Multichannel modeling and two-photon coherent transfer paths in NaK

NASA Astrophysics Data System (ADS)

Schulze, T. A.; Temelkov, I. I.; Gempel, M. W.; Hartmann, T.; Knöckel, H.; Ospelkaus, S.; Tiemann, E.

2013-08-01

We explore possible pathways for the creation of ultracold polar NaK molecules in their absolute electronic and rovibrational ground state starting from ultracold Feshbach molecules. In particular, we present a multichannel analysis of the electronic ground and K(4p)+Na(3s) excited-state manifold of NaK, analyze the spin character of both the Feshbach molecular state and the electronically excited intermediate states and discuss possible coherent two-photon transfer paths from Feshbach molecules to rovibronic ground-state molecules. The theoretical study is complemented by the demonstration of stimulated Raman adiabatic passage from the X1Σ+(v=0) state to the a3Σ+ manifold on a molecular beam experiment.

NO-sensing performance of vacancy defective monolayer MoS2 predicted by density function theory

NASA Astrophysics Data System (ADS)

Li, Feifei; Shi, Changmin

2018-03-01

Using density functional theory (DFT), we predict the NO-sensing performance of monolayer MoS2 (MoS2-MLs) with and without MoS3-vacancy/S-vacancy defects. Our theoretical results demonstrate that MoS3- and S-vacancy defective MoS2-MLs show stronger chemisorption and greater electron transfer effects than pure MoS2-MLs. The charge transfer analysis showed pure and defective MoS2-MLs all act as donors. Both MoS3-vacancy and S-vacancy defects induce dramatic changes of electronic properties of MoS2-MLs, which have direct relationship with gas sensing performance. In addition, S-vacancy defect leads to more electrons transfer to NO molecule than MoS3-vacancy defect. The H2O molecule urges more electrons transfer from MoS3- or S-vacancy defective MoS2-MLs to NO molecule. We believe that this calculation results will provide some information for future experiment.

Tip-Enhanced Photoinduced Electron Transfer and Ionization on Vertical Silicon Nanowires.

PubMed

Chen, Xiaoming; Wang, Tao; Lin, Leimiao; Wo, Fangjie; Liu, Yaqin; Liang, Xiao; Ye, Hui; Wu, Jianmin

2018-05-02

Nanostructured semiconductors are one of the most potent candidates for matrix-free laser desorption/ionization mass spectrometric (LDI-MS) analysis of low-molecular-weight molecules. Herein, the enhanced photoinduced electron transfer and LDI on the tip of a vertical silicon nanowire (SiNW) array were investigated. Theoretical simulation and LDI detection of indigo and isatin molecules in negative ion mode revealed that the electric field can be enhanced on the tip end of SiNWs, thereby promoting the energy and electron transfer to the analytes adsorbed on the tip of SiNWs. On the basis of this finding, a tip-contact sampling method coupled with LDI-MS detection was established. In this strategy, the tip of SiNWs can be regarded as microextraction heads for the sampling of molecules when they come in contact with analytes. Impression of skin, tissue, and pericarp on the vertical SiNW array can effectively transfer endogenous metabolites or exogenous substances onto the tip. Upon laser irradiation, the adsorbed molecules on the SiNW tip can be efficiently ionized and detected in negative ion mode because of the tip-enhanced electron transfer and LDI effect. We believe this work may significantly expand the application of LDI-MS in various fields.

Stabilizing photoassociated Cs2 molecules by optimal control

NASA Astrophysics Data System (ADS)

Zhang, Wei; Xie, Ting; Huang, Yin; Wang, Gao-Ren; Cong, Shu-Lin

2013-01-01

We demonstrate theoretically that photoassociated molecules can be stabilized to deeply bound states. This process is achieved by transferring the population from the outer well to the inner well using the optimal control theory, the Cs2 molecule is taken as an example. Numerical calculations show that weakly bound molecules formed in the outer well by a pump pulse can be compressed to the inner well via a vibrational level of the ground electronic state as an intermediary by an additionally optimized laser pulse. The positively chirped pulse can enhance the population of the target state. With a transform-limited dump pulse, nearly all the photoassociated molecules in the inner well of the excited electronic state can be transferred to the deeply vibrational level of the ground electronic state.

Improving the efficiency of water splitting in dye-sensitized solar cells by using a biomimetic electron transfer mediator

PubMed Central

Zhao, Yixin; Swierk, John R.; Megiatto, Jackson D.; Sherman, Benjamin; Youngblood, W. Justin; Qin, Dongdong; Lentz, Deanna M.; Moore, Ana L.; Moore, Thomas A.; Gust, Devens; Mallouk, Thomas E.

2012-01-01

Photoelectrochemical water splitting directly converts solar energy to chemical energy stored in hydrogen, a high energy density fuel. Although water splitting using semiconductor photoelectrodes has been studied for more than 40 years, it has only recently been demonstrated using dye-sensitized electrodes. The quantum yield for water splitting in these dye-based systems has, so far, been very low because the charge recombination reaction is faster than the catalytic four-electron oxidation of water to oxygen. We show here that the quantum yield is more than doubled by incorporating an electron transfer mediator that is mimetic of the tyrosine-histidine mediator in Photosystem II. The mediator molecule is covalently bound to the water oxidation catalyst, a colloidal iridium oxide particle, and is coadsorbed onto a porous titanium dioxide electrode with a Ruthenium polypyridyl sensitizer. As in the natural photosynthetic system, this molecule mediates electron transfer between a relatively slow metal oxide catalyst that oxidizes water on the millisecond timescale and a dye molecule that is oxidized in a fast light-induced electron transfer reaction. The presence of the mediator molecule in the system results in photoelectrochemical water splitting with an internal quantum efficiency of approximately 2.3% using blue light. PMID:22547794

Development of a Simple Electron Transfer and Polarization Model and Its Application to Biological Systems.

PubMed

Diller, David J

2017-01-10

Here we present a new method for point charge calculation which we call Q ET (charges by electron transfer). The intent of this work is to develop a method that can be useful for studying charge transfer in large biological systems. It is based on the intuitive framework of the Q EQ method with the key difference being that the Q ET method tracks all pairwise electron transfers by augmenting the Q EQ pseudoenergy function with a distance dependent cost function for each electron transfer. This approach solves the key limitation of the Q EQ method which is its handling of formally charged groups. First, we parametrize the Q ET method by fitting to electrostatic potentials calculated using ab initio quantum mechanics on over 11,000 small molecules. On an external test set of over 2500 small molecules the Q ET method achieves a mean absolute error of 1.37 kcal/mol/electron when compared to the ab initio electrostatic potentials. Second, we examine the conformational dependence of the charges on over 2700 tripeptides. With the tripeptide data set, we show that the conformational effects account for approximately 0.4 kcal/mol/electron on the electrostatic potentials. Third, we test the Q ET method for its ability to reproduce the effects of polarization and electron transfer on 1000 water clusters. For the water clusters, we show that the Q ET method captures about 50% of the polarization and electron transfer effects. Finally, we examine the effects of electron transfer and polarizability on the electrostatic interaction between p38 and 94 small molecule ligands. When used in conjunction with the Generalized-Born continuum solvent model, polarization and electron transfer with the Q ET model lead to an average change of 17 kcal/mol on the calculated electrostatic component of ΔG.

Electric field changes on Au nanoparticles on semiconductor supports--the molecular voltmeter and other methods to observe adsorbate-induced charge-transfer effects in Au/TiO2 nanocatalysts.

PubMed

McEntee, Monica; Stevanovic, Ana; Tang, Wenjie; Neurock, Matthew; Yates, John T

2015-02-11

Infrared (IR) studies of Au/TiO2 catalyst particles indicate that charge transfer from van der Waals-bound donor or acceptor molecules on TiO2 to or from Au occurs via transport of charge carriers in the semiconductor TiO2 support. The ΔνCO on Au is shown to be proportional to the polarizability of the TiO2 support fully covered with donor or acceptor molecules, producing a proportional frequency shift in νCO. Charge transfer through TiO2 is associated with the population of electron trap sites in the bandgap of TiO2 and can be independently followed by changes in photoluminescence intensity and by shifts in the broad IR absorbance region for electron trap sites, which is also proportional to the polarizability of donors by IR excitation. Density functional theory calculations show that electron transfer from the donor molecules to TiO2 and to supported Au particles produces a negative charge on the Au, whereas the transfer from the Au particles to the TiO2 support into acceptor molecules results in a positive charge on the Au. These changes along with the magnitudes of the shifts are consistent with the Stark effect. A number of experiments show that the ∼3 nm Au particles act as "molecular voltmeters" in influencing ΔνCO. Insulator particles, such as SiO2, do not display electron-transfer effects to Au particles on their surface. These studies are preliminary to doping studies of semiconductor-oxide particles by metal ions which modify Lewis acid/base oxide properties and possibly strongly modify the electron-transfer and catalytic activity of supported metal catalyst particles.

Tuning ultrafast electron injection dynamics at organic-graphene/metal interfaces.

PubMed

Ravikumar, Abhilash; Kladnik, Gregor; Müller, Moritz; Cossaro, Albano; Bavdek, Gregor; Patera, Laerte L; Sánchez-Portal, Daniel; Venkataraman, Latha; Morgante, Alberto; Brivio, Gian Paolo; Cvetko, Dean; Fratesi, Guido

2018-05-03

We compare the ultrafast charge transfer dynamics of molecules on epitaxial graphene and bilayer graphene grown on Ni(111) interfaces through first principles calculations and X-ray resonant photoemission spectroscopy. We use 4,4'-bipyridine as a prototypical molecule for these explorations as the energy level alignment of core-excited molecular orbitals allows ultrafast injection of electrons from a substrate to a molecule on a femtosecond timescale. We show that the ultrafast injection of electrons from the substrate to the molecule is ∼4 times slower on weakly coupled bilayer graphene than on epitaxial graphene. Through our experiments and calculations, we can attribute this to a difference in the density of states close to the Fermi level between graphene and bilayer graphene. We therefore show how graphene coupling with the substrate influences charge transfer dynamics between organic molecules and graphene interfaces.

Time-dependent view of an isotope effect in electron-nuclear nonequilibrium dynamics with applications to N2.

PubMed

Ajay, Jayanth S; Komarova, Ksenia G; Remacle, Francoise; Levine, R D

2018-06-05

Isotopic fractionation in the photodissociation of N 2 could explain the considerable variation in the 14 N/ 15 N ratio in different regions of our galaxy. We previously proposed that such an isotope effect is due to coupling of photoexcited bound valence and Rydberg electronic states in the frequency range where there is strong state mixing. We here identify features of the role of the mass in the dynamics through a time-dependent quantum-mechanical simulation. The photoexcitation of N 2 is by an ultrashort pulse so that the process has a sharply defined origin in time and so that we can monitor the isolated molecule dynamics in time. An ultrafast pulse is necessarily broad in frequency and spans several excited electronic states. Each excited molecule is therefore not in a given electronic state but in a superposition state. A short time after excitation, there is a fairly sharp onset of a mass-dependent large population transfer when wave packets on two different electronic states in the same molecule overlap. This coherent overlap of the wave packets on different electronic states in the region of strong coupling allows an effective transfer of population that is very mass dependent. The extent of the transfer depends on the product of the populations on the two different electronic states and on their relative phase. It is as if two molecules collide but the process occurs within one molecule, a molecule that is simultaneously in both states. An analytical toy model recovers the (strong) mass and energy dependence.

Electric-field-driven electron-transfer in mixed-valence molecules.

PubMed

Blair, Enrique P; Corcelli, Steven A; Lent, Craig S

2016-07-07

Molecular quantum-dot cellular automata is a computing paradigm in which digital information is encoded by the charge configuration of a mixed-valence molecule. General-purpose computing can be achieved by arranging these compounds on a substrate and exploiting intermolecular Coulombic coupling. The operation of such a device relies on nonequilibrium electron transfer (ET), whereby the time-varying electric field of one molecule induces an ET event in a neighboring molecule. The magnitude of the electric fields can be quite large because of close spatial proximity, and the induced ET rate is a measure of the nonequilibrium response of the molecule. We calculate the electric-field-driven ET rate for a model mixed-valence compound. The mixed-valence molecule is regarded as a two-state electronic system coupled to a molecular vibrational mode, which is, in turn, coupled to a thermal environment. Both the electronic and vibrational degrees-of-freedom are treated quantum mechanically, and the dissipative vibrational-bath interaction is modeled with the Lindblad equation. This approach captures both tunneling and nonadiabatic dynamics. Relationships between microscopic molecular properties and the driven ET rate are explored for two time-dependent applied fields: an abruptly switched field and a linearly ramped field. In both cases, the driven ET rate is only weakly temperature dependent. When the model is applied using parameters appropriate to a specific mixed-valence molecule, diferrocenylacetylene, terahertz-range ET transfer rates are predicted.

Toward an Organic Chemist's Periodic Table.

ERIC Educational Resources Information Center

Hall, H. K., Jr.

1980-01-01

An analogy between electron transfer reactions of the elements and those of organic molecules is offered. Examples of organic electron transfer reactions are presented. The rationale of constructing an organic chemists' periodic table is also discussed. (HM)

Molecular tips for scanning tunneling microscopy: intermolecular electron tunneling for single-molecule recognition and electronics.

PubMed

Nishino, Tomoaki

2014-01-01

This paper reviews the development of molecular tips for scanning tunneling microscopy (STM). Molecular tips offer many advantages: first is their ability to perform chemically selective imaging because of chemical interactions between the sample and the molecular tip, thus improving a major drawback of conventional STM. Rational design of the molecular tip allows sophisticated chemical recognition; e.g., chiral recognition and selective visualization of atomic defects in carbon nanotubes. Another advantage is that they provide a unique method to quantify electron transfer between single molecules. Understanding such electron transfer is mandatory for the realization of molecular electronics.

Distance dependence in photo-induced intramolecular electron transfer

NASA Astrophysics Data System (ADS)

Larsson, Sven; Volosov, Andrey

1986-09-01

The distance dependence of the rate of photo-induced electron transfer reactions is studied. A quantum mechanical method CNDO/S is applied to a series of molecules recently investigated by Hush et al. experimentally. The calculations show a large interaction through the saturated bridge which connects the two chromophores. The electronic matrix element HAB decreases a factor 10 in about 4 Å. There is also a decrease of the rate due to less exothermicity for the longer molecule. The results are in fair agreement with the experimental results.

Photoinduced Oxidative DNA Damage Revealed by an Agarose Gel Nicking Assay: A Biophysical Chemistry Laboratory Experiment

NASA Astrophysics Data System (ADS)

Shafirovich, Vladimir; Singh, Carolyn; Geacintov, Nicholas E.

2003-11-01

Oxidative damage of DNA molecules associated with electron-transfer reactions is an important phenomenon in living cells, which can lead to mutations and contribute to carcinogenesis and the aging processes. This article describes the design of several simple experiments to explore DNA damage initiated by photoinduced electron-transfer reactions sensitized by the acridine derivative, proflavine (PF). A supercoiled DNA agarose gel nicking assay is employed as a sensitive probe of DNA strand cleavage. A low-cost experimental and computer-interfaced imaging apparatus is described allowing for the digital recording and analysis of the gel electrophoresis results. The first experiment describes the formation of direct strand breaks in double-stranded DNA induced by photoexcitation of the intercalated PF molecules. The second experiment demonstrates that the addition of the well-known electron acceptor, methylviologen, gives rise to a significant enhancement of the photochemical DNA strand cleavage effect. This occurs by an electron transfer step to methylviologen that renders the inital photoinduced charge separation between photoexcited PF and DNA irreversible. The third experiment demonstrates that the action spectrum of the DNA photocleavage matches the absorption spectrum of DNA-bound, intercalated PF molecules, which differs from that of free PF molecules. This result demonstrates that the photoinduced DNA strand cleavage is initiated by intercalated rather than free PF molecules.

Light- induced electron transfer and ATP synthesis in a carotene synthesizing insect

NASA Astrophysics Data System (ADS)

Valmalette, Jean Christophe; Dombrovsky, Aviv; Brat, Pierre; Mertz, Christian; Capovilla, Maria; Robichon, Alain

2012-08-01

A singular adaptive phenotype of a parthenogenetic insect species (Acyrthosiphon pisum) was selected in cold conditions and is characterized by a remarkable apparition of a greenish colour. The aphid pigments involve carotenoid genes well defined in chloroplasts and cyanobacteria and amazingly present in the aphid genome, likely by lateral transfer during evolution. The abundant carotenoid synthesis in aphids suggests strongly that a major and unknown physiological role is related to these compounds beyond their canonical anti-oxidant properties. We report here that the capture of light energy in living aphids results in the photo induced electron transfer from excited chromophores to acceptor molecules. The redox potentials of molecules involved in this process would be compatible with the reduction of the NAD+ coenzyme. This appears as an archaic photosynthetic system consisting of photo-emitted electrons that are in fine funnelled into the mitochondrial reducing power in order to synthesize ATP molecules.

Protein Conformational Dynamics Probed by Single-Molecule Electron Transfer

NASA Astrophysics Data System (ADS)

Yang, Haw; Luo, Guobin; Karnchanaphanurach, Pallop; Louie, Tai-Man; Rech, Ivan; Cova, Sergio; Xun, Luying; Xie, X. Sunney

2003-10-01

Electron transfer is used as a probe for angstrom-scale structural changes in single protein molecules. In a flavin reductase, the fluorescence of flavin is quenched by a nearby tyrosine residue by means of photo-induced electron transfer. By probing the fluorescence lifetime of the single flavin on a photon-by-photon basis, we were able to observe the variation of flavin-tyrosine distance over time. We could then determine the potential of mean force between the flavin and the tyrosine, and a correlation analysis revealed conformational fluctuation at multiple time scales spanning from hundreds of microseconds to seconds. This phenomenon suggests the existence of multiple interconverting conformers related to the fluctuating catalytic reactivity.

Electric-field-driven electron-transfer in mixed-valence molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blair, Enrique P., E-mail: enrique-blair@baylor.edu; Corcelli, Steven A., E-mail: scorcell@nd.edu; Lent, Craig S., E-mail: lent@nd.edu

2016-07-07

Molecular quantum-dot cellular automata is a computing paradigm in which digital information is encoded by the charge configuration of a mixed-valence molecule. General-purpose computing can be achieved by arranging these compounds on a substrate and exploiting intermolecular Coulombic coupling. The operation of such a device relies on nonequilibrium electron transfer (ET), whereby the time-varying electric field of one molecule induces an ET event in a neighboring molecule. The magnitude of the electric fields can be quite large because of close spatial proximity, and the induced ET rate is a measure of the nonequilibrium response of the molecule. We calculate themore » electric-field-driven ET rate for a model mixed-valence compound. The mixed-valence molecule is regarded as a two-state electronic system coupled to a molecular vibrational mode, which is, in turn, coupled to a thermal environment. Both the electronic and vibrational degrees-of-freedom are treated quantum mechanically, and the dissipative vibrational-bath interaction is modeled with the Lindblad equation. This approach captures both tunneling and nonadiabatic dynamics. Relationships between microscopic molecular properties and the driven ET rate are explored for two time-dependent applied fields: an abruptly switched field and a linearly ramped field. In both cases, the driven ET rate is only weakly temperature dependent. When the model is applied using parameters appropriate to a specific mixed-valence molecule, diferrocenylacetylene, terahertz-range ET transfer rates are predicted.« less

Photoinduced electron transfer in covalent ruthenium-anthraquinone dyads: relative importance of driving-force, solvent polarity, and donor-bridge energy gap.

PubMed

Hankache, Jihane; Wenger, Oliver S

2012-02-28

Four rigid rod-like molecules comprised of a Ru(bpy)(3)(2+) (bpy = 2,2'-bipyridine) photosensitizer, a 9,10-anthraquinone electron acceptor, and a molecular bridge connecting the two redox partners were synthesized and investigated by optical spectroscopic and electrochemical means. An attempt was made to assess the relative importance of driving-force, solvent polarity, and bridge variation on the rates of photoinduced electron transfer in these molecules. Expectedly, introduction of tert-butyl substituents in the bipyridine ligands of the ruthenium complex and a change in solvent from dichloromethane to acetonitrile lead to a significant acceleration of charge transfer rates. In dichloromethane, photoinduced electron transfer is not competitive with the inherent excited-state deactivation processes of the photosensitizer. In acetonitrile, an increase in driving-force by 0.2 eV through attachment of tert-butyl substituents to the bpy ancillary ligands causes an increase in electron transfer rates by an order of magnitude. Replacement of a p-xylene bridge by a p-dimethoxybenzene spacer entails an acceleration of charge transfer rates by a factor of 3.5. In the dyads from this study, the relative order of importance of individual influences on electron transfer rates is therefore as follows: solvent polarity ≥ driving-force > donor-bridge energy gap.

Photoinduced charge transfer from vacuum-deposited molecules to single-layer transition metal dichalcogenides

NASA Astrophysics Data System (ADS)

Osada, Kazuki; Tanaka, Masatoshi; Ohno, Shinya; Suzuki, Takanori

2016-06-01

Variations of photoluminescence (PL) and Raman spectra of single-layer MoS2, MoSe2, WS2, and WSe2 due to the vacuum deposition of C60 or copper phthalocyanine (CuPc) molecules have been investigated. PL spectra are decomposed into two competitive components, an exciton and a charged exciton (trion), depending on carrier density. The variation of PL spectra is interpreted in terms of charge transfer across the interfaces between transition metal dichalcogenides (TMDs) and dopant molecules. We find that deposited C60 molecules inject photoexcited electrons into MoS2, MoSe2, and WS2 or holes into WSe2. CuPc molecules also inject electrons into MoS2, MoSe2, and WS2, while holes are depleted from WSe2 to CuPc. We then propose a band alignment between TMDs and dopant molecules. Peak shifts of Raman spectra and doped carrier density estimated using a three-level model also support the band alignment. We thus demonstrate photoinduced charge transfer from dopant molecules to single-layer TMDs.

Investigating molecule-semiconductor interfaces with nonlinear spectroscopies

NASA Astrophysics Data System (ADS)

Giokas, Paul George

Knowledge of electronic structures and transport mechanisms at molecule-semiconductor interfaces is motivated by their ubiquity in photoelectrochemical cells. In this dissertation, optical spectroscopies are used uncover the influence of electronic coupling, coherent vibrational motion, and molecular geometry, and other factors on dynamics initiated by light absorption at such interfaces. These are explored for a family of ruthenium bipyridyl chromophores bound to titanium dioxide. Transient absorption measurements show molecular singlet state electron injection in 100 fs or less. Resonance Raman intensity analysis suggests the electronic excitations possess very little charge transfer character. The connections drawn in this work between molecular structure and photophysical behavior contribute to the general understanding of photoelectrochemical cells. Knowledge of binding geometry in nanocrystalline films is challenged by heterogeneity of semiconductor surfaces. Polarized resonance Raman spectroscopy is used to characterize the ruthenium chromophore family on single crystal titanium dioxide . Chromophores display a broad distribution of molecular geometries at the interface, with increased variation in binding angle due to the presence of a methylene bridge, as well as additional phosphonate anchors. This result implies multiple binding configurations for chromophores which incorporate multiple phosphonate ligands, and indicates the need for careful consideration when developing surface-assembled chromophore-catalyst cells. Electron transfer transitions occurring on the 100 fs time scale challenge conventional second-order approximations made when modeling these reactions. A fourth-order perturbative model which includes the relationship between coincident electron transfer and nuclear relaxation processes is presented. Insights provided by the model are illustrated for a two-level donor molecule. The presented fourth-order rate formula constitutes a rigorous and intuitive framework for understanding sub-picosecond photoinduced electron transfer dynamics. Charge transfer systems fit by this model include catechol-sensitized titanium dioxide nanoparticles and a closely-related molecular complex. These systems exhibit vibrational coherence coincident with back-electron transfer in the first picosecond after excitation, which suggests that intramolecular nuclear motion strongly influences the electronic transfer process and plays an important role in the dynamics of interfacial systems following light absorption.

Electrode redox reactions with polarizable molecules.

PubMed

Matyushov, Dmitry V

2018-04-21

A theory of redox reactions involving electron transfer between a metal electrode and a polarizable molecule in solution is formulated. Both the existence of molecular polarizability and its ability to change due to electron transfer distinguish this problem from classical theories of interfacial electrochemistry. When the polarizability is different between the oxidized and reduced states, the statistics of thermal fluctuations driving the reactant over the activation barrier becomes non-Gaussian. The problem of electron transfer is formulated as crossing of two non-parabolic free energy surfaces. An analytical solution for these free energy surfaces is provided and the activation barrier of electrode electron transfer is given in terms of two reorganization energies corresponding to the oxidized and reduced states of the molecule in solution. The new non-Gaussian theory is, therefore, based on two theory parameters in contrast to one-parameter Marcus formulation for electrode reactions. The theory, which is consistent with the Nernst equation, predicts asymmetry between the cathodic and anodic branches of the electrode current. They show different slopes at small electrode overpotentials and become curved at larger overpotentials. However, the curvature of the Tafel plot is reduced compared to the Marcus-Hush model and approaches the empirical Butler-Volmer form with different transfer coefficients for the anodic and cathodic currents.

Electrode redox reactions with polarizable molecules

NASA Astrophysics Data System (ADS)

Matyushov, Dmitry V.

2018-04-01

A theory of redox reactions involving electron transfer between a metal electrode and a polarizable molecule in solution is formulated. Both the existence of molecular polarizability and its ability to change due to electron transfer distinguish this problem from classical theories of interfacial electrochemistry. When the polarizability is different between the oxidized and reduced states, the statistics of thermal fluctuations driving the reactant over the activation barrier becomes non-Gaussian. The problem of electron transfer is formulated as crossing of two non-parabolic free energy surfaces. An analytical solution for these free energy surfaces is provided and the activation barrier of electrode electron transfer is given in terms of two reorganization energies corresponding to the oxidized and reduced states of the molecule in solution. The new non-Gaussian theory is, therefore, based on two theory parameters in contrast to one-parameter Marcus formulation for electrode reactions. The theory, which is consistent with the Nernst equation, predicts asymmetry between the cathodic and anodic branches of the electrode current. They show different slopes at small electrode overpotentials and become curved at larger overpotentials. However, the curvature of the Tafel plot is reduced compared to the Marcus-Hush model and approaches the empirical Butler-Volmer form with different transfer coefficients for the anodic and cathodic currents.

Heterogeneous Electron-Transfer Dynamics through Dipole-Bridge Groups.

PubMed

Nieto-Pescador, Jesus; Abraham, Baxter; Li, Jingjing; Batarseh, Alberto; Bartynski, Robert A; Galoppini, Elena; Gundlach, Lars

2016-01-14

Heterogeneous electron transfer (HET) between photoexcited molecules and colloidal TiO 2 has been investigated for a set of Zn-porphyrin chromophores attached to the semiconductor via linkers that allow to change level alignment by 200 meV by reorientation of the dipole moment. These unique dye molecules have been studied by femtosecond transient absorption spectroscopy in solution and adsorbed on the TiO 2 colloidal film in vacuum. In solution energy transfer from the excited chromophore to the dipole group has been identified as a slow relaxation pathway competing with S 2 -S 1 internal conversion. On the film heterogeneous electron transfer occurred in 80 fs, much faster compared to all intramolecular pathways. Despite a difference of 200 meV in level alignment of the excited state with respect to the semiconductor conduction band, identical electron transfer times were measured for different linkers. The measurements are compared to a quantum-mechanical model that accounts for electronic-vibronic coupling and finite band width for the acceptor states. We conclude that HET occurs into a distribution of transition states that differs from regular surface states or bridge mediated states.

Water-mediated electron transfer between protein redox centers.

PubMed

Migliore, Agostino; Corni, Stefano; Felice, Rosa Di; Molinari, Elisa

2007-04-12

Recent experimental and theoretical investigations show that water molecules between or near redox partners can significantly affect their electron-transfer (ET) properties. Here we study the effects of intervening water molecules on the electron self-exchange reaction of azurin (Az), by performing a conformational sampling on the water medium and by using a newly developed ab initio method to calculate transfer integrals between molecular redox sites. We show that the insertion of water molecules at the interface between the copper active sites of Az dimers slightly increases the overall ET rate, while some favorable water conformations can considerably enhance the ET kinetics. These features are traced back to the interplay of two competing factors: the electrostatic interaction between the water and protein subsystems (mainly opposing the ET process for the water arrangements drawn from MD simulations) and the effectiveness of water in mediating ET coupling pathways. Such an interplay provides a physical basis for the found absence of correlation between the electronic couplings derived through ab initio electronic structure calculations and the related quantities obtained through the Empirical Pathways (EP) method. In fact, the latter does not account for electrostatic effects on the transfer integrals. Thus, we conclude that the water-mediated electron tunneling is not controlled by the geometry of a single physical pathway. We discuss the results in terms of the interplay between different ET pathways controlled by the conformational changes of one of the water molecules via its electrostatic influence. Finally, we examine the dynamical effects of the interfacial water and check the validity of the Condon approximation.

A simple model of solvent-induced symmetry-breaking charge transfer in excited quadrupolar molecules

NASA Astrophysics Data System (ADS)

Ivanov, Anatoly I.; Dereka, Bogdan; Vauthey, Eric

2017-04-01

A simple model has been developed to describe the symmetry-breaking of the electronic distribution of AL-D-AR type molecules in the excited state, where D is an electron donor and AL and AR are identical acceptors. The origin of this process is usually associated with the interaction between the molecule and the solvent polarization that stabilizes an asymmetric and dipolar state, with a larger charge transfer on one side than on the other. An additional symmetry-breaking mechanism involving the direct Coulomb interaction of the charges on the acceptors is proposed. At the same time, the electronic coupling between the two degenerate states, which correspond to the transferred charge being localised either on AL or AR, favours a quadrupolar excited state with equal amount of charge-transfer on both sides. Because of these counteracting effects, symmetry breaking is only feasible when the electronic coupling remains below a threshold value, which depends on the solvation energy and the Coulomb repulsion energy between the charges located on AL and AR. This model allows reproducing the solvent polarity dependence of the symmetry-breaking reported recently using time-resolved infrared spectroscopy.

Substituent effects on the electronic characteristics of pentacene derivatives for organic electronic devices: dioxolane-substituted pentacene derivatives with triisopropylsilylethynyl functional groups.

PubMed

Griffith, Olga Lobanova; Anthony, John E; Jones, Adolphus G; Shu, Ying; Lichtenberger, Dennis L

2012-08-29

The intramolecular electronic structures and intermolecular electronic interactions of 6,13-bis(triisopropylsilylethynyl)pentacene (TIPS pentacene), 6,14-bis-(triisopropylsilylethynyl)-1,3,9,11-tetraoxa-dicyclopenta[b,m]-pentacene (TP-5 pentacene), and 2,2,10,10-tetraethyl-6,14-bis-(triisopropylsilylethynyl)-1,3,9,11-tetraoxa-dicyclopenta[b,m]pentacene (EtTP-5 pentacene) have been investigated by the combination of gas-phase and solid-phase photoelectron spectroscopy measurements. Further insight has been provided by electrochemical measurements in solution, and the principles that emerge are supported by electronic structure calculations. The measurements show that the energies of electron transfer such as the reorganization energies, ionization energies, charge-injection barriers, polarization energies, and HOMO-LUMO energy gaps are strongly dependent on the particular functionalization of the pentacene core. The ionization energy trends as a function of the substitution observed for molecules in the gas phase are not reproduced in measurements of the molecules in the condensed phase due to polarization effects in the solid. The electronic behavior of these materials is impacted less by the direct substituent electronic effects on the individual molecules than by the indirect consequences of substituent effects on the intermolecular interactions. The ionization energies as a function of film thickness give information on the relative electrical conductivity of the films, and all three molecules show different material behavior. The stronger intermolecular interactions in TP-5 pentacene films lead to better charge transfer properties versus those in TIPS pentacene films, and EtTP-5 pentacene films have very weak intermolecular interactions and the poorest charge transfer properties of these molecules.

Ab initio quantum chemical calculation of electron transfer matrix elements for large molecules

NASA Astrophysics Data System (ADS)

Zhang, Linda Yu; Friesner, Richard A.; Murphy, Robert B.

1997-07-01

Using a diabatic state formalism and pseudospectral numerical methods, we have developed an efficient ab initio quantum chemical approach to the calculation of electron transfer matrix elements for large molecules. The theory is developed at the Hartree-Fock level and validated by comparison with results in the literature for small systems. As an example of the power of the method, we calculate the electronic coupling between two bacteriochlorophyll molecules in various intermolecular geometries. Only a single self-consistent field (SCF) calculation on each of the monomers is needed to generate coupling matrix elements for all of the molecular pairs. The largest calculations performed, utilizing 1778 basis functions, required ˜14 h on an IBM 390 workstation. This is considerably less cpu time than would be necessitated with a supermolecule adiabatic state calculation and a conventional electronic structure code.

Electron scattering by molecules. II - Experimental methods and data

NASA Technical Reports Server (NTRS)

Trajmar, S.; Chutjian, A.; Register, D. F.

1983-01-01

Experimental techniques for measuring electron-molecule collision cross sections are briefly summarized. A survey of the available experimental cross section data is presented. The emphasis here is on elastic scattering, rotational, vibrational and electronic excitations, total electron scattering, and momentum transfer in the few eV to few hundred eV impact energy range. Reference is made to works concerned with high energy electron scattering, innershell and multi-electron excitations, conicidence methods and electron scattering in laser fields.

Photoinduced electron transfer in rigidly linked dimethoxynapthalene-N-methylpyridinium donor-acceptor molecules

NASA Astrophysics Data System (ADS)

Clayton, Andrew H. A.; Ghiggino, Kenneth P.; Wilson, Gerard J.; Keyte, Peter J.; Paddon-Row, Michael N.

1992-07-01

Photoinduced electron transfer (ET) is studied in a series of novel molecules containing a dimethoxynaphthalene (DMN) donor and either a pyridine (P) or N-methylpyridinium (P-Me +) acceptor covalently linked via a rigid nonbornalogous bridge ( n sigma bonds in length). ET rates of the order of 10 10 s -1 were measured for the DMN- n-P-Me + series ( n = 4, 6), while no appreciable ET was observed for the DMN- n-P compounds. Electronic and nuclear factors are discussed and the results rationalized in terms of Marcus—Hush and non-adiabatic ET theories.

Synthesis of an A-D-A type of molecule used as electron acceptor for improving charge transfer in organic solar cells

NASA Astrophysics Data System (ADS)

Zhang, Chao-Zhi; Gu, Shu-Duo; Shen, Dan; Yuan, Yang; Zhang, Mingdao

2016-08-01

Electron-accepting molecules play an important role in developing organic solar cells. A new type of A-D-A molecule, 3,6-di([7-(5-bromothiophen-2-yl)-1,5,2,4,6,8-dithiotetrazocin-3-yl]thiophen-2-yl)-9-(2-ethylhexyl)carbazole, was synthesized. The lowest unoccupied molecular orbital (LUMO) and highest occupied molecular orbital (HOMO) energy levels are -3.55 and -5.85 eV, respectively. Therefore, the A-D-A type of compound could be used as electron acceptor for fabricating organic solar cell with a high open circuit voltage. Gibbs free energy (-49.2 kJ/mol) reveals that the process of A-D-A acceptor accepting an electron from poly(3-hexylthiophene) at excited state is spontaneous. The value of entropy (118 J/mol) in the process of an electron transferring from P3HT to the A-D-A acceptor at organic interface suggests that electrons generated from separation of electron-hole pairs at donor/acceptor interface would be delocalized efficiently. Therefore, the A-D-A molecule would be a potential acceptor for efficient organic BHJ solar cells.

Supramolecular networks with electron transfer in two dimensions

DOEpatents

Stupp, Samuel I.; Stoddart, J. Fraser; Shveyd, Alexander K.; Tayi, Alok S.; Sue, Chi-Hau; Narayanan, Ashwin

2016-09-13

Organic charge-transfer (CT) co-crystals in a crossed stack system are disclosed. The co-crystals exhibit bidirectional charge transfer interactions where one donor molecule shares electrons with two different acceptors, one acceptor face-to-face and the other edge-to-face. The assembly and charge transfer interaction results in a pleochroic material whereby the optical absorption continuously changes depending on the polarization angle of incident light.

Design of a Molecular Memory Device: The Electron Transfer Shift Register Memory

NASA Technical Reports Server (NTRS)

Beratan, D.

1993-01-01

A molecular shift register memory at the molecular level is described. The memory elements consist of molecules can exit in either an oxidized or reduced state and the bits are shifted between the cells with photoinduced electron transfer reactions.

Study on Synergistic Mechanism of Inhibitor Mixture Based on Electron Transfer Behavior

PubMed Central

Han, Peng; He, Yang; Chen, Changfeng; Yu, Haobo; Liu, Feng; Yang, Hong; Ma, Yue; Zheng, Yanjun

2016-01-01

Mixing is an important method to improve the performance of surfactants due to their synergistic effect. The changes in bonding interaction and adsorption structure of IM and OP molecules before and after co-adsorbed on Fe(001) surface is calculated by DFTB+ method. It is found that mixture enable the inhibitor molecules with higher EHOMO donate more electrons while the inhibitor molecules with lower ELUMO accept more electrons, which strengthens the bonding interaction of both inhibitor agent and inhibitor additive with metal surface. Meanwhile, water molecules in the compact layer of double electric layer are repulsed and the charge transfer resistance during the corrosion process increases. Accordingly, the correlation between the frontier orbital (EHOMO and ELUMO of inhibitor molecules and the Fermi level of metal) and inhibition efficiency is determined. Finally, we propose a frontier orbital matching principle for the synergistic effect of inhibitors, which is verified by electrochemical experiments. This frontier orbital matching principle provides an effective quantum chemistry calculation method for the optimal selection of inhibitor mixture. PMID:27671332

Information storage at the molecular level - The design of a molecular shift register memory

NASA Technical Reports Server (NTRS)

Beratan, David N.; Onuchic, Jose Nelson; Hopfield, J. J.

1989-01-01

The control of electron transfer rates is discussed and a molecular shift register memory at the molecular level is described. The memory elements are made up of molecules which can exist in either an oxidized or reduced state and the bits can be shifted between the cells with photoinduced electron transfer reactions. The device integrates designed molecules onto a VLSI substrate. A control structure to modify the flow of information along a shift register is indicated schematically.

A theoretical study of structural and electronic properties of pentacene/Al(100) interface.

PubMed

Saranya, G; Nair, Shiny; Natarajan, V; Kolandaivel, P; Senthilkumar, K

2012-09-01

The first principle calculations within the framework of density functional theory have been performed for the pentacene molecule deposited on the aluminum Al(100) substrate to study the structural and electronic properties of the pentacene/Al(100) interface. The most stable configuration was found at bridge site with 45° rotation of the pentacene molecule on Al(100) surface with a vertical distance of 3.4 Å within LDA and 3.8 Å within GGA functionals. The calculated adsorption energy reveals that the adsorption of pentacene molecule on Al(100) surface is physisorption. For the stable adsorption geometry the electronic properties such as density of states (DOS), partial density of states (PDOS), Mulliken population analysis and Schottky barrier height are studied. The analysis of atomic charge, DOS and PDOS show that the charge is transferred from the Al(100) surface to pentacene molecule, and the transferred charge is about -0.05 electrons. For the adsorbed system, the calculated Schottky barrier height for hole and electron transport is 0.27 and 1.55 eV, respectively. Copyright © 2012 Elsevier Inc. All rights reserved.

Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level

DOE PAGES

Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; ...

2016-09-09

In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less

Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gillet, Natacha; Berstis, Laura; Wu, Xiaojing

In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less

Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level.

PubMed

Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; Gajdos, Fruzsina; Heck, Alexander; de la Lande, Aurélien; Blumberger, Jochen; Elstner, Marcus

2016-10-11

In this article, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesized by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated π-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. These four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.

Electron Transfer as a Probe of the Interfacial Quantum Dot-Organic Molecule Interaction

NASA Astrophysics Data System (ADS)

Peterson, Mark D.

This dissertation describes a set of experimental and theoretical studies of the interaction between small organic molecules and the surfaces of semiconductor nanoparticles, also called quantum dots (QDs). Chapter 1 reviews the literature on the influence of ligands on exciton relaxation dynamics following photoexcitation of semiconductor QDs, and describes how ligands promote or inhibit processes such as emission, nonradiative relaxation, and charge transfer to redox active adsorbates. Chapter 2 investigates the specific interaction of alkylcarboxylated viologen derivatives with CdS QDs, and shows how a combination of steady-state photoluminescence (PL) and transient absorption (TA) experiments can be used to reveal the specific binding geometry of redox active organic molecules on QD surfaces. Chapter 3 expands on Chapter 2 by using PL and TA to provide information about the mechanisms through which methyl viologen (MV 2+) associates with CdS QDs to form a stable QD/MV2+ complex, suggesting two chemically distinct reactions. We use our understanding of the QD/molecule interaction to design a drug delivery system in Chapter 4, which employs PL and TA experiments to show that conformational changes in a redox active adsorbate may follow electron transfer, "activating" a biologically inert Schiff base to a protein inhibitor form. The protein inhibitor limits cell motility and may be used to prevent tumor metastasis in cancer patients. Chapter 5 discusses future applications of QD/molecule redox couples with an emphasis on efficient multiple charge-transfer reactions -- a process facilitated by the high degeneracy of band-edge states in QDs. These multiple charge-transfer reactions may potentially increase the thermodynamic efficiency of solar cells, and may also facilitate the splitting of water into fuel. Multiple exciton generation procedures, multi-electron transfer experiments, and future directions are discussed.

Molecular alignment effect on the photoassociation process via a pump-dump scheme.

PubMed

Wang, Bin-Bin; Han, Yong-Chang; Cong, Shu-Lin

2015-09-07

The photoassociation processes via the pump-dump scheme for the heternuclear (Na + H → NaH) and the homonuclear (Na + Na → Na2) molecular systems are studied, respectively, using the time-dependent quantum wavepacket method. For both systems, the initial atom pair in the continuum of the ground electronic state (X(1)Σ(+)) is associated into the molecule in the bound states of the excited state (A(1)Σ(+)) by the pump pulse. Then driven by a time-delayed dumping pulse, the prepared excited-state molecule can be transferred to the bound states of the ground electronic state. It is found that the pump process can induce a superposition of the rovibrational levels |v, j〉 on the excited state, which can lead to the field-free alignment of the excited-state molecule. The molecular alignment can affect the dumping process by varying the effective coupling intensity between the two electronic states or by varying the population transfer pathways. As a result, the final population transferred to the bound states of the ground electronic state varies periodically with the delay time of the dumping pulse.

Molecular alignment effect on the photoassociation process via a pump-dump scheme

NASA Astrophysics Data System (ADS)

Wang, Bin-Bin; Han, Yong-Chang; Cong, Shu-Lin

2015-09-01

The photoassociation processes via the pump-dump scheme for the heternuclear (Na + H → NaH) and the homonuclear (Na + Na → Na2) molecular systems are studied, respectively, using the time-dependent quantum wavepacket method. For both systems, the initial atom pair in the continuum of the ground electronic state (X1Σ+) is associated into the molecule in the bound states of the excited state (A1Σ+) by the pump pulse. Then driven by a time-delayed dumping pulse, the prepared excited-state molecule can be transferred to the bound states of the ground electronic state. It is found that the pump process can induce a superposition of the rovibrational levels |v, j> on the excited state, which can lead to the field-free alignment of the excited-state molecule. The molecular alignment can affect the dumping process by varying the effective coupling intensity between the two electronic states or by varying the population transfer pathways. As a result, the final population transferred to the bound states of the ground electronic state varies periodically with the delay time of the dumping pulse.

Direct Observation of Individual Charges and Their Dynamics on Graphene by Low-Energy Electron Holography.

PubMed

Latychevskaia, Tatiana; Wicki, Flavio; Longchamp, Jean-Nicolas; Escher, Conrad; Fink, Hans-Werner

2016-09-14

Visualizing individual charges confined to molecules and observing their dynamics with high spatial resolution is a challenge for advancing various fields in science, ranging from mesoscopic physics to electron transfer events in biological molecules. We show here that the high sensitivity of low-energy electrons to local electric fields can be employed to directly visualize individual charged adsorbates and to study their behavior in a quantitative way. This makes electron holography a unique probing tool for directly visualizing charge distributions with a sensitivity of a fraction of an elementary charge. Moreover, spatial resolution in the nanometer range and fast data acquisition inherent to lens-less low-energy electron holography allows for direct visual inspection of charge transfer processes.

Water Molecules Gating a Photoinduced One-Electron Two-Protons Transfer in a Tyrosine/Histidine (Tyr/His) Model of Photosystem II.

PubMed

Chararalambidis, Georgios; Das, Shyamal; Trapali, Adelais; Quaranta, Annamaria; Orio, Maylis; Halime, Zakaria; Fertey, Pierre; Guillot, Régis; Coutsolelos, Athanassios; Leibl, Winfried; Aukauloo, Ally; Sircoglou, Marie

2018-05-22

We investigate a biomimetic model of a Tyr Z /His 190 pair, a hydrogen-bonded phenol/imidazole covalently attached to a porphyrin sensitizer. Laser flash photolysis in the presence of an external electron acceptor reveals the need for water molecules to unlock the light-induced oxidation of the phenol through an intramolecular pathway. Kinetics monitoring encompasses two fast phases with distinct spectral properties. The first phase is related to a one-electron transfer from the phenol to the porphyrin radical cation coupled with a domino two-proton transfer leading to the ejection of a proton from the imidazole-phenol pair. The second phase concerns conveying the released proton to the porphyrin N 4 coordinating cavity. Our study provides an unprecedented example of a light-induced electron-transfer process in a Tyr Z /His 190 model of photosystem II, evidencing the movement of both the phenol and imidazole protons along an isoenergetic pathway. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Distance dependence in photoinduced intramolecular electron transfer. Additional remarks and calculations

NASA Astrophysics Data System (ADS)

Larsson, Sven; Volosov, Andrey

1987-12-01

Rate constants for photoinduced intramolecular electron transfer are calculated for four of the molecules studied by Hush et al. The electronic factor is obtained in quantum chemical calculations using the CNDO/S method. The results agree reasonably well with experiments for the forward reaction. Possible reasons for the disagreement for the charge recombination process are offered.

Photophysical Behaviors of Single Fluorophores Localized on Zinc Oxide Nanostructures

PubMed Central

Fu, Yi; Zhang, Jian; Lakowicz, Joseph R.

2012-01-01

Single-molecule fluorescence spectroscopy has now been widely used to investigate complex dynamic processes which would normally be obscured in an ensemble-averaged measurement. In this report we studied photophysical behaviors of single fluorophores in proximity to zinc oxide nanostructures by single-molecule fluorescence spectroscopy and time-correlated single-photon counting (TCSPC). Single fluorophores on ZnO surfaces showed enhanced fluorescence brightness to various extents compared with those on glass; the single-molecule time trajectories also illustrated pronounced fluctuations of emission intensities, with time periods distributed from milliseconds to seconds. We attribute fluorescence fluctuations to the interfacial electron transfer (ET) events. The fluorescence fluctuation dynamics were found to be inhomogeneous from molecule to molecule and from time to time, showing significant static and dynamic disorders in the interfacial electron transfer reaction processes. PMID:23109903

Plasmon enhanced heterogeneous electron transfer with continuous band energy model

NASA Astrophysics Data System (ADS)

Zhao, Dandan; Niu, Lu; Wang, Luxia

2017-08-01

Photoinduced charge injection from a perylene dye molecule into the conduction band of a TiO2 system decorated by a metal nanoparticles (MNP) is studied theoretically. Utilizing the density matrix theory the charge transfer dynamics is analyzed. The continuous behavior of the TiO2 conduction band is accounted for by a Legendre polynomials expansion. The simulations consider optical excitation of the dye molecule coupled to the MNP and the subsequent electron injection into the TiO2 semiconductor. Due to the energy transfer coupling between the molecule and the MNP optical excitation and subsequent charge injection into semiconductor is strongly enhanced. The respective enhancement factor can reach values larger than 103. Effects of pulse duration, coupling strength and energetic resonances are also analyzed. The whole approach offers an efficient way to increase charge injection in dye-sensitized solar cells.

Three-dimensional tertiary structure of yeast phenylalanine transfer RNA

NASA Technical Reports Server (NTRS)

Kim, S. H.; Sussman, J. L.; Suddath, F. L.; Quigley, G. J.; Mcpherson, A.; Wang, A. H. J.; Seeman, N. C.; Rich, A.

1974-01-01

Results of an analysis and interpretation of a 3-A electron density map of yeast phenylalanine transfer RNA. Some earlier detailed assignments of nucleotide residues to electron density peaks are found to be in error, even though the overall tracing of the backbone conformation of yeast phenylalanine transfer RNA was generally correct. A new, more comprehensive interpretation is made which makes it possible to define the tertiary interactions in the molecule. The new interpretation makes it possible to visualize a number of tertiary interactions which not only explain the structural role of most of the bases which are constant in transfer RNAs, but also makes it possible to understand in a direct and simple fashion the chemical modification data on transfer RNA. In addition, this pattern of tertiary interactions provides a basis for understanding the general three-dimensional folding of all transfer RNA molecules.

Single-Molecule Interfacial Electron Transfer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ho, Wilson

Interfacial electron transfer (ET) plays an important role in many chemical and biological processes. Specifically, interfacial ET in TiO 2-based systems is important to solar energy technology, catalysis, and environmental remediation technology. However, the microscopic mechanism of interfacial ET is not well understood with regard to atomic surface structure, molecular structure, bonding, orientation, and motion. In this project, we used two complementary methodologies; single-molecule fluorescence spectroscopy, and scanning-tunneling microscopy and spectroscopy (STM and STS) to address this scientific need. The goal of this project was to integrate these techniques and measure the molecular dependence of ET between adsorbed molecules andmore » TiO 2 semiconductor surfaces and the ET induced reactions such as the splitting of water. The scanning probe techniques, STM and STS, are capable of providing the highest spatial resolution but not easily time-resolved data. Single-molecule fluorescence spectroscopy is capable of good time resolution but requires further development to match the spatial resolution of the STM. The integrated approach involving Peter Lu at Bowling Green State University (BGSU) and Wilson Ho at the University of California, Irvine (UC Irvine) produced methods for time and spatially resolved chemical imaging of interfacial electron transfer dynamics and photocatalytic reactions. An integral aspect of the joint research was a significant exchange of graduate students to work at the two institutions. This project bridged complementary approaches to investigate a set of common problems by working with the same molecules on a variety of solid surfaces, but using appropriate techniques to probe under ambient (BGSU) and ultrahigh vacuum (UCI) conditions. The molecular level understanding of the fundamental interfacial electron transfer processes obtained in this joint project will be important for developing efficient light harvesting, solar energy conversion, and broadly applicable to problems in interface chemistry and surface physics.« less

Electron Transfer Mechanism in Gold Surface Modified with Self-Assembly Monolayers from First Principles

NASA Astrophysics Data System (ADS)

Lima, Filipe C. D. A.; Iost, Rodrigo M.; Crespilho, Frank N.; Caldas, Marília J.; Calzolari, Arrigo; Petrilli, Helena M.

2013-03-01

We report the investigation of electron tunneling mechanism of peptide ferrocenyl-glycylcystamine self-assembled monolayers (SAMs) onto Au (111) electrode surfaces. Recent experimental investigations showed that electron transfer in peptides can occur across long distances by separating the donor from the acceptor. This mechanism can be further fostered by the presence of electron donor terminations of Fc terminal units on SAMs but the charge transfer mechanism is still not clear. We study the interaction of the peptide ferrocenyl-glycylcystamine on the Au (111) from first principles calculations to evaluate the electron transfer mechanism. For this purpose, we used the Kohn Sham (KS) scheme for the Density Functional Theory (DFT) as implemented in the Quantum-ESPRESSO suit of codes, using Vandebilt ultrasoft pseudopotentials and GGA-PBE exchange correlation functional to evaluate the ground-state atomic and electronic structure of the system. The analysis of KS orbital at the Fermi Energy showed high electronic density localized in Fc molecules and the observation of a minor contribution from the solvent and counter ion. Based on the results, we infer evidences of electron tunneling mechanism from the molecule to the Au(111). We acknowledge FAPESP for grant support. Also, LCCA/USP, RICE and CENAPAD for computational resources.

Vibrational and Electronic Energy Transfer and Dissociation of Diatomic Molecules by Electron Collisions

NASA Technical Reports Server (NTRS)

Huo, Winifred M.; Langhoff, Stephen R. (Technical Monitor)

1995-01-01

At high altitudes and velocities equal to or greater than the geosynchronous return velocity (10 kilometers per second), the shock layer of a hypersonic flight will be in thermochemical nonequilibrium and partially ionized. The amount of ionization is determined by the velocity. For a trans atmospheric flight of 10 kilometers per second and at an altitude of 80 kilometers, a maximum of 1% ionization is expected. At a velocity of 12 - 17 kilometer per second, such as a Mars return mission, up to 30% of the atoms and molecules in the flow field will be ionized. Under those circumstances, electrons play an important role in determining the internal states of atoms and molecules in the flow field and hence the amount of radiative heat load and the distance it takes for the flow field to re-establish equilibrium. Electron collisions provide an effective means of transferring energy even when the electron number density is as low as 1%. Because the mass of an electron is 12,760 times smaller than the reduced mass of N2, its average speed, and hence its average collision frequency, is more than 100 times larger. Even in the slightly ionized regime with only 1% electrons, the frequency of electron-molecule collisions is equal to or larger than that of molecule-molecule collisions, an important consideration in the low density part of the atmosphere. Three electron-molecule collision processes relevant to hypersonic flows will be considered: (1) vibrational excitation/de-excitation of a diatomic molecule by electron impact, (2) electronic excitation/de-excitation, and (3) dissociative recombination in electron-diatomic ion collisions. A review of available data, both theory and experiment, will be given. Particular attention will be paid to tailoring the molecular physics to the condition of hypersonic flows. For example, the high rotational temperatures in a hypersonic flow field means that most experimental data carried out under room temperatures are not applicable. Also, the average electron temperature is expected to be between 10,000 and 20,000 K. Thus only data for low energy electrons are relevant to the model.

Modular Electron Donor Group Tuning Of Frontier Energy Levels In Diarylaminofluorenone Push-Pull Molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Homnick, Paul J.; Lahti, P. M.

2012-01-01

Push–pull organic molecules composed of electron donor diarylamines at the 2- and 2,7-positions of fluorenone exhibit intramolecular charge-transfer behaviour in static absorption and emission spectra. Electrochemical and spectral data combined in a modular electronic analysis model show how the donor HOMO and acceptor LUMO act as major determinants of the frontier molecular orbital energy levels.

Artificial photosynthesis using chlorophyll based carotenoid quinone triads: A brief synopsis of research progress as of 31 December 1986

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gust, D.; Moore, T.A.

1986-12-31

The design, synthesis and study of a series of carotenoid-chlorophyll-quinone triad molecules which mimic some of the basic photochemistry and photophysics of natural photosynthesis is sought. The first members of this series have now been prepared, and have been found to mimic photosynthetic charge separation, carotenoid antenna function, and carotenoid photoprotection from singlet oxygen damage. Although the triad molecules mimic the general principle of multistep electron transfer which is found in natural photosynthesis, the details of photosynthetic electron transfer differ in the triads, in that the first electron transfer step involves electron donation from the excited state donor, followed bymore » reduction of the resulting donor radical cation by the carotenoid. In photosynthesis, the electron is moved through several acceptors before the chlorophyll radical cation is reduced. Therefore, our recent work has concentrated on the design and synthesis of new model systems which better mimic certain aspects of natural photosynthesis.« less

Photoinduced electron transfer at the tetrapyrrole-TiO2 interface: Effect of the energy alignment

NASA Astrophysics Data System (ADS)

Nieto-Pescador, Jesus S.

Photoinduced electron transfer is a ubiquitous process behind several physical, chemical, and biological processes. Its potential applications, ranging from solar cell technologies to photodynamic cancer therapy, require a thorough understanding of the basics of the reaction. This dissertation addresses open questions for a particular case of electron transfer processes: Heterogeneous Electron Transfer (HET). In this process, an electron is transferred between a localized donor and a multitude of delocalized acceptor states. HET between photoexcited tetrapyrroles and colloidal TiO2 has been investigated using femtosecond transient absorption spectroscopy. Specifically, this work explores the not well-understood influence of the availability of states on the HET reaction. This problem is addressed by measuring electron injection times as a function of the energy difference between the LUMO and the conduction band of TiO2. The change in the energy alignment was done using two experimental strategies. The first one employs a recently synthesized phlorin with two different excited states above the conduction band of TiO2. This molecule allows comparing HET rates from two different excited states. The second strategy measures the electron injection rates after exciting the same electronic state of a set of specially designed porphyrins. The novelty of the approach is that the difference in energy alignment is attained by the introduction of dipole groups within the bridge group of the molecule. This strategy generates a difference in energy alignment of up to 200 meV. The reported measurements were carried in a high vacuum environment with an apparatus capable of resolving sub 30 fs processes. Disentanglement of the electron transfer processes was done, after careful study of the relaxation dynamics of the molecules in solution, by monitoring the decay of the excited state absorption and the rise of the cation spectral signatures. Within our time resolution, our results show that the increase in the availability of acceptor states does not influence the electron injection dynamics. The results suggest that the injection process takes place into a spectrum of states different from those obtained by steady state calculations.

Electron Transfer Between Electrically Conductive Minerals and Quinones

NASA Astrophysics Data System (ADS)

Taran, Olga

2017-07-01

Long-distance electron transfer in marine environments couples physically separated redox half-reactions, impacting biogeochemical cycles of iron, sulfur and carbon. Bacterial bio-electrochemical systems that facilitate electron transfer via conductive filaments or across man-made electrodes are well known, but the impact of abiotic currents across naturally occurring conductive and semiconducitve minerals is poorly understood. In this paper I use cyclic voltammetry to explore electron transfer between electrodes made of common iron minerals (magnetite, hematite, pyrite, pyrrhotite, mackinawite and greigite), and hydroquinones - a class of organic molecules found in carbon-rich sediments. Of all tested minerals, only pyrite and magnetite showed an increase in electric current in the presence of organic molecules, with pyrite showing excellent electrocatalytic performance. Pyrite electrodes performed better than commercially available glassy carbon electrodes and showed higher peak currents, lower overpotential values and a smaller separation between oxidation and reduction peaks for each tested quinone. Hydroquinone oxidation on pyrite surfaces was reversible, diffusion controlled, and stable over a large number of potential cycles. Given the ubiquity of both pyrite and quinones, abiotic electron transfer between minerals and organic molecules is likely widespread in Nature and may contribute to several different phenomena, including anaerobic respiration of a wide variety of microorganisms in temporally anoxic zones or in the proximity of hydrothermal vent chimneys, as well as quinone cycling and the propagation of anoxic zones in organic rich waters. Finally, interactions between pyrite and quinones make use of electrochemical gradients that have been suggested as an important source of energy for the origins of life on Earth. Ubiquinones and iron sulfide clusters are common redox cofactors found in electron transport chains across all domains of life and interactions between quinones and pyrite might have been an early analogue of this ubiquitous systems.

Molecular alignment effect on the photoassociation process via a pump-dump scheme

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Bin-Bin; Han, Yong-Chang, E-mail: ychan@dlut.edu.cn; Cong, Shu-Lin

The photoassociation processes via the pump-dump scheme for the heternuclear (Na + H → NaH) and the homonuclear (Na + Na → Na{sub 2}) molecular systems are studied, respectively, using the time-dependent quantum wavepacket method. For both systems, the initial atom pair in the continuum of the ground electronic state (X{sup 1}Σ{sup +}) is associated into the molecule in the bound states of the excited state (A{sup 1}Σ{sup +}) by the pump pulse. Then driven by a time-delayed dumping pulse, the prepared excited-state molecule can be transferred to the bound states of the ground electronic state. It is found thatmore » the pump process can induce a superposition of the rovibrational levels |v, j〉 on the excited state, which can lead to the field-free alignment of the excited-state molecule. The molecular alignment can affect the dumping process by varying the effective coupling intensity between the two electronic states or by varying the population transfer pathways. As a result, the final population transferred to the bound states of the ground electronic state varies periodically with the delay time of the dumping pulse.« less

Radiationless Electronic Excitation Energy Transfer Between Monolayers of J-Aggregates

NASA Astrophysics Data System (ADS)

Chmereva, T. M.; Kucherenko, M. G.

2018-06-01

Radiationless electronic excitation energy transfer between monolayers of cyanine dye molecules forming J-aggregates by means of surface plasmons of the metal film of nanometer thickness inserted between the monolayers is theoretically investigated. A dependence of the rate of energy transfer on the geometrical and electrodynamic parameters of the system is established. It is demonstrated that the energy transfer between the monolayers is more effective in the presence of the metal film than in a nonconductive medium.

Theoretical characterization of photoinduced electron transfer in rigidly linked donor-acceptor molecules: the fragment charge difference and the generalized Mulliken-Hush schemes

NASA Astrophysics Data System (ADS)

Lee, Sheng-Jui; Chen, Hung-Cheng; You, Zhi-Qiang; Liu, Kuan-Lin; Chow, Tahsin J.; Chen, I.-Chia; Hsu, Chao-Ping

2010-10-01

We calculate the electron transfer (ET) rates for a series of heptacyclo[6.6.0.02,6.03,13.014,11.05,9.010,14]-tetradecane (HCTD) linked donor-acceptor molecules. The electronic coupling factor was calculated by the fragment charge difference (FCD) [19] and the generalized Mulliken-Hush (GMH) schemes [20]. We found that the FCD is less prone to problems commonly seen in the GMH scheme, especially when the coupling values are small. For a 3-state case where the charge transfer (CT) state is coupled with two different locally excited (LE) states, we tested with the 3-state approach for the GMH scheme [30], and found that it works well with the FCD scheme. A simplified direct diagonalization based on Rust's 3-state scheme was also proposed and tested. This simplified scheme does not require a manual assignment of the states, and it yields coupling values that are largely similar to those from the full Rust's approach. The overall electron transfer (ET) coupling rates were also calculated.

Tuning electronic properties of graphene nanoflake polyaromatic hydrocarbon through molecular charge-transfer interactions

NASA Astrophysics Data System (ADS)

Sharma, Vaishali; Dabhi, Shweta D.; Shinde, Satyam; Jha, Prafulla K.

2018-05-01

By means of first principles calculation we have tuned the electronic properties of graphene nanoflake polyaromatic hydrocarbon via molecular charge transfer. Acceptor/donor Tetracyanoquinodimethane (TCNQ) and Tetrathiafulvalene (TTF) organic molecules are adsorbed on polyaromatic hydrocarbons (PAH) in order to introduce the charge transfer. The substrate's n- or p- type nature depends on the accepting/donating behavior of dopant molecules. Two different classes of PAH (extended form of triangulene) namely Bow-tie graphene nanoflake (BTGNF) and triangular zigzag graphene nanoflake (TZGNF). It is revealed that all the TCNQ and TTF modified graphene nanoflakes exhibit significant changes in HOMO-LUMO gap in range from 0.58 eV to 0.64 eV and 0.01 eV to 0.05 eV respectively. The adsorption energies are in the range of -0.05 kcal/mol to -2.6 kcal/mol. The change in work function is also calculated and discussed, the maximum charge transfer is for TCNQ adsorbed BTGNF. These alluring findings in the tuning of electronic properties will be advantageous for promoting graphene nanoflake polyaromatic hydrocarbon for their applications in electronic devices.

Triple differential cross section measurements for the outer valence molecular orbitals (1t2) of a methane molecule at 250 eV electron impact

NASA Astrophysics Data System (ADS)

Işık, N.; Doğan, M.; Bahçeli, S.

2016-03-01

In this study, detailed experimental research of triple differential cross section (TDCS) measurements is performed to investigate single ionization dynamics for the 1t2 orbital of methane molecule by 250 eV electron impact. In our experiments, the outgoing electrons are simultaneously measured in coincidence in a coplanar asymmetric geometry with the scattering angles of 10° and 20°. Therefore, TDCS measurements are performed for two different values of momentum transfer (K ≈ 0.9 au and 1.5 au). A detailed analysis of the dependence of the TDCS versus the momentum transfer is reported here.

An accurate and linear-scaling method for calculating charge-transfer excitation energies and diabatic couplings

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pavanello, Michele; Van Voorhis, Troy; Visscher, Lucas

2013-02-07

Quantum-mechanical methods that are both computationally fast and accurate are not yet available for electronic excitations having charge transfer character. In this work, we present a significant step forward towards this goal for those charge transfer excitations that take place between non-covalently bound molecules. In particular, we present a method that scales linearly with the number of non-covalently bound molecules in the system and is based on a two-pronged approach: The molecular electronic structure of broken-symmetry charge-localized states is obtained with the frozen density embedding formulation of subsystem density-functional theory; subsequently, in a post-SCF calculation, the full-electron Hamiltonian and overlapmore » matrix elements among the charge-localized states are evaluated with an algorithm which takes full advantage of the subsystem DFT density partitioning technique. The method is benchmarked against coupled-cluster calculations and achieves chemical accuracy for the systems considered for intermolecular separations ranging from hydrogen-bond distances to tens of Angstroms. Numerical examples are provided for molecular clusters comprised of up to 56 non-covalently bound molecules.« less

An accurate and linear-scaling method for calculating charge-transfer excitation energies and diabatic couplings.

PubMed

Pavanello, Michele; Van Voorhis, Troy; Visscher, Lucas; Neugebauer, Johannes

2013-02-07

Quantum-mechanical methods that are both computationally fast and accurate are not yet available for electronic excitations having charge transfer character. In this work, we present a significant step forward towards this goal for those charge transfer excitations that take place between non-covalently bound molecules. In particular, we present a method that scales linearly with the number of non-covalently bound molecules in the system and is based on a two-pronged approach: The molecular electronic structure of broken-symmetry charge-localized states is obtained with the frozen density embedding formulation of subsystem density-functional theory; subsequently, in a post-SCF calculation, the full-electron Hamiltonian and overlap matrix elements among the charge-localized states are evaluated with an algorithm which takes full advantage of the subsystem DFT density partitioning technique. The method is benchmarked against coupled-cluster calculations and achieves chemical accuracy for the systems considered for intermolecular separations ranging from hydrogen-bond distances to tens of Ångstroms. Numerical examples are provided for molecular clusters comprised of up to 56 non-covalently bound molecules.

Molecular Electronic Shift Registers

NASA Technical Reports Server (NTRS)

Beratan, David N.; Onuchic, Jose N.

1990-01-01

Molecular-scale shift registers eventually constructed as parts of high-density integrated memory circuits. In principle, variety of organic molecules makes possible large number of different configurations and modes of operation for such shift-register devices. Several classes of devices and implementations in some specific types of molecules proposed. All based on transfer of electrons or holes along chains of repeating molecular units.

Proton-coupled electron transfer and the role of water molecules in proton pumping by cytochrome c oxidase

PubMed Central

Sharma, Vivek; Enkavi, Giray; Vattulainen, Ilpo; Róg, Tomasz; Wikström, Mårten

2015-01-01

Molecular oxygen acts as the terminal electron sink in the respiratory chains of aerobic organisms. Cytochrome c oxidase in the inner membrane of mitochondria and the plasma membrane of bacteria catalyzes the reduction of oxygen to water, and couples the free energy of the reaction to proton pumping across the membrane. The proton-pumping activity contributes to the proton electrochemical gradient, which drives the synthesis of ATP. Based on kinetic experiments on the O–O bond splitting transition of the catalytic cycle (A → PR), it has been proposed that the electron transfer to the binuclear iron–copper center of O2 reduction initiates the proton pump mechanism. This key electron transfer event is coupled to an internal proton transfer from a conserved glutamic acid to the proton-loading site of the pump. However, the proton may instead be transferred to the binuclear center to complete the oxygen reduction chemistry, which would constitute a short-circuit. Based on atomistic molecular dynamics simulations of cytochrome c oxidase in an explicit membrane–solvent environment, complemented by related free-energy calculations, we propose that this short-circuit is effectively prevented by a redox-state–dependent organization of water molecules within the protein structure that gates the proton transfer pathway. PMID:25646428

State-to-state time-of-flight measurements of NO scattering from Au(111): direct observation of translation-to-vibration coupling in electronically nonadiabatic energy transfer.

PubMed

Golibrzuch, Kai; Shirhatti, Pranav R; Altschäffel, Jan; Rahinov, Igor; Auerbach, Daniel J; Wodtke, Alec M; Bartels, Christof

2013-09-12

Translational motion is believed to be a spectator degree of freedom in electronically nonadiabatic vibrational energy transfer between molecules and metal surfaces, but the experimental evidence available to support this view is limited. In this work, we have experimentally determined the translational inelasticity in collisions of NO molecules with a single-crystal Au(111) surface-a system with strong electronic nonadiabaticity. State-to-state molecular beam surface scattering was combined with an IR-UV double resonance scheme to obtain high-resolution time-of-flight data. The measurements include vibrationally elastic collisions (v = 3→3, 2→2) as well as collisions where one or two quanta of molecular vibration are excited (2→3, 2→4) or de-excited (2→1, 3→2, 3→1). In addition, we have carried out comprehensive measurements of the effects of rotational excitation on the translational energy of the scattered molecules. We find that under all conditions of this work, the NO molecules lose a large fraction (∼0.45) of their incidence translational energy to the surface. Those molecules that undergo vibrational excitation (relaxation) during the collision recoil slightly slower (faster) than vibrationally elastically scattered molecules. The amount of translational energy change depends on the surface temperature. The translation-to-rotation coupling, which is well-known for v = 0→0 collisions, is found to be significantly weaker for vibrationally inelastic than elastic channels. Our results clearly show that the spectator view of the translational motion in electronically nonadiabatic vibrational energy transfer between NO and Au(111) is only approximately correct.

Local light-induced magnetization using nanodots and chiral molecules.

PubMed

Dor, Oren Ben; Morali, Noam; Yochelis, Shira; Baczewski, Lech Tomasz; Paltiel, Yossi

2014-11-12

With the increasing demand for miniaturization, nanostructures are likely to become the primary components of future integrated circuits. Different approaches are being pursued toward achieving efficient electronics, among which are spin electronics devices (spintronics). In principle, the application of spintronics should result in reducing the power consumption of electronic devices. Recently a new, promising, effective approach for spintronics has emerged, using spin selectivity in electron transport through chiral molecules. In this work, using chiral molecules and nanocrystals, we achieve local spin-based magnetization generated optically at ambient temperatures. Through the chiral layer, a spin torque can be transferred without permanent charge transfer from the nanocrystals to a thin ferromagnetic layer, creating local perpendicular magnetization. We used Hall sensor configuration and atomic force microscopy (AFM) to measure the induced local magnetization. At low temperatures, anomalous spin Hall effects were measured using a thin Ni layer. The results may lead to optically controlled spintronics logic devices that will enable low power consumption, high density, and cheap fabrication.

Delayed Triplet-State Formation through Hybrid Charge Transfer Exciton at Copper Phthalocyanine/GaAs Heterojunction.

PubMed

Lim, Heeseon; Kwon, Hyuksang; Kim, Sang Kyu; Kim, Jeong Won

2017-10-05

Light absorption in organic molecules on an inorganic substrate and subsequent electron transfer to the substrate create so-called hybrid charge transfer exciton (HCTE). The relaxation process of the HCTE states largely determines charge separation efficiency or optoelectronic device performance. Here, the study on energy and time-dispersive behavior of photoelectrons at the hybrid interface of copper phthalocyanine (CuPc)/p-GaAs(001) upon light excitation of GaAs reveals a clear pathway for HCTE relaxation and delayed triplet-state formation. According to the ground-state energy level alignment at the interface, CuPc/p-GaAs(001) shows initially fast hole injection from GaAs to CuPc. Thus, the electrons in GaAs and holes in CuPc form an unusual HCTE state manifold. Subsequent electron transfer from GaAs to CuPc generates the formation of the triplet state in CuPc with a few picoseconds delay. Such two-step charge transfer causes delayed triplet-state formation without singlet excitation and subsequent intersystem crossing within the CuPc molecules.

Ultrafast direct electron transfer at organic semiconductor and metal interfaces.

PubMed

Xiang, Bo; Li, Yingmin; Pham, C Huy; Paesani, Francesco; Xiong, Wei

2017-11-01

The ability to control direct electron transfer can facilitate the development of new molecular electronics, light-harvesting materials, and photocatalysis. However, control of direct electron transfer has been rarely reported, and the molecular conformation-electron dynamics relationships remain unclear. We describe direct electron transfer at buried interfaces between an organic polymer semiconductor film and a gold substrate by observing the first dynamical electric field-induced vibrational sum frequency generation (VSFG). In transient electric field-induced VSFG measurements on this system, we observe dynamical responses (<150 fs) that depend on photon energy and polarization, demonstrating that electrons are directly transferred from the Fermi level of gold to the lowest unoccupied molecular orbital of organic semiconductor. Transient spectra further reveal that, although the interfaces are prepared without deliberate alignment control, a subensemble of surface molecules can adopt conformations for direct electron transfer. Density functional theory calculations support the experimental results and ascribe the observed electron transfer to a flat-lying polymer configuration in which electronic orbitals are found to be delocalized across the interface. The present observation of direct electron transfer at complex interfaces and the insights gained into the relationship between molecular conformations and electron dynamics will have implications for implementing novel direct electron transfer in energy materials.

Photoinduced electron transfer of oxazine 1/TiO2 nanoparticles at single molecule level by using confocal fluorescence microscopy.

PubMed

Chen, Yi-Ju; Tzeng, Hsin-Yu; Fan, Hsiu-Fang; Chen, Ming-Shiang; Huang, Jer-Shing; Lin, King-Chuen

2010-06-01

Kinetics of photoinduced electron transfer (ET) from oxazine 1 dye to TiO(2) nanoparticles (NPs) surface is studied at a single molecule level by using confocal fluorescence microscopy. Upon irradiation with a pulsed laser at 630 nm, the fluorescence lifetimes sampled among 100 different dye molecules are determined to yield an average lifetime of 2.9 +/- 0.3 ns, which is close to the value of 3.0 +/- 0.6 ns measured on the bare coverslip. The lifetime proximity suggests that most interfacial electron transfer (IFET) processes for the current system are inefficient, probably caused by physisorption between dye and the TiO(2) film. However, there might exist some molecules which are quenched before fluorescing and fail to be detected. With the aid of autocorrelation analysis under a three-level energy system, the IFET kinetics of single dye molecules in the conduction band of TiO(2) NPs is evaluated to be (1.0 +/- 0.1) x 10(4) s(-1) averaged over 100 single molecules and the back ET rate constant is 4.7 +/- 0.9 s(-1). When a thicker TiO(2) film is substituted, the resultant kinetic data do not make a significant difference. The trend of IFET efficacy agrees with the method of fluorescence lifetime measurements. The obtained forward ET rate constants are about ten times smaller than the photovoltage response measured in an assembled dye-sensitized solar cell. The discrepancy is discussed. The inhomogeneous and fluctuation characters for the IFET process are attributed to microenvironment variation for each single molecule. The obtained ET rates are much slower than the fluorescence relaxation. Such a small ET quantum yield is yet feasibly detectable at a single molecule level.

Molecules Without Atoms

NASA Astrophysics Data System (ADS)

Ruth, Anthony; Collins, Laura; Gomes, Kenjiro; Janko, Boldizsar

We present a real-space representation of molecules which results in the normal bonding rules and electronic structure of chemistry without atom-centered coulomb potentials. Using a simple mapping, we can generate atomless molecules from the structure of real molecules. Additionally, molecules without atoms show similar covalent bonding energies and transfer of charge in ionic bonds as real molecules. The atomless molecules contain only the valence and conduction electronic structure of the real molecule. Using the framework of the Atoms in Molecules (AIM) theory of Bader, we prove that the topological features of the valence charge distribution of molecules without atoms are identical to that of real molecules. In particular, the charge basins of atomless molecules show identical location and quantities of representative charge. We compare the accuracy, computational cost, and intuition gained from electronic structure calculations of molecules without atoms with the use of pseudopotentials to represent atomic cores in density functional theory. A. R. acknowledges support from a NASA Space Technology Research Fellowship.

Electronic Transport Properties of Carbon-Nanotube Networks: The Effect of Nitrate Doping on Intratube and Intertube Conductances

NASA Astrophysics Data System (ADS)

Ketolainen, T.; Havu, V.; Jónsson, E. Ö.; Puska, M. J.

2018-03-01

The conductivity of carbon-nanotube (CNT) networks can be improved markedly by doping with nitric acid. In the present work, CNTs and junctions of CNTs functionalized with NO3 molecules are investigated to understand the microscopic mechanism of nitric acid doping. According to our density-functional-theory band-structure calculations, there is charge transfer from the CNT to adsorbed molecules indicating p -type doping. The average doping efficiency of the NO3 molecules is higher if the NO3 molecules form complexes with water molecules. In addition to electron transport along individual CNTs, we also study electron transport between different types (metallic, semiconducting) of CNTs. Reflecting the differences in the electronic structures of semiconducting and metallic CNTs, we find that in addition to turning semiconducting CNTs metallic, doping further increases electron transport most efficiently along semiconducting CNTs as well as through the junctions between them.

Kinetic Monte Carlo Simulations and Molecular Conductance Measurements of the Bacterial Decaheme Cytochrome MtrF

DOE Office of Scientific and Technical Information (OSTI.GOV)

Byun, H. S.; Pirbadian, S.; Nakano, Aiichiro

2014-09-05

Microorganisms overcome the considerable hurdle of respiring extracellular solid substrates by deploying large multiheme cytochrome complexes that form 20 nanometer conduits to traffic electrons through the periplasm and across the cellular outer membrane. Here we report the first kinetic Monte Carlo simulations and single-molecule scanning tunneling microscopy (STM) measurements of the Shewanella oneidensis MR-1 outer membrane decaheme cytochrome MtrF, which can perform the final electron transfer step from cells to minerals and microbial fuel cell anodes. We find that the calculated electron transport rate through MtrF is consistent with previously reported in vitro measurements of the Shewanella Mtr complex, asmore » well as in vivo respiration rates on electrode surfaces assuming a reasonable (experimentally verified) coverage of cytochromes on the cell surface. The simulations also reveal a rich phase diagram in the overall electron occupation density of the hemes as a function of electron injection and ejection rates. Single molecule tunneling spectroscopy confirms MtrF's ability to mediate electron transport between an STM tip and an underlying Au(111) surface, but at rates higher than expected from previously calculated heme-heme electron transfer rates for solvated molecules.« less

Molecular electronics: some views on transport junctions and beyond.

PubMed

Joachim, Christian; Ratner, Mark A

2005-06-21

The field of molecular electronics comprises a fundamental set of issues concerning the electronic response of molecules as parts of a mesoscopic structure and a technology-facing area of science. We will overview some important aspects of these subfields. The most advanced ideas in the field involve the use of molecules as individual logic or memory units and are broadly based on using the quantum state space of the molecule. Current work in molecular electronics usually addresses molecular junction transport, where the molecule acts as a barrier for incoming electrons: This is the fundamental Landauer idea of "conduction as scattering" generalized to molecular junction structures. Another point of view in terms of superexchange as a guiding mechanism for coherent electron transfer through the molecular bridge is discussed. Molecules generally exhibit relatively strong vibronic coupling. The last section of this overview focuses on vibronic effects, including inelastic electron tunneling spectroscopy, hysteresis in junction charge transport, and negative differential resistance in molecular transport junctions.

Molecular electronics: Some views on transport junctions and beyond

PubMed Central

Joachim, Christian; Ratner, Mark A.

2005-01-01

The field of molecular electronics comprises a fundamental set of issues concerning the electronic response of molecules as parts of a mesoscopic structure and a technology-facing area of science. We will overview some important aspects of these subfields. The most advanced ideas in the field involve the use of molecules as individual logic or memory units and are broadly based on using the quantum state space of the molecule. Current work in molecular electronics usually addresses molecular junction transport, where the molecule acts as a barrier for incoming electrons: This is the fundamental Landauer idea of “conduction as scattering” generalized to molecular junction structures. Another point of view in terms of superexchange as a guiding mechanism for coherent electron transfer through the molecular bridge is discussed. Molecules generally exhibit relatively strong vibronic coupling. The last section of this overview focuses on vibronic effects, including inelastic electron tunneling spectroscopy, hysteresis in junction charge transport, and negative differential resistance in molecular transport junctions. PMID:15956192

Molecular implementation of molecular shift register memories

NASA Technical Reports Server (NTRS)

Beratan, David N. (Inventor); Onuchic, Jose N. (Inventor)

1991-01-01

An electronic shift register memory (20) at the molecular level is described. The memory elements are based on a chain of electron transfer molecules (22) and the information is shifted by photoinduced (26) electron transfer reactions. Thus, multi-step sequences of charge transfer reactions are used to move charge with high efficiency down a molecular chain. The device integrates compositions of the invention onto a VLSI substrate (36), providing an example of a molecular electronic device which may be fabricated. Three energy level schemes, molecular implementation of these schemes, optical excitation strategies, charge amplification strategies, and error correction strategies are described.

Electrical Matching at Metal/Molecule Contacts for Efficient Heterogeneous Charge Transfer.

PubMed

Sato, Shino; Iwase, Shigeru; Namba, Kotaro; Ono, Tomoya; Hara, Kenji; Fukuoka, Atsushi; Uosaki, Kohei; Ikeda, Katsuyoshi

2018-02-27

In a metal/molecule hybrid system, unavoidable electrical mismatch exists between metal continuum states and frontier molecular orbitals. This causes energy loss in the electron conduction across the metal/molecule interface. For efficient use of energy in a metal/molecule hybrid system, it is necessary to control interfacial electronic structures. Here we demonstrate that electrical matching between a gold substrate and π-conjugated molecular wires can be obtained by using monatomic foreign metal interlayers, which can change the degree of d-π* back-donation at metal/anchor contacts. This interfacial control leads to energy level alignment between the Fermi level of the metal electrode and conduction molecular orbitals, resulting in resonant electron conduction in the metal/molecule hybrid system. When this method is applied to molecule-modified electrocatalysts, the heterogeneous electrochemical reaction rate is considerably improved with significant suppression of energy loss at the internal electron conduction.

Photoelectron spectroscopy study of the electronic structures at CoPc/Bi(111) interface

NASA Astrophysics Data System (ADS)

Sun, Haoliang; Liang, Zhaofeng; Shen, Kongchao; Hu, Jinbang; Ji, Gengwu; Li, Zheshen; Li, Haiyang; Zhu, Zhiyuan; Li, Jiong; Gao, Xingyu; Han, Huang; Jiang, Zheng; Song, Fei

2017-07-01

Self-assembly of functional molecules on solid substrate has been recognized as an appealing approach for the fabrication of diverse nanostructures for nanoelectronics. Herein, we investigate the growth of cobalt phthalocyanine (CoPc) on a Bi(111) surface with focus on the interface electronic structures utilizing photoelectron spectroscopy. While charge transfer from bismuth substrate to the molecule results in the emergence of an interface component in the Co 3p core level at lower binding energy, core-levels associated to the molecular ligand (C 1s and N 1s) are less influenced by the adsorption. In addition, density functional theory (DFT) calculations also support the empirical inference that the molecule-substrate interaction mainly involves the out-of-plane empty Co 3d orbital and bismuth states. Finally, valence band spectra demonstrate the molecule-substrate interaction is induced by interface charge transfer, agreeing well with core level measurements. Charge transfer is shown to be mainly from the underlying bismuth substrate to the empty states located at the central Co atom in the CoPc molecules. This report may provide a fundamental basis to the on-surface engineering of interfaces for molecular devices and spintronics.

Role of quinones in electron transfer of PQQ–glucose dehydrogenase anodes—mediation or orientation effect

DOE PAGES

Babanova, Sofia; Matanovic, Ivana; Chavez, Madelaine Seow; ...

2015-06-16

In this study, the influence of two quinones (1,2- and 1,4-benzoquinone) on the operation and mechanism of electron transfer in PQQ-sGDH anodes has been determined. Benzoquinones were experimentally explored as mediators present in the electrolyte. The electrochemical performance of the PQQ–sGDH anodes with and without the mediators was examined and for the first time molecular docking simulations were used to gain a fundamental understanding to explain the role of the mediator molecules in the design and operation of the enzymatic electrodes. It was proposed that the higher performance of the PQQ–sGDH anodes in the presence of 1,2- and 1,4-benzoquinones introducedmore » in the solution is due to the shorter distance between these molecules and PQQ in the enzymatic molecule. It was also hypothesized that when 1,4-benzoquinone is adsorbed on a carbon support, it would play the dual role of a mediator and an orienting agent. At the same time, when 1,2-benzoquinone and ubiquinone are adsorbed on the electrode surface, the enzyme would transfer the electrons directly to the support, and these molecules would primarily play the role of an orienting agent.« less

Role of Quinones in Electron Transfer of PQQ–Glucose Dehydrogenase Anodes—Mediation or Orientation Effect

DOE Office of Scientific and Technical Information (OSTI.GOV)

Babanova, Sofia; Matanovic, Ivana; Chavez, Madelaine Seow

2015-06-24

In this study, the influence of two quinones (1,2- and 1,4-benzoquinone) on the operation and mechanism of electron transfer in PQQ-dependent glucose dehydrogenase (PQQ–sGDH) anodes has been determined. Benzoquinones were experimentally explored as mediators present in the electrolyte. The electrochemical performance of the PQQ–sGDH anodes with and without the mediators was examined and for the first time molecular docking simulations were used to gain a fundamental understanding to explain the role of the mediator molecules in the design and operation of the enzymatic electrodes. It was proposed that the higher performance of the PQQ–sGDH anodes in the presence of 1,2-more » and 1,4-benzoquinones introduced in the solution is due to the shorter distance between these molecules and PQQ in the enzymatic molecule. It was also hypothesized that when 1,4-benzoquinone is adsorbed on a carbon support, it would play the dual role of a mediator and an orienting agent. At the same time, when 1,2-benzoquinone and ubiquinone are adsorbed on the electrode surface, the enzyme would transfer the electrons directly to the support, and these molecules would primarily play the role of an orienting agent.« less

The angular electronic band structure and free particle model of aromatic molecules: High-frequency photon-induced ring current

NASA Astrophysics Data System (ADS)

Öncan, Mehmet; Koç, Fatih; Şahin, Mehmet; Köksal, Koray

2017-05-01

This work introduces an analysis of the relationship of first-principles calculations based on DFT method with the results of free particle model for ring-shaped aromatic molecules. However, the main aim of the study is to reveal the angular electronic band structure of the ring-shaped molecules. As in the case of spherical molecules such as fullerene, it is possible to observe a parabolic dispersion of electronic states with the variation of angular quantum number in the planar ring-shaped molecules. This work also discusses the transition probabilities between the occupied and virtual states by analyzing the angular electronic band structure and the possibility of ring currents in the case of spin angular momentum (SAM) or orbital angular momentum (OAM) carrying light. Current study focuses on the benzene molecule to obtain its angular electronic band structure. The obtained electronic band structure can be considered as a useful tool to see the transition probabilities between the electronic states and possible contribution of the states to the ring currents. The photoinduced current due to the transfer of SAM into the benzene molecule has been investigated by using analytical calculations within the frame of time-dependent perturbation theory.

Quantitative Connection Between Ensemble Thermodynamics and Single-Molecule Kinetics: A Case Study Using Cryo-EM and smFRET Investigations of the Ribosome

PubMed Central

Frank, Joachim; Gonzalez, Ruben L.

2015-01-01

At equilibrium, thermodynamic and kinetic information can be extracted from biomolecular energy landscapes by many techniques. However, while static, ensemble techniques yield thermodynamic data, often only dynamic, single-molecule techniques can yield the kinetic data that describes transition-state energy barriers. Here we present a generalized framework based upon dwell-time distributions that can be used to connect such static, ensemble techniques with dynamic, single-molecule techniques, and thus characterize energy landscapes to greater resolutions. We demonstrate the utility of this framework by applying it to cryogenic electron microscopy and single-molecule fluorescence resonance energy transfer studies of the bacterial ribosomal pretranslocation complex. Among other benefits, application of this framework to these data explains why two transient, intermediate conformations of the pretranslocation complex, which are observed in a cryogenic electron microscopy study, may not be observed in several single-molecule fluorescence resonance energy transfer studies. PMID:25785884

Quantitative Connection between Ensemble Thermodynamics and Single-Molecule Kinetics: A Case Study Using Cryogenic Electron Microscopy and Single-Molecule Fluorescence Resonance Energy Transfer Investigations of the Ribosome.

PubMed

Thompson, Colin D Kinz; Sharma, Ajeet K; Frank, Joachim; Gonzalez, Ruben L; Chowdhury, Debashish

2015-08-27

At equilibrium, thermodynamic and kinetic information can be extracted from biomolecular energy landscapes by many techniques. However, while static, ensemble techniques yield thermodynamic data, often only dynamic, single-molecule techniques can yield the kinetic data that describe transition-state energy barriers. Here we present a generalized framework based upon dwell-time distributions that can be used to connect such static, ensemble techniques with dynamic, single-molecule techniques, and thus characterize energy landscapes to greater resolutions. We demonstrate the utility of this framework by applying it to cryogenic electron microscopy (cryo-EM) and single-molecule fluorescence resonance energy transfer (smFRET) studies of the bacterial ribosomal pre-translocation complex. Among other benefits, application of this framework to these data explains why two transient, intermediate conformations of the pre-translocation complex, which are observed in a cryo-EM study, may not be observed in several smFRET studies.

The influence of the distance between the donor-acceptor groups of polymethine dyes on their photovoltaic properties

NASA Astrophysics Data System (ADS)

Seliverstova, E.; Ibrayev, N.

2018-01-01

Spectral-luminescent and photovoltaic properties of polymethine dyes of various structures are studied. It is shown that an increase in the length of the methylene chain between the active chromophores leads to a red-wave shift of the absorption and fluorescence spectra. Significant changes in the absorptivity and lifetime of fluorescence do not occur in this case. The best photovoltaic parameters have cells sensitized with shorter dye molecules. It is shown, that for a longer dye the resistance associated with electron recombination on the TiO2/electrolyte surface is much higher than the electron transfer resistance in the semiconductor, which reduces the efficiency of electron transfer in the solar cell, sensitized with longer dye molecules.

Using quantum dynamics simulations to follow the competition between charge migration and charge transfer in polyatomic molecules

NASA Astrophysics Data System (ADS)

Spinlove, K. E.; Vacher, M.; Bearpark, M.; Robb, M. A.; Worth, G. A.

2017-01-01

Recent work, particularly by Cederbaum and co-workers, has identified the phenomenon of charge migration, whereby charge flow occurs over a static molecular framework after the creation of an electronic wavepacket. In a real molecule, this charge migration competes with charge transfer, whereby the nuclear motion also results in the re-distribution of charge. To study this competition, quantum dynamics simulations need to be performed. To break the exponential scaling of standard grid-based algorithms, approximate methods need to be developed that are efficient yet able to follow the coupled electronic-nuclear motion of these systems. Using a simple model Hamiltonian based on the ionisation of the allene molecule, the performance of different methods based on Gaussian Wavepackets is demonstrated.

A molecularly based theory for electron transfer reorganization energy.

PubMed

Zhuang, Bilin; Wang, Zhen-Gang

2015-12-14

Using field-theoretic techniques, we develop a molecularly based dipolar self-consistent-field theory (DSCFT) for charge solvation in pure solvents under equilibrium and nonequilibrium conditions and apply it to the reorganization energy of electron transfer reactions. The DSCFT uses a set of molecular parameters, such as the solvent molecule's permanent dipole moment and polarizability, thus avoiding approximations that are inherent in treating the solvent as a linear dielectric medium. A simple, analytical expression for the free energy is obtained in terms of the equilibrium and nonequilibrium electrostatic potential profiles and electric susceptibilities, which are obtained by solving a set of self-consistent equations. With no adjustable parameters, the DSCFT predicts activation energies and reorganization energies in good agreement with previous experiments and calculations for the electron transfer between metallic ions. Because the DSCFT is able to describe the properties of the solvent in the immediate vicinity of the charges, it is unnecessary to distinguish between the inner-sphere and outer-sphere solvent molecules in the calculation of the reorganization energy as in previous work. Furthermore, examining the nonequilibrium free energy surfaces of electron transfer, we find that the nonequilibrium free energy is well approximated by a double parabola for self-exchange reactions, but the curvature of the nonequilibrium free energy surface depends on the charges of the electron-transferring species, contrary to the prediction by the linear dielectric theory.

Micellar control over tautomerization and photo-induced electron transfer of Lumichrome in the presence of aliphatic and aromatic amines: a transient absorption study

NASA Astrophysics Data System (ADS)

Sengupta, Chaitrali; Sarangi, Manas Kumar; Sau, Abhishek; Basu, Samita

2017-03-01

Lumichrome (Lc), a molecule consisting of a trinuclear alloxazine moiety is our present subject of interest. This molecule is subjected to tautomerization in the presence of pyridine, acetic acid, etc, through the formation of an eight-membered ring. In our present contribution, we have attempted to analyze the influence of the presence of an aliphatic amine, triethylamine (TEA) and an aromatic amine, N,N-dimethylaniline (DMA) in the double proton transfer step of the tautomerization as well as the photo-induced electron transfer (PET) from those amines to Lc. We have studied these phenomena within micelles, anionic and neutral, to observe the effect of confinement. Through our experiments, it could be stated that along with tautomerization and proton transfer, there is also evidence of PET in triplet excited state.

Ultrafast electron transport across nano gaps in nanowire circuits

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potma, Eric O.

In this Program we aim for a closer look at electron transfer through single molecules. To achieve this, we use ultrafast laser pulses to time stamp an electron tunneling event in a molecule that is connected between two metallic electrodes, while reading out the electron current. A key aspect of this project is the use of metallic substrates with plasmonic activity to efficiently manipulate the tunneling probability. The first Phase of this program is concerned with developing highly sensitive tools for the ultrafast optical manipulation of tethered molecules through the evanescent surface field of plasmonic substrates. The second Phase ofmore » the program aims to use these tools for exercising control over the electron tunneling probability.« less

Evidence of photo- and thermal-induced reversible intermolecular hydrogen-atom transfer in. gamma. -irradiated thiourea clathrates as studied by electron spin resonance

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ichikawa, T.

1979-05-17

There has been a report (M. Iwasaki and Toriyama) on an electron spin resonance study of reversible intramolecular radical conversion due to photo- and thermal-induced H-atom transfer. Schlenk, Brown, White, Chatini, and Nakatani reported H-atom abstraction of a photostimulated allylic radical from its neighbor molecules and thermal recovery of the allylic radical from photoirradiation in a thiourea clathrate. Radiolysis of a thiourea clathrate containing a mixture of 10 mol% 2,3-dimethylbutadiene and 90 mol% 2,3-dimethylbutane gave a resolved room-temperature spectrum. The result seemed to suggest that the monomer radical was stabilized in the canal even at room temperature in the presencemore » of the inert DBA molecules which might block chain propagation. Results suggested that the photostimulated R/sub 1/, radicals abstract H atoms from DBA molecules to form tetramethylethylene molecules and R/sub 2/ radicals and that the R/sub 2/ radicals produced by photoirradiation abstract H atoms from TME molecules to regenerate R/sub 1/ radicals and DBA molecules. 2 figures. (DP)« less

How the oxygen tolerance of a [NiFe]-hydrogenase depends on quaternary structure.

PubMed

Wulff, Philip; Thomas, Claudia; Sargent, Frank; Armstrong, Fraser A

2016-03-01

'Oxygen-tolerant' [NiFe]-hydrogenases can catalyze H2 oxidation under aerobic conditions, avoiding oxygenation and destruction of the active site. In one mechanism accounting for this special property, membrane-bound [NiFe]-hydrogenases accommodate a pool of electrons that allows an O2 molecule attacking the active site to be converted rapidly to harmless water. An important advantage may stem from having a dimeric or higher-order quaternary structure in which the electron-transfer relay chain of one partner is electronically coupled to that in the other. Hydrogenase-1 from E. coli has a dimeric structure in which the distal [4Fe-4S] clusters in each monomer are located approximately 12 Å apart, a distance conducive to fast electron tunneling. Such an arrangement can ensure that electrons from H2 oxidation released at the active site of one partner are immediately transferred to its counterpart when an O2 molecule attacks. This paper addresses the role of long-range, inter-domain electron transfer in the mechanism of O2-tolerance by comparing the properties of monomeric and dimeric forms of Hydrogenase-1. The results reveal a further interesting advantage that quaternary structure affords to proteins.

Molecules with enhanced electronic polarizabilities based on defect-like states in conjugated polymers

NASA Technical Reports Server (NTRS)

Beratan, David N. (Inventor)

1991-01-01

Highly conjugated organic polymers typically have large non-resonant electronic susceptibilities, which give the molecules unusual optical properties. To enhance these properties, defects are introduced into the polymer chain. Examples include light doping of the conjugated polymer and synthesis, conjugated polymers which incorporate either electron donating or accepting groups, and conjugated polymers which contain a photoexcitable species capable of reversibly transferring its electron to an acceptor. Such defects in the chain permit enhancement of the second hyperpolarizability by at least an order of magnitude.

Ultrafast Intramolecular Electron and Proton Transfer in Bis(imino)isoindole Derivatives.

PubMed

Driscoll, Eric; Sorenson, Shayne; Dawlaty, Jahan M

2015-06-04

Concerted motion of electrons and protons in the excited state is pertinent to a wide range of chemical phenomena, including those relevant for solar-to-fuel light harvesting. The excited state dynamics of small proton-bearing molecules are expected to serve as models for better understanding such phenomena. In particular, for designing the next generation of multielectron and multiproton redox catalysts, understanding the dynamics of more than one proton in the excited state is important. Toward this goal, we have measured the ultrafast dynamics of intramolecular excited state proton transfer in a recently synthesized dye with two equivalent transferable protons. We have used a visible ultrafast pump to initiate the proton transfer in the excited state, and have probed the transient absorption of the molecule over a wide bandwidth in the visible range. The measurement shows that the signal which is characteristic of proton transfer emerges within ∼710 fs. To identify whether both protons were transferred in the excited state, we have measured the ultrafast dynamics of a related derivative, where only a single proton was available for transfer. The measured proton transfer time in that molecule was ∼427 fs. The observed dynamics in both cases were reasonably fit with single exponentials. Supported by the ultrafast observations, steady-state fluorescence, and preliminary computations of the relaxed excited states, we argue that the doubly protonated derivative most likely transfers only one of its two protons in the excited state. We have performed calculations of the frontier molecular orbitals in the Franck-Condon region. The calculations show that in both derivatives, the excitation is primarily from the HOMO to LUMO causing a large rearrangement of the electronic charge density immediately after photoexcitation. In particular, charge density is shifted away from the phenolic protons and toward the proton acceptor nitrogens. The proton transfer is hypothesized to occur both due to enhanced acidity of the phenolic proton and enhanced basicity of the nitrogen in the excited state. We hope this study can provide insight for better understanding of the general class of excited state concerted electron-proton dynamics.

Sulfate-reducing bacteria: Microbiology and physiology

NASA Technical Reports Server (NTRS)

Peck, H. D.

1985-01-01

The sulfate reducing bacteria, the first nonphotosynthetic anaerobic bacteria demonstrated to contain c type cytochromes, perform electron transfer coupled to phosphorylation. A new bioenergetic scheme for the formation of a proton gradient for growth of Desulfovibrio on organic substrates and sulfate involving vectors electron transfer and consistent with the cellular localization of enzymes and electron transfer components was proposed. Hydrogen is produced in the cytoplasm from organic substrates and, as a permease molecule diffuses rapidly across the cytoplasmic membrane, it is oxidized to protons and electrons by the periplasmic hydrogenase. The electrons only are transferred across the cytoplasmic membrane to the cytoplasm where they are used to reduce sulfate to sulfide. The protons are used for transport or to drive a reversible ATPOSE. The net effect is the transfer of protons across the cytoplasmic membrane with the intervention of a proton pump. This type of H2 cycling is relevant to the bioenergetics of other types of anaerobic microorganisms.

Single Molecule Spectroelectrochemistry of Interfacial Charge Transfer Dynamics In Hybrid Organic Solar Cell

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pan, Shanlin

2014-11-16

Our research under support of this DOE grant is focused on applied and fundamental aspects of model organic solar cell systems. Major accomplishments are: 1) we developed a spectroelectorchemistry technique of single molecule single nanoparticle method to study charge transfer between conjugated polymers and semiconductor at the single molecule level. The fluorescence of individual fluorescent polymers at semiconductor surfaces was shown to exhibit blinking behavior compared to molecules on glass substrates. Single molecule fluorescence excitation anisotropy measurements showed the conformation of the polymer molecules did not differ appreciably between glass and semiconductor substrates. The similarities in molecular conformation suggest thatmore » the observed differences in blinking activity are due to charge transfer between fluorescent polymer and semiconductor, which provides additional pathways between states of high and low fluorescence quantum efficiency. Similar spectroelectrochemistry work has been done for small organic dyes for understand their charge transfer dynamics on various substrates and electrochemical environments; 2) We developed a method of transferring semiconductor nanoparticles (NPs) and graphene oxide (GO) nanosheets into organic solvent for a potential electron acceptor in bulk heterojunction organic solar cells which employed polymer semiconductor as the electron donor. Electron transfer from the polymer semiconductor to semiconductor and GO in solutions and thin films was established through fluorescence spectroscopy and electroluminescence measurements. Solar cells containing these materials were constructed and evaluated using transient absorption spectroscopy and dynamic fluorescence techniques to understand the charge carrier generation and recombination events; 3) We invented a spectroelectorchemistry technique using light scattering and electroluminescence for rapid size determination and studying electrochemistry of single NPs in an electrochemical cell. For example, we are able to use this technique to track electroluminescence of single Au NPs, and the electrodeposition of individual Ag NPs in-situ. These metallic NPs are useful to enhance light harvesting in organic photovoltaic systems. The scattering at the surface of an indium tin oxide (ITO) working electrode was measured during a potential sweep. Utilizing Mie scattering theory and high resolution scanning electron microscopy (SEM), the scattering data were used to calculate current-potential curves depicting the electrodeposition of individual Ag NPs. The oxidation of individual presynthesized and electrodeposited Ag NPs was also investigated using fluorescence and DFS microscopies. Our work has produced 1 US provisional patent, 15 published manuscripts, 1 submitted and two additional in-writing manuscripts. 5 graduate students, 1 postdoctoral student, 1 visiting professor, and two undergraduate students have received research training in the area of electrochemistry and optical spectroscopy under support of this award.« less

Unconventional molecule-resolved current rectification in diamondoid–fullerene hybrids

PubMed Central

Randel, Jason C.; Niestemski, Francis C.; Botello-Mendez, Andrés R.; Mar, Warren; Ndabashimiye, Georges; Melinte, Sorin; Dahl, Jeremy E. P.; Carlson, Robert M. K.; Butova, Ekaterina D.; Fokin, Andrey A.; Schreiner, Peter R.; Charlier, Jean-Christophe; Manoharan, Hari C.

2014-01-01

The unimolecular rectifier is a fundamental building block of molecular electronics. Rectification in single molecules can arise from electron transfer between molecular orbitals displaying asymmetric spatial charge distributions, akin to p–n junction diodes in semiconductors. Here we report a novel all-hydrocarbon molecular rectifier consisting of a diamantane–C60 conjugate. By linking both sp3 (diamondoid) and sp2 (fullerene) carbon allotropes, this hybrid molecule opposingly pairs negative and positive electron affinities. The single-molecule conductances of self-assembled domains on Au(111), probed by low-temperature scanning tunnelling microscopy and spectroscopy, reveal a large rectifying response of the molecular constructs. This specific electronic behaviour is postulated to originate from the electrostatic repulsion of diamantane–C60 molecules due to positively charged terminal hydrogen atoms on the diamondoid interacting with the top electrode (scanning tip) at various bias voltages. Density functional theory computations scrutinize the electronic and vibrational spectroscopic fingerprints of this unique molecular structure and corroborate the unconventional rectification mechanism. PMID:25202942

Long-range coupling of electron-hole pairs in spatially separated organic donor-acceptor layers

PubMed Central

Nakanotani, Hajime; Furukawa, Taro; Morimoto, Kei; Adachi, Chihaya

2016-01-01

Understanding exciton behavior in organic semiconductor molecules is crucial for the development of organic semiconductor-based excitonic devices such as organic light-emitting diodes and organic solar cells, and the tightly bound electron-hole pair forming an exciton is normally assumed to be localized on an organic semiconducting molecule. We report the observation of long-range coupling of electron-hole pairs in spatially separated electron-donating and electron-accepting molecules across a 10-nanometers-thick spacer layer. We found that the exciton energy can be tuned over 100 megaelectron volts and the fraction of delayed fluorescence can be increased by adjusting the spacer-layer thickness. Furthermore, increasing the spacer-layer thickness produced an organic light-emitting diode with an electroluminescence efficiency nearly eight times higher than that of a device without a spacer layer. Our results demonstrate the first example of a long-range coupled charge-transfer state between electron-donating and electron-accepting molecules in a working device. PMID:26933691

A theoretical-electron-density databank using a model of real and virtual spherical atoms.

PubMed

Nassour, Ayoub; Domagala, Slawomir; Guillot, Benoit; Leduc, Theo; Lecomte, Claude; Jelsch, Christian

2017-08-01

A database describing the electron density of common chemical groups using combinations of real and virtual spherical atoms is proposed, as an alternative to the multipolar atom modelling of the molecular charge density. Theoretical structure factors were computed from periodic density functional theory calculations on 38 crystal structures of small molecules and the charge density was subsequently refined using a density model based on real spherical atoms and additional dummy charges on the covalent bonds and on electron lone-pair sites. The electron-density parameters of real and dummy atoms present in a similar chemical environment were averaged on all the molecules studied to build a database of transferable spherical atoms. Compared with the now-popular databases of transferable multipolar parameters, the spherical charge modelling needs fewer parameters to describe the molecular electron density and can be more easily incorporated in molecular modelling software for the computation of electrostatic properties. The construction method of the database is described. In order to analyse to what extent this modelling method can be used to derive meaningful molecular properties, it has been applied to the urea molecule and to biotin/streptavidin, a protein/ligand complex.

Electronic levels and charge distribution near the interface of nickel

NASA Technical Reports Server (NTRS)

Waber, J. T.

1982-01-01

The energy levels in clusters of nickel atoms were investigated by means of a series of cluster calculations using both the multiple scattering and computational techniques (designated SSO) which avoids the muffin-tin approximation. The point group symmetry of the cluster has significant effect on the energy of levels nominally not occupied. This influences the electron transfer process during chemisorption. The SSO technique permits the approaching atom or molecule plus a small number of nickel atoms to be treated as a cluster. Specifically, molecular levels become more negative in the O atom, as well as in a CO molecule, as the metal atoms are approached. Thus, electron transfer from the nickel and bond formation is facilitated. This result is of importance in understanding chemisorption and catalytic processes.

Theoretical study of anisotropic mobility in ladder-type molecule organic semiconductors

NASA Astrophysics Data System (ADS)

Wei, Hui-Ling; Liu, Yu-Fang

2014-09-01

The properties of two ladder-type semiconductors {M1: 2,2'-(2,7-dihexy1-4,9-dihydro- s-indaceno[1,2- b:5,6- b']dithiophene-4,9-diylidene) dimalononitrile and M2: 2,7-dihexy1-4,9-dihydro- s-indaceno[1,2- b:5,6- b']dithiophene-4,9-dione} as the n-type and ambipolar organic materials are systematically investigated using the first-principle density functional theory combined with the Marcus-Hush electron transfer theory. It is found that the substitution of M1 induces large changes in its electron-transfer mobility of 1.370 cm2 V-1 s-1. M2 has both large electron- and hole-transfer mobility of 0.420 and 0.288 cm2 V-1 s-1, respectively, which indicates that M2 is potentially a high efficient ambipolar organic semiconducting material. Both the M1 and M2 crystals show remarkable anisotropic behavior. A proper design of the n-type and ambipolar organic electronic materials, which may have high mobility performance, is suggested based on the investigated two molecules.

Photoinduced energy and electron transfer processes in hexapyropheophorbide a- fullerene [C(60)] molecular systems.

PubMed

Regehly, Martin; Ermilov, Eugeny A; Helmreich, Matthias; Hirsch, Andreas; Jux, Norbert; Röder, Beate

2007-02-08

The photophysical properties of the novel hexapyropheophorbide a (P6), and hexakis (pyropheophorbide a)-C60 (FP6) were studied and compared with those of hexakis (pyropheophorbide a)-fullerene [5:1] hexaadduct (FHP6). It was found that after light absorption the pyropheophorbide a molecules in all three compounds undergo very efficient energy transfer as well as partly excitonic interactions. The last process results in the formation of energy traps, which could be resolved experimentally. For P6, due to shorter distances between neighboring dye molecules, stronger interactions between pyropheophorbide a units than for FHP6 were observed. As a consequence, the excitation energy is delivered rapidly to traps formed by stacked pyropheophorbide a molecules resulting in the reduction of fluorescence, intersystem crossing, and singlet oxygen quantum yields compared to the values of FHP6. For FP6 the reduction of these values is much stronger due to an additional fast and efficient deactivation process, namely photoinduced electron transfer from pyropheophorbide a to the fullerene moiety. Consequently, FP6 can be considered as a combination of a light-harvesting system consisting of several separate pyropheophorbide a molecules and a charge-separating center.

Photoinduced charge separation in a colloidal system of exfoliated layered semiconductor controlled by coexisting aluminosilicate clay.

PubMed

Nakato, Teruyuki; Yamada, Yoshimi; Miyamoto, Nobuyoshi

2009-02-05

We investigated photoinduced charge separation occurring in a multicomponent colloidal system composed of oxide nanosheets of photocatalytically active niobate and photochemically inert clay and electron accepting methylviologen dications (MV2+). The inorganic nanosheets were obtained by exfoliation of layered hexaniobate and hectorite clay. The niobate and clay nanosheets were spatially separated in the colloidally dispersed state, and the MV2+ molecules were selectively adsorbed on the clay platelets. UV irradiation of the colloids led to electron transfer from the niobate nanosheets to the MV2+ molecules adsorbed on clay. The photoinduced electron transfer produced methylviologen radical cations (MV*+), which was characterized by high yield and long lifetime. The yield and stability of the MV*+ species were found to depend strongly on the clay content of the colloid: from a few mol % to approximately 70 mol % of the yield and several tens of minutes to more than 40 h of the lifetime. The contents of the niobate nanosheets and MV2+ molecules and the aging of the colloid also affected the photoinduced charge separation. In the absence of MV2+ molecules in the colloid, UV irradiation induced electron accumulation in the niobate nanosheets. The stability of the electron-accumulated state also depended on the clay content. The variation in the photochemical behavior is discussed in relation to the viscosity of the colloid.

A novel chlorophyll solar cell

NASA Astrophysics Data System (ADS)

Ludlow, J. C.

The photosynthetic process is reviewed in order to produce a design for a chlorophyll solar cell. In a leaf, antenna chlorophyll absorbs light energy and conducts it to an energy trap composed of a protein and two chlorophyll molecules, which perform the oxidation-reduction chemistry. The redox potential of the trap changes from 0.4 to -0.6 V, which is sufficient to reduce nearby molecules with redox potentials in that range. The reduction occurs by transfer of an electron, and a chlorophyll solar cell would direct the transferred electron to a current carrier. Chlorophyll antenna and traps are placed on a metallic support immersed in an electron acceptor solution, and resulting electrons from exposure to light are gathered by a metallic current collector. Spinach chlorophyll extracted, purified, and applied in a cell featuring a Pt collector and an octane water emulsion resulted in intensity independent voltages.

Communication: Probing non-equilibrium vibrational relaxation pathways of highly excited C≡N stretching modes following ultrafast back-electron transfer.

PubMed

Lynch, Michael S; Slenkamp, Karla M; Khalil, Munira

2012-06-28

Fifth-order nonlinear visible-infrared spectroscopy is used to probe coherent and incoherent vibrational energy relaxation dynamics of highly excited vibrational modes indirectly populated via ultrafast photoinduced back-electron transfer in a trinuclear cyano-bridged mixed-valence complex. The flow of excess energy deposited into four C≡N stretching (ν(CN)) modes of the molecule is monitored by performing an IR pump-probe experiment as a function of the photochemical reaction (τ(vis)). Our results provide experimental evidence that the nuclear motions of the molecule are both coherently and incoherently coupled to the electronic charge transfer process. We observe that intramolecular vibrational relaxation dynamics among the highly excited ν(CN) modes change significantly en route to equilibrium. The experiment also measures a 7 cm(-1) shift in the frequency of a ∼57 cm(-1) oscillation reflecting a modulation of the coupling between the probed high-frequency ν(CN) modes for τ(vis) < 500 fs.

The influence of photoelectron processes in a semiconductor substrate on the adsorption of polycationic and polyanionic molecules

NASA Astrophysics Data System (ADS)

Stetsyura, S. V.; Kozlowski, A. V.

2017-03-01

White-light illumination during the adsorption of polyanionic molecules of glucose oxidase (GO x ) enzyme on the surface of p-Si/SiO2/polyethylenimine structure leads to a threefold decrease in the surface concentration of GO x molecules. Same illumination during the GO x adsorption on the n-Si/SiO2/PEI structure leads to a sevenfold increase in the surface concentration of enzyme molecules. Changes in the amount of adsorbed GO x molecules depending on the intensity of irradiation are explained by electron transfer processes and recharging of electronic states at the Si/SiO2 interface and within SiO2 layer.

Molecules for organic electronics studied one by one.

PubMed

Meyer, Jörg; Wadewitz, Anja; Lokamani; Toher, Cormac; Gresser, Roland; Leo, Karl; Riede, Moritz; Moresco, Francesca; Cuniberti, Gianaurelio

2011-08-28

The electronic and geometrical structure of single difluoro-bora-1,3,5,7-tetraphenyl-aza-dipyrromethene (aza-BODIPY) molecules adsorbed on the Au(111) surface is investigated by low temperature scanning tunneling microscopy and spectroscopy in conjunction with ab initio density functional theory simulations of the density of states and of the interaction with the substrate. Our DFT calculations indicate that the aza-bodipy molecule forms a chemical bond with the Au(111) substrate, with distortion of the molecular geometry and significant charge transfer between the molecule and the substrate. Nevertheless, most likely due to the low corrugation of the Au(111) surface, diffusion of the molecule is observed for applied bias in excess of 1 V.

Multiple electron injection dynamics in linearly-linked two dye co-sensitized nanocrystalline metal oxide electrodes for dye-sensitized solar cells.

PubMed

Shen, Qing; Ogomi, Yuhei; Park, Byung-wook; Inoue, Takafumi; Pandey, Shyam S; Miyamoto, Akari; Fujita, Shinsuke; Katayama, Kenji; Toyoda, Taro; Hayase, Shuzi

2012-04-07

Understanding the electron transfer dynamics at the interface between dye sensitizer and semiconductor nanoparticle is very important for both a fundamental study and development of dye-sensitized solar cells (DSCs), which are a potential candidate for next generation solar cells. In this study, we have characterized the ultrafast photoexcited electron dynamics in a newly produced linearly-linked two dye co-sensitized solar cell using both a transient absorption (TA) and an improved transient grating (TG) technique, in which tin(IV) 2,11,20,29-tetra-tert-butyl-2,3-naphthalocyanine (NcSn) and cis-diisothiocyanato-bis(2,2'-bipyridyl-4,4'-dicarboxylato)ruthenium(II) bis(tetrabutylammonium) (N719) are molecularly and linearly linked and are bonded to the surface of a nanocrystalline tin dioxide (SnO(2)) electrode by a metal-O-metal linkage (i.e. SnO(2)-NcSn-N719). By comparing the TA and TG kinetics of NcSn, N719, and hybrid NcSn-N719 molecules adsorbed onto both of the SnO(2) and zirconium dioxide (ZrO(2)) nanocrystalline films, the forward and backward electron transfer dynamics in SnO(2)-NcSn-N719 were clarified. We found that there are two pathways for electron injection from the linearly-linked two dye molecules (NcSn-N719) to SnO(2). The first is a stepwise electron injection, in which photoexcited electrons first transfer from N719 to NcSn with a transfer time of 0.95 ps and then transfer from NcSn to the conduction band (CB) of SnO(2) with two timescales of 1.6 ps and 4.2 ps. The second is direct photoexcited electron transfer from N719 to the CB of SnO(2) with a timescale of 20-30 ps. On the other hand, back electron transfer from SnO(2) to NcSn is on a timescale of about 2 ns, which is about three orders of magnitude slower compared to the forward electron transfer from NcSn to SnO(2). The back electron transfer from NcSn to N719 is on a timescale of about 40 ps, which is about one order slower compared to the forward electron transfer from N719 to NcSn. These results demonstrate that photoexcited electrons can be effectively injected into SnO(2) from both of the N719 and NcSn dyes.

Theoretical and Experimental Studies of N,N-Dimethyl-N'-Picryl-4,4'-Stilbenediamine.

PubMed

Papper, Vladislav; Wu, Yuanyuan; Kharlanov, Vladimir; Sukharaharja, Ayrine; Steele, Terry W J; Marks, Robert S

2018-01-01

N,N-dimethyl-N'-picryl-4,4'-stilbenediamine (DMPSDA) was prepared, purified and crystallised in a form of black lustrous crystals, and its absorption and fluorescence spectra were recorded in cyclohexane, acetonitrile and dimethyl sulfoxide. Non-emissive intramolecular charge transfer state (ICT) was clearly observed in this molecule in all three solvents. Theoretical calculations demonstrating a betaine electronic structure of the trinitrophenyl group in the ground state of the molecule and a charge transfer nature of the long wavelength transition S 0  → S 1 supported the experimental observations of the ICT formation in the molecule.

Van der Waals corrected DFT study of adsorption of groups VA and VIA hydrides on graphene monoxide

NASA Astrophysics Data System (ADS)

Notash, M. Yaghoobi; Ebrahimzadeh, A. Rastkar

2016-06-01

Adsorption properties of H2O, H2S, NH3 and PH3 on graphene monoxide (GMO) nano flack are investigated using density functional theory (DFT). Calculations were carried out by van der Waals correction and general gradient approximation. The adsorption energies and charge transfer between species are obtained and discussed for the considered positions of adsorbate molecules. Charge transfer analysis show that the gas molecules act as an electron acceptor in all cases. The analysis of the adsorption energies suggest GMO can be a good candidate for the adsorption of these molecules.

Crystallochromy of perylene pigments: Interference between Frenkel excitons and charge-transfer states

NASA Astrophysics Data System (ADS)

Gisslén, Linus; Scholz, Reinhard

2009-09-01

The optical properties of perylene-based pigments are arising from the interplay between neutral molecular excitations and charge transfer between adjacent molecules. In the crystalline phase, these excitations are coupled via electron and hole transfer, two quantities relating directly to the width of the conduction and valence band in the crystalline phase. Based on the crystal structure determined by x-ray diffraction, density-functional theory (DFT) and Hartree-Fock are used for the calculation of the electronic states of a dimer of stacked molecules. The resulting transfer parameters for electron and hole are used in an exciton model for the coupling between Frenkel excitons and charge-transfer states. The deformation of the positively or negatively charged molecular ions with respect to the neutral ground state is calculated with DFT and the geometry in the optically excited state is deduced from time-dependent DFT and constrained DFT. All of these deformations are interpreted in terms of the elongation of an effective internal vibration which is used subsequently in the exciton model for the crystalline phase. A comparison between the calculated dielectric function and the observed optical spectra allows to deduce the relative energetic position of Frenkel excitons and the charge-transfer state involving stack neighbors, a key parameter for various electronic and optoelectronic device applications. For five out of six perylene pigments studied in the present work, this exciton model results in excellent agreement between calculated and observed optical properties.

Charge transfer and charge localization in extended radical cations: Investigation of model molecules for peptides

NASA Astrophysics Data System (ADS)

Weinkauf, Rainer; Lehrer, Florian

1998-12-01

Molecules consisting of a flexible tail and an aromatic chromophore are used as model systems to understand the situation of a single chromophore in a small peptide. Their S0-S1 resonant multiphoton ionization (REMPI) spectra show, that in neutral molecules the tail-chromophore interaction is weak and electronic excitation is localized at the chromophore. For molecules, where the ionization energy of the tail is considerable higher than that of the chromophore, by high resolution REMPI photoelectron spectroscopy we find the charge to be localized on the aromatic chromophore. This scheme also in suitable peptides allows local ionization at the aromatic chromophore. An estimate for various charge positions in peptide chains, however, shows, that for most of the amino acids electron hole positions in the nitrogen and oxygen "lone pair" orbitals of the peptide bond are nearly degenerate. REMPI photoelectron spectra of phenylethylamine, which as a model system contains such two degenerate charge positions, show small energetic shift of the ionization energy but strong geometry changes upon electron removal. This result is interpreted as direct ionization into a mixed charge delocalized state. Consequences for the charge transfer mechanism in peptides are discussed.

Electron-transfer oxidation properties of DNA bases and DNA oligomers.

PubMed

Fukuzumi, Shunichi; Miyao, Hiroshi; Ohkubo, Kei; Suenobu, Tomoyoshi

2005-04-21

Kinetics for the thermal and photoinduced electron-transfer oxidation of a series of DNA bases with various oxidants having the known one-electron reduction potentials (E(red)) in an aqueous solution at 298 K were examined, and the resulting electron-transfer rate constants (k(et)) were evaluated in light of the free energy relationship of electron transfer to determine the one-electron oxidation potentials (E(ox)) of DNA bases and the intrinsic barrier of the electron transfer. Although the E(ox) value of GMP at pH 7 is the lowest (1.07 V vs SCE) among the four DNA bases, the highest E(ox) value (CMP) is only 0.19 V higher than that of GMP. The selective oxidation of GMP in the thermal electron-transfer oxidation of GMP results from a significant decrease in the pH dependent oxidation potential due to the deprotonation of GMP*+. The one-electron reduced species of the photosensitizer produced by photoinduced electron transfer are observed as the transient absorption spectra when the free energy change of electron transfer is negative. The rate constants of electron-transfer oxidation of the guanine moieties in DNA oligomers with Fe(bpy)3(3+) and Ru(bpy)3(3+) were also determined using DNA oligomers containing different guanine (G) sequences from 1 to 10 G. The rate constants of electron-transfer oxidation of the guanine moieties in single- and double-stranded DNA oligomers with Fe(bpy)3(2+) and Ru(bpy)3(3+) are dependent on the number of sequential guanine molecules as well as on pH.

Quantum coherent π-electron rotations in a non-planar chiral molecule induced by using a linearly polarized UV laser pulse

NASA Astrophysics Data System (ADS)

Mineo, Hirobumi; Fujimura, Yuichi

2015-06-01

We propose an ultrafast quantum switching method of π-electron rotations, which are switched among four rotational patterns in a nonplanar chiral aromatic molecule (P)-2,2’- biphenol and perform the sequential switching among four rotational patterns which are performed by the overlapped pump-dump laser pulses. Coherent π-electron dynamics are generated by applying the linearly polarized UV pulse laser to create a pair of coherent quasidegenerated excited states. We also plot the time-dependent π-electron ring current, and discussed ring current transfer between two aromatic rings.

Photoinduced electron transfer and solvation in iodide-doped acetonitrile clusters.

PubMed

Ehrler, Oli T; Griffin, Graham B; Young, Ryan M; Neumark, Daniel M

2009-04-02

We have used ultrafast time-resolved photoelectron imaging to measure charge transfer dynamics in iodide-doped acetonitrile clusters I(-)(CH(3)CN)(n) with n = 5-10. Strong modulations of vertical detachment energies were observed following charge transfer from the halide, allowing interpretation of the ongoing dynamics. We observe a sharp drop in the vertical detachment energy (VDE) within 300-400 fs, followed by a biexponential increase that is complete by approximately 10 ps. Comparison to theory suggests that the iodide is internally solvated and that photodetachment results in formation of a diffuse electron cloud in a confined cavity. We interpret the initial drop in VDE as a combination of expansion of the cavity and localization of the excess electron on one or two solvent molecules. The subsequent increase in VDE is attributed to a combination of the I atom leaving the cavity and rearrangement of the acetonitrile molecules to solvate the electron. The n = 5-8 clusters then show a drop in VDE of around 50 meV on a much longer time scale. The long-time VDEs are consistent with those of (CH(3)CN)(n)(-) clusters with internally solvated electrons. Although the excited-state created by the pump pulse decays by emission of a slow electron, no such decay is seen by 200 ps.

Properties of copper (fluoro-)phthalocyanine layers deposited on epitaxial graphene.

PubMed

Ren, Jun; Meng, Sheng; Wang, Yi-Lin; Ma, Xu-Cun; Xue, Qi-Kun; Kaxiras, Efthimios

2011-05-21

We investigate the atomic structure and electronic properties of monolayers of copper phthalocyanines (CuPc) deposited on epitaxial graphene substrate. We focus in particular on hexadecafluorophthalocyanine (F(16)CuPc), using both theoretical and experimental (scanning tunneling microscopy - STM) studies. For the individual CuPc and F(16)CuPc molecules, we calculated the electronic and optical properties using density functional theory (DFT) and time-dependent DFT and found a red-shift in the absorption peaks of F(16)CuPc relative to those of CuPc. In F(16)CuPc, the electronic wavefunctions are more polarized toward the electronegative fluorine atoms and away from the Cu atom at the center of the molecule. When adsorbed on graphene, the molecules lie flat and form closely packed patterns: F(16)CuPc forms a hexagonal pattern with two well-ordered alternating α and β stripes while CuPc arranges into a square lattice. The competition between molecule-substrate and intermolecular van der Waals interactions plays a crucial role in establishing the molecular patterns leading to tunable electron transfer from graphene to the molecules. This transfer is controlled by the layer thickness of, or the applied voltage on, epitaxial graphene resulting in selective F(16)CuPc adsorption, as observed in STM experiments. In addition, phthalocyanine adsorption modifies the electronic structure of the underlying graphene substrate introducing intensity smoothing in the range of 2-3 eV below the Dirac point (E(D)) and a small peak in the density of states at ∼0.4 eV above E(D). © 2011 American Institute of Physics.

First-principles study on the gas sensing property of the Ge, As, and Br doped PtSe2

NASA Astrophysics Data System (ADS)

Zhang, Jing; Yang, Gui; Tian, Junlong; Ma, Dongwei; Wang, Yuanxu

2018-03-01

Based on first-principles calculations, the adsorption behaviors of H2, O2, CO, CO2, NH3, NO, and NO2 molecules on the Ge-, As- and Br-doped PtSe2 monolayers are theoretically investigated. The results indicate that it is viable for the dopant atoms to be filled into the Se vacancies under Pt-rich conditions. Ge and As act as p-type dopants, while Br acts as n-type dopant. For the adsorption of molecules, the geometrical structures, adsorption energies, charge transfers and the electronic and magnetic properties of the most stable configurations are presented and discussed. It is found that the Ge-doped PtSe2 monolayers exhibit greatly enhanced sensitivity toward O2, CO, NH3, NO and NO2 molecules and the As-doped PtSe2 monolayers are more sensitive toward O2, NH3, NO and NO2 molecules than the pristine ones. This is evident from large adsorption energies, charge transfers, and obvious changes of the electronic states due to the molecule adsorption. However, Br doping cannot enhance the sensing sensitivity of the PtSe2 monolayer. The possible reason is that when substituting for the Se atom, the doped Br with more 4p electrons and less empty orbitals are already chemically saturated by the two of the three neighboring Pt atoms, and thus lose the ability of charge exchange with the adsorbed molecules. On the contrary, the Ge and As as p-type dopants have sizable empty 4p orbitals near the Fermi level to exchange the electrons with the adsorbed molecules, and thus form strong bonds with them.

Comment on ``long-range exchange contribution to singlet-singlet energy transfer in a series of rigid bichromophoric molecules'', chem. phys. letters 143 (1988) 488

NASA Astrophysics Data System (ADS)

Speiser, Shammai; Rubin, Mordecai B.

1988-09-01

We point out earlier work on intramolecular electronic energy tranfer in bichromophoric molecules and the possibility of an alternative interpretation of the results of Oevering, Verhoeven, Paddon-Row, Cotsaris and Hush.

Electron transport in ethanol & methanol absorbed defected graphene

NASA Astrophysics Data System (ADS)

Dandeliya, Sushmita; Srivastava, Anurag

2018-05-01

In the present paper, the sensitivity of ethanol and methanol molecules on surface of single vacancy defected graphene has been investigated using density functional theory (DFT). The changes in structural and electronic properties before and after adsorption of ethanol and methanol were analyzed and the obtained results show high adsorption energy and charge transfer. High adsorption happens at the active site with monovacancy defect on graphene surface. Present work confirms that the defected graphene increases the surface reactivity towards ethanol and methanol molecules. The presence of molecules near the active site affects the electronic and transport properties of defected graphene which makes it a promising choice for designing methanol and ethanol sensor.

Method of isotope separation by chemi-ionization

DOEpatents

Wexler, Sol; Young, Charles E.

1977-05-17

A method for separating specific isotopes present in an isotopic mixture by aerodynamically accelerating a gaseous compound to form a jet of molecules, and passing the jet through a stream of electron donor atoms whereby an electron transfer takes place, thus forming negative ions of the molecules. The molecular ions are then passed through a radiofrequency quadrupole mass filter to separate the specific isotopes. This method may be used for any compounds having a sufficiently high electron affinity to permit negative ion formation, and is especially useful for the separation of plutonium and uranium isotopes.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lei, Dongsheng; Rames, Matthew; Zhang, Xing

Cholesteryl ester transfer protein (CETP) mediates cholesteryl ester (CE) transfer from the atheroprotective high density lipoprotein (HDL) cholesterol to the atherogenic low density lipoprotein cholesterol. In the past decade, this property has driven the development of CETP inhibitors, which have been evaluated in large scale clinical trials for treating cardiovascular diseases. Despite the pharmacological interest, little is known about the fundamental mechanism of CETP in CE transfer. Recent electron microscopy (EM) experiments have suggested a tunnel mechanism, and molecular dynamics simulations have shown that the flexible N-terminal distal end of CETP penetrates into the HDL surface and takes up amore » CE molecule through an open pore. However, it is not known whether a CE molecule can completely transfer through an entire CETP molecule. Here, we used all-atom molecular dynamics simulations to evaluate this possibility. The results showed that a hydrophobic tunnel inside CETP is sufficient to allow a CE molecule to completely transfer through the entire CETP within a predicted transfer time and at a rate comparable with those obtained through physiological measurements. Analyses of the detailed interactions revealed several residues that might be critical for CETP function, which may provide important clues for the effective development of CETP inhibitors and treatment of cardiovascular diseases.« less

Influence of silver nanoparticles on relaxation processes and efficiency of dipole – dipole energy transfer between dye molecules in polymethylmethacrylate films

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bryukhanov, V V; Borkunov, R Yu; Tsarkov, M V

The fluorescence and phosphorescence of dyes in thin polymethylmethacrylate (PMMA) films in the presence of ablated silver nanoparticles has been investigated in a wide temperature range by methods of femtosecond and picosecond laser photoexcitation. The fluorescence and phosphorescence times, as well as spectral and kinetic characteristics of rhodamine 6G (R6G) molecules in PMMA films are measured in a temperature range of 80 – 330 K. The temperature quenching activation energy of the fluorescence of R6G molecules in the presence of ablated silver nanoparticles is found. The vibrational relaxation rate of R6G in PMMA films is estimated, the efficiency of themore » dipole – dipole electron energy transfer between R6G and brilliant green molecules (enhanced by plasmonic interaction with ablated silver nanoparticles) is analysed, and the constants of this energy transfer are determined. (nanophotonics)« less

Ultrafast inter- and intramolecular vibrational energy transfer between molecules at interfaces studied by time- and polarization-resolved SFG spectroscopy.

PubMed

Yamamoto, Susumu; Ghosh, Avishek; Nienhuys, Han-Kwang; Bonn, Mischa

2010-10-28

We present experimental results on femtosecond time-resolved surface vibrational spectroscopy aimed at elucidating the sub-picosecond reorientational dynamics of surface molecules. The approach, which relies on polarization- and time-resolved surface sum frequency generation (SFG), provides a general means to monitor interfacial reorientational dynamics through vibrations inherent in surface molecules in their electronic ground state. The technique requires an anisotropic vibrational excitation of surface molecules using orthogonally polarized infrared excitation light. The decay of the resulting anisotropy is followed in real-time. We employ the technique to reveal the reorientational dynamics of vibrational transition dipoles of long-chain primary alcohols on the water surface, and of water molecules at the water-air interface. The results demonstrate that, in addition to reorientational motion of specific molecules or molecular groups at the interface, inter- and intramolecular energy transfer processes can serve to scramble the initial anisotropy very efficiently. In the two exemplary cases demonstrated here, energy transfer occurs much faster than reorientational motion of interfacial molecules. This has important implications for the interpretation of static SFG spectra. Finally, we suggest experimental schemes and strategies to decouple effects resulting from energy transfer from those associated with surface molecular motion.

Dual Catalysis Strategies in Photochemical Synthesis

PubMed Central

2016-01-01

The interaction between an electronically excited photocatalyst and an organic molecule can result in the genertion of a diverse array of reactive intermediates that can be manipulated in a variety of ways to result in synthetically useful bond constructions. This Review summarizes dual-catalyst strategies that have been applied to synthetic photochemistry. Mechanistically distinct modes of photocatalysis are discussed, including photoinduced electron transfer, hydrogen atom transfer, and energy transfer. We focus upon the cooperative interactions of photocatalysts with redox mediators, Lewis and Brønsted acids, organocatalysts, enzymes, and transition metal complexes. PMID:27109441

Dual Catalysis Strategies in Photochemical Synthesis.

PubMed

Skubi, Kazimer L; Blum, Travis R; Yoon, Tehshik P

2016-09-14

The interaction between an electronically excited photocatalyst and an organic molecule can result in the genertion of a diverse array of reactive intermediates that can be manipulated in a variety of ways to result in synthetically useful bond constructions. This Review summarizes dual-catalyst strategies that have been applied to synthetic photochemistry. Mechanistically distinct modes of photocatalysis are discussed, including photoinduced electron transfer, hydrogen atom transfer, and energy transfer. We focus upon the cooperative interactions of photocatalysts with redox mediators, Lewis and Brønsted acids, organocatalysts, enzymes, and transition metal complexes.

Chemical dynamics of the first proton-coupled electron transfer of water oxidation on TiO2 anatase.

PubMed

Chen, Jia; Li, Ye-Fei; Sit, Patrick; Selloni, Annabella

2013-12-18

Titanium dioxide (TiO2) is a prototype, water-splitting (photo)catalyst, but its performance is limited by the large overpotential for the oxygen evolution reaction (OER). We report here a first-principles density functional theory study of the chemical dynamics of the first proton-coupled electron transfer (PCET), which is considered responsible for the large OER overpotential on TiO2. We use a periodic model of the TiO2/water interface that includes a slab of anatase TiO2 and explicit water molecules, sample the solvent configurations by first principles molecular dynamics, and determine the energy profiles of the two electronic states involved in the electron transfer (ET) by hybrid functional calculations. Our results suggest that the first PCET is sequential, with the ET following the proton transfer. The ET occurs via an inner sphere process, which is facilitated by a state in which one electronic hole is shared by the two oxygen ions involved in the transfer.

On the transferability of electron density in binary vanadium borides VB, V3B4 and VB2.

PubMed

Terlan, Bürgehan; Akselrud, Lev; Baranov, Alexey I; Borrmann, Horst; Grin, Yuri

2015-12-01

Binary vanadium borides are suitable model systems for a systematic analysis of the transferability concept in intermetallic compounds due to chemical intergrowth in their crystal structures. In order to underline this structural relationship, topological properties of the electron density in VB, V3B4 and VB2 reconstructed from high-resolution single-crystal X-ray diffraction data as well as derived from quantum chemical calculations, are analysed in terms of Bader's Quantum Theory of Atoms in Molecules [Bader (1990). Atoms in Molecules: A Quantum Theory, 1st ed. Oxford: Clarendon Press]. The compounds VB, V3B4 and VB2 are characterized by a charge transfer from the metal to boron together with two predominant atomic interactions, the shared covalent B-B interactions and the polar covalent B-M interactions. The resembling features of the crystal structures are well reflected by the respective B-B interatomic distances as well as by ρ(r) values at the B-B bond critical points. The latter decrease with an increase in the corresponding interatomic distances. The B-B bonds show transferable electron density properties at bond critical points depending on the respective bond distances.

Engineering coherence among excited states in synthetic heterodimer systems.

PubMed

Hayes, Dugan; Griffin, Graham B; Engel, Gregory S

2013-06-21

The design principles that support persistent electronic coherence in biological light-harvesting systems are obscured by the complexity of such systems. Some electronic coherences in these systems survive for hundreds of femtoseconds at physiological temperatures, suggesting that coherent dynamics may play a role in photosynthetic energy transfer. Coherent effects may increase energy transfer efficiency relative to strictly incoherent transfer mechanisms. Simple, tractable, manipulable model systems are required in order to probe the fundamental physics underlying these persistent electronic coherences, but to date, these quantum effects have not been observed in small molecules. We have engineered a series of rigid synthetic heterodimers that can serve as such a model system and observed quantum beating signals in their two-dimensional electronic spectra consistent with the presence of persistent electronic coherences.

Doping graphene films via chemically mediated charge transfer.

PubMed

Ishikawa, Ryousuke; Bando, Masashi; Morimoto, Yoshitaka; Sandhu, Adarsh

2011-01-31

Transparent conductive films (TCFs) are critical components of a myriad of technologies including flat panel displays, light-emitting diodes, and solar cells. Graphene-based TCFs have attracted a lot of attention because of their high electrical conductivity, transparency, and low cost. Carrier doping of graphene would potentially improve the properties of graphene-based TCFs for practical industrial applications. However, controlling the carrier type and concentration of dopants in graphene films is challenging, especially for the synthesis of p-type films. In this article, a new method for doping graphene using the conjugated organic molecule, tetracyanoquinodimethane (TCNQ), is described. Notably, TCNQ is well known as a powerful electron accepter and is expected to favor electron transfer from graphene into TCNQ molecules, thereby leading to p-type doping of graphene films. Small amounts of TCNQ drastically improved the resistivity without degradation of optical transparency. Our carrier doping method based on charge transfer has a huge potential for graphene-based TCFs.

Influencing the electronic interaction in diferrocenyl-1-phenyl-1H-pyrroles.

PubMed

Hildebrandt, Alexander; Lang, Heinrich

2011-11-28

Functionalised diferrocenyl-1-phenyl-1H-pyrroles were synthesised using Negishi C,C cross-coupling reactions. The influence of different substituents at the phenyl moiety on the electronic interaction was studied using electrochemistry (cyclic and square-wave voltammetry) and spectro-electrochemistry (in situ UV/Vis-NIR spectroscopy). The ferrocenyl moieties gave rise to two sequential, reversible redox processes in each of the diferrocenyl-1-phenyl-1H-pyrroles. The observed ΔE(1/2) values (ΔE(1/2) = difference between first and second oxidation) range between 420 and 480 mV. A linear relationship between the Hammett constants σ of the substituents and the separation of the redox potentials exists. The NIR measurements confirm electronic communication between the iron centers as intervalence charge transfer (IVCT) absorptions were observed in the corresponding mixed-valent monocationic species. All compounds were classified as class II systems according to Robin and Day (M. B. Robin and P. Day, Adv. Inorg. Chem., 1967, 10, 247-423). The oscillator strength of the charge transfer transition highly depends on the electron donating or electron withdrawing character of the phenyl substituents. This enables direct tuning of the intermetallic communication by simple modification of the molecule's functional group. Hence, this series of molecules may be regarded as model compounds for single molecule transistors.

Electronic shift register memory based on molecular electron-transfer reactions

NASA Technical Reports Server (NTRS)

Hopfield, J. J.; Onuchic, Jose Nelson; Beratan, David N.

1989-01-01

The design of a shift register memory at the molecular level is described in detail. The memory elements are based on a chain of electron-transfer molecules incorporated on a very large scale integrated (VLSI) substrate, and the information is shifted by photoinduced electron-transfer reactions. The design requirements for such a system are discussed, and several realistic strategies for synthesizing these systems are presented. The immediate advantage of such a hybrid molecular/VLSI device would arise from the possible information storage density. The prospect of considerable savings of energy per bit processed also exists. This molecular shift register memory element design solves the conceptual problems associated with integrating molecular size components with larger (micron) size features on a chip.

A density functional theory (DFT) and time-dependent density functional theory (TDDFT) study on optical transitions in oligo(p-phenylenevinylene)-fullerene dyads and the applicability to resonant energy transfer.

PubMed

Toivonen, Teemu L J; Hukka, Terttu I

2007-06-07

The optical transitions of three different size oligo(p-phenylenevinylene)-fullerene dyads (OPV(n)-MPC(60); n = 2-4) and of the corresponding separate molecules are studied using density functional theory (DFT) and time-dependent density functional theory. The DFT is used to determine the geometries and the electronic structures of the ground states. Transition energies and excited-state structures are obtained from the TDDFT calculations. Resonant energy transfer from OPV(n) to MPC(60) is also studied and the Fermi golden rule is used, along with two simple models to describe the electronic coupling to calculate the energy transfer rates. The hybrid-type PBE0 functional is used with a split-valence basis set augmented with a polarization function (SV(P)) in calculations and the calculated results are compared to the corresponding experimental results. The calculated PBE0 spectra of the OPV(n)-MPC(60) dyads correspond to the experimental spectra very well and are approximately sums of the absorption spectra of the separate OPV(n) and MPC(60) molecules. Also, the absorption energies of OPV(n) and MPC(60) and the emission energies of OPV(n) are predicted well with the PBE0 functional. The PBE0 calculated resonant energy transfer rates are in a good agreement with the experimental rates and show the existence of many possible pathways for energy transfer from the first excited singlet states of the OPV(n) molecules to the MPC(60) molecule.

Analysis of transformations of the ultrafast electron transfer photoreaction mechanism in liquid solutions by the rate distribution approach.

PubMed

Kuzmin, Michael G; Soboleva, Irina V

2014-05-01

Representation of the experimental reaction kinetics in the form of rate distribution is shown to be an effective method for the analysis of the mechanisms of these reactions and for comparisons of the kinetics with QC calculations, as well as with the experimental data on the medium mobility. The rate constant distribution function P(k) can be obtained directly from the experimental kinetics N(t) by an inverse Laplace transform. The application of this approach to kinetic data for several excited-state electron transfer reactions reveals the transformations of their rate control factors in the time domain of 1-1000 ps. In neat electron donating solvents two components are observed. The fastest component (k > 1 ps(-1)) was found to be controlled by the fluctuations of the overall electronic coupling matrix element, involving all the reactant molecules, located inside the interior of the solvent shell, rather than for specific pairs of reactant molecules. The slower component (1 > k > 0.1 ps(-1)) is controlled by the medium reorganization (longitudinal relaxation times, τL). A substantial contribution from the non-stationary diffusion controlled reaction is observed in diluted solutions ([Q] < 1 M). No contribution from the long-distance electron transfer (electron tunneling) proposed earlier for the excited-state electron transfer between perylene and tetracyanoethylene in acetonitrile is observed. The rate distribution approach provides a simple and efficient method for the quantitative analysis of the reaction mechanism and transformation of the rate control factors in the course of the reactions.

Insights into the Tunnel Mechanism of Cholesteryl Ester Transfer Protein through All-atom Molecular Dynamics Simulations

DOE PAGES

Lei, Dongsheng; Rames, Matthew; Zhang, Xing; ...

2016-05-03

Cholesteryl ester transfer protein (CETP) mediates cholesteryl ester (CE) transfer from the atheroprotective high density lipoprotein (HDL) cholesterol to the atherogenic low density lipoprotein cholesterol. In the past decade, this property has driven the development of CETP inhibitors, which have been evaluated in large scale clinical trials for treating cardiovascular diseases. Despite the pharmacological interest, little is known about the fundamental mechanism of CETP in CE transfer. Recent electron microscopy (EM) experiments have suggested a tunnel mechanism, and molecular dynamics simulations have shown that the flexible N-terminal distal end of CETP penetrates into the HDL surface and takes up amore » CE molecule through an open pore. However, it is not known whether a CE molecule can completely transfer through an entire CETP molecule. Here, we used all-atom molecular dynamics simulations to evaluate this possibility. The results showed that a hydrophobic tunnel inside CETP is sufficient to allow a CE molecule to completely transfer through the entire CETP within a predicted transfer time and at a rate comparable with those obtained through physiological measurements. Analyses of the detailed interactions revealed several residues that might be critical for CETP function, which may provide important clues for the effective development of CETP inhibitors and treatment of cardiovascular diseases.« less

Nanographenes as electron-deficient cores of donor-acceptor systems.

PubMed

Liu, Yu-Min; Hou, Hao; Zhou, Yan-Zhen; Zhao, Xin-Jing; Tang, Chun; Tan, Yuan-Zhi; Müllen, Klaus

2018-05-15

Conjugation of nanographenes (NGs) with electro-active molecules can establish donor-acceptor π-systems in which the former generally serve as the electron-donating moieties due to their electronic-rich nature. In contrast, here we report a series of reversed donor-acceptor structures are obtained by C-N coupling of electron-deficient perchlorinated NGs with electron-rich anilines. Selective amination at the vertexes of the NGs is unambiguously shown through X-ray crystallography. By varying the donating ability of the anilino groups, the optical and assembly properties of donor-acceptor NGs can be finely modulated. The electron-deficient concave core of the resulting conjugates can host electron-rich guest molecules by intermolecular donor-acceptor interactions and gives rise to charge-transfer supramolecular architectures.

Proton transfer from water to ketyl radical anion: Assessment of critical size of hydrated cluster and free energy barrier in solution from first principles simulations

NASA Astrophysics Data System (ADS)

Biswas, Sohag; Dasgupta, Teesta; Mallik, Bhabani S.

2016-09-01

We present the reactivity of an organic intermediate by studying the proton transfer process from water to ketyl radical anion using gas phase electronic structure calculations and the metadynamics method based first principles molecular dynamics (FPMD) simulations. Our results indicate that during the micro solvation of anion by water molecules systematically, the presence of minimum three water molecules in the gas phase cluster is sufficient to observe the proton transfer event. The analysis of trajectories obtained from initial FPMD simulation of an aqueous solution of the anion does not show any evident of complete transfer of the proton from water. The cooperativity of water molecules and the relatively weak anion-water interaction in liquid state prohibit the full release of the proton. Using biasing potential through first principles metadynamics simulations, we report the observation of proton transfer reaction from water to ketyl radical anion with a barrier height of 16.0 kJ/mol.

Kelvin probe force microscopy studies of the charge effects upon adsorption of carbon nanotubes and C60 fullerenes on hydrogen-terminated diamond

NASA Astrophysics Data System (ADS)

Kölsch, S.; Fritz, F.; Fenner, M. A.; Kurch, S.; Wöhrl, N.; Mayne, A. J.; Dujardin, G.; Meyer, C.

2018-01-01

Hydrogen-terminated diamond is known for its unusually high surface conductivity that is ascribed to its negative electron affinity. In the presence of acceptor molecules, electrons are expected to transfer from the surface to the acceptor, resulting in p-type surface conductivity. Here, we present Kelvin probe force microscopy (KPFM) measurements on carbon nanotubes and C60 adsorbed onto a hydrogen-terminated diamond(001) surface. A clear reduction in the Kelvin signal is observed at the position of the carbon nanotubes and C60 molecules as compared with the bare, air-exposed surface. This result can be explained by the high positive electron affinity of carbon nanotubes and C60, resulting in electron transfer from the surface to the adsorbates. When an oxygen-terminated diamond(001) is used instead, no reduction in the Kelvin signal is obtained. While the presence of a charged adsorbate or a difference in work function could induce a change in the KPFM signal, a charge transfer effect of the hydrogen-terminated diamond surface, by the adsorption of the carbon nanotubes and the C60 fullerenes, is consistent with previous theoretical studies.

Nuclear conversion theory: molecular hydrogen in non-magnetic insulators

NASA Astrophysics Data System (ADS)

Ilisca, Ernest; Ghiglieno, Filippo

2016-09-01

The hydrogen conversion patterns on non-magnetic solids sensitively depend upon the degree of singlet/triplet mixing in the intermediates of the catalytic reaction. Three main `symmetry-breaking' interactions are brought together. In a typical channel, the electron spin-orbit (SO) couplings introduce some magnetic excitations in the non-magnetic solid ground state. The electron spin is exchanged with a molecular one by the electric molecule-solid electron repulsion, mixing the bonding and antibonding states and affecting the molecule rotation. Finally, the magnetic hyperfine contact transfers the electron spin angular momentum to the nuclei. Two families of channels are considered and a simple criterion based on the SO coupling strength is proposed to select the most efficient one. The denoted `electronic' conversion path involves an emission of excitons that propagate and disintegrate in the bulk. In the other denoted `nuclear', the excited electron states are transients of a loop, and the electron system returns to its fundamental ground state. The described model enlarges previous studies by extending the electron basis to charge-transfer states and `continui' of band states, and focuses on the broadening of the antibonding molecular excited state by the solid conduction band that provides efficient tunnelling paths for the hydrogen conversion. After working out the general conversion algebra, the conversion rates of hydrogen on insulating and semiconductor solids are related to a few molecule-solid parameters (gap width, ionization and affinity potentials) and compared with experimental measures.

Electron transfer beyond the static picture: A TDDFT/TD-ZINDO study of a pentacene dimer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reslan, Randa; Lopata, Kenneth; Arntsen, Christopher

2012-12-14

We use time-dependent density functional theory and time-dependent ZINDO (a semi-empirical method) to study transfer of an extra electron between a pair of pentacene molecules. A measure of the electronic transfer integral is computed in a dynamic picture via the vertical excitation energy from a delocalized anionic ground state. With increasing dimer separation, this dynamical measurement of charge transfer is shown to be significantly larger than the commonly used static approximation (i.e., LUMO+1–LUMO of the neutral dimer, or HOMO–LUMO of the charged dimer), up to an order of magnitude higher at 6 Å. These results offer a word of cautionmore » for calculations involving large separations, as in organic photovoltaics, where care must be taken when using a static picture to model charge transfer.« less

Mechanism of charge transfer and its impacts on Fermi-level pinning for gas molecules adsorbed on monolayer WS2.

PubMed

Zhou, Changjie; Yang, Weihuang; Zhu, Huili

2015-06-07

Density functional theory calculations were performed to assess changes in the geometric and electronic structures of monolayer WS2 upon adsorption of various gas molecules (H2, O2, H2O, NH3, NO, NO2, and CO). The most stable configuration of the adsorbed molecules, the adsorption energy, and the degree of charge transfer between adsorbate and substrate were determined. All evaluated molecules were physisorbed on monolayer WS2 with a low degree of charge transfer and accept charge from the monolayer, except for NH3, which is a charge donor. Band structure calculations showed that the valence and conduction bands of monolayer WS2 are not significantly altered upon adsorption of H2, H2O, NH3, and CO, whereas the lowest unoccupied molecular orbitals of O2, NO, and NO2 are pinned around the Fermi-level when these molecules are adsorbed on monolayer WS2. The phenomenon of Fermi-level pinning was discussed in light of the traditional and orbital mixing charge transfer theories. The impacts of the charge transfer mechanism on Fermi-level pinning were confirmed for the gas molecules adsorbed on monolayer WS2. The proposed mechanism governing Fermi-level pinning is applicable to the systems of adsorbates on recently developed two-dimensional materials, such as graphene and transition metal dichalcogenides.

Photosensitizing Electron Transfer Processes of Fullerenes, Carbon Nanotubes, and Carbon Nanohorns.

PubMed

Ito, Osamu

2017-03-01

In this account, studies on the photosensitizing electron transfer of nanocarbons, such as fullerenes, single-walled carbon nanotubes (SWCNTs), and carbon nanohorns (CNH), performed in our laboratory for about 15 years in the early 21st century have been briefly reviewed. These novel nanocarbons act as excellent electron acceptors, when they are linked to light-absorbing electron donors, such as porphyrins or phthalocyanines. For such molecule-nanocarbon hybrids, the direct confirmation of fast, transient, electron-transfer phenomena must be performed with time-resolved spectroscopic methods, such as transient absorption spectral measurements, in addition to fluorescence time-profile measurements in the wide-wavelength regions. Careful use of these methods affords useful information to understand photoinduced electron-transfer mechanisms. In addition, kinetic data obtained by these methods can assist in the construction of light-active devices, such as photovoltaic cells and solar H 2 -generation systems. © 2017 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Apport de la microscopie a effet tunnel a la caracterisation d'interfaces molecule-metal a fort transfert de charge

NASA Astrophysics Data System (ADS)

Bedwani, Stephane

To assess the importance of charge-transfer on the interface properties, we studied the interaction of the tetracyanoethylene (TCNE) molecule with various copper surfaces. TCNE, a highly electrophilic molecule, appears as an ideal candidate to study the influence of high charge-transfer on the electronic and structural properties of molecule-surface interfaces. Indeed, various TCNE-transition metal complexes exhibit magnetism at room temperature, which is in agreement with a very significant change of the residual charge on the TCNE molecule. The adsorption of TCNE molecules on Cu(100) and Cu(111) surfaces was studied by scanning tunneling microscopy (STM) and by density functional theory (DFT) calculations with a local density approximation (LDA). DFT-LDA calculations were performed to determine the geometric and electronic structure of the studied interfaces. Mulliken analysis was used to evaluate the partial net charge on the adsorbed species. The density of states (DOS) diagrams provided informations on the nature of the frontier orbitals involved in the charge-transfer at molecule-metal interfaces. To validate the theoretical observations, a comparative study was conducted between our simulated STM images and experimental STM images provided by our collaborators. The theoretical STM images were obtained with the SPAGS-STM software using the Landauer-Buttiker formalism with a semi-empirical Hamiltonian based on the extended Huckel theory (EHT) and parameterized using DFT calculations. During the development of the SPAGS-STM software, we have created a discretization module allowing rapid generation of STM images. This module is based on an adaptive Delaunay meshing scheme to minimize the amount of tunneling current to be computed. The general idea consists into refining the mesh, and therefore the calculations, near large contrast zones rather than over the entire image. The adapted mesh provides an STM image resolution equivalent to that obtained with a conventional Cartesian grid but with a significantly smaller number of calculated pixels. This module is independent of the solver used to compute the tunneling current and can be transposed to different imaging techniques. Our work on the adsorption of TCNE molecules on Cu(100) surfaces revealed that the molecules assemble into a 1D chain, thereby buckling excessively a few Cu atoms from the surface. The large deformations observed at the molecule-metal interface show that the Cu atoms close to the TCNE nitrile groups assist the molecular assembly and show a distinct behavior compared with other Cu atoms. A strong charge-transfer is observed at the interface leading to an almost complete occupation of the state ascribed to the lowest unoccupied molecular orbital (LUMO) of TCNE in gas phase. In addition, a back-donation of charge from the molecule to the metal via the states associated with the highest occupied molecular orbitals (HOMO) of TCNE in gas phase may be seen. The magnitude of the charge-transfer between a TCNE molecule and Cu atoms is of the same order on the Cu(111) surface but causes much less buckling than that on the Cu(100) surface. However, experimental STM images of single TCNE molecules adsorbed on Cu(111) surfaces reveal a surprising electronic multistability. In addition, scanning tunneling spectroscopy (STS) reveals that one of these states has a magnetic nature and shows a Kondo resonance. STM simulations identified the source of two non-magnetic states. DFT-LDA calculations were able to ascribe the magnetic state to the partial occupation of a state corresponding to the LUMO+2 of TCNE. Moreover, the calculations showed that additional molecular deformations to those of TCNE in adsorbed phase, such the elongation of the C=C central bond and the bend of nitrile groups toward the surface, favor this charge-transfer to the LUMO+2. This suggested the presence of a Kondo state through the vibrational excitation of the stretching mode of the C=C central bond. The main results of this thesis led to the conclusion that strong charge-transfer between adsorbed molecules on a metallic surface may induce significant buckling of the surface. This surface reconstruction mechanism that involves a bidirectional charge-transfer between the species results into a partial net charge over the molecule. This mechanism is involved in the supramolecular self-assembly process that appears similar to a coordination network. Moreover, the adsorbed molecule presents some important geometric distortions that alter its electronic structure. Additional distortions on the adsorbed molecule induced by some molecular vibration modes seem to explain a stable magnetic state that can be switch on or off by an electrical impulse. (Abstract shortened by UMI.)

Enhancement of atom transfer in different surface chemistry of hydrogenated vs. fluorinated tribromobenzene on Ag(111) and Cu(111)

NASA Astrophysics Data System (ADS)

Cecily mary glory, D.; Sambathkumar, K.; Madivanane, R.; Rajkamal, N.; Venkatachalapathy, M.

2017-12-01

Systematic interactions of hydrogenated & fluorinated tribromobenzene on Ag and Cu surfaces. First bromine dehalogenation takes place right upon adsorption due to catalytic properties of Ag. Different adsorption geometries of monomers and dimmers of 1,3,5-tribromo-2,4,6-trifluoro-benzene(TBFB) and 1,3,5-tribromobenzene(TBB). DFT calculations of the Csbnd Br binding energy dependent on the amount of remaining bromine atoms for both TBFB and TBB were performed. The experiments were performed at low temperature of 80 K.STM measurements where performed for of TBFB and TBB. STM show adsorbed molecules in a loose arrangement of molecules. NBO analysis the stability of the molecule arising within hyper-conjugative interactions. The HOMO and LUMO energies and electronic charge transfer (ECT) confirms that electronic transition. High field indicates that this molecule exhibit considerable electrical conductivity in atomic charges. The ESP map is found to be positive within the molecule. The negative charges have a tendency to drift from left to right. The computed thermodynamic parameters like heat capacities (Cºp,m), entropies (Sºm) and enthalpies changes (Hºm) are used for various electrical field.

Theoretical simulations on the antioxidant mechanism of naturally occurring flavonoid: A DFT approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Praveena, R.; Sadasivam, K.

Synthetic antioxidants such as butylated hydroxyanisole (BHA) and butylated hydroxytoluene (BHT) are found to be toxic, hence non-carcinogenic naturally occurring radical scavengers especially flavonoids have gained considerable importance in the past two decades. In the present investigation, the radical scavenging activity of C-glycosyl flavonoids is evaluated using theoretical approach which could broaden its scope in therapeutic applications. Gas and solvent phase studies of structural and molecular characteristics of C-glycosyl flavonoid, isovitexin is investigated through hydrogen atom transfer mechanism (HAT), Electron transfer-proton transfer (ET–PT) and Sequential proton loss electron transfer (SPLET) by Density functional theory (DFT) using hybrid parameters. The computedmore » values of the adiabatic ionization potential, electron affinity, hardness, softness, electronegativity and electrophilic index indicate that isovitexin possess good radical scavenging activity. The behavior of different –OH groups in polyphenolic compounds is assessed by considering electronic effects of the neighbouring groups and the overall geometry of molecule which in turn helps in analyzing the antioxidant capacity of the polyphenolic molecule. The studies indicate that the H–atom abstraction from 4’–OH site is preferred during the radical scavenging process. From Mulliken spin density analysis and FMOs, B–ring is found to be more delocalized center and capable of electron donation. Comparison of antioxidant activity of vitexin and isovitexin leads to the conclusion that isovitexin acts as a better radical scavenger. This is an evidence for the importance of position of glucose unit in the flavonoid.« less

Electron tunnelling through single azurin molecules can be on/off switched by voltage pulses

NASA Astrophysics Data System (ADS)

Baldacchini, Chiara; Kumar, Vivek; Bizzarri, Anna Rita; Cannistraro, Salvatore

2015-05-01

Redox metalloproteins are emerging as promising candidates for future bio-optoelectronic and nano-biomemory devices, and the control of their electron transfer properties through external signals is still a crucial task. Here, we show that a reversible on/off switching of the electron current tunnelling through a single protein can be achieved in azurin protein molecules adsorbed on gold surfaces, by applying appropriate voltage pulses through a scanning tunnelling microscope tip. The observed changes in the hybrid system tunnelling properties are discussed in terms of long-sustained charging of the protein milieu.

CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

NASA Astrophysics Data System (ADS)

Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

2018-03-01

CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of <220>. Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

Different catalytic effects of a single water molecule: the gas-phase reaction of formic acid with hydroxyl radical in water vapor.

PubMed

Anglada, Josep M; Gonzalez, Javier

2009-12-07

The effect of a single water molecule on the reaction mechanism of the gas-phase reaction between formic acid and the hydroxyl radical was investigated with high-level quantum mechanical calculations using DFT-B3LYP, MP2 and CCSD(T) theoretical approaches in concert with the 6-311+G(2df,2p) and aug-cc-pVTZ basis sets. The reaction between HCOOH and HO has a very complex mechanism involving a proton-coupled electron transfer process (pcet), two hydrogen-atom transfer reactions (hat) and a double proton transfer process (dpt). The hydroxyl radical predominantly abstracts the acidic hydrogen of formic acid through a pcet mechanism. A single water molecule affects each one of these reaction mechanisms in different ways, depending on the way the water interacts. Very interesting is also the fact that our calculations predict that the participation of a single water molecule results in the abstraction of the formyl hydrogen of formic acid through a hydrogen atom transfer process (hat).

Preparation of high performance NBR/HNTs nanocomposites using an electron transferring interaction method

NASA Astrophysics Data System (ADS)

Yang, Shuyan; Zhou, Yanxue; Zhang, Peng; Cai, Zhuodi; Li, Yangping; Fan, Hongbo

2017-12-01

Interfacial interaction is one of the key factors to improve comprehensive properties of polymer/inorganic filler nanocomposites. In this work, a new interfacial interaction called electron transferring interaction is reported in the nitrile-butadiene rubber/halloysite nanotubes (NBR/HNTs) nanocomposites. The X-ray photoelectron spectroscopy (XPS) and in-situ controlling temperature Fourier transform infrared spectroscopy (FTIR) have confirmed that electrons of electron-rich -CN groups in NBR can transfer to the electron-deficiency aluminum atoms of HNTs, which packs a part of NBR molecules onto the surface of HNTs to form bound rubber and stabilize the homogeneous dispersion of HNTs with few agglomeration as revealed by scanning electron microscope (SEM) and dynamic mechanical analysis (DMA) performances, even at high HNTs addition, resulting in high light transmittance. The tensile strength of NBR/30wt%HNTs nanocomposites is about 291% higher than pure NBR, without sacrificing the elongation at break.

Design strategy for photoinduced electron transfer-based small-molecule fluorescent probes of biomacromolecules.

PubMed

Zhang, Wei; Ma, Zhao; Du, Lupei; Li, Minyong

2014-06-07

As the cardinal support of innumerable biological processes, biomacromolecules such as proteins, nucleic acids and polysaccharides are of importance to living systems. The key to understanding biological processes is to realize the role of these biomacromolecules in thte localization, distribution, conformation and interaction with other molecules. With the current development and adaptation of fluorescent technologies in biomedical and pharmaceutical fields, the fluorescence imaging (FLI) approach of using small-molecule fluorescent probes is becoming an up-to-the-minute method for the detection and monitoring of these imperative biomolecules in life sciences. However, conventional small-molecule fluorescent probes may provide undesirable results because of their intrinsic deficiencies such as low signal-to-noise ratio (SNR) and false-positive errors. Recently, small-molecule fluorescent probes with a photoinduced electron transfer (PET) "on/off" switch for biomacromolecules have been thoroughly considered. When recognized by the biomacromolecules, these probes turn on/off the PET switch and change the fluorescence intensity to present a high SNR result. It should be emphasized that these PET-based fluorescent probes could be advantageous for understanding the pathogenesis of various diseases caused by abnormal expression of biomacromolecules. The discussion of this successful strategy involved in this review will be a valuable guide for the further development of new PET-based small-molecule fluorescent probes for biomacromolecules.

Charge migration and charge transfer in molecular systems

PubMed Central

Wörner, Hans Jakob; Arrell, Christopher A.; Banerji, Natalie; Cannizzo, Andrea; Chergui, Majed; Das, Akshaya K.; Hamm, Peter; Keller, Ursula; Kraus, Peter M.; Liberatore, Elisa; Lopez-Tarifa, Pablo; Lucchini, Matteo; Meuwly, Markus; Milne, Chris; Moser, Jacques-E.; Rothlisberger, Ursula; Smolentsev, Grigory; Teuscher, Joël; van Bokhoven, Jeroen A.; Wenger, Oliver

2017-01-01

The transfer of charge at the molecular level plays a fundamental role in many areas of chemistry, physics, biology and materials science. Today, more than 60 years after the seminal work of R. A. Marcus, charge transfer is still a very active field of research. An important recent impetus comes from the ability to resolve ever faster temporal events, down to the attosecond time scale. Such a high temporal resolution now offers the possibility to unravel the most elementary quantum dynamics of both electrons and nuclei that participate in the complex process of charge transfer. This review covers recent research that addresses the following questions. Can we reconstruct the migration of charge across a molecule on the atomic length and electronic time scales? Can we use strong laser fields to control charge migration? Can we temporally resolve and understand intramolecular charge transfer in dissociative ionization of small molecules, in transition-metal complexes and in conjugated polymers? Can we tailor molecular systems towards specific charge-transfer processes? What are the time scales of the elementary steps of charge transfer in liquids and nanoparticles? Important new insights into each of these topics, obtained from state-of-the-art ultrafast spectroscopy and/or theoretical methods, are summarized in this review. PMID:29333473

Employing exciton transfer molecules to increase the lifetime of phosphorescent red organic light emitting diodes

NASA Astrophysics Data System (ADS)

Lindla, Florian; Boesing, Manuel; van Gemmern, Philipp; Bertram, Dietrich; Keiper, Dietmar; Heuken, Michael; Kalisch, Holger; Jansen, Rolf H.

2011-04-01

The lifetime of phosphorescent red organic light emitting diodes (OLEDs) is investigated employing either N,N'-diphenyl-N,N'-bis(1-naphthylphenyl)-1,1'-biphenyl-4,4'-diamine (NPB), TMM117, or 4,4',4″-tris(N-carbazolyl)-triphenylamine (TCTA) as hole-conducting host material (mixed with an electron conductor). All OLED (organic vapor phase deposition-processed) show similar efficiencies around 30 lm/W but strongly different lifetimes. Quickly degrading OLED based on TCTA can be stabilized by doping exciton transfer molecules [tris-(phenyl-pyridyl)-Ir (Ir(ppy)3)] to the emission layer. At a current density of 50 mA/cm2 (12 800 cd/m2), a lifetime of 387 h can be achieved. Employing exciton transfer molecules is suggested to prevent the degradation of the red emission layer in phosphorescent white OLED.

Photochromic molecules as building blocks for molecular electronics.

PubMed

Peter, Belser

2010-01-01

Energy and electron transfer processes can be easily induced by a photonic excitation of a donor metal complex ([Ru(bpy)3]2), which is connected via a wire-type molecular fragment to an acceptor metal complex ([Os(bpy)3]2+). The rate constant for the transfer process can be determined by emission measurements of the two connected metal complexes. The system can be modified by incorporation of a switching unit or an interrupter into the wire, influencing the transfer process. Such a molecular device corresponds to an interrupter, mimic the same function applied in molecular electronics. We have used organic switches, which show photochromic properties. By irradiation with light of different wavelengths, the switch changes its functionality by a photochemical reaction from an OFF- to an ON-state and vice versa. The ON- respectively OFF-state is manifested by a color change but also in different conductivity properties for energy and electron transfer processes. Therefore, the mentioned molecular device can work as a simple interrupter, controlling the rate of the transfer processes.

A Nonfullerene Small Molecule Acceptor with 3D Interlocking Geometry Enabling Efficient Organic Solar Cells.

PubMed

Lee, Jaewon; Singh, Ranbir; Sin, Dong Hun; Kim, Heung Gyu; Song, Kyu Chan; Cho, Kilwon

2016-01-06

A new 3D nonfullerene small-molecule acceptor is reported. The 3D interlocking geometry of the small-molecule acceptor enables uniform molecular conformation and strong intermolecular connectivity, facilitating favorable nanoscale phase separation and electron charge transfer. By employing both a novel polymer donor and a nonfullerene small-molecule acceptor in the solution-processed organic solar cells, a high-power conversion efficiency of close to 6% is demonstrated. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Distal [FeS]-Cluster Coordination in [NiFe]-Hydrogenase Facilitates Intermolecular Electron Transfer

PubMed Central

Petrenko, Alexander; Stein, Matthias

2017-01-01

Biohydrogen is a versatile energy carrier for the generation of electric energy from renewable sources. Hydrogenases can be used in enzymatic fuel cells to oxidize dihydrogen. The rate of electron transfer (ET) at the anodic side between the [NiFe]-hydrogenase enzyme distal iron–sulfur cluster and the electrode surface can be described by the Marcus equation. All parameters for the Marcus equation are accessible from Density Functional Theory (DFT) calculations. The distal cubane FeS-cluster has a three-cysteine and one-histidine coordination [Fe4S4](His)(Cys)3 first ligation sphere. The reorganization energy (inner- and outer-sphere) is almost unchanged upon a histidine-to-cysteine substitution. Differences in rates of electron transfer between the wild-type enzyme and an all-cysteine mutant can be rationalized by a diminished electronic coupling between the donor and acceptor molecules in the [Fe4S4](Cys)4 case. The fast and efficient electron transfer from the distal iron–sulfur cluster is realized by a fine-tuned protein environment, which facilitates the flow of electrons. This study enables the design and control of electron transfer rates and pathways by protein engineering. PMID:28067774

Photon-momentum transfer in molecular photoionization

NASA Astrophysics Data System (ADS)

Chelkowski, Szczepan; Bandrauk, André D.

2018-05-01

In most models and theoretical calculations describing multiphoton ionization by infrared light, the dipole approximation is used. This is equivalent to setting the very small photon momentum to zero. Using numerical solutions of the (nondipole) three-dimensional time-dependent Schrödinger equation for one electron in a H2+ molecular ion we investigate the effect the photon-momentum transfer to the photoelectron in an H2+ ion in various regimes. We find that the photon-momentum transfer in a molecule is very different from the transfer in atoms due to two-center interference effects. The photon-momentum transfer is very sensitive to the symmetry of the initial electronic state and is strongly dependent on the internuclear distance and on the ellipticity of the laser.

Composition Formulas of Inorganic Compounds in Terms of Cluster Plus Glue Atom Model.

PubMed

Ma, Yanping; Dong, Dandan; Wu, Aimin; Dong, Chuang

2018-01-16

The present paper attempts to identify the molecule-like structural units in inorganic compounds, by applying the so-called "cluster plus glue atom model". This model, originating from metallic glasses and quasi-crystals, describes any structure in terms of a nearest-neighbor cluster and a few outer-shell glue atoms, expressed in the cluster formula [cluster](glue atoms). Similar to the case for normal molecules where the charge transfer occurs within the molecule to meet the commonly known octet electron rule, the octet state is reached after matching the nearest-neighbor cluster with certain outer-shell glue atoms. These kinds of structural units contain information on local atomic configuration, chemical composition, and electron numbers, just as for normal molecules. It is shown that the formulas of typical inorganic compounds, such as fluorides, oxides, and nitrides, satisfy a similar octet electron rule, with the total number of valence electrons per unit formula being multiples of eight.

Structural and vibrational characteristics of a non-linear optical material 3-(4-nitrophenyl)-1-(pyridine-3-yl) prop-2-en-1-one probed by quantum chemical computation and spectroscopic techniques

NASA Astrophysics Data System (ADS)

Kumar, Ram; Karthick, T.; Tandon, Poonam; Agarwal, Parag; Menezes, Anthoni Praveen; Jayarama, A.

2018-07-01

Chalcone and its derivatives are well-known for their high non-linear optical behavior and charge transfer characteristics. The effectiveness of charge transfer via ethylenic group and increase in NLO response of the chalcone upon substitutions are of great interest. The present study focuses the structural, charge transfer and non-linear optical properties of a new chalcone derivative "3-(4-nitrophenyl)-1-(pyridine-3-yl) prop-2-en-1-one" (hereafter abbreviated as 4 NP3AP). To accomplish this task, we have incorporated the experimental FT-IR, FT-Raman and UV-vis spectroscopic studies along with quantum chemical calculations. The frequency assignments of peaks in IR and Raman have been done on the basis of potential energy distribution and the results were compared with the earlier reports on similar kind of molecules. For obtaining the electronic transition details of 4 NP3AP, UV-vis spectrum has been simulated by considering both gaseous and solvent phase using time-dependent density functional theory (TD-DFT). The HOMO-LUMO energy gap, most important factor to be considered for studying charge transfer properties of the molecule has been calculated. The electron density surface map corresponding to the net electrostatic point charges has been generated to obtain the electrophilic and nucleophilic sites. The charge transfer originating from the occupied (donor) and unoccupied (acceptor) molecular orbitals have been analyzed with the help of natural bond orbital theory. Moreover, the estimation of second-hyperpolarizability of the molecule confirms the non-linear optical behavior of the molecule.

Depopulation of Single-Phthalocyanine Molecular Orbitals upon Pyrrolic-Hydrogen Abstraction on Graphene.

PubMed

Néel, Nicolas; Lattelais, Marie; Bocquet, Marie-Laure; Kröger, Jörg

2016-02-23

Single-molecule chemistry with a scanning tunneling microscope has preponderantly been performed on metal surfaces. The molecule-metal hybridization, however, is often detrimental to genuine molecular properties and obscures their changes upon chemical reactions. We used graphene on Ir(111) to reduce the coupling between Ir(111) and adsorbed phthalocyanine molecules. By local electron injection from the tip of a scanning tunneling microscope the two pyrrolic H atoms were removed from single phthalocyanines. The detachment of the H atom pair induced a strong modification of the molecular electronic structure, albeit with no change in the adsorption geometry. Spectra and maps of the differential conductance combined with density functional calculations unveiled the entire depopulation of the highest occupied molecular orbital upon H abstraction. Occupied π states of intact molecules are proposed to be emptied via intramolecular electron transfer to dangling σ states of H-free N atoms.

Ultrafast electronic dynamics driven by nuclear motion

NASA Astrophysics Data System (ADS)

Vendrell, Oriol

2016-05-01

The transfer of electrical charge on a microscopic scale plays a fundamental role in chemistry, in biology, and in technological applications. In this contribution, we will discuss situations in which nuclear motion plays a central role in driving the electronic dynamics of photo-excited or photo-ionized molecular systems. In particular, we will explore theoretically the ultrafast transfer of a double electron hole between the functional groups of glycine after K-shell ionization and subsequent Auger decay. Although a large energy gap of about 15 eV initially exists between the two electronic states involved and coherent electronic dynamics play no role in the hole transfer, we will illustrate how the double hole can be transferred within 3 to 4 fs between both functional ends of the glycine molecule driven solely by specific nuclear displacements and non-Born-Oppenheimer effects. This finding challenges the common wisdom that nuclear dynamics of the molecular skeleton are unimportant for charge transfer processes at the few-femtosecond time scale and shows that they can even play a prominent role. We thank the Hamburg Centre for Ultrafast Imaging and the Volkswagen Foundation for financial support.

Spectral properties of chlorines and electron transfer with their participation in the photosynthetic reaction center of photosystem II

NASA Astrophysics Data System (ADS)

Shchupak, E. E.; Ivashin, N. V.

2014-02-01

Structural factors that provide localization of excited states and determine the properties of primary donor and acceptor of electron in the reaction center of photosystem II (PSII RC) are studied. The results of calculations using stationary and time-dependent density functional theory indicate an important role of protein environments of chlorophylls PA, PB, BA, and BB and pheophytins HA and HB in the area with a radius of no greater than ≤10 Å in the formation of excitonic states of PSII RC. When the neighboring elements are taken into account, the wavelength of long-wavelength Q y transition of chlorophyll molecules is varied by about 10 nm. The effect is less developed for pheophytin molecules (Δλ ≅ 2 nm). The following elements strongly affect energy of the transition: HisA198 and HisD197 amino-acid residues that serve as ligands of magnesium atoms affect PA and PB, respectively; MetA183 affects PA; MetA172 and MetD198 affect BA; water molecules that are located above the planes of the BA and BB macrocycles form H bonds with carbonyl groups; and phytol chains of PA and PB affect BA, BB, HA, and HB. The analysis of excitonic states, mutual positions of molecular orbitals of electron donors and acceptors, and matrix elements of electron transfer reaction shows that (i) charge separation between BA and HA and PB and BA is possible in the active A branch of cofactors of PSII RC and (ii) electron transfer is blocked at the BB - HB fragment in inactive B branch of PSII RC.

Computational design of molecules for an all-quinone redox flow battery† †Electronic supplementary information (ESI) available: The list of computationally predicted candidate quinone molecules with interesting redox properties. See DOI: 10.1039/c4sc03030c Click here for additional data file.

PubMed Central

Er, Süleyman; Suh, Changwon; Marshak, Michael P.

2015-01-01

Inspired by the electron transfer properties of quinones in biological systems, we recently showed that quinones are also very promising electroactive materials for stationary energy storage applications. Due to the practically infinite chemical space of organic molecules, the discovery of additional quinones or other redox-active organic molecules for energy storage applications is an open field of inquiry. Here, we introduce a high-throughput computational screening approach that we applied to an accelerated study of a total of 1710 quinone (Q) and hydroquinone (QH2) (i.e., two-electron two-proton) redox couples. We identified the promising candidates for both the negative and positive sides of organic-based aqueous flow batteries, thus enabling an all-quinone battery. To further aid the development of additional interesting electroactive small molecules we also provide emerging quantitative structure-property relationships. PMID:29560173

Photoinduced electron transfer in fixed distance chlorophyll-quinone donor-acceptor molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wasielewski, M.R.; Johnson, D.G.; Svec, W.A.

1987-01-01

A series of fixed distance chlorophyll-quinone donor-acceptor molecules have been prepared. The donor consists of either methyl pyropheophorbide a or methyl pyrochlorophyllide a, while the acceptor is either benzoquinone or naphthoquinone. The acceptors are fused to a triptycene spacer group, which in turn is attached to the donors at their vinyl groups. Picosecond transient absorption measurements have been used to identify electron transfer from the lowest excited singlet state of the donor to the acceptor as the mechanism of fluorescence quenching in these molecules. The charge separation rate constants increase from 2 x 10/sup 10/ s/sup -1/ to 4 xmore » 10/sup 11/ s/sup -1/ as the free energy of charge separation increases, while the radical pair recombination rate constants decrease from 1.2 x 10/sup 11/ s/sup -1/ to 2 x 10/sup 9/ s/sup -1/ as the free energy of recombination increases. The resulting total reorganization energy lambda = 0.9 eV.« less

Enhanced electronic excitation energy transfer between dye molecules incorporated in nano-scale media with apparent fractal dimensionality

NASA Astrophysics Data System (ADS)

Yefimova, Svetlana L.; Rekalo, Andrey M.; Gnap, Bogdan A.; Viagin, Oleg G.; Sorokin, Alexander V.; Malyukin, Yuri V.

2014-09-01

In the present study, we analyze the efficiency of Electronic Excitation Energy Transfer (EEET) between two dyes, an energy donor (D) and acceptor (A), concentrated in structurally heterogeneous media (surfactant micelles, liposomes, and porous SiO2 matrices). In all three cases, highly effective EEET in pairs of dyes has been found and cannot be explained by Standard Förster-type theory for homogeneous solutions. Two independent approaches based on the analysis of either the D relative quantum yield () or the D fluorescence decay have been used to study the deviation of experimental results from the theoretical description of EEET process. The observed deviation is quantified by the apparent fractal distribution of molecules parameter . We conclude that the highly effective EEET observed in the nano-scale media under study can be explained by both forced concentration of the hydrophobic dyes within nano-volumes and non-uniform cluster-like character of the distribution of D and A dye molecules within nano-volumes.

Magnetization switching in ferromagnets by adsorbed chiral molecules without current or external magnetic field.

PubMed

Ben Dor, Oren; Yochelis, Shira; Radko, Anna; Vankayala, Kiran; Capua, Eyal; Capua, Amir; Yang, See-Hun; Baczewski, Lech Tomasz; Parkin, Stuart Stephen Papworth; Naaman, Ron; Paltiel, Yossi

2017-02-23

Ferromagnets are commonly magnetized by either external magnetic fields or spin polarized currents. The manipulation of magnetization by spin-current occurs through the spin-transfer-torque effect, which is applied, for example, in modern magnetoresistive random access memory. However, the current density required for the spin-transfer torque is of the order of 1 × 10 6  A·cm -2 , or about 1 × 10 25 electrons s -1 cm -2 . This relatively high current density significantly affects the devices' structure and performance. Here we demonstrate magnetization switching of ferromagnetic thin layers that is induced solely by adsorption of chiral molecules. In this case, about 10 13 electrons per cm 2 are sufficient to induce magnetization reversal. The direction of the magnetization depends on the handedness of the adsorbed chiral molecules. Local magnetization switching is achieved by adsorbing a chiral self-assembled molecular monolayer on a gold-coated ferromagnetic layer with perpendicular magnetic anisotropy. These results present a simple low-power magnetization mechanism when operating at ambient conditions.

Magnetization switching in ferromagnets by adsorbed chiral molecules without current or external magnetic field

PubMed Central

Ben Dor, Oren; Yochelis, Shira; Radko, Anna; Vankayala, Kiran; Capua, Eyal; Capua, Amir; Yang, See-Hun; Baczewski, Lech Tomasz; Parkin, Stuart Stephen Papworth; Naaman, Ron; Paltiel, Yossi

2017-01-01

Ferromagnets are commonly magnetized by either external magnetic fields or spin polarized currents. The manipulation of magnetization by spin-current occurs through the spin-transfer-torque effect, which is applied, for example, in modern magnetoresistive random access memory. However, the current density required for the spin-transfer torque is of the order of 1 × 106 A·cm−2, or about 1 × 1025 electrons s−1 cm−2. This relatively high current density significantly affects the devices' structure and performance. Here we demonstrate magnetization switching of ferromagnetic thin layers that is induced solely by adsorption of chiral molecules. In this case, about 1013 electrons per cm2 are sufficient to induce magnetization reversal. The direction of the magnetization depends on the handedness of the adsorbed chiral molecules. Local magnetization switching is achieved by adsorbing a chiral self-assembled molecular monolayer on a gold-coated ferromagnetic layer with perpendicular magnetic anisotropy. These results present a simple low-power magnetization mechanism when operating at ambient conditions. PMID:28230054

DFT investigation on the electronic structure of Faujasite

NASA Astrophysics Data System (ADS)

Popeneciu, Horea; Calborean, Adrian; Tudoran, Cristian; Buimaga-Iarinca, Luiza

2013-11-01

We report here first-principle pseudopotential DFT calculations to investigate relevant aspects of the electronic structure of zeolites based FAU. Fundamental molecular issues of the band-gap and electronic population analysis were reviewed under GGA/RPBE level of theory, corroborated with a DZP basis set and Troullier-Martins norm conserving pseudo-potentials. The atom-projected density of states and the analysis of HOMO-LUMO frontier orbitals at Gamma point were performed. Their electronic transfers are discussed through the alignment and relative positions of orbitals in order to determine the way that the molecule interacts with adsorbed molecules and other practical applications. Mulliken population analysis was employed for describing atomic charge distribution in the chosen systems.

Photocatalytic Conversion of Nitrobenzene to Aniline through Sequential Proton-Coupled One-Electron Transfers from a Cadmium Sulfide Quantum Dot

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jensen, Stephen C.; Bettis Homan, Stephanie; Weiss, Emily A.

2016-01-28

This paper describes the use of cadmium sulfide quantum dots (CdS QDs) as visible-light photocatalysts for the reduction of nitrobenzene to aniline through six sequential photoinduced, proton-coupled electron transfers. At pH 3.6–4.3, the internal quantum yield of photons-to-reducing electrons is 37.1% over 54 h of illumination, with no apparent decrease in catalyst activity. Monitoring of the QD exciton by transient absorption reveals that, for each step in the catalytic cycle, the sacrificial reductant, 3-mercaptopropionic acid, scavenges the excitonic hole in ~5 ps to form QD•–; electron transfer to nitrobenzene or the intermediates nitrosobenzene and phenylhydroxylamine then occurs on the nanosecondmore » time scale. The rate constants for the single-electron transfer reactions are correlated with the driving forces for the corresponding proton-coupled electron transfers. This result suggests, but does not prove, that electron transfer, not proton transfer, is rate-limiting for these reactions. Nuclear magnetic resonance analysis of the QD–molecule systems shows that the photoproduct aniline, left unprotonated, serves as a poison for the QD catalyst by adsorbing to its surface. Performing the reaction at an acidic pH not only encourages aniline to desorb but also increases the probability of protonated intermediates; the latter effect probably ensures that recruitment of protons is not rate-limiting.« less

Electrical Conductivity of Ferritin Proteins by Conductive AFM

NASA Technical Reports Server (NTRS)

Xu, Degao; Watt, Gerald D.; Harb, John N.; Davis, Robert C.

2005-01-01

Electrical conductivity measurements were performed on single apoferritin and holoferritin molecules by conductive atomic force microscopy. Conductivity of self-assembled monolayer films of ferritin molecules on gold surfaces was also measured. Holoferritin was 5-25 times more conductive than apoferritin, indicating that for holoferritin most electron-transfer goes through the ferrihydrite core. With 1 V applied, the average electrical currents through single holoferritin and apoferritin molecules were 2.6 PA and 0.19 PA, respectively.

High-resolution neutron and X-ray diffraction room-temperature studies of an H-FABP-oleic acid complex: study of the internal water cluster and ligand binding by a transferred multipolar electron-density distribution.

PubMed

Howard, E I; Guillot, B; Blakeley, M P; Haertlein, M; Moulin, M; Mitschler, A; Cousido-Siah, A; Fadel, F; Valsecchi, W M; Tomizaki, Takashi; Petrova, T; Claudot, J; Podjarny, A

2016-03-01

Crystal diffraction data of heart fatty acid binding protein (H-FABP) in complex with oleic acid were measured at room temperature with high-resolution X-ray and neutron protein crystallography (0.98 and 1.90 Å resolution, respectively). These data provided very detailed information about the cluster of water molecules and the bound oleic acid in the H-FABP large internal cavity. The jointly refined X-ray/neutron structure of H-FABP was complemented by a transferred multipolar electron-density distribution using the parameters of the ELMAMII library. The resulting electron density allowed a precise determination of the electrostatic potential in the fatty acid (FA) binding pocket. Bader's quantum theory of atoms in molecules was then used to study interactions involving the internal water molecules, the FA and the protein. This approach showed H⋯H contacts of the FA with highly conserved hydrophobic residues known to play a role in the stabilization of long-chain FAs in the binding cavity. The determination of water hydrogen (deuterium) positions allowed the analysis of the orientation and electrostatic properties of the water molecules in the very ordered cluster. As a result, a significant alignment of the permanent dipoles of the water molecules with the protein electrostatic field was observed. This can be related to the dielectric properties of hydration layers around proteins, where the shielding of electrostatic interactions depends directly on the rotational degrees of freedom of the water molecules in the interface.

Charge-transfer complexes of 2,3-dichloro-5,6-dicyano-1,4-benzoquinone with amino molecules in polar solvents

NASA Astrophysics Data System (ADS)

Berto, Silvia; Chiavazza, Enrico; Ribotta, Valentina; Daniele, Pier Giuseppe; Barolo, Claudia; Giacomino, Agnese; Vione, Davide; Malandrino, Mery

2015-10-01

The charge-transfer complexes have scientific relevance because this type of molecular interaction is at the basis of the activity of pharmacological compounds and because the absorption bands of the complexes can be used for the quantification of electron donor molecules. This work aims to assess the stability of the charge-transfer complexes between the electron acceptor 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (DDQ) and two drugs, procaine and atenolol, in acetonitrile and ethanol. The stability of DDQ in solution and the time required to obtain the maximum complex formation were evaluated. The stoichiometry and the stability of the complexes were determined, respectively, by Job's plot method and by the elaboration of UV-vis titrations data. The latter task was carried out by using the non-linear global analysis approach to determine the equilibrium constants. This approach to data elaboration allowed us to overcome the disadvantages of the classical linear-regression method, to obtain reliable values of the association constants and to calculate the entire spectra of the complexes. NMR spectra were recorded to identify the portion of the donor molecule that was involved in the interaction. The data support the participation of the aliphatic amino groups in complex formation and exclude the involvement of the aromatic amine present in the procaine molecule.

Acid/base-regulated reversible electron transfer disproportionation of N–N linked bicarbazole and biacridine derivatives† †Electronic supplementary information (ESI) available: Experimental information, synthesis and characterization data, NMR spectra, solid state NMR data, X-ray data, ESR spectra, UV-Vis-NIR spectra, fluorescence spectra, kinetic experiments, theoretical calculations, Tables S1–S8, Scheme S1, Fig. S1–12, References. CCDC 1025063, 1038914, 1049677 and 1040722. For ESI and crystallographic data in CIF or other electronic format see DOI: 10.1039/c5sc00946d

PubMed Central

Pandit, Palash; Yamamoto, Koji; Nakamura, Toshikazu; Nishimura, Katsuyuki; Kurashige, Yuki; Yanai, Takeshi; Nakamura, Go; Masaoka, Shigeyuki; Furukawa, Ko; Yakiyama, Yumi; Kawano, Masaki

2015-01-01

Regulation of electron transfer on organic substances by external stimuli is a fundamental issue in science and technology, which affects organic materials, chemical synthesis, and biological metabolism. Nevertheless, acid/base-responsive organic materials that exhibit reversible electron transfer have not been well studied and developed, owing to the difficulty in inventing a mechanism to associate acid/base stimuli and electron transfer. We discovered a new phenomenon in which N–N linked bicarbazole (BC) and tetramethylbiacridine (TBA) derivatives undergo electron transfer disproportionation by acid stimulus, forming their stable radical cations and reduced species. The reaction occurs through a biradical intermediate generated by the acid-triggered N–N bond cleavage reaction of BC or TBA, which acts as a two electron acceptor to undergo electron transfer reactions with two equivalents of BC or TBA. In addition, in the case of TBA the disproportionation reaction is highly reversible through neutralization with NEt3, which recovers TBA through back electron transfer and N–N bond formation reactions. This highly reversible electron transfer reaction is possible due to the association between the acid stimulus and electron transfer via the acid-regulated N–N bond cleavage/formation reactions which provide an efficient switching mechanism, the ability of the organic molecules to act as multi-electron donors and acceptors, the extraordinary stability of the radical species, the highly selective reactivity, and the balance of the redox potentials. This discovery provides new design concepts for acid/base-regulated organic electron transfer systems, chemical reagents, or organic materials. PMID:29218181

Photoinduced electron transfer in a molecular dyad by nanosecond pump-pump-probe spectroscopy.

PubMed

Ha-Thi, M-H; Pham, V-T; Pino, T; Maslova, V; Quaranta, A; Lefumeux, C; Leibl, W; Aukauloo, A

2018-06-01

The design of robust and inexpensive molecular photocatalysts for the conversion of abundant stable molecules like H2O and CO2 into an energetic carrier is one of the major fundamental questions for scientists nowadays. The outstanding challenge is to couple single photoinduced charge separation events with the sequential accumulation of redox equivalents at the catalytic unit for performing multielectronic catalytic reactions. Herein, double excitation by nanosecond pump-pump-probe experiments was used to interrogate the photoinduced charge transfer and charge accumulation on a molecular dyad composed of a porphyrin chromophore and a ruthenium-based catalyst in the presence of a reversible electron acceptor. An accumulative charge transfer state is unattainable because of rapid reverse electron transfer to the photosensitizer upon the second excitation and the low driving force of the forward photodriven electron transfer reaction. Such a method allows the fundamental understanding of the relaxation mechanism after two sequential photon absorptions, deciphering the undesired electron transfer reactions that limit the charge accumulation efficiency. This study is a step toward the improvement of synthetic strategies of molecular photocatalysts for light-induced charge accumulation and more generally, for solar energy conversion.

Chemical Reactions of Molecules Promoted and Simultaneously Imaged by the Electron Beam in Transmission Electron Microscopy.

PubMed

Skowron, Stephen T; Chamberlain, Thomas W; Biskupek, Johannes; Kaiser, Ute; Besley, Elena; Khlobystov, Andrei N

2017-08-15

The main objective of this Account is to assess the challenges of transmission electron microscopy (TEM) of molecules, based on over 15 years of our work in this field, and to outline the opportunities in studying chemical reactions under the electron beam (e-beam). During TEM imaging of an individual molecule adsorbed on an atomically thin substrate, such as graphene or a carbon nanotube, the e-beam transfers kinetic energy to atoms of the molecule, displacing them from equilibrium positions. Impact of the e-beam triggers bond dissociation and various chemical reactions which can be imaged concurrently with their activation by the e-beam and can be presented as stop-frame movies. This experimental approach, which we term ChemTEM, harnesses energy transferred from the e-beam to the molecule via direct interactions with the atomic nuclei, enabling accurate predictions of bond dissociation events and control of the type and rate of chemical reactions. Elemental composition and structure of the reactant molecules as well as the operating conditions of TEM (particularly the energy of the e-beam) determine the product formed in ChemTEM processes, while the e-beam dose rate controls the reaction rate. Because the e-beam of TEM acts simultaneously as a source of energy for the reaction and as an imaging tool monitoring the same reaction, ChemTEM reveals atomic-level chemical information, such as pathways of reactions imaged for individual molecules, step-by-step and in real time; structures of illusive reaction intermediates; and direct comparison of catalytic activity of different transition metals filmed with atomic resolution. Chemical transformations in ChemTEM often lead to previously unforeseen products, demonstrating the potential of this method to become not only an analytical tool for studying reactions, but also a powerful instrument for discovery of materials that can be synthesized on preparative scale.

Spin Polarization Transfer from a Photogenerated Radical Ion Pair to a Stable Radical Controlled by Charge Recombination.

PubMed

Horwitz, Noah E; Phelan, Brian T; Nelson, Jordan N; Mauck, Catherine M; Krzyaniak, Matthew D; Wasielewski, Michael R

2017-06-15

Photoexcitation of electron donor-acceptor molecules frequently produces radical ion pairs with well-defined initial spin-polarized states that have attracted significant interest for spintronics. Transfer of this initial spin polarization to a stable radical is predicted to depend on the rates of the radical ion pair recombination reactions, but this prediction has not been tested experimentally. In this study, a stable radical/electron donor/chromophore/electron acceptor molecule, BDPA • -mPD-ANI-NDI, where BDPA • is α,γ-bisdiphenylene-β-phenylallyl, mPD is m-phenylenediamine, ANI is 4-aminonaphthalene-1,8-dicarboximide, and NDI is naphthalene-1,4:5,8-bis(dicarboximide), was synthesized. Photoexcitation of ANI produces the triradical BDPA • -mPD +• -ANI-NDI -• in which the mPD +• -ANI-NDI -• radical ion pair is spin coupled to the BDPA • stable radical. BDPA • -mPD +• -ANI-NDI -• and its counterpart lacking the stable radical are found to exhibit spin-selective charge recombination in which the triplet radical ion pair 3 (mPD +• -ANI-NDI -• ) is in equilibrium with the 3 *NDI charge recombination product. Time-resolved EPR measurements show that this process is associated with an inversion of the sign of the polarization transferred to BDPA • over time. The polarization transfer rates are found to be strongly solvent dependent, as shifts in this equilibrium affect the spin dynamics. These results demonstrate that even small changes in electron transfer dynamics can have a large effect on the spin dynamics of photogenerated multispin systems.

Crossed beam (E--VRT) energy transfer experiment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hertel, I.V.; Hofmann, H.; Rost, K.A.

A molecular crossed beam apparatus which has been developed to perform electronic-to-vibrational, rotational, translational (E--V,R,T) energy transfer studies is described. Its capabilities are illustrated on the basis of a number of energy transfer spectra obtained for collision systems of the type Na*+Mol(..nu..,j) ..-->..Na+Mol (..nu..',j') where Na* represents a laser excited sodium atom and Mol a diatomic or polyatomic molecule. Because of the lack of reliable dynamic theories on quenching processes, statistical approaches such as the ''linearly forced harmonic oscillator'' and ''prior distributions'' have been used to model the experimental spectra. The agreement is found to be satisfactory, so even suchmore » simple statistics may be useful to describe (E--V,R,T) energy transfer processes in collision systems with small molecules.« less

Redox active molecules cytochrome c and vitamin C enhance heme-enzyme peroxidations by serving as non-specific agents for redox relay

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gade, Sudeep Kumar; Bhattacharya, Subarna; Manoj, Kelath Murali, E-mail: satyamjayatu@yahoo.com

2012-03-09

Highlights: Black-Right-Pointing-Pointer At low concentrations, cytochrome c/vitamin C do not catalyze peroxidations. Black-Right-Pointing-Pointer But low levels of cytochrome c/vitamin C enhance diverse heme peroxidase activities. Black-Right-Pointing-Pointer Enhancement positively correlates to the concentration of peroxide in reaction. Black-Right-Pointing-Pointer Reducible additives serve as non-specific agents for redox relay in the system. Black-Right-Pointing-Pointer Insight into electron transfer processes in routine and oxidative-stress states. -- Abstract: We report that incorporation of very low concentrations of redox protein cytochrome c and redox active small molecule vitamin C impacted the outcome of one-electron oxidations mediated by structurally distinct plant/fungal heme peroxidases. Evidence suggests that cytochrome cmore » and vitamin C function as a redox relay for diffusible reduced oxygen species in the reaction system, without invoking specific or affinity-based molecular interactions for electron transfers. The findings provide novel perspectives to understanding - (1) the promiscuous role of cytochrome b{sub 5} in the metabolism mediated by liver microsomal xenobiotic metabolizing systems and (2) the roles of antioxidant molecules in affording relief from oxidative stress.« less

Carrier generation and electronic properties of a single-component pure organic metal

NASA Astrophysics Data System (ADS)

Kobayashi, Yuka; Terauchi, Takeshi; Sumi, Satoshi; Matsushita, Yoshitaka

2017-01-01

Metallic conduction generally requires high carrier concentration and wide bandwidth derived from strong orbital interaction between atoms or molecules. These requisites are especially important in organic compounds because a molecule is fundamentally an insulator; only multi-component salts with strong intermolecular interaction--namely, only charge transfer complexes and conducting polymers--have demonstrated intrinsic metallic behaviour. Herein we report a single-component electroactive molecule, zwitterionic tetrathiafulvalene(TTF)-extended dicarboxylate radical (TED), exhibiting metallic conduction even at low temperatures. TED exhibits d.c. conductivities of 530 S cm-1 at 300 K and 1,000 S cm-1 at 50 K with copper-like electronic properties. Spectroscopic and theoretical investigations of the carrier-generation mechanism and the electronic states of this single molecular species reveal a unique electronic structure with a spin-density gradient in the extended TTF moieties that becomes, in itself, a metallic state.

Cold denaturation induces inversion of dipole and spin transfer in chiral peptide monolayers

PubMed Central

Eckshtain-Levi, Meital; Capua, Eyal; Refaely-Abramson, Sivan; Sarkar, Soumyajit; Gavrilov, Yulian; Mathew, Shinto P.; Paltiel, Yossi; Levy, Yaakov; Kronik, Leeor; Naaman, Ron

2016-01-01

Chirality-induced spin selectivity is a recently-discovered effect, which results in spin selectivity for electrons transmitted through chiral peptide monolayers. Here, we use this spin selectivity to probe the organization of self-assembled α-helix peptide monolayers and examine the relation between structural and spin transfer phenomena. We show that the α-helix structure of oligopeptides based on alanine and aminoisobutyric acid is transformed to a more linear one upon cooling. This process is similar to the known cold denaturation in peptides, but here the self-assembled monolayer plays the role of the solvent. The structural change results in a flip in the direction of the electrical dipole moment of the adsorbed molecules. The dipole flip is accompanied by a concomitant change in the spin that is preferred in electron transfer through the molecules, observed via a new solid-state hybrid organic–inorganic device that is based on the Hall effect, but operates with no external magnetic field or magnetic material. PMID:26916536

Cold denaturation induces inversion of dipole and spin transfer in chiral peptide monolayers

NASA Astrophysics Data System (ADS)

Eckshtain-Levi, Meital; Capua, Eyal; Refaely-Abramson, Sivan; Sarkar, Soumyajit; Gavrilov, Yulian; Mathew, Shinto P.; Paltiel, Yossi; Levy, Yaakov; Kronik, Leeor; Naaman, Ron

2016-02-01

Chirality-induced spin selectivity is a recently-discovered effect, which results in spin selectivity for electrons transmitted through chiral peptide monolayers. Here, we use this spin selectivity to probe the organization of self-assembled α-helix peptide monolayers and examine the relation between structural and spin transfer phenomena. We show that the α-helix structure of oligopeptides based on alanine and aminoisobutyric acid is transformed to a more linear one upon cooling. This process is similar to the known cold denaturation in peptides, but here the self-assembled monolayer plays the role of the solvent. The structural change results in a flip in the direction of the electrical dipole moment of the adsorbed molecules. The dipole flip is accompanied by a concomitant change in the spin that is preferred in electron transfer through the molecules, observed via a new solid-state hybrid organic-inorganic device that is based on the Hall effect, but operates with no external magnetic field or magnetic material.

Electron transport parameters in NF3

NASA Astrophysics Data System (ADS)

Lisovskiy, V.; Yegorenkov, V.; Ogloblina, P.; Booth, J.-P.; Martins, S.; Landry, K.; Douai, D.; Cassagne, V.

2014-03-01

We present electron transport parameters (the first Townsend coefficient, the dissociative attachment coefficient, the fraction of electron energy lost by collisions with NF3 molecules, the average and characteristic electron energy, the electron mobility and the drift velocity) in NF3 gas calculated from published elastic and inelastic electron-NF3 collision cross-sections using the BOLSIG+ code. Calculations were performed for the combined RB (Rescigno 1995 Phys. Rev. E 52 329, Boesten et al 1996 J. Phys. B: At. Mol. Opt. Phys. 29 5475) momentum-transfer cross-section, as well as for the JB (Joucoski and Bettega 2002 J. Phys. B: At. Mol. Opt. Phys. 35 783) momentum-transfer cross-section. In addition, we have measured the radio frequency (rf) breakdown curves for various inter-electrode gaps and rfs, and from these we have determined the electron drift velocity in NF3 from the location of the turning point in these curves. These drift velocity values are in satisfactory agreement with those calculated by the BOLSIG+ code employing the JB momentum-transfer cross-section.

Electronic structure evolution of fullerene on CH 3NH 3PbI 3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Chenggong; Wang, Congcong; Liu, Xiaoliang

2015-03-19

The thickness dependence of fullerene on CH 3NH 3PbI 3 perovskitefilm surface has been investigated by using ultraviolet photoemission spectroscopy (UPS), X-ray photoemission spectroscopy(XPS), and inverse photoemission spectroscopy (IPES). The lowest unoccupied molecular orbital and highest occupied molecular orbital (HOMO) can be observed directly with IPES and UPS. It is observed that the HOMO level in fullerene shifts to lower binding energy. The XPS results show a strong initial shift of core levels to lower binding energy in the perovskite, which indicates that electrons transfer from the perovskitefilm to fullerene molecules. Further deposition of fullerene forms C 60 solid, accompaniedmore » by the reduction of the electron transfer. As a result, the strongest electron transfer happened at 1/4 monolayer of fullerene.« less

Electronic structure evolution of fullerene on CH{sub 3}NH{sub 3}PbI{sub 3}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Chenggong; Wang, Congcong; Kauppi, John

2015-03-16

The thickness dependence of fullerene on CH{sub 3}NH{sub 3}PbI{sub 3} perovskite film surface has been investigated by using ultraviolet photoemission spectroscopy (UPS), X-ray photoemission spectroscopy (XPS), and inverse photoemission spectroscopy (IPES). The lowest unoccupied molecular orbital and highest occupied molecular orbital (HOMO) can be observed directly with IPES and UPS. It is observed that the HOMO level in fullerene shifts to lower binding energy. The XPS results show a strong initial shift of core levels to lower binding energy in the perovskite, which indicates that electrons transfer from the perovskite film to fullerene molecules. Further deposition of fullerene forms C{submore » 60} solid, accompanied by the reduction of the electron transfer. The strongest electron transfer happened at 1/4 monolayer of fullerene.« less

Tunable Rh 2(II,II) Light Absorbers as Excited State Electron Donors and Acceptors Accessible with Red/Near-IR Irradiation

DOE PAGES

Whittemore, Tyler; Millet, Agustin; Sayre, Hannah; ...

2018-04-04

In this study, a series of dirhodium(II,II) paddlewheeel complexes of the type cis-[Rh 2(μ-DTolF) 2(μ-L) 2][BF 4] 2, where DTolF = N,N'-di(p-tolyl)formamidinate and L = 1,8-naphthyridine (np), 2-(pyridin-2-yl)-1,8-naphthyridine (pynp), 2-(quinolin-2-yl)-1,8-naphthyridine (qnnp), and 2-(1,8-naphthyridin-2-yl)quinoxaline (qxnp), were synthesized and characterized. These molecules feature new tridentate ligands that concomitantly bridge the dirhodium core and cap the axial positions. The complexes absorb light strongly throughout the ultraviolet/visible range and into the near-infrared region and exhibit relatively long-lived triplet excited-state lifetimes. Both the singlet and triplet excited states exhibit metal/ligand-to-ligand charge transfer (ML-LCT) in nature as determined by transient absorption spectroscopy and spectroelectrochemistry measurements. Whenmore » irradiated with low-energy light, these black dyes are capable of undergoing reversible bimolecular electron transfer both to the electron acceptor methyl viologen and from the electron donor p-phenylenediamine. Photoinduced charge transfer in the latter was inaccessible with previous Rh 2(II,II) complexes. Finally, these results underscore the fact that the excited state of this class of molecules can be readily tuned for electron-transfer reactions upon simple synthetic modification and highlight their potential as excellent candidates for p- and n-type semiconductor applications and for improved harvesting of low-energy light to drive useful photochemical reactions.« less

Tunable Rh 2(II,II) Light Absorbers as Excited State Electron Donors and Acceptors Accessible with Red/Near-IR Irradiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Whittemore, Tyler; Millet, Agustin; Sayre, Hannah

In this study, a series of dirhodium(II,II) paddlewheeel complexes of the type cis-[Rh 2(μ-DTolF) 2(μ-L) 2][BF 4] 2, where DTolF = N,N'-di(p-tolyl)formamidinate and L = 1,8-naphthyridine (np), 2-(pyridin-2-yl)-1,8-naphthyridine (pynp), 2-(quinolin-2-yl)-1,8-naphthyridine (qnnp), and 2-(1,8-naphthyridin-2-yl)quinoxaline (qxnp), were synthesized and characterized. These molecules feature new tridentate ligands that concomitantly bridge the dirhodium core and cap the axial positions. The complexes absorb light strongly throughout the ultraviolet/visible range and into the near-infrared region and exhibit relatively long-lived triplet excited-state lifetimes. Both the singlet and triplet excited states exhibit metal/ligand-to-ligand charge transfer (ML-LCT) in nature as determined by transient absorption spectroscopy and spectroelectrochemistry measurements. Whenmore » irradiated with low-energy light, these black dyes are capable of undergoing reversible bimolecular electron transfer both to the electron acceptor methyl viologen and from the electron donor p-phenylenediamine. Photoinduced charge transfer in the latter was inaccessible with previous Rh 2(II,II) complexes. Finally, these results underscore the fact that the excited state of this class of molecules can be readily tuned for electron-transfer reactions upon simple synthetic modification and highlight their potential as excellent candidates for p- and n-type semiconductor applications and for improved harvesting of low-energy light to drive useful photochemical reactions.« less

A study of vibrational spectra and investigations of charge transfer and chemical bonding features of 2-chloro benzimidazole based on DFT computations

NASA Astrophysics Data System (ADS)

Muthunatesan, S.; Ragavendran, V.

2015-01-01

Benzimidazoles are bicyclic heteroatomic molecules. Polycyclic heteroatomic molecules have extensive coupling of different modes leading to strong coupling of force constants associated with the various chemical bonds of the molecules. To carry out a detailed vibrational spectroscopic analysis of such a bicyclic heteroatomic molecule, FT-IR and FT-Raman spectra of 2-chloro benzimidazole (CBZ) have been recorded in the condensed phase. Density Functional Theory calculations in the B3LYP/6-31G* level have been carried out to determine the optimized geometry and vibrational frequencies. In order to obtain a close agreement between theoretical and observed frequencies and hence to perform a reliable assignment, the theoretical DFT force field was transformed from Cartesian to local symmetry co-ordinates and then scaled empirically using SQM methodology. The SQM treatment resulted in a RMS deviation of 9.4 cm-1. For visual comparison, the observed and calculated spectra are presented on a common wavenumber scale. From the NBO analysis, the electron density (ED) charge transfers in the σ* and π* antibonding orbitals and second order delocalization energies E(2) confirms the occurrence of intramolecular charge transfer (ICT) within the molecule. The calculated Homo and Lumo energies show that charge transfer occurs within the molecule. The results obtained from the vibrational, NBO and HOMO-LUMO analyses have been properly tabulated.

Electronic transfer studies of fullerene/polymer hybrids

NASA Astrophysics Data System (ADS)

Farrell, Garrett F.; Chambers, Gordon; Dalton, Alan B.; Byrne, Hugh J.

2003-03-01

In this study we examine the interaction of both cis and trans poly(m-phenylenevinylene-co-2,5-dioctyloxy-p-phenylenevinylene (PmPV-co-DOctOPV) with C60 in solution From the presented data it is clear that there is an interaction between the HE PmPV and C60. Just what this interaction is however is not as clear. A possible explanation that fits the available data involves the HE PmPV wrapping around the C60 molecules, similar to the effect observed by Dalton et al with Carbon Nanotubes. In theory the close proximately of the coils to the C60 molecules may allow for charge transfer or energy transfer between to the two molecules. If this theory is correct it would explain the why the absorption spectra of HE-PmPV at the different loaded fraction displays a negative deviation for the expected values. It may be speculated that due to the coiling the C60 molecules are prevented from absorbing photons of light, consequently resulting in a reduction in it's contribution to the overall intensity. This theory would also explain the increased quenching effect observed in the luminescence spectra at the same percentage weights, since the close proximity of the coils to the C60 molecules allows for charge or energy transfer between the two.

The role of electron transfer in DNA building blocks: Evaluation of strand breaks and their implications

NASA Astrophysics Data System (ADS)

Almeida, Diogo Alexandre Fialho de

Radiation-induced damage to biological systems, both direct and indirect processes, has increasingly come under scrutiny by the international scientific community due to recent findings that electrons are a very effective agent in damaging DNA/RNA. Indeed, much remains to be discovered regarding the exact physico-chemical processes that occur in the nascent stages of DNA/RNA damage by incident radiation. However, it is also known that electrons do not exist freely in the physiological medium, but rather solvated and/or pre-solvated states. This leads to the need for new techniques that can better explore the damaging role of "bound" electrons to DNA/RNA. The work presented in this thesis consists on the study of electron transfer in collisions of atomic species with molecules of biological relevance. In order to study these processes, two experimental setups were used. One setup consists of a crossed beam experiment where a neutral potassium beam is created and made to collide with an effusive molecular target beam. The anionic products that stem from electron transfer in potassium atom to the molecular target collisions are then extracted and time-of-flight (TOF) mass analysed. In the second setup a beam of anionic species is formed and made to collide with a molecular target. Collisions with three different anionic beams were performed (H-, O- and OH-), as well as with different simple organic molecules, by measuring the positive and negative ion fragmentation patterns with a quadrupole mass spectrometer (QMS). A comparison between these two collisional systems can greatly help to understand the underlying mechanisms of the electron transfer processes. Finally, studies of potassium collisions with sugar surrogates D-Ribose and THF were performed. These studies show very different fragmentation patterns from DEA, although in the case of THF, it is suggested that the initially accessed states are the same as in DEA. With these studies was also possible to show for the first time collision induced site and bond selectivity breaking, where the electron is transferred into a given state of the acceptor molecule and the resulting fragmentation pathways are exclusive to the initial anionic state. Furthermore, the role of the potassium cation post collisionwas explored and indeed its presence is suggested to induce at least partial suppression of auto-detachment. The implications that ensue from this degradation are analysed in the light of the obtained fragmentation patterns.

Effect of π-bridge units on properties of A-π-D-π-A-type nonfullerene acceptors for organic solar cells.

PubMed

Wang, Yan-Ling; Li, Quan-Song; Li, Ze-Sheng

2018-05-15

Acceptor-π-donor-π-acceptor (A-π-D-π-A)-types of small molecules are very promising nonfullerene acceptors to overcome the drawbacks of fullerene derivatives such as the weak absorption ability and electronic adjustability. However, only few attempts have been made to develop π-bridge units to construct highly efficient acceptors in OSCs. Herein, taking the reported acceptor P1 as a reference, five small-structured acceptors (P2, P3, P4, P5, and P6) have been designed via the replacement of the π-bridge unit. A combination of quantum chemistry and Marcus theory approaches is employed to investigate the effect of different π-bridge units on the optical, electronic, and charge transport properties of P1-P6. The calculation results show that the designed molecules P2 and P5 can become potential acceptor replacements of P1 due to their red-shifted absorption bands, appropriate energy levels, low exciton binding energy, and high electron affinity and electron mobility. Additionally, compared with P3HT/P1, P3HT/P2 and P3HT/P5 exhibit stronger and wider absorption peaks, larger electron transfer distances (DCT), greater transferred charge amounts (Δq), and smaller overlaps (Λ), which shows that P2 and P5 have more significant electron transfer characteristics and favorable exciton dissociation capabilities for enhancing the short-circuit current density (JSC) and thus, they are potential acceptors in OSCs.

Electronic structure and charge transfer excited states of endohedral fullerene containing electron donoracceptor complexes utilized in organic photovoltaics

NASA Astrophysics Data System (ADS)

Amerikheirabadi, Fatemeh

Organic Donor-Acceptor complexes form the main component of the organic photovoltaic devices (OPVs). The open circuit voltage of OPVs is directly related to the charge transfer excited state energies of these complexes. Currently a large number of different molecular complexes are being tested for their efficiency in photovoltaic devices. In this work, density functional theory as implemented in the NRLMOL code is used to investigate the electronic structure and related properties of these donor-acceptor complexes. The charge transfer excitation energies are calculated using the perturbative delta self-consistent field method recently developed in our group as the standard time dependent density functional approaches fail to accurately provide them. The model photovoltaics systems analyzed are as follows: Sc3N C 80--ZnTPP, Y3 N C80-- ZnTPP and Sc3 N C80-- ZnPc. In addition, a thorough analysis of the isolated donor and acceptor molecules is also provided. The studied acceptors are chosen from a class of fullerenes named trimetallic nitride endohedral fullerenes. These molecules have shown to possess advantages as acceptors such as long lifetimes of the charge-separated states.

Spying on the neighbors' pool

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xantheas, S. S.

2016-12-01

The structure and properties of the aqueous proton is of fundamental interest in many areas of chemistry and biology. Acids and bases are molecules that are able to transfer (donate / accept) a proton according to Brønsted and Lowry, a process that was further explained by Lewis in terms of changes in their electronic structure in an attempt to offer a generalization of the Arrhenius theory. Simple proton transfers or the ones coupled to an electron transfer determine speciation, valence and reactivity in aqueous media and explain electrochemical processes, while voltage-gated proton channels have severe implications to the function ofmore » a number of tissues and species.« less

Polarization and charge transfer in the hydration of chloride ions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao Zhen; Rogers, David M.; Beck, Thomas L.

2010-01-07

A theoretical study of the structural and electronic properties of the chloride ion and water molecules in the first hydration shell is presented. The calculations are performed on an ensemble of configurations obtained from molecular dynamics simulations of a single chloride ion in bulk water. The simulations utilize the polarizable AMOEBA force field for trajectory generation and MP2-level calculations are performed to examine the electronic structure properties of the ions and surrounding waters in the external field of more distant waters. The ChelpG method is employed to explore the effective charges and dipoles on the chloride ions and first-shell waters.more » The quantum theory of atoms in molecules (QTAIM) is further utilized to examine charge transfer from the anion to surrounding water molecules. The clusters extracted from the AMOEBA simulations exhibit high probabilities of anisotropic solvation for chloride ions in bulk water. From the QTAIM analysis, 0.2 elementary charges are transferred from the ion to the first-shell water molecules. The default AMOEBA model overestimates the average dipole moment magnitude of the ion compared to the quantum mechanical value. The average magnitude of the dipole moment of the water molecules in the first shell treated at the MP2-level, with the more distant waters handled with an AMOEBA effective charge model, is 2.67 D. This value is close to the AMOEBA result for first-shell waters (2.72 D) and is slightly reduced from the bulk AMOEBA value (2.78 D). The magnitude of the dipole moment of the water molecules in the first solvation shell is most strongly affected by the local water-water interactions and hydrogen bonds with the second solvation shell, rather than by interactions with the ion.« less

Heterogeneous catalysis with lasers

NASA Astrophysics Data System (ADS)

George, T. F.

1986-06-01

Theoretical techniques have been developed to describe a variety of laser-induced molecular rate processes occurring at solid surfaces which are involved in heterogeneous catalysis. Such processes include adsorption, migration, chemical reactions and desorption. The role of surface phonons in laser-selective processes and laser heating has been analyzed. The importance of electronic degrees of freedom has been considered for semiconductor and metal substrates, with special emphasis on the laser excitation of surface states. Surface-modified photochemistry has also been investigated, where the effect of a metal surface on the resonance fluorescence spectrum of a laser-driven atom/molecule has been assessed by means of surface-dressed optical Bloch equations. It is seen that the spectrum can be significantly different from the gas-phase case. Two related gas-surface collision processes have also been studied. First, the feasibility of the formation of the electron-hole pairs in a semiconductor by vibrationally excited molecules has been explored. Second, charge transfer in ion-surface collisions has been examined for both one-electron and two-electron transfer processes. Work has been initiated on microstructures and rough structures, including clusters and surface gratings.

Band gap opening in α-graphyne by adsorption of organic molecule

NASA Astrophysics Data System (ADS)

Majidi, R.; Karami, A. R.

2014-09-01

The lack of a band gap limits the application of graphyne in nanoelectronic devices. We have investigated possibility of opening a band gap in α-graphyne by adsorption of tetracyanoethylene. The electronic property of α-graphyne in the presence of different numbers of tetracyanoethylene has been studied using density functional theory. It is found that charge is transferred from graphyne sheet to tetracyanoethylene molecules. In the presence of this electron acceptor molecule, a semimetal α-graphyne shows semiconducting property. The energy band gap at the Dirac point is enhanced by increasing the number of tetracyanoethylene. Our results provide a simple method to create and control the band gap in α-graphyne.

Electron transfer dynamics of bistable single-molecule junctions.

PubMed

Danilov, Andrey V; Kubatkin, Sergey E; Kafanov, Sergey G; Flensberg, Karsten; Bjørnholm, Thomas

2006-10-01

We present transport measurements of single-molecule junctions bridged by a molecule with three benzene rings connected by two double bonds and with thiol end-groups that allow chemical binding to gold electrodes. The I-V curves show switching behavior between two distinct states. By statistical analysis of the switching events, we show that a 300 meV mode mediates the transition between the two states. We propose that breaking and reformation of a S-H bond in the contact zone between molecule and electrode explains the observed bistability.

Adsorption behavior of COF2 and CF4 gas on the MoS2 monolayer doped with Ni: A first-principles study

NASA Astrophysics Data System (ADS)

Li, Yi; Zhang, Xiaoxing; Chen, Dachang; Xiao, Song; Tang, Ju

2018-06-01

CF4 and COF2 are the two main decomposition products of fluorocarbon gas insulating medium. We explored the gas sensing properties of Ni-MoS2 to CF4 and COF2 based on the density functional theory calculations. The adsorption energy, charge transfer, density of states and electron density difference have been discussed. It was found that the interaction between COF2 molecule and Ni-MoS2 is strong, and the adsorption energy is 0.723 eV. Ni-MoS2 acts as the electron donor and transfers some electrons to COF2 molecule during the interaction. The adsorption energy of CF4 on Ni-MoS2 is lower than that of COF2, and the interaction between them belongs to physical adsorption. Ni-MoS2 has the potential to be used as a gas sensor for COF2 detection using in the field of gas insulated switchgear on-line monitoring.

In situ superexchange electron transfer through a single molecule: a rectifying effect.

PubMed

Kornyshev, Alexei A; Kuznetsov, Alexander M; Ulstrup, Jens

2006-05-02

An increasingly comprehensive body of literature is being devoted to single-molecule bridge-mediated electronic nanojunctions, prompted by their prospective applications in molecular electronics and single-molecule analysis. These junctions may operate in gas phase or electrolyte solution (in situ). For biomolecules, the latter is much closer to their native environment. Convenient target molecules are aromatic molecules, peptides, oligonucleotides, transition metal complexes, and, broadly, molecules with repetitive units, for which the conducting orbitals are energetically well below electronic levels of the solvent. A key feature for these junctions is rectification in the current-voltage relation. A common view is that asymmetric molecules or asymmetric links to the electrodes are needed to acquire rectification. However, as we show here, this requirement could be different in situ, where a structurally symmetric system can provide rectification because of the Debye screening of the electric field in the nanogap if the screening length is smaller than the bridge length. The Galvani potentials of each electrode can be varied independently and lead to a transistor effect. We explore this behavior for the superexchange mechanism of electron transport, appropriate for a wide class of molecules. We also include the effect of conformational fluctuations on the lowest unoccupied molecular orbital (LUMO) energy levels; that gives rise to non-Arrhenius temperature dependence of the conductance, affected by the molecule length. Our study offers an analytical formula for the current-voltage characteristics that demonstrates all these features. A detailed physical interpretation of the results is given with a discussion of reported experimental data.

Carbene-catalysed reductive coupling of nitrobenzyl bromides and activated ketones or imines via single-electron-transfer process

NASA Astrophysics Data System (ADS)

Li, Bao-Sheng; Wang, Yuhuang; Proctor, Rupert S. J.; Zhang, Yuexia; Webster, Richard D.; Yang, Song; Song, Baoan; Chi, Yonggui Robin

2016-09-01

Benzyl bromides and related molecules are among the most common substrates in organic synthesis. They are typically used as electrophiles in nucleophilic substitution reactions. These molecules can also be activated via single-electron-transfer (SET) process for radical reactions. Representative recent progress includes α-carbon benzylation of ketones and aldehydes via photoredox catalysis. Here we disclose the generation of (nitro)benzyl radicals via N-heterocyclic carbene (NHC) catalysis under reductive conditions. The radical intermediates generated via NHC catalysis undergo formal 1,2-addition with ketones to eventually afford tertiary alcohol products. The overall process constitutes a formal polarity-inversion of benzyl bromide, allowing a direct coupling of two initially electrophilic carbons. Our study provides a new carbene-catalysed reaction mode that should enable unconventional transformation of (nitro)benzyl bromides under mild organocatalytic conditions.

Adsorption of gas molecules on Cu impurities embedded monolayer MoS2: A first- principles study

NASA Astrophysics Data System (ADS)

Zhao, B.; Li, C. Y.; Liu, L. L.; Zhou, B.; Zhang, Q. K.; Chen, Z. Q.; Tang, Z.

2016-09-01

Adsorption of small gas molecules (O2, NO, NO2 and NH3) on transition-metal Cu atom embedded monolayer MoS2 was investigated by first-principles calculations based on the density-functional theory (DFT). The embedded Cu atom is strongly constrained on the sulfur vacancy of monolayer MoS2 with a high diffusion barrier. The stable adsorption geometry, charge transfer and electronic structures of these gas molecules on monolayer MoS2 embedded with transition-metal Cu atom are discussed in detail. It is found that the monolayer MoS2 with embedded Cu atom can effectively capture these gas molecules with high adsorption energy. The NH3 molecule acts as electron donor after adsorption, which is different from the other gas molecules (O2, NO, and NO2). The results suggest that MoS2-Cu system may be promising for future applications in gas molecules sensing and catalysis, which is similar to those of the transition-metal embedded graphene.

The low-energy, charge-transfer excited states of 4-amino-4-prime-nitrodiphenyl sulfide

NASA Technical Reports Server (NTRS)

O'Connor, Donald B.; Scott, Gary W.; Tran, Kim; Coulter, Daniel R.; Miskowski, Vincent M.; Stiegman, Albert E.; Wnek, Gary E.

1992-01-01

Absorption and emission spectra of 4-amino-4-prime-nitrodiphenyl sulfide in polar and nonpolar solvents were used to characterize and assign the low-energy excited states of the molecule. Fluorescence-excitation anisotropy spectra and fluorescence quantum yields were also used to characterize the photophysics of these states. The lowest-energy fluorescent singlet state was determined to be an intramolecular charge transfer (ICT) state involving transfer of a full electron charge from the amino to the nitro group yielding a dipole moment of about 50 D. A low-energy, intense absorption band is assigned as a transition to a different ICT state involving a partial electron charge transfer from sulfur to the nitro group.

Electrochemistry of redox-active self-assembled monolayers

PubMed Central

Eckermann, Amanda L.; Feld, Daniel J.; Shaw, Justine A.; Meade, Thomas J.

2010-01-01

Redox-active self-assembled monolayers (SAMs) provide an excellent platform for investigating electron transfer kinetics. Using a well-defined bridge, a redox center can be positioned at a fixed distance from the electrode and electron transfer kinetics probed using a variety of electrochemical techniques. Cyclic voltammetry, AC voltammetry, electrochemical impedance spectroscopy, and chronoamperometry are most commonly used to determine the rate of electron transfer of redox-activated SAMs. A variety of redox species have been attached to SAMs, and include transition metal complexes (e.g., ferrocene, ruthenium pentaammine, osmium bisbipyridine, metal clusters) and organic molecules (e.g., galvinol, C60). SAMs offer an ideal environment to study the outer-sphere interactions of redox species. The composition and integrity of the monolayer and the electrode material influence the electron transfer kinetics and can be investigated using electrochemical methods. Theoretical models have been developed for investigating SAM structure. This review discusses methods and monolayer compositions for electrochemical measurements of redox-active SAMs. PMID:20563297

DFT investigation on the electronic structure of Faujasite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popeneciu, Horea; Calborean, Adrian; Tudoran, Cristian

2013-11-13

We report here first-principle pseudopotential DFT calculations to investigate relevant aspects of the electronic structure of zeolites based FAU. Fundamental molecular issues of the band-gap and electronic population analysis were reviewed under GGA/RPBE level of theory, corroborated with a DZP basis set and Troullier-Martins norm conserving pseudo-potentials. The atom-projected density of states and the analysis of HOMO-LUMO frontier orbitals at Gamma point were performed. Their electronic transfers are discussed through the alignment and relative positions of orbitals in order to determine the way that the molecule interacts with adsorbed molecules and other practical applications. Mulliken population analysis was employed formore » describing atomic charge distribution in the chosen systems.« less

Catalytic behavior of ‘Pt-atomic chain encapsulated gold nanotube’: A density functional study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nigam, Sandeep, E-mail: snigam@barc.gov.in; Majumder, Chiranjib

2016-05-23

With an aim to design novel material and explore its catalytic performance towards CO oxidation, Pt atomic chain was introduced inside gold nanotube (Au-NT). Theoretical calculations at the level of first principles formalism was carried out to investigate the atomic and electronic properties of the composite. Geometrically Pt atoms prefer to align in zig-zag fashion. Significant electronic charge transfer from inside Pt atoms to the outer wall Au atoms is observed. Interaction of O{sub 2} with Au-NT wall follows by injection of additional electronic charge in the anti-bonding orbital of oxygen molecule leading to activation of the O-O bond. Furthermore » interaction of CO molecule with the activated oxygen molecule leads to spontaneous oxidation reaction and formation of CO{sub 2}.« less

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Excitation energy transfer in the photosystem I

DOE Office of Scientific and Technical Information (OSTI.GOV)

Webber, Andrew N

2012-09-25

Photosystem I is a multimeric pigment protein complex in plants, green alage and cyanobacteria that functions in series with Photosystem II to use light energy to oxidize water and reduce carbon dioxide. The Photosystem I core complex contains 96 chlorophyll a molecules and 22 carotenoids that are involved in light harvesting and electron transfer. In eucaryotes, PSI also has a peripheral light harvesting complex I (LHCI). The role of specific chlorophylls in excitation and electron transfer are still unresolved. In particular, the role of so-called bridging chlorophylls, located between the bulk antenna and the core electron transfer chain, in themore » transfer of excitation energy to the reaction center are unknown. During the past funding period, site directed mutagenesis has been used to create mutants that effect the physical properties of these key chlorophylls, and to explore how this alters the function of the photosystem. Studying these mutants using ultrafast absorption spectroscopy has led to a better understanding of the process by which excitation energy is transferred from the antenna chlorophylls to the electron transfer chain chlorophylls, and what the role of connecting chlorophylls and A_0 chlorophylls is in this process. We have also used these mutants to investigate whch of the central group of six chlorophylls are involved in the primary steps of charge separation and electron transfer.« less

Nanopore Electrochemistry: A Nexus for Molecular Control of Electron Transfer Reactions

PubMed Central

2018-01-01

Pore-based structures occur widely in living organisms. Ion channels embedded in cell membranes, for example, provide pathways, where electron and proton transfer are coupled to the exchange of vital molecules. Learning from mother nature, a recent surge in activity has focused on artificial nanopore architectures to effect electrochemical transformations not accessible in larger structures. Here, we highlight these exciting advances. Starting with a brief overview of nanopore electrodes, including the early history and development of nanopore sensing based on nanopore-confined electrochemistry, we address the core concepts and special characteristics of nanopores in electron transfer. We describe nanopore-based electrochemical sensing and processing, discuss performance limits and challenges, and conclude with an outlook for next-generation nanopore electrode sensing platforms and the opportunities they present. PMID:29392173

Reorganization energy upon charging a single molecule on an insulator measured by atomic force microscopy

NASA Astrophysics Data System (ADS)

Fatayer, Shadi; Schuler, Bruno; Steurer, Wolfram; Scivetti, Ivan; Repp, Jascha; Gross, Leo; Persson, Mats; Meyer, Gerhard

2018-05-01

Intermolecular single-electron transfer on electrically insulating films is a key process in molecular electronics1-4 and an important example of a redox reaction5,6. Electron-transfer rates in molecular systems depend on a few fundamental parameters, such as interadsorbate distance, temperature and, in particular, the Marcus reorganization energy7. This crucial parameter is the energy gain that results from the distortion of the equilibrium nuclear geometry in the molecule and its environment on charging8,9. The substrate, especially ionic films10, can have an important influence on the reorganization energy11,12. Reorganization energies are measured in electrochemistry13 as well as with optical14,15 and photoemission spectroscopies16,17, but not at the single-molecule limit and nor on insulating surfaces. Atomic force microscopy (AFM), with single-charge sensitivity18-22, atomic-scale spatial resolution20 and operable on insulating films, overcomes these challenges. Here, we investigate redox reactions of single naphthalocyanine (NPc) molecules on multilayered NaCl films. Employing the atomic force microscope as an ultralow current meter allows us to measure the differential conductance related to transitions between two charge states in both directions. Thereby, the reorganization energy of NPc on NaCl is determined as (0.8 ± 0.2) eV, and density functional theory (DFT) calculations provide the atomistic picture of the nuclear relaxations on charging. Our approach presents a route to perform tunnelling spectroscopy of single adsorbates on insulating substrates and provides insight into single-electron intermolecular transport.

Interfacial Molecular Packing Determines Exciton Dynamics in Molecular Heterostructures: The Case of Pentacene-Perfluoropentacene.

PubMed

Rinn, Andre; Breuer, Tobias; Wiegand, Julia; Beck, Michael; Hübner, Jens; Döring, Robin C; Oestreich, Michael; Heimbrodt, Wolfram; Witte, Gregor; Chatterjee, Sangam

2017-12-06

The great majority of electronic and optoelectronic devices depend on interfaces between p-type and n-type semiconductors. Finding matching donor-acceptor systems in molecular semiconductors remains a challenging endeavor because structurally compatible molecules may not necessarily be suitable with respect to their optical and electronic properties, and the large exciton binding energy in these materials may favor bound electron-hole pairs rather than free carriers or charge transfer at an interface. Regardless, interfacial charge-transfer exciton states are commonly considered as an intermediate step to achieve exciton dissociation. The formation efficiency and decay dynamics of such states will strongly depend on the molecular makeup of the interface, especially the relative alignment of donor and acceptor molecules. Structurally well-defined pentacene-perfluoropentacene heterostructures of different molecular orientations are virtually ideal model systems to study the interrelation between molecular packing motifs at the interface and their electronic properties. Comparing the emission dynamics of the heterosystems and the corresponding unitary films enables accurate assignment of every observable emission signal in the heterosystems. These heterosystems feature two characteristic interface-specific luminescence channels at around 1.4 and 1.5 eV that are not observed in the unitary samples. Their emission strength strongly depends on the molecular alignment of the respective donor and acceptor molecules, emphasizing the importance of structural control for device construction.

Probing conformational dynamics by photoinduced electron transfer

NASA Astrophysics Data System (ADS)

Neuweiler, Hannes; Herten, Dirk P.; Marme, N.; Knemeyer, J. P.; Piestert, Oliver; Tinnefeld, Philip; Sauer, Marcus

2004-07-01

We demonstrate how photoinduced electron transfer (PET) reactions can be successfully applied to monitor conformational dynamics in individual biopolymers. Single-pair fluorescence resonance energy transfer (FRET) experiments are ideally suited to study conformational dynamics occurring on the nanometer scale, e.g. during protein folding or unfolding. In contrast, conformational dynamics with functional significance, for example occurring in enzymes at work, often appear on much smaller spatial scales of up to several Angströms. Our results demonstrate that selective PET-reactions between fluorophores and amino acids or DNA nucleotides represent a versatile tool to measure small-scale conformational dynamics in biopolymers on a wide range of time scales, extending from nanoseconds to seconds, at the single-molecule level under equilibrium conditions. That is, the monitoring of conformational dynamics of biopolymers with temporal resolutions comparable to those within reach using new techniques of molecular dynamic simulations. We present data about structural changes of single biomolecules like DNA hairpins and peptides by using quenching electron transfer reactions between guanosine or tryptophan residues in close proximity to fluorescent dyes. Furthermore, we demonstrate that the strong distance dependence of charge separation reactions on the sub-nanometer scale can be used to develop conformationally flexible PET-biosensors. These sensors enable the detection of specific target molecules in the sub-picomolar range and allow one to follow their molecular binding dynamics with temporal resolution.

On vibrational circular dichroism chirality transfer in electron donor-acceptor complexes: a prediction for the quinine···BF3 system.

PubMed

Rode, Joanna E; Jamróz, Michał H; Dobrowolski, Jan Cz; Sadlej, Joanna

2012-08-02

Vibrational circular dichroism (VCD) chirality transfer occurs when an achiral molecule interacts with a chiral one and becomes VCD-active. Unlike for H-bonds, for organic electron donor-acceptor (EDA) complexes this phenomenon remains almost unknown. Here, the VCD chirality transfer from chiral quinine to achiral BF3 is studied at the B3LYP/aug-cc-pVDZ level. Accessibility of four quinine electron donor sites changes with conformation. Therefore, the quinine conformational landscape was explored and a considerable agreement between X-ray and the most stable conformer geometries was achieved. The BF3 complex through the aliphatic quinuclidine N atom is definitely dominating and is predicted to be easily recognizable in the VCD spectrum. Out of several VCD chirality transfer modes, the ν(s)(BF3) mode, the most intense in the entire VCD spectrum, satisfies the VCD mode robustness criterion and can be used for monitoring the chirality transfer phenomenon in quinine···BF3 system.

Single-molecule electrocatalysis by single-walled carbon nanotubes.

PubMed

Xu, Weilin; Shen, Hao; Kim, Yoon Ji; Zhou, Xiaochun; Liu, Guokun; Park, Jiwoong; Chen, Peng

2009-12-01

We report a single-molecule fluorescence study of electrocatalysis by single-walled carbon nanotubes (SWNTs) at single-reaction resolution. Applying super-resolution optical imaging, we find that the electrocatalysis occurs at discrete, nanometer-dimension sites on SWNTs. Single-molecule kinetic analysis leads to an electrocatalytic mechanism, allowing quantification of the reactivity and heterogeneity of individual reactive sites. Combined with conductivity measurements, this approach will be powerful to interrogate how the electronic structure of SWNTs affects the electrocatalytic interfacial charge transfer, a process fundamental to photoelectrochemical cells.

A Comprehensive Analysis in Terms of Molecule-Intrinsic, Quasi-Atomic Orbitals. III. The Covalent Bonding Structure of Urea.

PubMed

West, Aaron C; Schmidt, Michael W; Gordon, Mark S; Ruedenberg, Klaus

2015-10-15

The analysis of molecular electron density matrices in terms of quasi-atomic orbitals, which was developed in previous investigations, is quantitatively exemplified by a detailed application to the urea molecule. The analysis is found to identify strong and weak covalent bonding interactions as well as intramolecular charge transfers. It yields a qualitative as well as quantitative ab initio description of the bonding structure of this molecule, which raises questions regarding some traditional rationalizations.

Molecular orbital studies (hardness, chemical potential, electronegativity and electrophilicity), vibrational spectroscopic investigation and normal coordinate analysis of 5-{1-hydroxy-2-[(propan-2-yl)amino]ethyl}benzene-1,3-diol

NASA Astrophysics Data System (ADS)

Muthu, S.; Renuga, S.

2014-01-01

FT-IR and FT-Raman spectra of 5-{1-hydroxy-2-[(propan-2-yl) amino] ethyl} benzene-1,3-diol (abbrevi- 54 ated as HPAEBD) were recorded in the region 4000-450 cm-1 and 4000-100 cm-1 respectively. The structure of the molecule was optimized and the structural characteristics were determined by density functional theory (B3LYP) and HF method with 6-31 G(d,p) as basis set. The theoretical wave numbers were scaled and compared with experimental FT-IR and FT-Raman spectra. A detailed interpretation of the vibrational spectra of this compound has been made on the basis of the calculated Potential energy distribution (PED). Stability of the molecule arising from hyperconjugation and charge delocalization is confirmed by the natural bond orbital analysis (NBO). The results show that electron density (ED) in the σ antibonding orbitals and E (2) energies confirm the occurrence of intra molecular charge transfer (ICT) within the molecule. The molecule orbital contributions were studied by using the total (TDOS), sum of α and β electron (αβDOS) density of States. Mulliken population analysis of atomic charges is also calculated. The calculated HOMO and LUMO energy gap shows that charge transfer occurs within the molecule. The electron density-based local reactivity descriptors such as Fukui functions were calculated to explain the chemical selectivity or reactivity site in this compound. On the basis of vibrational analyses, the thermodynamic properties of title compound at different temperatures have been calculated.

Nonadiabatic Dynamics of Photoinduced Proton-Coupled Electron Transfer Processes

DTIC Science & Technology

devices and photoelectrochemical cells. Theoretical methodology for simulating the nonadiabatic dynamics of photoinduced PCET reactions in solution has...tuning and control of the ultrafast dynamics is crucial for designing renewable and sustainable energy sources, such as artificial photosynthesis...describes the solute with a multiconfigurational method in a bath of explicit solvent molecules. The transferring hydrogen nucleus is represented as a

Ultrafast Charge Transfer of a Valence Double Hole in Glycine Driven Exclusively by Nuclear Motion

NASA Astrophysics Data System (ADS)

Li, Zheng; Vendrell, Oriol; Santra, Robin

2015-10-01

We explore theoretically the ultrafast transfer of a double electron hole between the functional groups of glycine after K -shell ionization and subsequent Auger decay. Although a large energy gap of about 15 eV initially exists between the two electronic states involved and coherent electronic dynamics play no role in the hole transfer, we find that the double hole is transferred within 3 to 4 fs between both functional ends of the glycine molecule driven solely by specific nuclear displacements and non-Born-Oppenheimer effects. The nuclear displacements along specific vibrational modes are of the order of 15% of a typical chemical bond between carbon, oxygen, and nitrogen atoms and about 30% for bonds involving hydrogen atoms. The time required for the hole transfer corresponds to less than half a vibrational period of the involved nuclear modes. This finding challenges the common wisdom that nuclear dynamics of the molecular skeleton are unimportant for charge transfer processes at the few-femtosecond time scale and shows that they can even play a prominent role. It also indicates that in x-ray imaging experiments, in which ionization is unavoidable, valence electron redistribution caused by nuclear dynamics might be much faster than previously anticipated. Thus, non-Born-Oppenheimer effects may affect the apparent electron densities extracted from such measurements.

Ultrafast Charge Transfer of a Valence Double Hole in Glycine Driven Exclusively by Nuclear Motion.

PubMed

Li, Zheng; Vendrell, Oriol; Santra, Robin

2015-10-02

We explore theoretically the ultrafast transfer of a double electron hole between the functional groups of glycine after K-shell ionization and subsequent Auger decay. Although a large energy gap of about 15 eV initially exists between the two electronic states involved and coherent electronic dynamics play no role in the hole transfer, we find that the double hole is transferred within 3 to 4 fs between both functional ends of the glycine molecule driven solely by specific nuclear displacements and non-Born-Oppenheimer effects. The nuclear displacements along specific vibrational modes are of the order of 15% of a typical chemical bond between carbon, oxygen, and nitrogen atoms and about 30% for bonds involving hydrogen atoms. The time required for the hole transfer corresponds to less than half a vibrational period of the involved nuclear modes. This finding challenges the common wisdom that nuclear dynamics of the molecular skeleton are unimportant for charge transfer processes at the few-femtosecond time scale and shows that they can even play a prominent role. It also indicates that in x-ray imaging experiments, in which ionization is unavoidable, valence electron redistribution caused by nuclear dynamics might be much faster than previously anticipated. Thus, non-Born-Oppenheimer effects may affect the apparent electron densities extracted from such measurements.

A unified diabatic description for electron transfer reactions, isomerization reactions, proton transfer reactions, and aromaticity.

PubMed

Reimers, Jeffrey R; McKemmish, Laura K; McKenzie, Ross H; Hush, Noel S

2015-10-14

While diabatic approaches are ubiquitous for the understanding of electron-transfer reactions and have been mooted as being of general relevance, alternate applications have not been able to unify the same wide range of observed spectroscopic and kinetic properties. The cause of this is identified as the fundamentally different orbital configurations involved: charge-transfer phenomena involve typically either 1 or 3 electrons in two orbitals whereas most reactions are typically closed shell. As a result, two vibrationally coupled electronic states depict charge-transfer scenarios whereas three coupled states arise for closed-shell reactions of non-degenerate molecules and seven states for the reactions implicated in the aromaticity of benzene. Previous diabatic treatments of closed-shell processes have considered only two arbitrarily chosen states as being critical, mapping these states to those for electron transfer. We show that such effective two-state diabatic models are feasible but involve renormalized electronic coupling and vibrational coupling parameters, with this renormalization being property dependent. With this caveat, diabatic models are shown to provide excellent descriptions of the spectroscopy and kinetics of the ammonia inversion reaction, proton transfer in N2H7(+), and aromaticity in benzene. This allows for the development of a single simple theory that can semi-quantitatively describe all of these chemical phenomena, as well as of course electron-transfer reactions. It forms a basis for understanding many technologically relevant aspects of chemical reactions, condensed-matter physics, chemical quantum entanglement, nanotechnology, and natural or artificial solar energy capture and conversion.

Nonadiabatic Photo-Process Involving the πσ* State in Intramolecular Charge Transfer: a Concerted Spectroscopic and Computational Study 4-(DIMETHYLAMINO)BENZETHYNE and 4-(DIMETHYLAMINO)BENZONITRILE.

NASA Astrophysics Data System (ADS)

Fujiwara, Takashige; Segarra-Martí, Javier; Coto, Pedro B.

2014-06-01

The ubiquitous nature of the low-lying πσ* state in the photo-excited aromatic molecules or biomolecules is widely recognized to play an important role in nonadiabatic photo-process such as photodissociation or intramolecular charge transfer (ICT). For instance, the O--H elimination channel in phenol is attributed to the state-cross of the repulsive πσ* state that exhibits a conical intersection with the lowest bright ππ* state and with the ground state, leading to ultrafast electronic deactivation. A similar decay pathway has been found in the ICT formation of 4-(dialkylamino)benzonitriles in a polar environment, where an initially photoexcited Frank-Condon state bifurcates in the presence of a dark intermediate πσ* state that crosses the fluorescent ππ* state, followed by a conical intersection with the twisted intramolecular charge transfer (TICT) state. We proposed such a two-fold decay mechanism that πσ*-state highly mediates intramolecular charge transfer in 4-(dialkylamino)benzonitriles, which is supported from both our high-level ab initio calculations and ultrafast laser spectroscopies in the previous study. 4-(Dimethylamino)benzethyne (DMABE) is isoelectronic with 4-(dimethylamino)benzonitrile (DMABN), and the electronic structures and electronic spectra of the two molecules bear very close resemblance. However, DMABN does show the ICT formation in a polar environment, whereas DMABE does not. To probe the photophysical differences among the low-lying excited-state configurations, we performed concerted time-resolved laser spectroscopies and high level ab initio multireference perturbation theory quantum-chemical (CASPT2//CASSCF) computations on the two molecules. In this paper we demonstrate the importance of the bound excited-state of a πσ* configuration that induce highly πσ*-state mediated intramolecular charge transfer in 4-(dialkylamino)benzonitriles.

High-order above-threshold dissociation of molecules

NASA Astrophysics Data System (ADS)

Lu, Peifen; Wang, Junping; Li, Hui; Lin, Kang; Gong, Xiaochun; Song, Qiying; Ji, Qinying; Zhang, Wenbin; Ma, Junyang; Li, Hanxiao; Zeng, Heping; He, Feng; Wu, Jian

2018-03-01

Electrons bound to atoms or molecules can simultaneously absorb multiple photons via the above-threshold ionization featured with discrete peaks in the photoelectron spectrum on account of the quantized nature of the light energy. Analogously, the above-threshold dissociation of molecules has been proposed to address the multiple-photon energy deposition in the nuclei of molecules. In this case, nuclear energy spectra consisting of photon-energy spaced peaks exceeding the binding energy of the molecular bond are predicted. Although the observation of such phenomena is difficult, this scenario is nevertheless logical and is based on the fundamental laws. Here, we report conclusive experimental observation of high-order above-threshold dissociation of H2 in strong laser fields where the tunneling-ionized electron transfers the absorbed multiphoton energy, which is above the ionization threshold to the nuclei via the field-driven inelastic rescattering. Our results provide an unambiguous evidence that the electron and nuclei of a molecule as a whole absorb multiple photons, and thus above-threshold ionization and above-threshold dissociation must appear simultaneously, which is the cornerstone of the nowadays strong-field molecular physics.

The role of the tunneling matrix element and nuclear reorganization in the design of quantum-dot cellular automata molecules

NASA Astrophysics Data System (ADS)

Henry, Jackson; Blair, Enrique P.

2018-02-01

Mixed-valence molecules provide an implementation for a high-speed, energy-efficient paradigm for classical computing known as quantum-dot cellular automata (QCA). The primitive device in QCA is a cell, a structure with multiple quantum dots and a few mobile charges. A single mixed-valence molecule can function as a cell, with redox centers providing quantum dots. The charge configuration of a molecule encodes binary information, and device switching occurs via intramolecular electron transfer between dots. Arrays of molecular cells adsorbed onto a substrate form QCA logic. Individual cells in the array are coupled locally via the electrostatic electric field. This device networking enables general-purpose computing. Here, a quantum model of a two-dot molecule is built in which the two-state electronic system is coupled to the dominant nuclear vibrational mode via a reorganization energy. This model is used to explore the effects of the electronic inter-dot tunneling (coupling) matrix element and the reorganization energy on device switching. A semi-classical reduction of the model also is made to investigate the competition between field-driven device switching and the electron-vibrational self-trapping. A strong electron-vibrational coupling (high reorganization energy) gives rise to self-trapping, which inhibits the molecule's ability to switch. Nonetheless, there remains an expansive area in the tunneling-reorganization phase space where molecules can support adequate tunneling. Thus, the relationship between the tunneling matrix element and the reorganization energy affords significant leeway in the design of molecules viable for QCA applications.

Time-Domain Ab Initio Analysis of Excitation Dynamics in a Quantum Dot/Polymer Hybrid: Atomistic Description Rationalizes Experiment.

PubMed

Long, Run; Prezhdo, Oleg V

2015-07-08

Hybrid organic/inorganic polymer/quantum dot (QD) solar cells are an attractive alternative to the traditional cells. The original, simple models postulate that one-dimensional polymers have continuous energy levels, while zero-dimensional QDs exhibit atom-like electronic structure. A realistic, atomistic viewpoint provides an alternative description. Electronic states in polymers are molecule-like: finite in size and discrete in energy. QDs are composed of many atoms and have high, bulk-like densities of states. We employ ab initio time-domain simulation to model the experimentally observed ultrafast photoinduced dynamics in a QD/polymer hybrid and show that an atomistic description is essential for understanding the time-resolved experimental data. Both electron and hole transfers across the interface exhibit subpicosecond time scales. The interfacial processes are fast due to strong electronic donor-acceptor, as evidenced by the densities of the photoexcited states which are delocalized between the donor and the acceptor. The nonadiabatic charge-phonon coupling is also strong, especially in the polymer, resulting in rapid energy losses. The electron transfer from the polymer is notably faster than the hole transfer from the QD, due to a significantly higher density of acceptor states. The stronger molecule-like electronic and charge-phonon coupling in the polymer rationalizes why the electron-hole recombination inside the polymer is several orders of magnitude faster than in the QD. As a result, experiments exhibit multiple transfer times for the long-lived hole inside the QD, ranging from subpicoseconds to nanoseconds. In contrast, transfer of the short-lived electron inside the polymer does not occur beyond the first picosecond. The energy lost by the hole on its transit into the polymer is accommodated by polymer's high-frequency vibrations. The energy lost by the electron injected into the QD is accommodated primarily by much lower-frequency collective and QD modes. The electron dynamics is exponential, whereas evolution of the injected hole through the low density manifold of states of the polymer is highly nonexponential. The time scale of the electron-hole recombination at the interface is intermediate between those in pristine polymer and QD and is closer to that in the polymer. The detailed atomistic insights into the photoinduced charge and energy dynamics at the polymer/QD interface provide valuable guidelines for optimization of solar light harvesting and photovoltaic efficiency in modern nanoscale materials.

X-ray structural studies of the fungal laccase from Cerrena maxima.

PubMed

Lyashenko, Andrey V; Bento, Isabel; Zaitsev, Viatcheslav N; Zhukhlistova, Nadezhda E; Zhukova, Yuliya N; Gabdoulkhakov, Azat G; Morgunova, Ekaterina Y; Voelter, Wolfgang; Kachalova, Galina S; Stepanova, Elena V; Koroleva, Ol'ga V; Lamzin, Victor S; Tishkov, Vladimir I; Betzel, Christian; Lindley, Peter F; Mikhailov, Al'bert M

2006-11-01

Laccases are members of the blue multi-copper oxidase family. These enzymes oxidize substrate molecules by accepting electrons at a mononuclear copper centre and transferring them to a trinuclear centre. Dioxygen binds to the trinuclear centre and following the transfer of four electrons is reduced to two molecules of water. The X-ray structure of a laccase from Cerrena maxima has been elucidated at 1.9 A resolution using synchrotron data and the molecular replacement technique. The final refinement coefficients are Rcryst = 16.8% and Rfree = 23.0%, with root mean square deviations on bond lengths and bond angles of 0.015 A and 1.51 degrees , respectively. The type 1 copper centre has an isoleucine residue at the axial position and the "resting" state of the trinuclear centre comprises a single oxygen (OH) moiety asymmetrically disposed between the two type 3 copper ions and a water molecule attached to the type 2 ion. Several carbohydrate binding sites have been identified and the glycan chains appear to promote the formation of well-ordered crystals. Two tyrosine residues near the protein surface have been found in a nitrated state.

Computational design of molecules for an all-quinone redox flow battery.

PubMed

Er, Süleyman; Suh, Changwon; Marshak, Michael P; Aspuru-Guzik, Alán

2015-02-01

Inspired by the electron transfer properties of quinones in biological systems, we recently showed that quinones are also very promising electroactive materials for stationary energy storage applications. Due to the practically infinite chemical space of organic molecules, the discovery of additional quinones or other redox-active organic molecules for energy storage applications is an open field of inquiry. Here, we introduce a high-throughput computational screening approach that we applied to an accelerated study of a total of 1710 quinone (Q) and hydroquinone (QH 2 ) ( i.e. , two-electron two-proton) redox couples. We identified the promising candidates for both the negative and positive sides of organic-based aqueous flow batteries, thus enabling an all-quinone battery. To further aid the development of additional interesting electroactive small molecules we also provide emerging quantitative structure-property relationships.

Molecular electron recollision dynamics in intense circularly polarized laser pulses

NASA Astrophysics Data System (ADS)

Bandrauk, André D.; Yuan, Kai-Jun

2018-04-01

Extreme UV and x-ray table top light sources based on high-order harmonic generation (HHG) are focused now on circular polarization for the generation of circularly polarized attosecond pulses as new tools for controlling electron dynamics, such as charge transfer and migration and the generation of attosecond quantum electron currents for ultrafast magneto-optics. A fundamental electron dynamical process in HHG is laser induced electron recollision with the parent ion, well established theoretically and experimentally for linear polarization. We discuss molecular electron recollision dynamics in circular polarization by theoretical analysis and numerical simulation. The control of the polarization of HHG with circularly polarized ionizing pulses is examined and it is shown that bichromatic circularly polarized pulses enhance recollision dynamics, rendering HHG more efficient, especially in molecules because of their nonspherical symmetry. The polarization of the harmonics is found to be dependent on the compatibility of the rotational symmetry of the net electric field created by combinations of bichromatic circularly polarized pulses with the dynamical symmetry of molecules. We show how the field and molecule symmetry influences the electron recollision trajectories by a time-frequency analysis of harmonics. The results, in principle, offer new unique controllable tools in the study of attosecond molecular electron dynamics.

Vibrational and electronic absorption spectral studies of 5-amino-1-(4-bromophenyl)-3-phenyl-1-H-pyrazole

NASA Astrophysics Data System (ADS)

Prasad, M. V. S.; Chaitanya, Kadali; Udaya Sri, N.; Veeraiah, V.

2012-12-01

The FT-IR and FT-Raman spectra of 5-amino-1-(4-bromophenyl)-3-phenyl-1-H-pyrazole have been measured in the regions 4000-400 cm-1 and 3500-100 cm-1, respectively. The equilibrium geometry, bonding features and harmonic vibrational frequencies have been carried out with the help of DFT method. The assignments of the vibrational spectra have been carried out with the normal coordinate analysis (NCA) following the scaled quantum mechanical force field methodology (SQMFF). The first-order hyperpolarizability (β0) and related properties (μ, α0, and Δα) of 5A4BP3PP are calculated by using HF/6-31G(d,p) method on the finite field approach. Stability of the molecule arising from hyperconjugative interactions, charge delocalization have been analyzed using natural bonding orbital (NBO) analysis. The results show that electron density (ED) in the σ* and π* antibonding orbitals and second order delocalization energies E(2) confirms the occurrence of the intramolecular charge transfer (ICT) within the molecule. UV-vis spectrum of the compound was recorded and the electronic properties, such as HOMO and LUMO energies, were performed by TDDFT using 6-31G(d,p). The HOMO-LUMO calculations indicating the charge transfer takes place within the molecule.

Electronic structures of 1-ML C84/Ag(111): Energy level alignment and work function variation

NASA Astrophysics Data System (ADS)

Wang, Peng; Zhao, Li-Li; Zhang, Jin-Juan; Li, Wen-Jie; Liu, Wei-Hui; Chen, Da; Sheng, Chun-Qi; Wang, Jia-Ou; Qian, Hai-Jie; Ibrahim, Kurash; Li, Hong-Nian

2017-12-01

The electronic structures of fullerene/metal interface are critical to the performance of devices based on fullerene in molecular electronics and organic electronics. Herein, we investigate the electronic structures at the interface between C84 and Ag(111) by photoelectron spectroscopy and soft X-ray absorption spectroscopy techniques. It is observed that C84 monolayer on Ag(111) surface (1-ML C84/Ag(111)) has metallic nature. A charge transfer from substrate to the unoccupied states of C84 is determined to be 1.3 electrons per molecule. However, the work function of 1-ML C84 (4.72 eV) is observed slightly larger than that of the clean Ag(111) substrate (4.50 eV). A bidirectional charge transfer model is introduced to understand the work function variation of the fullerene/metal system. In addition to the charge transfer from substrate to the adsorbate's unoccupied states, there exists non-negligible back charge transfer from fullerene occupied molecular orbital to the metal substrate through interfacial hybridization. The Fermi level will be pinned at ∼4.72 eV for C84 monolayer on coinage metal substrate.

Atomic-Resolution Transmission Electron Microscopic Movies for Study of Organic Molecules, Assemblies, and Reactions: The First 10 Years of Development.

PubMed

Nakamura, Eiichi

2017-06-20

A molecule is a quantum mechanical entity. "Watching motions and reactions of a molecule with our eyes" has therefore been a dream of chemists for a century. This dream has come true with the aid of the movies of atomic-resolution transmission electron microscopic (AR-TEM) molecular images through real-time observation of dynamic motions of single organic molecules (denoted hereafter as single-molecule atomic-resolution real-time (SMART) TEM imaging). Since 2007, we have reported movies of a variety of single organic molecules, organometallic molecules, and their assemblies, which are rotating, stretching, and reacting. Like movies in the theater, the atomic-resolution molecular movies provide us information on the 3-D structures of the molecules and also their time evolution. The success of the SMART-TEM imaging crucially depends on the development of "chemical fishhooks" with which fish (organic molecules) in solution can be captured on a single-walled carbon nanotube (CNT, serving as a "fishing rod"). The captured molecules are connected to a slowly vibrating CNT, and their motions are displayed on a monitor in real time. A "fishing line" connecting the fish and the rod may be a σ-bond, a van der Waals force, or other weak connections. Here, the molecule/CNT system behaves as a coupled oscillator, where the low-frequency anisotropic vibration of the CNT is transmitted to the molecules via the weak chemical connections that act as an energy filter. Interpretation of the observed motions of the molecules at atomic resolution needs us to consider the quantum mechanical nature of electrons as well as bond rotation, letting us deviate from the conventional statistical world of chemistry. What new horizons can we explore? We have so far carried out conformational studies of individual molecules, assigning anti or gauche conformations to each C-C bond in conformers that we saw. We can also determine the structures of van der Waals assemblies of organic molecules, thereby providing mechanistic insights into crystal formation-phenomena of general significance in science, engineering, and our daily life. Whereas many of the single organic molecules in a vacuum seen by SMART-TEM are sufficiently long-lived for detailed studies, molecules with low ionization potentials (<6 eV) were found to undergo chemical reactions, for example, [60]fullerene and organometallic compounds possibly via a hole catalysis mechanism, where a radical cation of CNT generated under electron irradiation catalyzes the transformation via an electron transfer mechanism. Common organic molecules whose ionization potentials are much higher (>8 eV) than that of CNT (5 eV) remain stable for a time long enough for observation at 60-120 kV acceleration voltage, as they are not oxidized by the CNT radical cation. Alternatively, the reaction may have taken place via an excited state of a molecule produced by energy transfer from CNT possessing excess energy provided by the electron beam. SMART-TEM imaging is a simple approach to the study of the structures and reactions of molecules and their assemblies and will serve as a gateway to the research and education of the science connecting the quantum mechanical world and the real world.

Covalent electron transfer chemistry of graphene with diazonium salts.

PubMed

Paulus, Geraldine L C; Wang, Qing Hua; Strano, Michael S

2013-01-15

Graphene is an atomically thin, two-dimensional allotrope of carbon with exceptionally high carrier mobilities, thermal conductivity, and mechanical strength. From a chemist's perspective, graphene can be regarded as a large polycyclic aromatic molecule and as a surface without a bulk contribution. Consequently, chemistries typically performed on organic molecules and surfaces have been used as starting points for the chemical functionalization of graphene. The motivations for chemical modification of graphene include changing its doping level, opening an electronic band gap, charge storage, chemical and biological sensing, making new composite materials, and the scale-up of solution-processable graphene. In this Account, we focus on graphene functionalization via electron transfer chemistries, in particular via reactions with aryl diazonium salts. Because electron transfer chemistries depend on the Fermi energy of graphene and the density of states of the reagents, the resulting reaction rate depends on the number of graphene layers, edge states, defects, atomic structure, and the electrostatic environment. We limit our Account to focus on pristine graphene over graphene oxide, because free electrons in the latter are already bound to oxygen-containing functionalities and the resulting chemistries are dominated by localized reactivity and defects. We describe the reaction mechanism of diazonium functionalization of graphene and show that the reaction conditions determine the relative degrees of chemisorption and physisorption, which allows for controlled modulation of the electronic properties of graphene. Finally we discuss different applications for graphene modified by this chemistry, including as an additive in polymer matrices, as biosensors when coupled with cells and biomolecules, and as catalysts when combined with nanoparticles.

Quantum design rules for single molecule logic gates.

PubMed

Renaud, N; Hliwa, M; Joachim, C

2011-08-28

Recent publications have demonstrated how to implement a NOR logic gate with a single molecule using its interaction with two surface atoms as logical inputs [W. Soe et al., ACS Nano, 2011, 5, 1436]. We demonstrate here how this NOR logic gate belongs to the general family of quantum logic gates where the Boolean truth table results from a full control of the quantum trajectory of the electron transfer process through the molecule by very local and classical inputs practiced on the molecule. A new molecule OR gate is proposed for the logical inputs to be also single metal atoms, one per logical input.

Unraveling orbital hybridization of triplet emitters at the metal-organic interface.

PubMed

Ewen, Pascal R; Sanning, Jan; Doltsinis, Nikos L; Mauro, Matteo; Strassert, Cristian A; Wegner, Daniel

2013-12-27

We have investigated the structural and electronic properties of phosphorescent planar platinum(II) complexes at the interface of Au(111) with submolecular resolution using combined scanning tunneling microscopy and spectroscopy as well as density functional theory. Our analysis shows that molecule-substrate coupling and lateral intermolecular interactions are weak. While the ligand orbitals remain essentially unchanged upon contact with the substrate, we found modified electronic behavior at the Pt atom due to local hybridization and charge transfer to the substrate. Thus, this novel class of phosphorescent molecules exhibits well-defined and tunable interaction with its local environment.

Carbene-catalysed reductive coupling of nitrobenzyl bromides and activated ketones or imines via single-electron-transfer process

PubMed Central

Li, Bao-Sheng; Wang, Yuhuang; Proctor, Rupert S. J.; Zhang, Yuexia; Webster, Richard D.; Yang, Song; Song, Baoan; Chi, Yonggui Robin

2016-01-01

Benzyl bromides and related molecules are among the most common substrates in organic synthesis. They are typically used as electrophiles in nucleophilic substitution reactions. These molecules can also be activated via single-electron-transfer (SET) process for radical reactions. Representative recent progress includes α-carbon benzylation of ketones and aldehydes via photoredox catalysis. Here we disclose the generation of (nitro)benzyl radicals via N-heterocyclic carbene (NHC) catalysis under reductive conditions. The radical intermediates generated via NHC catalysis undergo formal 1,2-addition with ketones to eventually afford tertiary alcohol products. The overall process constitutes a formal polarity-inversion of benzyl bromide, allowing a direct coupling of two initially electrophilic carbons. Our study provides a new carbene-catalysed reaction mode that should enable unconventional transformation of (nitro)benzyl bromides under mild organocatalytic conditions. PMID:27671606

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ran, Niva A.; Roland, Steffen; Love, John A.

Here, a long standing question in organic electronics concerns the effects of molecular orientation at donor/acceptor heterojunctions. Given a well-controlled donor/acceptor bilayer system, we uncover the genuine effects of molecular orientation on charge generation and recombination. These effects are studied through the point of view of photovoltaics—however, the results have important implications on the operation of all optoelectronic devices with donor/acceptor interfaces, such as light emitting diodes and photodetectors. Our findings can be summarized by two points. First, devices with donor molecules face-on to the acceptor interface have a higher charge transfer state energy and less non-radiative recombination, resulting inmore » larger open-circuit voltages and higher radiative efficiencies. Second, devices with donor molecules edge-on to the acceptor interface are more efficient at charge generation, attributed to smaller electronic coupling between the charge transfer states and the ground state, and lower activation energy for charge generation.« less

Multiple exciton dissociation in CdSe quantum dots by ultrafast electron transfer to adsorbed methylene blue.

PubMed

Huang, Jier; Huang, Zhuangqun; Yang, Ye; Zhu, Haiming; Lian, Tianquan

2010-04-07

Multiexciton generation in quantum dots (QDs) may provide a new approach for improving the solar-to-electric power conversion efficiency in QD-based solar cells. However, it remains unclear how to extract these excitons before the ultrafast exciton-exciton annihilation process. In this study we investigate multiexciton dissociation dynamics in CdSe QDs adsorbed with methylene blue (MB(+)) molecules by transient absorption spectroscopy. We show that excitons in QDs dissociate by ultrafast electron transfer to MB(+) with an average time constant of approximately 2 ps. The charge separated state is long-lived (>1 ns), and the charge recombination rate increases with the number of dissociated excitons. Up to three MB(+) molecules per QD can be reduced by exciton dissociation. Our result demonstrates that ultrafast interfacial charge separation can effectively compete with exciton-exciton annihilation, providing a viable approach for utilizing short-lived multiple excitons in QDs.

Organic Semiconductor Photovoltaics

NASA Astrophysics Data System (ADS)

Sariciftci, Niyazi Serdar

2005-03-01

Recent developments on organic photovoltaic elements are reviewed. Semiconducting conjugated polymers and molecules as well as nanocrystalline inorganic semiconductors are used in composite thin films. The photophysics of such photoactive devices is based on the photoinduced charge transfer from donor type semiconducting molecules onto acceptor type molecules such as Buckminsterfullerene, C60 and/or nanoparticles. Similar to the first steps in natural photosynthesis, this photoinduced electron transfer leads to a number of potentially interesting applications which include sensitization of the photoconductivity and photovoltaic phenomena. Examples of photovoltaic architectures are discussed with their potential in terrestrial solar energy conversion. Several materials are introduced and discussed for their photovoltaic activities. Furthermore, nanomorphology has been investigated with AFM, SEM and TEM. The morphology/property relationship for a given photoactive system is found to be a major effect.

Time-dependent transition density matrix for visualizing charge-transfer excitations in photoexcited organic donor-acceptor systems

NASA Astrophysics Data System (ADS)

Li, Yonghui; Ullrich, Carsten

2013-03-01

The time-dependent transition density matrix (TDM) is a useful tool to visualize and interpret the induced charges and electron-hole coherences of excitonic processes in large molecules. Combined with time-dependent density functional theory on a real-space grid (as implemented in the octopus code), the TDM is a computationally viable visualization tool for optical excitation processes in molecules. It provides real-time maps of particles and holes which gives information on excitations, in particular those that have charge-transfer character, that cannot be obtained from the density alone. Some illustration of the TDM and comparison with standard density difference plots will be shown for photoexcited organic donor-acceptor molecules. This work is supported by NSF Grant DMR-1005651

Charge Transfer Dynamics at Dye-Sensitized ZnO and TiO2 Interfaces Studied by Ultrafast XUV Photoelectron Spectroscopy

PubMed Central

Borgwardt, Mario; Wilke, Martin; Kampen, Thorsten; Mähl, Sven; Xiao, Manda; Spiccia, Leone; Lange, Kathrin M.; Kiyan, Igor Yu.; Aziz, Emad F.

2016-01-01

Interfacial charge transfer from photoexcited ruthenium-based N3 dye molecules into ZnO thin films received controversial interpretations. To identify the physical origin for the delayed electron transfer in ZnO compared to TiO2, we probe directly the electronic structure at both dye-semiconductor interfaces by applying ultrafast XUV photoemission spectroscopy. In the range of pump-probe time delays between 0.5 to 1.0 ps, the transient signal of the intermediate states was compared, revealing a distinct difference in their electron binding energies of 0.4 eV. This finding strongly indicates the nature of the charge injection at the ZnO interface associated with the formation of an interfacial electron-cation complex. It further highlights that the energetic alignment between the dye donor and semiconductor acceptor states appears to be of minor importance for the injection kinetics and that the injection efficiency is dominated by the electronic coupling. PMID:27073060

Probing the dependence of electron transfer on size and coverage in carbon nanotube-quantum dot heterostructures

DOE PAGES

Wang, Lei; Wong, Stanislaus S.; Han, Jinkyu; ...

2015-11-16

As a model system for understanding charge transfer in novel architectural designs for solar cells, double-walled carbon nanotube (DWNT)–CdSe quantum dot (QD) (QDs with average diameters of 2.3, 3.0, and 4.1 nm) heterostructures have been fabricated. The individual nanoscale building blocks were successfully attached and combined using a hole-trapping thiol linker molecule, i.e., 4-mercaptophenol (MTH), through a facile, noncovalent π–π stacking attachment strategy. Transmission electron microscopy confirmed the attachment of QDs onto the external surfaces of the DWNTs. We herein demonstrate a meaningful and unique combination of near-edge X-ray absorption fine structure (NEXAFS) and Raman spectroscopies bolstered by complementary electricalmore » transport measurements in order to elucidate the synergistic interactions between CdSe QDs and DWNTs, which are facilitated by the bridging MTH molecules that can scavenge photoinduced holes and potentially mediate electron redistribution between the conduction bands in CdSe QDs and the C 2p-derived states of the DWNTs. Specifically, we correlated evidence of charge transfer as manifested by (i) changes in the NEXAFS intensities of π* resonance in the C K-edge and Cd M3-edge spectra, (ii) a perceptible outer tube G-band downshift in frequency in Raman spectra, as well as (iii) alterations in the threshold characteristics present in transport data as a function of CdSe QD deposition onto the DWNT surface. Furthermore, the separate effects of (i) varying QD sizes and (ii) QD coverage densities on the electron transfer were independently studied.« less

Microhydration effects on the electronic spectra of protonated polycyclic aromatic hydrocarbons: [naphthalene-(H2O)n = 1,2]H+

NASA Astrophysics Data System (ADS)

Alata, Ivan; Broquier, Michel; Dedonder-Lardeux, Claude; Jouvet, Christophe; Kim, Minho; Sohn, Woon Yong; Kim, Sang-su; Kang, Hyuk; Schütz, Markus; Patzer, Alexander; Dopfer, Otto

2011-02-01

Vibrational and electronic spectra of protonated naphthalene (NaphH+) microsolvated by one and two water molecules were obtained by photofragmentation spectroscopy. The IR spectrum of the monohydrated species is consistent with a structure with the proton located on the aromatic molecule, NaphH+-H2O. Similar to isolated NaphH+, the first electronic transition of NaphH+-H2O (S1) occurs in the visible range near 500 nm. The doubly hydrated species lacks any absorption in the visible range (420-600 nm) but absorbs in the UV range, similar to neutral Naph. This observation is consistent with a structure, in which the proton is located on the water moiety, Naph-(H2O)2H+. Ab initio calculations for [Naph-(H2O)n]H+ confirm that the excess proton transfers from Naph to the solvent cluster upon attachment of the second water molecule.

Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

NASA Astrophysics Data System (ADS)

Risqi, A. M.; Yudiarsah, E.

2017-07-01

Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

Characteristics of Organic-Metal Interaction: A Perspective from Bonding Distance to Orbital Delocalization

NASA Astrophysics Data System (ADS)

Kera, Satoshi; Hosokai, Takuya; Duhm, Steffen

2018-06-01

Understanding the mechanisms of energy-level alignment and charge transfer at the interface is one of the key issues in realizing organic electronics. However, the relation between the interface structure and the electronic structure is still not resolved in sufficient detail. An important character of materials used in organic electronics is the electronic localization of organic molecules at interfaces. To elucidate the impact of the molecular orbital distribution on the electronic structure, detailed structural information is required, particularly the vertical bonding distance at the interface, which is a signature of the interaction strength. We describe the recent progress in experimental studies on the impact of the molecule-metal interaction on the electronic structure of organic-metal interfaces by using various photoelectron spectroscopies, and review the results, focusing on the X-ray standing wave technique, to demonstrate the evaluation of the vertical bonding distance.

Methyl group transfer upon gas phase decomposition of protonated methyl benzoate and similar compounds.

PubMed

Frański, Rafał; Gierczyk, Błażej; Zalas, Maciej; Jankowski, Wojciech; Hoffmann, Marcin

2018-05-01

Gas phase decompositions of protonated methyl benzoate and its conjugates have been studied by using electrospray ionization-collision induced dissociation-tandem mass spectrometry. Loss of CO 2 molecule, thus transfer of methyl group, has been observed. In order to better understand this process, the theoretical calculations have been performed. For methyl benzoate conjugates, it has been found that position of substituent affects the loss of CO 2 molecule, not the electron donor/withdrawing properties of the substituent. Therefore, electrospray ionization-mass spectrometry in positive ion mode may be useful for differentiation of isomers of methyl benzoate conjugates. Copyright © 2018 John Wiley & Sons, Ltd.

Real-time investigation of cytochrome c release profiles in living neuronal cells undergoing amyloid beta oligomer-induced apoptosis

NASA Astrophysics Data System (ADS)

Lee, Jae Young; Park, Younggeun; Pun, San; Lee, Sung Sik; Lo, Joe F.; Lee, Luke P.

2015-06-01

Intracellular Cyt c release profiles in living human neuroblastoma undergoing amyloid β oligomer (AβO)-induced apoptosis, as a model Alzheimer's disease-associated pathogenic molecule, were analysed in a real-time manner using plasmon resonance energy transfer (PRET)-based spectroscopy.Intracellular Cyt c release profiles in living human neuroblastoma undergoing amyloid β oligomer (AβO)-induced apoptosis, as a model Alzheimer's disease-associated pathogenic molecule, were analysed in a real-time manner using plasmon resonance energy transfer (PRET)-based spectroscopy. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr02390d

Basic governing equations for the flight regimes of aeroassisted orbital transfer vehicles

NASA Technical Reports Server (NTRS)

Lee, J.-H.

1984-01-01

The basic governing equations for the low-density, high-enthalpy flow regimes expected in the shock layers over the heat shields of the proposed aeroassisted orbital transfer vehicles are derived by combining and extending existing theories. The conservation equations are derived from gas kinetic principles for a four-component ionized gas consisting of neutral molecules, neutral atoms, singly ionized ions, and electrons, assuming a continuum flow. The differences among translational-rotational, vibrational, and electron temperatures are accounted for, as well as chemical nonequilibrium and electric-charge separation. Expressions for convective and viscous fluxes, transport properties, and the terms representing interactions among various energy modes are given explicitly. The expressions for the rate of electron-vibration energy transfer, which violates the Landau-Teller conditions, is derived by solving the system of master equations accounting for the multiple-level transitions.

Basic Governing Equations for the Flight Regimes of Aeroassisted Orbital Transfer Vehicles

NASA Technical Reports Server (NTRS)

Lee, Jong-Hun

1985-01-01

The basic governing equations for the low-density, high-enthalpy flow regimes expected in the shock layers over the heat shields of the proposed aeroassisted orbital transfer vehicles are derived by combining and extending existing theories. The conservation equations are derived from gas kinetic principles for a four-component ionized gas consisting of neutral molecules, neutral atoms, singly ionized ions, and electrons, assuming a continuum flow. The differences among translational-rotational, vibrational, and electron temperatures are accounted for, as well as chemical nonequilibrium and electric-charge separation. Expressions for convective and viscous fluxes, transport properties, and the terms representing interactions among various energy modes are explicitly given. The expressions for the rate of electron-vibration energy transfer, which violates the Landau-Teller conditions, are derived by solving the system of master equations accounting for the multiple-level transitions.

Diazonium-functionalized horseradish peroxidase immobilized via addressable electrodeposition: direct electron transfer and electrochemical detection.

PubMed

Polsky, Ronen; Harper, Jason C; Dirk, Shawn M; Arango, Dulce C; Wheeler, David R; Brozik, Susan M

2007-01-16

A simple one-step procedure is introduced for the preparation of diazonium-enzyme adducts. The direct electrically addressable deposition of diazonium-modified enzymes is examined for electrochemical sensor applications. The deposition of diazonium-horseradish peroxidase leads to the direct electron transfer between the enzyme and electrode exhibiting a heterogeneous rate constant, ks, of 10.3 +/- 0.7 s-1 and a DeltaEp of 8 mV (v = 150 mV/s). The large ks and low DeltaEp are attributed to the intimate contact between enzyme and electrode attached by one to three phenyl molecules. Such an electrode shows high nonmediated catalytic activity toward H2O2 reduction. Future generations of arrayed electrochemical sensors and studies of direct electron transfer of enzymes can benefit from protein electrodes prepared by this method.

The merger of electrochemistry and molecular electronics.

PubMed

McCreery, Richard L

2012-02-01

Molecular Electronics has the potential to greatly enhance existing silicon-based microelectronics to realize new functions, higher device density, lower power consumption, and lower cost. Although the investigation of electron transport through single molecules and molecular monolayers in "molecular junctions" is a recent development, many of the relevant concepts and phenomena are derived from electrochemistry, as practiced for the past several decades. The past 10+ years have seen an explosion of research activity directed toward how the structure of molecules affects electron transport in molecular junctions, with the ultimate objective of "rational design" of molecular components with new electronic functions, such as chemical sensing, interactions with light, and low-cost, low-power consumer electronics. In order to achieve these scientifically and commercially important objectives, the factors controlling charge transport in molecules "connected" to conducting contacts must be understood, and methods for massively parallel manufacturing of molecular circuits must be developed. This Personal Account describes the development of reproducible and robust molecular electronic devices, starting with modified electrodes used in electrochemistry and progressing to manufacturable molecular junctions. Although the field faced some early difficulties in reliability and characterization, the pieces are now in place for rapid advances in understanding charge transport at the molecular level. Inherent in the field of Molecular Electronics are many electrochemical concepts, including tunneling, redox exchange, activated electron transfer, and electron coupling between molecules and conducting contacts. Copyright © 2012 The Japan Chemical Journal Forum and Wiley Periodicals, Inc.

Direct Interspecies Electron Transfer in Anaerobic Digestion: A Review.

PubMed

Dubé, Charles-David; Guiot, Serge R

2015-01-01

Direct interspecies electrons transfer (DIET) is a syntrophic metabolism in which free electrons flow from one cell to another without being shuttled by reduced molecules such as molecular hydrogen or formate. As more and more microorganisms show a capacity for electron exchange, either to export or import them, it becomes obvious that DIET is a syntrophic metabolism that is much more present in nature than previously thought. This article reviews literature related to DIET, specifically in reference to anaerobic digestion. Anaerobic granular sludge, a biofilm, is a specialized microenvironment where syntrophic bacterial and archaeal organisms grow together in close proximity. Exoelectrogenic bacteria degrading organic substrates or intermediates need an electron sink and electrotrophic methanogens represent perfect partners to assimilate those electrons and produce methane. The granule extracellular polymeric substances by making the biofilm matrix more conductive, play a role as electrons carrier in DIET.

Femtosecond excited state studies of the two-center three-electron bond driven twisted internal charge transfer dynamics in 1,8-bis(dimethylamino)naphthalene.

PubMed

Balkowski, Grzegorz; Szemik-Hojniak, Anna; van Stokkum, Ivo H M; Zhang, Hong; Buma, Wybren J

2005-04-28

Femtosecond fluorescence upconversion and transient absorption experiments have been performed to monitor the photoinduced electronic, geometry, and solvent relaxation dynamics of 1,8-bis(dimethylamino)naphthalene dissolved in methylcyclohexane or n-hexane, n-dodecane, dichloromethane, and acetonitrile. The data have been analyzed by using a sequential global analysis method that gives rise to species associated difference spectra. The spectral features in these spectra and their dynamic behavior enable us to associate them with specific processes occurring in the molecule. The experiments show that the internal charge-transfer lpi* state is populated after internal conversion from the 1La state. In the lpi state the molecule is concluded to be subject to a large-amplitude motion, thereby confirming our previous predictions that internal charge transfer in this state is accompanied by the formation of a two-center three-electron bond between the two nitrogen atoms. Solvent relaxation and vibrational cooling in the lpi* state cannot be separated in polar solvents, but in apolar solvents a distinct vibrational cooling process in the lpi* state is discerned. The spectral and dynamic characteristics of the final species created in the experiments are shown to correspond well with what has been determined before for the relaxed emissive lpi state.

Electron-transfer boat-vibration mechanism for superconductivity in organic molecules based on BEDT-TTF

DOE Office of Scientific and Technical Information (OSTI.GOV)

Demiralp, E.; Dasgupta, S.; Goddard, W.A. III

1995-08-09

The highest T{sub c} organic superconductors all involve the organic molecule bis(ethylenedithio)tetrathiafulvalene (denoted as BEDT-TTF or ET) coupled with an appropriate acceptor. This leads to ET, ET{sup +}, or (ET){sub 2}{sup +} species in the crystal. Using ab initio Hartree-Fock calculations (6-31G** basis set), we show that ET deforms to a boat structure with an energy 28 meV (0.65 kcal/mol) lower than that of planar ET (D{sub 2} symmetry). On the other hand, ET{sup +} is planar. Thus, conduction in this system leads to a coupling between charge transfer and the boat deformation vibrational modes at 20 cm{sup -1} (ET)more » and 28 cm{sup -1} (ET{sup +}). We suggest that this electron-phonon coupling is responsible for the superconductivity and predict the isotope shifts ({delta}T{sub c}) for experimental tests of the electron-transfer boat-vibration (ET-BV) mechanism. The low frequency of this boat mode and its coupling to various lattice modes could explain the sensitivity of T{sub c} to defects, impurities, and pressure. We suggest that new higher temperature organic donors can be sought by finding modifications that change the frequency and stability of this boat distortion mode. 25 refs., 5 figs., 4 tabs.« less

Structural and electronic properties of AlN(0001) surface under partial N coverage as determined by ab initio approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strak, Pawel; Sakowski, Konrad; Kempisty, Pawel

2015-09-07

Properties of bare and nitrogen-covered Al-terminated AlN(0001) surface were determined using density functional theory (DFT) calculations. At a low nitrogen coverage, the Fermi level is pinned by Al broken bond states located below conduction band minimum. Adsorption of nitrogen is dissociative with an energy gain of 6.05 eV/molecule at a H3 site creating an overlap with states of three neighboring Al surface atoms. During this adsorption, electrons are transferred from Al broken bond to topmost N adatom states. Accompanying charge transfer depends on the Fermi level. In accordance with electron counting rule (ECR), the DFT results confirm the Fermi levelmore » is not pinned at the critical value of nitrogen coverage θ{sub N}(1) = 1/4 monolayer (ML), but it is shifted from an Al-broken bond state to Np{sub z} state. The equilibrium thermodynamic potential of nitrogen in vapor depends drastically on the Fermi level pinning being shifted by about 4 eV for an ECR state at 1/4 ML coverage. For coverage above 1/4 ML, adsorption is molecular with an energy gain of 1.5 eV at a skewed on-top position above an Al surface atom. Electronic states of the admolecule are occupied as in the free molecule, no electron transfer occurs and adsorption of a N{sub 2} molecule does not depend on the Fermi level. The equilibrium pressure of molecular nitrogen above an AlN(0001) surface depends critically on the Fermi level position, being very low and very high for low and high coverage, respectively. From this fact, one can conclude that at typical growth conditions, the Fermi level is not pinned, and the adsorption and incorporation of impurities depend on the position of Fermi level in the bulk.« less

A hybrid biocatalyst consisting of silver nanoparticle and naphthalenethiol self-assembled monolayer prepared for anchoring glucose oxidase and its use for an enzymatic biofuel cell

NASA Astrophysics Data System (ADS)

Christwardana, Marcelinus; Kim, Do-Heyoung; Chung, Yongjin; Kwon, Yongchai

2018-01-01

A novel hybrid biocatalyst is synthesized by the enzyme composite consisting of silver nanoparticle (AgNP), naphthalene-thiol based couplers (Naph-SH) and glucose oxidase (GOx), which is then bonded with the supporter consisting of polyethyleneimine (PEI) and carbon nanotube (CNT) (CNT/PEI/AgNPs/Naph-SH/GOx) to facilitate glucose oxidation reaction (GOR). Here, the AgNPs play a role in obstructing denaturation of the GOx molecules from the supporter because of Ag-thiol bond, while the PEIs have the AgNPs keep their states without getting ionized by hydrogen peroxide produced during anodic reaction. The Naph-SHs also prevent ionization of the AgNP by forming self-assembled monolayer on their surface. Such roles of each component enable the catalyst to form (i) hydrophobic interaction between the GOx molecules and supporter and (ii) π-conjugated electron pathway between the GOx molecules and AgNP, promoting electron transfer. Catalytic nature of the catalyst is characterized by measuring catalytic activity and performance of enzymatic biofuel cell (EBC) using the catalyst. Regarding the catalytic activity, the catalyst leads to high electron transfer rate constant (9.6 ± 0.4 s-1), low Michaelis-Menten constant (0.51 ± 0.04 mM), and low charge transfer resistance (7.3 Ω cm2) and high amount of immobilized GOx (54.6%), while regarding the EBC performance, high maximum power density (1.46 ± 0.07 mW cm-2) with superior long-term stability result are observed.

Direct measurement of electron transfer distance decay constants of single redox proteins by electrochemical tunneling spectroscopy.

PubMed

Artés, Juan M; Díez-Pérez, Ismael; Sanz, Fausto; Gorostiza, Pau

2011-03-22

We present a method to measure directly and at the single-molecule level the distance decay constant that characterizes the rate of electron transfer (ET) in redox proteins. Using an electrochemical tunneling microscope under bipotentiostatic control, we obtained current−distance spectroscopic recordings of individual redox proteins confined within a nanometric tunneling gap at a well-defined molecular orientation. The tunneling current decays exponentially, and the corresponding decay constant (β) strongly supports a two-step tunneling ET mechanism. Statistical analysis of decay constant measurements reveals differences between the reduced and oxidized states that may be relevant to the control of ET rates in enzymes and biological electron transport chains.

Electron collisions with F2CO molecules

NASA Astrophysics Data System (ADS)

Freitas, Thiago Corrêa; Barbosa, Alessandra Souza; Bettega, Márcio Henrique Franco

2017-07-01

In this paper we present elastic differential, integral, and momentum-transfer cross sections for electron collisions with carbonyl fluoride (F2CO ) molecules for the incident electron's energy from 0.5 eV to 20 eV. The Schwinger multichannel method with pseudopotentials was employed to obtain the cross sections in the static-exchange and static-exchange plus polarization approximations. The present results were compared with the available data in the literature, in particular, with the results of Kaur, Mason, and Antony [Phys. Rev. A 92, 052702 (2015), 10.1103/PhysRevA.92.052702] for the differential, total, and momentum-transfer cross sections. We have found a π* shape resonance centered at 2.6 eV in the B1 symmetry and other resonance, in the B2 symmetry, located at around 9.7 eV. A systematic study of the inclusion of polarization effects was performed in order to have a well balanced description of this negative-ion transient state. The effects of the long-range electric dipole potential were included by the Born closure scheme. Electronic structure calculations were also performed to help in the interpretation of the scattering results, and associate the transient states to the unoccupied orbitals.

Catalysis and co-catalysis of bond cleavages in coal and coal analogs. Final report, August 1, 1990--January 31, 1994

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, B.

1994-05-01

In work prior to the inception of this project, the authors observed that mixtures of phenolic materials and polyalkoxyaromatic molecules were appreciably more effective in catalyzing the decompositions of di-2-naphthyl ether and of di-1-naphthyl sulfide in tetralin solutions at 450{degrees}C than were the phenols by themselves, even though the polyalkoxyaromatic molecules, in the absence of phenolic co- catalysts, show essentially no catalytic activity. This was of appreciable interest in coal research because dinapthyl ether and dinapthyl sulfide have been employed as model compounds for coals in studies aimed at cleaving ether and sulfide bonds similar to those in coals. Themore » authors proposed (R. K. Sharma, K. P. Raman, and B. Miller) that the mixed catalysts used in these studies catalyze cleavages of ether and sulfide bonds by means of a mechanism involving electron transfer from the polyalkoxyaromatics to the substrates, which are activated as electron acceptors by hydrogen bonding to phenols. Since phenols themselves are electron donors, they also proposed that the well known effects of phenols in catalyzing the conversion of coals are due to similar electron transfer mechanisms.« less

Guest-induced emergent properties in Metal–Organic Frameworks

DOE PAGES

Allendorf, Mark D.; Foster, Michael E.; Léonard, François; ...

2015-03-19

Metal–Organic frameworks (MOFs) are crystalline nanoporous materials comprised of organic electron donors linked to metal ions by strong coordination bonds. Applications such as gas storage and separations are currently receiving considerable attention, but if the unique properties of MOFs could be extended to electronics, magnetics, and photonics, the impact on material science would greatly increase. Recently, we obtained “emergent properties,” such as electronic conductivity and energy transfer, by infiltrating MOF pores with “guest” molecules that interact with the framework electronic structure. In this Perspective, we define a path to emergent properties based on the Guest@MOF concept, using zinc-carboxylate and copper-paddlewheelmore » MOFs for illustration. Energy transfer and light harvesting are discussed for zinc carboxylate frameworks infiltrated with triplet-scavenging organometallic compounds and thiophene- and fullerene-infiltrated MOF-177. In addition, we discuss the mechanism of charge transport in TCNQ-infiltrated HKUST-1, the first MOF with electrical conductivity approaching conducting organic polymers. Lastly, these examples show that guest molecules in MOF pores should be considered not merely as impurities or analytes to be sensed but also as an important aspect of rational design.« less

Electronic Energy Transfer in New Polymer Nanocomposite Assemblies

DTIC Science & Technology

1994-07-13

for public release and sale; its distribution is unlimited. OL AISTfrRACT fMaimunt 20o war*) New light-harvesting thin film supramolecular assemblies...be supression or reduction of exciplex formation between excited donor molecules and ground state acceptor molecules that may lead to nonradiative...nonradiative excited state decay exists other than EET.33 One possibility for this nonradiative and non-EET pathway is exciplex formation between the

Electron Tunneling in Lithium Ammonia Solutions Probed by Frequency-Dependent Electron-Spin Relaxation Studies

PubMed Central

Maeda, Kiminori; Lodge, Matthew T.J.; Harmer, Jeffrey; Freed, Jack H.; Edwards, Peter P.

2012-01-01

Electron transfer or quantum tunneling dynamics for excess or solvated electrons in dilute lithium-ammonia solutions have been studied by pulse electron paramagnetic resonance (EPR) spectroscopy at both X- (9.7 GHz) and W-band (94 GHz) frequencies. The electron spin-lattice (T1) and spin-spin (T2) relaxation data indicate an extremely fast transfer or quantum tunneling rate of the solvated electron in these solutions which serves to modulate the hyperfine (Fermi-contact) interaction with nitrogen nuclei in the solvation shells of ammonia molecules surrounding the localized, solvated electron. The donor and acceptor states of the solvated electron in these solutions are the initial and final electron solvation sites found before, and after, the transfer or tunneling process. To interpret and model our electron spin relaxation data from the two observation EPR frequencies requires a consideration of a multi-exponential correlation function. The electron transfer or tunneling process that we monitor through the correlation time of the nitrogen Fermi-contact interaction has a time scale of (1–10)×10−12 s over a temperature range 230–290K in our most dilute solution of lithium in ammonia. Two types of electron-solvent interaction mechanisms are proposed to account for our experimental findings. The dominant electron spin relaxation mechanism results from an electron tunneling process characterized by a variable donor-acceptor distance or range (consistent with such a rapidly fluctuating liquid structure) in which the solvent shell that ultimately accepts the transferring electron is formed from random, thermal fluctuations of the liquid structure in, and around, a natural hole or Bjerrum-like defect vacancy in the liquid. Following transfer and capture of the tunneling electron, further solvent-cage relaxation with a timescale of ca. 10−13 s results in a minor contribution to the electron spin relaxation times. This investigation illustrates the great potential of multi-frequency EPR measurements to interrogate the microscopic nature and dynamics of ultra fast electron transfer or quantum-tunneling processes in liquids. Our results also impact on the universal issue of the role of a host solvent (or host matrix, e.g. a semiconductor) in mediating long-range electron transfer processes and we discuss the implications of our results with a range of other materials and systems exhibiting the phenomenon of electron transfer. PMID:22568866

Coherent control of the formation of cold heteronuclear molecules by photoassociation

NASA Astrophysics Data System (ADS)

de Lima, Emanuel F.

2017-01-01

We consider the formation of cold diatomic molecules in the electronic ground state by photoassociation of atoms of dissimilar species. A combination of two transition pathways from the free colliding pair of atoms to a bound vibrational level of the electronic molecular ground state is envisioned. The first pathway consists of a pump-dump scheme with two time-delayed laser pulses in the near-infrared frequency domain. The pump pulse drives the transition to a bound vibrational level of an excited electronic state, while the dump pulse transfers the population to a bound vibrational level of the electronic ground state. The second pathway takes advantage of the existing permanent dipole moment and employs a single pulse in the far-infrared domain to drive the transition from the unbound atoms directly to a bound vibrational level in the electronic ground state. We show that this scheme offers the possibility to coherently control the photoassociation yield by manipulating the relative phase and timing of the pulses. The photoassociation mechanism is illustrated for the formation of cold LiCs molecules.

Development of a glucose sensor employing quick and easy modification method with mediator for altering electron acceptor preference.

PubMed

Hatada, Mika; Loew, Noya; Inose-Takahashi, Yuka; Okuda-Shimazaki, Junko; Tsugawa, Wakako; Mulchandani, Ashok; Sode, Koji

2018-06-01

Enzyme based electrochemical biosensors are divided into three generations according to their type of electron transfer from the cofactors of the enzymes to the electrodes. Although the 3rd generation sensors using direct electron transfer (DET) type enzymes are ideal, the number of enzyme types which possess DET ability is limited. In this study, we report of a glucose sensor using mediator-modified glucose dehydrogenase (GDH), that was fabricated by a new quick-and-easy method using the pre-functionalized amine reactive phenazine ethosulfate (arPES). Thus mediator-modified GDH obtained the ability to transfer electrons to bulky electron acceptors as well as electrodes. The concentration of glucose was successfully measured using electrodes with immobilized PES-modified GDH, without addition of external electron mediators. Therefore, continuous monitoring systems can be developed based on this "2.5th generation" electron transfer principle utilizing quasi-DET. Furthermore, we successfully modified two other diagnostically relevant enzymes, glucoside 3-dehydrogenase and lactate oxidase, with PES. Therefore, various kinds of diagnostic enzymes can achieve quasi-DET ability simply by modification with arPES, suggesting that continuous monitoring systems based on the 2.5th generation principle can be developed for various target molecules. Copyright © 2018 Elsevier B.V. All rights reserved.

Molecular Electronic Devices Based On Electrooptical Behavior Of Heme-Like Molecules

NASA Astrophysics Data System (ADS)

Simic-Glavaski, B.

1986-02-01

This paper discusses application of the electrically modulated and unusually strong Raman emitted light produced by an adsorbed monolayer of phthalocyanine molecules on silver electrode or silver bromide substrates and on neural membranes. The analysis of electronic energy levels in semiconducting silver bromide and the adsorbed phthalocyanine molecules suggests a lasing mechanism as a possible origin of the high enhancement factor in surface enhanced Raman scattering. Electrically modulated Raman scattering may be used as a carrier of information which is drawn fran the fast intramolecular electron transfer aN,the multiplicity of quantum wells in phthalocyanine molecules. Fast switching times on the order of 10-13 seconds have been measured at room temperature. Multilevel and multioutput optical signals have also been obtained fran such an electrically modulated adsorbed monolayer of phthalocyanine molecules which can be precisely addressed and interrogated. This may be of practical use to develop Nlecular electronic devices with high density memory and fast parallel processing systems with a typical 1020 gate Hz/cm2 capacity at room temperature for use in optical computers. The paper also discusses the electrooptical modulation of Raman signals obtained from adsorbed bio-compatible phthalocyanine molecules on nerve membranes. This optical probe of neural systems can be used in studies of complex information processing in neural nets and provides a possible method for interfacing natural and man-made information processing devices.

BiF(AO+, v’) Radiative Lifetimes and Rate Coefficients for V yields T Transfer and Electronic Quenching.

DTIC Science & Technology

1987-04-24

8217) Radiative Lifetimes and Rate Coefficients for V - T Transfer and Electronic Quenching R. F. HEIDNER Ill, H . HELVAJIAN ,J. S. HOLLOWAY, and J. B...ofoffene. 9. ~ ~ ~ ~ ~ ~ ~ ~ ~ ia U91FO01NGOGNIAIO AE N DDESIIIA T NR.ASK II.~~~~~~~~ WSPIUIOk:TTMET:. .I epn *~~ h Approsp c...collisions of the metastable NF(a 1 h ) state with ground-state BI? molecules, a chemical pumping scheme made efficient by the large densities of NF(a) that can

Charge-transfer photodissociation of adsorbed molecules via electron image states

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jensen, E. T.

The 248 and 193 nm photodissociations of submonolayer quantities of CH{sub 3}Br and CH{sub 3}I adsorbed on thin layers of n-hexane indicate that the dissociation is caused by dissociative electron attachment from subvacuum level photoelectrons created in the copper substrate. The characteristics of this photodissociation-translation energy distributions and coverage dependences show that the dissociation is mediated by an image potential state which temporarily traps the photoelectrons near the n-hexane-vacuum interface, and then the charge transfers from this image state to the affinity level of a coadsorbed halomethane which then dissociates.

Dynamics of intramolecular electron transfer reaction of FAD studied by magnetic field effects on transient absorption spectra.

PubMed

Murakami, Masaaki; Maeda, Kiminori; Arai, Tatsuo

2005-07-07

The kinetics of intermediates generated from intramolecular electron-transfer reaction by photo irradiation of the flavin adenine dinucleotide (FAD) molecule was studied by a magnetic field effect (MFE) on transient absorption (TA) spectra. Existence time of MFE and MFE action spectra have a strong dependence on the pH of solutions. The MFE action spectra have indicated the existence of interconversion between the radical pair and the cation form of the triplet excited state of flavin part. All rate constants of the triplet and the radical pair were determined by analysis of the MFE action spectra and decay kinetics of TA. The obtained values for the interconversion indicate that the formation of cation radical promotes the back electron-transfer reaction to the triplet excited state. Further, rate constants of spin relaxation and recombination have been studied by the time profiles of MFE at various pH. The drastic change of those two factors has been obtained and can be explained by SOC (spin-orbit coupling) induced back electron-transfer promoted by the formation of a stacking conformation at pH > 2.5.

Electron transport in doped fullerene molecular junctions

NASA Astrophysics Data System (ADS)

Kaur, Milanpreet; Sawhney, Ravinder Singh; Engles, Derick

The effect of doping on the electron transport of molecular junctions is analyzed in this paper. The doped fullerene molecules are stringed to two semi-infinite gold electrodes and analyzed at equilibrium and nonequilibrium conditions of these device configurations. The contemplation is done using nonequilibrium Green’s function (NEGF)-density functional theory (DFT) to evaluate its density of states (DOS), transmission coefficient, molecular orbitals, electron density, charge transfer, current, and conductance. We conclude from the elucidated results that Au-C16Li4-Au and Au-C16Ne4-Au devices behave as an ordinary p-n junction diode and a Zener diode, respectively. Moreover, these doped fullerene molecules do not lose their metallic nature when sandwiched between the pair of gold electrodes.

Molecular orbital studies (hardness, chemical potential, electronegativity and electrophilicity), vibrational spectroscopic investigation and normal coordinate analysis of 5-{1-hydroxy-2-[(propan-2-yl)amino]ethyl}benzene-1,3-diol.

PubMed

Muthu, S; Renuga, S

2014-01-24

FT-IR and FT-Raman spectra of 5-{1-hydroxy-2-[(propan-2-yl) amino] ethyl} benzene-1,3-diol (abbrevi- 54 ated as HPAEBD) were recorded in the region 4000-450 cm(-1) and 4000-100 cm(-1) respectively. The structure of the molecule was optimized and the structural characteristics were determined by density functional theory (B3LYP) and HF method with 6-31 G(d,p) as basis set. The theoretical wave numbers were scaled and compared with experimental FT-IR and FT-Raman spectra. A detailed interpretation of the vibrational spectra of this compound has been made on the basis of the calculated Potential energy distribution (PED). Stability of the molecule arising from hyperconjugation and charge delocalization is confirmed by the natural bond orbital analysis (NBO). The results show that electron density (ED) in the σ antibonding orbitals and E (2) energies confirm the occurrence of intra molecular charge transfer (ICT) within the molecule. The molecule orbital contributions were studied by using the total (TDOS), sum of α and β electron (αβDOS) density of States. Mulliken population analysis of atomic charges is also calculated. The calculated HOMO and LUMO energy gap shows that charge transfer occurs within the molecule. The electron density-based local reactivity descriptors such as Fukui functions were calculated to explain the chemical selectivity or reactivity site in this compound. On the basis of vibrational analyses, the thermodynamic properties of title compound at different temperatures have been calculated. Copyright © 2013 Elsevier B.V. All rights reserved.

Gas phase reaction of nitric acid with hydroxyl radical without and with water. A theoretical investigation.

PubMed

Gonzalez, Javier; Anglada, Josep M

2010-09-02

The gas phase reaction between nitric acid and hydroxyl radical, without and with a single water molecule, has been investigated theoretically using the DFT-B3LYP, MP2, QCISD, and CCSD(T) theoretical approaches with the 6-311+G(2df,2p) and aug-cc-pVTZ basis sets. The reaction without water begins with the formation of a prereactive hydrogen-bonded complex and has several elementary reactions processes. They include proton coupled electron transfer, hydrogen atom transfer, and proton transfer mechanisms, and our kinetic study shows a quite good agreement of the behavior of the rate constant with respect to the temperature and to the pressure with the experimental results from the literature. The addition of a single water molecule results in a much more complex potential energy surface although the different elementary reactions found have the same electronic features that the naked reaction. Two transition states are stabilized by the effect of a hydrogen bond interaction originated by the water molecule, and in the prereactive hydrogen bond region there is a geometrical rearrangement necessary to prepare the HO and HNO(3) moieties to react to each other. This step contributes the reaction to be slower than the reaction without water and explains the experimental finding, pointing out that there is no dependence for the HNO(3) + HO reaction on water vapor.

Time-resolved measurement of intramolecular photoinduced electron transfer processes in perylene diimides (Conference Presentation)

NASA Astrophysics Data System (ADS)

Döring, Robin Carl; Baal, Eduard; Sundermeyer, Jörg; Chatterjee, Sangam

2017-02-01

Perylene-3,4,9,10-tetracarboxylic acid (PTCDA) and respective derivatives (e.g. perylene diimide - PDI) are widely used as dyes but also for device applications such as organic field effect transistors or in organic photovoltaics. Due to their intrinsically high quantum efficiencies they are also used as spectroscopic standards. One major drawback of these materials is their low solubility in organic solvents which can be addressed by long alkyl substitutions. When introducing a tertiary amine into the molecule a mechanism known as photoinduced electron transfer (PET) can occur. Here, following an optically excited HOMO-LUMO transition of the core, an electron from the electron lone pair of the amine is transferred to the HOMO of the perylene core. Hence, radiative recombination is disallowed and photoluminescence effectively quenched. Here, we perform a systematic study of the distance dependence of the PET by introducing alkyle groups as spacer units between PDI core and the tertiary amine. Dynamics of the PET are extracted from ultrafast time-resolved photoluminescence measurement data. A rate equation model, simulating a three level system, reveals rate constant of the back electron transfer, otherwise not accessible with our experimental methods. Assuming a Marcus model of electron transfer, electronic coupling strength between the electronic states involved in the respective transitions can be calculated. In addition to the distance dependence, the effects of protonation and methylation of the the tertiary amine units are studied.

Redox chemistry at liquid/liquid interfaces

NASA Technical Reports Server (NTRS)

Volkov, A. G.; Deamer, D. W.

1997-01-01

The interface between two immiscible liquids with immobilized photosynthetic pigments can serve as the simplest model of a biological membrane convenient for the investigation of photoprocesses accompanied by spatial separation of charges. As it follows from thermodynamics, if the resolvation energies of substrates and products are very different, the interface between two immiscible liquids may act as a catalyst. Theoretical aspects of charge transfer reactions at oil/water interfaces are discussed. Conditions under which the free energy of activation of the interfacial reaction of electron transfer decreases are established. The activation energy of electron transfer depends on the charges of the reactants and dielectric permittivity of the non-aqueous phase. This can be useful when choosing a pair of immiscible solvents to decrease the activation energy of the reaction in question or to inhibit an undesired process. Experimental interfacial catalytic systems are discussed. Amphiphilic molecules such as chlorophyll or porphyrins were studied as catalysts of electron transfer reactions at the oil/water interface.

Vibronic transitions in the alkali-metal (Li, Na, K, Rb) - alkaline-earth-metal (Ca, Sr) series: A systematic analysis of de-excitation mechanisms based on the graphical mapping of Frank-Condon integrals

NASA Astrophysics Data System (ADS)

Pototschnig, Johann V.; Meyer, Ralf; Hauser, Andreas W.; Ernst, Wolfgang E.

2017-02-01

Research on ultracold molecules has seen a growing interest recently in the context of high-resolution spectroscopy and quantum computation. After forming weakly bound molecules from atoms in cold collisions, the preparation of molecules in low vibrational levels of the ground state is experimentally challenging, and typically achieved by population transfer using excited electronic states. Accurate potential energy surfaces are needed for a correct description of processes such as the coherent de-excitation from the highest and therefore weakly bound vibrational levels in the electronic ground state via couplings to electronically excited states. This paper is dedicated to the vibrational analysis of potentially relevant electronically excited states in the alkali-metal (Li, Na, K, Rb)- alkaline-earth metal (Ca,Sr) diatomic series. Graphical maps of Frank-Condon overlap integrals are presented for all molecules of the group. By comparison to overlap graphics produced for idealized potential surfaces, we judge the usability of the selected states for future experiments on laser-enhanced molecular formation from mixtures of quantum degenerate gases.

Towards quantification of vibronic coupling in photosynthetic antenna complexes

NASA Astrophysics Data System (ADS)

Singh, V. P.; Westberg, M.; Wang, C.; Dahlberg, P. D.; Gellen, T.; Gardiner, A. T.; Cogdell, R. J.; Engel, G. S.

2015-06-01

Photosynthetic antenna complexes harvest sunlight and efficiently transport energy to the reaction center where charge separation powers biochemical energy storage. The discovery of existence of long lived quantum coherence during energy transfer has sparked the discussion on the role of quantum coherence on the energy transfer efficiency. Early works assigned observed coherences to electronic states, and theoretical studies showed that electronic coherences could affect energy transfer efficiency—by either enhancing or suppressing transfer. However, the nature of coherences has been fiercely debated as coherences only report the energy gap between the states that generate coherence signals. Recent works have suggested that either the coherences observed in photosynthetic antenna complexes arise from vibrational wave packets on the ground state or, alternatively, coherences arise from mixed electronic and vibrational states. Understanding origin of coherences is important for designing molecules for efficient light harvesting. Here, we give a direct experimental observation from a mutant of LH2, which does not have B800 chromophores, to distinguish between electronic, vibrational, and vibronic coherence. We also present a minimal theoretical model to characterize the coherences both in the two limiting cases of purely vibrational and purely electronic coherence as well as in the intermediate, vibronic regime.

Raman spectroelectrochemistry of molecules within individual electromagnetic hot spots.

PubMed

Shegai, Timur; Vaskevich, Alexander; Rubinstein, Israel; Haran, Gilad

2009-10-14

The role of chemical enhancement in surface-enhanced Raman scattering (SERS) remains a contested subject. We study SERS spectra of 4-mercaptopyridine molecules excited far from the molecular resonance, which are collected from individual electromagnetic hot spots at concentrations close to the single-molecule limit. The hot spots are created by depositing Tollen's silver island films on a transparent electrode incorporated within an electrochemical cell. Analysis of the intensity of the spectra relative to those obtained from individual rhodamine 6G molecules on the same surface provides a lower limit of approximately 3 orders of magnitude for the chemical enhancement. This large enhancement is likely to be due to a charge transfer resonance involving the transfer of an electron from the metal to an adsorbed molecule. Excitation at three different wavelengths, as well as variation of electrode potential from 0 to -1.2 V, lead to significant changes in the relative intensities of bands in the spectrum. It is suggested that while the bulk of the enhancement is due to an Albrecht A-term resonance Raman effect (involving the charge transfer transition), vibronic coupling provides additional enhancement which is sensitive to electrode potential. The measurement of potential-dependent SERS spectra from individual hot spots opens the way to a thorough characterization of chemical enhancement, as well to studies of redox phenomena at the single-molecule level.

Electron transport in NH3/NO2 sensed buckled antimonene

NASA Astrophysics Data System (ADS)

Srivastava, Anurag; Khan, Md. Shahzad; Ahuja, Rajeev

2018-04-01

The structural and electronic properties of buckled antimonene have been analysed using density functional theory based ab-initio approach. Geometrical parameters in terms of bond length and bond angle are found close to the single ruffle mono-layer of rhombohedral antimony. Inter-frontier orbital analyses suggest localization of lone pair electrons at each atomic centre. Phonon dispersion along with high symmetry point of Brillouin zone does not signify any soft mode. With an electronic band gap of 1.8eV, the quasi-2D nano-surface has been further explored for NH3/NO2 molecules sensing and qualities of interaction between NH3/NO2 gas and antimonene scrutinized in terms of electronic charges transfer. A current-voltage characteristic has also been analysed, using Non Equilibrium Green's function (NEGF), for antimonene, in presence of incoming NH3/NO2 molecules.

Microhydration Prevents Fragmentation of Uracil and Thymine by Low-Energy Electrons.

PubMed

Kočišek, J; Pysanenko, A; Fárník, M; Fedor, J

2016-09-01

When ionizing radiation passes biological matter, a large number of secondary electrons with very low energies (<3 eV) is produced. It is known that such electrons cause an efficient fragmentation of isolated nucleobases via dissociative electron attachment. We present an experimental study of the electron attachment to microhydrated nucleobases. Our novel approach allows significant control over the hydration of molecules studied in the molecular beam. We directly show for the first time that the presence of a few water molecules suppresses the dissociative channel and leads exclusively to formation of intact molecular and hydrated anions. The suppression of fragmentation is ascribed to caging-like effects and fast energy transfer to the solvent. This is in contrast with theoretical prediction that microhydration strongly enhances the fragmentation of nucleobases. The current observation impacts mechanisms of reductive DNA strand breaks proposed to date on the basis of gas-phase experiments.

High-order above-threshold dissociation of molecules.

PubMed

Lu, Peifen; Wang, Junping; Li, Hui; Lin, Kang; Gong, Xiaochun; Song, Qiying; Ji, Qinying; Zhang, Wenbin; Ma, Junyang; Li, Hanxiao; Zeng, Heping; He, Feng; Wu, Jian

2018-02-27

Electrons bound to atoms or molecules can simultaneously absorb multiple photons via the above-threshold ionization featured with discrete peaks in the photoelectron spectrum on account of the quantized nature of the light energy. Analogously, the above-threshold dissociation of molecules has been proposed to address the multiple-photon energy deposition in the nuclei of molecules. In this case, nuclear energy spectra consisting of photon-energy spaced peaks exceeding the binding energy of the molecular bond are predicted. Although the observation of such phenomena is difficult, this scenario is nevertheless logical and is based on the fundamental laws. Here, we report conclusive experimental observation of high-order above-threshold dissociation of H 2 in strong laser fields where the tunneling-ionized electron transfers the absorbed multiphoton energy, which is above the ionization threshold to the nuclei via the field-driven inelastic rescattering. Our results provide an unambiguous evidence that the electron and nuclei of a molecule as a whole absorb multiple photons, and thus above-threshold ionization and above-threshold dissociation must appear simultaneously, which is the cornerstone of the nowadays strong-field molecular physics. Copyright © 2018 the Author(s). Published by PNAS.

Effects of Charge-Transfer Excitons on the Photophysics of Organic Semiconductors

NASA Astrophysics Data System (ADS)

Hestand, Nicholas J.

The field of organic electronics has received considerable attention over the past several years due to the promise of novel electronic materials that are cheap, flexible and light weight. While some devices based on organic materials have already emerged on the market (e.g. organic light emitting diodes), a deeper understanding of the excited states within the condensed phase is necessary both to improve current commercial products and to develop new materials for applications that are currently in the commercial pipeline (e.g. organic photovoltaics, wearable displays, and field effect transistors). To this end, a model for pi-conjugated molecular aggregates and crystals is developed and analyzed. The model considers two types of electronic excitations, namely Frenkel and charge-transfer excitons, both of which play a prominent role in determining the nature of the excited states within tightly-packed organic systems. The former consist of an electron-hole pair bound to the same molecule while in the later the electron and hole are located on different molecules. The model also considers the important nuclear reorganization that occurs when the system switches between electronic states. This is achieved using a Holstein-style Hamiltonian that includes linear vibronic coupling of the electronic states to the nuclear motion associated with the high frequency vinyl-stretching and ring-breathing modes. Analysis of the model reveals spectroscopic signatures of charge-transfer mediated J- and H-aggregation in systems where the photophysical properties are determined primarily by charge-transfer interactions. Importantly, such signatures are found to be sensitive to the relative phase of the intermolecular electron and hole transfer integrals, and the relative energy of the Frenkel and charge-transfer states. When the charge-transfer integrals are in phase and the energy of the charge-transfer state is higher than the Frenkel state, the system exhibits J-aggregate characteristics including a positive band curvature, a red shifted main absorption peak, and an increase in the ratio of the first two vibronic peaks relative to the monomer. On the other hand, when the charge-transfer integrals are out of phase and the energy of the charge-transfer state is higher than the Frenkel state, the system exhibits H-aggregate characteristics including a negative band curvature, a blue shifted main absorption peak, and a decrease in the ratio of the first two vibronic peaks relative to the monomer. Notably, these signatures are consistent with those exhibited by Coulombically coupled J- and H-aggregates. Additional signatures of charge-transfer J- and H-aggregation are also discovered, the most notable of which is the appearance of a second absorption band when the charge-transfer integrals are in phase and the charge-transfer and Frenkel excitons are near resonance. In such instances, the peak-to-peak spacing is found to be proportional to the sum of the electron and hole transfer integrals. Further analysis of the charge-transfer interactions within the context of an effective Frenkel exciton coupling reveals that the charge-transfer interactions interfere directly with the intermolecular Coulombic coupling. The interference can be either constructive or destructive resulting in either enhanced or suppressed J- or H- aggregate behavior relative to what is expected based on Coulombic coupling alone. Such interferences result in four new aggregate types, namely HH-, HJ-, JH-, and JJ-aggregates, where the first letter indicates the nature of the Coulombic coupling and the second indicates the nature of the charge-transfer coupling. Vibronic signatures of such aggregates are developed and provide a means by which to rapidly screen materials for certain electronic characteristics. Notably, a large total (Coulombic plus charge-transfer) exciton coupling is associated with an absorption spectrum in which the ratio of the first two vibronic peaks deviates significantly from that of the unaggregated monomer. Hence, strongly coupled, high exciton mobility aggregates can be readily distinguished from low mobility aggregates by the ratio of their first two vibronic peaks. (Abstract shortened by ProQuest.).

Substrate dependence of electron-stimulated O - yields from dissociative electron attachment to physisorbed O2

NASA Astrophysics Data System (ADS)

Huels, M. A.; Parenteau, L.; Sanche, L.

1994-03-01

We present measurements of O- electron stimulated desorption yields obtained under identical experimental conditions from 0.15 monolayers (ML) of O2 deposited onto disordered substrates consisting of 4 ML of either Kr, Xe, C2H6, C2H4, N2O, CH3Cl, or H2O, all condensed on Pt (polycrystalline). The resulting O- yield functions, for incident electron energies below 20 eV, are compared to that obtained from the O2/Kr solid; this allows us to assess the order of magnitude effects of the local substrate environment on dissociative electron attachment (DEA) via the 2Πu and gas phase forbidden 2Σ+g,u resonances of O-2. We note that, in addition to electron energy losses in the substrate prior to DEA to O2 and post-dissociation interactions of the O- with the substrate molecules, charge or energy transfer from the O-2 transient anion to a substrate molecule, and capture of the incident electron into a dissociative anion resonance of the substrate molecule may contribute to a reduced O- yield from the physisorbed O2. In the case of O2 deposited on amorphous ice, we find that the O- signal from DEA to O2 is completely absent for electron energies below 14 eV; we attribute this to a complete quenching of the dissociative O-2(2Πu, 2Σ+) resonances by the adjacent water molecules.

Interaction between NADH and electron-transferring flavoprotein from Megasphaera elsdenii.

PubMed

Sato, Kyosuke; Nishina, Yasuzo; Shiga, Kiyoshi

2013-06-01

Electron-transferring flavoprotein (ETF) from the anaerobic bacterium Megasphaera elsdenii is a heterodimer containing two FAD cofactors. Isolated ETF contains only one FAD molecule, FAD-1, because the other, FAD-2, is lost during purification. FAD-2 is recovered by adding FAD to the isolated ETF. The two FAD molecules in holoETF were characterized using NADH. Spectrophotometric titration of isolated ETF with NADH showed a two-electron reduction of FAD-1 according to a monophasic profile indicating that FAD-1 receives electrons from NADH without involvement of FAD-2. When holoETF was titrated with NADH, FAD-2 was reduced to an anionic semiquinone and then was fully reduced before the reduction of FAD-1. The midpoint potential values at pH 7 were +81, -136 and -279 mV for the reduction of oxidized FAD-2 to semiquinone, semiquinone to the fully reduced FAD-2 and the two-electron reduction of FAD-1, respectively. Both FAD-1 and FAD-2 in holoETF were reduced by excess NADH very rapidly. The reduction of FAD-2 was slowed by replacement of FAD-1 with 8-cyano-FAD indicating that FAD-2 receives electrons from FAD-1 but not from NADH directly. The present results suggest that FAD-2 is the counterpart of the FAD in human ETF, which contains one FAD and one AMP.

Electronic, structural and chemical effects of charge-transfer at organic/inorganic interfaces

NASA Astrophysics Data System (ADS)

Otero, R.; Vázquez de Parga, A. L.; Gallego, J. M.

2017-07-01

During the last decade, interest on the growth and self-assembly of organic molecular species on solid surfaces spread over the scientific community, largely motivated by the promise of cheap, flexible and tunable organic electronic and optoelectronic devices. These efforts lead to important advances in our understanding of the nature and strength of the non-bonding intermolecular interactions that control the assembly of the organic building blocks on solid surfaces, which have been recently reviewed in a number of excellent papers. To a large extent, such studies were possible because of a smart choice of model substrate-adsorbate systems where the molecule-substrate interactions were purposefully kept low, so that most of the observed supramolecular structures could be understood simply by considering intermolecular interactions, keeping the role of the surface always relatively small (although not completely negligible). On the other hand, the systems which are more relevant for the development of organic electronic devices include molecular species which are electron donors, acceptors or blends of donors and acceptors. Adsorption of such organic species on solid surfaces is bound to be accompanied by charge-transfer processes between the substrate and the adsorbates, and the physical and chemical properties of the molecules cannot be expected any longer to be the same as in solution phase. In recent years, a number of groups around the world have started tackling the problem of the adsorption, self- assembly and electronic and chemical properties of organic species which interact rather strongly with the surface, and for which charge-transfer must be considered. The picture that is emerging shows that charge transfer can lead to a plethora of new phenomena, from the development of delocalized band-like electron states at molecular overlayers, to the existence of new substrate-mediated intermolecular interactions or the strong modification of the chemical reactivity of the adsorbates. The aim of this review is to start drawing general conclusions and developing new concepts which will help the scientific community to proceed more efficiently towards the understanding of organic/inorganic interfaces in the strong interaction limit, where charge-transfer effects must be taken into consideration.

Visible light water splitting using dye-sensitized oxide semiconductors.

PubMed

Youngblood, W Justin; Lee, Seung-Hyun Anna; Maeda, Kazuhiko; Mallouk, Thomas E

2009-12-21

Researchers are intensively investigating photochemical water splitting as a means of converting solar to chemical energy in the form of fuels. Hydrogen is a key solar fuel because it can be used directly in combustion engines or fuel cells, or combined catalytically with CO(2) to make carbon containing fuels. Different approaches to solar water splitting include semiconductor particles as photocatalysts and photoelectrodes, molecular donor-acceptor systems linked to catalysts for hydrogen and oxygen evolution, and photovoltaic cells coupled directly or indirectly to electrocatalysts. Despite several decades of research, solar hydrogen generation is efficient only in systems that use expensive photovoltaic cells to power water electrolysis. Direct photocatalytic water splitting is a challenging problem because the reaction is thermodynamically uphill. Light absorption results in the formation of energetic charge-separated states in both molecular donor-acceptor systems and semiconductor particles. Unfortunately, energetically favorable charge recombination reactions tend to be much faster than the slow multielectron processes of water oxidation and reduction. Consequently, visible light water splitting has only recently been achieved in semiconductor-based photocatalytic systems and remains an inefficient process. This Account describes our approach to two problems in solar water splitting: the organization of molecules into assemblies that promote long-lived charge separation, and catalysis of the electrolysis reactions, in particular the four-electron oxidation of water. The building blocks of our artificial photosynthetic systems are wide band gap semiconductor particles, photosensitizer and electron relay molecules, and nanoparticle catalysts. We intercalate layered metal oxide semiconductors with metal nanoparticles. These intercalation compounds, when sensitized with [Ru(bpy)(3)](2+) derivatives, catalyze the photoproduction of hydrogen from sacrificial electron donors (EDTA(2-)) or non-sacrificial donors (I(-)). Through exfoliation of layered metal oxide semiconductors, we construct multilayer electron donor-acceptor thin films or sensitized colloids in which individual nanosheets mediate light-driven electron transfer reactions. When sensitizer molecules are "wired" to IrO(2).nH(2)O nanoparticles, a dye-sensitized TiO(2) electrode becomes the photoanode of a water-splitting photoelectrochemical cell. Although this system is an interesting proof-of-concept, the performance of these cells is still poor (approximately 1% quantum yield) and the dye photodegrades rapidly. We can understand the quantum efficiency and degradation in terms of competing kinetic pathways for water oxidation, back electron transfer, and decomposition of the oxidized dye molecules. Laser flash photolysis experiments allow us to measure these competing rates and, in principle, to improve the performance of the cell by changing the architecture of the electron transfer chain.

Physical stage of photosynthesis charge separation

NASA Astrophysics Data System (ADS)

Yakovlev, A. G.; Shuvalov, V. A.

2016-06-01

An analytical review is given concerning the biophysical aspects of light-driven primary charge separation in photosynthesis reaction centers (RCs) which are special pigment-protein complexes residing in a cell membrane. The primary (physical) stage of charge separation occurs in the pico- and femtosecond ranges and consists of transferring an electron along the active A-branch of pigments. The review presents vast factual material on both the general issues of primary photosynthesis and some more specific topics, including (1) the role of the inactive B-branch of pigments, (2) the effect of the protein environment on the charge separation, and (3) the participation of monomeric bacteriochlorophyll BA in primary electron acceptance. It is shown that the electron transfer and stabilization are strongly influenced by crystallographic water and tyrosine M210 molecules from the nearest environment of BA. A linkage between collective nuclear motions and electron transfer upon charge separation is demonstrated. The nature of the high quantum efficiency of primary charge separation reactions is discussed.

CuPc/Au(1 1 0): Determination of the azimuthal alignment by a combination of angle-resolved photoemission and density functional theory

PubMed Central

Lüftner, Daniel; Milko, Matus; Huppmann, Sophia; Scholz, Markus; Ngyuen, Nam; Wießner, Michael; Schöll, Achim; Reinert, Friedrich; Puschnig, Peter

2014-01-01

Here we report on a combined experimental and theoretical study on the structural and electronic properties of a monolayer of Copper-Phthalocyanine (CuPc) on the Au(1 1 0) surface. Low-energy electron diffraction reveals a commensurate overlayer unit cell containing one adsorbate species. The azimuthal alignment of the CuPc molecule is revealed by comparing experimental constant binding energy (kxky)-maps using angle-resolved photoelectron spectroscopy with theoretical momentum maps of the free molecule's highest occupied molecular orbital (HOMO). This structural information is confirmed by total energy calculations within the framework of van-der-Waals corrected density functional theory. The electronic structure is further analyzed by computing the molecule-projected density of states, using both a semi-local and a hybrid exchange-correlation functional. In agreement with experiment, the HOMO is located about 1.2 eV below the Fermi-level, while there is no significant charge transfer into the molecule and the CuPc LUMO remains unoccupied on the Au(1 1 0) surface. PMID:25284953

Reduced Charge Transfer Exciton Recombination in Organic Semiconductor Heterojunctions by Molecular Doping

NASA Astrophysics Data System (ADS)

Deschler, Felix; da Como, Enrico; Limmer, Thomas; Tautz, Raphael; Godde, Tillmann; Bayer, Manfred; von Hauff, Elizabeth; Yilmaz, Seyfullah; Allard, Sybille; Scherf, Ullrich; Feldmann, Jochen

2011-09-01

We investigate the effect of molecular doping on the recombination of electrons and holes localized at conjugated-polymer-fullerene interfaces. We demonstrate that a low concentration of p-type dopant molecules (<4% weight) reduces the interfacial recombination via charge transfer excitons and results in a favored formation of separated carriers. This is observed by the ultrafast quenching of photoluminescence from charge transfer excitons and the increase in photoinduced polaron density by ˜70%. The results are consistent with a reduced formation of emissive charge transfer excitons, induced by state filling of tail states.

Controlling molecular condensation/diffusion of copper phthalocyanine by local electric field induced with scanning tunneling microscope tip

NASA Astrophysics Data System (ADS)

Nagaoka, Katsumi; Yaginuma, Shin; Nakayama, Tomonobu

2018-02-01

We have discovered the condensation/diffusion phenomena of copper phthalocyanine (CuPc) molecules controlled with a pulsed electric field induced by the scanning tunneling microscope tip. This behavior is not explained by the conventional induced dipole model. In order to understand the mechanism, we have measured the electronic structure of the molecule by tunneling spectroscopy and also performed theoretical calculations on molecular orbitals. These data clearly indicate that the molecule is positively charged owing to charge transfer to the substrate, and that hydrogen bonding exists between CuPc molecules, which makes the molecular island stable.

Site energies and charge transfer rates near pentacene grain boundaries from first-principles calculations

NASA Astrophysics Data System (ADS)

Kobayashi, Hajime; Tokita, Yuichi

2015-03-01

Charge transfer rates near pentacene grain boundaries are derived by calculating the site energies and transfer integrals of 37 pentacene molecules using first-principles calculations. The site energies decrease considerably near the grain boundaries, and electron traps of up to 300 meV and hole barriers of up to 400 meV are generated. The charge transfer rates across the grain boundaries are found to be reduced by three to five orders of magnitude with a grain boundary gap of 4 Å because of the reduction in the transfer integrals. The electron traps and hole barriers also reduce the electron and hole transfer rates by factors of up to 10 and 50, respectively. It is essential to take the site energies into consideration to determine charge transport near the grain boundaries. We show that the complex site energy distributions near the grain boundaries can be represented by an equivalent site energy difference, which is a constant for any charge transfer pass. When equivalent site energy differences are obtained for various grain boundary structures by first-principles calculations, the effects of the grain boundaries on the charge transfer rates are introduced exactly into charge transport simulations, such as the kinetic Monte Carlo method.

Sensitive and Specific Guest Recognition through Pyridinium-Modification in Spindle-Like Coordination Containers.

PubMed

Bhuvaneswari, Nagarajan; Dai, Feng-Rong; Chen, Zhong-Ning

2018-05-02

An elaborately designed pyridinium-functionalized octanuclear zinc(II) coordination container 1-Zn was prepared through the self-assembly of Zn 2+ , p-tert-butylsulfonylcalix[4]arene, and pyridinium-functionalized angular flexible dicarboxylate linker (H 2 BrL1). The structure was determined by a single-crystal X-ray diffractometer. 1-Zn displays highly sensitive and specific recognition to 2-picolylamine as revealed by drastic blueshifts of the absorption and emission spectra, ascribed to the decrease of intramolecular charge transfer (ICT) character of the container and the occurrence of intermolecular charge transfer between the host and guest molecules. The intramolecular charge transfer plays a key role in the modulation of the electronic properties and is tunable through endo-encapsulation of specific guest molecules. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Conversion and origin of normal and abnormal temperature dependences of kinetic isotope effect in hydride transfer reactions.

PubMed

Zhu, Xiao-Qing; Li, Xiu-Tao; Han, Su-Hui; Mei, Lian-Rui

2012-05-18

The effects of substituents on the temperature dependences of kinetic isotope effect (KIE) for the reactions of the hydride transfer from the substituted 5-methyl-6-phenyl-5,6-dihydrophenanthridine (G-PDH) to thioxanthylium (TX(+)) in acetonitrile were examined, and the results show that the temperature dependences of KIE for the hydride transfer reactions can be converted by adjusting the nature of the substituents in the molecule of the hydride donor. In general, electron-withdrawing groups can make the KIE to have normal temperature dependence, but electron-donating groups can make the KIE to have abnormal temperature dependence. Thermodynamic analysis on the possible pathways of the hydride transfer from G-PDH to TX(+) in acetonitrile suggests that the transfers of the hydride anion in the reactions are all carried out by the concerted one-step mechanism whether the substituent is an electron-withdrawing group or an electron-donating group. But the examination of Hammett-type free energy analysis on the hydride transfer reactions supports that the concerted one-step hydride transfer is not due to an elementary chemical reaction. The experimental values of KIE at different temperatures for the hydride transfer reactions were modeled by using a kinetic equation formed according to a multistage mechanism of the hydride transfer including a returnable charge-transfer complex as the reaction intermediate; the real mechanism of the hydride transfer and the root that why the temperature dependences of KIE can be converted as the nature of the substituents are changed were discovered.

The derivative discontinuity of the exchange-correlation functional.

PubMed

Mori-Sánchez, Paula; Cohen, Aron J

2014-07-28

The derivative discontinuity is a key concept in electronic structure theory in general and density functional theory in particular. The electronic energy of a quantum system exhibits derivative discontinuities with respect to different degrees of freedom that are a consequence of the integer nature of electrons. The classical understanding refers to the derivative discontinuity of the total energy as a function of the total number of electrons (N), but it can also manifest at constant N. Examples are shown in models including several hydrogen systems with varying numbers of electrons or nuclear charge (Z), as well as the 1-dimensional Hubbard model (1DHM). Two sides of the problem are investigated: first, the failure of currently used approximate exchange-correlation functionals in DFT and, second, the importance of the derivative discontinuity in the exact electronic structure of molecules, as revealed by full configuration interaction (FCI). Currently, all approximate functionals, including hybrids, miss the derivative discontinuity, leading to basic errors that can be seen in many ways: from the complete failure to give the total energy of H2 and H2(+), to the missing gap in Mott insulators such as stretched H2 and the thermodynamic limit of the 1DHM, or a qualitatively incorrect density in the HZ molecule with two electrons and incorrect electron transfer processes. Description of the exact particle behaviour of electrons is emphasised, which is key to many important physical processes in real systems, especially those involving electron transfer, and offers a challenge for the development of new exchange-correlation functionals.

Intermolecular electron transfer from intramolecular excitation and coherent acoustic phonon generation in a hydrogen-bonded charge-transfer solid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rury, Aaron S., E-mail: arury@usc.edu; Sorenson, Shayne; Dawlaty, Jahan M.

2016-03-14

Organic materials that produce coherent lattice phonon excitations in response to external stimuli may provide next generation solutions in a wide range of applications. However, for these materials to lead to functional devices in technology, a full understanding of the possible driving forces of coherent lattice phonon generation must be attained. To facilitate the achievement of this goal, we have undertaken an optical spectroscopic study of an organic charge-transfer material formed from the ubiquitous reduction-oxidation pair hydroquinone and p-benzoquinone. Upon pumping this material, known as quinhydrone, on its intermolecular charge transfer resonance as well as an intramolecular resonance of p-benzoquinone,more » we find sub-cm{sup −1} oscillations whose dispersion with probe energy resembles that of a coherent acoustic phonon that we argue is coherently excited following changes in the electron density of quinhydrone. Using the dynamical information from these ultrafast pump-probe measurements, we find that the fastest process we can resolve does not change whether we pump quinhydrone at either energy. Electron-phonon coupling from both ultrafast coherent vibrational and steady-state resonance Raman spectroscopies allows us to determine that intramolecular electronic excitation of p-benzoquinone also drives the electron transfer process in quinhydrone. These results demonstrate the wide range of electronic excitations of the parent of molecules found in many functional organic materials that can drive coherent lattice phonon excitations useful for applications in electronics, photonics, and information technology.« less

Intermolecular electron transfer from intramolecular excitation and coherent acoustic phonon generation in a hydrogen-bonded charge-transfer solid

NASA Astrophysics Data System (ADS)

Rury, Aaron S.; Sorenson, Shayne; Dawlaty, Jahan M.

2016-03-01

Organic materials that produce coherent lattice phonon excitations in response to external stimuli may provide next generation solutions in a wide range of applications. However, for these materials to lead to functional devices in technology, a full understanding of the possible driving forces of coherent lattice phonon generation must be attained. To facilitate the achievement of this goal, we have undertaken an optical spectroscopic study of an organic charge-transfer material formed from the ubiquitous reduction-oxidation pair hydroquinone and p-benzoquinone. Upon pumping this material, known as quinhydrone, on its intermolecular charge transfer resonance as well as an intramolecular resonance of p-benzoquinone, we find sub-cm-1 oscillations whose dispersion with probe energy resembles that of a coherent acoustic phonon that we argue is coherently excited following changes in the electron density of quinhydrone. Using the dynamical information from these ultrafast pump-probe measurements, we find that the fastest process we can resolve does not change whether we pump quinhydrone at either energy. Electron-phonon coupling from both ultrafast coherent vibrational and steady-state resonance Raman spectroscopies allows us to determine that intramolecular electronic excitation of p-benzoquinone also drives the electron transfer process in quinhydrone. These results demonstrate the wide range of electronic excitations of the parent of molecules found in many functional organic materials that can drive coherent lattice phonon excitations useful for applications in electronics, photonics, and information technology.

Organic molecules on metal and oxide semiconductor substrates: Adsorption behavior and electronic energy level alignment

NASA Astrophysics Data System (ADS)

Ruggieri, Charles M.

Modern devices such as organic light emitting diodes use organic/oxide and organic/metal interfaces for crucial processes such as charge injection and charge transfer. Understanding fundamental physical processes occurring at these interfaces is essential to improving device performance. The ultimate goal of studying such interfaces is to form a predictive model of interfacial interactions, which has not yet been established. To this end, this thesis focuses on obtaining a better understanding of fundamental physical interactions governing molecular self-assembly and electronic energy level alignment at organic/metal and organic/oxide interfaces. This is accomplished by investigating both the molecular adsorption geometry using scanning tunneling microscopy, as well as the electronic structure at the interface using direct and inverse photoemission spectroscopy, and analyzing the results in the context of first principles electronic structure calculations. First, we study the adsorption geometry of zinc tetraphenylporphyrin (ZnTPP) molecules on three noble metal surfaces: Au(111), Ag(111), and Ag(100). These surfaces were chosen to systematically compare the molecular self-assembly and adsorption behavior on two metals of the same surface symmetry and two surface symmetries of one metal. From this investigation, we improve the understanding of self-assembly at organic/metal interfaces and the relative strengths of competing intermolecular and molecule-substrate interactions that influence molecular adsorption geometry. We then investigate the electronic structure of the ZnTPP/Au(111), Ag(111), and Ag(100) interfaces as examples of weakly-interacting systems. We compare these cases to ZnTPP on TiO2(110), a wide-bandgap oxide semiconductor, and explain the intermolecular and molecule-substrate interactions that determine the electronic energy level alignment at the interface. Finally we study tetracyanoquinodimethane (TCNQ), a strong electron acceptor, on TiO2(110), which exhibits chemical hybridization accompanied by molecular distortion, as well as extreme charge transfer resulting in the development of a space charge layer in the oxide. Thus, we present a broad experimental and theoretical perspective on the study of organic/metal and organic/oxide interfaces, elucidating fundamental physical interactions that govern molecular organization and energy level alignment.

Tungsten Hydride Phosphorus- and Arsenic-Bearing Molecules with Double and Triple W-P and W-As Bonds.

PubMed

Andrews, Lester; Cho, Han-Gook; Fang, Zongtang; Vasiliu, Monica; Dixon, David A

2018-05-07

Laser ablation of tungsten metal provides W atoms which react with phosphine and arsine during condensation in excess argon and neon, leading to major new infrared (IR) absorptions. Annealing, UV irradiation, and deuterium substitution experiments coupled with electronic structure calculations at the density functional theory level led to the assignment of the observed IR absorptions to the E≡WH 3 and HE═WH 2 molecules for E = P and As. The potential energy surfaces for hydrogen transfer from PH 3 to the W were calculated at the coupled-cluster CCSD(T)/complete basis set level. Additional weak bands in the phosphide and arsenide W-H stretching region are assigned to the molecules with loss of H from W, E≡WH 2 . The electronic structure calculations show that the E≡WH 3 molecules have a W-E triple bond, the HE═WH 2 molecules have a W-E double bond, and the H 2 E-WH molecules have a W-E single bond. The formation of multiple E-W bonds leads to increasing stability for the isomers.

Understanding Local and Macroscopic Electron Mobilities in the Fullerene Network of Conjugated Polymer-based Solar Cells. Time-Resolved Microwave Conductivity and Theory

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aguirre, Jordan C.; Arntsen, Christopher D.; Hernandez, Samuel

2013-09-23

The efficiency of bulk heterojunction (BHJ) organic photovoltaics is sensitive to the morphology of the fullerene network that transports electrons through the device. This sensitivity makes it difficult to distinguish the contrasting roles of local electron mobility (how easily electrons can transfer between neighboring fullerene molecules) and macroscopic electron mobility (how well-connected is the fullerene network on device length scales) in solar cell performance. In this work, a combination of density functional theory (DFT) calculations, flash-photolysis time-resolved microwave conductivity (TRMC) experiments, and space-charge-limit current (SCLC) mobility estimates are used to examine the roles of local and macroscopic electron mobility inmore » conjugated polymer/fullerene BHJ photovoltaics. The local mobility of different pentaaryl fullerene derivatives (so-called ‘shuttlecock’ molecules) is similar, so that differences in solar cell efficiency and SCLC mobilities result directly from the different propensities of these molecules to self-assemble on macroscopic length scales. These experiments and calculations also demonstrate that the local mobility of phenyl-C60 butyl methyl ester (PCBM) is an order of magnitude higher than that of other fullerene derivatives, explaining why PCBM has been the acceptor of choice for conjugated polymer BHJ devices even though it does not form an optimal macroscopic network. The DFT calculations indicate that PCBM's superior local mobility comes from the near-spherical nature of its molecular orbitals, which allow strong electronic coupling between adjacent molecules. In combination, DFT and TRMC techniques provide a tool for screening new fullerene derivatives for good local mobility when designing new molecules that can improve on the macroscopic electron mobility offered by PCBM.« less

Quantum electron tunneling in respiratory complex I.

PubMed

Hayashi, Tomoyuki; Stuchebrukhov, Alexei A

2011-05-12

We have simulated the atomistic details of electronic wiring of all Fe/S clusters in complex I, a key enzyme in the respiratory electron transport chain. The tunneling current theory of many-electron systems is applied to the broken-symmetry (BS) states of the protein at the ZINDO level. While the one-electron tunneling approximation is found to hold in electron tunneling between the antiferromagnetic binuclear and tetranuclear Fe/S clusters without major orbital or spin rearrangement of the core electrons, induced polarization of the core electrons contributes significantly to decrease the electron transfer rates to 19-56 %. Calculated tunneling energy is about 3 eV higher than Fermi level in the band gap of the protein, which supports that the mechanism of electron transfer is quantum mechanical tunneling, as in the rest of the electron transport chain. Resulting electron tunneling pathways consist of up to three key contributing protein residues between neighboring Fe/S clusters. A signature of the wave properties of electrons is observed as distinct quantum interferences when multiple tunneling pathways exist. In N6a-N6b, electron tunnels along different pathways depending on the involved BS states, suggesting possible fluctuations of the tunneling pathways driven by the local protein environment. The calculated distance dependence of the electron transfer rates with internal water molecules included is in good agreement with a reported phenomenological relation.

Characterization of 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide ([Emim][Tf2N])∕TX-100∕cyclohexane ternary microemulsion: investigation of photoinduced electron transfer in this RTIL containing microemulsion.

PubMed

Sarkar, Souravi; Pramanik, Rajib; Ghatak, Chiranjib; Rao, Vishal Govind; Sarkar, Nilmoni

2011-02-21

In this study we have characterized a ionic liquid 1-ethyl-3-methylimidazolium bis(trifluoromethyl- sulfonyl)imide containing ternary nonaqueous microemulsion ([Emim][Tf(2)N]∕∕TX-100∕cyclo- hexane). The phase behavior and dynamic light scattering study show that the [Emim][Tf(2)N]∕TX-100∕cyclohexane three component system can form microemulsion with [Emim][Tf(2)N] as polar core at suitable condition. We have investigated photoinduced electron transfer (PET) using dimethyl aniline as electron donor and several Coumarin dyes as electron acceptor molecules at two different R values (R = [ionic liquid]∕[surfactant]) to observe how the dynamics of the PET rate is affected in this type of confined microenvironment compared to that of the PET dynamics in neat ionic liquid and other pure solvent media. The plot of observed k(q) values with the free energy change (ΔG(0)) for electron transfer reaction shows an apparent inversion in the observed rate as predicted by the Marcus theory.

Monitoring the Reaction Process During the S2 → S3 Transition in Photosynthetic Water Oxidation Using Time-Resolved Infrared Spectroscopy.

PubMed

Sakamoto, Hiroki; Shimizu, Tatsuki; Nagao, Ryo; Noguchi, Takumi

2017-02-08

Photosynthetic water oxidation performed at the Mn 4 CaO 5 cluster in photosystem II plays a crucial role in energy production as electron and proton sources necessary for CO 2 fixation. Molecular oxygen, a byproduct, is a source of the oxygenic atmosphere that sustains life on earth. However, the molecular mechanism of water oxidation is not yet well-understood. In the reaction cycle of intermediates called S states, the S 2 → S 3 transition is particularly important; it consists of multiple processes of electron transfer, proton release, and water insertion, and generates an intermediate leading to O-O bond formation. In this study, we monitored the reaction process during the S 2 → S 3 transition using time-resolved infrared spectroscopy to clarify its molecular mechanism. A change in the hydrogen-bond interaction of the oxidized Y Z • radical, an immediate electron acceptor of the Mn 4 CaO 5 cluster, was clearly observed as a ∼100 μs phase before the electron-transfer phase with a time constant of ∼350 μs. This observation provides strong experimental evidence that rearrangement of the hydrogen-bond network around Y Z • , possibly due to the movement of a water molecule located near Y Z • to the Mn site, takes place before the electron transfer. The electron transfer was coupled with proton release, as revealed by a relatively high deuterium kinetic isotope effect of 1.9. This proton release, which decreases the redox potential of the Mn 4 CaO 5 cluster to facilitate electron transfer to Y Z • , was proposed to determine, as a rate-limiting step, the relatively slow electron-transfer rate of the S 2 → S 3 transition.

The determination of potential energy curve and dipole moment of the (5)0{sup +} electronic state of {sup 85}Rb{sup 133}Cs molecule by high resolution photoassociation spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yuan, Jinpeng; Zhao, Yanting, E-mail: zhaoyt@sxu.edu.cn; Ji, Zhonghua

2015-12-14

We present the formation of ultracold {sup 85}Rb{sup 133}Cs molecules in the (5)0{sup +} electronic state by photoassociation and their detection via resonance-enhanced two-photon ionization. Up to v = 47 vibrational levels including the lowest v = 0 vibrational and lowest J = 0 levels are identified with rotationally resolved high resolution photoassociation spectra. Precise Dunham coefficients are determined for the (5)0{sup +} state with high accuracy, then the Rydberg-Klein-Rees potential energy curve is derived. The electric dipole moments with respect to the vibrational numbers of the (5)0{sup +} electronic state of {sup 85}Rb{sup 133}Cs molecule are also measured inmore » the range between 1.9 and 4.8 D. These comprehensive studies on previously unobserved rovibrational levels of the (5)0{sup +} state are helpful to understand the molecular structure and discover suitable transition pathways for transferring ultracold atoms to deeply bound rovibrational levels of the electronic ground state.« less

New structural phase obtained by exerting high pressure on (Br2)n@AFI composite material

NASA Astrophysics Data System (ADS)

Yao, Zhen; Lv, Jia-Yin; Liu, Bo; Liu, Bing-Bing; Yang, Bai

2018-06-01

In this paper, we present a theoretical study on the high-pressure behaviors of a (Br2)n@AlPO4-5 (AFI) peapod structure. The influence of the encapsulated Br2 molecule on the structural deformation of AFI crystal is analyzed using the volume-pressure function. The bonding process of the linearly arrayed Br2 molecule transferring to the bromine atomic chain is analyzed by the electron density distribution. A new high-pressure phase with P2 point group symmetry is obtained as the pressure increases to 34 GPa. In addition, electron density difference calculations are used to study the systematic charge transformation. Further analysis indicates that the encapsulated Br2 molecules can significantly modify the electronic structure of the AFI crystal. The band gap of the (Br2)n@AFI decreases with pressure and closes at 9 GPa. Moreover, the calculated bulk modulus and electronic properties indicate that the new structural phase is metallic with a high hardness, providing a new strategy for exploring novel nanomaterials.

Electron transfer from plastocyanin to photosystem I.

PubMed Central

Haehnel, W; Jansen, T; Gause, K; Klösgen, R B; Stahl, B; Michl, D; Huvermann, B; Karas, M; Herrmann, R G

1994-01-01

Mutant plastocyanins with Leu at position 10, 90 or 83 (Gly, Ala and Tyr respectively in wildtype) were constructed by site-specific mutagenesis of the spinach gene, and expressed in transgenic potato plants under the control of the authentic plastocyanin promoter, as well as in Escherichia coli as truncated precursor intermediates carrying the C-terminal 22 amino acid residues of the transit peptide, i.e. the thylakoid-targeting domain that acts as a bacterial export signal. The identity of the purified plastocyanins was verified by matrix-assisted laser desorption/ionization mass spectrometry. The formation of a complex between authentic or mutant spinach plastocyanin and isolated photosystem I and the electron transfer has been studied from the biphasic reduction kinetics of P700+ after excitation with laser flashes. The formation of the complex was abolished by the bulky hydrophobic group of Leu at the respective position of G10 or A90 which are part of the conserved flat hydrophobic surface around the copper ligand H87. The rate of electron transfer decreased by both mutations to < 20% of that found with wildtype plastocyanin. We conclude that the conserved flat surface of plastocyanin represents one of two crucial structural elements for both the docking at photosystem I and the efficient electron transfer via H87 to P700+. The Y83L mutant exhibited faster electron transfer to P700+ than did authentic plastocyanin. This proves that Y83 is not involved in electron transfer to P700 and suggests that electron transfer from cytochrome f and to P700 follows different routes in the plastocyanin molecule. Plastocyanin (Y83L) expressed in either E. coli or potato exhibited different isoelectric points and binding constants to photosystem I indicative of differences in the folding of the protein. The structure of the binding site at photosystem I and the mechanism of electron transfer are discussed. Images PMID:8131737

Photoionization and pseudopotentials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Costa, Romarly F. da; Lima, Marco A.P.; Ferreira, Luiz G.

2003-05-01

Transferability of norm-conserving pseudopotentials to low-energy electron-molecule scattering processes has been very successful [Bettega et al., Phys. Rev. A 47, 1111 (1993)]. In this paper we discuss the possibility of using effective potentials in calculations of valence electrons photoionization cross sections. Through atomic targets, we illustrate that pseudopotentials can be optimized to give cross sections in good agreement with all-electron calculations. The present work represents a first step towards more elaborate computer programs for photoionization of molecular targets containing heavy atoms.

Magnetic Field Effect: An Efficient Tool To Investigate The Mechanism Of Reactions Using Laser Flash Photolysis Technique

DOE Office of Scientific and Technical Information (OSTI.GOV)

Basu, Samita; Bose, Adity; Dey, Debarati

2008-04-24

Magnetic field effect combined with laser flash photolysis technique have been used to study the mechanism of interactions between two drug-like quinone molecules, Menadione (1,4-naphthoquinone, MQ) and 9, 10 Anthraquinone (AQ) with one of the DNA bases, Adenine in homogeneous acetonitrile/water and heterogeneous micellar media. A switchover in reaction mode from electron transfer to hydrogen abstraction is observed with MQ on changing the solvent from acetonitrile/water to micelle; whereas, AQ retains its mode of interaction towards Adenine as electron transfer in both the media due to its bulky structure compared to MQ.

Magnetic Field Effect: An Efficient Tool To Investigate The Mechanism Of Reactions Using Laser Flash Photolysis Technique

NASA Astrophysics Data System (ADS)

Basu, Samita; Bose, Adity; Dey, Debarati

2008-04-01

Magnetic field effect combined with laser flash photolysis technique have been used to study the mechanism of interactions between two drug-like quinone molecules, Menadione (1,4-naphthoquinone, MQ) and 9, 10 Anthraquinone (AQ) with one of the DNA bases, Adenine in homogeneous acetonitrile/water and heterogeneous micellar media. A switchover in reaction mode from electron transfer to hydrogen abstraction is observed with MQ on changing the solvent from acetonitrile/water to micelle; whereas, AQ retains its mode of interaction towards Adenine as electron transfer in both the media due to its bulky structure compared to MQ.

Ab initio quantum chemical study of electron transfer in carboranes

NASA Astrophysics Data System (ADS)

Pati, Ranjit; Pineda, Andrew C.; Pandey, Ravindra; Karna, Shashi P.

2005-05-01

The electron transfer (ET) properties of 10- and 12-vertex carboranes are investigated by the ab initio Hartree-Fock method within the Marcus-Hush (MH) two-state model and the Koopman theorem (KT) approach. The calculated value of the ET coupling matrix element, VAB, is consistently higher in the KT approach than in the MH two-state model. For the carborane molecules functionalized by -CH 2 groups at C-vertices, VAB strongly depends on the relative orientation of the planes containing the terminal -CH 2 groups. The predicted conformation dependence of VAB offers a molecular mechanism to control ET between two active centers in molecular systems.

Effect of viscosity on photoinduced electron transfer reaction: An observation of the Marcus inverted region in homogeneous solvents

NASA Astrophysics Data System (ADS)

Saini, Rajesh Kumar; Kuchlyan, Jagannath; Sarkar, Nilmoni

2016-09-01

The viscosity effect of homogeneous solvents on the dynamics of photoinduced electron transfer (PET) reaction among the coumarins and N,N-dimethylaniline (DMA) is investigated using steady-state and time-resolved fluorescence spectroscopy. A bell shape Marcus inversion in the ET rates has been detected in the plot of ET rate constant (kq) with free energy change (ΔG0) in viscous solvents decanol and EG, but it is not observed in DMSO like low viscous solvent. We have also reported that there is no complex formation between the coumarin dye and DMA molecule by using fluorescence correlation spectroscopy.

Auger Emitting Radiopharmaceuticals for Cancer Therapy

NASA Astrophysics Data System (ADS)

Falzone, Nadia; Cornelissen, Bart; Vallis, Katherine A.

Radionuclides that emit Auger electrons have been of particular interest as therapeutic agents. This is primarily due to the short range in tissue, controlled linear paths and high linear energy transfer of these particles. Taking into consideration that ionizations are clustered within several cubic nanometers around the point of decay the possibility of incorporating an Auger emitter in close proximity to the cancer cell DNA has immense therapeutic potential thus making nuclear targeted Auger-electron emitters ideal for precise targeting of cancer cells. Furthermore, many Auger-electron emitters also emit γ-radiation, this property makes Auger emitting radionuclides a very attractive option as therapeutic and diagnostic agents in the molecular imaging and management of tumors. The first requirement for the delivery of Auger emitting nuclides is the definition of suitable tumor-selective delivery vehicles to avoid normal tissue toxicity. One of the main challenges of targeted radionuclide therapy remains in matching the physical and chemical characteristics of the radionuclide and targeting moiety with the clinical character of the tumor. Molecules and molecular targets that have been used in the past can be classified according to the carrier molecule used to deliver the Auger-electron-emitting radionuclide. These include (1) antibodies, (2) peptides, (3) small molecules, (4) oligonucleotides and peptide nucleic acids (PNAs), (5) proteins, and (6) nanoparticles. The efficacy of targeted radionuclide therapy depends greatly on the ability to increase intranuclear incorporation of the radiopharmaceutical without compromising toxicity. Several strategies to achieve this goal have been proposed in literature. The possibility of transferring tumor therapy based on the emission of Auger electrons from experimental models to patients has vast therapeutic potential, and remains a field of intense research.

Impact of interfacial molecular orientation on radiative recombination and charge generation efficiency

DOE PAGES

Ran, Niva A.; Roland, Steffen; Love, John A.; ...

2017-07-19

Here, a long standing question in organic electronics concerns the effects of molecular orientation at donor/acceptor heterojunctions. Given a well-controlled donor/acceptor bilayer system, we uncover the genuine effects of molecular orientation on charge generation and recombination. These effects are studied through the point of view of photovoltaics—however, the results have important implications on the operation of all optoelectronic devices with donor/acceptor interfaces, such as light emitting diodes and photodetectors. Our findings can be summarized by two points. First, devices with donor molecules face-on to the acceptor interface have a higher charge transfer state energy and less non-radiative recombination, resulting inmore » larger open-circuit voltages and higher radiative efficiencies. Second, devices with donor molecules edge-on to the acceptor interface are more efficient at charge generation, attributed to smaller electronic coupling between the charge transfer states and the ground state, and lower activation energy for charge generation.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matz, Dallas L.; Schalnat, Matthew C.; Pemberton, Jeanne E.

The reaction between small organic molecules and low work function metals is of interest in organometallic, astronomical, and optoelectronic device chemistry. Here, thin, solid-state, amorphous benzene and pyridine films are reacted with Ca at 30 K under ultrahigh vacuum with the reaction progress monitored by Raman spectroscopy. Although both films react with Ca to produce product species identifiable by their vibrational spectroscopic signatures, benzene is less reactive with Ca than pyridine. Benzene reacts by electron transfer from Ca to benzene producing multiple species including the phenyl radical anion, the phenyl radical, and the benzyne diradical. Pyridine initially reacts along amore » similar electron transfer pathway as indicated by the presence of the corresponding pyridyl radical and pyridyne diradical species, but these pyridyl radicals are less stable and subject to further ring-opening reactions that lead to a complex array of smaller molecule reaction products and ultimately amorphous carbon. The elucidation of this reaction pathway provides insight into the reactions of aromatics with Ca that are relevant in the areas of catalysis, astrochemistry, and organic optoelectronics.« less

Glucose sensing molecules having selected fluorescent properties

DOEpatents

Satcher, Jr., Joe H.; Lane, Stephen M.; Darrow, Christopher B.; Cary, Douglas R.; Tran, Joe Anh

2004-01-27

An analyte sensing fluorescent molecule that employs intramolecular electron transfer is designed to exhibit selected fluorescent properties in the presence of analytes such as saccharides. The selected fluorescent properties include excitation wavelength, emission wavelength, fluorescence lifetime, quantum yield, photostability, solubility, and temperature or pH sensitivity. The compound comprises an aryl or a substituted phenyl boronic acid that acts as a substrate recognition component, a fluorescence switch component, and a fluorophore. The fluorophore and switch component are selected such that the value of the free energy for electron transfer is less than about 3.0 kcal mol.sup.-1. Fluorescent compounds are described that are excited at wavelengths greater than 400 nm and emit at wavelengths greater than 450 nm, which is advantageous for optical transmission through skin. The fluorophore is typically selected from transition metal-ligand complexes and thiazine, oxazine, oxazone, or oxazine-one as well as anthracene compounds. The fluorescent compound can be immobilized in a glucose permeable biocompatible polymer matrix that is implantable below the skin.

Resonance Raman spectra of organic molecules absorbed on inorganic semiconducting surfaces: Contribution from both localized intramolecular excitation and intermolecular charge transfer excitation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ye, ChuanXiang; Zhao, Yi, E-mail: yizhao@xmu.edu.cn, E-mail: liangwz@xmu.edu.cn; Liang, WanZhen, E-mail: yizhao@xmu.edu.cn, E-mail: liangwz@xmu.edu.cn

2015-10-21

The time-dependent correlation function approach for the calculations of absorption and resonance Raman spectra (RRS) of organic molecules absorbed on semiconductor surfaces [Y. Zhao and W. Z. Liang, J. Chem. Phys. 135, 044108 (2011)] is extended to include the contribution of the intermolecular charge transfer (CT) excitation from the absorbers to the semiconducting nanoparticles. The results demonstrate that the bidirectionally interfacial CT significantly modifies the spectral line shapes. Although the intermolecular CT excitation makes the absorption spectra red shift slightly, it essentially changes the relative intensities of mode-specific RRS and causes the oscillation behavior of surface enhanced Raman spectra withmore » respect to interfacial electronic couplings. Furthermore, the constructive and destructive interferences of RRS from the localized molecular excitation and CT excitation are observed with respect to the electronic coupling and the bottom position of conductor band. The interferences are determined by both excitation pathways and bidirectionally interfacial CT.« less

Structure and functionality of bromine doped graphite.

PubMed

Hamdan, Rashid; Kemper, A F; Cao, Chao; Cheng, H P

2013-04-28

First-principles calculations are used to study the enhanced in-plane conductivity observed experimentally in Br-doped graphite, and to study the effect of external stress on the structure and functionality of such systems. The model used in the numerical calculations is that of stage two doped graphite. The band structure near the Fermi surface of the doped systems with different bromine concentrations is compared to that of pure graphite, and the charge transfer between carbon and bromine atoms is analyzed to understand the conductivity change along different high symmetry directions. Our calculations show that, for large interlayer separation between doped graphite layers, bromine is stable in the molecular form (Br2). However, with increased compression (decreased layer-layer separation) Br2 molecules tend to dissociate. While in both forms, bromine is an electron acceptor. The charge exchange between the graphite layers and Br atoms is higher than that with Br2 molecules. Electron transfer to the Br atoms increases the number of hole carriers in the graphite sheets, resulting in an increase of conductivity.

Shewanella secretes flavins that mediate extracellular electron transfer

PubMed Central

Marsili, Enrico; Baron, Daniel B.; Shikhare, Indraneel D.; Coursolle, Dan; Gralnick, Jeffrey A.; Bond, Daniel R.

2008-01-01

Bacteria able to transfer electrons to metals are key agents in biogeochemical metal cycling, subsurface bioremediation, and corrosion processes. More recently, these bacteria have gained attention as the transfer of electrons from the cell surface to conductive materials can be used in multiple applications. In this work, we adapted electrochemical techniques to probe intact biofilms of Shewanella oneidensis MR-1 and Shewanella sp. MR-4 grown by using a poised electrode as an electron acceptor. This approach detected redox-active molecules within biofilms, which were involved in electron transfer to the electrode. A combination of methods identified a mixture of riboflavin and riboflavin-5′-phosphate in supernatants from biofilm reactors, with riboflavin representing the dominant component during sustained incubations (>72 h). Removal of riboflavin from biofilms reduced the rate of electron transfer to electrodes by >70%, consistent with a role as a soluble redox shuttle carrying electrons from the cell surface to external acceptors. Differential pulse voltammetry and cyclic voltammetry revealed a layer of flavins adsorbed to electrodes, even after soluble components were removed, especially in older biofilms. Riboflavin adsorbed quickly to other surfaces of geochemical interest, such as Fe(III) and Mn(IV) oxy(hydr)oxides. This in situ demonstration of flavin production, and sequestration at surfaces, requires the paradigm of soluble redox shuttles in geochemistry to be adjusted to include binding and modification of surfaces. Moreover, the known ability of isoalloxazine rings to act as metal chelators, along with their electron shuttling capacity, suggests that extracellular respiration of minerals by Shewanella is more complex than originally conceived. PMID:18316736

Influence of orbital symmetry on diffraction imaging with rescattering electron wave packets

DOE PAGES

Pullen, M. G.; Wolter, B.; Le, A. -T.; ...

2016-06-22

The ability to directly follow and time-resolve the rearrangement of the nuclei within molecules is a frontier of science that requires atomic spatial and few-femtosecond temporal resolutions. While laser-induced electron diffraction can meet these requirements, it was recently concluded that molecules with particular orbital symmetries (such as pg) cannot be imaged using purely backscattering electron wave packets without molecular alignment. Here, we demonstrate, in direct contradiction to these findings, that the orientation and shape of molecular orbitals presents no impediment for retrieving molecular structure with adequate sampling of the momentum transfer space. We overcome previous issues by showcasing retrieval ofmore » the structure of randomly oriented O 2 and C 2H 2 molecules, with π g and π u symmetries, respectively, and where their ionization probabilities do not maximize along their molecular axes. As a result, while this removes a serious bottleneck for laser-induced diffraction imaging, we find unexpectedly strong backscattering contributions from low-Z atoms.« less

Big Data Meets Quantum Chemistry Approximations: The Δ-Machine Learning Approach.

PubMed

Ramakrishnan, Raghunathan; Dral, Pavlo O; Rupp, Matthias; von Lilienfeld, O Anatole

2015-05-12

Chemically accurate and comprehensive studies of the virtual space of all possible molecules are severely limited by the computational cost of quantum chemistry. We introduce a composite strategy that adds machine learning corrections to computationally inexpensive approximate legacy quantum methods. After training, highly accurate predictions of enthalpies, free energies, entropies, and electron correlation energies are possible, for significantly larger molecular sets than used for training. For thermochemical properties of up to 16k isomers of C7H10O2 we present numerical evidence that chemical accuracy can be reached. We also predict electron correlation energy in post Hartree-Fock methods, at the computational cost of Hartree-Fock, and we establish a qualitative relationship between molecular entropy and electron correlation. The transferability of our approach is demonstrated, using semiempirical quantum chemistry and machine learning models trained on 1 and 10% of 134k organic molecules, to reproduce enthalpies of all remaining molecules at density functional theory level of accuracy.

Non-renewal statistics for electron transport in a molecular junction with electron-vibration interaction

NASA Astrophysics Data System (ADS)

Kosov, Daniel S.

2017-09-01

Quantum transport of electrons through a molecule is a series of individual electron tunneling events separated by stochastic waiting time intervals. We study the emergence of temporal correlations between successive waiting times for the electron transport in a vibrating molecular junction. Using the master equation approach, we compute the joint probability distribution for waiting times of two successive tunneling events. We show that the probability distribution is completely reset after each tunneling event if molecular vibrations are thermally equilibrated. If we treat vibrational dynamics exactly without imposing the equilibration constraint, the statistics of electron tunneling events become non-renewal. Non-renewal statistics between two waiting times τ1 and τ2 means that the density matrix of the molecule is not fully renewed after time τ1 and the probability of observing waiting time τ2 for the second electron transfer depends on the previous electron waiting time τ1. The strong electron-vibration coupling is required for the emergence of the non-renewal statistics. We show that in the Franck-Condon blockade regime, extremely rare tunneling events become positively correlated.

Observing and understanding the ultrafast photochemistry in small molecules: applications to sunscreens.

PubMed

Baker, Lewis A; Stavros, Vasilios G

2016-09-01

In this review, we discuss the importance of biological and artificial photoprotection against overexposure to harmful ultraviolet radiation. Transient electronic and transient vibrational absorption spectroscopies are highlighted as important tools in understanding the energy transfer in small molecules, with a focus on the application to commercial sunscreens with representative examples given. Oxybenzone, a common ingredient in commercial sunscreens and sinapoyl malate, a biological sunscreen in plant leaves are presented as case studies.

Potassium-intercalated H2Pc films: Alkali-induced electronic and geometrical modifications

NASA Astrophysics Data System (ADS)

Nilson, K.; Åhlund, J.; Shariati, M.-N.; Schiessling, J.; Palmgren, P.; Brena, B.; Göthelid, E.; Hennies, F.; Huismans, Y.; Evangelista, F.; Rudolf, P.; Göthelid, M.; Mârtensson, N.; Puglia, C.

2012-07-01

X-ray spectroscopy studies of potassium intercalated metal-free phthalocyanine multilayers adsorbed on Al(110) have been undertaken. Photoelectron spectroscopy measurements show the presence of several charge states of the molecules upon K intercalation, due to a charge transfer from the alkali. In addition, the comparison of valence band photoemission spectra with the density functional theory calculations of the density of states of the H2Pc- anion indicates a filling of the formerly lowest unoccupied molecular orbital by charge transfer from the alkali. This is further confirmed by x-ray absorption spectroscopy (XAS) studies, which show a decreased density of unoccupied states. XAS measurements in different experimental geometries reveal that the molecules in the pristine film are standing upright on the surface or are only slightly tilted away from the surface normal but upon K intercalation, the molecular orientation is changed in that the tilt angle of the molecules increases.

Application of double-hybrid density functionals to charge transfer in N-substituted pentacenequinones.

PubMed

Sancho-García, J C

2012-05-07

A set of N-heteroquinones, deriving from oligoacenes, have been recently proposed as n-type organic semiconductors with high electron mobilities in thin-film transistors. Generally speaking, this class of compounds self-assembles in neighboring π-stacks linked by weak hydrogen bonds. We aim at theoretically characterizing here the sequential charge transport (hopping) process expected to take place across these arrays of molecules. To do so, we need to accurately address the preferred packing of these materials simultaneously to single-molecule properties related to charge-transfer events, carefully employing dispersion-corrected density functional theory methods to accurately extract the key molecular parameters governing this phenomenon at the nanoscale. This study confirms the great deal of interest around these compounds, since controlled functionalization of model molecules (i.e., pentacene) allows to efficiently tune the corresponding charge mobilities, and the capacity of modern quantum-chemical methods to predict it after rationalizing the underlying structure-property relationships.

Understanding the Role of Electron-driven Processes in Atmospheric Behaviour

NASA Astrophysics Data System (ADS)

Brunger, M. J.; Campbell, L.; Jones, D. B.; Cartwright, D. C.

2004-12-01

Electron-impact excitation plays a major role in emission from aurora and a less significant but nonetheless crucial role in the dayglow and nightglow. For some molecules, such as N2, O2 and NO, electron-impact excitation can be followed by radiative cascade through many different sets of energy levels, producing emission with a large number of lines. We review the application of our statistical equilibrium program to predict this rich spectrum of radiation, and we compare results we have obtained against available independent measurements. In addition, we also review the calculation of energy transfer rates from electrons to N2, O2 and NO in the thermosphere. Energy transfer from electrons to neutral gases and ions is one of the dominant electron cooling processes in the ionosphere, and the role of vibrationally excited N2 and O2 in this is particularly significant. The importance of the energy dependence and magnitude of the electron-impact vibrational cross sections in the calculation of these rates is assessed.

Modeling ultrafast solvated electronic dynamics using time-dependent density functional theory and polarizable continuum model.

PubMed

Liang, Wenkel; Chapman, Craig T; Ding, Feizhi; Li, Xiaosong

2012-03-01

A first-principles solvated electronic dynamics method is introduced. Solvent electronic degrees of freedom are coupled to the time-dependent electronic density of a solute molecule by means of the implicit reaction field method, and the entire electronic system is propagated in time. This real-time time-dependent approach, incorporating the polarizable continuum solvation model, is shown to be very effective in describing the dynamical solvation effect in the charge transfer process and yields a consistent absorption spectrum in comparison to the conventional linear response results in solution. © 2012 American Chemical Society

Bay-annulated indigo (BAI) as an excellent electron accepting building block for high performance organic semiconductors

DOEpatents

Liu, Yi; He, Bo; Pun, Andrew

2015-11-24

A novel electron acceptor based on bay-annulated indigo (BAI) was synthesized and used for the preparation of a series of high performance donor-acceptor small molecules and polymers. The resulting materials possess low-lying LUMO energy level and small HOMO-LUMO gaps, while their films exhibited high crystallinity upon thermal treatment, commensurate with high field effect mobilities and ambipolar transfer characteristics.

Bay-annulated indigo (BAI) as an excellent electron accepting building block for high performance organic semiconductors

DOEpatents

Liu, Yi; He, Bo; Pun, Andrew

2016-04-19

A novel electron acceptor based on bay-annulated indigo (BAI) was synthesized and used for the preparation of a series of high performance donor-acceptor small molecules and polymers. The resulting materials possess low-lying LUMO energy level and small HOMO-LUMO gaps, while their films exhibited high crystallinity upon thermal treatment, commensurate with high field effect mobilities and ambipolar transfer characteristics.

LASER APPLICATIONS AND OTHER TOPICS IN QUANTUM ELECTRONICS: Efficiency of passage of highly vibrationally excited CF3I molecules in a beam through a cooled converging hollow truncated cone

NASA Astrophysics Data System (ADS)

Makarov, Grigorii N.; Petin, A. N.

2006-09-01

The passage of CF3I molecules excited by high-intensity IR laser radiation to high vibrational states (with energy Ev >= 0.3-1.5 eV) and unexcited molecules in a pulsed beam through a converging truncated hollow metal cone cooled to Ts approx 80-85 K and mounted at an angle to the beam axis is studied. It is found that the excited molecules pass much more readily through the cone than the unexcited (vibrationally cold) molecules. This opens the possibility for studying the processes of energy transfer and redistribution over a cold surface covered by molecular (cluster) layers, and for separating excited and unexcited molecules in a beam.

The effect of oxygen molecule adsorption on lead iodide perovskite surface by first-principles calculation

NASA Astrophysics Data System (ADS)

Ma, Xia-Xia; Li, Ze-Sheng

2018-01-01

Oxygen molecule has a negative effect on perovskite solar cells, which has been investigated experimentally. However, detailed theoretical research is still rare. This study presents a microscopic view to reveal the interaction mechanism between O2 and perovskite based on the first-principles calculation. The results show that O2 is adsorbed on the (100) surface of MAPbI3 perovskite mainly by Van der Waals force. O2 adsorption makes the MAPbI3 surface generate a small number of positive charges, which leads to the increase of the work function of the MAPbI3 surface. This is in agreement with the experimental measurement. And increased work function of MAPbI3 surface is not beneficial to electron transfer from perovskite to electronic extraction layer (such as TiO2). Comparison of the density of states (DOS) of the clean (100) surface and the adsorbed system shows that an in-gap state belonging to O2 appears, which can explain the phenomenon observed from experiments that electron transfers from the surface of perovskite to O2 to form superoxide. The theoretical power conversion efficiency of the system with and without O2 adsorption is evaluated, and it turns out that the power conversion efficiency of the system with O2 adsorption is slightly lower than that of the system without O2 adsorption. This result indicates that avoiding the introduction of O2 molecules between perovskite and electronic extraction layer is beneficial to the perovskite solar cell.

Quantum Computational Studies of Electron Transfer in Respiratory Complex III and its Application for Designing New Mitocan Drugs

NASA Astrophysics Data System (ADS)

Hagras, Muhammad Ahmed

Electron transfer occurs in many biological systems which are imperative to sustain life; oxidative phosphorylation in prokaryotes and eukaryotes, and photophosphorylation in photosynthetic and plant cells are well-balanced and complementary processes. Investigating electron transfer in those natural systems provides detailed knowledge of the atomistic events that lead eventually to production of ATP, or harvesting light energy. Ubiquinol:cytochrome c oxidoreductase complex (also known as bc 1 complex, or respiratory complex III) is a middle player in the electron transport proton pumping orchestra, located in the inner-mitochondrial membrane in eukaryotes or plasma membrane in prokaryotes, which converts the free energy of redox reactions to electrochemical proton gradient across the membrane, following the fundamental chemiosmotic principle discovered by Peter Mitchell 1. In humans, the malfunctioned bc1 complex plays a major role in many neurodegenerative diseases, stress-induced aging, and cancer development, because it produces most of the reactive oxygen species, which are also involved in cellular signaling 2. The mitochondrial bc1 complex has an intertwined dimeric structure comprised of 11 subunits in each monomer, but only three of them have catalytic function, and those are the only domains found in bacterial bc1 complex. The core subunits include: Rieske domain, which incorporates iron-sulfur cluster [2Fe-2S]; trans-membrane cytochrome b domain, incorporating low-potential heme group (heme b L) and high-potential heme group (heme b H); and cytochrome c1 domain, containing heme c1 group and two separate binding sites, Qo (or QP) site where the hydrophobic electron carrier ubihydroquinol QH2 is oxidized, and Qi (or QN) site where ubiquinone molecule Q is reduced 3. Electrons and protons in the bc1 complex flow according to the proton-motive Q-cycle proposed by Mitchell, which includes a unique electron flow bifurcation at the Qo site. At this site, one electron of a bound QH2 molecule transfers to [2Fe-2S] cluster of the Rieske domain, docked at the proximal docking site, and another electron transfers to heme b L , which subsequently passes it to heme bH , and finally to Q or SQ molecule bound at the Qi-site 4. Rieske domain undergoes a domain movement 22 A to bind at the distal docking site, where [2Fe-2S] cluster passes its electron to heme c1, which in turn passes it to heme c of the water-soluble cytochrome c carrier 3c, 5 (which shuttles it to cytochrome c oxidase, complex IV). In the current compiled work presented in the subsequent chapters, we deployed a stacking tiers hierarchy where each chapter's work presents a foundation for the next one. In chapter 1, we first present different methods to calculate tunneling currents in proteins including a new derivation method for the inter-atomic tunneling current method. In addition, we show the results of the inter-atomic tunneling current theory on models based on heme bL-heme bH redox pair system in bc1 complex. Afterwards, in chapter 2, we examine the electron tunneling pathways 6 between different intra-monomeric and inter-monomeric redox centers of bc1 complex, including its electron carriers - ubiquinol, ubiquinone, and cytochrome c molecules, using the well-studied coarse-grained interatomic method of the tunneling current theory 7. Going through the different tunneling pathways in bc1 complex, we discovered a pair of internal switches that modulate the electron transfer rate which we discuss in full details in chapter 3. Motivated by the discovery of those internal switches, we discuss in chapter 4 the discovery of a new binding pocket (designated as NonQ-site or NQ-site for short) in bc 1 complex which is located at the opposite side of the enzyme with respect to Qo site. In contrast to Qo site, however, the NQ-site penetrates deeply in the cytochrome b domain and reaches very closely the LH region. Hence the NQ-site provides a suitable binding pocket for ligands that can influence the orientation of Phe90 residue, and hence modulate the corresponding ET rate between heme b L and heme bH. Finally we present in chapter 5 our unique integrated software package (called Electron Tunneling in Proteins Program or ETP) which provides an environment with different capabilities such as tunneling current calculation, semi-empirical quantum mechanical calculation and molecular modeling simulation for calculation and analysis of electron transfer reactions in proteins.

Energy transfer dynamics from individual semiconductor nanoantennae to dye molecules with implication to light-harvesting nanosystems

NASA Astrophysics Data System (ADS)

Shan, Guangcun; Hu, Mingjun; Yan, Ze; Li, Xin; Huang, Wei

2018-03-01

Semiconductor nanocrystals can be used as nanoscale optical antennae to photoexcite individual dye molecules in an ensemble via energy transfer mechanism. The theoretical framework developed by Förster and others describes how electronic excitation migrates in the photosynthetic apparatus of plants, algae, and bacteria from light absorbing pigments to reaction centers where light energy is utilized for the eventual conversion into chemical energy. Herein we investigate the effect of the average donor-acceptor spacing on the time-resolved fluorescence intensity and dynamics of single donor-acceptor pairs with the dye acceptor concentration decreasing by using quantum Monte-Carlo simulation of FRET dynamics. Our results validated that the spatial disorder controlling the microscopic energy transfer rates accounts for the scatter in donor fluorescence lifetimes and intensities, which provides a new design guideline for artificial light-harvesting nanosystems.

Femtosecond stimulated Raman evidence for charge-transfer character in pentacene singlet fission.

PubMed

Hart, Stephanie M; Silva, W Ruchira; Frontiera, Renee R

2018-02-07

Singlet fission is a spin-allowed process in which an excited singlet state evolves into two triplet states. We use femtosecond stimulated Raman spectroscopy, an ultrafast vibrational technique, to follow the molecular structural evolution during singlet fission in order to determine the mechanism of this process. In crystalline pentacene, we observe the formation of an intermediate characterized by pairs of excited state peaks that are red- and blue-shifted relative to the ground state features. We hypothesize that these features arise from the formation of cationic and anionic species due to partial transfer of electron density from one pentacene molecule to a neighboring molecule. These observations provide experimental evidence for the role of states with significant charge-transfer character which facilitate the singlet fission process in pentacene. Our work both provides new insight into the singlet fission mechanism in pentacene and demonstrates the utility of structurally-sensitive time-resolved spectroscopic techniques in monitoring ultrafast processes.

Bimolecular Rate Constants for FAD-Dependent Glucose Dehydrogenase from Aspergillus terreus and Organic Electron Acceptors.

PubMed

Tsuruoka, Nozomu; Sadakane, Takuya; Hayashi, Rika; Tsujimura, Seiya

2017-03-10

The flavin adenine dinucleotide-dependent glucose dehydrogenase (FAD-GDH) from Aspergillus species require suitable redox mediators to transfer electrons from the enzyme to the electrode surface for the application of bioelectrical devices. Although several mediators for FAD-GDH are already in use, they are still far from optimum in view of potential, kinetics, sustainability, and cost-effectiveness. Herein, we investigated the efficiency of various phenothiazines and quinones in the electrochemical oxidation of FAD-GDH from Aspergillus terreus . At pH 7.0, the logarithm of the bimolecular oxidation rate constants appeared to depend on the redox potentials of all the mediators tested. Notably, the rate constant of each molecule for FAD-GDH was approximately 2.5 orders of magnitude higher than that for glucose oxidase from Aspergillus sp. The results suggest that the electron transfer kinetics is mainly determined by the formal potential of the mediator, the driving force of electron transfer, and the electron transfer distance between the redox active site of the mediator and the FAD, affected by the steric or chemical interactions. Higher k ₂ values were found for ortho-quinones than for para-quinones in the reactions with FAD-GDH and glucose oxidase, which was likely due to less steric hindrance in the active site in the case of the ortho-quinones.

Efficient modulation of optical and electrical properties of X-shaped thermally activated delayed fluorescence emitters by substitution.

PubMed

Fan, Jianzhong; Wang, Xin; Lin, Lili; Wang, Chuankui

2016-08-01

A series of X-shaped thermally activated delayed fluorescence (TADF) emitters are systematically studied by first-principles calculations. Effects of the cyano group adding to the acceptor unit and the hydroxyl group adding to the donor part on the optical and electrical properties are analyzed. It is found that both kinds of groups can efficiently increase the emission wavelength to realize full-color emission. Although they play different roles in modulating the energy level of frontier orbitals, the S-T energy gap, the reorganization energy and transfer integral for different molecules, they can efficiently increase the charge transfer rate and reduce the difference of electron transfer rate and hole transfer rate. These results indicate that these designed strategies are efficient to achieve balanced charge transfer rates and modulate emission colors. By analyzing the energy matching between the TADF emitters and three kinds of hosts, the emission spectra of the 3,5-bis(N-carbazolyl)benzene (mcp) and the absorption spectra of most TADF emitters have a large overlap, which provides helpful information in application of these TADF molecules.

Multiple-time-scale motion in molecularly linked nanoparticle arrays.

PubMed

George, Christopher; Szleifer, Igal; Ratner, Mark

2013-01-22

We explore the transport of electrons between electrodes that encase a two-dimensional array of metallic quantum dots linked by molecular bridges (such as α,ω alkaline dithiols). Because the molecules can move at finite temperatures, the entire transport structure comprising the quantum dots and the molecules is in dynamical motion while the charge is being transported. There are then several physical processes (physical excursions of molecules and quantum dots, electronic migration, ordinary vibrations), all of which influence electronic transport. Each can occur on a different time scale. It is therefore not appropriate to use standard approaches to this sort of electron transfer problem. Instead, we present a treatment in which three different theoretical approaches-kinetic Monte Carlo, classical molecular dynamics, and quantum transport-are all employed. In certain limits, some of the dynamical effects are unimportant. But in general, the transport seems to follow a sort of dynamic bond percolation picture, an approach originally introduced as formal models and later applied to polymer electrolytes. Different rate-determining steps occur in different limits. This approach offers a powerful scheme for dealing with multiple time scale transport problems, as will exist in many situations with several pathways through molecular arrays or even individual molecules that are dynamically disordered.

Fluorescent tris-imidazolium sensors for picric acid explosive.

PubMed

Roy, Bijan; Bar, Arun Kumar; Gole, Bappaditya; Mukherjee, Partha Sarathi

2013-02-01

Two new anthracene-functionalized fluorescent tris-imidazolium salts have been synthesized, characterized, and proven to be selective sensors for picric acid, which is a common constituent of many powerful explosives. Theoretical studies revealed an unusual ground-state electron transfer from picrate anion to the sensor molecules.

Designing interfaces of hydrogenase-nanomaterial hybrids for efficient solar conversion.

PubMed

King, Paul W

2013-01-01

The direct conversion of sunlight into biofuels is an intriguing alternative to a continued reliance on fossil fuels. Natural photosynthesis has long been investigated both as a potential solution, and as a model for utilizing solar energy to drive a water-to-fuel cycle. The molecules and organizational structure provide a template to inspire the design of efficient molecular systems for photocatalysis. A clear design strategy is the coordination of molecular interactions that match kinetic rates and energetic levels to control the direction and flow of energy from light harvesting to catalysis. Energy transduction and electron-transfer reactions occur through interfaces formed between complexes of donor-acceptor molecules. Although the structures of several of the key biological complexes have been solved, detailed descriptions of many electron-transfer complexes are lacking, which presents a challenge to designing and engineering biomolecular systems for solar conversion. Alternatively, it is possible to couple the catalytic power of biological enzymes to light harvesting by semiconductor nanomaterials. In these molecules, surface chemistry and structure can be designed using ligands. The passivation effect of the ligand can also dramatically affect the photophysical properties of the semiconductor, and energetics of external charge-transfer. The length, degree of bond saturation (aromaticity), and solvent exposed functional groups of ligands can be manipulated to further tune the interface to control molecular assembly, and complex stability in photocatalytic hybrids. The results of this research show how ligand selection is critical to designing molecular interfaces that promote efficient self-assembly, charge-transfer and photocatalysis. This article is part of a Special Issue entitled: Metals in Bioenergetics and Biomimetics Systems. Copyright © 2013 Elsevier B.V. All rights reserved.

UVA radiation induced ultrafast electron transfer from a food carcinogen benzo[a]pyrene to organic molecules, biological macromolecules, and inorganic nano structures.

PubMed

Banerjee, Soma; Sarkar, Soumik; Lakshman, Karthik; Dutta, Joydeep; Pal, Samir Kumar

2013-04-11

Reactions involving electron transfer (ET) and reactive oxygen species (ROS) play a pivotal role in carcinogenesis and cancer biochemistry. Our present study emphasizes UVA radiation induced ET reaction as one of the key aspects of a potential carcinogen, benzo[a]pyrene (BP), in the presence of a wide variety of molecules covering organic p-benzoquinone (BQ), biological macromolecules like calf-thymus DNA (CT-DNA), human serum albumin (HSA) protein, and inorganic zinc oxide (ZnO) nanorods (NRs). Steady-state and picosecond-resolved fluorescence spectroscopy have been used to monitor such ET reactions. Physical consequences of BP association with CT-DNA have been investigated through temperature-dependent circular dichroism (CD) spectroscopy. The temperature-dependent steady-state, picosecond-resolved fluorescence lifetime and anisotropy studies reveal the effect of temperature on the perturbation of such ET reactions from BP to biological macromolecules, highlighting their temperature-dependent association. Furthermore, the electron-donating property of BP has been corroborated by measuring wavelength-dependent photocurrent in a BP-anchored ZnO NR-based photodevice, offering new physical insights for the carcinogenic study of BP.

Electronic coupling matrix elements from charge constrained density functional theory calculations using a plane wave basis set

NASA Astrophysics Data System (ADS)

Oberhofer, Harald; Blumberger, Jochen

2010-12-01

We present a plane wave basis set implementation for the calculation of electronic coupling matrix elements of electron transfer reactions within the framework of constrained density functional theory (CDFT). Following the work of Wu and Van Voorhis [J. Chem. Phys. 125, 164105 (2006)], the diabatic wavefunctions are approximated by the Kohn-Sham determinants obtained from CDFT calculations, and the coupling matrix element calculated by an efficient integration scheme. Our results for intermolecular electron transfer in small systems agree very well with high-level ab initio calculations based on generalized Mulliken-Hush theory, and with previous local basis set CDFT calculations. The effect of thermal fluctuations on the coupling matrix element is demonstrated for intramolecular electron transfer in the tetrathiafulvalene-diquinone (Q-TTF-Q-) anion. Sampling the electronic coupling along density functional based molecular dynamics trajectories, we find that thermal fluctuations, in particular the slow bending motion of the molecule, can lead to changes in the instantaneous electron transfer rate by more than an order of magnitude. The thermal average, ( {< {| {H_ab } |^2 } > } )^{1/2} = 6.7 {mH}, is significantly higher than the value obtained for the minimum energy structure, | {H_ab } | = 3.8 {mH}. While CDFT in combination with generalized gradient approximation (GGA) functionals describes the intermolecular electron transfer in the studied systems well, exact exchange is required for Q-TTF-Q- in order to obtain coupling matrix elements in agreement with experiment (3.9 mH). The implementation presented opens up the possibility to compute electronic coupling matrix elements for extended systems where donor, acceptor, and the environment are treated at the quantum mechanical (QM) level.

Structure of electron transfer flavoprotein-ubiquinone oxidoreductase and electron transfer to the mitochondrial ubiquinone pool

PubMed Central

Zhang, Jian; Frerman, Frank E.; Kim, Jung-Ja P.

2006-01-01

Electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO) is a 4Fe4S flavoprotein located in the inner mitochondrial membrane. It catalyzes ubiquinone (UQ) reduction by ETF, linking oxidation of fatty acids and some amino acids to the mitochondrial respiratory chain. Deficiencies in ETF or ETF-QO result in multiple acyl-CoA dehydrogenase deficiency, a human metabolic disease. Crystal structures of ETF-QO with and without bound UQ were determined, and they are essentially identical. The molecule forms a single structural domain. Three functional regions bind FAD, the 4Fe4S cluster, and UQ and are closely packed and share structural elements, resulting in no discrete structural domains. The UQ-binding pocket consists mainly of hydrophobic residues, and UQ binding differs from that of other UQ-binding proteins. ETF-QO is a monotopic integral membrane protein. The putative membrane-binding surface contains an α-helix and a β-hairpin, forming a hydrophobic plateau. The UQ—flavin distance (8.5 Å) is shorter than the UQ—cluster distance (18.8 Å), and the very similar redox potentials of FAD and the cluster strongly suggest that the flavin, not the cluster, transfers electrons to UQ. Two possible electron transfer paths can be envisioned. First, electrons from the ETF flavin semiquinone may enter the ETF-QO flavin one by one, followed by rapid equilibration with the cluster. Alternatively, electrons may enter via the cluster, followed by equilibration between centers. In both cases, when ETF-QO is reduced to a two-electron reduced state (one electron at each redox center), the enzyme is primed to reduce UQ to ubiquinol via FAD. PMID:17050691

Structure of electron transfer flavoprotein-ubiquinone oxidoreductase and electron transfer to the mitochondrial ubiquinone pool.

PubMed

Zhang, Jian; Frerman, Frank E; Kim, Jung-Ja P

2006-10-31

Electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO) is a 4Fe4S flavoprotein located in the inner mitochondrial membrane. It catalyzes ubiquinone (UQ) reduction by ETF, linking oxidation of fatty acids and some amino acids to the mitochondrial respiratory chain. Deficiencies in ETF or ETF-QO result in multiple acyl-CoA dehydrogenase deficiency, a human metabolic disease. Crystal structures of ETF-QO with and without bound UQ were determined, and they are essentially identical. The molecule forms a single structural domain. Three functional regions bind FAD, the 4Fe4S cluster, and UQ and are closely packed and share structural elements, resulting in no discrete structural domains. The UQ-binding pocket consists mainly of hydrophobic residues, and UQ binding differs from that of other UQ-binding proteins. ETF-QO is a monotopic integral membrane protein. The putative membrane-binding surface contains an alpha-helix and a beta-hairpin, forming a hydrophobic plateau. The UQ-flavin distance (8.5 A) is shorter than the UQ-cluster distance (18.8 A), and the very similar redox potentials of FAD and the cluster strongly suggest that the flavin, not the cluster, transfers electrons to UQ. Two possible electron transfer paths can be envisioned. First, electrons from the ETF flavin semiquinone may enter the ETF-QO flavin one by one, followed by rapid equilibration with the cluster. Alternatively, electrons may enter via the cluster, followed by equilibration between centers. In both cases, when ETF-QO is reduced to a two-electron reduced state (one electron at each redox center), the enzyme is primed to reduce UQ to ubiquinol via FAD.

Charge transfer interactions and nonlinear optical properties of push pull chromophore benzaldehyde phenylhydrazone: A vibrational approach

NASA Astrophysics Data System (ADS)

Ravikumar, C.; Joe, I. Hubert; Jayakumar, V. S.

2008-07-01

FT Raman and IR spectra of the crystallized nonlinear optic (NLO) molecule, benzaldehyde phenylhydrazone (BPH) have been recorded and analyzed. The equilibrium geometry, bonding features and harmonic vibrational frequencies of BPH have been investigated with the help of B3LYP density functional theory (DFT) method. The assignments of the vibrational spectra have been carried out with the help of normal coordinate analysis (NCA) following the scaled quantum mechanical force field methodology (SQMFF). From the optimized geometry, the decrease in C-N bond length indicates the electron delocalization over the region of the molecule. The vibrational analysis confirm the charge transfer interaction between the phenyl rings through ≻Cdbnd N-N≺ skeleton.

Absorption effects in electron-sulfur-dioxide collisions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Machado, L. E.; Sugohara, R. T.; Santos, A. S. dos

2011-09-15

A joint experimental-theoretical study on electron-SO{sub 2} collisions in the low and intermediate energy range is reported. More specifically, experimental elastic differential, integral, and momentum transfer cross sections in absolute scale are measured in the 100-1000 eV energy range using the relative-flow technique. Calculated elastic differential, integral, and momentum transfer cross sections as well as grand-total and total absorption cross sections are also presented in the 1-1000 eV energy range. A complex optical potential is used to represent the electron-molecule interaction dynamics, whereas the Schwinger variational iterative method combined with the distorted-wave approximation is used to solve the scattering equations.more » Comparison of the present results is made with the theoretical and experimental results available in the literature.« less

Electrostatic properties of the pyrimethamine-2,4-dihydroxybenzoic acid cocrystal in methanol studied using transferred electron-density parameters.

PubMed

Faroque, Muhammad Umer; Noureen, Sajida; Ahmed, Maqsood; Tahir, Muhammad Nawaz

2018-01-01

The crystal structure of the cocrystal salt form of the antimalarial drug pyrimethamine with 2,4-dihydroxybenzoic acid in methanol [systematic name: 2,4-diamino-5-(4-chlorophenyl)-6-ethylpyrimidin-1-ium 2,4-dihydroxybenzoate methanol monosolvate, C 12 H 14 ClN 4 + ·C 7 H 5 O 4 - ·CH 3 OH] has been studied using X-ray diffraction data collected at room temperature. The crystal structure was refined using the classical Independent Atom Model (IAM) and the Multipolar Atom Model by transferring electron-density parameters from the ELMAM2 database. The Cl atom was refined anharmonically. The results of both refinement methods have been compared. The intermolecular interactions have been characterized on the basis of Hirshfeld surface analysis and topological analysis using Bader's theory of Atoms in Molecules. The results show that the molecular assembly is built primarily on the basis of charge transfer between 2,4-dihydroxybenzoic acid and pyrimethamine, which results in strong intermolecular hydrogen bonds. This fact is further validated by the calculation of the electrostatic potential based on transferred electron-density parameters.

Excited-State Dynamics of Biological Molecules in Solution: Photoinduced Charge Transfer in Oxidatively Damaged DNA and Deactivation of Violacein in Viscous Solvents

NASA Astrophysics Data System (ADS)

Beckstead, Ashley Ann

UV radiation from the sun is strongly absorbed by DNA, and the resulting electronic excited states can lead to the formation of mutagenic photoproducts. Decades of research have brought to light the excited-state dynamics of single RNA and DNA nucleobases, but questions remain about the nature of excited states accessed in DNA strands. In this thesis, I present ultrafast spectroscopic observations of photoinduced electron transfer from the oxidatively damaged bases, 8-oxo-7,8-dihydro-2'-deoxyguanosine, 5-hydroxy-2'-deoxycytidine and 5-hydroxy-2'-deoxyuridine, to adenine in three dinucleotides. The results reveal that charge transfer states are formed on a timescale faster than our instrumental resolution (<0.5 ps), and back electron transfer efficiently returns the excited-state population to the ground state on timescales from tens to hundreds of ps. In addition to recent spectroscopic observations of charge transfer state species in DNA by other groups, our results have augmented understanding of the long-lived transient signals observed in DNA strands. The observation of photoinduced electron transfer in these oxidatively damaged nucleobases also supports a recent proposal regarding the role of oxidative products in pre-RNA catalysis. I discuss these observations in the contexts of fundamental DNA excited-state dynamics and prebiotic chemical evolution. In this thesis, I also present the first ultrafast spectroscopic investigation of violacein, a pigment isolated from Antarctic bacteria. Despite claims for the photoprotective role of this pigment, there has never been a spectroscopic analysis of excited-state deactivation in violacein. Emission spectra, fluorescence quantum yields and excited-state lifetimes of violacein in various solvents were measured for the first time. Both the fluorescence quantum yield and excited-state lifetime of violacein increase in increasingly viscous solvents, suggesting a large-scale motion mediates excited-state deactivation. I compare these results to similar observations of viscosity-dependent excited-state decay rates in other molecules. I also consider the relevance of violacein's excited-state properties to the hypothesized sunscreening role of violacein. Overall, the studies presented in this dissertation illustrate how ultrafast spectroscopic techniques can be used to unravel complex biomolecular excited-state dynamics in solution.

Electronic structure of Fe- vs. Ru-based dye molecules

NASA Astrophysics Data System (ADS)

Johnson, Phillip S.; Cook, Peter L.; Zegkinoglou, Ioannis; García-Lastra, J. M.; Rubio, Angel; Ruther, Rose E.; Hamers, Robert J.; Himpsel, F. J.

2013-01-01

In order to explore whether Ru can be replaced by inexpensive Fe in dye molecules for solar cells, the differences in the electronic structure of Fe- and Ru-based dyes are investigated by X-ray absorption spectroscopy and first-principles calculations. Molecules with the metal in a sixfold, octahedral N cage, such as tris(bipyridines) and tris(phenanthrolines), exhibit a systematic downward shift of the N 1s-to-π* transition when Ru is replaced by Fe. This shift is explained by an extra transfer of negative charge from the metal to the N ligands in the case of Fe, which reduces the binding energy of the N 1s core level. The C 1s-to-π* transitions show the opposite trend, with an increase in the transition energy when replacing Ru by Fe. Molecules with the metal in a fourfold, planar N cage (porphyrins) exhibit a more complex behavior due to a subtle competition between the crystal field, axial ligands, and the 2+ vs. 3+ oxidation states.

Single-Nanoparticle Photoelectrochemistry at a Nanoparticulate TiO2 -Filmed Ultramicroelectrode.

PubMed

Peng, Yue-Yi; Ma, Hui; Ma, Wei; Long, Yi-Tao; Tian, He

2018-03-26

An ultrasensitive photoelectrochemical method for achieving real-time detection of single nanoparticle collision events is presented. Using a micrometer-thick nanoparticulate TiO 2 -filmed Au ultra-microelectrode (TiO 2 @Au UME), a sub-millisecond photocurrent transient was observed for an individual N719-tagged TiO 2 (N719@TiO 2 ) nanoparticle and is due to the instantaneous collision process. Owing to a trap-limited electron diffusion process as the rate-limiting step, a random three-dimensional diffusion model was developed to simulate electron transport dynamics in TiO 2 film. The combination of theoretical simulation and high-resolution photocurrent measurement allow electron-transfer information of a single N719@TiO 2 nanoparticle to be quantified at single-molecule accuracy and the electron diffusivity and the electron-collection efficiency of TiO 2 @Au UME to be estimated. This method provides a test for studies of photoinduced electron transfer at the single-nanoparticle level. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

Microhydration of LiOH: Insight from electronic decays of core-ionized states

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kryzhevoi, Nikolai V., E-mail: nikolai.kryzhevoi@pci.uni-heidelberg.de

2016-06-28

We compute and compare the autoionization spectra of a core-ionized LiOH molecule both in its isolated and microhydrated states. Stepwise microhydration of LiOH leads to gradual elongation of the Li–OH bond length and finally to molecular dissociation. The accompanying changes in the local environment of the OH{sup −} and Li{sup +} counterions are reflected in the computed O 1s and Li 1s spectra. The role of solvent water molecules and the counterion in the spectral shape formation is assessed. Electronic decays of the microhydrated LiOH are found to be mostly intermolecular since the majority of the populated final states havemore » at least one outer-valence vacancy outside the initially core-ionized ion, mainly on a neighboring water molecule. The charge delocalization occurs through the intermolecular Coulombic and electron transfer mediated decays. Both mechanisms are highly efficient that is partly attributed to hybridization of molecular orbitals. The computed spectral shapes are sensitive to the counterion separation as well as to the number and arrangement of solvent molecules. These sensitivities can be used for studying the local hydration structure of solvated ions in aqueous solutions.« less

First principles study on the electronic transport properties of C{sub 60} and B{sub 80} molecular bridges

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zheng, X. H., E-mail: xhzheng@theory.issp.ac.cn; Hao, H.; Lan, J.

2014-08-21

The electronic transport properties of molecular bridges constructed by C{sub 60} and B{sub 80} molecules which have the same symmetry are investigated by first principles calculations combined with a non-equilibrium Green's function technique. It is found that, like C{sub 60}, monomer B{sub 80} is a good conductor arising from the charge transfer from the leads to the molecule, while the dimer (B{sub 80}){sub 2} and (C{sub 60}){sub 2} are both insulators due to the potential barrier formed at the molecule-molecule interface. Our further study shows that, although both the homogeneous dimer (B{sub 80}){sub 2} and (C{sub 60}){sub 2} display poormore » conductivity, the heterogeneous dimer B{sub 80}C{sub 60} shows a very high conductance as a result from the decreased HOMO-LUMO gap and the excess charge redistribution. Finally, we find that the conductivity of both (B{sub 80}){sub 2} and (C{sub 60}){sub 2} can be significantly improved by electron doping, for example, by doping C in (B{sub 80}){sub 2} and doping N in (C{sub 60}){sub 2}.« less

Imaging Plasmon Hybridization of Fano Resonances via Hot-Electron-Mediated Absorption Mapping.

PubMed

Simoncelli, Sabrina; Li, Yi; Cortés, Emiliano; Maier, Stefan A

2018-06-13

The inhibition of radiative losses in dark plasmon modes allows storing electromagnetic energy more efficiently than in far-field excitable bright-plasmon modes. As such, processes benefiting from the enhanced absorption of light in plasmonic materials could also take profit of dark plasmon modes to boost and control nanoscale energy collection, storage, and transfer. We experimentally probe this process by imaging with nanoscale precision the hot-electron driven desorption of thiolated molecules from the surface of gold Fano nanostructures, investigating the effect of wavelength and polarization of the incident light. Spatially resolved absorption maps allow us to show the contribution of each element of the nanoantenna in the hot-electron driven process and their interplay in exciting a dark plasmon mode. Plasmon-mode engineering allows control of nanoscale reactivity and offers a route to further enhance and manipulate hot-electron driven chemical reactions and energy-conversion and transfer at the nanoscale.

Peripheral Hole Acceptor Moieties on an Organic Dye Improve Dye‐Sensitized Solar Cell Performance

PubMed Central

Hao, Yan; Gabrielsson, Erik; Lohse, Peter William; Yang, Wenxing; Johansson, Erik M. J.; Hagfeldt, Anders

2015-01-01

Investigation of charge transfer dynamics in dye‐sensitized solar cells is of fundamental interest and the control of these dynamics is a key factor for developing more efficient solar cell devices. One possibility for attenuating losses through recombination between injected electrons and oxidized dye molecules is to move the positive charge further away from the metal oxide surface. For this purpose, a metal‐free dye named E6 is developed, in which the chromophore core is tethered to two external triphenylamine (TPA) units. After photoinduced electron injection into TiO2, the remaining hole is rapidly transferred to a peripheral TPA unit. Electron–hole recombination is slowed down by 30% compared to a reference dye without peripheral TPA units. Furthermore, it is found that the added TPA moieties improve the electron blocking effect of the dye, retarding recombination of electrons from TiO2 to the cobalt‐based electrolyte. PMID:27722076

Modeling Electronic-Nuclear Interactions for Excitation Energy Transfer Processes in Light-Harvesting Complexes.

PubMed

Lee, Mi Kyung; Coker, David F

2016-08-18

An accurate approach for computing intermolecular and intrachromophore contributions to spectral densities to describe the electronic-nuclear interactions relevant for modeling excitation energy transfer processes in light harvesting systems is presented. The approach is based on molecular dynamics (MD) calculations of classical correlation functions of long-range contributions to excitation energy fluctuations and a separate harmonic analysis and single-point gradient quantum calculations for electron-intrachromophore vibrational couplings. A simple model is also presented that enables detailed analysis of the shortcomings of standard MD-based excitation energy fluctuation correlation function approaches. The method introduced here avoids these problems, and its reliability is demonstrated in accurate predictions for bacteriochlorophyll molecules in the Fenna-Matthews-Olson pigment-protein complex, where excellent agreement with experimental spectral densities is found. This efficient approach can provide instantaneous spectral densities for treating the influence of fluctuations in environmental dissipation on fast electronic relaxation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arlt, T.; Penzkofer H.; Zinth, W.

The energetics of the primary electron donor (the special pair P) in reaction centers from Rhodopseudomonas viridis were modified by site-directed mutagenesis of histidine L168 to phenylalanine. This leads to the loss of a hydrogen bond between the amino acid side chain and the ring I acetyl carbonyl oxygen of the bacteriochlorophyll molecule BChl{sub LP}. As a result of the mutation, a 35 nm blue shift of the Q{sub y} band of the special pair and a decrease of 80 mV in the P/P{sup +} oxidation-reduction potential occur. Femtosecond spectroscopy revealed an acceleration of the first electron transfer step frommore » 3.5 ps in wild type to 1.1 ps in mutant. Analysis of change in the bacteriochlorophyll monomer (B) band of the mutant reaction centers showed strong bleaching. This is direct evidence that bacteriochlorophyll b is real intermediate in electron transfer. The changes in redox potential and time constants allow one to estimate the energetics in the wild-type and mutated reaction centers according to the Marcus electron transfer theory. 32 refs., 6 figs.« less

Handshake electron transfer from hydrogen Rydberg atoms incident at a series of metallic thin films

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gibbard, J. A.; Softley, T. P.

2016-06-21

Thin metallic films have a 1D quantum well along the surface normal direction, which yields particle-in-a-box style electronic quantum states. However the quantum well is not infinitely deep and the wavefunctions of these states penetrate outside the surface where the electron is bound by its own image-charge attraction. Therefore a series of discrete, vacant states reach out from the thin film into the vacuum increasing the probability of electron transfer from an external atom or molecule to the thin film, especially for the resonant case where the quantum well energy matches that of the atom. We show that “handshake” electronmore » transfer from a highly excited Rydberg atom to these thin-film states is experimentally measurable. Thicker films have a wider 1D box, changing the energetic distribution and image-state contribution to the thin film wavefunctions, resulting in more resonances. Calculations successfully predict the number of resonances and the nature of the thin-film wavefunctions for a given film thickness.« less

Electron Spin Polarization Transfer to ortho-H2 by Interaction of para-H2 with Paramagnetic Species: A Key to a Novel para → ortho Conversion Mechanism.

PubMed

Terenzi, Camilla; Bouguet-Bonnet, Sabine; Canet, Daniel

2015-05-07

We report that at ambient temperature and with 100% enriched para-hydrogen (p-H2) dissolved in organic solvents, paramagnetic spin catalysis of para → ortho hydrogen conversion is accompanied at the onset by a negative ortho-hydrogen (o-H2) proton NMR signal. This novel finding indicates an electron spin polarization transfer, and we show here that this can only occur if the H2 molecule is dissociated upon its transient adsorption by the paramagnetic catalyst. Following desorption, o-H2 is created until the thermodynamic equilibrium is reached. A simple theory confirms that in the presence of a static magnetic field, the hyperfine coupling between unpaired electrons and nuclear spins is responsible for the observed polarization transfer. Owing to the negative electron gyromagnetic ratio, this explains the experimental results and ascertains an as yet unexplored mechanism for para → ortho conversion. Finally, we show that the recovery of o-H2 magnetization toward equilibrium can be simply modeled, leading to the para → ortho conversion rate.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inhester, Ludger; Oostenrijk, Bart; Patanen, Minna

In many cases fragmentation of molecules upon inner-shell ionization is very unspecific with respect to the initially localized ionization site. Often this finding is interpreted in terms of an equilibration of internal energy into vibrational degrees of freedom after Auger decay. In this paper, we investigate the X-ray photofragmentation of ethyl trifluoroacetate upon core electron ionization at environmentally distinct carbon sites using photoelectron–photoion–photoion coincidence measurements and ab initio electronic structure calculations. For all four carbon ionization sites, the Auger decay weakens the same bonds and transfers the two charges to opposite ends of the molecule, which leads to a rapidmore » dissociation into three fragments, followed by further fragmentation steps. Finally, the lack of site specificity is attributed to the character of the dicationic electronic states after Auger decay instead of a fast equilibration of internal energy.« less

Current-voltage characteristics and transition voltage spectroscopy of individual redox proteins.

PubMed

Artés, Juan M; López-Martínez, Montserrat; Giraudet, Arnaud; Díez-Pérez, Ismael; Sanz, Fausto; Gorostiza, Pau

2012-12-19

Understanding how molecular conductance depends on voltage is essential for characterizing molecular electronics devices. We reproducibly measured current-voltage characteristics of individual redox-active proteins by scanning tunneling microscopy under potentiostatic control in both tunneling and wired configurations. From these results, transition voltage spectroscopy (TVS) data for individual redox molecules can be calculated and analyzed statistically, adding a new dimension to conductance measurements. The transition voltage (TV) is discussed in terms of the two-step electron transfer (ET) mechanism. Azurin displays the lowest TV measured to date (0.4 V), consistent with the previously reported distance decay factor. This low TV may be advantageous for fabricating and operating molecular electronic devices for different applications. Our measurements show that TVS is a helpful tool for single-molecule ET measurements and suggest a mechanism for gating of ET between partner redox proteins.

Prospects for transferring 87Rb84Sr dimers to the rovibrational ground state based on calculated molecular structures

NASA Astrophysics Data System (ADS)

Chen, Tao; Zhu, Shaobing; Li, Xiaolin; Qian, Jun; Wang, Yuzhu

2014-06-01

Using fitted model potential curves of the ground and lowest three excited states yielded by the relativistic Kramers-restricted multireference configuration interaction method with 19 electrons correlated, we theoretically investigate the rovibrational properties including the number of vibrational state and diagonally distributed Franck-Condon factors for a 87Rb84Sr molecule. Benefiting from a turning point at about v'=20 for the Franck-Condon factors between the ground state and spin-orbit 2(Ω=1/2) excited state, we choose |2(Ω=1/2),v'=21,J'=1> as the intermediate state in the three-level model to theoretically analyze the possibility of performing stimulated Raman adiabatic passage to transfer weakly bound RbSr molecules to the rovibrational ground state. With 1550 nm pump laser (2 W/cm2) and 1342 nm dump laser (10 mW/cm2) employed and appropriate settings of pulse time length (about 300 μs), we have formalistically achieved a round-trip transfer efficiency of 60%, namely 77% for one-way transfer. The results demonstrate the possibility of producing polar 87Rb84Sr molecules efficiently in a submicrokelvin regime, and further provide promising directions for future theoretical and experimental studies on alkali-alkaline(rare)-earth dimers.

Function of CN group in organic sensitizers: The first principle study.

PubMed

Liu, Yun; Shao, Di; Bai, Xiaohui; Yang, Zhenqing; Lin, Chundan; Shao, Changjin

2017-05-15

The cyano group (CN) of the acceptor in organic sensitizers plays an important role for highly efficient dye-sensitized solar cells. In this paper, three 5, 6-difluoro-2,1,3-benzothiadiazole (DFBTD) organic molecules with different number of CN units, named ME15, ME16 and ME17, were investigated by the density functional theory (DFT) and time-dependent DFT (TDDFT). We analyzed the CNs effects on the electronic structures, optical properties, adsorption modes and electron transfer and injection. The result shows that ME17 has the largest maximum absorption wavelength (λ max ) among these new designed dyes due to the strong electron withdrawing ability of two CNs. In addition, CN greatly influence the adsorption modes of dye/TiO 2 and electron injection mechanism. ME16 with one CN also has good optical absorption properties and its acceptor has the strongest coupling strength with the TiO 2 semiconductor which is favorable for electron transfer and injection. Thus, we believe that the number of CN groups in acceptor should be moderate and one CN in D-A-π-A structure dyes may be the more appropriate focusing on the light harvesting ability, electron transfer and electron injection. Copyright © 2017 Elsevier B.V. All rights reserved.

Systematic study on the TD-DFT calculated electronic circular dichroism spectra of chiral aromatic nitro compounds: A comparison of B3LYP and CAM-B3LYP.

PubMed

Komjáti, Balázs; Urai, Ákos; Hosztafi, Sándor; Kökösi, József; Kováts, Benjámin; Nagy, József; Horváth, Péter

2016-02-15

B3LYP is one of the most widely used functional for the prediction of electronic circular dichroism spectra, however if the studied molecule contains aromatic nitro group computations may fail to produce reliable results. A test set of molecules of known stereochemistry were synthesized to study this phenomenon in detail. Spectra were computed by B3LYP and CAM-B3LYP functionals with 6-311++G(2d,2p) basis set. It was found that the range separated CAM-B3LYP gives better predictions than B3LYP for all test molecules. Fragment population analysis revealed that the nitro groups form highly localized molecule orbitals but the exact composition depends on the functional. CAM-B3LYP allows sufficient spatial overlap between the nitro group and distant parts of the molecule, which is necessary for the accurate description of excited states especially for charge transfer states. This phenomenon and the synthesized test molecules can be used to benchmark theoretical methods as well as to help the development of new functionals intended for spectroscopical studies. Copyright © 2015 Elsevier B.V. All rights reserved.

A review on chemistry of a powerful organic electron acceptor 7, 7, 8, 8, tetracynoquinodimethane (TCNQ)

NASA Astrophysics Data System (ADS)

Singh, Yadunath

2018-05-01

Organic semiconductors have so far found extensive practical applications similar to inorganic semiconductors. Interest in these compounds has been stimulated by the synthesis of several powerful electron acceptors, such as tetracynoethylene (TCNE), 7, 7, 8, 8, tetracynoquinodimethane (TCNQ) and cyno-p-benzoquinone. In this connection TCNQ is of particular interest, due to presence of four powerful electron accepting groups in its molecule. Nucleophillic addition reactions, which are rarely encountered among unsaturated compounds, as well as addition reactions proceeding via a one electron transfer stage are characteristic of this substance.

Self-exchange reactions of radical anions in n-hexane.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Werst, D. W.; Chemistry

The formation and reactions of radical anions in n-hexane at 190 K were investigated by pulse radiolysis and time-resolved fluorescence-detected magnetic resonance (FDMR). Electron attachment was found to occur for compounds with gas-phase electron affinities (EA) more positive than -1.1 {+-} 0.1 eV. The FDMR concentration and time dependence are interpreted as evidence for self-exchange electron-transfer reactions, indicating that formation of dimer radical anions is not prevalent for the range of molecules studied. FDMR detection of radical anions is mainly restricted to electron acceptors with EA less than approximately 0.5 eV.

Charge separation and carrier dynamics in donor-acceptor heterojunction photovoltaic systems.

PubMed

Teuscher, Joël; Brauer, Jan C; Stepanov, Andrey; Solano, Alicia; Boziki, Ariadni; Chergui, Majed; Wolf, Jean-Pierre; Rothlisberger, Ursula; Banerji, Natalie; Moser, Jacques-E

2017-11-01

Electron transfer and subsequent charge separation across donor-acceptor heterojunctions remain the most important areas of study in the field of third-generation photovoltaics. In this context, it is particularly important to unravel the dynamics of individual ultrafast processes (such as photoinduced electron transfer, carrier trapping and association, and energy transfer and relaxation), which prevail in materials and at their interfaces. In the frame of the National Center of Competence in Research "Molecular Ultrafast Science and Technology," a research instrument of the Swiss National Science Foundation, several groups active in the field of ultrafast science in Switzerland have applied a number of complementary experimental techniques and computational simulation tools to scrutinize these critical photophysical phenomena. Structural, electronic, and transport properties of the materials and the detailed mechanisms of photoinduced charge separation in dye-sensitized solar cells, conjugated polymer- and small molecule-based organic photovoltaics, and high-efficiency lead halide perovskite solar energy converters have been scrutinized. Results yielded more than thirty research articles, an overview of which is provided here.

Water-chromophore electron transfer determines the photochemistry of cytosine and cytidine.

PubMed

Szabla, Rafał; Kruse, Holger; Šponer, Jiří; Góra, Robert W

2017-07-21

Many of the UV-induced phenomena observed experimentally for aqueous cytidine were lacking the mechanistic interpretation for decades. These processes include the substantial population of the puzzling long-lived dark state, photohydration, cytidine to uridine conversion and oxazolidinone formation. Here, we present quantum-chemical simulations of excited-state spectra and potential energy surfaces of N1-methylcytosine clustered with two water molecules using the second-order approximate coupled cluster (CC2), complete active space with second-order perturbation theory (CASPT2), and multireference configuration interaction with single and double excitation (MR-CISD) methods. We argue that the assignment of the long-lived dark state to a singlet nπ* excitation involving water-chromophore electron transfer might serve as an explanation for the numerous experimental observations. While our simulated spectra for the state are in excellent agreement with experimentally acquired data, the electron-driven proton transfer process occurring on the surface may initiate the subsequent damage in the vibrationally hot ground state of the chromophore.

Single-particle studies of band alignment effects on electron transfer dynamics from semiconductor hetero-nanostructures to single-walled carbon nanotubes.

PubMed

Yuan, Chi-Tsu; Wang, Yong-Gang; Huang, Kuo-Yen; Chen, Ting-Yu; Yu, Pyng; Tang, Jau; Sitt, Amit; Banin, Uri; Millo, Oded

2012-01-24

We utilize single-molecule spectroscopy combined with time-correlated single-photon counting to probe the electron transfer (ET) rates from various types of semiconductor hetero-nanocrystals, having either type-I or type-II band alignment, to single-walled carbon nanotubes. A significantly larger ET rate was observed for type-II ZnSe/CdS dot-in-rod nanostructures as compared to type-I spherical CdSe/ZnS core/shell quantum dots and to CdSe/CdS dot-in-rod structures. Furthermore, such rapid ET dynamics can compete with both Auger and radiative recombination processes, with significance for effective photovoltaic operation. © 2011 American Chemical Society

Studying electron-PAG interactions using electron-induced fluorescence

NASA Astrophysics Data System (ADS)

Narasimhan, Amrit; Grzeskowiak, Steven; Ostrander, Jonathan; Schad, Jonathon; Rebeyev, Eliran; Neisser, Mark; Ocola, Leonidas E.; Denbeaux, Gregory; Brainard, Robert L.

2016-03-01

In extreme ultraviolet (EUV) lithography, 92 eV photons are used to expose photoresists. Typical EUV resists are organic-based and chemically amplified using photoacid generators (PAGs). Upon exposure, PAGs produce acids which catalyze reactions that result in changes in solubility. In EUV lithography, photo- and secondary electrons (energies of 10- 80 eV) play a large role in PAG acid-production. Several mechanisms for electron-PAG interactions (e.g. electron trapping, and hole-initiated chemistry) have been proposed. The aim of this study is to explore another mechanism - internal excitation - in which a bound PAG electron can be excited by receiving energy from another energetic electron, causing a reaction that produces acid. This paper explores the mechanism of internal excitation through the analogous process of electron-induced fluorescence, in which an electron loses energy by transferring that energy to a molecule and that molecule emits a photon rather than decomposing. We will show and quantify electron-induced fluorescence of several fluorophores in polymer films to mimic resist materials, and use this information to refine our proposed mechanism. Relationships between the molecular structure of fluorophores and fluorescent quantum yield may aid in the development of novel PAGs for EUV lithography.

Fourier transform infrared difference and time-resolved infrared detection of the electron and proton transfer dynamics in photosynthetic water oxidation.

PubMed

Noguchi, Takumi

2015-01-01

Photosynthetic water oxidation, which provides the electrons necessary for CO₂ reduction and releases O₂ and protons, is performed at the Mn₄CaO₅ cluster in photosystem II (PSII). In this review, studies that assessed the mechanism of water oxidation using infrared spectroscopy are summarized focusing on electron and proton transfer dynamics. Structural changes in proteins and water molecules between intermediates known as Si states (i=0-3) were detected using flash-induced Fourier transform infrared (FTIR) difference spectroscopy. Electron flow in PSII and proton release from substrate water were monitored using the infrared changes in ferricyanide as an exogenous electron acceptor and Mes buffer as a proton acceptor. Time-resolved infrared (TRIR) spectroscopy provided information on the dynamics of proton-coupled electron transfer during the S-state transitions. In particular, a drastic proton movement during the lag phase (~200μs) before electron transfer in the S3→S0 transition was detected directly by monitoring the infrared absorption of a polarizable proton in a hydrogen bond network. Furthermore, the proton release pathways in the PSII proteins were analyzed by FTIR difference measurements in combination with site-directed mutagenesis, isotopic substitutions, and quantum chemical calculations. Therefore, infrared spectroscopy is a powerful tool for understanding the molecular mechanism of photosynthetic water oxidation. This article is part of a Special Issue entitled: Vibrational spectroscopies and bioenergetic systems. Copyright © 2014 Elsevier B.V. All rights reserved.

The dipole moment of the electron carrier adrenodoxin is not critical for redox partner interaction and electron transfer.

PubMed

Hannemann, Frank; Guyot, Arnaud; Zöllner, Andy; Müller, Jürgen J; Heinemann, Udo; Bernhardt, Rita

2009-07-01

Dipole moments of proteins arise from helical dipoles, hydrogen bond networks and charged groups at the protein surface. High protein dipole moments were suggested to contribute to the electrostatic steering between redox partners in electron transport chains of respiration, photosynthesis and steroid biosynthesis, although so far experimental evidence for this hypothesis was missing. In order to probe this assumption, we changed the dipole moment of the electron transfer protein adrenodoxin and investigated the influence of this on protein-protein interactions and electron transfer. In bovine adrenodoxin, the [2Fe-2S] ferredoxin of the adrenal glands, a dipole moment of 803 Debye was calculated for a full-length adrenodoxin model based on the Adx(4-108) and the wild type adrenodoxin crystal structures. Large distances and asymmetric distribution of the charged residues in the molecule mainly determine the observed high value. In order to analyse the influence of the resulting inhomogeneous electric field on the biological function of this electron carrier the molecular dipole moment was systematically changed. Five recombinant adrenodoxin mutants with successively reduced dipole moment (from 600 to 200 Debye) were analysed for their redox properties, their binding affinities to the redox partner proteins and for their function during electron transfer-dependent steroid hydroxylation. None of the mutants, not even the quadruple mutant K6E/K22Q/K24Q/K98E with a dipole moment reduced by about 70% showed significant changes in the protein function as compared with the unmodified adrenodoxin demonstrating that neither the formation of the transient complex nor the biological activity of the electron transfer chain of the endocrine glands was affected. This is the first experimental evidence that the high dipole moment observed in electron transfer proteins is not involved in electrostatic steering among the proteins in the redox chain.

Role of the photosynthetic electron transfer chain in electrogenic activity of cyanobacteria.

PubMed

Pisciotta, John M; Zou, Yongjin; Baskakov, Ilia V

2011-07-01

Certain anaerobic bacteria, termed electrogens, produce an electric current when electrons from oxidized organic molecules are deposited to extracellular metal oxide acceptors. In these heterotrophic "metal breathers", the respiratory electron transport chain (R-ETC) works in concert with membrane-bound cytochrome oxidases to transfer electrons to the extracellular acceptors. The diversity of bacteria able to generate an electric current appears more widespread than previously thought, and aerobic phototrophs, including cyanobacteria, possess electrogenic activity. However, unlike heterotrophs, cyanobacteria electrogenic activity is light dependent, which suggests that a novel pathway could exist. To elucidate the electrogenic mechanism of cyanobacteria, the current studies used site-specific inhibitors to target components of the photosynthetic electron transport chain (P-ETC) and cytochrome oxidases. Here, we show that (1) P-ETC and, particularly, water photolysed by photosystem II (PSII) is the source of electrons discharged to the environment by illuminated cyanobacteria, and (2) water-derived electrons are transmitted from PSII to extracellular electron acceptors via plastoquinone and cytochrome bd quinol oxidase. Two cyanobacterial genera (Lyngbya and Nostoc) displayed very similar electrogenic responses when treated with P-ETC site-specific inhibitors, suggesting a conserved electrogenic pathway. We propose that in cyanobacteria, electrogenic activity may represent a form of overflow metabolism to protect cells under high-intensity light. This study offers insight into electron transfer between phototrophic microorganisms and the environment and expands our knowledge into biologically based mechanisms for harnessing solar energy.

Theoretical study of solvent effects on the electronic coupling matrix elements in rigidly linked donor-acceptor systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cave, R.J.; Newton, M.D.; Kumar, K.

1995-12-07

The recently developed generalized Mulliken-Hush approach for the calculation of the electronic coupling matrix element for electron-transfer processes is applied to two rigidly linked donor-bridge-acceptor systems having dimethoxyanthracene as the donor and a dicarbomethoxycyclobutene unit as the acceptor. The dependence of the electronic coupling matrix element as a function of bridge type is examined with and without solvent molecules present. For clamp-shaped bridge structures solvent can have a dramatic effect on the electronic coupling matrix element. The behavior with variation of solvent is in good agreement with that observed experimentally for these systems. 23 refs., 2 tabs.

Electronuclear paths in the nuclear conversion of molecular hydrogen in silicon

NASA Astrophysics Data System (ADS)

Ilisca, Ernest; Ghiglieno, Filippo

2017-01-01

The ortho-para conversion of hydrogen molecules oscillating inside tetrahedral cages of silicon compounds relies on the interaction of the nuclear protons with the silicon electrons. At each collision against the cage hard walls, the electron repulsion changes the molecular rotation while projecting a valence electron in the antibonding molecular state dressed by a group of conduction ones. That «bridge» facilitates the hyperfine contact of the electrons with the protons. At room temperature, the angular momentum transfer is enhanced by electron fluctuations that overcome the silicon gap and accelerate the nuclear rates by more than one order of magnitude.

Ensemble and Single-Molecule Studies on Fluorescence Quenching in Transition Metal Bipyridine-Complexes

PubMed Central

Brox, Dominik; Kiel, Alexander; Wörner, Svenja Johanna; Pernpointner, Markus; Comba, Peter; Martin, Bodo; Herten, Dirk-Peter

2013-01-01

Beyond their use in analytical chemistry fluorescent probes continuously gain importance because of recent applications of single-molecule fluorescence spectroscopy to monitor elementary reaction steps. In this context, we characterized quenching of a fluorescent probe by different metal ions with fluorescence spectroscopy in the bulk and at the single-molecule level. We apply a quantitative model to explain deviations from existing standard models for fluorescence quenching. The model is based on a reversible transition from a bright to a dim state upon binding of the metal ion. We use the model to estimate the stability constants of complexes with different metal ions and the change of the relative quantum yield of different reporter dye labels. We found ensemble data to agree widely with results from single-molecule experiments. Our data indicates a mechanism involving close molecular contact of dye and quenching moiety which we also found in molecular dynamics simulations. We close the manuscript with a discussion of possible mechanisms based on Förster distances and electrochemical potentials which renders photo-induced electron transfer to be more likely than Förster resonance energy transfer. PMID:23483966

The fabrication of small molecule organic light-emitting diode pixels by laser-induced forward transfer

NASA Astrophysics Data System (ADS)

Shaw-Stewart, J. R. H.; Mattle, T.; Lippert, T. K.; Nagel, M.; Nüesch, F. A.; Wokaun, A.

2013-01-01

Laser-induced forward transfer (LIFT) is a versatile organic light-emitting diode (OLED) pixel deposition process, but has hitherto been applied exclusively to polymeric materials. Here, a modified LIFT process has been used to fabricate small molecule Alq3 organic light-emitting diodes (SMOLEDs). Small molecule thin films are considerably more mechanically brittle than polymeric thin films, which posed significant challenges for LIFT of these materials. The LIFT process presented here uses a polymeric dynamic release layer, a reduced environmental pressure, and a well-defined receiver-donor gap. The Alq3 pixels demonstrate good morphology and functionality, even when compared to conventionally fabricated OLEDs. The Alq3 SMOLED pixel performances show a significant amount of fluence dependence, not observed with polymerical OLED pixels made in previous studies. A layer of tetrabutyl ammonium hydroxide has been deposited on top of the aluminium cathode, as part of the donor substrate, to improve electron injection to the Alq3, by over 600%. These results demonstrate that this variant of LIFT is applicable for the deposition of functional small molecule OLEDs as well as polymeric OLEDs.

Ultrafast electron and energy transfer in dye-sensitized iron oxide and oxyhydroxide nanoparticles.

PubMed

Gilbert, Benjamin; Katz, Jordan E; Huse, Nils; Zhang, Xiaoyi; Frandsen, Cathrine; Falcone, Roger W; Waychunas, Glenn A

2013-10-28

An emerging area in chemical science is the study of solid-phase redox reactions using ultrafast time-resolved spectroscopy. We have used molecules of the photoactive dye 2',7'-dichlorofluorescein (DCF) anchored to the surface of iron(III) oxide nanoparticles to create iron(II) surface atoms via photo-initiated interfacial electron transfer. This approach enables time-resolved study of the fate and mobility of electrons within the solid phase. However, complete analysis of the ultrafast processes following dye photoexcitation of the sensitized iron(III) oxide nanoparticles has not been reported. We addressed this topic by performing femtosecond transient absorption (TA) measurements of aqueous suspensions of uncoated and DCF-sensitized iron oxide and oxyhydroxide nanoparticles, and an aqueous iron(III)-dye complex. Following light absorption, excited state relaxation times of the dye of 115-310 fs were found for all samples. Comparison between TA dynamics on uncoated and dye-sensitized hematite nanoparticles revealed the dye de-excitation pathway to consist of a competition between electron and energy transfer to the nanoparticles. We analyzed the TA data for hematite nanoparticles using a four-state model of the dye-sensitized system, finding electron and energy transfer to occur on the same ultrafast timescale. The interfacial electron transfer rates for iron oxides are very close to those previously reported for DCF-sensitized titanium dioxide (for which dye-oxide energy transfer is energetically forbidden) even though the acceptor states are different. Comparison of the alignment of the excited states of the dye and the unoccupied states of these oxides showed that the dye injects into acceptor states of different symmetry (Ti t2gvs. Fe eg).

Enhancement of humidity sensitivity of graphene through functionalization with polyethylenimine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ben Aziza, Zeineb; School of Electrical and Electronics Engineering, Nanyang Technological University, Block S1, 50 Nanyang Avenue, Singapore 639798; XLIM UMR 7252 Université de Limoges/CNRS, 123 Avenue Albert Thomas, 87060 Limoges

2015-09-28

In this work, we show that the sensing performance of graphene based humidity sensors can be largely improved through polymer functionalization. Chemical vapor deposited graphene is functionalized with amine rich polymer, leading to electron transfer from amine groups in the polymer to graphene. The functionalized graphene humidity sensor has demonstrated good sensitivity, recovery, and repeatability. Charge transfer between the functionalized graphene and water molecules and the sensing mechanism are studied systemically using field effect transistor geometry and scanning Kelvin probe microscopy.

Mutations in algal and cyanobacterial Photosystem I that independently affect the yield of initial charge separation in the two electron transfer cofactor branches.

PubMed

Badshah, Syed Lal; Sun, Junlei; Mula, Sam; Gorka, Mike; Baker, Patricia; Luthra, Rajiv; Lin, Su; van der Est, Art; Golbeck, John H; Redding, Kevin E

2018-01-01

In Photosystem I, light-induced electron transfer can occur in either of two symmetry-related branches of cofactors, each of which is composed of a pair of chlorophylls (ec2 A /ec3 A or ec2 B /ec3 B ) and a phylloquinone (PhQ A or PhQ B ). The axial ligand to the central Mg 2+ of the ec2 A and ec2 B chlorophylls is a water molecule that is also H-bonded to a nearby Asn residue. Here, we investigate the importance of this interaction for charge separation by converting each of the Asn residues to a Leu in the green alga, Chlamydomonas reinhardtii, and the cyanobacterium, Synechocystis sp. PCC6803, and studying the energy and electron transfer using time-resolved optical and EPR spectroscopy. Nanosecond transient absorbance measurements of the PhQ to F X electron transfer show that in both species, the PsaA-N604L mutation (near ec2 B ) results in a ~50% reduction in the amount of electron transfer in the B-branch, while the PsaB-N591L mutation (near ec2 A ) results in a ~70% reduction in the amount of electron transfer in the A-branch. A diminished quantum yield of P 700 + PhQ - is also observed in ultrafast optical experiments, but the lower yield does not appear to be a consequence of charge recombination in the nanosecond or microsecond timescales. The most significant finding is that the yield of electron transfer in the unaffected branch did not increase to compensate for the lower yield in the affected branch. Hence, each branch of the reaction center appears to operate independently of the other in carrying out light-induced charge separation. Copyright © 2017 Elsevier B.V. All rights reserved.

Chemical Control of Charge Trapping and Charge Transfer Processes at the Organic-Inorganic Interface within Quantum Dot-Organic Complexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weiss, Emily A.

Within the research program funded through the Early Career Research Award we designed complexes of colloidal semiconductor quantum dots (QDs) and organic molecules in which the interfacial chemistry controls the electronic structure and dynamics of the excitonic state of the QD. The program included two main projects; (1) investigation of the mechanisms by which organic surfactants control the quantum confinement of excitonic charge carriers; and (2) development of models for electron transfer between QDs and adsorbed molecules as a function of interfacial chemistry. This project was extremely successful in that our achievements in those two areas addressed the great majoritymore » of questions we outlined in the original proposal and answered questions I did not think to ask in that original proposal. Our work led to the discovery of “exciton delocalizing ligands”, which change the electronic structure of colloidal semiconductor nanocrystals by altering, with small synthetic modifications to their surfaces, their most defining characteristic – the quantum confinement of their excited states. It also led to detailed, quantitative descriptions of how the surface chemistry of a QD dictates, thermodynamically and kinetically, the probability of exchange of electrons between the QD and a small molecule. We used two of the three major techniques in the proposal (transient photoluminescence and transient absorption). Electrogenerated chemiluminescence was also proposed, but was too technically difficult with these systems to be useful. Instead, NMR spectroscopy emerged as a major analytical tool in our studies. With the fundamental advancements we made with this project, we believe that we can design QDs to be the next great class of visible-light photocatalysts.« less

Charge Separation and Triplet Exciton Formation Pathways in Small-Molecule Solar Cells as Studied by Time-Resolved EPR Spectroscopy

DOE PAGES

Thomson, Stuart A. J.; Niklas, Jens; Mardis, Kristy L.; ...

2017-09-13

Organic solar cells are a promising renewable energy technology, offering the advantages of mechanical flexibility and solution processability. An understanding of the electronic excited states and charge separation pathways in these systems is crucial if efficiencies are to be further improved. Here we use light induced electron paramagnetic resonance (LEPR) spectroscopy and density functional theory calculations (DFT) to study the electronic excited states, charge transfer (CT) dynamics and triplet exciton formation pathways in blends of the small molecule donors (DTS(FBTTh 2) 2, DTS(F2BTTh 2) 2, DTS(PTTh 2) 2, DTG(FBTTh 2) 2 and DTG(F2BTTh 2) 2) with the fullerene derivative PCmore » 61BM. Using high frequency EPR the g-tensor of the positive polaron on the donor molecules was determined. The experimental results are compared with DFT calculations which reveal that the spin density of the polaron is distributed over a dimer or trimer. Time-resolved EPR (TR-EPR) spectra attributed to singlet CT states were identified and the polarization patterns revealed similar charge separation dynamics in the four fluorobenzothiadiazole donors, while charge separation in the DTS(PTTh 2) 2 blend is slower. Using TR-EPR we also investigated the triplet exciton formation pathways in the blend. The polarization patterns reveal that the excitons originate from both intersystem crossing (ISC) and back electron transfer (BET) processes. The DTS(PTTh 2) 2 blend was found to contain substantially more triplet excitons formed by BET than the fluorobenzothiadiazole blends. As a result, the higher BET triplet exciton population in the DTS(PTTh 2) 2 blend is in accordance with the slower charge separation dynamics observed in this blend.« less

Charge Separation and Triplet Exciton Formation Pathways in Small Molecule Solar Cells as Studied by Time-resolved EPR Spectroscopy.

PubMed

Thomson, Stuart A J; Niklas, Jens; Mardis, Kristy L; Mallares, Christopher; Samuel, Ifor D W; Poluektov, Oleg G

2017-10-19

Organic solar cells are a promising renewable energy technology, offering the advantages of mechanical flexibility and solution processability. An understanding of the electronic excited states and charge separation pathways in these systems is crucial if efficiencies are to be further improved. Here we use light induced electron paramagnetic resonance (LEPR) spectroscopy and density functional theory calculations (DFT) to study the electronic excited states, charge transfer (CT) dynamics and triplet exciton formation pathways in blends of the small molecule donors (DTS(FBTTh 2 ) 2 , DTS(F 2 BTTh 2 ) 2 , DTS(PTTh 2 ) 2 , DTG(FBTTh 2 ) 2 and DTG(F 2 BTTh 2 ) 2 ) with the fullerene derivative PC 61 BM. Using high frequency EPR the g-tensor of the positive polaron on the donor molecules was determined. The experimental results are compared with DFT calculations which reveal that the spin density of the polaron is distributed over a dimer or trimer. Time-resolved EPR (TR-EPR) spectra attributed to singlet CT states were identified and the polarization patterns revealed similar charge separation dynamics in the four fluorobenzothiadiazole donors, while charge separation in the DTS(PTTh 2 ) 2 blend is slower. Using TR-EPR we also investigated the triplet exciton formation pathways in the blend. The polarization patterns reveal that the excitons originate from both intersystem crossing (ISC) and back electron transfer (BET) processes. The DTS(PTTh 2 ) 2 blend was found to contain substantially more triplet excitons formed by BET than the fluorobenzothiadiazole blends. The higher BET triplet exciton population in the DTS(PTTh 2 ) 2 blend is in accordance with the slower charge separation dynamics observed in this blend.

Charge Separation and Triplet Exciton Formation Pathways in Small-Molecule Solar Cells as Studied by Time-Resolved EPR Spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thomson, Stuart A. J.; Niklas, Jens; Mardis, Kristy L.

Organic solar cells are a promising renewable energy technology, offering the advantages of mechanical flexibility and solution processability. An understanding of the electronic excited states and charge separation pathways in these systems is crucial if efficiencies are to be further improved. Here we use light induced electron paramagnetic resonance (LEPR) spectroscopy and density functional theory calculations (DFT) to study the electronic excited states, charge transfer (CT) dynamics and triplet exciton formation pathways in blends of the small molecule donors (DTS(FBTTh 2) 2, DTS(F2BTTh 2) 2, DTS(PTTh 2) 2, DTG(FBTTh 2) 2 and DTG(F2BTTh 2) 2) with the fullerene derivative PCmore » 61BM. Using high frequency EPR the g-tensor of the positive polaron on the donor molecules was determined. The experimental results are compared with DFT calculations which reveal that the spin density of the polaron is distributed over a dimer or trimer. Time-resolved EPR (TR-EPR) spectra attributed to singlet CT states were identified and the polarization patterns revealed similar charge separation dynamics in the four fluorobenzothiadiazole donors, while charge separation in the DTS(PTTh 2) 2 blend is slower. Using TR-EPR we also investigated the triplet exciton formation pathways in the blend. The polarization patterns reveal that the excitons originate from both intersystem crossing (ISC) and back electron transfer (BET) processes. The DTS(PTTh 2) 2 blend was found to contain substantially more triplet excitons formed by BET than the fluorobenzothiadiazole blends. As a result, the higher BET triplet exciton population in the DTS(PTTh 2) 2 blend is in accordance with the slower charge separation dynamics observed in this blend.« less

Noble metal (Pt or Au)-doped monolayer MoS2 as a promising adsorbent and gas-sensing material to SO2, SOF2 and SO2F2: a DFT study

NASA Astrophysics Data System (ADS)

Chen, Dachang; Zhang, Xiaoxing; Tang, Ju; Cui, Hao; Li, Yi

2018-02-01

We explored the adsorption of SO2, SOF2, and SO2F2 on Pt- or Au-doped MoS2 monolayer based on density functional theory. The adsorption energy, adsorption distance, charge transfer as well as density of states were discussed. SO2 and SOF2 exhibit strong chemical interactions with Pt-doped MoS2 based on large adsorption energy, charge transfer, and changes of electron orbitals in gas molecule. SO2 also shows obvious chemisorption on Au-doped MoS2 with apparent magnetism transfer from Au to gas molecules. The adsorption of SO2F2 on Pt-MoS2 and SOF2 on Au-MoS2 exhibits weaker chemical interactions and SO2F2 losses electrons when adsorbed on Pt-MoS2 which is different from other gas adsorption. The adsorption of SO2F2 on Au-MoS2 represents no obvious chemical interaction but physisorption. The gas-sensing properties are also evaluated based on DFT results. This work could provide prospects and application value for typical noble metal-doped MoS2 as gas-sensing materials.

Femtosecond stimulated Raman evidence for charge-transfer character in pentacene singlet fission† †Electronic supplementary information (ESI) available: Actinic pump spectrum, discussion on ground state addition process, peak fitting procedure, transient absorption data, power dependence measurements, etalon pulse shaping, TIPS-pentacene FSRS data, and optimized geometry and frequency calculation results. See DOI: 10.1039/c7sc03496b

PubMed Central

Hart, Stephanie M.; Silva, W. Ruchira

2017-01-01

Singlet fission is a spin-allowed process in which an excited singlet state evolves into two triplet states. We use femtosecond stimulated Raman spectroscopy, an ultrafast vibrational technique, to follow the molecular structural evolution during singlet fission in order to determine the mechanism of this process. In crystalline pentacene, we observe the formation of an intermediate characterized by pairs of excited state peaks that are red- and blue-shifted relative to the ground state features. We hypothesize that these features arise from the formation of cationic and anionic species due to partial transfer of electron density from one pentacene molecule to a neighboring molecule. These observations provide experimental evidence for the role of states with significant charge-transfer character which facilitate the singlet fission process in pentacene. Our work both provides new insight into the singlet fission mechanism in pentacene and demonstrates the utility of structurally-sensitive time-resolved spectroscopic techniques in monitoring ultrafast processes. PMID:29675170

Activation of coherent lattice phonon following ultrafast molecular spin-state photo-switching: A molecule-to-lattice energy transfer

PubMed Central

Marino, A.; Cammarata, M.; Matar, S. F.; Létard, J.-F.; Chastanet, G.; Chollet, M.; Glownia, J. M.; Lemke, H. T.; Collet, E.

2015-01-01

We combine ultrafast optical spectroscopy with femtosecond X-ray absorption to study the photo-switching dynamics of the [Fe(PM-AzA)2(NCS)2] spin-crossover molecular solid. The light-induced excited spin-state trapping process switches the molecules from low spin to high spin (HS) states on the sub-picosecond timescale. The change of the electronic state (<50 fs) induces a structural reorganization of the molecule within 160 fs. This transformation is accompanied by coherent molecular vibrations in the HS potential and especially a rapidly damped Fe-ligand breathing mode. The time-resolved studies evidence a delayed activation of coherent optical phonons of the lattice surrounding the photoexcited molecules. PMID:26798836

Electron-rich triphenylamine-based sensors for picric acid detection.

PubMed

Chowdhury, Aniket; Mukherjee, Partha Sarathi

2015-04-17

This paper demonstrates the role of solvent in selectivity and sensitivity of a series of electron-rich compounds for the detection of trace amounts of picric acid. Two new electron-rich fluorescent esters (6, 7) containing a triphenylamine backbone as well as their analogous carboxylic acids (8, 9) have been synthesized and characterized. Fluorescent triphenylamine coupled with an ethynyl moiety constitutes π-electron-rich selective and sensitive probes for electron-deficient picric acid (PA). In solution, the high sensitivity of all the sensors toward PA can be attributed to a combined effect of the ground-state charge-transfer complex formation and resonance energy transfer between the sensor and analyte. The acids 8 and 9 also showed enhanced sensitivity for nitroaromatics in the solid state, and their enhanced sensitivity could be attributed to exciton migration due to close proximity of the neighboring acid molecules, as evident from the X-ray diffraction study. The compounds were found to be quite sensitive for the detection of trace amount of nitroaromatics in solution, solid, and contact mode.

Negative ion formation in potassium-nitromethane collisions.

PubMed

Antunes, R; Almeida, D; Martins, G; Mason, N J; Garcia, G; Maneira, M J P; Nunes, Y; Limão-Vieira, P

2010-10-21

Ion-pair formation in gaseous nitromethane (CH(3)NO(2)) induced by electron transfer has been studied by investigating the products of collisions between fast potassium atoms and nitromethane molecules using a crossed molecular-beam technique. The negative ions formed in such collisions were analysed using time-of-flight mass spectroscopy. The six most dominant product anions are NO(2)(-), O(-), CH(3)NO(2)(-), OH(-), CH(2)NO(2)(-) and CNO(-). By using nitromethane-d(3) (CD(3)NO(2)), we found that previous mass 17 amu assignment to O(-) delayed fragment, is in the present experiment may be unambiguously assigned to OH(-). The formation of CH(2)NO(2)(-) may be explained in terms of dissociative electron attachment to highly vibrationally excited molecules.

Response functions for dimers and square-symmetric molecules in four-wave-mixing experiments with polarized light

NASA Astrophysics Data System (ADS)

Smith, Eric Ryan; Farrow, Darcie A.; Jonas, David M.

2005-07-01

Four-wave-mixing nonlinear-response functions are given for intermolecular and intramolecular vibrations of a perpendicular dimer and intramolecular vibrations of a square-symmetric molecule containing a doubly degenerate state. A two-dimensional particle-in-a-box model is used to approximate the electronic wave functions and obtain harmonic potentials for nuclear motion. Vibronic interactions due to symmetry-lowering distortions along Jahn-Teller active normal modes are discussed. Electronic dephasing due to nuclear motion along both symmetric and asymmetric normal modes is included in these response functions, but population transfer between states is not. As an illustration, these response functions are used to predict the pump-probe polarization anisotropy in the limit of impulsive excitation.

Lateral hopping of CO molecules on Pt(111) surface by femtosecond laser pulses

NASA Astrophysics Data System (ADS)

Hayashi, M.; Ootsuka, Y.; Paulsson, M.; Persson, B. N. J.; Ueba, H.

2009-12-01

Theory of heat transfer between adsorbate vibrational degrees of freedom and ultrafast laser heated hot electrons including vibrational intermode coupling is applied to calculate two-pulse correlation, laser fluence dependence and time dependence of lateral hopping of CO molecules from a step to terrace site on a stepped Pt (111) surface. The intermode coupling is a key ingredient to describe vibrational heating of the frustrated translation mode responsible for the CO hopping. The calculated results are in good agreement with the experimental results, especially if we scale down the experimentally determined absorbed fluence. It is found that CO hopping is induced by indirect heating of the FT mode by the FR mode with a strong frictional coupling to hot electrons.

Vibrational excitation in O2and Cl2inductively-coupled plasmas and DC discharges

NASA Astrophysics Data System (ADS)

Booth, Jean-Paul; Marinov, Daniil; Foucher, Mickael; Annusova, Adriana; Guerra, Vasco

2016-09-01

Low-energy electrons can interact with molecules via resonances to cause vibrational excitation with large cross-sections. Such processes can absorb significant energy from the plasma electrons, affecting the electron energy distribution and potentially (via vibration-translation (VT) energy transfer) causing substantial gas heating. The presence of vibrationally excited molecules may significant increase the rates of collisional processes, including electron dissociative attachment and electron impact dissociation into neutral atoms. However, the cross-sections of these processes are often poorly known since they are extremely difficult to measure directly, and reliable theoretical calculations are only now appearing for simple diatomic molecules. We have measured the vibrational distributions in discharges in pure O2 and pure Cl2, using high-sensitivity ultra-broadband ultraviolet absorption spectroscopy. In O2 plasmas significant vibrational excitation is observed, up to v'' =18, with a tail temperature of around 8000K. In Cl2 excitation is only observed up to v'' =3, and the distribution appears to be in local equilibrium with the gas translational temperature (up to 1500K). We are developing a detailed self-consistent 0D global model of these systems including vibrational excitation. Work performed in the LABEX Plas@par project, with financial state aid (ANR-11-IDEX-0004-02 and ANR-13-BS09-0019).

Conductivity of Langmuir-Blodgett films of a disk-shaped liquid-crystalline molecule-DNA complex studied by current-sensing atomic force microscopy.

PubMed

Nayak, Alpana; Suresh, K A

2008-08-01

We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.

Conductivity of Langmuir-Blodgett films of a disk-shaped liquid-crystalline molecule-DNA complex studied by current-sensing atomic force microscopy

NASA Astrophysics Data System (ADS)

Nayak, Alpana; Suresh, K. A.

2008-08-01

We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.

Random walk on a leash: a simple single-molecule diffusion model for surface-tethered redox molecules with flexible linkers.

PubMed

Huang, Kuan-Chun; White, Ryan J

2013-08-28

We develop a random walk model to simulate the Brownian motion and the electrochemical response of a single molecule confined to an electrode surface via a flexible molecular tether. We use our simple model, which requires no prior knowledge of the physics of the molecular tether, to predict and better understand the voltammetric response of surface-confined redox molecules when motion of the redox molecule becomes important. The single molecule is confined to a hemispherical volume with a maximum radius determined by the flexible molecular tether (5-20 nm) and is allowed to undergo true three-dimensional diffusion. Distance- and potential-dependent electron transfer probabilities are evaluated throughout the simulations to generate cyclic voltammograms of the model system. We find that at sufficiently slow cyclic voltammetric scan rates the electrochemical reaction behaves like an adsorbed redox molecule with no mass transfer limitation; thus, the peak current is proportional to the scan rate. Conversely, at faster scan rates the diffusional motion of the molecule limits the simulated peak current, which exhibits a linear dependence on the square root of the scan rate. The switch between these two limiting regimes occurs when the diffusion layer thickness, (2Dt)(1/2), is ~10 times the tether length. Finally, we find that our model predicts the voltammetric behavior of a redox-active methylene blue tethered to an electrode surface via short flexible single-stranded, polythymine DNAs, allowing the estimation of diffusion coefficients for the end-tethered molecule.

Redox regulation of mitochondrial function with emphasis on cysteine oxidation reactions☆

PubMed Central

Mailloux, Ryan J.; Jin, Xiaolei; Willmore, William G.

2013-01-01

Mitochondria have a myriad of essential functions including metabolism and apoptosis. These chief functions are reliant on electron transfer reactions and the production of ATP and reactive oxygen species (ROS). The production of ATP and ROS are intimately linked to the electron transport chain (ETC). Electrons from nutrients are passed through the ETC via a series of acceptor and donor molecules to the terminal electron acceptor molecular oxygen (O2) which ultimately drives the synthesis of ATP. Electron transfer through the respiratory chain and nutrient oxidation also produces ROS. At high enough concentrations ROS can activate mitochondrial apoptotic machinery which ultimately leads to cell death. However, if maintained at low enough concentrations ROS can serve as important signaling molecules. Various regulatory mechanisms converge upon mitochondria to modulate ATP synthesis and ROS production. Given that mitochondrial function depends on redox reactions, it is important to consider how redox signals modulate mitochondrial processes. Here, we provide the first comprehensive review on how redox signals mediated through cysteine oxidation, namely S-oxidation (sulfenylation, sulfinylation), S-glutathionylation, and S-nitrosylation, regulate key mitochondrial functions including nutrient oxidation, oxidative phosphorylation, ROS production, mitochondrial permeability transition (MPT), apoptosis, and mitochondrial fission and fusion. We also consider the chemistry behind these reactions and how they are modulated in mitochondria. In addition, we also discuss emerging knowledge on disorders and disease states that are associated with deregulated redox signaling in mitochondria and how mitochondria-targeted medicines can be utilized to restore mitochondrial redox signaling. PMID:24455476

Redox regulation of mitochondrial function with emphasis on cysteine oxidation reactions.

PubMed

Mailloux, Ryan J; Jin, Xiaolei; Willmore, William G

2014-01-01

Mitochondria have a myriad of essential functions including metabolism and apoptosis. These chief functions are reliant on electron transfer reactions and the production of ATP and reactive oxygen species (ROS). The production of ATP and ROS are intimately linked to the electron transport chain (ETC). Electrons from nutrients are passed through the ETC via a series of acceptor and donor molecules to the terminal electron acceptor molecular oxygen (O2) which ultimately drives the synthesis of ATP. Electron transfer through the respiratory chain and nutrient oxidation also produces ROS. At high enough concentrations ROS can activate mitochondrial apoptotic machinery which ultimately leads to cell death. However, if maintained at low enough concentrations ROS can serve as important signaling molecules. Various regulatory mechanisms converge upon mitochondria to modulate ATP synthesis and ROS production. Given that mitochondrial function depends on redox reactions, it is important to consider how redox signals modulate mitochondrial processes. Here, we provide the first comprehensive review on how redox signals mediated through cysteine oxidation, namely S-oxidation (sulfenylation, sulfinylation), S-glutathionylation, and S-nitrosylation, regulate key mitochondrial functions including nutrient oxidation, oxidative phosphorylation, ROS production, mitochondrial permeability transition (MPT), apoptosis, and mitochondrial fission and fusion. We also consider the chemistry behind these reactions and how they are modulated in mitochondria. In addition, we also discuss emerging knowledge on disorders and disease states that are associated with deregulated redox signaling in mitochondria and how mitochondria-targeted medicines can be utilized to restore mitochondrial redox signaling.

Intermolecular interaction approach for TADF (Conference Presentation)

NASA Astrophysics Data System (ADS)

Wong, Ken-Tsung

2016-09-01

Materials with thermally activated delayed fluorescence (TADF) have recently emerged as new fluorescent emitters for highly efficient organic light-emitting diodes (OLEDs). Molecule with TADF behavior needs to have a small singlet-triplet energy difference (ΔES-T) that allows the up-conversion from nonradiative triplet state (T1) to radiative singlet state (S1) via reverse intersystem crossing (RISC) process. Generally, molecules with small ΔES-T can be obtained via carefully manipulate the degree of "intramolecular" charge transfer (ICT) between electron-donating and -accepting components, such that the electron exchange energy that contributes to ΔES-T, can be minimized. Alternatively, excited state with small ΔES-T can be feasibly realized via "intermolecular" charge transfer occurring at the interface between spatially separating donor (D) and acceptor (A) molecules. Because the exchange energy decreases as the HOMO-LUMO separation distance increases, theoretically, the intermolecular D/A charge transfer state (or exciplex) should have rather small ΔES-T, leading to efficient TADF. However, it is still a challenge to access highly efficient exciplex systems. This is mainly because exciplex formation is commonly accompanied with a large red shift of emission spectra and long radiative lifetime, which tend to diminish photoluminescence quantum yield (PLQY) as well as electroluminescence (EL) performance. Until now, exciplex-based OLEDs with external quantum efficiency (EQE) above 10% are still limited. By judicious selection of donor and acceptor, the formation of efficient exciplex can be feasibly achieved. In this conference, our recent efforts on highly efficient exciplexes using C3-symmetry triazine acceptors and various donors, and their device characteristics will be presented.

The creation of a biomimetic interface between boron-doped diamond and immobilized proteins.

PubMed

Hoffmann, René; Kriele, Armin; Obloh, Harald; Tokuda, Norio; Smirnov, Waldemar; Yang, Nianjun; Nebel, Christoph E

2011-10-01

Immobilization of proteins on a solid electrode is to date done by chemical cross-linking or by addition of an adjustable intermediate. In this paper we introduce a concept where a solid with variable surface properties is optimized to mediate binding of the electron-transfer protein Cytochrome c (Cyt c) by mimicking the natural binding environment. It is shown that, as a carbon-based material, boron-doped diamond can be adjusted by simple electrochemical surface treatments to the specific biochemical requirements of Cyt c. The structure and functionality of passively adsorbed Cyt c on variously terminated diamond surfaces were characterized in detail using a combination of electrochemical techniques and atomic force microscopy with single-molecule resolution. Partially oxidized diamond allowed stable immobilization of Cyt c together with high electron transfer activity, driven by a combination of electrostatic and hydrophobic interactions. This surface mimics the natural binding partner, where coarse orientation is governed by electrostatic interaction of the protein's dipole and hydrophobic interactions assist in formation of the electron transfer complex. The optimized surface mediated electron transfer kinetics around 100 times faster than those reported for other solids and even faster kinetics than on self-assembled monolayers of alkanethiols. Copyright © 2011 Elsevier Ltd. All rights reserved.

Conductive scanning probe microscopy of the semicontinuous gold film and its SERS enhancement toward two-step photo-induced charge transfer and effect of the supportive layer

NASA Astrophysics Data System (ADS)

Sinthiptharakoon, K.; Sapcharoenkun, C.; Nuntawong, N.; Duong, B.; Wutikhun, T.; Treetong, A.; Meemuk, B.; Kasamechonchung, P.; Klamchuen, A.

2018-05-01

The semicontinuous gold film, enabling various electronic applications including development of surface-enhanced Raman scattering (SERS) substrate, is investigated using conductive atomic force microscopy (CAFM) and Kelvin probe force microscopy (KPFM) to reveal and investigate local electronic characteristics potentially associated with SERS generation of the film material. Although the gold film fully covers the underlying silicon surface, CAFM results reveal that local conductivity of the film is not continuous with insulating nanoislands appearing throughout the surface due to incomplete film percolation. Our analysis also suggests the two-step photo-induced charge transfer (CT) play the dominant role in the enhancement of SERS intensity with strong contribution from free electrons of the silicon support. Silicon-to-gold charge transport is illustrated by KPFM results showing that Fermi level of the gold film is slightly inhomogeneous and far below the silicon conduction band. We propose that inhomogeneity of the film workfunction affecting chemical charge transfer between gold and Raman probe molecule is associated with the SERS intensity varying across the surface. These findings provide deeper understanding of charge transfer mechanism for SERS which can help in design and development of the semicontinuous gold film-based SERS substrate and other electronic applications.

The effect of twisted D–D–π–A configuration on electron transfer and photo-physics characteristics

NASA Astrophysics Data System (ADS)

Liu, Yunpeng; Li, Yuanzuo; Song, Peng; Ma, Fengcai; Yang, Yanhui

2018-05-01

Two D-D-π-A organic dyes (M45, M46) with dithieno[3,2-b:2‧,3‧-d]pyrrole (DTP) units as election donors in two perpendicular directions, were investigated using density functional theory (DFT) and time-dependent DFT. The ground-state geometries, the absorption, the electronic structures, the charge density difference and molecular electrostatic potential were obtained. To simulate a more realistic performance, all calculations were based on gas condition and dichloromethane solvent. Photoelectric parameters were evaluated by the following factors: the light harvesting efficiency, electron injection driving force, the excited lifetime and vertical dipole moment. Meanwhile, the polarisability and hyperpolarisability were investigated to further explain the relationship between non-linear optical properties and efficiency. The direction of the DTP obviously affects the twisted degree of molecule, forming a better coplanarity on the donor 2 of M45, which results in stronger charge transfer interactions. Furthermore, M45 possesses significant advantages in geometric structure, absorption band and intramolecular charge transfer mechanism. These critical parameters supported the higher performance of M45 in comparison with M46. Moreover, four dyes were designed by the substitution of donor 2, which further verify the influence of the twisted donor 2 on electron transfer and photoelectric properties of D-D-π-A configuration.

Understanding How Isotopes Affect Charge Transfer in P3HT/PCBM: A Quantum Trajectory-Electronic Structure Study with Nonlinear Quantum Corrections

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Lei; Jakowski, Jacek; Garashchuk, Sophya

The experimentally observed effect of selective deuterium substitution on the open circuit voltage for a blend of poly(3-hexylthiophene)(P3HT) and [6,6]-phenyl-C 61- butyric acid methyl ester (PCBM) (Nat. Commun. 5:3180, 2014) is explored using a 221-atom model of a polymer-wrapped PCBM molecule. We describe the protonic and deuteronic wavefunctions for the H/D isotopologues of the hexyl side chains within a Quantum Trajectory/Electronic Structure approach where the dynamics is performed with newly developed nonlinear corrections to the quantum forces, necessary to describe the nuclear wavefunctions; the classical forces are generated with a Density Functional Tight Binding method. We used the resulting protonicmore » and deuteronic time-dependent wavefunctions to assess the effects of isotopic substitution (deuteration) on the energy gaps relevant to the charge transfer for the donor and acceptor electronic states. Furthermore, while the isotope effect on the electronic energy levels is found negligible, the quantum-induced fluctuations of the energy gap between the charge transfer and charge separated states due to nuclear wavefunctions may account for experimental trends by promoting charge transfer in P3HT/PCBM and increasing charge recombination on the donor in the deuterium substituted P3HT/PCBM.« less

Understanding How Isotopes Affect Charge Transfer in P3HT/PCBM: A Quantum Trajectory-Electronic Structure Study with Nonlinear Quantum Corrections

DOE PAGES

Wang, Lei; Jakowski, Jacek; Garashchuk, Sophya; ...

2016-08-09

The experimentally observed effect of selective deuterium substitution on the open circuit voltage for a blend of poly(3-hexylthiophene)(P3HT) and [6,6]-phenyl-C 61- butyric acid methyl ester (PCBM) (Nat. Commun. 5:3180, 2014) is explored using a 221-atom model of a polymer-wrapped PCBM molecule. We describe the protonic and deuteronic wavefunctions for the H/D isotopologues of the hexyl side chains within a Quantum Trajectory/Electronic Structure approach where the dynamics is performed with newly developed nonlinear corrections to the quantum forces, necessary to describe the nuclear wavefunctions; the classical forces are generated with a Density Functional Tight Binding method. We used the resulting protonicmore » and deuteronic time-dependent wavefunctions to assess the effects of isotopic substitution (deuteration) on the energy gaps relevant to the charge transfer for the donor and acceptor electronic states. Furthermore, while the isotope effect on the electronic energy levels is found negligible, the quantum-induced fluctuations of the energy gap between the charge transfer and charge separated states due to nuclear wavefunctions may account for experimental trends by promoting charge transfer in P3HT/PCBM and increasing charge recombination on the donor in the deuterium substituted P3HT/PCBM.« less

What is beta-carotene doing in the photosystem II reaction centre?

PubMed Central

Telfer, Alison

2002-01-01

During photosynthesis carotenoids normally serve as antenna pigments, transferring singlet excitation energy to chlorophyll, and preventing singlet oxygen production from chlorophyll triplet states, by rapid spin exchange and decay of the carotenoid triplet to the ground state. The presence of two beta-carotene molecules in the photosystem II reaction centre (RC) now seems well established, but they do not quench the triplet state of the primary electron-donor chlorophylls, which are known as P(680). The beta-carotenes cannot be close enough to P(680) for triplet quenching because that would also allow extremely fast electron transfer from beta-carotene to P(+)(680), preventing the oxidation of water. Their transfer of excitation energy to chlorophyll, though not very efficient, indicates close proximity to the chlorophylls ligated by histidine 118 towards the periphery of the two main RC polypeptides. The primary function of the beta-carotenes is probably the quenching of singlet oxygen produced after charge recombination to the triplet state of P(680). Only when electron donation from water is disturbed does beta-carotene become oxidized. One beta-carotene can mediate cyclic electron transfer via cytochrome b559. The other is probably destroyed upon oxidation, which might trigger a breakdown of the polypeptide that binds the cofactors that carry out charge separation. PMID:12437882

Photocatalytic events of CdSe quantum dots in confined media. Electrodic behavior of coupled platinum nanoparticles.

PubMed

Harris, Clifton; Kamat, Prashant V

2010-12-28

The electrodic behavior of platinum nanoparticles (2.8 nm diameter) and their role in influencing the photocatalytic behavior of CdSe quantum dots (3.4 nm diameter) has been evaluated by confining both nanoparticles together in heptane/dioctyl sulphosuccinate/water reverse micelles. The particles spontaneously couple together within the micelles via micellar exchange processes and thus facilitate experimental observation of electron transfer reactions inside the water pools. Electron transfer from CdSe to Pt is found to occur with a rate constant of 1.22 × 10(9) s(-1). With the use of methyl viologen (MV(2+)) as a probe molecule, the role of Pt in the photocatalytic process is established. Ultrafast oxidation of the photogenerated MV(+•) radicals indicates that Pt acts as an electron sink, scavenging electrons from MV(+•) with a rate constant of 3.1 × 10(9) s(-1). The electron transfer between MV(+•) and Pt, and a drastically lower yield of MV(+•) under steady state irradiation, confirms the ability of Pt nanoparticles to discharge electrons quickly. The kinetic details of photoinduced processes in CdSe-Pt assemblies and the electrodic behavior of Pt nanoparticles provide important information for the development of light energy conversion devices.

Density functional theory of electron transfer beyond the Born-Oppenheimer approximation: Case study of LiF

NASA Astrophysics Data System (ADS)

Li, Chen; Requist, Ryan; Gross, E. K. U.

2018-02-01

We perform model calculations for a stretched LiF molecule, demonstrating that nonadiabatic charge transfer effects can be accurately and seamlessly described within a density functional framework. In alkali halides like LiF, there is an abrupt change in the ground state electronic distribution due to an electron transfer at a critical bond length R = Rc, where an avoided crossing of the lowest adiabatic potential energy surfaces calls the validity of the Born-Oppenheimer approximation into doubt. Modeling the R-dependent electronic structure of LiF within a two-site Hubbard model, we find that nonadiabatic electron-nuclear coupling produces a sizable elongation of the critical Rc by 0.5 bohr. This effect is very accurately captured by a simple and rigorously derived correction, with an M-1 prefactor, to the exchange-correlation potential in density functional theory, M = reduced nuclear mass. Since this nonadiabatic term depends on gradients of the nuclear wave function and conditional electronic density, ∇Rχ(R) and ∇Rn(r, R), it couples the Kohn-Sham equations at neighboring R points. Motivated by an observed localization of nonadiabatic effects in nuclear configuration space, we propose a local conditional density approximation—an approximation that reduces the search for nonadiabatic density functionals to the search for a single function y(n).

Charge transfer and optical properties of trifluoromethyl substituted benzodithiophene (TFMBDT): A theoretical study

NASA Astrophysics Data System (ADS)

Sahoo, Smruti Ranjan; Sahu, Sridhar; Sharma, Sagar

2018-05-01

We present density functional study of the charge transport and optical properties of trifluoromethyl substituted benzodithiophene (TFMBDT) molecule. We found the hole reorganization energy, reduced by 0.354 eV compared to the electron reorganization energy, thus favoring the hole transport across the molecular barrier. We found the maximum tH and tL at the tilting angle 85°, to be 0.473 eV and 0.472 eV, respectively. Although, both tH and tL are found to equivalent, however, low λh can contribute to the larger hole mobility. In the TD-DFT calculation, the low energy electronic transition (H→L) was found to be accordance with the electronic HOMO-LUMO energy gap of the conjugated organic molecule. The calculated gas phase maximum absorption (λmax) of TFMBDT molecule was observed at 337.31 nm (3.67 eV) for B3LYP/6-311+G(d, p) level and 328.04 nm (3.77 eV) for PBE1PBE/6-311+G(d, p) level, which is mostly associated with HOMO→LUMO transition.

Refining the reaction mechanism of O2 towards its co-substrate in cofactor-free dioxygenases

PubMed Central

2016-01-01

Cofactor-less oxygenases perform challenging catalytic reactions between singlet co-substrates and triplet oxygen, in spite of apparently violating the spin-conservation rule. In 1-H-3-hydroxy-4-oxoquinaldine-2,4-dioxygenase, the active site has been suggested by quantum chemical computations to fine tune triplet oxygen reactivity, allowing it to interact rapidly with its singlet substrate without the need for spin inversion, and in urate oxidase the reaction is thought to proceed through electron transfer from the deprotonated substrate to an aminoacid sidechain, which then feeds the electron to the oxygen molecule. In this work, we perform additional quantum chemical computations on these two systems to elucidate several intriguing features unaddressed by previous workers. These computations establish that in both enzymes the reaction proceeds through direct electron transfer from co-substrate to O2 followed by radical recombination, instead of minimum-energy crossing points between singlet and triplet potential energy surfaces without formal electron transfer. The active site does not affect the reactivity of oxygen directly but is crucial for the generation of the deprotonated form of the co-substrates, which have redox potentials far below those of their protonated forms and therefore may transfer electrons to oxygen without sizeable thermodynamic barriers. This mechanism seems to be shared by most cofactor-less oxidases studied so far. PMID:28028471

Refining the reaction mechanism of O2 towards its co-substrate in cofactor-free dioxygenases.

PubMed

Silva, Pedro J

2016-01-01

Cofactor-less oxygenases perform challenging catalytic reactions between singlet co-substrates and triplet oxygen, in spite of apparently violating the spin-conservation rule. In 1- H -3-hydroxy-4-oxoquinaldine-2,4-dioxygenase, the active site has been suggested by quantum chemical computations to fine tune triplet oxygen reactivity, allowing it to interact rapidly with its singlet substrate without the need for spin inversion, and in urate oxidase the reaction is thought to proceed through electron transfer from the deprotonated substrate to an aminoacid sidechain, which then feeds the electron to the oxygen molecule. In this work, we perform additional quantum chemical computations on these two systems to elucidate several intriguing features unaddressed by previous workers. These computations establish that in both enzymes the reaction proceeds through direct electron transfer from co-substrate to O 2 followed by radical recombination, instead of minimum-energy crossing points between singlet and triplet potential energy surfaces without formal electron transfer. The active site does not affect the reactivity of oxygen directly but is crucial for the generation of the deprotonated form of the co-substrates, which have redox potentials far below those of their protonated forms and therefore may transfer electrons to oxygen without sizeable thermodynamic barriers. This mechanism seems to be shared by most cofactor-less oxidases studied so far.

A comparative computational study of Csbnd N and Csbnd C bonding visible to NIR absorbing croconines

NASA Astrophysics Data System (ADS)

Chetti, Prabhakar; Tripathi, Anuj

2018-03-01

The lowest electronic excitations and charge transfer properties in two series of croconine dyes; 1) molecules with Csbnd N bonding, having an absorption in the visible region (400-600 nm) and 2) molecules with Csbnd C bonding, showing absorption in visible to near infrared (NIR) region (600-1100 nm) are analyzed by quantum-chemical calculations. The absorption maxima in Csbnd C bonding croconines (CCR) are always having 200-300 nm red shifted than its corresponding Csbnd N bonding croconines (NCR). The reason for this drastic red shift in CCR series than its corresponding NCR has been systematically studied by DFT, TDDFT and SAC-CI methods. It is found that, CCR series are with less charge transfer in nature and are having larger diradical character, whereas NCR series molecules showing larger charge transfer with lower diradical character. The change in bonding mode of central five membered croconate ring, from Csbnd N to Csbnd C, destabilization and/stabilization of HOMO LUMO levels were observed. This study may helpful in the design and synthesis of new visible to NIR absorbing croconine dyes which are useful in materials applications.

Complementary roles of benzylpiperazine and iodine 'vapor' in the strong enhancement of orange photoluminescence from CuI(1 1 1) thin film.

PubMed

Rawal, Takat B; Turkowski, Volodymyr; Rahman, Talat S

2014-05-07

We have employed density functional theory, corrected by the on-site electron-electron repulsion energy U, to clarify the mechanism behind the enhanced orange photoluminescence (PL) of a CuI(1 1 1) thin film conjugated with a benzylpiperazine (BZP) molecule in the presence of an iodine 'vapor' atom. Our results demonstrated that the adsorbed molecule and the 'vapor' atom play complementary roles in producing the PL. The latter, in attaching to the film surface, creates a hole-trapping surface state located ~0.25 eV above the valence band-edge of the film, in good agreement with ~0.2 eV reported in experiments. Upon photo-excitation of the BZP/CuI(1 1 1) system in the presence of surface iodine 'vapor' atoms, excited electrons are transferred into the conduction band of CuI, and holes are trapped by the 'vapor' atoms. These holes, in turn, quickly relax into the HOMO state of the BZP molecule, owing to the fact that the molecule adsorbs on the film surface in the immediate vicinity of a 'vapor' atom. Relaxed holes subsequently recombine with excited electrons in the conduction band of the CuI film, thereby producing a luminescence peak at ~2.1 eV, in qualitative agreement with experimental findings.

Enzyme-free monitoring of glucose utilization in stimulated macrophages using carbon nanotube-decorated electrochemical sensor

NASA Astrophysics Data System (ADS)

Madhurantakam, Sasya; Karnam, Jayanth Babu; Rayappan, John Bosco Balaguru; Krishnan, Uma Maheswari

2017-11-01

Carbon nanotubes (CNTs) have been extensively explored for a diverse range of applications due to their unique electrical and mechanical properties. CNT-incorporated electrochemical sensors have exhibited enhanced sensitivity towards the analyte molecule due to the excellent electron transfer properties of CNTs. In addition, CNTs possess a large surface area-to-volume ratio that favours the adhesion of analyte molecules as well as enhances the electroactive area. Most of the electrochemical sensors have employed CNTs as a nano-interface to promote electron transfer and as an immobilization matrix for enzymes. The present work explores the potential of CNTs to serve as a catalytic interface for the enzymeless quantification of glucose. The figure of merits for the enzymeless sensor was comparable to the performance of several enzyme-based sensors reported in literature. The developed sensor was successfully employed to determine the glucose utilization of unstimulated and stimulated macrophages. The significant difference in the glucose utilization levels in activated macrophages and quiescent cells observed in the present investigation opens up the possibilities of new avenues for effective medical diagnosis of inflammatory disorders.

Photoinduced ICT vs. excited rotamer intercoversion in two quadrupolar polyaromatic N-methylpyridinium cations.

PubMed

Cesaretti, A; Carlotti, B; Elisei, F; Fortuna, C G; Spalletti, A

2018-01-24

The excited state dynamics of two quadrupolar polyaromatic N-methylpyridinium cations have been fully investigated in order to acquire detailed information on their photo-induced behavior. The two molecules are symmetric push-pull compounds having a D-π-A + -π-D motif, with the same electron-acceptor central unit (A = N-methylpyridinium) and two distinctive electron-donor polyaromatic side groups (D), namely naphthyl and pyrenyl substituents. Both molecules undergo charge transfer during the absorption, as revealed by a significant solvatochromism exhibited with solvent polarity, but the fate of their excited state was found to be markedly different. The careful analysis of the data gathered from femtosecond-resolved fluorescence up-conversion and transient absorption experiments, supported by DFT quantum mechanical calculations and temperature-dependent stationary measurements, shows the leading role of intramolecular charge transfer, assisted by symmetry breaking, in the pyrenyl derivative and that of rotamer interconversion in the naphthtyl one. Both excited state processes are controlled by the viscosity rather than polarity of the solvent, and they occur during inertial solvation in low-viscous media and lengthening up to tens of picoseconds in highly viscous solvents.

Three-dimensional structure of human electron transfer flavoprotein to 2.1-Å resolution

PubMed Central

Roberts, David L.; Frerman, Frank E.; Kim, Jung-Ja P.

1996-01-01

Mammalian electron transfer flavoproteins (ETF) are heterodimers containing a single equivalent of flavin adenine dinucleotide (FAD). They function as electron shuttles between primary flavoprotein dehydrogenases involved in mitochondrial fatty acid and amino acid catabolism and the membrane-bound electron transfer flavoprotein ubiquinone oxidoreductase. The structure of human ETF solved to 2.1-Å resolution reveals that the ETF molecule is comprised of three distinct domains: two domains are contributed by the α subunit and the third domain is made up entirely by the β subunit. The N-terminal portion of the α subunit and the majority of the β subunit have identical polypeptide folds, in the absence of any sequence homology. FAD lies in a cleft between the two subunits, with most of the FAD molecule residing in the C-terminal portion of the α subunit. Alignment of all the known sequences for the ETF α subunits together with the putative FixB gene product shows that the residues directly involved in FAD binding are conserved. A hydrogen bond is formed between the N5 of the FAD isoalloxazine ring and the hydroxyl side chain of αT266, suggesting why the pathogenic mutation, αT266M, affects ETF activity in patients with glutaric acidemia type II. Hydrogen bonds between the 4′-hydroxyl of the ribityl chain of FAD and N1 of the isoalloxazine ring, and between αH286 and the C2-carbonyl oxygen of the isoalloxazine ring, may play a role in the stabilization of the anionic semiquinone. With the known structure of medium chain acyl-CoA dehydrogenase, we hypothesize a possible structure for docking the two proteins. PMID:8962055

Charge-transfer excited state in pyrene-1-carboxylic acids adsorbed on titanium dioxide nanoparticles

NASA Astrophysics Data System (ADS)

Krawczyk, S.; Nawrocka, A.; Zdyb, A.

2018-06-01

The electronic structure of excited photosensitizer adsorbed at the surface of a solid is the key factor in the electron transfer processes that underlie the efficiency of dye-sensitized solar cells and photocatalysts. In this work, Stark effect (electroabsorption) spectroscopy has been used to measure the polarizability and dipole moment changes in electronic transitions of pyrene-1-carboxylic (PCA), -acetic (PAA) and -butyric (PBA) acids in ethanol, both free and adsorbed on colloidal TiO2, in glassy ethanol at low temperature. The lack of appreciable increase of dipole moment in the excited state of free and adsorbed PAA and PBA points that two or more single bonds completely prevent the expansion of π-electrons from the aromatic ring towards the carboxylic group, thus excluding the possibility of direct electron injection into TiO2. In free PCA, the pyrene's forbidden S0 → S1 transition has increased intensity, exhibits a long progression in 1400 cm-1 Ag mode and is associated with |Δμ| of 2 D. Adsorption of PCA on TiO2 causes a broadening and red shift of the S0 → S1 absorption band and an increase in dipole moment change on electronic excitation to |Δμ| = 6.5 D. This value increased further to about 15 D when the content of acetic acid in the colloid was changed from 0.2% to 2%, and this effect is ascribed to the surface electric field. The large increase of |Δμ| points that the electric field effect can not only change the energetics of electron transfer from the excited sensitizer into the solid, but can also shift the molecular electronic density, thus directly influencing the electronic coupling factor relevant for electron transfer at the molecule-solid interface.

Size-Induced Segregation in the Stepwise Microhydration of Hydantoin and Its Role in Proton-Induced Charge Transfer

NASA Astrophysics Data System (ADS)

Calvo, Florent; Bacchus-Montabonel, Marie-Christine

2018-01-01

Recent photochemistry experiments provided evidence for the formation of hydantoin by irradiation of interstellar ice analogues. The significance of these results and the importance of hydantoin in prebiotic chemistry and polypeptide synthesis motivate the present theoretical investigation, in which we analyzed the effects of stepwise hydration on the electronic and thermodynamical properties of the structure of microhydrated hydantoin using a variety of computational approaches. We generally find microhydration to proceed around the hydantoin heterocycle until 5 water molecules are reached, at which stage hydration becomes segregated with a water cluster forming aside the heterocycle. The reactivity of microhydrated hydantoin caused by an impinging proton was evaluated through charge transfer collision cross sections for microhydrated compounds but also for hydantoin on icy grains modeled using a cluster approach mimicking the true hexagonal ice surface. The effects of hydration on charge transfer efficiency are mostly significant when few water molecules are present, and they progressively weaken and stabilize in larger clusters. On the ice substrate, charge transfer essentially contributes to a global increase in the cross sections.

Direct Observation of Double Hydrogen Transfer via Quantum Tunneling in a Single Porphycene Molecule on a Ag(110) Surface.

PubMed

Koch, Matthias; Pagan, Mark; Persson, Mats; Gawinkowski, Sylwester; Waluk, Jacek; Kumagai, Takashi

2017-09-13

Quantum tunneling of hydrogen atoms (or protons) plays a crucial role in many chemical and biological reactions. Although tunneling of a single particle has been examined extensively in various one-dimensional potentials, many-particle tunneling in high-dimensional potential energy surfaces remains poorly understood. Here we present a direct observation of a double hydrogen atom transfer (tautomerization) within a single porphycene molecule on a Ag(110) surface using a cryogenic scanning tunneling microscope (STM). The tautomerization rates are temperature independent below ∼10 K, and a large kinetic isotope effect (KIE) is observed upon substituting the transferred hydrogen atoms by deuterium, indicating that the process is governed by tunneling. The observed KIE for three isotopologues and density functional theory calculations reveal that a stepwise transfer mechanism is dominant in the tautomerization. It is also found that the tautomerization rate is increased by vibrational excitation via an inelastic electron tunneling process. Moreover, the STM tip can be used to manipulate the tunneling dynamics through modification of the potential landscape.

Charge-transfer contributions to the excitonic coupling matrix element in BODIPY-based energy transfer cassettes

NASA Astrophysics Data System (ADS)

Spiegel, J. Dominik; Lyskov, Igor; Kleinschmidt, Martin; Marian, Christel M.

2017-01-01

BODIPY-based dyads serve as model systems for the investigation of excitation energy transfer (EET). Through-space EET is brought about by direct and exchange interactions between the transition densities of donor and acceptor localized states. The presence of a molecular linker gives rise to additional charge transfer (CT) contributions. Here, we present a novel approach for the calculation of the excitonic coupling matrix element (ECME) including CT contributions which is based on supermolecular one-electron transition density matrices (STD). The validity of the approach is assessed for a model system of two π -stacked ethylene molecules at varying intermolecular separation. Wave functions and electronic excitation energies of five EET cassettes comprising anthracene as exciton donor and BODIPY as exciton acceptor are obtained by the redesigned combined density functional theory and multireference configuration interaction (DFT/MRCI-R) method. CT contributions to the ECME are shown to be important in the covalently linked EET cassettes.

Anharmonicity in a double hydrogen transfer reaction studied in a single porphycene molecule on a Cu(110) surface.

PubMed

Liu, S; Baugh, D; Motobayashi, K; Zhao, X; Levchenko, S V; Gawinkowski, S; Waluk, J; Grill, L; Persson, M; Kumagai, T

2018-05-07

Anharmonicity plays a crucial role in hydrogen transfer reactions in hydrogen-bonding systems, which leads to a peculiar spectral line shape of the hydrogen stretching mode as well as highly complex intra/intermolecular vibrational energy relaxation. Single-molecule study with a well-defined model is necessary to elucidate a fundamental mechanism. Recent low-temperature scanning tunnelling microscopy (STM) experiments revealed that the cis↔cis tautomerization in a single porphycene molecule on Cu(110) at 5 K can be induced by vibrational excitation via an inelastic electron tunnelling process and the N-H(D) stretching mode couples with the tautomerization coordinate [Kumagai et al. Phys. Rev. Lett. 2013, 111, 246101]. Here we discuss a pronounced anharmonicity of the N-H stretching mode observed in the STM action spectra and the conductance spectra. Density functional theory calculations find a strong intermode coupling of the N-H stretching with an in-plane bending mode within porphycene on Cu(110).

Investigating protein-protein interaction surfaces using a reduced stereochemical and electrostatic model.

PubMed

Warwicker, J

1989-03-20

A method of calculating the electrostatic potential energy between two molecules, using finite difference potential, is presented. A reduced charge set is used so that the interaction energy can be calculated as the two static molecules explore their full six-dimensional configurational space. The energies are contoured over surfaces fixed to each molecule with an interactive computer graphics program. For two crystal structures (trypsin-trypsin inhibitor and anti-lysozyme Fab-lysozyme), it is found that the complex corresponds to highly favourable interacting regions in the contour plots. These matches arise from a small number of protruding basic residues interacting with enhanced negative potential in each case. The redox pair cytochrome c peroxidase-cytochrome c exhibits an extensive favourably interacting surface within which a possible electron transfer complex may be defined by an increased electrostatic complementarity, but a decreased electrostatic energy. A possible substrate transfer configuration for the glycolytic enzyme pair glyceraldehyde phosphate dehydrogenase-phosphoglycerate kinase is presented.

Vibrational spectroscopic investigation and normal coordinate analysis of the fibrate hypolipidemic agent 5-(2,5-dimethylphenoxy)-2,2-dimethyl pentanoic acid (Gemfibrozil)

NASA Astrophysics Data System (ADS)

Priya, M. Siva; Benitta, T. Asenath; James, C.

2011-03-01

Colorless crystals of 5-(2,5-dimethylphenoxy)-2,2-dimethyl pentanoic acid were grown by slow evaporation method and the FT-IR and FT-Raman spectra of the sample were recorded in the region 4000-450 cm -1 and 4000-50 cm -1 respectively. Molecular structure is optimized with the help of B3LYP/6-31G (d) density functional theory method. Stability of the molecule arising from hyperconjugation and charge delocalization is confirmed by the natural bond orbital analysis (NBO). The results show that electron density (ED) in the σ ∗ antibonding orbitals and E (2) energies confirms the occurrence of intra-molecular charge transfer (ICT) within the molecule. The assignments of the vibrational spectra have been carried out with the help of Normal coordinate analysis following the scaled quantum mechanical force field (SQMFF) methodology. Mulliken population analysis on atomic charges is also calculated. The calculated HOMO and LUMO energy gap shows that charge transfer occurs within the molecule.

Room temperature deintercalation of alkali metal atoms from epitaxial graphene by formation of charge-transfer complexes

NASA Astrophysics Data System (ADS)

Shin, H.-C.; Ahn, S. J.; Kim, H. W.; Moon, Y.; Rai, K. B.; Woo, S. H.; Ahn, J. R.

2016-08-01

Atom (or molecule) intercalations and deintercalations have been used to control the electronic properties of graphene. In general, finite energies above room temperature (RT) thermal energy are required for the intercalations and deintercalations. Here, we demonstrate that alkali metal atoms can be deintercalated from epitaxial graphene on a SiC substrate at RT, resulting in the reduction in density of states at the Fermi level. The change in density of states at the Fermi level at RT can be applied to a highly sensitive graphene sensor operating at RT. Na atoms, which were intercalated at a temperature of 80 °C, were deintercalated at a high temperature above 1000 °C when only a thermal treatment was used. In contrast to the thermal treatment, the intercalated Na atoms were deintercalated at RT when tetrafluorotetracyanoquinodimethane (F4-TCNQ) molecules were adsorbed on the surface. The RT deintercalation occurred via the formation of charge-transfer complexes between Na atoms and F4-TCNQ molecules.

Water network-mediated, electron-induced proton transfer in [C5H5N ṡ (H2O)n]- clusters

NASA Astrophysics Data System (ADS)

DeBlase, Andrew F.; Wolke, Conrad T.; Weddle, Gary H.; Archer, Kaye A.; Jordan, Kenneth D.; Kelly, John T.; Tschumper, Gregory S.; Hammer, Nathan I.; Johnson, Mark A.

2015-10-01

The role of proton-assisted charge accommodation in electron capture by a heterocyclic electron scavenger is investigated through theoretical analysis of the vibrational spectra of cold, gas phase [Py ṡ (H2O)n=3-5]- clusters. These radical anions are formed when an excess electron is attached to water clusters containing a single pyridine (Py) molecule in a supersonic jet ion source. Under these conditions, the cluster ion distribution starts promptly at n = 3, and the photoelectron spectra, combined with vibrational predissociation spectra of the Ar-tagged anions, establish that for n > 3, these species are best described as hydrated hydroxide ions with the neutral pyridinium radical, PyH(0), occupying one of the primary solvation sites of the OH-. The n = 3 cluster appears to be a special case where charge localization on Py and hydroxide is nearly isoenergetic, and the nature of this species is explored with ab initio molecular dynamics calculations of the trajectories that start from metastable arrangements of the anion based on a diffuse, essentially dipole-bound electron. These calculations indicate that the reaction proceeds via a relatively slow rearrangement of the water network to create a favorable hydration configuration around the water molecule that eventually donates a proton to the Py nitrogen atom to yield the product hydroxide ion. The correlation between the degree of excess charge localization and the evolving shape of the water network revealed by this approach thus provides a microscopic picture of the "solvent coordinate" at the heart of a prototypical proton-coupled electron transfer reaction.

Interaction of fluorescent sensor with superparamagnetic iron oxide nanoparticles.

PubMed

Karunakaran, Chockalingam; Jayabharathi, Jayaraman; Sathishkumar, Ramalingam; Jayamoorthy, Karunamoorthy

2013-06-01

To sense superparamagnetic iron oxides (Fe2O3 and Fe3O4) nanocrystals a sensitive bioactive phenanthroimidazole based fluorescent molecule, 2-(4-fluorophenyl)-1-phenyl-1H-phenanthro [9,10-d] imidazole has been designed and synthesized. Electronic spectral studies show that phenanthroimidazole is bound to the surface of iron oxide semiconductors. Fluorescent enhancement has been explained on the basis of photo-induced electron transfer (PET) mechanism and apparent binding constants have been deduced. Binding of phenanthroimidazole with iron oxide nanoparticles lowers the HOMO and LUMO energy levels of phenanthroimidazole molecule. Chemical affinity between the nitrogen atom of the phenanthroimidazole and Fe(2+) and Fe(3+) ions on the surface of the nano-oxide may result in strong binding of the phenanthroimidazole derivative with the nanoparticles. The electron injection from the photoexcited phenanthroimidazole to the iron oxides conduction band explains the enhanced fluorescence. Copyright © 2013 Elsevier B.V. All rights reserved.

Communication: Multiple-property-based diabatization for open-shell van der Waals molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karman, Tijs; Avoird, Ad van der; Groenenboom, Gerrit C., E-mail: gerritg@theochem.ru.nl

2016-03-28

We derive a new multiple-property-based diabatization algorithm. The transformation between adiabatic and diabatic representations is determined by requiring a set of properties in both representations to be related by a similarity transformation. This set of properties is determined in the adiabatic representation by rigorous electronic structure calculations. In the diabatic representation, the same properties are determined using model diabatic states defined as products of undistorted monomer wave functions. This diabatic model is generally applicable to van der Waals molecules in arbitrary electronic states. Application to locating seams of conical intersections and collisional transfer of electronic excitation energy is demonstrated formore » O{sub 2} − O{sub 2} in low-lying excited states. Property-based diabatization for this test system included all components of the electric quadrupole tensor, orbital angular momentum, and spin-orbit coupling.« less

Chemical Understanding of the Limited Site-Specificity in Molecular Inner-Shell Photofragmentation

DOE PAGES

Inhester, Ludger; Oostenrijk, Bart; Patanen, Minna; ...

2018-02-14

In many cases fragmentation of molecules upon inner-shell ionization is very unspecific with respect to the initially localized ionization site. Often this finding is interpreted in terms of an equilibration of internal energy into vibrational degrees of freedom after Auger decay. In this paper, we investigate the X-ray photofragmentation of ethyl trifluoroacetate upon core electron ionization at environmentally distinct carbon sites using photoelectron–photoion–photoion coincidence measurements and ab initio electronic structure calculations. For all four carbon ionization sites, the Auger decay weakens the same bonds and transfers the two charges to opposite ends of the molecule, which leads to a rapidmore » dissociation into three fragments, followed by further fragmentation steps. Finally, the lack of site specificity is attributed to the character of the dicationic electronic states after Auger decay instead of a fast equilibration of internal energy.« less

Fluorination-enabled optimal morphology leads to over 11% efficiency for inverted small-molecule organic solar cells

PubMed Central

Deng, Dan; Zhang, Yajie; Zhang, Jianqi; Wang, Zaiyu; Zhu, Lingyun; Fang, Jin; Xia, Benzheng; Wang, Zhen; Lu, Kun; Ma, Wei; Wei, Zhixiang

2016-01-01

Solution-processable small molecules for organic solar cells have attracted intense attention for their advantages of definite molecular structures compared with their polymer counterparts. However, the device efficiencies based on small molecules are still lower than those of polymers, especially for inverted devices, the highest efficiency of which is <9%. Here we report three novel solution-processable small molecules, which contain π-bridges with gradient-decreased electron density and end acceptors substituted with various fluorine atoms (0F, 1F and 2F, respectively). Fluorination leads to an optimal active layer morphology, including an enhanced domain purity, the formation of hierarchical domain size and a directional vertical phase gradation. The optimal morphology balances charge separation and transfer, and facilitates charge collection. As a consequence, fluorinated molecules exhibit excellent inverted device performance, and an average power conversion efficiency of 11.08% is achieved for a two-fluorine atom substituted molecule. PMID:27991486

Combined spectroscopic, DFT, TD-DFT and MD study of newly synthesized thiourea derivative

NASA Astrophysics Data System (ADS)

Menon, Vidya V.; Sheena Mary, Y.; Shyma Mary, Y.; Panicker, C. Yohannan; Bielenica, Anna; Armaković, Stevan; Armaković, Sanja J.; Van Alsenoy, Christian

2018-03-01

A novel thiourea derivative, 1-(3-bromophenyl)-3-[3-(trifluoromethyl)phenyl]thiourea (ANF-22) is synthesized and characterized by FTIR, FT-Raman and NMR spectroscopy experimentally and theoretically. A detailed conformational analysis of the title molecule has been conducted in order to locate the lowest energy geometry, which was further subjected to the detailed investigation of spectroscopic, reactive, degradation and docking studies by density functional theory (DFT) calculations and molecular dynamics (MD) simulations. Time dependent DFT (TD-DFT) calculations have been used also in order to simulate UV spectra and investigate charge transfer within molecule. Natural bond orbital analysis has been performed analyzing the charge delocalization and using HOMO and LUMO energies the electronic properties are analyzed. Molecular electrostatic potential map is used for the quantitative measurement of active sites in the molecule. In order to determine the locations possibly prone to electrophilic attacks we have calculated average local ionization energies and mapped them to the electron density surface. Further insight into the local reactivity properties have been obtained by calculation of Fukui functions, also mapped to the electron density surface. Possible degradation properties by the autoxidation mechanism have been assessed by calculations of bond dissociation energies for hydrogen abstraction. Atoms of title molecule with significant interactions with water molecules have been determined by calculations of radial distribution functions. The title compound can be a lead compound for developing new analgesic drug.

Triarylborane-Based Materials for OLED Applications.

PubMed

Turkoglu, Gulsen; Cinar, M Emin; Ozturk, Turan

2017-09-13

Multidisciplinary research on organic fluorescent molecules has been attracting great interest owing to their potential applications in biomedical and material sciences. In recent years, electron deficient systems have been increasingly incorporated into fluorescent materials. Triarylboranes with the empty p orbital of their boron centres are electron deficient and can be used as strong electron acceptors in conjugated organic fluorescent materials. Moreover, their applications in optoelectronic devices, energy harvesting materials and anion sensing, due to their natural Lewis acidity and remarkable solid-state fluorescence properties, have also been investigated. Furthermore, fluorescent triarylborane-based materials have been commonly utilized as emitters and electron transporters in organic light emitting diode (OLED) applications. In this review, triarylborane-based small molecules and polymers will be surveyed, covering their structure-property relationships, intramolecular charge transfer properties and solid-state fluorescence quantum yields as functional emissive materials in OLEDs. Also, the importance of the boron atom in triarylborane compounds is emphasized to address the key issues of both fluorescent emitters and their host materials for the construction of high-performance OLEDs.

Direct electron-impact mechanism of excitation of mercury monobromide in a double-pulse dielectric-barrier-discharge HgBr lamp

NASA Astrophysics Data System (ADS)

Datsyuk, V. V.; Izmailov, I. A.; Naumov, V. V.; Kochelap, V. A.

2016-08-01

In a nonequlibrium plasma of a gas-discharge HgBr lamp, the terminal electronic state of the HgBr(B-X) radiative transition with a peak wavelength of 502 nm remains populated for a relatively long time and is repeatedly excited to the B state in collisions with plasma electrons. This transfer of the HgBr molecules from the ground state X to the excited state B is the main mechanism of formation of the light-emitting molecules especially when the lamp is excited by double current pulses. According to our simulations, due to the electron-induced transitions between HgBr(X) and HgBr(B), the output characteristics of the DBD lamp operating in a double-pulse regime are better than those of the lamp operating in a single-pulse regime. In the considered case, the peak power is calculated to increase by a factor of about 2 and the lamp efficiency increases by about 50%.

Surface Proton Transfer Promotes Four-Electron Oxygen Reduction on Gold Nanocrystal Surfaces in Alkaline Solution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Fang; Zhang, Yu; Liu, Shizhong

Four-electron oxygen reduction reaction (4e-ORR), as a key pathway in energy conversion, is preferred over the two-electron reduction pathway that falls short in dissociating dioxygen molecules. Gold (Au) surfaces exhibit high sensitivity of the ORR pathway to its atomic structures. The long-standing puzzle remains unsolved why the Au surfaces with {100} sub-facets were exceptionally capable to catalyze the 4e-ORR in alkaline solution, though limited within a narrow potential window. Herein we report the discovery of a dominant 4e-ORR over the whole potential range on {310} surface of Au nanocrystal shaped as truncated ditetragonal prism (TDP). In contrast, ORR pathways onmore » single-crystalline facets of shaped nanoparticles, including {111} on nano-octahedra and {100} on nano-cubes, are similar to their single-crystal counterparts. Combining our experimental results with density functional theory calculations, we elucidate the key role of surface proton transfers from co-adsorbed H 2O molecules in activating the facet- and potential-dependent 4e ORR on Au in alkaline solutions. These results elucidate how surface atomic structures determine the reaction pathways via bond scission and formation among weakly adsorbed water and reaction intermediates. The new insight helps in developing facet-specific nanocatalysts for various reactions.« less

Surface Proton Transfer Promotes Four-Electron Oxygen Reduction on Gold Nanocrystal Surfaces in Alkaline Solution

DOE PAGES

Lu, Fang; Zhang, Yu; Liu, Shizhong; ...

2017-05-11

Four-electron oxygen reduction reaction (4e-ORR), as a key pathway in energy conversion, is preferred over the two-electron reduction pathway that falls short in dissociating dioxygen molecules. Gold (Au) surfaces exhibit high sensitivity of the ORR pathway to its atomic structures. The long-standing puzzle remains unsolved why the Au surfaces with {100} sub-facets were exceptionally capable to catalyze the 4e-ORR in alkaline solution, though limited within a narrow potential window. Herein we report the discovery of a dominant 4e-ORR over the whole potential range on {310} surface of Au nanocrystal shaped as truncated ditetragonal prism (TDP). In contrast, ORR pathways onmore » single-crystalline facets of shaped nanoparticles, including {111} on nano-octahedra and {100} on nano-cubes, are similar to their single-crystal counterparts. Combining our experimental results with density functional theory calculations, we elucidate the key role of surface proton transfers from co-adsorbed H 2O molecules in activating the facet- and potential-dependent 4e ORR on Au in alkaline solutions. These results elucidate how surface atomic structures determine the reaction pathways via bond scission and formation among weakly adsorbed water and reaction intermediates. The new insight helps in developing facet-specific nanocatalysts for various reactions.« less

Simple structured hybrid WOLEDs based on incomplete energy transfer mechanism: from blue exciplex to orange dopant.

PubMed

Zhang, Tianyou; Zhao, Bo; Chu, Bei; Li, Wenlian; Su, Zisheng; Yan, Xingwu; Liu, Chengyuan; Wu, Hairuo; Gao, Yuan; Jin, Fangming; Hou, Fuhua

2015-05-15

Exciplex is well known as a charge transfer state formed between electron-donating and electron-accepting molecules. However, exciplex based organic light emitting diodes (OLED) often performed low efficiencies relative to pure phosphorescent OLED and could hardly be used to construct white OLED (WOLED). In this work, a new mechanism is developed to realize efficient WOLED with extremely simple structure by redistributing the energy of triplet exciplex to both singlet exciplex and the orange dopant. The micro process of energy transfer could be directly examined by detailed photoluminescence decay measurement and time resolved photoluminescence analysis. This strategy overcomes the low reverse intersystem crossing efficiency of blue exciplex and complicated device structure of traditional WOLED, enables us to achieve efficient hybrid WOLEDs. Based on this mechanism, we have successfully constructed both exciplex-fluorescence and exciplex-phosphorescence hybrid WOLEDs with remarkable efficiencies.

Simple structured hybrid WOLEDs based on incomplete energy transfer mechanism: from blue exciplex to orange dopant

NASA Astrophysics Data System (ADS)

Zhang, Tianyou; Zhao, Bo; Chu, Bei; Li, Wenlian; Su, Zisheng; Yan, Xingwu; Liu, Chengyuan; Wu, Hairuo; Gao, Yuan; Jin, Fangming; Hou, Fuhua

2015-05-01

Exciplex is well known as a charge transfer state formed between electron-donating and electron-accepting molecules. However, exciplex based organic light emitting diodes (OLED) often performed low efficiencies relative to pure phosphorescent OLED and could hardly be used to construct white OLED (WOLED). In this work, a new mechanism is developed to realize efficient WOLED with extremely simple structure by redistributing the energy of triplet exciplex to both singlet exciplex and the orange dopant. The micro process of energy transfer could be directly examined by detailed photoluminescence decay measurement and time resolved photoluminescence analysis. This strategy overcomes the low reverse intersystem crossing efficiency of blue exciplex and complicated device structure of traditional WOLED, enables us to achieve efficient hybrid WOLEDs. Based on this mechanism, we have successfully constructed both exciplex-fluorescence and exciplex-phosphorescence hybrid WOLEDs with remarkable efficiencies.

Simple structured hybrid WOLEDs based on incomplete energy transfer mechanism: from blue exciplex to orange dopant

PubMed Central

Zhang, Tianyou; Zhao, Bo; Chu, Bei; Li, Wenlian; Su, Zisheng; Yan, Xingwu; Liu, Chengyuan; Wu, Hairuo; Gao, Yuan; Jin, Fangming; Hou, Fuhua

2015-01-01

Exciplex is well known as a charge transfer state formed between electron-donating and electron-accepting molecules. However, exciplex based organic light emitting diodes (OLED) often performed low efficiencies relative to pure phosphorescent OLED and could hardly be used to construct white OLED (WOLED). In this work, a new mechanism is developed to realize efficient WOLED with extremely simple structure by redistributing the energy of triplet exciplex to both singlet exciplex and the orange dopant. The micro process of energy transfer could be directly examined by detailed photoluminescence decay measurement and time resolved photoluminescence analysis. This strategy overcomes the low reverse intersystem crossing efficiency of blue exciplex and complicated device structure of traditional WOLED, enables us to achieve efficient hybrid WOLEDs. Based on this mechanism, we have successfully constructed both exciplex-fluorescence and exciplex-phosphorescence hybrid WOLEDs with remarkable efficiencies. PMID:25975371

Light and colour as analytical detection tools: a journey into the periodic table using polyamines to bio-inspired systems as chemosensors.

PubMed

Lodeiro, Carlos; Capelo, José Luis; Mejuto, Juan Carlos; Oliveira, Elisabete; Santos, Hugo M; Pedras, Bruno; Nuñez, Cristina

2010-08-01

This critical review describes some developments on the chemistry of fluorescent and colorimetric molecular probes or chemosensors, based on polyamines and associated compounds having oxygen and/or sulfur as donor atoms. The reported systems are essentially based on some selected published work in this field in the last five years, and in the work developed by the authors from 2000 onwards. Some interesting properties beyond sensing molecules, ions or/and cations by fluorescence, colorimetry as well as by MALDI-TOF MS spectrometry can arise from these systems. A short brief on different examples activated by PET (photoinduced electron transfer), ICT (internal charge transfer) and EET (electronic energy transfer) phenomena will be provided. Finally the introduction of bio-inspired compounds derived from emissive amino acid or short peptide systems and nanoparticle devices to detect metal ions will be reviewed (202 references).

Clean graphene electrodes on organic thin-film devices via orthogonal fluorinated chemistry.

PubMed

Beck, Jonathan H; Barton, Robert A; Cox, Marshall P; Alexandrou, Konstantinos; Petrone, Nicholas; Olivieri, Giorgia; Yang, Shyuan; Hone, James; Kymissis, Ioannis

2015-04-08

Graphene is a promising flexible, highly transparent, and elementally abundant electrode for organic electronics. Typical methods utilized to transfer large-area films of graphene synthesized by chemical vapor deposition on metal catalysts are not compatible with organic thin-films, limiting the integration of graphene into organic optoelectronic devices. This article describes a graphene transfer process onto chemically sensitive organic semiconductor thin-films. The process incorporates an elastomeric stamp with a fluorinated polymer release layer that can be removed, post-transfer, via a fluorinated solvent; neither fluorinated material adversely affects the organic semiconductor materials. We used Raman spectroscopy, atomic force microscopy, and scanning electron microscopy to show that chemical vapor deposition graphene can be successfully transferred without inducing defects in the graphene film. To demonstrate our transfer method's compatibility with organic semiconductors, we fabricate three classes of organic thin-film devices: graphene field effect transistors without additional cleaning processes, transparent organic light-emitting diodes, and transparent small-molecule organic photovoltaic devices. These experiments demonstrate the potential of hybrid graphene/organic devices in which graphene is deposited directly onto underlying organic thin-film structures.

Analytical expression for the tunnel current through the redox-mediated tunneling contact in the case of the adiabatic electron transfer at one of the working electrodes and any possible type of the electron transfer at the other electrode

NASA Astrophysics Data System (ADS)

Medvedev, Igor G.

2017-11-01

We study the tunnel current through a one-level redox molecule immersed into the electrolyte solution for the case when the coupling of the molecule to one of the working electrodes is strong while it is arbitrary to the other electrode. Using the Feynman-Vernon influence functional theory and the perturbation expansion of the effective action of the classical oscillator coupled both to the valence level of the redox molecule and to the thermal bath representing the classical fluctuations of the polarization of the solvent, we obtain, following the canonical way, the Langevin equation for the oscillator. It is found that for the aqueous electrolyte solution, the damping and the stochastic forces which arise due to the tunnel current are much smaller than those due to the thermal bath and therefore can be neglected. We estimate the higher-order corrections to the effective action and show that the Langevin dynamics takes place in this case for arbitrary parameters of the tunneling junction under the condition of the strong coupling of the redox molecule to one of the working electrodes. Then the steady-state coordinate distribution function of the oscillator resulting from the corresponding Fokker-Planck equation is the Boltzmann distribution function which is determined by the adiabatic free energy surface arising from the mean current-induced force. It enables us to obtain the expression for the tunnel current in the case when the coupling of the redox molecule to one of the working electrodes is strong while it is arbitrary to the other electrode.

Analytical expression for the tunnel current through the redox-mediated tunneling contact in the case of the adiabatic electron transfer at one of the working electrodes and any possible type of the electron transfer at the other electrode.

PubMed

Medvedev, Igor G

2017-11-21

We study the tunnel current through a one-level redox molecule immersed into the electrolyte solution for the case when the coupling of the molecule to one of the working electrodes is strong while it is arbitrary to the other electrode. Using the Feynman-Vernon influence functional theory and the perturbation expansion of the effective action of the classical oscillator coupled both to the valence level of the redox molecule and to the thermal bath representing the classical fluctuations of the polarization of the solvent, we obtain, following the canonical way, the Langevin equation for the oscillator. It is found that for the aqueous electrolyte solution, the damping and the stochastic forces which arise due to the tunnel current are much smaller than those due to the thermal bath and therefore can be neglected. We estimate the higher-order corrections to the effective action and show that the Langevin dynamics takes place in this case for arbitrary parameters of the tunneling junction under the condition of the strong coupling of the redox molecule to one of the working electrodes. Then the steady-state coordinate distribution function of the oscillator resulting from the corresponding Fokker-Planck equation is the Boltzmann distribution function which is determined by the adiabatic free energy surface arising from the mean current-induced force. It enables us to obtain the expression for the tunnel current in the case when the coupling of the redox molecule to one of the working electrodes is strong while it is arbitrary to the other electrode.

Quantum Theory of Atoms in Molecules Charge-Charge Transfer-Dipolar Polarization Classification of Infrared Intensities.

PubMed

Duarte, Leonardo J; Richter, Wagner E; Silva, Arnaldo F; Bruns, Roy E

2017-10-26

Fundamental infrared vibrational transition intensities of gas-phase molecules are sensitive probes of changes in electronic structure accompanying small molecular distortions. Models containing charge, charge transfer, and dipolar polarization effects are necessary for a successful classification of the C-H, C-F, and C-Cl stretching and bending intensities. C-H stretching and in-plane bending vibrations involving sp 3 carbon atoms have small equilibrium charge contributions and are accurately modeled by the charge transfer-counterpolarization contribution and its interaction with equilibrium charge movement. Large C-F and C═O stretching intensities have dominant equilibrium charge movement contributions compared to their charge transfer-dipolar polarization ones and are accurately estimated by equilibrium charge and the interaction contribution. The C-F and C-Cl bending modes have charge and charge transfer-dipolar polarization contribution sums that are of similar size but opposite sign to their interaction values resulting in small intensities. Experimental in-plane C-H bends have small average intensities of 12.6 ± 10.4 km mol -1 owing to negligible charge contributions and charge transfer-counterpolarization cancellations, whereas their average out-of-plane experimental intensities are much larger, 65.7 ± 20.0 km mol -1 , as charge transfer is zero and only dipolar polarization takes place. The C-F bending intensities have large charge contributions but very small intensities. Their average experimental out-of-plane intensity of 9.9 ± 12.6 km mol -1 arises from the cancellation of large charge contributions by dipolar polarization contributions. The experimental average in-plane C-F bending intensity, 5.8 ± 7.3 km mol -1 , is also small owing to charge and charge transfer-counterpolarization sums being canceled by their interaction contributions. Models containing only atomic charges and their fluxes are incapable of describing electronic structure changes for simple molecular distortions that are of interest in classifying infrared intensities. One can expect dipolar polarization effects to also be important for larger distortions of chemical interest.

Experimental studies of fundamental issues in electron transfer through nanometer scale devices

NASA Astrophysics Data System (ADS)

Yamamoto, Hiromichi

Electron transfer reactions constitute many of the primary events in materials science, chemistry, physics, and biochemistry, e.g. the electron transport properties and photoexcited processes in solids and molecules, chemical reactions, corrosion, photosynthesis, respiration, and so forth. A self-assembled monolayer (SAM) film provides us with a unique environment not only to understand and manipulate the surface electronic properties of a solid, but also to control electron transfer processes at the interface. The first topic in this thesis describes the structure and electron tunneling characterization of alkanethiol SAMs on InP(100). Angle-resolved X-ray photoelectron spectroscopy was used to characterize the bonding of alkanethiols to n-InP surfaces and to measure the monolayer thickness. The results showed that the sulfur binds to In atoms on the surface, and provided film thicknesses of 6.4 A for C8H17SH, 11.1 A for C12H25SH, and 14.9 A for C16H 33SH, resulting in an average tilt angle of 55°. The analysis indicated that super-exchange coupling between the alkane chains plays an important role in defining electron tunneling barriers, especially for highly tilted chains. The second topic describes studies of cytochrome c bound to pure and mixed SAMs of o-terminated alkanethiol (terminated with pyridine, imidazole or nitrile groups) and alkanethiol on gold. Electrochemical methods are used to determine electron transfer rate constants of cytochrome c, and scanning tunneling microscopy to observe the cytochrome c on the SAM. Detailed analysis revealed direct association of the heme of cytochrome c with the terminal groups of the SAMs and a 'turning-over' of the electron transfer of cytochrome c from adiabatic to non-adiabatic regime. The third topic describes studies of oxidation and reduction of cytochrome c in solution through eleven different self-assembled monolayers (SAMs) on gold electrodes by cyclic voltammetry. Electron transfer rate constants of cytochrome c through the eleven SAMs ranged from ≤10-4 to ˜10-1 cm/sec. A strong correlation between the electron transfer rate constants and the hydrogen bonding ability of the SAM is identified. This correlation is discussed in terms of the dependence of the rate constant on the outer-sphere reorganization energy and the electronic coupling between the cytochrome and the differently terminated monolayer films.

Electron transfer, ionization, and excitation in atomic collisions. Progress report, June 15, 1992--June 14, 1995

DOE Office of Scientific and Technical Information (OSTI.GOV)

Winter, T.G.; Alston, S.G.

The research program of Winter and Alston addresses the fundamental processes of electron transfer, ionization, and excitation in ion-atom, ion-ion, and ion-molecule collisions. Attention is focussed on one- and two-electron systems and, more recently, quasi-one-electron systems whose electron-target-core interaction can be accurately modeled by one-electron potentials. The basic computational approaches can then be taken with few, if any, approximations, and the underlying collisional mechanisms can be more clearly revealed. Winter has focussed on intermediate collision energies (e.g., proton energies for p-He{sup +} collisions on the order of 100 kilo-electron volts), in which many electron states are strongly coupled during themore » collision and a coupled-state approach, such as a coupled-Sturmian-pseudostate approach, is appropriate. Alston has concentrated on higher collision energies (million electron-volt energies), or asymmetric collision systems, for which the coupling of the projectile is weaker with, however, many more target states being coupled together so that high-order perturbation theory is essential. Several calculations by Winter and Alston are described, as set forth in the original proposal.« less

Acceptor number-dependent ultrafast photo-physical properties of push-pull chromophores using time-resolved methods

NASA Astrophysics Data System (ADS)

Chi, Xiao-Chun; Wang, Ying-Hui; Gao, Yu; Sui, Ning; Zhang, Li-Quan; Wang, Wen-Yan; Lu, Ran; Ji, Wen-Yu; Yang, Yan-Qiang; Zhang, Han-Zhuang

2018-04-01

Three push-pull chromophores comprising a triphenylamine (TPA) as electron-donating moiety and functionalized β-diketones as electron acceptor units are studied by various spectroscopic techniques. The time-correlated single-photon counting data shows that increasing the number of electron acceptor units accelerates photoluminescence relaxation rate of compounds. Transient spectra data shows that intramolecular charge transfer (ICT) takes place from TPA units to β-diketones units after photo-excitation. Increasing the number of electron acceptor units would prolong the generation process of ICT state, and accelerate the excited molecule reorganization process and the relaxation process of ICT state.

Harnessing Reversible Electronic Energy Transfer: From Molecular Dyads to Molecular Machines.

PubMed

Denisov, Sergey A; Yu, Shinlin; Pozzo, Jean-Luc; Jonusauskas, Gediminas; McClenaghan, Nathan D

2016-06-17

Reversible electronic energy transfer (REET) may be instilled in bi-/multichromophoric molecule-based systems, following photoexcitation, upon judicious structural integration of matched chromophores. This leads to a new set of photophysical properties for the ensemble, which can be fully characterized by steady-state and time-resolved spectroscopic methods. Herein, we take a comprehensive look at progress in the development of this type of supermolecule in the last five years, which has seen systems evolve from covalently tethered dyads to synthetic molecular machines, exemplified by two different pseudorotaxanes. Indeed, REET holds promise in the control of movement in molecular machines, their assembly/disassembly, as well as in charge separation. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Length-dependence of intramolecular electron transfer in σ-bonded rigid molecular rods: an ab initio molecular orbital study

NASA Astrophysics Data System (ADS)

Pati, Ranjit; Karna, Shashi P.

2002-01-01

The dependence of electron transfer (ET) coupling element, VAB, on the length of rigid-rod-like systems consisting of bicyclo[1.1.1]pentane (BCP), cubane (CUB), and bicyclo[2.2.2]octane (BCO) monomers, has been investigated with the use of ab initio Hartree-Fock (HF) method employing Marcus-Hush two-state (TS) model. The value of VAB decreases exponentially with increase in the number of the cage units of the σ-bonded molecules. The calculated decay constant, β, shows good agreement with previously reported data. For molecular length⩾15 Å, the value of VAB becomes negligibly small, suggesting complete suppression of the through bond direct tunneling contribution to ET process.

Free energy landscape of electrocatalytic CO2 reduction to CO on aqueous FeN4 center embedded graphene studied by ab initio molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Sheng, Tian; Sun, Shi-Gang

2017-11-01

Experiments have found that the porphyrin-like FeN4 site in Fe-N-C materials is highly efficient for the electrochemical reduction of CO2 into CO. In this work, we investigated the reduction mechanisms on FeN4 embedded graphene layer catalyst with some explicit water molecules by combining the constrained ab initio molecular dynamics simulations and thermodynamic integrations. The reaction free energy and electron transfer in each elementary step were identified. The initial CO2 activation was identified to go through the first electron transfer to form adsorbed CO2- anion and the CO desorption was the rate limiting step in the overall catalytic cycle.

Effects of polymethylmethacrylate-transfer residues on the growth of organic semiconductor molecules on chemical vapor deposited graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kratzer, Markus, E-mail: markus.kratzer@unileoben.ac.at; Teichert, Christian; Bayer, Bernhard C.

Scalably grown and transferred graphene is a highly promising material for organic electronic applications, but controlled interfacing of graphene thereby remains a key challenge. Here, we study the growth characteristics of the important organic semiconductor molecule para-hexaphenyl (6P) on chemical vapor deposited graphene that has been transferred with polymethylmethacrylate (PMMA) onto oxidized Si wafer supports. A particular focus is on the influence of PMMA residual contamination, which we systematically reduce by H{sub 2} annealing prior to 6P deposition. We find that 6P grows in a flat-lying needle-type morphology, surprisingly independent of the level of PMMA residue and of graphene defects.more » Wrinkles in the graphene typically act as preferential nucleation centers. Residual PMMA does however limit the length of the resulting 6P needles by restricting molecular diffusion/attachment. We discuss the implications for organic device fabrication, with particular regard to contamination and defect tolerance.« less

Noncovalent binding of xanthene and phthalocyanine dyes with graphene sheets: the effect of the molecular structure revealed by a photophysical study.

PubMed

Zhang, Xian-Fu; Liu, Su-Ping; Shao, Xiao-Na

2013-09-01

The fluorescence and absorption properties of several xanthene and phthalocyanine dyes were measured in the presence and absence of chemically derived graphene (CDG) sheets. The interaction of pyronine Y (PYY) with graphene sheets was compared with that of rhodamine 6G (R6G) to reveal the effect of the molecular structure. Although the presence of the perpendicular benzene moiety in a R6G or phthalocyanine molecule does cause the difficulty for forming dye-CDG complex and make CDG less efficient in quenching the fluorescence intensity and shortening the fluorescence lifetime, it does not affect the band position of charge transfer absorption, suggesting that no molecular shape change occurred in a dye molecule caused by the interaction with CDG sheets. The spectroscopic and thermodynamic data indicated that the dye-CDG binding is of charge transfer nature, while the dynamic fluorescence quenching is due to photoinduced energy and electron transfer. Copyright © 2013 Elsevier B.V. All rights reserved.

Coherence and population dynamics of chlorophyll excitations in FCP complex: Two-dimensional spectroscopy study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Butkus, Vytautas; Gelzinis, Andrius; Valkunas, Leonas

2015-06-07

Energy transfer processes and coherent phenomena in the fucoxanthin–chlorophyll protein complex, which is responsible for the light harvesting function in marine algae diatoms, were investigated at 77 K by using two-dimensional electronic spectroscopy. Experiments performed on femtosecond and picosecond timescales led to separation of spectral dynamics, witnessing evolutions of coherence and population states of the system in the spectral region of Q{sub y} transitions of chlorophylls a and c. Analysis of the coherence dynamics allowed us to identify chlorophyll (Chl) a and fucoxanthin intramolecular vibrations dominating over the first few picoseconds. Closer inspection of the spectral region of the Q{submore » y} transition of Chl c revealed previously not identified, mutually non-interacting chlorophyll c states participating in femtosecond or picosecond energy transfer to the Chl a molecules. Consideration of separated coherent and incoherent dynamics allowed us to hypothesize the vibrations-assisted coherent energy transfer between Chl c and Chl a and the overall spatial arrangement of chlorophyll molecules.« less

On chirality transfer in electron donor-acceptor complexes. A prediction for the sulfinimine···BF3 system.

PubMed

Rode, Joanna E; Dobrowolski, Jan Cz

2012-01-01

Stabilization energies of the electron donor-acceptor sulfinimine···BF(3) complexes calculated at either the B3LYP/aug-cc-pVTZ or the MP2/aug-cc-pVTZ level do not allow to judge, whether the N- or O-atom in sulfinimine is stronger electron-donor to BF(3) . The problem seems to be solvable because chirality transfer phenomenon between chiral sulfinimine and achiral BF(3) is expected to be vibrational circular dichroism (VCD) active. Moreover, the bands associated with the achiral BF(3) molecule are predicted to be the most intense in the entire spectrum. However, the VCD band robustness analyses show that most of the chirality transfer modes of BF(3) are unreliable. Conversely, variation of VCD intensity with change of intermolecular distance, angle, and selected dihedrals between the complex partners shows that to establish the robustness of chirality transfer mode. It is also necessary to determine the influence of the potential energy surface (PES) shape on the VCD intensity. At the moment, there is still no universal criterion for the chirality transfer mode robustness and the conclusions formulated based on one system cannot be directly transferred even to a quite similar one. However, it is certain that more attention should be focused on relation of PES shape and the VCD mode robustness problem. Copyright © 2011 Wiley Periodicals, Inc.

Matrix photochemistry of small molecules: Influencing reaction dynamics on electronically excited hypersurfaces

DOE Office of Scientific and Technical Information (OSTI.GOV)

Laursen, S.L.

Investigations of chemical reactions on electronically excited reaction surfaces are presented. The role of excited-surface multiplicity is of particular interest, as are chemical reactivity and energy transfer in systems in which photochemistry is initiated through a metal atom sensitizer.'' Two approaches are employed: A heavy-atom matrix affords access to forbidden triplet reaction surfaces, eliminating the need for a potentially reactive sensitizer. Later, the role of the metal atom in the photosensitization process is examined directly.

Recent measurements concerning uranium hexafluoride-electron collision processes

NASA Technical Reports Server (NTRS)

Trajmar, S.; Chutjian, A.; Srivastava, S.; Williams, W.; Cartwright, D. C.

1976-01-01

Scattering of electrons by UF6 molecules was studied at impact energies ranging from 5 to 100 eV and momentum transfer, elastic and inelastic scattering cross sections were determined. The measurements also yielded spectroscopic information which made possible to extend the optical absorption cross sections from 2000 angstroms to 435 angstroms. It was found that UF6 is a very strong absorber in the vacuum UV region. No transitions were found to lie below the onset of the optically detected 3.0 eV feature.

Photodissociation of aligned CH3I and C6H3F2I molecules probed with time-resolved Coulomb explosion imaging by site-selective extreme ultraviolet ionization

PubMed Central

Amini, Kasra; Savelyev, Evgeny; Brauße, Felix; Berrah, Nora; Bomme, Cédric; Brouard, Mark; Burt, Michael; Christensen, Lauge; Düsterer, Stefan; Erk, Benjamin; Höppner, Hauke; Kierspel, Thomas; Krecinic, Faruk; Lauer, Alexandra; Lee, Jason W. L.; Müller, Maria; Müller, Erland; Mullins, Terence; Redlin, Harald; Schirmel, Nora; Thøgersen, Jan; Techert, Simone; Toleikis, Sven; Treusch, Rolf; Trippel, Sebastian; Ulmer, Anatoli; Vallance, Claire; Wiese, Joss; Johnsson, Per; Küpper, Jochen; Rudenko, Artem; Rouzée, Arnaud; Stapelfeldt, Henrik; Rolles, Daniel; Boll, Rebecca

2018-01-01

We explore time-resolved Coulomb explosion induced by intense, extreme ultraviolet (XUV) femtosecond pulses from a free-electron laser as a method to image photo-induced molecular dynamics in two molecules, iodomethane and 2,6-difluoroiodobenzene. At an excitation wavelength of 267 nm, the dominant reaction pathway in both molecules is neutral dissociation via cleavage of the carbon–iodine bond. This allows investigating the influence of the molecular environment on the absorption of an intense, femtosecond XUV pulse and the subsequent Coulomb explosion process. We find that the XUV probe pulse induces local inner-shell ionization of atomic iodine in dissociating iodomethane, in contrast to non-selective ionization of all photofragments in difluoroiodobenzene. The results reveal evidence of electron transfer from methyl and phenyl moieties to a multiply charged iodine ion. In addition, indications for ultrafast charge rearrangement on the phenyl radical are found, suggesting that time-resolved Coulomb explosion imaging is sensitive to the localization of charge in extended molecules. PMID:29430482

Photodissociation of aligned CH3I and C6H3F2I molecules probed with time-resolved Coulomb explosion imaging by site-selective extreme ultraviolet ionization.

PubMed

Amini, Kasra; Savelyev, Evgeny; Brauße, Felix; Berrah, Nora; Bomme, Cédric; Brouard, Mark; Burt, Michael; Christensen, Lauge; Düsterer, Stefan; Erk, Benjamin; Höppner, Hauke; Kierspel, Thomas; Krecinic, Faruk; Lauer, Alexandra; Lee, Jason W L; Müller, Maria; Müller, Erland; Mullins, Terence; Redlin, Harald; Schirmel, Nora; Thøgersen, Jan; Techert, Simone; Toleikis, Sven; Treusch, Rolf; Trippel, Sebastian; Ulmer, Anatoli; Vallance, Claire; Wiese, Joss; Johnsson, Per; Küpper, Jochen; Rudenko, Artem; Rouzée, Arnaud; Stapelfeldt, Henrik; Rolles, Daniel; Boll, Rebecca

2018-01-01

We explore time-resolved Coulomb explosion induced by intense, extreme ultraviolet (XUV) femtosecond pulses from a free-electron laser as a method to image photo-induced molecular dynamics in two molecules, iodomethane and 2,6-difluoroiodobenzene. At an excitation wavelength of 267 nm, the dominant reaction pathway in both molecules is neutral dissociation via cleavage of the carbon-iodine bond. This allows investigating the influence of the molecular environment on the absorption of an intense, femtosecond XUV pulse and the subsequent Coulomb explosion process. We find that the XUV probe pulse induces local inner-shell ionization of atomic iodine in dissociating iodomethane, in contrast to non-selective ionization of all photofragments in difluoroiodobenzene. The results reveal evidence of electron transfer from methyl and phenyl moieties to a multiply charged iodine ion. In addition, indications for ultrafast charge rearrangement on the phenyl radical are found, suggesting that time-resolved Coulomb explosion imaging is sensitive to the localization of charge in extended molecules.

Lateral hopping of CO on Cu(111) induced by femtosecond laser pulses

NASA Astrophysics Data System (ADS)

Ueba, H.; Ootsuka, Y.; Paulsson, M.; Persson, B. N. J.

2010-09-01

We present a theoretical study of the lateral hopping of a single CO molecule on Cu(111) induced by femtosecond laser pulses by Mehlhorn [Phys. Rev. Lett. 104, 076101 (2010)]10.1103/PhysRevLett.104.076101. Our model assumes an intermode coupling between the CO frustrated translation (FT) and frustrated rotation (FR) modes with a weak and strong electronic friction coupling to hot electrons, respectively, and heat transfer between the FT mode and the substrate phonons. In this model the effective electronic friction coupling of the FT mode depends on the absorbed laser fluence F through the temperature of the FR mode. The calculated hopping yield as a function of F nicely reproduces the nonlinear increase observed above F=4.0J/m2 . It is found that the electronic heating via friction coupling nor the phonon coupling alone cannot explain the experimental result. Both heatings are cooperatively responsible for CO hopping on Cu(111). The electronic heat transfer dominates over the phononic one at high F , where the effective electronic friction coupling becomes larger than the phononic coupling.

Short-Lived Electronically-Excited Diatomic Molecules Cooled via Supersonic Expansion from a Plasma Microjet

NASA Astrophysics Data System (ADS)

Houlahan, Thomas J., Jr.; Su, Rui; Eden, Gary

2014-06-01

Using a pulsed plasma microjet to generate short-lived, electronically-excited diatomic molecules, and subsequently ejecting them into vacuum to cool via supersonic expansion, we are able to monitor the cooling of molecules having radiative lifetimes as low as 16 ns. Specifically, we report on the rotational cooling of He_2 molecules in the d^3Σ_u^+, e^3Π_g, and f^3Σ_u^+ states, which have lifetimes of 25 ns, 67 ns, and 16 ns, respectively. The plasma microjet is driven with a 2.6 kV, 140 ns high-voltage pulse (risetime of 20 ns) which, when combined with a high-speed optical imaging system, allows the nonequilibrium rotational distribution for these molecular states to be monitored as they cool from 1200 K to below 250 K with spatial and temporal resolutions of below 10 μm and 10 ns, respectively. The spatial and temporal resolution afforded by this system also allows the observation of excitation transfer between the f^3Σ_u^+ state and the lower lying d^3Σ_u^+ and e^3Π_g states. The extension of this method to other electronically excited diatomics with excitation energies >5 eV will also be discussed.

Theory of raman scattering from molecules adsorbed at semiconductor surfaces

NASA Astrophysics Data System (ADS)

Ueba, H.

1983-09-01

A theory is presented to calculate the Raman polarizability of an adsorbed molecule at a semiconductor surface, where the electronic excitation in the molecular site interacts with excitons (elementary excitations in the semiconductor) through non-radiative energy transfer between them, in an intermediate state in the Raman scattering process. The Raman polarizability thus calculated is found to exhibit a peak at the energy corresponding to a resonant excitation of excitons, thereby suggesting the possibility of surface enhanced Raman scattering on semiconductor surfaces. The mechanism studied here can also give an explanation of a recent observation of the Raman excitation profiles of p-NDMA and p-DMAAB adsorbed on ZnO or TiO 2, where those profiles were best described by assuming a resonant intermediate state of the exciton transition in the semiconductors. It is also demonstrated that in addition to vibrational Raman scattering, excitonic Raman scattering of adsorbed molecules will occur in the coupled molecule-semiconductor system, where the molecular returns to its ground electronic state by leaving an exciton in the semiconductor. A spectrum of the excitonic Raman scattering is expected to appear in the background of the vibrational Raman band and to be characterized by the electronic structure of excitons. A desirable experiment is suggested for an examination of the theory.

Quantum Electron Tunneling in Respiratory Complex I1

PubMed Central

Hayashi, Tomoyuki; Stuchebrukhov, Alexei A.

2014-01-01

We have simulated the atomistic details of electronic wiring of all Fe/S clusters in complex I, a key enzyme in the respiratory electron transport chain. The tunneling current theory of many-electron systems is applied to the broken-symmetry (BS) states of the protein at the ZINDO level. One-electron tunneling approximation is found to hold in electron tunneling between the anti-ferromagnetic binuclear and tetranuclear Fe/S clusters with moderate induced polarization of the core electrons. Calculated tunneling energy is about 3 eV higher than Fermi level in the band gap of the protein, which supports that the mechanism of electron transfer is quantum mechanical tunneling, as in the rest of electron transport chain. Resulting electron tunneling pathways consist of up to three key contributing protein residues between neighboring Fe/S clusters. A distinct signature of the wave properties of electrons is observed as quantum interferences when multiple tunneling pathways exist. In N6a-N6b, electron tunnels along different pathways depending on the involved BS states, suggesting possible fluctuations of the tunneling pathways driven by the local protein environment. The calculated distance dependence of the electron transfer rates with internal water molecules included are in good agreement with a reported phenomenological relation. PMID:21495666

Two-Electron Transfer Pathways.

PubMed

Lin, Jiaxing; Balamurugan, D; Zhang, Peng; Skourtis, Spiros S; Beratan, David N

2015-06-18

The frontiers of electron-transfer chemistry demand that we develop theoretical frameworks to describe the delivery of multiple electrons, atoms, and ions in molecular systems. When electrons move over long distances through high barriers, where the probability for thermal population of oxidized or reduced bridge-localized states is very small, the electrons will tunnel from the donor (D) to acceptor (A), facilitated by bridge-mediated superexchange interactions. If the stable donor and acceptor redox states on D and A differ by two electrons, it is possible that the electrons will propagate coherently from D to A. While structure-function relations for single-electron superexchange in molecules are well established, strategies to manipulate the coherent flow of multiple electrons are largely unknown. In contrast to one-electron superexchange, two-electron superexchange involves both one- and two-electron virtual intermediate states, the number of virtual intermediates increases very rapidly with system size, and multiple classes of pathways interfere with one another. In the study described here, we developed simple superexchange models for two-electron transfer. We explored how the bridge structure and energetics influence multielectron superexchange, and we compared two-electron superexchange interactions to single-electron superexchange. Multielectron superexchange introduces interference between singly and doubly oxidized (or reduced) bridge virtual states, so that even simple linear donor-bridge-acceptor systems have pathway topologies that resemble those seen for one-electron superexchange through bridges with multiple parallel pathways. The simple model systems studied here exhibit a richness that is amenable to experimental exploration by manipulating the multiple pathways, pathway crosstalk, and changes in the number of donor and acceptor species. The features that emerge from these studies may assist in developing new strategies to deliver multiple electrons in condensed-phase redox systems, including multiple-electron redox species, multimetallic/multielectron redox catalysts, and multiexciton excited states.

Single or functionalized fullerenes interacting with heme group

DOE Office of Scientific and Technical Information (OSTI.GOV)

Costa, Wallison Chaves; Diniz, Eduardo Moraes, E-mail: eduardo.diniz@ufma.br

The heme group is responsible for iron transportation through the bloodstream, where iron participates in redox reactions, electron transfer, gases detection etc. The efficiency of such processes can be reduced if the whole heme molecule or even the iron is somehow altered from its original oxidation state, which can be caused by interactions with nanoparticles as fullerenes. To verify how such particles alter the geometry and electronic structure of heme molecule, here we report first principles calculations based on density functional theory of heme group interacting with single C{sub 60} fullerene or with C{sub 60} functionalized with small functional groupsmore » (−CH{sub 3}, −COOH, −NH{sub 2}, −OH). The calculations shown that the system heme + nanoparticle has a different spin state in comparison with heme group if the fullerene is functionalized. Also a functional group can provide a stronger binding between nanoparticle and heme molecule or inhibit the chemical bonding in comparison with single fullerene results. In addition heme molecule loses electrons to the nanoparticles and some systems exhibited a geometry distortion in heme group, depending on the binding energy. Furthermore, one find that such nanoparticles induce a formation of spin up states in heme group. Moreover, there exist modifications in density of states near the Fermi energy. Although of such changes in heme electronic structure and geometry, the iron atom remains in the heme group with the same oxidation state, so that processes that involve the iron might not be affected, only those that depend on the whole heme molecule.« less

Two-dimensional vibrational-electronic spectroscopy

NASA Astrophysics Data System (ADS)

Courtney, Trevor L.; Fox, Zachary W.; Slenkamp, Karla M.; Khalil, Munira

2015-10-01

Two-dimensional vibrational-electronic (2D VE) spectroscopy is a femtosecond Fourier transform (FT) third-order nonlinear technique that creates a link between existing 2D FT spectroscopies in the vibrational and electronic regions of the spectrum. 2D VE spectroscopy enables a direct measurement of infrared (IR) and electronic dipole moment cross terms by utilizing mid-IR pump and optical probe fields that are resonant with vibrational and electronic transitions, respectively, in a sample of interest. We detail this newly developed 2D VE spectroscopy experiment and outline the information contained in a 2D VE spectrum. We then use this technique and its single-pump counterpart (1D VE) to probe the vibrational-electronic couplings between high frequency cyanide stretching vibrations (νCN) and either a ligand-to-metal charge transfer transition ([FeIII(CN)6]3- dissolved in formamide) or a metal-to-metal charge transfer (MMCT) transition ([(CN)5FeIICNRuIII(NH3)5]- dissolved in formamide). The 2D VE spectra of both molecules reveal peaks resulting from coupled high- and low-frequency vibrational modes to the charge transfer transition. The time-evolving amplitudes and positions of the peaks in the 2D VE spectra report on coherent and incoherent vibrational energy transfer dynamics among the coupled vibrational modes and the charge transfer transition. The selectivity of 2D VE spectroscopy to vibronic processes is evidenced from the selective coupling of specific νCN modes to the MMCT transition in the mixed valence complex. The lineshapes in 2D VE spectra report on the correlation of the frequency fluctuations between the coupled vibrational and electronic frequencies in the mixed valence complex which has a time scale of 1 ps. The details and results of this study confirm the versatility of 2D VE spectroscopy and its applicability to probe how vibrations modulate charge and energy transfer in a wide range of complex molecular, material, and biological systems.

Two-dimensional vibrational-electronic spectroscopy.

PubMed

Courtney, Trevor L; Fox, Zachary W; Slenkamp, Karla M; Khalil, Munira

2015-10-21

Two-dimensional vibrational-electronic (2D VE) spectroscopy is a femtosecond Fourier transform (FT) third-order nonlinear technique that creates a link between existing 2D FT spectroscopies in the vibrational and electronic regions of the spectrum. 2D VE spectroscopy enables a direct measurement of infrared (IR) and electronic dipole moment cross terms by utilizing mid-IR pump and optical probe fields that are resonant with vibrational and electronic transitions, respectively, in a sample of interest. We detail this newly developed 2D VE spectroscopy experiment and outline the information contained in a 2D VE spectrum. We then use this technique and its single-pump counterpart (1D VE) to probe the vibrational-electronic couplings between high frequency cyanide stretching vibrations (νCN) and either a ligand-to-metal charge transfer transition ([Fe(III)(CN)6](3-) dissolved in formamide) or a metal-to-metal charge transfer (MMCT) transition ([(CN)5Fe(II)CNRu(III)(NH3)5](-) dissolved in formamide). The 2D VE spectra of both molecules reveal peaks resulting from coupled high- and low-frequency vibrational modes to the charge transfer transition. The time-evolving amplitudes and positions of the peaks in the 2D VE spectra report on coherent and incoherent vibrational energy transfer dynamics among the coupled vibrational modes and the charge transfer transition. The selectivity of 2D VE spectroscopy to vibronic processes is evidenced from the selective coupling of specific νCN modes to the MMCT transition in the mixed valence complex. The lineshapes in 2D VE spectra report on the correlation of the frequency fluctuations between the coupled vibrational and electronic frequencies in the mixed valence complex which has a time scale of 1 ps. The details and results of this study confirm the versatility of 2D VE spectroscopy and its applicability to probe how vibrations modulate charge and energy transfer in a wide range of complex molecular, material, and biological systems.

Reverse Transcriptase Activity in Mature Spermatozoa of Mouse

PubMed Central

Giordano, Roberto; Magnano, Anna Rosa; Zaccagnini, Germana; Pittoggi, Carmine; Moscufo, Nicola; Lorenzini, Rodolfo; Spadafora, Corrado

2000-01-01

We show here that a reverse transcriptase (RT) activity is present in murine epididymal spermatozoa. Sperm cells incubated with human poliovirus RNA can take up exogenous RNA molecules and internalize them in nuclei. Direct PCR amplification of DNA extracted from RNA-incubated spermatozoa indicate that poliovirus RNA is reverse-transcribed in cDNA fragments. PCR analysis of two-cell embryos shows that poliovirus RNA-challenged spermatozoa transfer retrotranscribed cDNA molecules into eggs during in vitro fertilization. Finally, RT molecules can be visualized on sperm nuclear scaffolds by immunogold electron microscopy. These results, therefore, reveal a novel metabolic function in spermatozoa, which may play a role during early embryonic development. PMID:10725323

Analysis of the complex formation, interaction and electron transfer pathway between the "open" conformation of NADPH-cytochrome P450 reductase and aromatase.

PubMed

Dai, Yuejie; Zhen, Jing; Zhang, Xiuli; Zhong, Yonghui; Liu, Shaodan; Sun, Ziyue; Guo, Yue; Wu, Qingli

2015-09-01

The complex structure of human aromatase (CYP19) and the open form of ΔTGEE mutant NADPH-cytochrome P450 reductase (mCPR) was constructed using template-based protein alignment method. Dynamic simulation of formed complex was performed on NAMD 2.9, in which CHARMm all 27_prot_lipid_na force field and an explicit TIP3P water solvent model were applied. The result showed mCPR in its open conformation could steadily combine with aromatase from the proximal face. Data analysis indicates hydrogen bonds and four salt bridges on the binding surface enhance the interaction between the two protein molecules. Amino acid, Lys108 plays a key role in aromatase activity through the formation of a salt bridge with Asp147 and two hydrogen bonds with Asp147 and Gln150 in mCPR. The optimal pathway for the first electron transfer from CPR to aromatase was revealed and calculated using HARLEM software. The rates for solvent mediated and non-solvent mediated electron transfer from FMNH2 to heme were determined as 1.04×10(6)s(-)(1) and 4.86×10(5)s(-)(1) respectively, which indicates the solvent water can facilitate the electron transfer from FMNH2 to heme. This study presents a novel strategy for the study of the protein-protein interactions based on the template-based protein alignment, which may help new aromtase development targeting the electron transfer between mCPR and aromatase. Copyright © 2015 Elsevier Inc. All rights reserved.

Electronic charge rearrangement at metal/organic interfaces induced by weak van der Waals interactions

NASA Astrophysics Data System (ADS)

Ferri, Nicola; Ambrosetti, Alberto; Tkatchenko, Alexandre

2017-07-01

Electronic charge rearrangements at interfaces between organic molecules and solid surfaces play a key role in a wide range of applications in catalysis, light-emitting diodes, single-molecule junctions, molecular sensors and switches, and photovoltaics. It is common to utilize electrostatics and Pauli pushback to control the interface electronic properties, while the ubiquitous van der Waals (vdW) interactions are often considered to have a negligible direct contribution (beyond the obvious structural relaxation). Here, we apply a fully self-consistent Tkatchenko-Scheffler vdW density functional to demonstrate that the weak vdW interactions can induce sizable charge rearrangements at hybrid metal/organic systems (HMOS). The complex vdW correlation potential smears out the interfacial electronic density, thereby reducing the charge transfer in HMOS, changes the interface work functions by up to 0.2 eV, and increases the interface dipole moment by up to 0.3 Debye. Our results suggest that vdW interactions should be considered as an additional control parameter in the design of hybrid interfaces with the desired electronic properties.

Zero Quantum Coherence in a Series of Covalent Spin-Correlated Radical Pairs.

PubMed

Nelson, Jordan N; Krzyaniak, Matthew D; Horwitz, Noah E; Rugg, Brandon K; Phelan, Brian T; Wasielewski, Michael R

2017-03-23

Photoinitiated subnanosecond electron transfer within covalently linked electron donor-acceptor molecules can result in the formation of a spin-correlated radical pair (SCRP) with a well-defined initial singlet spin configuration. Subsequent coherent mixing between the SCRP singlet and triplet m s = 0 spin states, the so-called zero quantum coherence (ZQC), is of potential interest in quantum information processing applications because the ZQC can be probed using pulse electron paramagnetic resonance (pulse-EPR) techniques. Here, pulse-EPR spectroscopy is utilized to examine the ZQC oscillation frequencies and ZQC dephasing in three structurally well-defined D-A systems. While transitions between the singlet and triplet m s = 0 spin states are formally forbidden (Δm s = 0), they can be addressed using specific microwave pulse turning angles to map information from the ZQC onto observable single quantum coherences. In addition, by using structural variations to tune the singlet-triplet energy gap, the ZQC frequencies determined for this series of molecules indicate a stronger dependence on the electronic g-factor than on electron-nuclear hyperfine interactions.

Engineering of Porphyrin Molecules for Use as Effective Cathode Interfacial Modifiers in Organic Solar Cells of Enhanced Efficiency and Stability.

PubMed

Tountas, Marinos; Verykios, Apostolis; Polydorou, Ermioni; Kaltzoglou, Andreas; Soultati, Anastasia; Balis, Nikolaos; Angaridis, Panagiotis A; Papadakis, Michael; Nikolaou, Vasilis; Auras, Florian; Palilis, Leonidas C; Tsikritzis, Dimitris; Evangelou, Evangelos K; Gardelis, Spyros; Koutsoureli, Matroni; Papaioannou, George; Petsalakis, Ioannis D; Kennou, Stella; Davazoglou, Dimitris; Argitis, Panagiotis; Falaras, Polycarpos; Coutsolelos, Athanassios G; Vasilopoulou, Maria

2018-06-20

In the present work, we effectively modify the TiO 2 electron transport layer of organic solar cells with an inverted architecture using appropriately engineered porphyrin molecules. The results show that the optimized porphyrin modifier bearing two carboxylic acids as the anchoring groups and a triazine electron-withdrawing spacer significantly reduces the work function of TiO 2 , thereby reducing the electron extraction barrier. Moreover, the lower surface energy of the porphyrin-modified substrate results in better physical compatibility between the latter and the photoactive blend. Upon employing porphyrin-modified TiO 2 electron transport layers in PTB7:PC 71 BM-based organic solar cells we obtained an improved average power conversion efficiency up to 8.73%. Importantly, porphyrin modification significantly increased the lifetime of the devices, which retained 80% of their initial efficiency after 500 h of storage in the dark. Because of its simplicity and efficacy, this approach should give tantalizing glimpses and generate an impact into the potential of porphyrins to facilitate electron transfer in organic solar cells and related devices.

Electron capture and transport mediated by lattice solitons

NASA Astrophysics Data System (ADS)

Hennig, D.; Chetverikov, A.; Velarde, M. G.; Ebeling, W.

2007-10-01

We study electron transport in a one-dimensional molecular lattice chain. The molecules are linked by Morse interaction potentials. The electronic degree of freedom, expressed in terms of a tight binding system, is coupled to the longitudinal displacements of the molecules from their equilibrium positions along the axis of the lattice. More specifically, the distance between two sites influences in an exponential fashion the corresponding electronic transfer matrix element. We demonstrate that when an electron is injected in the undistorted lattice it causes a local deformation such that a compression results leading to a lowering of the electron’s energy below the lower edge of the band of linear states. This corresponds to self-localization of the electron due to a polaronlike effect. Then, if a traveling soliton lattice deformation is launched a distance apart from the electron’s position, upon encountering the polaronlike state it captures the latter dragging it afterwards along its path. Strikingly, even when the electron is initially uniformly distributed over the lattice sites a traveling soliton lattice deformation gathers the electronic amplitudes during its traversing of the lattice. Eventually, the electron state is strongly localized and moves coherently in unison with the soliton lattice deformation. This shows that for the achievement of coherent electron transport we need not start with the polaronic effect.

Insulation of a synthetic hydrogen metabolism circuit in bacteria

PubMed Central

2010-01-01

Background The engineering of metabolism holds tremendous promise for the production of desirable metabolites, particularly alternative fuels and other highly reduced molecules. Engineering approaches must redirect the transfer of chemical reducing equivalents, preventing these electrons from being lost to general cellular metabolism. This is especially the case for high energy electrons stored in iron-sulfur clusters within proteins, which are readily transferred when two such clusters are brought in close proximity. Iron sulfur proteins therefore require mechanisms to ensure interaction between proper partners, analogous to many signal transduction proteins. While there has been progress in the isolation of engineered metabolic pathways in recent years, the design of insulated electron metabolism circuits in vivo has not been pursued. Results Here we show that a synthetic hydrogen-producing electron transfer circuit in Escherichia coli can be insulated from existing cellular metabolism via multiple approaches, in many cases improving the function of the pathway. Our circuit is composed of heterologously expressed [Fe-Fe]-hydrogenase, ferredoxin, and pyruvate-ferredoxin oxidoreductase (PFOR), allowing the production of hydrogen gas to be coupled to the breakdown of glucose. We show that this synthetic pathway can be insulated through the deletion of competing reactions, rational engineering of protein interaction surfaces, direct protein fusion of interacting partners, and co-localization of pathway components on heterologous protein scaffolds. Conclusions Through the construction and characterization of a synthetic metabolic circuit in vivo, we demonstrate a novel system that allows for predictable engineering of an insulated electron transfer pathway. The development of this system demonstrates working principles for the optimization of engineered pathways for alternative energy production, as well as for understanding how electron transfer between proteins is controlled. PMID:20184755

Reactivating Catalytic Surface: Insights into the Role of Hot Holes in Plasmonic Catalysis.

PubMed

Peng, Tianhuan; Miao, Junjian; Gao, Zhaoshuai; Zhang, Linjuan; Gao, Yi; Fan, Chunhai; Li, Di

2018-03-01

Surface plasmon resonance of coinage metal nanoparticles is extensively exploited to promote catalytic reactions via harvesting solar energy. Previous efforts on elucidating the mechanisms of enhanced catalysis are devoted to hot electron-induced photothermal conversion and direct charge transfer to the adsorbed reactants. However, little attention is paid to roles of hot holes that are generated concomitantly with hot electrons. In this work, 13 nm spherical Au nanoparticles with small absorption cross-section are employed to catalyze a well-studied glucose oxidation reaction. Density functional theory calculation and X-ray absorption spectrum analysis reveal that hot holes energetically favor transferring catalytic intermediates to product molecules and then desorbing from the surface of plasmonic catalysts, resulting in the recovery of their catalytic activities. The studies shed new light on the use of the synergy of hot holes and hot electrons for plasmon-promoted catalysis. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Photosynthesis.

PubMed

Johnson, Matthew P

2016-10-31

Photosynthesis sustains virtually all life on planet Earth providing the oxygen we breathe and the food we eat; it forms the basis of global food chains and meets the majority of humankind's current energy needs through fossilized photosynthetic fuels. The process of photosynthesis in plants is based on two reactions that are carried out by separate parts of the chloroplast. The light reactions occur in the chloroplast thylakoid membrane and involve the splitting of water into oxygen, protons and electrons. The protons and electrons are then transferred through the thylakoid membrane to create the energy storage molecules adenosine triphosphate (ATP) and nicotinomide-adenine dinucleotide phosphate (NADPH). The ATP and NADPH are then utilized by the enzymes of the Calvin-Benson cycle (the dark reactions), which converts CO 2 into carbohydrate in the chloroplast stroma. The basic principles of solar energy capture, energy, electron and proton transfer and the biochemical basis of carbon fixation are explained and their significance is discussed. © 2016 The Author(s).

Photophysical studies on the interaction of acridinedione dyes with universal protein denaturant: guanidine hydrochloride.

PubMed

Kumaran, R; Varalakshmi, T; Malar, E J Padma; Ramamurthy, P

2010-09-01

Photophysical studies of photoinduced electron transfer (PET) and non-PET based acridinedione dyes with guanidine hydrochloride (GuHCl) were carried out in water and methanol. Addition of GuHCl to photoinduced electron transfer (PET) based acridinedione dye (ADR 1) results in a fluorescence enhancement, whereas a non-PET based dye (ADR 2) shows no significant change in the fluorescence intensity and lifetime. Addition of GuHCl to ADR 1 dye in methanol results in single exponential decay behaviour, on the contrary a biexponential decay pattern was observed on the addition of GuHCl in water. Absorption and emission spectral studies of ADR 1 dye interaction with GuHCl reveals that the dye molecule is not in the protonated form in aqueous GuHCl solution, and the dye is confined to two distinguishable microenvironment in the aqueous phase. A large variation in the microenvironment around the dye molecule is created on the addition of GuHCl and this was ascertained by time-resolved area normalized emission spectroscopy (TRANES) and time-resolved emission spectroscopy (TRES). The dye molecule prefers to reside in the hydrophobic microenvironment, rather in the hydrophilic aqueous phase is well emphasized by time-resolved fluorescence lifetime studies. The mechanism of fluorescence enhancement of ADR 1 dye by GuHCl is attributed to the suppression of the PET process occurring through space.

Decomposition of the fluorescence spectra of two FAD molecules in electron-transferring flavoprotein from Megasphaera elsdenii.

PubMed

Sato, Kyosuke; Nishina, Yasuzo; Shiga, Kiyoshi

2013-07-01

Electron-transferring flavoprotein (ETF) from Megasphaera elsdenii contains two FAD molecules, FAD-1 and FAD-2. FAD-2 shows an unusual absorption spectrum with a 400-nm peak. In contrast, ETFs from other sources such as pig contain one FAD and one AMP with the FAD showing a typical flavin absorption spectrum with 380- and 440-nm peaks. It is presumed that FAD-2 is the counterpart of the FAD in other ETFs. In this study, the FAD-1 and FAD-2 fluorescence spectra were determined by titration of FAD-1-bound ETF with FAD using excitation-emission matrix (EEM) fluorescence spectroscopy. The EEM data were globally analysed, and the FAD fluorescence spectra were calculated from the principal components using their respective absorption spectra. The FAD-2 fluorescence spectrum was different from that of pig ETF, which is more intense and blue-shifted. AMP-free pig ETF in acidic solution, which has a comparable absorption spectrum to FAD-2, also had a similar fluorescence spectrum. This result suggests that FAD-2 in M. elsdenii ETF and the FAD in acidic AMP-free pig ETF share a common microenvironment. A review of published ETF fluorescence spectra led to the speculation that the majority of ETF molecules in solution are in the conformation depicted by the crystal structure.

Vibrational spectroscopy and density functional theory analysis of 3-O-caffeoylquinic acid

NASA Astrophysics Data System (ADS)

Mishra, Soni; Tandon, Poonam; Eravuchira, Pinkie J.; El-Abassy, Rasha M.; Materny, Arnulf

2013-03-01

Density functional theory (DFT) calculations are being performed to investigate the geometric, vibrational, and electronic properties of the chlorogenic acid isomer 3-CQA (1R,3R,4S,5R)-3-{[(2E)-3-(3,4-dihydroxyphenyl)prop-2-enoyl]oxy}-1,4,5-trihydroxycyclohexanecarboxylic acid), a major phenolic compound in coffee. DFT calculations with the 6-311G(d,p) basis set produce very good results. The electrostatic potential mapped onto an isodensity surface has been obtained. A natural bond orbital analysis (NBO) has been performed in order to study intramolecular bonding, interactions among bonds, and delocalization of unpaired electrons. HOMO-LUMO studies give insights into the interaction of the molecule with other species. The calculated HOMO and LUMO energies indicate that a charge transfer occurs within the molecule.

Photo-Redox Activated Drug Delivery Systems Operating Under Two Photon Excitation in the Near-IR

PubMed Central

Guardado-Alvarez, Tania M.; Devi, Lekshmi Sudha; Vabre, Jean-Marie; Pecorelli, Travis; Schwartz, Benjamin J.; Durand, Jean-Olivier; Mongin, Olivier; Blanchard-Desce, Mireille; Zink, Jeffrey I.

2014-01-01

We report the design and synthesis of a nano-container consisting of mesoporous silica nanoparticles with the pore openings covered by “snap-top” caps that are opened by near-IR light. A photo transducer molecule that is a reducing agent in an excited electronic state is covalently attached to the system. Near IR two-photon excitation causes inter-molecular electron transfer that reduces a disulfide bond holding the cap in place, thus allowing the cargo molecules to escape. We describe the operation of the “snap-top” release mechanism by both one- and two-photon activation. This system presents a proof of concept of a near-IR photoredox-induced nanoparticle delivery system that may lead to a new type of photodynamic drug release therapy. PMID:24647752

Photo-redox activated drug delivery systems operating under two photon excitation in the near-IR.

PubMed

Guardado-Alvarez, Tania M; Devi, Lekshmi Sudha; Vabre, Jean-Marie; Pecorelli, Travis A; Schwartz, Benjamin J; Durand, Jean-Olivier; Mongin, Olivier; Blanchard-Desce, Mireille; Zink, Jeffrey I

2014-05-07

We report the design and synthesis of a nano-container consisting of mesoporous silica nanoparticles with the pore openings covered by "snap-top" caps that are opened by near-IR light. A photo transducer molecule that is a reducing agent in an excited electronic state is covalently attached to the system. Near IR two-photon excitation causes inter-molecular electron transfer that reduces a disulfide bond holding the cap in place, thus allowing the cargo molecules to escape. We describe the operation of the "snap-top" release mechanism by both one- and two-photon activation. This system presents a proof of concept of a near-IR photoredox-induced nanoparticle delivery system that may lead to a new type of photodynamic drug release therapy.

Realization of a four-step molecular switch in scanning tunneling microscope manipulation of single chlorophyll-a molecules

PubMed Central

Iancu, Violeta; Hla, Saw-Wai

2006-01-01

Single chlorophyll-a molecules, a vital resource for the sustenance of life on Earth, have been investigated by using scanning tunneling microscope manipulation and spectroscopy on a gold substrate at 4.6 K. Chlorophyll-a binds on Au(111) via its porphyrin unit while the phytyl-chain is elevated from the surface by the support of four CH3 groups. By injecting tunneling electrons from the scanning tunneling microscope tip, we are able to bend the phytyl-chain, which enables the switching of four molecular conformations in a controlled manner. Statistical analyses and structural calculations reveal that all reversible switching mechanisms are initiated by a single tunneling-electron energy-transfer process, which induces bond rotation within the phytyl-chain. PMID:16954201

Vibrational Heat Transport in Molecular Junctions

NASA Astrophysics Data System (ADS)

Segal, Dvira; Agarwalla, Bijay Kumar

2016-05-01

We review studies of vibrational energy transfer in a molecular junction geometry, consisting of a molecule bridging two heat reservoirs, solids or large chemical compounds. This setup is of interest for applications in molecular electronics, thermoelectrics, and nanophononics, and for addressing basic questions in the theory of classical and quantum transport. Calculations show that system size, disorder, structure, dimensionality, internal anharmonicities, contact interaction, and quantum coherent effects are factors that combine to determine the predominant mechanism (ballistic/diffusive), effectiveness (poor/good), and functionality (linear/nonlinear) of thermal conduction at the nanoscale. We review recent experiments and relevant calculations of quantum heat transfer in molecular junctions. We recount the Landauer approach, appropriate for the study of elastic (harmonic) phononic transport, and outline techniques that incorporate molecular anharmonicities. Theoretical methods are described along with examples illustrating the challenge of reaching control over vibrational heat conduction in molecules.

A group electronegativity equalization scheme including external potential effects.

PubMed

Leyssens, Tom; Geerlings, Paul; Peeters, Daniel

2006-07-20

By calculating the electron affinity and ionization energy of different functional groups, CCSD electronegativity values are obtained, which implicitly account for the effect of the molecular environment. This latter is approximated using a chemically justified point charge model. On the basis of Sanderson's electronegativity equalization principle, this approach is shown to lead to reliable "group in molecule" electronegativities. Using a slight adjustment of the modeled environment and first-order principles, an electronegativity equalization scheme is obtained, which implicitly accounts for the major part of the external potential effect. This scheme can be applied in a predictive manner to estimate the charge transfer between two functional groups, without having to rely on cumbersome calibrations. A very satisfactory correlation is obtained between these charge transfers and those obtained from an ab initio calculation of the entire molecule.

Charge separation and carrier dynamics in donor-acceptor heterojunction photovoltaic systems

PubMed Central

Teuscher, Joël; Brauer, Jan C.; Stepanov, Andrey; Solano, Alicia; Boziki, Ariadni; Chergui, Majed; Wolf, Jean-Pierre; Rothlisberger, Ursula; Banerji, Natalie; Moser, Jacques-E.

2017-01-01

Electron transfer and subsequent charge separation across donor-acceptor heterojunctions remain the most important areas of study in the field of third-generation photovoltaics. In this context, it is particularly important to unravel the dynamics of individual ultrafast processes (such as photoinduced electron transfer, carrier trapping and association, and energy transfer and relaxation), which prevail in materials and at their interfaces. In the frame of the National Center of Competence in Research “Molecular Ultrafast Science and Technology,” a research instrument of the Swiss National Science Foundation, several groups active in the field of ultrafast science in Switzerland have applied a number of complementary experimental techniques and computational simulation tools to scrutinize these critical photophysical phenomena. Structural, electronic, and transport properties of the materials and the detailed mechanisms of photoinduced charge separation in dye-sensitized solar cells, conjugated polymer- and small molecule-based organic photovoltaics, and high-efficiency lead halide perovskite solar energy converters have been scrutinized. Results yielded more than thirty research articles, an overview of which is provided here. PMID:29308415

Electronic and magnetic properties of transition metal doped graphyne

NASA Astrophysics Data System (ADS)

Gangan, Abhijeet Sadashiv; Yadav, Asha S.; Chakraborty, Brahmananda; Ramaniah, Lavanya M.

2017-05-01

We have theoretically investigated the interaction of few 3d (V,Mn) and 4d (Y,Zr) transition metals with the γ-graphyne structure using the spin-polarized density functional theory for its potentials application in Hydrogen storage, spintronics and nano-electronics. By doping different TMs we have observed that the system can be either metallic(Y), semi-conducting or half metallic. The system for Y and Zr doped graphyne becomes non-magnetic while V and Mn doped graphyne have a magnetic moments of l μB and 3 μB respectively From bader charge analysis it is seen that there is a charge transfer from the TM atom to the graphyne. Zr and Y have a net charge transfer of 2.15e and 1.73e respectively. Charge density analysis also shows the polarization on the carbon skeleton which becomes larger as the charge transfer for the TM atom increases. Thus we see Y and Zr are better candidates for hydrogen storage devices since they are non-magnetic and have less d electrons which is ideal for kubas-type interactions between hydrogen molecule and TM.

Single molecule-level study of donor-acceptor interactions and nanoscale environment in blends

NASA Astrophysics Data System (ADS)

Quist, Nicole; Grollman, Rebecca; Rath, Jeremy; Robertson, Alex; Haley, Michael; Anthony, John; Ostroverkhova, Oksana

2017-02-01

Organic semiconductors have attracted considerable attention due to their applications in low-cost (opto)electronic devices. The most successful organic materials for applications that rely on charge carrier generation, such as solar cells, utilize blends of several types of molecules. In blends, the local environment strongly influences exciton and charge carrier dynamics. However, relationship between nanoscale features and photophysics is difficult to establish due to the lack of necessary spatial resolution. We use functionalized fluorinated pentacene (Pn) molecule as single molecule probes of intermolecular interactions and of the nanoscale environment in blends containing donor and acceptor molecules. Single Pn donor (D) molecules were imaged in PMMA in the presence of acceptor (A) molecules using wide-field fluorescence microscopy. Two sample configurations were realized: (i) a fixed concentration of Pn donor molecules, with increasing concentration of acceptor molecules (functionalized indenflouorene or PCBM) and (ii) a fixed concentration of acceptor molecules with an increased concentration of the Pn donor. The D-A energy transfer and changes in the donor emission due to those in the acceptor- modified polymer morphology were quantified. The increase in the acceptor concentration was accompanied by enhanced photobleaching and blinking of the Pn donor molecules. To better understand the underlying physics of these processes, we modeled photoexcited electron dynamics using Monte Carlo simulations. The simulated blinking dynamics were then compared to our experimental data, and the changes in the transition rates were related to the changes in the nanoscale environment. Our study provides insight into evolution of nanoscale environment during the formation of bulk heterojunctions.

Report on cascade energy relaxation from PVP to Tb3+:Bi2SiO5 nanophosphor through salicylic acid in composite polymeric film

NASA Astrophysics Data System (ADS)

Kumari, Pushpa; Dwivedi, Y.

2018-05-01

The present article reports structural and spectroscopic properties of Tb:Bi2SiO5 nanophosphors dispersed in Polyvinylpyrrolidone polymer film, in presence of Salicylic acid (SA) molecule, which acts as a sensitizer. Detailed structural and spectroscopic characterizations were carried out using X-ray diffraction patterns, Scanning Electron Microscope, Fourier Transform Infrared and Excitation and photoluminescence techniques. The mean crystallite size of Tb3+:Bi2SiO5 nanophosphor and Tb3+:Bi2SiO5 in Polyvinylpyrrolidone polymer composite was estimated ∼22 nm and ∼28 nm, respectively. We have report atleast two times enhancement in Tb3+ ions emission intensity due to the efficient energy transfer from salicylic acid molecule to Tb ions. In addition to energy transfer from salicylic acid, the Polyvinylpyrrolidone polymeric host was also reported to serve as a sensitizer for SA molecule and Tb3+ ions through a cascade energy relaxation process while exciting with 248 nm photons. On 248 nm photon excitation, atleast five improvements in Tb3+ ion emission intensity are reported. Presence of SA molecule facilitates precise colour tuning as obvious from the CIE coordinates.

Electrochemistry and spectroelectrochemistry of bioactive hydroxyquinolines: a mechanistic study.

PubMed

Sokolová, Romana; Nycz, Jacek E; Ramešová, Šárka; Fiedler, Jan; Degano, Ilaria; Szala, Marcin; Kolivoška, Viliam; Gál, Miroslav

2015-05-21

The oxidation mechanism of selected hydroxyquinoline carboxylic acids such as 8-hydroxyquinoline-7-carboxylic acid (1), the two positional isomers 2-methyl-8-hydroxyquinoline-7-carboxylic acid (3) and 2-methyl-5-hydroxyquinoline-6-carboxylic acid (4), as well as other hydroxyquinolines were studied in aprotic environment using cyclic voltammetry, controlled potential electrolysis, in situ UV-vis and IR spectroelectrochemistry, and HPLC-MS/MS techniques. IR spectroelectrochemistry showed that oxidation unexpectedly proceeds together with protonation of the starting compound. We proved that the nitrogen atom in the heterocycle of hydroxyquinolines is protonated during the apparent 0.7 electron oxidation process. This was rationalized by the autodeprotonation reaction by another two starting molecules of hydroxyquinoline, so that the overall oxidation mechanism involves two electrons and three starting molecules. Both the electrochemical and spectroelectrochemical results showed that the oxidation mechanism is not influenced by the presence of the carboxylic group in the chemical structure of hydroxyquinolines, as results from oxidation of 2,7-dimethyl-5-hydroxyquinoline (6). In the presence of a strong proton acceptor such as pyridine, the oxidation ECEC process involves two electrons and two protons per one molecule of the hydroxyquinoline derivative. The electron transfer efficiency of hydroxyquinolines in biosystems may be related to protonation of biocompounds containing nitrogen bases. Molecular orbital calculations support the experimental findings.

Radiation of nitrogen molecules in a dielectric barrier discharge with small additives of chlorine and bromine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Avtaeva, S. V.; Avdeev, S. M.; Sosnin, E. A.

2010-08-15

Spectral and energy characteristics of nitrogen molecule radiation in dielectric barrier discharges in Ar-N{sub 2}, Ar-N{sub 2}-Cl{sub 2}, and Ar-N{sub 2}-Br{sub 2} mixtures were investigated experimentally. Small additives of molecular chlorine or bromine to an Ar-N{sub 2} mixture are found to increase the radiation intensity of the second positive system of nitrogen. The conditions at which the radiation spectrum predominantly consists of vibronic bands of this system are determined. Using a numerical model of plasmachemical processes, it is shown that, at electron temperatures typical of gas discharges (2-4 eV), a minor additive of molecular chlorine to an Ar-N{sub 2} mixturemore » leads to an increase in the concentrations of electrons, positive ions, and metastable argon atoms. In turn, collisional energy transfer from metastable argon atoms to nitrogen molecules results in the excitation of the N{sub 2}(C{sup 3{Pi}}{sub u}) state.« less

Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

NASA Astrophysics Data System (ADS)

Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

2018-04-01

We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

Kinetics of highly vibrationally excited O2(X) molecules in inductively-coupled oxygen plasmas

NASA Astrophysics Data System (ADS)

Annušová, Adriana; Marinov, Daniil; Booth, Jean-Paul; Sirse, Nishant; Lino da Silva, Mário; Lopez, Bruno; Guerra, Vasco

2018-04-01

The high degree of vibrational excitation of O2 ground state molecules recently observed in inductively coupled plasma discharges is investigated experimentally in more detail and interpreted using a detailed self-consistent 0D global kinetic model for oxygen plasmas. Additional experimental results are presented and used to validate the model. The vibrational kinetics considers vibrational levels up to v = 41 and accounts for electron impact excitation and de-excitation (e-V), vibration-to-translation relaxation (V-T) in collisions with O2 molecules and O atoms, vibration-to-vibration energy exchanges (V-V), excitation of electronically excited states, dissociative electron attachment, and electron impact dissociation. Measurements were performed at pressures of 10–80 mTorr (1.33 and 10.67 Pa) and radio frequency (13.56 MHz) powers up to 500 W. The simulation results are compared with the absolute densities in each O2 vibrational level obtained by high sensitivity absorption spectroscopy measurements of the Schumann–Runge bands for O2(X, v = 4–18), O(3 P) atom density measurements by two-photon absorption laser induced fluorescence (TALIF) calibrated against Xe, and laser photodetachment measurements of the O‑ negative ions. The highly excited O2(X, v) distribution exhibits a shape similar to a Treanor-Gordiets distribution, but its origin lies in electron impact e-V collisions and not in V-V up-pumping, in contrast to what happens in all other molecular gases known to date. The relaxation of vibrational quanta is mainly due to V-T energy-transfer collisions with O atoms and to electron impact dissociation of vibrationally excited molecules, e+O2(X, v)→O(3P)+O(3P).

Discrete and continuum modeling of solvent effects in a twisted intramolecular charge transfer system: The 4-N,N-dimethylaminobenzonitrile (DMABN) molecule.

PubMed

Modesto-Costa, Lucas; Borges, Itamar

2018-08-05

The 4-N,N-dimethylaminobenzonitrile (DMABN) molecule is a prototypical system displaying twisted intramolecular (TICT) charge transfer effects. The ground and the first four electronic excited states (S 1 -S 4 ) in gas phase and upon solvation were studied. Charge transfer values as function of the torsion angle between the donor group (dimethylamine) and the acceptor moiety (benzonitrile) were explicitly computed. Potential energy curves were also obtained. The algebraic diagrammatic construction method at the second-order [ADC(2)] ab initio wave function was employed. Three solvents of increased polarities (benzene, DMSO and water) were investigated using discrete (average solvent electrostatic configuration - ASEC) and continuum (conductor-like screening model - COSMO) models. The results for the S 3 and S 4 excited states and the S 1 -S 4 charge transfer curves were not previously available in the literature. Electronic gas phase and solvent vertical spectra are in good agreement with previous theoretical and experimental results. In the twisted (90°) geometry the optical oscillator strengths have negligible values even for the S 2 bright state. Potential energy curves show two distinct pairs of curves intersecting at decreasing angles or not crossing in the more polar solvents. Charge transfer and electric dipole values allowed the rationalization of these results. The former effects are mostly independent of the solvent model and polarity. Although COSMO and ASEC solvent models mostly lead to similar results, there is an important difference: some crossings of the excitation energy curves appear only in the ASEC solvation model, which has important implications to the photochemistry of DMABN. Copyright © 2018 Elsevier B.V. All rights reserved.

Surface Redox Chemistry of Immobilized Nanodiamond: Effects of Particle Size and Electrochemical Environment

NASA Astrophysics Data System (ADS)

Gupta, S.; McDonald, B.; Carrizosa, S. B.

2017-07-01

The size of the diamond particle is tailored to nanoscale (nanodiamond, ND), and the ND surface is engineered targeting specific (electrochemical and biological) applications. In this work, we investigated the complex surface redox chemistry of immobilized ND layer on conductive boron-doped diamond electrode with a broad experimental parameter space such as particle size (nano versus micron), scan rate, pH (cationic/acidic versus anionic/basic), electrolyte KCl concentration (four orders of magnitude), and redox agents (neutral and ionic). We reported on the significant enhancement of ionic currents while recording reversible oxidation of neutral ferrocene methanol (FcMeOH) by almost one order of magnitude than traditional potassium ferricyanide (K3Fe(CN)6) redox agent. The current enhancement is inversely related to ND particle diameter in the following order: 1 μm << 1000 nm < 100 nm < 10 nm ≤ 5 nm < 2 nm. We attribute the current enhancement to concurrent electrocatalytic processes, i.e. the electron transfer between redox probes and electroactive surface functional (e.g. hydroxyl, carboxyl, epoxy) moieties and the electron transfer mediated by adsorbed FcMeOH+ (or Fe(CN) 6 3+ ) ions onto ND surface. The first process is pH dependent since it depends upon ND surface functionalities for which the electron transfer is coupled to proton transfer. The adsorption mediated process is observed most apparently at slower scan rates owing to self-exchange between adsorbed FcMeOH+ ions and FcMeOH redox agent molecules in diffusion-limited bulk electrolyte solution. Alternatively, it is hypothesized that the surface functionality and defect sites ( sp 2-bonded C shell and unsaturated bonds) give rise to surface electronic states with energies within the band gap (midgap states) in undoped ND. These surface states serve as electron donors (and acceptors) depending upon their bonding (and antibonding) character and, therefore, they can support electrocatalytic redox processes in the presence of specific redox-active molecules via feedback mechanism. Apparently, FcMeOH+ tended to have electrostatic affinity for negatively charged ND surface functionalities, corroborated by present experiments. We also attempted to study biocatalytic process using model metalloprotein (cytochrome c; Cyt c) immobilized on ND particles for investigating interfacial electron transfer kinetics and compared with those of functionalized graphene (graphene oxide; GO and reduced GO). The findings are discussed in terms of interplay of sp 3-bonded C (ND core) and sp 2-bonded C (ND shell and graphene-based systems).

Single-Molecule Sensing with Nanopore Confinement: From Chemical Reactions to Biological Interactions.

PubMed

Lin, Yao; Ying, Yi-Lun; Gao, Rui; Long, Yi-Tao

2018-03-25

The nanopore can generate an electrochemical confinement for single-molecule sensing that help understand the fundamental chemical principle in nanoscale dimensions. By observing the generated ionic current, individual bond-making and bond-breaking steps, single biomolecule dynamic conformational changes and electron transfer processes that occur within pore can be monitored with high temporal and current resolution. These single-molecule studies in nanopore confinement are revealing information about the fundamental chemical and biological processes that cannot be extracted from ensemble measurements. In this Concept article, we introduce and discuss the electrochemical confinement effects on single-molecule covalent reactions, conformational dynamics of individual molecules and host-guest interactions in protein nanopores. Then, we extend the concept of nanopore confinement effects to confine electrochemical redox reactions in solid-state nanopores for developing new sensing mechanisms. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Decomposition of energetic molecules by interfacing with a catalytic oxide: opportunities and challenges

NASA Astrophysics Data System (ADS)

Wang, Fenggong; Tsyshevsky, Roman; Zverev, Anton; Mitrofanov, Anatoly; Kuklja, Maija

Organic-inorganic interfaces provide both intrigues and opportunities for designing systems that possess properties and functionalities inaccessible by each individual component. In particular, mixing with a photocatalyst may significantly affect the adsorption, decomposition, and photoresponse of organic molecules. Here, we choose the formulation of TiO2 and trinitrotoluene (TNT), a highly catalytic oxide and a prominent explosive, as a prototypical example to explore the interaction at the interface on the photosensitivity of energetic materials. We show that, whether or not a catalytic oxide additive can help molecular decompositions under light illumination depends largely on the band alignment between the oxide surface and the energetic molecule. Furthermore, an oxygen vacancy can lead to the electron density transfer from the surface to the energetic molecules, causing an enhancement of the bonding between molecules and surface and a reduction of the molecular decomposition activation barriers.

Coherent Bichromatic Force Deflection of Molecules

NASA Astrophysics Data System (ADS)

Kozyryev, Ivan; Baum, Louis; Aldridge, Leland; Yu, Phelan; Eyler, Edward E.; Doyle, John M.

2018-02-01

We demonstrate the effect of the coherent optical bichromatic force on a molecule, the polar free radical strontium monohydroxide (SrOH). A dual-frequency retroreflected laser beam addressing the X˜2Σ+↔A˜2Π1 /2 electronic transition coherently imparts momentum onto a cryogenic beam of SrOH. This directional photon exchange creates a bichromatic force that transversely deflects the molecules. By adjusting the relative phase between the forward and counterpropagating laser beams we reverse the direction of the applied force. A momentum transfer of 70 ℏk is achieved with minimal loss of molecules to dark states. Modeling of the bichromatic force is performed via direct numerical solution of the time-dependent density matrix and is compared with experimental observations. Our results open the door to further coherent manipulation of molecular motion, including the efficient optical deceleration of diatomic and polyatomic molecules with complex level structures.

Vibrational spectroscopic and non-linear optical activity studies on nicotinanilide : A DFT approach

NASA Astrophysics Data System (ADS)

Premkumar, S.; Jawahar, A.; Mathavan, T.; Dhas, M. Kumara; Benial, A. Milton Franklin

2015-06-01

The molecular structure of nicotinanilide was optimized by the DFT/B3LYP method with cc-pVTZ basis set using Gaussian 09 program. The first order hyperpolarizability of the molecule was calculated, which exhibits the higher nonlinear optical activity. The natural bond orbital analysis confirms the presence of intramolecular charge transfer and the hydrogen bonding interaction, which leads to the higher nonlinear optical activity of the molecule. The Frontier molecular orbitals analysis of the molecule shows that the delocalization of electron density occurs within the molecule. The lower energy gap indicates that the hydrogen bond formation between the charged species. The vibrational frequencies were calculated and assigned on the basis of potential energy distribution calculation using the VEDA 4.0 program and the corresponding vibrational spectra were simulated. Hence, the nicotinanilide molecule can be a good candidate for second-order NLO material.

Influence of electron delocalization in heterocyclic core systems on the electrochemical communication in 2,5-di- and 2,3,4,5-tetraferrocenyl thiophenes, furans, and pyrroles.

PubMed

Hildebrandt, Alexander; Schaarschmidt, Dieter; Claus, Ron; Lang, Heinrich

2011-11-07

A series of 2,5-di- and 2,3,4,5-tetraferrocenyl-substituted thiophenes, furans, and pyrroles were synthesized using the Negishi C,C cross-coupling protocol. The electronic and electrochemical properties of these compounds were investigated by cyclic voltammetry (CV), square wave voltammetry (SWV), and in situ UV-vis/NIR spectroscopy. The molecular structures of 2,5-diferrocenyl furan and 2,3,4,5-tetraferrocenyl-1-methyl-1H-pyrrole in the solid state are discussed. The ferrocenyls could sequentially be oxidized giving two or four reversible responses for the appropriate di- or tetraferrocenyl-substituted heterocyclic molecules. The observed ΔE°' values range between 186 and 450 mV. The NIR measurements confirm electronic communication as intervalence charge transfer (IVCT) absorptions were found in the corresponding mono- and in case of the tetraferrocenyl compounds also in the dicationic species. All compounds, except tetraferrocenyl thiophene (a class I system), were classified as class II systems according to Robin and Day. They show a linear relationship between ΔE°' and the IVCT oscillator strength f which could be shown for the first time in organometallic chemistry. This was possible because the series of molecules exhibit analogous geometries and hence, similar electrostatic properties. This correlation was confirmed by electro- and spectro-electrochemical measurements. Within these studies a new approach for the estimation of the effective electron transfer distances r(ab) is discussed. © 2011 American Chemical Society

Molecules for Fluorescence Detection of Specific Chemicals

NASA Technical Reports Server (NTRS)

Fedor, Steve

2008-01-01

A family of fluorescent dye molecules has been developed for use in on-off fluorescence detection of specific chemicals. By themselves, these molecules do not fluoresce. However, when exposed to certain chemical analytes in liquid or vapor forms, they do fluoresce (see figure). These compounds are amenable to fixation on or in a variety of substrates for use in fluorescence-based detection devices: they can be chemically modified to anchor them to porous or non-porous solid supports or can be incorporated into polymer films. Potential applications for these compounds include detection of chemical warfare agents, sensing of acidity or alkalinity, and fluorescent tagging of proteins in pharmaceutical research and development. These molecules could also be exploited for use as two-photon materials for photodynamic therapy in the treatment of certain cancers and other diseases. A molecule in this family consists of a fluorescent core (such as an anthracene or pyrene) attached to two end groups that, when the dye is excited by absorption of light, transfer an electron to the core, thereby quenching the fluorescence. The end groups can be engineered so that they react chemically with certain analytes. Upon reaction, electrons on the end groups are no longer available for transfer to the core and, consequently, the fluorescence from the core is no longer quenched. The chemoselectivity of these molecules can be changed by changing the end groups. For example, aniline end groups afford a capability for sensing acids or acid halides (including those contained in chemical warfare agents). Pyridine or bipyridyl end groups would enable sensing of metal ions. Other chemicals that can be selectively detected through suitable choice of end groups include glucose and proteins. Moreover, the fluorescent cores can be changed to alter light-absorption and -emission characteristics: anthracene cores fluoresce at wavelengths around 500 nm, whereas perylene cores absorb and emit at wavelengths of about 600 nm.