Quantum electron tunneling in respiratory complex I.

PubMed

Hayashi, Tomoyuki; Stuchebrukhov, Alexei A

2011-05-12

We have simulated the atomistic details of electronic wiring of all Fe/S clusters in complex I, a key enzyme in the respiratory electron transport chain. The tunneling current theory of many-electron systems is applied to the broken-symmetry (BS) states of the protein at the ZINDO level. While the one-electron tunneling approximation is found to hold in electron tunneling between the antiferromagnetic binuclear and tetranuclear Fe/S clusters without major orbital or spin rearrangement of the core electrons, induced polarization of the core electrons contributes significantly to decrease the electron transfer rates to 19-56 %. Calculated tunneling energy is about 3 eV higher than Fermi level in the band gap of the protein, which supports that the mechanism of electron transfer is quantum mechanical tunneling, as in the rest of the electron transport chain. Resulting electron tunneling pathways consist of up to three key contributing protein residues between neighboring Fe/S clusters. A signature of the wave properties of electrons is observed as distinct quantum interferences when multiple tunneling pathways exist. In N6a-N6b, electron tunnels along different pathways depending on the involved BS states, suggesting possible fluctuations of the tunneling pathways driven by the local protein environment. The calculated distance dependence of the electron transfer rates with internal water molecules included is in good agreement with a reported phenomenological relation.

Studying electron transfer through alkanethiol self-assembled monolayers on a hanging mercury drop electrode using potentiometric measurements.

PubMed

Cohen-Atiya, Meirav; Mandler, Daniel

2006-10-14

A new approach based on measuring the change of the open-circuit potential (OCP) of a hanging mercury drop electrode (HMDE), modified with alkanethiols of different chain length conducted in a solution containing a mixture of Ru(NH3)6(2+) and Ru(NH3)6(3+) is used for studying electron transfer across the monolayer. Following the time dependence of the OCP allowed the extraction of the kinetic parameters, such as the charge transfer resistance (R(ct)) and the electron transfer rate constant (k(et)), for different alkanethiol monolayers. An electron tunneling coefficient, beta, of 0.9 A(-1) was calculated for the monolayers on Hg.

New acceptor-bridge-donor strategy for enhancing NLO response with long-range excess electron transfer from the NH2...M/M3O donor (M = Li, Na, K) to inside the electron hole cage C20F19 acceptor through the unusual σ chain bridge (CH2)4.

PubMed

Bai, Yang; Zhou, Zhong-Jun; Wang, Jia-Jun; Li, Ying; Wu, Di; Chen, Wei; Li, Zhi-Ru; Sun, Chia-Chung

2013-04-04

Using the strong electron hole cage C20F19 acceptor, the NH2...M/M3O (M = Li, Na, and K) complicated donors with excess electron, and the unusual σ chain (CH2)4 bridge, we construct a new kind of electride molecular salt e(-)@C20F19-(CH2)4-NH2...M(+)/M3O(+) (M = Li, Na, and K) with excess electron anion inside the hole cage (to be encapsulated excess electron-hole pair) serving as a new A-B-D strategy for enhancing nonlinear optical (NLO) response. An interesting push-pull mechanism of excess electron generation and its long-range transfer is exhibited. The excess electron is pushed out from the (super)alkali atom M/M3O by the lone pair of NH2 in the donor and further pulled inside the hole cage C20F19 acceptor through the efficient long σ chain (CH2)4 bridge. Owing to the long-range electron transfer, the new designed electride molecular salts with the excess electron-hole pair exhibit large NLO response. For the e(-)@C20F19-(CH2)4-NH2...Na(+), its large first hyperpolarizability (β0) reaches up to 9.5 × 10(6) au, which is about 2.4 × 10(4) times the 400 au for the relative e(-)@C20F20...Na(+) without the extended chain (CH2)4-NH2. It is shown that the new strategy is considerably efficient in enhancing the NLO response for the salts. In addition, the effects of different bridges and alkali atomic number on β0 are also exhibited. Further, three modulating factors are found for enhancing NLO response. They are the σ chain bridge, bridge-end group with lone pair, and (super)alkali atom. The new knowledge may be significant for designing new NLO materials and electronic devices with electrons inside the cages. They may also be the basis of establishing potential organic chemistry with electron-hole pair.

Protein electron transfer: Dynamics and statistics

NASA Astrophysics Data System (ADS)

Matyushov, Dmitry V.

2013-07-01

Electron transfer between redox proteins participating in energy chains of biology is required to proceed with high energetic efficiency, minimizing losses of redox energy to heat. Within the standard models of electron transfer, this requirement, combined with the need for unidirectional (preferably activationless) transitions, is translated into the need to minimize the reorganization energy of electron transfer. This design program is, however, unrealistic for proteins whose active sites are typically positioned close to the polar and flexible protein-water interface to allow inter-protein electron tunneling. The high flexibility of the interfacial region makes both the hydration water and the surface protein layer act as highly polar solvents. The reorganization energy, as measured by fluctuations, is not minimized, but rather maximized in this region. Natural systems in fact utilize the broad breadth of interfacial electrostatic fluctuations, but in the ways not anticipated by the standard models based on equilibrium thermodynamics. The combination of the broad spectrum of static fluctuations with their dispersive dynamics offers the mechanism of dynamical freezing (ergodicity breaking) of subsets of nuclear modes on the time of reaction/residence of the electron at a redox cofactor. The separation of time-scales of nuclear modes coupled to electron transfer allows dynamical freezing. In particular, the separation between the relaxation time of electro-elastic fluctuations of the interface and the time of conformational transitions of the protein caused by changing redox state results in dynamical freezing of the latter for sufficiently fast electron transfer. The observable consequence of this dynamical freezing is significantly different reorganization energies describing the curvature at the bottom of electron-transfer free energy surfaces (large) and the distance between their minima (Stokes shift, small). The ratio of the two reorganization energies establishes the parameter by which the energetic efficiency of protein electron transfer is increased relative to the standard expectations, thus minimizing losses of energy to heat. Energetically efficient electron transfer occurs in a chain of conformationally quenched cofactors and is characterized by flattened free energy surfaces, reminiscent of the flat and rugged landscape at the stability basin of a folded protein.

Protein electron transfer: Dynamics and statistics.

PubMed

Matyushov, Dmitry V

2013-07-14

Electron transfer between redox proteins participating in energy chains of biology is required to proceed with high energetic efficiency, minimizing losses of redox energy to heat. Within the standard models of electron transfer, this requirement, combined with the need for unidirectional (preferably activationless) transitions, is translated into the need to minimize the reorganization energy of electron transfer. This design program is, however, unrealistic for proteins whose active sites are typically positioned close to the polar and flexible protein-water interface to allow inter-protein electron tunneling. The high flexibility of the interfacial region makes both the hydration water and the surface protein layer act as highly polar solvents. The reorganization energy, as measured by fluctuations, is not minimized, but rather maximized in this region. Natural systems in fact utilize the broad breadth of interfacial electrostatic fluctuations, but in the ways not anticipated by the standard models based on equilibrium thermodynamics. The combination of the broad spectrum of static fluctuations with their dispersive dynamics offers the mechanism of dynamical freezing (ergodicity breaking) of subsets of nuclear modes on the time of reaction/residence of the electron at a redox cofactor. The separation of time-scales of nuclear modes coupled to electron transfer allows dynamical freezing. In particular, the separation between the relaxation time of electro-elastic fluctuations of the interface and the time of conformational transitions of the protein caused by changing redox state results in dynamical freezing of the latter for sufficiently fast electron transfer. The observable consequence of this dynamical freezing is significantly different reorganization energies describing the curvature at the bottom of electron-transfer free energy surfaces (large) and the distance between their minima (Stokes shift, small). The ratio of the two reorganization energies establishes the parameter by which the energetic efficiency of protein electron transfer is increased relative to the standard expectations, thus minimizing losses of energy to heat. Energetically efficient electron transfer occurs in a chain of conformationally quenched cofactors and is characterized by flattened free energy surfaces, reminiscent of the flat and rugged landscape at the stability basin of a folded protein.

Characterizing Plasmonic Excitations of Quasi-2D Chains

NASA Astrophysics Data System (ADS)

Townsend, Emily; Bryant, Garnett

A quantum description of the optical response of nanostructures and other atomic-scale systems is desirable for modeling systems that use plasmons for quantum information transfer, or coherent transport and interference of quantum states, as well as systems small enough for electron tunneling or quantum confinement to affect the electronic states of the system. Such a quantum description is complicated by the fact that collective and single-particle excitations can have similar energies and thus will mix. We seek to better understand the excitations of nanosystems to identify which characteristics of the excitations are most relevant to modeling their behavior. In this work we use a quasi 2-dimensional linear atomic chain as a model system, and exact diagonalization of the many-body Hamiltonian to obtain its excitations. We compare this to previous work in 1-d chains which used a combination of criteria involving a many-body state's transfer dipole moment, balance, transfer charge, dynamical response, and induced-charge distribution to identify which excitations are plasmonic in character.

Structure-Function of the Cytochrome b 6f Complex of Oxygenic Photosynthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cramer, W. A.; Yamashita, E.; Baniulis, D.

2014-03-20

Structure–function of the major integral membrane cytochrome b 6f complex that functions in cyanobacteria, algae, and green plants to transfer electrons between the two reaction center complexes in the electron transport chain of oxygenic photosynthesis is discussed in the context of recently obtained crystal structures of the complex and soluble domains of cytochrome f and the Rieske iron–sulfur protein. The energy-transducing function of the complex, generation of the proton trans-membrane electrochemical potential gradient, centers on the oxidation/reduction pathways of the plastoquinol/plastoquinone (QH 2/Q), the proton donor/acceptor within the complex. These redox reactions are carried out by five redox prosthetic groupsmore » embedded in each monomer, the high potential two iron–two sulfur cluster and the heme of cytochrome f on the electropositive side (p) of the complex, two noncovalently bound b-type hemes that cross the complex and the membrane, and a covalently bound c-type heme (c n) on the electronegative side (n). These five redox-active groups are organized in high- (cyt f/[2Fe–2S] and low-potential (hemes b p, b n, c n) electron transport pathways that oxidize and reduce the quinol and quinone on the p- and n-sides in a Q-cycle-type mechanism, while translocating as many as 2 H + to the p-side aqueous side for every electron transferred through the high potential chain to the photosystem I reaction center. The presence of heme c n and the connection of the n-side of the membrane and b 6f complex to the cyclic electron transport chain indicate that the Q cycle in the oxygenic photosynthetic electron transport chain differs from those connected to the bc 1 complex in the mitochondrial respiratory chain and the chain in photosynthetic bacteria. Inferences from the structure and C2 symmetry of the complex for the pathway of QH 2/Q transfer within the complex, problems posed by the presence of lipid in the inter-monomer cavity, and the narrow portal for QH2 passage through the p-side oxidation site proximal to the [2Fe–2S] cluster are discussed.« less

Molecules with enhanced electronic polarizabilities based on defect-like states in conjugated polymers

NASA Technical Reports Server (NTRS)

Beratan, David N. (Inventor)

1991-01-01

Highly conjugated organic polymers typically have large non-resonant electronic susceptibilities, which give the molecules unusual optical properties. To enhance these properties, defects are introduced into the polymer chain. Examples include light doping of the conjugated polymer and synthesis, conjugated polymers which incorporate either electron donating or accepting groups, and conjugated polymers which contain a photoexcitable species capable of reversibly transferring its electron to an acceptor. Such defects in the chain permit enhancement of the second hyperpolarizability by at least an order of magnitude.

Substrate Effects for Atomic Chain Electronics

NASA Technical Reports Server (NTRS)

Yamada, Toshishige; Saini, Subhash (Technical Monitor)

1998-01-01

A substrate for future atomic chain electronics, where adatoms are placed at designated positions and form atomically precise device components, is studied theoretically. The substrate has to serve as a two-dimensional template for adatom mounting with a reasonable confinement barrier and also provide electronic isolation, preventing unwanted coupling between independent adatom structures. For excellent structural stability, we demand chemical bonding between the adatoms and substrate atoms, but then good electronic isolation may not be guaranteed. Conditions are clarified for good isolation. Because of the chemical bonding, fundamental adatom properties are strongly influenced: a chain with group IV adatoms having two chemical bonds, or a chain with group III adatoms having one chemical bond is semiconducting. Charge transfer from or to the substrate atoms brings about unintentional doping, and the electronic properties have to be considered for the entire combination of the adatom and substrate systems even if the adatom modes are well localized at the surface.

Cytochromes and iron sulfur proteins in sulfur metabolism of phototrophic bacteria

NASA Technical Reports Server (NTRS)

Fischer, U.

1985-01-01

Dissimilatory sulfur metabolism in phototrophic sulfur bacteria provides the bacteria with electrons for photosynthetic electron transport chain and, with energy. Assimilatory sulfate reduction is necessary for the biosynthesis of sulfur-containing cell components. Sulfide, thiosulfate, and elemental sulfur are the sulfur compounds most commonly used by phototrophic bacteria as electron donors for anoxygenic photosynthesis. Cytochromes or other electron transfer proteins, like high-potential-iron-sulfur protein (HIPIP) function as electron acceptors or donors for most enzymatic steps during the oxidation pathways of sulfide or thiosulfate. Yet, heme- or siroheme-containing proteins themselves undergo enzymatic activities in sulfur metabolism. Sirohemes comprise a porphyrin-like prosthetic group of sulfate reductase. eenzymatic reactions involve electron transfer. Electron donors or acceptors are necessary for each reaction. Cytochromes and iron sulfur problems, are able to transfer electrons.

Oxidation of the FAD cofactor to the 8-formyl-derivative in human electron-transferring flavoprotein

PubMed Central

Augustin, Peter; Toplak, Marina; Fuchs, Katharina; Gerstmann, Eva Christine; Prassl, Ruth; Winkler, Andreas; Macheroux, Peter

2018-01-01

The heterodimeric human (h) electron-transferring flavoprotein (ETF) transfers electrons from at least 13 different flavin dehydrogenases to the mitochondrial respiratory chain through a non-covalently bound FAD cofactor. Here, we describe the discovery of an irreversible and pH-dependent oxidation of the 8α-methyl group to 8-formyl-FAD (8f-FAD), which represents a unique chemical modification of a flavin cofactor in the human flavoproteome. Furthermore, a set of hETF variants revealed that several conserved amino acid residues in the FAD-binding pocket of electron-transferring flavoproteins are required for the conversion to the formyl group. Two of the variants generated in our study, namely αR249C and αT266M, cause glutaric aciduria type II, a severe inherited disease. Both of the variants showed impaired formation of 8f-FAD shedding new light on the potential molecular cause of disease development. Interestingly, the conversion of FAD to 8f-FAD yields a very stable flavin semiquinone that exhibited slightly lower rates of electron transfer in an artificial assay system than hETF containing FAD. In contrast, the formation of 8f-FAD enhanced the affinity to human dimethylglycine dehydrogenase 5-fold, indicating that formation of 8f-FAD modulates the interaction of hETF with client enzymes in the mitochondrial matrix. Thus, we hypothesize that the FAD cofactor bound to hETF is subject to oxidation in the alkaline (pH 8) environment of the mitochondrial matrix, which may modulate electron transport between client dehydrogenases and the respiratory chain. This discovery challenges the current concepts of electron transfer processes in mitochondria. PMID:29301933

Differentiated effect of ageing on the enzymes of Krebs' cycle, electron transfer complexes and glutamate metabolism of non-synaptic and intra-synaptic mitochondria from cerebral cortex.

PubMed

Villa, R F; Gorini, A; Hoyer, S

2006-11-01

The effect of ageing on the activity of enzymes linked to Krebs' cycle, electron transfer chain and glutamate metabolism was studied in three different types of mitochondria of cerebral cortex of 1-year old and 2-year old male Wistar rats. We assessed the maximum rate (V(max)) of the mitochondrial enzyme activities in non-synaptic perikaryal mitochondria, and in two populations of intra-synaptic mitochondria. The results indicated that: (i) in normal, steady-state cerebral cortex the values of the catalytic activities of the enzymes markedly differed in the various populations of mitochondria; (ii) in intra-synaptic mitochondria, ageing affected the catalytic properties of the enzymes linked to Krebs' cycle, electron transfer chain and glutamate metabolism; (iii) these changes were more evident in intra-synaptic "heavy" than "light" mitochondria. These results indicate a different age-related vulnerability of subpopulations of mitochondria in vivo located into synapses than non-synaptic ones.

Identification of hemoglobin variants by top-down mass spectrometry using selected diagnostic product ions.

PubMed

Coelho Graça, Didia; Hartmer, Ralf; Jabs, Wolfgang; Beris, Photis; Clerici, Lorella; Stoermer, Carsten; Samii, Kaveh; Hochstrasser, Denis; Tsybin, Yury O; Scherl, Alexander; Lescuyer, Pierre

2015-04-01

Hemoglobin disorder diagnosis is a complex procedure combining several analytical steps. Due to the lack of specificity of the currently used protein analysis methods, the identification of uncommon hemoglobin variants (proteoforms) can become a hard task to accomplish. The aim of this work was to develop a mass spectrometry-based approach to quickly identify mutated protein sequences within globin chain variants. To reach this goal, a top-down electron transfer dissociation mass spectrometry method was developed for hemoglobin β chain analysis. A diagnostic product ion list was established with a color code strategy allowing to quickly and specifically localize a mutation in the hemoglobin β chain sequence. The method was applied to the analysis of rare hemoglobin β chain variants and an (A)γ-β fusion protein. The results showed that the developed data analysis process allows fast and reliable interpretation of top-down electron transfer dissociation mass spectra by nonexpert users in the clinical area.

A new type of localized fast moving electronic excitations in molecular chains

NASA Astrophysics Data System (ADS)

Korshunova, A. N.; Lakhno, V. D.

2014-06-01

It is shown that in a Holstein molecular chain placed in a strong longitudinal electric field some new types of excitations can arise. These excitations can transfer a charge over large distance (more than 1000 nucleotide pairs) along the chain retaining approximately their shapes. Excitations are formed only when a strong electric field either exists or quickly arises under especially preassigned conditions. These excitations transfer a charge even in the case when Holstein polarons are practically immobile. The results obtained are applied to synthetic homogeneous PolyG/PolyC DNA duplexes. They can also be provide the basis for explanation of famous H.W. Fink and C. Schönenberger experiment on long-range charge transfer in DNA.

Electronic phase transition in hollandite titanates BaxTi8O16 +δ

NASA Astrophysics Data System (ADS)

Murata, R.; Sato, T.; Okuda, T.; Horibe, Y.; Tsukasaki, H.; Mori, S.; Yamaguchi, N.; Sugimoto, K.; Kawaguchi, S.; Takata, M.; Katsufuji, T.

2015-12-01

We studied the physical properties of hollandite titanates, BaxTi8O16 +δ , which have double chains of edge-sharing TiO6 octahedra with d electrons in the t2 g states. We found that there is an electronic phase transition at ˜220 K, at which various properties exhibit anomalies. This phase transition is characterized by a modulation in the TiO6 chains and a spectral weight transfer of over 2 eV in the optical conductivity spectrum, which are presumably caused by charge and orbital ordering of the Ti t2 g electrons.

Sites of electron transfer to membrane-bound copper and hydroperoxide-induced damage in the respiratory chain of Escherichia coli.

PubMed

Rodríguez-Montelongo, L; Farías, R N; Massa, E M

1995-10-20

Previous studies in Escherichia coli as a model system for peroxide toxicity (L. Rodríguez-Montelongo, L. C. De la Cruz-Rodríguez, R. N. Farías, and E. M. Massa, 1993, Biochim. Biophys. Acta 1144, 77-84) have shown that electron flow through the respiratory chain supports a membrane-associated Cu(II)/Cu(I) redox cycle involved in irreversible impairment of the respiratory system by tert-butyl hydroperoxide (t-BOOH). In this paper, E. coli mutants deficient in specific respiratory chain components have been used to determine the sites of copper reduction and the targets inactivated by t-BOOH. Two sites of electron transfer to membrane-bound copper were identified: one in the region between NADH and ubiquinone supported by NADH as electron donor and another localized between ubiquinone and the cytochromes supported by electrons coming from NADH, succinate, or D-lactate. Electron flow through the former site in the presence of t-BOOH led to inactivation of NADH dehydrogenase II, whereas electron flow through the latter site in the presence of the hydroperoxide led to damage of ubiquinone. In agreement with the above in vitro results with isolated membranes, copper-dependent inactivation of NADH dehydrogenase and ubiquinone was demonstrated in E. coli cells exposed to t-BOOH. It is proposed that the t-BOOH-induced damage is a consequence of t-butylalkoxy radical generation through a Fenton-type reaction mediated by redox cycling of membrane-bound copper at those two loci of the respiratory chain.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Antonacci, R.; Colombo, I.; Volta, M.

The electron-transfer flavoprotein (ETF), located in the mitochondrial matrix, is a nuclear-encoded enzyme delivering to the respiratory chain electrons by straight-chain acyl-CoA dehydrogenases and other dehydrogenases. ETF is composed of a 35-kDa [alpha]-subunit that is cleaved to a 32-kDa protein during mitochondrial import (ETFA) and a [beta]-subunit that reaches the mitochondrion unmodified (ETFB). The cDNA encoding both these subunits has been cloned and sequenced. 14 refs., 1 fig.

Integration of CuAAC Polymerization and Controlled Radical Polymerization into Electron Transfer Mediated "Click-Radical" Concurrent Polymerization.

PubMed

Xue, Wentao; Wang, Jie; Wen, Ming; Chen, Gaojian; Zhang, Weidong

2017-03-01

The successful chain-growth copper(I)-catalyzed azide-alkyne cycloaddition (CuAAC) polymerization employing Cu(0)/pentamethyldiethylenetriamine (PMDETA) and alkyl halide as catalyst is first investigated by a combination of nuclear magnetic resonance, gel-permeation chromatography, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. In addition, the electron transfer mediated "click-radical" concurrent polymerization utilizing Cu(0)/PMDETA as catalyst is successfully employed to generate well-defined copolymers, where controlled CuAAC polymerization of clickable ester monomer is progressed in the main chain acting as the polymer backbone, the controlled radical polymerization (CRP) of acrylic monomer is carried out in the side chain. Furthermore, it is found that there is strong collaborative effect and compatibility between CRP and CuAAC polymerization to improve the controllability. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Recent Developments in the Synthesis of Biomacromolecules and their Conjugates by Single Electron Transfer-Living Radical Polymerization.

PubMed

Lligadas, Gerard; Grama, Silvia; Percec, Virgil

2017-04-10

Single electron transfer-living radical polymerization (SET-LRP) represents a robust and versatile tool for the synthesis of vinyl polymers with well-defined topology and chain end functionality. The crucial step in SET-LRP is the disproportionation of the Cu(I)X generated by activation with Cu(0) wire, powder, or nascent Cu(0) generated in situ into nascent, extremely reactive Cu(0) atoms and nanoparticles and Cu(II)X 2 . Nascent Cu(0) activates the initiator and dormant chains via a homogeneous or heterogeneous outer-sphere single-electron transfer mechanism (SET-LRP). SET-LRP provides an ultrafast polymerization of a plethora of monomers (e.g., (meth)-acrylates, (meth)-acrylamides, styrene, and vinyl chloride) including hydrophobic and water insoluble to hydrophilic and water soluble. Some advantageous features of SET-LRP are (i) the use of Cu(0) wire or powder as readily available catalysts under mild reaction conditions, (ii) their excellent control over molecular weight evolution and distribution as well as polymer chain ends, (iii) their high functional group tolerance allowing the polymerization of commercial-grade monomers, and (iv) the limited purification required for the resulting polymers. In this Perspective, we highlight the recent advancements of SET-LRP in the synthesis of biomacromolecules and of their conjugates.

Theoretical study on the spectroscopic and third-order nonlinear optical properties of two-dimensional charge-transfer pyrazine derivatives

NASA Astrophysics Data System (ADS)

Li, Haipeng; Zhang, Yi; Bi, Zetong; Xu, Runfeng; Li, Mingxue; Shen, Xiaopeng; Tang, Gang; Han, Kui

2017-12-01

In this paper, density functional theory method was employed to study the electronic absorption spectrum and electronic static second hyperpolarisability of X-shaped pyrazine derivatives with two-dimensional charge-transfer structures. Computational results show that the push-pull electron abilities of the substituent groups and the length of the conjugated chains affect the electronic spectrum and static second hyperpolarisability of the pyrazine derivatives. As the push-pull electron abilities of the substituent groups or the length of the conjugated chains increases, the frontier molecular orbital energy gap decreases, resulting in increased second hyperpolarisability and redshift of the electronic absorption bands. The electronic absorption spectra of the pyrazine derivatives maintain good transparency in the blue light band. The electronic static second hyperpolarisability exhibits a linear relationship to the frontier molecular orbital energy gap. Particularly, increasing/decreasing the push-pull electron abilities of the substituent groups considerably affect the static second hyperpolarisability in long conjugated systems, which is important to the modulation of molecular organic nonlinear optical (NLO) properties. The studied pyrazine derivatives show large third-order NLO response and good transparency in the blue light band and are thus promising candidates as NLO materials for photonics applications.

Photoinduced Bimolecular Electron Transfer in Ionic Liquids: Cationic Electron Donors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Boning; Liang, Min; Zmich, Nicole

Recently, we have reported a systematic study of photoinduced electron-transfer reactions in ionic liquid solvents using neutral and anionic electron donors and a series of cyano-substituted anthracene acceptors [Wu, B.; Maroncelli, M.; Castner, E. W., Jr.Photoinduced Bimolecular Electron Transfer in Ionic Liquids. J. Am. Chem. Soc.139, 2017, 14568]. In this paper, we report complementary results for a cationic class of 1-alkyl-4-dimethylaminopyridinium electron donors. Reductive quenching of cyano-substituted anthracene fluorophores by these cationic quenchers is studied in solutions of acetonitrile and the ionic liquid 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide. Varying the length of the alkyl chain permits tuning of the quencher diffusivities in solution.more » The observed quenching kinetics are interpreted using a diffusion-reaction analysis. Finally, together with results from the prior study, these results show that the intrinsic electron-transfer rate constant does not depend on the quencher charge in this family of reactions.« less

Photoinduced Bimolecular Electron Transfer in Ionic Liquids: Cationic Electron Donors

DOE PAGES

Wu, Boning; Liang, Min; Zmich, Nicole; ...

2018-01-29

Recently, we have reported a systematic study of photoinduced electron-transfer reactions in ionic liquid solvents using neutral and anionic electron donors and a series of cyano-substituted anthracene acceptors [Wu, B.; Maroncelli, M.; Castner, E. W., Jr.Photoinduced Bimolecular Electron Transfer in Ionic Liquids. J. Am. Chem. Soc.139, 2017, 14568]. In this paper, we report complementary results for a cationic class of 1-alkyl-4-dimethylaminopyridinium electron donors. Reductive quenching of cyano-substituted anthracene fluorophores by these cationic quenchers is studied in solutions of acetonitrile and the ionic liquid 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide. Varying the length of the alkyl chain permits tuning of the quencher diffusivities in solution.more » The observed quenching kinetics are interpreted using a diffusion-reaction analysis. Finally, together with results from the prior study, these results show that the intrinsic electron-transfer rate constant does not depend on the quencher charge in this family of reactions.« less

Dynamics driving function: new insights from electron transferring flavoproteins and partner complexes.

PubMed

Toogood, Helen S; Leys, David; Scrutton, Nigel S

2007-11-01

Electron transferring flavoproteins (ETFs) are soluble heterodimeric FAD-containing proteins that function primarily as soluble electron carriers between various flavoprotein dehydrogenases. ETF is positioned at a key metabolic branch point, responsible for transferring electrons from up to 10 primary dehydrogenases to the membrane-bound respiratory chain. Clinical mutations of ETF result in the often fatal disease glutaric aciduria type II. Structural and biophysical studies of ETF in complex with partner proteins have shown that ETF partitions the functions of partner binding and electron transfer between (a) a 'recognition loop', which acts as a static anchor at the ETF-partner interface, and (b) a highly mobile redox-active FAD domain. Together, this enables the FAD domain of ETF to sample a range of conformations, some compatible with fast interprotein electron transfer. This 'conformational sampling' enables ETF to recognize structurally distinct partners, whilst also maintaining a degree of specificity. Complex formation triggers mobility of the FAD domain, an 'induced disorder' mechanism contrasting with the more generally accepted models of protein-protein interaction by induced fit mechanisms. We discuss the implications of the highly dynamic nature of ETFs in biological interprotein electron transfer. ETF complexes point to mechanisms of electron transfer in which 'dynamics drive function', a feature that is probably widespread in biology given the modular assembly and flexible nature of biological electron transfer systems.

Amide Neighbouring-Group Effects in Peptides: Phenylalanine as Relay Amino Acid in Long-Distance Electron Transfer.

PubMed

Nathanael, Joses G; Gamon, Luke F; Cordes, Meike; Rablen, Paul R; Bally, Thomas; Fromm, Katharina M; Giese, Bernd; Wille, Uta

2018-05-04

In nature, proteins serve as media for long-distance electron transfer (ET) to carry out redox reactions in distant compartments. This ET occurs either by a single-step superexchange or through a multi-step charge hopping process, which uses side chains of amino acids as stepping stones. In this study we demonstrate that Phe can act as a relay amino acid for long-distance electron hole transfer through peptides. The considerably increased susceptibility of the aromatic ring to oxidation is caused by the lone pairs of neighbouring amide carbonyl groups, which stabilise the Phe radical cation. This neighbouring-amide-group effect helps improve understanding of the mechanism of extracellular electron transfer through conductive protein filaments (pili) of anaerobic bacteria during mineral respiration. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Dissimilatory Reduction of Extracellular Electron Acceptors in Anaerobic Respiration

PubMed Central

Richter, Katrin; Schicklberger, Marcus

2012-01-01

An extension of the respiratory chain to the cell surface is necessary to reduce extracellular electron acceptors like ferric iron or manganese oxides. In the past few years, more and more compounds were revealed to be reduced at the surface of the outer membrane of Gram-negative bacteria, and the list does not seem to have an end so far. Shewanella as well as Geobacter strains are model organisms to discover the biochemistry that enables the dissimilatory reduction of extracellular electron acceptors. In both cases, c-type cytochromes are essential electron-transferring proteins. They make the journey of respiratory electrons from the cytoplasmic membrane through periplasm and over the outer membrane possible. Outer membrane cytochromes have the ability to catalyze the last step of the respiratory chains. Still, recent discoveries provided evidence that they are accompanied by further factors that allow or at least facilitate extracellular reduction. This review gives a condensed overview of our current knowledge of extracellular respiration, highlights recent discoveries, and discusses critically the influence of different strategies for terminal electron transfer reactions. PMID:22179232

Quantum Electron Tunneling in Respiratory Complex I1

PubMed Central

Hayashi, Tomoyuki; Stuchebrukhov, Alexei A.

2014-01-01

We have simulated the atomistic details of electronic wiring of all Fe/S clusters in complex I, a key enzyme in the respiratory electron transport chain. The tunneling current theory of many-electron systems is applied to the broken-symmetry (BS) states of the protein at the ZINDO level. One-electron tunneling approximation is found to hold in electron tunneling between the anti-ferromagnetic binuclear and tetranuclear Fe/S clusters with moderate induced polarization of the core electrons. Calculated tunneling energy is about 3 eV higher than Fermi level in the band gap of the protein, which supports that the mechanism of electron transfer is quantum mechanical tunneling, as in the rest of electron transport chain. Resulting electron tunneling pathways consist of up to three key contributing protein residues between neighboring Fe/S clusters. A distinct signature of the wave properties of electrons is observed as quantum interferences when multiple tunneling pathways exist. In N6a-N6b, electron tunnels along different pathways depending on the involved BS states, suggesting possible fluctuations of the tunneling pathways driven by the local protein environment. The calculated distance dependence of the electron transfer rates with internal water molecules included are in good agreement with a reported phenomenological relation. PMID:21495666

Electronic shift register memory based on molecular electron-transfer reactions

NASA Technical Reports Server (NTRS)

Hopfield, J. J.; Onuchic, Jose Nelson; Beratan, David N.

1989-01-01

The design of a shift register memory at the molecular level is described in detail. The memory elements are based on a chain of electron-transfer molecules incorporated on a very large scale integrated (VLSI) substrate, and the information is shifted by photoinduced electron-transfer reactions. The design requirements for such a system are discussed, and several realistic strategies for synthesizing these systems are presented. The immediate advantage of such a hybrid molecular/VLSI device would arise from the possible information storage density. The prospect of considerable savings of energy per bit processed also exists. This molecular shift register memory element design solves the conceptual problems associated with integrating molecular size components with larger (micron) size features on a chip.

Biochemistry of Catabolic Reductive Dehalogenation.

PubMed

Fincker, Maeva; Spormann, Alfred M

2017-06-20

A wide range of phylogenetically diverse microorganisms couple the reductive dehalogenation of organohalides to energy conservation. Key enzymes of such anaerobic catabolic pathways are corrinoid and Fe-S cluster-containing, membrane-associated reductive dehalogenases. These enzymes catalyze the reductive elimination of a halide and constitute the terminal reductases of a short electron transfer chain. Enzymatic and physiological studies revealed the existence of quinone-dependent and quinone-independent reductive dehalogenases that are distinguishable at the amino acid sequence level, implying different modes of energy conservation in the respective microorganisms. In this review, we summarize current knowledge about catabolic reductive dehalogenases and the electron transfer chain they are part of. We review reaction mechanisms and the role of the corrinoid and Fe-S cluster cofactors and discuss physiological implications.

Experimental studies of fundamental issues in electron transfer through nanometer scale devices

NASA Astrophysics Data System (ADS)

Yamamoto, Hiromichi

Electron transfer reactions constitute many of the primary events in materials science, chemistry, physics, and biochemistry, e.g. the electron transport properties and photoexcited processes in solids and molecules, chemical reactions, corrosion, photosynthesis, respiration, and so forth. A self-assembled monolayer (SAM) film provides us with a unique environment not only to understand and manipulate the surface electronic properties of a solid, but also to control electron transfer processes at the interface. The first topic in this thesis describes the structure and electron tunneling characterization of alkanethiol SAMs on InP(100). Angle-resolved X-ray photoelectron spectroscopy was used to characterize the bonding of alkanethiols to n-InP surfaces and to measure the monolayer thickness. The results showed that the sulfur binds to In atoms on the surface, and provided film thicknesses of 6.4 A for C8H17SH, 11.1 A for C12H25SH, and 14.9 A for C16H 33SH, resulting in an average tilt angle of 55°. The analysis indicated that super-exchange coupling between the alkane chains plays an important role in defining electron tunneling barriers, especially for highly tilted chains. The second topic describes studies of cytochrome c bound to pure and mixed SAMs of o-terminated alkanethiol (terminated with pyridine, imidazole or nitrile groups) and alkanethiol on gold. Electrochemical methods are used to determine electron transfer rate constants of cytochrome c, and scanning tunneling microscopy to observe the cytochrome c on the SAM. Detailed analysis revealed direct association of the heme of cytochrome c with the terminal groups of the SAMs and a 'turning-over' of the electron transfer of cytochrome c from adiabatic to non-adiabatic regime. The third topic describes studies of oxidation and reduction of cytochrome c in solution through eleven different self-assembled monolayers (SAMs) on gold electrodes by cyclic voltammetry. Electron transfer rate constants of cytochrome c through the eleven SAMs ranged from ≤10-4 to ˜10-1 cm/sec. A strong correlation between the electron transfer rate constants and the hydrogen bonding ability of the SAM is identified. This correlation is discussed in terms of the dependence of the rate constant on the outer-sphere reorganization energy and the electronic coupling between the cytochrome and the differently terminated monolayer films.

Near-UV Photodissociation of Tryptic Peptide Cation Radicals. Scope and Effects of Amino Acid Residues and Radical Sites

NASA Astrophysics Data System (ADS)

Nguyen, Huong T. H.; Tureček, František

2017-07-01

Peptide cation-radical fragment ions of the z-type, [●AXAR+], [●AXAK+], and [●XAR+], where X = A, C, D, E, F, G, H, K, L, M, N, P, Y, and W, were generated by electron transfer dissociation of peptide dications and investigated by MS3-near-ultraviolet photodissociation (UVPD) at 355 nm. Laser-pulse dependence measurements indicated that the ion populations were homogeneous for most X residues except phenylalanine. UVPD resulted in dissociations of backbone CO-NH bonds that were accompanied by hydrogen atom transfer, producing fragment ions of the [yn]+ type. Compared with collision-induced dissociation, UVPD yielded less side-chain dissociations even for residues that are sensitive to radical-induced side-chain bond cleavages. The backbone dissociations are triggered by transitions to second ( B) excited electronic states in the peptide ion R-CH●-CONH- chromophores that are resonant with the 355-nm photon energy. Electron promotion increases the polarity of the B excited states, R-CH+-C●(O-)NH-, and steers the reaction to proceed by transfer of protons from proximate acidic Cα and amide nitrogen positions.

Effect of Molecular Interactions on Electron-Transfer and Antioxidant Activity of Bis(alkanol)selenides: A Radiation Chemical Study.

PubMed

Kumar, Pavitra V; Singh, Beena G; Phadnis, Prasad P; Jain, Vimal K; Priyadarsini, K Indira

2016-08-16

Understanding electron-transfer processes is crucial for developing organoselenium compounds as antioxidants and anti-inflammatory agents. To find new redox-active selenium antioxidants, we have investigated one-electron-transfer reactions between hydroxyl ((.) OH) radical and three bis(alkanol)selenides (SeROH) of varying alkyl chain length, using nanosecond pulse radiolysis. (.) OH radical reacts with SeROH to form radical adduct, which is converted primarily into a dimer radical cation (>Se∴Se<)(+) and α-{bis(hydroxyl alkyl)}-selenomethine radical along with a minor quantity of an intramolecularly stabilized radical cation. Some of these radicals have been subsequently converted to their corresponding selenoxide, and formaldehyde. Estimated yield of these products showed alkyl chain length dependency and correlated well with their antioxidant ability. Quantum chemical calculations suggested that compounds that formed more stable (>Se∴Se<)(+) , produced higher selenoxide and lower formaldehyde. Comparing these results with those for sulfur analogues confirmed for the first time the distinctive role of selenium in making such compounds better antioxidants. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Leveraging Electron Transfer Dissociation for Site Selective Radical Generation: Applications for Peptide Epimer Analysis

NASA Astrophysics Data System (ADS)

Lyon, Yana A.; Beran, Gregory; Julian, Ryan R.

2017-07-01

Traditional electron-transfer dissociation (ETD) experiments operate through a complex combination of hydrogen abundant and hydrogen deficient fragmentation pathways, yielding c and z ions, side-chain losses, and disulfide bond scission. Herein, a novel dissociation pathway is reported, yielding homolytic cleavage of carbon-iodine bonds via electronic excitation. This observation is very similar to photodissociation experiments where homolytic cleavage of carbon-iodine bonds has been utilized previously, but ETD activation can be performed without addition of a laser to the mass spectrometer. Both loss of iodine and loss of hydrogen iodide are observed, with the abundance of the latter product being greatly enhanced for some peptides after additional collisional activation. These observations suggest a novel ETD fragmentation pathway involving temporary storage of the electron in a charge-reduced arginine side chain. Subsequent collisional activation of the peptide radical produced by loss of HI yields spectra dominated by radical-directed dissociation, which can be usefully employed for identification of peptide isomers, including epimers.

Effect of the structure of imidazolium cations in [BF4](-)-type ionic liquids on direct electrochemistry and electrocatalysis of horseradish peroxidase in Nafion films.

PubMed

Lu, Lu; Huang, Xirong; Qu, Yinbo

2011-10-01

The direct electrochemistry and bioelectrocatalysis of horseradish peroxidase (HRP) in Nafion films at glassy carbon electrode (GCE) was investigated in three [BF(4)](-)-type room-temperature ionic liquids (ILs) to understand the structural effect of imidazolium cations. The three ILs are 1-ethyl-3-methylimidazolium tetrafluoroborate ([Emim][BF(4)]), 1-butyl-3-methylimidazolium tetrafluoroborate ([Bmim][BF(4)]) and 1-hexyl-3-methylimidazolium tetrafluoroborate ([Hmim][BF(4)]). A small amount of water in the three ILs is indispensable for maintaining the electrochemical activity of HRP in Nafion films, and the optimum water contents decrease with the increase of alkyl chain length on imidazole ring. Analysis shows that the optimum water contents are primarily determined by the hydrophilicity of ILs used. In contrast to aqueous medium, ILs media facilitate the direct electron transfer of HRP, and the electrochemical parameters obtained in different ILs are obviously related to the nature of ILs. The direct electron transfer between HRP and GCE is a surface-confined quasi-reversible single electron transfer process. The apparent heterogeneous electron transfer rate constant decreases gradually with the increase of alkyl chain length on imidazole ring, but the changing extent is relatively small. The electrocatalytic reduction current of H(2)O(2) at the present electrode decreases obviously with the increase of alkyl chain length, and the mass transfer of H(2)O(2) via diffusion in ILs should be responsible for the change. In addition, the modified electrode has good stability and reproducibility; the ability to tolerate high levels of F(-) has been greatly enhanced due to the use of Nafion film. When an appropriate mediator is included in the sensing layer, a sensitive nonaqueous biosensor could be fabricated. Copyright © 2011 Elsevier B.V. All rights reserved.

Assignment of Etfdh, Etfb, and Etfa to chromosomes 3, 7, and 13: The mouse homologs of genes respondible for glutaric acidemia type II in human

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, R.A.; Dowler, L.L.; Angeloni, S.V.

Electron transfer flavoprotein (composed of {alpha} and {beta} subunits) is an obligatory electron acceptor for several dehydrogenases and is located in the mitochondrial matrix. Electrons accepted by electron transfer flavo-protein (ETF) are transferred to the main mitochondrial respiratory chain by the way of ETF dehydrogenase (ETFDH). In humans, deficiency of ETF or ETFDH leads to glutaric acidemia type II, an inherited metabolic disorder that can be fatal in its neonatal form and is characterized by severe hypoketotic hypoglycemia and acidosis. We used cDNA probes for the Etfdh, Etfb, and Etfa genes to determine localization of these mouse genes to chromosomesmore » 3, 7, and 13. 18 refs., 3 figs.« less

Engineering live cell surfaces with functional polymers via cytocompatible controlled radical polymerization

NASA Astrophysics Data System (ADS)

Niu, Jia; Lunn, David J.; Pusuluri, Anusha; Yoo, Justin I.; O'Malley, Michelle A.; Mitragotri, Samir; Soh, H. Tom; Hawker, Craig J.

2017-06-01

The capability to graft synthetic polymers onto the surfaces of live cells offers the potential to manipulate and control their phenotype and underlying cellular processes. Conventional grafting-to strategies for conjugating preformed polymers to cell surfaces are limited by low polymer grafting efficiency. Here we report an alternative grafting-from strategy for directly engineering the surfaces of live yeast and mammalian cells through cell surface-initiated controlled radical polymerization. By developing cytocompatible PET-RAFT (photoinduced electron transfer-reversible addition-fragmentation chain-transfer polymerization), synthetic polymers with narrow polydispersity (Mw/Mn < 1.3) could be obtained at room temperature in 5 minutes. This polymerization strategy enables chain growth to be initiated directly from chain-transfer agents anchored on the surface of live cells using either covalent attachment or non-covalent insertion, while maintaining high cell viability. Compared with conventional grafting-to approaches, these methods significantly improve the efficiency of grafting polymer chains and enable the active manipulation of cellular phenotypes.

Hybrid fusions show that inter-monomer electron transfer robustly supports cytochrome bc{sub 1} function in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ekiert, Robert; Czapla, Monika; Sarewicz, Marcin

2014-08-22

Highlights: • We used hybrid fusion bc{sub 1} complex to test inter-monomer electron transfer in vivo. • Cross-inactivated complexes were able to sustain photoheterotrophic growth. • Inter-monomer electron transfer supports catalytic cycle in vivo. • bc{sub 1} dimer is functional even when cytochrome b subunits come from different species. - Abstract: Electronic connection between Q{sub o} and Q{sub i} quinone catalytic sites of dimeric cytochrome bc{sub 1} is a central feature of the energy-conserving Q cycle. While both the intra- and inter-monomer electron transfers were shown to connect the sites in the enzyme, mechanistic and physiological significance of the lattermore » remains unclear. Here, using a series of mutated hybrid cytochrome bc{sub 1}-like complexes, we show that inter-monomer electron transfer robustly sustains the function of the enzyme in vivo, even when the two subunits in a dimer come from different species. This indicates that minimal requirement for bioenergetic efficiency is to provide a chain of cofactors for uncompromised electron flux between the catalytic sites, while the details of protein scaffold are secondary.« less

Cardiolipin Fatty Acid Remodeling Regulates Mitochondrial Function by Modifying the Electron Entry Point in the Respiratory Chain

PubMed Central

Vergeade, Aurelia; Bertram, Clinton C.; Bikineyeva, Alfiya T.; Zackert, William E.; Zinkel, Sandra S.; May, James M.; Dikalov, Sergey I.; Roberts, L. Jackson; Boutaud, Olivier

2016-01-01

Modifications of cardiolipin (CL) levels or compositions are associated with changes in mitochondrial function in a wide range of pathologies. We have made the discovery that acetaminophen remodels CL fatty acids composition from tetralinoleoyl to linoleoyltrioleoyl-CL, a remodeling that is associated with decreased mitochondrial respiration. Our data show that CL remodeling causes a shift in electron entry from complex II to the β-oxidation electron transfer flavoprotein quinone oxidoreductase (ETF/QOR) pathway. These data demonstrate that electron entry in the respiratory chain is regulated by CL fatty acid composition and provide proof-of-concept that pharmacological intervention can be used to modify CL composition. PMID:27085476

Constraint-based modeling of carbon fixation and the energetics of electron transfer in Geobacter metallireducens.

PubMed

Feist, Adam M; Nagarajan, Harish; Rotaru, Amelia-Elena; Tremblay, Pier-Luc; Zhang, Tian; Nevin, Kelly P; Lovley, Derek R; Zengler, Karsten

2014-04-01

Geobacter species are of great interest for environmental and biotechnology applications as they can carry out direct electron transfer to insoluble metals or other microorganisms and have the ability to assimilate inorganic carbon. Here, we report on the capability and key enabling metabolic machinery of Geobacter metallireducens GS-15 to carry out CO2 fixation and direct electron transfer to iron. An updated metabolic reconstruction was generated, growth screens on targeted conditions of interest were performed, and constraint-based analysis was utilized to characterize and evaluate critical pathways and reactions in G. metallireducens. The novel capability of G. metallireducens to grow autotrophically with formate and Fe(III) was predicted and subsequently validated in vivo. Additionally, the energetic cost of transferring electrons to an external electron acceptor was determined through analysis of growth experiments carried out using three different electron acceptors (Fe(III), nitrate, and fumarate) by systematically isolating and examining different parts of the electron transport chain. The updated reconstruction will serve as a knowledgebase for understanding and engineering Geobacter and similar species.

Styrene-spaced copolymers including anthraquinone and β-O-4 lignin model units: synthesis, characterization and reactivity under alkaline pulping conditions.

PubMed

Megiatto, Jackson D; Cazeils, Emmanuel; Ham-Pichavant, Frédérique; Grelier, Stéphane; Gardrat, Christian; Castellan, Alain

2012-05-14

A series of random copoly(styrene)s has been synthesized via radical polymerization of functionalized anthraquinone (AQ) and β-O-4 lignin model monomers. The copolymers were designed to have a different number of styrene spacer groups between the AQ and β-O-4 lignin side chains aiming at investigating the distance effects on AQ/β-O-4 electron transfer mechanisms. A detailed molecular characterization, including techniques such as size exclusion chromatography, MALDI-TOF mass spectrometry, and (1)H, (13)C, (31)P NMR and UV-vis spectroscopies, afforded quantitative information about the composition of the copolymers as well as the average distribution of the AQ and β-O-4 groups in the macromolecular structures. TGA and DSC thermal analysis have indicated that the copolymers were thermally stable under regular pulping conditions, revealing the inertness of the styrene polymer backbone in the investigation of electron transfer mechanisms. Alkaline pulping experiments showed that close contact between the redox active side chains in the copolymers was fundamental for an efficient degradation of the β-O-4 lignin model units, highlighting the importance of electron transfer reactions in the lignin degradation mechanisms catalyzed by AQ. In the absence of glucose, AQ units oxidized phenolic β-O-4 lignin model parts, mainly by electron transfer leading to vanillin as major product. By contrast, in presence of glucose, anthrahydroquinone units (formed by reduction of AQ) reduced the quinone-methide units (issued by dehydration of phenolic β-O-4 lignin model part) mainly by electron transfer leading to guaiacol as major product. Both processes were distance dependent.

Specific Interaction between Redox Phospholipid Polymers and Plastoquinone in Photosynthetic Electron Transport Chain.

PubMed

Tanaka, Kenya; Kaneko, Masahiro; Ishikawa, Masahito; Kato, Souichiro; Ito, Hidehiro; Kamachi, Toshiaki; Kamiya, Kazuhide; Nakanishi, Shuji

2017-04-19

Redox phospholipid polymers added in culture media are known to be capable of extracting electrons from living photosynthetic cells across bacterial cell membranes with high cytocompatibility. In the present study, we identify the intracellular redox species that transfers electrons to the polymers. The open-circuit electrochemical potential of an electrolyte containing the redox polymer and extracted thylakoid membranes shift to positive (or negative) under light irradiation, when an electron transport inhibitor specific to plastoquinone is added upstream (or downstream) in the photosynthetic electron transport chain. The same trend is also observed for a medium containing living photosynthetic cells of Synechococcus elongatus PCC7942. These results clearly indicate that the phospholipid redox polymers extract photosynthetic electrons mainly from plastoquinone. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

First principles design of a core bioenergetic transmembrane electron-transfer protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goparaju, Geetha; Fry, Bryan A.; Chobot, Sarah E.

Here we describe the design, Escherichia coli expression and characterization of a simplified, adaptable and functionally transparent single chain 4-α-helix transmembrane protein frame that binds multiple heme and light activatable porphyrins. Such man-made cofactor-binding oxidoreductases, designed from first principles with minimal reference to natural protein sequences, are known as maquettes. This design is an adaptable frame aiming to uncover core engineering principles governing bioenergetic transmembrane electron-transfer function and recapitulate protein archetypes proposed to represent the origins of photosynthesis. This article is part of a Special Issue entitled Biodesign for Bioenergetics — the design and engineering of electronic transfer cofactors, proteinsmore » and protein networks, edited by Ronald L. Koder and J.L. Ross Anderson.« less

Photophysics and morphology of poly (3-dodecylthienylenevinylene)-[6,6]-phenyl-C{sub 61}-butyric acid methyl ester composite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lafalce, E.; Toglia, P.; Jiang, X.

2012-05-21

A series of low band gap poly(3-dodecylthienylenevinylene) (PTV) with controlled morphological order have been synthesized and blended with the electron acceptor [6,6]-phenyl-C{sub 61}-butyric acid methyl ester (PCBM) for organic photovoltaic devices. Two polymers with the most and least side chain regioregularity were chosen in this work, namely the PTV010 and PTV55, respectively. Using photoluminescence, photo-induced absorption spectroscopy, and atomic force microscopy, we find no direct evidence of photoinduced charge transfer between the two constituents, independent of the bulk-heterojunction morphology of the film, although the possibility of formation of P{sup +}/C{sub 60}{sup -} charge transfer complex was not completely ruled out.more » The large exciton binding energy (E{sub b} = 0.6 eV) in PTV inhibits the photoinduced electron transfer from PTV to PCBM. In addition, excitons formed on polymer chains suffer ultrafast (« less

Charge-density analysis of a protein structure at subatomic resolution: the human aldose reductase case.

PubMed

Guillot, Benoît; Jelsch, Christian; Podjarny, Alberto; Lecomte, Claude

2008-05-01

The valence electron density of the protein human aldose reductase was analyzed at 0.66 angstroms resolution. The methodological developments in the software MoPro to adapt standard charge-density techniques from small molecules to macromolecular structures are described. The deformation electron density visible in initial residual Fourier difference maps was significantly enhanced after high-order refinement. The protein structure was refined after transfer of the experimental library multipolar atom model (ELMAM). The effects on the crystallographic statistics, on the atomic thermal displacement parameters and on the structure stereochemistry are analyzed. Constrained refinements of the transferred valence populations Pval and multipoles Plm were performed against the X-ray diffraction data on a selected substructure of the protein with low thermal motion. The resulting charge densities are of good quality, especially for chemical groups with many copies present in the polypeptide chain. To check the effect of the starting point on the result of the constrained multipolar refinement, the same charge-density refinement strategy was applied but using an initial neutral spherical atom model, i.e. without transfer from the ELMAM library. The best starting point for a protein multipolar refinement is the structure with the electron density transferred from the database. This can be assessed by the crystallographic statistical indices, including Rfree, and the quality of the static deformation electron-density maps, notably on the oxygen electron lone pairs. The analysis of the main-chain bond lengths suggests that stereochemical dictionaries would benefit from a revision based on recently determined unrestrained atomic resolution protein structures.

Electron Transfer Strategies Regulate Carbonate Mineral and Micropore Formation.

PubMed

Zeng, Zhirui; Tice, Michael M

2018-01-01

Some microbial carbonates are robust biosignatures due to their distinct morphologies and compositions. However, whether carbonates induced by microbial iron reduction have such features is unknown. Iron-reducing bacteria use various strategies to transfer electrons to iron oxide minerals (e.g., membrane-bound enzymes, soluble electron shuttles, nanowires, as well as different mechanisms for moving over or attaching to mineral surfaces). This diversity has the potential to create mineral biosignatures through manipulating the microenvironments in which carbonate precipitation occurs. We used Shewanella oneidensis MR-1, Geothrix fermentans, and Geobacter metallireducens GS-15, representing three different strategies, to reduce solid ferric hydroxide in order to evaluate their influence on carbonate and micropore formation (micro-size porosity in mineral rocks). Our results indicate that electron transfer strategies determined the morphology (rhombohedral, spherical, or long-chained) of precipitated calcium-rich siderite by controlling the level of carbonate saturation and the location of carbonate formation. Remarkably, electron transfer strategies also produced distinctive cell-shaped micropores in both carbonate and hydroxide minerals, thus producing suites of features that could potentially serve as biosignatures recording information about the sizes, shapes, and physiologies of iron-reducing organisms. Key Words: Microbial iron reduction-Micropore-Electron transfer strategies-Microbial carbonate. Astrobiology 18, 28-36.

Mechanisms for the Reduction of Actinides and Tc(VII) in Geobacter sulfurreducens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lloyd, Jonathan R.

2004-06-01

The mechanism of the reduction of U(VI) and Cr(VI) has now been studied in detail. Cr(VI) is reduced by one-electron transfer reactions to Cr(III), via a cell-bound Cr(V) intermediate identified by EPR spectroscopy. Studies with a cytochrome c7 mutant demonstrate that the electron transfer chain includes this protein which may be the terminal reductase for Cr(VI). Potential mechanisms of inhibition of Cr(III) precipitation, involving complex formation with organic acids commonly used as electron donors for metal reduction in the subsurface have also been identified. We have also initiated a collaboration with computational chemists led by Prof Ian Hillier in Manchester,more » to model metal binding to cytochrome c7, and subsequent electron transfer from the enzyme to the metal quantum mechanically.« less

Cucumber possesses a single terminal alternative oxidase gene that is upregulated by cold stress and in the mosaic (MSC) mitochondrial mutants

USDA-ARS?s Scientific Manuscript database

In plants alternative oxidase (AOX) is an important nuclear-encoded enzyme active in the mitochondrial electron-transport chain, transferring electrons from ubiquinol to alternative oxidase instead of the cytochrome pathway to yield ubiquinone and water. AOX protects against unexpected inhibition of...

Charge-transfer dynamics in one-dimensional C 60 chains

NASA Astrophysics Data System (ADS)

Pérez-Dieste, V.; Tamai, A.; Greber, T.; Chiuzbaˇian, S. G.; Patthey, L.

2008-06-01

Charge transfer in highly-ordered C 60 chains grown on a Cu(5 5 3) vicinal surface is studied by means of resonant photoemission. Tuning the light polarization, autoionization of the highest occupied molecular orbital (HOMO) was expected to detect anisotropy in this one-dimensional system. For one monolayer C 60 we found no signature of autoionization. This indicates that for an electron which is excited from the C 1s level of C 60 to the lowest unoccupied molecular orbital (LUMO), hybridization leads to delocalization on the femtosecond time-scale and no influence of the light polarization is observed.

Electron Flow through Proteins

PubMed Central

Gray, Harry B.; Winkler, Jay R.

2009-01-01

Electron transfers in photosynthesis and respiration commonly occur between metal-containing cofactors that are separated by large molecular distances. Employing laser flash-quench triggering methods, we have shown that 20-Å, coupling-limited FeII to RuIII and CuI to RuIII electron tunneling in Ru-modified cytochromes and blue copper proteins can occur on the microsecond timescale both in solutions and crystals. Redox equivalents can be transferred even longer distances by multistep tunneling, often called hopping, through intervening amino acid side chains. Our work has established that 20-Å hole hopping through an intervening tryptophan is two orders of magnitude faster than single-step electron tunneling in a Re-modified blue copper protein. PMID:20161522

First principles study of hydrogen adsorption on carbon nanowires.

NASA Astrophysics Data System (ADS)

Tapia, Alejandro; Aguilera, Luis; Murrieta, Gabriel; de Coss, Romeo

2007-03-01

Recently has been reported a new type of one-dimensional carbon structures. Carbon nanowires formed by a linear carbon-atom chain inside an armchair (5,5) carbon nanotube has been observed using high-resolution transmission electron microscopy. In the present work we have studied the changes in the electronic structure of a carbon nanowires and (5,5) single-walled carbon nanotubes (SWCN) when a hydrogen atom is adsorbed. We used the Density Functional Theory and the calculations where performed by the pseudopotentials LCAO method (SIESTA code) and the Generalized Gradient Approximation (GGA) for the exchange-correlation potential. We have analyzed the changes in the atomic structure, density of states (LDOS), and the local orbital population. We found charge transfer from the nanotube to the linear chain and the hydrogen atom, the electronic character of the chain and nanotube sub-systems in chain@SWCN is the same that in the corresponding isolated systems, chain or SWCN. But the hydrogen adsorption produced changes in the atomic estructure and the electronic properties. This research was supported by PRIORI-UADY under Grant No. FING-05-004 and Consejo Nacional de Ciencia y Tecnolog'ia (Conacyt) under Grants No. 43830-F and 49985-J.

Model-based confirmation of alternative substrates of mitochondrial electron transport chain.

PubMed

Kleessen, Sabrina; Araújo, Wagner L; Fernie, Alisdair R; Nikoloski, Zoran

2012-03-30

Discrimination of metabolic models based on high throughput metabolomics data, reflecting various internal and external perturbations, is essential for identifying the components that contribute to the emerging behavior of metabolic processes. Here, we investigate 12 different models of the mitochondrial electron transport chain (ETC) in Arabidopsis thaliana during dark-induced senescence in order to elucidate the alternative substrates to this metabolic pathway. Our findings demonstrate that the coupling of the proposed computational approach, based on dynamic flux balance analysis, with time-resolved metabolomics data results in model-based confirmations of the hypotheses that, during dark-induced senescence in Arabidopsis, (i) under conditions where the main substrate for the ETC are not fully available, isovaleryl-CoA dehydrogenase and 2-hydroxyglutarate dehydrogenase are able to donate electrons to the ETC, (ii) phytanoyl-CoA does not act even as an indirect substrate of the electron transfer flavoprotein/electron-transfer flavoprotein:ubiquinone oxidoreductase complex, and (iii) the mitochondrial γ-aminobutyric acid transporter has functional significance in maintaining mitochondrial metabolism. Our study provides a basic framework for future in silico studies of alternative pathways in mitochondrial metabolism under extended darkness whereby the role of its components can be computationally discriminated based on available molecular profile data.

Study on the photo-induced oxygen reordering in YBa2Cu3O6+x

NASA Astrophysics Data System (ADS)

Milić, M. M.; Lazarov, N. Dj.; Cucić, D. A.

2012-05-01

Effect of the long term illumination of the YBa2Cu3O6+x with visible light or ultraviolet irradiation on its superconducting properties was studied in the frame of a simple theoretical model, which assumes that photodoping triggers rearrangement of oxygen monomers in the chain layers thus causing the enhancement of the average chain length, lav. Since, according to the model of charge transfer mechanism, long CuO chains are better electronic hole donors than the short ones, increase of the average chain length induces additional holes transfer from chain layers to the superconducting CuO2 planes which in turn leads to the increase of the superconducting transition temperature Tc. By the use of the expression for the chain length probability distribution and numerically calculated values for the average chain length in the non-excited system, we were able to estimate the doping p (number of holes per one Cu atom in the superconducting CuO2 planes) and Tc enhancement due to photo-induced oxygen reordering. The theoretical results are compared with available experimental data.

Distinguishing the Roles of Thylakoid Respiratory Terminal Oxidases in the Cyanobacterium Synechocystis sp. PCC 6803.

PubMed

Ermakova, Maria; Huokko, Tuomas; Richaud, Pierre; Bersanini, Luca; Howe, Christopher J; Lea-Smith, David J; Peltier, Gilles; Allahverdiyeva, Yagut

2016-06-01

Various oxygen-utilizing electron sinks, including the soluble flavodiiron proteins (Flv1/3), and the membrane-localized respiratory terminal oxidases (RTOs), cytochrome c oxidase (Cox) and cytochrome bd quinol oxidase (Cyd), are present in the photosynthetic electron transfer chain of Synechocystis sp. PCC 6803. However, the role of individual RTOs and their relative importance compared with other electron sinks are poorly understood, particularly under light. Via membrane inlet mass spectrometry gas exchange, chlorophyll a fluorescence, P700 analysis, and inhibitor treatment of the wild type and various mutants deficient in RTOs, Flv1/3, and photosystem I, we investigated the contribution of these complexes to the alleviation of excess electrons in the photosynthetic chain. To our knowledge, for the first time, we demonstrated the activity of Cyd in oxygen uptake under light, although it was detected only upon inhibition of electron transfer at the cytochrome b6f site and in ∆flv1/3 under fluctuating light conditions, where linear electron transfer was drastically inhibited due to impaired photosystem I activity. Cox is mostly responsible for dark respiration and competes with P700 for electrons under high light. Only the ∆cox/cyd double mutant, but not single mutants, demonstrated a highly reduced plastoquinone pool in darkness and impaired gross oxygen evolution under light, indicating that thylakoid-based RTOs are able to compensate partially for each other. Thus, both electron sinks contribute to the alleviation of excess electrons under illumination: RTOs continue to function under light, operating on slower time ranges and on a limited scale, whereas Flv1/3 responds rapidly as a light-induced component and has greater capacity. © 2016 American Society of Plant Biologists. All Rights Reserved.

Alternative Electron-Transfer Channels Ensure Ultrafast Deactivation of Light-Induced Excited States in Riboflavin Binding Protein.

PubMed

Zanetti-Polzi, Laura; Aschi, Massimiliano; Amadei, Andrea; Daidone, Isabella

2017-07-20

Flavoproteins, containing flavin chromophores, are enzymes capable of transferring electrons at very high speeds. The ultrafast photoinduced electron-transfer (ET) kinetics of riboflavin binding protein to the excited riboflavin was studied by femtosecond spectroscopy and found to occur within a few hundred femtoseconds [ Zhong and Zewail, Proc. Natl. Acad. Sci. U.S.A. 2001, 98, 11867-11872 ]. This ultrafast kinetics was attributed to the presence of two aromatic rings that could transfer the electron to riboflavin: the side chains of tryptophan 156 and tyrosine 75. However, the underlying ET mechanism remained unclear. Here, using a hybrid quantum mechanical-molecular dynamics approach, we perform ET dynamics simulations taking into account the motion of the protein and the solvent upon ET. This approach reveals that ET occurs via a major reaction channel involving tyrosine 75 (83%) and a minor one involving tryptophan 156 (17%). We also show that the protein environment is designed to ensure the fast quenching of the riboflavin excited state.

Three-dimensional structure of human electron transfer flavoprotein to 2.1-Å resolution

PubMed Central

Roberts, David L.; Frerman, Frank E.; Kim, Jung-Ja P.

1996-01-01

Mammalian electron transfer flavoproteins (ETF) are heterodimers containing a single equivalent of flavin adenine dinucleotide (FAD). They function as electron shuttles between primary flavoprotein dehydrogenases involved in mitochondrial fatty acid and amino acid catabolism and the membrane-bound electron transfer flavoprotein ubiquinone oxidoreductase. The structure of human ETF solved to 2.1-Å resolution reveals that the ETF molecule is comprised of three distinct domains: two domains are contributed by the α subunit and the third domain is made up entirely by the β subunit. The N-terminal portion of the α subunit and the majority of the β subunit have identical polypeptide folds, in the absence of any sequence homology. FAD lies in a cleft between the two subunits, with most of the FAD molecule residing in the C-terminal portion of the α subunit. Alignment of all the known sequences for the ETF α subunits together with the putative FixB gene product shows that the residues directly involved in FAD binding are conserved. A hydrogen bond is formed between the N5 of the FAD isoalloxazine ring and the hydroxyl side chain of αT266, suggesting why the pathogenic mutation, αT266M, affects ETF activity in patients with glutaric acidemia type II. Hydrogen bonds between the 4′-hydroxyl of the ribityl chain of FAD and N1 of the isoalloxazine ring, and between αH286 and the C2-carbonyl oxygen of the isoalloxazine ring, may play a role in the stabilization of the anionic semiquinone. With the known structure of medium chain acyl-CoA dehydrogenase, we hypothesize a possible structure for docking the two proteins. PMID:8962055

First principles studies of electron tunneling in proteins

PubMed Central

Hayashi, Tomoyuki; Stuchebrukhov, Alexei A.

2014-01-01

A first principles study of electronic tunneling along the chain of seven Fe/S clusters in respiratory complex I, a key enzyme in the respiratory electron transport chain, is described. The broken-symmetry states of the Fe/S metal clusters calculated at both DFT and semi-empirical ZINDO levels were utilized to examine both the extremely weak electronic couplings between Fe/S clusters and the tunneling pathways, which provide a detailed atomistic-level description of the charge transfer process in the protein. One-electron tunneling approximation was found to hold within a reasonable accuracy, with only a moderate induced polarization of the core electrons. The method is demonstrated to be able to calculate accurately the coupling matrix elements as small as 10−4 cm−1. A distinct signature of the wave properties of electrons is observed as quantum interferences of multiple tunneling pathways. PMID:25383312

Precise Nanoelectronics with Adatom Chains

NASA Technical Reports Server (NTRS)

Yamada, Toshishige

1999-01-01

Adatom chains on an atomically regulated substrate will be building components in future precise nanoelectronics. Adatoms need to be secured with chemical bonding, but then electronic isolation between the adatom and substrate systems is not guaranteed. A one-dimensional model shows that good isolation with existence of surface states is expected on an s-p crossing substrate such as Si, Ge, or GaAs, reflecting the bulk nature of the substrate. Isolation is better if adatoms are electronically similar to the substrate atoms, and can be manipulated by hydrogenation. Chain structures with group IV adatoms with two chemical bonds, or group III adatoms with one chemical bond, are semiconducting, reflecting the surface nature of the substrate. These structures are unintentionally doped due to the charge transfer across the chemical bonds. Physical properties of adatom chains have to be determined for the unified adatom-substrate system.

Effect of dynamic disorder on charge transport along a pentacene chain

NASA Astrophysics Data System (ADS)

Böhlin, J.; Linares, M.; Stafström, S.

2011-02-01

The lattice equation of motion and a numerical solution of the time-dependent Schrödinger equation provide us with a microscopic picture of charge transport in highly ordered molecular crystals. We have chosen the pentacene single crystal as a model system, and we study charge transport as a function of phonon-mode time-dependent fluctuations in the intermolecular electron transfer integral. For comparison, we include similar fluctuations also in the intramolecular potentials. The variance in these energy quantities is closely related to the temperature of the system. The pentacene system is shown to be very sensitive to fluctuation in the intermolecular transfer integral, revealing a transition from adiabatic to nonadiabatic polaron transport for increasing temperatures. The extension of the polaron at temperatures above 200 K is limited by the electron localization length rather than the interplay between the electron transfer integral and the electron-phonon coupling strength.

Electron Transfer Strategies Regulate Carbonate Mineral and Micropore Formation

NASA Astrophysics Data System (ADS)

Zeng, Zhirui; Tice, Michael M.

2018-01-01

Some microbial carbonates are robust biosignatures due to their distinct morphologies and compositions. However, whether carbonates induced by microbial iron reduction have such features is unknown. Iron-reducing bacteria use various strategies to transfer electrons to iron oxide minerals (e.g., membrane-bound enzymes, soluble electron shuttles, nanowires, as well as different mechanisms for moving over or attaching to mineral surfaces). This diversity has the potential to create mineral biosignatures through manipulating the microenvironments in which carbonate precipitation occurs. We used Shewanella oneidensis MR-1, Geothrix fermentans, and Geobacter metallireducens GS-15, representing three different strategies, to reduce solid ferric hydroxide in order to evaluate their influence on carbonate and micropore formation (micro-size porosity in mineral rocks). Our results indicate that electron transfer strategies determined the morphology (rhombohedral, spherical, or long-chained) of precipitated calcium-rich siderite by controlling the level of carbonate saturation and the location of carbonate formation. Remarkably, electron transfer strategies also produced distinctive cell-shaped micropores in both carbonate and hydroxide minerals, thus producing suites of features that could potentially serve as biosignatures recording information about the sizes, shapes, and physiologies of iron-reducing organisms.

Molecular Electronic Shift Registers

NASA Technical Reports Server (NTRS)

Beratan, David N.; Onuchic, Jose N.

1990-01-01

Molecular-scale shift registers eventually constructed as parts of high-density integrated memory circuits. In principle, variety of organic molecules makes possible large number of different configurations and modes of operation for such shift-register devices. Several classes of devices and implementations in some specific types of molecules proposed. All based on transfer of electrons or holes along chains of repeating molecular units.

Electron transfer flavoprotein domain II orientation monitored using double electron-electron resonance between an enzymatically reduced, native FAD cofactor, and spin labels

PubMed Central

Swanson, Michael A; Kathirvelu, Velavan; Majtan, Tomas; Frerman, Frank E; Eaton, Gareth R; Eaton, Sandra S

2011-01-01

Human electron transfer flavoprotein (ETF) is a soluble mitochondrial heterodimeric flavoprotein that links fatty acid β-oxidation to the main respiratory chain. The crystal structure of human ETF bound to medium chain acyl-CoA dehydrogenase indicates that the flavin adenine dinucleotide (FAD) domain (αII) is mobile, which permits more rapid electron transfer with donors and acceptors by providing closer access to the flavin and allows ETF to accept electrons from at least 10 different flavoprotein dehydrogenases. Sequence homology is high and low-angle X-ray scattering is identical for Paracoccus denitrificans (P. denitrificans) and human ETF. To characterize the orientations of the αII domain of P. denitrificans ETF, distances between enzymatically reduced FAD and spin labels in the three structural domains were measured by double electron-electron resonance (DEER) at X- and Q-bands. An FAD to spin label distance of 2.8 ± 0.15 nm for the label in the FAD-containing αII domain (A210C) agreed with estimates from the crystal structure (3.0 nm), molecular dynamics simulations (2.7 nm), and rotamer library analysis (2.8 nm). Distances between the reduced FAD and labels in αI (A43C) were between 4.0 and 4.5 ± 0.35 nm and for βIII (A111C) the distance was 4.3 ± 0.15 nm. These values were intermediate between estimates from the crystal structure of P. denitrificans ETF and a homology model based on substrate-bound human ETF. These distances suggest that the αII domain adopts orientations in solution that are intermediate between those which are observed in the crystal structures of free ETF (closed) and ETF bound to a dehydrogenase (open). PMID:21308847

[The H+/e- ratio in the photosynthetic electron transport chain].

PubMed

Ivanov, B N; Shmeleva, V L; Ovchinnikova, V I

1983-06-01

The number of protons adsorbed by tylakoids during one electron passage along the photosynthetic electron transport chain (i.e. the H+/e- ratio) was measured in isolated pea chloroplasts upon continuous illumination. Methylviologen was used as electron acceptor on the reducing side of PS I. It was found that at pH 6.0 upon illumination with red light (lambda greater than 620 nm) at an intensity of 2 . 10(5) erg/cm2 . s ("intensive" light) the H+/e- ratio is equal to 3. Upon illumination of dark-adapted chloroplasts with a "weak" light (900 erg/cm2 . s) the H+/e- ratio is equal to 2. Upon illumination of the chloroplasts with a "weak" after "intensive" light the value of this ratio is close to 3. Azide when added to the reaction mixture may interfere with the accuracy of measurements of the value of the H+/e- ratio by affecting proton exchange. Based on the changes in the H+/e- ratio induced by illumination it was assumed that at saturating intensity of the illuminating light the electron transport chain passes into a so-called "light" state when the mechanisms of proton-electron coupling differing from those of rare electron transfer ("weak" light, flashes) are triggered on. At pH 6.0 the "light" state of the electron transport chain is maintained for some time in the dark.

Inhibition of photophosphorylation and electron transport chain in thylakoids by lasiodiplodin, a natural product from Botryosphaeria rhodina.

PubMed

Veiga, Thiago A M; Silva, Sebastião C; Francisco, Archundia-Camacho; Filho, Edson R; Vieira, Paulo C; Fernandes, João B; Silva, Maria F G F; Müller, Manfred W; Lotina-Hennsen, Blas

2007-05-16

Four natural products were isolated from the fungus Botryosphaeria rhodina, and their effects on photosynthesis were tested. Only lasiodiplodin (1) inhibited ATP synthesis and electron flow from water to methylviologen; therefore, it acts as a Hill reaction inhibitor in freshly lysed spinach thylakoids. Photosystem I and II and partial reactions as well as ATPase were measured in the presence of 1. Three new different sites of 1 interaction and inhibition were found: one at CF1, the second in the water-splitting enzyme, and the third at the electron-transfer path between P680 and QA; these targets are different from that of the synthetic herbicides present. Electron transport chain inhibition by 1 was corroborated by fluorescence induction kinetics studies.

Activation Thermodynamics and H/D Kinetic Isotope Effect of the Hox to HredH+ Transition in [FeFe] Hydrogenase.

PubMed

Ratzloff, Michael W; Wilker, Molly B; Mulder, David W; Lubner, Carolyn E; Hamby, Hayden; Brown, Katherine A; Dukovic, Gordana; King, Paul W

2017-09-20

Molecular complexes between CdSe nanocrystals and Clostridium acetobutylicum [FeFe] hydrogenase I (CaI) enabled light-driven control of electron transfer for spectroscopic detection of redox intermediates during catalytic proton reduction. Here we address the route of electron transfer from CdSe→CaI and activation thermodynamics of the initial step of proton reduction in CaI. The electron paramagnetic spectroscopy of illuminated CdSe:CaI showed how the CaI accessory FeS cluster chain (F-clusters) functions in electron transfer with CdSe. The H ox →H red H + reduction step measured by Fourier-transform infrared spectroscopy showed an enthalpy of activation of 19 kJ mol -1 and a ∼2.5-fold kinetic isotope effect. Overall, these results support electron injection from CdSe into CaI involving F-clusters, and that the H ox →H red H + step of catalytic proton reduction in CaI proceeds by a proton-dependent process.

Electron transfer of quinone self-assembled monolayers on a gold electrode.

PubMed

Nagata, Morio; Kondo, Masaharu; Suemori, Yoshiharu; Ochiai, Tsuyoshi; Dewa, Takehisa; Ohtsuka, Toshiaki; Nango, Mamoru

2008-06-15

Dialkyl disulfide-linked naphthoquinone, (NQ-Cn-S)2, and anthraquinone, (AQ-Cn-S)2, derivatives with different spacer alkyl chains (Cn: n=2, 6, 12) were synthesized and these quinone derivatives were self-assembled on a gold electrode. The formation of self-assembled monolayers (SAMs) of these derivatives on a gold electrode was confirmed by infrared reflection-absorption spectroscopy (IR-RAS). Electron transfer between the derivatives and the gold electrode was studied by cyclic voltammetry. On the cyclic voltammogram a reversible redox reaction between quinone (Q) and hydroquinone (QH2) was clearly observed under an aqueous condition. The formal potentials for NQ and AQ derivatives were -0.48 and -0.58 V, respectively, that did not depend on the spacer length. The oxidation and reduction peak currents were strongly dependent on the spacer alkyl chain length. The redox behavior of quinone derivatives depended on the pH condition of the buffer solution. The pH dependence was in agreement with a theoretical value of E 1/2 (mV)=E'-59pH for 2H+/2e(-) process in the pH range 3-11. In the range higher than pH 11, the value was estimated with E 1/2 (mV)=E'-30pH , which may correspond to H+/2e(-) process. The tunneling barrier coefficients (beta) for NQ and AQ SAMs were determined to be 0.12 and 0.73 per methylene group (CH2), respectively. Comparison of the structures and the alkyl chain length of quinones derivatives on these electron transfers on the electrode is made.

Surface molecular imprinting onto fluorescein-coated magnetic nanoparticlesvia reversible addition fragmentation chain transfer polymerization: A facile three-in-one system for recognition and separation of endocrine disrupting chemicals

NASA Astrophysics Data System (ADS)

Li, Ying; Dong, Cunku; Chu, Jia; Qi, Jingyao; Li, Xin

2011-01-01

In this study, we present a general protocol for the making of surface-imprinted magnetic fluorescence beads viareversible addition-fragmentation chain transfer polymerization. The resulting composites were characterized by X-ray diffraction analysis, transmission electron microscopy, scanning electron microscopy, fluorescence spectroscopy, Fourier transform infrared spectroscopy, and energy dispersive spectroscopy. The as-synthesized beads exhibited homogeneous polymer films (thickness of about 5.7 nm), spherical shape, high fluorescence intensity and magnetic property (Magnetization (Ms) = 3.67 emu g-1). The hybrids bind the original template 17β-estradiol with an appreciable selectivity over structurally related compounds. In addition, the resulting hybrids performed without obvious deterioration after five repeated cycles. This study therefore demonstrates the potential of molecularly imprinted polymers for the recognition and separation of endocrine disrupting chemicals.In this study, we present a general protocol for the making of surface-imprinted magnetic fluorescence beads viareversible addition-fragmentation chain transfer polymerization. The resulting composites were characterized by X-ray diffraction analysis, transmission electron microscopy, scanning electron microscopy, fluorescence spectroscopy, Fourier transform infrared spectroscopy, and energy dispersive spectroscopy. The as-synthesized beads exhibited homogeneous polymer films (thickness of about 5.7 nm), spherical shape, high fluorescence intensity and magnetic property (Magnetization (Ms) = 3.67 emu g-1). The hybrids bind the original template 17β-estradiol with an appreciable selectivity over structurally related compounds. In addition, the resulting hybrids performed without obvious deterioration after five repeated cycles. This study therefore demonstrates the potential of molecularly imprinted polymers for the recognition and separation of endocrine disrupting chemicals. Electronic supplementary information (ESI) available: Supplementary figure S1. The hysteresis loop of Fe3O4 (a), Fe3O4@SiO2 (b), and Fe3O4@SiO2-Dye-SiO2 (c). See DOI: 10.1039/c0nr00614a

Binding of the human "electron transferring flavoprotein" (ETF) to the medium chain acyl-CoA dehydrogenase (MCAD) involves an arginine and histidine residue.

PubMed

Parker, Antony R

2003-10-01

The interaction between the "electron transferring flavoprotein" (ETF) and medium chain acyl-CoA dehydrogenase (MCAD) enables successful flavin to flavin electron transfer, crucial for the beta-oxidation of fatty acids. The exact biochemical determinants for ETF binding to MCAD are unknown. Here we show that binding of human ETF, to MCAD, was inhibited by 2,3-butanedione and diethylpyrocarbonate (DEPC) and reversed by incubation with free arginine and hydroxylamine respectively. Spectral analyses of native ETF vs modified ETF suggested that flavin binding was not affected and that the loss of ETF activity with MCAD involved modification of one ETF arginine residue and one ETF histidine residue respectively. MCAD and octanoyl-CoA protected ETF against inactivation by both 2,3-butanedione and DEPC indicating that the arginine and histidine residues are present in or around the MCAD binding site. Comparison of exposed arginine and histidine residues among different ETF species, however, indicates that arginine residues are highly conserved but that histidine residues are not. These results lead us to conclude that this single arginine residue is essential for the binding of ETF to MCAD, but that the single histidine residue, although involved, is not.

Direct measurement of electron transfer distance decay constants of single redox proteins by electrochemical tunneling spectroscopy.

PubMed

Artés, Juan M; Díez-Pérez, Ismael; Sanz, Fausto; Gorostiza, Pau

2011-03-22

We present a method to measure directly and at the single-molecule level the distance decay constant that characterizes the rate of electron transfer (ET) in redox proteins. Using an electrochemical tunneling microscope under bipotentiostatic control, we obtained current−distance spectroscopic recordings of individual redox proteins confined within a nanometric tunneling gap at a well-defined molecular orientation. The tunneling current decays exponentially, and the corresponding decay constant (β) strongly supports a two-step tunneling ET mechanism. Statistical analysis of decay constant measurements reveals differences between the reduced and oxidized states that may be relevant to the control of ET rates in enzymes and biological electron transport chains.

Photosensitized oxidation of nicotinamide adenine dinucleotide by diethoxyphosphorus(V)tetraphenylporphyrin and its fluorinated derivative: Possibility of chain reaction

NASA Astrophysics Data System (ADS)

Hirakawa, Kazutaka; Murata, Atsushi

2018-01-01

Water-soluble porphyrins, diethoxyphosphorus(V)tetraphenylporphyrin (EtP(V)TPP) and its fluorinated analogue (FEtP(V)TPP), decreased the typical absorption around 340 nm of nicotinamide adenine dinucleotide (NADH) under visible light irradiation, indicating oxidative decomposition. A singlet oxygen quencher, sodium azide, and a triplet quencher, potassium iodide, slightly inhibited photosensitized NADH oxidation. However, these inhibitory effects were very small. Furthermore, the fluorescence lifetime of these P(V)porphyrins was decreased by NADH, suggesting the contribution of electron transfer to the singlet excited (S1) state of P(V)porphyrin. The redox potential measurement supports the electron transfer-mediated oxidation of NADH. The quantum yields of NADH photodecomposition by P(V)porphyrins could be estimated from the kinetic data and the effect of these quenchers on NADH oxidation. The obtained values suggest that the electron accepting by the S1 states of P(V)porphyrins triggers a chain reaction of NADH oxidation. This photosensitized reaction may play an important role in the photocytotoxicity of P(V)porphyrins. The axial ligand fluorination of P(V)porphyrins improved electron accepting ability. However, fluorination slightly suppressed static interaction with NADH, resulting in decreased oxidation quantum yield.

Internal electron transfer between hemes and Cu(II) bound at cysteine beta93 promotes methemoglobin reduction by carbon monoxide.

PubMed

Bonaventura, C; Godette, G; Tesh, S; Holm, D E; Bonaventura, J; Crumbliss, A L; Pearce, L L; Peterson, J

1999-02-26

Previous studies showed that CO/H2O oxidation provides electrons to drive the reduction of oxidized hemoglobin (metHb). We report here that Cu(II) addition accelerates the rate of metHb beta chain reduction by CO by a factor of about 1000. A mechanism whereby electron transfer occurs via an internal pathway coupling CO/H2O oxidation to Fe(III) and Cu(II) reduction is suggested by the observation that the copper-induced rate enhancement is inhibited by blocking Cys-beta93 with N-ethylmaleimide. Furthermore, this internal electron-transfer pathway is more readily established at low Cu(II) concentrations in Hb Deer Lodge (beta2His --> Arg) and other species lacking His-beta2 than in Hb A0. This difference is consistent with preferential binding of Cu(II) in Hb A0 to a high affinity site involving His-beta2, which is ineffective in promoting electron exchange between Cu(II) and the beta heme iron. Effective electron transfer is thus affected by Hb type but is not governed by the R left arrow over right arrow T conformational equilibrium. The beta hemes in Cu(II)-metHb are reduced under CO at rates close to those observed for cytochrome c oxidase, where heme and copper are present together in the oxygen-binding site and where internal electron transfer also occurs.

Electron-deficient triarylborane block copolymers: synthesis by controlled free radical polymerization and application in the detection of fluoride ions.

PubMed

Cheng, Fei; Bonder, Edward M; Jäkle, Frieder

2013-11-20

Luminescent triarylborane homo and block copolymers with well-defined chain architectures were synthesized via reversible addition-fragmentation chain transfer polymerization of a vinyl-functionalized borane monomer. The Lewis acid properties of the polymers were exploited in the luminescent detection of fluoride ions. A dual-responsive fluoride sensor was developed by taking advantage of the reversible self-assembly of a PNIPAM-based amphiphilic block copolymer. Anion detection in aqueous solution was realized by introducing positively charged pyridinium moieties along the polymer chain.

UCP1 deficiency causes brown fat respiratory chain depletion and sensitizes mitochondria to calcium overload-induced dysfunction.

PubMed

Kazak, Lawrence; Chouchani, Edward T; Stavrovskaya, Irina G; Lu, Gina Z; Jedrychowski, Mark P; Egan, Daniel F; Kumari, Manju; Kong, Xingxing; Erickson, Brian K; Szpyt, John; Rosen, Evan D; Murphy, Michael P; Kristal, Bruce S; Gygi, Steven P; Spiegelman, Bruce M

2017-07-25

Brown adipose tissue (BAT) mitochondria exhibit high oxidative capacity and abundant expression of both electron transport chain components and uncoupling protein 1 (UCP1). UCP1 dissipates the mitochondrial proton motive force (Δp) generated by the respiratory chain and increases thermogenesis. Here we find that in mice genetically lacking UCP1, cold-induced activation of metabolism triggers innate immune signaling and markers of cell death in BAT. Moreover, global proteomic analysis reveals that this cascade induced by UCP1 deletion is associated with a dramatic reduction in electron transport chain abundance. UCP1-deficient BAT mitochondria exhibit reduced mitochondrial calcium buffering capacity and are highly sensitive to mitochondrial permeability transition induced by reactive oxygen species (ROS) and calcium overload. This dysfunction depends on ROS production by reverse electron transport through mitochondrial complex I, and can be rescued by inhibition of electron transfer through complex I or pharmacologic depletion of ROS levels. Our findings indicate that the interscapular BAT of Ucp1 knockout mice exhibits mitochondrial disruptions that extend well beyond the deletion of UCP1 itself. This finding should be carefully considered when using this mouse model to examine the role of UCP1 in physiology.

Measuring Interference of Drug-Like Molecules with the Respiratory Chain: Toward the Early Identification of Mitochondrial Uncouplers in Lead Finding

PubMed Central

Matter, Hans; Diekert, Kerstin; Dörner, Wolfgang; Dröse, Stefan; Licher, Thomas

2013-01-01

Abstract The electron transport chain (ETC) couples electron transfer between donors and acceptors with proton transport across the inner mitochondrial membrane. The resulting electrochemical proton gradient is used to generate chemical energy in the form of adenosine triphosphate (ATP). Proton transfer is based on the activity of complex I–V proteins in the ETC. The overall electrical activity of these proteins can be measured by proton transfer using Solid Supported Membrane technology. We tested the activity of complexes I, III, and V in a combined assay, called oxidative phosphorylation assay (oxphos assay), by activating each complex with the corresponding substrate. The oxphos assay was used to test in-house substances from different projects and several drugs currently available on the market that have reported effects on mitochondrial functions. The resulting data were compared to the influence of the respective compounds on mitochondria as determined by oxygen consumption and to data generated with an ATP depletion assay. The comparison shows that the oxidative phosphorylation assay provides both a rapid approach for detecting interaction of compounds with respiratory chain proteins and information on their mode of interaction. Therefore, the oxphos assay is a useful tool to support structure activity relationship studies by allowing early identification of mitotoxicity and for analyzing the outcome of phenotypic screens that are susceptible to the generation of mitotoxicity-related artifacts. PMID:23992120

Model-based Confirmation of Alternative Substrates of Mitochondrial Electron Transport Chain

PubMed Central

Kleessen, Sabrina; Araújo, Wagner L.; Fernie, Alisdair R.; Nikoloski, Zoran

2012-01-01

Discrimination of metabolic models based on high throughput metabolomics data, reflecting various internal and external perturbations, is essential for identifying the components that contribute to the emerging behavior of metabolic processes. Here, we investigate 12 different models of the mitochondrial electron transport chain (ETC) in Arabidopsis thaliana during dark-induced senescence in order to elucidate the alternative substrates to this metabolic pathway. Our findings demonstrate that the coupling of the proposed computational approach, based on dynamic flux balance analysis, with time-resolved metabolomics data results in model-based confirmations of the hypotheses that, during dark-induced senescence in Arabidopsis, (i) under conditions where the main substrate for the ETC are not fully available, isovaleryl-CoA dehydrogenase and 2-hydroxyglutarate dehydrogenase are able to donate electrons to the ETC, (ii) phytanoyl-CoA does not act even as an indirect substrate of the electron transfer flavoprotein/electron-transfer flavoprotein:ubiquinone oxidoreductase complex, and (iii) the mitochondrial γ-aminobutyric acid transporter has functional significance in maintaining mitochondrial metabolism. Our study provides a basic framework for future in silico studies of alternative pathways in mitochondrial metabolism under extended darkness whereby the role of its components can be computationally discriminated based on available molecular profile data. PMID:22334689

Side-chain amino-acid-based pH-responsive self-assembled block copolymers for drug delivery and gene transfer.

PubMed

Kumar, Sonu; Acharya, Rituparna; Chatterji, Urmi; De, Priyadarsi

2013-12-10

Developing safe and effective nanocarriers for multitype of delivery system is advantageous for several kinds of successful biomedicinal therapy with the same carrier. In the present study, we have designed amino acid biomolecules derived hybrid block copolymers which can act as a promising vehicle for both drug delivery and gene transfer. Two representative natural chiral amino acid-containing (l-phenylalanine and l-alanine) vinyl monomers were polymerized via reversible addition-fragmentation chain transfer (RAFT) process in the presence of monomethoxy poly(ethylene glycol) based macro-chain transfer agents (mPEGn-CTA) for the synthesis of well-defined side-chain amino-acid-based amphiphilic block copolymers, monomethoxy poly(ethylene glycol)-b-poly(Boc-amino acid methacryloyloxyethyl ester) (mPEGn-b-P(Boc-AA-EMA)). The self-assembled micellar aggregation of these amphiphilic block copolymers were studied by fluorescence spectroscopy, atomic force microscopy (AFM) and scanning electron microscopy (SEM). Potential applications of these hybrid polymers as drug carrier have been demonstrated in vitro by encapsulation of nile red dye or doxorubicin drug into the core of the micellar nanoaggregates. Deprotection of side-chain Boc- groups in the amphiphilic block copolymers subsequently transformed them into double hydrophilic pH-responsive cationic block copolymers having primary amino groups in the side-chain terminal. The DNA binding ability of these cationic block copolymers were further investigated by using agarose gel retardation assay and AFM. The in vitro cytotoxicity assay demonstrated their biocompatible nature and these polymers can serve as "smart" materials for promising bioapplications.

Tracking Electron Uptake from a Cathode into Shewanella Cells: Implications for Energy Acquisition from Solid-Substrate Electron Donors

PubMed Central

Rajeev, Pournami; Jain, Abhiney; Pirbadian, Sahand; Okamoto, Akihiro; Gralnick, Jeffrey A.; El-Naggar, Mohamed Y.; Nealson, Kenneth H.

2018-01-01

ABSTRACT While typically investigated as a microorganism capable of extracellular electron transfer to minerals or anodes, Shewanella oneidensis MR-1 can also facilitate electron flow from a cathode to terminal electron acceptors, such as fumarate or oxygen, thereby providing a model system for a process that has significant environmental and technological implications. This work demonstrates that cathodic electrons enter the electron transport chain of S. oneidensis when oxygen is used as the terminal electron acceptor. The effect of electron transport chain inhibitors suggested that a proton gradient is generated during cathode oxidation, consistent with the higher cellular ATP levels measured in cathode-respiring cells than in controls. Cathode oxidation also correlated with an increase in the cellular redox (NADH/FMNH2) pool determined with a bioluminescence assay, a proton uncoupler, and a mutant of proton-pumping NADH oxidase complex I. This work suggested that the generation of NADH/FMNH2 under cathodic conditions was linked to reverse electron flow mediated by complex I. A decrease in cathodic electron uptake was observed in various mutant strains, including those lacking the extracellular electron transfer components necessary for anodic-current generation. While no cell growth was observed under these conditions, here we show that cathode oxidation is linked to cellular energy acquisition, resulting in a quantifiable reduction in the cellular decay rate. This work highlights a potential mechanism for cell survival and/or persistence on cathodes, which might extend to environments where growth and division are severely limited. PMID:29487241

Realization of a four-step molecular switch in scanning tunneling microscope manipulation of single chlorophyll-a molecules

PubMed Central

Iancu, Violeta; Hla, Saw-Wai

2006-01-01

Single chlorophyll-a molecules, a vital resource for the sustenance of life on Earth, have been investigated by using scanning tunneling microscope manipulation and spectroscopy on a gold substrate at 4.6 K. Chlorophyll-a binds on Au(111) via its porphyrin unit while the phytyl-chain is elevated from the surface by the support of four CH3 groups. By injecting tunneling electrons from the scanning tunneling microscope tip, we are able to bend the phytyl-chain, which enables the switching of four molecular conformations in a controlled manner. Statistical analyses and structural calculations reveal that all reversible switching mechanisms are initiated by a single tunneling-electron energy-transfer process, which induces bond rotation within the phytyl-chain. PMID:16954201

Effect of cationic plastoquinone SkQ1 on electron transfer reactions in chloroplasts and mitochondria from pea seedlings.

PubMed

Samuilov, V D; Kiselevsky, D B

2015-04-01

Plastoquinone bound with decyltriphenylphosphonium cation (SkQ1) penetrating through the membrane in nanomolar concentrations inhibited H2O2 generation in cells of epidermis of pea seedling leaves that was detected by the fluorescence of 2',7'-dichlorofluorescein. Photosynthetic electron transfer in chloroplasts isolated from pea leaves is suppressed by SkQ1 at micromolar concentrations: the electron transfer in chloroplasts under the action of photosystem II or I (with silicomolybdate or methyl viologen as electron acceptors, respectively) is more sensitive to SkQ1 than under the action of photosystem II + I (with ferricyanide or p-benzoquinone as electron acceptors). SkQ1 reduced by borohydride is oxidized by ferricyanide, p-benzoquinone, and, to a lesser extent, by silicomolybdate, but not by methyl viologen. SkQ1 is not effective as an electron acceptor supporting O2 evolution from water in illuminated chloroplasts. The data on suppression of photosynthetic O2 evolution or consumption show that SkQ1, similarly to phenazine methosulfate, causes conversion of the chloroplast redox-chain from non-cyclic electron transfer mode to the cyclic mode without O2 evolution. Oxidation of NADH or succinate in mitochondria isolated from pea roots is stimulated by SkQ1.

Hydrogen is a preferred intermediate in the energy-conserving electron transport chain of Methanosarcina barkeri.

PubMed

Kulkarni, Gargi; Kridelbaugh, Donna M; Guss, Adam M; Metcalf, William W

2009-09-15

Methanogens use an unusual energy-conserving electron transport chain that involves reduction of a limited number of electron acceptors to methane gas. Previous biochemical studies suggested that the proton-pumping F(420)H(2) dehydrogenase (Fpo) plays a crucial role in this process during growth on methanol. However, Methanosarcina barkeri Delta fpo mutants constructed in this study display no measurable phenotype on this substrate, indicating that Fpo plays a minor role, if any. In contrast, Delta frh mutants lacking the cytoplasmic F(420)-reducing hydrogenase (Frh) are severely affected in their ability to grow and make methane from methanol, and double Delta fpo/Delta frh mutants are completely unable to use this substrate. These data suggest that the preferred electron transport chain involves production of hydrogen gas in the cytoplasm, which then diffuses out of the cell, where it is reoxidized with transfer of electrons into the energy-conserving electron transport chain. This hydrogen-cycling metabolism leads directly to production of a proton motive force that can be used by the cell for ATP synthesis. Nevertheless, M. barkeri does have the flexibility to use the Fpo-dependent electron transport chain when needed, as shown by the poor growth of the Delta frh mutant. Our data suggest that the rapid enzymatic turnover of hydrogenases may allow a competitive advantage via faster growth rates in this freshwater organism. The mutant analysis also confirms the proposed role of Frh in growth on hydrogen/carbon dioxide and suggests that either Frh or Fpo is needed for aceticlastic growth of M. barkeri.

Identifying the molecular functions of electron transport proteins using radial basis function networks and biochemical properties.

PubMed

Le, Nguyen-Quoc-Khanh; Nguyen, Trinh-Trung-Duong; Ou, Yu-Yen

2017-05-01

The electron transport proteins have an important role in storing and transferring electrons in cellular respiration, which is the most proficient process through which cells gather energy from consumed food. According to the molecular functions, the electron transport chain components could be formed with five complexes with several different electron carriers and functions. Therefore, identifying the molecular functions in the electron transport chain is vital for helping biologists understand the electron transport chain process and energy production in cells. This work includes two phases for discriminating electron transport proteins from transport proteins and classifying categories of five complexes in electron transport proteins. In the first phase, the performances from PSSM with AAIndex feature set were successful in identifying electron transport proteins in transport proteins with achieved sensitivity of 73.2%, specificity of 94.1%, and accuracy of 91.3%, with MCC of 0.64 for independent data set. With the second phase, our method can approach a precise model for identifying of five complexes with different molecular functions in electron transport proteins. The PSSM with AAIndex properties in five complexes achieved MCC of 0.51, 0.47, 0.42, 0.74, and 1.00 for independent data set, respectively. We suggest that our study could be a power model for determining new proteins that belongs into which molecular function of electron transport proteins. Copyright © 2017 Elsevier Inc. All rights reserved.

The electron transfer flavoprotein: ubiquinone oxidoreductases.

PubMed

Watmough, Nicholas J; Frerman, Frank E

2010-12-01

Electron transfer flavoprotein: ubiqionone oxidoreductase (ETF-QO) is a component of the mitochondrial respiratory chain that together with electron transfer flavoprotein (ETF) forms a short pathway that transfers electrons from 11 different mitochondrial flavoprotein dehydrogenases to the ubiquinone pool. The X-ray structure of the pig liver enzyme has been solved in the presence and absence of a bound ubiquinone. This structure reveals ETF-QO to be a monotopic membrane protein with the cofactors, FAD and a [4Fe-4S](+1+2) cluster, organised to suggests that it is the flavin that serves as the immediate reductant of ubiquinone. ETF-QO is very highly conserved in evolution and the recombinant enzyme from the bacterium Rhodobacter sphaeroides has allowed the mutational analysis of a number of residues that the structure suggested are involved in modulating the reduction potential of the cofactors. These experiments, together with the spectroscopic measurement of the distances between the cofactors in solution have confirmed the intramolecular pathway of electron transfer from ETF to ubiquinone. This approach can be extended as the R. sphaeroides ETF-QO provides a template for investigating the mechanistic consequences of single amino acid substitutions of conserved residues that are associated with a mild and late onset variant of the metabolic disease multiple acyl-CoA dehydrogenase deficiency (MADD). Copyright © 2010 Elsevier B.V. All rights reserved.

Efficiency of photochemical stages of photosynthesis in purple bacteria (a critical survey).

PubMed

Borisov, A Yu

2014-03-01

Based on currently available data, the energy transfer efficiency in the successive photophysical and photochemical stages has been analyzed for purple bacteria. This analysis covers the stages starting from migration of the light-induced electronic excitations from the bulk antenna pigments to the reaction centers up to irreversible stage of the electron transport along the transmembrane chain of cofactors-carriers. Some natural factors are revealed that significantly increase the rates of efficient processes in these stages. The influence on their efficiency by the "bottleneck" in the energy migration chain is established. The overall quantum yield of photosynthesis in these stages is determined.

Electron-transfer and acid-base properties of a two-electron oxidized form of quaterpyrrole that acts as both an electron donor and an acceptor.

PubMed

Zhang, Min; E, Wenbo; Ohkubo, Kei; Sanchez-Garcia, David; Yoon, Dae-Wi; Sessler, Jonathan L; Fukuzumi, Shunichi; Kadish, Karl M

2008-02-21

Electron-transfer interconversion between the four-electron oxidized form of a quaterpyrrole (abbreviated as P4 for four pyrroles) and the two-electron oxidized form (P4H2) as well as between P4H2 and its fully reduced form (P4H4) bearing analogous substituents in the alpha- and beta-pyrrolic positions was studied by means of cyclic voltammetry and UV-visible spectroelectrochemistry combined with ESR and laser flash photolysis measurements. The two-electron oxidized form, P4H2, acts as both an electron donor and an electron acceptor. The radical cation (P4H2*+) and radical anion (P4H2*-) are both produced by photoinduced electron transfer from dimeric 1-benzyl-1,4-dihydronicotinamide to P4H2, whereas the cation radical form of the compound is also produced by electron-transfer oxidation of P4H2 with [Ru(bpy)3]3+. The ESR spectra of P4H2*+ and P4H2*- were recorded at low temperature and exhibit spin delocalization over all four pyrrole units. Thus, the two-electron oxidized form of the quaterpyrrole (P4H2) displays redox and electronic features analogous to those seen in the case of porphyrins and may be considered as a simple, open-chain model of this well-studied tetrapyrrolic macrocycle. The dynamics of deprotonation from P4H2*+ and disproportionation of P4H2 were examined by laser flash photolysis measurements of photoinduced electron-transfer oxidation and reduction of P4H2, respectively.

Proton-coupled electron transfer and the role of water molecules in proton pumping by cytochrome c oxidase

PubMed Central

Sharma, Vivek; Enkavi, Giray; Vattulainen, Ilpo; Róg, Tomasz; Wikström, Mårten

2015-01-01

Molecular oxygen acts as the terminal electron sink in the respiratory chains of aerobic organisms. Cytochrome c oxidase in the inner membrane of mitochondria and the plasma membrane of bacteria catalyzes the reduction of oxygen to water, and couples the free energy of the reaction to proton pumping across the membrane. The proton-pumping activity contributes to the proton electrochemical gradient, which drives the synthesis of ATP. Based on kinetic experiments on the O–O bond splitting transition of the catalytic cycle (A → PR), it has been proposed that the electron transfer to the binuclear iron–copper center of O2 reduction initiates the proton pump mechanism. This key electron transfer event is coupled to an internal proton transfer from a conserved glutamic acid to the proton-loading site of the pump. However, the proton may instead be transferred to the binuclear center to complete the oxygen reduction chemistry, which would constitute a short-circuit. Based on atomistic molecular dynamics simulations of cytochrome c oxidase in an explicit membrane–solvent environment, complemented by related free-energy calculations, we propose that this short-circuit is effectively prevented by a redox-state–dependent organization of water molecules within the protein structure that gates the proton transfer pathway. PMID:25646428

Cyclopropyl conjugation and ketyl anions: when do things begin to fall apart?

PubMed

Tanko, J M; Li, Xiangzhong; Chahma, M'hamed; Jackson, Woodward F; Spencer, Jared N

2007-04-11

Results pertaining to the electrochemical reduction of 1,2-diacetylcyclopropane (5), 1-acetyl-2-phenylcyclopropane (6), 1-acetyl-2-benzoylcyclopropane (7), and 1,2-dibenzoylcyclopropane (8) are reported. While 6*- exists as a discrete species, the barrier to ring opening is very small (<1 kcal/mol) and the rate constant for ring opening is >10(7) s(-1). For 7 and 8, the additional resonance stabilization afforded by the benzoyl moieties results in significantly lower rate constants for ring opening, on the order of 10(5)-10(6) s(-1). Electron transfer to 8 serves to initiate an unexpected vinylcyclopropane --> cyclopentene type rearrangement, which occurs via a radical ion chain mechanism. The results for reduction of 5 are less clear-cut: The experimental results suggest that the reduction is unexceptional, with a symmetry coefficient alpha

Long-range electron tunneling.

PubMed

Winkler, Jay R; Gray, Harry B

2014-02-26

Electrons have so little mass that in less than a second they can tunnel through potential energy barriers that are several electron-volts high and several nanometers wide. Electron tunneling is a critical functional element in a broad spectrum of applications, ranging from semiconductor diodes to the photosynthetic and respiratory charge transport chains. Prior to the 1970s, chemists generally believed that reactants had to collide in order to effect a transformation. Experimental demonstrations that electrons can transfer between reactants separated by several nanometers led to a revision of the chemical reaction paradigm. Experimental investigations of electron exchange between redox partners separated by molecular bridges have elucidated many fundamental properties of these reactions, particularly the variation of rate constants with distance. Theoretical work has provided critical insights into the superexchange mechanism of electronic coupling between distant redox centers. Kinetics measurements have shown that electrons can tunnel about 2.5 nm through proteins on biologically relevant time scales. Longer-distance biological charge flow requires multiple electron tunneling steps through chains of redox cofactors. The range of phenomena that depends on long-range electron tunneling continues to expand, providing new challenges for both theory and experiment.

The influence of the distance between the donor-acceptor groups of polymethine dyes on their photovoltaic properties

NASA Astrophysics Data System (ADS)

Seliverstova, E.; Ibrayev, N.

2018-01-01

Spectral-luminescent and photovoltaic properties of polymethine dyes of various structures are studied. It is shown that an increase in the length of the methylene chain between the active chromophores leads to a red-wave shift of the absorption and fluorescence spectra. Significant changes in the absorptivity and lifetime of fluorescence do not occur in this case. The best photovoltaic parameters have cells sensitized with shorter dye molecules. It is shown, that for a longer dye the resistance associated with electron recombination on the TiO2/electrolyte surface is much higher than the electron transfer resistance in the semiconductor, which reduces the efficiency of electron transfer in the solar cell, sensitized with longer dye molecules.

Triplet Transport to and Trapping by Acceptor End Groups on Conjugated Polyfluorene Chains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sreearunothai, P.; Miller, J.; Estrada, A.

2011-08-31

Triplet excited states created in polyfluorene (pF) molecules having average lengths up to 170 repeat units were transported to and captured by trap groups at the ends in less {approx}40 ns. Almost all of the triplets attached to the chains reached the trap groups, ruling out the presence of substantial numbers of defects that prevent transport. The transport yields a diffusion coefficient D of at least 3 x 10{sup -4} cm{sup 2} s{sup -1}, which is 30 times typical molecular diffusion and close to a value for triplet transport reported by Keller (J. Am. Chem. Soc.2011, 133, 11289-11298). The tripletmore » states were created in solution by pulse radiolysis; time resolution was limited by the rate of attachment of triplets to the pF chains. Naphthylimide (NI) or anthraquinone (AQ) groups attached to the ends of the chains acted as traps for the triplets, although AQ would not have been expected to serve as a trap on the basis of triplet energies of the separate molecules. The depths of the NI and AQ triplet traps were determined by intermolecular triplet transfer equilibria and temperature dependence. The trap depths are shallow, just a few times thermal energy for both, so a small fraction of the triplets reside in the pF chains in equilibrium with the end-trapped triplets. Trapping by AQ appears to arise from charge transfer interactions between the pF chains and the electron-accepting AQ groups. Absorption bands of the end-trapped triplet states are similar in peak wavelength (760 nm) and shape to the 760 nm bands of triplets in the pF chains but have reduced intensities. When an electron donor, N,N,N',N'-tetramethyl-p-phenylenediamine (TMPD), is added to the solution, it reacts with the end-trapped triplets to remove the 760 nm bands and to make the trapping irreversible. New bands created upon reaction with TMPD may be due to charge transfer states.« less

Crystal Structure and Catalytic Mechanism of 7-Hydroxymethyl Chlorophyll a Reductase*

PubMed Central

Wang, Xiao; Liu, Lin

2016-01-01

7-Hydroxymethyl chlorophyll a reductase (HCAR) catalyzes the second half-reaction in chlorophyll b to chlorophyll a conversion. HCAR is required for the degradation of light-harvesting complexes and is necessary for efficient photosynthesis by balancing the chlorophyll a/b ratio. Reduction of the hydroxymethyl group uses redox cofactors [4Fe-4S] cluster and FAD to transfer electrons and is difficult because of the strong carbon-oxygen bond. Here, we report the crystal structure of Arabidopsis HCAR at 2.7-Å resolution and reveal that two [4Fe-4S]clusters and one FAD within a very short distance form a consecutive electron pathway to the substrate pocket. In vitro kinetic analysis confirms the ferredoxin-dependent electron transport chain, thus supporting a proton-activated electron transfer mechanism. HCAR resembles a partial reconstruction of an archaeal F420-reducing [NiFe] hydrogenase, which suggests a common mode of efficient proton-coupled electron transfer through conserved cofactor arrangements. Furthermore, the trimeric form of HCAR provides a biological clue of its interaction with light-harvesting complex II. PMID:27072131

Activation Thermodynamics and H/D Kinetic Isotope Effect of the H ox to H red H + Transition in [FeFe] Hydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ratzloff, Michael W.; Wilker, Molly B.; Mulder, David W.

Molecular complexes between CdSe nanocrystals and Clostridium acetobutylicum [FeFe] hydrogenase I (CaI) enabled light-driven control of electron transfer for spectroscopic detection of redox intermediates during catalytic proton reduction. Here in this paper we address the route of electron transfer from CdSe→CaI and activation thermodynamics of the initial step of proton reduction in CaI. The electron paramagnetic spectroscopy of illuminated CdSe:CaI showed how the CaI accessory FeS cluster chain (F-clusters) functions in electron transfer with CdSe. The H ox→H redH + reduction step measured by Fourier-transform infrared spectroscopy showed an enthalpy of activation of 19 kJ mol -1 and a ~2.5-foldmore » kinetic isotope effect. Overall these results support electron injection from CdSe into CaI involving F-clusters, and that the H ox→H redH + step of catalytic proton reduction in CaI proceeds by a proton-dependent process.« less

Activation Thermodynamics and H/D Kinetic Isotope Effect of the H ox to H red H + Transition in [FeFe] Hydrogenase

DOE PAGES

Ratzloff, Michael W.; Wilker, Molly B.; Mulder, David W.; ...

2017-08-29

Molecular complexes between CdSe nanocrystals and Clostridium acetobutylicum [FeFe] hydrogenase I (CaI) enabled light-driven control of electron transfer for spectroscopic detection of redox intermediates during catalytic proton reduction. Here in this paper we address the route of electron transfer from CdSe→CaI and activation thermodynamics of the initial step of proton reduction in CaI. The electron paramagnetic spectroscopy of illuminated CdSe:CaI showed how the CaI accessory FeS cluster chain (F-clusters) functions in electron transfer with CdSe. The H ox→H redH + reduction step measured by Fourier-transform infrared spectroscopy showed an enthalpy of activation of 19 kJ mol -1 and a ~2.5-foldmore » kinetic isotope effect. Overall these results support electron injection from CdSe into CaI involving F-clusters, and that the H ox→H redH + step of catalytic proton reduction in CaI proceeds by a proton-dependent process.« less

Alternative quinone substrates and inhibitors of human electron-transfer flavoprotein-ubiquinone oxidoreductase.

PubMed Central

Simkovic, Martin; Frerman, Frank E

2004-01-01

Electron-transfer flavoprotein (ETF)-ubiquinone (2,3-dimethoxy-5-methyl-1,4-benzoquinone) oxidoreductase (ETF-QO) is a membrane-bound iron-sulphur flavoprotein that participates in an electron-transport pathway between eleven mitochondrial flavoprotein dehydrogenases and the ubiquinone pool. ETF is the intermediate electron carrier between the dehydrogenases and ETF-QO. The steady-state kinetic constants of human ETF-QO were determined with ubiquinone homologues and analogues that contained saturated n-alkyl substituents at the 6 position. These experiments show that optimal substrates contain a ten-carbon-atom side chain, consistent with a preliminary crystal structure that shows that only the first two of ten isoprene units of co-enzyme Q10 (CoQ10) interact with the protein. Derivatives with saturated alkyl side chains are very good substrates, indicating that, unlike other ubiquinone oxidoreductases, there is little preference for the methyl branches or rigidity of the CoQ side chain. Few of the compounds that inhibit ubiquinone oxidoreductases inhibit ETF-QO. Compounds found to act as inhibitors of ETF-QO include 2-n-heptyl-4-hydroxyquinoline N-oxide, a naphthoquinone analogue, 2-(3-methylpentyl)-4,6-dinitrophenol and pentachlorophenol. 2,5-dibromo-3-methyl-6-isopropyl-p-benzoquinone (DBMIB), which inhibits the mitochondrial bc1 complex and the chloroplast b6 f complex in redox-dependent fashion, can serve as an electron acceptor for human ETF-QO. The observation of simple Michaelis-Menten kinetic patterns and a single type of quinone-binding site, determined by fluorescence titrations of the protein with DBMIB and 6-(10-bromodecyl)ubiquinone, are consistent with one ubiquinone-binding site per ETF-QO monomer. PMID:14640977

Alternative quinone substrates and inhibitors of human electron-transfer flavoprotein-ubiquinone oxidoreductase.

PubMed

Simkovic, Martin; Frerman, Frank E

2004-03-01

Electron-transfer flavoprotein (ETF)-ubiquinone (2,3-dimethoxy-5-methyl-1,4-benzoquinone) oxidoreductase (ETF-QO) is a membrane-bound iron-sulphur flavoprotein that participates in an electron-transport pathway between eleven mitochondrial flavoprotein dehydrogenases and the ubiquinone pool. ETF is the intermediate electron carrier between the dehydrogenases and ETF-QO. The steady-state kinetic constants of human ETF-QO were determined with ubiquinone homologues and analogues that contained saturated n-alkyl substituents at the 6 position. These experiments show that optimal substrates contain a ten-carbon-atom side chain, consistent with a preliminary crystal structure that shows that only the first two of ten isoprene units of co-enzyme Q10 (CoQ10) interact with the protein. Derivatives with saturated alkyl side chains are very good substrates, indicating that, unlike other ubiquinone oxidoreductases, there is little preference for the methyl branches or rigidity of the CoQ side chain. Few of the compounds that inhibit ubiquinone oxidoreductases inhibit ETF-QO. Compounds found to act as inhibitors of ETF-QO include 2-n-heptyl-4-hydroxyquinoline N-oxide, a naphthoquinone analogue, 2-(3-methylpentyl)-4,6-dinitrophenol and pentachlorophenol. 2,5-dibromo-3-methyl-6-isopropyl-p-benzoquinone (DBMIB), which inhibits the mitochondrial bc1 complex and the chloroplast b6 f complex in redox-dependent fashion, can serve as an electron acceptor for human ETF-QO. The observation of simple Michaelis-Menten kinetic patterns and a single type of quinone-binding site, determined by fluorescence titrations of the protein with DBMIB and 6-(10-bromodecyl)ubiquinone, are consistent with one ubiquinone-binding site per ETF-QO monomer.

5,5'-Dithiobis-(2-nitrobenzoic acid) as a probe for a non-essential cysteine residue at the medium chain acyl-coenzyme A dehydrogenase binding site of the human 'electron transferring flavoprotein' (ETF).

PubMed

Parker, A; Engel, P C

1999-01-01

Human 'electron transferring flavoprotein' (ETF) was inactivated by the thiol-specific reagent 5,5'-dithiobis-(2-nitrobenzoic acid) (DTNB). The kinetic profile showed the reaction followed pseudo-first-order kinetics during the initial phase of inactivation. Monitoring the release of 5-thio-2-nitrobenzoate (TNB) showed that modification of 1 cysteine residue was responsible for the loss of activity. The inactivation of ETF by DTNB could be reversed upon incubation with thiol-containing reagents. The loss of activity was prevented by the inclusion of medium chain acyl-CoA dehydrogenase (MCAD) and octanoyl-CoA. Cyanolysis of the DTNB modified-ETF with KCN led to the release of TNB accompanied presumably by the formation of the thio-cyano enzyme and with almost full recovery of activity. Conservation studies and the lack of 100% inactivation, however, suggested that this cysteine residue is not essential for the interaction with MCAD.

Does menaquinone participate in brain astrocyte electron transport?

PubMed

Lovern, Douglas; Marbois, Beth

2013-10-01

Quinone compounds act as membrane resident carriers of electrons between components of the electron transport chain in the periplasmic space of prokaryotes and in the mitochondria of eukaryotes. Vitamin K is a quinone compound in the human body in a storage form as menaquinone (MK); distribution includes regulated amounts in mitochondrial membranes. The human brain, which has low amounts of typical vitamin K dependent function (e.g., gamma carboxylase) has relatively high levels of MK, and different regions of brain have different amounts. Coenzyme Q (Q), is a quinone synthesized de novo, and the levels of synthesis decline with age. The levels of MK are dependent on dietary intake and generally increase with age. MK has a characterized role in the transfer of electrons to fumarate in prokaryotes. A newly recognized fumarate cycle has been identified in brain astrocytes. The MK precursor menadione has been shown to donate electrons directly to mitochondrial complex III. Vitamin K compounds function in the electron transport chain of human brain astrocytes. Copyright © 2013 Elsevier Ltd. All rights reserved.

In Situ Solid-State Reactions Monitored by X-ray Absorption Spectroscopy: Temperature-Induced Proton Transfer Leads to Chemical Shifts.

PubMed

Stevens, Joanna S; Walczak, Monika; Jaye, Cherno; Fischer, Daniel A

2016-10-24

The dramatic colour and phase alteration with the solid-state, temperature-dependent reaction between squaric acid and 4,4'-bipyridine has been probed in situ with X-ray absorption spectroscopy. The electronic and chemical sensitivity to the local atomic environment through chemical shifts in the near-edge X-ray absorption fine structure (NEXAFS) revealed proton transfer from the acid to the bipyridine base through the change in nitrogen protonation state in the high-temperature form. Direct detection of proton transfer coupled with structural analysis elucidates the nature of the solid-state process, with intermolecular proton transfer occurring along an acid-base chain followed by a domino effect to the subsequent acid-base chains, leading to the rapid migration along the length of the crystal. NEXAFS thereby conveys the ability to monitor the nature of solid-state chemical reactions in situ, without the need for a priori information or long-range order. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Multicenter Aerobic Iron Respiratory Chain of Acidithiobacillus ferrooxidans Functions as an Ensemble with a Single Macroscopic Rate Constant

DOE PAGES

Li, Ting-Feng; Painter, Richard G.; Ban, Bhupal; ...

2015-06-03

Electron transfer reactions among three prominent colored proteins in intact cells of Acidithiobacillus ferrooxidans were monitored using an integrating cavity absorption meter that permitted the acquisition of accurate absorbance data in suspensions of cells that scattered light. The concentrations of proteins in the periplasmic space were estimated to be 350 and 25 mg/ml for rusticyanin and cytochrome c, respectively; cytochrome a was present as one molecule for every 91 nm2 in the cytoplasmic membrane. All three proteins were rapidly reduced to the same relative extent when suspensions of live bacteria were mixed with different concentrations of ferrous ions at pHmore » 1.5. The subsequent molecular oxygen-dependent oxidation of the multicenter respiratory chain occurred with a single macroscopic rate constant, regardless of the proteins' in vitro redox potentials or their putative positions in the aerobic iron respiratory chain. The crowded electron transport proteins in the periplasm of the organism constituted an electron conductive medium where the network of protein interactions functioned in a concerted fashion as a single ensemble with a standard reduction potential of 650 mV. The appearance of product ferric ions was correlated with the reduction levels of the periplasmic electron transfer proteins; the limiting first-order catalytic rate constant for aerobic respiration on iron was 7,400 s -1. The ability to conduct direct spectrophotometric studies under noninvasive physiological conditions represents a new and powerful approach to examine the extent and rates of biological events in situ without disrupting the complexity of the live cellular environment.« less

Electron transfer flavoprotein domain II orientation monitored using double electron-electron resonance between an enzymatically reduced, native FAD cofactor, and spin labels.

PubMed

Swanson, Michael A; Kathirvelu, Velavan; Majtan, Tomas; Frerman, Frank E; Eaton, Gareth R; Eaton, Sandra S

2011-03-01

Human electron transfer flavoprotein (ETF) is a soluble mitochondrial heterodimeric flavoprotein that links fatty acid β-oxidation to the main respiratory chain. The crystal structure of human ETF bound to medium chain acyl-CoA dehydrogenase indicates that the flavin adenine dinucleotide (FAD) domain (αII) is mobile, which permits more rapid electron transfer with donors and acceptors by providing closer access to the flavin and allows ETF to accept electrons from at least 10 different flavoprotein dehydrogenases. Sequence homology is high and low-angle X-ray scattering is identical for Paracoccus denitrificans (P. denitrificans) and human ETF. To characterize the orientations of the αII domain of P. denitrificans ETF, distances between enzymatically reduced FAD and spin labels in the three structural domains were measured by double electron-electron resonance (DEER) at X- and Q-bands. An FAD to spin label distance of 2.8 ± 0.15 nm for the label in the FAD-containing αII domain (A210C) agreed with estimates from the crystal structure (3.0 nm), molecular dynamics simulations (2.7 nm), and rotamer library analysis (2.8 nm). Distances between the reduced FAD and labels in αI (A43C) were between 4.0 and 4.5 ± 0.35 nm and for βIII (A111C) the distance was 4.3 ± 0.15 nm. These values were intermediate between estimates from the crystal structure of P. denitrificans ETF and a homology model based on substrate-bound human ETF. These distances suggest that the αII domain adopts orientations in solution that are intermediate between those which are observed in the crystal structures of free ETF (closed) and ETF bound to a dehydrogenase (open). Copyright © 2011 The Protein Society.

Photosensitized oxidation of nicotinamide adenine dinucleotide by diethoxyphosphorus(V)tetraphenylporphyrin and its fluorinated derivative: Possibility of chain reaction.

PubMed

Hirakawa, Kazutaka; Murata, Atsushi

2018-01-05

Water-soluble porphyrins, diethoxyphosphorus(V)tetraphenylporphyrin (EtP(V)TPP) and its fluorinated analogue (FEtP(V)TPP), decreased the typical absorption around 340nm of nicotinamide adenine dinucleotide (NADH) under visible light irradiation, indicating oxidative decomposition. A singlet oxygen quencher, sodium azide, and a triplet quencher, potassium iodide, slightly inhibited photosensitized NADH oxidation. However, these inhibitory effects were very small. Furthermore, the fluorescence lifetime of these P(V)porphyrins was decreased by NADH, suggesting the contribution of electron transfer to the singlet excited (S 1 ) state of P(V)porphyrin. The redox potential measurement supports the electron transfer-mediated oxidation of NADH. The quantum yields of NADH photodecomposition by P(V)porphyrins could be estimated from the kinetic data and the effect of these quenchers on NADH oxidation. The obtained values suggest that the electron accepting by the S 1 states of P(V)porphyrins triggers a chain reaction of NADH oxidation. This photosensitized reaction may play an important role in the photocytotoxicity of P(V)porphyrins. The axial ligand fluorination of P(V)porphyrins improved electron accepting ability. However, fluorination slightly suppressed static interaction with NADH, resulting in decreased oxidation quantum yield. Copyright © 2017 Elsevier B.V. All rights reserved.

UCP1 deficiency causes brown fat respiratory chain depletion and sensitizes mitochondria to calcium overload-induced dysfunction

PubMed Central

Kazak, Lawrence; Chouchani, Edward T.; Stavrovskaya, Irina G.; Lu, Gina Z.; Jedrychowski, Mark P.; Egan, Daniel F.; Kumari, Manju; Kong, Xingxing; Erickson, Brian K.; Szpyt, John; Rosen, Evan D.; Murphy, Michael P.; Kristal, Bruce S.; Gygi, Steven P.; Spiegelman, Bruce M.

2017-01-01

Brown adipose tissue (BAT) mitochondria exhibit high oxidative capacity and abundant expression of both electron transport chain components and uncoupling protein 1 (UCP1). UCP1 dissipates the mitochondrial proton motive force (Δp) generated by the respiratory chain and increases thermogenesis. Here we find that in mice genetically lacking UCP1, cold-induced activation of metabolism triggers innate immune signaling and markers of cell death in BAT. Moreover, global proteomic analysis reveals that this cascade induced by UCP1 deletion is associated with a dramatic reduction in electron transport chain abundance. UCP1-deficient BAT mitochondria exhibit reduced mitochondrial calcium buffering capacity and are highly sensitive to mitochondrial permeability transition induced by reactive oxygen species (ROS) and calcium overload. This dysfunction depends on ROS production by reverse electron transport through mitochondrial complex I, and can be rescued by inhibition of electron transfer through complex I or pharmacologic depletion of ROS levels. Our findings indicate that the interscapular BAT of Ucp1 knockout mice exhibits mitochondrial disruptions that extend well beyond the deletion of UCP1 itself. This finding should be carefully considered when using this mouse model to examine the role of UCP1 in physiology. PMID:28630339

Charge transfer at organic-inorganic interfaces—Indoline layers on semiconductor substrates

NASA Astrophysics Data System (ADS)

Meyenburg, I.; Falgenhauer, J.; Rosemann, N. W.; Chatterjee, S.; Schlettwein, D.; Heimbrodt, W.

2016-12-01

We studied the electron transfer from excitons in adsorbed indoline dye layers across the organic-inorganic interface. The hybrids consist of indoline derivatives on the one hand and different inorganic substrates (TiO2, ZnO, SiO2(0001), fused silica) on the other. We reveal the electron transfer times from excitons in dye layers to the organic-inorganic interface by analyzing the photoluminescence transients of the dye layers after femtosecond excitation and applying kinetic model calculations. A correlation between the transfer times and four parameters have been found: (i) the number of anchoring groups, (ii) the distance between the dye and the organic-inorganic interface, which was varied by the alkyl-chain lengths between the carboxylate anchoring group and the dye, (iii) the thickness of the adsorbed dye layer, and (iv) the level alignment between the excited dye ( π* -level) and the conduction band minimum of the inorganic semiconductor.

Elucidation of the Key Role of [Ru(bpy)3 ](2+) in Photocatalyzed RAFT Polymerization.

PubMed

Christmann, Julien; Ibrahim, Ahmad; Charlot, Vincent; Croutxé-Barghorn, Céline; Ley, Christian; Allonas, Xavier

2016-08-04

Photocatalysis reactions using [Ru(II) (bpy)3 ](2+) were studied on the example of visible-light-sensitized reversible addition-fragmentation chain transfer (RAFT) polymerization. Although both photoinduced electron- and energy-transfer mechanisms are able to describe this interaction, no definitive experimental proof has been presented so far. This paper investigates the actual mechanism governing this reaction. A set of RAFT agents was selected, their redox potentials measured by cyclic voltammetry, and relaxed triplet energies calculated by quantum mechanics. Gibbs free-energy values were calculated for both electron- and energy-transfer mechanisms. Quenching rate constants were determined by laser flash photolysis. The results undoubtedly evidence the involvement of a photoinduced energy-transfer reaction. Controlled photopolymerization experiments are discussed in the light of the primary photochemical process and photodissociation ability of RAFT agent triplet states. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A numerical study of mobility in thin films of fullerene derivatives.

PubMed

Mackenzie, Roderick C I; Frost, Jarvist M; Nelson, Jenny

2010-02-14

The effect of functional group size on the electron mobility in films of fullerene derivatives is investigated numerically. A series of four C(60) derivatives are formed by attaching saturated hydrocarbon chains to the C(60) cage via a methano bridge. For each of the derivatives investigated, molecular dynamics is used to generate a realistic material morphology. Quantum chemical methods are then used to calculate intermolecular charge transfer rates. Finally, Monte Carlo methods are used to simulate time-of-flight experiments and thus calculate the electron mobility. It is found that as the length of the aliphatic side chain increases, the configurational disorder increases and thus the mobility decreases.

Significant enhancement by biochar of caproate production via chain elongation.

PubMed

Liu, Yuhao; He, Pinjing; Shao, Liming; Zhang, Hua; Lü, Fan

2017-08-01

In this study, biochar was introduced into a chain elongation system to enhance the bioproduction of caproate and caprylate. The concentration of caproate increased to 21.1 g/L upon the addition of biochar, which is the highest level of caproate reported for such a system to date when ethanol was used as electron donor. The addition of biochar created a tougher system with more stable microorganism community structure for chain elongation, in which no obvious inhibition by products or substrates was observed, moreover, the lag phase was reduced 2.3-fold compared to the system without biochar. These reinforcement effect of biochar are attributed to the enhanced conductivity due to the significant enrichment of functional microorganisms via the microbial network surrounding smaller biochar particles, and via the adsorption on the rough surfaces or pores of larger particles, which facilitated electron transfer. Higher amounts of extracellular polymer substances and higher conductivity induced by biochar could contribute to the reinforcement effect in chain elongation. Copyright © 2017 Elsevier Ltd. All rights reserved.

Charge transfer fluorescence and 34 nm exciton diffusion length in polymers with electron acceptor end traps

DOE PAGES

Zaikowski, Lori; Mauro, Gina; Bird, Matthew; ...

2014-12-22

Photoexcitation of conjugated poly-2,7-(9,9-dihexylfluorene) polyfluorenes with naphthylimide (NI) and anthraquinone (AQ) electron-acceptor end traps produces excitons that form charge transfer states at the end traps. Intramolecular singlet exciton transport to end traps was examined by steady state fluorescence for polyfluorenes of 17 to 127 repeat units in chloroform, dimethylformamide (DMF), tetrahydrofuran (THF), and p-xylene. End traps capture excitons and form charge transfer (CT) states at all polymer lengths and in all solvents. The CT nature of the end-trapped states is confirmed by their fluorescence spectra, solvent and trap group dependence and DFT descriptions. Quantum yields of CT fluorescence are asmore » large as 46%. This strong CT emission is understood in terms of intensity borrowing. Energies of the CT states from onsets of the fluorescence spectra give the depths of the traps which vary with solvent polarity. For NI end traps the trap depths are 0.06 (p-xylene), 0.13 (THF) and 0.19 eV (CHCl 3). For AQ, CT fluorescence could be observed only in p-xylene where the trap depth is 0.27 eV. Quantum yields, emission energies, charge transfer energies, solvent reorganization and vibrational energies were calculated. Fluorescence measurements on chains >100 repeat units indicate that end traps capture ~50% of the excitons, and that the exciton diffusion length L D =34 nm, which is much larger than diffusion lengths reported in polymer films or than previously known for diffusion along isolated chains. As a result, the efficiency of exciton capture depends on chain length, but not on trap depth, solvent polarity or which trap group is present.« less

A Combined Theoretical and Experimental Study of Dissociation of Charge Transfer States at the Donor-Acceptor Interface of Organic Solar Cells.

PubMed

Tscheuschner, Steffen; Bässler, Heinz; Huber, Katja; Köhler, Anna

2015-08-13

The observation that in efficient organic solar cells almost all electron-hole pairs generated at the donor-acceptor interface escape from their mutual coulomb potential remains to be a conceptual challenge. It has been argued that it is the excess energy dissipated in the course of electron or hole transfer at the interface that assists this escape process. The current work demonstrates that this concept is unnecessary to explain the field dependence of electron-hole dissociation. It is based upon the formalism developed by Arkhipov and co-workers as well as Baranovskii and co-workers. The key idea is that the binding energy of the dissociating "cold" charge-transfer state is reduced by delocalization of the hole along the polymer chain, quantified in terms of an "effective mass", as well as the fractional strength of dipoles existent at the interface in the dark. By covering a broad parameter space, we determine the conditions for efficient electron-hole dissociation. Spectroscopy of the charge-transfer state on bilayer solar cells as well as measurements of the field dependence of the dissociation yield over a broad temperature range support the theoretical predictions.

How the oxygen tolerance of a [NiFe]-hydrogenase depends on quaternary structure.

PubMed

Wulff, Philip; Thomas, Claudia; Sargent, Frank; Armstrong, Fraser A

2016-03-01

'Oxygen-tolerant' [NiFe]-hydrogenases can catalyze H2 oxidation under aerobic conditions, avoiding oxygenation and destruction of the active site. In one mechanism accounting for this special property, membrane-bound [NiFe]-hydrogenases accommodate a pool of electrons that allows an O2 molecule attacking the active site to be converted rapidly to harmless water. An important advantage may stem from having a dimeric or higher-order quaternary structure in which the electron-transfer relay chain of one partner is electronically coupled to that in the other. Hydrogenase-1 from E. coli has a dimeric structure in which the distal [4Fe-4S] clusters in each monomer are located approximately 12 Å apart, a distance conducive to fast electron tunneling. Such an arrangement can ensure that electrons from H2 oxidation released at the active site of one partner are immediately transferred to its counterpart when an O2 molecule attacks. This paper addresses the role of long-range, inter-domain electron transfer in the mechanism of O2-tolerance by comparing the properties of monomeric and dimeric forms of Hydrogenase-1. The results reveal a further interesting advantage that quaternary structure affords to proteins.

A single arginine residue is required for the interaction of the electron transferring flavoprotein (ETF) with three of its dehydrogenase partners.

PubMed

Parker, Antony R

2003-12-01

The interaction of several dehydrogenases with the electron transferring flavoprotein (ETF) is a crucial step required for the successful transfer of electrons into the electron transport chain. The exact determinants regarding the interaction of ETF with its dehydrogenase partners are still unknown. Chemical modification of ETF with arginine-specific reagents resulted in the loss, to varying degrees, of activity with medium chain acyl-coenzyme A dehydrogenase (MCAD). The kinetic profiles showed the inactivations followed pseudo-first-order kinetics for all reagents used. For activity with MCAD, maximum inactivation of ETF was accomplished by 2,3-butanedione (4% residual activity after 120 min) and it was shown that modification of one arginine residue was responsible for the inactivation. Almost 100% restoration of this ETF activity was achieved upon incubation with free arginine. However, the same 2,3-butanedione modified ETF only possessed decreased activity with dimethylglycine-(DMGDH, 44%) and sarcosine- (SDH, 27%) dehydrogenases unlike the abolition with MCAD. Full protection of ETF from arginine modification by 2,3-butanedione was achieved using substrate-protected DMGDH, MCAD and SDH respectively. Cross-protection studies of ETF with the three dehydrogenases implied use of the same single arginine residue in the binding of all three dehydrogenases. These results lead us to conclude that this single arginine residue is essential in the binding of the ETF to MCAD, but only contributes partially to the binding of ETF to SDH and DMGDH and thus, the determinants of the dehydrogenase binding sites overlap but are not identical.

Autocatalytic formation of an iron(IV)-oxo complex via scandium ion-promoted radical chain autoxidation of an iron(II) complex with dioxygen and tetraphenylborate.

PubMed

Nishida, Yusuke; Lee, Yong-Min; Nam, Wonwoo; Fukuzumi, Shunichi

2014-06-04

A non-heme iron(IV)-oxo complex, [(TMC)Fe(IV)(O)](2+) (TMC = 1,4,8,11-tetramethyl-1,4,8,11-tetraazacyclotetradecane), was formed by oxidation of an iron(II) complex ([(TMC)Fe(II)](2+)) with dioxygen (O2) and tetraphenylborate (BPh4(-)) in the presence of scandium triflate (Sc(OTf)3) in acetonitrile at 298 K via autocatalytic radical chain reactions rather than by a direct O2 activation pathway. The autocatalytic radical chain reaction is initiated by scandium ion-promoted electron transfer from BPh4(-) to [(TMC)Fe(IV)(O)](2+) to produce phenyl radical (Ph(•)). The chain propagation step is composed of the addition of O2 to Ph(•) and the reduction of the resulting phenylperoxyl radical (PhOO(•)) by scandium ion-promoted electron transfer from BPh4(-) to PhOO(•) to produce phenyl hydroperoxide (PhOOH), accompanied by regeneration of phenyl radical. PhOOH reacts with [(TMC)Fe(II)](2+) to yield phenol (PhOH) and [(TMC)Fe(IV)(O)](2+). Biphenyl (Ph-Ph) was formed via the radical chain autoxidation of BPh3 by O2. The induction period of the autocatalytic radical chain reactions was shortened by addition of a catalytic amount of [(TMC)Fe(IV)(O)](2+), whereas addition of a catalytic amount of ferrocene that can reduce [(TMC)Fe(IV)(O)](2+) resulted in elongation of the induction period. Radical chain autoxidation of BPh4(-) by O2 also occurred in the presence of Sc(OTf)3 without [(TMC)Fe(IV)(O)](2+), initiating the autocatalytic oxidation of [(TMC)Fe(II)](2+) with O2 and BPh4(-) to yield [(TMC)Fe(IV)(O)](2+). Thus, the general view for formation of non-heme iron(IV)-oxo complexes via O2-binding iron species (e.g., Fe(III)(O2(•-))) without contribution of autocatalytic radical chain reactions should be viewed with caution.

Electron-lattice interactions strongly renormalize the charge-transfer energy in the spin-chain cuprate Li 2CuO 2

DOE PAGES

Johnston, Steve; Monney, Claude; Bisogni, Valentina; ...

2016-02-17

Strongly correlated insulators are broadly divided into two classes: Mott–Hubbard insulators, where the insulating gap is driven by the Coulomb repulsion U on the transition-metal cation, and charge-transfer insulators, where the gap is driven by the charge-transfer energy Δ between the cation and the ligand anions. The relative magnitudes of U and Δ determine which class a material belongs to, and subsequently the nature of its low-energy excitations. These energy scales are typically understood through the local chemistry of the active ions. Here we show that the situation is more complex in the low-dimensional charge-transfer insulator Li 2CuO 2, wheremore » Δ has a large non-electronic component. Combining resonant inelastic X-ray scattering with detailed modelling, we determine how the elementary lattice, charge, spin and orbital excitations are entangled in this material. This results in a large lattice-driven renormalization of Δ, which significantly reshapes the fundamental electronic properties of Li 2CuO 2.« less

Structure of electron transfer flavoprotein-ubiquinone oxidoreductase and electron transfer to the mitochondrial ubiquinone pool

PubMed Central

Zhang, Jian; Frerman, Frank E.; Kim, Jung-Ja P.

2006-01-01

Electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO) is a 4Fe4S flavoprotein located in the inner mitochondrial membrane. It catalyzes ubiquinone (UQ) reduction by ETF, linking oxidation of fatty acids and some amino acids to the mitochondrial respiratory chain. Deficiencies in ETF or ETF-QO result in multiple acyl-CoA dehydrogenase deficiency, a human metabolic disease. Crystal structures of ETF-QO with and without bound UQ were determined, and they are essentially identical. The molecule forms a single structural domain. Three functional regions bind FAD, the 4Fe4S cluster, and UQ and are closely packed and share structural elements, resulting in no discrete structural domains. The UQ-binding pocket consists mainly of hydrophobic residues, and UQ binding differs from that of other UQ-binding proteins. ETF-QO is a monotopic integral membrane protein. The putative membrane-binding surface contains an α-helix and a β-hairpin, forming a hydrophobic plateau. The UQ—flavin distance (8.5 Å) is shorter than the UQ—cluster distance (18.8 Å), and the very similar redox potentials of FAD and the cluster strongly suggest that the flavin, not the cluster, transfers electrons to UQ. Two possible electron transfer paths can be envisioned. First, electrons from the ETF flavin semiquinone may enter the ETF-QO flavin one by one, followed by rapid equilibration with the cluster. Alternatively, electrons may enter via the cluster, followed by equilibration between centers. In both cases, when ETF-QO is reduced to a two-electron reduced state (one electron at each redox center), the enzyme is primed to reduce UQ to ubiquinol via FAD. PMID:17050691

Structure of electron transfer flavoprotein-ubiquinone oxidoreductase and electron transfer to the mitochondrial ubiquinone pool.

PubMed

Zhang, Jian; Frerman, Frank E; Kim, Jung-Ja P

2006-10-31

Electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO) is a 4Fe4S flavoprotein located in the inner mitochondrial membrane. It catalyzes ubiquinone (UQ) reduction by ETF, linking oxidation of fatty acids and some amino acids to the mitochondrial respiratory chain. Deficiencies in ETF or ETF-QO result in multiple acyl-CoA dehydrogenase deficiency, a human metabolic disease. Crystal structures of ETF-QO with and without bound UQ were determined, and they are essentially identical. The molecule forms a single structural domain. Three functional regions bind FAD, the 4Fe4S cluster, and UQ and are closely packed and share structural elements, resulting in no discrete structural domains. The UQ-binding pocket consists mainly of hydrophobic residues, and UQ binding differs from that of other UQ-binding proteins. ETF-QO is a monotopic integral membrane protein. The putative membrane-binding surface contains an alpha-helix and a beta-hairpin, forming a hydrophobic plateau. The UQ-flavin distance (8.5 A) is shorter than the UQ-cluster distance (18.8 A), and the very similar redox potentials of FAD and the cluster strongly suggest that the flavin, not the cluster, transfers electrons to UQ. Two possible electron transfer paths can be envisioned. First, electrons from the ETF flavin semiquinone may enter the ETF-QO flavin one by one, followed by rapid equilibration with the cluster. Alternatively, electrons may enter via the cluster, followed by equilibration between centers. In both cases, when ETF-QO is reduced to a two-electron reduced state (one electron at each redox center), the enzyme is primed to reduce UQ to ubiquinol via FAD.

Catalytic behavior of ‘Pt-atomic chain encapsulated gold nanotube’: A density functional study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nigam, Sandeep, E-mail: snigam@barc.gov.in; Majumder, Chiranjib

2016-05-23

With an aim to design novel material and explore its catalytic performance towards CO oxidation, Pt atomic chain was introduced inside gold nanotube (Au-NT). Theoretical calculations at the level of first principles formalism was carried out to investigate the atomic and electronic properties of the composite. Geometrically Pt atoms prefer to align in zig-zag fashion. Significant electronic charge transfer from inside Pt atoms to the outer wall Au atoms is observed. Interaction of O{sub 2} with Au-NT wall follows by injection of additional electronic charge in the anti-bonding orbital of oxygen molecule leading to activation of the O-O bond. Furthermore » interaction of CO molecule with the activated oxygen molecule leads to spontaneous oxidation reaction and formation of CO{sub 2}.« less

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Transport of triplet excitons along continuous 100 nm polyfluorene chains

DOE PAGES

Xi, Liang; Bird, Matthew; Mauro, Gina; ...

2014-12-03

Triplet excitons created in poly-2,7-(9,9-dihexyl)fluorene (pF) chains with end trap groups in solution are efficiently transported to and captured by the end groups. The triplets explore the entire lengths of the chains, even for ~100 nm long chains enabling determination of the completeness of end capping. The results show that the chains continuous: they may contain transient barriers or traps, such as those from fluctuations of dihedral angles, but are free of major defects that stop motion of the triplets. Quantitative determinations are aided by the addition of a strong electron donor, TMPD, which removes absorption bands of the end-trappedmore » triplets. For chains having at least one end trap, triplet capture is quantitative on the 1 µs timescale imposed by the use of the donor. Fractions of chains having no end traps were 0.15 for pF samples with anthraquinone (AQ) end traps and 0.063 with naphthylimide (NI) end traps. These determinations agreed with measurements by NMR for short (<40 polymer repeat units (PRU)) chains, where NMR determinations are accurate. The results find no evidence for traps or barriers to transport of triplets, and places limits on the possible presence of defects as impenetrable barriers to less than one per 300 PRU. The present results present a paradigm different from the current consensus, derived from observations of singlet excitons, that conjugated chains are divided into “segments,” perhaps by some kind of defects. For the present pF chains, the segmentation either does not apply to triplet excitons or is transient so that the defects are healed or surmounted in times much shorter than 1 µs. Triplets on chains without end trap groups transfer to chains with end traps on a slower time scale. Rate constants for these bimolecular triplet transfer reactions were found to increase with the length of the accepting chain, as did rate constants for triplet transfer to the chains from small molecules like biphenyl. As a result, a second set of polyfluorenes with 2-butyloctyl side chains was found to have a much lower completeness of end capping.« less

Catalytic Mechanism of Short Ethoxy Chain Nonylphenol Dehydrogenase Belonging to a Polyethylene Glycol Dehydrogenase Group in the GMC Oxidoreductase Family

PubMed Central

Liu, Xin; Ohta, Takeshi; Kawabata, Takeshi; Kawai, Fusako

2013-01-01

Ethoxy (EO) chain nonylphenol dehydrogenase (NPEO-DH) from Ensifer sp. AS08 and EO chain octylphenol dehydrogenase from Pseudomonas putida share common molecular characteristics with polyethylene glycol (PEG) dehydrogenases (PEG-DH) and comprise a PEG-DH subgroup in the family of glucose-methanol-choline (GMC) oxidoreductases that includes glucose/alcohol oxidase and glucose/choline dehydrogenase. Three-dimensional (3D) molecular modeling suggested that differences in the size, secondary structure and hydropathy in the active site caused differences in their substrate specificities toward EO chain alkylphenols and free PEGs. Based on 3D molecular modeling, site-directed mutagenesis was utilized to introduce mutations into potential catalytic residues of NPEO-DH. From steady state and rapid kinetic characterization of wild type and mutant NPEO-DHs, we can conclude that His465 and Asn507 are directly involved in the catalysis. Asn507 mediates the transfer of proton from a substrate to FAD and His465 transfers the same proton from the reduced flavin to an electron acceptor. PMID:23306149

Catalytic mechanism of short ethoxy chain nonylphenol dehydrogenase belonging to a polyethylene glycol dehydrogenase group in the GMC oxidoreductase family.

PubMed

Liu, Xin; Ohta, Takeshi; Kawabata, Takeshi; Kawai, Fusako

2013-01-10

Ethoxy (EO) chain nonylphenol dehydrogenase (NPEO-DH) from Ensifer sp. AS08 and EO chain octylphenol dehydrogenase from Pseudomonas putida share common molecular characteristics with polyethylene glycol (PEG) dehydrogenases (PEG-DH) and comprise a PEG-DH subgroup in the family of glucose-methanol-choline (GMC) oxidoreductases that includes glucose/alcohol oxidase and glucose/choline dehydrogenase. Three-dimensional (3D) molecular modeling suggested that differences in the size, secondary structure and hydropathy in the active site caused differences in their substrate specificities toward EO chain alkylphenols and free PEGs. Based on 3D molecular modeling, site-directed mutagenesis was utilized to introduce mutations into potential catalytic residues of NPEO-DH. From steady state and rapid kinetic characterization of wild type and mutant NPEO-DHs, we can conclude that His465 and Asn507 are directly involved in the catalysis. Asn507 mediates the transfer of proton from a substrate to FAD and His465 transfers the same proton from the reduced flavin to an electron acceptor.

Ultrafast exciton migration in an HJ-aggregate: Potential surfaces and quantum dynamics

NASA Astrophysics Data System (ADS)

Binder, Robert; Polkehn, Matthias; Ma, Tianji; Burghardt, Irene

2017-01-01

Quantum dynamical and electronic structure calculations are combined to investigate the mechanism of exciton migration in an oligothiophene HJ aggregate, i.e., a combination of oligomer chains (J-type aggregates) and stacked aggregates of such chains (H-type aggregates). To this end, a Frenkel exciton model is parametrized by a recently introduced procedure [Binder et al., J. Chem. Phys. 141, 014101 (2014)] which uses oligomer excited-state calculations to perform an exact, point-wise mapping of coupled potential energy surfaces to an effective Frenkel model. Based upon this parametrization, the Multi-Layer Multi-Configuration Time-Dependent Hartree (ML-MCTDH) method is employed to investigate ultrafast dynamics of exciton transfer in a small, asymmetric HJ aggregate model composed of 30 sites and 30 active modes. For a partially delocalized initial condition, it is shown that a torsional defect confines the trapped initial exciton, and planarization induces an ultrafast resonant transition between an HJ-aggregated segment and a covalently bound "dangling chain" end. This model is a minimal realization of experimentally investigated mixed systems exhibiting ultrafast exciton transfer between aggregated, highly planarized chains and neighboring disordered segments.

Conductance of single microRNAs chains related to the autism spectrum disorder

NASA Astrophysics Data System (ADS)

Oliveira, J. I. N.; Albuquerque, E. L.; Fulco, U. L.; Mauriz, P. W.; Sarmento, R. G.; Caetano, E. W. S.; Freire, V. N.

2014-09-01

The charge transport properties of single-stranded microRNAs (miRNAs) chains associated to autism disorder were investigated. The computations were performed within a tight-binding model, together with a transfer matrix technique, with ionization energies and hopping parameters obtained by quantum chemistry method. Current-voltage (I× V) curves of twelve miRNA chains related to the autism spectrum disorders were calculated and analysed. We have obtained both semiconductor and insulator behavior, and a relationship between the current intensity and the autism-related miRNA bases sequencies, suggesting that a kind of electronic biosensor can be developed to distinguish different profiles of autism disorders.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arlt, T.; Penzkofer H.; Zinth, W.

The energetics of the primary electron donor (the special pair P) in reaction centers from Rhodopseudomonas viridis were modified by site-directed mutagenesis of histidine L168 to phenylalanine. This leads to the loss of a hydrogen bond between the amino acid side chain and the ring I acetyl carbonyl oxygen of the bacteriochlorophyll molecule BChl{sub LP}. As a result of the mutation, a 35 nm blue shift of the Q{sub y} band of the special pair and a decrease of 80 mV in the P/P{sup +} oxidation-reduction potential occur. Femtosecond spectroscopy revealed an acceleration of the first electron transfer step frommore » 3.5 ps in wild type to 1.1 ps in mutant. Analysis of change in the bacteriochlorophyll monomer (B) band of the mutant reaction centers showed strong bleaching. This is direct evidence that bacteriochlorophyll b is real intermediate in electron transfer. The changes in redox potential and time constants allow one to estimate the energetics in the wild-type and mutated reaction centers according to the Marcus electron transfer theory. 32 refs., 6 figs.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xi, Liang; Bird, Matthew; Mauro, Gina

Triplet excitons created in poly-2,7-(9,9-dihexyl)fluorene (pF) chains with end trap groups in solution are efficiently transported to and captured by the end groups. The triplets explore the entire lengths of the chains, even for ~100 nm long chains enabling determination of the completeness of end capping. The results show that the chains continuous: they may contain transient barriers or traps, such as those from fluctuations of dihedral angles, but are free of major defects that stop motion of the triplets. Quantitative determinations are aided by the addition of a strong electron donor, TMPD, which removes absorption bands of the end-trappedmore » triplets. For chains having at least one end trap, triplet capture is quantitative on the 1 µs timescale imposed by the use of the donor. Fractions of chains having no end traps were 0.15 for pF samples with anthraquinone (AQ) end traps and 0.063 with naphthylimide (NI) end traps. These determinations agreed with measurements by NMR for short (<40 polymer repeat units (PRU)) chains, where NMR determinations are accurate. The results find no evidence for traps or barriers to transport of triplets, and places limits on the possible presence of defects as impenetrable barriers to less than one per 300 PRU. The present results present a paradigm different from the current consensus, derived from observations of singlet excitons, that conjugated chains are divided into “segments,” perhaps by some kind of defects. For the present pF chains, the segmentation either does not apply to triplet excitons or is transient so that the defects are healed or surmounted in times much shorter than 1 µs. Triplets on chains without end trap groups transfer to chains with end traps on a slower time scale. Rate constants for these bimolecular triplet transfer reactions were found to increase with the length of the accepting chain, as did rate constants for triplet transfer to the chains from small molecules like biphenyl. As a result, a second set of polyfluorenes with 2-butyloctyl side chains was found to have a much lower completeness of end capping.« less

Photogeneration of hydrogen from water by a robust dye-sensitized photocathode

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shan, B.; Das, A. K.; Marquard, S.

2016-11-15

We report here on a novel photocathode with a “donor-dye-catalyst” assembly structure for water reduction. The photoelectrocatalytic performance of the photocathode under mild conditions, with a photocurrent of -56 μA/cm2 and a Faradaic yield of 53%, is superior relative to other reported photocathodes with surface attached molecular catalysts. Detailed electron transfer analyses, based on transient absorption measurements, show that the successful application of this photocathode originates mainly from the slow back electron transfer following light excitation. The results also demonstrate that addition of the long-chain assembly to the macro-mesoporous electrode surface plays a fundamental role in providing sufficient catalyst formore » water reduction.« less

Facile Synthesis of Worm-like Micelles by Visible Light Mediated Dispersion Polymerization Using Photoredox Catalyst

PubMed Central

Yeow, Jonathan; Xu, Jiangtao; Boyer, Cyrille

2016-01-01

Presented herein is a protocol for the facile synthesis of worm-like micelles by visible light mediated dispersion polymerization. This approach begins with the synthesis of a hydrophilic poly(oligo(ethylene glycol) methyl ether methacrylate) (POEGMA) homopolymer using reversible addition-fragmentation chain-transfer (RAFT) polymerization. Under mild visible light irradiation (λ = 460 nm, 0.7 mW/cm2), this macro-chain transfer agent (macro-CTA) in the presence of a ruthenium based photoredox catalyst, Ru(bpy)3Cl2 can be chain extended with a second monomer to form a well-defined block copolymer in a process known as Photoinduced Electron Transfer RAFT (PET-RAFT). When PET-RAFT is used to chain extend POEGMA with benzyl methacrylate (BzMA) in ethanol (EtOH), polymeric nanoparticles with different morphologies are formed in situ according to a polymerization-induced self-assembly (PISA) mechanism. Self-assembly into nanoparticles presenting POEGMA chains at the corona and poly(benzyl methacrylate) (PBzMA) chains in the core occurs in situ due to the growing insolubility of the PBzMA block in ethanol. Interestingly, the formation of highly pure worm-like micelles can be readily monitored by observing the onset of a highly viscous gel in situ due to nanoparticle entanglements occurring during the polymerization. This process thereby allows for a more reproducible synthesis of worm-like micelles simply by monitoring the solution viscosity during the course of the polymerization. In addition, the light stimulus can be intermittently applied in an ON/OFF manner demonstrating temporal control over the nanoparticle morphology. PMID:27340940

Facile Synthesis of Worm-like Micelles by Visible Light Mediated Dispersion Polymerization Using Photoredox Catalyst.

PubMed

Yeow, Jonathan; Xu, Jiangtao; Boyer, Cyrille

2016-06-08

Presented herein is a protocol for the facile synthesis of worm-like micelles by visible light mediated dispersion polymerization. This approach begins with the synthesis of a hydrophilic poly(oligo(ethylene glycol) methyl ether methacrylate) (POEGMA) homopolymer using reversible addition-fragmentation chain-transfer (RAFT) polymerization. Under mild visible light irradiation (λ = 460 nm, 0.7 mW/cm(2)), this macro-chain transfer agent (macro-CTA) in the presence of a ruthenium based photoredox catalyst, Ru(bpy)3Cl2 can be chain extended with a second monomer to form a well-defined block copolymer in a process known as Photoinduced Electron Transfer RAFT (PET-RAFT). When PET-RAFT is used to chain extend POEGMA with benzyl methacrylate (BzMA) in ethanol (EtOH), polymeric nanoparticles with different morphologies are formed in situ according to a polymerization-induced self-assembly (PISA) mechanism. Self-assembly into nanoparticles presenting POEGMA chains at the corona and poly(benzyl methacrylate) (PBzMA) chains in the core occurs in situ due to the growing insolubility of the PBzMA block in ethanol. Interestingly, the formation of highly pure worm-like micelles can be readily monitored by observing the onset of a highly viscous gel in situ due to nanoparticle entanglements occurring during the polymerization. This process thereby allows for a more reproducible synthesis of worm-like micelles simply by monitoring the solution viscosity during the course of the polymerization. In addition, the light stimulus can be intermittently applied in an ON/OFF manner demonstrating temporal control over the nanoparticle morphology.

The Nature of the Intramolecular Charge Transfer State in Peridinin

PubMed Central

Wagner, Nicole L.; Greco, Jordan A.; Enriquez, Miriam M.; Frank, Harry A.; Birge, Robert R.

2013-01-01

Experimental and theoretical evidence is presented that supports the theory that the intramolecular charge transfer (ICT) state of peridinin is an evolved state formed via excited-state bond-order reversal and solvent reorganization in polar media. The ICT state evolves in <100 fs and is characterized by a large dipole moment (∼35 D). The charge transfer character involves a shift of electron density within the polyene chain, and it does not involve participation of molecular orbitals localized in either of the β-rings. Charge is moved from the allenic side of the polyene into the furanic ring region and is accompanied by bond-order reversal in the central portion of the polyene chain. The electronic properties of the ICT state are generated via mixing of the “11Bu+” ionic state and the lowest-lying “21Ag–” covalent state. The resulting ICT state is primarily 1Bu+-like in character and exhibits not only a large oscillator strength but an unusually large doubly excited character. In most solvents, two populations exist in equilibrium, one with a lowest-lying ICT ionic state and a second with a lowest-lying “21Ag–” covalent state. The two populations are separated by a small barrier associated with solvent relaxation and cavity formation. PMID:23528091

Chromophores in phenylenevinylene-based conjugated polymers: role of conformational kinks and chemical defects.

PubMed

Hennebicq, Emmanuelle; Deleener, Caroline; Brédas, Jean-Luc; Scholes, Gregory D; Beljonne, David

2006-08-07

The influence of chemical defects and conformational kinks on the nature of the lowest electronic excitations in phenylenevinylene-based polymers is assessed at the semiempirical quantum-chemical level. The amount of excited-state localization and the amplitude of through-space (Coulomb-like) versus through-bond (charge-transfer-like) interactions have been quantified by comparing the results provided by excitonic and supermolecular models. While excitation delocalization among conjugated segments delineated by the defects occurs in the acceptor configuration, self-confinement on individual chromophores follows from geometric relaxation in the excited-state donor configuration. The extent of excited-state localization is found to be sensitive to both the nature of the defect and the length of the conjugated chains. Implications for resonant energy transfer along conjugated polymer chains are discussed.

Redox regulation of mitochondrial function with emphasis on cysteine oxidation reactions☆

PubMed Central

Mailloux, Ryan J.; Jin, Xiaolei; Willmore, William G.

2013-01-01

Mitochondria have a myriad of essential functions including metabolism and apoptosis. These chief functions are reliant on electron transfer reactions and the production of ATP and reactive oxygen species (ROS). The production of ATP and ROS are intimately linked to the electron transport chain (ETC). Electrons from nutrients are passed through the ETC via a series of acceptor and donor molecules to the terminal electron acceptor molecular oxygen (O2) which ultimately drives the synthesis of ATP. Electron transfer through the respiratory chain and nutrient oxidation also produces ROS. At high enough concentrations ROS can activate mitochondrial apoptotic machinery which ultimately leads to cell death. However, if maintained at low enough concentrations ROS can serve as important signaling molecules. Various regulatory mechanisms converge upon mitochondria to modulate ATP synthesis and ROS production. Given that mitochondrial function depends on redox reactions, it is important to consider how redox signals modulate mitochondrial processes. Here, we provide the first comprehensive review on how redox signals mediated through cysteine oxidation, namely S-oxidation (sulfenylation, sulfinylation), S-glutathionylation, and S-nitrosylation, regulate key mitochondrial functions including nutrient oxidation, oxidative phosphorylation, ROS production, mitochondrial permeability transition (MPT), apoptosis, and mitochondrial fission and fusion. We also consider the chemistry behind these reactions and how they are modulated in mitochondria. In addition, we also discuss emerging knowledge on disorders and disease states that are associated with deregulated redox signaling in mitochondria and how mitochondria-targeted medicines can be utilized to restore mitochondrial redox signaling. PMID:24455476

Identification of the 2-Hydroxyglutarate and Isovaleryl-CoA Dehydrogenases as Alternative Electron Donors Linking Lysine Catabolism to the Electron Transport Chain of Arabidopsis Mitochondria[W][OA

PubMed Central

Araújo, Wagner L.; Ishizaki, Kimitsune; Nunes-Nesi, Adriano; Larson, Tony R.; Tohge, Takayuki; Krahnert, Ina; Witt, Sandra; Obata, Toshihiro; Schauer, Nicolas; Graham, Ian A.; Leaver, Christopher J.; Fernie, Alisdair R.

2010-01-01

The process of dark-induced senescence in plants is relatively poorly understood, but a functional electron-transfer flavoprotein/electron-transfer flavoprotein:ubiquinone oxidoreductase (ETF/ETFQO) complex, which supports respiration during carbon starvation, has recently been identified. Here, we studied the responses of Arabidopsis thaliana mutants deficient in the expression of isovaleryl-CoA dehydrogenase and 2-hydroxyglutarate dehydrogenase to extended darkness and other environmental stresses. Evaluations of the mutant phenotypes following carbon starvation induced by extended darkness identify similarities to those exhibited by mutants of the ETF/ETFQO complex. Metabolic profiling and isotope tracer experimentation revealed that isovaleryl-CoA dehydrogenase is involved in degradation of the branched-chain amino acids, phytol, and Lys, while 2-hydroxyglutarate dehydrogenase is involved exclusively in Lys degradation. These results suggest that isovaleryl-CoA dehydrogenase is the more critical for alternative respiration and that a series of enzymes, including 2-hydroxyglutarate dehydrogenase, plays a role in Lys degradation. Both physiological and metabolic phenotypes of the isovaleryl-CoA dehydrogenase and 2-hydroxyglutarate dehydrogenase mutants were not as severe as those observed for mutants of the ETF/ETFQO complex, indicating some functional redundancy of the enzymes within the process. Our results aid in the elucidation of the pathway of plant Lys catabolism and demonstrate that both isovaleryl-CoA dehydrogenase and 2-hydroxyglutarate dehydrogenase act as electron donors to the ubiquinol pool via an ETF/ETFQO-mediated route. PMID:20501910

Redox regulation of mitochondrial function with emphasis on cysteine oxidation reactions.

PubMed

Mailloux, Ryan J; Jin, Xiaolei; Willmore, William G

2014-01-01

Mitochondria have a myriad of essential functions including metabolism and apoptosis. These chief functions are reliant on electron transfer reactions and the production of ATP and reactive oxygen species (ROS). The production of ATP and ROS are intimately linked to the electron transport chain (ETC). Electrons from nutrients are passed through the ETC via a series of acceptor and donor molecules to the terminal electron acceptor molecular oxygen (O2) which ultimately drives the synthesis of ATP. Electron transfer through the respiratory chain and nutrient oxidation also produces ROS. At high enough concentrations ROS can activate mitochondrial apoptotic machinery which ultimately leads to cell death. However, if maintained at low enough concentrations ROS can serve as important signaling molecules. Various regulatory mechanisms converge upon mitochondria to modulate ATP synthesis and ROS production. Given that mitochondrial function depends on redox reactions, it is important to consider how redox signals modulate mitochondrial processes. Here, we provide the first comprehensive review on how redox signals mediated through cysteine oxidation, namely S-oxidation (sulfenylation, sulfinylation), S-glutathionylation, and S-nitrosylation, regulate key mitochondrial functions including nutrient oxidation, oxidative phosphorylation, ROS production, mitochondrial permeability transition (MPT), apoptosis, and mitochondrial fission and fusion. We also consider the chemistry behind these reactions and how they are modulated in mitochondria. In addition, we also discuss emerging knowledge on disorders and disease states that are associated with deregulated redox signaling in mitochondria and how mitochondria-targeted medicines can be utilized to restore mitochondrial redox signaling.

Identification of the 2-hydroxyglutarate and isovaleryl-CoA dehydrogenases as alternative electron donors linking lysine catabolism to the electron transport chain of Arabidopsis mitochondria.

PubMed

Araújo, Wagner L; Ishizaki, Kimitsune; Nunes-Nesi, Adriano; Larson, Tony R; Tohge, Takayuki; Krahnert, Ina; Witt, Sandra; Obata, Toshihiro; Schauer, Nicolas; Graham, Ian A; Leaver, Christopher J; Fernie, Alisdair R

2010-05-01

The process of dark-induced senescence in plants is relatively poorly understood, but a functional electron-transfer flavoprotein/electron-transfer flavoprotein:ubiquinone oxidoreductase (ETF/ETFQO) complex, which supports respiration during carbon starvation, has recently been identified. Here, we studied the responses of Arabidopsis thaliana mutants deficient in the expression of isovaleryl-CoA dehydrogenase and 2-hydroxyglutarate dehydrogenase to extended darkness and other environmental stresses. Evaluations of the mutant phenotypes following carbon starvation induced by extended darkness identify similarities to those exhibited by mutants of the ETF/ETFQO complex. Metabolic profiling and isotope tracer experimentation revealed that isovaleryl-CoA dehydrogenase is involved in degradation of the branched-chain amino acids, phytol, and Lys, while 2-hydroxyglutarate dehydrogenase is involved exclusively in Lys degradation. These results suggest that isovaleryl-CoA dehydrogenase is the more critical for alternative respiration and that a series of enzymes, including 2-hydroxyglutarate dehydrogenase, plays a role in Lys degradation. Both physiological and metabolic phenotypes of the isovaleryl-CoA dehydrogenase and 2-hydroxyglutarate dehydrogenase mutants were not as severe as those observed for mutants of the ETF/ETFQO complex, indicating some functional redundancy of the enzymes within the process. Our results aid in the elucidation of the pathway of plant Lys catabolism and demonstrate that both isovaleryl-CoA dehydrogenase and 2-hydroxyglutarate dehydrogenase act as electron donors to the ubiquinol pool via an ETF/ETFQO-mediated route.

Tattoo-Paper Transfer as a Versatile Platform for All-Printed Organic Edible Electronics.

PubMed

Bonacchini, Giorgio E; Bossio, Caterina; Greco, Francesco; Mattoli, Virgilio; Kim, Yun-Hi; Lanzani, Guglielmo; Caironi, Mario

2018-04-01

The use of natural or bioinspired materials to develop edible electronic devices is a potentially disruptive technology that can boost point-of-care testing. The technology exploits devices that can be safely ingested, along with pills or even food, and operated from within the gastrointestinal tract. Ingestible electronics can potentially target a significant number of biomedical applications, both as therapeutic and diagnostic tool, and this technology may also impact the food industry, by providing ingestible or food-compatible electronic tags that can "smart" track goods and monitor their quality along the distribution chain. Temporary tattoo-paper is hereby proposed as a simple and versatile platform for the integration of electronics onto food and pharmaceutical capsules. In particular, the fabrication of all-printed organic field-effect transistors on untreated commercial tattoo-paper, and their subsequent transfer and operation on edible substrates with a complex nonplanar geometry is demonstrated. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Defining Electron Bifurcation in the Electron-Transferring Flavoprotein Family.

PubMed

Garcia Costas, Amaya M; Poudel, Saroj; Miller, Anne-Frances; Schut, Gerrit J; Ledbetter, Rhesa N; Fixen, Kathryn R; Seefeldt, Lance C; Adams, Michael W W; Harwood, Caroline S; Boyd, Eric S; Peters, John W

2017-11-01

Electron bifurcation is the coupling of exergonic and endergonic redox reactions to simultaneously generate (or utilize) low- and high-potential electrons. It is the third recognized form of energy conservation in biology and was recently described for select electron-transferring flavoproteins (Etfs). Etfs are flavin-containing heterodimers best known for donating electrons derived from fatty acid and amino acid oxidation to an electron transfer respiratory chain via Etf-quinone oxidoreductase. Canonical examples contain a flavin adenine dinucleotide (FAD) that is involved in electron transfer, as well as a non-redox-active AMP. However, Etfs demonstrated to bifurcate electrons contain a second FAD in place of the AMP. To expand our understanding of the functional variety and metabolic significance of Etfs and to identify amino acid sequence motifs that potentially enable electron bifurcation, we compiled 1,314 Etf protein sequences from genome sequence databases and subjected them to informatic and structural analyses. Etfs were identified in diverse archaea and bacteria, and they clustered into five distinct well-supported groups, based on their amino acid sequences. Gene neighborhood analyses indicated that these Etf group designations largely correspond to putative differences in functionality. Etfs with the demonstrated ability to bifurcate were found to form one group, suggesting that distinct conserved amino acid sequence motifs enable this capability. Indeed, structural modeling and sequence alignments revealed that identifying residues occur in the NADH- and FAD-binding regions of bifurcating Etfs. Collectively, a new classification scheme for Etf proteins that delineates putative bifurcating versus nonbifurcating members is presented and suggests that Etf-mediated bifurcation is associated with surprisingly diverse enzymes. IMPORTANCE Electron bifurcation has recently been recognized as an electron transfer mechanism used by microorganisms to maximize energy conservation. Bifurcating enzymes couple thermodynamically unfavorable reactions with thermodynamically favorable reactions in an overall spontaneous process. Here we show that the electron-transferring flavoprotein (Etf) enzyme family exhibits far greater diversity than previously recognized, and we provide a phylogenetic analysis that clearly delineates bifurcating versus nonbifurcating members of this family. Structural modeling of proteins within these groups reveals key differences between the bifurcating and nonbifurcating Etfs. Copyright © 2017 American Society for Microbiology.

Defining Electron Bifurcation in the Electron-Transferring Flavoprotein Family

PubMed Central

Garcia Costas, Amaya M.; Poudel, Saroj; Miller, Anne-Frances; Schut, Gerrit J.; Ledbetter, Rhesa N.; Seefeldt, Lance C.; Adams, Michael W. W.

2017-01-01

ABSTRACT Electron bifurcation is the coupling of exergonic and endergonic redox reactions to simultaneously generate (or utilize) low- and high-potential electrons. It is the third recognized form of energy conservation in biology and was recently described for select electron-transferring flavoproteins (Etfs). Etfs are flavin-containing heterodimers best known for donating electrons derived from fatty acid and amino acid oxidation to an electron transfer respiratory chain via Etf-quinone oxidoreductase. Canonical examples contain a flavin adenine dinucleotide (FAD) that is involved in electron transfer, as well as a non-redox-active AMP. However, Etfs demonstrated to bifurcate electrons contain a second FAD in place of the AMP. To expand our understanding of the functional variety and metabolic significance of Etfs and to identify amino acid sequence motifs that potentially enable electron bifurcation, we compiled 1,314 Etf protein sequences from genome sequence databases and subjected them to informatic and structural analyses. Etfs were identified in diverse archaea and bacteria, and they clustered into five distinct well-supported groups, based on their amino acid sequences. Gene neighborhood analyses indicated that these Etf group designations largely correspond to putative differences in functionality. Etfs with the demonstrated ability to bifurcate were found to form one group, suggesting that distinct conserved amino acid sequence motifs enable this capability. Indeed, structural modeling and sequence alignments revealed that identifying residues occur in the NADH- and FAD-binding regions of bifurcating Etfs. Collectively, a new classification scheme for Etf proteins that delineates putative bifurcating versus nonbifurcating members is presented and suggests that Etf-mediated bifurcation is associated with surprisingly diverse enzymes. IMPORTANCE Electron bifurcation has recently been recognized as an electron transfer mechanism used by microorganisms to maximize energy conservation. Bifurcating enzymes couple thermodynamically unfavorable reactions with thermodynamically favorable reactions in an overall spontaneous process. Here we show that the electron-transferring flavoprotein (Etf) enzyme family exhibits far greater diversity than previously recognized, and we provide a phylogenetic analysis that clearly delineates bifurcating versus nonbifurcating members of this family. Structural modeling of proteins within these groups reveals key differences between the bifurcating and nonbifurcating Etfs. PMID:28808132

Reductive dehalogenation of 5-bromouracil by aliphatic organic radicals in aqueous solutions; electron transfer and proton-coupled electron transfer mechanisms

NASA Astrophysics Data System (ADS)

Matasović, Brunislav; Bonifačić, Marija

2011-06-01

Reductive dehalogenation of 5-bromouracil by aliphatic organic radicals CO2-rad , rad CH 2OH, rad CH(CH 3)OH, and rad CH(CH 3)O - have been studied in oxygen free aqueous solutions in the presence of organic additives: formate, methanol or ethanol. For radicals production 60Co γ-radiolysis was employed and the yield of bromide was measured by means of ion chromatography. Both radical anions have reducing potential negative enough to transfer an electron to BrU producing bromide ion and U rad radical. High yields of bromide have been measured increasing proportional to the concentration of the corresponding organic additives at a constant dose rate. This is characteristic for a chain process where regeneration of radical ions occurs by H-atom abstraction by U rad radical from formate or ethanol. Results with the neutral radicals conformed earlier proposition that the reduction reaction of α-hydroxyalkyl radicals proceeds by the proton-coupled electron transfer mechanism ( Matasović and Bonifačić, 2007). Thus, while both rad CH 2OH and rad CH(CH 3)OH did not react with BrU in water/alcohol solutions, addition of bicarbonate and acetate in mmol dm -3 concentrations, pH 7, brought about chain debromination to occur in the case of rad CH(CH 3)OH radical as reactant. Under the same conditions phosphate buffer, a base with higher bulk proton affinity, failed to have any influence. The results are taken as additional proofs for the specific complex formation of α-hydroxyalkyl radicals with suitable bases which enhances radicals' reduction potential in comparison with only water molecules as proton acceptors. Rate constants for the H-atom abstraction from ethanol and formate by U rad radicals have been estimated to amount to about ≥85 and 1200 dm 3 mol -1 s -1, respectively.

Theoretical studies of optics and charge transport in organic conducting oligomers and polymers: Rational design of improved transparent and conducting polymers

NASA Astrophysics Data System (ADS)

Hutchison, Geoffrey Rogers

Theoretical studies on a variety of oligo- and polyheterocycles elucidate their optical and charge transport properties, suggesting new, improved transparent conductive polymers. First-principles calculations provide accurate methodologies for predicting both optical band gaps of neutral and cationic oligomers and intrinsic charge transfer rates. Multidimensional analysis reveals important motifs in chemical tailorability of oligoheterocycle optical and charge transport properties. The results suggest new directions for design of novel materials. Using both finite oligomer and infinite polymer calculations, the optical band gaps in polyheterocycles follow a modified particle-in-a-box formalism, scaling approximately as 1/N (where N is the number of monomer units) in short chains, saturating for long chains. Calculations demonstrate that band structure changes upon heteroatom substitution, (e.g., from polythiophene to polypyrrole) derive from heteroatom electron affinity. Further investigation of chemical variability in substituted oligoheterocycles using multidimensional statistics reveals the interplay between heteroatom and substituent in correlations between structure and redox/optical properties of neutral and cationic species. A linear correlation between band gaps of neutral and cationic species upon oxidation of conjugated oligomers, shows redshifts of optical absorption for most species and blueshifts for small band gap species. Interstrand charge-transport studies focus on two contributors to hopping-style charge transfer rates: internal reorganization energy and the electronic coupling matrix element. Statistical analysis of chemical variability of reorganization energies in oligoheterocycles proves the importance of reorganization energy in determining intrinsic charge transfer rates (e.g., charge mobility in unsubstituted oligothiophenes). Computed bandwidths across several oligothiophene crystal packing motifs show similar electron and hole bandwidths, and show that well-known tilted and herringbone motifs in oligothiophenes are driven by electrostatic repulsion. Tilted stacks exhibit intrinsic charge-transfer rates smaller than cofacial stacks, but with lower packing energy. Given similar electron and hole bandwidths, a charge injection model explains substitution-modulated majority carrier changes in n- and p-type oligothiophene field-effect transistors.

Proton pumping in the bc1 complex: a new gating mechanism that prevents short circuits.

PubMed

Crofts, Antony R; Lhee, Sangmoon; Crofts, Stephanie B; Cheng, Jerry; Rose, Stuart

2006-08-01

The Q-cycle mechanism of the bc1 complex explains how the electron transfer from ubihydroquinone (quinol, QH2) to cytochrome (cyt) c (or c2 in bacteria) is coupled to the pumping of protons across the membrane. The efficiency of proton pumping depends on the effectiveness of the bifurcated reaction at the Q(o)-site of the complex. This directs the two electrons from QH2 down two different pathways, one to the high potential chain for delivery to an electron acceptor, and the other across the membrane through a chain containing heme bL and bH to the Qi-site, to provide the vectorial charge transfer contributing to the proton gradient. In this review, we discuss problems associated with the turnover of the bc1 complex that center around rates calculated for the normal forward and reverse reactions, and for bypass (or short-circuit) reactions. Based on rate constants given by distances between redox centers in known structures, these appeared to preclude conventional electron transfer mechanisms involving an intermediate semiquinone (SQ) in the Q(o)-site reaction. However, previous research has strongly suggested that SQ is the reductant for O2 in generation of superoxide at the Q(o)-site, introducing an apparent paradox. A simple gating mechanism, in which an intermediate SQ mobile in the volume of the Q(o)-site is a necessary component, can readily account for the observed data through a coulombic interaction that prevents SQ anion from close approach to heme bL when the latter is reduced. This allows rapid and reversible QH2 oxidation, but prevents rapid bypass reactions. The mechanism is quite natural, and is well supported by experiments in which the role of a key residue, Glu-295, which facilitates proton transfer from the site through a rotational displacement, has been tested by mutation.

The structure of Escherichia coli signal recognition particle revealed by scanning transmission electron microscopy.

PubMed

Mainprize, Iain L; Beniac, Daniel R; Falkovskaia, Elena; Cleverley, Robert M; Gierasch, Lila M; Ottensmeyer, F Peter; Andrews, David W

2006-12-01

Structural studies on various domains of the ribonucleoprotein signal recognition particle (SRP) have not converged on a single complete structure of bacterial SRP consistent with the biochemistry of the particle. We obtained a three-dimensional structure for Escherichia coli SRP by cryoscanning transmission electron microscopy and mapped the internal RNA by electron spectroscopic imaging. Crystallographic data were fit into the SRP reconstruction, and although the resulting model differed from previous models, they could be rationalized by movement through an interdomain linker of Ffh, the protein component of SRP. Fluorescence resonance energy transfer experiments determined interdomain distances that were consistent with our model of SRP. Docking our model onto the bacterial ribosome suggests a mechanism for signal recognition involving interdomain movement of Ffh into and out of the nascent chain exit site and suggests how SRP could interact and/or compete with the ribosome-bound chaperone, trigger factor, for a nascent chain during translation.

Dietary avocado oil supplementation attenuates the alterations induced by type I diabetes and oxidative stress in electron transfer at the complex II-complex III segment of the electron transport chain in rat kidney mitochondria.

PubMed

Ortiz-Avila, Omar; Sámano-García, Carlos Alberto; Calderón-Cortés, Elizabeth; Pérez-Hernández, Ismael H; Mejía-Zepeda, Ricardo; Rodríguez-Orozco, Alain R; Saavedra-Molina, Alfredo; Cortés-Rojo, Christian

2013-06-01

Impaired complex III activity and reactive oxygen species (ROS) generation in mitochondria have been identified as key events leading to renal damage during diabetes. Due to its high content of oleic acid and antioxidants, we aimed to test whether avocado oil may attenuate the alterations in electron transfer at complex III induced by diabetes by a mechanism related with increased resistance to lipid peroxidation. 90 days of avocado oil administration prevented the impairment in succinate-cytochrome c oxidoreductase activity caused by streptozotocin-induced diabetes in kidney mitochondria. This was associated with a protection against decreased electron transfer through high potential chain in complex III related to cytochromes c + c1 loss. During Fe(2+)-induced oxidative stress, avocado oil improved the activities of complexes II and III and enhanced the protection conferred by a lipophilic antioxidant against damage by Fe(2+). Avocado oil also decreased ROS generation in Fe(2+)-damaged mitochondria. Alterations in the ratio of C20:4/C18:2 fatty acids were observed in mitochondria from diabetic animals that not were corrected by avocado oil treatment, which yielded lower peroxidizability indexes only in diabetic mitochondria although avocado oil caused an augment in the total content of monounsaturated fatty acids. Moreover, a protective effect of avocado oil against lipid peroxidation was observed consistently only in control mitochondria. Since the beneficial effects of avocado oil in diabetic mitochondria were not related to increased resistance to lipid peroxidation, these effects were discussed in terms of the antioxidant activity of both C18:1 and the carotenoids reported to be contained in avocado oil.

The mitochondrial electron transfer flavoprotein complex is essential for survival of Arabidopsis in extended darkness.

PubMed

Ishizaki, Kimitsune; Schauer, Nicolas; Larson, Tony R; Graham, Ian A; Fernie, Alisdair R; Leaver, Christopher J

2006-09-01

In mammals, the electron transfer flavoprotein (ETF) is a heterodimeric protein composed of two subunits, alpha and beta, that is responsible for the oxidation of at least nine mitochondrial matrix flavoprotein dehydrogenases. Electrons accepted by ETF are further transferred to the main respiratory chain via the ETF ubiquinone oxide reductase (ETFQO). Sequence analysis of the unique Arabidopsis homologues of two subunits of ETF revealed their high similarity to both subunits of the mammalian ETF. Yeast two-hybrid experiments showed that the Arabidopsis ETFalpha and ETFbeta can form a heteromeric protein. Isolation and characterization of two independent T-DNA insertional Arabidopsis mutants of the ETFbeta gene revealed accelerated senescence and early death compared to wild-type during extended darkness. Furthermore in contrast to wild-type, the etfb mutants demonstrated a significant accumulation of several amino acids, isovaleryl CoA and phytanoyl CoA during dark-induced carbohydrate deprivation. These phenotypic characteristics of etfb mutants are broadly similar to those that we observed previously in Arabidopsis etfqo mutants, suggesting functional association between ETF and ETFQO in Arabidopsis, and confirming the essential roles of the ETF/ETFQO electron transfer complex in the catabolism of leucine and involvement in the chlorophyll degradation pathway activated during dark-induced carbohydrate deprivation.

Understanding How Isotopes Affect Charge Transfer in P3HT/PCBM: A Quantum Trajectory-Electronic Structure Study with Nonlinear Quantum Corrections

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Lei; Jakowski, Jacek; Garashchuk, Sophya

The experimentally observed effect of selective deuterium substitution on the open circuit voltage for a blend of poly(3-hexylthiophene)(P3HT) and [6,6]-phenyl-C 61- butyric acid methyl ester (PCBM) (Nat. Commun. 5:3180, 2014) is explored using a 221-atom model of a polymer-wrapped PCBM molecule. We describe the protonic and deuteronic wavefunctions for the H/D isotopologues of the hexyl side chains within a Quantum Trajectory/Electronic Structure approach where the dynamics is performed with newly developed nonlinear corrections to the quantum forces, necessary to describe the nuclear wavefunctions; the classical forces are generated with a Density Functional Tight Binding method. We used the resulting protonicmore » and deuteronic time-dependent wavefunctions to assess the effects of isotopic substitution (deuteration) on the energy gaps relevant to the charge transfer for the donor and acceptor electronic states. Furthermore, while the isotope effect on the electronic energy levels is found negligible, the quantum-induced fluctuations of the energy gap between the charge transfer and charge separated states due to nuclear wavefunctions may account for experimental trends by promoting charge transfer in P3HT/PCBM and increasing charge recombination on the donor in the deuterium substituted P3HT/PCBM.« less

Understanding How Isotopes Affect Charge Transfer in P3HT/PCBM: A Quantum Trajectory-Electronic Structure Study with Nonlinear Quantum Corrections

DOE PAGES

Wang, Lei; Jakowski, Jacek; Garashchuk, Sophya; ...

2016-08-09

The experimentally observed effect of selective deuterium substitution on the open circuit voltage for a blend of poly(3-hexylthiophene)(P3HT) and [6,6]-phenyl-C 61- butyric acid methyl ester (PCBM) (Nat. Commun. 5:3180, 2014) is explored using a 221-atom model of a polymer-wrapped PCBM molecule. We describe the protonic and deuteronic wavefunctions for the H/D isotopologues of the hexyl side chains within a Quantum Trajectory/Electronic Structure approach where the dynamics is performed with newly developed nonlinear corrections to the quantum forces, necessary to describe the nuclear wavefunctions; the classical forces are generated with a Density Functional Tight Binding method. We used the resulting protonicmore » and deuteronic time-dependent wavefunctions to assess the effects of isotopic substitution (deuteration) on the energy gaps relevant to the charge transfer for the donor and acceptor electronic states. Furthermore, while the isotope effect on the electronic energy levels is found negligible, the quantum-induced fluctuations of the energy gap between the charge transfer and charge separated states due to nuclear wavefunctions may account for experimental trends by promoting charge transfer in P3HT/PCBM and increasing charge recombination on the donor in the deuterium substituted P3HT/PCBM.« less

Connection between the membrane electron transport system and Hyn hydrogenase in the purple sulfur bacterium, Thiocapsa roseopersicina BBS.

PubMed

Tengölics, Roland; Mészáros, Lívia; Győri, E; Doffkay, Zsolt; Kovács, Kornél L; Rákhely, Gábor

2014-10-01

Thiocapsa. roseopersicina BBS has four active [NiFe] hydrogenases, providing an excellent opportunity to examine their metabolic linkages to the cellular redox processes. Hyn is a periplasmic membrane-associated hydrogenase harboring two additional electron transfer subunits: Isp1 is a transmembrane protein, while Isp2 is located on the cytoplasmic side of the membrane. In this work, the connection of HynSL to various electron transport pathways is studied. During photoautotrophic growth, electrons, generated from the oxidation of thiosulfate and sulfur, are donated to the photosynthetic electron transport chain via cytochromes. Electrons formed from thiosulfate and sulfur oxidation might also be also used for Hyn-dependent hydrogen evolution which was shown to be light and proton motive force driven. Hyn-linked hydrogen uptake can be promoted by both sulfur and nitrate. The electron flow from/to HynSL requires the presence of Isp2 in both directions. Hydrogenase-linked sulfur reduction could be inhibited by a QB site competitive inhibitor, terbutryne, suggesting a redox coupling between the Hyn hydrogenase and the photosynthetic electron transport chain. Based on these findings, redox linkages of Hyn hydrogenase are modeled. Copyright © 2014 Elsevier B.V. All rights reserved.

Ground-state and magnetocaloric properties of a coupled spin-electron double-tetrahedral chain (exact study at the half filling)

NASA Astrophysics Data System (ADS)

Gálisová, Lucia; Jakubczyk, Dorota

2017-01-01

Ground-state and magnetocaloric properties of a double-tetrahedral chain, in which nodal lattice sites occupied by the localized Ising spins regularly alternate with triangular clusters half filled with mobile electrons, are exactly investigated by using the transfer-matrix method in combination with the construction of the Nth tensor power of the discrete Fourier transformation. It is shown that the ground state of the model is formed by two non-chiral phases with the zero residual entropy and two chiral phases with the finite residual entropy S = NkB ln 2. Depending on the character of the exchange interaction between the localized Ising spins and mobile electrons, one or three magnetization plateaus can be observed in the magnetization process. Their heights basically depend on the values of Landé g-factors of the Ising spins and mobile electrons. It is also evidenced that the system exhibits both the conventional and inverse magnetocaloric effect depending on values of the applied magnetic field and temperature.

Ultrafast Spectroscopy Reveals Electron-Transfer Cascade That Improves Hydrogen Evolution with Carbon Nitride Photocatalysts.

PubMed

Corp, Kathryn L; Schlenker, Cody W

2017-06-14

Solar hydrogen generation from water represents a compelling component of a future sustainable energy portfolio. Recently, chemically robust heptazine-based polymers known as graphitic carbon nitrides (g-C 3 N 4 ) have emerged as promising photocatalysts for hydrogen evolution using visible light while withstanding harsh chemical environments. However, since g-C 3 N 4 electron-transfer dynamics are poorly understood, rational design rules for improving activity remain unclear. Here, we use visible and near-infrared femtosecond transient absorption (TA) spectroscopy to reveal an electron-transfer cascade that correlates with a near-doubling in photocatalytic activity from 2050 to 3810 μmol h -1 g -1 when we infuse a suspension of bulk g-C 3 N 4 with 10% mass loading of chemically exfoliated carbon nitride. TA spectroscopy indicates that exfoliated carbon nitride quenches photogenerated electrons on g-C 3 N 4 at rates approaching the molecular diffusion limit. The TA signal for photogenerated electrons on g-C 3 N 4 decays with a time constant of 1/k e ' = 660 ps in the mixture versus 1/k e = 4.1 ns in g-C 3 N 4 alone. Our TA measurements suggest that the charge generation efficiency in g-C 3 N 4 is greater than 65%. Exfoliated carbon nitride, which liberates only trace hydrogen levels when photoexcited directly, does not appear to independently sustain appreciable long-lived charge generation. Thus, the activity enhancement in the two-component infusion evidently results from a cooperative effect in which charge is generated on g-C 3 N 4 , followed by electron transfer to exfoliated carbon nitride containing photocatalytic chain terminations. This correlation between electron transfer and photocatalytic activity provides new insight into structural modifications for controlling charge separation dynamics and activity of carbon-based photocatalysts.

Using Hyperfine Electron Paramagnetic Resonance Spectroscopy to Define the Proton-Coupled Electron Transfer Reaction at Fe-S Cluster N2 in Respiratory Complex I.

PubMed

Le Breton, Nolwenn; Wright, John J; Jones, Andrew J Y; Salvadori, Enrico; Bridges, Hannah R; Hirst, Judy; Roessler, Maxie M

2017-11-15

Energy-transducing respiratory complex I (NADH:ubiquinone oxidoreductase) is one of the largest and most complicated enzymes in mammalian cells. Here, we used hyperfine electron paramagnetic resonance (EPR) spectroscopic methods, combined with site-directed mutagenesis, to determine the mechanism of a single proton-coupled electron transfer reaction at one of eight iron-sulfur clusters in complex I, [4Fe-4S] cluster N2. N2 is the terminal cluster of the enzyme's intramolecular electron-transfer chain and the electron donor to ubiquinone. Because of its position and pH-dependent reduction potential, N2 has long been considered a candidate for the elusive "energy-coupling" site in complex I at which energy generated by the redox reaction is used to initiate proton translocation. Here, we used hyperfine sublevel correlation (HYSCORE) spectroscopy, including relaxation-filtered hyperfine and single-matched resonance transfer (SMART) HYSCORE, to detect two weakly coupled exchangeable protons near N2. We assign the larger coupling with A( 1 H) = [-3.0, -3.0, 8.7] MHz to the exchangeable proton of a conserved histidine and conclude that the histidine is hydrogen-bonded to N2, tuning its reduction potential. The histidine protonation state responds to the cluster oxidation state, but the two are not coupled sufficiently strongly to catalyze a stoichiometric and efficient energy transduction reaction. We thus exclude cluster N2, despite its proton-coupled electron transfer chemistry, as the energy-coupling site in complex I. Our work demonstrates the capability of pulse EPR methods for providing detailed information on the properties of individual protons in even the most challenging of energy-converting enzymes.

Kinetics and mechanism of electron transfer reaction of single and double chain surfactant cobalt(III) complex by Fe2+ ions in liposome (dipalmitoylphosphotidylcholine) vesicles: effects of phase transition

NASA Astrophysics Data System (ADS)

Nagaraj, Karuppiah; Senthil Murugan, Krishnan; Thangamuniyandi, Pilavadi

2015-05-01

In this study, we report the kinetics of reduction reactions of single and double chain surfactant cobalt(III) complexes of octahedral geometry, cis-[Co(en)2(4AMP)(DA)](ClO4)3 and cis-[Co(dmp)2(C12H25NH2)2](ClO4)3 (en = ethylenediamine, dmp = 1,3-diaminopropane, 4AMP = 4-aminopropane, C12H25NH2 = dodecylamine) by Fe2+ ion in dipalmitoylphosphotidylcholine (DPPC) vesicles at different temperatures under pseudo first-order conditions. The kinetics of these reactions is followed by spectrophotometry method. The reactions are found to be second order and the electron transfer is postulated as outer sphere. The remarkable findings in the present investigation are that, below the phase transition temperature of DPPC, the rate decreases with an increase in the concentration of DPPC, while above the phase transition temperature the rate increases with an increase in the concentration of DPPC. The main driving force for this phenomenon is considered to be the intervesicular hydrophobic interaction between vesicles surface and hydrophobic part of the surfactant complexes. Besides, comparing the values of rate constants of these outer-sphere electron transfer reactions in the absence and in the presence of DPPC, the rate constant values in the presence of DPPC are always found to be greater than in the absence of DPPC. This is ascribed to the double hydrophobic fatty acid chain in the DPPC that gives the molecule an overall tubular shape due to the intervesicular hydrophobic interaction between vesicles surface and hydrophobic part of the surfactant complexes more suitable for vesicle aggregation which facilitates lower activation energy, and consequently higher rate is observed in the presence of DPPC. The activation parameters (ΔS# and ΔH#) of the reactions at different temperatures have been calculated which corroborate the kinetics of the reaction.

De Novo Construction of Redox Active Proteins.

PubMed

Moser, C C; Sheehan, M M; Ennist, N M; Kodali, G; Bialas, C; Englander, M T; Discher, B M; Dutton, P L

2016-01-01

Relatively simple principles can be used to plan and construct de novo proteins that bind redox cofactors and participate in a range of electron-transfer reactions analogous to those seen in natural oxidoreductase proteins. These designed redox proteins are called maquettes. Hydrophobic/hydrophilic binary patterning of heptad repeats of amino acids linked together in a single-chain self-assemble into 4-alpha-helix bundles. These bundles form a robust and adaptable frame for uncovering the default properties of protein embedded cofactors independent of the complexities introduced by generations of natural selection and allow us to better understand what factors can be exploited by man or nature to manipulate the physical chemical properties of these cofactors. Anchoring of redox cofactors such as hemes, light active tetrapyrroles, FeS clusters, and flavins by His and Cys residues allow cofactors to be placed at positions in which electron-tunneling rates between cofactors within or between proteins can be predicted in advance. The modularity of heptad repeat designs facilitates the construction of electron-transfer chains and novel combinations of redox cofactors and new redox cofactor assisted functions. Developing de novo designs that can support cofactor incorporation upon expression in a cell is needed to support a synthetic biology advance that integrates with natural bioenergetic pathways. © 2016 Elsevier Inc. All rights reserved.

Sulphate respiration from hydrogen in Desulfovibrio bacteria: a structural biology overview.

PubMed

Matias, Pedro M; Pereira, Inês A C; Soares, Cláudio M; Carrondo, Maria Arménia

2005-11-01

Sulphate-reducing organisms are widespread in anaerobic enviroments, including the gastrointestinal tract of man and other animals. The study of these bacteria has attracted much attention over the years, due also to the fact that they can have important implications in industry (in biocorrosion and souring of oil and gas deposits), health (in inflamatory bowel diseases) and the environment (bioremediation). The characterization of the various components of the electron transport chain associated with the hydrogen metabolism in Desulfovibrio has generated a large and comprehensive list of studies. This review summarizes the more relevant aspects of the current information available on the structural data of various molecules associated with hydrogen metabolism, namely hydrogenases and cytochromes. The transmembrane redox complexes known to date are also described and discussed. Redox-Bohr and cooperativity effects, observed in a few cytochromes, and believed to be important for their functional role, are discussed. Kinetic studies performed with these redox proteins, showing clues to their functional inter-relationship, are also addressed. These provide the groundwork for the application of a variety of molecular modelling approaches to understanding electron transfer and protein interactions among redox partners, leading to the characterization of several transient periplasmic complexes. In contrast to the detailed understanding of the periplasmic hydrogen oxidation process, very little is known about the cytoplasmic side of the respiratory electron transfer chain, in terms of molecular components (with exception of the terminal reductases), their structure and the protein-protein interactions involved in sulphate reduction. Therefore, a thorough understanding of the sulphate respiratory chain in Desulfovibrio remains a challenging task.

Electrical control of spin dynamics in finite one-dimensional systems

NASA Astrophysics Data System (ADS)

Pertsova, A.; Stamenova, M.; Sanvito, S.

2011-10-01

We investigate the possibility of the electrical control of spin transfer in monoatomic chains incorporating spin impurities. Our theoretical framework is the mixed quantum-classical (Ehrenfest) description of the spin dynamics, in the spirit of the s-d model, where the itinerant electrons are described by a tight-binding model while localized spins are treated classically. Our main focus is on the dynamical exchange interaction between two well-separated spins. This can be quantified by the transfer of excitations in the form of transverse spin oscillations. We systematically study the effect of an electrostatic gate bias Vg on the interconnecting channel and we map out the long-range dynamical spin transfer as a function of Vg. We identify regions of Vg giving rise to significant amplification of the spin transmission at low frequencies and relate this to the electronic structure of the channel.

Light-induced Conversion of Trp to Gly and Gly Hydroperoxide in IgG1

PubMed Central

Haywood, Jessica; Mozziconacci, Olivier; Allegre, Kevin M.; Kerwin, Bruce A.; Schöneich, Christian

2013-01-01

The exposure of IgG1 in aqueous solution to light with λ = 254 nm or λ > 295 nm yields products consistent with Trp radical cation formation followed by αC-βC cleavage of the Trp side chain. The resulting glycyl radicals are either reduced to Gly, or add oxygen prior to reduction to Gly hydroperoxide. Photoirradiation at λ = 254 nm targets Trp at positions 191 (light chain), 309 and 377 (heavy chain) while photoirradiation at λ > 295 nm targets Trp at position 309 (heavy chain). Mechanistically, the formation of Trp radical cations likely proceeds via photo-induced electron- or hydrogen-transfer to disulfide bonds, yielding thiyl radicals and thiols, where thiols may serve as reductants for the intermediary glycyl or glycylperoxyl radicals. PMID:23363477

Constraint-Based Modeling of Carbon Fixation and the Energetics of Electron Transfer in Geobacter metallireducens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feist, AM; Nagarajan, H; Rotaru, AE

2014-04-24

Geobacter species are of great interest for environmental and biotechnology applications as they can carry out direct electron transfer to insoluble metals or other microorganisms and have the ability to assimilate inorganic carbon. Here, we report on the capability and key enabling metabolic machinery of Geobacter metallireducens GS-15 to carry out CO2 fixation and direct electron transfer to iron. An updated metabolic reconstruction was generated, growth screens on targeted conditions of interest were performed, and constraint-based analysis was utilized to characterize and evaluate critical pathways and reactions in G. metallireducens. The novel capability of G. metallireducens to grow autotrophically withmore » formate and Fe(III) was predicted and subsequently validated in vivo. Additionally, the energetic cost of transferring electrons to an external electron acceptor was determined through analysis of growth experiments carried out using three different electron acceptors (Fe(III), nitrate, and fumarate) by systematically isolating and examining different parts of the electron transport chain. The updated reconstruction will serve as a knowledgebase for understanding and engineering Geobacter and similar species. Author Summary The ability of microorganisms to exchange electrons directly with their environment has large implications for our knowledge of industrial and environmental processes. For decades, it has been known that microbes can use electrodes as electron acceptors in microbial fuel cell settings. Geobacter metallireducens has been one of the model organisms for characterizing microbe-electrode interactions as well as environmental processes such as bioremediation. Here, we significantly expand the knowledge of metabolism and energetics of this model organism by employing constraint-based metabolic modeling. Through this analysis, we build the metabolic pathways necessary for carbon fixation, a desirable property for industrial chemical production. We further discover a novel growth condition which enables the characterization of autotrophic (i.e., carbon-fixing) metabolism in Geobacter. Importantly, our systems-level modeling approach helped elucidate the key metabolic pathways and the energetic cost associated with extracellular electron transfer. This model can be applied to characterize and engineer the metabolism and electron transfer capabilities of Geobacter for biotechnological applications.« less

Complexation facilitated reduction of aromatic N-oxides by aqueous Fe(II)-tiron complex: reaction kinetics and mechanisms.

PubMed

Chen, Yiling; Zhang, Huichun

2013-10-01

Rapid reduction of carbadox (CDX), olaquindox and several other aromatic N-oxides were investigated in aqueous solution containing Fe(II) and tiron. Consistent with previous work, the 1:2 Fe(II)-tiron complex, FeL2(6-), is the dominant reactive species as its concentration linearly correlates with the observed rate constant kobs under various conditions. The N-oxides without any side chains were much less reactive, suggesting direct reduction of the N-oxides is slow. UV-vis spectra suggest FeL2(6-) likely forms 5- or 7-membered rings with CDX and olaquindox through the N and O atoms on the side chain. The formed inner-sphere complexes significantly facilitated electron transfer from FeL2(6-) to the N-oxides. Reduction products of the N-oxides were identified by HPLC/QToF-MS to be the deoxygenated analogs. QSAR analysis indicated neither the first electron transfer nor N-O bond cleavage is the rate-limiting step. Calculations of the atomic spin densities of the anionic N-oxides confirmed the extensive delocalization between the aromatic ring and the side chain, suggesting complex formation can significantly affect the reduction kinetics. Our results suggest the complexation facilitated N-oxide reduction by Fe(II)-tiron involves a free radical mechanism, and the subsequent deoxygenation might also benefit from the weak complexation of Fe(II) with the N-oxide O atom.

Investigation of local modification and luminescence of a carbon nanotube by scanning tunneling microscopy

NASA Astrophysics Data System (ADS)

Katano, Satoshi; Fujita, Hiroto; Uehara, Yoichi

2018-01-01

We have studied the nanoscale luminescence from a multiwalled carbon nanotube (CNT) adsorbed on Au(111) using a scanning tunneling microscope (STM). STM images revealed that a number of isolated chains of CNTs can be deposited by dry contact transfer while keeping the surface clean. By injecting tunneling electrons from the STM tip to the CNT, we observed STM light emission (STM-LE) from the CNT in the visible-light range, showing electronic transitions between the bands associated with the van Hove singularity in the density of states of the CNT. The STM-LE spectrum was obviously changed after introducing the local defect created by the STM tip, indicating the controllability of the nanoscale luminescence within a single chain of a CNT.

Effect of magnetic ion Ni doping for Cu in the CuO 2 plane on electronic structure and superconductivity on Y123 cuprate

NASA Astrophysics Data System (ADS)

Cao, Shixun; Li, Pinglin; Cao, Guixin; Zhang, Jincang

2003-05-01

The YBa2Cu3-xNixO7-δ with x=0-0.4 have been studied using positron annihilation technique. The changes of positron annihilation parameters with the Ni substitution concentration x are given. From the change of electronic density ne and Tc, it would prove that the localized carriers (electron and hole) in Cu-O chain and CuO2 planes have enormous influence on superconductivity by affecting charge transfer between the reservoir layer and CuO2 planes.

Elucidating the design principles of photosynthetic electron-transfer proteins by site-directed spin labeling EPR spectroscopy.

PubMed

Ishara Silva, K; Jagannathan, Bharat; Golbeck, John H; Lakshmi, K V

2016-05-01

Site-directed spin labeling electron paramagnetic resonance (SDSL EPR) spectroscopy is a powerful tool to determine solvent accessibility, side-chain dynamics, and inter-spin distances at specific sites in biological macromolecules. This information provides important insights into the structure and dynamics of both natural and designed proteins and protein complexes. Here, we discuss the application of SDSL EPR spectroscopy in probing the charge-transfer cofactors in photosynthetic reaction centers (RC) such as photosystem I (PSI) and the bacterial reaction center (bRC). Photosynthetic RCs are large multi-subunit proteins (molecular weight≥300 kDa) that perform light-driven charge transfer reactions in photosynthesis. These reactions are carried out by cofactors that are paramagnetic in one of their oxidation states. This renders the RCs unsuitable for conventional nuclear magnetic resonance spectroscopy investigations. However, the presence of native paramagnetic centers and the ability to covalently attach site-directed spin labels in RCs makes them ideally suited for the application of SDSL EPR spectroscopy. The paramagnetic centers serve as probes of conformational changes, dynamics of subunit assembly, and the relative motion of cofactors and peptide subunits. In this review, we describe novel applications of SDSL EPR spectroscopy for elucidating the effects of local structure and dynamics on the electron-transfer cofactors of photosynthetic RCs. Because SDSL EPR Spectroscopy is uniquely suited to provide dynamic information on protein motion, it is a particularly useful method in the engineering and analysis of designed electron transfer proteins and protein networks. This article is part of a Special Issue entitled Biodesign for Bioenergetics--the design and engineering of electronic transfer cofactors, proteins and protein networks, edited by Ronald L. Koder and J.L. Ross Anderson. Copyright © 2016. Published by Elsevier B.V.

Potentiation of antimicrobial photodynamic inactivation mediated by a cationic fullerene by added iodide: in vitro and in vivo studies

PubMed Central

Zhang, Yunsong; Dai, Tianhong; Wang, Min; Vecchio, Daniela; Chiang, Long Y; Hamblin, Michael R

2016-01-01

Background Antimicrobial photodynamic inactivation with fullerenes bearing cationic charges may overcome resistant microbes. Methods & results We synthesized C60-fullerene (LC16) bearing decaquaternary chain and deca-tertiary-amino groups that facilitates electron-transfer reactions via the photoexcited fullerene. Addition of the harmless salt, potassium iodide (10 mM) potentiated the ultraviolet A (UVA) or white light-mediated killing of Gram-negative bacteria Acinetobacter baumannii, Gram-positive methicillin-resistant Staphylococcus aureus and fungal yeast Candida albicans by 1–2+ logs. Mouse model infected with bioluminescent Acinetobacter baumannii gave increased loss of bioluminescence when iodide (10 mM) was combined with LC16 and UVA/white light. Conclusion The mechanism may involve photoinduced electron reduction of 1(C60>)* or 3(C60>)* by iodide producing I· or I2 followed by subsequent intermolecular electron-transfer events of (C60>)−· to produce reactive radicals. PMID:25723093

Photosynthesis.

PubMed

Johnson, Matthew P

2016-10-31

Photosynthesis sustains virtually all life on planet Earth providing the oxygen we breathe and the food we eat; it forms the basis of global food chains and meets the majority of humankind's current energy needs through fossilized photosynthetic fuels. The process of photosynthesis in plants is based on two reactions that are carried out by separate parts of the chloroplast. The light reactions occur in the chloroplast thylakoid membrane and involve the splitting of water into oxygen, protons and electrons. The protons and electrons are then transferred through the thylakoid membrane to create the energy storage molecules adenosine triphosphate (ATP) and nicotinomide-adenine dinucleotide phosphate (NADPH). The ATP and NADPH are then utilized by the enzymes of the Calvin-Benson cycle (the dark reactions), which converts CO 2 into carbohydrate in the chloroplast stroma. The basic principles of solar energy capture, energy, electron and proton transfer and the biochemical basis of carbon fixation are explained and their significance is discussed. © 2016 The Author(s).

Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

NASA Astrophysics Data System (ADS)

Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

2018-04-01

We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

Mitochondrial Protein Interaction Mapping Identifies Regulators of Respiratory Chain Function.

PubMed

Floyd, Brendan J; Wilkerson, Emily M; Veling, Mike T; Minogue, Catie E; Xia, Chuanwu; Beebe, Emily T; Wrobel, Russell L; Cho, Holly; Kremer, Laura S; Alston, Charlotte L; Gromek, Katarzyna A; Dolan, Brendan K; Ulbrich, Arne; Stefely, Jonathan A; Bohl, Sarah L; Werner, Kelly M; Jochem, Adam; Westphall, Michael S; Rensvold, Jarred W; Taylor, Robert W; Prokisch, Holger; Kim, Jung-Ja P; Coon, Joshua J; Pagliarini, David J

2016-08-18

Mitochondria are essential for numerous cellular processes, yet hundreds of their proteins lack robust functional annotation. To reveal functions for these proteins (termed MXPs), we assessed condition-specific protein-protein interactions for 50 select MXPs using affinity enrichment mass spectrometry. Our data connect MXPs to diverse mitochondrial processes, including multiple aspects of respiratory chain function. Building upon these observations, we validated C17orf89 as a complex I (CI) assembly factor. Disruption of C17orf89 markedly reduced CI activity, and its depletion is found in an unresolved case of CI deficiency. We likewise discovered that LYRM5 interacts with and deflavinates the electron-transferring flavoprotein that shuttles electrons to coenzyme Q (CoQ). Finally, we identified a dynamic human CoQ biosynthetic complex involving multiple MXPs whose topology we map using purified components. Collectively, our data lend mechanistic insight into respiratory chain-related activities and prioritize hundreds of additional interactions for further exploration of mitochondrial protein function. Copyright © 2016 Elsevier Inc. All rights reserved.

Electron Transfer Between Electrically Conductive Minerals and Quinones

NASA Astrophysics Data System (ADS)

Taran, Olga

2017-07-01

Long-distance electron transfer in marine environments couples physically separated redox half-reactions, impacting biogeochemical cycles of iron, sulfur and carbon. Bacterial bio-electrochemical systems that facilitate electron transfer via conductive filaments or across man-made electrodes are well known, but the impact of abiotic currents across naturally occurring conductive and semiconducitve minerals is poorly understood. In this paper I use cyclic voltammetry to explore electron transfer between electrodes made of common iron minerals (magnetite, hematite, pyrite, pyrrhotite, mackinawite and greigite), and hydroquinones - a class of organic molecules found in carbon-rich sediments. Of all tested minerals, only pyrite and magnetite showed an increase in electric current in the presence of organic molecules, with pyrite showing excellent electrocatalytic performance. Pyrite electrodes performed better than commercially available glassy carbon electrodes and showed higher peak currents, lower overpotential values and a smaller separation between oxidation and reduction peaks for each tested quinone. Hydroquinone oxidation on pyrite surfaces was reversible, diffusion controlled, and stable over a large number of potential cycles. Given the ubiquity of both pyrite and quinones, abiotic electron transfer between minerals and organic molecules is likely widespread in Nature and may contribute to several different phenomena, including anaerobic respiration of a wide variety of microorganisms in temporally anoxic zones or in the proximity of hydrothermal vent chimneys, as well as quinone cycling and the propagation of anoxic zones in organic rich waters. Finally, interactions between pyrite and quinones make use of electrochemical gradients that have been suggested as an important source of energy for the origins of life on Earth. Ubiquinones and iron sulfide clusters are common redox cofactors found in electron transport chains across all domains of life and interactions between quinones and pyrite might have been an early analogue of this ubiquitous systems.

Photoinduced electron transfer through peptide-based self-assembled monolayers chemisorbed on gold electrodes: directing the flow-in and flow-out of electrons through peptide helices.

PubMed

Venanzi, Mariano; Gatto, Emanuela; Caruso, Mario; Porchetta, Alessandro; Formaggio, Fernando; Toniolo, Claudio

2014-08-21

Photoinduced electron transfer (PET) experiments have been carried out on peptide self-assembled monolayers (SAM) chemisorbed on a gold substrate. The oligopeptide building block was exclusively formed by C(α)-tetrasubstituted α-aminoisobutyric residues to attain a helical conformation despite the shortness of the peptide chain. Furthermore, it was functionalized at the C-terminus by a pyrene choromophore to enhance the UV photon capture cross-section of the compound and by a lipoic group at the N-terminus for linking to gold substrates. Electron transfer across the peptide SAM has been studied by photocurrent generation experiments in an electrochemical cell employing a gold substrate modified by chemisorption of a peptide SAM as a working electrode and by steady-state and time-resolved fluorescence experiments in solution and on a gold-coated glass. The results show that the electronic flow through the peptide bridge is strongly asymmetric; i.e., PET from the C-terminus to gold is highly favored with respect to PET in the opposite direction. This effect arises from the polarity of the Au-S linkage (Au(δ+)-S(δ-), junction effect) and from the electrostatic field generated by the peptide helix.

Electronic coupling through natural amino acids.

PubMed

Berstis, Laura; Beckham, Gregg T; Crowley, Michael F

2015-12-14

Myriad scientific domains concern themselves with biological electron transfer (ET) events that span across vast scales of rate and efficiency through a remarkably fine-tuned integration of amino acid (AA) sequences, electronic structure, dynamics, and environment interactions. Within this intricate scheme, many questions persist as to how proteins modulate electron-tunneling properties. To help elucidate these principles, we develop a model set of peptides representing the common α-helix and β-strand motifs including all natural AAs within implicit protein-environment solvation. Using an effective Hamiltonian strategy with density functional theory, we characterize the electronic coupling through these peptides, furthermore considering side-chain dynamics. For both motifs, predictions consistently show that backbone-mediated electronic coupling is distinctly sensitive to AA type (aliphatic, polar, aromatic, negatively charged and positively charged), and to side-chain orientation. The unique properties of these residues may be employed to design activated, deactivated, or switch-like superexchange pathways. Electronic structure calculations and Green's function analyses indicate that localized shifts in the electron density along the peptide play a role in modulating these pathways, and further substantiate the experimentally observed behavior of proline residues as superbridges. The distinct sensitivities of tunneling pathways to sequence and conformation revealed in this electronic coupling database help improve our fundamental understanding of the broad diversity of ET reactivity and provide guiding principles for peptide design.

Charge-Transfer-Induced Fluorescence Quenching of Anthracene Derivatives and Selective Detection of Picric Acid.

PubMed

Santra, Dines Chandra; Bera, Manas Kumar; Sukul, Pradip Kumar; Malik, Sudip

2016-02-01

2,6-Divinylpyridine-appended anthracene derivatives flanked by two alkyl chains at the 9,10-position of the core have been designed, synthesized, and characterized by NMR, MALDI-TOF, FTIR, and single-crystal XRD. These anthracene derivatives are able to recognize picric acid (2,4,6-trinitrophenol, PA) selectively down to parts per billion (ppb) level in aqueous as well as nonaqueous medium. Fluorescence emission of these derivatives in solution is significantly quenched by adding trace amounts of PA, even in the presence of other competing analogues, such as 2,4-dinitrophenol (2,4-DNP), 4-nitrophenol (NP), nitrobenzene (NB), benzoic acid (BA), and phenol (PH). The high sensitivity of these derivatives toward PA is considered as a combined effect of the proton-induced intramolecular charge transfer (ICT) as well as electron transfer from the electron-rich anthracene to the electron-deficient PA. Moreover, visual detection of PA has been successfully demonstrated in the solid state by using different substrates. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Mechanisms of Oxygen Reduction in the Terminal Reducing Segment of the Chloroplast Photosynthetic Electron Transport Chain.

PubMed

Kozuleva, Marina A; Ivanov, Boris N

2016-07-01

The review is dedicated to ascertainment of the roles of the electron transfer cofactors of the pigment-protein complex of PSI, ferredoxin (Fd) and ferredoxin-NADP reductase in oxygen reduction in the photosynthetic electron transport chain (PETC) in the light. The data regarding oxygen reduction in other segments of the PETC are briefly analyzed, and it is concluded that their participation in the overall process in the PETC under unstressful conditions should be insignificant. Data concerning the contribution of Fd to the oxygen reduction in the PETC are examined. A set of collateral evidence as well as results of direct measurements of the involvement of Fd in this process in the presence of isolated thylakoids led to the inference that this contribution in vivo is negligible. The increase in oxygen reduction rate in the isolated thylakoids in the presence of either Fd or Fd plus NADP + under increasing light intensity was attributed to the increase in oxygen reduction executed by the membrane-bound oxygen reductants. Data are presented which imply that a main reductant of the O 2 molecule in the terminal reducing segment of the PETC is the electron transfer cofactor of PSI, phylloquinone. The physiological significance of characteristic properties of oxygen reductants in this segment of the PETC is discussed. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Assessment of eHealth capabilities and utilization in residential care settings.

PubMed

Towne, Samuel D; Lee, Shinduk; Li, Yajuan; Smith, Matthew Lee

2016-12-01

The US National Survey of Residential Care Facilities was used to conduct cross-sectional analyses of residential care facilities (n = 2302). Most residential care facilities lacked computerized capabilities for one or more of these capabilities in 2010. Lacking computerized systems supporting electronic health information exchange with pharmacies was associated with non-chain affiliation (p < .05). Lacking electronic health information exchange with physicians was associated with being a small-sized facility (vs large) (p < .05). Lacking computerized capabilities for discharge/transfer summaries was associated with for-profit status (p < .05) and small-sized facilities (p < .05). Lacking computerized capabilities for medical provider information was associated with non-chain affiliation (p < .05), small- or medium-sized facilities (p < .05), and for-profit status (p < .05). Lack of electronic health record was associated with non-chain affiliation (p < .05), small- or medium-sized facilities (p < .05), for-profit status (p < .05), and location in urban areas (p < .05). eHealth disparities exist across residential care facilities. As the older adult population continues to grow, resources must be in place to provide an integrated system of care across multiple settings. © The Author(s) 2015.

Strategies for manipulation of oxygen utilization by the electron transfer chain in microbes for metabolic engineering purposes.

PubMed

Bennett, George N; San, Ka-Yiu

2017-05-01

Microaerobic growth is of importance in ecological niches, pathogenic infections and industrial production of chemicals. The use of low levels of oxygen enables the cell to gain energy and grow more robustly in the presence of a carbon source that can be oxidized and provide electrons to the respiratory chain in the membrane. A considerable amount of information is available on the genes and proteins involved in respiratory growth and the regulation of genes involved in aerobic and anaerobic metabolism. The dependence of regulation on sensing systems that respond to reduced quinones (e.g. ArcB) or oxygen levels that affect labile redox components of transcription regulators (Fnr) are key in understanding the regulation. Manipulation of the amount of respiration can be difficult to control in dense cultures or inadequately mixed reactors leading to inhomogeneous cultures that may have lower than optimal performance. Efforts to control respiration through genetic means have been reported and address mutations affecting components of the electron transport chain. In a recent report completion for intermediates of the ubiquinone biosynthetic pathway was used to dial the level of respiration vs lactate formation in an aerobically grown E. coli culture.

Biomimetic Interfacial Electron-Induced Electrochemiluminesence.

PubMed

Pu, Guiqiang; Zhang, Dongxu; Mao, Xiang; Zhang, Zhen; Wang, Huan; Ning, Xingming; Lu, Xiaoquan

2018-04-17

We provide here, for the first time, a new interfacial electron-induced electrochemiluminescence (IEIECL) system, realizing bionic construction of bioluminescence (BL) by exploiting electrochemiluminescence (ECL) and ITIES (the interface between two immiscible electrolyte solutions). Significantly, the superiority of the IEIECL system is embodied with the solution of the two bottlenecks encountered in the conventional ECL innovation: that are (a) the applications of hydrophobic luminophores in more commonly used aqueous solution are inhibited tremendously due to the poor inherent solubility and the instability of radicals and (b) the analytes, insoluble in water, are hard to be discovered in an aqueous system because of too little content. More productive IEIECL radiation, analogous to BL, originates from the triplet excited state porphyrin in comparison to the homogeneous ECL. The mechanism of IEIECL, as well as the interaction mechanism between IEIECL and charge transfer (comprising electron transfer (ET), ion transfer (IT), and facilitated ion transfer (FIT)) at the ITIES, are explored in detail. Finally, we emphasize the actual application potential of the IEIECL system with the detection of cytochrome c (Cyt c); it is a key biomolecule in the electron transport chain in the process of biological oxidation and is also an intermediate species in apoptosis. Potentially, the IEIECL system permits ones to explore the lifetime and diffusion path of free radicals, as well as imparting a possibility for the construction of a bionic sensor.

How to polymerize ethylene in a highly controlled fashion?

PubMed

Kempe, Rhett

2007-01-01

Very fast, reversible, polyethylene (PE) chain transfer or complex-catalysed "Aufbaureaktion" describes a "living" chain-growing process on a main-group metal or zinc atom; this process is catalysed by an organo-transition-metal or lanthanide complex. PE chains are transferred very fast between the two metal sites and chain growth takes place through ethylene insertion into the transition-metal- or lanthanide-carbon bond-coordinative chain-transfer polymerisation (CCTP). The transferred chains "rest" at the main-group or zinc centre, at which chain-termination processes like beta-H transfer/elimination are of low significance. Such protocols can be used to synthesise very narrowly distributed PE materials (M(w)/M(n)<1.1 up to a molecular weight of about 4000 g mol(-1)) with differently functionalised end groups. Higher molecular-weight polymers can be obtained with a slightly increased M(w)/M(n), since diffusion control and precipitation of the polymers influences the chain-transfer process. Recently, a few transition-metal- or lanthanide-based catalyst systems that catalyse such a highly reversible chain-growing process have been described. They are summarised and compared within this contribution.

CypD(-/-) hearts have altered levels of proteins involved in Krebs cycle, branch chain amino acid degradation and pyruvate metabolism.

PubMed

Menazza, Sara; Wong, Renee; Nguyen, Tiffany; Wang, Guanghui; Gucek, Marjan; Murphy, Elizabeth

2013-03-01

Cyclophilin D (CypD) is a mitochondrial chaperone that has been shown to regulate the mitochondrial permeability transition pore (MPTP). MPTP opening is a major determinant of mitochondrial dysfunction and cardiomyocyte death during ischemia/reperfusion (I/R) injury. Mice lacking CypD have been widely used to study regulation of the MPTP, and it has been shown recently that genetic depletion of CypD correlates with elevated levels of mitochondrial Ca(2+). The present study aimed to characterize the metabolic changes in CypD(-/-) hearts. Initially, we used a proteomics approach to examine protein changes in CypD(-/-) mice. Using pathway analysis, we found that CypD(-/-) hearts have alterations in branched chain amino acid metabolism, pyruvate metabolism and the Krebs cycle. We tested whether these metabolic changes were due to inhibition of electron transfer from these metabolic pathways into the electron transport chain. As we found decreased levels of succinate dehydrogenase and electron transfer flavoprotein in the proteomics analysis, we examined whether activities of these enzymes might be altered. However, we found no alterations in their activities. The proteomics study also showed a 23% decrease in carnitine-palmitoyltransferase 1 (CPT1), which prompted us to perform a metabolomics analysis. Consistent with the decrease in CPT1, we found a significant decrease in C4/Ci4, C5-OH/C3-DC, C12:1, C14:1, C16:1, and C20:3 acyl carnitines in hearts from CypD(-/-) mice. In summary, CypD(-/-) hearts exhibit changes in many metabolic pathways and caution should be used when interpreting results from these mice as due solely to inhibition of the MPTP. Published by Elsevier Ltd.

The cytochrome b6f complex at the crossroad of photosynthetic electron transport pathways.

PubMed

Tikhonov, Alexander N

2014-08-01

Regulation of photosynthetic electron transport at the level of the cytochrome b6f complex provides efficient performance of the chloroplast electron transport chain (ETC). In this review, after brief overview of the structural organization of the chloroplast ETC, the consideration of the problem of electron transport control is focused on the plastoquinone (PQ) turnover and its interaction with the b6f complex. The data available show that the rates of plastoquinol (PQH2) formation in PSII and its diffusion to the b6f complex do not limit the overall rate of electron transfer between photosystem II (PSII) and photosystem I (PSI). Analysis of experimental and theoretical data demonstrates that the rate-limiting step in the intersystem chain of electron transport is determined by PQH2 oxidation at the Qo-site of the b6f complex, which is accompanied by the proton release into the thylakoid lumen. The acidification of the lumen causes deceleration of PQH2 oxidation, thus impeding the intersystem electron transport. Two other mechanisms of regulation of the intersystem electron transport have been considered: (i) "state transitions" associated with the light-induced redistribution of solar energy between PSI and PSII, and (ii) redistribution of electron fluxes between alternative pathways (noncyclic electron transport and cyclic electron flow around PSI). Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Role of Reversible Histidine Coordination in Hydroxylamine Reduction by Plant Hemoglobins (Phytoglobins).

PubMed

Athwal, Navjot Singh; Alagurajan, Jagannathan; Andreotti, Amy H; Hargrove, Mark S

2016-10-18

Reduction of hydroxylamine to ammonium by phytoglobin, a plant hexacoordinate hemoglobin, is much faster than that of other hexacoordinate hemoglobins or pentacoordinate hemoglobins such as myoglobin, leghemoglobin, and red blood cell hemoglobin. The reason for differences in reactivity is not known but could be intermolecular electron transfer between protein molecules in support of the required two-electron reduction, hydroxylamine binding, or active site architecture favoring the reaction. Experiments were conducted with phytoglobins from rice, tomato, and soybean along with human neuroglobin and soybean leghemoglobin that reveal hydroxylamine binding as the rate-limiting step. For hexacoordinate hemoglobins, binding is limited by the dissociation rate constant for the distal histidine, while leghemoglobin is limited by an intrinsically low affinity for hydroxylamine. When the distal histidine is removed from rice phytoglobin, a hydroxylamine-bound intermediate is formed and the reaction rate is diminished, indicating that the distal histidine imidazole side chain is critical for the reaction, albeit not for electron transfer but rather for direct interaction with the substrate. Together, these results demonstrate that phytoglobins are superior at hydroxylamine reduction because they have distal histidine coordination affinity constants near 1, and facile rate constants for binding and dissociation of the histidine side chain. Hexacoordinate hemoglobins such as neuroglobin are limited by tighter histidine coordination that blocks hydroxylamine binding, and pentacoordinate hemoglobins have intrinsically lower hydroxylamine affinities.

The influence of alternative pathways of respiration that utilize branched-chain amino acids following water shortage in Arabidopsis.

PubMed

Pires, Marcel V; Pereira Júnior, Adilson A; Medeiros, David B; Daloso, Danilo M; Pham, Phuong Anh; Barros, Kallyne A; Engqvist, Martin K M; Florian, Alexandra; Krahnert, Ina; Maurino, Veronica G; Araújo, Wagner L; Fernie, Alisdair R

2016-06-01

During dark-induced senescence isovaleryl-CoA dehydrogenase (IVDH) and D-2-hydroxyglutarate dehydrogenase (D-2HGDH) act as alternate electron donors to the ubiquinol pool via the electron-transfer flavoprotein/electron-transfer flavoprotein:ubiquinone oxidoreductase (ETF/ETFQO) pathway. However, the role of this pathway in response to other stresses still remains unclear. Here, we demonstrated that this alternative pathway is associated with tolerance to drought in Arabidopsis. In comparison with wild type (WT) and lines overexpressing D-2GHDH, loss-of-function etfqo-1, d2hgdh-2 and ivdh-1 mutants displayed compromised respiration rates and were more sensitive to drought. Our results demonstrated that an operational ETF/ETFQO pathway is associated with plants' ability to withstand drought and to recover growth once water becomes replete. Drought-induced metabolic reprogramming resulted in an increase in tricarboxylic acid (TCA) cycle intermediates and total amino acid levels, as well as decreases in protein, starch and nitrate contents. The enhanced levels of the branched-chain amino acids in loss-of-function mutants appear to be related to their increased utilization as substrates for the TCA cycle under water stress. Our results thus show that mitochondrial metabolism is highly active during drought stress responses and provide support for a role of alternative respiratory pathways within this response. © 2015 John Wiley & Sons Ltd.

Organic-inorganic random copolymers from methacrylate-terminated poly(ethylene oxide) with 3-methacryloxypropylheptaphenyl polyhedral oligomeric silsesquioxane: synthesis via RAFT polymerization and self-assembly behavior.

PubMed

Wei, Kun; Li, Lei; Zheng, Sixun; Wang, Ge; Liang, Qi

2014-01-14

In this contribution, we report the synthesis of organic-inorganic random polymers from methacrylate-terminated poly(ethylene oxide) (MAPEO) (Mn = 950) and 3-methacryloxypropylheptaphenyl polyhedral oligomeric silsesquioxane (MAPOSS) macromers via reversible addition-fragmentation chain transfer (RAFT) polymerization with 4-cyano-4-(thiobenzoylthio) valeric acid (CTBTVA) as the chain transfer agent. The organic-inorganic random copolymers were characterized by means of (1)H NMR spectroscopy, gel permeation chromatography (GPC) and differential scanning calorimetry (DSC). The results of GPC indicate that the polymerizations were carried out in a controlled fashion. Transmission electron microscopy (TEM) showed that the organic-inorganic random copolymers in bulk were microphase-separated and the POSS microdomains were formed via POSS-POSS interactions. In aqueous solutions the organic-inorganic random copolymers were capable of self-assembling into spherical nanoobjects as evidenced by transmission electron microscopy (TEM) and dynamic laser scattering (DLS). The self-assembly behavior of the organic-inorganic random copolymers was also found to occur in the mixtures with the precursors of epoxy. The nanostructures were further fixed via subsequent curing reaction and thus the organic-inorganic nanocomposites were obtained. The formation of nanophases in epoxy thermosets was confirmed by transmission electron microscopy (TEM) and dynamic mechanical thermal analysis (DMTA). The organic-inorganic nanocomposites displayed the enhanced surface hydrophobicity as evidenced by surface contact angle measurements.

Genomic, proteomic, and biochemical analysis of the organohalide respiratory pathway in Desulfitobacterium dehalogenans.

PubMed

Kruse, Thomas; van de Pas, Bram A; Atteia, Ariane; Krab, Klaas; Hagen, Wilfred R; Goodwin, Lynne; Chain, Patrick; Boeren, Sjef; Maphosa, Farai; Schraa, Gosse; de Vos, Willem M; van der Oost, John; Smidt, Hauke; Stams, Alfons J M

2015-03-01

Desulfitobacterium dehalogenans is able to grow by organohalide respiration using 3-chloro-4-hydroxyphenyl acetate (Cl-OHPA) as an electron acceptor. We used a combination of genome sequencing, biochemical analysis of redox active components, and shotgun proteomics to study elements of the organohalide respiratory electron transport chain. The genome of Desulfitobacterium dehalogenans JW/IU-DC1(T) consists of a single circular chromosome of 4,321,753 bp with a GC content of 44.97%. The genome contains 4,252 genes, including six rRNA operons and six predicted reductive dehalogenases. One of the reductive dehalogenases, CprA, is encoded by a well-characterized cprTKZEBACD gene cluster. Redox active components were identified in concentrated suspensions of cells grown on formate and Cl-OHPA or formate and fumarate, using electron paramagnetic resonance (EPR), visible spectroscopy, and high-performance liquid chromatography (HPLC) analysis of membrane extracts. In cell suspensions, these components were reduced upon addition of formate and oxidized after addition of Cl-OHPA, indicating involvement in organohalide respiration. Genome analysis revealed genes that likely encode the identified components of the electron transport chain from formate to fumarate or Cl-OHPA. Data presented here suggest that the first part of the electron transport chain from formate to fumarate or Cl-OHPA is shared. Electrons are channeled from an outward-facing formate dehydrogenase via menaquinones to a fumarate reductase located at the cytoplasmic face of the membrane. When Cl-OHPA is the terminal electron acceptor, electrons are transferred from menaquinones to outward-facing CprA, via an as-yet-unidentified membrane complex, and potentially an extracellular flavoprotein acting as an electron shuttle between the quinol dehydrogenase membrane complex and CprA. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Genomic, Proteomic, and Biochemical Analysis of the Organohalide Respiratory Pathway in Desulfitobacterium dehalogenans

PubMed Central

van de Pas, Bram A.; Atteia, Ariane; Krab, Klaas; Hagen, Wilfred R.; Goodwin, Lynne; Chain, Patrick; Boeren, Sjef; Maphosa, Farai; Schraa, Gosse; de Vos, Willem M.; van der Oost, John; Smidt, Hauke

2014-01-01

Desulfitobacterium dehalogenans is able to grow by organohalide respiration using 3-chloro-4-hydroxyphenyl acetate (Cl-OHPA) as an electron acceptor. We used a combination of genome sequencing, biochemical analysis of redox active components, and shotgun proteomics to study elements of the organohalide respiratory electron transport chain. The genome of Desulfitobacterium dehalogenans JW/IU-DC1T consists of a single circular chromosome of 4,321,753 bp with a GC content of 44.97%. The genome contains 4,252 genes, including six rRNA operons and six predicted reductive dehalogenases. One of the reductive dehalogenases, CprA, is encoded by a well-characterized cprTKZEBACD gene cluster. Redox active components were identified in concentrated suspensions of cells grown on formate and Cl-OHPA or formate and fumarate, using electron paramagnetic resonance (EPR), visible spectroscopy, and high-performance liquid chromatography (HPLC) analysis of membrane extracts. In cell suspensions, these components were reduced upon addition of formate and oxidized after addition of Cl-OHPA, indicating involvement in organohalide respiration. Genome analysis revealed genes that likely encode the identified components of the electron transport chain from formate to fumarate or Cl-OHPA. Data presented here suggest that the first part of the electron transport chain from formate to fumarate or Cl-OHPA is shared. Electrons are channeled from an outward-facing formate dehydrogenase via menaquinones to a fumarate reductase located at the cytoplasmic face of the membrane. When Cl-OHPA is the terminal electron acceptor, electrons are transferred from menaquinones to outward-facing CprA, via an as-yet-unidentified membrane complex, and potentially an extracellular flavoprotein acting as an electron shuttle between the quinol dehydrogenase membrane complex and CprA. PMID:25512312

Nonmetallic electronegativity equalization and point-dipole interaction model including exchange interactions for molecular dipole moments and polarizabilities.

PubMed

Smalø, Hans S; Astrand, Per-Olof; Jensen, Lasse

2009-07-28

The electronegativity equalization model (EEM) has been combined with a point-dipole interaction model to obtain a molecular mechanics model consisting of atomic charges, atomic dipole moments, and two-atom relay tensors to describe molecular dipole moments and molecular dipole-dipole polarizabilities. The EEM has been phrased as an atom-atom charge-transfer model allowing for a modification of the charge-transfer terms to avoid that the polarizability approaches infinity for two particles at infinite distance and for long chains. In the present work, these shortcomings have been resolved by adding an energy term for transporting charges through individual atoms. A Gaussian distribution is adopted for the atomic charge distributions, resulting in a damping of the electrostatic interactions at short distances. Assuming that an interatomic exchange term may be described as the overlap between two electronic charge distributions, the EEM has also been extended by a short-range exchange term. The result is a molecular mechanics model where the difference of charge transfer in insulating and metallic systems is modeled regarding the difference in bond length between different types of system. For example, the model is capable of modeling charge transfer in both alkanes and alkenes with alternating double bonds with the same set of carbon parameters only relying on the difference in bond length between carbon sigma- and pi-bonds. Analytical results have been obtained for the polarizability of a long linear chain. These results show that the model is capable of describing the polarizability scaling both linearly and nonlinearly with the size of the system. Similarly, a linear chain with an end atom with a high electronegativity has been analyzed analytically. The dipole moment of this model system can either be independent of the length or increase linearly with the length of the chain. In addition, the model has been parametrized for alkane and alkene chains with data from density functional theory calculations, where the polarizability behaves differently with the chain length. For the molecular dipole moment, the same two systems have been studied with an aldehyde end group. Both the molecular polarizability and the dipole moment are well described as a function of the chain length for both alkane and alkene chains demonstrating the power of the presented model.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bolton, Justin; Rzayev, Javid

Polystyrene–poly(methyl methacrylate)–polylactide (PS–PMMA–PLA) triblock bottlebrush copolymer with nearly symmetric volume fractions was synthesized by grafting from a symmetrical triblock backbone and the resulting melt was characterized by scanning electron microscopy and small-angle X-ray scattering. The copolymer backbone was prepared by sequential reversible addition–fragmentation chain transfer (RAFT) polymerization of solketal methacrylate (SM), 2-(bromoisobutyryl)ethyl methacrylate (BIEM), and 5-(trimethylsilyl)-4-pentyn-1-ol methacrylate (TPYM). PMMA branches were grafted by atom transfer radical polymerization from the poly(BIEM) segment, PS branches were grafted by RAFT polymerization from the poly(TPYM) block after installment of the RAFT agents, while PLA side chains were grafted from the deprotected poly(SM) block. Themore » resulting copolymer was found to exhibit a lamellae morphology with a domain spacing of 79 nm. Differential scanning calorimetry analysis indicated that PMMA was preferentially mixing with PS while phase separating from PLA domains.« less

An essential role of the mitochondrial electron transport chain in cell proliferation is to enable aspartate synthesis

PubMed Central

Birsoy, Kıvanç; Wang, Tim; Chen, Walter; Freinkman, Elizaveta; Abu-Remaileh, Monther; Sabatini, David M.

2015-01-01

Summary The mitochondrial electron transport chain (ETC) enables many metabolic processes, but why its inhibition suppresses cell proliferation is unclear. It is also not well understood why pyruvate supplementation allows cells lacking ETC function to proliferate. We used a CRISPR-based genetic screen to identify genes whose loss sensitizes human cells to phenformin, a complex I inhibitor. The screen yielded GOT1, the cytosolic aspartate aminotransferase, loss of which kills cells upon ETC inhibition. GOT1 normally consumes aspartate to transfer electrons into mitochondria, but, upon ETC inhibition, it reverses to generate aspartate in the cytosol, which partially compensates for the loss of mitochondrial aspartate synthesis. Pyruvate stimulates aspartate synthesis in a GOT1-dependent fashion, which is required for pyruvate to rescue proliferation of cells with ETC dysfunction. Aspartate supplementation or overexpression of an aspartate transporter allows cells without ETC activity to proliferate. Thus, enabling aspartate synthesis is an essential role of the ETC in cell proliferation. PMID:26232224

An Essential Role of the Mitochondrial Electron Transport Chain in Cell Proliferation Is to Enable Aspartate Synthesis.

PubMed

Birsoy, Kıvanç; Wang, Tim; Chen, Walter W; Freinkman, Elizaveta; Abu-Remaileh, Monther; Sabatini, David M

2015-07-30

The mitochondrial electron transport chain (ETC) enables many metabolic processes, but why its inhibition suppresses cell proliferation is unclear. It is also not well understood why pyruvate supplementation allows cells lacking ETC function to proliferate. We used a CRISPR-based genetic screen to identify genes whose loss sensitizes human cells to phenformin, a complex I inhibitor. The screen yielded GOT1, the cytosolic aspartate aminotransferase, loss of which kills cells upon ETC inhibition. GOT1 normally consumes aspartate to transfer electrons into mitochondria, but, upon ETC inhibition, it reverses to generate aspartate in the cytosol, which partially compensates for the loss of mitochondrial aspartate synthesis. Pyruvate stimulates aspartate synthesis in a GOT1-dependent fashion, which is required for pyruvate to rescue proliferation of cells with ETC dysfunction. Aspartate supplementation or overexpression of an aspartate transporter allows cells without ETC activity to proliferate. Thus, enabling aspartate synthesis is an essential role of the ETC in cell proliferation. Copyright © 2015 Elsevier Inc. All rights reserved.

Analysis of a Range of Catabolic Mutants Provides Evidence That Phytanoyl-Coenzyme A Does Not Act as a Substrate of the Electron-Transfer Flavoprotein/Electron-Transfer Flavoprotein:Ubiquinone Oxidoreductase Complex in Arabidopsis during Dark-Induced Senescence1[W][OA

PubMed Central

Araújo, Wagner L.; Ishizaki, Kimitsune; Nunes-Nesi, Adriano; Tohge, Takayuki; Larson, Tony R.; Krahnert, Ina; Balbo, Ilse; Witt, Sandra; Dörmann, Peter; Graham, Ian A.; Leaver, Christopher J.; Fernie, Alisdair R.

2011-01-01

The process of dark-induced senescence in plants is not fully understood, however, the functional involvement of an electron-transfer flavoprotein/electron-transfer flavoprotein:ubiquinone oxidoreductase (ETF/ETFQO), has been demonstrated. Recent studies have revealed that the enzymes isovaleryl-coenzyme A (CoA) dehydrogenase and 2-hydroxyglutarate dehydrogenase act as important electron donors to this complex. In addition both enzymes play a role in the breakdown of cellular carbon storage reserves with isovaleryl-CoA dehydrogenase being involved in degradation of the branched-chain amino acids, phytol, and lysine while 2-hydroxyglutarate dehydrogenase is exclusively involved in lysine degradation. Given that the chlorophyll breakdown intermediate phytanoyl-CoA accumulates dramatically both in knockout mutants of the ETF/ETFQO complex and of isovaleryl-CoA dehydrogenase following growth in extended dark periods we have investigated the direct importance of chlorophyll breakdown for the supply of carbon and electrons during this process. For this purpose we isolated three independent Arabidopsis (Arabidopsis thaliana) knockout mutants of phytanoyl-CoA 2-hydroxylase and grew them under the same extended darkness regime as previously used. Despite the fact that these mutants accumulated phytanoyl-CoA and also 2-hydroxyglutarate they exhibited no morphological changes in comparison to the other mutants previously characterized. These results are consistent with a single entry point of phytol breakdown into the ETF/ETFQO system and furthermore suggest that phytol is not primarily metabolized by this pathway. Furthermore analysis of isovaleryl-CoA dehydrogenase/2-hydroxyglutarate dehydrogenase double mutants generated here suggest that these two enzymes essentially account for the entire electron input via the ETF complex. PMID:21788362

Structure and charge transfer correlated with oxygen content for a Y0.8Ca0.2Ba2Cu3Oy (y = 6.84 6.32) system: a positron study

NASA Astrophysics Data System (ADS)

Cao, Shixun; Li, Lingwei; Liu, Fen; Li, Wenfeng; Chi, Changyun; Jing, Chao; Zhang, Jincang

2005-05-01

The structure and charge transfer correlated with oxygen content are studied by measuring the positron lifetime parameters of the Y0.8Ca0.2Ba2Cu3Oy system with a large range of oxygen content (y = 6.84-6.32). The local electron density ne is evaluated from the positron lifetime data. The positron lifetime parameters show a clear change around y = 6.50 where the compounds undergo the orthorhombic-tetragonal phase transition. The effect of ne and oxygen content on the structure, charge transfer and superconductivity are discussed. With the decrease of oxygen content y, O(4) tends to the Cu(1) site, causing carrier localization, and accordingly, the decrease of ne. This would prove that the localized carriers (electrons and holes) in the Cu-O chain region have great influence on the superconductivity by affecting the charge transfer between the reservoir layers and the conducting layers. The positron annihilation mechanism and its relation with superconductivity are also discussed.

Merging Photoredox with 1,2-Metallate Rearrangements: The Photochemical Alkylation of Vinyl Boronate Complexes.

PubMed

Silvi, Mattia; Sandford, Christopher; Aggarwal, Varinder K

2017-04-26

Vinyl boronates react with electron-deficient alkyl iodides in the presence of visible light to give boronic esters in which two new C-C bonds have been created. The reaction occurs by radical addition of an electron-deficient alkyl radical to the vinyl boronate followed by electron transfer with another molecule of alkyl iodide, continuing the chain, and triggering a 1,2-metalate rearrangement. In a number of cases, the use of a photoredox catalyst enhances yields significantly. The scope of the radical precursor includes α-iodo ketones, esters, nitriles, primary amides, α-fluorinated halo-acetates and perfluoroalkyl iodides.

Exciton Resonances in Novel Silicon Carbide Polymers

NASA Astrophysics Data System (ADS)

Burggraf, Larry; Duan, Xiaofeng

2015-05-01

A revolutionary technology transformation from electronics to excitionics for faster signal processing and computing will be advantaged by coherent exciton transfer at room temperature. The key feature required of exciton components for this technology is efficient and coherent transfer of long-lived excitons. We report theoretical investigations of optical properties of SiC materials having potential for high-temperature excitonics. Using Car-Parinello simulated annealing and DFT we identified low-energy SiC molecular structures. The closo-Si12C12 isomer, the most stable 12-12 isomer below 1100 C, has potential to make self-assembled chains and 2-D nanostructures to construct exciton components. Using TDDFT, we calculated the optical properties of the isomer as well as oligomers and 2-D crystal formed from the isomer as the monomer unit. This molecule has large optical oscillator strength in the visible. Its high-energy and low-energy transitions (1.15 eV and 2.56 eV) are nearly pure one-electron silicon-to-carbon transitions, while an intermediate energy transition (1.28 eV) is a nearly pure carbon-to-silicon one-electron charge transfer. These results are useful to describe resonant, coherent transfer of dark excitons in the nanostructures. Research supported by the Air Force Office of Scientific Research.

Cytochrome b 6 f function and localization, phosphorylation state of thylakoid membrane proteins and consequences on cyclic electron flow.

PubMed

Dumas, Louis; Chazaux, Marie; Peltier, Gilles; Johnson, Xenie; Alric, Jean

2016-09-01

Both the structure and the protein composition of thylakoid membranes have an impact on light harvesting and electron transfer in the photosynthetic chain. Thylakoid membranes form stacks and lamellae where photosystem II and photosystem I localize, respectively. Light-harvesting complexes II can be associated to either PSII or PSI depending on the redox state of the plastoquinone pool, and their distribution is governed by state transitions. Upon state transitions, the thylakoid ultrastructure and lateral distribution of proteins along the membrane are subject to significant rearrangements. In addition, quinone diffusion is limited to membrane microdomains and the cytochrome b 6 f complex localizes either to PSII-containing grana stacks or PSI-containing stroma lamellae. Here, we discuss possible similarities or differences between green algae and C3 plants on the functional consequences of such heterogeneities in the photosynthetic electron transport chain and propose a model in which quinones, accepting electrons either from PSII (linear flow) or NDH/PGR pathways (cyclic flow), represent a crucial control point. Our aim is to give an integrated description of these processes and discuss their potential roles in the balance between linear and cyclic electron flows.

Functional and surface-active membranes from poly(vinylidene fluoride)-graft-poly(acrylic acid) prepared via RAFT-mediated graft copolymerization.

PubMed

Ying, L; Yu, W H; Kang, E T; Neoh, K G

2004-07-06

Poly (vinylidene fluoride) (PVDF) with "living" poly (acrylic acid) (PAAc) side chains (PVDF-g-PAAc) was prepared by reversible addition-fragmentation chain transfer (RAFT)-mediated graft copolymerization of acrylic acid (AAc) with the ozone-pretreated PVDF. The chemical composition and structure of the copolymers were characterized by elemental analysis, Fourier transform infrared spectroscopy, and thermogravimetric analysis. The copolymer could be readily cast into pH-sensitive microfiltration (MF) membranes with enriched living PAAc graft chains on the surface (including the pore surfaces) by phase inversion in an aqueous medium. The surface composition of the membranes was determined by X-ray photoelectron spectroscopy. The morphology of the membranes was characterized by scanning electron microscopy. The pore size distribution of the membranes was found to be much more uniform than that of the corresponding membranes cast from PVDF-g-PAAc prepared by the "conventional" free-radical graft copolymerization process. Most important of all, the MF membranes with surface-tethered PAAc macro chain transfer agents, or the living membrane surfaces, could be further functionalized via surface-initiated block copolymerization with N-isopropylacrylamide (NIPAAM) to obtain the PVDF-g-PAAc-b-PNIPAAM MF membranes, which exhibited both pH- and temperature-dependent permeability to aqueous media.

Changing the ligation of the distal [4Fe4S] cluster in NiFe hydrogenase impairs inter- and intramolecular electron transfers.

PubMed

Dementin, Sébastien; Belle, Valérie; Bertrand, Patrick; Guigliarelli, Bruno; Adryanczyk-Perrier, Géraldine; De Lacey, Antonio L; Fernandez, Victor M; Rousset, Marc; Léger, Christophe

2006-04-19

In NiFe hydrogenases, electrons are transferred from the active site to the redox partner via a chain of three Iron-Sulfur clusters, and the surface-exposed [4Fe4S] cluster has an unusual His(Cys)3 ligation. When this Histidine (H184 in Desulfovibrio fructosovorans) is changed into a cysteine or a glycine, a distal cubane is still assembled but the oxidative activity of the mutants is only 1.5 and 3% of that of the WT, respectively. We compared the activities of the WT and engineered enzymes for H2 oxidation, H+ reduction and H/D exchange, under various conditions: (i) either with the enzyme directly adsorbed onto an electrode or using soluble redox partners, and (ii) in the presence of exogenous ligands whose binding to the exposed Fe of H184G was expected to modulate the properties of the distal cluster. Protein film voltammetry proved particularly useful to unravel the effects of the mutations on inter and intramolecular electron transfer (ET). We demonstrate that changing the coordination of the distal cluster has no effect on cluster assembly, protein stability, active-site chemistry and proton transfer; however, it slows down the first-order rates of ET to and from the cluster. All-sulfur coordination is actually detrimental to ET, and intramolecular (uphill) ET is rate determining in the glycine variant. This demonstrates that although [4Fe4S] clusters are robust chemical constructs, the direct protein ligands play an essential role in imparting their ability to transfer electrons.

Electronic coupling through natural amino acids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berstis, Laura; Beckham, Gregg T., E-mail: michael.crowley@nrel.gov, E-mail: gregg.beckham@nrel.gov; Crowley, Michael F., E-mail: michael.crowley@nrel.gov, E-mail: gregg.beckham@nrel.gov

2015-12-14

Myriad scientific domains concern themselves with biological electron transfer (ET) events that span across vast scales of rate and efficiency through a remarkably fine-tuned integration of amino acid (AA) sequences, electronic structure, dynamics, and environment interactions. Within this intricate scheme, many questions persist as to how proteins modulate electron-tunneling properties. To help elucidate these principles, we develop a model set of peptides representing the common α-helix and β-strand motifs including all natural AAs within implicit protein-environment solvation. Using an effective Hamiltonian strategy with density functional theory, we characterize the electronic coupling through these peptides, furthermore considering side-chain dynamics. For bothmore » motifs, predictions consistently show that backbone-mediated electronic coupling is distinctly sensitive to AA type (aliphatic, polar, aromatic, negatively charged and positively charged), and to side-chain orientation. The unique properties of these residues may be employed to design activated, deactivated, or switch-like superexchange pathways. Electronic structure calculations and Green’s function analyses indicate that localized shifts in the electron density along the peptide play a role in modulating these pathways, and further substantiate the experimentally observed behavior of proline residues as superbridges. The distinct sensitivities of tunneling pathways to sequence and conformation revealed in this electronic coupling database help improve our fundamental understanding of the broad diversity of ET reactivity and provide guiding principles for peptide design.« less

The inter-relationship of ascorbate transport, metabolism and mitochondrial, plastidic respiration.

PubMed

Szarka, András; Bánhegyi, Gábor; Asard, Han

2013-09-20

Ascorbate, this multifaceted small molecular weight carbohydrate derivative, plays important roles in a range of cellular processes in plant cells, from the regulation of cell cycle, through cell expansion and senescence. Beyond these physiological functions, ascorbate has a critical role in responses to abiotic stresses, such as high light, high salinity, or drought. The biosynthesis, recycling, and intracellular transport are important elements of the balancing of ascorbate level to the always-changing conditions and demands. A bidirectional tight relationship was described between ascorbate biosynthesis and the mitochondrial electron transfer chain (mETC), since L-galactono-1,4-lactone dehydrogenase (GLDH), the enzyme catalyzing the ultimate step of ascorbate biosynthesis, uses oxidized cytochrome c as the only electron acceptor and has a role in the assembly of Complex I. A similar bidirectional relationship was revealed between the photosynthetic apparatus and ascorbate biosynthesis since the electron flux through the photosynthetic ETC affects the biosynthesis of ascorbate and the level of ascorbate could affect photosynthesis. The details of this regulatory network of photosynthetic electron transfer, respiratory electron transfer, and ascorbate biosynthesis are still not clear, as are the potential regulatory role and the regulation of intracellular ascorbate transport and fluxes. The elucidation of the role of ascorbate as an important element of the network of photosynthetic, respiratory ETC and tricarboxylic acid cycle will contribute to understanding plant cell responses to different stress conditions.

Irreversible Heavy Chain Transfer to Chondroitin*

PubMed Central

Lauer, Mark E.; Hascall, Vincent C.; Green, Dixy E.; DeAngelis, Paul L.; Calabro, Anthony

2014-01-01

We have recently demonstrated that the transfer of heavy chains (HCs) from inter-α-inhibitor, via the enzyme TSG-6 (tumor necrosis factor-stimulated gene 6), to hyaluronan (HA) oligosaccharides is an irreversible event in which subsequent swapping of HCs between HA molecules does not occur. We now describe our results of HC transfer experiments to chondroitin sulfate A, chemically desulfated chondroitin, chemoenzymatically synthesized chondroitin, unsulfated heparosan, heparan sulfate, and alginate. Of these potential HC acceptors, only chemically desulfated chondroitin and chemoenzymatically synthesized chondroitin were HC acceptors. The kinetics of HC transfer to chondroitin was similar to HA. At earlier time points, HCs were more widely distributed among the different sizes of chondroitin chains. As time progressed, the HCs migrated to lower molecular weight chains of chondroitin. Our interpretation is that TSG-6 swaps the HCs from the larger, reversible sites on chondroitin chains, which function as HC acceptors, onto smaller chondroitin chains, which function as irreversible HC acceptors. HCs transferred to smaller chondroitin chains were unable to be swapped off the smaller chondroitin chains and transferred to HA. HCs transferred to high molecular weight HA were unable to be swapped onto chondroitin. We also present data that although chondroitin was a HC acceptor, HA was the preferred acceptor when chondroitin and HA were in the same reaction mixture. PMID:25135638

Top-Down Charge Transfer Dissociation (CTD) of Gas-Phase Insulin: Evidence of a One-Step, Two-Electron Oxidation Mechanism

NASA Astrophysics Data System (ADS)

Li, Pengfei; Kreft, Iris; Jackson, Glen P.

2018-02-01

Top-down analyses of protonated insulin cations of charge states of 4+, 5+, or 6+ were performed by exposing the isolated precursor ions to a beam of helium cations with kinetic energy of more than 6 keV, in a technique termed charge transfer dissociation (CTD). The 100 ms charge transfer reaction resulted in approximately 20% conversion efficiency to other intact charge exchange products (CTnoD), and a range of low abundance fragment ions. To increase backbone and sulfide cleavages, and to provide better structural information than straightforward MS2 CTD, the CTnoD oxidized products were isolated and subjected to collisional activation at the MS3 level. The MS3 CTD/CID reaction effectively broke the disulfide linkages, separated the two chains, and yielded more structurally informative fragment ions within the inter-chain cyclic region. CTD also provided doubly oxidized intact product ions at the MS2 level, and resonance ejection of the singly oxidized product ion revealed that the doubly oxidized product originates directly from the isolated precursor ion and not from consecutive CTD reactions of a singly oxidized intermediate. MS4 experiments were employed to help identify potential radical cations and diradical cations, but the results were negative or inconclusive. Nonetheless, the two-electron oxidation process is a demonstration of the very large potential energy (>20 eV) available through CTD, and is a notable capability for a 3D ion trap platform.

Electron Transfer Dissociation with Supplemental Activation to Differentiate Aspartic and Isoaspartic Residues in Doubly Charged Peptide Cations

PubMed Central

Chan, Wai Yi Kelly; Chan, T. W. Dominic; O’Connor, Peter B.

2011-01-01

Electron-transfer dissociation (ETD) with supplemental activation of the doubly charged deamidated tryptic digested peptide ions allows differentiation of isoaspartic acid and aspartic acid residues using c + 57 or z• − 57 peaks. The diagnostic peak clearly localizes and characterizes the isoaspartic acid residue. Supplemental activation in ETD of the doubly charged peptide ions involves resonant excitation of the charge reduced precursor radical cations and leads to further dissociation, including extra backbone cleavages and secondary fragmentation. Supplemental activation is essential to obtain a high quality ETD spectrum (especially for doubly charged peptide ions) with sequence information. Unfortunately, the low-resolution of the ion trap mass spectrometer makes detection of the diagnostic peak for the aspartic acid residue difficult due to interference with side-chain loss from arginine and glutamic acid residues. PMID:20304674

Atomistic determinants of co-enzyme Q reduction at the Qi-site of the cytochrome bc1 complex

NASA Astrophysics Data System (ADS)

Postila, Pekka A.; Kaszuba, Karol; Kuleta, Patryk; Vattulainen, Ilpo; Sarewicz, Marcin; Osyczka, Artur; Róg, Tomasz

2016-09-01

The cytochrome (cyt) bc1 complex is an integral component of the respiratory electron transfer chain sustaining the energy needs of organisms ranging from humans to bacteria. Due to its ubiquitous role in the energy metabolism, both the oxidation and reduction of the enzyme’s substrate co-enzyme Q has been studied vigorously. Here, this vast amount of data is reassessed after probing the substrate reduction steps at the Qi-site of the cyt bc1 complex of Rhodobacter capsulatus using atomistic molecular dynamics simulations. The simulations suggest that the Lys251 side chain could rotate into the Qi-site to facilitate binding of half-protonated semiquinone - a reaction intermediate that is potentially formed during substrate reduction. At this bent pose, the Lys251 forms a salt bridge with the Asp252, thus making direct proton transfer possible. In the neutral state, the lysine side chain stays close to the conserved binding location of cardiolipin (CL). This back-and-forth motion between the CL and Asp252 indicates that Lys251 functions as a proton shuttle controlled by pH-dependent negative feedback. The CL/K/D switching, which represents a refinement to the previously described CL/K pathway, fine-tunes the proton transfer process. Lastly, the simulation data was used to formulate a mechanism for reducing the substrate at the Qi-site.

Efficient quantum state transfer in an engineered chain of quantum bits

NASA Astrophysics Data System (ADS)

Sandberg, Martin; Knill, Emanuel; Kapit, Eliot; Vissers, Michael R.; Pappas, David P.

2016-03-01

We present a method of performing quantum state transfer in a chain of superconducting quantum bits. Our protocol is based on engineering the energy levels of the qubits in the chain and tuning them all simultaneously with an external flux bias. The system is designed to allow sequential adiabatic state transfers, resulting in on-demand quantum state transfer from one end of the chain to the other. Numerical simulations of the master equation using realistic parameters for capacitive nearest-neighbor coupling, energy relaxation, and dephasing show that fast, high-fidelity state transfer should be feasible using this method.

FAD oxidizes the ERO1-PDI electron transfer chain: The role of membrane integrity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Papp, Eszter; Nardai, Gabor; Mandl, Jozsef

2005-12-16

The molecular steps of the electron transfer in the endoplasmic reticulum from the secreted proteins during their oxidation are relatively unknown. We present here that flavine adenine dinucleotide (FAD) is a powerful oxidizer of the oxidoreductase system, Ero1 and PDI, besides the proteins of rat liver microsomes and HepG2 hepatoma cells. Inhibition of FAD transport hindered the action of FAD. Microsomal membrane integrity was mandatory for all FAD-related oxidation steps downstream of Ero1. The PDI inhibitor bacitracin could inhibit FAD-mediated oxidation of microsomal proteins and PDI, but did not hinder the FAD-driven oxidation of Ero1. Our data demonstrated that Ero1more » can utilize FAD as an electron acceptor and that FAD-driven protein oxidation goes through the Ero1-PDI pathway and requires the integrity of the endoplasmic reticulum membrane. Our findings prompt further studies to elucidate the membrane-dependent steps of PDI oxidation and the role of FAD in redox folding.« less

The insecticide target in the PSST subunit of complex I.

PubMed

Schuler, F; Casida, J E

2001-10-01

Current insecticides have been selected by sifting and winnowing hundreds of thousands of synthetic chemicals and natural products to obtain commercial preparations of optimal effectiveness and safety. This process has often ended up with compounds of high potency as inhibitors of the electron transport chain and more specifically of complex I (NADH:ubiquinone oxidoreductase). Many classes of chemicals are involved and the enzyme is one of the most complicated known, with 43 subunits catalyzing electron transfer from NADH to ubiquinone through flavin mononucleotide and up to eight iron-sulfur clusters. We used a potent photoaffinity ligand, (trifluoromethyl)diazirinyl[3H]pyridaben, to localize the insecticide target to a single high-affinity site in the PSST subunit that couples electron transfer from iron-sulfur cluster N2 to ubiquinone. Most importantly, all of the potent complex I-inhibiting pesticides, despite their great structural diversity, compete for this same specific binding domain in PSST. Finding their common mode of action and target provides insight into shared toxicological features and potential selection for resistant pests.

Public-private partnerships in the Canadian environment: options for hospital pharmacies.

PubMed

Uddin, Z; Bear, R A

1997-01-01

This brief report explores the direction being pursued by hospitals interested in outsourcing non-core activities within the pharmacy department. Private sector logistics companies are looking to position themselves in the drug product supply chain to facilitate seamless transfers of drug products, ordering information and payments between drug manufacturers and hospitals. Opportunities for implementing consolidated purchasing, unit dosing, just-in-time inventory and electronic commerce systems are discussed.

Degradable Polymers and Block Copolymers from Electron-deficient Carbonyl Compounds (STIR) (7.3 Polymer Chemistry - Synthesis: Architecture and Composition)

DTIC Science & Technology

2015-04-23

polymerization results Illustrations: Scheme 1. Polymerization of aldehydes and depolymerization of polyacetals. Scheme 2. Optimized methods for...oligomers) to the pure aldehyde monomer requires several distillations and transfer of the monomer at reflux directly to the polymerization vessel. Low...the controlled organocatalytic chain polymerization of ethyl glyoxylate and other reactive aldehydes , which will enable the preparation of

Malate-aspartate shuttle and exogenous NADH/cytochrome c electron transport pathway as two independent cytosolic reducing equivalent transfer systems.

PubMed

Abbrescia, Daniela Isabel; La Piana, Gianluigi; Lofrumento, Nicola Elio

2012-02-15

In mammalian cells aerobic oxidation of glucose requires reducing equivalents produced in glycolytic phase to be channelled into the phosphorylating respiratory chain for the reduction of molecular oxygen. Data never presented before show that the oxidation rate of exogenous NADH supported by the malate-aspartate shuttle system (reconstituted in vitro with isolated liver mitochondria) is comparable to the rate obtained on activation of the cytosolic NADH/cytochrome c electron transport pathway. The activities of these two reducing equivalent transport systems are independent of each other and additive. NADH oxidation induced by the malate-aspartate shuttle is inhibited by aminooxyacetate and by rotenone and/or antimycin A, two inhibitors of the respiratory chain, while the NADH/cytochrome c system remains insensitive to all of them. The two systems may simultaneously or mutually operate in the transfer of reducing equivalents from the cytosol to inside the mitochondria. In previous reports we suggested that the NADH/cytochrome c system is expected to be functioning in apoptotic cells characterized by the presence of cytochrome c in the cytosol. As additional new finding the activity of reconstituted shuttle system is linked to the amount of α-ketoglutarate generated inside the mitochondria by glutamate dehydrogenase rather than by aspartate aminotransferase. Copyright © 2011 Elsevier Inc. All rights reserved.

Excitation wavelength dependence of excited state intramolecular proton transfer reaction of 4'-N,N-diethylamino-3-hydroxyflavone in room temperature ionic liquids studied by optical Kerr gate fluorescence measurement.

PubMed

Suda, Kayo; Terazima, Masahide; Sato, Hirofumi; Kimura, Yoshifumi

2013-10-17

Excited state intramolecular proton transfer reactions (ESIPT) of 4'-N,N-diethylamino-3-hydroxyflavone (DEAHF) in ionic liquids have been studied by steady-state and time-resolved fluorescence measurements at different excitation wavelengths. Steady-state measurements show the relative yield of the tautomeric form to the normal form of DEAHF decreases as excitation wavelength is increased from 380 to 450 nm. The decrease in yield is significant in ionic liquids that have cations with long alkyl chains. The extent of the decrease is correlated with the number of carbon atoms in the alkyl chains. Time-resolved fluorescence measurements using optical Kerr gate spectroscopy show that ESIPT rate has a strong excitation wavelength dependence. There is a large difference between the spectra at a 200 ps delay from different excitation wavelengths in each ionic liquid. The difference is pronounced in ionic liquids having a long alkyl chain. The equilibrium constant in the electronic excited state obtained at a 200 ps delay and the average reaction rate are also correlated with the alkyl chain length. Considering the results of the steady-state fluorescence and time-resolved measurements, the excitation wavelength dependence of ESIPT is explained by state selective excitation due to the difference of the solvation, and the number of alkyl chain carbon atoms is found to be a good indicator of the effect of inhomogeneity for this reaction.

The Impacts of Phosphorus Deficiency on the Photosynthetic Electron Transport Chain1[OPEN

PubMed Central

2018-01-01

Phosphorus (P) is an essential macronutrient, and P deficiency limits plant productivity. Recent work showed that P deficiency affects electron transport to photosystem I (PSI), but the underlying mechanisms are unknown. Here, we present a comprehensive biological model describing how P deficiency disrupts the photosynthetic machinery and the electron transport chain through a series of sequential events in barley (Hordeum vulgare). P deficiency reduces the orthophosphate concentration in the chloroplast stroma to levels that inhibit ATP synthase activity. Consequently, protons accumulate in the thylakoids and cause lumen acidification, which inhibits linear electron flow. Limited plastoquinol oxidation retards electron transport to the cytochrome b6f complex, yet the electron transfer rate of PSI is increased under steady-state growth light and is limited under high-light conditions. Under P deficiency, the enhanced electron flow through PSI increases the levels of NADPH, whereas ATP production remains restricted and, hence, reduces CO2 fixation. In parallel, lumen acidification activates the energy-dependent quenching component of the nonphotochemical quenching mechanism and prevents the overexcitation of photosystem II and damage to the leaf tissue. Consequently, plants can be severely affected by P deficiency for weeks without displaying any visual leaf symptoms. All of the processes in the photosynthetic machinery influenced by P deficiency appear to be fully reversible and can be restored in less than 60 min after resupply of orthophosphate to the leaf tissue. PMID:29540590

Self-assembled structures of N-alkylated bisbenzimidazolyl naphthalene in aqueous media for highly sensitive detection of picric acid.

PubMed

Wu, Yan-Cheng; Luo, Shi-He; Cao, Liang; Jiang, Kai; Wang, Ling-Yun; Xie, Jie-Chun; Wang, Zhao-Yang

2017-07-11

A 2,6-dibenzimidazole-appended naphthalene derivative flanking with two N-alkyl chains (sensor 4) was designed and applied for highly sensitive detection of picric acid (PA) in aqueous media. Driven by the hydrophobicity of alkyl chain and π-π stacking effect of aryl, sensor 4 can undergo self-assembly to form an orderly rod-like structure in H 2 O/THF (v/v, 90/10) solution, as shown by the dynamic light scattering (DLS) and scanning electron microscopy (SEM) studies. Sensor 4 shows high selectivity and sensitivity toward PA over other nitroaromatic explosives. DFT calculations and 1 H NMR, the time-correlated single photon counting (TCSPC) experiments confirm that the quenching mechanism is due to both electron and energy transfer from the electron-rich sensor 4 to the electron-deficient PA. Sensor 4 can detect as low as 0.57 ppb PA in aqueous media and 11.46 ag cm -2 PA by contact mode. Importantly, sensor 4 exhibits low interference against common solvents, metal ions and anions. Thus, it is practically applicable for sensing PA in real environmental samples and vapor phase. Copyright © 2017 Elsevier B.V. All rights reserved.

Respiratory chain components involved in the glycerophosphate dehydrogenase-dependent ROS production by brown adipose tissue mitochondria.

PubMed

Vrbacký, Marek; Drahota, Zdenek; Mrácek, Tomás; Vojtísková, Alena; Jesina, Pavel; Stopka, Pavel; Houstek, Josef

2007-07-01

Involvement of mammalian mitochondrial glycerophosphate dehydrogenase (mGPDH, EC 1.1.99.5) in reactive oxygen species (ROS) generation was studied in brown adipose tissue mitochondria by different spectroscopic techniques. Spectrofluorometry using ROS-sensitive probes CM-H2DCFDA and Amplex Red was used to determine the glycerophosphate- or succinate-dependent ROS production in mitochondria supplemented with respiratory chain inhibitors antimycin A and myxothiazol. In case of glycerophosphate oxidation, most of the ROS originated directly from mGPDH and coenzyme Q while complex III was a typical site of ROS production in succinate oxidation. Glycerophosphate-dependent ROS production monitored by KCN-insensitive oxygen consumption was highly activated by one-electron acceptor ferricyanide, whereas succinate-dependent ROS production was unaffected. In addition, superoxide anion radical was detected as a mGPDH-related primary ROS species by fluorescent probe dihydroethidium, as well as by electron paramagnetic resonance (EPR) spectroscopy with DMPO spin trap. Altogether, the data obtained demonstrate pronounced differences in the mechanism of ROS production originating from oxidation of glycerophosphate and succinate indicating that electron transfer from mGPDH to coenzyme Q is highly prone to electron leak and superoxide generation.

Computational Investigation of the Photochemical Reaction Path of Some Synthesized and Experimentally Analyzed Small-Chain Conjugated Nitrones.

PubMed

Saini, Praveen; Banerjee, Mainak; Chattopadhyay, Anjan

2016-01-28

This combined theoretical and experimental study has revealed the photochemistry of two small open-chain conjugated N-methylnitrone systems with phenyl substitutions at the C-terminal positions. The UV spectra of these synthesized nitrones have shown intense peaks around 330 nm while the new bands formed near 260 nm after their photoirradiation are predicted to be arising from the photoproduct oxaziridine. Photoexcitation of α-styryl N-methylnitrone populates the first excited singlet state which relaxes by 8 kcal/mol from the vertically excited state and subsequently goes toward the lowest-energy conical intersection (CI) geometry (situated 27-30 kcal/mol below) with a terminal CNO-kink. Following the gradient difference vectors of this CI, we have located the oxaziridine structure with its characteristic geometry at roughly 14 kcal/mol above the ground state. This whole process is triggered by a transfer of electronic cloud from oxygen to the conjugated chain side. On the other hand, the photoexcitation of the nonplanar 3,3-diphenylethylene N-methylnitrone has two strong singlet-singlet absorptions with almost 5 D transition moment values. Here the initial S2-S1 relaxation is followed by oxaziridine formation through the terminally twisted CI. However, the initially photoexcited S1 state in this nitrone is found to head toward some other direction with transfer of huge amount of nonbonding electron cloud of oxygen to the π* orbital, creating a stable excited state geometry with an elongated N-O bond which gets involved in a sloped CI with the ground state.

Enhanced photocurrent production by bio-dyes of photosynthetic macromolecules on designed TiO2 film

PubMed Central

Yu, Daoyong; Wang, Mengfei; Zhu, Guoliang; Ge, Baosheng; Liu, Shuang; Huang, Fang

2015-01-01

The macromolecular pigment-protein complex has the merit of high efficiency for light-energy capture and transfer after long-term photosynthetic evolution. Here bio-dyes of A. platensis photosystem I (PSI) and spinach light-harvesting complex II (LHCII) are spontaneously sensitized on three types of designed TiO2 films, to assess the effects of pigment-protein complex on the performance of bio-dye sensitized solar cells (SSC). Adsorption models of bio-dyes are proposed based on the 3D structures of PSI and LHCII, and the size of particles and inner pores in the TiO2 film. PSI shows its merit of high efficiency for captured energy transfer, charge separation and transfer in the electron transfer chain (ETC), and electron injection from FB to the TiO2 conducting band. After optimization, the best short current (JSC) and photoelectric conversion efficiency (η) of PSI-SSC and LHCII-SSC are 1.31 mA cm-2 and 0.47%, and 1.51 mA cm-2 and 0.52%, respectively. The potential for further improvement of this PSI based SSC is significant and could lead to better utilization of solar energy. PMID:25790735

Ab initio evaluation of the thermodynamic and electrochemical properties of alkyl halides and radicals and their mechanistic implications for atom transfer radical polymerization.

PubMed

Lin, Ching Yeh; Coote, Michelle L; Gennaro, Armando; Matyjaszewski, Krzysztof

2008-09-24

High-level ab initio molecular orbital calculations are used to study the thermodynamics and electrochemistry relevant to the mechanism of atom transfer radical polymerization (ATRP). Homolytic bond dissociation energies (BDEs) and standard reduction potentials (SRPs) are reported for a series of alkyl halides (R-X; R = CH 2CN, CH(CH 3)CN, C(CH 3) 2CN, CH 2COOC 2H 5, CH(CH 3)COOCH 3, C(CH 3) 2COOCH 3, C(CH 3) 2COOC 2H 5, CH 2Ph, CH(CH 3)Ph, CH(CH 3)Cl, CH(CH 3)OCOCH 3, CH(Ph)COOCH 3, SO 2Ph, Ph; X = Cl, Br, I) both in the gas phase and in two common organic solvents, acetonitrile and dimethylformamide. The SRPs of the corresponding alkyl radicals, R (*), are also examined. The computational results are in a very good agreement with the experimental data. For all alkyl halides examined, it is found that, in the solution phase, one-electron reduction results in the fragmentation of the R-X bond to the corresponding alkyl radical and halide anion; hence it may be concluded that a hypothetical outer-sphere electron transfer (OSET) in ATRP should occur via concerted dissociative electron transfer rather than a two-step process with radical anion intermediates. Both the homolytic and heterolytic reactions are favored by electron-withdrawing substituents and/or those that stabilize the product alkyl radical, which explains why monomers such as acrylonitrile and styrene require less active ATRP catalysts than vinyl chloride and vinyl acetate. The rate constant of the hypothetical OSET reaction between bromoacetonitrile and Cu (I)/TPMA complex was estimated using Marcus theory for the electron-transfer processes. The estimated rate constant k OSET = approximately 10 (-11) M (-1) s (-1) is significantly smaller than the experimentally measured activation rate constant ( k ISET = approximately 82 M (-1) s (-1) at 25 degrees C in acetonitrile) for the concerted atom transfer mechanism (inner-sphere electron transfer, ISET), implying that the ISET mechanism is preferred. For monomers bearing electron-withdrawing groups, the one-electron reduction of the propagating alkyl radical to the carbanion is thermodynamically and kinetically favored over the one-electron reduction of the corresponding alkyl halide unless the monomer bears strong radical-stabilizing groups. Thus, for monomers such as acrylates, catalysts favoring ISET over OSET are required in order to avoid chain-breaking side reactions.

Influence of acceptor on charge mobility in stacked π-conjugated polymers

NASA Astrophysics Data System (ADS)

Sun, Shih-Jye; Menšík, Miroslav; Toman, Petr; Gagliardi, Alessio; Král, Karel

2018-02-01

We present a quantum molecular model to calculate mobility of π-stacked P3HT polymer layers with electron acceptor dopants coupled next to side groups in random position with respect to the linear chain. The hole density, the acceptor LUMO energy and the hybridization transfer integral between the acceptor and polymer were found to be very critical factors to the final hole mobility. For a dopant LUMO energy close and high above the top of the polymer valence band we have found a significant mobility increase with the hole concentration and with the dopant LUMO energy approaching the top of the polymer valence band. Higher mobility was achieved for small values of hybridization transfer integral between polymer and the acceptor, corresponding to the case of weakly bound acceptor. Strong couplings between the polymer and the acceptor with Coulomb repulsion interactions induced from the electron localizations was found to suppress the hole mobility.

Electron spin relaxation enhancement measurements of interspin distances in human, porcine, and Rhodobacter electron transfer flavoprotein ubiquinone oxidoreductase (ETF QO)

NASA Astrophysics Data System (ADS)

Fielding, Alistair J.; Usselman, Robert J.; Watmough, Nicholas; Simkovic, Martin; Frerman, Frank E.; Eaton, Gareth R.; Eaton, Sandra S.

2008-02-01

Electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO) is a membrane-bound electron transfer protein that links primary flavoprotein dehydrogenases with the main respiratory chain. Human, porcine, and Rhodobacter sphaeroides ETF-QO each contain a single [4Fe-4S] 2+,1+ cluster and one equivalent of FAD, which are diamagnetic in the isolated enzyme and become paramagnetic on reduction with the enzymatic electron donor or with dithionite. The anionic flavin semiquinone can be reduced further to diamagnetic hydroquinone. The redox potentials for the three redox couples are so similar that it is not possible to poise the proteins in a state where both the [4Fe-4S] + cluster and the flavoquinone are fully in the paramagnetic form. Inversion recovery was used to measure the electron spin-lattice relaxation rates for the [4Fe-4S] + between 8 and 18 K and for semiquinone between 25 and 65 K. At higher temperatures the spin-lattice relaxation rates for the [4Fe-4S] + were calculated from the temperature-dependent contributions to the continuous wave linewidths. Although mixtures of the redox states are present, it was possible to analyze the enhancement of the electron spin relaxation of the FAD semiquinone signal due to dipolar interaction with the more rapidly relaxing [4Fe-4S] + and obtain point-dipole interspin distances of 18.6 ± 1 Å for the three proteins. The point-dipole distances are within experimental uncertainty of the value calculated based on the crystal structure of porcine ETF-QO when spin delocalization is taken into account. The results demonstrate that electron spin relaxation enhancement can be used to measure distances in redox poised proteins even when several redox states are present.

Electron Spin Relaxation Enhancement Measurements of Interspin Distances in Human, Porcine, and Rhodobacter Electron Transfer Flavoprotein-ubiquinone Oxidoreductase (ETF-QO)

PubMed Central

Fielding, Alistair J.; Usselman, Robert J.; Watmough, Nicholas; Simkovic, Martin; Frerman, Frank E.; Eaton, Gareth R.; Eaton, Sandra S.

2008-01-01

Electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO) is a membrane-bound electron transfer protein that links primary flavoprotein dehydrogenases with the main respiratory chain. Human, porcine, and Rhodobacter sphaeroides ETF-QO each contain a single [4Fe-4S]2+,1+ cluster and one equivalent of FAD, which are diamagnetic in the isolated enzyme and become paramagnetic on reduction with the enzymatic electron donor or with dithionite. The anionic flavin semiquinone can be reduced further to diamagnetic hydroquinone. The redox potentials for the three redox couples are so similar that it is not possible to poise the proteins in a state where both the [4Fe-4S]+ cluster and the flavoquinone are fully in the paramagnetic form. Inversion recovery was used to measure the electron spin-lattice relaxation rates for the [4Fe-4S]+ between 8 and 18 K and for semiquinone between 25 and 65 K. At higher temperatures the spin-lattice relaxation rates for the [4Fe-4S]+ were calculated from the temperature-dependent contributions to the continuous wave linewidths. Although mixtures of the redox states are present, it was possible to analyze the enhancement of the electron spin relaxation of the FAD semiquinone signal due to dipolar interaction with the more rapidly relaxing [4Fe-4S]+ and obtain point dipole interspin distances of 18.6 ± 1 Å for the three proteins. The point-dipole distances are within experimental uncertainty of the value calculated based on the crystal structure of porcine ETF-QO when spin delocalization is taken into account. The results demonstrate that electron spin relaxation enhancement can be used to measure distances in redox poised proteins even when several redox states are present. PMID:18037314

Electron spin relaxation enhancement measurements of interspin distances in human, porcine, and Rhodobacter electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO).

PubMed

Fielding, Alistair J; Usselman, Robert J; Watmough, Nicholas; Simkovic, Martin; Frerman, Frank E; Eaton, Gareth R; Eaton, Sandra S

2008-02-01

Electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO) is a membrane-bound electron transfer protein that links primary flavoprotein dehydrogenases with the main respiratory chain. Human, porcine, and Rhodobacter sphaeroides ETF-QO each contain a single [4Fe-4S](2+,1+) cluster and one equivalent of FAD, which are diamagnetic in the isolated enzyme and become paramagnetic on reduction with the enzymatic electron donor or with dithionite. The anionic flavin semiquinone can be reduced further to diamagnetic hydroquinone. The redox potentials for the three redox couples are so similar that it is not possible to poise the proteins in a state where both the [4Fe-4S](+) cluster and the flavoquinone are fully in the paramagnetic form. Inversion recovery was used to measure the electron spin-lattice relaxation rates for the [4Fe-4S](+) between 8 and 18K and for semiquinone between 25 and 65K. At higher temperatures the spin-lattice relaxation rates for the [4Fe-4S](+) were calculated from the temperature-dependent contributions to the continuous wave linewidths. Although mixtures of the redox states are present, it was possible to analyze the enhancement of the electron spin relaxation of the FAD semiquinone signal due to dipolar interaction with the more rapidly relaxing [4Fe-4S](+) and obtain point-dipole interspin distances of 18.6+/-1A for the three proteins. The point-dipole distances are within experimental uncertainty of the value calculated based on the crystal structure of porcine ETF-QO when spin delocalization is taken into account. The results demonstrate that electron spin relaxation enhancement can be used to measure distances in redox poised proteins even when several redox states are present.

Identification of a multi-protein reductive dehalogenase complex in Dehalococcoides mccartyi strain CBDB1 suggests a protein-dependent respiratory electron transport chain obviating quinone involvement.

PubMed

Kublik, Anja; Deobald, Darja; Hartwig, Stefanie; Schiffmann, Christian L; Andrades, Adarelys; von Bergen, Martin; Sawers, R Gary; Adrian, Lorenz

2016-09-01

Dehalococcoides mccartyi strain CBDB1 is an obligate organohalide-respiring bacterium using only hydrogen as electron donor and halogenated organics as electron acceptor. Here, we studied proteins involved in the respiratory chain under non-denaturing conditions. Using blue native gel electrophoresis (BN-PAGE), gel filtration and ultrafiltration an active dehalogenating protein complex with a molecular mass of 250-270 kDa was identified. The active subunit of reductive dehalogenase (RdhA) colocalised with a complex iron-sulfur molybdoenzyme (CISM) subunit (CbdbA195) and an iron-sulfur cluster containing subunit (CbdbA131) of the hydrogen uptake hydrogenase (Hup). No colocalisation between the catalytically active subunits of hydrogenase and reductive dehalogenase was found. By two-dimensional BN/SDS-PAGE the stability of the complex towards detergents was assessed, demonstrating stepwise disintegration with increasing detergent concentrations. Chemical cross-linking confirmed the presence of a higher molecular mass reductive dehalogenase protein complex composed of RdhA, CISM I and Hup hydrogenase and proved to be a potential tool for stabilising protein-protein interactions of the dehalogenating complex prior to membrane solubilisation. Taken together, the identification of the respiratory dehalogenase protein complex and the absence of indications for quinone participation in the respiration suggest a quinone-independent protein-based respiratory electron transfer chain in D. mccartyi. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

Silver transfer in proustite Ag{sub 3}AsS{sub 3} at high temperatures: Conductivity and single-crystal X-ray studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gagor, Anna; Pawlowski, Antoni; Pietraszko, Adam

2009-03-15

Single crystals of proustite Ag{sub 3}AsS{sub 3} have been characterised by impedance spectroscopy and single-crystal X-ray diffraction in the temperature ranges of 295-543 and 295-695 K, respectively. An analysis of the one-particle potential of silver atoms shows that in the whole measuring temperature range defects in the silver substructure play a major role in the conduction mechanism. Furthermore, the silver transfer is equally probable within silver chains and spirals, as well as between chains and spirals. The trigonal R3c room temperature phase does not change until the decomposition of the crystal. The electric anomaly of the first-order character which appearsmore » near 502 K is related to an increase in the electronic component of the total conductivity resulting from Ag{sub 2}S deposition at the sample surface. - Joint probability density function map of silver atoms at T=695 K.« less

Redox Conditions Affect Ultrafast Exciton Transport in Photosynthetic Pigment-Protein Complexes.

PubMed

Allodi, Marco A; Otto, John P; Sohail, Sara H; Saer, Rafael G; Wood, Ryan E; Rolczynski, Brian S; Massey, Sara C; Ting, Po-Chieh; Blankenship, Robert E; Engel, Gregory S

2018-01-04

Pigment-protein complexes in photosynthetic antennae can suffer oxidative damage from reactive oxygen species generated during solar light harvesting. How the redox environment of a pigment-protein complex affects energy transport on the ultrafast light-harvesting time scale remains poorly understood. Using two-dimensional electronic spectroscopy, we observe differences in femtosecond energy-transfer processes in the Fenna-Matthews-Olson (FMO) antenna complex under different redox conditions. We attribute these differences in the ultrafast dynamics to changes to the system-bath coupling around specific chromophores, and we identify a highly conserved tyrosine/tryptophan chain near the chromophores showing the largest changes. We discuss how the mechanism of tyrosine/tryptophan chain oxidation may contribute to these differences in ultrafast dynamics that can moderate energy transfer to downstream complexes where reactive oxygen species are formed. These results highlight the importance of redox conditions on the ultrafast transport of energy in photosynthesis. Tailoring the redox environment may enable energy transport engineering in synthetic light-harvesting systems.

Synthesis and Characterization of Poly (styrene-co-butyl acrylate)/Silica Aerogel Nanocomposites by in situ AGET ATRP: Investigating Thermal Properties

NASA Astrophysics Data System (ADS)

Khezri, Khezrollah; Fazli, Yousef

2017-10-01

Hydrophilic silica aerogel nanoparticles surface was modified with hexamethyldisilazane. Then, the resultant modified nanoparticles were used in random copolymerization of styrene and butyl acrylate via activators generated by electron transfer for atom transfer radical polymerization. Conversion and molecular weight determinations were performed using gas and size exclusion chromatography respectively. Addition of modified nanoparticles by 3 wt% results in a decrease of conversion from 68 to 46 %. Molecular weight of copolymer chains decreases from 12,500 to 7,500 g.mol-1 by addition of 3 wt% modified nanoparticles; however, PDI values increase from 1.1 to 1.4. Proton nuclear magnetic resonance spectroscopy results indicate that the molar ratio of each monomer in the copolymer chains is approximately similar to the initial selected mole ratio of them. Increasing thermal stability of the nanocomposites is demonstrated by thermal gravimetric analysis. Differential scanning calorimetry also shows a decrease in glass transition temperature by increasing modified silica aerogel nanoparticles.

Bacterial social networks: structure and composition of Myxococcus xanthus outer membrane vesicle chains.

PubMed

Remis, Jonathan P; Wei, Dongguang; Gorur, Amita; Zemla, Marcin; Haraga, Jessica; Allen, Simon; Witkowska, H Ewa; Costerton, J William; Berleman, James E; Auer, Manfred

2014-02-01

The social soil bacterium, Myxococcus xanthus, displays a variety of complex and highly coordinated behaviours, including social motility, predatory rippling and fruiting body formation. Here we show that M. xanthus cells produce a network of outer membrane extensions in the form of outer membrane vesicle chains and membrane tubes that interconnect cells. We observed peritrichous display of vesicles and vesicle chains, and increased abundance in biofilms compared with planktonic cultures. By applying a range of imaging techniques, including three-dimensional (3D) focused ion beam scanning electron microscopy, we determined these structures to range between 30 and 60 nm in width and up to 5 μm in length. Purified vesicle chains consist of typical M. xanthus lipids, fucose, mannose, N-acetylglucosamine and N-acetylgalactoseamine carbohydrates and a small set of cargo protein. The protein content includes CglB and Tgl outer membrane proteins known to be transferable between cells in a contact-dependent manner. Most significantly, the 3D organization of cells within biofilms indicates that cells are connected via an extensive network of membrane extensions that may connect cells at the level of the periplasmic space. Such a network would allow the transfer of membrane proteins and other molecules between cells, and therefore could provide a mechanism for the coordination of social activities. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

The transfer of titanium dioxide nanoparticles from the host plant to butterfly larvae through a food chain

PubMed Central

Kubo-Irie, Miyoko; Yokoyama, Masaaki; Shinkai, Yusuke; Niki, Rikio; Takeda, Ken; Irie, Masaru

2016-01-01

This study aimed to examine the transfer of nanoparticles within a terrestrial food chain. Oviposited eggs of the swallowtail butterfly (Atrophaneura alcinous) were hatched on the leaves of the host plant (Aristolochia debilis), and the root stock and root hairs were submerged in a suspension of 10 μg/ml titanium dioxide nanoparticles (TiO2-NPs) in a 100 ml bottle. The presence of TiO2-NPs in the veins of the leaves was confirmed by X-ray analytical microscopy (X-ray AM). The hatched 1st instar larvae fed on the leaves to moult into 2nd instar larvae. Small agglomerates of TiO2-NPs less than 150 nm in diameter were identified in the vascular tissue of the exposed plant, the midgut and the excreta of the larvae by transmission electron microscopy. The image of Ti elemental mapping by X-ray AM was analysed with the quantitative spatial information mapping (QSIM) technique. The results demonstrated that TiO2-NPs were transferred from the plant to the larvae and they were disseminated throughout the environment via larval excreta. PMID:27030539

Cation Recombination Energy/Coulomb Repulsion Effects in ETD/ECD as Revealed by Variation of Charge per Residue at Fixed Total Charge

PubMed Central

Mentinova, Marija; Crizer, David M.; Baba, Takashi; McGee, William M.; Glish, Gary L.; McLuckey, Scott A.

2013-01-01

Electron capture dissociation (ECD) and electron transfer dissociation (ETD) experiments in electrodynamic ion traps operated in the presence of a bath gas in the 1–10 mTorr range have been conducted on a common set of doubly protonated model peptides of the form X(AG)nX (X = lysine, arginine, or histidine, n=1, 2, or 4). The partitioning of reaction products was measured using thermal electrons, anions of azobenzene, and anions of 1,3-dinitrobenzene as reagents. Variation of n alters the charge per residue of the peptide cation, which affects recombination energy. The ECD experiments showed that H-atom loss is greatest for the n=1 peptides and decreases as n increases. Proton transfer in ETD, on the other hand, is expected to increase as charge per residue decreases (i.e., as n increases). These opposing tendencies were apparent in the data for the K(AG)nK peptides. H-atom loss appeared to be more prevalent in ECD than in ETD and is rationalized on the basis of either internal energy differences, differences in angular momentum transfer associated with the electron capture versus electron transfer processes, or a combination of the two. The histidine peptides showed the greatest extent of charge reduction without dissociation, the arginine peptides showed the greatest extent of side-chain cleavages, and the lysine peptides generally showed the greatest extent of partitioning into the c/z•-product ion channels. The fragmentation patterns for the complementary c- and z•-ions for ETD and ECD were found to be remarkably similar, particularly for the peptides with X = lysine. PMID:23568028

Spontaneous transfer of stearic acids between human serum albumin and PEG:2000-grafted DPPC membranes.

PubMed

Pantusa, Manuela; Stirpe, Andrea; Sportelli, Luigi; Bartucci, Rosa

2010-05-01

Electron spin resonance (ESR) spectroscopy is used to study the transfer of stearic acids between human serum albumin (HSA) and sterically stabilized liposomes (SSL) composed of dipalmitoylphosphatidylcholine (DPPC) and of submicellar content of poly(ethylene glycol:2000)-dipalmitoylphosphatidylethanolamine (PEG:2000-DPPE). Protein/lipid dispersions are considered in which spin-labelled stearic acids at the 16th carbon atom along the acyl chain (16-SASL) are inserted either in the protein or in the SSL. Two component ESR spectra with different rotational mobility are obtained over a broad range of temperature and membrane composition. Indeed, superimposed to an anisotropic protein-signal, appears a more isotropic lipid-signal. Since in the samples only one matrix (protein or membranes) is spin-labelled, the other component accounts for the transfer of 16-SASL between albumin and membranes. The two components have been resolved and quantified by spectral subtractions, and the fraction, f (p) (16-SASL), of spin labels bound non-covalently to the protein has been used to monitor the transfer. It is found that it depends on the type of donor and acceptor matrix, on the physical state of the membranes and on the grafting density of the polymer-lipids. Indeed, it is favoured from SSL to HSA and the fraction of stearic acids transferred increases with temperature in both directions of transfer. Moreover, in the presence of polymer-lipids, the transfer from HSA to SSL is slightly attenuated, especially in the brush regime of the polymer-chains. Instead, the transfer from SSL to HSA is favoured by the polymer-lipids much more in the mushroom than in the brush regime.

Functional characteristics of spirilloxanthin and keto-bearing Analogues in light-harvesting LH2 complexes from Rhodobacter sphaeroides with a genetically modified carotenoid synthesis pathway.

PubMed

Niedzwiedzki, Dariusz M; Dilbeck, Preston L; Tang, Qun; Mothersole, David J; Martin, Elizabeth C; Bocian, David F; Holten, Dewey; Hunter, C Neil

2015-01-01

Light-harvesting 2 (LH2) complexes from a genetically modified strain of the purple photosynthetic bacterium Rhodobacter (Rba.) sphaeroides were studied using static and ultrafast optical methods and resonance Raman spectroscopy. Carotenoid synthesis in the Rba. sphaeroides strain was engineered to redirect carotenoid production away from spheroidene into the spirilloxanthin synthesis pathway. The strain assembles LH2 antennas with substantial amounts of spirilloxanthin (total double-bond conjugation length N=13) if grown anaerobically and of keto-bearing long-chain analogs [2-ketoanhydrorhodovibrin (N=13), 2-ketospirilloxanthin (N=14) and 2,2'-diketospirilloxanthin (N=15)] if grown semi-aerobically (with ratios that depend on growth conditions). We present the photophysical, electronic, and vibrational properties of these carotenoids, both isolated in organic media and assembled within LH2 complexes. Measurements of excited-state energy transfer to the array of excitonically coupled bacteriochlorophyll a molecules (B850) show that the mean lifetime of the first singlet excited state (S1) of the long-chain (N≥13) carotenoids does not change appreciably between organic media and the protein environment. In each case, the S1 state appears to lie lower in energy than that of B850. The energy-transfer yield is ~0.4 in LH2 (from the strain grown aerobically or semi-aerobically), which is less than half that achieved for LH2 that contains short-chain (N≤11) analogues. Collectively, the results suggest that the S1 excited state of the long-chain (N≥13) carotenoids participates little if at all in carotenoid-to-BChl a energy transfer, which occurs predominantly via the carotenoid S2 excited state in these antennas. Copyright © 2015 Elsevier B.V. All rights reserved.

Long-Range Superexchange in Electron Transport Proteins

NASA Astrophysics Data System (ADS)

Gruschus, James Michael

A new Hamiltonian model for the calculation of long-range electronic couplings in complex molecular systems is presented. These couplings make possible the electron transfers occurring at several critical steps in photosynthesis and respiration. The couplings studied are demonstrated to arise from a mechanism known as superexchange, where the electrons of the insulating medium are intimately involved in the delocalization of the donor wavefunction tail, allowing significant interaction with the acceptor at much greater separations than could be achieved were the medium absent. Superexchange phenomena in molecules of moderate complexity are first compared to couplings calculated with the model Hamiltonian, with very encouraging results. The method is then applied to several cytochrome c proteins where electron transfer has been measured between a zinc-substituted porphyrin and a ruthenium complex ligated to several sites at the protein surface. The calculated couplings are in unprecedented agreement with experiment. Novel, analytical derivatives of the superexchange coupling with respect to the orbital energies and interactions are then carried out on these proteins yielding the general, chemically relevant result that the entire three-dimensional zone between redox sites is important in mediating the superexchange coupling, in contrast to the prevailing assumption that the coupling can be characterized by a one-dimensional pathway consisting primarily of chains of bonded atoms. In addition, the derivatives provide the most comprehensive ever, atom-by -atom visualization of the superexchange process. Using AMBER molecular dynamics trajectories of the cytochrome c proteins, the effect of structural fluctuations on superexchange is examined. The calculated couplings show a substantial variability, a result contrary to the constant coupling implicit in most present-day transfer rate theory. Couplings are also calculated on surfaces enveloping several variants of cytochrome c, as well as plastocyanin, cytochrome b _5, and cytochrome c peroxidase. The surfaces reveal important clues as to which conformations of the electron transport protein complexes actually give rise to electron transfer, a subject of broad biological interest.

Facile doping of anionic narrow-band-gap conjugated polyelectrolytes during dialysis.

PubMed

Mai, Cheng-Kang; Zhou, Huiqiong; Zhang, Yuan; Henson, Zachary B; Nguyen, Thuc-Quyen; Heeger, Alan J; Bazan, Guillermo C

2013-12-02

PCPDTBTSO3 K, an anionic, narrow-band-gap conjugated polyelectrolyte, was found to be doped after dialysis. The proposed doping mechanism involves protonation of the polymer backbone, followed by electron transfer from a neutral chain, to generate radical cations, which are stabilized by the pendant sulfonate anions. Formation of polarons is supported by spectroscopy and electrical-conductivity measurements. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Impairment of extramitochondrial oxidative phosphorylation in mouse rod outer segments by blue light irradiation.

PubMed

Calzia, Daniela; Panfoli, Isabella; Heinig, Nora; Schumann, Ulrike; Ader, Marius; Traverso, Carlo Enrico; Funk, Richard H W; Roehlecke, Cora

2016-06-01

Exposure to short wavelength light causes increased reactive oxygen intermediates production in the outer retina, particularly in the rod Outer Segments (OS). Consistently, the OS were shown to conduct aerobic ATP production through the ectopic expression of the electron transfer chain complexes I-IV and F1Fo-ATP synthase. These facts prompted us to verify if the oxidative phosphorylation in the OS is implied in the oxidative damage of the blue-light (BL) treated OS, in an organotypic model of mouse retina. Whole mouse eyeball cultures were treated with short wavelength BL (peak at 405 nm, output power 1 mW/cm(2)) for 6 h. Immunogold transmission electron microscopy confirmed the expression of Complex I and F1Fo-ATP synthase in the OS. In situ histochemical assays on unfixed sections showed impairment of respiratory Complexes I and II after BL exposure, both in the OS and IS, utilized as a control. Basal O2 consumption and ATP synthesis were impaired in the OS purified from blue-light irradiated eyeball cultures. Electron transfer capacity between Complex I and II as well as activity of Complexes I and II was decreased in blue-light irradiated purified OS. The severe malfunctioning of the OS aerobic respiratory capacity after 6 h BL treatment may be the consequence of a self-induced damage. BL exposure would cause an initial over-functioning of both the phototransduction and respiratory chain, with reactive oxygen species production. In a self-renewal vicious cycle, membrane and protein oxidative damage, proton leakage and uncoupling, would impair redox chains, perpetuating the damage and causing hypo-metabolism with eventual apoptosis of the rod. Data may shed new light on the rod-driven retinopathies such as Age Related Macular Degeneration, of which blue-light irradiated retina represents a model. Copyright © 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

L-tryptophan-induced electron transport across supported lipid bilayers: an alkyl-chain tilt-angle, and bilayer-symmetry dependence.

PubMed

Sarangi, Nirod Kumar; Patnaik, Archita

2012-12-21

Molecular orientation-dependent electron transport across supported 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) lipid bilayers (SLBs) on semiconducting indium tin oxide (ITO) is reported with an aim towards potential nanobiotechnological applications. A bifunctional strategy is adopted to form symmetric and asymmetric bilayers of DPPC that interact with L-tryptophan, and are analyzed by surface manometry and atomic force microscopy. Polarization-dependent real-time Fourier transform infrared reflection absorption spectroscopy (FT-IRRAS) analysis of these SLBs reveals electrostatic, hydrogen-bonding, and cation-π interactions between the polar head groups of the lipid and the indole side chains. Consequently, a molecular tilt arises from the effective interface dipole, facilitating electron transport across the ITO-anchored SLBs in the presence of an internal Fe(CN)(6)(4-/3-) redox probe. The incorporation of tryptophan enhances the voltammetric features of the SLBs. The estimated electron-transfer rate constants for symmetric and asymmetric bilayers (k(s) = 2.0×10(-2) and 2.8×10(-2) s(-1)) across the two-dimensional (2D) ordered DPPC/tryptophan SLBs are higher compared to pure DPPC SLBs (k(s) = 3.2×10(-3) and 3.9×10(-3) s(-1)). In addition, they are molecular tilt-dependent, as it is the case with the standard apparent rate constants k(app)(0), estimated from electrochemical impedance spectroscopy and bipotentiostatic experiments with a Pt ultramicroelectrode. Lower magnitudes of k(s) and k(app)(0) imply that electrochemical reactions across the ITO-SLB electrodes are kinetically limited and consequently governed by electron tunneling across the SLBs. Standard theoretical rate constants (k(th)(0)) accrued upon electron tunneling comply with the potential-independent electron-tunneling coefficient β = 0.15 Å(-1). Insulator-semiconductor transitions moving from a liquid-expanded to a condensed 2D-phase state of the SLBs are noted, adding a new dimension to their transport behavior. These results highlight the role of tryptophan in expediting electron transfer across lipid bilayer membranes in a cellular environment and can provide potential clues towards patterned lipid nanocomposites and devices. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Broad AOX expression in a genetically tractable mouse model does not disturb normal physiology

PubMed Central

Szibor, Marten; Dhandapani, Praveen K.; Dufour, Eric; Holmström, Kira M.; Zhuang, Yuan; Salwig, Isabelle; Wittig, Ilka; Heidler, Juliana; Gizatullina, Zemfira; Fuchs, Helmut; Gailus-Durner, Valérie; de Angelis, Martin Hrabě; Nandania, Jatin; Velagapudi, Vidya; Wietelmann, Astrid; Rustin, Pierre; Gellerich, Frank N.; Braun, Thomas

2017-01-01

ABSTRACT Plants and many lower organisms, but not mammals, express alternative oxidases (AOXs) that branch the mitochondrial respiratory chain, transferring electrons directly from ubiquinol to oxygen without proton pumping. Thus, they maintain electron flow under conditions when the classical respiratory chain is impaired, limiting excess production of oxygen radicals and supporting redox and metabolic homeostasis. AOX from Ciona intestinalis has been used to study and mitigate mitochondrial impairments in mammalian cell lines, Drosophila disease models and, most recently, in the mouse, where multiple lentivector-AOX transgenes conferred substantial expression in specific tissues. Here, we describe a genetically tractable mouse model in which Ciona AOX has been targeted to the Rosa26 locus for ubiquitous expression. The AOXRosa26 mouse exhibited only subtle phenotypic effects on respiratory complex formation, oxygen consumption or the global metabolome, and showed an essentially normal physiology. AOX conferred robust resistance to inhibitors of the respiratory chain in organello; moreover, animals exposed to a systemically applied LD50 dose of cyanide did not succumb. The AOXRosa26 mouse is a useful tool to investigate respiratory control mechanisms and to decipher mitochondrial disease aetiology in vivo. PMID:28067626

Acute high-altitude hypoxic brain injury: Identification of ten differential proteins

PubMed Central

Li, Jianyu; Qi, Yuting; Liu, Hui; Cui, Ying; Zhang, Li; Gong, Haiying; Li, Yaxiao; Li, Lingzhi; Zhang, Yongliang

2013-01-01

Hypobaric hypoxia can cause severe brain damage and mitochondrial dysfunction, and is involved in hypoxic brain injury. However, little is currently known about the mechanisms responsible for mitochondrial dysfunction in hypobaric hypoxic brain damage. In this study, a rat model of hypobaric hypoxic brain injury was established to investigate the molecular mechanisms associated with mitochondrial dysfunction. As revealed by two-dimensional electrophoresis analysis, 16, 21, and 36 differential protein spots in cerebral mitochondria were observed at 6, 12, and 24 hours post-hypobaric hypoxia, respectively. Furthermore, ten protein spots selected from each hypobaric hypoxia subgroup were similarly regulated and were identified by mass spectrometry. These detected proteins included dihydropyrimidinase-related protein 2, creatine kinase B-type, isovaleryl-CoA dehydrogenase, elongation factor Ts, ATP synthase beta-subunit, 3-mercaptopyruvate sulfurtransferase, electron transfer flavoprotein alpha-subunit, Chain A of 2-enoyl-CoA hydratase, NADH dehydrogenase iron-sulfur protein 8 and tropomyosin beta chain. These ten proteins are all involved in the electron transport chain and the function of ATP synthase. Our findings indicate that hypobaric hypoxia can induce the differential expression of several cerebral mitochondrial proteins, which are involved in the regulation of mitochondrial energy production. PMID:25206614

From Fullerene-Polymer to All-Polymer Solar Cells: The Importance of Molecular Packing, Orientation, and Morphology Control.

PubMed

Kang, Hyunbum; Lee, Wonho; Oh, Jiho; Kim, Taesu; Lee, Changyeon; Kim, Bumjoon J

2016-11-15

All-polymer solar cells (all-PSCs), consisting of conjugated polymers as both electron donor (P D ) and acceptor (P A ), have recently attracted great attention. Remarkable progress has been achieved during the past few years, with power conversion efficiencies (PCEs) now approaching 8%. In this Account, we first discuss the major advantages of all-PSCs over fullerene-polymer solar cells (fullerene-PSCs): (i) high light absorption and chemical tunability of P A , which affords simultaneous enhancement of both the short-circuit current density (J SC ) and the open-circuit voltage (V OC ), and (ii) superior long-term stability (in particular, thermal and mechanical stability) of all-PSCs due to entangled long P A chains. In the second part of this Account, we discuss the device operation mechanism of all-PSCs and recognize the major challenges that need to be addressed in optimizing the performance of all-PSCs. The major difference between all-PSCs and fullerene-PSCs originates from the molecular structures and interactions, i.e., the electron transport ability in all-PSCs is significantly affected by the packing geometry of two-dimensional P A chains relative to the electrodes (e.g., face-on or edge-on orientation), whereas spherically shaped fullerene acceptors can facilitate isotropic electron transport properties in fullerene-PSCs. Moreover, the crystalline packing structures of P D and P A at the P D -P A interface greatly affect their free charge carrier generation efficiencies. The design of P A polymers (e.g., main backbone, side chain, and molecular weight) should therefore take account of optimizing three major aspects in all-PSCs: (1) the electron transport ability of P A , (2) the molecular packing structure and orientation of P A , and (3) the blend morphology. First, control of the backbone and side-chain structures, as well as the molecular weight, is critical for generating strong intermolecular assembly of P A and its network, thus enabling high electron transport ability of P A comparable to that of fullerenes. Second, the molecular orientation of anisotropically structured P A should be favorably controlled in order to achieve efficient charge transport as well as charge transfer at the P D -P A interface. For instance, face-to-face stacking between P D and P A at the interface is desired for efficient free charge carrier generation because misoriented chains often cause an additional energy barrier for overcoming the binding energy of the charge transfer state. Third, large-scale phase separation often occurs in all-PSCs because of the significantly reduced entropic contribution by two macromolecular chains of P D and P A that energetically disfavors mixing. In this Account, we review the recent progress toward overcoming each recognized challenge and intend to provide guidelines for the future design of P A . We believe that by optimization of the parameters discussed above the PCE values of all-PSCs will surpass the 10% level in the near future and that all-PSCs are promising candidates for the successful realization of flexible and portable power generators.

Effect of ageing and ischemia on enzymatic activities linked to Krebs' cycle, electron transfer chain, glutamate and aminoacids metabolism of free and intrasynaptic mitochondria of cerebral cortex.

PubMed

Villa, Roberto Federico; Gorini, Antonella; Hoyer, Siegfried

2009-12-01

The effect of ageing and the relationships between the catalytic properties of enzymes linked to Krebs' cycle, electron transfer chain, glutamate and aminoacid metabolism of cerebral cortex, a functional area very sensitive to both age and ischemia, were studied on mitochondria of adult and aged rats, after complete ischemia of 15 minutes duration. The maximum rate (Vmax) of the following enzyme activities: citrate synthase, malate dehydrogenase, succinate dehydrogenase for Krebs' cycle; NADH-cytochrome c reductase as total (integrated activity of Complex I-III), rotenone sensitive (Complex I) and cytochrome oxidase (Complex IV) for electron transfer chain; glutamate dehydrogenase, glutamate-oxaloacetate-and glutamate-pyruvate transaminases for glutamate metabolism were assayed in non-synaptic, perikaryal mitochondria and in two populations of intra-synaptic mitochondria, i.e., the light and heavy mitochondrial fraction. The results indicate that in normal, steady-state cerebral cortex, the value of the same enzyme activity markedly differs according (a) to the different populations of mitochondria, i.e., non-synaptic or intra-synaptic light and heavy, (b) and respect to ageing. After 15 min of complete ischemia, the enzyme activities of mitochondria located near the nucleus (perikaryal mitochondria) and in synaptic structures (intra-synaptic mitochondria) of the cerebral tissue were substantially modified by ischemia. Non-synaptic mitochondria seem to be more affected by ischemia in adult and particularly in aged animals than the intra-synaptic light and heavy mitochondria. The observed modifications in enzyme activities reflect the metabolic state of the tissue at each specific experimental condition, as shown by comparative evaluation with respect to the content of energy-linked metabolites and substrates. The derangements in enzyme activities due to ischemia is greater in aged than in adult animals and especially the non-synaptic and the intra-synaptic light mitochondria seems to be more affected in aged animals. These data allow the hypothesis that the observed modifications of catalytic activities in non-synaptic and intra-synaptic mitochondrial enzyme systems linked to energy metabolism, amino acids and glutamate metabolism are primary responsible for the physiopathological responses of cerebral tissue to complete cerebral ischemia for 15 min duration during ageing.

Effects of internal friction on contact formation dynamics of polymer chain

NASA Astrophysics Data System (ADS)

Bian, Yukun; Li, Peng; Zhao, Nanrong

2018-04-01

A theoretical framework is presented to study the contact formation dynamics of polymer chains, in accompany with an electron-transfer quenching. Based on a non-Markovian Smoluchowski equation supplemented with an exponential sink term, we derive the mean time of contact formation under Wilemski-Fixman approximation. Our particular attentions are paid to the effect of internal friction. We find out that internal friction induces a novel fractional viscosity dependence, which will become more remarkable as internal friction increases. Furthermore, we clarify that internal friction inevitably promotes a diffusion-controlled mechanism by slowing the chain relaxation. Finally, we apply our theory to rationalise the experimental investigation for contact formation of a single-stranded DNA. The theoretical results can reproduce the experimental data very well with quite reasonable estimation for the intrinsic parameters. Such good agreements clearly demonstrate the validity of our theory which has appropriately addressed the very role of internal friction to the relevant dynamics.

Synthesis of silver nanoparticles in melts of amphiphilic polyesters

NASA Astrophysics Data System (ADS)

Vasylyev, S.; Damm, C.; Segets, D.; Hanisch, M.; Taccardi, N.; Wasserscheid, P.; Peukert, W.

2013-03-01

The current work presents a one-step procedure for the synthesis of amphiphilic silver nanoparticles suitable for production of silver-filled polymeric materials. This solvent free synthesis via reduction of Tollens’ reagent as silver precursor in melts of amphiphilic polyesters consisting of hydrophilic poly(ethylene glycol) blocks and hydrophobic alkyl chains allows the production of silver nanoparticles without any by-product formation. This makes them especially interesting for the production of medical devices with antimicrobial properties. In this article the influences of the chain length of the hydrophobic block in the amphiphilic polyesters and the process temperature on the particle size distribution (PSD) and the stability of the particles against agglomeration are discussed. According to the results of spectroscopic and viscosimetric investigations the silver precursor is reduced to elemental silver nanoparticles by a single electron transfer process from the poly(ethylene glycol) chain to the silver ion.

PSI Mehler reaction is the main alternative photosynthetic electron pathway in Symbiodinium sp., symbiotic dinoflagellates of cnidarians.

PubMed

Roberty, Stéphane; Bailleul, Benjamin; Berne, Nicolas; Franck, Fabrice; Cardol, Pierre

2014-10-01

Photosynthetic organisms have developed various photoprotective mechanisms to cope with exposure to high light intensities. In photosynthetic dinoflagellates that live in symbiosis with cnidarians, the nature and relative amplitude of these regulatory mechanisms are a matter of debate. In our study, the amplitude of photosynthetic alternative electron flows (AEF) to oxygen (chlororespiration, Mehler reaction), the mitochondrial respiration and the Photosystem I (PSI) cyclic electron flow were investigated in strains belonging to three clades (A1, B1 and F1) of Symbiodinium. Cultured Symbiodinium strains were maintained under identical environmental conditions, and measurements of oxygen evolution, fluorescence emission and absorption changes at specific wavelengths were used to evaluate PSI and PSII electron transfer rates (ETR). A light- and O2 -dependent ETR was observed in all strains. This electron transfer chain involves PSII and PSI and is insensitive to inhibitors of mitochondrial activity and carbon fixation. We demonstrate that in all strains, the Mehler reaction responsible for photoreduction of oxygen by the PSI under high light, is the main AEF at the onset and at the steady state of photosynthesis. This sustained photosynthetic AEF under high light intensities acts as a photoprotective mechanism and leads to an increase of the ATP/NADPH ratio. © 2014 The Authors New Phytologist © 2014 New Phytologist Trust.

Mitochondrial origin of extracelullar transferred electrons in yeast-based biofuel cells.

PubMed

Hubenova, Yolina; Mitov, Mario

2015-12-01

The influence of mitochondrial electron transport chain inhibitors on the electricity outputs of Candida melibiosica yeast-based biofuel cell was investigated. The addition of 30 μM rotenone or antimycin A to the yeast suspension results in a decrease in the current generation, corresponding to 25.7±1.3%, respectively 38.8±1.9% reduction in the electric charge passed through the bioelectrochemical system. The latter percentage coincides with the share of aerobic respiration in the yeast catabolic processes, determined by the decrease of the ethanol production during cultivation in the presence of oxygen compared with that obtained under strict anaerobic conditions. It was established that the presence of both inhibitors leads to almost complete mitochondrial dysfunction, expressed by inactivation of cytochrome c oxidase and NADH:ubiquinone oxidoreductase as well as reduced electrochemical activity of isolated yeast mitochondria. It was also found that methylene blue partially neutralized the rotenone poisoning, probably serving as alternative intracellular electron shuttle for by-passing the complex I blockage. Based on the obtained results, we suppose that electrons generated through the aerobic respiration processes in the mitochondria participate in the extracellular electron transfer from the yeast cells to the biofuel cell anode, which contributes to higher current outputs at aerobic conditions. Copyright © 2014 Elsevier B.V. All rights reserved.

Possible Dynamically Gated Conductance along Heme Wires in Bacterial Multiheme Cytochromes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smith, Dayle MA; Rosso, Kevin M.

2014-07-24

The staggered cross decaheme configuration of electron transfer co-factors in the outer-membrane cytochrome MtrF may serve as a prototype for conformationally-gated multi-heme electron transport. Derived from the bacterium Shewanella oneidensis, the staggered cross configuration reveals intersecting c-type octaheme and tetraheme “wires” containing thermodynamic “hills” and “valleys”, suggesting that the protein structure may include a dynamical mechanism for conductance and pathway switching depending on enzymatic functional need. Recent molecular simulations have established the pair-wise electronic couplings, redox potentials, and reorganization energies to predict the maximum conductance along the various heme wire pathways by sequential hopping of a single electron (PNAS (2014)more » 11,611-616). Here, we expand this information with classical molecular and statistical mechanics calculations of large-amplitude protein dynamics in MtrF, to address its potential to modulate pathway conductance, including assessment of the effect of the total charge state. Explicit solvent molecular dynamics simulations of fully oxidized and fully reduced MtrF employing ten independent 50-ns simulations at 300 K and 1 atm showed that reduced MtrF is more expanded and explores more conformational space than oxidized MtrF, and that heme reduction leads to increased heme solvent exposure. The slowest mode of collective decaheme motion is 90% similar between the oxidized and reduced states, and consists primarily of inter-heme separation with minor rotational contributions. The frequency of this motion is 1.7×107 s 1 for fully-oxidized and fully-reduced MtrF, respectively, slower than the downhill electron transfer rates between stacked heme pairs at the octaheme termini and faster than the electron transfer rates between parallel hemes in the tetraheme chain. This implies that MtrF uses slow conformational fluctuations to modulate electron flow along the octaheme pathway, apparently for the purpose of increasing the residence time of electrons on lowest potential hemes 4 and 9. This apparent gating mechanism should increase the success rate of electron transfer from MtrF to low potential environmental acceptors via these two solvent-exposed hemes.« less

The Impacts of Phosphorus Deficiency on the Photosynthetic Electron Transport Chain.

PubMed

Carstensen, Andreas; Herdean, Andrei; Schmidt, Sidsel Birkelund; Sharma, Anurag; Spetea, Cornelia; Pribil, Mathias; Husted, Søren

2018-05-01

Phosphorus (P) is an essential macronutrient, and P deficiency limits plant productivity. Recent work showed that P deficiency affects electron transport to photosystem I (PSI), but the underlying mechanisms are unknown. Here, we present a comprehensive biological model describing how P deficiency disrupts the photosynthetic machinery and the electron transport chain through a series of sequential events in barley ( Hordeum vulgare ). P deficiency reduces the orthophosphate concentration in the chloroplast stroma to levels that inhibit ATP synthase activity. Consequently, protons accumulate in the thylakoids and cause lumen acidification, which inhibits linear electron flow. Limited plastoquinol oxidation retards electron transport to the cytochrome b 6 f complex, yet the electron transfer rate of PSI is increased under steady-state growth light and is limited under high-light conditions. Under P deficiency, the enhanced electron flow through PSI increases the levels of NADPH, whereas ATP production remains restricted and, hence, reduces CO 2 fixation. In parallel, lumen acidification activates the energy-dependent quenching component of the nonphotochemical quenching mechanism and prevents the overexcitation of photosystem II and damage to the leaf tissue. Consequently, plants can be severely affected by P deficiency for weeks without displaying any visual leaf symptoms. All of the processes in the photosynthetic machinery influenced by P deficiency appear to be fully reversible and can be restored in less than 60 min after resupply of orthophosphate to the leaf tissue. © 2018 American Society of Plant Biologists. All Rights Reserved.

Improved stability of a metallic state in benzothienobenzothiophene-based molecular conductors: an effective increase of dimensionality with hydrogen bonds.

PubMed

Higashino, Toshiki; Ueda, Akira; Yoshida, Junya; Mori, Hatsumi

2017-03-25

A dihydroxy-substituted benzothienobenzothiophene, BTBT(OH) 2 , was synthesized, and its charge-transfer (CT) salt, β-[BTBT(OH) 2 ] 2 ClO 4 , was successfully obtained. Thanks to the introduced hydroxy groups, a hydrogen-bonded chain structure connecting the BTBT molecules and counter anions was formed in the CT salt, which effectively increases the dimensionality of the electronic structure and consequently leads to a stable metallic state.

Electron transfer dissociation of synthetic and natural peptides containing lanthionine/methyllanthionine bridges.

PubMed

Dolle, Ashwini B; Jagadeesh, Narasimhappagari; Bhaumik, Suman; Prakash, Sunita; Biswal, Himansu S; Gowd, Konkallu Hanumae

2018-06-15

The modes of cleavage of lanthionine/methyllanthionine bridges under electron transfer dissociation (ETD) were investigated using synthetic and natural lantipeptides. Knowledge of the mass spectrometric fragmentation of lanthionine/methyllanthionine bridges may assist in the development of analytical methods for the rapid discovery of new lantibiotics. The present study strengthens the advantage of ETD in the characterization of posttranslational modifications of peptides and proteins. Synthetic and natural lantipeptides were obtained by desulfurization of peptide disulfides and cyanogen bromide digestion of the lantibiotic nisin, respectively. These peptides were subjected to electrospray ionization collision-induced dissociation tandem mass spectrometry (CID-MS/MS) and ETD-MS/MS using an HCT ultra ETDII ion trap mass spectrometer. MS 3 CID was performed on the desired product ions to prove cleavage of the lanthionine/methyllanthionine bridge during ETD-MS/MS. ETD has advantages over CID in the cleavage of the side chain of lanthionine/methyllanthionine bridges. The cleavage of the N-Cα backbone peptide bond followed by C-terminal side chain of the lanthionine bridge results in formation of c •+ and z + ions. Cleavage at the preceding peptide bond to the C-terminal side chain of lanthionine/methyllanthionine bridges yields specific fragments with the cysteine/methylcysteine thiyl radical and dehydroalanine. ETD successfully cleaves the lanthionine/methyllanthionine bridges of synthetic and natural lantipeptides. Diagnostic fragment ions of ETD cleavage of lanthionine/methyllanthionine bridges are the N-terminal cysteine/methylcysteine thiyl radical and C-terminal dehydroalanine. Detection of the cysteine/methylcysteine thiyl radical and dehydroalanine in combined ETD-CID-MS may be used for the rapid identification of lantipeptide natural products. Copyright © 2018 John Wiley & Sons, Ltd.

Self-assembly of block copolymer micelles: synthesis via reversible addition-fragmentation chain transfer polymerization and aqueous solution properties.

PubMed

Mya, Khine Y; Lin, Esther M J; Gudipati, Chakravarthy S; Gose, Halima B A S; He, Chaobin

2010-07-22

Poly(hexafluorobutyl methacrylate) (PHFBMA) homopolymer was synthesized by reversible addition-fragmentation chain transfer (RAFT)-mediated living radical polymerization in the presence of cyano-2-propyl dithiobenzoate (CPDB) RAFT agent. A block copolymer of PHFBMA-poly(propylene glycol acrylate) (PHFBMA-b-PPGA) with dangling poly(propylene glycol) (PPG) side chains was then synthesized by using CPDB-terminated PHFBMA as a macro-RAFT agent. The amphiphilic properties and self-assembly of PHFBMA-b-PPGA block copolymer in aqueous solution were investigated by dynamic and static light scattering (DLS and SLS) studies, in combination with fluorescence spectroscopy and transmission electron microscopy (TEM). Although PPG shows moderately hydrophilic character, the formation of nanosize polymeric micelles was confirmed by fluorescence and TEM studies. The low value of the critical aggregation concentration exhibited that the tendency for the formation of copolymer aggregates in aqueous solution was very high due to the strong hydrophobicity of the PHFBMA(145)-b-PPGA(33) block copolymer. The combination of DLS and SLS measurements revealed the existence of micellar aggregates in aqueous solution with an association number of approximately 40 +/- 7 for block copolymer micelles. It was also found in TEM observation that there are 40-50 micelles accumulated into one aggregate and these micelles are loosely packed inside the aggregate.

Characterization of a unique [FeS] cluster in the electron transfer chain of the oxygen tolerant [NiFe] hydrogenase from Aquifex aeolicus.

PubMed

Pandelia, Maria-Eirini; Nitschke, Wolfgang; Infossi, Pascale; Giudici-Orticoni, Marie-Thérèse; Bill, Eckhard; Lubitz, Wolfgang

2011-04-12

Iron-sulfur clusters are versatile electron transfer cofactors, ubiquitous in metalloenzymes such as hydrogenases. In the oxygen-tolerant Hydrogenase I from Aquifex aeolicus such electron "wires" form a relay to a diheme cytb, an integral part of a respiration pathway for the reduction of O(2) to water. Amino acid sequence comparison with oxygen-sensitive hydrogenases showed conserved binding motifs for three iron-sulfur clusters, the nature and properties of which were unknown so far. Electron paramagnetic resonance spectra exhibited complex signals that disclose interesting features and spin-coupling patterns; by redox titrations three iron-sulfur clusters were identified in their usual redox states, a [3Fe4S] and two [4Fe4S], but also a unique high-potential (HP) state was found. On the basis of (57)Fe Mössbauer spectroscopy we attribute this HP form to a superoxidized state of the [4Fe4S] center proximal to the [NiFe] site. The unique environment of this cluster, characterized by a surplus cysteine coordination, is able to tune the redox potentials and make it compliant with the [4Fe4S](3+) state. It is actually the first example of a biological [4Fe4S] center that physiologically switches between 3+, 2+, and 1+ oxidation states within a very small potential range. We suggest that the (1 + /2+) redox couple serves the classical electron transfer reaction, whereas the superoxidation step is associated with a redox switch against oxidative stress.

Characterization of a unique [FeS] cluster in the electron transfer chain of the oxygen tolerant [NiFe] hydrogenase from Aquifex aeolicus

PubMed Central

Pandelia, Maria-Eirini; Nitschke, Wolfgang; Infossi, Pascale; Giudici-Orticoni, Marie-Thérèse; Bill, Eckhard; Lubitz, Wolfgang

2011-01-01

Iron-sulfur clusters are versatile electron transfer cofactors, ubiquitous in metalloenzymes such as hydrogenases. In the oxygen-tolerant Hydrogenase I from Aquifex aeolicus such electron “wires” form a relay to a diheme cytb, an integral part of a respiration pathway for the reduction of O2 to water. Amino acid sequence comparison with oxygen-sensitive hydrogenases showed conserved binding motifs for three iron-sulfur clusters, the nature and properties of which were unknown so far. Electron paramagnetic resonance spectra exhibited complex signals that disclose interesting features and spin-coupling patterns; by redox titrations three iron-sulfur clusters were identified in their usual redox states, a [3Fe4S] and two [4Fe4S], but also a unique high-potential (HP) state was found. On the basis of 57Fe Mössbauer spectroscopy we attribute this HP form to a superoxidized state of the [4Fe4S] center proximal to the [NiFe] site. The unique environment of this cluster, characterized by a surplus cysteine coordination, is able to tune the redox potentials and make it compliant with the [4Fe4S]3+ state. It is actually the first example of a biological [4Fe4S] center that physiologically switches between 3+, 2+, and 1+ oxidation states within a very small potential range. We suggest that the (1 + /2+) redox couple serves the classical electron transfer reaction, whereas the superoxidation step is associated with a redox switch against oxidative stress. PMID:21444783

Polonium (210Po) and lead (210Pb) in marine organisms and their transfer in marine food chains.

PubMed

Carvalho, Fernando P

2011-05-01

The determination of (210)Po and (210)Pb was performed in marine organisms from the seashore to abyssal depths, encompassing a plethora of species from the microscopic plankton to the sperm whale. Concentrations of those radionuclides ranged from low values of about 5 × 10(-1) Bq kg(-1) (wet wt.) in jellyfish, to very high values of about of 3 × 10(4) Bq kg(-1) (wet wt.) in the gut walls of sardines, with a common pattern of (210)Po > (210)Pb.These radionuclides are primarily absorbed from water and concentrated by phyto- and microzooplankton, and then are transferred to the next trophic level along marine food chains. Investigation in epipelagic, mesopelagic, bathypelagic and abyssobenthic organisms revealed that (210)Po is transferred in the marine food webs with transfer factors ranging from 0.1 to 0.7, and numerically similar to those of the energy transfer in the marine food chains. As (210)Po preferentially binds to amino acids and proteins, its transfer in food chains likely traces protein transfer and, thus, (210)Po transfer factors are similar to ecotrophic coefficients. (210)Pb is transferred less efficiently in marine food chains and this contributes to increased (210)Po:(210)Pb activity ratios in some trophic levels. Copyright © 2010 Elsevier Ltd. All rights reserved.

Embedded top-coat for reducing the effect out of band radiation in EUV lithography

NASA Astrophysics Data System (ADS)

Du, Ke; Siauw, Meiliana; Valade, David; Jasieniak, Marek; Voelcker, Nico; Trefonas, Peter; Thackeray, Jim; Blakey, Idriss; Whittaker, Andrew

2017-03-01

Out of band (OOB) radiation from the EUV source has significant implications for the performance of EUVL photoresists. Here we introduce a surface-active polymer additive, capable of partitioning to the top of the resist film during casting and annealing, to protect the underlying photoresist from OOB radiation. Copolymers were prepared using reversible addition-fragmentation chain transfer (RAFT) polymerization, and rendered surface active by chain extension with a block of fluoro-monomer. Films were prepared from the EUV resist with added surface-active Embedded Barrier Layer (EBL), and characterized using measurements of contact angles and spectroscopic ellipsometry. Finally, the lithographic performance of the resist containing the EBL was evaluated using Electron Beam Lithography exposure

Dissection of the Caffeate Respiratory Chain in the Acetogen Acetobacterium woodii: Identification of an Rnf-Type NADH Dehydrogenase as a Potential Coupling Site▿

PubMed Central

Imkamp, Frank; Biegel, Eva; Jayamani, Elamparithi; Buckel, Wolfgang; Müller, Volker

2007-01-01

The anaerobic acetogenic bacterium Acetobacterium woodii couples caffeate reduction with electrons derived from hydrogen to the synthesis of ATP by a chemiosmotic mechanism with sodium ions as coupling ions, a process referred to as caffeate respiration. We addressed the nature of the hitherto unknown enzymatic activities involved in this process and their cellular localization. Cell extract of A. woodii catalyzes H2-dependent caffeate reduction. This reaction is strictly ATP dependent but can be activated also by acetyl coenzyme A (CoA), indicating that there is formation of caffeyl-CoA prior to reduction. Two-dimensional gel electrophoresis revealed proteins present only in caffeate-grown cells. Two proteins were identified by electrospray ionization-mass spectrometry/mass spectrometry, and the encoding genes were cloned. These proteins are very similar to subunits α (EtfA) and β (EtfB) of electron transfer flavoproteins present in various anaerobic bacteria. Western blot analysis demonstrated that they are induced by caffeate and localized in the cytoplasm. Etf proteins are known electron carriers that shuttle electrons from NADH to different acceptors. Indeed, NADH was used as an electron donor for cytosolic caffeate reduction. Since the hydrogenase was soluble and used ferredoxin as an electron acceptor, the missing link was a ferredoxin:NAD+ oxidoreductase. This activity could be determined and, interestingly, was membrane bound. A search for genes that could encode this activity revealed DNA fragments encoding subunits C and D of a membrane-bound Rnf-type NADH dehydrogenase that is a potential Na+ pump. These data suggest the following electron transport chain: H2 → ferredoxin → NAD+ → Etf → caffeyl-CoA reductase. They also imply that the sodium motive step in the chain is the ferredoxin-dependent NAD+ reduction catalyzed by Rnf. PMID:17873051

Picosecond spectroscopic study of chlorophyll-based models for the primary photochemistry of photosynthesis. [Dimers and trimers of chlorophyllide derivatives

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bucks, R.R.; Netzel, T.L.; Fujita, I.

1982-05-27

A series of covalently linked dimers and trimers of chlorophyllide derivatives was investigated by time-resolved absorption and fluorescence spectroscopy (3 to 10/sup 4/ ps). For these compounds, the free energy difference between the singlet excited state of the electron donor and the anticipated cation-anion photoproduct (..delta..G/sub ET/) is estimated to range from +200 to -400 MeV. For the dimers studied, the singlet-excited-state lifetimes range from 1 to 7 ns and depend inversely on the solvent's static dielectric constant. Since no decrease in lifetime or fluorescence quantum yield was found as ..delta..G/sub ET/ became more negative, this effect is unlikely tomore » be due to slow electron transfer. It may be a result of fluctuating intramolecular association of the nonpolar macrocycles in solvents with a high dielectric constant. We also studied two trimers, each having the same chlorophyllide a dimer as the electron donor, but with pyropheophorbide a or pheophorbide a as the electron acceptor (the latter is 90 MeV easier to reduce than the former). For the trimer with pheophorbide a as the acceptor, there is evidence for a new path of radiationless decay which may involve an electron-transfer product. However, the rate of formation of this product is slow (less than or equal to 10/sup 10/ s/sup -1/), and its yield is low (less than or equal to 50%). Taken together, these results suggest that chlorophyll-based, donor-acceptor pairs connected by flexible chains longer than five atoms are not likely to duplicate the highly efficient excited-singlet-state electron-transfer reactions characteristic of the primary photochemistry of photosynthetic organisms.« less

Novel molecular host materials based on carbazole/PO hybrids with wide bandgap via unique linkages for solution-processed blue phosphorescent OLEDs

NASA Astrophysics Data System (ADS)

Ye, Hua; Zhou, Kaifeng; Wu, Hongyu; Chen, Kai; Xie, Gaozhan; Hu, Jingang; Yan, Guobing; Ma, Songhua; Su, Shi-Jian; Cao, Yong

2016-10-01

A series of novel molecules with wide bandgap based on electron-withdrawing diphenyl phosphine oxide units and electron-donating carbazolyl moieties through insulated unique linkages of flexible chains terminated by oxygen or sulfur atoms as solution-processable host materials were successfully synthesized for the first time, and their thermal, photophysical, and electrochemical properties were studied thoroughly. These materials possess high triplet energy levels (ET, 2.76-2.77 eV) due to the introduction of alkyl chain to interrupt the conjugation between electron-donor and electron-acceptor. Such high ET could effectively curb the energy from phosphorescent emitter transfer to the host molecules and thus assuring the emission of devices was all from the blue phosphorescent emitter iridium (III) bis [(4,6-difluorophenyl)-pyridinate-N,C2‧]picolinate (FIrpic). Among them, the solution-processed device based on CBCR6OPO without extra vacuum thermal-deposited hole-blocking layer and electron-transporting layer showed the highest maximum current efficiency (CEmax) of 4.16 cd/A. Moreover, the device presented small efficiency roll-off with current efficiency (CE) of 4.05 cd/A at high brightness up to 100 cd/m2. Our work suggests the potential applications of the solution-processable materials with wide bandgap in full-color flat-panel displays and organic lighting.

Subwavelength dielectric nanorod chains for energy transfer in the visible range.

PubMed

Li, Dongdong; Zhang, Jingjing; Yan, Changchun; Xu, Zhengji; Zhang, Dao Hua

2017-10-15

We report a new type of energy transfer device, formed by a dielectric nanorod array embedded in a silver slab. Such dielectric chain structures allow surface plasmon wave guiding with large propagation length and highly suppressed crosstalk between adjacent transmission channels. The simulation results show that our proposed design can be used to enhance the energy transfer along the waveguide-like dielectric nanorod chains via coupled plasmons, where the energy spreading is effectively suppressed, and superior imaging properties in terms of resolution and energy transfer distance can be achieved.

Intramolecular electronic energy transfer in peptides carrying naphthalene and protoporphyrin molecules: a spectroscopic and conformational statistics investigation.

PubMed

Pispisa, B; Venanzi, M; Palleschi, A; Zanotti, G

1995-10-01

Short linear peptides, carrying an AA spacer in the backbone chain (AA = Aib or Ala), and naphthalene (N) and protoporphyrin IX (P) covalently bound to epsilon-amino groups of lysine side chains, were synthesized. The general formula is Boc-Leu-Leu-Lys(P)-(AA)n-Leu-Leu-Lys(N)-OtBu, with n = 0-2. The photophysical behavior of these compounds was investigated in water/methanol 75/25 (v/v) solution by steady-state and time-resolved fluorescence experiments. Quenching of excited naphthyl chromophore takes place by electronic energy transfer to the porphyrin ground state, and proceeds on a time scale of 3-8 ns, while a minor and slower (approximately 45 ns) fluorescence lifetime measures the decay of the exciplexes. The results were compared with those earlier obtained with the P(Ala)nN peptides (n = 0-4) in methanol solution, showing that addition of water does not significantly alter the dynamic relaxation behavior of the systems investigated, but affects the dissipation mechanism of the energy transferred to P. Quenching efficiencies from both fluorescence intensity and fluorescence lifetime measurements follow a different trend as the number of AA units increases, depending on whether AA = Aib or Ala, indicating that there are differences in the structural features of the two series of peptides. Consistently, CD spectral results suggest that the former compounds attain ordered conformations, possibly of the 3(10)-helical type, while the latter populate alpha-helical structures to an extent depending on the chain length. The ir data in dilute CD3OD or CDCl3 solution confirm this conclusion in that there is an increased percentage of intramolecular H bonds in the P(Aib)nN as compared to the corresponding P(Ala)nN peptides. The photophysical results can be well described by a long-range dipole-dipole interaction model, provided the separation distances distribution and mutual orientation of N and P groups are taken into account. The need of using the angular relationships between the probes implies that interconversion among conformational substates of chromophores linkages is slow on the time scale of the transfer process, very likely because of both the amide bond in the linkages and the bulkiness of the donor-acceptor pair.

[F-18]Fluorodihydrorotenone: Synthesis and evaluation of a mitochondrial electron transport chain (ETC) complex I probe for PET

DOE Office of Scientific and Technical Information (OSTI.GOV)

VanBrocklin, H.F.; Enas, J.D.; Hanrahan, S.M.

1994-05-01

The mitochondrial electron transport chain (ETC) consists of five enzyme complexes (I-V) which participate in the transfer of electrons to oxygen and phosphorylation of ADP (oxidative phosphorylation). ETC dysfunction has been linked to several genetic neurological diseases as well as implicated in Parkinson`s (complex I) and Huntington`s (complex I) disease and normal aging processes. Dihydrorotenone (DHR) is a specific high affinity inhibitor of complex I. In order to develop a PET tracer for complex I, we have labeled DHR with fluorine-18. The tosylate precursor was produced in three steps from commercially available rotenone. Fluorine-18 was introduced by nucleophilic displacement ofmore » the tosylate using tetrabutyl-ammonium fluoride. Subsequent oxidation with MnO{sub 2} and HPLC purification gave the desired [{sup 18}F]fluoro-DHR. Initial biodistribution studies were carried out in {approximately}200 g male Sprague-Dawley rats. The tracer was taken up rapidly in the heart, an organ highly enriched with mitochondria, (5.5-6% injected dose (ID)/g at 30 minutes) and in the brain ({approximately}1.5% ID/g at 1 hour).« less

The role of solitons in charge and energy transfer in 1D molecular chains

NASA Astrophysics Data System (ADS)

Ivić , Zoran

1998-03-01

The idea that polarons and solitons could play the crucial role in the transport processes in biological structures, has been critically reexamined on the basis of the general theory of self-trapping phenomena. The criteria which enable one to determine conditions for the existence and stability of polarons and solitons and to determine their character, in dependence of the values of the basic physical parameters of the system, were formulated. Validity of the so-called Davydov's soliton model was discussed on the basis of these criteria. It was found that the original Davydov's proposal, based upon the idea of the soliton creation due to the single excitation (particle, vibron, etc.) self-trapping, cannot explain the intramolecular energy transfer in α-helix and acetanilide. However, Davydov theory is flexible enough to describe the single electron transfer in some systems (α-helix and acetanilide for example). In the many-particle systems, dressing effect, due to the quantum nature of phonons, may cause the creation of the bound states of the several excitons in the molecular chain. The possibility of creation of the soliton states of this type is discussed for the simple Fröhlich's one-dimensional model. The regions of the system parameter space where different mechanisms dominate the behaviour of such entities are characterized.

Size-scaling behaviour of the electronic polarizability of one-dimensional interacting systems

NASA Astrophysics Data System (ADS)

Chiappe, G.; Louis, E.; Vergés, J. A.

2018-05-01

Electronic polarizability of finite chains is accurately calculated from the total energy variation of the system produced by small but finite static electric fields applied along the chain direction. Normalized polarizability, that is, polarizability divided by chain length, diverges as the second power of length for metallic systems but approaches a constant value for insulating systems. This behaviour provides a very convenient way to characterize the wave-function malleability of finite systems as it avoids the need of attaching infinite contacts to the chain ends. Hubbard model calculations at half filling show that the method works for a small U  =  1 interaction value that corresponds to a really small spectral gap of 0.005 (hopping t  =  ‑1 is assumed). Once successfully checked, the method has been applied to the long-range hopping model of Gebhard and Ruckenstein showing 1/r hopping decay (Gebhard and Ruckenstein 1992 Phys. Rev. Lett. 68 244; Gebhard et al 1994 Phys. Rev. B 49 10926). Metallicity for U values below the reported metal-insulator transition is obtained but the surprise comes for U values larger than the critical one (when a gap appears in the spectral density of states) because a steady increase of the normalized polarizability with size is obtained. This critical size-scaling behaviour can be understood as corresponding to a molecule which polarizability is unbounded. We have checked that a real transfer of charge from one chain end to the opposite occurs as a response to very small electric fields in spite of the existence of a large gap of the order of U for one-particle excitations. Finally, ab initio quantum chemistry calculations of realistic poly-acetylene chains prove that the occurrence of such critical behaviour in real systems is unlikely.

A hermetic self-sustained microbial solar cell based on Chlorella vulgaris and a versatile charge transfer chain

NASA Astrophysics Data System (ADS)

Pan, Keliang; Zhou, Peijiang

2015-10-01

A hermetic noble-metal-free membrane-less microbial solar cell (MSC) is established. The substances decomposition and regeneration in this MSC are carried out only by Chlorella vulgaris simultaneously. The conversion of metabolism types of C. vulgaris is controlled only by illumination. By using a pleiotropic redox mediator and a cupric hexacyanoferrate modified cathode, a two-phase three-stage charge transfer chain is formed. Through this pathway, the one microorganism self-sustained system gets a long-term power output up to 0.04773 mW/cm2 at 0.423 V without any material exchange with external, which is 50 times higher than that obtained from the original system. Benefiting from this electron buffer system, the battery will achieve an electricity generation in both light and dark conditions. There is almost no consumption of any substrates throughout the stabilized process, and no more additions are required. This maintenance-free and extremely inexpensive reactor with a simple structure and a long service life demonstrates the possibility of combining the microbial, chemical and photo cells.

High efficiency ZnO-based dye-sensitized solar cells with a 1H,1H,2H,2H-perfluorodecyltriethoxysilane chain barrier for cutting on interfacial recombination

NASA Astrophysics Data System (ADS)

Xie, Yahong; Zhou, Xiaofeng; Mi, Hongyu; Ma, Junhong; Yang, Jianya; Cheng, Jian

2018-03-01

Charge recombination at the ZnO photoanode/electrolyte interface is one of the major limitations for high performance dye-sensitized solar cells (DSSCs) toward their theoretical power conversion efficiency (PCE). Here, we proposed an efficient approach for reducing this interfacial losses and consequently facilitating charge transfer by decorating a hydrophobic thin-film on the surface of the dye-coated zinc oxide photoanode via 1H,1H,2H,2H-perfluorodecyltriethoxysilane (PFDTES) hexane solution immersing. As a result, a high PCE of 8.22% was obtained, which far exceeded the efficiency of 5.40% in a conventional DSSC without PFDTES treatment. Furthermore, PFDTES treatment also largely elongated the lifetime of photogenerated electrons, and maintained a good photo-response at the photoelectrode. This work provides a comprehensive explanation of electron injection, transfer and recombination at the ZnO photoanode/electrolyte interface, and a promising strategy to explore high efficiency ZnO-based DSSCs.

Electron-transfer dynamics in highly reduced states of simple and superstructured metalloporphyrins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anxolabehere, E.; Lexa, D.; Saveant, J.M.

1992-02-06

The standard rate constants of the Fe(I){sup -}/Fe({open_quotes}0{close_quotes}){sup 2-} couple in a series of four simple and basket-handle superstructured porphyrins have been measured by means of fast cyclic voltammetry at mercury and gold ultramicroelectrodes. Analysis of the experimental data by the Marcus-Hush model revealed that the main rate-controlling factor of these very fast electron-transfer reactions is solvent reorganization. The presence of secondary amide groups borne by the basket-handle structure and located in the close vicinity of the metalloporphyrin center largely facilitates the reaction from a thermodynamic viewpoint. This facilitation of the reaction is not counterbalanced by any significant contribution ofmore » the fluctuational reorganization of the NHCO dipoles thanks to their attachment to the basket-handle chains. A few complementary experiments were carried out with zinc and copper porphyrins where the same general trends were observed. 16 refs., 3 figs., 2 tabs.« less

Lysine desuccinylase SIRT5 binds to cardiolipin and regulates the electron transport chain.

PubMed

Zhang, Yuxun; Bharathi, Sivakama S; Rardin, Matthew J; Lu, Jie; Maringer, Katherine V; Sims-Lucas, Sunder; Prochownik, Edward V; Gibson, Bradford W; Goetzman, Eric S

2017-06-16

SIRT5 is a lysine desuccinylase known to regulate mitochondrial fatty acid oxidation and the urea cycle. Here, SIRT5 was observed to bind to cardiolipin via an amphipathic helix on its N terminus. In vitro , succinyl-CoA was used to succinylate liver mitochondrial membrane proteins. SIRT5 largely reversed the succinyl-CoA-driven lysine succinylation. Quantitative mass spectrometry of SIRT5-treated membrane proteins pointed to the electron transport chain, particularly Complex I, as being highly targeted for desuccinylation by SIRT5. Correspondingly, SIRT5 -/- HEK293 cells showed defects in both Complex I- and Complex II-driven respiration. In mouse liver, SIRT5 expression was observed to localize strictly to the periportal hepatocytes. However, homogenates prepared from whole SIRT5 -/- liver did show reduced Complex II-driven respiration. The enzymatic activities of Complex II and ATP synthase were also significantly reduced. Three-dimensional modeling of Complex II suggested that several SIRT5-targeted lysine residues lie at the protein-lipid interface of succinate dehydrogenase subunit B. We postulate that succinylation at these sites may disrupt Complex II subunit-subunit interactions and electron transfer. Lastly, SIRT5 -/- mice, like humans with Complex II deficiency, were found to have mild lactic acidosis. Our findings suggest that SIRT5 is targeted to protein complexes on the inner mitochondrial membrane via affinity for cardiolipin to promote respiratory chain function. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Inhibition of electron transfer and uncoupling effects by emodin and emodinanthrone in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ubbink-Kok, T.; Anderson, J.A.; Konings, W.N.

1986-07-01

The anthraquinones emodin (1,3,delta-trihydroxy-6-methylanthraquinone) and emodinanthrone (1,3,8-trihydroxy-6-methylanthrone) inhibited respiration-driven solute transport at micromolar concentrations in membrane vesicles of Escherichia coli. This inhibition was enhanced by Ca ions. The inhibitory action on solute transport is caused by inhibition of electron flow in the respiratory chain, most likely at the level between ubiquinone and cytochrome b, and by dissipation of the proton motive force. The uncoupling action was confirmed by studies on the proton motive force in beef heart cytochrome oxidase proteoliposomes. These two effects on energy transduction in cytoplasmic membranes explain the antibiotic properties of emodin and emodinanthrone.

Inhibition of electron transfer and uncoupling effects by emodin and emodinanthrone in Escherichia coli.

PubMed

Ubbink-Kok, T; Anderson, J A; Konings, W N

1986-07-01

The anthraquinones emodin (1,3,delta-trihydroxy-6-methylanthraquinone) and emodinanthrone (1,3,8-trihydroxy-6-methylanthrone) inhibited respiration-driven solute transport at micromolar concentrations in membrane vesicles of Escherichia coli. This inhibition was enhanced by Ca ions. The inhibitory action on solute transport is caused by inhibition of electron flow in the respiratory chain, most likely at the level between ubiquinone and cytochrome b, and by dissipation of the proton motive force. The uncoupling action was confirmed by studies on the proton motive force in beef heart cytochrome oxidase proteoliposomes. These two effects on energy transduction in cytoplasmic membranes explain the antibiotic properties of emodin and emodinanthrone.

The Role of Glycine Residues 140 and 141 of Subunit B in the Functional Ubiquinone Binding Site of the Na+-pumping NADH:quinone Oxidoreductase from Vibrio cholerae*

PubMed Central

Juárez, Oscar; Neehaul, Yashvin; Turk, Erin; Chahboun, Najat; DeMicco, Jessica M.; Hellwig, Petra; Barquera, Blanca

2012-01-01

The Na+-pumping NADH:quinone oxidoreductase (Na+-NQR) is the main entrance for electrons into the respiratory chain of many marine and pathogenic bacteria. The enzyme accepts electrons from NADH and donates them to ubiquinone, and the free energy released by this redox reaction is used to create an electrochemical gradient of sodium across the cell membrane. Here we report the role of glycine 140 and glycine 141 of the NqrB subunit in the functional binding of ubiquinone. Mutations at these residues altered the affinity of the enzyme for ubiquinol. Moreover, mutations in residue NqrB-G140 almost completely abolished the electron transfer to ubiquinone. Thus, NqrB-G140 and -G141 are critical for the binding and reaction of Na+-NQR with its electron acceptor, ubiquinone. PMID:22645140

Kinetics of interprotein electron transfer between cytochrome c6 and the soluble CuA domain of cyanobacterial cytochrome c oxidase.

PubMed

Paumann, Martina; Feichtinger, Markus; Bernroitner, Margit; Goldfuhs, Judith; Jakopitsch, Christa; Furtmüller, Paul G; Regelsberger, Günther; Peschek, Günter A; Obinger, Christian

2004-10-08

Cytochrome c6 is a soluble metalloprotein located in the periplasmic space and the thylakoid lumen of many cyanobacteria and is known to carry electrons from cytochrome b6f to photosystem I. The CuA domain of cytochrome c oxidase, the terminal enzyme which catalyzes the four-electron reduction of molecular oxygen in the respiratory chains of mitochondria and many bacteria, also has a periplasmic location. In order to test whether cytochrome c6 could also function as a donor for cytochrome c oxidase, we investigated the kinetics of the electron transfer between recombinant cytochrome c6 (produced in high yield in Escherichia coli by coexpressing the maturation proteins encoded by the ccmA-H gene cluster) and the recombinant soluble CuA domain (i.e., the donor binding and electron entry site) of subunit II of cytochrome c oxidase from Synechocystis PCC 6803. The forward and the reverse electron transfer reactions were studied by the stopped-flow technique and yielded apparent bimolecular rate constants of (3.3 +/- 0.3) x 10(5) M(-1) s(-1) and (3.9 +/- 0.1) x 10(6) M(-1) s(-1), respectively, in 5 mM potassium phosphate buffer, pH 7, containing 20 mM potassium chloride and 25 degrees C. This corresponds to an equilibrium constant Keq of 0.085 in the physiological direction (DeltarG'0 = 6.1 kJ/mol). The reduction of the CuA fragment by cytochrome c6 is almost independent on ionic strength, which is in contrast to the reaction of the CuA domain with horse heart cytochrome c, which decreases with increasing ionic strength. The findings are discussed with respect to the potential role of cytochrome c6 as mobile electron carrier in both cyanobacterial electron transport pathways. Copyright 2004 Federation of European Biochemical Societies

Final Progress Report for Grant Number DE-SC0007229

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blake, Robert

2016-08-18

We exploited a novel spectrophotometer where the cuvette is a reflecting cavity completely filled with an absorbing suspension of live, intact bacteria to monitor the in situ absorbance changes in bacteria as they respired aerobically on soluble ferrous ions. Our prior observations suggested the following hypothesis: acidophilic bacteria that belong to different phyla express different types of electron transfer proteins to respire on extracellular iron. We tested this hypothesis using six different organisms that represented each of the six phyla of microorganisms that respire aerobically on iron. Each of these six organisms expressed spectrally different biomolecules that were redox-active duringmore » aerobic respiration on iron. In all six cases, compelling kinetic evidence was collected to indicate that the biomolecules in question were obligatory intermediates in their respective respiratory chains. Additional experiments with intact Acidithiobacillus ferrooxidans revealed that the crowded electron transport proteins in this organism’s periplasm constituted a semi-conducting medium where the network of protein interactions functioned in a concerted fashion as a single ensemble. Thus the molecular oxygen-dependent oxidation of the multi-center respiratory chain occurred with a single macroscopic rate constant, regardless of the proteins’ individual redox potentials or their putative positions in the aerobic iron respiratory chain.« less

Bioaccumulation of 14C-Labeled Graphene in an Aquatic Food Chain through Direct Uptake or Trophic Transfer.

PubMed

Dong, Shipeng; Xia, Tian; Yang, Yu; Lin, Sijie; Mao, Liang

2018-01-16

The growing applications of graphene materials warrant a careful evaluation of their environmental fate in aquatic food webs. Escherichia coli (Bacteria), Tetrahymena thermophila (protozoa), Daphnia magna (zooplankton), and Danio rerio (vertebrate) were used to build aquatic food chains to investigate the waterborne uptake and trophic transfer of 14 C-labeled graphene. Body burden factor (BBF) and trophic transfer factor (TTF) were analyzed for each organism and food chain to assess the bioaccumulation and biomagnification of graphene. The test organisms have high potential of accumulating graphene via direct uptake from culture medium with log-transformed BBF (log BBF) values of 3.66, 5.1, 3.9, and 1.62 for each organism, respectively. In the food chain from E. coli to T. thermophila, the calculated TTFs of 0.2 to 8.6 indicate the high trophic transfer potential in this aquatic food chain. However, the TTFs calculated for the food chain from T. thermophila to D. magna and from D. magna to D. rerio are much lower than 1, indicating that biomagnification was unlikely to occur in these food chains. Body burden measured for dietary uptake by T. thermophila, D. magna, and D. rerio are higher than that via waterborne exposure in a similar nominal concentration, respectively, indicating that trophic transfer is a nonnegligible route for the bioaccumulation of graphene in organisms.

Relaxation-optimized transfer of spin order in Ising spin chains

NASA Astrophysics Data System (ADS)

Stefanatos, Dionisis; Glaser, Steffen J.; Khaneja, Navin

2005-12-01

In this paper, we present relaxation optimized methods for the transfer of bilinear spin correlations along Ising spin chains. These relaxation optimized methods can be used as a building block for the transfer of polarization between distant spins on a spin chain, a problem that is ubiquitous in multidimensional nuclear magnetic resonance spectroscopy of proteins. Compared to standard techniques, significant reduction in relaxation losses is achieved by these optimized methods when transverse relaxation rates are much larger than the longitudinal relaxation rates and comparable to couplings between spins. We derive an upper bound on the efficiency of the transfer of the spin order along a chain of spins in the presence of relaxation and show that this bound can be approached by the relaxation optimized pulse sequences presented in the paper.

Mitochondrial respiratory chain complexes as sources and targets of thiol-based redox-regulation.

PubMed

Dröse, Stefan; Brandt, Ulrich; Wittig, Ilka

2014-08-01

The respiratory chain of the inner mitochondrial membrane is a unique assembly of protein complexes that transfers the electrons of reducing equivalents extracted from foodstuff to molecular oxygen to generate a proton-motive force as the primary energy source for cellular ATP-synthesis. Recent evidence indicates that redox reactions are also involved in regulating mitochondrial function via redox-modification of specific cysteine-thiol groups in subunits of respiratory chain complexes. Vice versa the generation of reactive oxygen species (ROS) by respiratory chain complexes may have an impact on the mitochondrial redox balance through reversible and irreversible thiol-modification of specific target proteins involved in redox signaling, but also pathophysiological processes. Recent evidence indicates that thiol-based redox regulation of the respiratory chain activity and especially S-nitrosylation of complex I could be a strategy to prevent elevated ROS production, oxidative damage and tissue necrosis during ischemia-reperfusion injury. This review focuses on the thiol-based redox processes involving the respiratory chain as a source as well as a target, including a general overview on mitochondria as highly compartmentalized redox organelles and on methods to investigate the redox state of mitochondrial proteins. This article is part of a Special Issue entitled: Thiol-Based Redox Processes. Copyright © 2014 Elsevier B.V. All rights reserved.

Different Functions of Phylogenetically Distinct Bacterial Complex I Isozymes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spero, Melanie A.; Brickner, Joshua R.; Mollet, Jordan T.

NADH:quinone oxidoreductase (complex I) is a bioenergetic enzyme that transfers electrons from NADH to quinone, conserving the energy of this reaction by contributing to the proton motive force. While the importance of NADH oxidation to mitochondrial aerobic respiration is well documented, the contribution of complex I to bacterial electron transport chains has been tested in only a few species. Here, we analyze the function of two phylogenetically distinct complex I isozymes in Rhodobacter sphaeroides, an alphaproteobacterium that contains well-characterized electron transport chains. We found that R. sphaeroides complex I activity is important for aerobic respiration and required for anaerobic dimethylmore » sulfoxide (DMSO) respiration (in the absence of light), photoautotrophic growth, and photoheterotrophic growth (in the absence of an external electron acceptor). Our data also provide insight into the functions of the phylogenetically distinct R. sphaeroides complex I enzymes (complex I A and complex I E) in maintaining a cellular redox state during photoheterotrophic growth. We propose that the function of each isozyme during photoheterotrophic growth is either NADH synthesis (complex I A) or NADH oxidation (complex I E). The canonical alphaproteobacterial complex I isozyme (complex I A) was also shown to be important for routing electrons to nitrogenase-mediated H 2 production, while the horizontally acquired enzyme (complex I E) was dispensable in this process. Unlike the singular role of complex I in mitochondria, we predict that the phylogenetically distinct complex I enzymes found across bacterial species have evolved to enhance the functions of their respective electron transport chains. Cells use a proton motive force (PMF), NADH, and ATP to support numerous processes. In mitochondria, complex I uses NADH oxidation to generate a PMF, which can drive ATP synthesis. This study analyzed the function of complex I in bacteria, which contain more-diverse and more-flexible electron transport chains than mitochondria. We tested complex I function in Rhodobacter sphaeroides, a bacterium predicted to encode two phylogenetically distinct complex I isozymes. R. sphaeroides cells lacking both isozymes had growth defects during all tested modes of growth, illustrating the important function of this enzyme under diverse conditions. We conclude that the two isozymes are not functionally redundant and predict that phylogenetically distinct complex I enzymes have evolved to support the diverse lifestyles of bacteria.« less

Different Functions of Phylogenetically Distinct Bacterial Complex I Isozymes

DOE PAGES

Spero, Melanie A.; Brickner, Joshua R.; Mollet, Jordan T.; ...

2016-02-01

NADH:quinone oxidoreductase (complex I) is a bioenergetic enzyme that transfers electrons from NADH to quinone, conserving the energy of this reaction by contributing to the proton motive force. While the importance of NADH oxidation to mitochondrial aerobic respiration is well documented, the contribution of complex I to bacterial electron transport chains has been tested in only a few species. Here, we analyze the function of two phylogenetically distinct complex I isozymes in Rhodobacter sphaeroides, an alphaproteobacterium that contains well-characterized electron transport chains. We found that R. sphaeroides complex I activity is important for aerobic respiration and required for anaerobic dimethylmore » sulfoxide (DMSO) respiration (in the absence of light), photoautotrophic growth, and photoheterotrophic growth (in the absence of an external electron acceptor). Our data also provide insight into the functions of the phylogenetically distinct R. sphaeroides complex I enzymes (complex I A and complex I E) in maintaining a cellular redox state during photoheterotrophic growth. We propose that the function of each isozyme during photoheterotrophic growth is either NADH synthesis (complex I A) or NADH oxidation (complex I E). The canonical alphaproteobacterial complex I isozyme (complex I A) was also shown to be important for routing electrons to nitrogenase-mediated H 2 production, while the horizontally acquired enzyme (complex I E) was dispensable in this process. Unlike the singular role of complex I in mitochondria, we predict that the phylogenetically distinct complex I enzymes found across bacterial species have evolved to enhance the functions of their respective electron transport chains. Cells use a proton motive force (PMF), NADH, and ATP to support numerous processes. In mitochondria, complex I uses NADH oxidation to generate a PMF, which can drive ATP synthesis. This study analyzed the function of complex I in bacteria, which contain more-diverse and more-flexible electron transport chains than mitochondria. We tested complex I function in Rhodobacter sphaeroides, a bacterium predicted to encode two phylogenetically distinct complex I isozymes. R. sphaeroides cells lacking both isozymes had growth defects during all tested modes of growth, illustrating the important function of this enzyme under diverse conditions. We conclude that the two isozymes are not functionally redundant and predict that phylogenetically distinct complex I enzymes have evolved to support the diverse lifestyles of bacteria.« less

Ruthenium based metallopolymer grafted reduced graphene oxide as a new hybrid solar light harvester in polymer solar cells

PubMed Central

Vinoth, R.; Babu, S. Ganesh; Bharti, Vishal; Gupta, V.; Navaneethan, M.; Bhat, S. Venkataprasad; Muthamizhchelvan, C.; Ramamurthy, Praveen C.; Sharma, Chhavi; Aswal, Dinesh K.; Hayakawa, Yasuhiro; Neppolian, B.

2017-01-01

A new class of pyridyl benzimdazole based Ru complex decorated polyaniline assembly (PANI-Ru) was covalently grafted onto reduced graphene oxide sheets (rGO) via covalent functionalization approach. The covalent attachment of PANI-Ru with rGO was confirmed from XPS analysis and Raman spectroscopy. The chemical bonding between PANI-Ru and rGO induced the electron transfer from Ru complex to rGO via backbone of the conjugated PANI chain. The resultant hybrid metallopolymer assembly was successfully demonstrated as an electron donor in bulk heterojunction polymer solar cells (PSCs). A PSC device fabricated with rGO/PANI-Ru showed an utmost ~6 fold and 2 fold enhancement in open circuit potential (Voc) and short circuit current density (Jsc) with respect to the standard device made with PANI-Ru (i.e., without rGO) under the illumination of AM 1.5 G. The excellent electronic properties of rGO significantly improved the electron injection from PANI-Ru to PCBM and in turn the overall performance of the PSC device was enhanced. The ultrafast excited state charge separation and electron transfer role of rGO sheet in hybrid metallopolymer was confirmed from ultrafast spectroscopy measurements. This covalent modification of rGO with metallopolymer assembly may open a new strategy for the development of new hybrid nanomaterials for light harvesting applications. PMID:28225039

Excited states in polydiacetylene chains: A density matrix renormalization group study

NASA Astrophysics Data System (ADS)

Barcza, Gergely; Barford, William; Gebhard, Florian; Legeza, Örs

2013-06-01

We study theoretically polydiacetylene chains diluted in their monomer matrix. We employ the density matrix renormalization group method on finite chains to calculate the ground state and low-lying excitations of the corresponding Peierls-Hubbard-Ohno Hamiltonian which is characterized by the electron transfer amplitude t0 between nearest neighbors, by the electron-phonon coupling constant α, by the Hubbard interaction U, and by the long-range interaction V. We treat the lattice relaxation in the adiabatic limit, i.e., we calculate the polaronic lattice distortions for each excited state. Using chains with up to 102 lattice sites, we can safely perform the extrapolation to the thermodynamic limit for the ground-state energy and conformation, the single-particle gap, and the energies of the singlet exciton, the triplet ground state, and the optical excitation of the triplet ground state. The corresponding gaps are known with high precision from experiments. We determine a coherent parameter set (t0*=2.4eV,α*=3.4eV/Å,U*=6eV,V*=3eV) from a fit of the experimental gap energies to the theoretical values which we obtain for 81 parameter points in the four-dimensional search space (t0,α,U,V). We identify dark in-gap states in the singlet and triplet sectors as seen in experiments. Using a fairly stiff spring constant, the length of our unit cell is about 1% larger than its experimental value.

Spectral properties of chlorines and electron transfer with their participation in the photosynthetic reaction center of photosystem II

NASA Astrophysics Data System (ADS)

Shchupak, E. E.; Ivashin, N. V.

2014-02-01

Structural factors that provide localization of excited states and determine the properties of primary donor and acceptor of electron in the reaction center of photosystem II (PSII RC) are studied. The results of calculations using stationary and time-dependent density functional theory indicate an important role of protein environments of chlorophylls PA, PB, BA, and BB and pheophytins HA and HB in the area with a radius of no greater than ≤10 Å in the formation of excitonic states of PSII RC. When the neighboring elements are taken into account, the wavelength of long-wavelength Q y transition of chlorophyll molecules is varied by about 10 nm. The effect is less developed for pheophytin molecules (Δλ ≅ 2 nm). The following elements strongly affect energy of the transition: HisA198 and HisD197 amino-acid residues that serve as ligands of magnesium atoms affect PA and PB, respectively; MetA183 affects PA; MetA172 and MetD198 affect BA; water molecules that are located above the planes of the BA and BB macrocycles form H bonds with carbonyl groups; and phytol chains of PA and PB affect BA, BB, HA, and HB. The analysis of excitonic states, mutual positions of molecular orbitals of electron donors and acceptors, and matrix elements of electron transfer reaction shows that (i) charge separation between BA and HA and PB and BA is possible in the active A branch of cofactors of PSII RC and (ii) electron transfer is blocked at the BB - HB fragment in inactive B branch of PSII RC.

Charge transfer and charge localization in extended radical cations: Investigation of model molecules for peptides

NASA Astrophysics Data System (ADS)

Weinkauf, Rainer; Lehrer, Florian

1998-12-01

Molecules consisting of a flexible tail and an aromatic chromophore are used as model systems to understand the situation of a single chromophore in a small peptide. Their S0-S1 resonant multiphoton ionization (REMPI) spectra show, that in neutral molecules the tail-chromophore interaction is weak and electronic excitation is localized at the chromophore. For molecules, where the ionization energy of the tail is considerable higher than that of the chromophore, by high resolution REMPI photoelectron spectroscopy we find the charge to be localized on the aromatic chromophore. This scheme also in suitable peptides allows local ionization at the aromatic chromophore. An estimate for various charge positions in peptide chains, however, shows, that for most of the amino acids electron hole positions in the nitrogen and oxygen "lone pair" orbitals of the peptide bond are nearly degenerate. REMPI photoelectron spectra of phenylethylamine, which as a model system contains such two degenerate charge positions, show small energetic shift of the ionization energy but strong geometry changes upon electron removal. This result is interpreted as direct ionization into a mixed charge delocalized state. Consequences for the charge transfer mechanism in peptides are discussed.

Insights into the post-transcriptional regulation of the mitochondrial electron transport chain.

PubMed

Sirey, Tamara M; Ponting, Chris P

2016-10-15

The regulation of the mitochondrial electron transport chain is central to the control of cellular homeostasis. There are significant gaps in our understanding of how the expression of the mitochondrial and nuclear genome-encoded components of the electron transport chain are co-ordinated, and how the assembly of the protein complexes that constitute the electron transport chain are regulated. Furthermore, the role post-transcriptional gene regulation may play in modulating these processes needs to be clarified. This review summarizes the current knowledge regarding the post-transcriptional gene regulation of the electron transport chain and highlights how noncoding RNAs may contribute significantly both to complex electron transport chain regulatory networks and to mitochondrial dysfunction. © 2016 The Author(s).

Electron localization of anions probed by nitrile vibrations

DOE PAGES

Mani, Tomoyasu; Grills, David C.; Newton, Marshall D.; ...

2015-08-02

Localization and delocalization of electrons is a key concept in chemistry, and is one of the important factors determining the efficiency of electron transport through organic conjugated molecules, which have potential to act as “molecular wires”. This, in turn, substantially influences the efficiencies of organic solar cells and other molecular electronic devices. It is also necessary to understand the electronic energy landscape and the dynamics of electrons through molecular chain that govern their transport capabilities in one-dimensional conjugated chains so that we can better define the design principles of conjugated molecules for their applications. We show that nitrile ν(C≡N) vibrationsmore » respond to the degree of electron localization in nitrile-substituted organic anions by utilizing time-resolved infrared (TRIR) detection combined with pulse radiolysis. Measurements of a series of aryl nitrile anions allow us to construct a semi-empirical calibration curve between the changes in the ν(C≡N) IR shifts and the changes in the electronic charges from the neutral to the anion states in the nitriles; more electron localization in the nitrile anion results in larger IR shifts. Furthermore, the IR linewidth in anions can report a structural change accompanying changes in the electronic density distribution. Probing the shift of the nitrile ν(C≡N) IR vibrational bands enables us to determine how the electron is localized in anions of nitrile-functionalized oligofluorenes, considered as organic mixed-valence compounds. We estimate the diabatic electron transfer distance, electronic coupling strengths, and energy barriers in these organic mixed-valence compounds. The analysis reveals a dynamic picture, showing that the electron is moving back and forth within the oligomers with a small activation energy of ≤ k BT, likely controlled by the movement of dihedral angles between monomer units. Thus, implications for the electron transport capability in "molecular wires" are discussed.« less

Crystal structure of the Leishmania major peroxidase–cytochrome c complex

PubMed Central

Jasion, Victoria S.; Doukov, Tzanko; Pineda, Stephanie H.; Li, Huiying; Poulos, Thomas L.

2012-01-01

The causative agent of leishmaniasis is the protozoan parasite Leishmania major. Part of the host protective mechanism is the production of reactive oxygen species including hydrogen peroxide. In response, L. major produces a peroxidase, L. major peroxidase (LmP), that helps to protect the parasite from oxidative stress. LmP is a heme peroxidase that catalyzes the peroxidation of mitochondrial cytochrome c. We have determined the crystal structure of LmP in a complex with its substrate, L. major cytochrome c (LmCytc) to 1.84 Å, and compared the structure to its close homolog, the yeast cytochrome c peroxidase–cytochrome c complex. The binding interface between LmP and LmCytc has one strong and one weak ionic interaction that the yeast system lacks. The differences between the steady-state kinetics correlate well with the Lm redox pair being more dependent on ionic interactions, whereas the yeast redox pair depends more on nonpolar interactions. Mutagenesis studies confirm that the ion pairs at the intermolecular interface are important to both kcat and KM. Despite these differences, the electron transfer path, with respect to the distance between hemes, along the polypeptide chain is exactly the same in both redox systems. A potentially important difference, however, is the side chains involved. LmP has more polar groups (Asp and His) along the pathway compared with the nonpolar groups (Leu and Ala) in the yeast system, and as a result, the electrostatic environment along the presumed electron transfer path is substantially different. PMID:23100535

Xanthohumol induces generation of reactive oxygen species and triggers apoptosis through inhibition of mitochondrial electron transfer chain complex I.

PubMed

Zhang, Bo; Chu, Wei; Wei, Peng; Liu, Ying; Wei, Taotao

2015-12-01

Xanthohumol is a prenylflavonoid extracted from hops (Humulus lupulus). It possesses anti-cancer and anti-inflammatory activities in vitro and in vivo, and offers therapeutic benefits for treatment of metabolic syndromes. However, the precise mechanisms underlying its pharmacological effects remain to be elucidated, together with its cellular target. Here, we provide evidence that xanthohumol directly interacts with the mitochondrial electron transfer chain complex I (NADH dehydrogenase), inhibits the oxidative phosphorylation, triggers the production of reactive oxygen species, and induces apoptosis. In addition, we show that as a result of the inhibition of the mitochondrial oxidative phosphorylation, xanthohumol exposure causes a rapid decrease of mitochondrial transmembrane potential. Furthermore, we showed that xanthohumol up-regulates the glycolytic capacity in cells, and thus compensates cellular ATP generation. Dissection of the multiple steps of aerobic respiration by extracellular flux assays revealed that xanthohumol specifically inhibits the activity of mitochondrial complex I, but had little effect on that of complex II, III and IV. Inhibition of complex I by xanthohumol caused the overproduction of reactive oxygen species, which are responsible for the induction of apoptosis in cancer cells. We also found that isoxanthohumol, the structural isomer of xanthohumol, is inactive to cells, suggesting that the reactive 2-hydroxyl group of xanthohumol is crucial for its targeting to the mitochondrial complex I. Together, the remodeling of cell metabolism revealed here has therapeutic potential for the use of xanthohumol. Copyright © 2015 Elsevier Inc. All rights reserved.

Spontaneous Isomerization of Peptide Cation Radicals Following Electron Transfer Dissociation Revealed by UV-Vis Photodissociation Action Spectroscopy.

PubMed

Imaoka, Naruaki; Houferak, Camille; Murphy, Megan P; Nguyen, Huong T H; Dang, Andy; Tureček, František

2018-01-16

Peptide cation radicals of the z-type were produced by electron transfer dissociation (ETD) of peptide dications and studied by UV-Vis photodissociation (UVPD) action spectroscopy. Cation radicals containing the Asp (D), Asn (N), Glu (E), and Gln (Q) residues were found to spontaneously isomerize by hydrogen atom migrations upon ETD. Canonical N-terminal [z 4 + H] +● fragment ion-radicals of the R-C ● H-CONH- type, initially formed by N-C α bond cleavage, were found to be minor components of the stable ion fraction. Vibronically broadened UV-Vis absorption spectra were calculated by time-dependent density functional theory for several [ ● DAAR + H] + isomers and used to assign structures to the action spectra. The potential energy surface of [ ● DAAR + H] + isomers was mapped by ab initio and density functional theory calculations that revealed multiple isomerization pathways by hydrogen atom migrations. The transition-state energies for the isomerizations were found to be lower than the dissociation thresholds, accounting for the isomerization in non-dissociating ions. The facile isomerization in [ ● XAAR + H] + ions (X = D, N, E, and Q) was attributed to low-energy intermediates having the radical defect in the side chain that can promote hydrogen migration along backbone C α positions. A similar side-chain mediated mechanism is suggested for the facile intermolecular hydrogen migration between the c- and [z + H] ● -ETD fragments containing Asp, Asn, Glu, and Gln residues. Graphical Abstract ᅟ.

Spontaneous Isomerization of Peptide Cation Radicals Following Electron Transfer Dissociation Revealed by UV-Vis Photodissociation Action Spectroscopy

NASA Astrophysics Data System (ADS)

Imaoka, Naruaki; Houferak, Camille; Murphy, Megan P.; Nguyen, Huong T. H.; Dang, Andy; Tureček, František

2018-01-01

Peptide cation radicals of the z-type were produced by electron transfer dissociation (ETD) of peptide dications and studied by UV-Vis photodissociation (UVPD) action spectroscopy. Cation radicals containing the Asp (D), Asn (N), Glu (E), and Gln (Q) residues were found to spontaneously isomerize by hydrogen atom migrations upon ETD. Canonical N-terminal [z4 + H]+● fragment ion-radicals of the R-C●H-CONH- type, initially formed by N-Cα bond cleavage, were found to be minor components of the stable ion fraction. Vibronically broadened UV-Vis absorption spectra were calculated by time-dependent density functional theory for several [●DAAR + H]+ isomers and used to assign structures to the action spectra. The potential energy surface of [●DAAR + H]+ isomers was mapped by ab initio and density functional theory calculations that revealed multiple isomerization pathways by hydrogen atom migrations. The transition-state energies for the isomerizations were found to be lower than the dissociation thresholds, accounting for the isomerization in non-dissociating ions. The facile isomerization in [●XAAR + H]+ ions (X = D, N, E, and Q) was attributed to low-energy intermediates having the radical defect in the side chain that can promote hydrogen migration along backbone Cα positions. A similar side-chain mediated mechanism is suggested for the facile intermolecular hydrogen migration between the c- and [z + H]●-ETD fragments containing Asp, Asn, Glu, and Gln residues. [Figure not available: see fulltext.

Correlation between morphology, electron band structure, and resistivity of Pb atomic chains on the Si(5 5 3)-Au surface

NASA Astrophysics Data System (ADS)

Jałochowski, M.; Kwapiński, T.; Łukasik, P.; Nita, P.; Kopciuszyński, M.

2016-07-01

Structural and electron transport properties of multiple Pb atomic chains fabricated on the Si(5 5 3)-Au surface are investigated using scanning tunneling spectroscopy, reflection high electron energy diffraction, angular resolved photoemission electron spectroscopy and in situ electrical resistance. The study shows that Pb atomic chains growth modulates the electron band structure of pristine Si(5 5 3)-Au surface and hence changes its sheet resistivity. Strong correlation between chains morphology, electron band structure and electron transport properties is found. To explain experimental findings a theoretical tight-binding model of multiple atomic chains interacting on effective substrate is proposed.

Method-Unifying View of Loop-Formation Kinetics in Peptide and Protein Folding.

PubMed

Jacob, Maik H; D'Souza, Roy N; Schwarzlose, Thomas; Wang, Xiaojuan; Huang, Fang; Haas, Elisha; Nau, Werner M

2018-04-26

Protein folding can be described as a probabilistic succession of events in which the peptide chain forms loops closed by specific amino acid residue contacts, herein referred to as loop nodes. To measure loop rates, several photophysical methods have been introduced where a pair of optically active probes is incorporated at selected chain positions and the excited probe undergoes contact quenching (CQ) upon collision with the second probe. The quenching mechanisms involved triplet-triplet energy transfer, photoinduced electron transfer, and collision-induced fluorescence quenching, where the fluorescence of Dbo, an asparagine residue conjugated to 2,3-diazabicyclo[2.2.2]octane, is quenched by tryptophan. The discrepancy between the loop rates afforded from these three CQ techniques has, however, remained unresolved. In analyzing this discrepancy, we now report two short-distance FRET methods where Dbo acts as an energy acceptor in combination with tryptophan and naphtylalanine, two donors with largely different fluorescence lifetimes of 1.3 and 33 ns, respectively. Despite the different quenching mechanisms, the rates from FRET and CQ methods were, surprisingly, of comparable magnitude. This combination of FRET and CQ data led to a unifying physical model and to the conclusion that the rate of loop formation in folding reactions varies not only with the kind and number of residues that constitute the chain but also in particular with the size and properties of the residues that constitute the loop node.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhu, Jia, E-mail: jia-zhu@jxnu.edu.cn, E-mail: zhangyf@fzu.edu.cn; Zhang, Hui; Tong, Yawen

The structures and electronic properties of bimetallic oxide CrW{sub 2}O{sub 9} clusters supported on the perfect and defective MgO(001) surfaces with three different color centers, F{sub S}{sup 0}, F{sub S}{sup +}, and F{sub S}{sup 2+} centers, respectively, have been investigated by density functional theory calculations. Our results show that the configurations, adsorption energies, charge transfers, and bonding modes of dispersed CrW{sub 2}O{sub 9} clusters are sensitive to the charge states of the F{sub S} centers. Compared with the gas-phase configuration, the CrW{sub 2}O{sub 9} clusters supported on the defective surfaces are distorted dramatically, which exhibit different chain structures. On themore » perfect MgO surface, the depositions of clusters do not involve obvious charge transfer, while the situation is quite different on the defective MgO(001) surfaces in which significant electron transfer occurs from the surface to the cluster. Interestingly, this effect becomes more remarkable for electron-rich oxygen vacancies (F{sub S}{sup 0} center) than that for electron-poor oxygen vacancies (F{sub S}{sup +} and F{sub S}{sup 2+} centers). Furthermore, our work reveals a progressive Brønsted acid sites where spin density preferentially localized around the Cr atoms not the W atoms for all kinds of F{sub S}-centers, indicating the better catalytic activities can be expected for CrW{sub 2}O{sub 9} cluster on defective MgO(001) surfaces with respect to the W{sub 3}O{sub 9} cluster.« less

Introduction to the Thematic Minireview Series: Redox metabolism and signaling.

PubMed

Banerjee, Ruma

2017-10-13

Life on oxygen predisposes cells to reactive oxygen species (ROS) generation by electron slippage in the electron transfer chain. Aerobic metabolism also generates superoxide (O 2 ̇̄ ) and hydrogen peroxide (H 2 O 2 ) as bona fide products in reactions involving 1- or 2-electron reduction of O 2 Although often viewed as dangerous, ROS are now recognized as important messengers in redox signaling pathways. A delicate balance between needed versus excessive ROS production distinguishes health from an array of disease states. A collection of provocative reviews in this thematic series discusses the relative importance of mitochondrial sites for ROS production, ROS signaling-mediated regulation of cellular stress responses and thermogenesis, and how O 2 deficiency leads to metabolic reprograming in cancer. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Redox-coupled proton transfer mechanism in nitrite reductase revealed by femtosecond crystallography.

PubMed

Fukuda, Yohta; Tse, Ka Man; Nakane, Takanori; Nakatsu, Toru; Suzuki, Mamoru; Sugahara, Michihiro; Inoue, Shigeyuki; Masuda, Tetsuya; Yumoto, Fumiaki; Matsugaki, Naohiro; Nango, Eriko; Tono, Kensuke; Joti, Yasumasa; Kameshima, Takashi; Song, Changyong; Hatsui, Takaki; Yabashi, Makina; Nureki, Osamu; Murphy, Michael E P; Inoue, Tsuyoshi; Iwata, So; Mizohata, Eiichi

2016-03-15

Proton-coupled electron transfer (PCET), a ubiquitous phenomenon in biological systems, plays an essential role in copper nitrite reductase (CuNiR), the key metalloenzyme in microbial denitrification of the global nitrogen cycle. Analyses of the nitrite reduction mechanism in CuNiR with conventional synchrotron radiation crystallography (SRX) have been faced with difficulties, because X-ray photoreduction changes the native structures of metal centers and the enzyme-substrate complex. Using serial femtosecond crystallography (SFX), we determined the intact structures of CuNiR in the resting state and the nitrite complex (NC) state at 2.03- and 1.60-Å resolution, respectively. Furthermore, the SRX NC structure representing a transient state in the catalytic cycle was determined at 1.30-Å resolution. Comparison between SRX and SFX structures revealed that photoreduction changes the coordination manner of the substrate and that catalytically important His255 can switch hydrogen bond partners between the backbone carbonyl oxygen of nearby Glu279 and the side-chain hydroxyl group of Thr280. These findings, which SRX has failed to uncover, propose a redox-coupled proton switch for PCET. This concept can explain how proton transfer to the substrate is involved in intramolecular electron transfer and why substrate binding accelerates PCET. Our study demonstrates the potential of SFX as a powerful tool to study redox processes in metalloenzymes.

General synthesis and physicochemical characterisation of a series of peptide-mimic lysine-based amino-functionalised lipids.

PubMed

Wölk, Christian; Drescher, Simon; Meister, Annette; Blume, Alfred; Langner, Andreas; Dobner, Bodo

2013-09-16

A series of novel malonic acid diamides (second generation) with two long hydrophobic alkyl chains and an alkaline polar head group was synthesised and characterised as a new class of amino-functionalised lipids. These peptide-mimic lipids are suitable for polynucleotide transfer. The lipids bear a novel backbone consisting of a lysine unit and a malonic acid unit. Six different head-group structures, which vary in size and number of amino groups that can be protonated, were attached to the backbone structure. Furthermore, different alkyl chains were used to build the lipophilic part (namely tetradecyl, hexadecyl, and oleyl). Phase transitions of the new compounds in aqueous dispersions at pH 10 were analysed and discussed in terms of head group and alkyl chain variations. The shape and size of the formed aggregates of selected lipid dispersions were investigated by dynamic light scattering and transmission electron microscopy. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Microbial electron transport and energy conservation – the foundation for optimizing bioelectrochemical systems

PubMed Central

Kracke, Frauke; Vassilev, Igor; Krömer, Jens O.

2015-01-01

Microbial electrochemical techniques describe a variety of emerging technologies that use electrode–bacteria interactions for biotechnology applications including the production of electricity, waste and wastewater treatment, bioremediation and the production of valuable products. Central in each application is the ability of the microbial catalyst to interact with external electron acceptors and/or donors and its metabolic properties that enable the combination of electron transport and carbon metabolism. And here also lies the key challenge. A wide range of microbes has been discovered to be able to exchange electrons with solid surfaces or mediators but only a few have been studied in depth. Especially electron transfer mechanisms from cathodes towards the microbial organism are poorly understood but are essential for many applications such as microbial electrosynthesis. We analyze the different electron transport chains that nature offers for organisms such as metal respiring bacteria and acetogens, but also standard biotechnological organisms currently used in bio-production. Special focus lies on the essential connection of redox and energy metabolism, which is often ignored when studying bioelectrochemical systems. The possibility of extracellular electron exchange at different points in each organism is discussed regarding required redox potentials and effect on cellular redox and energy levels. Key compounds such as electron carriers (e.g., cytochromes, ferredoxin, quinones, flavins) are identified and analyzed regarding their possible role in electrode–microbe interactions. This work summarizes our current knowledge on electron transport processes and uses a theoretical approach to predict the impact of different modes of transfer on the energy metabolism. As such it adds an important piece of fundamental understanding of microbial electron transport possibilities to the research community and will help to optimize and advance bioelectrochemical techniques. PMID:26124754

Phospholipid bilayer relaxation dynamics as revealed by the pulsed electron-electron double resonance of spin labels

NASA Astrophysics Data System (ADS)

Syryamina, V. N.; Dzuba, S. A.

2012-10-01

Electron paramagnetic resonance (EPR) spectroscopy in the form of pulsed electron-electron double resonance (ELDOR) was applied to 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) phospholipid bilayers containing lipids that were spin-labeled at different carbon positions along the lipid acyl chain. Pulsed ELDOR detects motionally induced spin flips of nitrogen nuclei in the nitroxide spin labels, which manifests itself as magnetization transfer (MT) in the nitroxide EPR spectrum. The MT effect was observed over a wide temperature range (100-225 K) on a microsecond time scale. In line with a previous study on molecular glasses [N. P. Isaev and S. A. Dzuba, J. Chem. Phys. 135, 094508 (2011), 10.1063/1.3633241], the motions that induce MT effect were suggested to have the same nature as those in dielectric secondary (β) Johari-Goldstein fast relaxation. The results were compared with literature dielectric relaxation data for POPC bilayers, revealing some common features. Molecular motions resulting in MT are faster for deeper spin labels in the membrane interior. The addition of cholesterol to the bilayer suppresses the lipid motions near the steroid nucleus and accelerates the lipid motions beyond the steroid nucleus, in the bilayer interior. This finding was attributed to the lipid acyl chains being more ordered near the steroid nucleus and less ordered in the bilayer interior. The motions are absent in dry lipids, indicating that the motions are determined by intermolecular interactions in the bilayer.

Quasi one-dimensional band dispersion and surface metallization in long-range ordered polymeric wires

DOE PAGES

Vasseur, Guillaume; Fagot-Revurat, Yannick; Sicot, Muriel; ...

2016-01-04

We study the electronic structure of an ordered array of poly(para-phenylene) chains produced by surface-catalyzed dehalogenative polymerization of 1,4-dibromobenzene on copper (110). The quantization of unoccupied molecular states is measured as a function of oligomer length by scanning tunnelling spectroscopy, with Fermi level crossings observed for chains longer than ten phenyl rings. Angle-resolved photoelectron spectroscopy reveals a quasi-one-dimensional valence band as well as a direct gap of 1.15 eV, as the conduction band is partially filled through adsorption on the surface. Tight-binding modelling and ab initio density functional theory calculations lead to a full description of the organic band-structure, includingmore » the k-dispersion, the gap size and electron charge transfer mechanisms, highlighting a strong substrate-molecule interaction that drives the system into a metallic behaviour. In summary, we have fully characterized the band structure of a carbon-based conducting wire. This model system may be considered as a fingerprint of -conjugation of surface organic frameworks.« less

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

Reactive Oxygen Species Production by Forward and Reverse Electron Fluxes in the Mitochondrial Respiratory Chain

PubMed Central

Selivanov, Vitaly A.; Votyakova, Tatyana V.; Pivtoraiko, Violetta N.; Zeak, Jennifer; Sukhomlin, Tatiana; Trucco, Massimo; Roca, Josep; Cascante, Marta

2011-01-01

Reactive oxygen species (ROS) produced in the mitochondrial respiratory chain (RC) are primary signals that modulate cellular adaptation to environment, and are also destructive factors that damage cells under the conditions of hypoxia/reoxygenation relevant for various systemic diseases or transplantation. The important role of ROS in cell survival requires detailed investigation of mechanism and determinants of ROS production. To perform such an investigation we extended our rule-based model of complex III in order to account for electron transport in the whole RC coupled to proton translocation, transmembrane electrochemical potential generation, TCA cycle reactions, and substrate transport to mitochondria. It fits respiratory electron fluxes measured in rat brain mitochondria fueled by succinate or pyruvate and malate, and the dynamics of NAD+ reduction by reverse electron transport from succinate through complex I. The fitting of measured characteristics gave an insight into the mechanism of underlying processes governing the formation of free radicals that can transfer an unpaired electron to oxygen-producing superoxide and thus can initiate the generation of ROS. Our analysis revealed an association of ROS production with levels of specific radicals of individual electron transporters and their combinations in species of complexes I and III. It was found that the phenomenon of bistability, revealed previously as a property of complex III, remains valid for the whole RC. The conditions for switching to a state with a high content of free radicals in complex III were predicted based on theoretical analysis and were confirmed experimentally. These findings provide a new insight into the mechanisms of ROS production in RC. PMID:21483483

The End of the Line: Can Ferredoxin and Ferredoxin NADP(H) Oxidoreductase Determine the Fate of Photosynthetic Electrons?

PubMed Central

Goss, Tatjana; Hanke, Guy

2014-01-01

At the end of the linear photosynthetic electron transfer (PET) chain, the small soluble protein ferredoxin (Fd) transfers electrons to Fd:NADP(H) oxidoreductase (FNR), which can then reduce NADP+ to support C assimilation. In addition to this linear electron flow (LEF), Fd is also thought to mediate electron flow back to the membrane complexes by different cyclic electron flow (CEF) pathways: either antimycin A sensitive, NAD(P)H complex dependent, or through FNR located at the cytochrome b6f complex. Both Fd and FNR are present in higher plant genomes as multiple gene copies, and it is now known that specific Fd iso-proteins can promote CEF. In addition, FNR iso-proteins vary in their ability to dynamically interact with thylakoid membrane complexes, and it has been suggested that this may also play a role in CEF. We will highlight work on the different Fd-isoproteins and FNR-membrane association found in the bundle sheath (BSC) and mesophyll (MC) cell chloroplasts of the C4 plant maize. These two cell types perform predominantly CEF and LEF, and the properties and activities of Fd and FNR in the BSC and MC are therefore specialized for CEF and LEF respectively. A diversity of Fd isoproteins and dynamic FNR location has also been recorded in C3 plants, algae and cyanobacteria. This indicates that the principles learned from the extreme electron transport situations in the BSC and MC of maize might be usefully applied to understanding the dynamic transition between these states in other systems. PMID:24678667

Delta-proteobacterial SAR324 group in hydrothermal plumes on the South Mid-Atlantic Ridge.

PubMed

Cao, Huiluo; Dong, Chunming; Bougouffa, Salim; Li, Jiangtao; Zhang, Weipeng; Shao, Zongze; Bajic, Vladimir B; Qian, Pei-Yuan

2016-03-08

In the dark ocean, the SAR324 group of Delta-proteobacteria has been associated with a chemolithotrophic lifestyle. However, their electron transport chain for energy generation and information system has not yet been well characterized. In the present study, four SAR324 draft genomes were extracted from metagenomes sampled from hydrothermal plumes in the South Mid-Atlantic Ridge. We describe novel electron transport chain components in the SAR324 group, particularly the alternative complex III, which is involved in energy generation. Moreover, we propose that the C-type cytochrome, for example the C553, may play a novel role in electron transfer, adding to our knowledge regarding the energy generation process in the SAR324 cluster. The central carbon metabolism in the described SAR324 genomes exhibits several new features other than methanotrophy e.g. aromatic compound degradation. This suggests that methane oxidation may not be the main central carbon metabolism component in SAR324 cluster bacteria. The reductive acetyl-CoA pathway may potentially be essential in carbon fixation due to the absence of components from the Calvin-Benson cycle. Our study provides insight into the role of recombination events in shaping the genome of the SAR324 group based on a larger number of repeat regions observed, which has been overlooked thus far.

Delta-proteobacterial SAR324 group in hydrothermal plumes on the South Mid-Atlantic Ridge

PubMed Central

Cao, Huiluo; Dong, Chunming; Bougouffa, Salim; Li, Jiangtao; Zhang, Weipeng; Shao, Zongze; Bajic, Vladimir B.; Qian, Pei-Yuan

2016-01-01

In the dark ocean, the SAR324 group of Delta-proteobacteria has been associated with a chemolithotrophic lifestyle. However, their electron transport chain for energy generation and information system has not yet been well characterized. In the present study, four SAR324 draft genomes were extracted from metagenomes sampled from hydrothermal plumes in the South Mid-Atlantic Ridge. We describe novel electron transport chain components in the SAR324 group, particularly the alternative complex III, which is involved in energy generation. Moreover, we propose that the C-type cytochrome, for example the C553, may play a novel role in electron transfer, adding to our knowledge regarding the energy generation process in the SAR324 cluster. The central carbon metabolism in the described SAR324 genomes exhibits several new features other than methanotrophy e.g. aromatic compound degradation. This suggests that methane oxidation may not be the main central carbon metabolism component in SAR324 cluster bacteria. The reductive acetyl-CoA pathway may potentially be essential in carbon fixation due to the absence of components from the Calvin-Benson cycle. Our study provides insight into the role of recombination events in shaping the genome of the SAR324 group based on a larger number of repeat regions observed, which has been overlooked thus far. PMID:26953077

Electronic connection between the quinone and cytochrome C redox pools and its role in regulation of mitochondrial electron transport and redox signaling.

PubMed

Sarewicz, Marcin; Osyczka, Artur

2015-01-01

Mitochondrial respiration, an important bioenergetic process, relies on operation of four membranous enzymatic complexes linked functionally by mobile, freely diffusible elements: quinone molecules in the membrane and water-soluble cytochromes c in the intermembrane space. One of the mitochondrial complexes, complex III (cytochrome bc1 or ubiquinol:cytochrome c oxidoreductase), provides an electronic connection between these two diffusible redox pools linking in a fully reversible manner two-electron quinone oxidation/reduction with one-electron cytochrome c reduction/oxidation. Several features of this homodimeric enzyme implicate that in addition to its well-defined function of contributing to generation of proton-motive force, cytochrome bc1 may be a physiologically important point of regulation of electron flow acting as a sensor of the redox state of mitochondria that actively responds to changes in bioenergetic conditions. These features include the following: the opposing redox reactions at quinone catalytic sites located on the opposite sides of the membrane, the inter-monomer electronic connection that functionally links four quinone binding sites of a dimer into an H-shaped electron transfer system, as well as the potential to generate superoxide and release it to the intermembrane space where it can be engaged in redox signaling pathways. Here we highlight recent advances in understanding how cytochrome bc1 may accomplish this regulatory physiological function, what is known and remains unknown about catalytic and side reactions within the quinone binding sites and electron transfers through the cofactor chains connecting those sites with the substrate redox pools. We also discuss the developed molecular mechanisms in the context of physiology of mitochondria. Copyright © 2015 the American Physiological Society.

Electronic Connection Between the Quinone and Cytochrome c Redox Pools and Its Role in Regulation of Mitochondrial Electron Transport and Redox Signaling

PubMed Central

Sarewicz, Marcin; Osyczka, Artur

2015-01-01

Mitochondrial respiration, an important bioenergetic process, relies on operation of four membranous enzymatic complexes linked functionally by mobile, freely diffusible elements: quinone molecules in the membrane and water-soluble cytochromes c in the intermembrane space. One of the mitochondrial complexes, complex III (cytochrome bc1 or ubiquinol:cytochrome c oxidoreductase), provides an electronic connection between these two diffusible redox pools linking in a fully reversible manner two-electron quinone oxidation/reduction with one-electron cytochrome c reduction/oxidation. Several features of this homodimeric enzyme implicate that in addition to its well-defined function of contributing to generation of proton-motive force, cytochrome bc1 may be a physiologically important point of regulation of electron flow acting as a sensor of the redox state of mitochondria that actively responds to changes in bioenergetic conditions. These features include the following: the opposing redox reactions at quinone catalytic sites located on the opposite sides of the membrane, the inter-monomer electronic connection that functionally links four quinone binding sites of a dimer into an H-shaped electron transfer system, as well as the potential to generate superoxide and release it to the intermembrane space where it can be engaged in redox signaling pathways. Here we highlight recent advances in understanding how cytochrome bc1 may accomplish this regulatory physiological function, what is known and remains unknown about catalytic and side reactions within the quinone binding sites and electron transfers through the cofactor chains connecting those sites with the substrate redox pools. We also discuss the developed molecular mechanisms in the context of physiology of mitochondria. PMID:25540143

Effect of the different chain transfer agents on molecular weight and optical properties of poly(methyl methacrylate)

NASA Astrophysics Data System (ADS)

Çetinkaya, Onur; Demirci, Gökhan; Mergo, Paweł

2017-08-01

Investigation of molecular weight and optical properties of poly(methyl metacrylate) (PMMA) polymerized in house with different chain transfer agents was studied. Isopropyl alcohol (IPA), n-butyl mercaptan (nBMC) and pentamethyl disilane (PMDS) were used as chain transfer agents. The molecular weight (Mw) of PMMA samples were measured by Ostwald viscometer. Mw of bulk polymer samples were decreased with increase the concentration of chain transfer agents (CTA). Since reactivity of used CTAs is not same, molecular weights of samples which were produced with different type of CTA but same concentration of CTA was varied. Higher concentration of n-BMC showed higher scattering. Transmission of samples could not be correlated with different concentration of CTA. Refractive index of samples was not affected by concentration of CTA nevertheless higher molecular weight of CTA showed higher refractive index.

Mechanism-based inhibitors of MenE, an acyl-CoA synthetase involved in bacterial menaquinone biosynthesis†

PubMed Central

Lu, Xuequan; Zhang, Huaning; Tonge, Peter J.; Tan, Derek S.

2008-01-01

Menaquinone (vitamin K2) is an essential component of the electron transfer chain in many pathogens, including Mycobacterium tuberculosis and Staphylococcus aureus, and menaquinone biosynthesis is a potential target for antibiotic drug discovery. We report herein a series of mechanism-based inhibitors of MenE, an acyl-CoA synthetase that catalyzes adenylation and thioesterification of o-succinylbenzoic acid (OSB) during menaquinone biosynthesis. The most potent compound inhibits MenE with an IC50 value of 5.7 μM. PMID:18762421

Biochemistry of Ammonia Monoxygenase from Nitrosomonas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alan Hooper

2009-07-15

Major results. 1. CytochromecM552, a protein in the electron transfer chain to ammonia monooxygenase. Purification, modeling of protein structure based on primary structure, characterization of 4 hemes by magnetic spectroscopy, potentiometry, ligand binding and turnover. Kim, H. J., ,Zatsman, et al. 2008). 2. Characterization of proteins which thought to be involved in the AMO reaction or to protect AMO from toxic nitrogenous intermediates such as NO. Nitrosocyanin is a protein present only in bacteria which catalyze the ammonia monoxygenase reaction (1). Cytochrome c P460 beta and cytochrome c’ beta.

Molecular study of electron transfer flavoprotein alpha-subunit deficiency in two Japanese children with different phenotypes of glutaric acidemia type II.

PubMed

Purevjav, E; Kimura, M; Takusa, Y; Ohura, T; Tsuchiya, M; Hara, N; Fukao, T; Yamaguchi, S

2002-09-01

Electron transfer flavoprotein is a mitochondrial matrix protein composed of alpha- and beta-subunits (ETF alpha and ETF beta, respectively). This protein transfers electrons between several mitochondrial dehydrogenases and the main respiratory chain via ETF dehydrogenase (ETF-DH). Defects in ETF or ETF-DH cause glutaric acidemias type II (GAII). We investigated the molecular basis of ETF alpha deficiency in two Japanese children with different clinical phenotypes using expression study. Patient 1 had the severe form of GAII, a compound heterozygote of two mutations: 799G to A (alpha G267R) and nonsense 7C to T (alpha R3X). Patient 2 had the mild form and carried two heterozygous mutations: 764G to T (alpha G255V) and 478delG (frameshift). Both patients had one each of missense mutations in one allele; the others were either nonsense or truncated. Restriction enzyme digestion assay using genomic DNAs from 100 healthy Japanese revealed that these mutations were all novel. No signal for ETF alpha was detected by immunoblotting in cases of missense mutants, while wild-type cDNA resulted in expression of ETF alpha protein. Transfection with wild-type ETF alpha cDNA into cultured cells from both patients elevated incorporation of radioisotope-labelled fatty acids. These four mutations were pathogenic for GAII and missense mutations, alpha G255V and alpha G267R were considered anecdotal for mild and severe forms, respectively.

Fabrication of ZnS nanoparticle chains on a protein template

PubMed Central

Hulleman, J.; Kim, S. M.; Tumkur, T.; Rochet, J.-C.; Stach, E.; Stanciu, L.

2011-01-01

In the present study, we have exploited the properties of a fibrillar protein for the template synthesis of zinc sulfide (ZnS) nanoparticle chains. The diameter of the ZnS nanoparticle chains was tuned in range of ~30 to ~165 nm by varying the process variables. The nanoparticle chains were characterized by field emission scanning electron microscopy, UV–Visible spectroscopy, transmission electron microscopy, electron energy loss spectroscopy, and high-resolution transmission electron microscopy. The effect of incubation temperature on the morphology of the nanoparticle chains was also studied. PMID:21804765

Impact of nitrophenols on the photosynthetic electron transport chain and ATP content in Nostoc muscorum and Chlorella vulgaris.

PubMed

Umamaheswari, A; Venkateswarlu, K

2004-06-01

Concentration-dependent inhibition of the photosynthetic electron transport chain (photosystem I (PS I), photosystem II (PS II) and whole chain reaction) and ATP content was observed in Nostoc muscorum and Chlorella vulgaris grown with o-nitrophenol, m-nitrophenol, or 2,4-dinitrophenol. Although the extents of inhibition of the photosynthetic electron transport chain in both organisms were similar, PS II was more sensitive than PS I and whole chain reaction to the nitrophenols. Depletion of the ATP pool was noted in nitrophenol-grown cultures, probably as a consequence of nearly complete inhibition of the photosynthetic electron transport chain.

Effects of Alkylthio and Alkoxy Side Chains in Polymer Donor Materials for Organic Solar Cells.

PubMed

Cui, Chaohua; Wong, Wai-Yeung

2016-02-01

Side chains play a considerable role not only in improving the solubility of polymers for solution-processed device fabrication, but also in affecting the molecular packing, electron affinity and thus the device performance. In particular, electron-donating side chains show unique properties when employed to tune the electronic character of conjugated polymers in many cases. Therefore, rational electron-donating side chain engineering can improve the photovoltaic properties of the resulting polymer donors to some extent. Here, a survey of some representative examples which use electron-donating alkylthio and alkoxy side chains in conjugated organic polymers for polymer solar cell applications will be presented. It is envisioned that an analysis of the effect of such electron-donating side chains in polymer donors would contribute to a better understanding of this kind of side chain behavior in solution-processed conjugated organic polymers for polymer solar cells. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Unravelling electronic and structural requisites of triplet-triplet energy transfer by advanced electron paramagnetic resonance and density functional theory

NASA Astrophysics Data System (ADS)

Di Valentin, M.; Salvadori, E.; Barone, V.; Carbonera, D.

2013-10-01

Advanced electron paramagnetic resonance (EPR) techniques, in combination with Density Functional theory (DFT), have been applied to the comparative study of carotenoid triplet states in two major photosynthetic antenna complexes, the Peridinin-chlorophyll a-protein of dinoflagellates and the light-harvesting complex II of higher plants. Carotenoid triplet states are populated by triplet-triplet energy transfer (TTET) from chlorophyll molecules to photoprotect the system from singlet oxygen formation under light-stress conditions. The TTET process is strongly dependent on the relative arrangement and on the electronic properties of the triplet states involved. The proposed spectroscopic approach exploits the concept of spin conservation during TTET, which leads to recognisable spin polarisation effects in the time-resolved and field-swept echo-detected EPR spectra. The electron spin polarisation produced at the carotenoid acceptor site depends on the initial polarisation of the chlorophyll donor and on the relative geometrical arrangement of the donor-acceptor zero-field splitting axes. We have demonstrated that a proper analysis of the spectra in the framework of spin angular momentum conservation allows to derive the pathways of TTET and to gain insight into the structural requirements of this mechanism for those antenna complexes, whose X-ray structure is available. We have further proved that this method, developed for natural antenna complexes of known X-ray structure, can be extended to systems lacking structural information in order to derive the relative arrangement of the partners in the energy transfer process. The structural requirements for efficient TTET, obtained from time-resolved and pulse EPR, have been complemented by a detailed description of the electronic structure of the carotenoid triplet state, provided by pulse Electron-Nuclear DOuble Resonance (ENDOR) experiments. Triplet-state hyperfine couplings of the α- and β-protons of the carotenoid conjugated chain have been assigned with the aid of quantum chemical calculation. DFT predictions of the electronic structure of the carotenoid triplet state, in terms of spin density distribution, frontier orbital description and orbital excitation represent suitable building blocks toward a deeper understanding of electronic requirements for efficient TTET.

Structural symmetry breaking of silicon containing polymers and their relation with electrical conductivity and Raman active vibrations

NASA Astrophysics Data System (ADS)

Cabrera, Alejandro; González, Carmen; Tagle, Luis; Terraza, Claudio; Volkmann, Ulrich; Barriga, Andrés; Ramos, Esteban; Pavez, Maximiliano

2011-03-01

The incorporation of silicon into the polymeric main chain or side groups can provide an enhancement in chemical, physical and mechanical properties. We report an efficient method for the synthesis of polymers containing silicon in the main chain, from the polycondensation reactions of four optically active carboxylic diacid. The solubility of the polymers, the molecular weight, the glass transition and the thermal stability were studied by standard techniques. Raman spectroscopy was used to probe the conformation of stretching modes as function of the temperature. The conductivity measurements indicated that the alignment of the molecules is a crucial parameter for electrical performance. When the polymers were exposed to iodine, charge transfer increased their mobility and decreased their optical band gaps. These novel properties highlight the possibility to generate alternative active opto-electronics polymers.

The general mitochondrial processing peptidase from potato is an integral part of cytochrome c reductase of the respiratory chain.

PubMed Central

Braun, H P; Emmermann, M; Kruft, V; Schmitz, U K

1992-01-01

The major mitochondrial processing activity removing presequences from nuclear encoded precursor proteins is present in the soluble fraction of fungal and mammalian mitochondria. We found that in potato, this activity resides in the inner mitochondrial membrane. Surprisingly, the proteolytic activity co-purifies with cytochrome c reductase, a protein complex of the respiratory chain. The purified complex is bifunctional, as it has the ability to transfer electrons from ubiquinol to cytochrome c and to cleave off the presequences of mitochondrial precursor proteins. In contrast to the nine subunit fungal complex, cytochrome c reductase from potato comprises 10 polypeptides. Protein sequencing of peptides from individual subunits and analysis of corresponding cDNA clones reveals that subunit III of cytochrome c reductase (51 kDa) represents the general mitochondrial processing peptidase. Images PMID:1324169

Recycling Pricing and Coordination of WEEE Dual-Channel Closed-Loop Supply Chain Considering Consumers' Bargaining.

PubMed

Zhu, Xiaodong; Wang, Jing; Tang, Juan

2017-12-15

Environmentally friendly handling and efficient recycling of waste electrical on Waste Electrical and Electronic Equipment (WEEE) have grown to be a global social problem. As holders of WEEE, consumers have a significant effect on the recycling process. A consideration of and attention to the influence of consumer behavior in the recycling process can help achieve more effective recycling of WEEE. In this paper, we built a dual-channel closed-loop supply chain model composed of manufacturers, retailers, and network recycling platforms. Based on the influence of customer bargaining behavior, we studied several different scenarios of centralized decision-making, decentralized decision-making, and contract coordination, using the Stackelberg game theory. The results show that retailers and network recycling platforms will reduce the direct recovery prices to maintain their own profit when considering the impact of consumer bargaining behavior, while remanufacturers will improve the transfer payment price for surrendering part of the profit under revenue and the expense sharing contract. Using this contract, we can achieve supply chain coordination and eliminate the effect of consumer bargaining behavior on supply chain performance. It can be viewed from the parameter sensitivity analysis that when we select the appropriate sharing coefficient, the closed-loop supply chain can achieve the same system performance under a centralized decision.

Recycling Pricing and Coordination of WEEE Dual-Channel Closed-Loop Supply Chain Considering Consumers’ Bargaining

PubMed Central

Zhu, Xiaodong; Wang, Jing; Tang, Juan

2017-01-01

Environmentally friendly handling and efficient recycling of waste electrical on Waste Electrical and Electronic Equipment (WEEE) have grown to be a global social problem. As holders of WEEE, consumers have a significant effect on the recycling process. A consideration of and attention to the influence of consumer behavior in the recycling process can help achieve more effective recycling of WEEE. In this paper, we built a dual-channel closed-loop supply chain model composed of manufacturers, retailers, and network recycling platforms. Based on the influence of customer bargaining behavior, we studied several different scenarios of centralized decision-making, decentralized decision-making, and contract coordination, using the Stackelberg game theory. The results show that retailers and network recycling platforms will reduce the direct recovery prices to maintain their own profit when considering the impact of consumer bargaining behavior, while remanufacturers will improve the transfer payment price for surrendering part of the profit under revenue and the expense sharing contract. Using this contract, we can achieve supply chain coordination and eliminate the effect of consumer bargaining behavior on supply chain performance. It can be viewed from the parameter sensitivity analysis that when we select the appropriate sharing coefficient, the closed-loop supply chain can achieve the same system performance under a centralized decision. PMID:29244778

Synthesis and self-assembly of four-armed star copolymer based on poly(ethylene brassylate) hydrophobic block as potential drug carries

NASA Astrophysics Data System (ADS)

Chen, Jiucun; Li, Junzhi; Liu, Jianhua; Weng, Bo; Xu, Liqun

2016-05-01

A novel well-defined four-armed star poly(ethylene brassylate)- b-poly(poly(ethylene glycol)methyl ether methacrylate) (s-PEB- b-P(PEGMA)) was synthesized and self-assembled via the combination of ring-opening polymerization and reversible addition-fragmentation chain transfer polymerization (RAFT) in this work. It proceeded firstly with the synthesis of hydrophobic four-armed star homopolymer of ethylene brassylate (EB) via ROP with organic catalyst, followed by the esterification reaction of s-PEB with chain transfer agent. Afterward, RAFT polymerization of PEGMA monomer was initialed using PEB-based macro-RAFT agent, resulting in the target amphiphilic four-armed star copolymer. The obtained s-PEB- b-P(PEGMA) can assemble into micelles with PEB segments as core and P(PEGMA) segments as shell in aqueous solution. The self-assembly behavior was studied by dynamic light scattering and transmission electron microscope. The micelles of s-PEB- b-P(PEGMA) exhibited higher loading capacity of the anticancer drug doxorubicin (DOX). The investigation of DOX release from the micelles demonstrated that the release rate of the hydrophobic drug could be effectively controlled.

Application of an Addition-Fragmentation-Chain Transfer Monomer in Di(meth)acrylate Network Formation to Reduce Polymerization Shrinkage Stress.

PubMed

Shah, Parag K; Stansbury, Jeffrey W; Bowman, Christopher N

2017-08-14

A new addition-fragmentation chain transfer (AFT) capable moiety was incorporated into a dimethacrylate monomer that participated readily in network formation by copolymerizing with multifunctional methacrylates or acrylates. The process of AFT occurred simultaneously with photopolymerization of the AFT monomer (AFM) and other (meth)acrylate monomers leading to polymer stress relaxation via network reconfiguration. At low loading levels of the AFM, a significant reduction in shrinkage stress, especially for acrylate monomers, was observed with nominal effects on conversion. At higher loading levels of the AFM, the photopolymerization reaction kinetics and final double bond conversion were significantly lowered along with a delay in the gel-point conversion. Electron paramagnetic resonance studies during polymerization revealed the presence of a distinct radical species that was present in proportional quantities to the AFM content in the system. The lifetime and the character of the persistent radicals were altered due to the presence of the distinctive radical, in turn affecting the polymerization kinetics. With polymerization conducted at higher irradiance, the differential conversion between the control resin and samples with moderate AFM content was minimal, especially for the methacrylate-based formulations.

Sulfate-mediated electrooxidation of X-ray contrast media on boron-doped diamond anode.

PubMed

Radjenovic, Jelena; Petrovic, Mira

2016-05-01

Recently, electrochemical activation of sulfate ions to sulfate radical species and nonradically activated persulfate has been demonstrated at boron-doped diamond (BDD) anode, which enhanced the electrooxidation kinetics of several persistent contaminants. In this study, we investigated the transformation pathways of two X-ray contrast media (ICM), diatrizoate and iopromide, in electrooxidation at BDD anode using sulfate and inert nitrate anolyte. Sulfate anolyte yielded a seven-fold increase in apparent rate constants for ICM oxidation compared to inert nitrate anolyte, and a two-fold increase for the removal of organic carbon. Higher iodine release was observed in electrooxidation of diatrizoate compared to iopromide. In the case of diatrizoate, around 80% of deiodination efficiency was achieved in both anolytes. Deiodination efficiency of iopromide was somewhat lower in nitrate anolyte (≤75%) and significantly reduced in sulfate anolyte (≤46%) due to a larger steric hindrance of alkyl side chains. Moreover, a considerable lag phase of iopromide deiodination was observed in sulfate anolyte, indicating that initial oxidation reactions took place almost exclusively at the alkyl side chains. Several transformation products (TPs) of ICM were identified in electrooxidation in sulfate anolyte, and only three TPs in the case of nitrate anolyte. The main mechanistic steps in the oxidation of iopromide were H-abstraction and bond cleavage in the alkyl side chains. Diatrizoate was mainly transformed through oxidative cleavage of iodine substituent and inter-molecular cyclization. Two hydroxylamine derivatives of iopromide and a nitro-derivative of diatrizoate were observed in sulfate anolyte. These products have not been reported previously for hydroxyl radical-mediated oxidation of ICM. Given that electron-transfer mechanism is more typical for sulfate than for hydroxyl radicals, formation of hydroxylamine and nitro-derivatives of ICM was assigned to one-electron charge transfer to sulfate radical species and formation of N-centered radicals. Copyright © 2016 Elsevier Ltd. All rights reserved.

Reversible Addition Fragmentation Chain Transfer (RAFT) Polymerization of 4-Vinylbenzaldehyde

PubMed Central

Sun, Guorong; Cheng, Chong; Wooley, Karen L.

2008-01-01

The direct reversible addition fragmentation chain transfer (RAFT) polymerization of 4-vinylbenzaldehyde (VBA) was established as a new synthetic method for the preparation of well-defined poly(vinylbenzaldehyde) (PVBA), a polymer having reactive aldehyde side chain substiuents. RAFT polymerization of VBA was investigated using S-1-dodecyl-S’-(α,α’-dimethyl-α”-acetic acid)trithiocarbonate (DDMAT) as chain transfer agent (CTA) and 2,2′-azobis(isobutyronitrile) (AIBN) as initiator in 1,4-dioxane or 2-butanone at 70-75 °C for 7.5-22.5 h. With 45-76% of monomer conversion, the resulting PVBA had well controlled number-average molecular weight (Mn) and low polydispersity (PDI < 1.17). The living characteristic of the RAFT polymerization process was confirmed by the linearity between the Mn values of PVBA and monomer conversions. Well-defined PVBA was further used as a macromolecular chain transfer agent (macro-CTA) in RAFT polymerization of styrene (St), and a block copolymer PVBA-b-PSt with relatively low polydispersity (PDI = 1.20) was successfully synthesized. PMID:19066633

Chlorinated paraffins wrapping of carbon nanotubes: A theoretical investigation

NASA Astrophysics Data System (ADS)

Ding, Qiuyue; Ding, Ning; Chen, Xiangfeng; Wu, Chi-Man Lawrence

2018-04-01

How nanomaterials interact with pollutants is the central for understanding their environmental behavior and practical application. In this work, molecular dynamics (MD) and density functional theoretical (DFT) methods were used to investigated the influence of carbon chain length, degree of chlorination, chain configuration, and chirality of chlorinated paraffin (CP) and diameter of single-walled carbon nanotubes (SWNTs) on the interaction between CPs and SWNTs. The simulation results demonstrated that CP chain length and chlorination degree played considerably important roles in determining interaction strength between SWNTs and CPs. The interaction energies increased with increasing chain length and chlorination degree. The chirality of SWNT exerted negligible influence on the interaction energy between SWNTs and CPs. On the contrary, interaction energy increased with increasing radius of SWNTs due to the surface curvatures. This result was rationalized by considering the decrease in SWNT curvature with increasing radius, which resulted in plane-like CNT wall. The negligible influence of CP chain configurations was attributed to relative flexibility of CP carbon chains, which can wrap on tubes through conformational changes with low-energy barriers. MD results indicated that CPs could adsorb on SWNT surface rapidly in aqueous environment. Charge transfer and electronic density results indicated that the interaction between CPs and SWNTs was physisorption in nature. This work provides fundamental information regarding SWNTs as sorbents for CPs extraction and adsorptive removal from environmental water system.

The green hemoproteins of bovine erythrocytes. II. Spectral, ligand-binding, and electrochemical properties.

PubMed

DeFilippi, L J; Hultquist, D E

1978-05-10

The two green hemoproteins isolated from bovine erythrocytes (form I and form II) have been characterized as to spectral, electrochemical, and chemical properties. The absorption spectra of the isolated hemoproteins are typical of high spin ferric states. Reduction of the hemoproteins yields high spin ferrohemoproteins. Complexation of the ferrohemoproteins with CO and the ferrihemoproteins with cyanide yields low spin complexes, demonstrating the presence of an exchangeable weak field ligand in both the ferrous and ferric states of the hemoproteins. The differences in position and intensity of the absorption peaks of the visible spectra allow the two forms to be distinguished from one another. The midpoint potential of forms I and II were found to be +0.075 and +0.019 V, respectively, at pH 6.4 and +0.038 and -0.005 V, respectively, at pH 7.0. This is consistent with the gaining of 1 proton/electron during the reduction. The Nernst plot reveals an unusual 0.5-electron transfer, whereas a quantitative titration demonstrates a 1-electron transfer. Form I binds cyanide more tightly than form II (KD of 84 and 252 micrometer, respectively). The observed spectral, electrochemical, and ligand-binding differences between forms I and II can be explained in terms of a greater electron-withdrawing ability of the side chains of the heme of form I relative to the heme of form II.

Structural basis for energy transduction by respiratory alternative complex III.

PubMed

Sousa, Joana S; Calisto, Filipa; Langer, Julian D; Mills, Deryck J; Refojo, Patrícia N; Teixeira, Miguel; Kühlbrandt, Werner; Vonck, Janet; Pereira, Manuela M

2018-04-30

Electron transfer in respiratory chains generates the electrochemical potential that serves as energy source for the cell. Prokaryotes can use a wide range of electron donors and acceptors and may have alternative complexes performing the same catalytic reactions as the mitochondrial complexes. This is the case for the alternative complex III (ACIII), a quinol:cytochrome c/HiPIP oxidoreductase. In order to understand the catalytic mechanism of this respiratory enzyme, we determined the structure of ACIII from Rhodothermus marinus at 3.9 Å resolution by single-particle cryo-electron microscopy. ACIII presents a so-far unique structure, for which we establish the arrangement of the cofactors (four iron-sulfur clusters and six c-type hemes) and propose the location of the quinol-binding site and the presence of two putative proton pathways in the membrane. Altogether, this structure provides insights into a mechanism for energy transduction and introduces ACIII as a redox-driven proton pump.

Evidence of photo- and thermal-induced reversible intermolecular hydrogen-atom transfer in. gamma. -irradiated thiourea clathrates as studied by electron spin resonance

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ichikawa, T.

1979-05-17

There has been a report (M. Iwasaki and Toriyama) on an electron spin resonance study of reversible intramolecular radical conversion due to photo- and thermal-induced H-atom transfer. Schlenk, Brown, White, Chatini, and Nakatani reported H-atom abstraction of a photostimulated allylic radical from its neighbor molecules and thermal recovery of the allylic radical from photoirradiation in a thiourea clathrate. Radiolysis of a thiourea clathrate containing a mixture of 10 mol% 2,3-dimethylbutadiene and 90 mol% 2,3-dimethylbutane gave a resolved room-temperature spectrum. The result seemed to suggest that the monomer radical was stabilized in the canal even at room temperature in the presencemore » of the inert DBA molecules which might block chain propagation. Results suggested that the photostimulated R/sub 1/, radicals abstract H atoms from DBA molecules to form tetramethylethylene molecules and R/sub 2/ radicals and that the R/sub 2/ radicals produced by photoirradiation abstract H atoms from TME molecules to regenerate R/sub 1/ radicals and DBA molecules. 2 figures. (DP)« less

X-ray structural studies of the fungal laccase from Cerrena maxima.

PubMed

Lyashenko, Andrey V; Bento, Isabel; Zaitsev, Viatcheslav N; Zhukhlistova, Nadezhda E; Zhukova, Yuliya N; Gabdoulkhakov, Azat G; Morgunova, Ekaterina Y; Voelter, Wolfgang; Kachalova, Galina S; Stepanova, Elena V; Koroleva, Ol'ga V; Lamzin, Victor S; Tishkov, Vladimir I; Betzel, Christian; Lindley, Peter F; Mikhailov, Al'bert M

2006-11-01

Laccases are members of the blue multi-copper oxidase family. These enzymes oxidize substrate molecules by accepting electrons at a mononuclear copper centre and transferring them to a trinuclear centre. Dioxygen binds to the trinuclear centre and following the transfer of four electrons is reduced to two molecules of water. The X-ray structure of a laccase from Cerrena maxima has been elucidated at 1.9 A resolution using synchrotron data and the molecular replacement technique. The final refinement coefficients are Rcryst = 16.8% and Rfree = 23.0%, with root mean square deviations on bond lengths and bond angles of 0.015 A and 1.51 degrees , respectively. The type 1 copper centre has an isoleucine residue at the axial position and the "resting" state of the trinuclear centre comprises a single oxygen (OH) moiety asymmetrically disposed between the two type 3 copper ions and a water molecule attached to the type 2 ion. Several carbohydrate binding sites have been identified and the glycan chains appear to promote the formation of well-ordered crystals. Two tyrosine residues near the protein surface have been found in a nitrated state.

Theoretical insights into the photo-protective mechanisms of natural biological sunscreens: building blocks of eumelanin and pheomelanin.

PubMed

Marchetti, Barbara; Karsili, Tolga N V

2016-02-07

Eumelanin (EM) and pheomelanin (PM) are ubiquitous in mammalian skin and hair--protecting against harmful radiation from the sun. Their primary roles are to absorb solar radiation and efficiently dissipate the excess excited state energy in the form of heat without detriment to the polymeric structure. EU and PM exist as polymeric chains consisting of exotic arrangements of functionalised heteroaromatic molecules. Here we have used state-of-the-art electronic structure calculations and on-the-fly surface hopping molecular dynamics simulations to study the intrinsic deactivation paths of various building blocks of EU and PM. Ultrafast excited state decay, via electron-driven proton transfer (in EU and PM) and proton-transfer coupled ring-opening (in PM) reactions, have been identified to proceed along hitherto unknown charge-separated states in EU and PM oligomers. These results shed light on the possible relaxation pathways that dominate the photochemistry of natural skin melanins. Extrapolation of such findings could provide a gateway into engineering more effective molecular constituents in commercial sunscreens--with reduced phototoxicity.

FOB-SH: Fragment orbital-based surface hopping for charge carrier transport in organic and biological molecules and materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spencer, J.; Gajdos, F.; Blumberger, J., E-mail: j.blumberger@ucl.ac.uk

2016-08-14

We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on themore » adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.« less

Dipole-Guided Electron Capture Causes Abnormal Dissociations of Phosphorylated Pentapeptides

NASA Astrophysics Data System (ADS)

Moss, Christopher L.; Chung, Thomas W.; Wyer, Jean A.; Nielsen, Steen Brøndsted; Hvelplund, Preben; Tureček, František

2011-04-01

Electron transfer and capture mass spectra of a series of doubly charged ions that were phosphorylated pentapeptides of a tryptic type (pS,A,A,A,R) showed conspicuous differences in dissociations of charge-reduced ions. Electron transfer from both gaseous cesium atoms at 100 keV kinetic energies and fluoranthene anion radicals in an ion trap resulted in the loss of a hydrogen atom, ammonia, and backbone cleavages forming complete series of sequence z ions. Elimination of phosphoric acid was negligible. In contrast, capture of low-energy electrons by doubly charged ions in a Penning ion trap induced loss of a hydrogen atom followed by elimination of phosphoric acid as the dominant dissociation channel. Backbone dissociations of charge-reduced ions also occurred but were accompanied by extensive fragmentation of the primary products. z-Ions that were terminated with a deaminated phosphoserine radical competitively eliminated phosphoric acid and H2PO4 radicals. A mechanism is proposed for this novel dissociation on the basis of a computational analysis of reaction pathways and transition states. Electronic structure theory calculations in combination with extensive molecular dynamics mapping of the potential energy surface provided structures for the precursor phosphopeptide dications. Electron attachment produces a multitude of low lying electronic states in charge-reduced ions that determine their reactivity in backbone dissociations and H- atom loss. The predominant loss of H atoms in ECD is explained by a distortion of the Rydberg orbital space by the strong dipolar field of the peptide dication framework. The dipolar field steers the incoming electron to preferentially attach to the positively charged arginine side chain to form guanidinium radicals and trigger their dissociations.

FOB-SH: Fragment orbital-based surface hopping for charge carrier transport in organic and biological molecules and materials

NASA Astrophysics Data System (ADS)

Spencer, J.; Gajdos, F.; Blumberger, J.

2016-08-01

We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on the adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.

Retraction Note: Catalytic living ring-opening metathesis polymerization

NASA Astrophysics Data System (ADS)

Nagarkar, Amit A.; Kilbinger, Andreas F. M.

2018-05-01

We the authors are retracting this Article because of our failure to reproduce the molecular weight dispersities (PDI) shown in Fig. 4 using the chain-transfer agent described in the paper (CTA1). While the degenerate chain-transfer mechanism described in Fig. 3 is correct, the best molecular weight dispersities that could be reproduced with the chain-transfer agent shown in the Article are much larger (PDI > 2.0) than reported.We have since studied the kinetics of CTA1 in comparison with several other chain-transfer agents we are currently investigating and we now understand that the reactivity of CTA1 towards propagating ruthenium alkylidene complexes is very low. Very long monomer addition times would therefore have been necessary to gain control over the molecular weight distribution. Such long addition times would exceed the lifetime of the Grubbs catalyst in solution. Faster addition of the monomer has since repeatedly been shown to broaden the molecular weight dispersity.Additionally, the best chain-transfer agents we are currently investigating are orders of magnitude more reactive than CTA1 but give broader molecular weight dispersities than reported in Fig. 4. Molecular weight and dispersity control as shown in Fig. 4 is therefore an inappropriate claim for CTA1.The authors deeply regret these errors and apologize to the community.

First principles calculation of the structural, electronic, and magnetic properties of Au-Pd atomic chains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dave, Mudra R., E-mail: mdave-phy@yahoo.co.in; Sharma, A. C.

2015-06-24

The structural, electronic and magnetic properties of free standing Au-Pd bimetallic atomic chain is studied using ab-initio method. It is found that electronic and magnetic properties of chains depend on position of atoms and number of atoms. Spin polarization factor for different atomic configuration of atomic chain is calculated predicting a half metallic behavior. It suggests a total spin polarised transport in these chains.

The controlled relay of multiple protons required at the active site of nitrogenase.

PubMed

Dance, Ian

2012-07-07

The enzyme nitrogenase, when reducing natural and unnatural substrates, requires large numbers of protons per chemical catalytic cycle. The active face of the catalytic site (the FeMo-cofactor, FeMo-co) is situated in a protein domain which is largely hydrophobic and anhydrous, and incapable of serial provision of multiple protons. Through detailed analysis of the high quality protein crystal structures available the characteristics of a chain of water molecules leading from the protein surface to a key sulfur atom (S3B) of FeMo-co are described. The first half of the water chain from the surface inwards is branched, slightly variable, and able to accommodate exogenous small molecules: this is dubbed the proton bay. The second half, from the proton bay to S3B, is comprised of a single chain of eight hydrogen bonded water molecules. This section is strictly conserved, and is intimately involved in hydrogen bonds with homocitrate, an essential component that chelates Mo. This is the proton wire, and a detailed Grotthuss mechanism for serial translocation of protons through this proton wire to S3B is proposed. This controlled serial proton relay from the protein surface to S3B is an essential component of the intramolecular hydrogenation paradigm for the complete chemical mechanisms of nitrogenase. Each proton reaching S3B, instigated by electron transfer to FeMo-co, becomes a hydrogen atom that migrates to other components of the active face of FeMo-co and to bound substrates and intermediates, allowing subsequent multiple proton transfers along the proton wire. Experiments to test the proposed mechanism of proton supply are suggested. The water chain in nitrogenase is comparable with the purported proton pumping pathway of cytochrome c oxidase.

Electron Bifurcation: Thermodynamics and Kinetics of Two-Electron Brokering in Biological Redox Chemistry.

PubMed

Zhang, Peng; Yuly, Jonathon L; Lubner, Carolyn E; Mulder, David W; King, Paul W; Peters, John W; Beratan, David N

2017-09-19

How can proteins drive two electrons from a redox active donor onto two acceptors at very different potentials and distances? And how can this transaction be conducted without dissipating very much energy or violating the laws of thermodynamics? Nature appears to have addressed these challenges by coupling thermodynamically uphill and downhill electron transfer reactions, using two-electron donor cofactors that have very different potentials for the removal of the first and second electron. Although electron bifurcation is carried out with near perfection from the standpoint of energy conservation and electron delivery yields, it is a biological energy transduction paradigm that has only come into focus recently. This Account provides an exegesis of the biophysical principles that underpin electron bifurcation. Remarkably, bifurcating electron transfer (ET) proteins typically send one electron uphill and one electron downhill by similar energies, such that the overall reaction is spontaneous, but not profligate. Electron bifurcation in the NADH-dependent reduced ferredoxin: NADP + oxidoreductase I (Nfn) is explored in detail here. Recent experimental progress in understanding the structure and function of Nfn allows us to dissect its workings in the framework of modern ET theory. The first electron that leaves the two-electron donor flavin (L-FAD) executes a positive free energy "uphill" reaction, and the departure of this electron switches on a second thermodynamically spontaneous ET reaction from the flavin along a second pathway that moves electrons in the opposite direction and at a very different potential. The singly reduced ET products formed from the bifurcating flavin are more than two nanometers distant from each other. In Nfn, the second electron to leave the flavin is much more reducing than the first: the potentials are said to be "crossed." The eventually reduced cofactors, NADH and ferredoxin in the case of Nfn, perform crucial downstream redox processes of their own. We dissect the thermodynamics and kinetics of electron bifurcation in Nfn and find that the key features of electron bifurcation are (1) spatially separated transfer pathways that diverge from a two-electron donor, (2) one thermodynamically uphill and one downhill redox pathway, with a large negative shift in the donor's reduction potential after departure of the first electron, and (3) electron tunneling and activation factors that enable bifurcation, producing a 1:1 partitioning of electrons onto the two pathways. Electron bifurcation is found in the CO 2 reducing pathways of methanogenic archaea, in the hydrogen pathways of hydrogenases, in the nitrogen fixing pathway of Fix, and in the mitochondrial charge transfer chain of complex III, cytochrome bc 1 . While crossed potentials may offer the biological advantage of producing tightly regulated high energy reactive species, neither kinetic nor thermodynamic considerations mandate crossed potentials to generate successful electron bifurcation. Taken together, the theoretical framework established here, focusing on the underpinning electron tunneling barriers and activation free energies, explains the logic of electron bifurcation that enables energy conversion and conservation in Nfn, points toward bioinspired schemes to execute multielectron redox chemistry, and establishes a roadmap for examining novel electron bifurcation networks in nature.

Differential affinity of BsSCO for Cu(II) and Cu(I) suggests a redox role in copper transfer to the Cu(A) center of cytochrome c oxidase.

PubMed

Hill, Bruce C; Andrews, Diann

2012-06-01

SCO (synthesis of cytochrome c oxidase) proteins are involved in the assembly of the respiratory chain enzyme cytochrome c oxidase acting to assist in the assembly of the Cu(A) center contained within subunit II of the oxidase complex. The Cu(A) center receives electrons from the reductive substrate ferrocytochrome c, and passes them on to the cytochrome a center. Cytochrome a feeds electrons to the oxygen reaction site composed of cytochrome a(3) and Cu(B). Cu(A) consists of two copper ions positioned within bonding distance and ligated by two histidine side chains, one methionine, a backbone carbonyl and two bridging cysteine residues. The complex structure and redox capacity of Cu(A) present a potential assembly challenge. SCO proteins are members of the thioredoxin family which led to the early suggestion of a disulfide exchange function for SCO in Cu(A) assembly, whereas the copper binding capacity of the Bacillus subtilis version of SCO (i.e., BsSCO) suggests a direct role for SCO proteins in copper transfer. We have characterized redox and copper exchange properties of apo- and metalated-BsSCO. The release of copper (II) from its complex with BsSCO is best achieved by reducing it to Cu(I). We propose a mechanism involving both disulfide and copper exchange between BsSCO and the apo-Cu(A) site. This article is part of a Special Issue entitled: Biogenesis/Assembly of Respiratory Enzyme Complexes. Copyright © 2011 Elsevier B.V. All rights reserved.

Structural and Functional Characterization of a Short-Chain Flavodoxin Associated with a Noncanonical 1,2-Propanediol Utilization Bacterial Microcompartment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Plegaria, Jefferson S.; Sutter, Markus; Ferlez, Bryan

Bacterial microcompartments (BMCs) are proteinaceous organelles that encapsulate enzymes involved in CO2 fixation (carboxysomes). or carbon catabolism (metabolosomes). Metabolosomes share a common core of enzymes and a distinct signature enzyme for substrate degradation that defines the function of the BMC (e,g., propanediol or ethanolamine utilization BMCs, or glycyl-radical enzyme microcompartments). Loci encoding metabolosomes also typically contain genes for proteins that support organelle function, such as regulation, transport of substrate, and cofactor (e.g., vitamin B-12) synthesis and recycling. Flavoproteins are frequently among these ancillary gene products, suggesting that these redox active proteins play an undetermined function in many metabolosomes. Here, wemore » report the first characterization of a BMC-associated flavodoxin (Fld1C), a small flavoprotein, derived from the noncanonical 1,2-propanediol utilization BMC locus (PDU1C) of Lactobacillus reuteri. The 2.0 angstrom X-ray structure of Fld1C displays the alpha/beta flavodoxin fold, which noncovalently binds a single flavin mononucleotide molecule. Fld1C is a short-chain flavodoxin with redox potentials of -240 +/- 3 mV oxidized/semiquinone and -344 +/- 1 mV semiquinone/hydroquinone versus the standard hydrogen electrode at pH 7.5. It can participate in an electron transfer reaction with a photoreductant to form a stable semiquinone species. Collectively, our structural and functional results suggest that PDU1C BMCs encapsulate Fld1C to store and transfer electrons for the reactivation and/or recycling of the B-12 cofactor utilized by the signature enzyme.« less

Biosynthesis and bioproduction of coenzyme Q10 by yeasts and other organisms.

PubMed

Kawamukai, Makoto

2009-06-22

CoQ (coenzyme Q), an isoprenylated benzoquinone, is a well-known component of the electron-transfer system in eukaryotes. The main role of CoQ is to transfer electrons from NADH dehydrogenase and succinate dehydrogenase to CoQ:cytochrome c reductase in the respiratory chain. However, recent evidence indicates that an involvement in respiration is not the only role of CoQ. The second apparent role of CoQ is its anti-oxidation property, and other novel roles for CoQ, such as in disulfide-bond formation, sulfide oxidation and pyrimidine metabolism, have been reported. CoQ10, having ten isoprene units in the isoprenoid side chain, has been used as a medicine and is now commercially popular as a food supplement. Two yeast species, namely the budding yeast Saccharomyces cerevisiae, which produces CoQ6, and the fission yeast Schizosaccharomyces pombe, which produces CoQ10, are the main subjects of the present minireview because they have greatly contributed to our basic knowledge of CoQ biosynthesis among eukaryotes. The biosynthetic pathway that converts p-hydroxybenzoate into CoQ consists of eight steps in yeasts. The five enzymes involved in the biosynthetic pathway have been identified in both yeasts, yet the functions of three proteins were still not known. Analyses of the biosynthetic pathway in yeasts also contribute to the understanding of human genetic diseases related to CoQ deficiency. In the present minireview I focus on the biochemical and commercial aspects of CoQ in yeasts and in other organisms for comparison.

A systematic computational study of electronic effects on hydrogen sensitivity of olefin polymerization catalysts (abstract only).

PubMed

Coussens, Betty B; Budzelaar, Peter H M; Friederichs, Nic

2008-02-13

One of the important product parameters of polyolefins is their molecular weight (distribution). A common way to control this parameter is to add molecular hydrogen during the polymerization, which then acts as a chain transfer agent. The factors governing the hydrogen sensitivity of olefin polymerization catalysts are poorly understood and have attracted little attention from computational chemists. To explore the electronic factors determining hydrogen sensitivity we performed density functional calculations on a wide range of simple model systems including some metallocenes and a few basic models of heterogeneous catalysts. As a quantitative measure for hydrogen sensitivity we used the ratio of (i) the rate constant for chain transfer to hydrogen to (ii) the rate constant for ethene insertion, k(h)/k(p) (see the scheme below), and as a measure of electrophilicity we used the energy of complexation to the probe molecule ammonia. [Formula: see text] For isolated species in the gas phase, complexation energies appear to dominate the chemistry. Ethene complexes more strongly than hydrogen and with increasing electrophilicity of the metal centre this difference grows; the hydrogen sensitivity decreases accordingly. Although many factors (like catalyst dormancy and deactivation issues) complicate the comparison with experiment, this result seems to agree both in broad terms with the experimental lower hydrogen sensitivity of heterogeneous catalysts, and more specifically with the increased hydrogen sensitivity of highly alkylated or fused metallocenes. The opposite conclusion reached by Blom (see Blom et al 2002 Macromol. Chem. Phys. 203 381-7) is due to the use of a very different measure of electrophilicity, rather than to different experimental data.

Multiple Acyl-CoA Dehydrogenation Deficiency (Glutaric Aciduria Type II) with a Novel Mutation of Electron Transfer Flavoprotein-Dehydrogenase in a Cat.

PubMed

Wakitani, Shoichi; Torisu, Shidow; Yoshino, Taiki; Hattanda, Kazuhisa; Yamato, Osamu; Tasaki, Ryuji; Fujita, Haruo; Nishino, Koichiro

2014-01-01

Multiple acyl-CoA dehydrogenation deficiency (MADD; also known as glutaric aciduria type II) is a human autosomal recessive disease classified as one of the mitochondrial fatty-acid oxidation disorders. MADD is caused by a defect in the electron transfer flavoprotein (ETF) or ETF dehydrogenase (ETFDH) molecule, but as yet, inherited MADD has not been reported in animals. Here we present the first report of MADD in a cat. The affected animal presented with symptoms characteristic of MADD including hypoglycemia, hyperammonemia, vomiting, diagnostic organic aciduria, and accumulation of medium- and long-chain fatty acids in plasma. Treatment with riboflavin and L-carnitine ameliorated the symptoms. To detect the gene mutation responsible for MADD in this case, we determined the complete cDNA sequences of feline ETFα, ETFβ, and ETFDH. Finally, we identified the feline patient-specific mutation, c.692T>G (p.F231C) in ETFDH. The affected animal only carries mutant alleles of ETFDH. p.F231 in feline ETFDH is completely conserved in eukaryotes, and is located on the apical surface of ETFDH, receiving electrons from ETF. This study thus identified the mutation strongly suspected to have been the cause of MADD in this cat.

Ground and Excited-Electronic-State Dissociations of Hydrogen-Rich and Hydrogen-Deficient Tyrosine Peptide Cation Radicals

NASA Astrophysics Data System (ADS)

Viglino, Emilie; Lai, Cheuk Kuen; Mu, Xiaoyan; Chu, Ivan K.; Tureček, František

2016-09-01

We report a comprehensive study of collision-induced dissociation (CID) and near-UV photodissociation (UVPD) of a series of tyrosine-containing peptide cation radicals of the hydrogen-rich and hydrogen-deficient types. Stable, long-lived, hydrogen-rich peptide cation radicals, such as [AAAYR + 2H]+● and several of its sequence and homology variants, were generated by electron transfer dissociation (ETD) of peptide-crown-ether complexes, and their CID-MS3 dissociations were found to be dramatically different from those upon ETD of the respective peptide dications. All of the hydrogen-rich peptide cation radicals contained major (77%-94%) fractions of species having radical chromophores created by ETD that underwent photodissociation at 355 nm. Analysis of the CID and UVPD spectra pointed to arginine guanidinium radicals as the major components of the hydrogen-rich peptide cation radical population. Hydrogen-deficient peptide cation radicals were generated by intramolecular electron transfer in CuII(2,2 ':6 ',2 ″-terpyridine) complexes and shown to contain chromophores absorbing at 355 nm and undergoing photodissociation. The CID and UVPD spectra showed major differences in fragmentation for [AAAYR]+● that diminished as the Tyr residue was moved along the peptide chain. UVPD was found to be superior to CID in localizing Cα-radical positions in peptide cation radical intermediates.

Morphology-induced defects enhance lipid transfer rates

DOE PAGES

Xia, Yan; Charubin, Kamil; Marquardt, Drew; ...

2016-08-25

Molecular transfer between nanoparticles has been considered to have important implications regarding nanoparticle stability. Recently, the interparticle spontaneous lipid transfer rate constant for discoidal bicelles was found to be very different from spherical, unilamellar vesicles (ULVs). Here, we investigate the mechanism responsible for this discrepancy. Analysis of the data indicates that lipid transfer is entropically favorable, but enthalpically unfavorable with an activation energy that is independent of bicelle size and long- to short-chain lipid molar ratio. Moreover, molecular dynamics simulations reveal a lower lipid dissociation energy cost in the vicinity of interfaces (“defects”) induced by the segregation of the long-more » and short-chain lipids in bicelles; these defects are not present in ULVs. Taken together, these results suggest that the enhanced lipid transfer observed in bicelles arises from interfacial defects as a result of the hydrophobic mismatch between the long- and short-chain lipid species. In conclusion, the observed lipid transfer rate is found to be independent of nanoparticle stability.« less

Para-Krawtchouk polynomials on a bi-lattice and a quantum spin chain with perfect state transfer

NASA Astrophysics Data System (ADS)

Vinet, Luc; Zhedanov, Alexei

2012-07-01

Analogues of Krawtchouk polynomials defined on a bi-lattice are introduced. They are shown to provide a (novel) spin chain with perfect transfer. Their characterization, as well as their connection to the quadratic Hahn algebra, is given.

Characterization and prediction of monomer-based dose rate effects in electron-beam polymerization

NASA Astrophysics Data System (ADS)

Schissel, Sage M.; Lapin, Stephen C.; Jessop, Julie L. P.

2017-12-01

Properties of some materials produced by electron-beam (EB) induced polymerization appear dependent upon the rate at which the initiating dose was delivered. However, the magnitude of these dose rate effects (DREs) can vary greatly with different monomer formulations, suggesting DREs are dependent on chemical structure. The relationship among dose, dose rate, conversion, and the glass transition temperature (Tg) of the cured material was explored for an acrylate monomer series. A strong correlation was determined between the DRE magnitude and monomer size, and this correlation may be attributed to chain transfer. Using the Tg shift caused by changes in dose, a preliminary predictive relationship was developed to estimate the magnitude of the Tg DRE, enabling scale-up of process variables for polymers prone to dose rate effects.

Light-Directed Tuning of Plasmon Resonances via Plasmon-Induced Polymerization Using Hot Electrons

PubMed Central

2017-01-01

The precise morphology of nanoscale gaps between noble-metal nanostructures controls their resonant wavelengths. Here we show photocatalytic plasmon-induced polymerization can locally enlarge the gap size and tune the plasmon resonances. We demonstrate light-directed programmable tuning of plasmons can be self-limiting. Selective control of polymer growth around individual plasmonic nanoparticles is achieved, with simultaneous real-time monitoring of the polymerization process in situ using dark-field spectroscopy. Even without initiators present, we show light-triggered chain growth of various monomers, implying plasmon initiation of free radicals via hot-electron transfer to monomers at the Au surface. This concept not only provides a programmable way to fine-tune plasmons for many applications but also provides a window on polymer chemistry at the sub-nanoscale. PMID:28670601

Interplay of localized pyrene chromophores and π-conjugation in novel poly(2,7-pyrene) ladder polymers

NASA Astrophysics Data System (ADS)

Rudnick, Alexander; Kass, Kim-Julia; Preis, Eduard; Scherf, Ullrich; Bässler, Heinz; Köhler, Anna

2017-05-01

We present a detailed spectroscopic study, along with the synthesis, of conjugated, ladder-type 2,7-linked poly(pyrene)s. We observe a delocalization of the first singlet excited state along the polymer backbone, i.e., across the 2,7 linkage in the pyrene moiety, in contrast to earlier studies on conjugated 2,7-linked poly(pyrene)s without ladder structure. The electronic signature of the pyrene unit is, however, manifested in an increased lifetime and reduced oscillator strength as well as a modified vibronic progression in absorption of the singlet state compared to a ladder-type poly(para-phenylene) (MeLPPP). Furthermore, the reduced oscillator strength and increased lifetime slow down Förster-type energy transfer in films, where this transfer occurs to sites with increasing inter-chain coupling of H-type nature.

Modulating Charge Transfer Through Cyclic D,L α-Peptide Self-Assembly

PubMed Central

Horne, W. Seth; Ashkenasy, Nurit; Ghadiri, M. Reza

2007-01-01

We describe a concise solid support-based synthetic method for the preparation of cyclic D,L α-peptides bearing 1,4,5,8-naphthalenetetracarboxylic diimide (NDI) side chains. Studies of the structural and photoluminescence properties of these molecules in solution show that the hydrogen bond directed self-assembly of the cyclic D,L α-peptide backbone promotes intermolecular NDI excimer formation. The efficiency of NDI charge transfer in the resulting supramolecular assemblies is shown to depend on the length of the linker between the NDI and the peptide backbone, the distal NDI substituent, and the number of NDIs incorporated in a given structure. The design rationale and synthetic strategies described here should provide a basic blueprint for a series of self-assembling cyclic D,L α-peptide nanotubes with interesting optical and electronic properties. PMID:15624124

Electron capture and transport mediated by lattice solitons

NASA Astrophysics Data System (ADS)

Hennig, D.; Chetverikov, A.; Velarde, M. G.; Ebeling, W.

2007-10-01

We study electron transport in a one-dimensional molecular lattice chain. The molecules are linked by Morse interaction potentials. The electronic degree of freedom, expressed in terms of a tight binding system, is coupled to the longitudinal displacements of the molecules from their equilibrium positions along the axis of the lattice. More specifically, the distance between two sites influences in an exponential fashion the corresponding electronic transfer matrix element. We demonstrate that when an electron is injected in the undistorted lattice it causes a local deformation such that a compression results leading to a lowering of the electron’s energy below the lower edge of the band of linear states. This corresponds to self-localization of the electron due to a polaronlike effect. Then, if a traveling soliton lattice deformation is launched a distance apart from the electron’s position, upon encountering the polaronlike state it captures the latter dragging it afterwards along its path. Strikingly, even when the electron is initially uniformly distributed over the lattice sites a traveling soliton lattice deformation gathers the electronic amplitudes during its traversing of the lattice. Eventually, the electron state is strongly localized and moves coherently in unison with the soliton lattice deformation. This shows that for the achievement of coherent electron transport we need not start with the polaronic effect.

Comparative Genomics of Syntrophic Branched-Chain Fatty Acid Degrading Bacteria

PubMed Central

Narihiro, Takashi; Nobu, Masaru K.; Tamaki, Hideyuki; Kamagata, Yoichi; Sekiguchi, Yuji; Liu, Wen-Tso

2016-01-01

The syntrophic degradation of branched-chain fatty acids (BCFAs) such as 2-methylbutyrate and isobutyrate is an essential step in the production of methane from proteins/amino acids in anaerobic ecosystems. While a few syntrophic BCFA-degrading bacteria have been isolated, their metabolic pathways in BCFA and short-chain fatty acid (SCFA) degradation as well as energy conservation systems remain unclear. In an attempt to identify these pathways, we herein performed comparative genomics of three syntrophic bacteria: 2-methylbutyrate-degrading “Syntrophomonas wolfei subsp. methylbutyratica” strain JCM 14075T (=4J5T), isobutyrate-degrading Syntrophothermus lipocalidus strain TGB-C1T, and non-BCFA-metabolizing S. wolfei subsp. wolfei strain GöttingenT. We demonstrated that 4J5 and TGB-C1 both encode multiple genes/gene clusters involved in β-oxidation, as observed in the Göttingen genome, which has multiple copies of genes associated with butyrate degradation. The 4J5 genome possesses phylogenetically distinct β-oxidation genes, which may be involved in 2-methylbutyrate degradation. In addition, these Syntrophomonadaceae strains harbor various hydrogen/formate generation systems (i.e., electron-bifurcating hydrogenase, formate dehydrogenase, and membrane-bound hydrogenase) and energy-conserving electron transport systems, including electron transfer flavoprotein (ETF)-linked acyl-CoA dehydrogenase, ETF-linked iron-sulfur binding reductase, ETF dehydrogenase (FixABCX), and flavin oxidoreductase-heterodisulfide reductase (Flox-Hdr). Unexpectedly, the TGB-C1 genome encodes a nitrogenase complex, which may function as an alternative H2 generation mechanism. These results suggest that the BCFA-degrading syntrophic strains 4J5 and TGB-C1 possess specific β-oxidation-related enzymes for BCFA oxidation as well as appropriate energy conservation systems to perform thermodynamically unfavorable syntrophic metabolism. PMID:27431485

Photocatalysts Based on Cobalt-Chelating Conjugated Polymers for Hydrogen Evolution from Water

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Lianwei; Hadt, Ryan G.; Yao, Shiyu

Developing photocatalytic systems for water splitting to generate oxygen and hydrogen is one of the biggest chemical challenges in solar energy utilization. In this work, we report the first example of heterogeneous photocatalysts for hydrogen evolution based on in-chain cobalt-chelating conjugated polymers. Four conjugated polymers chelated with earth abundant cobalt ions were synthesized and found to evolve hydrogen photocatalytically from water. These polymers are designed to combine functions of the conjugated backbone as light-harvesting antenna and electron transfer conduit with the in-chain bipyridyl chelated transition metal centers as catalytic active sites. In addition, these polymers are soluble in organic solvents,more » enabling effective interactions with the substrates as well as detailed characterization. We also found a polymer-dependent optimal cobalt chelating concentration at which the highest photocatalytic hydrogen production (PHP) activity can be achieved.« less

Conformational Flexibility of Metazoan Fatty Acid Synthase Enables Catalysis

PubMed Central

Brignole, Edward J.; Smith, Stuart; Asturias, Francisco J.

2008-01-01

The metazoan cytosolic fatty acid synthase (FAS) contains all of the enzymes required for de novo fatty acid biosynthesis covalently linked around two reaction chambers. While the 3D architecture of FAS has been mostly defined, it is unclear how reaction intermediates can transfer between distant catalytic domains. Using single-particle electron microscopy we have identified a near continuum of conformations consistent with remarkable flexibility of FAS. The distribution of conformations was influenced by the presence of substrates and altered by different catalytic mutations suggesting a direct correlation between conformation and specific enzymatic activities. 3D reconstructions were interpreted by docking high-resolution structures of individual domains and illustrate that the substrate loading and condensation domains dramatically swing and swivel to access substrates within either reaction chamber. Concomitant rearrangement of the β-carbon processing domains synchronizes acyl-chain reduction in one chamber with acyl-chain elongation in the other. PMID:19151726

Synthesis and Self-Assembly of Block Copolymers Containing Temperature Sensitive and Degradable Chain Segments.

PubMed

Gong, Hong-Liang; Lei, Lei; Shi, Shu-Xian; Xia, Yu-Zheng; Chen, Xiao-Nong

2018-05-01

In this work, polylactide-b-poly(N-isopropylacrylamide) were synthesized by the combination of controlled ring-opening polymerization and reversible addition fragmentation chain transfer polymerization. These block copolymers with molecular weight range from 7,900 to 12,000 g/mol and narrow polydispersity (≤1.19) can self-assemble into micelles (polylactide core, poly(N-isopropylacrylamide) shell) in water at certain temperature range, which have been evidenced by laser particle size analyzer proton nuclear magnetic resonance and transmission electron microscopy. Such micelles exhibit obvious thermo-responsive properties: (1) Poly(N-isopropylacrylamide) blocks collapse on the polylactide core as system temperature increase, leading to reduce of micelle size. (2) Micelles with short poly(N-isopropylacrylamide) blocks tend to aggregate together when temperature increased, which is resulted from the reduction of the system hydrophilicity and the decreased repulsive force between micelles.

Negative Ion Chemistry in the Coma of Comet 1P/Halley

NASA Technical Reports Server (NTRS)

Cordiner, M. A.; Charnley, S. B.

2012-01-01

Negative ions (anions) were identified in the coma of comet 1P/Halley from in-situ measurements performed by the Giotto spacecraft in 1986. These anions were detected with masses in the range 7-110 amu, but with insufficient mass resolution to permit unambiguous identification. We present details of a new chemical-hydrodynamic model for the coma of comet Halley that includes - for the first time - atomic and molecular anions, in addition to a comprehensive hydrocarbon chemistry. Anion number densities arc calculated as a function of radius in the coma, and compared with the Giotto results. Important anion production mechanisms arc found to include radiative electron attachment, polar photodissociation, dissociative electron attachment, and proton transfer. The polyyne anions C4H(-) and C6H(-) arc found to be likely candidates to explain the Giotto anion mass spectrum in the range 49-73 amu. Thc CN(-) anion probably makes a significant contribution to the mass spectrum at 26 amu. Larger carbon-chain anions such as C8H(1) can explain the peak near 100 amu provided there is a source of large carbon-chain-bearing molecules from the cometary nucleus.

Historical time-recessive recombinant nucleotidal gene transfer

NASA Astrophysics Data System (ADS)

Norton, Michael A.

2013-10-01

Whether conscious of it or not, physicist Tim Berners-Lee basically applied principle of a nuclear chain reaction to electron transport, a remarkable outcome being the world wide web. On a less dense exponential than the nucleus, but still by out of control design (1999), the flow of electrons with high symmetry (hypertext) brought about astonishing new insights to the field. No one in the author's sphere of influence, including the author, ever learned or taught that such chain reactions have a time-recessive trajectory, such that key significant moments in the new science had impact not only the world at present, but on scale overlapping with ancestors. Dr. Chuck Darwin learned man indeed did arise in Africa (brown toastmasters); author suggests his creed ``survival of the fittest'' in post-20th century hindsight, for man initialized nuclear energy in Eurasia (white toastmasters), and nearly brought the world to collapse by dropping nuclear weapons on humans in Asia (yellow toastmasters), be best updated ``survival of the most communicative.'' If true, this informs that the measure of the appended science's power is as equally as important as the measure of its speed, ergo, there really is no energy crisis.

Mutual Information and Information Gating in Synfire Chains

DOE PAGES

Xiao, Zhuocheng; Wang, Binxu; Sornborger, Andrew Tyler; ...

2018-02-01

Here, coherent neuronal activity is believed to underlie the transfer and processing of information in the brain. Coherent activity in the form of synchronous firing and oscillations has been measured in many brain regions and has been correlated with enhanced feature processing and other sensory and cognitive functions. In the theoretical context, synfire chains and the transfer of transient activity packets in feedforward networks have been appealed to in order to describe coherent spiking and information transfer. Recently, it has been demonstrated that the classical synfire chain architecture, with the addition of suitably timed gating currents, can support the gradedmore » transfer of mean firing rates in feedforward networks (called synfire-gated synfire chains—SGSCs). Here we study information propagation in SGSCs by examining mutual information as a function of layer number in a feedforward network. We explore the effects of gating and noise on information transfer in synfire chains and demonstrate that asymptotically, two main regions exist in parameter space where information may be propagated and its propagation is controlled by pulse-gating: a large region where binary codes may be propagated, and a smaller region near a cusp in parameter space that supports graded propagation across many layers.« less

Mutual Information and Information Gating in Synfire Chains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiao, Zhuocheng; Wang, Binxu; Sornborger, Andrew Tyler

Here, coherent neuronal activity is believed to underlie the transfer and processing of information in the brain. Coherent activity in the form of synchronous firing and oscillations has been measured in many brain regions and has been correlated with enhanced feature processing and other sensory and cognitive functions. In the theoretical context, synfire chains and the transfer of transient activity packets in feedforward networks have been appealed to in order to describe coherent spiking and information transfer. Recently, it has been demonstrated that the classical synfire chain architecture, with the addition of suitably timed gating currents, can support the gradedmore » transfer of mean firing rates in feedforward networks (called synfire-gated synfire chains—SGSCs). Here we study information propagation in SGSCs by examining mutual information as a function of layer number in a feedforward network. We explore the effects of gating and noise on information transfer in synfire chains and demonstrate that asymptotically, two main regions exist in parameter space where information may be propagated and its propagation is controlled by pulse-gating: a large region where binary codes may be propagated, and a smaller region near a cusp in parameter space that supports graded propagation across many layers.« less

Local Intermolecular Order Controls Photoinduced Charge Separation at Donor/Acceptor Interfaces in Organic Semiconductors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feier, Hilary M.; Reid, Obadiah G.; Pace, Natalie A.

2016-03-23

How free charge is generated at organic donor-acceptor interfaces is an important question, as the binding energy of the lowest energy (localized) charge transfer states should be too high for the electron and hole to escape each other. Recently, it has been proposed that delocalization of the electronic states participating in charge transfer is crucial, and aggregated or otherwise locally ordered structures of the donor or the acceptor are the precondition for this electronic characteristic. The effect of intermolecular aggregation of both the polymer donor and fullerene acceptor on charge separation is studied. In the first case, the dilute electronmore » acceptor triethylsilylhydroxy-1,4,8,11,15,18,22,25-octabutoxyphthalocyaninatosilicon(IV) (SiPc) is used to eliminate the influence of acceptor aggregation, and control polymer order through side-chain regioregularity, comparing charge generation in 96% regioregular (RR-) poly(3-hexylthiophene) (P3HT) with its regiorandom (RRa-) counterpart. In the second case, ordered phases in the polymer are eliminated by using RRa-P3HT, and phenyl-C61-butyric acid methyl ester (PC61BM) is used as the acceptor, varying its concentration to control aggregation. Time-resolved microwave conductivity, time-resolved photoluminescence, and transient absorption spectroscopy measurements show that while ultrafast charge transfer occurs in all samples, long-lived charge carriers are only produced in films with intermolecular aggregates of either RR-P3HT or PC61BM, and that polymer aggregates are just as effective in this regard as those of fullerenes.« less

Fast dynamic electron transfer along infinite anion-cation chains in technetium and rhenium acido clusters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Antipov, B.G.; Kryuchkov, S.V.; Grigor`ev, M.S.

1995-09-01

New technetium and rhenium compounds with ferricenium cations - [Fe(C{sub 5}H{sub 5}){sub 2}]{sub 3}[Tc{sub 6}I{sub 14}], [Fe(C{sub 5}H{sub 5}){sub 2}]{sub 3}[Tc{sub 6}Cl{sub 14}], [Fe(C{sub 5}H{sub 5}){sub 2}]{sub 2}[Tc{sub 8}Br{sub 14}], and [Fe(C{sub 5}H{sub 5}){sub 2}]{sub 2}[Re{sub 2}Br{sub 8}] - are synthesized and identified. The compounds are characterized by the methods of static magnetic susceptibility and differential scanning calorimetry; solid-state conductivity measurements; and IR, EPR, {sup 57}Fe Moessbauer, and X-ray photoelectron spectroscopic data. These data are compared with the physicochemical characteristics of ferricenium pertechnetate and hexachlorotechnetate, as well as of a number of reference technetium and rhenium compounds containing the samemore » anions but different cations. The structure of [Fe(C{sub 5}H{sub 5}){sub 2}]{sub 3}[Tc{sub 6}I{sub 14}] is determined by X-ray diffraction analysis of a single crystal [space group P6/m, a = 15.34(2), c = 12.70(1) {angstrom}]. The structures of the remaining compounds were confirmed by comparing their spectroscopic properties with corresponding properties of compounds with known composition and structure. None of the compounds with ferricenium cations exhibit covalent or other localized bonds between anions and cations. However, the physicochemical properties of these compounds indicate the occurrence of a fast dynamic electron transfer along infinite anion-cation chains. Compounds [Fe(C{sub 5}H{sub 5}){sub 2}]{sub 3}[Tc{sub 6}Cl{sub 14}] and [Fe(C{sub 5}H{sub 5}){sub 2}]{sub 2}[Tc{sub 8}Br{sub 14}] were found to exhibit a new phenomenon of X-ray-induced low-temper ature high-energy electron emission.« less

Is DNA a metal, semiconductor or insulator? A theoretical approach

NASA Astrophysics Data System (ADS)

Rey-Gonzalez, Rafael; Fonseca-Romero, Karen; Plazas, Carlos; Grupo de Óptica e Información Cuántica Team

Over the last years, scientific interest for designing and making low dimensional electronic devices with traditional or novel materials has been increased. These experimental and theoretical researches in electronic properties at molecular scale are looking for developing efficient devices able to carry out tasks which are currently done by silicon transistors and devices. Among the new materials DNA strands are highlighted, but the experimental results have been contradictories pointing to behaviors as conductor, semiconductor or insulator. To contribute to the understanding of the origin of the disparity of the measurements, we perform a numerical calculation of the electrical conductance of DNA segments, modeled as 1D disordered finite chains. The system is described into a Tight binding model with nearest neighbor interactions and a s orbital per site. Hydration effects are included as random variations of self-energies. The electronic current as a function of applied bias is calculated using Launder formalism, where the transmission probability is determined into the transfer matrix formalism. We find a conductor-to-semiconductor-to-insulator transition as a function of the three effects taken into account: chain size, intrinsic disorder, and hydration We thank Fundación para la Promoción de la Investigación y la Tecnología, Colombia, and Dirección de Investigación de Bogotá, Universidad Nacional de Colombia, for partial financial support.

Green Perylene Bisimide Dyes: Synthesis, Photophysical and Electrochemical Properties

PubMed Central

Chang, Che-Wei; Tsai, Hsing-Yang; Chen, Kew-Yu

2014-01-01

Three asymmetric amino-substituted perylene bisimide dyes with different n-alkyl chain lengths (n = 6, 12, or 18), 1-(N,N-dialkylamino)perylene bisimides (1a–1c), were synthesized under mild condition in high yields and were characterized by 1H NMR, 13C NMR (nuclear magnetic resonance), HRMS (High Resolution Mass Spectrometer), UV-Vis and fluorescence spectra, as well as cyclic voltammetry (CV). These molecules show intense green color in both solution and solid state and are highly soluble in dichloromethane and even in nonpolar solvents, such as hexane. The shapes of the absorption spectra of 1a–1c in solid state and in solution were found to be virtually the same, indicating that the long alkyl chains could efficiently prevent aggregation. They exhibit a unique charge transfer emission in the near-infrared region, of which the peak wavelengths show strong solvatochromism. The dipole moments of the compounds have been estimated using the Lippert-Mataga equation, and upon excitation, they show larger dipole moment changes than that of 1-aminoperylene bisimide (2). Furthermore, all of the compounds exhibit two quasi-reversible one-electron oxidations and two quasi-reversible one-electron reductions in dichloromethane at modest potentials. Complementary density functional theory (DFT) calculations performed on these dyes are reported in order to rationalize their molecular structures and electronic properties. PMID:28788140

1,7-Bis-(N,N-dialkylamino)perylene Bisimides: Facile Synthesis and Characterization as Near-Infrared Fluorescent Dyes

PubMed Central

Chen, Kew-Yu; Chang, Che-Wei

2014-01-01

Three symmetric alkylamino-substituted perylene bisimides with different n-alkyl chain lengths (n = 6, 12, or 18), 1,7-bis-(N,N-dialkylamino)perylene bisimides (1a–1c), were synthesized under mild condition and were characterized by 1H NMR, 13C NMR and high resolution mass spectroscopy. Their optical and electrochemical properties were measured using UV-Vis and emission spectroscopic techniques as well as cyclic voltammetry (CV). These compounds show deep green color in both solution and solid state, and are highly soluble in dichloromethane and even in nonpolar solvents such as hexane. The shapes of the absorption spectra of 1a–1c in the solution and solid state were found to be almost the same, indicating that the long alkyl chains could efficiently prevent intermolecular contact and aggregation. They show a unique charge transfer emission in the near-infrared region, of which the peak wavelengths exhibit strong solvatochromism. The dipole moments of the molecules have been estimated using the Lippert–Mataga equation, and upon excitation, they show larger dipole moment changes than that of 1,7-diaminoperylene bisimide (2). Moreover, all the dyes exhibit two irreversible one-electron oxidations and two quasi-reversible one-electron reductions in dichloromethane at modest potentials. Complementary density functional theory calculations performed on these chromophores are reported in order to rationalize their electronic structure and optical properties. PMID:28788262

Electromagnetic Basis of Metabolism and Heredity

NASA Technical Reports Server (NTRS)

Freund, Friedemann; Stolc, Viktor

2016-01-01

Living organisms control their cellular biological clocks to maintain functional oscillation of the redox cycle, also called the "metabolic cycle" or "respiratory cycle". Organization of cellular processes requires parallel processing on a synchronized time-base. These clocks coordinate the timing of all biochemical processes in the cell, including energy production, DNA replication, and RNA transcription. When this universal time keeping function is perturbed by exogenous induction of reactive oxygen species (ROS), the rate of metabolism changes. This causes oxidative stress, aging and mutations. Therefore, good temporal coordination of the redox cycle not only actively prevents chemical conflict between the reductive and oxidative partial reactions; it also maintains genome integrity and lifespan. Moreover, this universal biochemical rhythm can be disrupted by ROS induction in vivo. This in turn can be achieved by blocking the electron transport chain either endogenously or exogenously by various metabolites, e.g. hydrogen sulfide (H2S), highly diffusible drugs, and carbon monoxide (CO). Alternatively, the electron transport in vivo can be attenuated via a coherent or interfering transfer of energy from exogenous ultralow frequency (ULF) and extremely low frequency (ELF) electromagnetic (EM) fields, suggesting that-on Earth-such ambient fields are an omnipresent (and probably crucially important) factor for the time-setting basis of universal biochemical reactions in living cells. Our work demonstrated previously un-described evidence for quantum effects in biology by electromagnetic coupling below thermal noise at the universal electron transport chain (ETC) in vivo.

Trophic transfer potential of aluminium oxide nanoparticles using representative primary producer (Chlorella ellipsoides) and a primary consumer (Ceriodaphnia dubia).

PubMed

Pakrashi, Sunandan; Dalai, Swayamprava; Chandrasekaran, Natarajan; Mukherjee, Amitava

2014-07-01

The transfer of nanoparticles through the food chain can lead to bioaccumulation and biomagnification resulting in a long term negative impact on the ecosystem functions. The primary objective of this study was evaluation of aluminium oxide nanoparticles transfer from primary producers to primary consumers. A simple set up consisting of a primary producer (Chlorella ellipsoides) and a primary consumer (Ceriodaphnia dubia) was used. Here, C. ellipsoides were exposed to the varying concentrations of the nanoparticles ranging from 20 to 120μg/mL (196 to 1176μM) for 48h and the infested algal cells were used as the feed to C. dubia. The bioaccumulation of the nanoparticles into the daphnids was noted and the biomagnification factors were computed. The exposure was noted to cause subtle alterations in the feeding behaviour of the daphnids. This might have long term consequences in the energy flow through the food chain. The reproductive behaviour of the daphnids remained unaffected upon exposure to nanoparticle infested algal feed. Distinct observations at ultra-structural scale using transmission electron microscopy provided visual evidences for the disrupted feeding behaviour upon exposure to nanoparticle treated algae. Internalization of nanoparticle like inclusion bodies in the intracellular space of algae was also detected. The findings were further substantiated by a detailed analysis of hydrodynamic stability, bioavailability and dissolution of ions from the nanoparticles over the exposure period. Altogether, the study brings out the first of its kind of observation of trophic transfer potential/behaviour of aluminium oxide nanoparticles and its probable impacts on the energy flow in the fresh water aquatic ecosystem. Copyright © 2014 Elsevier B.V. All rights reserved.

Hybrid quantum chemical studies for the methanol formation reaction assisted by the proton transfer mechanism in supercritical water: CH3Cl+nH2O-->CH3OH+HCl+(n-1)H2O

NASA Astrophysics Data System (ADS)

Hori, T.; Takahashi, H.; Nitta, T.

2003-10-01

The proton transfer along the chain of hydrogen bonds is involved in many chemical reactions in aqueous solution and known to play a decisive role. We have performed the hybrid quantum chemical simulations for the methanol formation reaction catalyzed by the proton transfer mechanism [CH3Cl+nH2O→CH3OH+HCl+(n-1)H2O, n=3] in supercritical water (SCW) to investigate the role of water solvent on the reaction. In the simulation, the electronic state of the chemically active solutes (CH3Cl+3H2O) has been determined quantum mechanically, while the static water solvent has been represented by a classical model. The activation free energy for the water-catalytic reaction in SCW has been found to be 9.6 kcal/mol, which is much lower than that in the gas phase (29.2 kcal/mol). The fractional charge analysis has revealed that the notable charge separation in the solute complex takes place at the transition state (TS) and the resulting huge dipole gives rise to the considerable stabilization of the TS as compared to the reactant. It has been shown that the reaction assisted by the proton transfer mechanism is energetically much favored than the ionic SN2 reaction (CH3Cl+OH-→CH3OH+Cl-, 18.8 kcal/mol). The present calculations suggest that the proton migrations through the chain of hydrogen bonds can be regarded as a probable candidate responsible for the anomalous reactivities observed in SCW.

Experimental observation of boron nitride chains.

PubMed

Cretu, Ovidiu; Komsa, Hannu-Pekka; Lehtinen, Ossi; Algara-Siller, Gerardo; Kaiser, Ute; Suenaga, Kazu; Krasheninnikov, Arkady V

2014-12-23

We report the formation and characterization of boron nitride atomic chains. The chains were made from hexagonal boron nitride sheets using the electron beam inside a transmission electron microscope. We find that the stability and lifetime of the chains are significantly improved when they are supported by another boron nitride layer. With the help of first-principles calculations, we prove the heteroatomic structure of the chains and determine their mechanical and electronic properties. Our study completes the analogy between various boron nitride and carbon polymorphs, in accordance with earlier theoretical predictions.

Long-range doublon transfer in a dimer chain induced by topology and ac fields

NASA Astrophysics Data System (ADS)

Bello, M.; Creffield, C. E.; Platero, G.

2016-03-01

The controlled transfer of particles from one site of a spatial lattice to another is essential for many tasks in quantum information processing and quantum communication. In this work we study how to induce long-range transfer between the two ends of a dimer chain, by coupling states that are localized just on the chain’s end-points. This has the appealing feature that the transfer occurs only between the end-points - the particle does not pass through the intermediate sites-making the transfer less susceptible to decoherence. We first show how a repulsively bound-pair of fermions, known as a doublon, can be transferred from one end of the chain to the other via topological edge states. We then show how non-topological surface states of the familiar Shockley or Tamm type can be used to produce a similar form of transfer under the action of a periodic driving potential. Finally we show that combining these effects can produce transfer by means of more exotic topological effects, in which the driving field can be used to switch the topological character of the edge states, as measured by the Zak phase. Our results demonstrate how to induce long range transfer of strongly correlated particles by tuning both topology and driving.

Synthesis of hydrophilic carbon nanotubes by grafting poly(methyl methacrylate) via click reaction and its effect on poly(vinylidene fluoride)-carbon nanotube composite membrane properties1

NASA Astrophysics Data System (ADS)

Ma, Wenzhong; Zhao, Yuchen; Li, Yuxue; Zhang, Peng; Cao, Zheng; Yang, Haicun; Liu, Chunlin; Tao, Guoliang; Gong, Fanghong; Matsuyama, Hideto

2018-03-01

Surface modification of azide-decorated multiwalled carbon nanotubes (MWCNTs) with well-defined alkyne-terminated poly(methyl methacrylate) (PMMA) chains was accomplished via the combination of reversible addition fragmentation chain transfer (RAFT) and "click" chemistry. Successful attachment of PMMA onto MWCNT was confirmed by Fourier transform infrared spectroscopy, thermogravimetric analysis (TGA), gel permeation chromatography, Raman spectroscopy, and transmission electron microscopy. The highest grafting percentage (GP) of the PMMA chains (GP = 23.3%) was calculated using TGA. The effect of the PMMA-grafted-MWCNTs (MWCNTs-g-PMMA) content on the performance of the poly(vinylidene fluoride) (PVDF)-MWCNTs-g-PMMA composite membrane was studied. The MWCNTs-g-PMMA was found to be well dispersed in the PVDF composite membrane matrix because of the excellent compatibility between the PMMA and PVDF chains. The composite membranes showed improved porosity, hydrophilicity, water flux, β-PVDF content, and mechanical properties at an optimal amount of 2 wt% MWCNTs-g-PMMA incorporated in the PVDF membrane matrix. In contrast, the hydroxyl functionalized MWCNTs (MWCNTs-OH) showed limited enhancement in the water flux and mechanical strength, which is mainly due to the poor dispersion of MWCNT because of the weak interaction between the MWCNT and PVDF chains. This study reveals the excellent prospect of the MWCNT-based ultrafiltration membrane with enhanced properties in water treatment applications.

The Q-cycle reviewed: How well does a monomeric mechanism of the bc(1) complex account for the function of a dimeric complex?

PubMed

Crofts, Antony R; Holland, J Todd; Victoria, Doreen; Kolling, Derrick R J; Dikanov, Sergei A; Gilbreth, Ryan; Lhee, Sangmoon; Kuras, Richard; Kuras, Mariana Guergova

2008-01-01

Recent progress in understanding the Q-cycle mechanism of the bc(1) complex is reviewed. The data strongly support a mechanism in which the Q(o)-site operates through a reaction in which the first electron transfer from ubiquinol to the oxidized iron-sulfur protein is the rate-determining step for the overall process. The reaction involves a proton-coupled electron transfer down a hydrogen bond between the ubiquinol and a histidine ligand of the [2Fe-2S] cluster, in which the unfavorable protonic configuration contributes a substantial part of the activation barrier. The reaction is endergonic, and the products are an unstable ubisemiquinone at the Q(o)-site, and the reduced iron-sulfur protein, the extrinsic mobile domain of which is now free to dissociate and move away from the site to deliver an electron to cyt c(1) and liberate the H(+). When oxidation of the semiquinone is prevented, it participates in bypass reactions, including superoxide generation if O(2) is available. When the b-heme chain is available as an acceptor, the semiquinone is oxidized in a process in which the proton is passed to the glutamate of the conserved -PEWY- sequence, and the semiquinone anion passes its electron to heme b(L) to form the product ubiquinone. The rate is rapid compared to the limiting reaction, and would require movement of the semiquinone closer to heme b(L) to enhance the rate constant. The acceptor reactions at the Q(i)-site are still controversial, but likely involve a "two-electron gate" in which a stable semiquinone stores an electron. Possible mechanisms to explain the cyt b(150) phenomenon are discussed, and the information from pulsed-EPR studies about the structure of the intermediate state is reviewed. The mechanism discussed is applicable to a monomeric bc(1) complex. We discuss evidence in the literature that has been interpreted as shown that the dimeric structure participates in a more complicated mechanism involving electron transfer across the dimer interface. We show from myxothiazol titrations and mutational analysis of Tyr-199, which is at the interface between monomers, that no such inter-monomer electron transfer is detected at the level of the b(L) hemes. We show from analysis of strains with mutations at Asn-221 that there are coulombic interactions between the b-hemes in a monomer. The data can also be interpreted as showing similar coulombic interaction across the dimer interface, and we discuss mechanistic implications.

Electron flow in multicenter enzymes: theory, applications, and consequences on the natural design of redox chains.

PubMed

Léger, Christophe; Lederer, Florence; Guigliarelli, Bruno; Bertrand, Patrick

2006-01-11

In protein film voltammetry, a redox enzyme is directly connected to an electrode; in the presence of substrate and when the driving force provided by the electrode is appropriate, a current flow reveals the steady-state turnover. We show that, in the case of a multicenter enzyme, this signal reports on the energetics and kinetics of electron transfer (ET) along the redox chain that wires the active site to the electrode, and this provides a new strategy for studying intramolecular ET. We propose a model which takes into account all the enzyme's redox microstates, and we prove it useful to interpret data for various enzymes. Several general ideas emerge from this analysis. Considering the reversibility of ET is a requirement: the usual picture, where ET is depicted as a series of irreversible steps, is oversimplified and lacks the important features that we emphasize. We give justification to the concept of apparent reduction potential on the time scale of turnover and we explain how the value of this potential relates to the thermodynamic and kinetic properties of the system. When intramolecular ET does not limit turnover, the redox chain merely mediates the driving force provided by the electrode or the soluble redox partner, whereas when intramolecular ET is slow, the enzyme behaves as if its active active site had apparent redox properties which depend on the reduction potentials of the relays. This suggests an alternative to the idea that redox chains are optimized in terms of speed: evolutionary pressure may have resulted in slowing down intramolecular ET in order to tune the enzyme's "operating potential".

Down-regulated PAR-2 is associated in part with interrupted melanosome transfer in pigmented basal cell epithelioma.

PubMed

Sakuraba, Kazuko; Hayashi, Nobukazu; Kawashima, Makoto; Imokawa, Genji

2004-08-01

In pigmented basal cell epithelioma (BCE), there seems to be an abnormal transfer of melanized melanosomes from proliferating melanocytes to basaloid tumor cells. In this study, the interruption of that melanosome transfer was studied with special respect to the altered function of a phagocytic receptor, protease-activated receptor (PAR)-2 in the basaloid tumor cells. We used electron microscopy to clarify the disrupted transfer at the ultrastructural level and then performed immunohistochemistry and reverse transcription-polymerase chain reaction (RT-PCR) to examine the regulation of a phagocytic receptor, PAR-2, expressed on basaloid tumor cells. Electron microscopic analysis revealed that basaloid tumor cells of pigmented BCE have a significantly lower population of melanosomes ( approximately 16.4%) than do normal keratinocytes located in the perilesional normal epidermis ( approximately 91.0%). In contrast, in pigmented seborrheic keratosis (SK), a similarly pigmented epidermal tumor, the distribution of melanin granules does not differ between the lesional ( approximately 93.9%) and the perilesional normal epidermis ( approximately 92.2 %), indicating that interrupted melanosome transfer occurs in BCE but not in all pigmented epithelial tumors. RT-PCR analysis demonstrated that the expression of PAR-2 mRNA transcripts in basaloid cells is significantly decreased in pigmented BCE compared with the perilesional normal epidermis. In contrast, in pigmented SK, where melanosome transfer to basaloid tumor cells is not interrupted, the expression of PAR-2 mRNA transcripts is comparable between the basaloid tumor cells and the perilesional normal epidermis. Immunohistochemistry demonstrated that basaloid cells in pigmented BCE have less immunostaining for PAR-2 than do keratinocytes in the perilesional normal epidermis whereas in pigmented SK, there is no difference in immunostaining for PAR-2 between the basaloid tumor and the perilesional normal epidermis. These findings suggest that the decreased expression of PAR-2 in the basaloid cells is associated in part with the observed interruption of melanosome transfer in pigmented BCE.

Energetics of bacterial photosynthesis.

PubMed

Lebard, David N; Matyushov, Dmitry V

2009-09-10

We report the results of extensive numerical simulations and theoretical calculations of electronic transitions in the reaction center of Rhodobacter sphaeroides photosynthetic bacterium. The energetics and kinetics of five electronic transitions related to the kinetic scheme of primary charge separation have been analyzed and compared to experimental observations. Nonergodic formulation of the reaction kinetics is required for the calculation of the rates due to a severe breakdown of the system ergodicity on the time scale of primary charge separation, with the consequent inapplicability of the standard canonical prescription to calculate the activation barrier. Common to all reactions studied is a significant excess of the charge-transfer reorganization energy from the width of the energy gap fluctuations over that from the Stokes shift of the transition. This property of the hydrated proteins, breaking the linear response of the thermal bath, allows the reaction center to significantly reduce the reaction free energy of near-activationless electron hops and thus raise the overall energetic efficiency of the biological charge-transfer chain. The increase of the rate of primary charge separation with cooling is explained in terms of the temperature variation of induction solvation, which dominates the average donor-acceptor energy gap for all electronic transitions in the reaction center. It is also suggested that the experimentally observed break in the Arrhenius slope of the primary recombination rate, occurring near the temperature of the dynamical transition in proteins, can be traced back to a significant drop of the solvent reorganization energy close to that temperature.

Electron transport chain-dependent and -independent mechanisms of mitochondrial H2O2 emission during long-chain fatty acid oxidation.

PubMed

Seifert, Erin L; Estey, Carmen; Xuan, Jian Y; Harper, Mary-Ellen

2010-02-19

Oxidative stress in skeletal muscle is a hallmark of various pathophysiologic states that also feature increased reliance on long-chain fatty acid (LCFA) substrate, such as insulin resistance and exercise. However, little is known about the mechanistic basis of the LCFA-induced reactive oxygen species (ROS) burden in intact mitochondria, and elucidation of this mechanistic basis was the goal of this study. Specific aims were to determine the extent to which LCFA catabolism is associated with ROS production and to gain mechanistic insights into the associated ROS production. Because intermediates and by-products of LCFA catabolism may interfere with antioxidant mechanisms, we predicted that ROS formation during LCFA catabolism reflects a complex process involving multiple sites of ROS production as well as modified mitochondrial function. Thus, we utilized several complementary approaches to probe the underlying mechanism(s). Using skeletal muscle mitochondria, our findings indicate that even a low supply of LCFA is associated with ROS formation in excess of that generated by NADH-linked substrates. Moreover, ROS production was evident across the physiologic range of membrane potential and was relatively insensitive to membrane potential changes. Determinations of topology and membrane potential as well as use of inhibitors revealed complex III and the electron transfer flavoprotein (ETF) and ETF-oxidoreductase, as likely sites of ROS production. Finally, ROS production was sensitive to matrix levels of LCFA catabolic intermediates, indicating that mitochondrial export of LCFA catabolic intermediates can play a role in determining ROS levels.

Switching single chain magnet behavior via photoinduced bidirectional metal-to-metal charge transfer† †Electronic supplementary information (ESI) available: Synthesis and physical measurement details. Crystal data in CIF format and additional figures (Fig. S1–S15). CCDC 1528877. For ESI and crystallographic data in CIF or other electronic format see DOI: 10.1039/c7sc03401f

PubMed Central

Jiang, Wenjing; Jiao, Chengqi; Meng, Yinshan; Zhao, Liang; Liu, Qiang

2017-01-01

The preparation of single-chain magnets (SCMs) with photo-switchable bistable states is essential for the development of high-density photo-recording devices. However, the reversible switching of the SCM behavior upon light irradiation is a formidable challenge. Here we report a well-isolated double zigzag chain {[Fe(bpy)(CN)4]2[Co(phpy)2]}·2H2O (bpy = 2,2′-bipyridine, phpy = 4-phenylpyridine), which exhibits reversible redox reactions with interconversion between FeIIILS(μ-CN)CoIIHS(μ-NC)FeIIILS (LS = low-spin, HS = high-spin) and FeIIILS(μ-CN)CoIIILS(μ-NC)FeIILS linkages under alternating irradiation with 808 and 532 nm lasers. The bidirectional photo-induced metal-to-metal charge transfer results in significant changes of anisotropy and intrachain magnetic interactions, reversibly switching the SCM behavior. The on-switching SCM behavior driven by light irradiation at 808 nm could be reversibly switched off by irradiation at 532 nm. The results provide an additional and independent way to control the bistable states of SCMs by switching in the 0 → 1 → 0 sequence, with potential applications in high density storage and molecular switches. PMID:29629126

Doping of Semiconducting Atomic Chains

NASA Technical Reports Server (NTRS)

Toshishige, Yamada; Kutler, Paul (Technical Monitor)

1997-01-01

Due to the rapid progress in atom manipulation technology, atomic chain electronics would not be a dream, where foreign atoms are placed on a substrate to form a chain, and its electronic properties are designed by controlling the lattice constant d. It has been shown theoretically that a Si atomic chain is metallic regardless of d and that a Mg atomic chain is semiconducting or insulating with a band gap modified with d. For electronic applications, it is essential to establish a method to dope a semiconducting chain, which is to control the Fermi energy position without altering the original band structure. If we replace some of the chain atoms with dopant atoms randomly, the electrons will see random potential along the chain and will be localized strongly in space (Anderson localization). However, if we replace periodically, although the electrons can spread over the chain, there will generally appear new bands and band gaps reflecting the new periodicity of dopant atoms. This will change the original band structure significantly. In order to overcome this dilemma, we may place a dopant atom beside the chain at every N lattice periods (N > 1). Because of the periodic arrangement of dopant atoms, we can avoid the unwanted Anderson localization. Moreover, since the dopant atoms do not constitute the chain, the overlap interaction between them is minimized, and the band structure modification can be made smallest. Some tight-binding results will be discussed to demonstrate the present idea.

The Nature of Bonding in Bulk Tellurium Composed of One-Dimensional Helical Chains.

PubMed

Yi, Seho; Zhu, Zhili; Cai, Xiaolin; Jia, Yu; Cho, Jun-Hyung

2018-05-07

Bulk tellurium (Te) is composed of one-dimensional (1D) helical chains which have been considered to be coupled by van der Waals (vdW) interactions. However, on the basis of first-principles density functional theory calculations, we here propose a different bonding nature between neighboring chains: i.e., helical chains made of normal covalent bonds are connected together by coordinate covalent bonds. It is revealed that the lone pairs of electrons of Te atoms participate in forming coordinate covalent bonds between neighboring chains, where each Te atom behaves as both an electron donor to neighboring chains and an electron acceptor from neighboring chains. This ligand-metal-like bonding nature in bulk Te results in the same order of bulk moduli along the directions parallel and perpendicular to the chains, contrasting with the large anisotropy of bulk moduli in vdW crystals. We further find that the electron effective masses parallel and perpendicular to the chains are almost the same as each other, consistent with the observed nearly isotropic electrical resistivity. It is thus demonstrated that the normal/coordinate covalent bonds parallel/perpendicular to the chains in bulk Te lead to a minor anisotropy in structural and transport properties.

DOS cones along atomic chains

NASA Astrophysics Data System (ADS)

Kwapiński, Tomasz

2017-03-01

The electron transport properties of a linear atomic chain are studied theoretically within the tight-binding Hamiltonian and the Green’s function method. Variations of the local density of states (DOS) along the chain are investigated. They are crucial in scanning tunnelling experiments and give important insight into the electron transport mechanism and charge distribution inside chains. It is found that depending on the chain parity the local DOS at the Fermi level can form cone-like structures (DOS cones) along the chain. The general condition for the local DOS oscillations is obtained and the linear behaviour of the local density function is confirmed analytically. DOS cones are characterized by a linear decay towards the chain which is in contrast to the propagation properties of charge density waves, end states and Friedel oscillations in one-dimensional systems. We find that DOS cones can appear due to non-resonant electron transport, the spin-orbit scattering or for chains fabricated on a substrate with localized electrons. It is also shown that for imperfect chains (e.g. with a reduced coupling strength between two neighboring sites) a diamond-like structure of the local DOS along the chain appears.

Universal scheme for finite-probability perfect transfer of arbitrary multispin states through spin chains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Man, Zhong-Xiao, E-mail: zxman@mail.qfnu.edu.cn; An, Nguyen Ba, E-mail: nban@iop.vast.ac.vn; Xia, Yun-Jie, E-mail: yjxia@mail.qfnu.edu.cn

In combination with the theories of open system and quantum recovering measurement, we propose a quantum state transfer scheme using spin chains by performing two sequential operations: a projective measurement on the spins of ‘environment’ followed by suitably designed quantum recovering measurements on the spins of interest. The scheme allows perfect transfer of arbitrary multispin states through multiple parallel spin chains with finite probability. Our scheme is universal in the sense that it is state-independent and applicable to any model possessing spin–spin interactions. We also present possible methods to implement the required measurements taking into account the current experimental technologies.more » As applications, we consider two typical models for which the probabilities of perfect state transfer are found to be reasonably high at optimally chosen moments during the time evolution. - Highlights: • Scheme that can achieve perfect quantum state transfer is devised. • The scheme is state-independent and applicable to any spin-interaction models. • The scheme allows perfect transfer of arbitrary multispin states. • Applications to two typical models are considered in detail.« less

12 CFR 1005.14 - Electronic fund transfer service provider not holding consumer's account.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 12 Banks and Banking 8 2012-01-01 2012-01-01 false Electronic fund transfer service provider not... PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) § 1005.14 Electronic fund transfer service provider not holding consumer's account. (a) Provider of electronic fund transfer service. A person that provides an...

12 CFR 1005.14 - Electronic fund transfer service provider not holding consumer's account.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 12 Banks and Banking 8 2013-01-01 2013-01-01 false Electronic fund transfer service provider not... PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) General § 1005.14 Electronic fund transfer service provider not holding consumer's account. (a) Provider of electronic fund transfer service. A person that...

12 CFR 1005.14 - Electronic fund transfer service provider not holding consumer's account.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 12 Banks and Banking 8 2014-01-01 2014-01-01 false Electronic fund transfer service provider not... PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) General § 1005.14 Electronic fund transfer service provider not holding consumer's account. (a) Provider of electronic fund transfer service. A person that...

Metallocene-Containing Homopolymers and Heterobimetallic Block Copolymers via Photoinduced RAFT Polymerization

PubMed Central

Yang, Peng; Pageni, Parasmani; Kabir, Mohammad Pabel; Zhu, Tianyu; Tang, Chuanbing

2017-01-01

We report the synthesis of cationic cobaltocenium and neutral ferrocene containing homopolymers mediated by photoinduced reversible addition-fragmentation chain transfer (RAFT) polymerization with a photocatalyst fac-[Ir(ppy)3]. The homopolymers were further used as macromolecular chain transfer agents to synthesize diblock copolymers via chain extension. Controlled/“living” feature of photoinduced RAFT polymerization was confirmed by kinetic studies even without prior deoxygenation. A light switch between ON and OFF provided a spatiotemporal control of polymerization. PMID:29276651

The E3 ligase HOIP specifies linear ubiquitin chain assembly through its RING-IBR-RING domain and the unique LDD extension

PubMed Central

Smit, Judith J; Monteferrario, Davide; Noordermeer, Sylvie M; van Dijk, Willem J; van der Reijden, Bert A; Sixma, Titia K

2012-01-01

Activation of the NF-κB pathway requires the formation of Met1-linked ‘linear' ubiquitin chains on NEMO, which is catalysed by the Linear Ubiquitin Chain Assembly Complex (LUBAC) E3 consisting of HOIP, HOIL-1L and Sharpin. Here, we show that both LUBAC catalytic activity and LUBAC specificity for linear ubiquitin chain formation are embedded within the RING-IBR-RING (RBR) ubiquitin ligase subunit HOIP. Linear ubiquitin chain formation by HOIP proceeds via a two-step mechanism involving both RING and HECT E3-type activities. RING1-IBR catalyses the transfer of ubiquitin from the E2 onto RING2, to transiently form a HECT-like covalent thioester intermediate. Next, the ubiquitin is transferred from HOIP onto the N-terminus of a target ubiquitin. This transfer is facilitated by a unique region in the C-terminus of HOIP that we termed ‘Linear ubiquitin chain Determining Domain' (LDD), which may coordinate the acceptor ubiquitin. Consistent with this mechanism, the RING2-LDD region was found to be important for NF-κB activation in cellular assays. These data show how HOIP combines a general RBR ubiquitin ligase mechanism with unique, LDD-dependent specificity for producing linear ubiquitin chains. PMID:22863777

Using Adobe Flash Animations of Electron Transport Chain to Teach and Learn Biochemistry

ERIC Educational Resources Information Center

Teplá, Milada; Klímová, Helena

2015-01-01

Teaching the subject of the electron transport chain is one of the most challenging aspects of the chemistry curriculum at the high school level. This article presents an educational program called "Electron Transport Chain" which consists of 14 visual animations including a biochemistry quiz. The program was created in the Adobe Flash…

Roles of the twin-arginine translocase and associated chaperones in the biogenesis of the electron transport chains of the human pathogen Campylobacter jejuni.

PubMed

Hitchcock, Andrew; Hall, Stephen J; Myers, Jonathan D; Mulholland, Francis; Jones, Michael A; Kelly, David J

2010-10-01

The zoonotic pathogen Campylobacter jejuni NCTC 11168 uses a complex set of electron transport chains to ensure growth with a variety of electron donors and alternative electron acceptors, some of which are known to be important for host colonization. Many of the key redox proteins essential for electron transfer in this bacterium have N-terminal twin-arginine translocase (TAT) signal sequences that ensure their transport across the cytoplasmic membrane in a folded state. By comparisons of 2D gels of periplasmic extracts, gene fusions and specific enzyme assays in wild-type, tatC mutant and complemented strains, we experimentally verified the TAT dependence of 10 proteins with an N-terminal twin-arginine motif. NrfH, which has a TAT-like motif (LRRKILK), was functional in nitrite reduction in a tatC mutant, and was correctly rejected as a TAT substrate by the tatfind and TatP prediction programs. However, the hydrogenase subunit HydA is also rejected by tatfind, but was shown to be TAT-dependent experimentally. The YedY homologue Cj0379 is the only TAT translocated molybdoenzyme of unknown function in C. jejuni; we show that a cj0379c mutant is deficient in chicken colonization and has a nitrosative stress phenotype, suggestive of a possible role for Cj0379 in the reduction of reactive nitrogen species in the periplasm. Only two potential TAT chaperones, NapD and Cj1514, are encoded in the genome. Surprisingly, despite homology to TorD, Cj1514 was shown to be specifically required for the activity of formate dehydrogenase, not trimethylamine N-oxide reductase, and was designated FdhM.

Mitochondrial Targeting of Vitamin E Succinate Enhances Its Pro-apoptotic and Anti-cancer Activity via Mitochondrial Complex II*

PubMed Central

Dong, Lan-Feng; Jameson, Victoria J. A.; Tilly, David; Cerny, Jiri; Mahdavian, Elahe; Marín-Hernández, Alvaro; Hernández-Esquivel, Luz; Rodríguez-Enríquez, Sara; Stursa, Jan; Witting, Paul K.; Stantic, Bela; Rohlena, Jakub; Truksa, Jaroslav; Kluckova, Katarina; Dyason, Jeffrey C.; Ledvina, Miroslav; Salvatore, Brian A.; Moreno-Sánchez, Rafael; Coster, Mark J.; Ralph, Stephen J.; Smith, Robin A. J.; Neuzil, Jiri

2011-01-01

Mitochondrial complex II (CII) has been recently identified as a novel target for anti-cancer drugs. Mitochondrially targeted vitamin E succinate (MitoVES) is modified so that it is preferentially localized to mitochondria, greatly enhancing its pro-apoptotic and anti-cancer activity. Using genetically manipulated cells, MitoVES caused apoptosis and generation of reactive oxygen species (ROS) in CII-proficient malignant cells but not their CII-dysfunctional counterparts. MitoVES inhibited the succinate dehydrogenase (SDH) activity of CII with IC50 of 80 μm, whereas the electron transfer from CII to CIII was inhibited with IC50 of 1.5 μm. The agent had no effect either on the enzymatic activity of CI or on electron transfer from CI to CIII. Over 24 h, MitoVES caused stabilization of the oxygen-dependent destruction domain of HIF1α fused to GFP, indicating promotion of the state of pseudohypoxia. Molecular modeling predicted the succinyl group anchored into the proximal CII ubiquinone (UbQ)-binding site and successively reduced interaction energies for serially shorter phytyl chain homologs of MitoVES correlated with their lower effects on apoptosis induction, ROS generation, and SDH activity. Mutation of the UbQ-binding Ser68 within the proximal site of the CII SDHC subunit (S68A or S68L) suppressed both ROS generation and apoptosis induction by MitoVES. In vivo studies indicated that MitoVES also acts by causing pseudohypoxia in the context of tumor suppression. We propose that mitochondrial targeting of VES with an 11-carbon chain localizes the agent into an ideal position across the interface of the mitochondrial inner membrane and matrix, optimizing its biological effects as an anti-cancer drug. PMID:21059645

Involvement of the chloroplast plastoquinone pool in the Mehler reaction.

PubMed

Vetoshkina, Daria V; Ivanov, Boris N; Khorobrykh, Sergey A; Proskuryakov, Ivan I; Borisova-Mubarakshina, Maria M

2017-09-01

Light-dependent oxygen reduction in the photosynthetic electron transfer chain, i.e. the Mehler reaction, has been studied using isolated pea thylakoids. The role of the plastoquinone pool in the Mehler reaction was investigated in the presence of dinitrophenyl ether of 2-iodo-4-nitrothymol (DNP-INT), the inhibitor of plastohydroquinone oxidation by cytochrome b6/f complex. Oxygen reduction rate in the presence of DNP-INT was higher than in the absence of the inhibitor in low light at pH 6.5 and 7.6, showing that the capacity of the plastoquinone pool to reduce molecular oxygen in this case exceeded that of the entire electron transfer chain. In the presence of DNP-INT, appearance of superoxide anion radicals outside thylakoid membrane represented approximately 60% of the total superoxide anion radicals produced. The remaining 40% of the produced superoxide anion radicals was suggested to be trapped by plastohydroquinone molecules within thylakoid membrane, leading to the formation of hydrogen peroxide (H 2 O 2 ). To validate the reaction of superoxide anion radical with plastohydroquinone, xanthine/xanthine oxidase system was integrated with thylakoid membrane in order to generate superoxide anion radical in close vicinity of plastohydroquinone. Addition of xanthine/xanthine oxidase to the thylakoid suspension resulted in a decrease in the reduction level of the plastoquinone pool in the light. The obtained data provide additional clarification of the aspects that the plastoquinone pool is involved in both reduction of oxygen to superoxide anion radicals and reduction of superoxide anion radicals to H 2 O 2 . Significance of the plastoquinone pool involvement in the Mehler reaction for the acclimation of plants to light conditions is discussed. © 2017 Scandinavian Plant Physiology Society.

THE ENERGY CONVERSION APPARATUS IN PHOTOSYNTHESIS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sauer, K.

1962-12-01

An analysis of outstanding problems still presenting difficulty with respect to understanding the quantumconversion process in photosynthesis is presented. Considerations of how some of these difficulties may be overcome are included. The dynamic process of energy conversion is considered in terms of photon absorption, electronic energy transfer, trapping in long-lived excited states, primary oxidants and reductants, and the electron transport chain leading to products representing stored chemical potential. The physical structure of the apparatus accomplishing this energy conversion is sought in the framework of the concept of the photosynthetic unit. The nature of this unit--its size, composition, arrangement and orientationmore » of components, internal electrical and polarizability properties, and assembly and aggregation in the chloroplast--and the problems related to its determination are essential considerations in the overall approach to the understanding of the mechanism of energy conversion. (auth)« less

Energy transfer within self-assembled cyclic multichromophoric arrays based on orthogonally arranged donor-acceptor building blocks.

PubMed

Karakostas, Nikolaos; Kaloudi-Chantzea, Antonia; Martinou, Elisabeth; Seintis, Kostas; Pitterl, Florian; Oberacher, Herbert; Fakis, Mihalis; Kallitsis, Joannis K; Pistolis, George

2015-01-01

We herein present the coordination-driven supramolecular synthesis and photophysics of a [4+4] and a [2+2] assembly, built up by alternately collocated donor-acceptor chromophoric building blocks based, respectively, on the boron dipyrromethane (Bodipy) and perylene bisimide dye (PBI). In these multichromophoric scaffolds, the intensely absorbing/emitting dipoles of the Bodipy subunit are, by construction, cyclically arranged at the corners and aligned perpendicular to the plane formed by the closed polygonal chain comprising the PBI units. Steady-state and fs time-resolved spectroscopy reveal the presence of efficient energy transfer from the vertices (Bodipys) to the edges (PBIs) of the polygons. Fast excitation energy hopping - leading to a rapid excited state equilibrium among the low energy perylene-bisimide chromophores - is revealed by fluorescence anisotropy decays. The dynamics of electronic excitation energy hopping between the PBI subunits was approximated on the basis of a theoretical model within the framework of Förster energy transfer theory. All energy-transfer processes are quantitatively describable with Förster theory. The influence of structural deformations and orientational fluctuations of the dipoles in certain kinetic schemes is discussed.

Optimal dephasing for ballistic energy transfer in disordered linear chains

NASA Astrophysics Data System (ADS)

Zhang, Yang; Celardo, G. Luca; Borgonovi, Fausto; Kaplan, Lev

2017-11-01

We study the interplay between dephasing, disorder, and coupling to a sink on transport efficiency in a one-dimensional chain of finite length N , and in particular the beneficial or detrimental effect of dephasing on transport. The excitation moves along the chain by coherent nearest-neighbor hopping Ω , under the action of static disorder W and dephasing γ . The last site is coupled to an external acceptor system (sink), where the excitation can be trapped with a rate Γtrap. While it is known that dephasing can help transport in the localized regime, here we show that dephasing can enhance energy transfer even in the ballistic regime. Specifically, in the localized regime we recover previous results, where the optimal dephasing is independent of the chain length and proportional to W or W2/Ω . In the ballistic regime, the optimal dephasing decreases as 1 /N or 1 /√{N } , respectively, for weak and moderate static disorder. When focusing on the excitation starting at the beginning of the chain, dephasing can help excitation transfer only above a critical value of disorder Wcr, which strongly depends on the sink coupling strength Γtrap. Analytic solutions are obtained for short chains.

Technology transfer of hearing aids to low and middle income countries: policy and market factors.

PubMed

Seelman, Katherine D; Werner, Roye

2014-09-01

The competitive market advantages of industry and the balancing force of international governmental organizations (IGOs) are examined to identify market and policy in support of sustainable technology transfer of hearing aids to low and middle income countries. A second purpose is to examine the usefulness of findings for other assistive technologies (AT). Searches of electronic databases, IGO documents, industry reports and journals were supplemented by informal discussions with industry and IGO staff and audiologists. The value chain is used to examine the competitive advantage of industry and the balancing tools of certain IGOs. Both industry and IGOs engage in intellectual property (IP) and competition activities and are active in each segment of the hearing aid value chain. Their market and policy objectives and strategies are different. IGOs serve as balancing forces for the competitive advantages of industry. The hearing aid market configuration and hearing aid fitting process are not representative of other AT products but IP, trade and competition policy tools used by IGOs and governments are relevant to other AT. The value chain is a useful tool to identify the location of price mark-ups and the influence of actors. Market factors and reimbursement and subsidization policies drive hearing aid innovation. UN-related international government organization activities are responsive to the needs of disability populations who cannot afford assistive technology. Policy tools used by international governmental organizations are applicable across assistive technology. A partnership model is important to distribution of hearing aids to low and middle income countries.

Reduction in aggregation and energy transfer of quantum dots incorporated in polystyrene beads by kinetic entrapment due to cross-linking during polymerization.

PubMed

Vaidya, Shyam V; Couzis, Alex; Maldarelli, Charles

2015-03-17

We report the development of barcoded polystyrene microbeads, approximately 50 μm in diameter, which are encoded by incorporating multicolored semiconductor fluorescent nanocrystals (quantum dots or QDs) within the microbeads and using the emission spectrum of the embedded QDs as a spectral label. The polymer/nanocrystal bead composites are formed by polymerizing emulsified liquid droplets of styrene monomer and QDs suspended in an immiscible continuous phase (suspension polymerization). We focus specifically on the effect of divinylbenzene (DVB) added to cross-link the linearly growing styrene polymer chains and the effect of this cross-linking on the state of aggregation of the nanocrystals in the composite. Aggregated states of multicolor QDs give rise to nonradiative resonance energy transfer (RET) which distorts the emission label from a spectrum recorded in a reference solvent in which the nanocrystals are well dispersed and unaggregated. A simple barcode is chosen of a mixture of QDs emitting at 560 (yellow) and 620 nm (red). We find that for linear chain growth (no DVB), the QDs aggregate as is evident from the emission spectrum and the QD distribution as seen from confocal laser scanning microscopy (CLSM) and transmission electron microscopy (TEM) images. Increasing the extent of cross-linking by the addition of DVB is shown to significantly decrease the aggregation and provide a clear label. We suggest that in the absence of cross-linking, linearly growing polymer chains, through enthalpic and entropic effects, drive the nanocrystals into inclusions, while cross-linking kinetically entraps the particle and prevents their aggregation.

Amphiphilic conjunct of methyl cellulose and well-defined polyvinyl acetate.

PubMed

Xiao, Congming; Xia, Cunping

2013-01-01

Tailor-made conjunct of methyl cellulose (MC) and polyvinyl acetate (PVAc) was synthesized through the combination of reversible addition-fragmentation chain transfer (RAFT) polymerization and thiol-ene click reaction. MC was firstly transferred into unsaturated MC (UMC), and then covalently connected with well-defined PVAc obtained by RAFT polymerization of vinyl acetate. The structure of the conjunct polymer (MCV) was confirmed with Fourier transform infrared spectra (FTIR) and proton nuclear magnetic resonance ((1)H NMR). Well-defined MCV was amphiphilic and able to self-assemble into size controllable micelles, which was verified with transmission electron microscopy (TEM) and size distribution analysis. It was found that the mean diameters of the micelles in aqueous solution were 105.6, 96.0 and 75.9 nm when the number average molecular weights of PVAc segments of MCV were 49,300, 32,500 and 18,200, respectively. Copyright © 2012 Elsevier B.V. All rights reserved.

On Substrate for Atomic Chain Electronics

NASA Technical Reports Server (NTRS)

Yamada, Toshishige; Bauschlicher, Charles W., Jr.; Partridge, Harry; Saini, Subhash (Technical Monitor)

1998-01-01

A substrate for future atomic chain electronics, where adatoms are placed at designated positions and form atomically precise device components, is studied theoretically. The substrate has to serve as a two-dimensional template for adatom mounting with a reasonable confinement barrier and also provide electronic isolation, preventing unwanted coupling between independent adatom structures. However, the two requirements conflict. For excellent electronic isolation, we may seek adatom confinement via van der Waals interaction without chemical bonding to the substrate atoms, but the confinement turns out to be very weak and hence unsatisfactory. An alternative chemical bonding scheme with excellent structural strength is examined, but even fundamental adatom chain properties such as whether chains are semiconducting or metallic are strongly influenced by the nature of the chemical bonding, and electronic isolation is not always achieved. Conditions for obtaining semiconducting chains with well-localized surface-modes, leading to good isolation, are clarified and discussed.

An efficient buffer-mediated control between free radical substitution and proton-coupled electron transfer: dehalogenation of iodoethane by the α-hydroxyethyl radical in aqueous solution.

PubMed

Ljubić, Ivan; Matasović, Brunislav; Bonifačić, Marija

2013-11-07

A remarkable buffer-mediated control between free-radical substitution (FRS) and proton-coupled electron transfer (PCET) is demonstrated for the reaction between iodoethane and the α-hydroxyethyl radical in neutral aqueous solution in the presence of bicarbonate or phosphate buffer. The reaction is initiated by the γ-radiolysis of the water solvent, and the products, either the iodine atom (FRS) or anion (PCET), are analysed using ion chromatographic and spectrophotometric techniques. A detailed insight into the mechanism is gained by employing density functional theory (M06-2X), Møller-Plesset perturbation treatment to the second order (MP2), and multireference methods (CASSCF/CASPT2). Addition of a basic buffer anion is indispensable for the reaction to occur and the competition between the two channels depends subtly on its proton accepting affinity, with FRS being the dominant channel in the phosphate and PCET in the bicarbonate containing solutions. Unlike the former, the latter channel sustains a chain-like process which significantly enhances the dehalogenation. The present systems furnish an example of the novel PCET/FRS dichotomy, as well as insights into possibilities of its efficient control.

Introduction of a specific binding domain on myoglobin surface by new chemical modification.

PubMed

Hayashi, T; Ando, T; Matsuda, T; Yonemura, H; Yamada, S; Hisaeda, Y

2000-11-01

A new myoglobin, reconstituted with a modified zinc protoporphyrin, having a total of four ammonium groups at the terminal of the two propionate side chains was constructed to introduce a substrate binding site. The protein with a positively charged patch on the surface formed a stable complex with negatively charged substrates, such as hexacyanoferrate(III) and anthraquinonesulfonate via an electrostatic interaction. The complexation was monitored by fluorescence quenching due to singlet electron transfer from the photoexcited reconstituted zinc myoglobin to the substrates. The binding properties were evaluated by Stern-Volmer plots from the fluorescence quenching of the zinc myoglobin by a quencher. Particularly, anthraquinone-2,7-disulfonic acid showed a high affinity with a binding constant of 1.5 x 10(5) M(-1) in 10 mM phosphate buffer, pH 7.0. In contrast, the plots upon the addition of anthraquinone-2-sulfonic acid at different ionic strengths indicated that the complex was formed not only by an electrostatic interaction but also by a hydrophobic contact. The findings from the fluorescence studies conclude that the present system is a useful model for discussion of electron transfer via non-covalently linked donor-acceptor pairing on the protein surface.

Aromatic Side Chain Water-to-Lipid Transfer Free Energies Show a Depth Dependence across the Membrane Normal.

PubMed

McDonald, Sarah K; Fleming, Karen G

2016-06-29

Quantitating and understanding the physical forces responsible for the interactions of biomolecules are fundamental to the biological sciences. This is especially challenging for membrane proteins because they are embedded within cellular bilayers that provide a unique medium in which hydrophobic sequences must fold. Knowledge of the energetics of protein-lipid interactions is thus vital to understand cellular processes involving membrane proteins. Here we used a host-guest mutational strategy to calculate the Gibbs free energy changes of water-to-lipid transfer for the aromatic side chains Trp, Tyr, and Phe as a function of depth in the membrane. This work reveals an energetic gradient in the transfer free energies for Trp and Tyr, where transfer was most favorable to the membrane interfacial region and comparatively less favorable into the bilayer center. The transfer energetics follows the concentration gradient of polar atoms across the bilayer normal that naturally occurs in biological membranes. Additional measurements revealed nearest-neighbor coupling in the data set are influenced by a network of aromatic side chains in the host protein. Taken together, these results show that aromatic side chains contribute significantly to membrane protein stability through either aromatic-aromatic interactions or placement at the membrane interface.

Effects of Nanoparticle Morphology and Acyl Chain Length on Spontaneous Lipid Transfer Rates

DOE PAGES

Xia, Yan; Li, Ming; Charubin, Kamil; ...

2015-11-05

In this paper, we report on studies of lipid transfer rates between different morphology nanoparticles and lipids with different length acyl chains. The lipid transfer rate of dimyristoylphosphatidylcholine (di-C 14, DMPC) in discoidal “bicelles” (0.156 h –1) is 2 orders of magnitude greater than that of DMPC vesicles (ULVs) (1.1 × 10 –3 h –1). For both bicellar and ULV morphologies, increasing the acyl chain length by two carbons [going from di-C 14 DMPC to di-C 16, dipalmitoylphosphatidylcholine (DPPC)] causes lipid transfer rates to decrease by more than 2 orders of magnitude. Results from small angle neutron scattering (SANS), differentialmore » scanning calorimetry (DSC), and fluorescence correlation spectroscopy (FCS) are in good agreement. Finally, the present studies highlight the importance of lipid dynamic processes taking place in different morphology biomimetic membranes.« less

Controlled chain polymerisation and chemical soldering for single-molecule electronics.

PubMed

Okawa, Yuji; Akai-Kasaya, Megumi; Kuwahara, Yuji; Mandal, Swapan K; Aono, Masakazu

2012-05-21

Single functional molecules offer great potential for the development of novel nanoelectronic devices with capabilities beyond today's silicon-based devices. To realise single-molecule electronics, the development of a viable method for connecting functional molecules to each other using single conductive polymer chains is required. The method of initiating chain polymerisation using the tip of a scanning tunnelling microscope (STM) is very useful for fabricating single conductive polymer chains at designated positions and thereby wiring single molecules. In this feature article, developments in the controlled chain polymerisation of diacetylene compounds and the properties of polydiacetylene chains are summarised. Recent studies of "chemical soldering", a technique enabling the covalent connection of single polydiacetylene chains to single functional molecules, are also introduced. This represents a key step in advancing the development of single-molecule electronics.

Targeted energy transfers and passive acoustic wave redirection in a two-dimensional granular network under periodic excitation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yijing, E-mail: yzhng123@illinois.edu; Moore, Keegan J.; Vakakis, Alexander F.

2015-12-21

We study passive pulse redirection and nonlinear targeted energy transfer in a granular network composed of two semi-infinite, ordered homogeneous granular chains mounted on linear elastic foundations and coupled by weak linear stiffnesses. Periodic excitation in the form of repetitive half-sine pulses is applied to one of the chains, designated as the “excited chain,” whereas the other chain is initially at rest and is regarded as the “absorbing chain.” We show that passive pulse redirection and targeted energy transfer from the excited to the absorbing chain can be achieved by macro-scale realization of the spatial analog of the Landau-Zener quantummore » tunneling effect. This is realized by finite stratification of the elastic foundation of the excited chain and depends on the system parameters (e.g., the percentage of stratification) and on the parameters of the periodic excitation. Utilizing empirical mode decomposition and numerical Hilbert transforms, we detect the existence of two distinct nonlinear phenomena in the periodically forced network; namely, (i) energy localization in the absorbing chain due to sustained 1:1 resonance capture leading to irreversible pulse redirection from the excited chain, and (ii) continuous energy exchanges in the form of nonlinear beats between the two chains in the absence of resonance capture. Our results extend previous findings of transient passive energy redirection in impulsively excited granular networks and demonstrate that steady state passive pulse redirection in these networks can be robustly achieved under periodic excitation.« less

Electrocatalytic Mechanism Involving Michaelis-Menten Kinetics at the Preparative Scale: Theory and Applicability to Photocurrents from a Photosynthetic Algae Suspension With Quinones.

PubMed

Longatte, Guillaume; Guille-Collignon, Manon; Lemaître, Frédéric

2017-10-06

In the past years, many strategies have been implemented to benefit from oxygenic photosynthesis to harvest photosynthetic electrons and produce a significant photocurrent. Therefore, electrochemical tools were considered and have globally relied on the electron transfer(s) between the photosynthetic chain and a collecting electrode. In this context, we recently reported the implementation of an electrochemical set-up at the preparative scale to produce photocurrents from a Chlamydomonas reinhardtii algae suspension with an appropriate mediator (2,6-DCBQ) and a carbon gauze as the working electrode. In the present work, we wish to describe a mathematical modeling of the recorded photocurrents to better understand the effects of the experimental conditions on the photosynthetic extraction of electrons. In that way, we established a general model of an electrocatalytic mechanism at the preparative scale (that is, assuming a homogenous bulk solution at any time and a constant diffusion layer, both assumptions being valid under forced convection) in which the chemical step involves a Michaelis-Menten-like behaviour. Dependences of transient and steady-state corresponding currents were analysed as a function of different parameters by means of zone diagrams. This model was tested to our experimental data related to photosynthesis. The corresponding results suggest that competitive pathways beyond photosynthetic harvesting alone should be taken into account. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Vibronic coupling effect on the electron transport through molecules

NASA Astrophysics Data System (ADS)

Tsukada, Masaru; Mitsutake, Kunihiro

2007-03-01

Electron transport through molecular bridges or molecular layers connected to nano-electrodes is determined by the combination of coherent and dissipative processes, controlled by the electron-vibron coupling, transfer integrals between the molecular orbitals, applied electric field and temperature. We propose a novel theoretical approach, which combines ab initio molecular orbital method with analytical many-boson model. As a case study, the long chain model of the thiophene oligomer is solved by a variation approach. Mixed states of moderately extended molecular orbital states mediated and localised by dress of vibron cloud are found as eigen-states. All the excited states accompanied by multiple quanta of vibration can be solved, and the overall carrier transport properties including the conductance, mobility, dissipation spectra are analyzed by solving the master equation with the transition rates estimated by the golden rule. We clarify obtained in a uniform systematic way, how the transport mode changes from a dominantly coherent transport to the dissipative hopping transport.

Photoactive layer based on T-shaped benzimidazole dyes used for solar cell: from photoelectric properties to molecular design

NASA Astrophysics Data System (ADS)

Xu, Beibei; Li, Yuanzuo; Song, Peng; Ma, Fengcai; Sun, Mengtao

2017-03-01

Three benzimidazole-based organic dyes, possessing the same triphenylamine donors and cyanoacrylic acid acceptors with the bithiophene π-bridges combined in different nuclear positions of benzimidazole, were investigated in the utility of dye-sensitizer solar cells. The structure, molecular orbital and energy, absorption spectra and some important parameters (such as light harvesting efficiency (LHE), electron injection driving force, the electron injection time, chemical reactivity parameters, vertical dipole moment as well as interaction models of dye-I2) were obtained according to Newns-Anderson model and DFT calculation. The process and strength of charge transfer and separation were visualized with charge different density and index of spatial extent (S, D and Δq). Current work paid attention to the new T-shaped dyes to reveal the relation between the structure and photoelectric performance. Furthermore, nine dyes (substitution of alkyl chains and π-bridges) have been designed and characterized to screen promising sensitizer candidates with excellent photo-electronic properties.

Energy conservation by oxidation of formate to carbon dioxide and hydrogen via a sodium ion current in a hyperthermophilic archaeon

PubMed Central

Lim, Jae Kyu; Mayer, Florian; Kang, Sung Gyun; Müller, Volker

2014-01-01

Thermococcus onnurineus NA1 is known to grow by the anaerobic oxidation of formate to CO2 and H2, a reaction that operates near thermodynamic equilibrium. Here we demonstrate that this reaction is coupled to ATP synthesis by a transmembrane ion current. Formate oxidation leads to H+ translocation across the cytoplasmic membrane that then drives Na+ translocation. The ion-translocating electron transfer system is rather simple, consisting of only a formate dehydrogenase module, a membrane-bound hydrogenase module, and a multisubunit Na+/H+ antiporter module. The electrochemical Na+ gradient established then drives ATP synthesis. These data give a mechanistic explanation for chemiosmotic energy conservation coupled to formate oxidation to CO2 and H2. Because it is discussed that the membrane-bound hydrogenase with the Na+/H+ antiporter module are ancestors of complex I of mitochondrial and bacterial electron transport these data also shed light on the evolution of ion transport in complex I-like electron transport chains. PMID:25049407

Energy conservation by oxidation of formate to carbon dioxide and hydrogen via a sodium ion current in a hyperthermophilic archaeon.

PubMed

Lim, Jae Kyu; Mayer, Florian; Kang, Sung Gyun; Müller, Volker

2014-08-05

Thermococcus onnurineus NA1 is known to grow by the anaerobic oxidation of formate to CO2 and H2, a reaction that operates near thermodynamic equilibrium. Here we demonstrate that this reaction is coupled to ATP synthesis by a transmembrane ion current. Formate oxidation leads to H(+) translocation across the cytoplasmic membrane that then drives Na(+) translocation. The ion-translocating electron transfer system is rather simple, consisting of only a formate dehydrogenase module, a membrane-bound hydrogenase module, and a multisubunit Na(+)/H(+) antiporter module. The electrochemical Na(+) gradient established then drives ATP synthesis. These data give a mechanistic explanation for chemiosmotic energy conservation coupled to formate oxidation to CO2 and H2. Because it is discussed that the membrane-bound hydrogenase with the Na(+)/H(+) antiporter module are ancestors of complex I of mitochondrial and bacterial electron transport these data also shed light on the evolution of ion transport in complex I-like electron transport chains.

Computational study of the RGD-peptide interactions with perovskite-type BFO-(1 1 1) membranes under aqueous conditions

NASA Astrophysics Data System (ADS)

Li, Hai-long; Bian, Liang; Hou, Wen-ping; Dong, Fa-Qin; Song, Mian-Xin; Zhang, Xiao-yan; Wang, Li-sheng

2016-07-01

We elucidated a number of facets regarding arginine-glycine-aspartate (RGD)-bismuth ferrite (BFO)-(1 1 1) membrane interactions and reactivity that have previously remained unexplored on a molecular level. Results demonstrate the intra-molecular interaction facilitates a ;horseshoe; structure of RGD adsorbed onto the BFO-(1 1 1) membrane, through the electrostatic (Asp-cation-Fe) and water-bridge (Osbnd H2O and H2Osbnd NH2) interactions. The effect of structural and electron-transfer interactions is attributed to the cation-valences, indicating that the divalent cations are electron-acceptors and the monovalent cations as electron-donors. Notably, the strongly bound Ca2+ ion exerts a ;gluing; effect on the Asp-side-chain, indicating a tightly packed RGD-BFO configuration. Thus, modulating the biological response of BFO-(1 1 1) membrane will allow us to design more appropriate interfaces for implantable diagnostic and therapeutic perovskite-type micro-devices.

An investigation of the iron-sulphur proteins of benzene dioxygenase from Pseudomonas putida by electron-spin-resonance spectroscopy.

PubMed Central

Geary, P J; Saboowalla, F; Patil, D; Cammack, R

1984-01-01

Benzene dioxygenase from Pseudomonas putida comprises three components, namely a flavoprotein (NADH:ferredoxin oxidoreductase; Mr 81000), an intermediate electron-transfer protein, or ferredoxin (Mr 12000) with a [2Fe-2S] cluster, and a terminal dioxygenase containing two [2Fe-2S] iron-sulphur clusters (Mr 215000), which requires two additional Fe2+ atoms/molecule for oxygenase activity. The ferredoxin and the dioxygenase give e.s.r. signals in the reduced state with rhombic symmetry and average g values of 1.92 and 1.896 respectively. The mid-point redox potentials were determined by e.s.r. titration at pH 7.0 to be -155 mV and -112 mV respectively. The signal from the dioxygenase shows pronounced g anisotropy and most closely resembles those of 4-methoxybenzoate mono-oxygenase from Pseudomonas putida and the [2Fe-2S] 'Rieske' proteins of the quinone-cytochrome c region of electron-transport chains of respiration and photosynthesis. PMID:6324743

New structural phase obtained by exerting high pressure on (Br2)n@AFI composite material

NASA Astrophysics Data System (ADS)

Yao, Zhen; Lv, Jia-Yin; Liu, Bo; Liu, Bing-Bing; Yang, Bai

2018-06-01

In this paper, we present a theoretical study on the high-pressure behaviors of a (Br2)n@AlPO4-5 (AFI) peapod structure. The influence of the encapsulated Br2 molecule on the structural deformation of AFI crystal is analyzed using the volume-pressure function. The bonding process of the linearly arrayed Br2 molecule transferring to the bromine atomic chain is analyzed by the electron density distribution. A new high-pressure phase with P2 point group symmetry is obtained as the pressure increases to 34 GPa. In addition, electron density difference calculations are used to study the systematic charge transformation. Further analysis indicates that the encapsulated Br2 molecules can significantly modify the electronic structure of the AFI crystal. The band gap of the (Br2)n@AFI decreases with pressure and closes at 9 GPa. Moreover, the calculated bulk modulus and electronic properties indicate that the new structural phase is metallic with a high hardness, providing a new strategy for exploring novel nanomaterials.

Quantum tunneling resonant electron transfer process in Lorentzian plasmas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hong, Woo-Pyo; Jung, Young-Dae, E-mail: ydjung@hanyang.ac.kr; Department of Applied Physics and Department of Bionanotechnology, Hanyang University, Ansan, Kyunggi-Do 426-791

The quantum tunneling resonant electron transfer process between a positive ion and a neutral atom collision is investigated in nonthermal generalized Lorentzian plasmas. The result shows that the nonthermal effect enhances the resonant electron transfer cross section in Lorentzian plasmas. It is found that the nonthermal effect on the classical resonant electron transfer cross section is more significant than that on the quantum tunneling resonant charge transfer cross section. It is shown that the nonthermal effect on the resonant electron transfer cross section decreases with an increase of the Debye length. In addition, the nonthermal effect on the quantum tunnelingmore » resonant electron transfer cross section decreases with increasing collision energy. The variation of nonthermal and plasma shielding effects on the quantum tunneling resonant electron transfer process is also discussed.« less

Ultrafast direct electron transfer at organic semiconductor and metal interfaces.

PubMed

Xiang, Bo; Li, Yingmin; Pham, C Huy; Paesani, Francesco; Xiong, Wei

2017-11-01

The ability to control direct electron transfer can facilitate the development of new molecular electronics, light-harvesting materials, and photocatalysis. However, control of direct electron transfer has been rarely reported, and the molecular conformation-electron dynamics relationships remain unclear. We describe direct electron transfer at buried interfaces between an organic polymer semiconductor film and a gold substrate by observing the first dynamical electric field-induced vibrational sum frequency generation (VSFG). In transient electric field-induced VSFG measurements on this system, we observe dynamical responses (<150 fs) that depend on photon energy and polarization, demonstrating that electrons are directly transferred from the Fermi level of gold to the lowest unoccupied molecular orbital of organic semiconductor. Transient spectra further reveal that, although the interfaces are prepared without deliberate alignment control, a subensemble of surface molecules can adopt conformations for direct electron transfer. Density functional theory calculations support the experimental results and ascribe the observed electron transfer to a flat-lying polymer configuration in which electronic orbitals are found to be delocalized across the interface. The present observation of direct electron transfer at complex interfaces and the insights gained into the relationship between molecular conformations and electron dynamics will have implications for implementing novel direct electron transfer in energy materials.

Energy transfer in PPV-based conjugated polymers: a defocused widefield fluorescence microscopy study.

PubMed

Hooley, E N; Tilley, A J; White, J M; Ghiggino, K P; Bell, T D M

2014-04-21

Both pendant and main chain conjugated MEH-PPV based polymers have been studied at the level of single chains using confocal and widefield fluorescence microscopy techniques. In particular, defocused widefield fluorescence is applied to reveal the extent of energy transfer in these polymers by identifying whether they act as single emitters. For main chain conjugated MEH-PPV, molecular weight and the surrounding matrix play a primary role in determining energy transport processes and whether single emitter behaviour is observed. Surprisingly in polymers with a saturated backbone but containing the same pendant MEH-PPV oligomer on each repeating unit, intra-chain energy transfer to a single emitter is also apparent. The results imply there is chromophore heterogeneity that can facilitate energy funneling to the emitting site. Both main chain conjugated and pendant MEH-PPV polymers exhibit changes in orientation of the emission dipole during a fluorescence trajectory of many seconds, whereas a model MEH-PPV oligomer does not. The results suggest that, in the polymers, the nature of the emitting chromophores can change during the time trajectory.

Spontaneous charged lipid transfer between lipid vesicles.

PubMed

Richens, Joanna L; Tyler, Arwen I I; Barriga, Hanna M G; Bramble, Jonathan P; Law, Robert V; Brooks, Nicholas J; Seddon, John M; Ces, Oscar; O'Shea, Paul

2017-10-03

An assay to study the spontaneous charged lipid transfer between lipid vesicles is described. A donor/acceptor vesicle system is employed, where neutrally charged acceptor vesicles are fluorescently labelled with the electrostatic membrane probe Fluoresceinphosphatidylethanolamine (FPE). Upon addition of charged donor vesicles, transfer of negatively charged lipid occurs, resulting in a fluorescently detectable change in the membrane potential of the acceptor vesicles. Using this approach we have studied the transfer properties of a range of lipids, varying both the headgroup and the chain length. At the low vesicle concentrations chosen, the transfer follows a first-order process where lipid monomers are transferred presumably through the aqueous solution phase from donor to acceptor vesicle. The rate of transfer decreases with increasing chain length which is consistent with energy models previously reported for lipid monomer vesicle interactions. Our assay improves on existing methods allowing the study of a range of unmodified lipids, continuous monitoring of transfer and simplified experimental procedures.

Contribution of direct electron transfer mechanisms to overall electron transfer in microbial fuel cells utilising Shewanella oneidensis as biocatalyst.

PubMed

Fapetu, Segun; Keshavarz, Taj; Clements, Mark; Kyazze, Godfrey

2016-09-01

To investigate the contribution of direct electron transfer mechanisms to electricity production in microbial fuel cells by physically retaining Shewanella oneidensis cells close to or away from the anode electrode. A maximum power output of 114 ± 6 mWm(-2) was obtained when cells were retained close to the anode using a dialysis membrane. This was 3.5 times more than when the cells were separated away from the anode. Without the membrane the maximum power output was 129 ± 6 mWm(-2). The direct mechanisms of electron transfer contributed significantly to overall electron transfer from S. oneidensis to electrodes, a result that was corroborated by another experiment where S. oneidensis cells were entrapped in alginate gels. S. oneidensis transfers electrons primarily by direct electron transfer as opposed to mediated electron transfer.

Electrochemical Measurement of Electron Transfer Kinetics by Shewanella oneidensis MR-1*

PubMed Central

Baron, Daniel; LaBelle, Edward; Coursolle, Dan; Gralnick, Jeffrey A.; Bond, Daniel R.

2009-01-01

Shewanella oneidensis strain MR-1 can respire using carbon electrodes and metal oxyhydroxides as electron acceptors, requiring mechanisms for transferring electrons from the cell interior to surfaces located beyond the cell. Although purified outer membrane cytochromes will reduce both electrodes and metals, S. oneidensis also secretes flavins, which accelerate electron transfer to metals and electrodes. We developed techniques for detecting direct electron transfer by intact cells, using turnover and single turnover voltammetry. Metabolically active cells attached to graphite electrodes produced thin (submonolayer) films that demonstrated both catalytic and reversible electron transfer in the presence and absence of flavins. In the absence of soluble flavins, electron transfer occurred in a broad potential window centered at ∼0 V (versus standard hydrogen electrode), and was altered in single (ΔomcA, ΔmtrC) and double deletion (ΔomcA/ΔmtrC) mutants of outer membrane cytochromes. The addition of soluble flavins at physiological concentrations significantly accelerated electron transfer and allowed catalytic electron transfer to occur at lower applied potentials (−0.2 V). Scan rate analysis indicated that rate constants for direct electron transfer were slower than those reported for pure cytochromes (∼1 s−1). These observations indicated that anodic current in the higher (>0 V) window is due to activation of a direct transfer mechanism, whereas electron transfer at lower potentials is enabled by flavins. The electrochemical dissection of these activities in living cells into two systems with characteristic midpoint potentials and kinetic behaviors explains prior observations and demonstrates the complementary nature of S. oneidensis electron transfer strategies. PMID:19661057

Frenkel-Charge-Transfer exciton intermixing theory for molecular crystals with two isolated Frenkel exciton states.

NASA Astrophysics Data System (ADS)

Bondarev, Igor; Popescu, Adrian

We develop an analytical theory for the intra-intermolecular exciton intermixing in periodic 1D chains of planar organic molecules with two isolated low-lying Frenkel exciton states, typical of copper phthalocyanine (CuPc) and other transition metal phthalocyanine molecules. We formulate the Hamiltonian and use the exact Bogoliubov diagonalization procedure to derive the eigen energy spectrum for the two lowest intramolecular Frenkel excitons coupled to the intermolecular charge transfer (CT) exciton state. By comparing our theoretical spectrum with available experimental CuPc absorption data, we obtain the parameters of the Frenkel-CT exciton intermixing in CuPc thin films. The two Frenkel exciton states here are spaced apart by 0.26 eV, and the charge transfer exciton state is 50 meV above the lowest Frenkel exciton. Both Frenkel excitons are strongly mixed with the CT exciton, showing the coupling constant 0.17 eV in agreement with earlier electron transport experiments. Our results can be used for the proper interpretation of the physical properties of crystalline phthalocyanines. DOE-DE-SC0007117 (I.B.), UNC-GA ROI Grant (A.P.).

Biocompatible Polysiloxane-Containing Diblock Copolymer PEO-b-PγMPS for Coating Magnetic Nanoparticles

PubMed Central

Chen, Hongwei; Wu, Xinying; Duan, Hongwei; Wang, Y. Andrew; Wang, Liya; Zhang, Minming; Mao, Hui

2009-01-01

We report a biocompatible polysiloxane containing amphiphilic diblock copolymer, poly(ethylene oxide)-block-poly(γ-methacryloxypropyltrimethoxysilane) (PEO-b-PγMPS), for coating and stabilizing nanoparticles for biomedical applications. Such amphiphilic diblock copolymer which comprises both a hydrophobic segment with “surface anchoring moiety” (silane group) and a hydrophilic segment with PEO (Mn=5000 g/mol) was obtained by the reversible addition fragmentation chain transfer (RAFT) polymerization using the PEO macromolecular chain transfer agent. When used for coating paramagnetic iron oxide nanoparticles (IONPs), copolymers were mixed with hydrophobic oleic acid coated core size uniformed IONPs (D=13 nm) in co-solvent tetrahydrofuran. After being aged over a period of time, resulting monodispersed IONPs can be transferred into aqueous medium. With proper PγMPS block length (Mn=10,000 g/mol), polysiloxane containing diblock copolymers formed a thin layer of coating (~3 nm) around monocrystalline nanoparticles as measured by transmission electron microscopy (TEM). Magnetic resonance imaging (MRI) experiments showed excellent T2 weighted contrast effect from coated IONPs with a transverse relaxivity r2=98.6 mM−1s−1 (at 1.5 Tesla). Such thin coating layer has little effect on the relaxivity when compared to that of IONPs coated with conventional amphiphilic copolymer. Polysiloxane containing diblock copolymer coated IONPs are stable without aggregation or binding to proteins in serum when incubated for 24 h in culture medium containing 10% serum. Furthermore, much lower level of intracellular uptake by macrophage cells was observed with polysiloxane containing diblock copolymers coated IONPs, suggesting the reduction of non-specific cell uptakes and antibiofouling effect. PMID:20161520

Construction of Hierarchical Polymer Brushes on Upconversion Nanoparticles via NIR-Light-Initiated RAFT Polymerization.

PubMed

Xie, Zhongxi; Deng, Xiaoran; Liu, Bei; Huang, Shanshan; Ma, Pingan; Hou, Zhiyao; Cheng, Ziyong; Lin, Jun; Luan, Shifang

2017-09-13

Photoinduced reversible addition-fragmentation chain transfer (RAFT) polymerization generally adopts high-energy ultraviolet (UV) or blue light. In combination with photoredox catalyst, the excitation light wavelength was extended to the visible and even near-infrared (NIR) region for photoinduced electron transfer RAFT polymerization. In this report, we introduce for the first time a surface NIR-light-initiated RAFT polymerization on upconversion nanoparticles (UCNPs) without adding any photocatalyst and construct a functional inorganic core/polymer shell nanohybrid for application in cancer theranostics. The multilayer core-shell UCNPs (NaYF 4 :Yb/Tm@NaYbF 4 :Gd@NaNdF 4 :Yb@NaYF 4 ), with surface anchorings of chain transfer agents, can serve as efficient NIR-to-UV light transducers for initiating the RAFT polymerization. A hierarchical double block copolymer brush, consisting of poly(acrylic acid) (PAA) and poly(oligo(ethylene oxide)methacrylate-co-2-(2-methoxy-ethoxy)ethyl methacrylate) (PEG for short), was grafted from the surface in sequence. The targeting arginine-glycine-aspartic (RGD) peptide was modified at the end of the copolymer through the trithiolcarbonate end group. After loading of doxorubicin, the UCNPs@PAA-b-PEG-RGD exhibited an enhanced U87MG cancer cell uptake efficiency and cytotoxicity. Besides, the unique upconversion luminescence of the nanohybrids was used for the autofluoresence-free cell imaging and labeling. Therefore, our strategy verified that UCNPs could efficiently activate RAFT polymerization by NIR photoirradiation and construct the complex nanohybrids, exhibiting prospective biomedical applications due to the low phototoxicity and deep penetration of NIR light.

Quantum communication beyond the localization length in disordered spin chains.

PubMed

Allcock, Jonathan; Linden, Noah

2009-03-20

We study the effects of localization on quantum state transfer in spin chains. We show how to use quantum error correction and multiple parallel spin chains to send a qubit with high fidelity over arbitrary distances, in particular, distances much greater than the localization length of the chain.

Graded, Dynamically Routable Information Processing with Synfire-Gated Synfire Chains.

PubMed

Wang, Zhuo; Sornborger, Andrew T; Tao, Louis

2016-06-01

Coherent neural spiking and local field potentials are believed to be signatures of the binding and transfer of information in the brain. Coherent activity has now been measured experimentally in many regions of mammalian cortex. Recently experimental evidence has been presented suggesting that neural information is encoded and transferred in packets, i.e., in stereotypical, correlated spiking patterns of neural activity. Due to their relevance to coherent spiking, synfire chains are one of the main theoretical constructs that have been appealed to in order to describe coherent spiking and information transfer phenomena. However, for some time, it has been known that synchronous activity in feedforward networks asymptotically either approaches an attractor with fixed waveform and amplitude, or fails to propagate. This has limited the classical synfire chain's ability to explain graded neuronal responses. Recently, we have shown that pulse-gated synfire chains are capable of propagating graded information coded in mean population current or firing rate amplitudes. In particular, we showed that it is possible to use one synfire chain to provide gating pulses and a second, pulse-gated synfire chain to propagate graded information. We called these circuits synfire-gated synfire chains (SGSCs). Here, we present SGSCs in which graded information can rapidly cascade through a neural circuit, and show a correspondence between this type of transfer and a mean-field model in which gating pulses overlap in time. We show that SGSCs are robust in the presence of variability in population size, pulse timing and synaptic strength. Finally, we demonstrate the computational capabilities of SGSC-based information coding by implementing a self-contained, spike-based, modular neural circuit that is triggered by streaming input, processes the input, then makes a decision based on the processed information and shuts itself down.

Quantum spin transistor with a Heisenberg spin chain

PubMed Central

Marchukov, O. V.; Volosniev, A. G.; Valiente, M.; Petrosyan, D.; Zinner, N. T.

2016-01-01

Spin chains are paradigmatic systems for the studies of quantum phases and phase transitions, and for quantum information applications, including quantum computation and short-distance quantum communication. Here we propose and analyse a scheme for conditional state transfer in a Heisenberg XXZ spin chain which realizes a quantum spin transistor. In our scheme, the absence or presence of a control spin excitation in the central gate part of the spin chain results in either perfect transfer of an arbitrary state of a target spin between the weakly coupled input and output ports, or its complete blockade at the input port. We also discuss a possible proof-of-concept realization of the corresponding spin chain with a one-dimensional ensemble of cold atoms with strong contact interactions. Our scheme is generally applicable to various implementations of tunable spin chains, and it paves the way for the realization of integrated quantum logic elements. PMID:27721438

Quantum spin transistor with a Heisenberg spin chain.

PubMed

Marchukov, O V; Volosniev, A G; Valiente, M; Petrosyan, D; Zinner, N T

2016-10-10

Spin chains are paradigmatic systems for the studies of quantum phases and phase transitions, and for quantum information applications, including quantum computation and short-distance quantum communication. Here we propose and analyse a scheme for conditional state transfer in a Heisenberg XXZ spin chain which realizes a quantum spin transistor. In our scheme, the absence or presence of a control spin excitation in the central gate part of the spin chain results in either perfect transfer of an arbitrary state of a target spin between the weakly coupled input and output ports, or its complete blockade at the input port. We also discuss a possible proof-of-concept realization of the corresponding spin chain with a one-dimensional ensemble of cold atoms with strong contact interactions. Our scheme is generally applicable to various implementations of tunable spin chains, and it paves the way for the realization of integrated quantum logic elements.

Photosynthetic water splitting by the Mn4Ca2+OX catalyst of photosystem II: its structure, robustness and mechanism.

PubMed

Barber, James

2017-01-01

The biological energy cycle of our planet is driven by photosynthesis whereby sunlight is absorbed by chlorophyll and other accessory pigments. The excitation energy is then efficiently transferred to a reaction centre where charge separation occurs in a few picoseconds. In the case of photosystem II (PSII), the energy of the charge transfer state is used to split water into oxygen and reducing equivalents. This is accomplished by the relatively low energy content of four photons of visible light. PSII is a large multi-subunit membrane protein complex embedded in the lipid environment of the thylakoid membranes of plants, algae and cyanobacteria. Four high energy electrons, together with four protons (4H+), are used to reduce plastoquinone (PQ), the terminal electron acceptor of PSII, to plastoquinol (PQH2). PQH2 passes its reducing equivalents to an electron transfer chain which feeds into photosystem I (PSI) where they gain additional reducing potential from a second light reaction which is necessary to drive CO2 reduction. The catalytic centre of PSII consists of a cluster of four Mn ions and a Ca2+ linked by oxo bonds. In addition, there are seven amino acid ligands. In this Article, I discuss the structure of this metal cluster, its stability and the probability that an acid-base (nucleophilic-electrophilic) mechanism catalyses the water splitting reaction on the surface of the metal-cluster. Evidence for this mechanism is presented from studies on water splitting catalysts consisting of organo-complexes of ruthenium and manganese and also by comparison with the enzymology of carbon monoxide dehydrogenase (CODH). Finally the relevance of our understanding of PSII is discussed in terms of artificial photosynthesis with emphasis on inorganic water splitting catalysts as oxygen generating photoelectrodes.

Respiratory Complex I in Bos taurus and Paracoccus denitrificans Pumps Four Protons across the Membrane for Every NADH Oxidized.

PubMed

Jones, Andrew J Y; Blaza, James N; Varghese, Febin; Hirst, Judy

2017-03-24

Respiratory complex I couples electron transfer between NADH and ubiquinone to proton translocation across an energy-transducing membrane to support the proton-motive force that drives ATP synthesis. The proton-pumping stoichiometry of complex I ( i.e. the number of protons pumped for each two electrons transferred) underpins all mechanistic proposals. However, it remains controversial and has not been determined for any of the bacterial enzymes that are exploited as model systems for the mammalian enzyme. Here, we describe a simple method for determining the proton-pumping stoichiometry of complex I in inverted membrane vesicles under steady-state ADP-phosphorylating conditions. Our method exploits the rate of ATP synthesis, driven by oxidation of NADH or succinate with different sections of the respiratory chain engaged in catalysis as a proxy for the rate of proton translocation and determines the stoichiometry of complex I by reference to the known stoichiometries of complexes III and IV. Using vesicles prepared from mammalian mitochondria (from Bos taurus ) and from the bacterium Paracoccus denitrificans , we show that four protons are pumped for every two electrons transferred in both cases. By confirming the four-proton stoichiometry for mammalian complex I and, for the first time, demonstrating the same value for a bacterial complex, we establish the utility of P. denitrificans complex I as a model system for the mammalian enzyme. P. denitrificans is the first system described in which mutagenesis in any complex I core subunit may be combined with quantitative proton-pumping measurements for mechanistic studies. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Hydrated Electron Transfer to Nucleobases in Aqueous Solutions Revealed by Ab Initio Molecular Dynamics Simulations.

PubMed

Zhao, Jing; Wang, Mei; Fu, Aiyun; Yang, Hongfang; Bu, Yuxiang

2015-08-03

We present an ab initio molecular dynamics (AIMD) simulation study into the transfer dynamics of an excess electron from its cavity-shaped hydrated electron state to a hydrated nucleobase (NB)-bound state. In contrast to the traditional view that electron localization at NBs (G/A/C/T), which is the first step for electron-induced DNA damage, is related only to dry or prehydrated electrons, and a fully hydrated electron no longer transfers to NBs, our AIMD simulations indicate that a fully hydrated electron can still transfer to NBs. We monitored the transfer dynamics of fully hydrated electrons towards hydrated NBs in aqueous solutions by using AIMD simulations and found that due to solution-structure fluctuation and attraction of NBs, a fully hydrated electron can transfer to a NB gradually over time. Concurrently, the hydrated electron cavity gradually reorganizes, distorts, and even breaks. The transfer could be completed in about 120-200 fs in four aqueous NB solutions, depending on the electron-binding ability of hydrated NBs and the structural fluctuation of the solution. The transferring electron resides in the π*-type lowest unoccupied molecular orbital of the NB, which leads to a hydrated NB anion. Clearly, the observed transfer of hydrated electrons can be attributed to the strong electron-binding ability of hydrated NBs over the hydrated electron cavity, which is the driving force, and the transfer dynamics is structure-fluctuation controlled. This work provides new insights into the evolution dynamics of hydrated electrons and provides some helpful information for understanding the DNA-damage mechanism in solution. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Electron transport chains of lactic acid bacteria - walking on crutches is part of their lifestyle

PubMed Central

Brooijmans, Rob; Hugenholtz, Jeroen

2009-01-01

A variety of lactic acid bacteria contain rudimentary electron transport chains that can be reconstituted by the addition of heme and menaquinone to the growth medium. These activated electron transport chains lead to higher biomass production and increased robustness, which is beneficial for industrial applications, but a major concern when dealing with pathogenic lactic acid bacteria. PMID:20948651

Traceability and Risk Analysis Strategies for Addressing Counterfeit Electronics in Supply Chains for Complex Systems.

PubMed

DiMase, Daniel; Collier, Zachary A; Carlson, Jinae; Gray, Robin B; Linkov, Igor

2016-10-01

Within the microelectronics industry, there is a growing concern regarding the introduction of counterfeit electronic parts into the supply chain. Even though this problem is widespread, there have been limited attempts to implement risk-based approaches for testing and supply chain management. Supply chain risk management tends to focus on the highly visible disruptions of the supply chain instead of the covert entrance of counterfeits; thus counterfeit risk is difficult to mitigate. This article provides an overview of the complexities of the electronics supply chain, and highlights some gaps in risk assessment practices. In particular, this article calls for enhanced traceability capabilities to track and trace parts at risk through various stages of the supply chain. Placing the focus on risk-informed decision making through the following strategies is needed, including prioritization of high-risk parts, moving beyond certificates of conformance, incentivizing best supply chain management practices, adoption of industry standards, and design and management for supply chain resilience. © 2016 Society for Risk Analysis.

Electron transfer and conformational change in complexes of trimethylamine dehydrogenase and electron transferring flavoprotein.

PubMed

Jones, Matthew; Talfournier, Francois; Bobrov, Anton; Grossmann, J Günter; Vekshin, Nikolai; Sutcliffe, Michael J; Scrutton, Nigel S

2002-03-08

The trimethylamine dehydrogenase-electron transferring flavoprotein (TMADH.ETF) electron transfer complex has been studied by fluorescence and absorption spectroscopies. These studies indicate that a series of conformational changes occur during the assembly of the TMADH.ETF electron transfer complex and that the kinetics of assembly observed with mutant TMADH (Y442F/L/G) or ETF (alpha R237A) complexes are much slower than are the corresponding rates of electron transfer in these complexes. This suggests that electron transfer does not occur in the thermodynamically most favorable state (which takes too long to form), but that one or more metastable states (which are formed more rapidly) are competent in transferring electrons from TMADH to ETF. Additionally, fluorescence spectroscopy studies of the TMADH.ETF complex indicate that ETF undergoes a stable conformational change (termed structural imprinting) when it interacts transiently with TMADH to form a second, distinct, structural form. The mutant complexes compromise imprinting of ETF, indicating a dependence on the native interactions present in the wild-type complex. The imprinted form of semiquinone ETF exhibits an enhanced rate of electron transfer to the artificial electron acceptor, ferricenium. Overall molecular conformations as probed by small-angle x-ray scattering studies are indistinguishable for imprinted and non-imprinted ETF, suggesting that changes in structure likely involve confined reorganizations within the vicinity of the FAD. Our results indicate a series of conformational events occur during the assembly of the TMADH.ETF electron transfer complex, and that the properties of electron transfer proteins can be affected lastingly by transient interaction with their physiological redox partners. This may have significant implications for our understanding of biological electron transfer reactions in vivo, because ETF encounters TMADH at all times in the cell. Our studies suggest that caution needs to be exercised in extrapolating the properties of in vitro interprotein electron transfer reactions to those occurring in vivo.

31 CFR 208.3 - Payment by electronic funds transfer.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 31 Money and Finance:Treasury 2 2011-07-01 2011-07-01 false Payment by electronic funds transfer... DISBURSEMENTS § 208.3 Payment by electronic funds transfer. Subject to § 208.4, and notwithstanding any other... electronic funds transfer. ...

48 CFR 18.124 - Electronic funds transfer.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 1 2011-10-01 2011-10-01 false Electronic funds transfer. 18.124 Section 18.124 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...

48 CFR 18.124 - Electronic funds transfer.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 1 2013-10-01 2013-10-01 false Electronic funds transfer. 18.124 Section 18.124 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...

31 CFR 208.3 - Payment by electronic funds transfer.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 31 Money and Finance:Treasury 2 2012-07-01 2012-07-01 false Payment by electronic funds transfer... DISBURSEMENTS § 208.3 Payment by electronic funds transfer. Subject to § 208.4, and notwithstanding any other... electronic funds transfer. ...

48 CFR 18.123 - Electronic funds transfer.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Electronic funds transfer. 18.123 Section 18.123 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...

48 CFR 18.124 - Electronic funds transfer.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 1 2012-10-01 2012-10-01 false Electronic funds transfer. 18.124 Section 18.124 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...

48 CFR 18.124 - Electronic funds transfer.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 1 2014-10-01 2014-10-01 false Electronic funds transfer. 18.124 Section 18.124 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...

Rheology of Hyperbranched Poly(triglyceride)-Based Thermoplastic Elastomers via RAFT polymerization

NASA Astrophysics Data System (ADS)

Yan, Mengguo; Cochran, Eric

2014-03-01

In this contribution we discuss how melt- and solid-state properties are influenced by the degree of branching and molecular weight in a family of hyperbranched thermoplastics derived from soybean oil. Acrylated epoxidized triglycerides from soybean oils have been polymerized to hyperbranched thermoplastic elastomers using reversible addition-fragmentation chain transfer (RAFT) polymerization. With the proper choice of chain transfer agent, both homopolymer and block copolymer can be synthesized. By changing the number of acrylic groups per triglycerides, the chain architectures can range from nearly linear to highly branched. We show how the fundamental viscoelastic properties (e.g. entanglement molecular weight, plateau modulus, etc.) are influenced by chain architecture and molecular weight.

Tuning electronic transport via hepta-alanine peptides junction by tryptophan doping.

PubMed

Guo, Cunlan; Yu, Xi; Refaely-Abramson, Sivan; Sepunaru, Lior; Bendikov, Tatyana; Pecht, Israel; Kronik, Leeor; Vilan, Ayelet; Sheves, Mordechai; Cahen, David

2016-09-27

Charge migration for electron transfer via the polypeptide matrix of proteins is a key process in biological energy conversion and signaling systems. It is sensitive to the sequence of amino acids composing the protein and, therefore, offers a tool for chemical control of charge transport across biomaterial-based devices. We designed a series of linear oligoalanine peptides with a single tryptophan substitution that acts as a "dopant," introducing an energy level closer to the electrodes' Fermi level than that of the alanine homopeptide. We investigated the solid-state electron transport (ETp) across a self-assembled monolayer of these peptides between gold contacts. The single tryptophan "doping" markedly increased the conductance of the peptide chain, especially when its location in the sequence is close to the electrodes. Combining inelastic tunneling spectroscopy, UV photoelectron spectroscopy, electronic structure calculations by advanced density-functional theory, and dc current-voltage analysis, the role of tryptophan in ETp is rationalized by charge tunneling across a heterogeneous energy barrier, via electronic states of alanine and tryptophan, and by relatively efficient direct coupling of tryptophan to a Au electrode. These results reveal a controlled way of modulating the electrical properties of molecular junctions by tailor-made "building block" peptides.

Sieving polymer synthesis by reversible addition fragmentation chain transfer polymerization.

PubMed

Nai, Yi Heng; Jones, Roderick C; Breadmore, Michael C

2013-12-01

Replaceable sieving polymers are the fundamental component for high resolution nucleic acids separation in CE. The choice of polymer and its physical properties play significant roles in influencing separation performance. Recently, reversible addition fragmentation chain transfer (RAFT) polymerization has been shown to be a versatile polymerization technique capable of yielding well defined polymers previously unattainable by conventional free radical polymerization. In this study, a high molecular weight PDMA at 765 000 gmol-1 with a PDI of 1.55 was successfully synthesized with the use of chain transfer agent - 2-propionic acidyl butyl trithiocarbonate (PABTC) in a multi-step sequential RAFT polymerization approach. This study represents the first demonstration of RAFT polymerization for synthesizing polymers with the molecular weight range suitable for high resolution DNA separation in sieving electrophoresis. Adjustment of pH in the reaction was found to be crucial for the successful RAFT polymerization of high molecular weight polymer as the buffered condition minimizes the effect of hydrolysis and aminolysis commonly associated with trithiocarbonate chain transfer agents. The separation efficiency of PABTC-PDMA was found to have marginally superior separation performance compared to a commercial PDMA formulation, POP™-CAP, of similar molecular weight range.

Respiratory enzymes of Thiobacillus ferrooxidans. Kinetic properties of an acid-stable iron:rusticyanin oxidoreductase.

PubMed

Blake, R C; Shute, E A

1994-08-09

Rusticyanin is an acid-stable, soluble blue copper protein found in abundance in the periplasmic space of Thiobacillus ferrooxidans, an acidophilic bacterium capable of growing autotrophically on soluble ferrous sulfate. An acid-stable iron:rusticyanin oxidoreductase activity was partially purified from cell-free extracts of T. ferrooxidans. The enzyme-catalyzed, iron-dependent reduction of the rusticyanin exhibited three kinetic properties characteristic of aerobic iron oxidation by whole cells. (i) A survey of 14 different anions indicated that catalysis by the oxidoreductase occurred only in the presence of sulfate or selenate, an anion specificity identical to that of whole cells. (ii) Saturation with both sulfatoiron(II) and the catalyst produced a concentration-independent rate constant of 3 s-1 for the reduction of the rusticyanin, which is an electron transfer reaction sufficiently rapid to account for the flux of electrons through the iron respiratory chain. (iii) Values for the enzyme-catalyzed pseudo-first-order rate constants for the reduction of the rusticyanin showed a hyperbolic dependence on the concentration of sulfatoiron(II) with a half-maximal effect at 300 microM, a value similar to the apparent KM for iron shown by whole cells. On the basis of these favorable comparisons between the behavior patterns of isolated biomolecules and those of whole cells, this iron:rusticyanin oxidoreductase is postulated to be the primary cellular oxidant of ferrous ions in the iron respiratory electron transport chain of T. ferrooxidans.

Composition of the mitochondrial electron transport chain in acanthamoeba castellanii: structural and evolutionary insights.

PubMed

Gawryluk, Ryan M R; Chisholm, Kenneth A; Pinto, Devanand M; Gray, Michael W

2012-11-01

The mitochondrion, derived in evolution from an α-proteobacterial progenitor, plays a key metabolic role in eukaryotes. Mitochondria house the electron transport chain (ETC) that couples oxidation of organic substrates and electron transfer to proton pumping and synthesis of ATP. The ETC comprises several multiprotein enzyme complexes, all of which have counterparts in bacteria. However, mitochondrial ETC assemblies from animals, plants and fungi are generally more complex than their bacterial counterparts, with a number of 'supernumerary' subunits appearing early in eukaryotic evolution. Little is known, however, about the ETC of unicellular eukaryotes (protists), which are key to understanding the evolution of mitochondria and the ETC. We present an analysis of the ETC proteome from Acanthamoeba castellanii, an ecologically, medically and evolutionarily important member of Amoebozoa (sister to Opisthokonta). Data obtained from tandem mass spectrometric (MS/MS) analyses of purified mitochondria as well as ETC complexes isolated via blue native polyacrylamide gel electrophoresis are combined with the results of bioinformatic queries of sequence databases. Our bioinformatic analyses have identified most of the ETC subunits found in other eukaryotes, confirming and extending previous observations. The assignment of proteins as ETC subunits by MS/MS provides important insights into the primary structures of ETC proteins and makes possible, through the use of sensitive profile-based similarity searches, the identification of novel constituents of the ETC along with the annotation of highly divergent but phylogenetically conserved ETC subunits. © 2012 Elsevier B.V. All rights reserved.

Photoinduced electron transfer from semiconductor quantum dots to metal oxide nanoparticles

PubMed Central

Tvrdy, Kevin; Frantsuzov, Pavel A.; Kamat, Prashant V.

2011-01-01

Quantum dot-metal oxide junctions are an integral part of next-generation solar cells, light emitting diodes, and nanostructured electronic arrays. Here we present a comprehensive examination of electron transfer at these junctions, using a series of CdSe quantum dot donors (sizes 2.8, 3.3, 4.0, and 4.2 nm in diameter) and metal oxide nanoparticle acceptors (SnO2, TiO2, and ZnO). Apparent electron transfer rate constants showed strong dependence on change in system free energy, exhibiting a sharp rise at small driving forces followed by a modest rise further away from the characteristic reorganization energy. The observed trend mimics the predicted behavior of electron transfer from a single quantum state to a continuum of electron accepting states, such as those present in the conduction band of a metal oxide nanoparticle. In contrast with dye-sensitized metal oxide electron transfer studies, our systems did not exhibit unthermalized hot-electron injection due to relatively large ratios of electron cooling rate to electron transfer rate. To investigate the implications of these findings in photovoltaic cells, quantum dot-metal oxide working electrodes were constructed in an identical fashion to the films used for the electron transfer portion of the study. Interestingly, the films which exhibited the fastest electron transfer rates (SnO2) were not the same as those which showed the highest photocurrent (TiO2). These findings suggest that, in addition to electron transfer at the quantum dot-metal oxide interface, other electron transfer reactions play key roles in the determination of overall device efficiency. PMID:21149685

Photoinduced electron transfer from semiconductor quantum dots to metal oxide nanoparticles.

PubMed

Tvrdy, Kevin; Frantsuzov, Pavel A; Kamat, Prashant V

2011-01-04

Quantum dot-metal oxide junctions are an integral part of next-generation solar cells, light emitting diodes, and nanostructured electronic arrays. Here we present a comprehensive examination of electron transfer at these junctions, using a series of CdSe quantum dot donors (sizes 2.8, 3.3, 4.0, and 4.2 nm in diameter) and metal oxide nanoparticle acceptors (SnO(2), TiO(2), and ZnO). Apparent electron transfer rate constants showed strong dependence on change in system free energy, exhibiting a sharp rise at small driving forces followed by a modest rise further away from the characteristic reorganization energy. The observed trend mimics the predicted behavior of electron transfer from a single quantum state to a continuum of electron accepting states, such as those present in the conduction band of a metal oxide nanoparticle. In contrast with dye-sensitized metal oxide electron transfer studies, our systems did not exhibit unthermalized hot-electron injection due to relatively large ratios of electron cooling rate to electron transfer rate. To investigate the implications of these findings in photovoltaic cells, quantum dot-metal oxide working electrodes were constructed in an identical fashion to the films used for the electron transfer portion of the study. Interestingly, the films which exhibited the fastest electron transfer rates (SnO(2)) were not the same as those which showed the highest photocurrent (TiO(2)). These findings suggest that, in addition to electron transfer at the quantum dot-metal oxide interface, other electron transfer reactions play key roles in the determination of overall device efficiency.

Homochiral Evolution in Self-Assembled Chiral Polymers and Block Copolymers.

PubMed

Wen, Tao; Wang, Hsiao-Fang; Li, Ming-Chia; Ho, Rong-Ming

2017-04-18

The significance of chirality transfer is not only involved in biological systems, such as the origin of homochiral structures in life but also in man-made chemicals and materials. How the chiral bias transfers from molecular level (molecular chirality) to helical chain (conformational chirality) and then to helical superstructure or phase (hierarchical chirality) from self-assembly is vital for the chemical and biological processes in nature, such as communication, replication, and enzyme catalysis. In this Account, we summarize the methodologies for the examination of homochiral evolution at different length scales based on our recent studies with respect to the self-assembly of chiral polymers and chiral block copolymers (BCPs*). A helical (H*) phase to distinguish its P622 symmetry from that of normal hexagonally packed cylinder phase was discovered in the self-assembly of BCPs* due to the chirality effect on BCP self-assembly. Enantiomeric polylactide-containing BCPs*, polystyrene-b-poly(l-lactide) (PS-PLLA) and polystyrene-b-poly(d-lactide) (PS-PDLA), were synthesized for the examination of homochiral evolution. The optical activity (molecular chirality) of constituted chiral repeating unit in the chiral polylactide is detected by electronic circular dichroism (ECD) whereas the conformational chirality of helical polylactide chain can be explicitly determined by vibrational circular dichroism (VCD). The H* phases of the self-assembled polylactide-containing BCPs* can be directly visualized by 3D transmission electron microscopy (3D TEM) technique at which the handedness (hierarchical chirality) of the helical nanostructure is thus determined. The results from the ECD, VCD, and 3D TEM for the investigated chirality at different length scales suggest the homochiral evolution in the self-assembly of the BCPs*. For chiral polylactides, twisted lamellae in crystalline banded spherulite can be formed by dense packing scheme and effective interactions upon helical chains from self-assembly. The handedness of the twisted lamella can be determined by using rotation experiment of polarized light microscopy (PLM). Similar to the self-assembly of BCPs*, the examined results suggest the homochiral evolution in the crystallized chiral polylactides. The results presented in this Account demonstrate the notable progress in the spectral and morphological determination for the examination of molecular, conformational, and hierarchical chirality in self-assembled twisted superstructures of chiral polymers and helical phases of block copolymers and suggest the attainability of homochiral evolution in the self-assembly of chiral homopolymers and BCPs*. The suggested methodologies for the understanding of the mechanisms of the chirality transfer at different length scales provide the approaches to give Supporting Information for disclosing the mysteries of the homochiral evolution from molecular level.

PATHWAYS - ELECTRON TUNNELING PATHWAYS IN PROTEINS

NASA Technical Reports Server (NTRS)

Beratan, D. N.

1994-01-01

The key to understanding the mechanisms of many important biological processes such as photosynthesis and respiration is a better understanding of the electron transfer processes which take place between metal atoms (and other groups) fixed within large protein molecules. Research is currently focused on the rate of electron transfer and the factors that influence it, such as protein composition and the distance between metal atoms. Current models explain the swift transfer of electrons over considerable distances by postulating bridge-mediated tunneling, or physical tunneling pathways, made up of interacting bonds in the medium around and between donor and acceptor sites. The program PATHWAYS is designed to predict the route along which electrons travel in the transfer processes. The basic strategy of PATHWAYS is to begin by recording each possible path element on a connectivity list, including in each entry which two atoms are connected and what contribution the connection would make to the overall rate if it were included in a pathway. The list begins with the bonded molecular structure (including the backbone sequence and side chain connectivity), and then adds probable hydrogen bond links and through-space contacts. Once this list is completed, the program runs a tree search from the donor to the acceptor site to find the dominant pathways. The speed and efficiency of the computer search offers an improvement over manual techniques. PATHWAYS is written in FORTRAN 77 for execution on DEC VAX series computers running VMS. The program inputs data from four data sets and one structure file. The software was written to input BIOGRAF (old format) structure files based on x-ray crystal structures and outputs ASCII files listing the best pathways and BIOGRAF vector files containing the paths. Relatively minor changes could be made in the input format statements for compatibility with other graphics software. The executable and source code are included with the distribution. The main memory requirement for execution is 2.6 Mb. This program is available in DEC VAX BACKUP format on a 9-track 1600 BPI magnetic tape (standard distribution) or on a TK50 tape cartridge. PATHWAYS was developed in 1988. PATHWAYS is a copyrighted work with all copyright vested in NASA. DEC, VAX, VMS, and TK50 are trademarks of Digital Equipment Corporation. BIOGRAF is a trademark of Molecular Simulations, Inc., Sunnyvale, CA.

Modular electron transfer circuits for synthetic biology

PubMed Central

Agapakis, Christina M

2010-01-01

Electron transfer is central to a wide range of essential metabolic pathways, from photosynthesis to fermentation. The evolutionary diversity and conservation of proteins that transfer electrons makes these pathways a valuable platform for engineered metabolic circuits in synthetic biology. Rational engineering of electron transfer pathways containing hydrogenases has the potential to lead to industrial scale production of hydrogen as an alternative source of clean fuel and experimental assays for understanding the complex interactions of multiple electron transfer proteins in vivo. We designed and implemented a synthetic hydrogen metabolism circuit in Escherichia coli that creates an electron transfer pathway both orthogonal to and integrated within existing metabolism. The design of such modular electron transfer circuits allows for facile characterization of in vivo system parameters with applications toward further engineering for alternative energy production. PMID:21468209

Nacre-mimetic clay/xyloglucan bionanocomposites: a chemical modification route for hygromechanical performance at high humidity.

PubMed

Kochumalayil, Joby J; Morimune, Seira; Nishino, Takashi; Ikkala, Olli; Walther, Andreas; Berglund, Lars A

2013-11-11

Nacre-mimetic bionanocomposites of high montmorillonite (MTM) clay content, prepared from hydrocolloidal suspensions, suffer from reduced strength and stiffness at high relative humidity. We address this problem by chemical modification of xyloglucan in (XG)/MTM nacre-mimetic nanocomposites, by subjecting the XG to regioselective periodate oxidation of side chains to enable it to form covalent cross-links to hydroxyl groups in neighboring XG chains or to the MTM surface. The resulting materials are analyzed by FTIR spectroscopy, thermogravimetric analysis, carbohydrate analysis, calorimetry, X-ray diffraction, scanning electron microscopy, tensile tests, and oxygen barrier properties. We compare the resulting mechanical properties at low and high relative humidity. The periodate oxidation leads to a strong increase in modulus and strength of the materials. A modulus of 30 GPa for cross-linked composite at 50% relative humidity compared with 13.7 GPa for neat XG/MTM demonstrates that periodate oxidation of the XG side chains leads to crucially improved stress transfer at the XG/MTM interface, possibly through covalent bond formation. This enhanced interfacial adhesion and internal cross-linking of the matrix moreover preserves the mechanical properties at high humidity condition and leads to a Young's modulus of 21 GPa at 90%RH.

Impact of aryloxy initiators on the living and immortal polymerization of lactide.

PubMed

Chile, L-E; Ebrahimi, T; Wong, A; Aluthge, D C; Hatzikiriakos, S G; Mehrkhodavandi, P

2017-05-23

This report describes two different methodologies for the synthesis of aryl end-functionalized poly(lactide)s (PLAs) catalyzed by indium complexes. In the first method, a series of para-functionalized phenoxy-bridged dinuclear indium complexes [(NNO)InCl] 2 (μ-Cl)(μ-OPh R ) (R = OMe (1), Me (2), H (3), Br (4), NO 2 (5)) were synthesized and fully characterized. The solution and solid state structures of these complexes reflect the electronic differences between these initiators. The polymerization rates correlate with the electron donating ability of the phenoxy initiators: the para-nitro substituted complex 5 is essentially inactive. However, the para-methoxy variant, while less active than the ethoxy-bridged complex [(NNO)InCl] 2 (μ-Cl)(μ-OEt) (A), shows sufficient activity. Alternatively, aryl-capped PLAs were synthesized via immortal polymerization of PLA with A in the presence of a range of arylated chain transfer agents. Certain aromatic diols shut down polymerization by chelating one indium centre to form a stable metal complex. Immortal ROP was successful when using phenol, and 1,5-naphthalenediol. These polymers were analysed and chain end fidelity was confirmed using 1 H NMR spectroscopy, MALDI-TOF mass spectrometry, and UV-Vis spectroscopy. This study shed light on possible speciation when attempting to generate PLA-lignin copolymers.

Electrochemical control over photoinduced electron transfer and trapping in CdSe-CdTe quantum-dot solids.

PubMed

Boehme, Simon C; Walvis, T Ardaan; Infante, Ivan; Grozema, Ferdinand C; Vanmaekelbergh, Daniël; Siebbeles, Laurens D A; Houtepen, Arjan J

2014-07-22

Understanding and controlling charge transfer between different kinds of colloidal quantum dots (QDs) is important for devices such as light-emitting diodes and solar cells and for thermoelectric applications. Here we study photoinduced electron transfer between CdTe and CdSe QDs in a QD film. We find that very efficient electron trapping in CdTe QDs obstructs electron transfer to CdSe QDs under most conditions. Only the use of thiol ligands results in somewhat slower electron trapping; in this case the competition between trapping and electron transfer results in a small fraction of electrons being transferred to CdSe. However, we demonstrate that electron trapping can be controlled and even avoided altogether by using the unique combination of electrochemistry and transient absorption spectroscopy. When the Fermi level is raised electrochemically, traps are filled with electrons and electron transfer from CdTe to CdSe QDs occurs with unity efficiency. These results show the great importance of knowing and controlling the Fermi level in QD films and open up the possibility of studying the density of trap states in QD films as well as the systematic investigation of the intrinsic electron transfer rates in donor-acceptor films.

Uptake of perfluorinated alkyl acids by hydroponically grown lettuce (Lactuca sativa).

PubMed

Felizeter, Sebastian; McLachlan, Michael S; de Voogt, Pim

2012-11-06

An uptake study was carried out to assess the potential human exposure to perfluorinated alkyl acids (PFAAs) through the ingestion of vegetables. Lettuce (Lactuca sativa) was grown in PFAA-spiked nutrient solutions at four different concentrations, ranging from 10 ng/L to 10 μg/L. Eleven perfluorinated carboxylic acids (PFCAs) and three perfluorinated sulfonic acids (PFSAs) were analyzed by HPLC-MS/MS. At the end of the experiment, the major part of the total mass of each of the PFAAs (except the short-chain, C4-C7, PFCAs) taken up by plants appeared to be retained in the nonedible part, viz. the roots. Root concentration factors (RCF), foliage/root concentration factors (FRCF), and transpiration stream concentration factors (TSCF) were calculated. For the long chained PFAAs, RCF values were highest, whereas FRCF were lowest. This indicates that uptake by roots is likely governed by sorption of PFAAs to lipid-rich root solids. Translocation from roots to shoots is restricted and highly depending on the hydrophobicity of the compounds. Although the TSCF show that longer-chain PFCAs (e.g., perfluorododecanoic acid) get better transferred from the nutrient solution to the foliage than shorter-chain PFCAs (e.g., perfluoroheptanoic acid), the major fraction of longer-chain PFCAs is found in roots due to additional adsorption from the spiked solution. Due to the strong electron-withdrawing effect of the fluorine atoms the role of the negative charge of the dissociated PFAAs is likely insignificant.

Automated side-chain model building and sequence assignment by template matching.

PubMed

Terwilliger, Thomas C

2003-01-01

An algorithm is described for automated building of side chains in an electron-density map once a main-chain model is built and for alignment of the protein sequence to the map. The procedure is based on a comparison of electron density at the expected side-chain positions with electron-density templates. The templates are constructed from average amino-acid side-chain densities in 574 refined protein structures. For each contiguous segment of main chain, a matrix with entries corresponding to an estimate of the probability that each of the 20 amino acids is located at each position of the main-chain model is obtained. The probability that this segment corresponds to each possible alignment with the sequence of the protein is estimated using a Bayesian approach and high-confidence matches are kept. Once side-chain identities are determined, the most probable rotamer for each side chain is built into the model. The automated procedure has been implemented in the RESOLVE software. Combined with automated main-chain model building, the procedure produces a preliminary model suitable for refinement and extension by an experienced crystallographer.

How can we make stable linear monoatomic chains? Gold-cesium binary subnanowires as an example of a charge-transfer-driven approach to alloying.

PubMed

Choi, Young Cheol; Lee, Han Myoung; Kim, Woo Youn; Kwon, S K; Nautiyal, Tashi; Cheng, Da-Yong; Vishwanathan, K; Kim, Kwang S

2007-02-16

On the basis of first-principles calculations of clusters and one dimensional infinitely long subnanowires of the binary systems, we find that alkali-noble metal alloy wires show better linearity and stability than either pure alkali metal or noble metal wires. The enhanced alternating charge buildup on atoms by charge transfer helps the atoms line up straight. The cesium doped gold wires showing significant charge transfer from cesium to gold can be stabilized as linear or circular monoatomic chains.

Hot-electron transfer in quantum-dot heterojunction films.

PubMed

Grimaldi, Gianluca; Crisp, Ryan W; Ten Brinck, Stephanie; Zapata, Felipe; van Ouwendorp, Michiko; Renaud, Nicolas; Kirkwood, Nicholas; Evers, Wiel H; Kinge, Sachin; Infante, Ivan; Siebbeles, Laurens D A; Houtepen, Arjan J

2018-06-13

Thermalization losses limit the photon-to-power conversion of solar cells at the high-energy side of the solar spectrum, as electrons quickly lose their energy relaxing to the band edge. Hot-electron transfer could reduce these losses. Here, we demonstrate fast and efficient hot-electron transfer between lead selenide and cadmium selenide quantum dots assembled in a quantum-dot heterojunction solid. In this system, the energy structure of the absorber material and of the electron extracting material can be easily tuned via a variation of quantum-dot size, allowing us to tailor the energetics of the transfer process for device applications. The efficiency of the transfer process increases with excitation energy as a result of the more favorable competition between hot-electron transfer and electron cooling. The experimental picture is supported by time-domain density functional theory calculations, showing that electron density is transferred from lead selenide to cadmium selenide quantum dots on the sub-picosecond timescale.

Heat conduction in chain polymer liquids: molecular dynamics study on the contributions of inter- and intramolecular energy transfer.

PubMed

Ohara, Taku; Yuan, Tan Chia; Torii, Daichi; Kikugawa, Gota; Kosugi, Naohiro

2011-07-21

In this paper, the molecular mechanisms which determine the thermal conductivity of long chain polymer liquids are discussed, based on the results observed in molecular dynamics simulations. Linear n-alkanes, which are typical polymer molecules, were chosen as the target of our studies. Non-equilibrium molecular dynamics simulations of bulk liquid n-alkanes under a constant temperature gradient were performed. Saturated liquids of n-alkanes with six different chain lengths were examined at the same reduced temperature (0.7T(c)), and the contributions of inter- and intramolecular energy transfer to heat conduction flux, which were identified as components of heat flux by the authors' previous study [J. Chem. Phys. 128, 044504 (2008)], were observed. The present study compared n-alkane liquids with various molecular lengths at the same reduced temperature and corresponding saturated densities, and found that the contribution of intramolecular energy transfer to the total heat flux, relative to that of intermolecular energy transfer, increased with the molecular length. The study revealed that in long chain polymer liquids, thermal energy is mainly transferred in the space along the stiff intramolecular bonds. This finding implies a connection between anisotropic thermal conductivity and the orientation of molecules in various organized structures with long polymer molecules aligned in a certain direction, which includes confined polymer liquids and self-organized structures such as membranes of amphiphilic molecules in water.

Electron-transfer oxidation properties of DNA bases and DNA oligomers.

PubMed

Fukuzumi, Shunichi; Miyao, Hiroshi; Ohkubo, Kei; Suenobu, Tomoyoshi

2005-04-21

Kinetics for the thermal and photoinduced electron-transfer oxidation of a series of DNA bases with various oxidants having the known one-electron reduction potentials (E(red)) in an aqueous solution at 298 K were examined, and the resulting electron-transfer rate constants (k(et)) were evaluated in light of the free energy relationship of electron transfer to determine the one-electron oxidation potentials (E(ox)) of DNA bases and the intrinsic barrier of the electron transfer. Although the E(ox) value of GMP at pH 7 is the lowest (1.07 V vs SCE) among the four DNA bases, the highest E(ox) value (CMP) is only 0.19 V higher than that of GMP. The selective oxidation of GMP in the thermal electron-transfer oxidation of GMP results from a significant decrease in the pH dependent oxidation potential due to the deprotonation of GMP*+. The one-electron reduced species of the photosensitizer produced by photoinduced electron transfer are observed as the transient absorption spectra when the free energy change of electron transfer is negative. The rate constants of electron-transfer oxidation of the guanine moieties in DNA oligomers with Fe(bpy)3(3+) and Ru(bpy)3(3+) were also determined using DNA oligomers containing different guanine (G) sequences from 1 to 10 G. The rate constants of electron-transfer oxidation of the guanine moieties in single- and double-stranded DNA oligomers with Fe(bpy)3(2+) and Ru(bpy)3(3+) are dependent on the number of sequential guanine molecules as well as on pH.

Transfer of the cytochrome P450-dependent dhurrin pathway from Sorghum bicolor into Nicotiana tabacum chloroplasts for light-driven synthesis

PubMed Central

Gnanasekaran, Thiyagarajan; Karcher, Daniel; Nielsen, Agnieszka Zygadlo; Martens, Helle Juel; Ruf, Stephanie; Kroop, Xenia; Olsen, Carl Erik; Motawie, Mohammed Saddik; Pribil, Mathias; Møller, Birger Lindberg; Bock, Ralph; Jensen, Poul Erik

2016-01-01

Plant chloroplasts are light-driven cell factories that have great potential to act as a chassis for metabolic engineering applications. Using plant chloroplasts, we demonstrate how photosynthetic reducing power can drive a metabolic pathway to synthesise a bio-active natural product. For this purpose, we stably engineered the dhurrin pathway from Sorghum bicolor into the chloroplasts of Nicotiana tabacum (tobacco). Dhurrin is a cyanogenic glucoside and its synthesis from the amino acid tyrosine is catalysed by two membrane-bound cytochrome P450 enzymes (CYP79A1 and CYP71E1) and a soluble glucosyltransferase (UGT85B1), and is dependent on electron transfer from a P450 oxidoreductase. The entire pathway was introduced into the chloroplast by integrating CYP79A1, CYP71E1, and UGT85B1 into a neutral site of the N. tabacum chloroplast genome. The two P450s and the UGT85B1 were functional when expressed in the chloroplasts and converted endogenous tyrosine into dhurrin using electrons derived directly from the photosynthetic electron transport chain, without the need for the presence of an NADPH-dependent P450 oxidoreductase. The dhurrin produced in the engineered plants amounted to 0.1–0.2% of leaf dry weight compared to 6% in sorghum. The results obtained pave the way for plant P450s involved in the synthesis of economically important compounds to be engineered into the thylakoid membrane of chloroplasts, and demonstrate that their full catalytic cycle can be driven directly by photosynthesis-derived electrons. PMID:26969746

Anaerobic Sulfur Metabolism Coupled to Dissimilatory Iron Reduction in the Extremophile Acidithiobacillus ferrooxidans

PubMed Central

Osorio, Héctor; Mangold, Stefanie; Denis, Yann; Ñancucheo, Ivan; Esparza, Mario; Johnson, D. Barrie; Bonnefoy, Violaine; Dopson, Mark

2013-01-01

Gene transcription (microarrays) and protein levels (proteomics) were compared in cultures of the acidophilic chemolithotroph Acidithiobacillus ferrooxidans grown on elemental sulfur as the electron donor under aerobic and anaerobic conditions, using either molecular oxygen or ferric iron as the electron acceptor, respectively. No evidence supporting the role of either tetrathionate hydrolase or arsenic reductase in mediating the transfer of electrons to ferric iron (as suggested by previous studies) was obtained. In addition, no novel ferric iron reductase was identified. However, data suggested that sulfur was disproportionated under anaerobic conditions, forming hydrogen sulfide via sulfur reductase and sulfate via heterodisulfide reductase and ATP sulfurylase. Supporting physiological evidence for H2S production came from the observation that soluble Cu2+ included in anaerobically incubated cultures was precipitated (seemingly as CuS). Since H2S reduces ferric iron to ferrous in acidic medium, its production under anaerobic conditions indicates that anaerobic iron reduction is mediated, at least in part, by an indirect mechanism. Evidence was obtained for an alternative model implicating the transfer of electrons from S0 to Fe3+ via a respiratory chain that includes a bc1 complex and a cytochrome c. Central carbon pathways were upregulated under aerobic conditions, correlating with higher growth rates, while many Calvin-Benson-Bassham cycle components were upregulated during anaerobic growth, probably as a result of more limited access to carbon dioxide. These results are important for understanding the role of A. ferrooxidans in environmental biogeochemical metal cycling and in industrial bioleaching operations. PMID:23354702

Distinctive Responses of Ribulose-1,5-Bisphosphate Carboxylase and Carbonic Anhydrase in Wheat Leaves to Nitrogen Nutrition and their Possible Relationships to CO2-Transfer Resistance 1

PubMed Central

Makino, Amane; Sakashita, Hiroshi; Hidema, Jun; Mae, Tadahiko; Ojima, Kunihiko; Osmond, Barry

1992-01-01

The amounts of ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco), total chlorophyll (Chl), and total leaf nitrogen were measured in fully expanded, young leaves of wheat (Triticum aestivum L.), rice (Oryza sativa L.), spinach (Spinacia oleracea L.), bean (Phaseolus vulgaris L.), and pea (Pisum sativum L.). In addition, the activities of whole-chain electron transport and carbonic anhydrase were measured. All plants were grown hydroponically at different nitrogen concentrations. Although a greater than proportional increase in Rubisco content relative to leaf nitrogen content and Chl was found with increasing nitrogen supply for rice, spinach, bean, and pea, the ratio of Rubisco to total leaf nitrogen or Chl in wheat was essentially independent of nitrogen treatment. In addition, the ratio of Rubisco to electron transport activities remained constant only in wheat. Nevertheless, gas-exchange analysis showed that the in vivo balance between the capacities of Rubisco and electron transport in wheat, rice, and spinach remained almost constant, irrespective of nitrogen treatment. The in vitro carbonic anhydrase activity in wheat was very low and strongly responsive to increasing nitrogen content. Such a response was not found for the other C3 plants examined, which had 10- to 30-fold higher carbonic anhydrase activity than wheat at any leaf-nitrogen content. These distinctive responses of carbonic anhydrase activity in wheat were discussed in relation to CO2-transfer resistance and the in vivo balance between the capacities of Rubisco and electron transport. PMID:16653191

14 CFR 1274.931 - Electronic funds transfer payment methods.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 14 Aeronautics and Space 5 2011-01-01 2010-01-01 true Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS WITH COMMERCIAL FIRMS Other Provisions and Special Conditions § 1274.931 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods July 2002 Payments under this...

77 FR 40459 - Electronic Fund Transfers (Regulation E); Correction

Federal Register 2010, 2011, 2012, 2013, 2014

2012-07-10

... Electronic Fund Transfers (Regulation E); Correction AGENCY: Bureau of Consumer Financial Protection. ACTION... published the Final Rule (77 FR 6194), which implements the Electronic Fund Transfer Act, and the official... Sec. 1005.3(a) in the interim final rule, Electronic Fund Transfers (Regulation E), published on...

14 CFR 1274.931 - Electronic funds transfer payment methods.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 14 Aeronautics and Space 5 2013-01-01 2013-01-01 false Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS WITH COMMERCIAL FIRMS Other Provisions and Special Conditions § 1274.931 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods July 2002 Payments under this...

Electron Transport Chain-dependent and -independent Mechanisms of Mitochondrial H2O2 Emission during Long-chain Fatty Acid Oxidation*

PubMed Central

Seifert, Erin L.; Estey, Carmen; Xuan, Jian Y.; Harper, Mary-Ellen

2010-01-01

Oxidative stress in skeletal muscle is a hallmark of various pathophysiologic states that also feature increased reliance on long-chain fatty acid (LCFA) substrate, such as insulin resistance and exercise. However, little is known about the mechanistic basis of the LCFA-induced reactive oxygen species (ROS) burden in intact mitochondria, and elucidation of this mechanistic basis was the goal of this study. Specific aims were to determine the extent to which LCFA catabolism is associated with ROS production and to gain mechanistic insights into the associated ROS production. Because intermediates and by-products of LCFA catabolism may interfere with antioxidant mechanisms, we predicted that ROS formation during LCFA catabolism reflects a complex process involving multiple sites of ROS production as well as modified mitochondrial function. Thus, we utilized several complementary approaches to probe the underlying mechanism(s). Using skeletal muscle mitochondria, our findings indicate that even a low supply of LCFA is associated with ROS formation in excess of that generated by NADH-linked substrates. Moreover, ROS production was evident across the physiologic range of membrane potential and was relatively insensitive to membrane potential changes. Determinations of topology and membrane potential as well as use of inhibitors revealed complex III and the electron transfer flavoprotein (ETF) and ETF-oxidoreductase, as likely sites of ROS production. Finally, ROS production was sensitive to matrix levels of LCFA catabolic intermediates, indicating that mitochondrial export of LCFA catabolic intermediates can play a role in determining ROS levels. PMID:20032466

Choline and dimethylglycine produce superoxide/hydrogen peroxide from the electron transport chain in liver mitochondria.

PubMed

Mailloux, Ryan J; Young, Adrian; Chalker, Julia; Gardiner, Danielle; O'Brien, Marisa; Slade, Liam; Brosnan, John T

2016-12-01

Here, we report that choline and dimethylglycine can stimulate reactive oxygen species (ROS) production in liver mitochondria. Choline stimulated O 2 ˙ - /H 2 O 2 formation at a concentration of 5 μm. We also observed that Complex II and III inhibitors, atpenin A5 and myxothiazol, collectively induced a 95% decrease in O 2 ˙ - /H 2 O 2 production indicating both sites serve as the main sources of ROS during choline oxidation. Dimethylglycine, an intermediate of choline oxidation, was a more effective ROS generator. Rates of production were ~ 43% higher than choline-mediated O 2 ˙ - /H 2 O 2 production. The main site for dimethylglycine-mediated ROS production was via reverse electron transfer to Complex I. Our results demonstrate that metabolism of essential metabolites involved in methionine and folic acid biosynthesis can stimulate mitochondrial ROS production. © 2016 Federation of European Biochemical Societies.

Respiratory arsenate reductase as a bidirectional enzyme

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richey, Christine; Chovanec, Peter; Department of Chemistry and Biochemistry, Duquesne University, Pittsburgh, PA 15282

2009-05-01

The haloalkaliphilic bacterium Alkalilimnicola ehrlichii is capable of anaerobic chemolithoautotrophic growth by coupling the oxidation of arsenite (As(III)) to the reduction of nitrate and carbon dioxide. Analysis of its complete genome indicates that it lacks a conventional arsenite oxidase (Aox), but instead possesses two operons that each encode a putative respiratory arsenate reductase (Arr). Here we show that one homolog is expressed under chemolithoautotrophic conditions and exhibits both arsenite oxidase and arsenate reductase activity. We also demonstrate that Arr from two arsenate respiring bacteria, Alkaliphilus oremlandii and Shewanella sp. strain ANA-3, is also biochemically reversible. Thus Arr can function asmore » a reductase or oxidase. Its physiological role in a specific organism, however, may depend on the electron potentials of the molybdenum center and [Fe-S] clusters, additional subunits, or constitution of the electron transfer chain. This versatility further underscores the ubiquity and antiquity of microbial arsenic metabolism.« less

Respiratory arsenate reductase as a bidirectional enzyme

USGS Publications Warehouse

Richey, C.; Chovanec, P.; Hoeft, S.E.; Oremland, R.S.; Basu, P.; Stolz, J.F.

2009-01-01

The haloalkaliphilic bacterium Alkalilimnicola ehrlichii is capable of anaerobic chemolithoautotrophic growth by coupling the oxidation of arsenite (As(III)) to the reduction of nitrate and carbon dioxide. Analysis of its complete genome indicates that it lacks a conventional arsenite oxidase (Aox), but instead possesses two operons that each encode a putative respiratory arsenate reductase (Arr). Here we show that one homolog is expressed under chemolithoautotrophic conditions and exhibits both arsenite oxidase and arsenate reductase activity. We also demonstrate that Arr from two arsenate respiring bacteria, Alkaliphilus oremlandii and Shewanella sp. strain ANA-3, is also biochemically reversible. Thus Arr can function as a reductase or oxidase. Its physiological role in a specific organism, however, may depend on the electron potentials of the molybdenum center and [Fe–S] clusters, additional subunits, or constitution of the electron transfer chain. This versatility further underscores the ubiquity and antiquity of microbial arsenic metabolism.

Doping Scheme in Atomic Chain Electronics

NASA Technical Reports Server (NTRS)

Toshishige, Yamada

1997-01-01

Due to the dramatic reduction in MOS size, there appear many unwanted effects. In these small devices, the number of dopant atoms in the channel is not macroscopic and electrons may suffer significantly different scattering from device to device since the spatial distribution of dopant atoms is no longer regarded as continuous. This prohibits integration, while it is impossible to control such dopant positions within atomic scale. A fundamental solution is to create electronics with simple but atomically precise structures, which could be fabricated with recent atom manipulation technology. All the constituent atoms are placed as planned, and then the device characteristics are deviation-free, which is mandatory for integration. Atomic chain electronics belongs to this category. Foreign atom chains or arrays form devices, and they are placed on the atomically flat substrate surface. We can design the band structure and the resultant Fermi energy of these structures by manipulating the lattice constant. Using the tight-binding theory with universal parameters, it has been predicted that isolated Si chains and arrays are metallic, Mg chains are insulating, and Mg arrays have metallic and insulating phases [1]. The transport properties along a metallic chain have been studied, emphasizing the role of the contact to electrodes [2]. For electronic applications, it is essential to establish a method to dope a semiconducting chain, which is to control the Fermi energy position without altering the original band structure. If we replace some of the chain atoms with dopant atoms randomly, the electrons will see random potential along die chain and will be localized strongly in space (Anderson localization). However, if we replace periodically, although the electrons can spread over the chain, there will generally appear new bands and band gaps reflecting the new periodicity of dopant atoms. This will change the original band structure significantly. In order to overcome this dilemma, we may place a dopant atom beside the chain at every N lattice periods (N > 1). Because of the periodic arrangement of pant atoms, we can avoid the unwanted Anderson localization. Moreover, since the dopant atoms do not constitute the chain, the overlap interaction between them is minimized, and the band structure modification can be made smallest. Some tight-binding results will be discussed to demonstrate the present idea.

Mapping bright and dark modes in gold nanoparticle chains using electron energy loss spectroscopy.

PubMed

Barrow, Steven J; Rossouw, David; Funston, Alison M; Botton, Gianluigi A; Mulvaney, Paul

2014-07-09

We present a scanning transmission electron microscopy-electron energy loss spectroscopy (STEM-EELS) investigation of gold nanosphere chains with lengths varying from 1 to 5 particles. We show localized EELS signals from the chains and identify energy-loss peaks arising due to l = 1, 2, 3, 4, and 5 plasmon modes through the use of EELS mapping. We also show the evolution of the energy of these modes as the length of a given chain increases, and we find that a chain containing N particles can accommodate at least N experimentally observable modes, in addition to the transverse mode. As the chain length is increased by the addition of one more gold particle to the chain, the new N + 1 mode becomes the highest energy mode, while the existing modes lower their energy and eventually asymptote as they delocalize along the chain. We also show that modes become increasingly difficult to detect with the EELS technique as l approaches N. The data are compared to numerical simulations.

Inelastic electron injection in a water chain

PubMed Central

Rizzi, Valerio; Todorov, Tchavdar N.; Kohanoff, Jorge J.

2017-01-01

Irradiation of biological matter triggers a cascade of secondary particles that interact with their surroundings, resulting in damage. Low-energy electrons are one of the main secondary species and electron-phonon interaction plays a fundamental role in their dynamics. We have developed a method to capture the electron-phonon inelastic energy exchange in real time and have used it to inject electrons into a simple system that models a biological environment, a water chain. We simulated both an incoming electron pulse and a steady stream of electrons and found that electrons with energies just outside bands of excited molecular states can enter the chain through phonon emission or absorption. Furthermore, this phonon-assisted dynamical behaviour shows great sensitivity to the vibrational temperature, highlighting a crucial controlling factor for the injection and propagation of electrons in water. PMID:28350013

14 CFR § 1260.69 - Electronic funds transfer payment methods.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 14 Aeronautics and Space 5 2014-01-01 2014-01-01 false Electronic funds transfer payment methods... GRANTS AND COOPERATIVE AGREEMENTS General Special Conditions § 1260.69 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods October 2000 (a) Payments under this grant will be made...

14 CFR 1260.69 - Electronic funds transfer payment methods.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 14 Aeronautics and Space 5 2013-01-01 2013-01-01 false Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS General Special Conditions § 1260.69 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods October 2000 (a) Payments under this grant will be made by the...

14 CFR 1260.69 - Electronic funds transfer payment methods.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 14 Aeronautics and Space 5 2012-01-01 2012-01-01 false Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS General Special Conditions § 1260.69 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods October 2000 (a) Payments under this grant will be made by the...

14 CFR 1260.69 - Electronic funds transfer payment methods.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 14 Aeronautics and Space 5 2011-01-01 2010-01-01 true Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS General Special Conditions § 1260.69 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods October 2000 (a) Payments under this grant will be made by the...

Medium-chain-length poly-3-hydroxyalkanoates-carbon nanotubes composite anode enhances the performance of microbial fuel cell.

PubMed

Hindatu, Y; Annuar, M S M; Subramaniam, R; Gumel, A M

2017-06-01

Insufficient power generation from a microbial fuel cell (MFC) hampers its progress towards utility-scale development. Electrode modification with biopolymeric materials could potentially address this issue. In this study, medium-chain-length poly-3-hydroxyalkanoates (PHA)/carbon nanotubes (C) composite (CPHA) was successfully applied to modify the surface of carbon cloth (CC) anode in MFC. Characterization of the functional groups on the anodic surface and its morphology was carried out. The CC-CPHA composite anode recorded maximum power density of 254 mW/m 2 , which was 15-53% higher than the MFC operated with CC-C (214 mW/m 2 ) and pristine CC (119 mW/m 2 ) as the anode in a double-chambered MFC operated with Escherichia coli as the biocatalyst. Electrochemical impedance spectroscopy and cyclic voltammetry showed that power enhancement was attributed to better electron transfer capability by the bacteria for the MFC setup with CC-CPHA anode.

The Buccaneer software for automated model building. 1. Tracing protein chains.

PubMed

Cowtan, Kevin

2006-09-01

A new technique for the automated tracing of protein chains in experimental electron-density maps is described. The technique relies on the repeated application of an oriented electron-density likelihood target function to identify likely C(alpha) positions. This function is applied both in the location of a few promising ;seed' positions in the map and to grow those initial C(alpha) positions into extended chain fragments. Techniques for assembling the chain fragments into an initial chain trace are discussed.

The influence of dielectric relaxation on intramolecular electron transfer

NASA Astrophysics Data System (ADS)

Heitele, H.; Michel-Beyerle, M. E.; Finckh, P.

1987-07-01

An unusually strong temperature dependence on the intramolecular electron-transfer rate has been observed for bridged donor-acceptor compounds in propylene glycol solution. In the frame of recent electron-transfer theories this effect reflects the influence of dielectric relaxation dynamics on electron transfer. With increasing dielectric relaxation time a smooth transition from non-adiabatic to solvent-controlled adiabatic behaviour is observed. The electron transfer rate in the solvent-controlled adiabatic limit is dominated by an inhomogeneous distribution of relaxation times.

Facile preparation of cobaltocenium-containing polyelectrolyte via click chemistry and RAFT polymerization.

PubMed

Yan, Yi; Zhang, Jiuyang; Qiao, Yali; Tang, Chuanbing

2014-01-01

A facile method to prepare cationic cobaltocenium-containing polyelectrolyte is reported. Cobaltocenium monomer with methacrylate is synthesized by copper-catalyzed azide-alkyne cycloaddition (CuAAC) reaction between 2-azidoethyl methacrylate and ethynylcobaltocenium hexafluorophosphate. Further controlled polymerization is achieved by reversible addition-fragmentation chain transfer polymerization (RAFT) by using cumyl dithiobenzoate (CDB) as a chain transfer agent. Kinetic study demonstrates the controlled/living process of polymerization. The obtained side-chain cobaltocenium-containing polymer is a metal-containing polyelectrolyte that shows characteristic redox behavior of cobaltocenium. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

48 CFR 252.246-7007 - Contractor Counterfeit Electronic Part Detection and Avoidance System.

Code of Federal Regulations, 2014 CFR

2014-10-01

... chain back to the original manufacturer, whether the electronic parts are supplied as discrete...; clear identification of the name and location of supply chain intermediaries from the manufacturer to... the supply chain until such time that the parts are determined to be authentic. (7) Methodologies to...

Surface zwitterionicalization of poly(vinylidene fluoride) membranes from the entrapped reactive core-shell silica nanoparticles.

PubMed

Zhu, Li-Jing; Zhu, Li-Ping; Zhang, Pei-Bin; Zhu, Bao-Ku; Xu, You-Yi

2016-04-15

We demonstrate the preparation and properties of poly(vinylidene fluoride) (PVDF) filtration membranes modified via surface zwitterionicalization mediated by reactive core-shell silica nanoparticles (SiO2 NPs). The organic/inorganic hybrid SiO2 NPs grafted with poly(methyl meth acrylate)-block-poly(2-dimethylaminoethyl methacrylate) copolymer (PMMA-b-PDMAEMA) shell were prepared by surface-initiated reversible addition fragmentation chain transfer (SI-RAFT) polymerization and then used as a membrane-making additive of PVDF membranes. The PDMAEMA exposed on membrane surface and pore walls were quaternized into zwitterionic poly(sulfobetaine methacrylate) (PSBMA) using 1,3-propane sultone (1,3-PS) as the quaternization agent. The membrane surface chemistry and morphology were analyzed by attenuated total reflectance Fourier transform infrared spectroscopy (ATR-FTIR), X-ray photoelectron spectroscopy (XPS) and scanning electron microscopy (SEM), respectively. The hydrophilicity, permeability and antifouling ability of the investigated membranes were evaluated in detail. It was found that the PSBMA chains brought highly-hydrophilic and strong fouling resistant characteristics to PVDF membranes due to the powerful hydration of zwitterionic surface. The SiO2 cores and PMMA chains in the hybrid NPs play a role of anchors for the linking of PSBMA chains to membrane surface. Compared to the traditional strategies for membrane hydrophilic modification, the developed method in this work combined the advantages of both blending and surface reaction. Copyright © 2016 Elsevier Inc. All rights reserved.

RAFT Aqueous Dispersion Polymerization Yields Poly(ethylene glycol)-Based Diblock Copolymer Nano-Objects with Predictable Single Phase Morphologies

PubMed Central

2013-01-01

A poly(ethylene glycol) (PEG) macromolecular chain transfer agent (macro-CTA) is prepared in high yield (>95%) with 97% dithiobenzoate chain-end functionality in a three-step synthesis starting from a monohydroxy PEG113 precursor. This PEG113-dithiobenzoate is then used for the reversible addition–fragmentation chain transfer (RAFT) aqueous dispersion polymerization of 2-hydroxypropyl methacrylate (HPMA). Polymerizations conducted under optimized conditions at 50 °C led to high conversions as judged by 1H NMR spectroscopy and relatively low diblock copolymer polydispersities (Mw/Mn < 1.25) as judged by GPC. The latter technique also indicated good blocking efficiencies, since there was minimal PEG113 macro-CTA contamination. Systematic variation of the mean degree of polymerization of the core-forming PHPMA block allowed PEG113-PHPMAx diblock copolymer spheres, worms, or vesicles to be prepared at up to 17.5% w/w solids, as judged by dynamic light scattering and transmission electron microscopy studies. Small-angle X-ray scattering (SAXS) analysis revealed that more exotic oligolamellar vesicles were observed at 20% w/w solids when targeting highly asymmetric diblock compositions. Detailed analysis of SAXS curves indicated that the mean number of membranes per oligolamellar vesicle is approximately three. A PEG113-PHPMAx phase diagram was constructed to enable the reproducible targeting of pure phases, as opposed to mixed morphologies (e.g., spheres plus worms or worms plus vesicles). This new RAFT PISA formulation is expected to be important for the rational and efficient synthesis of a wide range of biocompatible, thermo-responsive PEGylated diblock copolymer nano-objects for various biomedical applications. PMID:24400622

Ester versus polyketone formation in the palladium-diphosphine catalyzed carbonylation of ethene.

PubMed

Zuidema, Erik; Bo, Carles; van Leeuwen, Piet W N M

2007-04-04

The origin of the chemoselectivity of palladium catalysts containing bidentate phosphine ligands toward either methoxycarbonylation of ethene or the copolymerization of ethene and carbon monoxide was investigated using density functional theory based calculations. For a palladium catalyst containing the electron-donating bis(dimethylphosphino)ethane (dmpe) ligand, the rate determining step for chain propagation is shown to be the insertion of ethene into the metal-acyl bond. The high barrier for chain propagation is attributed to the low stability of the ethene intermediate, (dmpe)Pd(ethene)(C(O)CH3). For the competing methanolysis process, the most likely pathway involves the formation of (dmpe)Pd(CH3OH)(C(O)CH3) via dissociative ligand exchange, followed by a solvent mediated proton-transfer/reductive- elimination process. The overall barrier for this process is higher than the barrier for ethene insertion into the palladium-acetyl bond, in line with the experimentally observed preference of this type of catalyst toward the formation of polyketone. Electronic bite angle effects on the rates of ethene insertion and ethanoyl methanolysis were evaluated using four electronically and sterically related ligands (Me)2P(CH2)nP(Me)2 (n = 1-4). Steric effects were studied for larger tert-butyl substituted ligands using a QM/MM methodology. The results show that ethene coordination to the metal center and subsequent insertion into the palladium-ethanoyl bond are disfavored by the addition of steric bulk around the metal center. Key intermediates in the methanolysis mechanism, on the other hand, are stabilized because of electronic effects caused by increasing the bite angle of the diphosphine ligand. The combined effects explain successfully which ligands give polymer and which ones give methyl propionate as the major products of the reaction.

[Influence of over expression of CsRCA on photosynthesis of cucumber seedlings under high temperature stress.

PubMed

Bi, Huan Gai; Dong, Xu Bing; Liu, Pei Pei; Li, Qing Ming; Ai, Xi Zhen

2016-07-01

In the present work, transgenic cucumber seedlings over expressing CsRCA and wild-type cucumber seedlings '08-1'at three-leaf stage exposed to high temperature (40 ℃, PFD 600 μmol· m -2 · s -1 ) were used to study the regulatory mechanism of photosynthesis by CsRCA. The results showed that the mRNA abundance of rbcL and rbcS as well as the activities of ribulose bisphosphate carboxylic enzyme (Rubisco) and Rubisco activase (RCA) were significantly higher in CsRCA over-expressing cucumber seedlings than in wild type (WT). Following 2-h exposure to high temperature, a notable decrease was observed in photosynthetic rate (P n ), photochemical perfor-mance index based on the absorption of light energy (PI ABS ), activities of Rubisco and RCA as well as the relative expression of rbcL, rbcS and CsRCA in both wild-type cucumber seedlings and transgenic cucumber seedlings. It was found that high temperature stress led to higher W k , a parameter of chlorophyll (Chl) a fluorescence OJIP curve. Furthermore, high temperature greatly reduced the efficiency of electron transfer along the electron transport chain beyond Q A (ψ 0 ) and the quantum yield for electron transport (φ E0 ), indicating that PSII oxygen complexes (OEC) and electron transport chain downstream Q A were inhibited by high temperature. However, the inhibition could be alleviated by over expressing CsRCA in cucumber seedlings. Taken together, our data suggested that over expressing CsRCA improves photosynthesis in cucumber seedlings under high temperature stress by enhancing activities of the Rubisco and RCA, and maintaining the number of active reaction centers.

Secondary coenzyme Q10 deficiency and oxidative stress in cultured fibroblasts from patients with riboflavin responsive multiple Acyl-CoA dehydrogenation deficiency.

PubMed

Cornelius, Nanna; Byron, Colleen; Hargreaves, Iain; Guerra, Paula Fernandez; Furdek, Andrea K; Land, John; Radford, Weston W; Frerman, Frank; Corydon, Thomas J; Gregersen, Niels; Olsen, Rikke K J

2013-10-01

Coenzyme Q10 (CoQ10) is essential for the energy production of the cells and as an electron transporter in the mitochondrial respiratory chain. CoQ10 links the mitochondrial fatty acid β-oxidation to the respiratory chain by accepting electrons from electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO). Recently, it was shown that a group of patients with the riboflavin responsive form of multiple acyl-CoA dehydrogenation deficiency (RR-MADD) carrying inherited amino acid variations in ETF-QO also had secondary CoQ10 deficiency with beneficial effects of CoQ10 treatment, thus adding RR-MADD to an increasing number of diseases involving secondary CoQ10 deficiency. In this study, we show that moderately decreased CoQ10 levels in fibroblasts from six unrelated RR-MADD patients were associated with increased levels of mitochondrial reactive oxygen species (ROS). Treatment with CoQ10, but not with riboflavin, could normalize the CoQ10 level and decrease the level of ROS in the patient cells. Additionally, riboflavin-depleted control fibroblasts showed moderate CoQ10 deficiency, but not increased mitochondrial ROS, indicating that variant ETF-QO proteins and not CoQ10 deficiency are the causes of mitochondrial ROS production in the patient cells. Accordingly, the corresponding variant Rhodobacter sphaeroides ETF-QO proteins, when overexpressed in vitro, bind a CoQ10 pseudosubstrate, Q10Br, less tightly than the wild-type ETF-QO protein, suggesting that molecular oxygen can get access to the electrons in the misfolded ETF-QO protein, thereby generating superoxide and oxidative stress, which can be reversed by CoQ10 treatment.

Light, nutrients, and food-chain length constrain planktonic energy transfer efficiency across multiple trophic levels

PubMed Central

Dickman, Elizabeth M.; Newell, Jennifer M.; González, María J.; Vanni, Michael J.

2008-01-01

The efficiency of energy transfer through food chains [food chain efficiency (FCE)] is an important ecosystem function. It has been hypothesized that FCE across multiple trophic levels is constrained by the efficiency at which herbivores use plant energy, which depends on plant nutritional quality. Furthermore, the number of trophic levels may also constrain FCE, because herbivores are less efficient in using plant production when they are constrained by carnivores. These hypotheses have not been tested experimentally in food chains with 3 or more trophic levels. In a field experiment manipulating light, nutrients, and food-chain length, we show that FCE is constrained by algal food quality and food-chain length. FCE across 3 trophic levels (phytoplankton to carnivorous fish) was highest under low light and high nutrients, where algal quality was best as indicated by taxonomic composition and nutrient stoichiometry. In 3-level systems, FCE was constrained by the efficiency at which both herbivores and carnivores converted food into production; a strong nutrient effect on carnivore efficiency suggests a carryover effect of algal quality across 3 trophic levels. Energy transfer efficiency from algae to herbivores was also higher in 2-level systems (without carnivores) than in 3-level systems. Our results support the hypothesis that FCE is strongly constrained by light, nutrients, and food-chain length and suggest that carryover effects across multiple trophic levels are important. Because many environmental perturbations affect light, nutrients, and food-chain length, and many ecological services are mediated by FCE, it will be important to apply these findings to various ecosystem types. PMID:19011082

An RFID-Based Smart Structure for the Supply Chain: Resilient Scanning Proofs and Ownership Transfer with Positive Secrecy Capacity Channels.

PubMed

Burmester, Mike; Munilla, Jorge; Ortiz, Andrés; Caballero-Gil, Pino

2017-07-04

The National Strategy for Global Supply Chain Security published in 2012 by the White House identifies two primary goals for strengthening global supply chains: first, to promote the efficient and secure movement of goods, and second to foster a resilient supply chain. The Internet of Things (IoT), and in particular Radio Frequency Identification (RFID) technology, can be used to realize these goals. For product identification, tracking and real-time awareness, RFID tags are attached to goods. As tagged goods move along the supply chain from the suppliers to the manufacturers, and then on to the retailers until eventually they reach the customers, two major security challenges can be identified: (I) to protect the shipment of goods that are controlled by potentially untrusted carriers; and (II) to secure the transfer of ownership at each stage of the chain. For the former, grouping proofs in which the tags of the scanned goods generate a proof of "simulatenous" presence can be employed, while for the latter, ownership transfer protocols (OTP) are used. This paper describes enhanced security solutions for both challenges. We first extend earlier work on grouping proofs and group codes to capture resilient group scanning with untrusted readers; then, we describe a modified version of a recently published OTP based on channels with positive secrecy capacity adapted to be implemented on common RFID systems in the supply chain. The proposed solutions take into account the limitations of low cost tags employed in the supply chain, which are only required to generate pseudorandom numbers and compute one-way hash functions.

12 CFR 205.15 - Electronic fund transfer of government benefits.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 12 Banks and Banking 2 2011-01-01 2011-01-01 false Electronic fund transfer of government benefits. 205.15 Section 205.15 Banks and Banking FEDERAL RESERVE SYSTEM BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.15 Electronic fund transfer of government...

12 CFR 1005.3 - Coverage.

Code of Federal Regulations, 2014 CFR

2014-01-01

...-time electronic fund transfer from a consumer's account. The consumer must authorize the transfer. (ii... one-time electronic fund transfer (in providing a check to a merchant or other payee for the MICR... transfer. A consumer authorizes a one-time electronic fund transfer from his or her account to pay the fee...

Time-resolved studies of energy transfer from meso-tetrakis(N-methylpyridinium-4-yl)- porphyrin to 3,3'-diethyl-2,2'-thiatricarbocyanine iodide along deoxyribonucleic acid Chain.

PubMed

Kakiuchi, Toshifumi; Ito, Fuyuki; Nagamura, Toshihiko

2008-04-03

The excitation energy transfer from meso-tetrakis(N-methylpyridinium-4-yl)porphyrin (TMPyP) to 3,3'-diethyl-2,2'-thiatricarbocyanine iodide (DTTCI) along the deoxyribonucleic acid (DNA) double strand was investigated by the steady-state absorption and fluorescence measurements and time-resolved fluorescence measurements. The steady-state fluorescence spectra showed that the near-infrared fluorescence of DTTCI was strongly enhanced up to 86 times due to the energy transfer from the excited TMPyP molecule in DNA buffer solution. Furthermore, we elucidated the mechanism of fluorescence quenching and enhancement by the direct observation of energy transfer using the time-resolved measurements. The fluorescence quenching of TMPyP chiefly consists of a static component due to the formation of complex and dynamic components due to the excitation energy transfer. In a heterogeneous one-dimensional system such as a DNA chain, it was proved that the energy transfer process only carries out within the critical distance based on the Förster theory and within a threshold value estimated from the modified Stern-Volmer equation. The present results showed that DNA chain is one of the most powerful tools for nanoassemblies and will give a novel concepts of material design.

Partitioning of electron flux between the respiratory chains of the yeast Candida parapsilosis: parallel working of the two chains.

PubMed

Guerin, M G; Camougrand, N M

1994-02-08

Partitioning of the electron flux between the classical and the alternative respiratory chains of the yeast Candida parapsilosis, was measured as a function of the oxidation rate and of the Q-pool redox poise. At low respiration rate, electrons from external NADH travelled preferentially through the alternative pathway as indicated by the antimycin A-insensitivity of electron flow. Inhibition of the alternative pathway by SHAM restored full antimycin A-sensitivity to the remaining electro flow. The dependence of the respiratory rate on the redox poise of the quinone pool was investigated when the electron flux was mediated either by the main respiratory chain (growth in the absence of antimycin A) or by the second respiratory chain (growth in the presence of antimycin A). In the former case, a linear relationship was found between these two parameters. In contrast, in the latter case, the relationship between Q-pool reduction level and electron flux was non-linear, but it could be resolved into two distinct curves. This second quinone is not reducible in the presence of antimycin A but only in the presence of high concentrations of myxothiazol or cyanide. Since two quinone species exist in C. parapsilosis, UQ9 and Qx (C33H54O4), we hypothesized that these two curves could correspond to the functioning of the second quinone engaged during the alternative pathway activity. Partitioning of electrons between both respiratory chains could occur upstream of complex III with the second chain functioning in parallel to the main one, and with the additional possibility of merging into the main one at the complex IV level.

Ultrafast inter- and intramolecular vibrational energy transfer between molecules at interfaces studied by time- and polarization-resolved SFG spectroscopy.

PubMed

Yamamoto, Susumu; Ghosh, Avishek; Nienhuys, Han-Kwang; Bonn, Mischa

2010-10-28

We present experimental results on femtosecond time-resolved surface vibrational spectroscopy aimed at elucidating the sub-picosecond reorientational dynamics of surface molecules. The approach, which relies on polarization- and time-resolved surface sum frequency generation (SFG), provides a general means to monitor interfacial reorientational dynamics through vibrations inherent in surface molecules in their electronic ground state. The technique requires an anisotropic vibrational excitation of surface molecules using orthogonally polarized infrared excitation light. The decay of the resulting anisotropy is followed in real-time. We employ the technique to reveal the reorientational dynamics of vibrational transition dipoles of long-chain primary alcohols on the water surface, and of water molecules at the water-air interface. The results demonstrate that, in addition to reorientational motion of specific molecules or molecular groups at the interface, inter- and intramolecular energy transfer processes can serve to scramble the initial anisotropy very efficiently. In the two exemplary cases demonstrated here, energy transfer occurs much faster than reorientational motion of interfacial molecules. This has important implications for the interpretation of static SFG spectra. Finally, we suggest experimental schemes and strategies to decouple effects resulting from energy transfer from those associated with surface molecular motion.

Biophysical basis of low-power-laser effects

NASA Astrophysics Data System (ADS)

Karu, Tiina I.

1996-06-01

Biological responses of cells to visible and near IR (laser) radiation occur due to physical and/or chemical changes in photoacceptor molecules, components of respiratory chains (cyt a/a3 in mitochondria). As a result of the photoexcitation of electronic states, the following physical and/or chemical changes can occur: alteration of redox properties and acceleration of electron transfer, changes in biochemical activity due to local transient heating of chromophores, one-electron auto-oxidation and O2- production, and photodynamic action and 1O2 production. Different reaction channels can be activated to achieve the photobiological macroeffect. The primary physical and/or chemical changes induced by light in photoacceptor molecules are followed by a cascade of biochemical reactions in the cell that do not need further light activation and occur in the dark (photosignal transduction and amplification chains). These actions are connected with changes in cellular homeostasis parameters. The crucial step here is thought to be an alteration of the cellular redox state: a shift towards oxidation is associated with stimulation of cellular vitality, and a shift towards reduction is linked to inhibition. Cells with a lower than normal pH, where the redox state is shifted in the reduced direction, are considered to be more sensitive to the stimulative action of light than those with the respective parameters being optimal or near optimal. This circumstance explains the possible variations in observed magnitudes of low-power laser effects. Light action on the redox state of a cell via the respiratory chain also explains the diversity of low-power laser effects. Beside explaining many controversies in the field of low-power laser effects (i.e., the diversity of effects, the variable magnitude or absence of effects in certain studies), the proposed redox-regulation mechanism may be a fundamental explanation for some clinical effects of irradiation, for example the positive results achieved in treating wounds, chronic inflammation, and ischemia, all characterized by acidosis and hypoxia.

Interactions of monochromatic visible light and near-IR radiation with cells: currently discussed mechanisms

NASA Astrophysics Data System (ADS)

Karu, Tiina I.

1995-05-01

Biological responses of cells to visible and near IR (laser) radiation occur due to physical and/or chemical changes in photoacceptor molecules, components of respiratory chains (cyt a/a3 in mitochondria, and cyt d in E. coli). As a result of the photoexcitation of electronic states, the following physical and/or chemical changes can occur: alteration of redox properties and acceleration of electron transfer, changes in biochemical activity due to local transient heating of chromophores, one-electron auto-oxidation and O2- production, and photodynamic action and 1O2 production. Different reaction channels can be activated to achieve the photobiological macroeffect. The primary physical and/or chemical changes induced by light in photoacceptor molecules are followed by a cascade of biochemical reactions in the cell that do not need further light activation and occur in the dark (photosignal transduction and amplification chains). These reactions are connected with changes in cellular homeostasis parameters. The crucial step here is thought to be an alteration of the cellular redox state: a shift towards oxidation is associated with stimulation of cellular vitality, and a shift towards reduction is linked to inhibition. Cells with a lower than normal pH, where the redox state is shifted in the reduced direction, are considered to be more sensitive to the stimulative action of light than those with the respective parameters being optimal or near optimal. This circumstance explains the possible variations in observed magnitudes of low-power laser effects. Light action on the redox state of a cell via the respiratory chain also explains the diversity of low-power laser effects. Beside explaining many controversies in the field of low-power laser effects (i.e., the diversity of effects, the variable magnitude or absence of effects in certain studies), the proposed redox-regulation mechanism may be a fundamental explanation of some clinical effects of irradiation, for example the positive results achieved in treating wounds, chronic inflammation, and ischemia, all characterized by acidosis and hypoxia.

Mechanisms of interaction of monochromatic visible light with cells

NASA Astrophysics Data System (ADS)

Karu, Tiina I.

1996-01-01

Biological responses of cells to visible and near IR (laser) radiation occur due to physical and/or chemical changes in photoacceptor molecules, components of respiratory chains (cyt a/a3 in mitochondria). As a result of the photoexcitation of electronic states, the following physical and/or chemical changes can occur: alteration of redox properties and acceleration of electron transfer, changes in biochemical activity due to local transient heating of chromophores, one-electron auto-oxidation and O'2- production, and photodynamic action and 1O2 production. Different reaction channels can be activated to achieve the photobiological macroeffect. The primary physical and/or chemical changes induced by light in photoacceptor molecules are followed by a cascade of biochemical reactions in the cell that do not need further light activation and occur in the dark (photosignal transduction and amplification chains). These reactions are connected with changes in cellular homeostasis parameters. The crucial step here is thought to be an alteration of the cellular redox state: a shift towards oxidation is associated with stimulation of cellular vitality, and a shift towards reduction is linked to inhibition. Cells with a lower than normal pH, where the redox state is shifted in the reduced direction, are considered to be more sensitive to the stimulative action of light than those with the respective parameters being optimal or near optimal. This circumstance explains the possible variations in observed magnitudes of low- power laser effects. Light action on the redox state of a cell via the respiratory chain also explains the diversity of low-power laser effects. Besides explaining many controversies in the field of low-power laser effects (i.e., the diversity of effects, the variable magnitude or absence of effects in certain studies), the proposed redox-regulation mechanism may be a fundamental explanation for some clinical effects of irradiation, for example the positive results achieved in treating wounds, chronic inflammation, and ischemia, all characterized by acidosis and hypoxia.

Chaining direct memory access data transfer operations for compute nodes in a parallel computer

DOEpatents

Archer, Charles J.; Blocksome, Michael A.

2010-09-28

Methods, systems, and products are disclosed for chaining DMA data transfer operations for compute nodes in a parallel computer that include: receiving, by an origin DMA engine on an origin node in an origin injection FIFO buffer for the origin DMA engine, a RGET data descriptor specifying a DMA transfer operation data descriptor on the origin node and a second RGET data descriptor on the origin node, the second RGET data descriptor specifying a target RGET data descriptor on the target node, the target RGET data descriptor specifying an additional DMA transfer operation data descriptor on the origin node; creating, by the origin DMA engine, an RGET packet in dependence upon the RGET data descriptor, the RGET packet containing the DMA transfer operation data descriptor and the second RGET data descriptor; and transferring, by the origin DMA engine to a target DMA engine on the target node, the RGET packet.

Toxicity of nano-TiO2 on algae and the site of reactive oxygen species production.

PubMed

Li, Fengmin; Liang, Zhi; Zheng, Xiang; Zhao, Wei; Wu, Miao; Wang, Zhenyu

2015-01-01

Given the extensive use of nanomaterials, they may enter aquatic environments and harm the growth of algae, which are primary producers in an aquatic ecosystem. Thus, the balance of an aquatic ecosystem may be destroyed. In this study, Karenia brevis and Skeletonema costatum were exposed to nano-TiO2 (anatase, average particle size of 5-10 nm, specific surface area of 210±10 m(2) g(-1)) to assess the effects of nano-TiO2 on algae. The findings of transmission electron microscopy-energy dispersive X-ray spectroscopy (TEM-EDX) and scanning electron microscopy (SEM) demonstrate aggregation of nano-TiO2 in the algal suspension. Nano-TiO2 was also found to be inside algal cells. The growth of the two species of algae was inhibited under nano-TiO2 exposure. The 72 h EC50 values of nano-TiO2 to K. brevis and S. costatum were 10.69 and 7.37 mg L(-1), respectively. TEM showed that the cell membrane of K. brevis was destroyed and its organelles were almost undistinguished under nano-TiO2 exposure. The malondialdehyde (MDA) contents of K. brevis and S. costatum significantly increased compared with those of the control (p<0.05). Meanwhile, superoxide dismutase (SOD) and catalase activities (CAT) of K. brevis and S. costatum changed in different ways. The reactive oxygen species (ROS) levels in both species were significantly higher than those of the control (p<0.05). The site of ROS production and accumulation in K. brevis and S. costatum under nano-TiO2 exposure was explored with the addition of inhibitors of different electron transfer chains. This study indicated that nano-TiO2 in algal suspensions inhibited the growth of K. brevis and S. costatum. This effect was attributed to oxidative stress caused by ROS production inside algal cells. The levels of anti-oxidative enzymes changed, which destroyed the balance between oxidation and anti-oxidation. Thus, algae were damaged by ROS accumulation, resulting in lipid oxidation and inhibited algae growth. The inhibitors of the electron transfer chain showed that the site of ROS production and accumulation in K. brevis cells was the chloroplast. Copyright © 2014 Elsevier B.V. All rights reserved.

Quantum communication through an unmodulated spin chain.

PubMed

Bose, Sougato

2003-11-14

We propose a scheme for using an unmodulated and unmeasured spin chain as a channel for short distance quantum communications. The state to be transmitted is placed on one spin of the chain and received later on a distant spin with some fidelity. We first obtain simple expressions for the fidelity of quantum state transfer and the amount of entanglement sharable between any two sites of an arbitrary Heisenberg ferromagnet using our scheme. We then apply this to the realizable case of an open ended chain with nearest neighbor interactions. The fidelity of quantum state transfer is obtained as an inverse discrete cosine transform and as a Bessel function series. We find that in a reasonable time, a qubit can be directly transmitted with better than classical fidelity across the full length of chains of up to 80 spins. Moreover, our channel allows distillable entanglement to be shared over arbitrary distances.

Spectro-temporal characterization of the photoactivation mechanism of two new oxidized cryptochrome/photolyase photoreceptors.

PubMed

Brazard, Johanna; Usman, Anwar; Lacombat, Fabien; Ley, Christian; Martin, Monique M; Plaza, Pascal; Mony, Laetitia; Heijde, Marc; Zabulon, Gérald; Bowler, Chris

2010-04-07

The photoactivation dynamics of two new flavoproteins (OtCPF1 and OtCPF2) of the cryptochrome photolyase family (CPF), belonging to the green alga Ostreococcus tauri , was studied by broadband UV-vis femtosecond absorption spectroscopy. Upon excitation of the protein chromophoric cofactor, flavin adenine dinucleotide in its oxidized form (FAD(ox)), we observed in both cases the ultrafast photoreduction of FAD(ox): in 390 fs for OtCPF1 and 590 fs for OtCPF2. Although such ultrafast electron transfer has already been reported for other flavoproteins and CPF members, the present result is the first demonstration with full spectral characterization of the mechanism. Analysis of the photoproduct spectra allowed identifying tryptophan as the primary electron donor. This residue is found to be oxidized to its protonated radical cation form (WH(*+)), while FAD(ox) is reduced to FAD(*-). Subsequent kinetics were observed in the picosecond and subnanosecond regime, mostly described by a biexponential partial decay of the photoproduct transient signal (9 and 81 ps for OtCPF1, and 13 and 340 ps for OtCPF2), with reduced spectral changes, while a long-lived photoproduct remains in the nanosecond time scale. We interpret these observations within the model proposed by the groups of Brettel and Vos, which describes the photoreduction of FADH(*) within E. coli CPD photolyase (EcCPD) as a sequential electron transfer along a chain of three tryptophan residues, although in that case the rate limiting step was the primary photoreduction in 30 ps. In the present study, excitation of FAD(ox) permitted to reveal the following steps and spectroscopically assign them to the hole-hopping process along the tryptophan chain, accompanied by partial charge recombination at each step. In addition, structural analysis performed by homology modeling allowed us to propose a tentative structure of the relative orientations of FAD and the conserved tryptophan triad. The results of preliminary transient anisotropy measurements performed on OtCPF2 finally showed good compatibility with the oxidation of the distal tryptophan residue (WH(351)) in 340 ps, hence, with the overall Brettel-Vos mechanism.

Using Adobe Flash animations of electron transport chain to teach and learn biochemistry.

PubMed

Teplá, Milada; Klímová, Helena

2015-01-01

Teaching the subject of the electron transport chain is one of the most challenging aspects of the chemistry curriculum at the high school level. This article presents an educational program called "Electron Transport Chain" which consists of 14 visual animations including a biochemistry quiz. The program was created in the Adobe Flash CS3 Professional animation program and is designed for high school chemistry students. Our goal is to develop educational materials that facilitate the comprehension of this complex subject through dynamic animations which show the course of the electron transport chain and simultaneously explain its nature. We record the process of the electron transport chain, including connections with oxidative phosphorylation, in such a way as to minimize the occurrence of discrepancies in interpretation. The educational program was evaluated in high schools through the administration of a questionnaire, which contained 12 opened-ended items and which required participants to evaluate the graphics of the animations, chemical content, student preferences, and its suitability for high school biochemistry teaching. © 2015 The International Union of Biochemistry and Molecular Biology.

Identification of the Catalytic Ubiquinone-binding Site of Vibrio cholerae Sodium-dependent NADH Dehydrogenase

PubMed Central

Tuz, Karina; Li, Chen; Fang, Xuan; Raba, Daniel A.; Liang, Pingdong; Minh, David D. L.; Juárez, Oscar

2017-01-01

The sodium-dependent NADH dehydrogenase (Na+-NQR) is a key component of the respiratory chain of diverse prokaryotic species, including pathogenic bacteria. Na+-NQR uses the energy released by electron transfer between NADH and ubiquinone (UQ) to pump sodium, producing a gradient that sustains many essential homeostatic processes as well as virulence factor secretion and the elimination of drugs. The location of the UQ binding site has been controversial, with two main hypotheses that suggest that this site could be located in the cytosolic subunit A or in the membrane-bound subunit B. In this work, we performed alanine scanning mutagenesis of aromatic residues located in transmembrane helices II, IV, and V of subunit B, near glycine residues 140 and 141. These two critical glycine residues form part of the structures that regulate the site's accessibility. Our results indicate that the elimination of phenylalanine residue 211 or 213 abolishes the UQ-dependent activity, produces a leak of electrons to oxygen, and completely blocks the binding of UQ and the inhibitor HQNO. Molecular docking calculations predict that UQ interacts with phenylalanine 211 and pinpoints the location of the binding site in the interface of subunits B and D. The mutagenesis and structural analysis allow us to propose a novel UQ-binding motif, which is completely different compared with the sites of other respiratory photosynthetic complexes. These results are essential to understanding the electron transfer pathways and mechanism of Na+-NQR catalysis. PMID:28053088

Electron-Transfer Secondary Reaction Matrices for MALDI MS Analysis of Bacteriochlorophyll a in Rhodobacter sphaeroides and Its Zinc and Copper Analogue Pigments

NASA Astrophysics Data System (ADS)

Calvano, Cosima Damiana; Ventura, Giovanni; Trotta, Massimo; Bianco, Giuliana; Cataldi, Tommaso R. I.; Palmisano, Francesco

2017-01-01

Bacteriochlorophyll a ( BChl a), a photosynthetic pigment performing the same functions of chlorophylls in plants, features a bacteriochlorin macrocycle ring (18 π electrons) with two reduced pyrrole rings along with a hydrophobic terpenoid side chain (i.e., the phytol residue). Chlorophylls analysis by matrix-assisted laser desorption/ionization mass spectrometry (MALDI MS) is not so straightforward since pheophytinization (i.e., release of the central metal ion) and cleavage of the phytol-ester linkage are invariably observed by employing protonating matrices such as 2,5-dihydroxybenzoic acid, sinapinic acid, and α-cyano-4-hydroxycinnamic acid. Using BChl a from Rhodobacter sphaeroides R26 strain as a model system, different electron-transfer (ET) secondary reaction matrices, leading to the formation of almost stable radical ions in both positive ([M]+•) and negative ([M]-•) ionization modes at m/z 910.55, were evaluated. Compared with ET matrices such as trans-2-[3-(4-t-butyl-phenyl)-2-methyl-2-propenylidene]malononitrile (DCTB), 2,2':5',2''-terthiophene (TER), anthracene (ANT), and 9,10-diphenylanthracene (DP-ANT), 1,5-diaminonaphthalene (DAN) was found to provide the highest ionization yield with a negligible fragmentation. DAN also displayed excellent ionization properties for two metal ion-substituted bacteriochlorophylls, (i.e., Zn- and Cu-BChl a at m/z 950.49 and 949.49), respectively. MALDI MS/MS of both radical charged molecular species provide complementary information, thus making analyte identification more straightforward.

Impact of charge-transfer excitons in regioregular polythiophene on the charge separation at polythiophene-fullerene heterojunctions

NASA Astrophysics Data System (ADS)

Polkehn, M.; Tamura, H.; Burghardt, I.

2018-01-01

This study addresses the mechanism of ultrafast charge separation in regioregular oligothiophene-fullerene assemblies representative of poly-3-hexylthiophene (P3HT)-[6,6]-phenyl-C61 butyric acid methyl ester (PCBM) heterojunctions, with special emphasis on the inclusion of charge transfer excitons in the oligothiophene phase. The formation of polaronic inter-chain charge separated species in highly ordered oligothiophene has been demonstrated in recent experiments and could have a significant impact on the net charge transfer to the fullerene acceptor. The present approach combines a first-principles parametrized multi-site Hamiltonian, based on time-dependent density functional theory calculations, with accurate quantum dynamics simulations using the multi-layer multi-configuration time-dependent Hartree method. Quantum dynamical studies are carried out for up to 182 electronic states and 112 phonon modes. The present analysis follows up on our previous study of (Huix-Rotllant et al 2015 J. Phys. Chem. Lett. 6 1702) and significantly expands the scope of this analysis by including the dynamical role of charge transfer excitons. Our investigation highlights the pronounced mixing of photogenerated Frenkel excitons with charge transfer excitons in the oligothiophene domain, and the opening of new transfer channels due the creation of such charge-separated species. As a result, it turns out that the interfacial donor/acceptor charge transfer state can be largely circumvented due to the presence of charge transfer excitons. However, the latter states in turn act as a trap, such that the free carrier yield observed on ultrafast time scales is tangibly reduced. The present analysis underscores the complexity of the transfer pathways at P3HT-PCBM type junctions.

Real-space localization and quantification of hole distribution in chain-ladder Sr3Ca11Cu24O41 superconductor.

PubMed

Bugnet, Matthieu; Löffler, Stefan; Hawthorn, David; Dabkowska, Hanna A; Luke, Graeme M; Schattschneider, Peter; Sawatzky, George A; Radtke, Guillaume; Botton, Gianluigi A

2016-03-01

Understanding the physical properties of the chain-ladder Sr3Ca11Cu24O41 hole-doped superconductor has been precluded by the unknown hole distribution among chains and ladders. We use electron energy-loss spectrometry (EELS) in a scanning transmission electron microscope (STEM) at atomic resolution to directly separate the contributions of chains and ladders and to unravel the hole distribution from the atomic scale variations of the O-K near-edge structures. The experimental data unambiguously demonstrate that most of the holes lie within the chain layers. A quantitative interpretation supported by inelastic scattering calculations shows that about two holes are located in the ladders, and about four holes in the chains, shedding light on the electronic structure of Sr3Ca11Cu24O41. Combined atomic resolution STEM-EELS and inelastic scattering calculations is demonstrated as a powerful approach toward a quantitative understanding of the electronic structure of cuprate superconductors, offering new possibilities for elucidating their physical properties.

Real-space localization and quantification of hole distribution in chain-ladder Sr3Ca11Cu24O41 superconductor

PubMed Central

Bugnet, Matthieu; Löffler, Stefan; Hawthorn, David; Dabkowska, Hanna A.; Luke, Graeme M.; Schattschneider, Peter; Sawatzky, George A.; Radtke, Guillaume; Botton, Gianluigi A.

2016-01-01

Understanding the physical properties of the chain-ladder Sr3Ca11Cu24O41 hole-doped superconductor has been precluded by the unknown hole distribution among chains and ladders. We use electron energy-loss spectrometry (EELS) in a scanning transmission electron microscope (STEM) at atomic resolution to directly separate the contributions of chains and ladders and to unravel the hole distribution from the atomic scale variations of the O-K near-edge structures. The experimental data unambiguously demonstrate that most of the holes lie within the chain layers. A quantitative interpretation supported by inelastic scattering calculations shows that about two holes are located in the ladders, and about four holes in the chains, shedding light on the electronic structure of Sr3Ca11Cu24O41. Combined atomic resolution STEM-EELS and inelastic scattering calculations is demonstrated as a powerful approach toward a quantitative understanding of the electronic structure of cuprate superconductors, offering new possibilities for elucidating their physical properties. PMID:27051872

12 CFR 205.14 - Electronic fund transfer service provider not holding consumer's account.

Code of Federal Regulations, 2010 CFR

2010-01-01

... consumer learns of the loss or theft; and extends the time periods for reporting unauthorized transfers or... 12 Banks and Banking 2 2010-01-01 2010-01-01 false Electronic fund transfer service provider not... GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.14 Electronic fund...