng-Hsuan; Tung, Tsan-Hua; Hsiao, Chi-Sheng; Liu, Dean-Mo

    2012-06-20

    Silane-modified amphiphilic chitosan was synthesized by anchoring a silane coupling agent, (3-aminopropyl)triethoxysilane, to a novel amphiphilic carboxymethyl-hexanoyl chitosan (CHC). The chemical structure of this new organic-inorganic hybrid molecule was characterized by FTIR and 13C-, 29Si-nuclear magnetic resonance, while the structural evolution was examined using scanning electron microscopy (SEM), transmission electron microscopy (TEM), X-ray diffraction (XRD), and dynamic light scattering (DLS). Experimental results indicated a self-assembly behaviour of molecules into nanoparticles with a stable polygonal geometry, consisting of ordered silane layers of 6 nm in thickness. The self-assembly property was found to be influenced by chemical composition and concentration of silane incorporated, while the size can be varied by the amount of anchored silane. It was also demonstrated that such vesicle exhibited excellent cytocompatibility and cellular internalization capability in ARPE-19 cell line, and presented well-controlled encapsulation and release profiles for (S)-(+)-camptothecin. These unique properties render it as a potential drug delivery nanosystem. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Fine-structure-resolution for Rovibrational Excitation of CN Due to H2

    NASA Astrophysics Data System (ADS)

    Byrd, Nat; Yang, Benhui H.; Stancil, Phillip C.

    2018-06-01

    Diatomic molecules can be readily excited in interstellar environments exposed to intense UV radiation, such as the inner rim of a protoplanetary disk. Non-thermal populations of excited rovibrational levels can result, for example, following decay from electronically excited states to the electronic ground state. Competition between radiative decay and collisional processes, mostly due to H2, determine the resulting rovibrational emission spectrum. For CN, and other open-shell molecules, the resulting spectrum will be complicated due to fine-structure splitting of the rotational levels. In some cases, fine-structure resolution has been previously computed for rotational transitions in atom- or diatom-diatom collisional processes. Here we present the first fine-structure resolution for vibrational deexcitation for CN colliding with H2. The collisional cross sections were computed using a 6D potential energy surface with a full close-coupling approach. Fine-structure resolution is obtained by adopting an angular momentum recoupling scheme to transform the scattering matrices to a recoupled basis. Here we present low-energy calculations for the v=1 to 0 transition.This work was supported by NASA Grant NNX16AF09G.

  12. Effect of electron-electron scattering on the conductance of a quantum wire studied with the Boltzman transport equation

    NASA Astrophysics Data System (ADS)

    Lyo, S. K.; Huang, Danhong

    2006-05-01

    Electron-electron scattering conserves total momentum and does not dissipate momentum directly in a low-density system where the umklapp process is forbidden. However, it can still affect the conductance through the energy relaxation of the electrons. We show here that this effect can be studied with arbitrary accuracy in a multisublevel one-dimensional (1D) single quantum wire system in the presence of roughness and phonon scattering using a formally exact solution of the Boltzmann transport equation. The intrasubband electron-electron scattering is found to yield no net effect on the transport of electrons in 1D with only one sublevel occupied. For a system with a multilevel occupation, however, we find a significant effect of intersublevel electron-electron scattering on the temperature and density dependence of the resistance at low temperatures.

  13. Vibrational energy distribution in aniline scattered from surfaces covered with organized organic monolayers

    NASA Astrophysics Data System (ADS)

    Paz, Y.; Naaman, R.

    1990-08-01

    Energy distribution in aniline molecules scattered from organized organic monolayers was investigated using a resonance-enhanced two-photon ionization technique. Two type of monolayers were used, one exposing a floppy unsubstituted aliphatic chain (OTS, n-octadecyltrichlorosilane), and the second having a perfluorinated tail (PFDA, perfluorodecanoic acid). The dependence of the internal and translational energy of the scattered aniline is monitored as a function of collision energy and surface properties. The data reveal an unusually high propensity for excitation of the NH 2 inversion mode in aniline. Vibrationally excited molecules are scattered with a narrower time-of-flight (TOF) distribution than those in the ground vibrational state.

  14. A comparative study between titania and zirconia as material for scattering layer in dye-sensitized solar cells

    NASA Astrophysics Data System (ADS)

    Nursam, N. M.; Hidayat, J.; Shobih; Rosa, E. S.; Pranoto, L. M.

    2018-04-01

    The photoanode of dye-sensitized solar cells (DSSC) is typically composed of nanocrystalline titania (TiO2) layer that has been sensitized with light-absorbing dye molecules. Large portion of the light, however, could not be efficiently absorbed due to some physical reasons, such as TiO2 crystal size (typically 10-25 nm) that makes the photoanode remains partially transparent to the visible region in the solar spectrum. One of the ways to improve the light harvesting efficiency in DSSC could be achieved by employing an additional scattering layer over the TiO2 electron transport material. In this contribution, we evaluate the effect of light scattering properties on the performance of DSSC. Specifically, the light scattering properties provided from two different scattering materials, i.e. additional TiO2 scattering layer and zirconia (ZrO2) scattering layer, were compared. Both layers were deposited using screen printing technique under the same condition on top of 8 µm thick TiO2 photoanode layer. All samples subsequently received the same thermal annealing treatment at 500 °C and sensitized with ruthenium-based synthetic dyes. Our results revealed that the thickness of the scattering layer for both TiO2 and ZrO2 had a significant effect on the solar cell performance. The best photoconversion efficiency was achieved by samples that were coated with one screen-printing cycle, giving an overall efficiency of 3.50 % and 4.02% for TiO2 and ZrO2, respectively.

  15. Diffuse X-ray scattering from benzil, C(14)H(10)O(2): analysis via automatic refinement of a Monte Carlo model.

    PubMed

    Welberry, T R; Goossens, D J; Edwards, A J; David, W I

    2001-01-01

    A recently developed method for fitting a Monte Carlo computer-simulation model to observed single-crystal diffuse X-ray scattering has been used to study the diffuse scattering in benzil, diphenylethanedione, C(6)H(5)-CO-CO-C(6)H(5). A model involving 13 parameters consisting of 11 intermolecular force constants, a single intramolecular torsional force constant and a local Debye-Waller factor was refined to give an agreement factor, R = [summation operator omega(Delta I)(2)/summation operator omega I(obs)(2)](1/2), of 14.5% for 101,324 data points. The model was purely thermal in nature. The analysis has shown that the diffuse lines, which feature so prominently in the observed diffraction patterns, are due to strong longitudinal displacement correlations. These are transmitted from molecule to molecule via a network of contacts involving hydrogen bonding of an O atom on one molecule and the para H atom of the phenyl ring of a neighbouring molecule. The analysis also allowed the determination of a torsional force constant for rotations about the single bonds in the molecule. This is the first diffuse scattering study in which measurement of such internal molecular torsion forces has been attempted.

  16. SLOW-NEUTRON SCATTERING BY MOLECULES OF LIQUID METHANE

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rogalska, Z.

    1962-10-01

    The total slow neutron scattering cross section of liquid methane molecules as a function of neutron energy was measured. Agreement between experimental results and the theoretical curve, calculated on the basis of the Krieger and Nelkin theory for gaseous methane, was found. The most reasonable interpretation of this agreement was attributed to the fact that there exists a free rotation of molecules in liquid methane. It might be concluded that a free rotation is maintained at the transition from gas to liquid. (auth)

  17. Understanding Molecular Conduction: Old Wine in a New Bottle?

    NASA Astrophysics Data System (ADS)

    Ghosh, Avik

    2007-03-01

    Molecules provide an opportunity to test our understanding of fundamental non-equilibrium transport processes, as well as explore new device possibilities. We have developed a unified approach to nanoscale conduction, coupling bandstructure and electrostatics of the channel and contacts with a quantum kinetic theory of current flow. This allows us to describe molecular conduction at various levels of detail, -- from quantum corrected compact models, to semi-empirical models for quick physical insights, and `first-principles' calculations of current-voltage (I-V) characteristics with no adjustable parameters. Using this suite of tools, we can quantitatively explain various experimental I-Vs, including complex reconstructed silicon substrates. We find that conduction in most molecules is contact dominated, and limited by fundamental electrostatic and thermodynamic restrictions quite analogous to those faced by the silicon industry, barring a few interesting exceptions. The distinction between molecular and silicon electronics must therefore be probed at a more fundamental level. Ultra-short molecules are unique in that they possess large Coulomb energies as well as anomalous vibronic couplings with current flow -- in other words, strong non-equilibrium electron-electron and electron-phonon correlations. These effects yield prominent experimental signatures, but require a completely different modeling approach -- in fact, popular approaches to include correlation typically do not work for non-equilibrium. Molecules exhibit rich physics, including the ability to function both as weakly interacting current conduits (quantum wires) as well as strongly correlated charge storage centers (quantum dots). Theoretical treatment of the intermediate coupling regime is particularly challenging, with a large `fine structure constant' for transport that negates orthodox theories of Coulomb Blockade and phonon-assisted tunneling. It is in this regime that the scientific and technological merits of molecular conductors may need to be explored. For instance, the tunable quantum coupling of current flow in silicon transistors with engineered molecular scatterers could lead to devices that operate on completely novel principles.

  18. Magnetic coupling of Fe-porphyrin molecules adsorbed on clean and c(2×2) oxygen-reconstructed Co(100) investigated by spin-polarized photoemission spectroscopy

    NASA Astrophysics Data System (ADS)

    Weber, A. P.; Caruso, A. N.; Vescovo, E.; Ali, Md. E.; Tarafder, K.; Janjua, S. Z.; Sadowski, J. T.; Oppeneer, P. M.

    2013-05-01

    The spin-polarized electronic structure of iron octaethylporphyrin (FeOEP) molecules adsorbed on a pristine and on a c(2×2) oxygen-reconstructed Co(100) surface has been analyzed by means of spin-polarized photoemission spectroscopy (SPPES) and first-principles density functional theory with the on-site Coulomb repulsion U term (DFT+U) calculations with and without Van der Waals corrections. The aim is to examine the magnetic exchange mechanism between the FeOEP molecules and the Co(100) substrate in the presence or absence of the oxygen mediator. The results demonstrate that the magnetic coupling from the ferromagnetic substrate to the adsorbed FeOEP molecules is ferromagnetic, whereas, the coupling is antiferromagnetic for the FeOEP on the c(2×2)O/Co(100) system. Spin-resolved partial densities of states extracted from ab initio DFT+U modeling are in fairly good comparison with the electronic spectral densities seen in angle-integrated SPPES energy dispersion curves for submonolayer coverages of FeOEP. Through combined analysis of these spectra and theoretical results, we determine that hybridization of 2p orbitals of N and O with Co 3d orbitals facilitates indirect magnetic exchange interactions between Fe and Co, whereas, a direct Fe-Co interaction involving the Fe dz2 orbital is also found for FeOEP on Co. It is observed through SPPES that the spin polarization of the photoemission-visible molecular overlayers decreases to zero as coverage is increased beyond the submonolayer regime, indicating that only interfacial magnetic coupling is at work. Microspot low-energy electron diffraction and low-energy electron microscopy were performed to characterize the physical order of the molecular coverage, revealing that FeOEP structural domains are orders of magnitude greater in size on c(2×2)O/Co(100) than on clean Co(100), which coincides with reduced scattering from the disorder and sharper features seen in SPPES.

  19. Interplay Between Electron-Electron, Electron-Impurity and Electron-Boundary Scattering in a Two Dimensional Electron Gas (2DEG)

    NASA Astrophysics Data System (ADS)

    Abraham, Mathew C.; Ram, Rajeev J.; Gossard, A. C.

    2003-03-01

    A small group of experiments have been conducted over the past decade that explore the fact that even though electron-electron (e-e) scattering in a 2DEG is momentum conserving, its interplay with electron-impurity (e-i)and electron-boundary (e-b) scattering can change the resistance of bulk and mesoscopic devices respectively. The interplay between e-e and e-i scattering in a bulk sample has been shown to cause a fall in the resistivity as a function of electron temperature in the regime where the scattering length l_ee > l_ei and a rise when l_ee < l_ei. In contrast, the interplay between e-e and e-b scattering has been demonstrated to raise the resistivity of a mesoscopic sized wire as a function of electron temperature in the regime l_ee > lb and a fall when l_ee < l_b. We attempt to present a comprehensive picture of these two apparently competing effects by studying devices that are affected by both phenomena simultaneously.

  20. Screening of charged impurities as a possible mechanism for conductance change in graphene gas sensing

    NASA Astrophysics Data System (ADS)

    Liang, Sang-Zi; Chen, Gugang; Harutyunyan, Avetik R.; Sofo, Jorge O.

    2014-09-01

    In carbon nanotube and graphene gas sensing, the measured conductance change after the sensor is exposed to target molecules has been traditionally attributed to carrier density change due to charge transfer between the sample and the adsorbed molecule. However, this explanation has many problems when it is applied to graphene: The increased amount of Coulomb impurities should lead to decrease in carrier mobility which was not observed in many experiments, carrier density is controlled by the gate voltage in the experimental setup, and there are inconsistencies in the energetics of the charge transfer. In this paper we explore an alternative mechanism. Charged functional groups and dipolar molecules on the surface of graphene may counteract the effect of charged impurities on the substrate. Because scattering of electrons with these charged impurities has been shown to be the limiting factor in graphene conductivity, this leads to significant changes in the transport behavior. A model for the conductivity is established using the random phase approximation dielectric function of graphene and the first-order Born approximation for scattering. The model predicts optimal magnitudes for the charge and dipole moment which maximally screen a given charged impurity. The dipole screening is shown to be generally weaker than the charge screening although the former becomes more effective with higher gate voltage away from the charge neutrality point. The model also predicts that with increasing amount of adsorbates, the charge impurities eventually become saturated and additional adsorption always lead to decreasing conductivity.

  1. Genuine binding energy of the hydrated electron

    PubMed Central

    Luckhaus, David; Yamamoto, Yo-ichi; Suzuki, Toshinori; Signorell, Ruth

    2017-01-01

    The unknown influence of inelastic and elastic scattering of slow electrons in water has made it difficult to clarify the role of the solvated electron in radiation chemistry and biology. We combine accurate scattering simulations with experimental photoemission spectroscopy of the hydrated electron in a liquid water microjet, with the aim of resolving ambiguities regarding the influence of electron scattering on binding energy spectra, photoelectron angular distributions, and probing depths. The scattering parameters used in the simulations are retrieved from independent photoemission experiments of water droplets. For the ground-state hydrated electron, we report genuine values devoid of scattering contributions for the vertical binding energy and the anisotropy parameter of 3.7 ± 0.1 eV and 0.6 ± 0.2, respectively. Our probing depths suggest that even vacuum ultraviolet probing is not particularly surface-selective. Our work demonstrates the importance of quantitative scattering simulations for a detailed analysis of key properties of the hydrated electron. PMID:28508051

  2. The role of polarization coulomb field scattering in the electron mobility of AlGaN/AlN/GaN heterostructure field-effect transistors

    NASA Astrophysics Data System (ADS)

    Liu, Yan; Lin, Zhaojun; Zhao, Jingtao; Yang, Ming; Shi, Wenjing; Lv, Yuanjie; Feng, Zhihong

    2016-04-01

    The electron mobility for the prepared AlGaN/AlN/GaN heterostructure field-effect transistor (HFET) with the ratio of the gate length to the drain-to-source distance being less than 1/2 has been studied by comparing the measured electron mobility with the theoretical value. The measured electron mobility is derived from the measured capacitance-voltage (C-V) and current-voltage (I-V) characteristics, and the theoretical mobility is determined by using Matthiessen's law, involving six kinds of important scattering mechanisms. For the prepared device at room temperature, longitudinal optical phonon scattering (LO scattering) was found to have a remarkable effect on the value of the electron mobility, and polarization Coulomb field scattering (PCF scattering ) was found to be important to the changing trend of the electron mobility versus the two-dimensional electron gas (2DEG) density.

  3. Naphthodipyrrolidone (NDP) based conjugated polymers with high electron mobility and ambipolar transport properties

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Haichang; Zhang, Shuo; Mao, Yifan

    Two novel donor–acceptor π-conjugated polymers based on naphthodipyrrolidone (NDP) were synthesized and characterized. The polymers possess low band gaps and suitable molecular orbital levels as ambipolar semiconductors. The thin film organic field effect transistor of NDP polymers exhibited ambipolar transport properties with a high electron mobility up to 0.67 cm 2 V –1 s –1. The grazing-incidence wide-angle X-ray scattering (GIWAXS) studies demonstrated that the polymer molecules pack into a long-range-ordered lamellar structure with isotropically oriented crystalline domains. Thermal annealing promoted edge-on lamellar stacking as evidenced by the increased diffraction intensity along the out-of-plane direction. In conclusion, the polymer withmore » NDP and bithiophene units achieved the best edge-on lamellar stacking after thermal annealing, which yielded the best electron transport performance in this work.« less

  4. Naphthodipyrrolidone (NDP) based conjugated polymers with high electron mobility and ambipolar transport properties

    DOE PAGES

    Zhang, Haichang; Zhang, Shuo; Mao, Yifan; ...

    2017-05-12

    Two novel donor–acceptor π-conjugated polymers based on naphthodipyrrolidone (NDP) were synthesized and characterized. The polymers possess low band gaps and suitable molecular orbital levels as ambipolar semiconductors. The thin film organic field effect transistor of NDP polymers exhibited ambipolar transport properties with a high electron mobility up to 0.67 cm 2 V –1 s –1. The grazing-incidence wide-angle X-ray scattering (GIWAXS) studies demonstrated that the polymer molecules pack into a long-range-ordered lamellar structure with isotropically oriented crystalline domains. Thermal annealing promoted edge-on lamellar stacking as evidenced by the increased diffraction intensity along the out-of-plane direction. In conclusion, the polymer withmore » NDP and bithiophene units achieved the best edge-on lamellar stacking after thermal annealing, which yielded the best electron transport performance in this work.« less

  5. Raman spectroscopy: Watching a molecule breathe

    NASA Astrophysics Data System (ADS)

    Piatkowski, Lukasz; Hugall, James T.; van Hulst, Niek F.

    2014-08-01

    Marrying the single-molecule detection ability of surface-enhanced Raman scattering with the extreme time resolution of ultrafast coherent spectroscopy enables the vibrations of a single molecule to be observed.

  6. Methylation effects in state resolved quenching of highly vibrationally excited azabenzenes (Evib˜38 500 cm-1). I. Collisions with water

    NASA Astrophysics Data System (ADS)

    Elioff, Michael S.; Fang, Maosen; Mullin, Amy S.

    2001-10-01

    To investigate the role of molecular structure in collisions that quench highly vibrationally excited molecules, we have performed state resolved transient infrared absorption studies of energy gain in a number of rotational levels of H2O(000) resulting from collisions of water with vibrationally excited 2-methylpyridine (2-picoline) and 2,6-dimethylpyridine (2,6-lutidine) in a low-pressure gas-phase environment at 298 K. Vibrationally excited methylpyridines were prepared with ˜38 500 cm-1 of internal energy using 266 nm ultraviolet excitation to an S1 electronic state followed by rapid radiationless decay to the S0 electronic state. Collisions that populate rotationally excited states of H2O(000) were investigated with infrared absorption by monitoring the appearance of individual rotational states of H2O(000) with energies between 1000 and 2000 cm-1. Rotational state distributions for recoiling water molecules were characterized by Boltzmann temperatures of Trot=590±90 K for quenching of hot picoline and Trot=490±80 K for lutidine quenching. Doppler-broadened transient absorption line profiles show that the scattered H2O(000) molecules have laboratory-frame translational energy distributions corresponding to Ttrans≈600 K for deactivation of picoline and Ttrans≈590 K for lutidine. Energy transfer rate constant measurements indicate that rotational excitation of H2O(000) with Evib>1000 cm-1 occurs for one in 31 picoline/water collisions and one in 17 lutidine/water collisions. Comparison with earlier quenching studies on pyrazine [M. Fraelich, M. S. Elioff, and A. S. Mullin, J. Phys. Chem. 102, 9761 (1998)] and pyridine [M. S. Elioff, M. Fraelich, R. L. Sansom, and A. S. Mullin, J. Chem. Phys. 111, 3517 (1999)] indicate that, for the same initial internal energy in the hot donor, the extent of rotational excitation in water is diminished as the number of vibrational modes in the donor increases. The energy transfer probability for this pathway exhibits opposite behavior, with the larger donor molecules being more likely to excite the high energy rotations in water. These results are interpreted using a statistical description of the high energy donors and highlight the role of low frequency vibrational modes in the vibrationally hot donor molecules. A Fermi's golden rule approach is successful at explaining differences in the observed scattering dynamics for the various donor molecules.

  7. Room scatter effects in Total Skin Electron Irradiation: Monte Carlo simulation study.

    PubMed

    Nevelsky, Alexander; Borzov, Egor; Daniel, Shahar; Bar-Deroma, Raquel

    2017-01-01

    Total Skin Electron Irradiation (TSEI) is a complex technique which usually involves the use of large electron fields and the dual-field approach. In this situation, many electrons scattered from the treatment room floor are produced. However, no investigations of the effect of scattered electrons in TSEI treatments have been reported. The purpose of this work was to study the contribution of floor scattered electrons to skin dose during TSEI treatment using Monte Carlo (MC) simulations. All MC simulations were performed with the EGSnrc code. Influence of beam energy, dual-field angle, and floor material on the contribution of floor scatter was investigated. Spectrum of the scattered electrons was calculated. Measurements of dose profile were performed in order to verify MC calculations. Floor scatter dependency on the floor material was observed (at 20 cm from the floor, scatter contribution was about 21%, 18%, 15%, and 12% for iron, concrete, PVC, and water, respectively). Although total dose profiles exhibited slight variation as functions of beam energy and dual-field angle, no dependence of the floor scatter contribution on the beam energy or dual-field angle was found. The spectrum of the scattered electrons was almost uniform between a few hundred KeV to 4 MeV, and then decreased linearly to 6 MeV. For the TSEI technique, dose contribution due to the electrons scattered from the room floor may be clinically significant and should be taken into account during design and commissioning phases. MC calculations can be used for this task. © 2017 The Authors. Journal of Applied Clinical Medical Physics published by Wiley Periodicals, Inc. on behalf of American Association of Physicists in Medicine.

  8. Electron stimulated desorption studies of the adsorption and dynamics of molecules on a copper(110) single crystal surface

    NASA Astrophysics Data System (ADS)

    Mocuta, Dan Mihai

    This thesis describes studies of angular distributions produced by the electron stimulated desorption of ions and neutrals from adsorbates on a Cu(110) surface. A new technique, time-of-flight electron stimulated desorption ion angular distribution (TOF-ESDIAD), has been developed and several studies using this method are reported. The low frequency frustrated translation mode of a model system, low coverage CO/Cu(110), is analyzed using TOF-ESDIAD. A simplified model is used to extract the energies of this mode along the two crystal azimuthal directions. A first time measurement of an anisotropy of this mode in the two directions is reported. The same frustrated translational energies giving the same anisotropy have been measured in a helium atom scattering experiment in confirmation of the ESDIAD measurements. An analysis of the TOF distributions of species desorbing from CO/Cu(110) shows that these are Maxwellian. It is shown that CO* and CO+ have similar TOF distributions, indicating a common desorption channel for both species. The ability of ESDIAD to measure chemical bond directions has been put to use in the observation of interadsorbate interactions. It is shown that at high CO coverage on the Cu(110) surface, the CO molecules agglomerate in chains and tilt away from the surface normal. The same phenomenon is observed in the case of NH3, where H+ ions produced by rupturing the N-H bonds of this molecule are imaged. The NH3 molecules can be trapped in a tilted position by cooling the copper surface using liquid helium. It is shown that such a configuration is a precursor to the upright chemisorbed configuration, in which the molecules rotate around the C3v axis. Not only can we image using the electrons, but we can produce new species by electron bombardment. The dissociation of NH3 to NH2 and H has been induced by electrons and the formation of these products is witnessed using ESDIAD. The oxygen induced reconstruction of the Cu(110) surface is studied. The formation of the characteristic striped oxide structure is witnessed using ESDIAD and new details on the interactions between the oxide ions within the stripes are revealed by the ejection directions of the O+ ions produced by electron stimulation. The interaction between the oxide structure and coadsorbed Ar and CO is also described. Aspects on the thermal activation of low frequency vibrational modes of adsorbates are addressed. The thesis concludes with a look at the possible other developments in the use of TOF-ESDIAD.

  9. Visualization of Microbial Biomarkers by Scanning Electron Microscopy

    NASA Technical Reports Server (NTRS)

    Wainwright, Norman R.; Allen, Carlton C.; Child, Alice

    2001-01-01

    We are developing tools to link the biochemical structure of selected biomarkers with putative biogenic structures observed in mineralized samples. The detection of evidence of life on Mars and other planets will rely on methods that can discriminate compounds formed exclusively by living organisms. While biogenic compounds, such as amino acids and nucleotides have been discovered in extraterrestrial sources, such as meteorites and comets, their formation can be explained by abiotic means. The formation of cellular structures, or more elaborate organic molecules, such as complex lipids, proteins or nucleic acids, however, is strongly correlated to the presence of even the most primitive life processes. Recent evidence lends support to the hypothesis that life may have once existed on Mars. Carbonate globules and ppm concentrations of polycyclic aromatic hydrocarbons (PAHs) have been described in ALH84001, a meteorite originating from Mars ejecta captured by Earth over 13,000 years ago. The localized high concentration of PAHs that follow an increasing gradient from the intact fusion crust towards the interior corresponds to microgram quantities of hydrocarbon. Even though ALH84001 and other similar meteorites have withstood the forces capable of ejecting rock through Mars' escape velocity, upon entering Earth's atmosphere, their core temperatures are likely not to have been raised significantly, as evidenced by the survival of remanent magnetic signatures. Ideal biomarkers of ancient or modern biological life would include molecules that are (or were) pervasive and highly resistant to degradation. Also, requisite methods of detection should be simple, extremely sensitive and broadly inclusive (NASA SP-530). Lipopolysaccharide (LPS), peptidoglycan or pseudopeptidoglycan and beta-glucan are microbial cell wall components which together cover the entire microbial spectrum of eubacteria, archea and fungi. They are all remarkably resistant to thermal degradation. Fortunately, many antimicrobial defense systems of higher organisms require sensitive detection to combat microbial pathogens. We employ here the primitive immune system of the evolutionarily ancient horseshoe crab, Limulus polyphemus. This species relies on multi-enzyme signal amplification detection of cell wall molecules and they can be applied to the development of useful detectors of life. An extension of this work includes the visualization of microbial signatures by labeling LAL components with chromogenic or electron dense markers. The protein Limulus Anti-LPS Factor (LALF) has an extremely high affinity for LPS. By coupling LALF binding with colloidal gold labels we demonstrate a correlation of the structures visible by electron microscopy with biochemical evidence of microbial cell wall materials. Pure silica particles were mixed with cultures of E. coli (10(exp 6) cfu/mL). Samples were washed sequentially with buffered saline, LALF, antibody to LALF and finally colloidal gold-labeled Protein A. Negative controls were not exposed to E. coli but received identical treatment otherwise. Samples were coated with carbon and imaged on a JEOL JSM-840 scanning electron microscope with LaB6 source in the back scatter mode with the JEOL annular back scatter detector. 20 nm-scale black spots in this contrast-reversed image originate from electrons back-scattered by gold atoms. Negative controls did not give any signal. Future work will expand application of this technique to soil simulants and mineralized rock samples.

  10. Scattering matrix approach to the dissociative recombination of HCO{sup +} and N{sub 2}H{sup +}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fonseca dos Santos, S.; Douguet, N.; Orel, A. E.

    We present a theoretical study of the indirect dissociative recombination of linear polyatomic ions at low collisional energies. The approach is based on the computation of the scattering matrix just above the ionization threshold and enables the explicit determination of all diabatic electronic couplings responsible for dissociative recombination. In addition, we use the multi-channel quantum-defect theory to demonstrate the precision of the scattering matrix by reproducing accurately ab initio Rydberg state energies of the neutral molecule. We consider the molecular ions N{sub 2}H{sup +} and HCO{sup +} as benchmark systems of astrophysical interest and improve former theoretical studies, which hadmore » repeatedly produced smaller cross sections than experimentally measured. Specifically, we demonstrate the crucial role of the previously overlooked stretching modes for linear polyatomic ions with large permanent dipole moment. The theoretical cross sections for both ions agree well with experimental data over a wide energy range. Finally, we consider the potential role of the HOC{sup +} isomer in the experimental cross sections of HCO{sup +} at energies below 10 meV.« less

  11. Inelastic effects in molecular transport junctions: The probe technique at high bias

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kilgour, Michael; Segal, Dvira, E-mail: dsegal@chem.utoronto.ca

    2016-03-28

    We extend the Landauer-Büttiker probe formalism for conductances to the high bias regime and study the effects of environmentally induced elastic and inelastic scattering on charge current in single molecule junctions, focusing on high-bias effects. The probe technique phenomenologically incorporates incoherent elastic and inelastic effects to the fully coherent case, mimicking a rich physical environment at trivial cost. We further identify environmentally induced mechanisms which generate an asymmetry in the current, manifested as a weak diode behavior. This rectifying behavior, found in two types of molecular junction models, is absent in the coherent-elastic limit and is only active in themore » case with incoherent-inelastic scattering. Our work illustrates that in the low bias-linear response regime, the commonly used “dephasing probe” (mimicking only elastic decoherence effects) operates nearly indistinguishably from a “voltage probe” (admitting inelastic-dissipative effects). However, these probes realize fundamentally distinct I-V characteristics at high biases, reflecting the central roles of dissipation and inelastic scattering processes on molecular electronic transport far-from-equilibrium.« less

  12. Electron collisions with phenol: Total, integral, differential, and momentum transfer cross sections and the role of multichannel coupling effects on the elastic channel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Costa, Romarly F. da; Centro de Ciências Naturais e Humanas, Universidade Federal do ABC, 09210-580 Santo André, São Paulo; Oliveira, Eliane M. de

    2015-03-14

    We report theoretical and experimental total cross sections for electron scattering by phenol (C{sub 6}H{sub 5}OH). The experimental data were obtained with an apparatus based in Madrid and the calculated cross sections with two different methodologies, the independent atom method with screening corrected additivity rule (IAM-SCAR), and the Schwinger multichannel method with pseudopotentials (SMCPP). The SMCPP method in the N{sub open}-channel coupling scheme, at the static-exchange-plus-polarization approximation, is employed to calculate the scattering amplitudes at impact energies ranging from 5.0 eV to 50 eV. We discuss the multichannel coupling effects in the calculated cross sections, in particular how the numbermore » of excited states included in the open-channel space impacts upon the convergence of the elastic cross sections at higher collision energies. The IAM-SCAR approach was also used to obtain the elastic differential cross sections (DCSs) and for correcting the experimental total cross sections for the so-called forward angle scattering effect. We found a very good agreement between our SMCPP theoretical differential, integral, and momentum transfer cross sections and experimental data for benzene (a molecule differing from phenol by replacing a hydrogen atom in benzene with a hydroxyl group). Although some discrepancies were found for lower energies, the agreement between the SMCPP data and the DCSs obtained with the IAM-SCAR method improves, as expected, as the impact energy increases. We also have a good agreement among the present SMCPP calculated total cross section (which includes elastic, 32 inelastic electronic excitation processes and ionization contributions, the latter estimated with the binary-encounter-Bethe model), the IAM-SCAR total cross section, and the experimental data when the latter is corrected for the forward angle scattering effect [Fuss et al., Phys. Rev. A 88, 042702 (2013)].« less

  13. Surface enhanced Raman scattering of aged graphene: Effects of annealing in vacuum

    NASA Astrophysics Data System (ADS)

    Wang, Yingying; Ni, Zhenhua; Li, Aizhi; Zafar, Zainab; Zhang, Yan; Ni, Zhonghua; Qu, Shiliang; Qiu, Teng; Yu, Ting; Xiang Shen, Ze

    2011-12-01

    In this paper, we report a simple method to recover the surface enhanced Raman scattering activity of aged graphene. The Raman signals of Rhodamine molecules absorbed on aged graphene are dramatically increased after vacuum annealing and comparable to those on fresh graphene. Atomic force microscopy measurements indicate that residues on aged graphene surface can efficiently be removed by vacuum annealing, which makes target molecule closely contact with graphene. We also find that the hole doping in graphene will facilitate charge transfer between graphene and molecule. These results confirm the strong Raman enhancement of target molecule absorbed on graphene is due to the charge transfer mechanism.

  14. How mobile are dye adsorbates and acetonitrile molecules on the surface of TiO2 nanoparticles? A quasi-elastic neutron scattering study

    PubMed Central

    Vaissier, Valerie; Sakai, Victoria Garcia; Li, Xiaoe; Cabral, João T.; Nelson, Jenny; Barnes, Piers R. F.

    2016-01-01

    Motions of molecules adsorbed to surfaces may control the rate of charge transport within monolayers in systems such as dye sensitized solar cells. We used quasi-elastic neutron scattering (QENS) to evaluate the possible dynamics of two small dye moieties, isonicotinic acid (INA) and bis-isonicotinic acid (BINA), attached to TiO2 nanoparticles via carboxylate groups. The scattering data indicate that moieties are immobile and do not rotate around the anchoring groups on timescales between around 10 ps and a few ns (corresponding to the instrumental range). This gives an upper limit for the rate at which conformational fluctuations can assist charge transport between anchored molecules. Our observations suggest that if the conformation of larger dye molecules varies with time, it does so on longer timescales and/or in parts of the molecule which are not directly connected to the anchoring group. The QENS measurements also indicate that several layers of acetonitrile solvent molecules are immobilized at the interface with the TiO2 on the measurement time scale, in reasonable agreement with recent classical molecular dynamics results. PMID:27991538

  15. How mobile are dye adsorbates and acetonitrile molecules on the surface of TiO2 nanoparticles? A quasi-elastic neutron scattering study

    NASA Astrophysics Data System (ADS)

    Vaissier, Valerie; Sakai, Victoria Garcia; Li, Xiaoe; Cabral, João T.; Nelson, Jenny; Barnes, Piers R. F.

    2016-12-01

    Motions of molecules adsorbed to surfaces may control the rate of charge transport within monolayers in systems such as dye sensitized solar cells. We used quasi-elastic neutron scattering (QENS) to evaluate the possible dynamics of two small dye moieties, isonicotinic acid (INA) and bis-isonicotinic acid (BINA), attached to TiO2 nanoparticles via carboxylate groups. The scattering data indicate that moieties are immobile and do not rotate around the anchoring groups on timescales between around 10 ps and a few ns (corresponding to the instrumental range). This gives an upper limit for the rate at which conformational fluctuations can assist charge transport between anchored molecules. Our observations suggest that if the conformation of larger dye molecules varies with time, it does so on longer timescales and/or in parts of the molecule which are not directly connected to the anchoring group. The QENS measurements also indicate that several layers of acetonitrile solvent molecules are immobilized at the interface with the TiO2 on the measurement time scale, in reasonable agreement with recent classical molecular dynamics results.

  16. Characterization of the water of crystallization in CsMnCl3.2H2O (2D2O) by Raman scattering

    NASA Astrophysics Data System (ADS)

    Jia, Weiyi; Strauss, E.; Yen, W. M.; Xia, Kehui; Zhao, Minguang

    1989-06-01

    Raman spectra of CsMnCl3.2H2O (2D2O) (CMC) were measured at low temperatures. The spectra demonstrated features which are related to the chain and layered structures of the compound. The vibration characteristics of the water of crystallization were investigated in detail, allowing us to derive the spatial orientation of the water molecules and the direction of their hydrogen bonds. Strong Raman scattering from the OH stretching mode in the (zz) configuration indicates the existence of hydrogen bonds linking the layers along the z axis. Various combination frequencies of the water vibrations were observed; for example, the OH (OD) stretching mode is seen to couple to vibrations of oxygen and chlorine atoms. These combination modes play an important role in quenching 4T1-->6A1 electronic transition of Mn2+ ions through multiphonon nonradiative processes.

  17. Enhancement of Raman scattering signal of a few molecules using photonic nanojet mediated SERS technique

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Das, G. M.; Parit, M. K.; Laha, R.

    2016-05-06

    Now a days, single molecule surface enhanced Raman spectroscopy (SMSERS) has become a fascinating tool for studying the structural properties, static and dynamic events of single molecules (instead of ensemble average), with the help of efficient plasmonic nanostructures. This is extremely useful in the field of proteomics because the structural properties of protein molecules are heterogeneous. Even though, SMSERS provides wealthy information about single molecules, it demands high quality surface enhanced Raman scattering (SERS) substrates. So far, a very few researchers succeeded in demonstrating the single molecule Raman scattering using conventional SERS technique. However, the experimental S/N of the Ramanmore » signal has been found to be very poor. Recently, with the help of photonic nanojet of an optical microsphere, we were able to enhance the SERS signal of a few molecules adsorbed on the SERS substrates (gold symmetric and asymmetric nanodimers and trimers dispersed on a glass slide). Herein, we report a few details about photonic nanojet mediated SERS technique, a few experimental results and a detailed theoretical study on symmetric and asymmetric nanosphere dimers to understand the dependence of localised surface plasmon resonance (LSPR) wavelength of a nanodimer on the nanogap size and polarization of the excitation light.« less

  18. Surface-enhanced Raman scattering (SERS) by molecules adsorbed at spherical particles: errata

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kerker, M.; Wang, D.S.; Chew, H.

    1980-12-15

    A model for Raman scattering by a molecule adsorbed at the surface of a spherical particle is articulated by treating the molecule as a classical electric dipole. This follows Moskovits's suggestion (J. Chem. Phys. 69, 4159 (1978)) and the experiments by Creighton et al. (J. Chem. Soc. Faraday Trans. II, 75, 790(1979)) that such a system may exhibit SERS simlar to that at roughened electrode surfaces. The molecule is stimulated by a primary field comprised of the incident and near-scattered fields. Emission consists of the dipole field plus a scattered field, each at the shifted frequency. Addition of feedback termsmore » between the dipole and the particle makes only a negligible contribution to the fields. For pyridine adsorbed at the surface of a silver sphere, the 1010 cm/sup -1/ band is enhanced by approx.10/sup 6/ if the radius is much less than the wavelengths and the excitation wavelength is approx.382 nm, a wavelength for which the relative refractive index of silver is close to m = ..sqrt..2i. Detailed results are given for the effect upon the angular distribution and the polarization of the Raman emission of particle size, distance from the surface, excitation wavelength, and location of the molecule upon the surface. These results simulate those observed at roughened silver electrodes and suggest that the mechanism of SERS at those electrodes may resemble the electromagnetic mechanism elucidated here. The authors predict that comparable effects should be observed for fluorescent scattering. 53 references, 9 figures.« less

  19. When holography meets coherent diffraction imaging.

    PubMed

    Latychevskaia, Tatiana; Longchamp, Jean-Nicolas; Fink, Hans-Werner

    2012-12-17

    The phase problem is inherent to crystallographic, astronomical and optical imaging where only the intensity of the scattered signal is detected and the phase information is lost and must somehow be recovered to reconstruct the object's structure. Modern imaging techniques at the molecular scale rely on utilizing novel coherent light sources like X-ray free electron lasers for the ultimate goal of visualizing such objects as individual biomolecules rather than crystals. Here, unlike in the case of crystals where structures can be solved by model building and phase refinement, the phase distribution of the wave scattered by an individual molecule must directly be recovered. There are two well-known solutions to the phase problem: holography and coherent diffraction imaging (CDI). Both techniques have their pros and cons. In holography, the reconstruction of the scattered complex-valued object wave is directly provided by a well-defined reference wave that must cover the entire detector area which often is an experimental challenge. CDI provides the highest possible, only wavelength limited, resolution, but the phase recovery is an iterative process which requires some pre-defined information about the object and whose outcome is not always uniquely-defined. Moreover, the diffraction patterns must be recorded under oversampling conditions, a pre-requisite to be able to solve the phase problem. Here, we report how holography and CDI can be merged into one superior technique: holographic coherent diffraction imaging (HCDI). An inline hologram can be recorded by employing a modified CDI experimental scheme. We demonstrate that the amplitude of the Fourier transform of an inline hologram is related to the complex-valued visibility, thus providing information on both, the amplitude and the phase of the scattered wave in the plane of the diffraction pattern. With the phase information available, the condition of oversampling the diffraction patterns can be relaxed, and the phase problem can be solved in a fast and unambiguous manner. We demonstrate the reconstruction of various diffraction patterns of objects recorded with visible light as well as with low-energy electrons. Although we have demonstrated our HCDI method using laser light and low-energy electrons, it can also be applied to any other coherent radiation such as X-rays or high-energy electrons.

  20. Molecular structures and intramolecular dynamics of pentahalides

    NASA Astrophysics Data System (ADS)

    Ischenko, A. A.

    2017-03-01

    This paper reviews advances of modern gas electron diffraction (GED) method combined with high-resolution spectroscopy and quantum chemical calculations in studies of the impact of intramolecular dynamics in free molecules of pentahalides. Some recently developed approaches to the electron diffraction data interpretation, based on direct incorporation of the adiabatic potential energy surface parameters to the diffraction intensity are described. In this way, complementary data of different experimental and computational methods can be directly combined for solving problems of the molecular structure and its dynamics. The possibility to evaluate some important parameters of the adiabatic potential energy surface - barriers to pseudorotation and saddle point of intermediate configuration from diffraction intensities in solving the inverse GED problem is demonstrated on several examples. With increasing accuracy of the electron diffraction intensities and the development of the theoretical background of electron scattering and data interpretation, it has become possible to investigate complex nuclear dynamics in fluxional systems by the GED method. Results of other research groups are also included in the discussion.

  1. Intensity enhancement and selective detection of proximate solvent molecules by molecular near-field effect in resonance hyper-Raman scattering

    NASA Astrophysics Data System (ADS)

    Shimada, Rintaro; Kano, Hideaki; Hamaguchi, Hiro-o.

    2008-07-01

    A new molecular phenomenon associated with resonance hyper-Raman (HR) scattering in solution has been discovered. Resonance HR spectra of all-trans-β-carotene and all-trans-lycopene in various solvents exhibited several extra bands that were not assignable to the solute but were unequivocally assigned to the solvents. Neat solvents did not show detectable HR signals under the same experimental conditions. Similar experiments with all-trans-retinal did not exhibit such enhancement either. All-trans-β-carotene and all-trans-lycopene have thus been shown to induce enhanced HR scattering of solvent molecules through a novel molecular effect that is not associated with all-trans-retinal. We call this new effect the "molecular near-field effect." In order to explain this newly found effect, an extended vibronic theory of resonance HR scattering is developed where the vibronic interaction including the proximate solvent molecule (intermolecular vibronic coupling) is explicitly introduced in the solute hyperpolarizability tensor. The potential of "molecular near-field HR spectroscopy," which selectively detects molecules existing in the close vicinity of a HR probe in complex chemical or biological systems, is discussed.

  2. Plasma characterization using ultraviolet Thomson scattering from ion-acoustic and electron plasma waves (invited).

    PubMed

    Follett, R K; Delettrez, J A; Edgell, D H; Henchen, R J; Katz, J; Myatt, J F; Froula, D H

    2016-11-01

    Collective Thomson scattering is a technique for measuring the plasma conditions in laser-plasma experiments. Simultaneous measurements of ion-acoustic and electron plasma-wave spectra were obtained using a 263.25-nm Thomson-scattering probe beam. A fully reflective collection system was used to record light scattered from electron plasma waves at electron densities greater than 10 21 cm -3 , which produced scattering peaks near 200 nm. An accurate analysis of the experimental Thomson-scattering spectra required accounting for plasma gradients, instrument sensitivity, optical effects, and background radiation. Practical techniques for including these effects when fitting Thomson-scattering spectra are presented and applied to the measured spectra to show the improvements in plasma characterization.

  3. Exploring Redox States, Doping and Ordering of Electroactive Star-Shaped Oligo(aniline)s.

    PubMed

    Mills, Benjamin M; Fey, Natalie; Marszalek, Tomasz; Pisula, Wojciech; Rannou, Patrice; Faul, Charl F J

    2016-11-14

    We have prepared a simple star-shaped oligo(aniline) (TDPB) and characterised it in detail by MALDI-TOF MS, UV/Vis/NIR spectroscopy, time-dependent DFT, cyclic voltammetry and EPR spectroscopy. TDPB is part of an underdeveloped class of π-conjugated molecules with great potential for organic electronics, display and sensor applications. It is redox active and reacts with acids to form radical cations. Acid-doped TDPB shows behaviour similar to discotic liquid crystals, with X-ray scattering investigations revealing columnar self-assembled arrays. The combination of unpaired electrons and supramolecular stacking suggests that star-shaped oligo(aniline)s like TDPB have the potential to form conducting nanowires and organic magnetic materials. © 2016 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  4. Extremely strong self-assembly of a bimetallic salen complex visualized at the single-molecule level.

    PubMed

    Salassa, Giovanni; Coenen, Michiel J J; Wezenberg, Sander J; Hendriksen, Bas L M; Speller, Sylvia; Elemans, Johannes A A W; Kleij, Arjan W

    2012-04-25

    A bis-Zn(salphen) structure shows extremely strong self-assembly both in solution as well as at the solid-liquid interface as evidenced by scanning tunneling microscopy, competitive UV-vis and fluorescence titrations, dynamic light scattering, and transmission electron microscopy. Density functional theory analysis on the Zn(2) complex rationalizes the very high stability of the self-assembled structures provoked by unusual oligomeric (Zn-O)(n) coordination motifs within the assembly. This coordination mode is strikingly different when compared with mononuclear Zn(salphen) analogues that form dimeric structures having a typical Zn(2)O(2) central unit. The high stability of the multinuclear structure therefore holds great promise for the development of stable self-assembled monolayers with potential for new opto-electronic materials.

  5. Communication: Transient anion states of phenol…(H2O)n (n = 1, 2) complexes: Search for microsolvation signatures

    NASA Astrophysics Data System (ADS)

    de Oliveira, Eliane M.; Freitas, Thiago C.; Coutinho, Kaline; do N. Varella, Márcio T.; Canuto, Sylvio; Lima, Marco A. P.; Bettega, Márcio H. F.

    2014-08-01

    We report on the shape resonance spectra of phenol-water clusters, as obtained from elastic electron scattering calculations. Our results, along with virtual orbital analysis, indicate that the well-known indirect mechanism for hydrogen elimination in the gas phase is significantly impacted on by microsolvation, due to the competition between vibronic couplings on the solute and solvent molecules. This fact suggests how relevant the solvation effects could be for the electron-driven damage of biomolecules and the biomass delignification [E. M. de Oliveira et al., Phys. Rev. A 86, 020701(R) (2012)]. We also discuss microsolvation signatures in the differential cross sections that could help to identify the solvated complexes and access the composition of gaseous admixtures of these species.

  6. Future of Electron Scattering and Diffraction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hall, Ernest; Stemmer, Susanne; Zheng, Haimei

    2014-02-25

    The ability to correlate the atomic- and nanoscale-structure of condensed matter with physical properties (e.g., mechanical, electrical, catalytic, and optical) and functionality forms the core of many disciplines. Directing and controlling materials at the quantum-, atomic-, and molecular-levels creates enormous challenges and opportunities across a wide spectrum of critical technologies, including those involving the generation and use of energy. The workshop identified next generation electron scattering and diffraction instruments that are uniquely positioned to address these grand challenges. The workshop participants identified four key areas where the next generation of such instrumentation would have major impact: A – Multidimensional Visualizationmore » of Real Materials B – Atomic-scale Molecular Processes C – Photonic Control of Emergence in Quantum Materials D – Evolving Interfaces, Nucleation, and Mass Transport Real materials are comprised of complex three-dimensional arrangements of atoms and defects that directly determine their potential for energy applications. Understanding real materials requires new capabilities for three-dimensional atomic scale tomography and spectroscopy of atomic and electronic structures with unprecedented sensitivity, and with simultaneous spatial and energy resolution. Many molecules are able to selectively and efficiently convert sunlight into other forms of energy, like heat and electric current, or store it in altered chemical bonds. Understanding and controlling such process at the atomic scale require unprecedented time resolution. One of the grand challenges in condensed matter physics is to understand, and ultimately control, emergent phenomena in novel quantum materials that necessitate developing a new generation of instruments that probe the interplay among spin, charge, orbital, and lattice degrees of freedom with intrinsic time- and length-scale resolutions. Molecules and soft matter require imaging and spectroscopy with high spatial resolution without damaging their structure. The strong interaction of electrons with matter allows high-energy electron pulses to gather structural information before a sample is damaged. Electron ScatteringImaging, diffraction, and spectroscopy are the fundamental capabilities of electron-scattering instruments. The DOE BES-funded TEAM (Transmission Electron Aberration-corrected Microscope) project achieved unprecedented sub-atomic spatial resolution in imaging through aberration-corrected transmission electron microscopy. To further advance electron scattering techniques that directly enable groundbreaking science, instrumentation must advance beyond traditional two-dimensional imaging. Advances in temporal resolution, recording the full phase and energy spaces, and improved spatial resolution constitute a new frontier in electron microscopy, and will directly address the BES Grand Challenges, such as to “control the emergent properties that arise from the complex correlations of atomic and electronic constituents” and the “hidden states” “very far away from equilibrium”. Ultrafast methods, such as the pump-probe approach, enable pathways toward understanding, and ultimately controlling, the chemical dynamics of molecular systems and the evolution of complexity in mesoscale and nanoscale systems. Central to understanding how to synthesize and exploit functional materials is having the ability to apply external stimuli (such as heat, light, a reactive flux, and an electrical bias) and to observe the resulting dynamic process in situ and in operando, and under the appropriate environment (e.g., not limited to UHV conditions). To enable revolutionary advances in electron scattering and science, the participants of the workshop recommended three major new instrumental developments: A. Atomic-Resolution Multi-Dimensional Transmission Electron Microscope: This instrument would provide quantitative information over the entire real space, momentum space, and energy space for visualizing dopants, interstitials, and light elements; for imaging localized vibrational modes and the motion of charged particles and vacancies; for correlating lattice, spin, orbital, and charge; and for determining the structure and molecular chemistry of organic and soft matter. The instrument will be uniquely suited to answer fundamental questions in condensed matter physics that require understanding the physical and electronic structure at the atomic scale. Key developments include stable cryogenic capabilities that will allow access to emergent electronic phases, as well as hard/soft interfaces and radiation- sensitive materials. B. Ultrafast Electron Diffraction and Microscopy Instrument: This instrument would be capable of nano-diffraction with 10 fs temporal resolution in stroboscopic mode, and better than 100 fs temporal resolution in single shot mode. The instrument would also achieve single- shot real-space imaging with a spatial/temporal resolution of 10 nm/10 ps, representing a thousand fold improvement over current microscopes. Such a capability would be complementary to x-ray free electron lasers due to the difference in the nature of electron and x-ray scattering, enabling space-time mapping of lattice vibrations and energy transport, facilitating the understanding of molecular dynamics of chemical reactions, the photonic control of emergence in quantum materials, and the dynamics of mesoscopic materials. C. Lab-In-Gap Dynamic Microscope: This instrument would enable quantitative measurements of materials structure, composition, and bonding evolution in technologically relevant environments, including liquids, gases and plasmas, thereby assuring the understanding of structure function relationship at the atomic scale with up to nanosecond temporal resolution. This instrument would employ a versatile, modular sample stage and holder geometry to allow the multi-modal (e.g., optical, thermal, mechanical, electrical, and electrochemical) probing of materials’ functionality in situ and in operando. The electron optics encompasses a pole piece that can accommodate the new stage, differential pumping, detectors, aberration correctors, and other electron optical elements for measurement of materials dynamics. To realize the proposed instruments in a timely fashion, BES should aggressively support research and development of complementary and enabling instruments, including new electron sources, advanced electron optics, new tunable specimen pumps and sample stages, and new detectors. The proposed instruments would have transformative impact on physics, chemistry, materials science, engineering« less

  7. Efficient implementation of core-excitation Bethe-Salpeter equation calculations

    NASA Astrophysics Data System (ADS)

    Gilmore, K.; Vinson, John; Shirley, E. L.; Prendergast, D.; Pemmaraju, C. D.; Kas, J. J.; Vila, F. D.; Rehr, J. J.

    2015-12-01

    We present an efficient implementation of the Bethe-Salpeter equation (BSE) method for obtaining core-level spectra including X-ray absorption (XAS), X-ray emission (XES), and both resonant and non-resonant inelastic X-ray scattering spectra (N/RIXS). Calculations are based on density functional theory (DFT) electronic structures generated either by ABINIT or QuantumESPRESSO, both plane-wave basis, pseudopotential codes. This electronic structure is improved through the inclusion of a GW self energy. The projector augmented wave technique is used to evaluate transition matrix elements between core-level and band states. Final two-particle scattering states are obtained with the NIST core-level BSE solver (NBSE). We have previously reported this implementation, which we refer to as OCEAN (Obtaining Core Excitations from Ab initio electronic structure and NBSE) (Vinson et al., 2011). Here, we present additional efficiencies that enable us to evaluate spectra for systems ten times larger than previously possible; containing up to a few thousand electrons. These improvements include the implementation of optimal basis functions that reduce the cost of the initial DFT calculations, more complete parallelization of the screening calculation and of the action of the BSE Hamiltonian, and various memory reductions. Scaling is demonstrated on supercells of SrTiO3 and example spectra for the organic light emitting molecule Tris-(8-hydroxyquinoline)aluminum (Alq3) are presented. The ability to perform large-scale spectral calculations is particularly advantageous for investigating dilute or non-periodic systems such as doped materials, amorphous systems, or complex nano-structures.

  8. Electron-exchange and quantum screening effects on the Thomson scattering process in quantum Fermi plasmas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Gyeong Won; Jung, Young-Dae; Department of Physics, Applied Physics, and Astronomy, Rensselaer Polytechnic Institute, 110 Eighth Street, Troy, New York 12180-3590

    2013-06-15

    The influence of the electron-exchange and quantum screening on the Thomson scattering process is investigated in degenerate quantum Fermi plasmas. The Thomson scattering cross section in quantum plasmas is obtained by the plasma dielectric function and fluctuation-dissipation theorem as a function of the electron-exchange parameter, Fermi energy, plasmon energy, and wave number. It is shown that the electron-exchange effect enhances the Thomson scattering cross section in quantum plasmas. It is also shown that the differential Thomson scattering cross section has a minimum at the scattering angle Θ=π/2. It is also found that the Thomson scattering cross section increases with anmore » increase of the Fermi energy. In addition, the Thomson scattering cross section is found to be decreased with increasing plasmon energy.« less

  9. Electron density inversed by plasma lines induced by suprathermal electron in the ionospheric modification experiment

    NASA Astrophysics Data System (ADS)

    Wang, Xiang; Zhou, Chen

    2018-05-01

    Incoherent scatter radar (ISR) is the most powerful ground-based measurement facility to study the ionosphere. The plasma lines are not routinely detected by the incoherent scatter radar due to the low intensity, which falls below the measured spectral noise level of the incoherent scatter radar. The plasma lines are occasionally enhanced by suprathermal electrons through the Landau damping process and detectable to the incoherent scatter radar. In this study, by using the European Incoherent Scatter Association (EISCAT) UHF incoherent scatter radar, the experiment observation presents that the enhanced plasma lines were observed. These plasma lines were considered as manifest of the suprathermal electrons generated by the high-frequency heating wave during the ionospheric modification. The electron density profile is also obtained from the enhanced plasma lines. This study can be a promising technique for obtaining the accurate electron density during ionospheric modification experiment.

  10. Derivation of the chemical-equilibrium rate coefficient using scattering theory

    NASA Technical Reports Server (NTRS)

    Mickens, R. E.

    1977-01-01

    Scattering theory is applied to derive the equilibrium rate coefficient for a general homogeneous chemical reaction involving ideal gases. The reaction rate is expressed in terms of the product of a number of normalized momentum distribution functions, the product of the number of molecules with a given internal energy state, and the spin-averaged T-matrix elements. An expression for momentum distribution at equilibrium for an arbitrary molecule is presented, and the number of molecules with a given internal-energy state is represented by an expression which includes the partition function.

  11. Diagnostics of Unseeded Air and Nitrogen Flows by Molecular Tagging

    DTIC Science & Technology

    2015-07-21

    the polarization components across the FLEET line and the computed molecular density and dissociation fraction. Rayleigh Scattering Polarimetry V...Pol H Pol BPF HP CCM FLEET Emission Imaging Planar Rayleigh Scattering Rayleigh Scattering Polarimetry Density of molecules (normalized...the flow transport properties. This has been studied using Rayleigh scattering and Rayleigh scattering polarimetry . Figure 8 shows the evolution of

  12. Monte Carlo calculation of large and small-angle electron scattering in air

    NASA Astrophysics Data System (ADS)

    Cohen, B. I.; Higginson, D. P.; Eng, C. D.; Farmer, W. A.; Friedman, A.; Grote, D. P.; Larson, D. J.

    2017-11-01

    A Monte Carlo method for angle scattering of electrons in air that accommodates the small-angle multiple scattering and larger-angle single scattering limits is introduced. The algorithm is designed for use in a particle-in-cell simulation of electron transport and electromagnetic wave effects in air. The method is illustrated in example calculations.

  13. Ferric ion-assisted in situ synthesis of silver nanoplates on polydopamine-coated silk.

    PubMed

    Xiao, Jing; Zhang, Huihui; Mao, Cuiping; Wang, Ying; Wang, Ling; Lu, Zhisong

    2016-10-01

    In the present study, a ferric ion (Fe(3+))-assisted in situ synthesis approach was developed to grow silver (Ag) nanoplates on the polydopamine (PDA)-coated silk without the use of additional reductants. The essential role of Fe(3+) in the formation of Ag nanoplates is revealed by comparing the morphologies of Ag nanostructures prepared on the silk-coated PDA film with/without Fe(3+) doping. Scanning electron micrographs show that high-density Ag nanoplates could be synthesized in the reaction system containing 50μg/mL FeCl3 and 50mM AgNO3. The size of the Ag nanoplate could be tuned by adjusting the reaction duration. Based on the data, a mechanism involving the Fe(3+)-selected growth of Ag atoms along the certain crystal faces was proposed to explain the fabrication process. Transmission electron microscopy and X-ray diffractometry indicate that the Ag nanoplates possess good crystalline structures. Raman spectra demonstrate that the nanoplates could strongly enhance the Raman scattering of the PDA molecules. The Ag nanoplate-coated silk could be utilized as a flexible substrate for the development of surface-enhanced Raman scattering biosensors. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Ultralong-range Rydberg Molecules: Investigation of a Novel Binding Mechanism

    NASA Astrophysics Data System (ADS)

    Butscher, Björn; Bendkowsky, Vera; Nipper, Johannes; Balewski, Jonathan; Shaffer, James P.; Löw, Robert; Pfau, Tilman

    2010-03-01

    For highly excited Rydberg atoms, the scattering of the Rydberg electron from a nearby polarizable ground state atom can generate an attractive mean-field potential which is able to bind the ground state atom to the Rydberg atom within the Rydberg electron wave function at binding energies ranging from a few MHz to hundreds of MHz[1]. We present spectroscopic data on the observation of various bound states including the vibrational ground and excited states of rubidium dimers Rb(5S)-Rb(nS) as well as those of trimer states. Furthermore, we show calculations that reproduce the observed binding energies remarkably well and reveal that some of the excited states are purely bound by quantum reflection at a shape resonance for p-wave scattering [2]. To further characterize the coherent excitation of the molecular states, we performed echo experiments. [0pt] [1] V. Bendkowsky, B. Butscher, J. Nipper, J. P. Shaffer, R. Löw, T. Pfau, Nature 458, 1005 (2009); [2] V. Bendkowsky, B. Butscher, J. Nipper, J. Balewski, J. P. Shaffer, R. Löw, T. Pfau, W. Li, J. Stanojevic, T. Pohl,and J. M. Rost, arXiv:0912.4058 (2009)

  15. Probing periodic potential of crystals via strong-field re-scattering

    NASA Astrophysics Data System (ADS)

    You, Yong Sing; Cunningham, Eric; Reis, David A.; Ghimire, Shambhu

    2018-06-01

    Strong-field ionization and re-scattering phenomena have been used to image angstrom-scale structures of isolated molecules in the gas phase. These methods typically make use of the anisotropic response of the participating molecular orbital. Recently, an anisotropic strong-field response has also been observed in high-order harmonic generation (HHG) from bulk crystals (2016 Nat. Phys. 13 345). In a (100) cut magnesium oxide crystal, extreme ultraviolet high-harmonics are found to depend strongly on the crystal structure and inter-atomic bonding. Here, we extend these measurements to other two important crystal orientations: (111) and (110). We find that HHG from these orientations is also strongly anisotropic. The underlying dynamics is understood using a real-space picture, where high-harmonics are produced via coherent collision of strong-field driven electrons from the atomic sites, including from the nearest neighbor atoms. We find that harmonic efficiency is enhanced when semi-classical electron trajectories connect to the concentrated valence charge distribution regions around the atomic cores. Similarly, the efficiency is suppressed when the trajectories miss the atomic cores. These results further support the real-space picture of HHG with implications for retrieving the periodic potential of the crystal, if not the wavefunctions in three-dimensions.

  16. Spectroscopic studies of conformational changes of β-lactoglobulin adsorbed on gold nanoparticle surfaces.

    PubMed

    Winuprasith, Thunnalin; Suphantharika, Manop; McClements, David Julian; He, Lili

    2014-02-15

    In this work, we investigated the conformational changes of a globular protein (β-lactoglobulin, β-lg) coated on the surface of 200 nm gold nanoparticles (GNPs) using a number of analytical techniques: dynamic light scattering (DLS); particle electrophoresis (ζ-potential); localized surface plasmon resonance (LSPR) spectroscopy; transmission electron microscopy (TEM); and surface-enhanced Raman scattering (SERS). The β-lg (pH 3) concentration had a pronounced effect on the aggregation and surface charge of β-lg-coated GNPs. The surface charge of GNPs changed from negative to positive as increasing amounts of β-lg molecule were added, indicating that the globular protein molecules adsorbed to the surfaces of the particles. Extensive particle aggregation occurred when β-lg did not saturate the GNP surfaces, which was attributed to electrostatic bridging flocculation. Modifications in LSPR and SERS spectra after addition of β-lg to the GNP suspensions supported the adsorption of β-lg to the particle surfaces. Moreover, SERS highlighted the importance of a number of specific molecular groups in the binding interaction, and suggested conformational changes of the globular protein after adsorption. This research provides useful information for characterizing and understanding the interactions between globular proteins and colloidal particles. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Using support vector machines to improve elemental ion identification in macromolecular crystal structures

    DOE PAGES

    Morshed, Nader; Echols, Nathaniel; Adams, Paul D.

    2015-04-25

    In the process of macromolecular model building, crystallographers must examine electron density for isolated atoms and differentiate sites containing structured solvent molecules from those containing elemental ions. This task requires specific knowledge of metal-binding chemistry and scattering properties and is prone to error. A method has previously been described to identify ions based on manually chosen criteria for a number of elements. Here, the use of support vector machines (SVMs) to automatically classify isolated atoms as either solvent or one of various ions is described. Two data sets of protein crystal structures, one containing manually curated structures deposited with anomalousmore » diffraction data and another with automatically filtered, high-resolution structures, were constructed. On the manually curated data set, an SVM classifier was able to distinguish calcium from manganese, zinc, iron and nickel, as well as all five of these ions from water molecules, with a high degree of accuracy. Additionally, SVMs trained on the automatically curated set of high-resolution structures were able to successfully classify most common elemental ions in an independent validation test set. This method is readily extensible to other elemental ions and can also be used in conjunction with previous methods based on a priori expectations of the chemical environment and X-ray scattering.« less

  18. Extension of nano-scaled exploration into solution/liquid systems using tip-enhanced Raman scattering

    NASA Astrophysics Data System (ADS)

    Pienpinijtham, Prompong; Vantasin, Sanpon; Kitahama, Yasutaka; Ekgasit, Sanong; Ozaki, Yukihiro

    2017-08-01

    This review shows updated experimental cases of tip-enhanced Raman scattering (TERS) operated in solution/liquid systems. TERS in solution/liquid is still infancy, but very essential and challenging because crucial and complicated biological processes such as photosynthesis, biological electron transfer, and cellular respiration take place and undergo in water, electrolytes, or buffers. The measurements of dry samples do not reflect real activities in those kinds of systems. To deeply understand them, TERS in solution/liquid is needed to be developed. The first TERS experiment in solution/liquid is successfully performed in 2009. After that time, TERS in solution/liquid has gradually been developed. It shows a potential to study structural changes of biomembranes, opening the world of dynamic living cells. TERS is combined with electrochemical techniques, establishing electrochemical TERS (EC-TERS) in 2015. EC-TERS creates an interesting path to fulfil the knowledge about electrochemical-related reactions or processes. TERS tip can be functionalized with sensitive molecules to act as a "surface-enhanced Raman scattering (SERS) at tip" for investigating distinct properties of systems in solution/liquid e.g., pH and electron transfer mechanism. TERS setup is continuously under developing. Versatile geometry of the setup and a guideline of a systematic implementation for a setup of TERS in solution/liquid are proposed. New style of setup is also reported for TERS imaging in solution/liquid. From all of these, TERS in solution/liquid will expand a nano-scaled exploration into solution/liquid systems of various fields e.g., energy storages, catalysts, electronic devices, medicines, alternative energy sources, and build a next step of nanoscience and nanotechnology.

  19. Spectrum bandwidth narrowing of Thomson scattering X-rays with energy chirped electron beams from laser wakefield acceleration

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Tong; Chen, Min, E-mail: minchen@sjtu.edu.cn; Li, Fei-Yu

    2014-01-06

    We study incoherent Thomson scattering between an ultrashort laser pulse and an electron beam accelerated from a laser wakefield. The energy chirp effects of the accelerated electron beam on the final radiation spectrum bandwidth are investigated. It is found that the scattered X-ray radiation has the minimum spectrum width and highest intensity as electrons are accelerated up to around the dephasing point. Furthermore, it is proposed that the electron acceleration process inside the wakefield can be studied by use of 90° Thomson scattering. The dephasing position and beam energy chirp can be deduced from the intensity and bandwidth of themore » scattered radiation.« less

  20. Star-Shaped Conjugated Molecules with Oxa- or Thiadiazole Bithiophene Side Arms.

    PubMed

    Kotwica, Kamil; Kostyuchenko, Anastasia S; Data, Przemyslaw; Marszalek, Tomasz; Skorka, Lukasz; Jaroch, Tomasz; Kacka, Sylwia; Zagorska, Malgorzata; Nowakowski, Robert; Monkman, Andrew P; Fisyuk, Alexander S; Pisula, Wojciech; Pron, Adam

    2016-08-08

    Star-shaped conjugated molecules, consisting of a benzene central unit symmetrically trisubstituted with either oxa- or thiadiazole bithiophene groups, were synthesized as promising molecules and building blocks for application in (opto)electronics and electrochromic devices. Their optical (Eg (opt)) as well as electrochemical (Eg (electro)) band gaps depended on the type of the side arm and the number of solubilizing alkyl substituents. Oxadiazole derivatives showed Eg (opt) slightly below 3 eV and by 0.2 eV larger than those determined for thiadiazole-based compounds. The presence of alkyl substituents in the arms additionally lowered the band gap. The obtained compounds were efficient electroluminophores in guest/host-type light-emitting diodes. They also showed a strong tendency to self-organize in monolayers deposited on graphite, as evidenced by scanning tunneling microscopy. The structural studies by X-ray scattering revealed the formation of supramolecular columnar stacks in which the molecules were organized. Differences in macroscopic alignment in the specimen indicated variations in the self-assembly mechanism between the molecules. The compounds as trifunctional monomers were electrochemically polymerized to yield the corresponding polymer network. As shown by UV/Vis-NIR spectroelectrochemical studies, these networks exhibited reversible electrochromic behavior both in the oxidation and in the reduction modes. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Plasma characterization using ultraviolet Thomson scattering from ion-acoustic and electron plasma waves (invited)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Follett, R. K., E-mail: rfollett@lle.rochester.edu; Delettrez, J. A.; Edgell, D. H.

    2016-11-15

    Collective Thomson scattering is a technique for measuring the plasma conditions in laser-plasma experiments. Simultaneous measurements of ion-acoustic and electron plasma-wave spectra were obtained using a 263.25-nm Thomson-scattering probe beam. A fully reflective collection system was used to record light scattered from electron plasma waves at electron densities greater than 10{sup 21} cm{sup −3}, which produced scattering peaks near 200 nm. An accurate analysis of the experimental Thomson-scattering spectra required accounting for plasma gradients, instrument sensitivity, optical effects, and background radiation. Practical techniques for including these effects when fitting Thomson-scattering spectra are presented and applied to the measured spectra tomore » show the improvements in plasma characterization.« less

  2. Relativistic electron scattering by magnetosonic waves: Effects of discrete wave emission and high wave amplitudes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Artemyev, A. V., E-mail: ante0226@gmail.com; Mourenas, D.; Krasnoselskikh, V. V.

    2015-06-15

    In this paper, we study relativistic electron scattering by fast magnetosonic waves. We compare results of test particle simulations and the quasi-linear theory for different spectra of waves to investigate how a fine structure of the wave emission can influence electron resonant scattering. We show that for a realistically wide distribution of wave normal angles θ (i.e., when the dispersion δθ≥0.5{sup °}), relativistic electron scattering is similar for a wide wave spectrum and for a spectrum consisting in well-separated ion cyclotron harmonics. Comparisons of test particle simulations with quasi-linear theory show that for δθ>0.5{sup °}, the quasi-linear approximation describes resonantmore » scattering correctly for a large enough plasma frequency. For a very narrow θ distribution (when δθ∼0.05{sup °}), however, the effect of a fine structure in the wave spectrum becomes important. In this case, quasi-linear theory clearly fails in describing accurately electron scattering by fast magnetosonic waves. We also study the effect of high wave amplitudes on relativistic electron scattering. For typical conditions in the earth's radiation belts, the quasi-linear approximation cannot accurately describe electron scattering for waves with averaged amplitudes >300 pT. We discuss various applications of the obtained results for modeling electron dynamics in the radiation belts and in the Earth's magnetotail.« less

  3. Peptide-based ambidextrous bifunctional gelator: applications in oil spill recovery and removal of toxic organic dyes for waste water management.

    PubMed

    Basu, Kingshuk; Nandi, Nibedita; Mondal, Biplab; Dehsorkhi, Ashkan; Hamley, Ian W; Banerjee, Arindam

    2017-12-06

    A low molecular weight peptide-based ambidextrous gelator molecule has been discovered for efficient control of water pollution. The gelator molecules can gel various organic solvents with diverse polarity, e.g. n -hexane, n -octane, petroleum ether, petrol, diesel, aromatic solvents like chlorobenzene, toluene, benzene, o -xylene and even aqueous phosphate buffer of pH 7.5. These gels have been thoroughly characterized using various techniques including field emission scanning electron microscopy, Fourier transform infrared spectroscopy, X-ray powder diffraction analysis, small angle X-ray scattering and rheological experiments. Interestingly, hydrogel obtained from the gelator molecule has been found to absorb toxic organic dyes (both cationic and anionic dyes) from dye-contaminated water. The gelator molecule can be reused for several cycles, indicating its possible future use in waste water management. Moreover, this gelator can selectively gel petrol, diesel, pump oil from an oil-water mixture in the presence of a carrier solvent, ethyl acetate, suggesting its efficient application for oil spill recovery. These results indicate that the peptide-based ambidextrous gelator produces soft materials (gels) with dual function: (i) removal of toxic organic dyes in waste water treatment and (ii) oil spill recovery.

  4. Carbon Nanotube Devices Engineered by Atomic Force Microscopy

    NASA Astrophysics Data System (ADS)

    Prisbrey, Landon

    This dissertation explores the engineering of carbon nanotube electronic devices using atomic force microscopy (AFM) based techniques. A possible application for such devices is an electronic interface with individual biological molecules. This single molecule biosensing application is explored both experimentally and with computational modeling. Scanning probe microscopy techniques, such as AFM, are ideal to study nanoscale electronics. These techniques employ a probe which is raster scanned above a sample while measuring probe-surface interactions as a function of position. In addition to topographical and electrostatic/magnetic surface characterization, the probe may also be used as a tool to manipulate and engineer at the nanoscale. Nanoelectronic devices built from carbon nanotubes exhibit many exciting properties including one-dimensional electron transport. A natural consequence of onedimensional transport is that a single perturbation along the conduction channel can have extremely large effects on the device's transport characteristics. This property may be exploited to produce electronic sensors with single-molecule resolution. Here we use AFM-based engineering to fabricate atomic-sized transistors from carbon nanotube network devices. This is done through the incorporation of point defects into the carbon nanotube sidewall using voltage pulses from an AFM probe. We find that the incorporation of an oxidative defect leads to a variety of possible electrical signatures including sudden switching events, resonant scattering, and breaking of the symmetry between electron and hole transport. We discuss the relationship between these different electronic signatures and the chemical structure/charge state of the defect. Tunneling through a defect-induced Coulomb barrier is modeled with numerical Verlet integration of Schrodinger's equation and compared with experimental results. Atomic-sized transistors are ideal for single-molecule applications due to their sensitivity to electric fields with very small detection volumes. In this work we demonstrate these devices as single-molecule sensors to detect individual N-(3-Dimethylaminopropyl)- N'-ethylcarbodiimide (EDC) molecules in an aqueous environment. An exciting application of these sensors is to study individual macromolecules participating in biological reactions, or undergoing conformational change. However, it is unknown whether the associated electrostatic signals exceed detection limits. We report calculations which reveal that enzymatic processes, such as substrate binding and internal protein dynamics, are detectable at the single-molecule level using existing atomic-sized transistors. Finally, we demonstrate the use of AFM-based engineering to control the function of nanoelectronic devices without creating a point defect in the sidewall of the nanotube. With a biased AFM probe we write charge patterns on a silicon dioxide surface in close proximity to a carbon nanotube device. The written charge induces image charges in the nearby electronics, and can modulate the Fermi level in a nanotube by +/-1 eV. We use this technique to induce a spatially controlled doping charge pattern in the conduction channel, and thereby reconfigure a field-effect transistor into a pn junction. Other simple charge patterns could be used to create other devices. The doping charge persists for days and can be erased and rewritten, offering a new tool for prototyping nanodevices and optimizing electrostatic doping profiles.

  5. A novel analytical model for scattering limited electron transport in nano-dimensional InAlAs/InGaAs heterostructure for cryogenic applications

    NASA Astrophysics Data System (ADS)

    Sharma, Neetika; Verma, Neha; Jogi, Jyotika

    2017-11-01

    This paper models the scattering limited electron transport in a nano-dimensional In0.52Al0.48As/In0.53Ga0.47As/InP heterostructure. An analytical model for temperature dependent sheet carrier concentration and carrier mobility in a two dimensional electron gas, confined in a triangular potential well has been developed. The model accounts for all the major scattering process including ionized impurity scattering and lattice scattering. Quantum mechanical variational technique is employed for studying the intrasubband scattering mechanism in the two dimensional electron gas. Results of various scattering limited structural parameters such as energy band-gap and functional parameters such as sheet carrier concentration, scattering rate and mobility are presented. The model corroborates the dominance of ionized impurity scattering mechanism at low temperatures and that of lattice scattering at high temperatures, both in turn limiting the carrier mobility. Net mobility obtained taking various scattering mechanisms into account has been found in agreement with earlier reported results, thus validating the model.

  6. Simple systematization of vibrational excitation cross-section calculations for resonant electron-molecule scattering in the boomerang and impulse models.

    PubMed

    Sarma, Manabendra; Adhikari, S; Mishra, Manoj K

    2007-01-28

    Vibrational excitation (nu(f)<--nu(i)) cross-sections sigma(nu(f)<--nu(i) )(E) in resonant e-N(2) and e-H(2) scattering are calculated from transition matrix elements T(nu(f),nu(i) )(E) obtained using Fourier transform of the cross correlation function , where psi(nu(i))(R,t) approximately =e(-iH(A(2))-(R)t/h phi(nu(i))(R) with time evolution under the influence of the resonance anionic Hamiltonian H(A(2) (-))(A(2) (-)=N(2)(-)/H(2) (-)) implemented using Lanczos and fast Fourier transforms. The target (A(2)) vibrational eigenfunctions phi(nu(i))(R) and phi(nu(f))(R) are calculated using Fourier grid Hamiltonian method applied to potential energy (PE) curves of the neutral target. Application of this simple systematization to calculate vibrational structure in e-N(2) and e-H(2) scattering cross-sections provides mechanistic insights into features underlying presence/absence of structure in e-N(2) and e-H(2) scattering cross-sections. The results obtained with approximate PE curves are in reasonable agreement with experimental/calculated cross-section profiles, and cross correlation functions provide a simple demarcation between the boomerang and impulse models.

  7. Monte Carlo calculation of large and small-angle electron scattering in air

    DOE PAGES

    Cohen, B. I.; Higginson, D. P.; Eng, C. D.; ...

    2017-08-12

    A Monte Carlo method for angle scattering of electrons in air that accommodates the small-angle multiple scattering and larger-angle single scattering limits is introduced. In this work, the algorithm is designed for use in a particle-in-cell simulation of electron transport and electromagnetic wave effects in air. The method is illustrated in example calculations.

  8. Comparative electron temperature measurements of Thomson scattering and electron cyclotron emission diagnostics in TCABR plasmas.

    PubMed

    Alonso, M P; Figueiredo, A C A; Borges, F O; Elizondo, J I; Galvão, R M O; Severo, J H F; Usuriaga, O C; Berni, L A; Machida, M

    2010-10-01

    We present the first simultaneous measurements of the Thomson scattering and electron cyclotron emission radiometer diagnostics performed at TCABR tokamak with Alfvén wave heating. The Thomson scattering diagnostic is an upgraded version of the one previously installed at the ISTTOK tokamak, while the electron cyclotron emission radiometer employs a heterodyne sweeping radiometer. For purely Ohmic discharges, the electron temperature measurements from both diagnostics are in good agreement. Additional Alfvén wave heating does not affect the capability of the Thomson scattering diagnostic to measure the instantaneous electron temperature, whereas measurements from the electron cyclotron emission radiometer become underestimates of the actual temperature values.

  9. The Radiation Belt Electron Scattering by Magnetosonic Wave: Dependence on Key Parameters

    NASA Astrophysics Data System (ADS)

    Lei, Mingda; Xie, Lun; Li, Jinxing; Pu, Zuyin; Fu, Suiyan; Ni, Binbin; Hua, Man; Chen, Lunjin; Li, Wen

    2017-12-01

    Magnetosonic (MS) waves have been found capable of creating radiation belt electron butterfly distributions in the inner magnetosphere. To investigate the physical nature of the interactions between radiation belt electrons and MS waves, and to explore a preferential condition for MS waves to scatter electrons efficiently, we performed a comprehensive parametric study of MS wave-electron interactions using test particle simulations. The diffusion coefficients simulated by varying the MS wave frequency show that the scattering effect of MS waves is frequency insensitive at low harmonics (f < 20 fcp), which has great implications on modeling the electron scattering caused by MS waves with harmonic structures. The electron scattering caused by MS waves is very sensitive to wave normal angles, and MS waves with off 90° wave normal angles scatter electrons more efficiently. By simulating the diffusion coefficients and the electron phase space density evolution at different L shells under different plasma environment circumstances, we find that MS waves can readily produce electron butterfly distributions in the inner part of the plasmasphere where the ratio of electron plasma-to-gyrofrequency (fpe/fce) is large, while they may essentially form a two-peak distribution outside the plasmapause and in the inner radiation belt where fpe/fce is small.

  10. Enhancing scattering images for orientation recovery with diffusion map

    DOE PAGES

    Winter, Martin; Saalmann, Ulf; Rost, Jan M.

    2016-02-12

    We explore the possibility for orientation recovery in single-molecule coherent diffractive imaging with diffusion map. This algorithm approximates the Laplace-Beltrami operator, which we diagonalize with a metric that corresponds to the mapping of Euler angles onto scattering images. While suitable for images of objects with specific properties we show why this approach fails for realistic molecules. Here, we introduce a modification of the form factor in the scattering images which facilitates the orientation recovery and should be suitable for all recovery algorithms based on the distance of individual images. (C) 2016 Optical Society of America

  11. Characterization of 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide ([Emim][Tf2N])∕TX-100∕cyclohexane ternary microemulsion: investigation of photoinduced electron transfer in this RTIL containing microemulsion.

    PubMed

    Sarkar, Souravi; Pramanik, Rajib; Ghatak, Chiranjib; Rao, Vishal Govind; Sarkar, Nilmoni

    2011-02-21

    In this study we have characterized a ionic liquid 1-ethyl-3-methylimidazolium bis(trifluoromethyl- sulfonyl)imide containing ternary nonaqueous microemulsion ([Emim][Tf(2)N]∕∕TX-100∕cyclo- hexane). The phase behavior and dynamic light scattering study show that the [Emim][Tf(2)N]∕TX-100∕cyclohexane three component system can form microemulsion with [Emim][Tf(2)N] as polar core at suitable condition. We have investigated photoinduced electron transfer (PET) using dimethyl aniline as electron donor and several Coumarin dyes as electron acceptor molecules at two different R values (R = [ionic liquid]∕[surfactant]) to observe how the dynamics of the PET rate is affected in this type of confined microenvironment compared to that of the PET dynamics in neat ionic liquid and other pure solvent media. The plot of observed k(q) values with the free energy change (ΔG(0)) for electron transfer reaction shows an apparent inversion in the observed rate as predicted by the Marcus theory.

  12. Bound and resonance states of the dipolar anion of hydrogen cyanide: Competition between threshold effects and rotation in an open quantum system

    DOE PAGES

    Fossez, K.; Michel, N.; Nazarewicz, W.; ...

    2015-01-12

    In this paper, bound and resonance states of the dipole-bound anion of hydrogen cyanide HCN – are studied using a nonadiabatic pseudopotential method and the Berggren expansion technique involving bound states, decaying resonant states, and nonresonant scattering continuum. We devise an algorithm to identify the resonant states in the complex energy plane. To characterize spatial distributions of electronic wave functions, we introduce the body-fixed density and use it to assign families of resonant states into collective rotational bands. We find that the nonadiabatic coupling of electronic motion to molecular rotation results in a transition from the strong-coupling to weak-coupling regime.more » In the strong-coupling limit, the electron moving in a subthreshold, spatially extended halo state follows the rotational motion of the molecule. Above the ionization threshold, the electron's motion in a resonance state becomes largely decoupled from molecular rotation. Finally, the widths of resonance-band members depend primarily on the electron orbital angular momentum.« less

  13. Raman spectroelectrochemistry of molecules within individual electromagnetic hot spots.

    PubMed

    Shegai, Timur; Vaskevich, Alexander; Rubinstein, Israel; Haran, Gilad

    2009-10-14

    The role of chemical enhancement in surface-enhanced Raman scattering (SERS) remains a contested subject. We study SERS spectra of 4-mercaptopyridine molecules excited far from the molecular resonance, which are collected from individual electromagnetic hot spots at concentrations close to the single-molecule limit. The hot spots are created by depositing Tollen's silver island films on a transparent electrode incorporated within an electrochemical cell. Analysis of the intensity of the spectra relative to those obtained from individual rhodamine 6G molecules on the same surface provides a lower limit of approximately 3 orders of magnitude for the chemical enhancement. This large enhancement is likely to be due to a charge transfer resonance involving the transfer of an electron from the metal to an adsorbed molecule. Excitation at three different wavelengths, as well as variation of electrode potential from 0 to -1.2 V, lead to significant changes in the relative intensities of bands in the spectrum. It is suggested that while the bulk of the enhancement is due to an Albrecht A-term resonance Raman effect (involving the charge transfer transition), vibronic coupling provides additional enhancement which is sensitive to electrode potential. The measurement of potential-dependent SERS spectra from individual hot spots opens the way to a thorough characterization of chemical enhancement, as well to studies of redox phenomena at the single-molecule level.

  14. Reliable structural interpretation of small-angle scattering data from bio-molecules in solution--the importance of quality control and a standard reporting framework.

    PubMed

    Jacques, David A; Guss, Jules Mitchell; Trewhella, Jill

    2012-05-17

    Small-angle scattering is becoming an increasingly popular tool for the study of bio-molecular structures in solution. The large number of publications with 3D-structural models generated from small-angle solution scattering data has led to a growing consensus for the need to establish a standard reporting framework for their publication. The International Union of Crystallography recently established a set of guidelines for the necessary information required for the publication of such structural models. Here we describe the rationale for these guidelines and the importance of standardising the way in which small-angle scattering data from bio-molecules and associated structural interpretations are reported.

  15. X-ray Raman scattering from molecules and solids in the framework of the Mahan-Nozières-De Dominicis model

    NASA Astrophysics Data System (ADS)

    Privalov, Timofei; Gel'mukhanov, Faris; Ågren, Hans

    2001-10-01

    We have developed a formulation of resonant x-ray Raman scattering of molecules and solids based on the Mahan-Nozières-De Dominicis model. A key step in the formulation is given by a reduction of the Keldysh-Dyson equations for the Green's function to a set of linear algebraic equations. This gave way for a tractable scheme that can be used to analyze the resonant x-ray scattering in the whole time domain. The formalism is used to investigate the role of core-hole relaxation, interference, band filling, detuning, and size of the scattering target. Numerical applications are performed with a one-dimensional tight-binding model.

  16. Low frequency mechanical modes of viruses with atomic detail

    NASA Astrophysics Data System (ADS)

    Dykeman, Eric; Sankey, Otto

    2008-03-01

    The low frequency mechanical modes of viruses can provide important insights into the large global motions that a virus may exhibit. Recently it has been proposed that these large global motions may be excited using impulsive stimulated Raman scattering producing permanent damage to the virus. In order to understand the coupling of external probes to the capsid, vibrational modes with atomic detail are essential. The standard approach to find the atomic modes of a molecule with N atoms requires the formation and diagonlization of a 3Nx3N matrix. As viruses have 10^5 or more atoms, the standard approach is difficult. Using ideas from electronic structure theory, we have developed a method to construct the mechanical modes of large molecules such as viruses with atomic detail. Application to viruses such as the cowpea chlorotic mottle virus, satellite tobacco necrosis virus, and M13 bacteriophage show a fairly complicated picture of the mechanical modes.

  17. Energy transfer dynamics from individual semiconductor nanoantennae to dye molecules with implication to light-harvesting nanosystems

    NASA Astrophysics Data System (ADS)

    Shan, Guangcun; Hu, Mingjun; Yan, Ze; Li, Xin; Huang, Wei

    2018-03-01

    Semiconductor nanocrystals can be used as nanoscale optical antennae to photoexcite individual dye molecules in an ensemble via energy transfer mechanism. The theoretical framework developed by Förster and others describes how electronic excitation migrates in the photosynthetic apparatus of plants, algae, and bacteria from light absorbing pigments to reaction centers where light energy is utilized for the eventual conversion into chemical energy. Herein we investigate the effect of the average donor-acceptor spacing on the time-resolved fluorescence intensity and dynamics of single donor-acceptor pairs with the dye acceptor concentration decreasing by using quantum Monte-Carlo simulation of FRET dynamics. Our results validated that the spatial disorder controlling the microscopic energy transfer rates accounts for the scatter in donor fluorescence lifetimes and intensities, which provides a new design guideline for artificial light-harvesting nanosystems.

  18. Spin doping using transition metal phthalocyanine molecules

    PubMed Central

    Atxabal, A.; Ribeiro, M.; Parui, S.; Urreta, L.; Sagasta, E.; Sun, X.; Llopis, R.; Casanova, F.; Hueso, L. E.

    2016-01-01

    Molecular spins have become key enablers for exploring magnetic interactions, quantum information processes and many-body effects in metals. Metal-organic molecules, in particular, let the spin state of the core metal ion to be modified according to its organic environment, allowing localized magnetic moments to emerge as functional entities with radically different properties from its simple atomic counterparts. Here, using and preserving the integrity of transition metal phthalocyanine high-spin complexes, we demonstrate the magnetic doping of gold thin films, effectively creating a new ground state. We demonstrate it by electrical transport measurements that are sensitive to the scattering of itinerant electrons with magnetic impurities, such as Kondo effect and weak antilocalization. Our work expands in a simple and powerful way the classes of materials that can be used as magnetic dopants, opening a new channel to couple the wide range of molecular properties with spin phenomena at a functional scale. PMID:27941810

  19. Negative ions of polyatomic molecules.

    PubMed Central

    Christophorou, L G

    1980-01-01

    In this paper general concepts relating to, and recent advances in, the study of negative ions of polyatomic molecules area discussed with emphasis on halocarbons. The topics dealt with in the paper are as follows: basic electron attachment processes, modes of electron capture by molecules, short-lived transient negative ions, dissociative electron attachment to ground-state molecules and to "hot" molecules (effects of temperature on electron attachment), parent negative ions, effect of density, nature, and state of the medium on electron attachment, electron attachment to electronically excited molecules, the binding of attached electrons to molecules ("electron affinity"), and the basic and the applied significance of negative-ion studies. PMID:7428744

  20. Laser Rayleigh and Raman Diagnostics for Small Hydrogen/oxygen Rockets

    NASA Technical Reports Server (NTRS)

    Degroot, Wilhelmus A.; Zupanc, Frank J.

    1993-01-01

    Localized velocity, temperature, and species concentration measurements in rocket flow fields are needed to evaluate predictive computational fluid dynamics (CFD) codes and identify causes of poor rocket performance. Velocity, temperature, and total number density information have been successfully extracted from spectrally resolved Rayleigh scattering in the plume of small hydrogen/oxygen rockets. Light from a narrow band laser is scattered from the moving molecules with a Doppler shifted frequency. Two components of the velocity can be extracted by observing the scattered light from two directions. Thermal broadening of the scattered light provides a measure of the temperature, while the integrated scattering intensity is proportional to the number density. Spontaneous Raman scattering has been used to measure temperature and species concentration in similar plumes. Light from a dye laser is scattered by molecules in the rocket plume. Raman spectra scattered from major species are resolved by observing the inelastically scattered light with linear array mounted to a spectrometer. Temperature and oxygen concentrations have been extracted by fitting a model function to the measured Raman spectrum. Results of measurements on small rockets mounted inside a high altitude chamber using both diagnostic techniques are reported.

  1. Low-energy elastic electron scattering from furan

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khakoo, M. A.; Muse, J.; Ralphs, K.

    We report normalized experimental and theoretical differential cross sections for elastic electron scattering by C{sub 4}H{sub 4}O (furan) molecules from a collaborative project between several Brazilian theoretical groups and an experimental group at California State Fullerton, USA. The measurements are obtained by using the relative flow method with helium as the standard gas and a thin aperture target gas collimating source. The relative flow method is applied without the restriction imposed by the relative flow pressure condition on helium and the unknown gas. The experimental data were taken at incident electron energies of 1, 1.5, 1.73, 2, 2.7, 3, 5,more » 7, 10, 20, 30, and 50 eV and covered the angular range between 10 deg. and 130 deg. The measurements verify observed {pi}* shape resonances at 1.65{+-}0.05eV and 3.10{+-}0.05 eV scattering energies, in good agreement with the transmission electron data of Modelli and Burrow [J. Phys. Chem. A 108, 5721 (2004)]. Furthermore, the present results also indicated both resonances dominantly in the d-wave channel. The differential cross sections are integrated in the standard way to obtain integral elastic cross sections and momentum transfer cross sections. The calculations employed the Schwinger multichannel method with pseudopotentials and were performed in the static-exchange and in the static-exchange plus polarization approximations. The calculated integral and momentum transfer cross sections clearly revealed the presence of two shape resonances located at 1.95 and 3.56 eV and ascribed to the B{sub 1} and A{sub 2} symmetries of the C{sub 2v} point group, respectively, in very good agreement with the experimental findings. Overall agreement between theory and experiment regarding the differential, momentum transfer, and integral cross sections is very good, especially for energies below 10 eV.« less

  2. Low-energy elastic electron scattering from furan

    NASA Astrophysics Data System (ADS)

    Khakoo, M. A.; Muse, J.; Ralphs, K.; da Costa, R. F.; Bettega, M. H. F.; Lima, M. A. P.

    2010-06-01

    We report normalized experimental and theoretical differential cross sections for elastic electron scattering by C4H4O (furan) molecules from a collaborative project between several Brazilian theoretical groups and an experimental group at California State Fullerton, USA. The measurements are obtained by using the relative flow method with helium as the standard gas and a thin aperture target gas collimating source. The relative flow method is applied without the restriction imposed by the relative flow pressure condition on helium and the unknown gas. The experimental data were taken at incident electron energies of 1, 1.5, 1.73, 2, 2.7, 3, 5, 7, 10, 20, 30, and 50 eV and covered the angular range between 10° and 130°. The measurements verify observed π* shape resonances at 1.65±0.05eV and 3.10±0.05 eV scattering energies, in good agreement with the transmission electron data of Modelli and Burrow [J. Phys. Chem. AJPCAFH 1089-563910.1021/jp048759a 108, 5721 (2004)]. Furthermore, the present results also indicated both resonances dominantly in the d-wave channel. The differential cross sections are integrated in the standard way to obtain integral elastic cross sections and momentum transfer cross sections. The calculations employed the Schwinger multichannel method with pseudopotentials and were performed in the static-exchange and in the static-exchange plus polarization approximations. The calculated integral and momentum transfer cross sections clearly revealed the presence of two shape resonances located at 1.95 and 3.56 eV and ascribed to the B1 and A2 symmetries of the C2v point group, respectively, in very good agreement with the experimental findings. Overall agreement between theory and experiment regarding the differential, momentum transfer, and integral cross sections is very good, especially for energies below 10 eV.

  3. Precision calculation of the lowest 1S resonance in e-H scattering. [electron-hydrogen scattering

    NASA Technical Reports Server (NTRS)

    Ho, Y. K.; Bhatia, A. K.; Temkin, A.

    1977-01-01

    The position and width of the lowest resonance in electron-hydrogen scattering have been calculated using a Hylleraas correlation function with up to 95 terms in the optical potential formalism. The results should be useful as calibration points for experimental electron scattering purposes. A formula relating the conventional (Breit-Wigner) width with the Feschbach formalism is derived.

  4. Investigation of superelastic electron scattering by laser-excited Ba - Experimental procedures and results

    NASA Technical Reports Server (NTRS)

    Register, D. F.; Trajmar, S.; Fineman, M. A.; Poe, R. T.; Csanak, G.; Jensen, S. W.

    1983-01-01

    Differential (in angle) electron scattering experiments on laser-excited Ba-138 1P were carried out at 30- and 100-eV impact energies. The laser light was linearly polarized and located in the scattering plane. The superelastic scattering signal was measured as a function of polarization direction of the laser light with respect to the scattering plane. It was found at low electron scattering angles that the superelastic scattering signal was asymmetric to reflection of the polarization vector with respect to the scattering plane. This is in contradiction with theoretical predictions. An attempt was made to pinpoint the reason for this observation, and a detailed investigation of the influence of experimental conditions on the superelastic scattering was undertaken. No explanation for the asymmetry has as yet been found.

  5. Biosensing via light scattering from plasmonic core-shell nanospheres coated with DNA molecules

    NASA Astrophysics Data System (ADS)

    Xie, Huai-Yi; Chen, Minfeng; Chang, Yia-Chung; Moirangthem, Rakesh Singh

    2017-05-01

    We present both experimental and theoretical studies for investigating DNA molecules attached on metallic nanospheres. We have developed an efficient and accurate numerical method to investigate light scattering from plasmonic nanospheres on a substrate covered by a shell, based on the Green's function approach with suitable spherical harmonic basis. Next, we use this method to study optical scattering from DNA molecules attached to metallic nanoparticles placed on a substrate and compare with experimental results. We obtain fairly good agreement between theoretical predictions and the measured ellipsometric spectra. The metallic nanoparticles were used to detect the binding with DNA molecules in a microfluidic setup via spectroscopic ellipsometry (SE), and a detectable change in ellipsometric spectra was found when DNA molecules are captured on Au nanoparticles. Our theoretical simulation indicates that the coverage of Au nanosphere by a submonolayer of DNA molecules, which is modeled by a thin layer of dielectric material (which may absorb light), can lead to a small but detectable spectroscopic shift in both the Ψ and Δ spectra with more significant change in Δ spectra in agreement with experimental results. Our studies demonstrated the ultrasensitive capability of SE for sensing submonolayer coverage of DNA molecules on Au nanospheres. Hence the spectroscopic ellipsometric measurements coupled with theoretical analysis via an efficient computation method can be an effective tool for detecting DNA molecules attached on Au nanoparticles, thus achieving label-free, non-destructive, and high-sensitivity biosensing with nanoscale resolution.

  6. Precision determination of electron scattering angle by differential nuclear recoil energy method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liyanage, N.; Saenboonruang, K.

    2015-12-01

    The accurate determination of the scattered electron angle is crucial to electron scattering experiments, both with open-geometry large-acceptance spectrometers and ones with dipole-type magnetic spectrometers for electron detection. In particular, for small central-angle experiments using dipole-type magnetic spectrometers, in which surveys are used to measure the spectrometer angle with respect to the primary electron beam, the importance of the scattering angle determination is emphasized. However, given the complexities of large experiments and spectrometers, the accuracy of such surveys is limited and insufficient to meet demands of some experiments. In this article, we present a new technique for determination of themore » electron scattering angle based on an accurate measurement of the primary beam energy and the principle of differential nuclear recoil. This technique was used to determine the scattering angle for several experiments carried out at the Experimental Hall A, Jefferson Lab. Results have shown that the new technique greatly improved the accuracy of the angle determination compared to surveys.« less

  7. Precision Determination of Electron Scattering Angle by Differential Nuclear Recoil Energy Method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liyanage, Nilanga; Saenboonruang, Kiadtisak

    2015-09-01

    The accurate determination of the scattered electron angle is crucial to electron scattering experiments, both with open-geometry large-acceptance spectrometers and ones with dipole-type magnetic spectrometers for electron detection. In particular, for small central-angle experiments using dipole-type magnetic spectrometers, in which surveys are used to measure the spectrometer angle with respect to the primary electron beam, the importance of the scattering angle determination is emphasized. However, given the complexities of large experiments and spectrometers, the accuracy of such surveys is limited and insufficient to meet demands of some experiments. In this article, we present a new technique for determination of themore » electron scattering angle based on an accurate measurement of the primary beam energy and the principle of differential nuclear recoil. This technique was used to determine the scattering angle for several experiments carried out at the Experimental Hall A, Jefferson Lab. Results have shown that the new technique greatly improved the accuracy of the angle determination compared to surveys.« less

  8. Comptonization of thermal photons by relativistic electron beams

    NASA Technical Reports Server (NTRS)

    Daugherty, Joseph K.; Harding, Alice K.

    1989-01-01

    This paper presents a numerical calculation of gamma-ray emission produced by Compton scattering of relativistic electron beams on background thermal radiation, which includes spatial dependence of electron energy losses and cyclotron resonance scattering in a strong magnetic field. In the first version, the scattering is described by the fully relativistic Klein-Nishina cross section, but the magnetic field is neglected. In the second version, the scattering is described by the magnetic resonant cross section in the Thomson limit. It is found that when the magnetic field is not included, electron energy losses are important only at higher neutron star surface temperatures (T about 3,000,000 K). In the presence of a strong magnetic field, (10 to the 12th G), resonant scattering greatly increases electron energy losses, making scattering very efficient even at lower surface temperatures. Resulting photon and electron spectra for both cases ae discussed in relation to models for pulsar X-ray and gamma-ray emission.

  9. Insights from soft X-rays: the chlorine and sulfur sub-structures of a CK2alpha/DRB complex.

    PubMed

    Raaf, Jennifer; Issinger, Olaf-Georg; Niefind, Karsten

    2008-09-01

    The diffraction pattern of a protein crystal is normally a product of the interference of electromagnetic waves scattered by electrons of the crystalline sample. The diffraction pattern undergoes systematic changes in case additionally X-ray absorption occurs, meaning if the wavelength of the primary X-ray beam is relatively close to the absorption edge of selected elements of the sample. The resulting effects are summarized as "anomalous dispersion" and can be always observed with "soft" X-rays (wavelength around 2 A) since they match the absorption edges of sulfur and chlorine. A particularly useful application of this phenomenon is the experimental detection of the sub-structures of the anomalous scatterers in protein crystals. We demonstrate this here with a crystal of a C-terminally truncated variant of human CK2alpha to which two molecules of the inhibitor 5,6-dichloro-1-beta-D-ribo-furanosyl-benzimidazole (DRB) are bound. The structure of this co-crystal has been solved recently. For this study we measured an additional diffraction data set at a wavelength of 2 A which showed strong anomalous dispersion effects. On the basis of these effects we detected all sulfur atoms of the protein, the two liganded DRB molecules and a total of 16 additional chloride ions some of them emerging at positions filled with water molecules in previous structure determinations. A number of chloride ions are bound to structural and functional important locations fitting to the constitutive activity and the acidophilic substrate specificity of the enzyme.

  10. Surface-enhanced Raman scattering on molecular self-assembly in nanoparticle-hydrogel composite.

    PubMed

    Miljanić, Snezana; Frkanec, Leo; Biljan, Tomislav; Meić, Zlatko; Zinić, Mladen

    2006-10-24

    Surface-enhanced Raman scattering has been applied to study weak intermolecular interactions between small organic gelling molecules involved in the silver nanoparticle-hydrogel composite formation. Assembly and disassembly of the gelator molecules in close vicinity to embedded silver nanoparticles were followed by changes in Raman intensity of the amide II and carboxyl vibrational bands, whereas the strength of the bands related to benzene modes remained constant. This implied that the gelator molecules were strongly attached to the silver particles through the benzene units, while participating in gel structure organization by intermolecular hydrogen bonding between oxalyl amide and carboxyl groups.

  11. Fabry-Perot interferometer measurement of static temperature and velocity for ASTOVL model tests

    NASA Technical Reports Server (NTRS)

    Kourous, Helen E.; Seacholtz, Richard G.

    1995-01-01

    A spectrally resolved Rayleigh/Mie scattering diagnostic was developed to measure temperature and wing-spanwise velocity in the vicinity of an ASTOVL aircraft model in the Lewis 9 x 15 Low Speed Wind Tunnel. The spectrum of argon-ion laser light scattered by the air molecules and particles in the flow was resolved with a Fabry-Perot interferometer. Temperature was extracted from the spectral width of the Rayleigh scattering component, and spanwise gas velocity from the gross spectral shift. Nozzle temperature approached 800 K, and the velocity component approached 30 m/s. The measurement uncertainty was about 5 percent for the gas temperature, and about 10 m/s for the velocity. The large difference in the spectral width of the Mie scattering from particles and the Rayleigh scattering from gas molecules allowed the gas temperature to be measured in flow containing both naturally occurring dust and LDV seed (both were present).

  12. Optical Lattice Clocks with Weakly Bound Molecules.

    PubMed

    Borkowski, Mateusz

    2018-02-23

    Optical molecular clocks promise unparalleled sensitivity to the temporal variation of the electron-to-proton mass ratio and insight into possible new physics beyond the standard model. We propose to realize a molecular clock with bosonic ^{174}Yb_{2} molecules, where the forbidden ^{1}S_{0}→^{3}P_{0} clock transition would be induced magnetically. The use of a bosonic species avoids possible complications due to the hyperfine structure present in fermionic species. While direct clock line photoassociation would be challenging, weakly bound ground state molecules could be produced by stimulated Raman adiabatic passage and used instead. The recent scattering measurements [L. Franchi, et al. New J. Phys. 19, 103037 (2017)NJOPFM1367-263010.1088/1367-2630/aa8fb4] enable us to determine the positions of target ^{1}S_{0}+^{3}P_{0} vibrational levels and calculate the Franck-Condon factors for clock transitions between ground and excited molecular states. The resulting magnetically induced Rabi frequencies are similar to those for atoms hinting that an experimental realization is feasible. A successful observation could pave the way towards Hz-level molecular spectroscopy.

  13. Deep absorbing porphyrin small molecule for high-performance organic solar cells with very low energy losses.

    PubMed

    Gao, Ke; Li, Lisheng; Lai, Tianqi; Xiao, Liangang; Huang, Yuan; Huang, Fei; Peng, Junbiao; Cao, Yong; Liu, Feng; Russell, Thomas P; Janssen, René A J; Peng, Xiaobin

    2015-06-17

    We designed and synthesized the DPPEZnP-TEH molecule, with a porphyrin ring linked to two diketopyrrolopyrrole units by ethynylene bridges. The resulting material exhibits a very low energy band gap of 1.37 eV and a broad light absorption to 907 nm. An open-circuit voltage of 0.78 V was obtained in bulk heterojunction (BHJ) organic solar cells, showing a low energy loss of only 0.59 eV, which is the first report that small molecule solar cells show energy losses <0.6 eV. The optimized solar cells show remarkable external quantum efficiency, short circuit current, and power conversion efficiency up to 65%, 16.76 mA/cm(2), and 8.08%, respectively, which are the best values for BHJ solar cells with very low energy losses. Additionally, the morphology of DPPEZnP-TEH neat and blend films with PC61BM was studied thoroughly by grazing incidence X-ray diffraction, resonant soft X-ray scattering, and transmission electron microscopy under different fabrication conditions.

  14. Optical Lattice Clocks with Weakly Bound Molecules

    NASA Astrophysics Data System (ADS)

    Borkowski, Mateusz

    2018-02-01

    Optical molecular clocks promise unparalleled sensitivity to the temporal variation of the electron-to-proton mass ratio and insight into possible new physics beyond the standard model. We propose to realize a molecular clock with bosonic 174Yb2 molecules, where the forbidden 1S0 →3P0 clock transition would be induced magnetically. The use of a bosonic species avoids possible complications due to the hyperfine structure present in fermionic species. While direct clock line photoassociation would be challenging, weakly bound ground state molecules could be produced by stimulated Raman adiabatic passage and used instead. The recent scattering measurements [L. Franchi, et al. New J. Phys. 19, 103037 (2017), 10.1088/1367-2630/aa8fb4] enable us to determine the positions of target 1S0 +3P0 vibrational levels and calculate the Franck-Condon factors for clock transitions between ground and excited molecular states. The resulting magnetically induced Rabi frequencies are similar to those for atoms hinting that an experimental realization is feasible. A successful observation could pave the way towards Hz-level molecular spectroscopy.

  15. Concentration Dependence of Gold Nanoparticles for Fluorescence Enhancement

    NASA Astrophysics Data System (ADS)

    Solomon, Joel; Wittmershaus, Bruce

    Noble metal nanoparticles possess a unique property known as surface plasmon resonance in which the conduction electrons oscillate due to incoming light, dramatically increasing their absorption and scattering of light. The oscillating electrons create a varying electric field that can affect nearby molecules. The fluorescence and photostability of fluorophores can be enhanced significantly when they are near plasmonic nanoparticles. This effect is called metal enhanced fluorescence (MEF). MEF from two fluorescence organic dyes, Lucifer Yellow CH and Riboflavin, was measured with different concentrations of 50-nm colloidal gold nanoparticles (Au-NP). The concentration range of Au-NP was varied from 2.5 to 250 pM. To maximize the interaction, the dyes were chosen so their emission spectra had considerable overlap with the absorption spectra of the Au-NP, which is common in MEF studies. If the dye molecules are too close to the surface of Au-NP, fluorescence quenching can occur instead of MEF. To try to observe this difference, silica-coated Au-NP were compared to citrate-based Au-NP; however, fluorescence quenching was observed with both Au-NP. This material is based upon work supported by the National Science Foundation under Grant Number NSF-ECCS-1306157.

  16. Role of Crystallization in the Morphology of Polymer: Non-fullerene Acceptor Bulk Heterojunctions

    DOE PAGES

    O’Hara, Kathryn A.; Ostrowski, David P.; Koldemir, Unsal; ...

    2017-05-22

    Many high efficiency organic photovoltaics use fullerene-based acceptors despite their high production cost, weak optical absorption in the visible range, and limited synthetic variability of electronic and optical properties. To circumvent this deficiency, non-fullerene small-molecule acceptors have been developed that have good synthetic flexibility, allowing for precise tuning of optoelectronic properties, leading to enhanced absorption of the solar spectrum and increased open-circuit voltages ( V OC). We examined the detailed morphology of bulk heterojunctions of poly(3-hexylthiophene) and the small-molecule acceptor HPI-BT to reveal structural changes that lead to improvements in the fill factor of solar cells upon thermal annealing. Themore » kinetics of the phase transformation process of HPI-BT during thermal annealing were investigated through in situ grazing incidence wide-angle X-ray scattering studies, atomic force microscopy, and transmission electron microscopy. The HPI-BT acceptor crystallizes during film formation to form micron-sized domains embedded within the film center and a donor rich capping layer at the cathode interface reducing efficient charge extraction. Thermal annealing changes the surface composition and improves charge extraction. In conclusion, this study reveals the need for complementary methods to investigate the morphology of BHJs.« less

  17. Role of Crystallization in the Morphology of Polymer: Non-fullerene Acceptor Bulk Heterojunctions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    O’Hara, Kathryn A.; Ostrowski, David P.; Koldemir, Unsal

    Many high efficiency organic photovoltaics use fullerene-based acceptors despite their high production cost, weak optical absorption in the visible range, and limited synthetic variability of electronic and optical properties. To circumvent this deficiency, non-fullerene small-molecule acceptors have been developed that have good synthetic flexibility, allowing for precise tuning of optoelectronic properties, leading to enhanced absorption of the solar spectrum and increased open-circuit voltages ( V OC). We examined the detailed morphology of bulk heterojunctions of poly(3-hexylthiophene) and the small-molecule acceptor HPI-BT to reveal structural changes that lead to improvements in the fill factor of solar cells upon thermal annealing. Themore » kinetics of the phase transformation process of HPI-BT during thermal annealing were investigated through in situ grazing incidence wide-angle X-ray scattering studies, atomic force microscopy, and transmission electron microscopy. The HPI-BT acceptor crystallizes during film formation to form micron-sized domains embedded within the film center and a donor rich capping layer at the cathode interface reducing efficient charge extraction. Thermal annealing changes the surface composition and improves charge extraction. In conclusion, this study reveals the need for complementary methods to investigate the morphology of BHJs.« less

  18. Theory of Raman scattering in coupled electron-phonon systems

    NASA Astrophysics Data System (ADS)

    Itai, K.

    1992-01-01

    The Raman spectrum is calculated for a coupled conduction-electron-phonon system in the zero-momentum-transfer limit. The Raman scattering is due to electron-hole excitations and phonons as well. The phonons of those branches that contribute to the electron self-energy and the correction of the electron-phonon vertex are assumed to have flat energy dispersion (the Einstein phonons). The effect of electron-impurity scattering is also incorporated. Both the electron-phonon interaction and the electron-impurity interaction cause the fluctuation of the electron distribution between different parts of the Fermi surface, which results in overdamped zero-sound modes of various symmetries. The scattering cross section is obtained by solving the Bethe-Salpeter equation. The spectrum shows a lower threshold at the smallest Einstein phonon energy when only the electron-phonon interaction is taken into consideration. When impurities are also taken into consideration, the threshold disappears.

  19. Evidence for a quantum dipole liquid state in an organic quasi-two-dimensional material.

    PubMed

    Hassan, Nora; Cunningham, Streit; Mourigal, Martin; Zhilyaeva, Elena I; Torunova, Svetlana A; Lyubovskaya, Rimma N; Schlueter, John A; Drichko, Natalia

    2018-06-08

    Mott insulators are commonly pictured with electrons localized on lattice sites, with their low-energy degrees of freedom involving spins only. Here, we observe emergent charge degrees of freedom in a molecule-based Mott insulator κ-(BEDT-TTF) 2 Hg(SCN) 2 Br, resulting in a quantum dipole liquid state. Electrons localized on molecular dimer lattice sites form electric dipoles that do not order at low temperatures and fluctuate with frequency detected experimentally in our Raman spectroscopy experiments. The heat capacity and Raman scattering response are consistent with a scenario in which the composite spin and electric dipole degrees of freedom remain fluctuating down to the lowest measured temperatures. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  20. Seeing real-space dynamics of liquid water through inelastic x-ray scattering.

    PubMed

    Iwashita, Takuya; Wu, Bin; Chen, Wei-Ren; Tsutsui, Satoshi; Baron, Alfred Q R; Egami, Takeshi

    2017-12-01

    Water is ubiquitous on earth, but we know little about the real-space motion of molecules in liquid water. We demonstrate that high-resolution inelastic x-ray scattering measurement over a wide range of momentum and energy transfer makes it possible to probe real-space, real-time dynamics of water molecules through the so-called Van Hove function. Water molecules are found to be strongly correlated in space and time with coupling between the first and second nearest-neighbor molecules. The local dynamic correlation of molecules observed here is crucial to a fundamental understanding of the origin of the physical properties of water, including viscosity. The results also suggest that the quantum-mechanical nature of hydrogen bonds could influence its dynamics. The approach used here offers a powerful experimental method for investigating real-space dynamics of liquids.

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jana, R. N.; Meikap, A. K.

    The results of a comprehensive study of weak electron localization (WEL) and electron-electron interaction (EEI) effects in disordered V{sub 75}X{sub 25} (X = Pd, Al) alloys has been reported. The resistivity in absence of magnetic field shows a minimum at temperature T = T{sub m} and follows T{sup 1/2} law within the temperature range 5 K ≤ T ≤ T{sub m}, which suggests predominant EEI effect. Magnetoresistivity is positive due to strong spin-orbit interaction. The dephasing scattering time is dominated by the electron-phonon scattering. The electron-phonon scattering rate shows quadratic temperature dependence behavior, which is explained by the theory ofmore » incomplete dragging at the random scattering potential by phonons. The zero temperature scattering time strongly depends on the disorder and its magnitude decreases with increasing disorder.« less

  2. Competitive binding effects on surface-enhanced Raman scattering of peptide molecules

    NASA Astrophysics Data System (ADS)

    Seballos, Leo; Richards, Nicole; Stevens, Daniel J.; Patel, Mira; Kapitzky, Laura; Lokey, Scott; Millhauser, Glenn; Zhang, Jin Z.

    2007-10-01

    Surface enhanced Raman scattering (SERS) has been conducted on tryptophan (W), proline (P) and tyrosine (Y) containing peptides that include W-P-Y, Y-P-W, W-P-P-P-Y, Y-P-P-P-W, W-P-P-P-P-P-Y, and Y-P-P-P-P-P-W to gain insight into molecular binding behavior on a metal substrate to eventually apply in protein SERS detection. The peptides are shown to bind through the molecule's carboxylic end, but the strong affinity of the tryptophan residue to the substrate surface, in conjunction with its large polarizability, dominates each molecule's SERS signal with the strong presence of its ring modes in all samples. These results are important for understanding SERS of protein molecules.

  3. Oxygen K edge scattering from bulk comb diblock copolymer reveals extended, ordered backbones above lamellar order-disorder transition

    DOE PAGES

    Kortright, Jeffrey Barrett; Sun, Jing; Spencer, Ryan K.; ...

    2016-12-14

    The evolution of molecular morphology in bulk samples of comb diblock copolymer pNdc 12-b-pNte 21 across the lamellar order-disorder transition (ODT) is studied using resonant x-ray scattering at the oxygen K edge, with the goal of determining whether the molecules remain extended or collapse above the ODT. The distinct spectral resonances of carbonyl oxygen on the backbone and ether oxygen in the pNte side chains combine with their different site symmetry within the molecule to yield strong differences in bulk structural sensitivity at all temperatures. Comparison with simple models for the disordered phase clearly reveals that disordering at the ODTmore » corresponds to loss of positional order of molecules with extended backbones that retain orientational order, rather than backbone collapse into a locally isotropic disordered phase. This conclusion is facilitated directly by the distinct structural sensitivity at the two resonances. Lastly, we discuss the roles of depolarized scattering in enhancing this sensitivity, and background fluorescence in limiting dynamic range, in oxygen resonant scattering.« less

  4. Applicability of modified effective-range theory to positron-atom and positron-molecule scattering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Idziaszek, Zbigniew; Karwasz, Grzegorz; Instytut Fizyki, Uniwersytet Mikolaja Kopernika, 87-100 Torun

    2006-06-15

    We analyze low-energy scattering of positrons on Ar atoms and N{sub 2} molecules using the modified effective-range theory (MERT) developed by O'Malley, et al. [J. Math. Phys. 2, 491 (1961)]. We use the formulation of MERT based on exact solutions of the Schroedinger equation with polarization potential rather than low-energy expansions of phase shifts into momentum series. We show that MERT describes the experimental data well, provided that effective-range expansion is performed both for s- and p-wave scattering, which dominate in the considered regime of positron energies (0.4-2 eV). We estimate the values of the s-wave scattering length and themore » effective range for e{sup +}-Ar and e{sup +}-N{sub 2} collisions.« less

  5. Measurement of Tensor Analyzing Powers for Elastic Electron Scattering from a Polarized 2H Target Internal to a Storage Ring

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    M. Ferro-Luzzi; M. Bouwhuis; E. Passchier

    1996-09-23

    We report an absolute measurement of the tensor analyzing powers T20 and T22 in elastic electron-deuteron scattering at a momentum transfer of 1.6 fm{sup -1}. The novel approach of this measurement is the use of a tensor polarized 2H target internal to an electron storage ring, with in situ measurement of the polarization of the target gas. Scattered electrons and recoil deuterons were detected in coincidence with two large acceptance nonmagnetic detectors. The techniques demonstrated have broad applicability to further measurements of spin-dependent electron scattering.

  6. Time-Resolved IR-Absorption Spectroscopy of Hot-Electron Dynamics in Satellite and Upper Conduction Bands in GaP

    NASA Technical Reports Server (NTRS)

    Cavicchia, M. A.; Alfano, R. R.

    1995-01-01

    The relaxation dynamics of hot electrons in the X6 and X7 satellite and upper conduction bands in GaP was directly measured by femtosecond UV-pump-IR-probe absorption spectroscopy. From a fit to the induced IR-absorption spectra the dominant scattering mechanism giving rise to the absorption at early delay times was determined to be intervalley scattering of electrons out of the X7 upper conduction-band valley. For long delay times the dominant scattering mechanism is electron-hole scattering. Electron transport dynamics of the upper conduction band of GaP has been time resolved.

  7. Vibrational and rotational transitions in low-energy electron-diatomic-molecule collisions. I - Close-coupling theory in the moving body-fixed frame. II - Hybrid theory and close-coupling theory: An /l subscript z-prime/-conserving close-coupling approximation

    NASA Technical Reports Server (NTRS)

    Choi, B. H.; Poe, R. T.

    1977-01-01

    A detailed vibrational-rotational (V-R) close-coupling formulation of electron-diatomic-molecule scattering is developed in which the target molecular axis is chosen to be the z-axis and the resulting coupled differential equation is solved in the moving body-fixed frame throughout the entire interaction region. The coupled differential equation and asymptotic boundary conditions in the body-fixed frame are given for each parity, and procedures are outlined for evaluating V-R transition cross sections on the basis of the body-fixed transition and reactance matrix elements. Conditions are discussed for obtaining identical results from the space-fixed and body-fixed formulations in the case where a finite truncated basis set is used. The hybrid theory of Chandra and Temkin (1976) is then reformulated, relevant expressions and formulas for the simultaneous V-R transitions of the hybrid theory are obtained in the same forms as those of the V-R close-coupling theory, and distorted-wave Born-approximation expressions for the cross sections of the hybrid theory are presented. A close-coupling approximation that conserves the internuclear axis component of the incident electronic angular momentum (l subscript z-prime) is derived from the V-R close-coupling formulation in the moving body-fixed frame.

  8. Quantum translator-rotator: inelastic neutron scattering of dihydrogen molecules trapped inside anisotropic fullerene cages.

    PubMed

    Horsewill, A J; Panesar, K S; Rols, S; Johnson, M R; Murata, Y; Komatsu, K; Mamone, S; Danquigny, A; Cuda, F; Maltsev, S; Grossel, M C; Carravetta, M; Levitt, M H

    2009-01-09

    We report an inelastic neutron scattering investigation of the quantum dynamics of hydrogen molecules trapped inside anisotropic fullerene cages. Transitions among the manifold of quantized rotational and translational states are directly observed. The spectra recorded as a function of energy and momentum transfer are interpreted in terms of the rotational potential and the cage dimensions. The thermodynamics of orthohydrogen and parahydrogen are investigated through temperature dependence measurements.

  9. Angular-momentum couplings in ultra-long-range giant dipole molecules

    NASA Astrophysics Data System (ADS)

    Stielow, Thomas; Scheel, Stefan; Kurz, Markus

    2018-02-01

    In this article we extend the theory of ultra-long-range giant dipole molecules, formed by an atom in a giant dipole state and a ground-state alkali-metal atom, by angular-momentum couplings known from recent works on Rydberg molecules. In addition to s -wave scattering, the next higher order of p -wave scattering in the Fermi pseudopotential describing the binding mechanism is considered. Furthermore, the singlet and triplet channels of the scattering interaction as well as angular-momentum couplings such as hyperfine interaction and Zeeman interactions are included. Within the framework of Born-Oppenheimer theory, potential energy surfaces are calculated in both first-order perturbation theory and exact diagonalization. Besides the known pure triplet states, mixed-spin character states are obtained, opening up a whole new landscape of molecular potentials. We determine exact binding energies and wave functions of the nuclear rotational and vibrational motion numerically from the various potential energy surfaces.

  10. Distinguishing Individual DNA Bases in a Network by Non-Resonant Tip-Enhanced Raman Scattering.

    PubMed

    Zhang, Rui; Zhang, Xianbiao; Wang, Huifang; Zhang, Yao; Jiang, Song; Hu, Chunrui; Zhang, Yang; Luo, Yi; Dong, Zhenchao

    2017-05-08

    The importance of identifying DNA bases at the single-molecule level is well recognized for many biological applications. Although such identification can be achieved by electrical measurements using special setups, it is still not possible to identify single bases in real space by optical means owing to the diffraction limit. Herein, we demonstrate the outstanding ability of scanning tunneling microscope (STM)-controlled non-resonant tip-enhanced Raman scattering (TERS) to unambiguously distinguish two individual complementary DNA bases (adenine and thymine) with a spatial resolution down to 0.9 nm. The distinct Raman fingerprints identified for the two molecules allow to differentiate in real space individual DNA bases in coupled base pairs. The demonstrated ability of non-resonant Raman scattering with super-high spatial resolution will significantly extend the applicability of TERS, opening up new routes for single-molecule DNA sequencing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Electron mobility of two-dimensional electron gas in InGaN heterostructures: Effects of alloy disorder and random dipole scatterings

    NASA Astrophysics Data System (ADS)

    Hoshino, Tomoki; Mori, Nobuya

    2018-04-01

    InGaN has a smaller electron effective mass and is expected to be used as a channel material for high-electron-mobility transistors. However, it is an alloy semiconductor with a random distribution of atoms, which introduces additional scattering mechanisms: alloy disorder and random dipole scatterings. In this work, we calculate the electron mobility in InGaN- and GaN-channel high-electron-mobility transistors (HEMTs) while taking into account acoustic deformation potential, polar optical phonon, alloy disorder, and random dipole scatterings. For InGaN-channel HEMTs, we find that not only alloy disorder but also random dipole scattering has a strong impact on the electron mobility and it significantly decreases as the In mole fraction of the channel increases. Our calculation also shows that the channel thickness w dependence of the mobility is rather weak when w > 1 nm for In0.1Ga0.9N-channel HEMTs.

  12. Currents and Associated Electron Scattering and Bouncing Near the Diffusion Region at Earth's Magnetopause

    NASA Technical Reports Server (NTRS)

    Lavraud, B.; Zhang, Y. C.; Vernisse, Y.; Gershman, D. J.; Dorelli, J.; Cassak, P. A.; Dargent, J.; Pollock, C.; Giles, B.; Aunai, N.; hide

    2016-01-01

    Based on high-resolution measurements from NASA's Magnetospheric Multlscale mission, we present the dynamics of electrons associated with current systems observed near the diffusion region of magnetic reconnection at Earth's magnetopause. Using pitch angle distributions (PAD) and magnetic curvature analysis, we demonstrate the occurrence of electron scattering in the curved magnetic field of the diffusion region down to energies of 20eV. We show that scattering occurs closer to the current sheet as the electron energy decreases. The scattering of Inflowing electrons, associated with field-aligned electrostatic potentials and Hall currents, produces a new population of scattered electrons with broader PAD which bounce back and forth in the exhaust. Except at the center of the diffusion region the two populations are collocated and appear to behave adiabatically: the inflowing electron PAD focuses inward (toward lower magnetic field), while the bouncing population PAD gradually peaks at 90 degrees away from the center (where it mirrors owing to higher magnetic field and probable field-aligned potentials).

  13. GEC Plasma Data Exchange Project

    NASA Astrophysics Data System (ADS)

    Pitchford, L. C.

    2013-08-01

    In 2010 the Gaseous Electronics Conference (GEC), a major international conference for the low temperature plasma science (LTPS) community, initiated the Plasma Data Exchange Project (PDEP). The PDEP is an informal, community-based project that aims to address, at least in part, the well-recognized needs for the community to organize the means of collecting, evaluating and sharing data both for modelling and for interpretation of experiments. The emphasis to date in the PDEP has been on data related to the electron and ion components of these plasmas rather than on the plasma chemistry. At the heart of the PDEP is the open-access website, LXCat [1], developed by researchers at LAPLACE (Laboratoire Plasma et Conversion d'Energie, Toulouse, France). LXCat is a platform for archiving and manipulating collections of data related to electron scattering and transport in cold, neutral gases, organized in databases set-up by individual members or institutions of the LTPS community. At present, 15 databases of electron scattering data, contributed by groups around the world, can be accessed on LXCat. These databases include complete sets of electron cross sections, over an energy range from thermal to nominally 1 keV, for almost 40 ground-state neutral species and partial sets of data for about 30 other neutral, excited and ionized species. 'Complete' implies that all the major electron momentum and energy loss processes are well described in the dataset. Such 'complete' datasets can be used as input to a Boltzmann calculation of the electron energy distribution function (generally non-Maxwellian), and electron transport and rate coefficients can be obtained in pure gases or mixtures by averaging over the distribution function. Online tools enable importing and exporting data, plotting and comparing different sets of data. An online version of the Boltzmann equation solver BOLSIG+ [2] is also available on the LXCat site. Other members of the community have contributed their collections of transport and rate coefficient data, and comparisons of calculated and measured data can also be made online through the LXCat site. A large body of data for ion scattering and transport is available on the sister site, ICECat [3], which is now being merged into a new and improved LXCat platform [4] under development. The GEC hosted workshops on the PDEP in 2011 and 2012, with the third in the series being planned for October 2013. The purpose of these workshops has been to report progress towards the evaluation of data available on LXCat or elsewhere. The focus of the 2011 workshop was electron scattering and transport in noble gases, and the articles in this cluster issue were originally reported at that occasion. The 2012 workshop focused on electron transport in simple molecular gases, and plans are to publish documentation and evaluations of datasets for H2, N2 and O2, as reported at the 2012 GEC. The focus topic for the 2013 workshop is electron scattering in H2O and other complex molecules. The first three papers (paper I on Ar, by Pitchford et al [5], paper II on He and Ne, by Alves et al [6], and paper III on Kr and Xe, by Bordage et al [7]) in this cluster issue aim to provide documentation of the datasets available on LXCat for noble gases. Paper IV by Klaus Bartschat [8] gives an overview of theoretical methods for calculations of electron-atom scattering cross sections. This is important because, in some cases, theory has now advanced to the point of being able to provide complete sets of electron scattering cross-sections in noble gases to the accuracy required for use in plasma modelling. The discussion provided in the four papers in this cluster issue is intended to help users decide which datasets best fit their needs. We urge the users of these data to include complete and proper references in all publications. Open-access data should not become anonymous data! Finally, it is with sadness that we acknowledge the passing of our colleague Art Phelps in December 2012. Art was a key person on the GEC Plasma Data Exchange Project and a major contributor to the LXCat site, having made available his compilations of electron and ion scattering cross sections as well as many of his unpublished notes and documents on related issues. Throughout his long and remarkably productive career, Art Phelps held the bar high for the entire GEC community. We can only aspire to his example. We dedicate this cluster issue to him with the knowledge that he could have improved on these papers but with the hope that he would have been satisfied with their final versions.

  14. Experimental electron energy-loss spectra and cross sections for the 4/2/S - 4/2/P transition in Zn II

    NASA Technical Reports Server (NTRS)

    Chutjian, A.; Newell, W. R.

    1982-01-01

    Electron energy-loss spectra and differential cross sections are reported for inelastic scattering from Zn II. Measurements were carried out in a crossed electron beam-ion beam apparatus, at incident electron energies of 30, 40, 50, 60, 75, 85, and 100 eV, and at a scattering angle of 14 deg. The present results are the first reported measurements of inelastic electron scattering from an ion.

  15. Surface roughness scattering of electrons in bulk mosfets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zuverink, Amanda Renee

    2015-11-01

    Surface-roughness scattering of electrons at the Si-SiO 2 interface is a very important consideration when analyzing Si metal-oxide-semiconductor field-effect transistors (MOSFETs). Scattering reduces the mobility of the electrons and degrades the device performance. 250-nm and 50-nm bulk MOSFETs were simulated with varying device parameters and mesh sizes in order to compare the effects of surface-roughness scattering in multiple devices. The simulation framework includes the ensemble Monte Carlo method used to solve the Boltzmann transport equation coupled with a successive over-relaxation method used to solve the two-dimensional Poisson's equation. Four methods for simulating the surface-roughness scattering of electrons were implemented onmore » both devices and compared: the constant specularity parameter, the momentum-dependent specularity parameter, and the real-space-roughness method with both uniform and varying electric fields. The specularity parameter is the probability of an electron scattering speculariy from a rough surface. It can be chosen as a constant, characterizing partially diffuse scattering of all electrons from the surface the same way, or it can be momentum dependent, where the size of rms roughness and the normal component of the electron wave number determine the probability of electron-momentum randomization. The real-space rough surface method uses the rms roughness height and correlation length of an actual MOSFET to simulate a rough interface. Due to their charge, electrons scatter from the electric field and not directly from the surface. If the electric field is kept uniform, the electrons do not perceive the roughness and scatter as if from a at surface. However, if the field is allowed to vary, the electrons scatter from the varying electric field as they would in a MOSFET. These methods were implemented for both the 50-nm and 250-nm MOSFETs, and using the rms roughness heights and correlation lengths for real devices. The current-voltage and mobility-electric field curves were plotted for each method on the two devices and compared. The conclusion is that the specularity-parameter methods are valuable as simple models for relatively smooth interfaces. However, they have limitations, as they cannot accurately describe the drastic reduction in the current and the electron mobility that occur in MOSFETs with very rough Si-SiO 2 interfaces.« less

  16. A multiple-scattering polaritonic-operator method for hybrid arrays of metal nanoparticles and quantum emitters

    NASA Astrophysics Data System (ADS)

    Chatzidakis, Georgios D.; Yannopapas, Vassilios

    2018-05-01

    We present a new technique for the study of hybrid collections of quantum emitters (atoms, molecules, quantum dots) with nanoparticles. The technique is based on a multiple-scattering polaritonic-operator formalism in conjunction with an electromagnetic coupled dipole method. Apart from collections of quantum emitters and nanoparticles, the method can equally treat the interaction of a collection of quantum emitters with a single nano-object of arbitrary shape in which case the nano-object is treated as a finite three-dimensional lattice of point scatterers. We have applied our method to the case of linear array (chain) of dimers of quantum emitters and metallic nanoparticles wherein the corresponding (geometrical and physical) parameters of the dimers are chosen so as the interaction between the emitter and the nanoparticle lies in the strong-coupling regime in order to enable the formation of plexciton states in the dimer. In particular, for a linear chain of dimers, we show that the corresponding light spectra reveal a multitude of plexciton modes resulting from the hybridization of the plexciton resonances of each individual dimer in a manner similar to the tight-binding description of electrons in solids.

  17. Measure of Backscatter for small particles of atmosphere by lasers

    NASA Astrophysics Data System (ADS)

    Abud, Mariam M.

    2018-05-01

    It developed a program for the atmosphere to study the backscattering for contents gas and molecules, aerosol, fog, clouds and rain droplets. By using Rayleigh, Mie and geometric scattering. The aim of research, using different types of lasers from various optical region, is to calculate differential cross scatter section and backscatter of atmosphere component in one layer from height 10-2000m. 180° is backscattering angle using ISA standard sea level condition P=1013.25 (kpa) at t0=15 ° C.and then calculated the density of molecules and water vapor molecules represented D in kg/m3. Results reflected index consist of the large value of the real part and imaginary m=1.463-0.028i.this research diff. scatter cross section of different component of atmosphere layer decreased vs. wavelengths. The purpose of lider research to find backscatter from UV to IR laser within the optical range in the atmosphere and measurement of excitation and analysis of backscatter signals. Recently, the atmosphere of Iraq has become full of dust and pollution, so by knowing the differential cross scatter section and backscatter of atmosphere. Relation between total Rayleigh scatter coefficient & type of particles include fog and clouds, aerosols and water droplets (-0.01, 0.025,- 0.005) m-1/sr-1.

  18. Exceptional enhancement of Raman scattering on silver chlorobromide nanocube photonic crystals: chemical and photonic contributions

    DOE PAGES

    Li, Zheng; Gosztola, David J.; Sun, Cheng-Jun; ...

    2015-02-02

    Photonic crystals made from self-assembly of mono-dispersed AgCl xBr 1-x nanocubes, which are not plasmonically active, have been discovered to exceptionally enhance Raman scattering of molecules chemically adsorbed on their surfaces. Comprehensive control measurements and X-ray absorption near-edge structure spectroscopy indicate that the Raman enhancement on the AgCl xBr 1-x nanocube photonic crystals is primarily ascribed to the chemical enhancement mechanism associated with the chemical interactions between adsorbing molecules and the AgCl xBr 1-x surfaces. In addition, the ordering of the AgCl xBr 1-x nanocubes in the photonic crystals can selectively reflect Raman scattering back to the detector at themore » bandgap position of the photonic crystals to provide additional enhancement, i.e., photonic mode enhancement. The thiophenol molecules adsorbed on the AgCl 0.44Br 0.56 nanocube photonic crystals exhibit astonishingly strong Raman signals that are on the same order of magnitude as those recorded from the thiophenol molecules adsorbed on the assembled Ag nanocubes.« less

  19. Radiative transfer in the earth's atmosphere and ocean: influence of ocean waves.

    PubMed

    Plass, G N; Kattawar, G W; Guinn, J A

    1975-08-01

    The radiance in the earth's atmosphere and ocean is calculated for a realistic model including an ocean surface with waves. Individual photons are followed in a Monte Carlo calculation. In the atmosphere, both Rayleigh scattering by the molecules and Mie scattering by the aerosols as well as molecular and aerosol absorption are taken into account. Similarly, in the ocean, both Rayleigh scattering by the water molecules and Mie scattering by the hydrosols as well as absorption by the water molecules and hydrosols are considered. Separate single-scattering functions are used which are calculated separately for the aerosols and the hydrosols from the Mie theory with appropriate and different size distributions in each case. The scattering angles are determined from the appropriate scattering function including the strong forwardscattering peak when there is aerosol or hydrosol scattering. Both the reflected and refracted rays, as well as the rays that undergo total internal reflection, are followed at the oceanc surface. The wave slope is chosen from the Cox-Munk distribution. Graphs show the influence of the waves on the upward radiance at the top of the atmosphere and just above the ocean surface and on the downward radiance just below the ocean surface as well as deeper within the ocean. The radiance changes are sufficient at the top of the atmosphere to determine the sea state from satellite measurements. Within the ocean the waves smooth out the abrupt transition that occurs at the edge of the allowed cone for radiation entering a calm ocean. The influence of the waves on the contrast between the sky and sea at the horizon is discussed. It is shown that the downward flux just below the surface increases with wind speed at all solar angles.

  20. High energy Coulomb-scattered electrons for relativistic particle beams and diagnostics

    DOE PAGES

    Thieberger, P.; Altinbas, Z.; Carlson, C.; ...

    2016-03-29

    A new system used for monitoring energetic Coulomb-scattered electrons as the main diagnostic for accurately aligning the electron and ion beams in the new Relativistic Heavy Ion Collider (RHIC) electron lenses is described in detail. The theory of electron scattering from relativistic ions is developed and applied to the design and implementation of the system used to achieve and maintain the alignment. Commissioning with gold and 3He beams is then described as well as the successful utilization of the new system during the 2015 RHIC polarized proton run. Systematic errors of the new method are then estimated. Lastly, some possiblemore » future applications of Coulomb-scattered electrons for beam diagnostics are briefly discussed.« less

  1. Raman scattering by H2 and N2 in the atmospheres of exoplanets

    NASA Astrophysics Data System (ADS)

    Oklopcic, Antonija; Hirata, Christopher M.; Heng, Kevin

    2016-06-01

    Rayleigh scattering is an important source of opacity in the atmospheres of exoplanets at short optical and near-UV wavelengths. Raman scattering is an inelastic process related to Rayleigh scattering, but with a weaker cross section. We analyze the signatures of Raman scattering imprinted in the reflected light and the geometric albedo of exoplanets. Raman scattering causes filling-in of absorption lines in the incident spectrum, thus producing sharp enhancements in the geometric albedo. It also shifts the wavelengths of spectral features in the reflected light causing the Raman ghost lines. Observing the albedo enhancements could be used to measure the column density of the scattering molecule and provide constrains on the presence of clouds and hazes in the atmosphere. Observing the Raman ghost lines could be used to spectroscopically identify the main scatterer in the atmosphere -- molecules like H2 or N2 which do not show prominent spectral signatures in the optical wavelength range. If detected, ghost lines could also provide information about the temperature of the atmosphere. Here we present how these signatures of Raman scattering in hydrogen- and nitrogen-dominated atmospheres can be used as probes of atmospheric pressure, temperature and composition. We analyze the feasibility of detecting these features in the albedo spectra of nearby exoplanets with the existing and future observational facilities.

  2. Challenges for single molecule electronic devices with nanographene and organic molecules. Do single molecules offer potential as elements of electronic devices in the next generation?

    NASA Astrophysics Data System (ADS)

    Enoki, Toshiaki; Kiguchi, Manabu

    2018-03-01

    Interest in utilizing organic molecules to fabricate electronic materials has existed ever since organic (molecular) semiconductors were first discovered in the 1950s. Since then, scientists have devoted serious effort to the creation of various molecule-based electronic systems, such as molecular metals and molecular superconductors. Single-molecule electronics and the associated basic science have emerged over the past two decades and provided hope for the development of highly integrated molecule-based electronic devices in the future (after the Si-based technology era has ended). Here, nanographenes (nano-sized graphene) with atomically precise structures are among the most promising molecules that can be utilized for electronic/spintronic devices. To manipulate single small molecules for an electronic device, a single molecular junction has been developed. It is a powerful tool that allows even small molecules to be utilized. External electric, magnetic, chemical, and mechanical perturbations can change the physical and chemical properties of molecules in a way that is different from bulk materials. Therefore, the various functionalities of molecules, along with changes induced by external perturbations, allows us to create electronic devices that we cannot create using current top-down Si-based technology. Future challenges that involve the incorporation of condensed matter physics, quantum chemistry calculations, organic synthetic chemistry, and electronic device engineering are expected to open a new era in single-molecule device electronic technology.

  3. Electron transport in erbium arsenide:indium gallium(aluminum)arsenide metal/semiconductor nanocomposites for thermoelectric power generation

    NASA Astrophysics Data System (ADS)

    Bahk, Je-Hyeong

    Electron transport in thin film ErAs:InGa(Al)As metal/semiconductor nanocomposite materials grown by molecular beam epitaxy is investigated experimentally and theoretically for efficient thermoelectric power generation. Thermoelectric properties such as the Seebeck coefficient, the electrical conductivity, and the thermal conductivity are measured for the various compositions of the material up to 840 K. A special sample preparation method is proposed to protect the thin films from damage and/or decomposition, and prevent the parasitic substrate conduction effect during the high temperature measurements. The sample preparation method includes surface passivation, high temperature metallization with a diffusion barrier, and the covalent oxide bonding technique for substrate removal. The experimental results for the nanocomposite materials are analyzed using the Boltzmann transport equation under the relaxation time approximation. The scattering characteristics of free electrons in the InGa(Al)As is defined by four major scattering mechanisms such as the polar optical phonon scattering, the ionized impurity scattering, the alloy scattering, and the acoustic phonon deformation potential scattering. Combining these scattering mechanisms, the electron transport model successfully fits the temperature-dependent thermoelectric properties of Si-doped InGaAlAs materials, and predicts the figure of merits at various doping levels in various Al compositions. The nanoparticle-electron interaction is modeled as a momentum scattering for free electrons caused by the electrostatic potential perturbation around nanoparticles and the band offset at the interface. The ErAs nanoparticles are assumed to be semi-metals that can donate electrons to the matrix, and positively charged after the charge transfer to build up the screened coulomb potential outside them. The nanoparticle scattering rate is calculated for this potential profile using the partial wave method, and used to analyze the enhancement of the Seebeck coefficient. Finally, the experimental results for the various compositions of the ErAs:InGa(Al)As nanocomposites are fit using the electron transport model and the nanoparticle scattering. It is shown that nanoparticle scattering can enhance the power factor via energy-dependent electron scattering in ErAs:InGaAs system. The figure of merit for the 0.6% ErAs:(InGaAs)0.8(InAlAs) 0.2 lattice matched to InP is measured to be 1.3 at 800 K, and the theory predicts that it can reach 1.9 at 1000 K.

  4. Electron attenuation in free, neutral ethane clusters.

    PubMed

    Winkler, M; Myrseth, V; Harnes, J; Børve, K J

    2014-10-28

    The electron effective attenuation length (EAL) in free, neutral ethane clusters has been determined at 40 eV kinetic energy by combining carbon 1s x-ray photoelectron spectroscopy and theoretical lineshape modeling. More specifically, theory is employed to form model spectra on a grid in cluster size (N) and EAL (λ), allowing N and λ to be determined by optimizing the goodness-of-fit χ(2)(N, λ) between model and observed spectra. Experimentally, the clusters were produced in an adiabatic-expansion setup using helium as the driving gas, spanning a range of 100-600 molecules in mean cluster size. The effective attenuation length was determined to be 8.4 ± 1.9 Å, in good agreement with an independent estimate of 10 Å formed on the basis of molecular electron-scattering data and Monte Carlo simulations. The aggregation state of the clusters as well as the cluster temperature and its importance to the derived EAL value are discussed in some depth.

  5. Chirp effects on impulsive vibrational spectroscopy: a multimode perspective.

    PubMed

    Wand, Amir; Kallush, Shimshon; Shoshanim, Ofir; Bismuth, Oshrat; Kosloff, Ronnie; Ruhman, Sanford

    2010-03-07

    The well-documented propensity of negatively-chirped pulses to enhance resonant impulsive Raman scattering has been rationalized in terms of a one pulse pump-dump sequence which "follows" the evolution of the excited molecules and dumps them back at highly displaced configurations. The aim of this study was to extend the understanding of this effect to molecules with many displaced vibrational modes in the presence of condensed surroundings. In particular, to define an optimally chirped pulse, to investigate what exactly it "follows" and to discover how this depends on the molecule under study. To this end, linear chirp effects on vibrational coherences in poly-atomics are investigated experimentally and theoretically. Chirped pump-impulsive probe experiments are reported for Sulforhodamine-B ("Kiton Red"), Betaine-30 and Oxazine-1 in ethanol solutions with <10 fs resolution. Numerical simulations, including numerous displaced modes and electronic dephasing, are conducted to reproduce experimental results. Through semi-quantitative reproduction of experimental results in all three systems we show that the effect of group velocity dispersion (GVD) on the buildup of ground state wave-packets depends on the pulse spectrum, on the displacements of vibrational modes upon excitation, on the detuning of the excitation pulses from resonance, and on electronic dephasing rates. Akin to scenarios described for frequency-domain resonance Raman, within the small-displacement regime each mode responds to excitation chirp independently and the optimal GVD is mode-specific. Highly-displaced modes entangle the dynamics of excitation in different modes, requiring a multi-dimensional description of the response. Rapid photochemistry and ultrafast electronic dephasing narrow the window of opportunity for coherent manipulations, leading to a reduced and similar optimal chirp for different modes. Finally, non-intuitive coherent aspects of chirp "following" are predicted in the small-displacement and slow-dephasing regime, which remain to be observed in experiment.

  6. Thomson scattering from a three-component plasma.

    PubMed

    Johnson, W R; Nilsen, J

    2014-02-01

    A model for a three-component plasma consisting of two distinct ionic species and electrons is developed and applied to study x-ray Thomson scattering. Ions of a specific type are assumed to be identical and are treated in the average-atom approximation. Given the plasma temperature and density, the model predicts mass densities, effective ionic charges, and cell volumes for each ionic type, together with the plasma chemical potential and free-electron density. Additionally, the average-atom treatment of individual ions provides a quantum-mechanical description of bound and continuum electrons. The model is used to obtain parameters needed to determine the dynamic structure factors for x-ray Thomson scattering from a three-component plasma. The contribution from inelastic scattering by free electrons is evaluated in the random-phase approximation. The contribution from inelastic scattering by bound electrons is evaluated using the bound-state and scattering wave functions obtained from the average-atom calculations. Finally, the partial static structure factors for elastic scattering by ions are evaluated using a two-component version of the Ornstein-Zernike equations with hypernetted chain closure, in which electron-ion interactions are accounted for using screened ion-ion interaction potentials. The model is used to predict the x-ray Thomson scattering spectrum from a CH plasma and the resulting spectrum is compared with experimental results obtained by Feltcher et al. [Phys. Plasmas 20, 056316 (2013)].

  7. Low-voltage electron microscopy of polymer and organic molecular thin films.

    PubMed

    Drummy, Lawrence F; Yang, Junyan; Martin, David C

    2004-06-01

    We have demonstrated the capabilities of a novel low-voltage electron microscope (LVEM) for imaging polymer and organic molecular thin films. The LVEM can operate in transmission electron microscopy, scanning transmission electron microscopy, scanning electron microscopy, and electron diffraction modes. The microscope operates at a nominal accelerating voltage of 5 kV and fits on a tabletop. A detailed discussion of the electron-sample interaction processes is presented, and the mean free path for total electron scattering was calculated to be 15 nm for organic samples at 5 kV. The total end point dose for the destruction of crystallinity at 5 kV was estimated at 5 x 10(-4) and 3.5 x 10(-2) C/cm2 for polyethylene and pentacene, respectively. These values are significantly lower than those measured at voltages greater than 100 kV. A defocus series of colloidal gold particles allowed us to estimate the experimental contrast transfer function of the microscope. Images taken of several organic materials have shown high contrast for low atomic number elements and a resolution of 2.5 nm. The materials studied here include thin films of the organic semiconductor pentacene, triblock copolymer films, single-molecule dendrimers, electrospun polymer fibers and gold nanoparticles. Copyright 2004 Elsevier B.V.

  8. Small-angle X-ray scattering probe of intermolecular interaction in red blood cells

    NASA Astrophysics Data System (ADS)

    Liu, Guan-Fen; Wang, We-Jia; Xu, Jia-Hua; Dong, Yu-Hui

    2015-03-01

    With high concentrations of hemoglobin (Hb) in red blood cells, self-interactions among these molecules could increase the propensities of their polymerization and aggregation. In the present work, high concentration Hb in solution and red blood cells were analyzed by small-angle X-ray scattering. Calculation of the effective structure factor indicates that the interaction of Hb molecules is the same when they are crowded together in both the cell and physiological saline. The Hb molecules stay individual without the formation of aggregates and clusters in cells. Supported by National Basic Research Program of China (2009CB918600) and National Natural Science Foundation of China (10979005)

  9. Low-energy electron scattering from atomic hydrogen. II. Elastic and inelastic scattering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    James, K.E. Jr.; Childers, J.G.; Khakoo, M.A.

    2004-02-01

    We present measurements of differential cross sections for elastic electron scattering from atomic hydrogen at 20 eV and 40 eV incident electron energies and ratios of differential cross sections for electron-impact excitation of atomic hydrogen to the n=2, 3, and 4 levels at incident electron energies of 14.6 eV, 15.6 eV, 17.6 eV, 20 eV, 25 eV, and 40 eV with scattering angles ranging from 10 deg. to 130 deg. We compare our results to available experimental measurements and recent convergent close-coupling calculations. Our results resolve significant discrepancies that existed between theory and past experiments.

  10. Detection of nerve gases using surface-enhanced Raman scattering substrates with high droplet adhesion

    NASA Astrophysics Data System (ADS)

    Hakonen, Aron; Rindzevicius, Tomas; Schmidt, Michael Stenbæk; Andersson, Per Ola; Juhlin, Lars; Svedendahl, Mikael; Boisen, Anja; Käll, Mikael

    2016-01-01

    Threats from chemical warfare agents, commonly known as nerve gases, constitute a serious security issue of increasing global concern because of surging terrorist activity worldwide. However, nerve gases are difficult to detect using current analytical tools and outside dedicated laboratories. Here we demonstrate that surface-enhanced Raman scattering (SERS) can be used for sensitive detection of femtomol quantities of two nerve gases, VX and Tabun, using a handheld Raman device and SERS substrates consisting of flexible gold-covered Si nanopillars. The substrate surface exhibits high droplet adhesion and nanopillar clustering due to elasto-capillary forces, resulting in enrichment of target molecules in plasmonic hot-spots with high Raman enhancement. The results may pave the way for strategic life-saving SERS detection of chemical warfare agents in the field.Threats from chemical warfare agents, commonly known as nerve gases, constitute a serious security issue of increasing global concern because of surging terrorist activity worldwide. However, nerve gases are difficult to detect using current analytical tools and outside dedicated laboratories. Here we demonstrate that surface-enhanced Raman scattering (SERS) can be used for sensitive detection of femtomol quantities of two nerve gases, VX and Tabun, using a handheld Raman device and SERS substrates consisting of flexible gold-covered Si nanopillars. The substrate surface exhibits high droplet adhesion and nanopillar clustering due to elasto-capillary forces, resulting in enrichment of target molecules in plasmonic hot-spots with high Raman enhancement. The results may pave the way for strategic life-saving SERS detection of chemical warfare agents in the field. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06524k

  11. An analytic formula for the relativistic incoherent Thomson backscattering spectrum for a drifting bi-Maxwellian plasma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Naito, O.

    2015-08-15

    An analytic formula has been derived for the relativistic incoherent Thomson backscattering spectrum for a drifting anisotropic plasma when the scattering vector is parallel to the drifting direction. The shape of the scattering spectrum is insensitive to the electron temperature perpendicular to the scattering vector, but its amplitude may be modulated. As a result, while the measured temperature correctly represents the electron distribution parallel to the scattering vector, the electron density may be underestimated when the perpendicular temperature is higher than the parallel temperature. Since the scattering spectrum in shorter wavelengths is greatly enhanced by the existence of drift, themore » diagnostics might be used to measure local electron current density in fusion plasmas.« less

  12. Seeing real-space dynamics of liquid water through inelastic x-ray scattering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Iwashita, Takuya; Wu, Bin; Chen, Wei-Ren

    Water is ubiquitous on earth, but we know little about the real-space motion of molecules in liquid water. We demonstrate that high-resolution inelastic x-ray scattering measurement over a wide range of momentum and energy transfer makes it possible to probe real-space, real-time dynamics of water molecules through the so-called Van Hove function. Water molecules are found to be strongly correlated in space and time with coupling between the first and second nearest-neighbor molecules. The local dynamic correlation of molecules observed here is crucial to a fundamental understanding of the origin of the physical properties of water, including viscosity. The resultsmore » also suggest that the quantum-mechanical nature of hydrogen bonds could influence its dynamics. Finally, the approach used here offers a powerful experimental method for investigating real-space dynamics of liquids.« less

  13. Seeing real-space dynamics of liquid water through inelastic x-ray scattering

    DOE PAGES

    Iwashita, Takuya; Wu, Bin; Chen, Wei-Ren; ...

    2017-12-22

    Water is ubiquitous on earth, but we know little about the real-space motion of molecules in liquid water. We demonstrate that high-resolution inelastic x-ray scattering measurement over a wide range of momentum and energy transfer makes it possible to probe real-space, real-time dynamics of water molecules through the so-called Van Hove function. Water molecules are found to be strongly correlated in space and time with coupling between the first and second nearest-neighbor molecules. The local dynamic correlation of molecules observed here is crucial to a fundamental understanding of the origin of the physical properties of water, including viscosity. The resultsmore » also suggest that the quantum-mechanical nature of hydrogen bonds could influence its dynamics. Finally, the approach used here offers a powerful experimental method for investigating real-space dynamics of liquids.« less

  14. Surface enhanced Raman scattering activity of dual-functional Fe3O4/Au composites

    NASA Astrophysics Data System (ADS)

    Wang, Li-Ping; Huang, Yu-Bin; Lai, Ying-Huang

    2018-03-01

    There is a high demand for multifunctional materials that can integrate sample collection and sensing. In this study, magnetic Fe3O4 clusters were fabricated using a simple solvent-thermal method. The effect of the reductant (sodium citrate, SC) on the structure and morphology of Fe3O4 was examined by the variation in the reagent amount. The resulting Fe3O4 clusters were functionalized with 3-aminopropyltriethoxysilane (APTES) to anchor Au nanoparticles to its surface. The fabricated composites were characterized by X-ray diffraction (XRD), transmission electron microscopy (TEM), and a superconducting quantum interference device (SQUID) magnetometer. Dual-functional Fe3O4/Au clusters were obtained, effectively combining magnetic and plasmonic optical properties. The magnetic Fe3O4 cluster cores permitted the adsorption of the probe molecules, while sample concentration and collection were carried out under an external magnetic field. In addition, 4-nitrothiophenol (4-NTP) was chosen as the probe molecule to examine the analyte concentration ability and surface-enhanced Raman scattering (SERS) activity of the Fe3O4/Au composites. The results indicated that the Fe3O4/Au clusters exhibit a prominent SERS effect. The best 4-NTP detection limit obtained was 1 × 10-8 M, with a corresponding SERS analytical enhancement factor (AEF) exceeding 2 × 105.

  15. Proline induced disruption of the structure and dynamics of water.

    PubMed

    Yu, Dehong; Hennig, Marcus; Mole, Richard A; Li, Ji Chen; Wheeler, Cheryl; Strässle, Thierry; Kearley, Gordon J

    2013-12-21

    We use quasi-elastic neutron scattering spectroscopy to study the diffusive motion of water molecules at ambient temperature as a function of the solute molar fraction of the amino acid, proline. We validate molecular dynamics simulations against experimental quasielastic neutron scattering data and then use the simulations to reveal, and understand, a strong dependence of the translational self-diffusion coefficient of water on the distance to the amino acid molecule. An analysis based on the juxtaposition of water molecules in the simulation shows that the rigidity of proline imposes itself on the local water structure, which disrupts the hydrogen-bond network of water leading to an increase in the mean lifetime of hydrogen bonds. The net effect is some distortion of the proline molecule and a slowing down of the water mobility.

  16. A United Effort for Crystal Growth, Neutron Scattering, and X-ray Scattering Studies of Novel Correlated Electron Materials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Young S.

    2015-02-12

    The research accomplishments during the award involved experimental studies of correlated electron systems and quantum magnetism. The techniques of crystal growth, neutron scattering, x-ray scattering, and thermodynamic & transport measurements were employed, and graduate students and postdoctoral research associates were trained in these techniques.

  17. Chemo-spectroscopic sensor for carboxyl terminus overexpressed in carcinoma cell membrane.

    PubMed

    Stanca, Sarmiza E; Matthäus, Christian; Neugebauer, Ute; Nietzsche, Sandor; Fritzsche, Wolfgang; Dellith, Jan; Heintzmann, Rainer; Weber, Karina; Deckert, Volker; Krafft, Christoph; Popp, Jürgen

    2015-10-01

    Certain carboxyl groups of the plasma membrane are involved in tumorgenesis processes. A gold core-hydroxyapatite shell (AuHA) nanocomposite is introduced as chemo-spectroscopic sensor to monitor these carboxyl groups of the cell membrane. Hydroxyapatite (HA) plays the role both of a chemical detector and of a biocompatible Raman marker. The principle of detection is based on chemical interaction between the hydroxyl groups of the HA and the carboxyl terminus of the proteins. The AuHA exhibits a surface enhanced Raman scattering (SERS) signal at 954 cm(-1) which can be used for its localization. The bio-sensing capacity of AuHA towards human skin epidermoid carcinoma (A431) and Chinese hamster ovary (CHO) cell lines is investigated using Raman microspectroscopic imaging. The localization of AuHA on cells is correlated with scanning electron microscopy, transmission electron microscopy and structured illumination fluorescence microscopy. This qualitative approach is a step towards a quantitative study of the proteins terminus. This method would enable further studies on the molecular profiling of the plasma membrane, in an attempt to provide accurate cell identification. Using a gold core-hydroxyapatite shell (AuHA) nanocomposite, the authors in this paper showed the feasibility of detecting and differentiating cell surface molecules by surface enhanced Raman scattering. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Spin-dependence of the electron scattering cross section by a magnetic layer system and the magneto-resistance

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, J.T.; Tang, F.; Brown, W.D.

    1998-12-20

    The authors present a theoretical model for calculating the spin-dependent cross section of the scattering of electrons by a magnetic layer system. The model demonstrates that the cross sections of the scattering are different for spin up and spin down electrons. The model assumes that the electrical resistivity in a conductor is proportional to the scattering cross section of the electron in it. It is believed to support the two channel mechanism in interpreting magneto-resistance (MR). Based on the model without considering the scattering due to the interfacial roughness and the spin flipping scattering, the authors have established a relationshipmore » between MR and the square of the magnetic moment in the bulk sample without considering the scattering due to the interfacial roughness and the spin flipping scattering. It can also qualitatively explain the MR difference between the current in plane (CIP) and current perpendicular to the plane (CPP) configurations. The predictions by the model agree well with the experimental findings.« less

  19. Resonance Raman scattering of β-carotene solution excited by visible laser beams into second singlet state.

    PubMed

    Lu, Luyao; Shi, Lingyan; Secor, Jeff; Alfano, Robert

    2018-02-01

    This study aimed to use self-absorption correction to determine the Raman enhancement of β-carotene. The Raman spectra of β-carotene solutions were measured using 488nm, 514nm, 532nm and 633nm laser beams, which exhibited significant resonance Raman (RR) enhancement when the laser energy approaches the electronic transition energy from S 0 to S 2 state. The Raman intensity and the actual resonance Raman gain without self-absorption from S 2 state by β-carotene were also obtained to evaluate the effect of self-absorption on RR scattering. Moreover, we observed the Raman intensity strength followed the absorption spectra. Our study found that, although 488nm and 514nm pumps seemed better for stronger RR enhancement, 532nm would be the optimum Raman pump laser with moderate RR enhancement due to reduced fluorescence and self-absorption. The 532nm excitation will be helpful for applying resonance Raman spectroscopy to investigate biological molecules in tissues. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Electron scattering in large water clusters from photoelectron imaging with high harmonic radiation.

    PubMed

    Gartmann, Thomas E; Hartweg, Sebastian; Ban, Loren; Chasovskikh, Egor; Yoder, Bruce L; Signorell, Ruth

    2018-06-06

    Low-energy electron scattering in water clusters (H2O)n with average cluster sizes of n < 700 is investigated by angle-resolved photoelectron spectroscopy using high harmonic radiation at photon energies of 14.0, 20.3, and 26.5 eV for ionization from the three outermost valence orbitals. The measurements probe the evolution of the photoelectron anisotropy parameter β as a function of cluster size. A remarkably steep decrease of β with increasing cluster size is observed, which for the largest clusters reaches liquid bulk values. Detailed electron scattering calculations reveal that neither gas nor condensed phase scattering can explain the cluster data. Qualitative agreement between experiment and simulations is obtained with scattering calculations that treat cluster scattering as an intermediate case between gas and condensed phase scattering.

Top